#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA13	154664	genome.wustl.edu	37	7	48547582	48547582	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr7:48547582G>T	ENST00000435803.1	+	50	13485	c.13461G>T	c.(13459-13461)agG>agT	p.R4487S	ABCA13_ENST00000544596.1_Missense_Mutation_p.R217S	NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4487					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						GAGCCAAAAGGTTGCAGCACA	0.517																																						dbGAP											0													95.0	97.0	97.0					7																	48547582		2102	4230	6332	-	-	-	SO:0001583	missense	0			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.13461G>T	7.37:g.48547582G>T	ENSP00000411096:p.Arg4487Ser		K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.R4487S	ENST00000435803.1	37	c.13461	CCDS47584.1	7	.	.	.	.	.	.	.	.	.	.	G	15.10	2.732704	0.48939	.	.	ENSG00000179869	ENST00000435803;ENST00000411975;ENST00000544596	D;D;D	0.87103	-2.21;-2.21;-2.21	5.5	-1.92	0.07618	.	0.000000	0.56097	D	0.000026	D	0.90943	0.7153	M	0.80183	2.485	0.19575	N	0.999964	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.972;0.982;0.998	T	0.83271	-0.0043	10	0.72032	D	0.01	.	7.6067	0.28105	0.4774:0.1094:0.4132:0.0	.	217;2189;4487	F5H7B7;Q86UQ4-3;Q86UQ4	.;.;ABCAD_HUMAN	S	4487;260;217	ENSP00000411096:R4487S;ENSP00000391042:R260S;ENSP00000442634:R217S	ENSP00000391042:R260S	R	+	3	2	ABCA13	48518128	0.036000	0.19791	0.091000	0.20842	0.636000	0.38137	-0.221000	0.09202	-0.197000	0.10350	-0.145000	0.13849	AGG	ABCA13	-	NULL	ENSG00000179869		0.517	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2	57	0.00	0	G	NM_152701		48547582	48547582	+1	no_errors	ENST00000435803	ensembl	human	known	69_37n	missense	28	49.09	27	SNP	0.039	T
AGAP6	414189	genome.wustl.edu	37	10	51748684	51748684	+	Missense_Mutation	SNP	G	G	A	rs61848260	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr10:51748684G>A	ENST00000374056.4	+	1	607	c.209G>A	c.(208-210)cGg>cAg	p.R70Q	AGAP6_ENST00000412531.3_Missense_Mutation_p.R70Q			Q5VW22	AGAP6_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 6	70				R -> Q (in Ref. 2; BC131545). {ECO:0000305}.	regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(1)|lung(8)|prostate(3)|skin(1)|stomach(2)	29						GTTCGTGACCGGGAGATGCCT	0.592													G|||	2505	0.5002	0.6067	0.5519	5008	,	,		18957	0.3899		0.4463	False		,,,				2504	0.4888					dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS44397.1	10q11.23	2013-01-10	2008-09-22	2008-09-22	ENSG00000204149	ENSG00000204149		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	23466	protein-coding gene	gene with protein product			"""centaurin, gamma-like family, member 3"""	CTGLF3			Standard	NM_001077665		Approved	bA324H6.1	uc001jix.4	Q5VW22	OTTHUMG00000018220	ENST00000374056.4:c.209G>A	10.37:g.51748684G>A	ENSP00000363168:p.Arg70Gln			Missense_Mutation	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,superfamily_ArfGAP,superfamily_Ankyrin_rpt-contain_dom,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP	p.R70Q	ENST00000374056.4	37	c.209		10	.	.	.	.	.	.	.	.	.	.	G	4.840	0.156245	0.09236	.	.	ENSG00000204149	ENST00000374056;ENST00000412531	D;D	0.89196	-2.48;-2.48	1.2	1.2	0.21068	.	0.119796	0.56097	D	0.000023	T	0.76593	0.4009	N	0.20574	0.59	0.54753	P	1.799999999996249E-5	B	0.02656	0.0	B	0.01281	0.0	T	0.71314	-0.4630	9	0.40728	T	0.16	.	5.7611	0.18201	0.0:0.0:1.0:0.0	rs61848260	70	C9IYN2	.	Q	70	ENSP00000363168:R70Q;ENSP00000400972:R70Q	ENSP00000363168:R70Q	R	+	2	0	AGAP6	51418690	0.995000	0.38212	0.964000	0.40570	0.005000	0.04900	0.588000	0.23924	0.963000	0.38082	0.187000	0.17357	CGG	AGAP6	-	NULL	ENSG00000204149		0.592	AGAP6-201	KNOWN	basic|appris_candidate	protein_coding	AGAP6	HGNC	protein_coding		121	0.00	0	G	NM_001077665		51748684	51748684	+1	no_errors	ENST00000374056	ensembl	human	known	69_37n	missense	106	12.40	15	SNP	0.971	A
ACTR1A	10121	genome.wustl.edu	37	10	104239100	104239100	+	3'UTR	SNP	T	T	C	rs5870	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr10:104239100T>C	ENST00000369905.4	-	0	2714				ACTR1A_ENST00000487599.1_3'UTR|ACTR1A_ENST00000470322.1_5'UTR	NM_005736.3	NP_005727.1	P61163	ACTZ_HUMAN	ARP1 actin-related protein 1 homolog A, centractin alpha (yeast)						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|vesicle-mediated transport (GO:0016192)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|extracellular vesicular exosome (GO:0070062)|microtubule associated complex (GO:0005875)	ATP binding (GO:0005524)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	13		Colorectal(252;0.122)		Epithelial(162;5.34e-09)|all cancers(201;1.43e-07)|BRCA - Breast invasive adenocarcinoma(275;0.222)		GGTGAGTTGGTTAAGCGCACT	0.597													T|||	2242	0.447684	0.4871	0.3804	5008	,	,		22208	0.3105		0.5696	False		,,,				2504	0.4581					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			X82206	CCDS7536.1	10q24	2008-07-08	2001-11-28		ENSG00000138107	ENSG00000138107			167	protein-coding gene	gene with protein product		605143	"""ARP1 (actin-related protein 1, yeast) homolog A (centractin alpha)"""			1528266	Standard	NM_005736		Approved	ARP1	uc001kvv.3	P61163	OTTHUMG00000018956	ENST00000369905.4:c.*1520A>G	10.37:g.104239100T>C			B2R6B0|P42024	RNA	SNP	-	NULL	ENST00000369905.4	37	NULL	CCDS7536.1	10																																																																																			ACTR1A	-	-	ENSG00000138107		0.597	ACTR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTR1A	HGNC	protein_coding	OTTHUMT00000050053.1	24	0.00	0	T			104239100	104239100	-1	no_errors	ENST00000470322	ensembl	human	known	69_37n	rna	17	15.00	3	SNP	0.989	C
AHNAK2	113146	genome.wustl.edu	37	14	105414242	105414242	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr14:105414242C>T	ENST00000333244.5	-	7	7665	c.7546G>A	c.(7546-7548)Gac>Aac	p.D2516N	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2516						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			AGGCTCCCGTCGGCCTCCACC	0.622																																						dbGAP											0													119.0	137.0	132.0					14																	105414242		1919	4115	6034	-	-	-	SO:0001583	missense	0			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.7546G>A	14.37:g.105414242C>T	ENSP00000353114:p.Asp2516Asn		Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.D2516N	ENST00000333244.5	37	c.7546	CCDS45177.1	14	.	.	.	.	.	.	.	.	.	.	c	20.9	4.066485	0.76187	.	.	ENSG00000185567	ENST00000333244	T	0.02140	4.43	2.87	2.87	0.33458	.	.	.	.	.	T	0.06962	0.0177	M	0.67625	2.065	0.24283	N	0.995199	D	0.67145	0.996	P	0.54026	0.74	T	0.32745	-0.9895	9	0.27082	T	0.32	.	13.8184	0.63306	0.0:1.0:0.0:0.0	.	2516	Q8IVF2	AHNK2_HUMAN	N	2516	ENSP00000353114:D2516N	ENSP00000353114:D2516N	D	-	1	0	AHNAK2	104485287	0.001000	0.12720	0.006000	0.13384	0.008000	0.06430	0.907000	0.28531	1.619000	0.50296	0.306000	0.20318	GAC	AHNAK2	-	NULL	ENSG00000185567		0.622	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	52	0.00	0	C	NM_138420		105414242	105414242	-1	no_errors	ENST00000333244	ensembl	human	known	69_37n	missense	39	43.48	30	SNP	0.572	T
ALDH4A1	8659	genome.wustl.edu	37	1	19209063	19209063	+	Intron	SNP	C	C	T			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr1:19209063C>T	ENST00000375341.3	-	7	936				ALDH4A1_ENST00000290597.5_Intron|ALDH4A1_ENST00000538839.1_Intron|ALDH4A1_ENST00000454547.1_5'UTR|MIR4695_ENST00000577305.1_RNA|RP13-279N23.2_ENST00000494072.3_Intron|ALDH4A1_ENST00000538309.1_Intron	NM_003748.3	NP_003739.2	P30038	AL4A1_HUMAN	aldehyde dehydrogenase 4 family, member A1						4-hydroxyproline catabolic process (GO:0019470)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|proline biosynthetic process (GO:0006561)|proline catabolic process (GO:0006562)|proline catabolic process to glutamate (GO:0010133)|proline metabolic process (GO:0006560)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	1-pyrroline-5-carboxylate dehydrogenase activity (GO:0003842)|aldehyde dehydrogenase (NAD) activity (GO:0004029)|electron carrier activity (GO:0009055)|identical protein binding (GO:0042802)			cervix(2)|endometrium(1)|large_intestine(3)|lung(8)|prostate(1)	15		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00479)|BRCA - Breast invasive adenocarcinoma(304;3.67e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		TTTCTCTGCTCCATCATTTat	0.463																																						dbGAP											0													156.0	152.0	153.0					1																	19209063		876	1991	2867	-	-	-	SO:0001627	intron_variant	0			U24266	CCDS188.1, CCDS53272.1	1p36	2008-02-05			ENSG00000159423	ENSG00000159423	1.5.1.12	"""Aldehyde dehydrogenases"""	406	protein-coding gene	gene with protein product		606811		ALDH4		8621661	Standard	NM_003748		Approved	P5CDh	uc001bbc.3	P30038	OTTHUMG00000002443	ENST00000375341.3:c.678+554G>A	1.37:g.19209063C>T			A8K1Q7|B4DGE4|D2D4A3|Q16882|Q53HU4|Q5JNV6|Q8IZ38|Q96IF0|Q9UDI6	RNA	SNP	-	NULL	ENST00000375341.3	37	NULL	CCDS188.1	1																																																																																			ALDH4A1	-	-	ENSG00000159423		0.463	ALDH4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH4A1	HGNC	protein_coding	OTTHUMT00000006954.1	85	0.00	0	C			19209063	19209063	-1	no_errors	ENST00000454547	ensembl	human	known	69_37n	rna	48	36.36	28	SNP	0.000	T
ANKRD20A2	441430	genome.wustl.edu	37	9	42368549	42368549	+	Silent	SNP	C	C	T			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr9:42368549C>T	ENST00000377601.2	+	1	247	c.135C>T	c.(133-135)gaC>gaT	p.D45D	RP11-216M21.7_ENST00000450520.1_RNA	NM_001012421.1	NP_001012421.1	Q5SQ80	A20A2_HUMAN	ankyrin repeat domain 20 family, member A2	45										large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	4						TCAAAGGCGACGCCGCGGAGG	0.677																																						dbGAP											0													8.0	7.0	8.0					9																	42368549		2144	4122	6266	-	-	-	SO:0001819	synonymous_variant	0				CCDS35028.1	9p12	2013-01-10			ENSG00000183148	ENSG00000183148		"""Ankyrin repeat domain containing"""	31979	protein-coding gene	gene with protein product							Standard	XM_005272519		Approved			Q5SQ80	OTTHUMG00000058641	ENST00000377601.2:c.135C>T	9.37:g.42368549C>T				Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.D45	ENST00000377601.2	37	c.135	CCDS35028.1	9																																																																																			ANKRD20A2	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000183148		0.677	ANKRD20A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD20A2	HGNC	protein_coding	OTTHUMT00000129794.1	34	0.00	0	C	NM_001012421		42368549	42368549	+1	no_errors	ENST00000377601	ensembl	human	known	69_37n	silent	36	12.20	5	SNP	0.000	T
ANKRD40	91369	genome.wustl.edu	37	17	48776840	48776840	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr17:48776840G>C	ENST00000285243.6	-	3	967	c.698C>G	c.(697-699)cCt>cGt	p.P233R	Y_RNA_ENST00000364470.1_RNA	NM_052855.3	NP_443087.1	Q6AI12	ANR40_HUMAN	ankyrin repeat domain 40	233	Pro-rich.									breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|skin(1)|urinary_tract(1)	11			BRCA - Breast invasive adenocarcinoma(22;2.03e-09)			CCCATTTTGAGGCTCCAGAGA	0.512																																						dbGAP											0													114.0	122.0	120.0					17																	48776840		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC012978	CCDS11572.1	17q21.33	2013-01-10			ENSG00000154945	ENSG00000154945		"""Ankyrin repeat domain containing"""	28233	protein-coding gene	gene with protein product						12477932	Standard	NM_052855		Approved	MGC15396	uc002iso.3	Q6AI12	OTTHUMG00000162255	ENST00000285243.6:c.698C>G	17.37:g.48776840G>C	ENSP00000285243:p.Pro233Arg		Q96E32	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.P233R	ENST00000285243.6	37	c.698	CCDS11572.1	17	.	.	.	.	.	.	.	.	.	.	G	10.11	1.261149	0.23051	.	.	ENSG00000154945	ENST00000285243	T	0.22945	1.93	5.17	4.14	0.48551	.	0.283098	0.35124	N	0.003424	T	0.19604	0.0471	L	0.29908	0.895	0.31922	N	0.613274	B	0.20671	0.047	B	0.19946	0.027	T	0.11867	-1.0570	10	0.54805	T	0.06	-9.1487	12.269	0.54695	0.0:0.0:0.7613:0.2387	.	233	Q6AI12	ANR40_HUMAN	R	233	ENSP00000285243:P233R	ENSP00000285243:P233R	P	-	2	0	ANKRD40	46131839	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.386000	0.34419	2.567000	0.86603	0.650000	0.86243	CCT	ANKRD40	-	NULL	ENSG00000154945		0.512	ANKRD40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD40	HGNC	protein_coding	OTTHUMT00000368201.2	58	0.00	0	G	NM_052855		48776840	48776840	-1	no_errors	ENST00000285243	ensembl	human	known	69_37n	missense	33	35.29	18	SNP	1.000	C
APC	324	genome.wustl.edu	37	5	112155003	112155006	+	Frame_Shift_Del	DEL	AAGC	AAGC	-	rs77907679|rs200598389	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	AAGC	AAGC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr5:112155003_112155006delAAGC	ENST00000457016.1	+	10	1654_1657	c.1274_1277delAAGC	c.(1273-1278)gaagctfs	p.EA425fs	APC_ENST00000257430.4_Frame_Shift_Del_p.EA425fs|APC_ENST00000508376.2_Frame_Shift_Del_p.EA425fs			P25054	APC_HUMAN	adenomatous polyposis coli	425	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)			NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GAGTGGCAGGAAGCTCATGAACCA	0.441		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	dbGAP	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	0																																										-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.1274_1277delAAGC	5.37:g.112155003_112155006delAAGC	ENSP00000413133:p.Glu425fs		D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Del	DEL	pfam_APC_basic_dom,pfam_EB1-bd,pfam_APC_Cys-rich_rpt,pfam_Armadillo,pfam_SAMP,pfam_APC_15aa_rpt,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.E425fs	ENST00000457016.1	37	c.1274_1277	CCDS4107.1	5																																																																																			APC	-	superfamily_ARM-type_fold	ENSG00000134982		0.441	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	APC	HGNC	protein_coding	OTTHUMT00000250738.2	43	0.00	0	AAGC	NM_000038		112155003	112155006	+1	no_errors	ENST00000257430	ensembl	human	known	69_37n	frame_shift_del	23	20.59	7	DEL	1.000:1.000:1.000:1.000	-
ARAP1	116985	genome.wustl.edu	37	11	72404378	72404378	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr11:72404378C>T	ENST00000393609.3	-	29	4148	c.3946G>A	c.(3946-3948)Gag>Aag	p.E1316K	ARAP1_ENST00000455638.2_Missense_Mutation_p.E1316K|ARAP1_ENST00000429686.1_Missense_Mutation_p.E1010K|ARAP1-AS1_ENST00000542022.1_RNA|ARAP1_ENST00000393605.3_Missense_Mutation_p.E1076K|ARAP1_ENST00000359373.5_Missense_Mutation_p.E1316K|ARAP1_ENST00000426523.1_Missense_Mutation_p.E1071K|ARAP1_ENST00000495878.1_5'UTR|ARAP1_ENST00000334211.8_Missense_Mutation_p.E1071K	NM_001040118.2	NP_001035207.1	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1	1316	PH 4. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin filament reorganization involved in cell cycle (GO:0030037)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of receptor recycling (GO:0001921)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of cellular component movement (GO:0051270)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27						ACCCGGACCTCCTTGTAGAGC	0.607																																					Ovarian(102;1198 1520 13195 17913 37529)	dbGAP											0													56.0	59.0	58.0					11																	72404378		2200	4293	6493	-	-	-	SO:0001583	missense	0			AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2			Standard	NM_001040118		Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.3946G>A	11.37:g.72404378C>T	ENSP00000377233:p.Glu1316Lys		A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_ArfGAP,pfam_SAM_type1,pfam_Ras-assoc,pfam_SAM_2,superfamily_Rho_GTPase_activation_prot,superfamily_ArfGAP,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.E1316K	ENST00000393609.3	37	c.3946	CCDS41687.1	11	.	.	.	.	.	.	.	.	.	.	C	26.4	4.732235	0.89482	.	.	ENSG00000186635	ENST00000359373;ENST00000455638;ENST00000393605;ENST00000334211;ENST00000393609;ENST00000426523;ENST00000429686;ENST00000542596	T;T;T;T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55	5.74	5.74	0.90152	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.107611	0.64402	D	0.000008	T	0.50497	0.1619	L	0.46157	1.445	0.51012	D	0.999901	D;D;D;D;D	0.89917	1.0;0.998;0.995;0.999;1.0	D;D;D;D;D	0.77557	0.99;0.969;0.91;0.98;0.982	T	0.45716	-0.9242	10	0.66056	D	0.02	.	17.4163	0.87500	0.0:1.0:0.0:0.0	.	1071;1010;1316;1316;1076	E7EU13;B2RTS2;Q96P48-3;Q96P48;Q96P48-1	.;.;.;ARAP1_HUMAN;.	K	1316;1316;1076;1071;1316;1071;1010;120	ENSP00000352332:E1316K;ENSP00000390461:E1316K;ENSP00000377230:E1076K;ENSP00000335506:E1071K;ENSP00000377233:E1316K;ENSP00000392264:E1071K;ENSP00000403127:E1010K;ENSP00000441741:E120K	ENSP00000335506:E1071K	E	-	1	0	ARAP1	72082026	1.000000	0.71417	1.000000	0.80357	0.390000	0.30446	7.042000	0.76565	2.709000	0.92574	0.555000	0.69702	GAG	ARAP1	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000186635		0.607	ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARAP1	HGNC	protein_coding	OTTHUMT00000347428.1	59	0.00	0	C	NM_001040118		72404378	72404378	-1	no_errors	ENST00000393609	ensembl	human	known	69_37n	missense	97	16.95	20	SNP	1.000	T
ARAP3	64411	genome.wustl.edu	37	5	141052602	141052602	+	Silent	SNP	G	G	A	rs543101279		TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr5:141052602G>A	ENST00000239440.4	-	7	1136	c.1071C>T	c.(1069-1071)ttC>ttT	p.F357F	ARAP3_ENST00000508305.1_Silent_p.F279F|ARAP3_ENST00000513878.1_Silent_p.F19F	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	357	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						TGCGGAACACGAACACCCTCT	0.597													G|||	1	0.000199681	0.0	0.0	5008	,	,		15192	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													149.0	102.0	118.0					5																	141052602		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.1071C>T	5.37:g.141052602G>A			B4DIT1|D3DQE3	Silent	SNP	pfam_RhoGAP_dom,pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ras-assoc,pfam_SAM_2,pfam_SAM_type1,superfamily_Rho_GTPase_activation_prot,superfamily_ArfGAP,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.F357	ENST00000239440.4	37	c.1071	CCDS4266.1	5																																																																																			ARAP3	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000120318		0.597	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARAP3	HGNC	protein_coding	OTTHUMT00000251805.1	13	0.00	0	G	NM_022481		141052602	141052602	-1	no_errors	ENST00000239440	ensembl	human	known	69_37n	silent	10	28.57	4	SNP	0.995	A
ARHGAP25	9938	genome.wustl.edu	37	2	69002760	69002760	+	Intron	SNP	C	C	T	rs10445945	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr2:69002760C>T	ENST00000295381.3	+	2	680				ARHGAP25_ENST00000467265.1_Intron|ARHGAP25_ENST00000409220.1_Intron|ARHGAP25_ENST00000456116.2_Intron|ARHGAP25_ENST00000497079.1_Intron|ARHGAP25_ENST00000544262.1_Intron|ARHGAP25_ENST00000409202.3_Intron|ARHGAP25_ENST00000409030.3_Intron	NM_001007231.2	NP_001007232.2	P42331	RHG25_HUMAN	Rho GTPase activating protein 25						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(20)|ovary(3)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	52						AGCACCAGGACGGGCACTGTG	0.488													T|||	1588	0.317093	0.2247	0.3271	5008	,	,		20204	0.3135		0.3608	False		,,,				2504	0.3937					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			D29642	CCDS33214.1, CCDS46312.1, CCDS33214.2, CCDS54363.1, CCDS54364.1	2p13.3	2013-01-10			ENSG00000163219	ENSG00000163219		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	28951	protein-coding gene	gene with protein product		610587				7584044	Standard	NM_001007231		Approved	KIAA0053	uc010fdg.3	P42331	OTTHUMG00000152621	ENST00000295381.3:c.261+208C>T	2.37:g.69002760C>T			A8K2Y1|B7Z498|E9PFQ7|G5E9G2|Q8IXQ2	Missense_Mutation	SNP	NULL	p.T67M	ENST00000295381.3	37	c.200		2																																																																																			ARHGAP25	-	NULL	ENSG00000163219		0.488	ARHGAP25-201	KNOWN	basic|appris_candidate	protein_coding	ARHGAP25	HGNC	protein_coding		31	0.00	0	C	NM_014882		69002760	69002760	+1	no_errors	ENST00000473986	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	0.000	T
ARHGAP5	394	genome.wustl.edu	37	14	32615468	32615468	+	Splice_Site	SNP	G	G	T			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr14:32615468G>T	ENST00000345122.3	+	4	4180		c.e4-1		ARHGAP5_ENST00000433497.1_Splice_Site|ARHGAP5_ENST00000396582.2_Splice_Site|ARHGAP5_ENST00000556611.1_Splice_Site|ARHGAP5_ENST00000539826.2_Splice_Site|ARHGAP5_ENST00000432921.1_Splice_Site	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5						cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		TATTCTCTTAGGGTTATGTAC	0.403																																					NSCLC(9;77 350 3443 29227 41353)	dbGAP											0													110.0	107.0	108.0					14																	32615468		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.3866-1G>T	14.37:g.32615468G>T			A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Splice_Site	SNP	-	e3-1	ENST00000345122.3	37	c.3866-1	CCDS32062.1	14	.	.	.	.	.	.	.	.	.	.	G	23.0	4.365876	0.82463	.	.	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000396582;ENST00000345122;ENST00000432921;ENST00000433497;ENST00000554090	.	.	.	5.28	5.28	0.74379	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2809	0.94052	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ARHGAP5	31685219	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	9.149000	0.94659	2.624000	0.88883	0.585000	0.79938	.	ARHGAP5	-	-	ENSG00000100852		0.403	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP5	HGNC	protein_coding	OTTHUMT00000409735.1	36	0.00	0	G	NM_001030055	Intron	32615468	32615468	+1	no_errors	ENST00000345122	ensembl	human	known	69_37n	splice_site	33	10.81	4	SNP	1.000	T
ATP1B4	23439	genome.wustl.edu	37	X	119513401	119513401	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chrX:119513401G>T	ENST00000218008.3	+	8	1043	c.986G>T	c.(985-987)tGc>tTc	p.C329F	ATP1B4_ENST00000361319.3_Missense_Mutation_p.C325F|ATP1B4_ENST00000539306.1_Missense_Mutation_p.C286F	NM_001142447.2	NP_001135919.1	Q9UN42	AT1B4_HUMAN	ATPase, Na+/K+ transporting, beta 4 polypeptide	329					monovalent inorganic cation transport (GO:0015672)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|nuclear inner membrane (GO:0005637)|sodium:potassium-exchanging ATPase complex (GO:0005890)	monovalent inorganic cation transmembrane transporter activity (GO:0015077)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	33						CCTGTGCAGTGCCAACTGAAG	0.448																																						dbGAP											0													160.0	128.0	139.0					X																	119513401		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF158383	CCDS14598.1, CCDS48158.1	Xq24	2012-10-22	2010-04-20		ENSG00000101892	ENSG00000101892		"""ATPases / P-type"""	808	protein-coding gene	gene with protein product	"""Na,K-ATPase beta m-subunit"""		"""ATPase, (Na+)/K+ transporting, beta 4 polypeptide"""			10456317, 17592128	Standard	NM_012069		Approved		uc004esr.3	Q9UN42	OTTHUMG00000022299	ENST00000218008.3:c.986G>T	X.37:g.119513401G>T	ENSP00000218008:p.Cys329Phe		Q17RR0|Q9UN41	Missense_Mutation	SNP	pfam_ATPase_P-typ_cation-exchng_bsu,tigrfam_ATPase_P-typ_cation-exchng_bsu	p.C329F	ENST00000218008.3	37	c.986	CCDS48158.1	X	.	.	.	.	.	.	.	.	.	.	G	19.75	3.886294	0.72410	.	.	ENSG00000101892	ENST00000218008;ENST00000361319;ENST00000539306	T;T;T	0.57907	0.37;0.37;0.37	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.80121	0.4565	M	0.93939	3.475	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.999;0.999	D	0.85916	0.1443	10	0.87932	D	0	-0.0787	16.9636	0.86279	0.0:0.0:1.0:0.0	.	286;294;329;325	B7ZKW0;B7ZKV9;Q9UN42;Q9UN42-2	.;.;AT1B4_HUMAN;.	F	329;325;286	ENSP00000218008:C329F;ENSP00000355346:C325F;ENSP00000443334:C286F	ENSP00000218008:C329F	C	+	2	0	ATP1B4	119397429	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.876000	0.92379	2.213000	0.71641	0.600000	0.82982	TGC	ATP1B4	-	pfam_ATPase_P-typ_cation-exchng_bsu,tigrfam_ATPase_P-typ_cation-exchng_bsu	ENSG00000101892		0.448	ATP1B4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATP1B4	HGNC	protein_coding	OTTHUMT00000058095.1	30	0.00	0	G	NM_001142447		119513401	119513401	+1	no_errors	ENST00000218008	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	1.000	T
BIRC3	330	genome.wustl.edu	37	11	102207781	102207781	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr11:102207781G>T	ENST00000263464.3	+	9	4513	c.1763G>T	c.(1762-1764)tGt>tTt	p.C588F	BIRC3_ENST00000532808.1_Missense_Mutation_p.C588F	NM_001165.4	NP_001156.1	Q13489	BIRC3_HUMAN	baculoviral IAP repeat containing 3	588					apoptotic process (GO:0006915)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of necroptotic process (GO:0060546)|negative regulation of phosphorylation (GO:0042326)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein ubiquitination (GO:0031398)|protein heterooligomerization (GO:0051291)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cysteine-type endopeptidase activity (GO:2000116)|regulation of inflammatory response (GO:0050727)|regulation of innate immune response (GO:0045088)|regulation of necroptotic process (GO:0060544)|regulation of nucleotide-binding oligomerization domain containing signaling pathway (GO:0070424)|regulation of RIG-I signaling pathway (GO:0039535)|regulation of toll-like receptor signaling pathway (GO:0034121)|spermatogenesis (GO:0007283)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane raft (GO:0045121)|nucleus (GO:0005634)|protein complex (GO:0043234)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(7)|lung(5)|ovary(3)|skin(1)	21	all_cancers(8;0.00044)|all_epithelial(12;0.00348)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0093)	Lung(13;0.109)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0146)		TTAAGAAAGTGTCCTATTTGT	0.333			T	MALT1	MALT																																	dbGAP		Dom	yes		11	11q22-q23	330	baculoviral IAP repeat-containing 3		L	0													109.0	95.0	100.0					11																	102207781		2203	4299	6502	-	-	-	SO:0001583	missense	0			L49432	CCDS8315.1	11q22	2011-01-25	2011-01-25			ENSG00000023445		"""Baculoviral IAP repeat containing"", ""RING-type (C3HC4) zinc fingers"""	591	protein-coding gene	gene with protein product	"""apoptosis inhibitor 2"", ""TNFR2-TRAF signaling complex protein"", ""mammalian IAP homolog C"", ""inhibitor of apoptosis protein 1"""	601721	"""baculoviral IAP repeat-containing 3"""	API2		8552191, 8548810	Standard	NM_001165		Approved	cIAP2, hiap-1, MIHC, RNF49, MALT2, c-IAP2	uc001pgx.3	Q13489		ENST00000263464.3:c.1763G>T	11.37:g.102207781G>T	ENSP00000263464:p.Cys588Phe		Q16628|Q9HC27|Q9UP46	Missense_Mutation	SNP	pfam_BIR,pfam_CARD,superfamily_DEATH-like,smart_BIR,smart_CARD,smart_Znf_RING,pfscan_CARD,pfscan_BIR,pfscan_Znf_RING	p.C588F	ENST00000263464.3	37	c.1763	CCDS8315.1	11	.	.	.	.	.	.	.	.	.	.	G	23.2	4.382743	0.82792	.	.	ENSG00000023445	ENST00000263464;ENST00000532808;ENST00000532609	D;D	0.99656	-6.31;-6.31	5.14	5.14	0.70334	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	0.000000	0.85682	D	0.000000	D	0.99832	0.9924	H	0.98612	4.28	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96775	0.9571	10	0.87932	D	0	.	19.1568	0.93514	0.0:0.0:1.0:0.0	.	588	Q13489	BIRC3_HUMAN	F	588;588;356	ENSP00000263464:C588F;ENSP00000432907:C588F	ENSP00000263464:C588F	C	+	2	0	BIRC3	101712991	1.000000	0.71417	1.000000	0.80357	0.796000	0.44982	9.601000	0.98297	2.832000	0.97577	0.655000	0.94253	TGT	BIRC3	-	smart_Znf_RING,pfscan_Znf_RING	ENSG00000023445		0.333	BIRC3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BIRC3	HGNC	protein_coding	OTTHUMT00000394159.1	52	0.00	0	G	NM_001165		102207781	102207781	+1	no_errors	ENST00000263464	ensembl	human	known	69_37n	missense	40	11.11	5	SNP	1.000	T
C17orf97	400566	genome.wustl.edu	37	17	263516	263516	+	Silent	SNP	C	C	T	rs75627881|rs71369085|rs71369084		TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr17:263516C>T	ENST00000360127.6	+	2	898	c.882C>T	c.(880-882)ggC>ggT	p.G294G	AC108004.3_ENST00000466740.2_RNA|C17orf97_ENST00000571106.1_Intron	NM_001013672.4	NP_001013694.4	Q6ZQX7	CQ097_HUMAN	chromosome 17 open reading frame 97	324	20 X 10 AA approximative tandem repeat of A-L-K-G-F-H-P-D-P-E.									breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)	14						CCCTCAAGGGCTTCCACCCCG	0.667																																						dbGAP											0													20.0	22.0	21.0					17																	263516		2174	4278	6452	-	-	-	SO:0001819	synonymous_variant	0			AK128660, BC057385	CCDS32519.2	17p13.3	2008-08-15			ENSG00000187624	ENSG00000187624			33800	protein-coding gene	gene with protein product						12477932	Standard	NM_001013672		Approved	LOC400566	uc021tna.1	Q6ZQX7	OTTHUMG00000132479	ENST00000360127.6:c.882C>T	17.37:g.263516C>T			A5D8T6|Q6NSI2|Q6PFW9	Silent	SNP	NULL	p.G294	ENST00000360127.6	37	c.882	CCDS32519.2	17																																																																																			C17orf97	-	NULL	ENSG00000187624		0.667	C17orf97-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C17orf97	HGNC	protein_coding	OTTHUMT00000255648.4	62	0.00	0	C	NM_001013672		263516	263516	+1	no_errors	ENST00000360127	ensembl	human	known	69_37n	silent	51	10.53	6	SNP	0.002	T
C17orf97	400566	genome.wustl.edu	37	17	263622	263622	+	Missense_Mutation	SNP	A	A	G	rs71369083|rs71145728|rs76926791	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr17:263622A>G	ENST00000360127.6	+	2	1004	c.988A>G	c.(988-990)Aag>Gag	p.K330E	AC108004.3_ENST00000466740.2_RNA|C17orf97_ENST00000571106.1_Intron	NM_001013672.4	NP_001013694.4	Q6ZQX7	CQ097_HUMAN	chromosome 17 open reading frame 97	360	20 X 10 AA approximative tandem repeat of A-L-K-G-F-H-P-D-P-E.									breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)	14						CCCCGACCCCAAGGCCCTCAA	0.706																																						dbGAP											0													13.0	18.0	17.0					17																	263622		2111	4164	6275	-	-	-	SO:0001583	missense	0			AK128660, BC057385	CCDS32519.2	17p13.3	2008-08-15			ENSG00000187624	ENSG00000187624			33800	protein-coding gene	gene with protein product						12477932	Standard	NM_001013672		Approved	LOC400566	uc021tna.1	Q6ZQX7	OTTHUMG00000132479	ENST00000360127.6:c.988A>G	17.37:g.263622A>G	ENSP00000353245:p.Lys330Glu		A5D8T6|Q6NSI2|Q6PFW9	Missense_Mutation	SNP	NULL	p.K330E	ENST00000360127.6	37	c.988	CCDS32519.2	17	409	0.18727106227106227	139	0.28252032520325204	73	0.20165745856353592	110	0.19230769230769232	87	0.11477572559366754	A	0	-2.741325	0.00087	.	.	ENSG00000187624	ENST00000360127	T	0.30182	1.54	2.05	-4.1	0.03940	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.20739	-1.0266	8	0.02654	T	1	.	1.1358	0.01755	0.4018:0.196:0.2673:0.1349	.	330	Q6ZQX7-4	.	E	330	ENSP00000353245:K330E	ENSP00000353245:K330E	K	+	1	0	C17orf97	263968	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.402000	0.07223	-2.779000	0.00361	-1.216000	0.01612	AAG	C17orf97	-	NULL	ENSG00000187624		0.706	C17orf97-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C17orf97	HGNC	protein_coding	OTTHUMT00000255648.4	34	0.00	0	A	NM_001013672		263622	263622	+1	no_errors	ENST00000360127	ensembl	human	known	69_37n	missense	36	12.20	5	SNP	0.000	G
C17orf53	78995	genome.wustl.edu	37	17	42225833	42225833	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr17:42225833G>A	ENST00000319977.4	+	3	899	c.662G>A	c.(661-663)gGt>gAt	p.G221D	C17orf53_ENST00000585683.1_Missense_Mutation_p.G221D|C17orf53_ENST00000245382.6_Missense_Mutation_p.G221D	NM_001171251.1|NM_024032.3	NP_001164722.1|NP_076937.2	Q8N3J3	CQ053_HUMAN	chromosome 17 open reading frame 53	221										NS(1)|breast(3)|cervix(1)|kidney(3)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	22		Breast(137;0.0364)|Prostate(33;0.0376)		BRCA - Breast invasive adenocarcinoma(366;0.114)		CACAAAGCGGGTATCATGTCC	0.567																																						dbGAP											0													118.0	117.0	117.0					17																	42225833		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK021656	CCDS11477.1, CCDS59293.1	17q21.31	2012-10-11			ENSG00000125319	ENSG00000125319			28460	protein-coding gene	gene with protein product							Standard	NM_001171251		Approved	MGC3130	uc002ifi.2	Q8N3J3	OTTHUMG00000181808	ENST00000319977.4:c.662G>A	17.37:g.42225833G>A	ENSP00000313500:p.Gly221Asp		A8K7A9|Q9BWM9|Q9HAI1	Missense_Mutation	SNP	NULL	p.G221D	ENST00000319977.4	37	c.662	CCDS11477.1	17	.	.	.	.	.	.	.	.	.	.	G	11.45	1.641610	0.29157	.	.	ENSG00000125319	ENST00000319977;ENST00000245382	T;T	0.39787	1.06;1.06	4.43	1.07	0.20283	.	0.976965	0.08394	N	0.952524	T	0.19287	0.0463	N	0.08118	0	0.09310	N	1	B;B;B	0.16802	0.019;0.008;0.019	B;B;B	0.19946	0.027;0.009;0.027	T	0.24621	-1.0155	10	0.30078	T	0.28	-2.7473	1.1087	0.01700	0.2008:0.1642:0.4442:0.1908	.	221;221;221	A8K7A9;Q8N3J3-3;Q8N3J3	.;.;CQ053_HUMAN	D	221	ENSP00000313500:G221D;ENSP00000245382:G221D	ENSP00000245382:G221D	G	+	2	0	C17orf53	39581359	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	-0.088000	0.11198	0.516000	0.28340	0.561000	0.74099	GGT	C17orf53	-	NULL	ENSG00000125319		0.567	C17orf53-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C17orf53	HGNC	protein_coding	OTTHUMT00000457697.1	52	0.00	0	G	NM_024032		42225833	42225833	+1	no_errors	ENST00000319977	ensembl	human	known	69_37n	missense	41	12.50	6	SNP	0.000	A
C19orf54	284325	genome.wustl.edu	37	19	41255500	41255500	+	Missense_Mutation	SNP	C	C	G	rs2254343	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr19:41255500C>G	ENST00000378313.2	-	1	328	c.209G>C	c.(208-210)cGt>cCt	p.R70P	C19orf54_ENST00000598485.2_5'UTR|C19orf54_ENST00000339153.3_5'UTR|C19orf54_ENST00000598729.1_5'UTR|C19orf54_ENST00000470681.1_5'UTR|SNRPA_ENST00000243563.3_5'Flank	NM_198476.3	NP_940878.3	Q5BKX5	CS054_HUMAN	chromosome 19 open reading frame 54	70				R -> P (in Ref. 3; BC020262). {ECO:0000305}.						breast(1)|lung(1)|urinary_tract(2)	4			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			GAAGACATGACGGGGAGCAGG	0.617													G|||	3790	0.756789	0.8994	0.7968	5008	,	,		16044	0.6349		0.7247	False		,,,				2504	0.6943					dbGAP											0													22.0	29.0	27.0					19																	41255500		692	1591	2283	-	-	-	SO:0001583	missense	0			AK123126	CCDS12564.2	19q13.2	2012-10-26			ENSG00000188493	ENSG00000188493			24758	protein-coding gene	gene with protein product							Standard	NM_198476		Approved	FLJ41131	uc002oou.1	Q5BKX5	OTTHUMG00000150174	ENST00000378313.2:c.209G>C	19.37:g.41255500C>G	ENSP00000367564:p.Arg70Pro		A8MSZ5|B4DNU7	Missense_Mutation	SNP	NULL	p.R70P	ENST00000378313.2	37	c.209	CCDS12564.2	19	1684	0.7710622710622711	450	0.9146341463414634	282	0.7790055248618785	393	0.6870629370629371	559	0.737467018469657	G	7.742	0.701392	0.15172	.	.	ENSG00000188493	ENST00000378313	.	.	.	4.59	4.59	0.56863	.	0.770143	0.10066	N	0.720321	T	0.00012	0.0000	N	0.00210	-1.845	0.09310	P	0.9999999999999999	B	0.02656	0.0	B	0.01281	0.0	T	0.37056	-0.9722	8	0.02654	T	1	-3.7994	10.7158	0.46011	0.0:0.1929:0.8071:0.0	rs2254343;rs17608836;rs58684549;rs2254343	70	Q5BKX5	CS054_HUMAN	P	70	.	ENSP00000367564:R70P	R	-	2	0	C19orf54	45947340	1.000000	0.71417	0.997000	0.53966	0.836000	0.47400	2.689000	0.46993	1.160000	0.42584	-0.120000	0.15030	CGT	C19orf54	-	NULL	ENSG00000188493		0.617	C19orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C19orf54	HGNC	protein_coding	OTTHUMT00000316701.1	32	0.00	0	C	NM_198476		41255500	41255500	-1	no_errors	ENST00000378313	ensembl	human	known	69_37n	missense	43	13.73	7	SNP	1.000	G
B3GALT5	10317	genome.wustl.edu	37	21	40971464	40971464	+	Intron	SNP	G	G	C	rs582539	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr21:40971464G>C	ENST00000380620.4	+	2	69				C21orf88_ENST00000489821.1_5'UTR|C21orf88_ENST00000380612.4_Intron			Q9Y2C3	B3GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5						protein glycosylation (GO:0006486)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	16		Prostate(19;2.55e-06)				AGACATATGTGGGGCTGAGCT	0.577													C|||	2968	0.592652	0.7874	0.4352	5008	,	,		19737	0.4355		0.5626	False		,,,				2504	0.6339					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB020337	CCDS13667.1, CCDS74795.1	21q22.3	2013-02-19			ENSG00000183778	ENSG00000183778		"""Beta 3-glycosyltransferases"""	920	protein-coding gene	gene with protein product	"""homolog of C. elegans Bt toxin resistance gene bre-5"", ""GlcNAc-beta-1,3-galactosyltransferase 5"""	604066				10212226	Standard	NM_006057		Approved	beta3Gal-T5, B3GalT-V, GLCT5, B3T5	uc002yyj.1	Q9Y2C3	OTTHUMG00000086725	ENST00000380620.4:c.-523-5557G>C	21.37:g.40971464G>C			A8KA86|D3DSI3|Q2M3L5|Q53Z19|Q9NY96|Q9P1X6|Q9P1X7	RNA	SNP	-	NULL	ENST00000380620.4	37	NULL	CCDS13667.1	21																																																																																			C21orf88	-	-	ENSG00000184809		0.577	B3GALT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C21orf88	HGNC	protein_coding	OTTHUMT00000195008.2	28	0.00	0	G	NM_033170		40971464	40971464	-1	no_errors	ENST00000489821	ensembl	human	known	69_37n	rna	24	14.29	4	SNP	0.000	C
C9orf62	157927	genome.wustl.edu	37	9	138236031	138236031	+	Silent	SNP	A	A	G	rs914398	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr9:138236031A>G	ENST00000320778.2	+	2	387	c.237A>G	c.(235-237)ccA>ccG	p.P79P		NM_173520.2	NP_775791.1	Q8N4C0	CI062_HUMAN	chromosome 9 open reading frame 62	79																	CCGGACGCCCAGTCCTGGGCT	0.622											OREG0019607	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	A|||	2629	0.52496	0.7383	0.5677	5008	,	,		18306	0.3998		0.4871	False		,,,				2504	0.3742					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			BC034752	CCDS59154.1	9q34.3	2008-02-05			ENSG00000178243	ENSG00000178243			28581	protein-coding gene	gene with protein product						12477932	Standard	NM_173520		Approved	MGC35463	uc004cfo.3	Q8N4C0	OTTHUMG00000020900	ENST00000320778.2:c.237A>G	9.37:g.138236031A>G		1639	Q5T7E2	Silent	SNP	NULL	p.P79	ENST00000320778.2	37	c.237	CCDS59154.1	9																																																																																			C9orf62	-	NULL	ENSG00000178243		0.622	C9orf62-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	C9orf62	HGNC	protein_coding	OTTHUMT00000054980.2	29	0.00	0	A	NM_173520		138236031	138236031	+1	no_errors	ENST00000320778	ensembl	human	putative	69_37n	silent	28	15.15	5	SNP	0.000	G
C9orf116	138162	genome.wustl.edu	37	9	138391299	138391299	+	Intron	SNP	T	T	A	rs7037251	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr9:138391299T>A	ENST00000429260.2	-	1	164				MRPS2_ENST00000241600.5_5'Flank|MRPS2_ENST00000371785.1_5'Flank|C9orf116_ENST00000371789.3_Intron|C9orf116_ENST00000371791.1_Intron	NM_001048265.1|NM_144654.2	NP_001041730.1|NP_653255.1	Q5BN46	CI116_HUMAN	chromosome 9 open reading frame 116																OV - Ovarian serous cystadenocarcinoma(145;7.39e-08)|Epithelial(140;5.19e-07)|all cancers(34;1.04e-05)		CCGACACAAATCAGTGGAGCT	0.607													A|||	2901	0.579273	0.5734	0.5288	5008	,	,		17089	0.8343		0.4553	False		,,,				2504	0.4877					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC021261	CCDS6989.1, CCDS43899.1	9q34.3	2012-04-02			ENSG00000160345	ENSG00000160345			28435	protein-coding gene	gene with protein product	"""p53-induced expression 1 in Rb&#8722;/&#8722; cells"""	614502				12477932	Standard	NM_144654		Approved	MGC29761, RbEST47, PIERCE1	uc004cft.1	Q5BN46	OTTHUMG00000020902	ENST00000429260.2:c.143+255A>T	9.37:g.138391299T>A			Q5T897|Q8WU44	Nonstop_Mutation	SNP	NULL	p.*22C	ENST00000429260.2	37	c.66	CCDS43899.1	9	1292	0.5915750915750916	288	0.5853658536585366	178	0.49171270718232046	478	0.8356643356643356	348	0.45910290237467016	A	2.793	-0.250786	0.05867	.	.	ENSG00000160345	ENST00000419770	.	.	.	1.38	-2.76	0.05896	.	.	.	.	.	.	.	.	.	.	.	0.58432	P	1.999999999946489E-6	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.2759	0.06898	0.3587:0.0:0.4381:0.2032	rs7037251;rs58096808;rs7037251	.	.	.	C	22	.	.	X	-	3	0	C9orf116	137531120	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.249000	0.08842	-1.669000	0.01470	-0.364000	0.07487	TGA	C9orf116	-	NULL	ENSG00000160345		0.607	C9orf116-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf116	HGNC	protein_coding	OTTHUMT00000054985.2	48	0.00	0	T	NM_144654		138391299	138391299	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000419770	ensembl	human	putative	69_37n	nonstop	38	11.63	5	SNP	0.000	A
CACNB3	784	genome.wustl.edu	37	12	49220574	49220574	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr12:49220574G>T	ENST00000301050.2	+	11	1126	c.927G>T	c.(925-927)aaG>aaT	p.K309N	CACNB3_ENST00000540990.1_Missense_Mutation_p.K296N|CACNB3_ENST00000547230.1_Missense_Mutation_p.K268N|CACNB3_ENST00000547392.1_Missense_Mutation_p.K282N|CACNB3_ENST00000536187.2_Missense_Mutation_p.K308N	NM_000725.3	NP_000716.2	P54284	CACB3_HUMAN	calcium channel, voltage-dependent, beta 3 subunit	309					axon guidance (GO:0007411)|calcium ion transport (GO:0006816)|membrane depolarization (GO:0051899)|synaptic transmission (GO:0007268)|T cell receptor signaling pathway (GO:0050852)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|membrane (GO:0016020)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			autonomic_ganglia(1)|breast(1)|large_intestine(5)|lung(4)|prostate(1)	12					Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	CCCGGGGGAAGTCACAGATGA	0.617																																						dbGAP											0													168.0	172.0	171.0					12																	49220574		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8769.1, CCDS55821.1, CCDS55822.1, CCDS55823.1	12q13	2008-05-02				ENSG00000167535		"""Calcium channel subunits"""	1403	protein-coding gene	gene with protein product		601958		CACNLB3		8119293	Standard	NM_000725		Approved		uc010sly.2	P54284		ENST00000301050.2:c.927G>T	12.37:g.49220574G>T	ENSP00000301050:p.Lys309Asn		A8K0Z4|B7Z4Q1|B7Z973|B7ZAK8|F5GZW7|F5H2P6|F8VSG3|Q13913	Missense_Mutation	SNP	pfam_Guanylate_kin,pfam_VDCC_L_bsu,superfamily_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,prints_VDCC_L_bsu,prints_VDCC_L_b3su	p.K309N	ENST00000301050.2	37	c.927	CCDS8769.1	12	.	.	.	.	.	.	.	.	.	.	G	20.3	3.974077	0.74246	.	.	ENSG00000167535	ENST00000540990;ENST00000536187;ENST00000547392;ENST00000301050;ENST00000547230	T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86	5.64	4.74	0.60224	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (1);	0.000000	0.85682	D	0.000000	T	0.70116	0.3187	M	0.91717	3.235	0.58432	D	0.999999	D;D;D;D	0.76494	0.996;0.999;0.997;0.999	D;D;D;D	0.77557	0.99;0.973;0.953;0.984	T	0.74615	-0.3606	10	0.87932	D	0	-28.8307	6.5295	0.22320	0.2357:0.0:0.7643:0.0	.	308;296;309;296	F5GZW7;F5H2P6;P54284;B7Z973	.;.;CACB3_HUMAN;.	N	296;308;282;309;268	ENSP00000445495:K296N;ENSP00000444160:K308N;ENSP00000446529:K282N;ENSP00000301050:K309N;ENSP00000448304:K268N	ENSP00000301050:K309N	K	+	3	2	CACNB3	47506841	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.703000	0.47110	2.651000	0.90000	0.655000	0.94253	AAG	CACNB3	-	pfam_Guanylate_kin,smart_Guanylate_kin/L-typ_Ca_channel,prints_VDCC_L_bsu	ENSG00000167535		0.617	CACNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNB3	HGNC	protein_coding	OTTHUMT00000408886.1	37	0.00	0	G			49220574	49220574	+1	no_errors	ENST00000301050	ensembl	human	known	69_37n	missense	33	10.53	4	SNP	1.000	T
CCDC74B	91409	genome.wustl.edu	37	2	130900188	130900188	+	Intron	SNP	A	A	G	rs28743163	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr2:130900188A>G	ENST00000310463.6	-	3	433				CCDC74B_ENST00000409128.1_Intron|CCDC74B_ENST00000392984.3_Missense_Mutation_p.V123A|CCDC74B_ENST00000409943.3_Intron	NM_207310.2	NP_997193.1	Q96LY2	CC74B_HUMAN	coiled-coil domain containing 74B											endometrium(2)|large_intestine(1)|lung(3)	6	Colorectal(110;0.1)					TGCCCCAGCTACGATGTTCCC	0.602													.|||	2533	0.505791	0.7171	0.4986	5008	,	,		16839	0.4454		0.3559	False		,,,				2504	0.4417					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS2155.1, CCDS58726.1	2q21.1	2006-11-29		2006-02-16	ENSG00000152076	ENSG00000152076			25267	protein-coding gene	gene with protein product							Standard	NM_001258307		Approved	DKFZp434E2321	uc002tqn.2	Q96LY2	OTTHUMG00000131629	ENST00000310463.6:c.296-234T>C	2.37:g.130900188A>G			Q6NW18	Missense_Mutation	SNP	NULL	p.V123A	ENST00000310463.6	37	c.368	CCDS2155.1	2	934	0.42765567765567764	318	0.6463414634146342	150	0.4143646408839779	245	0.42832167832167833	221	0.29155672823219	.	0.005	-2.181722	0.00308	.	.	ENSG00000152076	ENST00000392984	T	0.29142	1.58	1.5	-0.946	0.10385	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.43360	-0.9396	7	0.02654	T	1	.	2.154	0.03807	0.3657:0.0:0.3896:0.2447	rs28743163	123	E7ESC5	.	A	123	ENSP00000376710:V123A	ENSP00000376710:V123A	V	-	2	0	CCDC74B	130616658	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.214000	0.09292	-1.386000	0.02098	-1.311000	0.01308	GTA	CCDC74B	-	NULL	ENSG00000152076		0.602	CCDC74B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC74B	HGNC	protein_coding	OTTHUMT00000254522.3	29	0.00	0	A	NM_207310		130900188	130900188	-1	no_errors	ENST00000392984	ensembl	human	known	69_37n	missense	26	23.53	8	SNP	0.000	G
CD2AP	23607	genome.wustl.edu	37	6	47549883	47549883	+	Intron	SNP	T	T	C	rs2275446	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr6:47549883T>C	ENST00000359314.5	+	11	1564					NM_012120.2	NP_036252.1	Q9Y5K6	CD2AP_HUMAN	CD2-associated protein						mitotic nuclear division (GO:0007067)|negative regulation of transforming growth factor beta1 production (GO:0032911)|positive regulation of protein localization to nucleus (GO:1900182)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein complex assembly (GO:0006461)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of receptor-mediated endocytosis (GO:0048259)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|substrate-dependent cell migration, cell extension (GO:0006930)|vesicle organization (GO:0016050)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	SH3 domain binding (GO:0017124)|structural constituent of cytoskeleton (GO:0005200)			kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	20			Lung(136;0.105)|LUSC - Lung squamous cell carcinoma(51;0.138)			CACACTGAGTTATTTACACTG	0.299													C|||	2618	0.522764	0.4955	0.4496	5008	,	,		16187	0.2808		0.6889	False		,,,				2504	0.6902					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF146277	CCDS34472.1	6p12	2008-02-05			ENSG00000198087	ENSG00000198087			14258	protein-coding gene	gene with protein product		604241				10339567	Standard	NM_012120		Approved	CMS	uc003oyw.3	Q9Y5K6	OTTHUMG00000014799	ENST00000359314.5:c.1108+82T>C	6.37:g.47549883T>C			A6NL34|Q5VYA3|Q9UG97	RNA	SNP	-	NULL	ENST00000359314.5	37	NULL	CCDS34472.1	6																																																																																			CD2AP	-	-	ENSG00000198087		0.299	CD2AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD2AP	HGNC	protein_coding	OTTHUMT00000040817.2	23	0.00	0	T			47549883	47549883	+1	no_errors	ENST00000479857	ensembl	human	known	69_37n	rna	18	21.74	5	SNP	0.000	C
CDH1	999	genome.wustl.edu	37	16	68845757	68845757	+	Nonsense_Mutation	SNP	C	C	T	rs587780784		TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr16:68845757C>T	ENST00000261769.5	+	7	1194	c.1003C>T	c.(1003-1005)Cga>Tga	p.R335*	RP11-354M1.2_ENST00000563916.1_RNA|CDH1_ENST00000422392.2_Nonsense_Mutation_p.R335*|CDH1_ENST00000562836.1_3'UTR	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	335	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.R335*(1)|p.?(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		TGGGCTGGACCGAGAGGTCAG	0.507			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	2	Substitution - Nonsense(1)|Unknown(1)	large_intestine(1)|breast(1)	GRCh37	CM022775	CDH1	M							75.0	71.0	72.0					16																	68845757		2198	4300	6498	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.1003C>T	16.37:g.68845757C>T	ENSP00000261769:p.Arg335*		A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R335*	ENST00000261769.5	37	c.1003	CCDS10869.1	16	.	.	.	.	.	.	.	.	.	.	C	37	6.218011	0.97385	.	.	ENSG00000039068	ENST00000261769;ENST00000379120;ENST00000268794;ENST00000422392	.	.	.	5.47	3.22	0.36961	.	0.000000	0.44688	D	0.000437	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.3929	0.60834	0.4318:0.5681:0.0:0.0	.	.	.	.	X	335	.	ENSP00000261769:R335X	R	+	1	2	CDH1	67403258	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	1.320000	0.33666	1.416000	0.47057	0.561000	0.74099	CGA	CDH1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000039068		0.507	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	34	0.00	0	C	NM_004360		68845757	68845757	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	nonsense	8	57.14	12	SNP	1.000	T
CELA3B	23436	genome.wustl.edu	37	1	22304463	22304463	+	Intron	SNP	A	A	G	rs12058649	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr1:22304463A>G	ENST00000337107.6	+	2	62				RN7SL421P_ENST00000582599.1_RNA	NM_007352.2	NP_031378.1	P08861	CEL3B_HUMAN	chymotrypsin-like elastase family, member 3B						cholesterol metabolic process (GO:0008203)|proteolysis (GO:0006508)		peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			breast(2)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	8						cggcctctcaaagcactagga	0.493													G|||	3804	0.759585	0.5862	0.8588	5008	,	,		13145	0.6558		0.8936	False		,,,				2504	0.8926					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			M18692	CCDS219.1	1p36.12	2009-05-05	2009-05-05	2009-05-05	ENSG00000219073	ENSG00000219073	3.4.21.70		15945	protein-coding gene	gene with protein product	"""proteinase E"", ""elastase 1"", ""cholesterol-binding pancreatic protease"", ""pancreatic endopeptidase E"""		"""elastase 3B, pancreatic"""	ELA3B		2826474, 2460440	Standard	NM_007352		Approved	CBPP	uc001bfk.3	P08861	OTTHUMG00000002758	ENST00000337107.6:c.44-399A>G	1.37:g.22304463A>G			B2RE44|P11423|Q5VU28|Q5VU29|Q5VU30	Silent	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.Q25	ENST00000337107.6	37	c.75	CCDS219.1	1																																																																																			CELA3B	-	NULL	ENSG00000219073		0.493	CELA3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELA3B	HGNC	protein_coding	OTTHUMT00000007797.1	15	0.00	0	A	NM_007352		22304463	22304463	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000374666	ensembl	human	known	69_37n	silent	11	31.25	5	SNP	0.000	G
CHRNA7	1139	genome.wustl.edu	37	15	32460485	32460485	+	Silent	SNP	C	C	T	rs200301018		TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr15:32460485C>T	ENST00000306901.3	+	10	1432	c.1335C>T	c.(1333-1335)aaC>aaT	p.N445N	CHRNA7_ENST00000454250.3_Silent_p.N474N|CHRNA7_ENST00000455693.2_Silent_p.N264N	NM_000746.5	NP_000737.1	P36544	ACHA7_HUMAN	cholinergic receptor, nicotinic, alpha 7 (neuronal)	445					activation of MAPK activity (GO:0000187)|associative learning (GO:0008306)|B cell activation (GO:0042113)|behavioral response to ethanol (GO:0048149)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cellular calcium ion homeostasis (GO:0006874)|cognition (GO:0050890)|dopamine biosynthetic process (GO:0042416)|endocytosis (GO:0006897)|generation of ovulation cycle rhythm (GO:0060112)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|memory (GO:0007613)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of tumor necrosis factor production (GO:0032720)|neuronal action potential (GO:0019228)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart rate involved in baroreceptor response to decreased systemic arterial blood pressure (GO:0001988)|regulation of norepinephrine secretion (GO:0014061)|regulation of synaptic transmission, dopaminergic (GO:0032225)|response to food (GO:0032094)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|signal transduction (GO:0007165)|sperm motility (GO:0030317)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|T cell activation (GO:0042110)	acetylcholine-gated channel complex (GO:0005892)|apical plasma membrane (GO:0016324)|asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|external side of plasma membrane (GO:0009897)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|acetylcholine-gated cation channel activity (GO:0022848)|beta-amyloid binding (GO:0001540)|chloride channel regulator activity (GO:0017081)|drug binding (GO:0008144)|protein homodimerization activity (GO:0042803)|toxic substance binding (GO:0015643)			endometrium(3)|large_intestine(1)|lung(6)|ovary(2)	12		all_lung(180;6.35e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	ACATTGCCAACCGCTTCCGCT	0.667																																					Esophageal Squamous(193;529 2900 40232 43193)	dbGAP											0													1.0	2.0	2.0					15																	32460485		1021	2461	3482	-	-	-	SO:0001819	synonymous_variant	0			Z23141	CCDS10027.1, CCDS53924.1	15q13.3	2012-02-11	2012-02-07		ENSG00000175344	ENSG00000175344		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1960	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 7 (neuronal)"""	118511	"""cholinergic receptor, nicotinic, alpha polypeptide 7"""			8188270	Standard	NM_001190455		Approved		uc021sic.2	P36544	OTTHUMG00000129285	ENST00000306901.3:c.1335C>T	15.37:g.32460485C>T			A8K7Q4|B4DFS0|Q15826|Q8IUZ4|Q96RH2|Q99555|Q9BXH0	Silent	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.N474	ENST00000306901.3	37	c.1422	CCDS10027.1	15																																																																																			CHRNA7	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel	ENSG00000175344		0.667	CHRNA7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CHRNA7	HGNC	protein_coding	OTTHUMT00000251410.2	14	0.00	0	C			32460485	32460485	+1	no_errors	ENST00000454250	ensembl	human	known	69_37n	silent	14	36.36	8	SNP	1.000	T
CKAP2	26586	genome.wustl.edu	37	13	53035902	53035902	+	Nonsense_Mutation	SNP	C	C	G			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr13:53035902C>G	ENST00000378037.5	+	4	1034	c.944C>G	c.(943-945)tCa>tGa	p.S315*	CKAP2_ENST00000258607.5_Nonsense_Mutation_p.S314*|CKAP2_ENST00000378034.3_Nonsense_Mutation_p.S314*|CKAP2_ENST00000490903.1_Nonsense_Mutation_p.S266*	NM_001098525.1|NM_018204.3	NP_001091995.1|NP_060674.3			cytoskeleton associated protein 2											breast(2)|kidney(3)|large_intestine(3)|lung(7)|ovary(3)|skin(1)|urinary_tract(1)	20		Breast(56;0.000207)|Lung NSC(96;0.00212)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.6e-08)		AAGACTCTATCAAGATCCATA	0.388																																						dbGAP											0													77.0	83.0	81.0					13																	53035902		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF177227	CCDS9435.1, CCDS41893.1, CCDS66557.1, CCDS73578.1	13q14	2014-03-21			ENSG00000136108	ENSG00000136108			1990	protein-coding gene	gene with protein product		611569				9771967	Standard	XM_005266343		Approved	LB1, FLJ10749, se20-10, TMAP	uc001vgv.2	Q8WWK9	OTTHUMG00000016967	ENST00000378037.5:c.944C>G	13.37:g.53035902C>G	ENSP00000367276:p.Ser315*			Nonsense_Mutation	SNP	NULL	p.S315*	ENST00000378037.5	37	c.944	CCDS41893.1	13	.	.	.	.	.	.	.	.	.	.	.	11.75	1.731894	0.30684	.	.	ENSG00000136108	ENST00000398044;ENST00000258607;ENST00000378034;ENST00000378037;ENST00000490903	.	.	.	5.57	4.73	0.59995	.	0.981199	0.08355	N	0.958553	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-2.1126	8.2449	0.31682	0.0:0.7597:0.1563:0.0839	.	.	.	.	X	315;314;314;315;266	.	.	S	+	2	0	CKAP2	51933903	0.004000	0.15560	0.007000	0.13788	0.001000	0.01503	1.100000	0.31025	1.353000	0.45828	-0.143000	0.13931	TCA	CKAP2	-	NULL	ENSG00000136108		0.388	CKAP2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CKAP2	HGNC	protein_coding	OTTHUMT00000355010.2	20	0.00	0	C			53035902	53035902	+1	no_errors	ENST00000378037	ensembl	human	known	69_37n	nonsense	23	28.12	9	SNP	0.011	G
CPNE4	131034	genome.wustl.edu	37	3	131253669	131253669	+	3'UTR	SNP	C	C	G			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr3:131253669C>G	ENST00000512055.1	-	0	4170				CPNE4_ENST00000429747.1_3'UTR|CPNE4_ENST00000503204.1_5'UTR			Q96A23	CPNE4_HUMAN	copine IV							extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|liver(1)|lung(16)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	39						TTTCGTCTATCAACATTCAGT	0.274																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			H29499	CCDS3072.1, CCDS75010.1	3q22.1	2014-09-04			ENSG00000196353	ENSG00000196353			2317	protein-coding gene	gene with protein product	"""copine 8"""	604208				9430674, 12670487	Standard	XM_005247107		Approved	COPN4, CPN4	uc003eok.3	Q96A23	OTTHUMG00000159631	ENST00000512055.1:c.*370G>C	3.37:g.131253669C>G			D3DNC5|Q8TEX1	RNA	SNP	-	NULL	ENST00000512055.1	37	NULL	CCDS3072.1	3																																																																																			CPNE4	-	-	ENSG00000196353		0.274	CPNE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE4	HGNC	protein_coding	OTTHUMT00000356583.4	22	0.00	0	C	NM_130808		131253669	131253669	-1	no_errors	ENST00000503204	ensembl	human	known	69_37n	rna	16	50.00	16	SNP	0.992	G
CPNE4	131034	genome.wustl.edu	37	3	131253786	131253786	+	3'UTR	SNP	C	C	T			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr3:131253786C>T	ENST00000512055.1	-	0	4053				CPNE4_ENST00000429747.1_3'UTR|CPNE4_ENST00000511604.1_Intron|CPNE4_ENST00000503204.1_5'UTR|CPNE4_ENST00000512332.1_3'UTR			Q96A23	CPNE4_HUMAN	copine IV							extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|liver(1)|lung(16)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	39						AGGCGACATGCTGTAATGTAA	0.313																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			H29499	CCDS3072.1, CCDS75010.1	3q22.1	2014-09-04			ENSG00000196353	ENSG00000196353			2317	protein-coding gene	gene with protein product	"""copine 8"""	604208				9430674, 12670487	Standard	XM_005247107		Approved	COPN4, CPN4	uc003eok.3	Q96A23	OTTHUMG00000159631	ENST00000512055.1:c.*253G>A	3.37:g.131253786C>T			D3DNC5|Q8TEX1	RNA	SNP	-	NULL	ENST00000512055.1	37	NULL	CCDS3072.1	3																																																																																			CPNE4	-	-	ENSG00000196353		0.313	CPNE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE4	HGNC	protein_coding	OTTHUMT00000356583.4	40	0.00	0	C	NM_130808		131253786	131253786	-1	no_errors	ENST00000503204	ensembl	human	known	69_37n	rna	22	38.89	14	SNP	1.000	T
CRHBP	1393	genome.wustl.edu	37	5	76264653	76264653	+	Silent	SNP	C	C	T	rs563228859		TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr5:76264653C>T	ENST00000274368.4	+	7	1334	c.912C>T	c.(910-912)taC>taT	p.Y304Y	CRHBP_ENST00000514258.1_Intron	NM_001882.3	NP_001873.2	P24387	CRHBP_HUMAN	corticotropin releasing hormone binding protein	304					behavioral response to ethanol (GO:0048149)|cellular response to calcium ion (GO:0071277)|cellular response to cAMP (GO:0071320)|cellular response to cocaine (GO:0071314)|cellular response to drug (GO:0035690)|cellular response to estradiol stimulus (GO:0071392)|cellular response to estrogen stimulus (GO:0071391)|cellular response to gonadotropin-releasing hormone (GO:0097211)|cellular response to potassium ion (GO:0035865)|cellular response to stress (GO:0033554)|cellular response to tumor necrosis factor (GO:0071356)|female pregnancy (GO:0007565)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|inflammatory response (GO:0006954)|learning or memory (GO:0007611)|maternal aggressive behavior (GO:0002125)|negative regulation of corticotropin secretion (GO:0051460)|negative regulation of corticotropin-releasing hormone receptor activity (GO:1900011)|regulated secretory pathway (GO:0045055)|regulation of corticotropin secretion (GO:0051459)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|signal transduction (GO:0007165)|synaptic transmission, dopaminergic (GO:0001963)	axon terminus (GO:0043679)|dendrite (GO:0030425)|dense core granule (GO:0031045)|extracellular space (GO:0005615)|intracellular (GO:0005622)|microtubule (GO:0005874)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|perikaryon (GO:0043204)|secondary lysosome (GO:0005767)|secretory granule (GO:0030141)|varicosity (GO:0043196)	corticotropin-releasing hormone binding (GO:0051424)|peptide binding (GO:0042277)			kidney(3)|large_intestine(4)|lung(6)|prostate(1)|skin(2)	16		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-51)|Epithelial(54;8.79e-46)|all cancers(79;2.49e-41)		TGGAGCCGTACGAGCTGGAAA	0.458													C|||	1	0.000199681	0.0	0.0	5008	,	,		18715	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													146.0	131.0	136.0					5																	76264653		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X58022	CCDS4034.1	5q	2008-07-18	2001-11-28		ENSG00000145708	ENSG00000145708			2356	protein-coding gene	gene with protein product		122559	"""corticotropin releasing hormone-binding protein"""			8198617	Standard	NM_001882		Approved	CRF-BP, CRFBP	uc003ker.3	P24387	OTTHUMG00000102133	ENST00000274368.4:c.912C>T	5.37:g.76264653C>T			Q53F32|Q6FHT5	Silent	SNP	pfam_CRF-bd,superfamily_CUB,pirsf_CRF-bd	p.Y304	ENST00000274368.4	37	c.912	CCDS4034.1	5																																																																																			CRHBP	-	pfam_CRF-bd,pirsf_CRF-bd	ENSG00000145708		0.458	CRHBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRHBP	HGNC	protein_coding	OTTHUMT00000219972.2	36	0.00	0	C	NM_001882		76264653	76264653	+1	no_errors	ENST00000274368	ensembl	human	known	69_37n	silent	31	36.73	18	SNP	0.000	T
CT47A6	728062	genome.wustl.edu	37	X	120094429	120094429	+	Silent	SNP	C	C	T			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chrX:120094429C>T	ENST00000443600.2	-	1	908	c.654G>A	c.(652-654)gaG>gaA	p.E218E	CT47A5_ENST00000419194.2_Intron	NM_001080141.1	NP_001073610.1	Q5JQC4	CT47A_HUMAN	cancer/testis antigen family 47, member A6	218										large_intestine(1)|lung(4)	5						CTGAGAGCTTCTCCTCTGCGG	0.677																																						dbGAP											0													14.0	39.0	34.0					X																	120094429		628	2270	2898	-	-	-	SO:0001819	synonymous_variant	0				CCDS35386.1	Xq24	2013-10-15			ENSG00000226023	ENSG00000226023			33287	protein-coding gene	gene with protein product	"""cancer/testis CT47 family, member 6"""	300785				16382448	Standard	NM_001080141		Approved	CT47.6	uc004eth.3	Q5JQC4	OTTHUMG00000022316	ENST00000443600.2:c.654G>A	X.37:g.120094429C>T			Q8N747	Silent	SNP	NULL	p.E218	ENST00000443600.2	37	c.654	CCDS35386.1	X																																																																																			CT47A6	-	NULL	ENSG00000226023		0.677	CT47A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CT47A6	HGNC	protein_coding	OTTHUMT00000058129.1	76	0.00	0	C	NM_001080141		120094429	120094429	-1	no_errors	ENST00000443600	ensembl	human	known	69_37n	silent	17	72.58	45	SNP	0.038	T
NDUFA6-AS1	100132273	genome.wustl.edu	37	22	42537597	42537597	+	RNA	SNP	A	A	G	rs1800754	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr22:42537597A>G	ENST00000416037.2	+	0	8970				CYP2D7P1_ENST00000358097.4_RNA|RP4-669P10.16_ENST00000428786.1_RNA|CYP2D7P1_ENST00000433992.1_RNA|CYP2D7P1_ENST00000424775.1_RNA	NR_034118.1				NDUFA6 antisense RNA 1 (head to head)																		CAGCGTGGTCAAGGTGGTCAC	0.627													N|||	2485	0.496206	0.6528	0.5389	5008	,	,		20495	0.3036		0.4672	False		,,,				2504	0.4826					dbGAP											0																																										-	-	-			0			BC039542		22q13.2	2013-03-18	2013-03-18		ENSG00000237037	ENSG00000237037		"""Long non-coding RNAs"""	45273	non-coding RNA	RNA, long non-coding							Standard	NR_034118		Approved		uc003bcd.1		OTTHUMG00000150917		22.37:g.42537597A>G				Silent	SNP	NULL	p.L311	ENST00000416037.2	37	c.933		22	1061	0.4858058608058608	321	0.6524390243902439	190	0.5248618784530387	196	0.34265734265734266	354	0.46701846965699206	N	0.201	-1.044666	0.01997	.	.	ENSG00000205702	ENST00000428297;ENST00000354609;ENST00000381321;ENST00000436260	.	.	.	3.59	2.46	0.29980	.	0.381500	0.24886	N	0.034809	T	0.00012	0.0000	.	.	.	0.20489	P	0.999899446	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.45145	-0.9281	7	0.02654	T	1	.	8.282	0.31906	0.0988:0.1583:0.7429:0.0	rs1800754	311;221	Q6XP50;F5H167	.;.	S	310;259;257;221	.	ENSP00000442416:L259S	L	-	2	0	CYP2D7P1	40867541	0.013000	0.17824	0.021000	0.16686	0.062000	0.15995	1.734000	0.38166	0.857000	0.35407	-0.498000	0.04607	TTG	CYP2D7P1	-	NULL	ENSG00000205702		0.627	NDUFA6-AS1-001	KNOWN	basic|exp_conf	antisense	CYP2D7P1	HGNC	processed_transcript	OTTHUMT00000320522.4	43	0.00	0	A	NR_034118		42537597	42537597	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000433992	ensembl	human	known	69_37n	silent	23	17.86	5	SNP	0.308	G
CYP2D7	1564	genome.wustl.edu	37	22	42538618	42538618	+	RNA	SNP	A	A	G	rs2267448	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr22:42538618A>G	ENST00000428786.1	-	0	0				CYP2D7P1_ENST00000358097.4_RNA|CYP2D7P1_ENST00000433992.1_RNA|CYP2D7P1_ENST00000424775.1_RNA																							TGTCCAAGAGACCGTTGGGGC	0.667													N|||	2010	0.401358	0.3079	0.5216	5008	,	,		15068	0.3026		0.4632	False		,,,				2504	0.4806					dbGAP											0																																										-	-	-			0																															22.37:g.42538618A>G				Missense_Mutation	SNP	NULL	p.S177P	ENST00000428786.1	37	c.529		22	817|817	0.3740842490842491|0.3740842490842491	146|146	0.2967479674796748|0.2967479674796748	180|180	0.4972375690607735|0.4972375690607735	165|165	0.28846153846153844|0.28846153846153844	326|326	0.43007915567282323|0.43007915567282323	G|G	10.57|10.57	1.386771|1.386771	0.25031|0.25031	.|.	.|.	ENSG00000205702|ENSG00000205702	ENST00000535769|ENST00000381321	.|.	.|.	.|.	3.26|3.26	-6.53|-6.53	0.01866|0.01866	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	.|.	.|.	.|.	0.58432|0.58432	P|P	9.99999999995449E-6|9.99999999995449E-6	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.37384|0.37384	-0.9708|-0.9708	4|4	0.87932|0.72032	D|D	0|0.01	.|.	3.9589|3.9589	0.09403|0.09403	0.1795:0.4982:0.1961:0.1262|0.1795:0.4982:0.1961:0.1262	rs3021080;rs57365807|rs3021080;rs57365807	.|.	.|.	.|.	P|A	67|124	.|.	ENSP00000445124:S177P|ENSP00000446103:V124A	S|V	-|-	1|2	0|0	CYP2D7P1|CYP2D7P1	40868562|40868562	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-1.610000|-1.610000	0.02064|0.02064	-1.561000|-1.561000	0.01684|0.01684	-2.500000|-2.500000	0.00191|0.00191	TCT|GTC	CYP2D7P1	-	NULL	ENSG00000205702		0.667	RP4-669P10.16-001	KNOWN	basic|exp_conf	sense_intronic	CYP2D7P1	HGNC	sense_intronic	OTTHUMT00000320534.1	82	0.00	0	A			42538618	42538618	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000433992	ensembl	human	known	69_37n	missense	42	12.50	6	SNP	0.000	G
DNAAF2	55172	genome.wustl.edu	37	14	50101024	50101024	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr14:50101024C>T	ENST00000298292.8	-	1	924	c.844G>A	c.(844-846)Gag>Aag	p.E282K	DNAAF2_ENST00000406043.3_Missense_Mutation_p.E282K	NM_018139.2	NP_060609.2	Q9NVR5	KTU_HUMAN	dynein, axonemal, assembly factor 2	282					axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)				kidney(1)|lung(4)	5						ATCACCAGCTCATGGGGCACG	0.667																																						dbGAP											0													18.0	21.0	20.0					14																	50101024		2089	4168	6257	-	-	-	SO:0001583	missense	0			AK001425	CCDS9691.2, CCDS45100.1	14q21.3	2012-05-03	2011-06-09	2011-06-09	ENSG00000165506	ENSG00000165506			20188	protein-coding gene	gene with protein product	"""kintoun"""	612517	"""chromosome 14 open reading frame 104"""	C14orf104			Standard	NM_001083908		Approved	FLJ10563, KTU, PF13, CILD10	uc001wws.4	Q9NVR5	OTTHUMG00000152331	ENST00000298292.8:c.844G>A	14.37:g.50101024C>T	ENSP00000298292:p.Glu282Lys		B9WS54|C0JAP7|Q86TR1|Q86TY8|Q969Z5	Missense_Mutation	SNP	NULL	p.E282K	ENST00000298292.8	37	c.844	CCDS9691.2	14	.	.	.	.	.	.	.	.	.	.	C	21.2	4.112106	0.77210	.	.	ENSG00000165506	ENST00000298292;ENST00000406043	T;T	0.18657	2.2;2.2	5.23	5.23	0.72850	.	.	.	.	.	T	0.42108	0.1188	L	0.51422	1.61	0.51012	D	0.999907	D;P	0.89917	1.0;0.608	D;P	0.83275	0.996;0.613	T	0.09662	-1.0664	9	0.42905	T	0.14	.	17.619	0.88075	0.0:1.0:0.0:0.0	.	282;282	Q9NVR5-2;Q9NVR5	.;KTU_HUMAN	K	282	ENSP00000298292:E282K;ENSP00000384862:E282K	ENSP00000298292:E282K	E	-	1	0	DNAAF2	49170774	0.998000	0.40836	1.000000	0.80357	0.106000	0.19336	4.099000	0.57755	2.471000	0.83476	0.449000	0.29647	GAG	DNAAF2	-	NULL	ENSG00000165506		0.667	DNAAF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DNAAF2	HGNC	protein_coding	OTTHUMT00000276813.1	9	0.00	0	C			50101024	50101024	-1	no_errors	ENST00000298292	ensembl	human	known	69_37n	missense	5	58.33	7	SNP	1.000	T
DST	667	genome.wustl.edu	37	6	56323956	56323956	+	Silent	SNP	G	G	A			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr6:56323956G>A	ENST00000361203.3	-	98	22240	c.22233C>T	c.(22231-22233)atC>atT	p.I7411I	DST_ENST00000421834.2_Silent_p.I5407I|DST_ENST00000244364.6_Silent_p.I5121I|DST_ENST00000370754.5_Silent_p.I7700I|DST_ENST00000312431.6_3'UTR|DST_ENST00000370769.4_Silent_p.I7522I|DST_ENST00000370788.2_Silent_p.I5325I|DST_ENST00000446842.2_Silent_p.I7196I			Q03001	DYST_HUMAN	dystonin	7520					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			ACACGGACTGGATTTCTGAAA	0.572																																						dbGAP											0													64.0	68.0	67.0					6																	56323956		2009	4186	6195	-	-	-	SO:0001819	synonymous_variant	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.22233C>T	6.37:g.56323956G>A			B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	pfam_GAS2_dom,superfamily_GAS2_dom,smart_GAS2_dom	p.S209F	ENST00000361203.3	37	c.626		6	.	.	.	.	.	.	.	.	.	.	G	8.060	0.767955	0.15983	.	.	ENSG00000151914	ENST00000523292	.	.	.	5.96	5.0	0.66597	.	.	.	.	.	T	0.55641	0.1933	.	.	.	.	.	.	.	.	.	.	.	.	T	0.58792	-0.7574	3	.	.	.	.	14.7683	0.69657	0.0739:0.0:0.9261:0.0	.	.	.	.	F	209	.	.	S	-	2	0	DST	56431915	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.932000	0.56537	1.363000	0.46019	0.655000	0.94253	TCC	DST	-	NULL	ENSG00000151914		0.572	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	32	0.00	0	G	NM_001723		56323956	56323956	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000523292	ensembl	human	novel	69_37n	missense	18	43.75	14	SNP	1.000	A
ERICH1	157697	genome.wustl.edu	37	8	565232	565232	+	Silent	SNP	C	C	G	rs1669694	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr8:565232C>G	ENST00000522706.1	-	4	1064	c.1029G>C	c.(1027-1029)ggG>ggC	p.G343G				Q86X53	ERIC1_HUMAN	glutamate-rich 1	0										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|pancreas(1)	20		Colorectal(14;0.158)|Ovarian(12;0.17)|Myeloproliferative disorder(644;0.185)|Hepatocellular(245;0.236)		Epithelial(5;3.29e-14)|BRCA - Breast invasive adenocarcinoma(11;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(5;3.65e-06)|READ - Rectum adenocarcinoma(1;0.0325)		GTTAAGGCAGCCCCTCTCTCT	0.428													c|||	2712	0.541534	0.5802	0.6225	5008	,	,		22143	0.4722		0.507	False		,,,				2504	0.5389					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0				CCDS5955.1	8p23.3	2005-09-01			ENSG00000104714	ENSG00000104714			27234	protein-coding gene	gene with protein product							Standard	NM_207332		Approved		uc003wph.3	Q86X53	OTTHUMG00000129163	ENST00000522706.1:c.1029G>C	8.37:g.565232C>G			A8K2J9|Q9P063	Silent	SNP	NULL	p.G343	ENST00000522706.1	37	c.1029		8																																																																																			ERICH1	-	NULL	ENSG00000104714		0.428	ERICH1-003	NOVEL	basic|appris_candidate	protein_coding	ERICH1	HGNC	protein_coding	OTTHUMT00000374540.1	66	0.00	0	C	NM_207332		565232	565232	-1	no_errors	ENST00000522706	ensembl	human	novel	69_37n	silent	31	16.22	6	SNP	0.000	G
VSIG2	23584	genome.wustl.edu	37	11	124622534	124622534	+	5'Flank	SNP	C	C	T	rs61910626	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr11:124622534C>T	ENST00000326621.5	-	0	0				VSIG2_ENST00000403470.1_5'Flank|ESAM_ENST00000442070.2_Nonsense_Mutation_p.W123*	NM_014312.3	NP_055127.2	Q96IQ7	VSIG2_HUMAN	V-set and immunoglobulin domain containing 2							integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(5)	19	all_hematologic(175;0.215)	Breast(109;0.00663)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0215)		ATTTCCAGAGCCACTCCATTT	0.507													C|||	24	0.00479233	0.0008	0.0086	5008	,	,		20482	0.0		0.0139	False		,,,				2504	0.0031					dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			AF061022	CCDS8452.1	11q24	2013-01-11			ENSG00000019102	ENSG00000019102		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	17149	protein-coding gene	gene with protein product		606011				9862345	Standard	NM_014312		Approved	CTXL, CTH	uc001qas.3	Q96IQ7	OTTHUMG00000150357		11.37:g.124622534C>T	Exception_encountered		O95791|Q9NX42	Nonsense_Mutation	SNP	NULL	p.W123*	ENST00000326621.5	37	c.369	CCDS8452.1	11	14	0.00641025641025641	1	0.0020325203252032522	5	0.013812154696132596	0	0.0	8	0.010554089709762533	C	11.86	1.763587	0.31228	.	.	ENSG00000149564	ENST00000442070;ENST00000444566	.	.	.	3.92	-4.24	0.03777	.	.	.	.	.	.	.	.	.	.	.	0.39208	D	0.963261	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.6669	0.17700	0.0:0.2165:0.2642:0.5193	rs61910626	.	.	.	X	123	.	ENSP00000410351:W123X	W	-	3	0	ESAM	124127744	0.000000	0.05858	0.000000	0.03702	0.129000	0.20672	-1.330000	0.02675	-0.906000	0.03866	0.561000	0.74099	TGG	ESAM	-	NULL	ENSG00000149564		0.507	VSIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESAM	HGNC	protein_coding	OTTHUMT00000317785.1	37	0.00	0	C	NM_014312		124622534	124622534	-1	no_errors	ENST00000442070	ensembl	human	known	69_37n	nonsense	27	12.50	4	SNP	0.000	T
EXD1	161829	genome.wustl.edu	37	15	41518645	41518645	+	Intron	SNP	C	C	T			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr15:41518645C>T	ENST00000314992.5	-	1	219				EXD1_ENST00000458580.2_Silent_p.K43K|EXD1_ENST00000559743.1_5'UTR	NM_152596.2	NP_689809.2	Q8NHP7	EXD1_HUMAN	exonuclease 3'-5' domain containing 1								3'-5' exonuclease activity (GO:0008408)|nucleic acid binding (GO:0003676)			large_intestine(5)|liver(1)|lung(4)|ovary(2)|prostate(2)|skin(2)	16						CAAGACCTTTCTTCAGGACAA	0.423																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC030628	CCDS10072.1, CCDS66738.1	15q15.1	2009-02-24	2009-02-24	2009-02-24	ENSG00000178997	ENSG00000178997			28507	protein-coding gene	gene with protein product			"""exonuclease 3'-5' domain-like 1"""	EXDL1		12477932	Standard	NM_001286441		Approved	MGC33637	uc001znk.3	Q8NHP7	OTTHUMG00000130232	ENST00000314992.5:c.28+4031G>A	15.37:g.41518645C>T			A8K909|B7Z839|Q6ZW94	Silent	SNP	pfam_3'-5'_exonuclease_dom,superfamily_RNaseH-like_dom,smart_3'-5'_exonuclease_dom	p.K43	ENST00000314992.5	37	c.129	CCDS10072.1	15																																																																																			EXD1	-	NULL	ENSG00000178997		0.423	EXD1-001	KNOWN	basic|CCDS	protein_coding	EXD1	HGNC	protein_coding	OTTHUMT00000252553.2	20	0.00	0	C	NM_152596		41518645	41518645	-1	no_errors	ENST00000458580	ensembl	human	putative	69_37n	silent	16	40.74	11	SNP	0.996	T
FAM3C	10447	genome.wustl.edu	37	7	120990532	120990532	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr7:120990532G>A	ENST00000359943.3	-	10	880	c.667C>T	c.(667-669)Ccc>Tcc	p.P223S		NM_001040020.1|NM_014888.2	NP_001035109.1|NP_055703.1	Q92520	FAM3C_HUMAN	family with sequence similarity 3, member C	223					multicellular organismal development (GO:0007275)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	cytokine activity (GO:0005125)			kidney(1)|lung(8)	9	all_neural(327;0.117)					TGCTTCTGGGGGATGCATCCT	0.368																																						dbGAP											0													136.0	129.0	132.0					7																	120990532		2202	4288	6490	-	-	-	SO:0001583	missense	0			D87120	CCDS5782.1	7q22.1-q31.1	2014-08-14			ENSG00000196937	ENSG00000196937			18664	protein-coding gene	gene with protein product	"""predicted osteoblast protein"", ""interleukin-like EMT inducer"", ""interleukin-like epithelial-mesenchymal transition inducer"""	608618				12160727	Standard	NM_014888		Approved	GS3876, ILEI	uc010lkm.3	Q92520	OTTHUMG00000156979	ENST00000359943.3:c.667C>T	7.37:g.120990532G>A	ENSP00000353025:p.Pro223Ser		A6NDN2|A8K3R7	Missense_Mutation	SNP	NULL	p.P223S	ENST00000359943.3	37	c.667	CCDS5782.1	7	.	.	.	.	.	.	.	.	.	.	G	29.1	4.981437	0.93044	.	.	ENSG00000196937	ENST00000359943	T	0.68479	-0.33	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.84243	0.5429	M	0.84326	2.69	0.80722	D	1	D	0.69078	0.997	D	0.72075	0.976	D	0.84408	0.0564	10	0.62326	D	0.03	-9.9528	20.6525	0.99598	0.0:0.0:1.0:0.0	.	223	Q92520	FAM3C_HUMAN	S	223	ENSP00000353025:P223S	ENSP00000353025:P223S	P	-	1	0	FAM3C	120777768	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	9.363000	0.97131	2.890000	0.99128	0.585000	0.79938	CCC	FAM3C	-	NULL	ENSG00000196937		0.368	FAM3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM3C	HGNC	protein_coding	OTTHUMT00000346945.1	28	0.00	0	G	NM_001040020		120990532	120990532	-1	no_errors	ENST00000359943	ensembl	human	known	69_37n	missense	26	35.00	14	SNP	1.000	A
RMDN1	51115	genome.wustl.edu	37	8	87486571	87486571	+	Missense_Mutation	SNP	G	G	T	rs143734293		TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr8:87486571G>T	ENST00000406452.3	-	10	1070	c.911C>A	c.(910-912)gCt>gAt	p.A304D	RMDN1_ENST00000523911.1_Intron|RMDN1_ENST00000519966.1_Missense_Mutation_p.A261D|RMDN1_ENST00000430676.2_Missense_Mutation_p.A274D	NM_016033.2	NP_057117.2	Q96DB5	RMD1_HUMAN	regulator of microtubule dynamics 1	304						microtubule (GO:0005874)|mitochondrion (GO:0005739)											AAGCAACTGAGCAGCTTCTGT	0.303																																						dbGAP											0													65.0	71.0	69.0					8																	87486571		2202	4293	6495	-	-	-	SO:0001583	missense	0			AK000672	CCDS34918.1, CCDS69509.1, CCDS69510.1	8q21.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000176623	ENSG00000176623			24285	protein-coding gene	gene with protein product		611871	"""family with sequence similarity 82, member B"""	FAM82B		10810093	Standard	NM_016033		Approved	CGI-90, FLJ20665, RMD1	uc003ydu.3	Q96DB5	OTTHUMG00000163692	ENST00000406452.3:c.911C>A	8.37:g.87486571G>T	ENSP00000385927:p.Ala304Asp		A9UMZ8|B4DNF5|B4DZW6|B5MC61|C9JSC6|E7EVI2|Q9Y398	Missense_Mutation	SNP	NULL	p.A304D	ENST00000406452.3	37	c.911	CCDS34918.1	8	.	.	.	.	.	.	.	.	.	.	G	15.02	2.708168	0.48412	.	.	ENSG00000176623	ENST00000406452;ENST00000519966;ENST00000430676;ENST00000520719	T;T;T;T	0.44482	1.5;0.92;0.96;0.93	5.0	4.12	0.48240	.	0.629626	0.16550	N	0.209532	T	0.37839	0.1018	L	0.51422	1.61	0.31047	N	0.71561	P;P;B	0.49090	0.919;0.778;0.046	B;P;B	0.45829	0.425;0.494;0.096	T	0.20739	-1.0266	10	0.13108	T	0.6	-2.8615	10.2502	0.43364	0.1572:0.0:0.8428:0.0	.	274;261;304	B4DZW6;E7EVI2;Q96DB5	.;.;RMD1_HUMAN	D	304;261;274;155	ENSP00000385927:A304D;ENSP00000428661:A261D;ENSP00000409661:A274D;ENSP00000428360:A155D	ENSP00000385927:A304D	A	-	2	0	FAM82B	87555687	0.998000	0.40836	1.000000	0.80357	0.968000	0.65278	2.828000	0.48120	2.295000	0.77249	0.557000	0.71058	GCT	FAM82B	-	NULL	ENSG00000176623		0.303	RMDN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM82B	HGNC	protein_coding	OTTHUMT00000374770.2	27	0.00	0	G	NM_016033		87486571	87486571	-1	no_errors	ENST00000406452	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	0.993	T
FAT2	2196	genome.wustl.edu	37	5	150925106	150925106	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr5:150925106T>A	ENST00000261800.5	-	9	5594	c.5582A>T	c.(5581-5583)cAt>cTt	p.H1861L		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	1861	Cadherin 16. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ATCTCTGACATGAATGATGAC	0.468																																						dbGAP											0													85.0	93.0	90.0					5																	150925106		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.5582A>T	5.37:g.150925106T>A	ENSP00000261800:p.His1861Leu		O75091|Q9NSR7	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl,smart_Cadherin,smart_Laminin_G,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.H1861L	ENST00000261800.5	37	c.5582	CCDS4317.1	5	.	.	.	.	.	.	.	.	.	.	T	5.696	0.312949	0.10789	.	.	ENSG00000086570	ENST00000261800	T	0.59906	0.23	5.01	2.2	0.27929	Cadherin (3);Cadherin-like (1);	1.505550	0.04201	N	0.330119	T	0.41143	0.1146	N	0.20574	0.59	0.09310	N	1	B	0.21225	0.053	B	0.27715	0.082	T	0.28776	-1.0033	10	0.11182	T	0.66	.	5.0335	0.14423	0.1514:0.1091:0.0:0.7395	.	1861	Q9NYQ8	FAT2_HUMAN	L	1861	ENSP00000261800:H1861L	ENSP00000261800:H1861L	H	-	2	0	FAT2	150905299	0.189000	0.23263	0.064000	0.19789	0.536000	0.34869	1.048000	0.30379	0.631000	0.30412	0.383000	0.25322	CAT	FAT2	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000086570		0.468	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT2	HGNC	protein_coding	OTTHUMT00000252434.1	18	0.00	0	T	NM_001447		150925106	150925106	-1	no_errors	ENST00000261800	ensembl	human	known	69_37n	missense	14	36.36	8	SNP	0.000	A
FEZ1	9638	genome.wustl.edu	37	11	125325838	125325838	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr11:125325838G>A	ENST00000278919.3	-	6	1066	c.832C>T	c.(832-834)Cag>Tag	p.Q278*	FEZ1_ENST00000527350.1_5'UTR	NM_005103.4	NP_005094.1	Q99689	FEZ1_HUMAN	fasciculation and elongation protein zeta 1 (zygin I)	278					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to growth factor stimulus (GO:0071363)|establishment of mitochondrion localization (GO:0051654)|nervous system development (GO:0007399)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|transport (GO:0006810)	axon (GO:0030424)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	24	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0934)		TGCTTGTTCTGAACCTCAATA	0.542																																					Melanoma(180;509 2033 10762 15939 24711)	dbGAP											0													154.0	141.0	145.0					11																	125325838		2201	4299	6500	-	-	-	SO:0001587	stop_gained	0			U60060	CCDS31716.1, CCDS44758.1	11q24.2	2005-09-29			ENSG00000149557	ENSG00000149557			3659	protein-coding gene	gene with protein product		604825				9096408, 15843383	Standard	NM_005103		Approved		uc001qbx.3	Q99689	OTTHUMG00000165886	ENST00000278919.3:c.832C>T	11.37:g.125325838G>A	ENSP00000278919:p.Gln278*		O00679|O00728|Q6IBI7	Nonsense_Mutation	SNP	pfam_FEZ	p.Q278*	ENST00000278919.3	37	c.832	CCDS31716.1	11	.	.	.	.	.	.	.	.	.	.	G	38	6.813132	0.97857	.	.	ENSG00000149557	ENST00000278919	.	.	.	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-16.3796	19.2857	0.94069	0.0:0.0:1.0:0.0	.	.	.	.	X	278	.	ENSP00000278919:Q278X	Q	-	1	0	FEZ1	124831048	1.000000	0.71417	0.995000	0.50966	0.994000	0.84299	9.776000	0.99001	2.648000	0.89879	0.563000	0.77884	CAG	FEZ1	-	pfam_FEZ	ENSG00000149557		0.542	FEZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FEZ1	HGNC	protein_coding	OTTHUMT00000386875.1	32	0.00	0	G	NM_005103		125325838	125325838	-1	no_errors	ENST00000278919	ensembl	human	known	69_37n	nonsense	14	60.00	21	SNP	1.000	A
G6PC	2538	genome.wustl.edu	37	17	41059644	41059644	+	Splice_Site	SNP	C	C	T			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr17:41059644C>T	ENST00000253801.2	+	3	524	c.445C>T	c.(445-447)Cgg>Tgg	p.R149W	G6PC_ENST00000592383.1_Splice_Site_p.S123L|G6PC_ENST00000585489.1_Splice_Site_p.R149W	NM_000151.3	NP_000142.2	P35575	G6PC_HUMAN	glucose-6-phosphatase, catalytic subunit	149					carbohydrate metabolic process (GO:0005975)|cholesterol homeostasis (GO:0042632)|dephosphorylation (GO:0016311)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose homeostasis (GO:0042593)|glucose transport (GO:0015758)|glucose-6-phosphate transport (GO:0015760)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|hexose transport (GO:0008645)|multicellular organism growth (GO:0035264)|regulation of gene expression (GO:0010468)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|transmembrane transport (GO:0055085)|triglyceride metabolic process (GO:0006641)|urate metabolic process (GO:0046415)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	glucose-6-phosphatase activity (GO:0004346)|phosphate ion binding (GO:0042301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)	23		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.113)		CTACAGATTTCGGTAAGAACT	0.542																																						dbGAP											0													51.0	45.0	47.0					17																	41059644		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U01120	CCDS11446.1, CCDS59291.1	17q21	2014-09-17	2006-06-28			ENSG00000131482	3.1.3.9		4056	protein-coding gene	gene with protein product	"""glycogen storage disease type I, von Gierke disease"""	613742	"""glucose-6-phosphatase, catalytic (glycogen storage disease type I, von Gierke disease)"""	G6PT		7774924	Standard	NM_000151		Approved	GSD1a	uc002icb.2	P35575		ENST00000253801.2:c.446+1C>T	17.37:g.41059644C>T			A1L4C0|B4E1C3|K7EL82	Missense_Mutation	SNP	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase,pirsf_Glucose-6-phosphatase	p.R149W	ENST00000253801.2	37	c.445	CCDS11446.1	17	.	.	.	.	.	.	.	.	.	.	C	10.53	1.374647	0.24857	.	.	ENSG00000131482	ENST00000253801	T	0.77489	-1.1	5.05	1.99	0.26369	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.429273	0.23656	N	0.045866	T	0.64000	0.2559	L	0.39326	1.205	0.30788	N	0.74129	B	0.12013	0.005	B	0.04013	0.001	T	0.55730	-0.8095	10	0.31617	T	0.26	.	6.1461	0.20287	0.1339:0.6498:0.0:0.2163	.	149	P35575	G6PC_HUMAN	W	149	ENSP00000253801:R149W	ENSP00000253801:R149W	R	+	1	2	G6PC	38313170	0.103000	0.21917	0.996000	0.52242	0.596000	0.36781	0.148000	0.16224	0.305000	0.22832	0.555000	0.69702	CGG	G6PC	-	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase,pirsf_Glucose-6-phosphatase	ENSG00000131482		0.542	G6PC-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	G6PC	HGNC	protein_coding	OTTHUMT00000452451.1	22	0.00	0	C	NM_000151	Missense_Mutation	41059644	41059644	+1	no_errors	ENST00000253801	ensembl	human	known	69_37n	missense	16	44.83	13	SNP	0.927	T
ZFP41	286128	genome.wustl.edu	37	8	144357213	144357213	+	Intron	SNP	G	G	C	rs3817675	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr8:144357213G>C	ENST00000522452.1	+	3	2390				GLI4_ENST00000340042.1_Intron|GLI4_ENST00000523812.1_3'UTR|GLI4_ENST00000521682.1_Missense_Mutation_p.V97L|GLI4_ENST00000344692.3_3'UTR|GLI4_ENST00000523522.1_Intron|GLI4_ENST00000517468.1_3'UTR			Q8N8Y5	ZFP41_HUMAN	ZFP41 zinc finger protein						cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|lung(4)|ovary(1)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.6e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			GTGGCCCCACGTGGACTCCTG	0.667													G|||	2385	0.476238	0.0749	0.6715	5008	,	,		14550	0.6746		0.5179	False		,,,				2504	0.6329					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS6397.1	8q24.3	2013-01-08	2012-11-27		ENSG00000181638	ENSG00000181638		"""Zinc fingers, C2H2-type"""	26786	protein-coding gene	gene with protein product			"""zinc finger protein 41 homolog (mouse)"""			11214971	Standard	NM_173832		Approved	FLJ38705, FLJ00028, ZNF753	uc003yxw.4	Q8N8Y5	OTTHUMG00000164951	ENST00000522452.1:c.594+241G>C	8.37:g.144357213G>C			D3DWJ5	Missense_Mutation	SNP	NULL	p.V97L	ENST00000522452.1	37	c.289	CCDS6397.1	8	1060	0.48534798534798534	50	0.1016260162601626	230	0.6353591160220995	392	0.6853146853146853	388	0.5118733509234829	G	9.718	1.158945	0.21454	.	.	ENSG00000250571	ENST00000521682	.	.	.	2.23	2.23	0.28157	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.27662	P	0.9470537	.	.	.	.	.	.	T	0.42015	-0.9476	4	0.87932	D	0	.	8.4658	0.32956	0.0:0.0:1.0:0.0	rs3817675	.	.	.	L	97	.	ENSP00000430292:V97L	V	+	1	0	GLI4	144428588	0.000000	0.05858	0.126000	0.21872	0.112000	0.19704	-0.667000	0.05274	1.174000	0.42811	0.561000	0.74099	GTG	GLI4	-	NULL	ENSG00000250571		0.667	ZFP41-001	KNOWN	NMD_exception|basic|appris_principal|readthrough_transcript|CCDS	protein_coding	GLI4	HGNC	protein_coding	OTTHUMT00000381125.2	29	0.00	0	G	NM_173832		144357213	144357213	+1	no_errors	ENST00000521682	ensembl	human	putative	69_37n	missense	26	13.33	4	SNP	0.249	C
GPR25	2848	genome.wustl.edu	37	1	200843069	200843069	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr1:200843069G>T	ENST00000304244.2	+	1	987	c.904G>T	c.(904-906)Gcc>Tcc	p.A302S		NM_005298.2	NP_005289.2	O00155	GPR25_HUMAN	G protein-coupled receptor 25	302					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			large_intestine(1)|lung(2)|ovary(1)|skin(1)	5						CAACAGCTGCGCCAACCCGCT	0.736																																						dbGAP											0													19.0	21.0	21.0					1																	200843069		2168	4247	6415	-	-	-	SO:0001583	missense	0			U91939	CCDS1405.1	1q32.1	2012-08-21			ENSG00000170128	ENSG00000170128		"""GPCR / Class A : Orphans"""	4480	protein-coding gene	gene with protein product		602174				9020062	Standard	NM_005298		Approved		uc001gvn.2	O00155	OTTHUMG00000035788	ENST00000304244.2:c.904G>T	1.37:g.200843069G>T	ENSP00000301917:p.Ala302Ser		A0AVJ5	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.A302S	ENST00000304244.2	37	c.904	CCDS1405.1	1	.	.	.	.	.	.	.	.	.	.	G	19.67	3.870625	0.72065	.	.	ENSG00000170128	ENST00000304244	T	0.37411	1.2	4.53	4.53	0.55603	GPCR, rhodopsin-like superfamily (1);	0.000000	0.32719	U	0.005729	T	0.52041	0.1710	M	0.79258	2.445	0.30721	N	0.748191	D	0.52996	0.957	P	0.59221	0.854	T	0.60078	-0.7333	10	0.72032	D	0.01	-10.1271	7.1104	0.25386	0.1981:0.0:0.8018:0.0	.	302	O00155	GPR25_HUMAN	S	302	ENSP00000301917:A302S	ENSP00000301917:A302S	A	+	1	0	GPR25	199109692	0.910000	0.30920	1.000000	0.80357	0.996000	0.88848	0.034000	0.13776	2.058000	0.61347	0.462000	0.41574	GCC	GPR25	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000170128		0.736	GPR25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR25	HGNC	protein_coding	OTTHUMT00000087056.1	22	0.00	0	G	NM_005298		200843069	200843069	+1	no_errors	ENST00000304244	ensembl	human	known	69_37n	missense	17	15.00	3	SNP	1.000	T
GRHL1	29841	genome.wustl.edu	37	2	10098918	10098918	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr2:10098918C>G	ENST00000324907.9	+	3	347	c.211C>G	c.(211-213)Cca>Gca	p.P71A	GRHL1_ENST00000324883.5_5'UTR|GRHL1_ENST00000405379.2_Missense_Mutation_p.P71A	NM_198182.2	NP_937825.2	Q9NZI5	GRHL1_HUMAN	grainyhead-like 1 (Drosophila)	71	Transcription activation.				cellular lipid metabolic process (GO:0044255)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	17	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.246)		ATATCAGGTTCCAAGAGAGAG	0.408																																						dbGAP											0													101.0	102.0	102.0					2																	10098918		1951	4146	6097	-	-	-	SO:0001583	missense	0			AF198489	CCDS33144.1, CCDS33144.2	2p25.2	2008-02-05	2005-07-11	2005-07-11	ENSG00000134317	ENSG00000134317			17923	protein-coding gene	gene with protein product		609786	"""transcription factor CP2-like 2"""	TFCP2L2		10644752, 12393799	Standard	NM_198182		Approved	LBP-32, MGR	uc002raa.3	Q9NZI5	OTTHUMG00000151704	ENST00000324907.9:c.211C>G	2.37:g.10098918C>G	ENSP00000324693:p.Pro71Ala		A6NLA4|B2R7E4|B5MEC2|Q53T93|Q6NWN7|Q6NWN8|Q6NWN9|Q8NI33	Missense_Mutation	SNP	pfam_CP2	p.P71A	ENST00000324907.9	37	c.211	CCDS33144.2	2	.	.	.	.	.	.	.	.	.	.	C	26.3	4.724196	0.89298	.	.	ENSG00000134317	ENST00000405379;ENST00000324907	T;T	0.62639	0.01;0.01	6.11	6.11	0.99139	.	0.000000	0.85682	D	0.000000	D	0.82472	0.5044	M	0.84082	2.675	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82948	-0.0204	10	0.72032	D	0.01	-29.9732	20.7342	0.99715	0.0:1.0:0.0:0.0	.	71	Q9NZI5	GRHL1_HUMAN	A	71	ENSP00000384209:P71A;ENSP00000324693:P71A	ENSP00000324693:P71A	P	+	1	0	GRHL1	10016369	1.000000	0.71417	0.918000	0.36340	0.991000	0.79684	5.335000	0.65929	2.906000	0.99361	0.655000	0.94253	CCA	GRHL1	-	NULL	ENSG00000134317		0.408	GRHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRHL1	HGNC	protein_coding	OTTHUMT00000323543.2	18	0.00	0	C	NM_014552		10098918	10098918	+1	no_errors	ENST00000324907	ensembl	human	known	69_37n	missense	3	76.92	10	SNP	1.000	G
GUCA1C	9626	genome.wustl.edu	37	3	108626979	108626979	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr3:108626979C>T	ENST00000261047.3	-	4	652	c.520G>A	c.(520-522)Gac>Aac	p.D174N	GUCA1C_ENST00000393963.3_Missense_Mutation_p.R187Q	NM_005459.3	NP_005450.3	O95843	GUC1C_HUMAN	guanylate cyclase activator 1C	174					phototransduction, visible light (GO:0007603)|positive regulation of guanylate cyclase activity (GO:0031284)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)	calcium ion binding (GO:0005509)|calcium sensitive guanylate cyclase activator activity (GO:0008048)			endometrium(2)|large_intestine(1)|liver(1)|lung(8)|pancreas(1)|skin(1)	14						TTGGAGAAGTCGAAGCTCTTG	0.423																																					NSCLC(157;1360 1999 30631 40189 44208)	dbGAP											0													102.0	97.0	99.0					3																	108626979		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF110002	CCDS2954.1	3q13.1	2013-01-10			ENSG00000138472	ENSG00000138472		"""EF-hand domain containing"""	4680	protein-coding gene	gene with protein product	"""guanylyl cyclase-activating protein 3"""	605128				10037746, 11860507	Standard	NM_005459		Approved	GCAP3	uc003dxj.2	O95843	OTTHUMG00000159204	ENST00000261047.3:c.520G>A	3.37:g.108626979C>T	ENSP00000261047:p.Asp174Asn		O95844|Q9UNM0	Missense_Mutation	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2,prints_Recoverin	p.D174N	ENST00000261047.3	37	c.520	CCDS2954.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.96|16.96	3.266697|3.266697	0.59540|0.59540	.|.	.|.	ENSG00000138472|ENSG00000138472	ENST00000261047|ENST00000393963	T|T	0.73681|0.70164	-0.77|-0.46	5.01|5.01	1.21|1.21	0.21127|0.21127	.|.	0.472195|.	0.23426|.	N|.	0.048301|.	T|T	0.56645|0.56645	0.1999|0.1999	M|M	0.67397|0.67397	2.05|2.05	0.09310|0.09310	N|N	0.999995|0.999995	D|P	0.89917|0.35272	1.0|0.493	D|B	0.85130|0.16289	0.997|0.015	T|T	0.46748|0.46748	-0.9169|-0.9169	10|9	0.72032|0.87932	D|D	0.01|0	.|.	8.1857|8.1857	0.31337|0.31337	0.0:0.6556:0.0:0.3444|0.0:0.6556:0.0:0.3444	.|.	174|187	O95843|C9JNI2	GUC1C_HUMAN|.	N|Q	174|187	ENSP00000261047:D174N|ENSP00000377535:R187Q	ENSP00000261047:D174N|ENSP00000377535:R187Q	D|R	-|-	1|2	0|0	GUCA1C|GUCA1C	110109669|110109669	0.040000|0.040000	0.19996|0.19996	0.000000|0.000000	0.03702|0.03702	0.902000|0.902000	0.53008|0.53008	0.081000|0.081000	0.14823|0.14823	-0.050000|-0.050000	0.13356|0.13356	0.563000|0.563000	0.77884|0.77884	GAC|CGA	GUCA1C	-	NULL	ENSG00000138472		0.423	GUCA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCA1C	HGNC	protein_coding	OTTHUMT00000353819.1	28	0.00	0	C	NM_005459		108626979	108626979	-1	no_errors	ENST00000261047	ensembl	human	known	69_37n	missense	38	22.45	11	SNP	0.114	T
HMCN1	83872	genome.wustl.edu	37	1	186106712	186106712	+	Silent	SNP	G	G	T			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr1:186106712G>T	ENST00000271588.4	+	88	13894	c.13665G>T	c.(13663-13665)ctG>ctT	p.L4555L	HMCN1_ENST00000367492.2_Silent_p.L4555L	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4555	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GGAGTCGTCTGTGCAACCAGC	0.493																																						dbGAP											0													69.0	70.0	69.0					1																	186106712		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.13665G>T	1.37:g.186106712G>T			A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd,pfam_Thrombospondin_1_rpt,superfamily_Green_fluorescent_prot-like,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like	p.L4555	ENST00000271588.4	37	c.13665	CCDS30956.1	1																																																																																			HMCN1	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000143341		0.493	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	32	0.00	0	G	NM_031935		186106712	186106712	+1	no_errors	ENST00000271588	ensembl	human	known	69_37n	silent	36	10.00	4	SNP	0.953	T
HS3ST3A1	9955	genome.wustl.edu	37	17	13399616	13399616	+	Silent	SNP	A	A	T	rs62057033	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr17:13399616A>T	ENST00000284110.1	-	2	1916	c.1119T>A	c.(1117-1119)ccT>ccA	p.P373P	HS3ST3A1_ENST00000578576.1_Silent_p.P171P	NM_006042.1	NP_006033.1	Q9Y663	HS3SA_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 3A1	373					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 3 activity (GO:0033872)|sulfotransferase activity (GO:0008146)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_lung(20;0.114)		UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		GGTCGATCTCAGGATGGGTCC	0.607													A|||	2091	0.417532	0.1823	0.5144	5008	,	,		13730	0.5585		0.3459	False		,,,				2504	0.5951					dbGAP											0													20.0	21.0	20.0					17																	13399616		2194	4261	6455	-	-	-	SO:0001819	synonymous_variant	0			AF105376	CCDS11165.1	17p12	2007-04-02			ENSG00000153976	ENSG00000153976	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5196	protein-coding gene	gene with protein product		604057				9988767	Standard	NM_006042		Approved	3OST3A1, 30ST3A1	uc002gob.1	Q9Y663	OTTHUMG00000058768	ENST00000284110.1:c.1119T>A	17.37:g.13399616A>T			A8K7N2	Silent	SNP	pfam_Sulfotransferase_dom	p.P373	ENST00000284110.1	37	c.1119	CCDS11165.1	17																																																																																			HS3ST3A1	-	pfam_Sulfotransferase_dom	ENSG00000153976		0.607	HS3ST3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS3ST3A1	HGNC	protein_coding	OTTHUMT00000129952.1	41	0.00	0	A	NM_006042		13399616	13399616	-1	no_errors	ENST00000284110	ensembl	human	known	69_37n	silent	33	13.16	5	SNP	0.998	T
ICOSLG	23308	genome.wustl.edu	37	21	45648918	45648918	+	Nonstop_Mutation	SNP	C	C	G			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr21:45648918C>G	ENST00000407780.3	-	7	1035	c.908G>C	c.(907-909)tGa>tCa	p.*303S	ICOSLG_ENST00000400379.3_3'UTR|ICOSLG_ENST00000344330.4_Intron|ICOSLG_ENST00000400377.3_Nonstop_Mutation_p.*186S	NM_001283052.1	NP_001269981.1	O75144	ICOSL_HUMAN	inducible T-cell co-stimulator ligand	0					B cell activation (GO:0042113)|defense response (GO:0006952)|hyperosmotic response (GO:0006972)|positive regulation of activated T cell proliferation (GO:0042104)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			endometrium(2)|lung(1)|stomach(1)|urinary_tract(1)	5				Colorectal(79;0.0163)|READ - Rectum adenocarcinoma(84;0.0772)		GAGCTCCGGTCAAACGTGGCC	0.607																																						dbGAP											0													65.0	77.0	73.0					21																	45648918		2149	4247	6396	-	-	-	SO:0001578	stop_lost	0			AB014553	CCDS42952.1, CCDS63377.1, CCDS63379.1	21q22.3	2014-01-30		2005-01-12	ENSG00000160223	ENSG00000160223		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Endogenous ligands"""	17087	protein-coding gene	gene with protein product	"""B7-related protein 1"", ""B7 homologue 2"", ""B7 homolog 2"""	605717		ICOSL		9734811, 11007762	Standard	NM_001283050		Approved	KIAA0653, GL50, B7-H2, B7RP-1, B7H2, B7RP1, ICOS-L, CD275	uc002zee.3	O75144	OTTHUMG00000086920	ENST00000407780.3:c.908G>C	21.37:g.45648918C>G			A8MUZ1|Q9HD18|Q9NRQ1	Nonstop_Mutation	SNP	pfam_Ig_V-set,pfam_CD80_C2-set,smart_Ig_sub,pfscan_Ig-like	p.*303S	ENST00000407780.3	37	c.908	CCDS42952.1	21	.	.	.	.	.	.	.	.	.	.	C	0.785	-0.760915	0.02996	.	.	ENSG00000160223	ENST00000407780;ENST00000400377	.	.	.	2.48	2.48	0.30137	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.5803	0.33623	0.0:1.0:0.0:0.0	.	.	.	.	S	303;186	.	.	X	-	2	2	ICOSLG	44473346	0.215000	0.23574	0.017000	0.16124	0.053000	0.15095	2.686000	0.46968	1.711000	0.51337	0.411000	0.27672	TGA	ICOSLG	-	NULL	ENSG00000160223		0.607	ICOSLG-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ICOSLG	HGNC	protein_coding	OTTHUMT00000195838.1	58	0.00	0	C	NM_015259		45648918	45648918	-1	no_errors	ENST00000407780	ensembl	human	known	69_37n	nonstop	34	38.18	21	SNP	0.019	G
IGHV4-31	28396	genome.wustl.edu	37	14	106805395	106805395	+	RNA	SNP	G	G	A	rs61995641|rs563529045	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr14:106805395G>A	ENST00000438142.2	-	0	239									immunoglobulin heavy variable 4-31																		GGCGGATCCAGCTCCAGTAGT	0.577																																						dbGAP											0													94.0	144.0	128.0					14																	106805395		1922	4121	6043	-	-	-			0			L10098		14q32.33	2012-02-08			ENSG00000231475	ENSG00000231475		"""Immunoglobulins / IGH locus"""	5649	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000152097		14.37:g.106805395G>A				Silent	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.S56	ENST00000438142.2	37	c.168		14																																																																																			IGHV4-31	-	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000231475		0.577	IGHV4-31-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGHV4-31	HGNC	IG_V_gene	OTTHUMT00000325194.1	40	0.00	0	G	NG_001019		106805395	106805395	-1	no_stop_codon	ENST00000438142	ensembl	human	known	69_37n	silent	61	11.59	8	SNP	0.002	A
IGHV4-31	28396	genome.wustl.edu	37	14	106805408	106805408	+	RNA	SNP	C	C	T	rs61995642|rs574314937	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr14:106805408C>T	ENST00000438142.2	-	0	226									immunoglobulin heavy variable 4-31																		CCAGTAGTAACCACCACTGCT	0.597																																						dbGAP											0													92.0	137.0	123.0					14																	106805408		1935	4126	6061	-	-	-			0			L10098		14q32.33	2012-02-08			ENSG00000231475	ENSG00000231475		"""Immunoglobulins / IGH locus"""	5649	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000152097		14.37:g.106805408C>T				Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.G52D	ENST00000438142.2	37	c.155		14																																																																																			IGHV4-31	-	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000231475		0.597	IGHV4-31-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGHV4-31	HGNC	IG_V_gene	OTTHUMT00000325194.1	42	0.00	0	C	NG_001019		106805408	106805408	-1	no_stop_codon	ENST00000438142	ensembl	human	known	69_37n	missense	59	10.61	7	SNP	0.000	T
IGSF22	283284	genome.wustl.edu	37	11	18731134	18731134	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr11:18731134G>C	ENST00000513874.1	-	18	2937	c.2798C>G	c.(2797-2799)tCt>tGt	p.S933C	RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	832										NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						GATGTAGCCAGAGGGTGGGTC	0.582																																						dbGAP											0													60.0	63.0	62.0					11																	18731134		1954	4131	6085	-	-	-	SO:0001583	missense	0			AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.2798C>G	11.37:g.18731134G>C	ENSP00000421191:p.Ser933Cys		A6NNA0|D6RGV7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.S933C	ENST00000513874.1	37	c.2798	CCDS41625.2	11	.	.	.	.	.	.	.	.	.	.	G	15.81	2.943307	0.53079	.	.	ENSG00000179057	ENST00000513874	T	0.58506	0.33	4.58	3.67	0.42095	.	.	.	.	.	T	0.66336	0.2779	L	0.41710	1.295	0.09310	N	1	D	0.89917	1.0	D	0.87578	0.998	T	0.55108	-0.8192	9	0.54805	T	0.06	.	10.7177	0.46021	0.0902:0.0:0.9098:0.0	.	933	D6RGV7	.	C	933	ENSP00000421191:S933C	ENSP00000322422:S832C	S	-	2	0	IGSF22	18687710	0.005000	0.15991	0.504000	0.27639	0.860000	0.49131	0.566000	0.23593	1.161000	0.42604	0.655000	0.94253	TCT	IGSF22	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000179057		0.582	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF22	HGNC	protein_coding	OTTHUMT00000360850.2	26	0.00	0	G	NM_173588		18731134	18731134	-1	no_errors	ENST00000513874	ensembl	human	known	69_37n	missense	32	34.69	17	SNP	0.538	C
IL1RL1	9173	genome.wustl.edu	37	2	102957716	102957716	+	Intron	SNP	C	C	T	rs1420101	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr2:102957716C>T	ENST00000233954.1	+	5	881				IL1RL1_ENST00000393393.3_Silent_p.L227L|IL1RL1_ENST00000311734.2_Intron|IL1RL1_ENST00000404917.2_Intron|IL1RL1_ENST00000409584.1_Intron	NM_016232.4	NP_057316.3	Q01638	ILRL1_HUMAN	interleukin 1 receptor-like 1						immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of T-helper 1 type immune response (GO:0002826)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of macrophage activation (GO:0043032)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	cytokine receptor activity (GO:0004896)|interleukin-1 receptor activity (GO:0004908)|interleukin-33 receptor activity (GO:0002114)|receptor signaling protein activity (GO:0005057)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(3)|urinary_tract(1)	16						GATTCAAAGTCTAATGAGAGG	0.323													t|||	1803	0.360024	0.3616	0.2522	5008	,	,		14714	0.4633		0.34	False		,,,				2504	0.3487					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			D12764	CCDS2057.1, CCDS2058.1, CCDS74548.1	2q12	2013-01-29			ENSG00000115602	ENSG00000115602		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5998	protein-coding gene	gene with protein product	"""homolog of mouse growth stimulation-expressed"""	601203				1482686, 10191101, 16286016	Standard	NM_016232		Approved	ST2, FIT-1, ST2L, ST2V, DER4, T1, IL33R	uc002tbu.1	Q01638	OTTHUMG00000130782	ENST00000233954.1:c.610+428C>T	2.37:g.102957716C>T			A8K6B3|B4E0I3|Q53TU7|Q8NEJ3|Q9ULV7|Q9UQ44	Silent	SNP	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,prints_IL1_rcpt_I/II,pfscan_Ig-like	p.L227	ENST00000233954.1	37	c.679	CCDS2057.1	2																																																																																			IL1RL1	-	NULL	ENSG00000115602		0.323	IL1RL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1RL1	HGNC	protein_coding	OTTHUMT00000253296.1	37	0.00	0	C	NM_016232		102957716	102957716	+1	no_errors	ENST00000393393	ensembl	human	known	69_37n	silent	43	10.42	5	SNP	0.001	T
ITGA2	3673	genome.wustl.edu	37	5	52361805	52361805	+	Silent	SNP	C	C	T			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr5:52361805C>T	ENST00000296585.5	+	15	2084	c.1941C>T	c.(1939-1941)ctC>ctT	p.L647L		NM_002203.3	NP_002194.2	P17301	ITA2_HUMAN	integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)	647					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular response to hormone stimulus (GO:0032870)|collagen-activated signaling pathway (GO:0038065)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|hepatocyte differentiation (GO:0070365)|hypotonic response (GO:0006971)|integrin-mediated signaling pathway (GO:0007229)|mammary gland development (GO:0030879)|mesodermal cell differentiation (GO:0048333)|organ morphogenesis (GO:0009887)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell projection organization (GO:0031346)|positive regulation of collagen binding (GO:0033343)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA binding (GO:0043388)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|response to amine (GO:0014075)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to muscle activity (GO:0014850)|response to organic cyclic compound (GO:0014070)|skin morphogenesis (GO:0043589)|substrate-dependent cell migration (GO:0006929)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	axon terminus (GO:0043679)|basal part of cell (GO:0045178)|cell outer membrane (GO:0009279)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin alpha2-beta1 complex (GO:0034666)|integrin complex (GO:0008305)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(1)|lung(18)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	47		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				TGGTTCAACTCTGGTGAGTCA	0.428																																						dbGAP											0													138.0	129.0	132.0					5																	52361805		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS3957.1	5q11.2	2010-03-23			ENSG00000164171	ENSG00000164171		"""CD molecules"", ""Integrins"""	6137	protein-coding gene	gene with protein product		192974		CD49B			Standard	NM_002203		Approved	CD49b	uc003joy.3	P17301	OTTHUMG00000131165	ENST00000296585.5:c.1941C>T	5.37:g.52361805C>T			Q14595	Silent	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,prints_Integrin_alpha,pfscan_VWF_A	p.L647	ENST00000296585.5	37	c.1941	CCDS3957.1	5																																																																																			ITGA2	-	smart_Int_alpha_beta-p	ENSG00000164171		0.428	ITGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA2	HGNC	protein_coding	OTTHUMT00000253857.2	38	0.00	0	C	NM_002203		52361805	52361805	+1	no_errors	ENST00000296585	ensembl	human	known	69_37n	silent	36	41.94	26	SNP	1.000	T
KIAA2026	158358	genome.wustl.edu	37	9	5968235	5968235	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr9:5968235C>G	ENST00000399933.3	-	3	1995	c.1996G>C	c.(1996-1998)Gag>Cag	p.E666Q	KIAA2026_ENST00000381461.2_Missense_Mutation_p.E666Q	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	666										breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		AGTGACTGCTCTAATAGAATA	0.308																																						dbGAP											0													78.0	72.0	74.0					9																	5968235		1826	4078	5904	-	-	-	SO:0001583	missense	0			AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.1996G>C	9.37:g.5968235C>G	ENSP00000382815:p.Glu666Gln		A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Missense_Mutation	SNP	superfamily_Bromodomain	p.E666Q	ENST00000399933.3	37	c.1996		9	.	.	.	.	.	.	.	.	.	.	C	15.15	2.747889	0.49257	.	.	ENSG00000183354	ENST00000399933;ENST00000381461;ENST00000513355	.	.	.	5.88	5.88	0.94601	.	0.253773	0.26035	U	0.026728	T	0.30665	0.0772	N	0.24115	0.695	0.29284	N	0.869847	P	0.38597	0.639	B	0.32928	0.155	T	0.37291	-0.9712	9	0.72032	D	0.01	.	16.4699	0.84109	0.0:0.8691:0.1309:0.0	.	666	Q5HYC2	K2026_HUMAN	Q	666;666;599	.	ENSP00000370870:E666Q	E	-	1	0	KIAA2026	5958235	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	3.990000	0.56965	2.791000	0.96007	0.491000	0.48974	GAG	KIAA2026	-	NULL	ENSG00000183354		0.308	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	KIAA2026	HGNC	protein_coding	OTTHUMT00000051652.2	16	0.00	0	C	NM_001017969		5968235	5968235	-1	no_errors	ENST00000399933	ensembl	human	novel	69_37n	missense	15	28.57	6	SNP	1.000	G
KIAA2026	158358	genome.wustl.edu	37	9	5968452	5968452	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr9:5968452C>G	ENST00000399933.3	-	3	1778	c.1779G>C	c.(1777-1779)agG>agC	p.R593S	KIAA2026_ENST00000381461.2_Missense_Mutation_p.R593S	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	593										breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		CCCCTGGACTCCTTGGTTTCT	0.363																																						dbGAP											0													98.0	95.0	96.0					9																	5968452		1807	4071	5878	-	-	-	SO:0001583	missense	0			AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.1779G>C	9.37:g.5968452C>G	ENSP00000382815:p.Arg593Ser		A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Missense_Mutation	SNP	superfamily_Bromodomain	p.R593S	ENST00000399933.3	37	c.1779		9	.	.	.	.	.	.	.	.	.	.	C	5.848	0.340731	0.11069	.	.	ENSG00000183354	ENST00000399933;ENST00000381461;ENST00000513355	D;D;D	0.89875	-2.58;-2.58;-2.58	5.86	-1.36	0.09085	.	1.047280	0.07734	U	0.945816	T	0.70780	0.3263	N	0.08118	0	0.09310	N	0.999996	B	0.06786	0.001	B	0.01281	0.0	T	0.57165	-0.7858	10	0.13470	T	0.59	.	1.7299	0.02929	0.1805:0.2645:0.1022:0.4528	.	593	Q5HYC2	K2026_HUMAN	S	593;593;526	ENSP00000382815:R593S;ENSP00000370870:R593S;ENSP00000444993:R526S	ENSP00000370870:R593S	R	-	3	2	KIAA2026	5958452	0.096000	0.21769	0.597000	0.28824	0.988000	0.76386	0.258000	0.18387	0.049000	0.15920	0.591000	0.81541	AGG	KIAA2026	-	NULL	ENSG00000183354		0.363	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	KIAA2026	HGNC	protein_coding	OTTHUMT00000051652.2	40	0.00	0	C	NM_001017969		5968452	5968452	-1	no_errors	ENST00000399933	ensembl	human	novel	69_37n	missense	29	32.56	14	SNP	0.004	G
KIAA2026	158358	genome.wustl.edu	37	9	5968701	5968701	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr9:5968701C>G	ENST00000399933.3	-	3	1529	c.1530G>C	c.(1528-1530)gaG>gaC	p.E510D	KIAA2026_ENST00000381461.2_Missense_Mutation_p.E510D	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	510										breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		ACTTCAATTTCTCCAATTTAA	0.393																																						dbGAP											0													100.0	97.0	98.0					9																	5968701		1823	4082	5905	-	-	-	SO:0001583	missense	0			AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.1530G>C	9.37:g.5968701C>G	ENSP00000382815:p.Glu510Asp		A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Missense_Mutation	SNP	superfamily_Bromodomain	p.E510D	ENST00000399933.3	37	c.1530		9	.	.	.	.	.	.	.	.	.	.	C	9.123	1.009531	0.19277	.	.	ENSG00000183354	ENST00000399933;ENST00000381461;ENST00000513355	D;D;D	0.92249	-3.0;-3.0;-3.0	6.08	5.18	0.71444	.	0.000000	0.49305	U	0.000146	D	0.92100	0.7496	L	0.32530	0.975	0.27002	N	0.964895	D	0.76494	0.999	D	0.66084	0.941	D	0.86122	0.1569	10	0.54805	T	0.06	.	9.3116	0.37908	0.0:0.7408:0.0:0.2592	.	510	Q5HYC2	K2026_HUMAN	D	510;510;443	ENSP00000382815:E510D;ENSP00000370870:E510D;ENSP00000444993:E443D	ENSP00000370870:E510D	E	-	3	2	KIAA2026	5958701	0.999000	0.42202	1.000000	0.80357	0.738000	0.42128	0.607000	0.24209	1.575000	0.49775	0.591000	0.81541	GAG	KIAA2026	-	NULL	ENSG00000183354		0.393	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	KIAA2026	HGNC	protein_coding	OTTHUMT00000051652.2	11	0.00	0	C	NM_001017969		5968701	5968701	-1	no_errors	ENST00000399933	ensembl	human	novel	69_37n	missense	15	42.31	11	SNP	1.000	G
LIFR	3977	genome.wustl.edu	37	5	38557622	38557622	+	Intron	SNP	G	G	A			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr5:38557622G>A	ENST00000263409.4	-	2	144				LIFR_ENST00000503088.1_Intron|LIFR-AS1_ENST00000500733.2_RNA|MIR3650_ENST00000581972.1_RNA|LIFR-AS1_ENST00000500817.2_RNA|LIFR_ENST00000453190.2_5'Flank|LIFR-AS1_ENST00000514291.1_RNA	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha						cell surface receptor signaling pathway (GO:0007166)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|leukemia inhibitory factor signaling pathway (GO:0048861)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|leukemia inhibitory factor receptor activity (GO:0004923)			NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)					GTGCCAGACAGAGCCCCTGGC	0.478			T	PLAG1	salivary adenoma																																Melanoma(13;4 730 6426 9861 34751)	dbGAP		Dom	yes		5	5p13-p12	3977	leukemia inhibitory factor receptor		E	0																																										-	-	-	SO:0001627	intron_variant	0			X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594		"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""			1915266	Standard	NM_001127671		Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.19-26854C>T	5.37:g.38557622G>A			Q6LCD9	RNA	SNP	-	NULL	ENST00000263409.4	37	NULL	CCDS3927.1	5																																																																																			LIFR-AS1	-	-	ENSG00000244968		0.478	LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIFR-AS1	HGNC	protein_coding	OTTHUMT00000253823.1	31	0.00	0	G	NM_002310		38557622	38557622	+1	no_errors	ENST00000500733	ensembl	human	known	69_37n	rna	21	41.67	15	SNP	0.002	A
LILRB4	11006	genome.wustl.edu	37	19	55174362	55174362	+	5'UTR	SNP	G	G	C			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr19:55174362G>C	ENST00000391736.1	+	0	192				LILRB4_ENST00000391733.3_5'Flank|LILRB4_ENST00000391734.3_5'Flank|LILRB4_ENST00000430952.2_5'Flank|LILRB4_ENST00000270452.2_5'UTR	NM_001278426.2|NM_001278428.2|NM_001278429.2|NM_001278430.2	NP_001265355.1|NP_001265357.1|NP_001265358.1|NP_001265359.1	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4						immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(20)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	39				GBM - Glioblastoma multiforme(193;0.035)		GTGGGCTGCTGATGGAACAAC	0.587											OREG0003670	type=REGULATORY REGION|Gene=LILRB4|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																										dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			U82979	CCDS12902.1, CCDS42618.1	19q13.4	2013-01-11				ENSG00000186818		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6608	protein-coding gene	gene with protein product		604821				9151699, 9079806	Standard	XM_005277050		Approved	LIR-5, ILT3, HM18, LIR5, CD85k	uc002qgp.3	Q8NHJ6		ENST00000391736.1:c.-124G>C	19.37:g.55174362G>C		1005	A8MVL8|O15468|O75021|Q6FGQ9|Q8N1C7|Q8NHL5	RNA	SNP	-	NULL	ENST00000391736.1	37	NULL	CCDS12902.1	19																																																																																			LILRB4	-	-	ENSG00000186818		0.587	LILRB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB4	HGNC	protein_coding	OTTHUMT00000141127.3	21	0.00	0	G			55174362	55174362	+1	no_errors	ENST00000494796	ensembl	human	known	69_37n	rna	11	47.62	10	SNP	0.006	C
LMNB1	4001	genome.wustl.edu	37	5	126172195	126172195	+	3'UTR	SNP	C	C	T	rs1051644	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr5:126172195C>T	ENST00000261366.5	+	0	2361				LMNB1_ENST00000460265.1_3'UTR	NM_001198557.1|NM_005573.3	NP_001185486.1|NP_005564.1	P20700	LMNB1_HUMAN	lamin B1						apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	lamin filament (GO:0005638)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear inner membrane (GO:0005637)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(142;0.103)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.033)|OV - Ovarian serous cystadenocarcinoma(64;0.0398)|all cancers(49;0.0903)		GTGTACTGTTCGGAAGGGGTT	0.333													C|||	2243	0.447883	0.2625	0.4741	5008	,	,		16447	0.5585		0.4612	False		,,,				2504	0.5521					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			L37737	CCDS4140.1	5q23.2	2013-01-16			ENSG00000113368	ENSG00000113368		"""Intermediate filaments type V, lamins"""	6637	protein-coding gene	gene with protein product		150340				7557986, 8838815	Standard	NM_005573		Approved		uc003kud.2	P20700	OTTHUMG00000128969	ENST00000261366.5:c.*239C>T	5.37:g.126172195C>T			B2R6J6|Q3SYN7|Q96EI6	RNA	SNP	-	NULL	ENST00000261366.5	37	NULL	CCDS4140.1	5																																																																																			LMNB1	-	-	ENSG00000113368		0.333	LMNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMNB1	HGNC	protein_coding	OTTHUMT00000250956.2	24	0.00	0	C	NM_005573		126172195	126172195	+1	no_errors	ENST00000460265	ensembl	human	known	69_37n	rna	28	20.00	7	SNP	0.210	T
LRRD1	401387	genome.wustl.edu	37	7	91779971	91779971	+	Missense_Mutation	SNP	T	T	G	rs6465353	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr7:91779971T>G	ENST00000458448.1	-	4	2355	c.2155A>C	c.(2155-2157)Att>Ctt	p.I719L	LRRD1_ENST00000454089.2_Missense_Mutation_p.I70L|LRRD1_ENST00000422722.1_5'UTR|CTB-161K23.1_ENST00000453068.1_RNA|LRRD1_ENST00000430130.2_Missense_Mutation_p.I719L|LRRD1_ENST00000343318.5_Missense_Mutation_p.I70L			A4D1F6	LRRD1_HUMAN	leucine-rich repeats and death domain containing 1	719					signal transduction (GO:0007165)					breast(4)|endometrium(1)	5						AGTGAAAAAATATTGTAGATA	0.323													G|||	2086	0.416534	0.6717	0.3732	5008	,	,		15605	0.1885		0.3926	False		,,,				2504	0.362					dbGAP											0													97.0	79.0	84.0					7																	91779971		692	1591	2283	-	-	-	SO:0001583	missense	0			BC026112	CCDS55124.1	7q21.2	2011-05-23			ENSG00000240720	ENSG00000240720			34300	protein-coding gene	gene with protein product							Standard	NM_001161528		Approved	IMAGE:4798971	uc011khp.1	A4D1F6	OTTHUMG00000155861	ENST00000458448.1:c.2155A>C	7.37:g.91779971T>G	ENSP00000405987:p.Ile719Leu		B7ZMM9|Q49AT9	Missense_Mutation	SNP	pfam_Leu-rich_rpt,superfamily_DEATH-like,smart_Leu-rich_rpt_typical-subtyp,pfscan_Death	p.I719L	ENST00000458448.1	37	c.2155	CCDS55124.1	7	899	0.4116300366300366	342	0.6951219512195121	144	0.39779005524861877	114	0.1993006993006993	299	0.3944591029023747	G	5.515	0.279899	0.10458	.	.	ENSG00000240720	ENST00000343318;ENST00000458448;ENST00000430130;ENST00000454089	T;T;T;T	0.17054	2.62;2.3;2.3;2.62	5.61	5.61	0.85477	.	.	.	.	.	T	0.00012	0.0000	N	0.00068	-2.285	0.54753	P	1.799999999996249E-5	B	0.02656	0.0	B	0.01281	0.0	T	0.42327	-0.9458	8	0.02654	T	1	.	15.7556	0.78021	0.0:0.0:0.8621:0.1379	rs6465353;rs59146464;rs6465353	719	A4D1F6	LRRD1_HUMAN	L	70;719;719;70	ENSP00000339642:I70L;ENSP00000405987:I719L;ENSP00000411568:I719L;ENSP00000392112:I70L	ENSP00000339642:I70L	I	-	1	0	LRRD1	91617907	1.000000	0.71417	0.510000	0.27712	0.523000	0.34469	4.909000	0.63314	1.386000	0.46466	-0.121000	0.15023	ATT	LRRD1	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000240720		0.323	LRRD1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRD1	HGNC	protein_coding	OTTHUMT00000342027.2	35	0.00	0	T	NM_001045475		91779971	91779971	-1	no_errors	ENST00000430130	ensembl	human	known	69_37n	missense	26	13.33	4	SNP	0.683	G
LYRM5	144363	genome.wustl.edu	37	12	25357011	25357011	+	Intron	SNP	C	C	G			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr12:25357011C>G	ENST00000381356.4	+	3	210				LYRM5_ENST00000556351.1_Intron|LYRM5_ENST00000555711.1_Missense_Mutation_p.I19M|LYRM5_ENST00000557540.2_Intron|LYRM5_ENST00000556885.1_Intron|LYRM5_ENST00000553788.1_Intron|LYRM5_ENST00000554266.1_Missense_Mutation_p.L39V|LYRM5_ENST00000556927.1_Intron|LYRM5_ENST00000556402.1_Missense_Mutation_p.L39V	NM_001001660.2	NP_001001660.2	Q6IPR1	LYRM5_HUMAN	LYR motif containing 5							mitochondrion (GO:0005739)				large_intestine(3)	3	all_cancers(2;4.75e-35)|all_epithelial(2;1.91e-37)|all_lung(3;1.07e-23)|Lung NSC(3;5.49e-23)|Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.0016)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;2.21e-21)|Epithelial(3;8.04e-19)|all cancers(3;2.26e-16)|STAD - Stomach adenocarcinoma(2;0.00138)			AATATATAATCTTTCTTTTTG	0.274																																						dbGAP											0													18.0	16.0	17.0					12																	25357011		1769	4021	5790	-	-	-	SO:0001627	intron_variant	0			AK057730	CCDS53764.1	12p12.1	2006-09-19				ENSG00000205707		"""LYR motif containing"""	27052	protein-coding gene	gene with protein product							Standard	NM_001001660		Approved		uc001rgn.3	Q6IPR1		ENST00000381356.4:c.52-14C>G	12.37:g.25357011C>G			J3KPI7	Missense_Mutation	SNP	NULL	p.L39V	ENST00000381356.4	37	c.115	CCDS53764.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.324|9.324	1.058692|1.058692	0.19987|0.19987	.|.	.|.	ENSG00000205707|ENSG00000205707	ENST00000555711|ENST00000554266;ENST00000556402	.|.	.|.	.|.	5.91|5.91	1.17|1.17	0.20885|0.20885	.|.	.|.	.|.	.|.	.|.	T|T	0.46852|0.46852	0.1414|0.1414	.|.	.|.	.|.	0.39192|0.39192	D|D	0.962987|0.962987	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.35101|0.35101	-0.9802|-0.9802	4|4	.|.	.|.	.|.	.|.	4.9966|4.9966	0.14243|0.14243	0.4524:0.3402:0.0:0.2074|0.4524:0.3402:0.0:0.2074	.|.	.|.	.|.	.|.	M|V	19|39	.|.	.|.	I|L	+|+	3|1	3|0	LYRM5|LYRM5	25248278|25248278	0.891000|0.891000	0.30450|0.30450	0.993000|0.993000	0.49108|0.49108	0.876000|0.876000	0.50452|0.50452	0.072000|0.072000	0.14617|0.14617	0.270000|0.270000	0.21984|0.21984	0.655000|0.655000	0.94253|0.94253	ATC|CTT	LYRM5	-	NULL	ENSG00000205707		0.274	LYRM5-201	KNOWN	basic|CCDS	protein_coding	LYRM5	HGNC	protein_coding		36	0.00	0	C	NM_001001660		25357011	25357011	+1	no_errors	ENST00000554266	ensembl	human	putative	69_37n	missense	23	56.60	30	SNP	0.712	G
MALT1	10892	genome.wustl.edu	37	18	56377273	56377273	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr18:56377273T>A	ENST00000348428.3	+	6	1152	c.894T>A	c.(892-894)agT>agA	p.S298R	MALT1_ENST00000345724.3_Missense_Mutation_p.S298R|RP11-126O1.4_ENST00000588835.1_RNA	NM_006785.2|NM_173844.1	NP_006776.1|NP_776216.1	Q9UDY8	MALT1_HUMAN	mucosa associated lymphoid tissue lymphoma translocation gene 1	298	Ig-like C2-type 2.				activation of NF-kappaB-inducing kinase activity (GO:0007250)|B-1 B cell differentiation (GO:0001923)|defense response (GO:0006952)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|nuclear export (GO:0051168)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|protein oligomerization (GO:0051259)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of T cell receptor signaling pathway (GO:0050856)|response to fungus (GO:0009620)|response to molecule of bacterial origin (GO:0002237)|T cell proliferation (GO:0042098)|T cell receptor signaling pathway (GO:0050852)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	cysteine-type endopeptidase activity (GO:0004197)|peptidase activity (GO:0008233)|protein self-association (GO:0043621)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|large_intestine(7)|lung(1)|ovary(2)|skin(1)	12						ATCGAGACAGTCAAGATAGCA	0.358			T	BIRC3	MALT																																	dbGAP		Dom	yes		18	18q21	10892	mucosa associated lymphoid tissue lymphoma translocation gene 1		L	0													142.0	146.0	145.0					18																	56377273		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS11967.1, CCDS11968.1	18q21	2013-01-11			ENSG00000172175	ENSG00000172175		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6819	protein-coding gene	gene with protein product	"""paracaspase"""	604860		MLT		10339464, 10406266, 10523859	Standard	NM_006785		Approved		uc002lhm.1	Q9UDY8	OTTHUMG00000132761	ENST00000348428.3:c.894T>A	18.37:g.56377273T>A	ENSP00000319279:p.Ser298Arg		Q9NTB7|Q9ULX4	Missense_Mutation	SNP	pfam_Pept_C14_cat,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_DEATH-like,smart_Ig_sub,smart_Ig_sub2,pfscan_Pept_C14_ICE_p20,pfscan_Ig-like	p.S298R	ENST00000348428.3	37	c.894	CCDS11967.1	18	.	.	.	.	.	.	.	.	.	.	T	11.43	1.635678	0.29068	.	.	ENSG00000172175	ENST00000348428;ENST00000345724	T;T	0.15487	2.42;2.42	5.34	2.92	0.33932	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.418166	0.31949	N	0.006808	T	0.11410	0.0278	L	0.37850	1.14	0.38914	D	0.957594	B;B	0.18013	0.008;0.025	B;B	0.14023	0.007;0.01	T	0.17167	-1.0378	10	0.25106	T	0.35	.	6.0631	0.19848	0.1619:0.0:0.1694:0.6686	.	298;298	Q9UDY8-2;Q9UDY8	.;MALT1_HUMAN	R	298	ENSP00000319279:S298R;ENSP00000304161:S298R	ENSP00000304161:S298R	S	+	3	2	MALT1	54528253	0.997000	0.39634	0.996000	0.52242	0.988000	0.76386	0.134000	0.15932	0.414000	0.25790	0.374000	0.22700	AGT	MALT1	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000172175		0.358	MALT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MALT1	HGNC	protein_coding	OTTHUMT00000256132.2	18	0.00	0	T			56377273	56377273	+1	no_errors	ENST00000348428	ensembl	human	known	69_37n	missense	23	28.12	9	SNP	1.000	A
MARCH10	162333	genome.wustl.edu	37	17	60821780	60821780	+	Silent	SNP	C	C	T			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr17:60821780C>T	ENST00000311269.5	-	5	766	c.492G>A	c.(490-492)caG>caA	p.Q164Q	MARCH10_ENST00000544856.2_Silent_p.Q163Q|MARCH10_ENST00000583600.1_Silent_p.Q202Q|MARCH10_ENST00000456609.2_Silent_p.Q164Q	NM_152598.2	NP_689811.2	Q8NA82	MARHA_HUMAN	membrane-associated ring finger (C3HC4) 10, E3 ubiquitin protein ligase	164					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|liver(1)|lung(15)	38						ACTGCTGTTTCTGTCTGCTTC	0.542																																						dbGAP											0													118.0	112.0	114.0					17																	60821780		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK093076	CCDS11635.1, CCDS74122.1, CCDS74123.1	17q23.3	2013-01-09	2012-02-23	2007-08-20		ENSG00000173838		"""RING-type (C3HC4) zinc fingers"", ""MARCH membrane-associated ring fingers"""	26655	protein-coding gene	gene with protein product		613337	"""ring finger protein 190"", ""membrane-associated ring finger (C3HC4) 10"""	RNF190		17604280	Standard	XM_005257103		Approved	FLJ35757, MARCH-X	uc002jag.4	Q8NA82		ENST00000311269.5:c.492G>A	17.37:g.60821780C>T			D3DU09|Q8IYS7|Q8N7Z7	Silent	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH	p.Q164	ENST00000311269.5	37	c.492	CCDS11635.1	17																																																																																			MARCH10	-	NULL	ENSG00000173838		0.542	MARCH10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MARCH10	HGNC	protein_coding	OTTHUMT00000445252.1	24	0.00	0	C	NM_152598		60821780	60821780	-1	no_errors	ENST00000311269	ensembl	human	known	69_37n	silent	11	47.62	10	SNP	0.997	T
MIR3144	100422951	genome.wustl.edu	37	6	120336327	120336327	+	RNA	SNP	C	C	A	rs68035463	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr6:120336327C>A	ENST00000579460.1	+	0	3					NR_036098.1				microRNA 3144																		cagactgaaactacactttaa	0.313													C|||	1018	0.203275	0.1929	0.3617	5008	,	,		13938	0.1171		0.2167	False		,,,				2504	0.18					dbGAP											0																																										-	-	-			0					6	2011-09-12				ENSG00000265725		"""ncRNAs / Micro RNAs"""	38331	non-coding RNA	RNA, micro							Standard	NR_036098		Approved	hsa-mir-3144					6.37:g.120336327C>A				RNA	SNP	-	NULL	ENST00000579460.1	37	NULL		6																																																																																			MIR3144	-	-	ENSG00000265725		0.313	MIR3144-201	KNOWN	basic	miRNA	MIR3144	HGNC	miRNA		25	0.00	0	C	NR_036098		120336327	120336327	+1	no_errors	ENST00000579460	ensembl	human	known	69_37n	rna	33	10.81	4	SNP	0.224	A
KIRREL3	84623	genome.wustl.edu	37	11	126858392	126858392	+	Intron	SNP	A	A	G	rs670637	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr11:126858392A>G	ENST00000525144.2	-	1	305				KIRREL3_ENST00000525704.2_Intron|KIRREL3_ENST00000529097.2_Intron|MIR3167_ENST00000579623.1_RNA|KIRREL3_ENST00000533026.2_Intron	NM_032531.3	NP_115920.1	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 (Drosophila)						hemopoiesis (GO:0030097)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(5)|large_intestine(11)|lung(8)|ovary(3)|prostate(1)	29	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		TCCTTCCTGAAGAATTTCAGA	0.552													A|||	948	0.189297	0.2965	0.1758	5008	,	,		14926	0.0486		0.2207	False		,,,				2504	0.1667					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB058770	CCDS53723.1, CCDS55796.1, CCDS73413.1	11q24	2013-01-29			ENSG00000149571	ENSG00000149571		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	23204	protein-coding gene	gene with protein product		607761				12424224, 11347906	Standard	NM_032531		Approved	NEPH2, KIAA1867, KIRRE	uc001qea.3	Q8IZU9	OTTHUMG00000165831	ENST00000525144.2:c.55+11958T>C	11.37:g.126858392A>G			Q3MIJ7|Q6UWJ9|Q6UWL5|Q96JG0	RNA	SNP	-	NULL	ENST00000525144.2	37	NULL	CCDS53723.1	11																																																																																			MIR3167	-	-	ENSG00000266215		0.552	KIRREL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MIR3167	HGNC	protein_coding	OTTHUMT00000386479.2	37	0.00	0	A	NM_032531		126858392	126858392	-1	no_errors	ENST00000579623	ensembl	human	known	69_37n	rna	34	12.82	5	SNP	0.083	G
MLIP	90523	genome.wustl.edu	37	6	54002231	54002231	+	Intron	SNP	A	A	C	rs2754779	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr6:54002231A>C	ENST00000274897.5	+	4	725				MLIP_ENST00000502396.1_Missense_Mutation_p.E455A|MLIP_ENST00000358276.5_Intron|MLIP_ENST00000514921.1_Missense_Mutation_p.E444A|MLIP_ENST00000509997.1_Intron|MLIP_ENST00000370876.2_Intron|MLIP_ENST00000511744.1_3'UTR|MLIP_ENST00000370877.2_Intron	NM_138569.2	NP_612636.2	Q5VWP3	MLIP_HUMAN	muscular LMNA-interacting protein							nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|PML body (GO:0016605)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(16)|ovary(8)|skin(4)|stomach(1)|urinary_tract(1)	34						GACCAAAAAGAAAAGCAGACC	0.527													C|||	1527	0.304912	0.5832	0.3501	5008	,	,		18193	0.0833		0.2704	False		,,,				2504	0.1605					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK055530	CCDS4954.1, CCDS64448.1, CCDS64449.1	6p12.2-p12.1	2011-04-29	2011-04-29	2011-04-29	ENSG00000146147	ENSG00000146147			21355	protein-coding gene	gene with protein product	"""muscle-enriched A-type lamin interacting protein"""	614106	"""chromosome 6 open reading frame 142"""	C6orf142		21498514	Standard	NM_138569		Approved	MGC18257	uc011dxa.2	Q5VWP3	OTTHUMG00000014891	ENST00000274897.5:c.613-11623A>C	6.37:g.54002231A>C			B7Z2N0|D6RE05|Q96H08|Q96NF7	Missense_Mutation	SNP	NULL	p.E455A	ENST00000274897.5	37	c.1364	CCDS4954.1	6	667	0.30540293040293043	281	0.5711382113821138	132	0.36464088397790057	47	0.08216783216783216	207	0.27308707124010556	C	0.030	-1.337566	0.01287	.	.	ENSG00000146147	ENST00000514921;ENST00000503951;ENST00000502396	T;T;T	0.39787	2.06;1.06;2.07	5.04	-1.38	0.09027	.	.	.	.	.	T	0.07143	0.0181	.	.	.	0.80722	P	0.0	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.35599	-0.9782	7	0.16896	T	0.51	.	5.4706	0.16668	0.1365:0.395:0.0:0.4685	rs2754779;rs60117302;rs2754779	455;455;444	Q5VWP3-3;B7ZA42;D6RE05	.;.;.	A	444;403;455	ENSP00000425142:E444A;ENSP00000426830:E403A;ENSP00000426290:E455A	ENSP00000426290:E455A	E	+	2	0	MLIP	54110190	0.000000	0.05858	0.002000	0.10522	0.080000	0.17528	-0.917000	0.04025	-0.580000	0.05944	-0.935000	0.02700	GAA	MLIP	-	NULL	ENSG00000146147		0.527	MLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLIP	HGNC	protein_coding	OTTHUMT00000040979.3	16	0.00	0	A	NM_138569		54002231	54002231	+1	no_errors	ENST00000502396	ensembl	human	putative	69_37n	missense	30	16.67	6	SNP	0.002	C
KMT2E	55904	genome.wustl.edu	37	7	104748202	104748202	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr7:104748202C>T	ENST00000311117.3	+	22	3843	c.3298C>T	c.(3298-3300)Cga>Tga	p.R1100*	SRPK2_ENST00000493638.1_5'Flank|KMT2E_ENST00000334914.7_Nonsense_Mutation_p.R155*|KMT2E_ENST00000257745.4_Nonsense_Mutation_p.R1100*|CTB-152G17.6_ENST00000607968.1_RNA|KMT2E_ENST00000334877.4_Nonsense_Mutation_p.R1100*	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	1100					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										AGGAGGCTTCCGAATAAGTGA	0.473																																						dbGAP											0													90.0	87.0	88.0					7																	104748202		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.3298C>T	7.37:g.104748202C>T	ENSP00000312379:p.Arg1100*		B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Nonsense_Mutation	SNP	pfam_SET_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_SET_dom,pfscan_SET_dom,pfscan_Znf_PHD-finger	p.R1100*	ENST00000311117.3	37	c.3298	CCDS34723.1	7	.	.	.	.	.	.	.	.	.	.	C	57	29.020738	0.99974	.	.	ENSG00000005483	ENST00000311117;ENST00000393656;ENST00000334877;ENST00000351043;ENST00000257745;ENST00000334914	.	.	.	5.85	5.85	0.93711	.	0.160745	0.40144	N	0.001167	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.0461	0.64706	0.2509:0.7491:0.0:0.0	.	.	.	.	X	1100;1100;1100;1020;1100;155	.	ENSP00000257745:R1100X	R	+	1	2	MLL5	104535438	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.554000	0.45845	2.753000	0.94483	0.655000	0.94253	CGA	MLL5	-	NULL	ENSG00000005483		0.473	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLL5	HGNC	protein_coding	OTTHUMT00000348697.1	50	0.00	0	C			104748202	104748202	+1	no_errors	ENST00000257745	ensembl	human	known	69_37n	nonsense	32	25.58	11	SNP	1.000	T
MORC1	27136	genome.wustl.edu	37	3	108682297	108682297	+	Silent	SNP	A	A	G			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr3:108682297A>G	ENST00000483760.1	-	26	2743	c.2700T>C	c.(2698-2700)cgT>cgC	p.R900R	MORC1_ENST00000232603.5_Silent_p.R921R					MORC family CW-type zinc finger 1											breast(7)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(47)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	105						CCAGTTTTATACGAAGATTCT	0.358																																						dbGAP											0													232.0	225.0	228.0					3																	108682297		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AF084946	CCDS2955.1	3q13	2011-10-26	2005-06-15	2005-06-15	ENSG00000114487	ENSG00000114487			7198	protein-coding gene	gene with protein product	"""cancer/testis antigen 33"""	603205	"""microrchidia (mouse) homolog"", ""microrchidia homolog (mouse)"""	MORC		10369865	Standard	NM_014429		Approved	ZCW6, CT33	uc003dxl.3	Q86VD1	OTTHUMG00000159209	ENST00000483760.1:c.2700T>C	3.37:g.108682297A>G				Silent	SNP	pfam_Znf_CW,superfamily_ATPase-like_ATP-bd,pfscan_Znf_CW	p.R921	ENST00000483760.1	37	c.2763		3																																																																																			MORC1	-	NULL	ENSG00000114487		0.358	MORC1-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	MORC1	HGNC	protein_coding	OTTHUMT00000353844.1	50	0.00	0	A			108682297	108682297	-1	no_errors	ENST00000232603	ensembl	human	known	69_37n	silent	49	18.33	11	SNP	0.032	G
MPEG1	219972	genome.wustl.edu	37	11	58979628	58979628	+	Silent	SNP	G	G	A			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr11:58979628G>A	ENST00000361050.3	-	1	796	c.711C>T	c.(709-711)acC>acT	p.T237T	RN7SL42P_ENST00000579786.1_RNA	NM_001039396.1	NP_001034485.1	Q2M385	MPEG1_HUMAN	macrophage expressed 1	237	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.					integral component of membrane (GO:0016021)		p.T237T(1)		NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(21)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		all_epithelial(135;0.125)				CAGCAGAGGCGGTCACGGCAC	0.537																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											52.0	51.0	52.0					11																	58979628		1943	4130	6073	-	-	-	SO:0001819	synonymous_variant	0			AK097211	CCDS41650.1	11q12.1	2013-07-31				ENSG00000197629			29619	protein-coding gene	gene with protein product	"""macrophage expressed gene 1"""	610390				7888681, 23257510	Standard	NM_001039396		Approved	MPG1	uc001nnu.4	Q2M385		ENST00000361050.3:c.711C>T	11.37:g.58979628G>A			Q2M1T6|Q8TEF8	Silent	SNP	pfam_MACPF,smart_MACPF	p.T237	ENST00000361050.3	37	c.711	CCDS41650.1	11																																																																																			MPEG1	-	pfam_MACPF,smart_MACPF	ENSG00000197629		0.537	MPEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPEG1	HGNC	protein_coding	OTTHUMT00000370027.1	22	0.00	0	G	NM_001039396		58979628	58979628	-1	no_errors	ENST00000361050	ensembl	human	known	69_37n	silent	2	80.00	8	SNP	0.001	A
MUC4	4585	genome.wustl.edu	37	3	195509955	195509955	+	Silent	SNP	A	A	C	rs71635078		TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr3:195509955A>C	ENST00000463781.3	-	2	8955	c.8496T>G	c.(8494-8496)tcT>tcG	p.S2832S	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.S2832S	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGACAGGAAGAGAGGTGGCAT	0.592																																						dbGAP											0													95.0	61.0	71.0					3																	195509955		685	1545	2230	-	-	-	SO:0001819	synonymous_variant	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8496T>G	3.37:g.195509955A>C			O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.S2832	ENST00000463781.3	37	c.8496	CCDS54700.1	3																																																																																			MUC4	-	NULL	ENSG00000145113		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	75	0.00	0	A	NM_018406		195509955	195509955	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	silent	114	10.94	14	SNP	0.089	C
MUC4	4585	genome.wustl.edu	37	3	195513102	195513102	+	Silent	SNP	A	A	G	rs3103958	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr3:195513102A>G	ENST00000463781.3	-	2	5808	c.5349T>C	c.(5347-5349)tcT>tcC	p.S1783S	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.S1783S	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.S1783S(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGGAAGCTGAAGAAAGGCCGG	0.592																																						dbGAP											1	Substitution - coding silent(1)	endometrium(1)											77.0	79.0	78.0					3																	195513102		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.5349T>C	3.37:g.195513102A>G			O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.S1783	ENST00000463781.3	37	c.5349	CCDS54700.1	3																																																																																			MUC4	-	NULL	ENSG00000145113		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	52	0.00	0	A	NM_018406		195513102	195513102	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	silent	94	11.32	12	SNP	0.011	G
MUM1L1	139221	genome.wustl.edu	37	X	105450896	105450896	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chrX:105450896G>C	ENST00000357175.2	+	4	2120	c.1471G>C	c.(1471-1473)Gag>Cag	p.E491Q	MUM1L1_ENST00000337685.2_Missense_Mutation_p.E491Q|MUM1L1_ENST00000372552.1_Missense_Mutation_p.E491Q	NM_001171020.1	NP_001164491.1	Q5H9M0	MUML1_HUMAN	melanoma associated antigen (mutated) 1-like 1	491						extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31						CTCTTTGCTTGAGTATTATGC	0.403																																						dbGAP											0													66.0	59.0	61.0					X																	105450896		1834	4083	5917	-	-	-	SO:0001583	missense	0			AK090835	CCDS55469.1	Xq22.3	2008-02-05			ENSG00000157502	ENSG00000157502			26583	protein-coding gene	gene with protein product							Standard	NM_152423		Approved	FLJ33516	uc004emf.2	Q5H9M0	OTTHUMG00000022146	ENST00000357175.2:c.1471G>C	X.37:g.105450896G>C	ENSP00000349699:p.Glu491Gln		D3DUX2|Q49AS5|Q8N2C0|Q96MT6	Missense_Mutation	SNP	superfamily_PyrdxlP-dep_Trfase_major_dom	p.E491Q	ENST00000357175.2	37	c.1471	CCDS55469.1	X	.	.	.	.	.	.	.	.	.	.	G	15.66	2.897959	0.52227	.	.	ENSG00000157502	ENST00000357175;ENST00000337685;ENST00000372552	T;T;T	0.73363	-0.74;-0.74;-0.74	4.84	4.84	0.62591	.	0.000000	0.53938	D	0.000060	D	0.83450	0.5257	M	0.65975	2.015	0.35684	D	0.814321	D	0.89917	1.0	D	0.81914	0.995	D	0.88097	0.2817	10	0.72032	D	0.01	-41.2365	12.2749	0.54728	0.0:0.0:1.0:0.0	.	491	Q5H9M0	MUML1_HUMAN	Q	491	ENSP00000349699:E491Q;ENSP00000338641:E491Q;ENSP00000361632:E491Q	ENSP00000338641:E491Q	E	+	1	0	MUM1L1	105337552	1.000000	0.71417	1.000000	0.80357	0.763000	0.43281	3.880000	0.56145	2.388000	0.81334	0.529000	0.55759	GAG	MUM1L1	-	NULL	ENSG00000157502		0.403	MUM1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MUM1L1	HGNC	protein_coding	OTTHUMT00000057795.1	52	0.00	0	G	NM_152423		105450896	105450896	+1	no_errors	ENST00000337685	ensembl	human	known	69_37n	missense	33	53.42	39	SNP	1.000	C
MYH9	4627	genome.wustl.edu	37	22	36705366	36705366	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr22:36705366G>A	ENST00000216181.5	-	15	2034	c.1804C>T	c.(1804-1806)Cag>Tag	p.Q602*		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	602	Myosin motor.				actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						TCAGAGGACTGGTGGAGCAGT	0.577			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																													dbGAP		Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	0													220.0	164.0	183.0					22																	36705366		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.1804C>T	22.37:g.36705366G>A	ENSP00000216181:p.Gln602*		A8K6E4|O60805|Q60FE2|Q86T83	Nonsense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_Regulat_G_prot_signal_superfam,superfamily_Prefoldin,superfamily_Myosin_S1_N,superfamily_STAT_TF_coiled-coil,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.Q602*	ENST00000216181.5	37	c.1804	CCDS13927.1	22	.	.	.	.	.	.	.	.	.	.	G	42	9.174413	0.99089	.	.	ENSG00000100345	ENST00000337818;ENST00000216181	.	.	.	4.73	4.73	0.59995	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.6762	0.88232	0.0:0.0:1.0:0.0	.	.	.	.	X	466;602	.	ENSP00000216181:Q602X	Q	-	1	0	MYH9	35035312	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.350000	0.79820	0.563000	0.77884	CAG	MYH9	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000100345		0.577	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH9	HGNC	protein_coding	OTTHUMT00000259110.3	29	0.00	0	G	NM_002473		36705366	36705366	-1	no_errors	ENST00000216181	ensembl	human	known	69_37n	nonsense	25	32.43	12	SNP	1.000	A
NAMPT	10135	genome.wustl.edu	37	7	105910666	105910666	+	Intron	SNP	C	C	T	rs6947766	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr7:105910666C>T	ENST00000222553.3	-	5	755				NAMPT_ENST00000354289.4_Intron|NAMPT_ENST00000484527.1_Intron	NM_005746.2	NP_005737.1	P43490	NAMPT_HUMAN	nicotinamide phosphoribosyltransferase						cell-cell signaling (GO:0007267)|circadian regulation of gene expression (GO:0032922)|NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|nicotinamide metabolic process (GO:0006769)|positive regulation of cell proliferation (GO:0008284)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|nicotinamide phosphoribosyltransferase activity (GO:0047280)|nicotinate-nucleotide diphosphorylase (carboxylating) activity (GO:0004514)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	14						tagaaattcacttcttcattc	0.328													C|||	1277	0.254992	0.0756	0.317	5008	,	,		16704	0.4742		0.2783	False		,,,				2504	0.2035					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U02020	CCDS5737.1	7q22.3	2012-10-02	2008-03-27	2008-03-27	ENSG00000105835	ENSG00000105835			30092	protein-coding gene	gene with protein product	"""visfatin"""	608764	"""pre-B-cell colony enhancing factor 1"""	PBEF1		8289818	Standard	NM_005746		Approved	PBEF	uc003vdq.3	P43490	OTTHUMG00000140388	ENST00000222553.3:c.448-908G>A	7.37:g.105910666C>T			A4D0Q9|A4D0R0|Q3KQV0|Q8WW95	RNA	SNP	-	NULL	ENST00000222553.3	37	NULL	CCDS5737.1	7																																																																																			NAMPT	-	-	ENSG00000105835		0.328	NAMPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAMPT	HGNC	protein_coding	OTTHUMT00000277146.1	42	0.00	0	C	NM_182790		105910666	105910666	-1	no_errors	ENST00000393618	ensembl	human	known	69_37n	rna	22	12.00	3	SNP	0.005	T
NRK	203447	genome.wustl.edu	37	X	105153826	105153826	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chrX:105153826G>A	ENST00000243300.9	+	13	2496	c.2193G>A	c.(2191-2193)tgG>tgA	p.W731*	NRK_ENST00000428173.2_Nonsense_Mutation_p.W732*	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	731					activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						AACGCAGATGGGAAGATATCT	0.398										HNSCC(51;0.14)																												dbGAP											0													17.0	14.0	15.0					X																	105153826		1863	4084	5947	-	-	-	SO:0001587	stop_gained	0			BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.2193G>A	X.37:g.105153826G>A	ENSP00000434830:p.Trp731*		Q32ND6|Q5H9K2|Q6ZMP2	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Citron,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_cat_dom	p.W732*	ENST00000243300.9	37	c.2196		X	.	.	.	.	.	.	.	.	.	.	G	38	6.845203	0.97881	.	.	ENSG00000123572	ENST00000243300;ENST00000428173	.	.	.	4.54	3.65	0.41850	.	0.152207	0.31554	N	0.007441	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.7112	0.34385	0.0:0.0:0.7743:0.2257	.	.	.	.	X	731;732	.	ENSP00000434830:W731X	W	+	3	0	NRK	105040482	1.000000	0.71417	1.000000	0.80357	0.271000	0.26615	2.381000	0.44336	1.218000	0.43458	0.600000	0.82982	TGG	NRK	-	NULL	ENSG00000123572		0.398	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	NRK	HGNC	protein_coding	OTTHUMT00000106480.6	43	0.00	0	G	NM_198465		105153826	105153826	+1	no_errors	ENST00000428173	ensembl	human	known	69_37n	nonsense	25	41.86	18	SNP	1.000	A
NXPE1	120400	genome.wustl.edu	37	11	114401577	114401577	+	Silent	SNP	T	T	C	rs524911	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr11:114401577T>C	ENST00000424269.1	-	2	152	c.153A>G	c.(151-153)gcA>gcG	p.A51A	NXPE1_ENST00000251921.2_5'UTR|NXPE1_ENST00000536271.1_5'Flank|NXPE1_ENST00000536312.1_Silent_p.A51A			Q8N323	NXPE1_HUMAN	neurexophilin and PC-esterase domain family, member 1	51						extracellular region (GO:0005576)											ATAAGGACTTTGCGGAGTTGT	0.373													T|||	2028	0.404952	0.3744	0.3141	5008	,	,		16962	0.6687		0.336	False		,,,				2504	0.3098					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			BC029049	CCDS8372.1	11q23.2	2012-06-14	2012-06-11	2012-06-11	ENSG00000095110	ENSG00000095110			28527	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member A"""	FAM55A		12477932	Standard	NM_152315		Approved	MGC34290	uc001ppa.3	Q8N323	OTTHUMG00000168284	ENST00000424269.1:c.153A>G	11.37:g.114401577T>C			B0YJ13	Silent	SNP	superfamily_Ig_E-set	p.A51	ENST00000424269.1	37	c.153		11																																																																																			NXPE1	-	NULL	ENSG00000095110		0.373	NXPE1-201	KNOWN	basic	protein_coding	NXPE1	HGNC	protein_coding		37	0.00	0	T	NM_152315		114401577	114401577	-1	no_errors	ENST00000424269	ensembl	human	known	69_37n	silent	36	16.28	7	SNP	0.000	C
OPN1SW	611	genome.wustl.edu	37	7	128412693	128412693	+	Silent	SNP	C	C	T			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr7:128412693C>T	ENST00000249389.2	-	5	947	c.948G>A	c.(946-948)aaG>aaA	p.K316K		NM_001708.2	NP_001699.1	P03999	OPSB_HUMAN	opsin 1 (cone pigments), short-wave-sensitive	316					phototransduction (GO:0007602)|phototransduction, visible light (GO:0007603)|protein-chromophore linkage (GO:0018298)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)|receptor activity (GO:0004872)	p.K316N(1)		NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|stomach(1)	19						CACACACCATCTTCATGATGC	0.463																																						dbGAP											1	Substitution - Missense(1)	NS(1)											193.0	168.0	176.0					7																	128412693		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U53874	CCDS5806.1	7q31.3-q32	2013-01-08	2008-04-16		ENSG00000128617	ENSG00000128617		"""GPCR / Class A : Opsin receptors"""	1012	protein-coding gene	gene with protein product	"""color blindness, tritan"", ""blue-sensitive opsin"""	613522	"""blue cone photoreceptor pigment"""	BCP		2937147, 8270261	Standard	NM_001708		Approved	BOP, CBT	uc003vnt.4	P03999	OTTHUMG00000158311	ENST00000249389.2:c.948G>A	7.37:g.128412693C>T			Q13877	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_supfam,prints_Opsin_blue,prints_7TM_GPCR_Rhodpsn,prints_Opsin	p.K316	ENST00000249389.2	37	c.948	CCDS5806.1	7																																																																																			OPN1SW	-	pfam_7TM_GPCR_serpentine_rcpt_Srw,pfam_7TM_GPCR_serpentine_rcpt_Srv,prints_Opsin_blue	ENSG00000128617		0.463	OPN1SW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPN1SW	HGNC	protein_coding	OTTHUMT00000350655.1	37	0.00	0	C	NM_001708		128412693	128412693	-1	no_errors	ENST00000249389	ensembl	human	known	69_37n	silent	27	34.15	14	SNP	1.000	T
OR2T8	343172	genome.wustl.edu	37	1	248085011	248085011	+	Missense_Mutation	SNP	C	C	G	rs4595394	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr1:248085011C>G	ENST00000319968.4	+	1	692	c.692C>G	c.(691-693)gCc>gGc	p.A231G		NM_001005522.1	NP_001005522.1	A6NH00	OR2T8_HUMAN	olfactory receptor, family 2, subfamily T, member 8	231						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(20)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0211)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			TCTACAGAAGCCCGCAAGAAG	0.517													C|||	1773	0.354034	0.2829	0.2723	5008	,	,		13941	0.5397		0.2127	False		,,,				2504	0.4622					dbGAP											0													10.0	10.0	10.0					1																	248085011		2046	4081	6127	-	-	-	SO:0001583	missense	0				CCDS31100.1	1q44	2012-08-09		2004-03-10	ENSG00000177462	ENSG00000177462		"""GPCR / Class A : Olfactory receptors"""	15020	protein-coding gene	gene with protein product				OR2T8P			Standard	XM_005273117		Approved		uc010pzc.2	A6NH00	OTTHUMG00000040205	ENST00000319968.4:c.692C>G	1.37:g.248085011C>G	ENSP00000326225:p.Ala231Gly			Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.A231G	ENST00000319968.4	37	c.692	CCDS31100.1	1	690	0.3159340659340659	141	0.2865853658536585	93	0.2569060773480663	308	0.5384615384615384	148	0.19525065963060687	C	2.075	-0.412164	0.04799	.	.	ENSG00000177462	ENST00000319968	T	0.00014	9.2	3.56	0.209	0.15226	GPCR, rhodopsin-like superfamily (1);	0.246533	0.21007	U	0.081750	T	0.00012	0.0000	N	0.00602	-1.34	0.58432	P	4.000000000004E-6	D	0.67145	0.996	D	0.72075	0.976	T	0.17930	-1.0353	9	0.02654	T	1	.	7.4212	0.27073	0.0:0.3221:0.5593:0.1186	rs4595394	231	A6NH00	OR2T8_HUMAN	G	231	ENSP00000326225:A231G	ENSP00000326225:A231G	A	+	2	0	OR2T8	246151634	0.002000	0.14202	0.002000	0.10522	0.023000	0.10783	0.406000	0.21032	0.191000	0.20236	-0.490000	0.04691	GCC	OR2T8	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000177462		0.517	OR2T8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T8	HGNC	protein_coding	OTTHUMT00000096862.1	20	0.00	0	C	NM_001005522		248085011	248085011	+1	no_errors	ENST00000319968	ensembl	human	known	69_37n	missense	24	17.24	5	SNP	0.131	G
OR2W1	26692	genome.wustl.edu	37	6	29012878	29012878	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr6:29012878C>T	ENST00000377175.1	-	1	139	c.75G>A	c.(73-75)atG>atA	p.M25I		NM_030903.3	NP_112165.1	Q9Y3N9	OR2W1_HUMAN	olfactory receptor, family 2, subfamily W, member 1	25						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|skin(1)	23						CTGACAGGATCATCTCCATTT	0.408																																						dbGAP											0													113.0	123.0	119.0					6																	29012878		1469	2688	4157	-	-	-	SO:0001583	missense	0			AL035402	CCDS4656.1	6p22.1	2012-08-09			ENSG00000204704	ENSG00000204704		"""GPCR / Class A : Olfactory receptors"""	8281	protein-coding gene	gene with protein product							Standard	NM_030903		Approved	hs6M1-15	uc003nlw.2	Q9Y3N9	OTTHUMG00000031048	ENST00000377175.1:c.75G>A	6.37:g.29012878C>T	ENSP00000366380:p.Met25Ile		B0S7Y5|Q5JNZ1|Q6IEU0|Q96R17|Q9GZL0|Q9GZL1	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.M25I	ENST00000377175.1	37	c.75	CCDS4656.1	6	.	.	.	.	.	.	.	.	.	.	C	1.758	-0.487582	0.04352	.	.	ENSG00000204704	ENST00000377175	T	0.00337	8.05	4.45	0.31	0.15825	.	1.231290	0.05581	N	0.572929	T	0.00039	0.0001	N	0.12443	0.215	0.09310	N	1	B	0.20671	0.047	B	0.17979	0.02	T	0.09684	-1.0663	10	0.27082	T	0.32	.	0.8417	0.01151	0.1633:0.3832:0.1596:0.2939	.	25	Q9Y3N9	OR2W1_HUMAN	I	25	ENSP00000366380:M25I	ENSP00000366380:M25I	M	-	3	0	OR2W1	29120857	0.000000	0.05858	0.004000	0.12327	0.216000	0.24613	-4.387000	0.00242	0.103000	0.17682	-0.225000	0.12378	ATG	OR2W1	-	NULL	ENSG00000204704		0.408	OR2W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2W1	HGNC	protein_coding	OTTHUMT00000076053.2	32	0.00	0	C			29012878	29012878	-1	no_errors	ENST00000377175	ensembl	human	known	69_37n	missense	33	31.25	15	SNP	0.002	T
OR4N4	283694	genome.wustl.edu	37	15	22383258	22383258	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr15:22383258C>G	ENST00000328795.4	+	1	877	c.786C>G	c.(784-786)ttC>ttG	p.F262L	RP11-69H14.6_ENST00000558896.1_RNA	NM_001005241.2	NP_001005241.2	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N, member 4	262						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(19)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	40		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		TGTGCCCTTTCAGGGCCTTAC	0.433																																						dbGAP											0													223.0	198.0	206.0					15																	22383258		2189	4262	6451	-	-	-	SO:0001583	missense	0			AI018459	CCDS32173.1	15q11.2	2012-08-09				ENSG00000183706		"""GPCR / Class A : Olfactory receptors"""	15375	protein-coding gene	gene with protein product							Standard	NM_001005241		Approved		uc010tzv.2	Q8N0Y3		ENST00000328795.4:c.786C>G	15.37:g.22383258C>G	ENSP00000332500:p.Phe262Leu		Q6IEY3|Q6IF56	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.F262L	ENST00000328795.4	37	c.786	CCDS32173.1	15	.	.	.	.	.	.	.	.	.	.	.	9.282	1.048292	0.19827	.	.	ENSG00000183706	ENST00000328795	T	0.00063	8.78	3.2	2.27	0.28462	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000154	T	0.00241	0.0007	L	0.39326	1.205	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.59553	-0.7433	10	0.15499	T	0.54	-18.0231	8.0673	0.30667	0.0:0.8672:0.0:0.1328	.	262	Q8N0Y3	OR4N4_HUMAN	L	262	ENSP00000332500:F262L	ENSP00000332500:F262L	F	+	3	2	OR4N4	19884622	0.000000	0.05858	0.711000	0.30485	0.026000	0.11368	-0.863000	0.04259	1.784000	0.52394	0.404000	0.27445	TTC	OR4N4	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000183706		0.433	OR4N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4N4	HGNC	protein_coding	OTTHUMT00000414922.1	95	0.00	0	C			22383258	22383258	+1	no_errors	ENST00000328795	ensembl	human	known	69_37n	missense	81	26.36	29	SNP	0.020	G
PLCH1	23007	genome.wustl.edu	37	3	155311860	155311860	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr3:155311860G>A	ENST00000340059.7	-	3	303	c.304C>T	c.(304-306)Cac>Tac	p.H102Y	PLCH1_ENST00000447496.2_Missense_Mutation_p.H102Y|PLCH1_ENST00000460012.1_Missense_Mutation_p.H84Y|PLCH1_ENST00000414191.1_Missense_Mutation_p.H84Y|PLCH1_ENST00000334686.6_Missense_Mutation_p.H84Y|PLCH1_ENST00000494598.1_Missense_Mutation_p.H102Y	NM_001130960.1	NP_001124432.1	Q4KWH8	PLCH1_HUMAN	phospholipase C, eta 1	102	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phosphatidylinositol-mediated signaling (GO:0048015)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase C activity (GO:0050429)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			NS(3)|breast(3)|endometrium(9)|kidney(4)|large_intestine(20)|lung(45)|ovary(2)|prostate(5)|skin(8)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	107			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			GACTCCATGTGGTTGCCATGG	0.557																																						dbGAP											0													74.0	66.0	69.0					3																	155311860		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB028992	CCDS33881.1, CCDS46939.1, CCDS46940.1	3q25	2013-01-10	2006-03-16	2006-03-16	ENSG00000114805	ENSG00000114805	3.1.4.11	"""EF-hand domain containing"""	29185	protein-coding gene	gene with protein product		612835	"""phospholipase C-like 3"""	PLCL3		15702972	Standard	NM_014996		Approved	KIAA1069, MGC117152, DKFZp434C1372, PLCeta1	uc021xge.1	Q4KWH8	OTTHUMG00000158477	ENST00000340059.7:c.304C>T	3.37:g.155311860G>A	ENSP00000345988:p.His102Tyr		Q29RV9|Q4KWH9|Q68CN0|Q86XK4|Q9H9U2|Q9UPT3	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,smart_EF_hand_Ca-bd,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,pfscan_EF_HAND_2,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.H102Y	ENST00000340059.7	37	c.304	CCDS46939.1	3	.	.	.	.	.	.	.	.	.	.	G	32	5.162148	0.94727	.	.	ENSG00000114805	ENST00000494598;ENST00000460012;ENST00000447496;ENST00000340059;ENST00000334686;ENST00000414191	T;T;T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07;-0.07;-0.07	5.93	5.93	0.95920	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	T	0.78641	0.4315	M	0.61703	1.905	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.74023	0.982;0.96;0.964	T	0.78558	-0.2158	10	0.72032	D	0.01	.	20.3437	0.98782	0.0:0.0:1.0:0.0	.	84;102;102	Q4KWH8-2;Q4KWH8;Q4KWH8-3	.;PLCH1_HUMAN;.	Y	102;84;102;102;84;84	ENSP00000419100:H102Y;ENSP00000417502:H84Y;ENSP00000402759:H102Y;ENSP00000345988:H102Y;ENSP00000335469:H84Y;ENSP00000412977:H84Y	ENSP00000335469:H84Y	H	-	1	0	PLCH1	156794554	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.731000	0.98807	2.815000	0.96918	0.561000	0.74099	CAC	PLCH1	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000114805		0.557	PLCH1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCH1	HGNC	protein_coding	OTTHUMT00000351125.1	53	0.00	0	G	NM_014996		155311860	155311860	-1	no_errors	ENST00000340059	ensembl	human	known	69_37n	missense	37	22.92	11	SNP	1.000	A
PLEKHN1	84069	genome.wustl.edu	37	1	907800	907800	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr1:907800C>T	ENST00000379409.2	+	9	1184	c.1154C>T	c.(1153-1155)tCg>tTg	p.S385L	PLEKHN1_ENST00000379410.3_Missense_Mutation_p.S333L|PLEKHN1_ENST00000379407.3_Missense_Mutation_p.S345L			Q494U1	PKHN1_HUMAN	pleckstrin homology domain containing, family N member 1	385										central_nervous_system(1)|endometrium(3)|kidney(1)|lung(2)|skin(1)|urinary_tract(1)	9	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.93e-23)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.00095)|Kidney(185;0.0023)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.199)		TTCCCAGGGTCGCAGGTGAGG	0.677																																						dbGAP											0													11.0	12.0	12.0					1																	907800		2174	4267	6441	-	-	-	SO:0001583	missense	0			AL136730	CCDS4.1, CCDS53256.1	1p36.33	2013-01-11			ENSG00000187583	ENSG00000187583		"""Pleckstrin homology (PH) domain containing"""	25284	protein-coding gene	gene with protein product						11230166	Standard	NM_032129		Approved	DKFZP434H2010	uc001acd.3	Q494U1	OTTHUMG00000040756	ENST00000379409.2:c.1154C>T	1.37:g.907800C>T	ENSP00000368719:p.Ser385Leu		Q494U2|Q5SV98|Q9H0M7	Missense_Mutation	SNP	smart_Pleckstrin_homology	p.S385L	ENST00000379409.2	37	c.1154		1	.	.	.	.	.	.	.	.	.	.	c	7.618	0.676126	0.14841	.	.	ENSG00000187583	ENST00000379410;ENST00000379407;ENST00000379409	T;T;T	0.46063	0.88;0.89;0.91	4.19	-0.867	0.10655	.	0.704564	0.12681	N	0.448003	T	0.12603	0.0306	N	0.00841	-1.15	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.31280	-0.9949	10	0.25106	T	0.35	.	7.9258	0.29874	0.0:0.5639:0.0:0.4361	.	345;385;333	Q494U1-3;Q494U1;Q494U1-2	.;PKHN1_HUMAN;.	L	333;345;385	ENSP00000368720:S333L;ENSP00000368717:S345L;ENSP00000368719:S385L	ENSP00000368717:S345L	S	+	2	0	PLEKHN1	897663	0.000000	0.05858	0.409000	0.26459	0.039000	0.13416	-0.349000	0.07731	0.073000	0.16731	-0.778000	0.03378	TCG	PLEKHN1	-	NULL	ENSG00000187583		0.677	PLEKHN1-005	KNOWN	basic	protein_coding	PLEKHN1	HGNC	protein_coding	OTTHUMT00000473256.1	17	0.00	0	C	NM_032129		907800	907800	+1	no_errors	ENST00000379409	ensembl	human	known	69_37n	missense	18	28.00	7	SNP	0.007	T
PRRG3	79057	genome.wustl.edu	37	X	150868724	150868724	+	Intron	SNP	A	A	G	rs7052313	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chrX:150868724A>G	ENST00000370353.3	+	3	558				PRRG3_ENST00000538575.1_Intron|PRRG3_ENST00000370354.1_Silent_p.K96K			Q9BZD7	TMG3_HUMAN	proline rich Gla (G-carboxyglutamic acid) 3 (transmembrane)							extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(6)|ovary(3)|prostate(2)|skin(3)	24	Acute lymphoblastic leukemia(192;6.56e-05)					AAGCAAGGAAAGACACCCAGC	0.537													A|||	795	0.210596	0.2405	0.3487	3775	,	,		15409	0.0813		0.0577	False		,,,				2504	0.0971					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK074574	CCDS14699.1	Xq28	2008-02-05			ENSG00000130032	ENSG00000130032			30798	protein-coding gene	gene with protein product		300685				11171957	Standard	NM_024082		Approved	TMG3	uc022cgt.1	Q9BZD7	OTTHUMG00000024170	ENST00000370353.3:c.168+96A>G	X.37:g.150868724A>G			A1A523|A1A575|Q8N2N6	Silent	SNP	pfam_GLA_domain,superfamily_GLA_domain,smart_GLA_domain,prints_GLA_domain,pfscan_GLA_domain	p.K96	ENST00000370353.3	37	c.288	CCDS14699.1	X																																																																																			PRRG3	-	NULL	ENSG00000130032		0.537	PRRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRG3	HGNC	protein_coding	OTTHUMT00000060880.1	47	0.00	0	A	NM_024082		150868724	150868724	+1	no_errors	ENST00000370354	ensembl	human	known	69_37n	silent	40	11.11	5	SNP	0.001	G
PRUNE2	158471	genome.wustl.edu	37	9	79259592	79259592	+	Intron	SNP	C	C	T	rs511040	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr9:79259592C>T	ENST00000376718.3	-	12	8852				PRUNE2_ENST00000443509.2_Intron|PRUNE2_ENST00000466266.2_Intron|PRUNE2_ENST00000428286.1_Intron|PRUNE2_ENST00000223609.6_Intron	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)						apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						AGACTCACTTCATGATTTTAA	0.433													T|||	3109	0.620807	0.6762	0.536	5008	,	,		18984	0.622		0.5537	False		,,,				2504	0.6738					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.8728+62G>A	9.37:g.79259592C>T			B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	RNA	SNP	-	NULL	ENST00000376718.3	37	NULL	CCDS47982.1	9																																																																																			PRUNE2	-	-	ENSG00000106772		0.433	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	PRUNE2	HGNC	protein_coding	OTTHUMT00000052730.2	31	0.00	0	C	NM_138818		79259592	79259592	-1	no_errors	ENST00000488346	ensembl	human	known	69_37n	rna	42	14.29	7	SNP	0.000	T
PTCH1	5727	genome.wustl.edu	37	9	98209357	98209357	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr9:98209357C>T	ENST00000331920.6	-	23	4480	c.4181G>A	c.(4180-4182)cGa>cAa	p.R1394Q	PTCH1_ENST00000437951.1_Missense_Mutation_p.R1328Q|PTCH1_ENST00000421141.1_Missense_Mutation_p.R1243Q|PTCH1_ENST00000430669.2_Missense_Mutation_p.R1328Q|PTCH1_ENST00000418258.1_Missense_Mutation_p.R1243Q|PTCH1_ENST00000375274.2_Missense_Mutation_p.R1393Q|PTCH1_ENST00000429896.2_Missense_Mutation_p.R1243Q	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	1394					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)			NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				GAGTCCCCCTCGGGGGTTCCG	0.677																																						dbGAP											0													41.0	47.0	45.0					9																	98209357		2203	4300	6503	-	-	-	SO:0001583	missense	0			AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.4181G>A	9.37:g.98209357C>T	ENSP00000332353:p.Arg1394Gln		A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD,tigrfam_TM_rcpt_patched	p.R1394Q	ENST00000331920.6	37	c.4181	CCDS6714.1	9	.	.	.	.	.	.	.	.	.	.	C	14.66	2.601409	0.46423	.	.	ENSG00000185920	ENST00000331920;ENST00000437951;ENST00000421141;ENST00000418258;ENST00000430669;ENST00000375284;ENST00000429896;ENST00000375274	D;D;D;D;D;D;D	0.89939	-2.59;-2.58;-2.56;-2.56;-2.58;-2.56;-2.59	5.06	5.06	0.68205	.	0.472329	0.22934	N	0.053874	T	0.78470	0.4288	N	0.19112	0.55	0.26783	N	0.969555	P;P;B	0.35155	0.487;0.487;0.355	B;B;B	0.28232	0.037;0.087;0.04	T	0.70163	-0.4947	10	0.29301	T	0.29	-2.7242	11.9993	0.53222	0.0:0.9213:0.0:0.0787	.	1328;1393;1394	Q13635-3;Q13635-2;Q13635	.;.;PTC1_HUMAN	Q	1394;1328;1243;1243;1328;186;1243;1393	ENSP00000332353:R1394Q;ENSP00000389744:R1328Q;ENSP00000399981:R1243Q;ENSP00000396135:R1243Q;ENSP00000410287:R1328Q;ENSP00000414823:R1243Q;ENSP00000364423:R1393Q	ENSP00000332353:R1394Q	R	-	2	0	PTCH1	97249178	0.998000	0.40836	1.000000	0.80357	0.900000	0.52787	3.022000	0.49659	2.623000	0.88846	0.655000	0.94253	CGA	PTCH1	-	NULL	ENSG00000185920		0.677	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCH1	HGNC	protein_coding	OTTHUMT00000053229.2	37	0.00	0	C	NM_000264		98209357	98209357	-1	no_errors	ENST00000331920	ensembl	human	known	69_37n	missense	26	27.78	10	SNP	0.991	T
REL	5966	genome.wustl.edu	37	2	61128216	61128216	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr2:61128216A>G	ENST00000295025.8	+	4	712	c.392A>G	c.(391-393)aAt>aGt	p.N131S	REL_ENST00000394479.3_Missense_Mutation_p.N131S	NM_002908.2	NP_002899.1	Q04864	REL_HUMAN	v-rel avian reticuloendotheliosis viral oncogene homolog	131	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				cytokine production (GO:0001816)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of neuron death (GO:1901215)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|large_intestine(5)|lung(3)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	16	all_hematologic(2;0.0797)	Ovarian(717;0.0728)	LUSC - Lung squamous cell carcinoma(5;6.2e-08)|Lung(5;1.65e-06)|Epithelial(17;0.064)|all cancers(80;0.221)			AATCCATTCAATGGTAAGTAT	0.274			A		Hodgkin Lymphoma																																	dbGAP		Dom	yes		2	2p13-p12	5966	v-rel reticuloendotheliosis viral oncogene homolog (avian)		L	0													52.0	52.0	52.0					2																	61128216		2203	4295	6498	-	-	-	SO:0001583	missense	0			M11595	CCDS1864.1, CCDS74515.1	2p13-p12	2013-07-09	2013-07-09		ENSG00000162924	ENSG00000162924			9954	protein-coding gene	gene with protein product		164910				1577270	Standard	XM_005264470		Approved	I-Rel, c-Rel	uc002sam.1	Q04864	OTTHUMG00000129418	ENST00000295025.8:c.392A>G	2.37:g.61128216A>G	ENSP00000295025:p.Asn131Ser		Q17RU2|Q2PNZ7|Q6LDY0	Missense_Mutation	SNP	pfam_RHD,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT_TIG_rcpt,pfscan_RHD,prints_NF_Rel_dor	p.N131S	ENST00000295025.8	37	c.392	CCDS1864.1	2	.	.	.	.	.	.	.	.	.	.	A	13.15	2.150094	0.37923	.	.	ENSG00000162924	ENST00000295025;ENST00000394479	T;T	0.42900	0.96;0.96	5.55	1.43	0.22495	Rel homology (3);p53-like transcription factor, DNA-binding (1);	0.241654	0.49305	N	0.000152	T	0.29028	0.0721	L	0.37507	1.11	0.39815	D	0.972768	B;B	0.16802	0.01;0.019	B;B	0.09377	0.003;0.004	T	0.07751	-1.0756	10	0.33940	T	0.23	-17.3238	9.1155	0.36755	0.7374:0.0:0.2626:0.0	.	131;131	Q17RU2;Q04864	.;REL_HUMAN	S	131	ENSP00000295025:N131S;ENSP00000377989:N131S	ENSP00000295025:N131S	N	+	2	0	REL	60981720	1.000000	0.71417	0.995000	0.50966	0.982000	0.71751	1.368000	0.34216	0.155000	0.19261	0.533000	0.62120	AAT	REL	-	pfam_RHD,superfamily_p53-like_TF_DNA-bd,pfscan_RHD	ENSG00000162924		0.274	REL-001	KNOWN	basic|CCDS	protein_coding	REL	HGNC	protein_coding	OTTHUMT00000251576.3	23	0.00	0	A	NM_002908		61128216	61128216	+1	no_errors	ENST00000295025	ensembl	human	known	69_37n	missense	13	45.83	11	SNP	1.000	G
RFX8	731220	genome.wustl.edu	37	2	102014165	102014165	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr2:102014165C>G	ENST00000376826.2	-	15	1605	c.1606G>C	c.(1606-1608)Gat>Cat	p.D536H	RFX8_ENST00000428343.1_Missense_Mutation_p.D423H			Q6ZV50	RFX8_HUMAN	RFX family member 8, lacking RFX DNA binding domain	536					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|kidney(1)|stomach(1)	3						GTGGTTTCATCTTCCAACAGC	0.403																																						dbGAP											0													226.0	175.0	190.0					2																	102014165		692	1591	2283	-	-	-	SO:0001583	missense	0			AK124976	CCDS46376.1	2q11.2	2012-11-15	2012-11-15		ENSG00000196460	ENSG00000196460			37253	protein-coding gene	gene with protein product			"""regulatory factor X, 8"", ""RFX gene family member 8, lacking RFX DNA binding domain"""				Standard	NM_001145664		Approved	FLJ42986	uc010yvx.1	Q6ZV50	OTTHUMG00000130693	ENST00000376826.2:c.1606G>C	2.37:g.102014165C>G	ENSP00000366022:p.Asp536His		B4DQ32	Missense_Mutation	SNP	pfam_DNA-bd_RFX	p.D536H	ENST00000376826.2	37	c.1606		2	.	.	.	.	.	.	.	.	.	.	C	13.82	2.352415	0.41700	.	.	ENSG00000196460	ENST00000376826;ENST00000428343	T;T	0.80738	-1.41;0.59	5.16	5.16	0.70880	.	0.000000	0.52532	D	0.000077	D	0.84615	0.5511	L	0.32530	0.975	0.37227	D	0.905516	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.87613	0.2505	10	0.87932	D	0	-24.6205	15.4803	0.75521	0.0:1.0:0.0:0.0	.	423;536	Q6ZV50-3;Q6ZV50	.;RFX8_HUMAN	H	536;423	ENSP00000366022:D536H;ENSP00000401536:D423H	ENSP00000366022:D536H	D	-	1	0	RFX8	101380597	1.000000	0.71417	0.913000	0.36048	0.024000	0.10985	3.870000	0.56070	2.686000	0.91538	0.603000	0.83216	GAT	RFX8	-	NULL	ENSG00000196460		0.403	RFX8-201	KNOWN	basic|appris_principal	protein_coding	RFX8	HGNC	protein_coding		46	0.00	0	C	NM_001145664		102014165	102014165	-1	no_errors	ENST00000376826	ensembl	human	known	69_37n	missense	37	33.93	19	SNP	1.000	G
RAB17	64284	genome.wustl.edu	37	2	238483164	238483164	+	3'UTR	SNP	T	T	C	rs6766	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr2:238483164T>C	ENST00000264601.3	-	0	1766				RAB17_ENST00000538644.1_3'UTR|RAB17_ENST00000409576.1_Silent_p.P25P	NM_022449.3	NP_071894.1	Q9H0T7	RAB17_HUMAN	RAB17, member RAS oncogene family						cilium assembly (GO:0042384)|endocytic recycling (GO:0032456)|establishment of melanosome localization (GO:0032401)|filopodium assembly (GO:0046847)|GTP catabolic process (GO:0006184)|immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor (GO:0002415)|melanosome transport (GO:0032402)|protein transport (GO:0015031)|regulation of dendrite development (GO:0050773)|regulation of filopodium assembly (GO:0051489)|regulation of synapse assembly (GO:0051963)|small GTPase mediated signal transduction (GO:0007264)|transcytosis (GO:0045056)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|dendrite (GO:0030425)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|melanosome (GO:0042470)|neuronal cell body (GO:0043025)|recycling endosome (GO:0055037)|recycling endosome membrane (GO:0055038)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(1)	4		Renal(207;0.00272)|Breast(86;0.00297)|all_hematologic(139;0.182)|Ovarian(221;0.221)		Epithelial(121;9.36e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.26e-10)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000354)|Lung(119;0.011)|LUSC - Lung squamous cell carcinoma(224;0.026)		CACCAAGATGTGGAAATCCTG	0.617													C|||	2358	0.470847	0.8495	0.3285	5008	,	,		16713	0.4177		0.2217	False		,,,				2504	0.3712				Colon(56;987 1029 6466 13943 27336)	dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK022600	CCDS2520.1	2q37.3	2008-05-23			ENSG00000124839	ENSG00000124839		"""RAB, member RAS oncogene"""	16523	protein-coding gene	gene with protein product		602206				9624171	Standard	NM_022449		Approved		uc002vwz.2	Q9H0T7	OTTHUMG00000133299	ENST00000264601.3:c.*498A>G	2.37:g.238483164T>C			Q53QV6|Q6IA73|Q6PJZ0|Q9BVU1|Q9H9U9	Silent	SNP	NULL	p.P25	ENST00000264601.3	37	c.75	CCDS2520.1	2																																																																																			RAB17	-	NULL	ENSG00000124839		0.617	RAB17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB17	HGNC	protein_coding	OTTHUMT00000257084.2	36	0.00	0	T			238483164	238483164	-1	no_errors	ENST00000409576	ensembl	human	putative	69_37n	silent	33	10.81	4	SNP	0.000	C
RNASEL	6041	genome.wustl.edu	37	1	182551306	182551306	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr1:182551306G>A	ENST00000367559.3	-	4	1907	c.1654C>T	c.(1654-1656)Caa>Taa	p.Q552*	RNASEL_ENST00000539397.1_Nonsense_Mutation_p.Q552*|RNASEL_ENST00000444138.1_Nonsense_Mutation_p.Q552*	NM_021133.3	NP_066956.1	Q05823	RN5A_HUMAN	ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent)	552	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|mRNA processing (GO:0006397)|negative regulation of viral genome replication (GO:0045071)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA processing (GO:0006364)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)|endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(9)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(1)	27						ggagaaagttgaaccaCCTCT	0.488																																						dbGAP											0													189.0	172.0	178.0					1																	182551306		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			L10381	CCDS1347.1	1q25	2013-01-10			ENSG00000135828	ENSG00000135828	3.1.26.-	"""Ankyrin repeat domain containing"""	10050	protein-coding gene	gene with protein product		180435	"""prostate cancer 1"""	RNS4, PRCA1		7514564	Standard	NM_021133		Approved		uc009wxz.2	Q05823	OTTHUMG00000035213	ENST00000367559.3:c.1654C>T	1.37:g.182551306G>A	ENSP00000356530:p.Gln552*		Q5W0L2|Q6AI46	Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_KEN_RNase_activator,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Ankyrin_rpt-contain_dom,superfamily_Kinase-like_dom,smart_Ankyrin_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_PUG-dom,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_cat_dom	p.Q552*	ENST00000367559.3	37	c.1654	CCDS1347.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.266058	0.95399	.	.	ENSG00000135828	ENST00000367559;ENST00000444138;ENST00000539397	.	.	.	5.1	-3.75	0.04372	.	3.365840	0.00846	N	0.001785	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	0.0029	5.6939	0.17845	0.0781:0.5081:0.1853:0.2286	.	.	.	.	X	552	.	ENSP00000356530:Q552X	Q	-	1	0	RNASEL	180817929	0.000000	0.05858	0.000000	0.03702	0.113000	0.19764	-2.371000	0.01074	-0.304000	0.08843	0.650000	0.86243	CAA	RNASEL	-	superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	ENSG00000135828		0.488	RNASEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASEL	HGNC	protein_coding	OTTHUMT00000085189.1	31	0.00	0	G	NM_021133		182551306	182551306	-1	no_errors	ENST00000367559	ensembl	human	known	69_37n	nonsense	28	30.00	12	SNP	0.000	A
RGS18	64407	genome.wustl.edu	37	1	192150504	192150504	+	Silent	SNP	C	C	T			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr1:192150504C>T	ENST00000367460.3	+	4	547	c.366C>T	c.(364-366)ttC>ttT	p.F122F		NM_130782.2	NP_570138.1	Q9NS28	RGS18_HUMAN	regulator of G-protein signaling 18	122	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				G-protein coupled receptor signaling pathway (GO:0007186)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			kidney(1)|large_intestine(2)|lung(15)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GTGAAGATTTCAAGAAAAGCA	0.323																																						dbGAP											0													46.0	49.0	48.0					1																	192150504		2198	4289	6487	-	-	-	SO:0001819	synonymous_variant	0			AF268036	CCDS1374.1	1q31.2	2008-02-05	2007-08-14		ENSG00000150681	ENSG00000150681		"""Regulators of G-protein signaling"""	14261	protein-coding gene	gene with protein product		607192	"""regulator of G-protein signalling 18"""			11042171	Standard	NM_130782		Approved	RGS13	uc001gsg.3	Q9NS28	OTTHUMG00000035592	ENST00000367460.3:c.366C>T	1.37:g.192150504C>T			B2RD23	Silent	SNP	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.F122	ENST00000367460.3	37	c.366	CCDS1374.1	1																																																																																			RGS18	-	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	ENSG00000150681		0.323	RGS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS18	HGNC	protein_coding	OTTHUMT00000086382.1	84	0.00	0	C	NM_130782		192150504	192150504	+1	no_errors	ENST00000367460	ensembl	human	known	69_37n	silent	79	26.17	28	SNP	1.000	T
SERHL2	253190	genome.wustl.edu	37	22	42952207	42952207	+	Intron	SNP	C	C	T	rs142212902		TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr22:42952207C>T	ENST00000327678.5	+	5	450				SERHL2_ENST00000335879.5_Intron|SERHL2_ENST00000340239.4_Intron|SERHL2_ENST00000407614.4_Intron|RRP7B_ENST00000357802.2_RNA	NM_014509.3	NP_055324.2	Q9NQF3	SERHL_HUMAN	serine hydrolase-like 2								hydrolase activity (GO:0016787)			breast(1)|endometrium(2)|lung(3)|skin(1)|stomach(1)	8						GTCACAGTGACAGTCCTTATA	0.587																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS14037.1, CCDS63498.1	22q13	2005-08-09			ENSG00000183569	ENSG00000183569			29446	protein-coding gene	gene with protein product							Standard	NM_014509		Approved		uc003bcr.3	Q9H4I8	OTTHUMG00000150892	ENST00000327678.5:c.348+118C>T	22.37:g.42952207C>T			Q5JZ95|Q9UH21	RNA	SNP	-	NULL	ENST00000327678.5	37	NULL	CCDS14037.1	22																																																																																			RRP7B	-	-	ENSG00000182841		0.587	SERHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRP7B	HGNC	protein_coding	OTTHUMT00000320454.1	34	0.00	0	C	NM_014509		42952207	42952207	-1	no_errors	ENST00000357802	ensembl	human	known	69_37n	rna	16	20.00	4	SNP	0.000	T
SERHL2	253190	genome.wustl.edu	37	22	42970736	42970736	+	IGR	SNP	G	G	A	rs137059	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr22:42970736G>A	ENST00000327678.5	+	0	1374				RRP7B_ENST00000357802.2_RNA	NM_014509.3	NP_055324.2	Q9NQF3	SERHL_HUMAN	serine hydrolase-like 2								hydrolase activity (GO:0016787)			breast(1)|endometrium(2)|lung(3)|skin(1)|stomach(1)	8						CGGCTCTCACGGCTCAGTAGG	0.637													.|||	893	0.178315	0.3714	0.1009	5008	,	,		18397	0.128		0.1014	False		,,,				2504	0.1033					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0				CCDS14037.1, CCDS63498.1	22q13	2005-08-09			ENSG00000183569	ENSG00000183569			29446	protein-coding gene	gene with protein product							Standard	NM_014509		Approved		uc003bcr.3	Q9H4I8	OTTHUMG00000150892		22.37:g.42970736G>A			Q5JZ95|Q9UH21	RNA	SNP	-	NULL	ENST00000327678.5	37	NULL	CCDS14037.1	22																																																																																			RRP7B	-	-	ENSG00000182841		0.637	SERHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRP7B	HGNC	protein_coding	OTTHUMT00000320454.1	60	0.00	0	G	NM_014509		42970736	42970736	-1	no_errors	ENST00000357802	ensembl	human	known	69_37n	rna	36	14.29	6	SNP	0.001	A
RTEL1	51750	genome.wustl.edu	37	20	62303913	62303913	+	Missense_Mutation	SNP	G	G	T	rs549397879		TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr20:62303913G>T	ENST00000360203.5	+	9	1029	c.704G>T	c.(703-705)cGc>cTc	p.R235L	RTEL1_ENST00000370018.3_Missense_Mutation_p.R235L|RTEL1-TNFRSF6B_ENST00000482936.1_Missense_Mutation_p.R235L|RTEL1_ENST00000508582.2_Missense_Mutation_p.R259L|RTEL1_ENST00000318100.4_Missense_Mutation_p.R235L					regulator of telomere elongation helicase 1											NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			CTGTAGAGCCGCAGAGCACAC	0.557													G|||	0	0.0	0.0	0.0	5008	,	,		18019	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													79.0	58.0	65.0					20																	62303913		2203	4297	6500	-	-	-	SO:0001583	missense	0			AB029011	CCDS13530.2, CCDS13531.1, CCDS13530.3, CCDS63331.1, CCDS74751.1	20q13.3	2012-06-27	2004-10-29	2004-10-29	ENSG00000258366	ENSG00000258366			15888	protein-coding gene	gene with protein product		608833	"""chromosome 20 open reading frame 41"""	C20orf41		10655513, 15210109	Standard	NM_016434		Approved	bK3184A7.3, NHL, DKFZP434C013, KIAA1088, RTEL	uc011abd.2	Q9NZ71	OTTHUMG00000032992	ENST00000360203.5:c.704G>T	20.37:g.62303913G>T	ENSP00000353332:p.Arg235Leu			Missense_Mutation	SNP	pfam_DEAD_2,smart_Helicase-like_DEXD_c2,smart_ATP-dep_Helicase_C,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3,tigrfam_DNA_helicase_DNA-repair_Rad3	p.R235L	ENST00000360203.5	37	c.704		20	.	.	.	.	.	.	.	.	.	.	g	16.45	3.125692	0.56721	.	.	ENSG00000258366	ENST00000370018;ENST00000318100;ENST00000508582;ENST00000360203;ENST00000356810	T;T;T;T;T	0.73681	-0.77;-0.77;-0.77;-0.77;-0.77	4.44	3.46	0.39613	DEAD2 (1);Helicase-like, DEXD box c2 type (1);Helicase, superfamily 1/2, ATP-binding domain, DinG/Rad3-type (1);	0.061540	0.64402	D	0.000002	D	0.88202	0.6373	M	0.91406	3.205	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;0.986;1.0;1.0	D;D;D;D	0.97110	1.0;0.96;0.999;0.997	D	0.90399	0.4401	10	0.72032	D	0.01	-24.9668	14.0689	0.64849	0.0:0.1524:0.8476:0.0	.	259;259;235;235	Q9NZ71-7;D6RBA3;Q9NZ71;Q9NZ71-6	.;.;RTEL1_HUMAN;.	L	235;235;259;235;285	ENSP00000359035:R235L;ENSP00000322287:R235L;ENSP00000424307:R259L;ENSP00000353332:R235L;ENSP00000349265:R285L	ENSP00000349265:R285L	R	+	2	0	AL353715.1	61774357	1.000000	0.71417	0.579000	0.28588	0.044000	0.14063	6.199000	0.72112	0.953000	0.37825	0.645000	0.84053	CGC	RTEL1	-	pfam_DEAD_2,smart_Helicase-like_DEXD_c2,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3	ENSG00000258366		0.557	RTEL1-011	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	RTEL1	HGNC	protein_coding	OTTHUMT00000289781.1	34	0.00	0	G	NM_032957		62303913	62303913	+1	no_errors	ENST00000318100	ensembl	human	known	69_37n	missense	26	13.33	4	SNP	1.000	T
RUNX3	864	genome.wustl.edu	37	1	25256116	25256116	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr1:25256116G>T	ENST00000308873.6	-	1	252	c.244C>A	c.(244-246)Cac>Aac	p.H82N	RUNX3_ENST00000399916.1_Missense_Mutation_p.H96N|RUNX3_ENST00000540420.1_5'Flank|RUNX3_ENST00000496967.1_5'Flank|RUNX3_ENST00000338888.3_Missense_Mutation_p.H96N	NM_004350.2	NP_004341.1	Q13761	RUNX3_HUMAN	runt-related transcription factor 3	82	Runt. {ECO:0000255|PROSITE- ProRule:PRU00399}.				axon guidance (GO:0007411)|cell maturation (GO:0048469)|chondrocyte differentiation (GO:0002062)|hair follicle morphogenesis (GO:0031069)|interferon-gamma production (GO:0032609)|negative regulation of cell cycle (GO:0045786)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peripheral nervous system neuron development (GO:0048935)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(3)	18		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00131)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;2.85e-26)|Colorectal(126;4.35e-08)|COAD - Colon adenocarcinoma(152;1.92e-06)|GBM - Glioblastoma multiforme(114;0.000102)|STAD - Stomach adenocarcinoma(196;0.000766)|KIRC - Kidney renal clear cell carcinoma(1967;0.00148)|BRCA - Breast invasive adenocarcinoma(304;0.00173)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.136)		CAGCGCCAGTGCGAGGGCAGC	0.736																																						dbGAP											0													34.0	30.0	31.0					1																	25256116		2201	4298	6499	-	-	-	SO:0001583	missense	0			BC013362	CCDS257.1, CCDS30633.1	1p36	2008-02-05			ENSG00000020633	ENSG00000020633			10473	protein-coding gene	gene with protein product		600210		CBFA3		7835892	Standard	NM_001031680		Approved	AML2, PEBP2A3	uc001bjq.3	Q13761	OTTHUMG00000003316	ENST00000308873.6:c.244C>A	1.37:g.25256116G>T	ENSP00000308051:p.His82Asn		B1AJV5|Q12969|Q13760	Missense_Mutation	SNP	pfam_AML1/Runt_N,pfam_RunxI,superfamily_p53-like_TF_DNA-bd,pirsf_TF_Runt-rel_RUNX,prints_AML1_Runt,pfscan_AML1/Runt_N	p.H96N	ENST00000308873.6	37	c.286	CCDS257.1	1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.818441	0.90790	.	.	ENSG00000020633	ENST00000399916;ENST00000308873;ENST00000338888;ENST00000428150	D;D;D	0.99843	-7.11;-7.11;-7.11	3.52	3.52	0.40303	Acute myeloid leukemia 1 (AML 1)/Runt (2);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.060041	0.64402	D	0.000003	D	0.99806	0.9916	M	0.89840	3.065	0.80722	D	1	D;P;D;P	0.61080	0.989;0.946;0.957;0.891	D;P;P;P	0.67231	0.95;0.723;0.819;0.542	D	0.96614	0.9454	10	0.87932	D	0	-37.1582	13.8059	0.63230	0.0:0.0:1.0:0.0	.	82;96;96;82	E9PH34;Q13761-2;B1AJV5;Q13761	.;.;.;RUNX3_HUMAN	N	96;82;96;82	ENSP00000382800:H96N;ENSP00000308051:H82N;ENSP00000343477:H96N	ENSP00000308051:H82N	H	-	1	0	RUNX3	25128703	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.069000	0.93967	1.813000	0.52934	0.491000	0.48974	CAC	RUNX3	-	pfam_AML1/Runt_N,superfamily_p53-like_TF_DNA-bd,pirsf_TF_Runt-rel_RUNX,prints_AML1_Runt,pfscan_AML1/Runt_N	ENSG00000020633		0.736	RUNX3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RUNX3	HGNC	protein_coding	OTTHUMT00000009284.1	26	0.00	0	G	NM_004350		25256116	25256116	-1	no_errors	ENST00000338888	ensembl	human	known	69_37n	missense	6	33.33	3	SNP	1.000	T
SARDH	1757	genome.wustl.edu	37	9	136559429	136559429	+	Missense_Mutation	SNP	G	G	T	rs112883474		TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr9:136559429G>T	ENST00000371872.4	-	15	2129	c.1872C>A	c.(1870-1872)agC>agA	p.S624R	SARDH_ENST00000439388.1_Missense_Mutation_p.S624R|SARDH_ENST00000422262.2_Missense_Mutation_p.S456R|SARDH_ENST00000371868.1_Missense_Mutation_p.S52R	NM_007101.3	NP_009032.2	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase	624					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|sarcosine dehydrogenase activity (GO:0008480)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(13)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	44				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		GTGCCAGGCGGCTGACAGTCA	0.667																																						dbGAP											0													32.0	27.0	28.0					9																	136559429		1938	3764	5702	-	-	-	SO:0001583	missense	0				CCDS6978.1	9q33-q34	2008-02-05			ENSG00000123453	ENSG00000123453	1.5.99.2		10536	protein-coding gene	gene with protein product		604455		DMGDHL1		10444331	Standard	NM_007101		Approved	SDH	uc004cep.4	Q9UL12	OTTHUMG00000020879	ENST00000371872.4:c.1872C>A	9.37:g.136559429G>T	ENSP00000360938:p.Ser624Arg		B2RMR5|B4DPI2|B7ZLT6|Q5SYV0|Q9Y280|Q9Y2Y3	Missense_Mutation	SNP	pfam_FAD-dep_OxRdtase,pfam_GCV_T_N,pfam_GCV_T_C	p.S624R	ENST00000371872.4	37	c.1872	CCDS6978.1	9	.	.	.	.	.	.	.	.	.	.	G	18.54	3.645604	0.67358	.	.	ENSG00000123453	ENST00000371872;ENST00000371868;ENST00000439388;ENST00000422262	T;T;T;T	0.75154	-0.91;-0.91;-0.91;-0.91	4.55	3.5	0.40072	Glycine cleavage T-protein, N-terminal (1);	0.095736	0.64402	D	0.000001	T	0.80919	0.4716	M	0.66439	2.03	0.80722	D	1	D;D	0.69078	0.993;0.997	D;D	0.72982	0.962;0.979	T	0.79262	-0.1876	10	0.40728	T	0.16	-28.65	7.3761	0.26829	0.1767:0.0:0.8233:0.0	.	624;52	Q9UL12;Q5SYV2	SARDH_HUMAN;.	R	624;52;624;456	ENSP00000360938:S624R;ENSP00000360934:S52R;ENSP00000403084:S624R;ENSP00000415537:S456R	ENSP00000360934:S52R	S	-	3	2	SARDH	135549250	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	3.053000	0.49901	2.040000	0.60383	0.467000	0.42956	AGC	SARDH	-	pfam_GCV_T_N	ENSG00000123453		0.667	SARDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SARDH	HGNC	protein_coding	OTTHUMT00000054931.1	93	0.00	0	G			136559429	136559429	-1	no_errors	ENST00000371872	ensembl	human	known	69_37n	missense	65	35.64	36	SNP	0.990	T
SIGLEC6	946	genome.wustl.edu	37	19	52033094	52033094	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr19:52033094G>C	ENST00000425629.3	-	5	1050	c.896C>G	c.(895-897)tCc>tGc	p.S299C	SIGLEC6_ENST00000391797.3_Missense_Mutation_p.S288C|SIGLEC6_ENST00000474054.1_5'Flank|SIGLEC6_ENST00000343300.4_Missense_Mutation_p.S299C|SIGLEC6_ENST00000346477.3_Missense_Mutation_p.S283C|SIGLEC6_ENST00000436458.1_Missense_Mutation_p.S247C|SIGLEC6_ENST00000359982.4_Missense_Mutation_p.S310C	NM_001245.5	NP_001236.4	O43699	SIGL6_HUMAN	sialic acid binding Ig-like lectin 6	299	Ig-like C2-type 2.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)			endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(15)|ovary(1)|stomach(1)	28		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00115)|OV - Ovarian serous cystadenocarcinoma(262;0.0165)		CCCGGTATTGGAGATGGGGGT	0.627																																						dbGAP											0													50.0	59.0	56.0					19																	52033094		2190	4285	6475	-	-	-	SO:0001583	missense	0			D86358	CCDS12834.3, CCDS12835.3, CCDS12836.3, CCDS54307.1, CCDS54308.1, CCDS59417.1	19q13.3	2013-01-29			ENSG00000105492	ENSG00000105492		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10875	protein-coding gene	gene with protein product		604405		CD33L, CD33L1		9465907	Standard	NM_001245		Approved	OB-BP1, SIGLEC-6, CD327	uc002pwy.3	O43699	OTTHUMG00000133571	ENST00000425629.3:c.896C>G	19.37:g.52033094G>C	ENSP00000401502:p.Ser299Cys		A8MV71|B2RTS8|C9JBE5|F8WA78|O15388|O43700	Missense_Mutation	SNP	pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.S299C	ENST00000425629.3	37	c.896	CCDS12834.3	19	.	.	.	.	.	.	.	.	.	.	G	9.445	1.089106	0.20390	.	.	ENSG00000105492	ENST00000346477;ENST00000391797;ENST00000425629;ENST00000359982;ENST00000436458;ENST00000343300	T;T;T;T	0.68903	-0.36;-0.36;-0.36;-0.36	3.71	1.51	0.23008	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.644553	0.12846	N	0.434370	T	0.69984	0.3172	M	0.76433	2.335	0.09310	N	1	P;B;P;P;P;B	0.40515	0.545;0.42;0.719;0.545;0.577;0.445	B;B;P;B;B;P	0.48166	0.264;0.277;0.514;0.191;0.431;0.569	T	0.60105	-0.7328	10	0.52906	T	0.07	.	6.3893	0.21577	0.0:0.2034:0.5865:0.2101	.	310;247;288;299;283;299	F8WA78;C9JBE5;O43699-4;O43699-2;O43699-3;O43699	.;.;.;.;.;SIGL6_HUMAN	C	272;283;299;310;247;299	ENSP00000401502:S299C;ENSP00000353071:S310C;ENSP00000410679:S247C;ENSP00000345907:S299C	ENSP00000345907:S299C	S	-	2	0	SIGLEC6	56724906	0.000000	0.05858	0.001000	0.08648	0.014000	0.08584	0.504000	0.22626	0.357000	0.24183	0.514000	0.50259	TCC	SIGLEC6	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000105492		0.627	SIGLEC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIGLEC6	HGNC	protein_coding	OTTHUMT00000257670.3	29	0.00	0	G	NM_001245		52033094	52033094	-1	no_errors	ENST00000425629	ensembl	human	known	69_37n	missense	17	37.04	10	SNP	0.001	C
SLC25A28	81894	genome.wustl.edu	37	10	101373387	101373387	+	Intron	SNP	G	G	T			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr10:101373387G>T	ENST00000370495.4	-	2	549				SLC25A28_ENST00000496035.1_Intron	NM_031212.3	NP_112489.3	Q96A46	MFRN2_HUMAN	solute carrier family 25 (mitochondrial iron transporter), member 28						ion transport (GO:0006811)|iron ion homeostasis (GO:0055072)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(2)|stomach(1)	11		Colorectal(252;0.234)		Epithelial(162;2.57e-10)|all cancers(201;2.01e-08)		AGACTGGAAAGCACTGACAGC	0.527																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF327402	CCDS41559.1	10q24.2	2013-05-22	2012-03-29		ENSG00000155287	ENSG00000155287		"""Solute carriers"""	23472	protein-coding gene	gene with protein product	"""mitoferrin 2"""	609767	"""solute carrier family 25, member 28"""			11297739	Standard	NM_031212		Approved	MRS3/4, MRS4L	uc001kpx.2	Q96A46	OTTHUMG00000018886	ENST00000370495.4:c.520+65C>A	10.37:g.101373387G>T			Q4VBZ0|Q5T777|Q86VX5|Q969G8|Q9H2J3	RNA	SNP	-	NULL	ENST00000370495.4	37	NULL	CCDS41559.1	10																																																																																			SLC25A28	-	-	ENSG00000155287		0.527	SLC25A28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A28	HGNC	protein_coding	OTTHUMT00000049801.1	26	0.00	0	G	NM_031212		101373387	101373387	-1	no_errors	ENST00000479722	ensembl	human	known	69_37n	rna	29	12.12	4	SNP	1.000	T
SLC4A11	83959	genome.wustl.edu	37	20	3218634	3218634	+	5'Flank	SNP	G	G	C	rs3810562	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr20:3218634G>C	ENST00000380056.3	-	0	0				SLC4A11_ENST00000539553.2_Intron|SLC4A11_ENST00000380059.3_Missense_Mutation_p.P26R	NM_032034.3	NP_114423.1	Q8NBS3	S4A11_HUMAN	solute carrier family 4, sodium borate transporter, member 11						bicarbonate transport (GO:0015701)|borate transmembrane transport (GO:0035445)|borate transport (GO:0046713)|cellular cation homeostasis (GO:0030003)|fluid transport (GO:0042044)|proton transport (GO:0015992)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	bicarbonate transmembrane transporter activity (GO:0015106)|borate transmembrane transporter activity (GO:0046715)|hydrogen ion channel activity (GO:0015252)|inorganic anion exchanger activity (GO:0005452)|protein dimerization activity (GO:0046983)|sodium channel activity (GO:0005272)|symporter activity (GO:0015293)	p.P26R(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(4)|soft_tissue(1)|urinary_tract(1)	40						CTCTCTCCTCGGATGCCAAGG	0.637													C|||	3213	0.641573	0.8215	0.5807	5008	,	,		15857	0.6766		0.5795	False		,,,				2504	0.4693				NSCLC(190;922 2139 10266 10292 38692)	dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)																																								-	-	-	SO:0001631	upstream_gene_variant	0			AF336127	CCDS13052.1, CCDS54445.1, CCDS54446.1	20p13	2014-02-14	2007-08-03		ENSG00000088836	ENSG00000088836		"""Solute carriers"""	16438	protein-coding gene	gene with protein product		610206	"""corneal endothelial dystrophy 2 (autosomal recessive)"", ""solute carrier family 4, sodium bicarbonate transporter-like, member 11"", ""corneal dystrophy and perceptive deafness 1"""	CHED2, CDPD1		10843999, 11302728, 16767101	Standard	NM_001174089		Approved	dJ794I6.2, BTR1, NaBC1, FECD4	uc010zqe.2	Q8NBS3	OTTHUMG00000031740		20.37:g.3218634G>C	Exception_encountered		B4DKC8|B4DKX9|G3V1M3|Q2TB62|Q2TB63|Q9BXF4|Q9NTW9	Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_PTS_EIIA_2,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk	p.P26R	ENST00000380056.3	37	c.77	CCDS13052.1	20	1403	0.6423992673992674	385	0.782520325203252	209	0.5773480662983426	382	0.6678321678321678	427	0.5633245382585752	C	3.200	-0.163983	0.06502	.	.	ENSG00000088836	ENST00000380059	T	0.80909	-1.43	3.5	-1.98	0.07480	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.58432	P	1.0000000000287557E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.38001	-0.9681	8	0.11182	T	0.66	.	4.6723	0.12694	0.1395:0.2058:0.5427:0.112	rs3810562	26	B4DKC8	.	R	26	ENSP00000369399:P26R	ENSP00000369399:P26R	P	-	2	0	SLC4A11	3166634	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	-0.858000	0.04281	-0.398000	0.07679	-1.307000	0.01316	CCG	SLC4A11	-	NULL	ENSG00000088836		0.637	SLC4A11-002	KNOWN	basic|CCDS	protein_coding	SLC4A11	HGNC	protein_coding	OTTHUMT00000077728.1	47	0.00	0	G			3218634	3218634	-1	no_errors	ENST00000380059	ensembl	human	known	69_37n	missense	48	14.04	8	SNP	0.000	C
SNHG14	104472715	genome.wustl.edu	37	15	25417703	25417703	+	RNA	SNP	C	C	T			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr15:25417703C>T	ENST00000441592.2	+	0	0				SNORD115-1_ENST00000364961.1_RNA|SNORD115-3_ENST00000363100.1_RNA|SNORD115-2_ENST00000362842.1_RNA|SNHG14_ENST00000553149.1_RNA					small nucleolar RNA host gene 14 (non-protein coding)																		CCCTGGCACTCTGGTCTCCTG	0.622																																						dbGAP											0																																										-	-	-			0					15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25417703C>T				RNA	SNP	-	NULL	ENST00000441592.2	37	NULL		15																																																																																			SNHG14	-	-	ENSG00000224078		0.622	SNHG14-009	KNOWN	basic	antisense	SNHG14	HGNC	processed_transcript	OTTHUMT00000126736.3	21	0.00	0	C			25417703	25417703	+1	no_errors	ENST00000549301	ensembl	human	known	69_37n	rna	20	35.48	11	SNP	0.000	T
SPOCK1	6695	genome.wustl.edu	37	5	136315033	136315033	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr5:136315033C>T	ENST00000394945.1	-	10	1286	c.1117G>A	c.(1117-1119)Gct>Act	p.A373T	SPOCK1_ENST00000282223.7_Missense_Mutation_p.A373T|SPOCK1_ENST00000509978.1_5'UTR	NM_004598.3	NP_004589.1	Q08629	TICN1_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1	373	Thyroglobulin type-1. {ECO:0000255|PROSITE-ProRule:PRU00500}.				cell adhesion (GO:0007155)|central nervous system neuron differentiation (GO:0021953)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron projection development (GO:0010977)|nervous system development (GO:0007399)|neurogenesis (GO:0022008)|neuron migration (GO:0001764)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|postsynaptic density (GO:0014069)|proteinaceous extracellular matrix (GO:0005578)|sarcoplasm (GO:0016528)	calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CAGCTCACAGCACCCTGTTTC	0.557																																						dbGAP											0													173.0	159.0	164.0					5																	136315033		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF231124	CCDS4191.1	5q31.2	2008-02-05	2005-11-04	2005-11-04	ENSG00000152377	ENSG00000152377			11251	protein-coding gene	gene with protein product		602264	"""sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican)"""	TIC1, SPOCK		9545645	Standard	NM_004598		Approved	testican-1	uc003lbp.3	Q08629	OTTHUMG00000129157	ENST00000394945.1:c.1117G>A	5.37:g.136315033C>T	ENSP00000378401:p.Ala373Thr		B3KSW3|Q59EW0|Q8N630|Q9UCL8	Missense_Mutation	SNP	pfam_SPARC/Testican_Ca-bd-dom,pfam_Thyroglobulin_1,pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,superfamily_Thyroglobulin_1,smart_Prot_inh_Kazal,smart_Thyroglobulin_1,pfscan_Thyroglobulin_1	p.A373T	ENST00000394945.1	37	c.1117	CCDS4191.1	5	.	.	.	.	.	.	.	.	.	.	C	8.408	0.843458	0.16963	.	.	ENSG00000152377	ENST00000394945;ENST00000282223	T;T	0.63096	-0.02;-0.02	5.25	2.1	0.27182	Thyroglobulin type-1 (5);	0.409404	0.27881	N	0.017462	T	0.33059	0.0850	N	0.11023	0.085	0.09310	N	1	B	0.02656	0.0	B	0.10450	0.005	T	0.15065	-1.0450	10	0.11485	T	0.65	.	3.9877	0.09524	0.1592:0.4076:0.0:0.4332	.	373	Q08629	TICN1_HUMAN	T	373	ENSP00000378401:A373T;ENSP00000282223:A373T	ENSP00000282223:A373T	A	-	1	0	SPOCK1	136342932	0.270000	0.24152	0.216000	0.23742	0.994000	0.84299	0.731000	0.26058	0.065000	0.16485	0.650000	0.86243	GCT	SPOCK1	-	pfam_Thyroglobulin_1,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pfscan_Thyroglobulin_1	ENSG00000152377		0.557	SPOCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPOCK1	HGNC	protein_coding	OTTHUMT00000251222.1	30	0.00	0	C	NM_004598		136315033	136315033	-1	no_errors	ENST00000282223	ensembl	human	known	69_37n	missense	22	15.38	4	SNP	0.062	T
SRCAP	10847	genome.wustl.edu	37	16	30727792	30727792	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr16:30727792C>T	ENST00000262518.4	+	18	3194	c.2809C>T	c.(2809-2811)Ccc>Tcc	p.P937S	SRCAP_ENST00000395059.2_Missense_Mutation_p.P937S|SRCAP_ENST00000344771.4_Missense_Mutation_p.P937S	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	937					histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			GGATGTCCATCCCCTCCAGGT	0.498																																						dbGAP											0													201.0	204.0	203.0					16																	30727792		2197	4300	6497	-	-	-	SO:0001583	missense	0			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.2809C>T	16.37:g.30727792C>T	ENSP00000262518:p.Pro937Ser		B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	pfam_SNF2_N,pfam_HSA,pfam_Helicase_C,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,smart_AT_hook_DNA-bd_motif,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_AT_hook-like	p.P937S	ENST00000262518.4	37	c.2809	CCDS10689.2	16	.	.	.	.	.	.	.	.	.	.	C	18.58	3.655297	0.67472	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	D;D;D	0.92397	-3.03;-2.91;-2.88	5.36	5.36	0.76844	.	0.000000	0.53938	D	0.000042	D	0.94945	0.8365	L	0.56280	1.765	0.80722	D	1	D;D;D	0.89917	0.978;1.0;1.0	D;D;D	0.91635	0.945;0.999;0.997	D	0.94226	0.7472	10	0.46703	T	0.11	-13.2916	18.0761	0.89427	0.0:1.0:0.0:0.0	.	937;937;937	Q6ZRS2-3;Q6ZRS2-2;Q6ZRS2	.;.;SRCAP_HUMAN	S	937	ENSP00000262518:P937S;ENSP00000378499:P937S;ENSP00000343042:P937S	ENSP00000262518:P937S	P	+	1	0	SRCAP	30635293	0.998000	0.40836	0.997000	0.53966	0.997000	0.91878	4.459000	0.60102	2.809000	0.96659	0.555000	0.69702	CCC	SRCAP	-	NULL	ENSG00000080603		0.498	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRCAP	HGNC	protein_coding	OTTHUMT00000255523.1	35	0.00	0	C	NM_006662		30727792	30727792	+1	no_errors	ENST00000262518	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	1.000	T
SRSF11	9295	genome.wustl.edu	37	1	70694186	70694186	+	Silent	SNP	G	G	A			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr1:70694186G>A	ENST00000370950.3	+	3	367	c.285G>A	c.(283-285)ctG>ctA	p.L95L	SRSF11_ENST00000405432.1_Silent_p.L95L|SRSF11_ENST00000436161.2_Silent_p.L95L|SRSF11_ENST00000370951.1_Silent_p.L95L|SRSF11_ENST00000454435.2_Silent_p.L95L			Q05519	SRS11_HUMAN	serine/arginine-rich splicing factor 11	95	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			large_intestine(3)|ovary(2)|skin(1)	6						CACAGCATCTGACAAACACTG	0.413																																						dbGAP											0													259.0	219.0	233.0					1																	70694186		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M74002	CCDS647.1, CCDS53332.1	1p31.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000116754	ENSG00000116754		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10782	protein-coding gene	gene with protein product	"""SR splicing factor 11"""	602010	"""splicing factor, arginine/serine-rich 11"""	SFRS11		1896467, 20516191	Standard	NM_004768		Approved	p54, NET2	uc001des.3	Q05519	OTTHUMG00000009342	ENST00000370950.3:c.285G>A	1.37:g.70694186G>A			Q5T758|Q8IWE6	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.L95	ENST00000370950.3	37	c.285	CCDS647.1	1																																																																																			SRSF11	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000116754		0.413	SRSF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SRSF11	HGNC	protein_coding	OTTHUMT00000025889.1	64	0.00	0	G	NM_004768		70694186	70694186	+1	no_errors	ENST00000370950	ensembl	human	known	69_37n	silent	38	38.10	24	SNP	1.000	A
STAT1	6772	genome.wustl.edu	37	2	191863009	191863009	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr2:191863009C>G	ENST00000361099.3	-	8	954	c.567G>C	c.(565-567)aaG>aaC	p.K189N	STAT1_ENST00000409465.1_Missense_Mutation_p.K189N|STAT1_ENST00000540176.1_Intron|STAT1_ENST00000392323.2_Missense_Mutation_p.K191N|STAT1_ENST00000392322.3_Missense_Mutation_p.K189N	NM_007315.3	NP_009330.1	P42224	STAT1_HUMAN	signal transducer and activator of transcription 1, 91kDa	189					apoptotic process (GO:0006915)|blood circulation (GO:0008015)|cellular response to insulin stimulus (GO:0032869)|cellular response to interferon-beta (GO:0035458)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of macrophage fusion (GO:0034240)|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003340)|negative regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|renal tubule development (GO:0061326)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to exogenous dsRNA (GO:0043330)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|tumor necrosis factor receptor binding (GO:0005164)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			OV - Ovarian serous cystadenocarcinoma(117;0.00434)|Epithelial(96;0.0555)|all cancers(119;0.141)			TCTGATCACTCTTTGCCACAC	0.338																																						dbGAP											0													169.0	162.0	164.0					2																	191863009		2202	4299	6501	-	-	-	SO:0001583	missense	0				CCDS2309.1, CCDS42793.1	2q32.2-q32.3	2014-09-17	2002-08-29		ENSG00000115415	ENSG00000115415		"""SH2 domain containing"""	11362	protein-coding gene	gene with protein product	"""transcription factor ISGF-3 components p91/p84"""	600555	"""signal transducer and activator of transcription 1, 91kD"""			7885841	Standard	NM_139266		Approved	STAT91, ISGF-3	uc002usj.2	P42224	OTTHUMG00000132699	ENST00000361099.3:c.567G>C	2.37:g.191863009C>G	ENSP00000354394:p.Lys189Asn		A8K989|B2RCA0|D2KFR8|D3DPI7|Q53S88|Q53XW4|Q68D00|Q9UDL5	Missense_Mutation	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_STAT1_TAZ2-bd_C,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,pfscan_SH2	p.K189N	ENST00000361099.3	37	c.567	CCDS2309.1	2	.	.	.	.	.	.	.	.	.	.	C	1.397	-0.579080	0.03854	.	.	ENSG00000115415	ENST00000361099;ENST00000409465;ENST00000392322;ENST00000392323;ENST00000544783	T;T;T;T	0.59906	0.23;0.23;0.23;0.23	4.59	3.7	0.42460	STAT transcription factor, all-alpha (2);STAT transcription factor, coiled coil (1);	0.869844	0.10493	N	0.668232	T	0.45875	0.1364	L	0.34521	1.04	0.21527	N	0.999658	B;B	0.23249	0.082;0.002	B;B	0.23574	0.047;0.014	T	0.21518	-1.0243	10	0.35671	T	0.21	-32.8223	9.3925	0.38381	0.0:0.7847:0.0:0.2153	.	189;189	P42224-2;P42224	.;STAT1_HUMAN	N	189;189;189;191;97	ENSP00000354394:K189N;ENSP00000386244:K189N;ENSP00000376136:K189N;ENSP00000376137:K191N	ENSP00000354394:K189N	K	-	3	2	STAT1	191571254	0.972000	0.33761	0.860000	0.33809	0.027000	0.11550	0.571000	0.23669	2.536000	0.85505	0.655000	0.94253	AAG	STAT1	-	pfam_STAT_TF_alpha,superfamily_STAT_TF_coiled-coil	ENSG00000115415		0.338	STAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAT1	HGNC	protein_coding	OTTHUMT00000255997.3	37	0.00	0	C	NM_007315		191863009	191863009	-1	no_errors	ENST00000361099	ensembl	human	known	69_37n	missense	22	47.62	20	SNP	0.253	G
SULT1A1	6817	genome.wustl.edu	37	16	28617552	28617552	+	Silent	SNP	C	C	G	rs3176926	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr16:28617552C>G	ENST00000395607.1	-	7	873	c.600G>C	c.(598-600)ccG>ccC	p.P200P	SULT1A1_ENST00000314752.7_Silent_p.P200P|SULT1A1_ENST00000395609.1_Silent_p.P200P|SULT1A1_ENST00000569554.1_Silent_p.P200P|SULT1A1_ENST00000350842.4_Silent_p.P122P	NM_177530.2|NM_177534.2	NP_803566.1|NP_803878.1	P50225	ST1A1_HUMAN	sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1	200					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|amine metabolic process (GO:0009308)|catecholamine metabolic process (GO:0006584)|estrogen metabolic process (GO:0008210)|flavonoid metabolic process (GO:0009812)|small molecule metabolic process (GO:0044281)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	aryl sulfotransferase activity (GO:0004062)|flavonol 3-sulfotransferase activity (GO:0047894)|steroid sulfotransferase activity (GO:0050294)|sulfotransferase activity (GO:0008146)			endometrium(2)|kidney(7)|large_intestine(2)|lung(2)|ovary(1)|stomach(2)	16					Acetaminophen(DB00316)|Tamoxifen(DB00675)	TCTCCCTTTTCGGGTTCTGAG	0.547																																						dbGAP											0													82.0	61.0	68.0					16																	28617552		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			U52852	CCDS10637.1, CCDS32420.1	16p12.1	2008-02-05			ENSG00000196502	ENSG00000196502	2.8.2.1	"""Sulfotransferases, cytosolic"""	11453	protein-coding gene	gene with protein product		171150		STP, STP1		8288252, 8912648	Standard	NM_177534		Approved	P-PST	uc002dqj.3	P50225	OTTHUMG00000131765	ENST00000395607.1:c.600G>C	16.37:g.28617552C>G			Q2NL71|Q86U58|Q92818|Q9BVU6|Q9UGG7	Silent	SNP	pfam_Sulfotransferase_dom	p.P200	ENST00000395607.1	37	c.600	CCDS32420.1	16																																																																																			SULT1A1	-	pfam_Sulfotransferase_dom	ENSG00000196502		0.547	SULT1A1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SULT1A1	HGNC	protein_coding	OTTHUMT00000254694.2	35	0.00	0	C	NM_001055		28617552	28617552	-1	no_errors	ENST00000314752	ensembl	human	known	69_37n	silent	31	16.22	6	SNP	0.986	G
SYN2	6854	genome.wustl.edu	37	3	12224979	12224979	+	RNA	SNP	G	G	T			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr3:12224979G>T	ENST00000432424.2	+	0	1648							Q92777	SYN2_HUMAN	synapsin II						neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)			breast(5)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	18						GAAATTTTAAGCCAAAAACAA	0.423																																						dbGAP											0													31.0	32.0	31.0					3																	12224979		1841	4076	5917	-	-	-			0				CCDS74900.1, CCDS74901.1	3p25.2	2013-09-20			ENSG00000157152	ENSG00000157152			11495	protein-coding gene	gene with protein product		600755				8530057	Standard	XM_006713311		Approved	SYNII, SYNIIa, SYNIIb	uc003bwm.3	Q92777	OTTHUMG00000155335		3.37:g.12224979G>T			A8MY98	RNA	SNP	-	NULL	ENST00000432424.2	37	NULL		3																																																																																			SYN2	-	-	ENSG00000157152		0.423	SYN2-002	KNOWN	basic	processed_transcript	SYN2	HGNC	processed_transcript	OTTHUMT00000339528.3	34	0.00	0	G	NM_133625		12224979	12224979	+1	no_errors	ENST00000425297	ensembl	human	known	69_37n	rna	45	29.69	19	SNP	1.000	T
TAF4B	6875	genome.wustl.edu	37	18	23901109	23901109	+	Missense_Mutation	SNP	G	G	A	rs200477306		TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr18:23901109G>A	ENST00000269142.5	+	11	3076	c.2078G>A	c.(2077-2079)cGa>cAa	p.R693Q	TAF4B_ENST00000578121.1_Missense_Mutation_p.R698Q	NM_005640.1	NP_005631.1	Q92750	TAF4B_HUMAN	TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa	693	Histone-fold.				gene expression (GO:0010467)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|NF-kappaB binding (GO:0051059)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(13)|prostate(1)|skin(1)	29	all_cancers(21;0.00151)|Lung NSC(5;0.000401)|all_lung(6;0.00115)|Ovarian(20;0.124)		Epithelial(2;9.57e-07)|all cancers(3;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(3;1.96e-05)|LUSC - Lung squamous cell carcinoma(2;0.00594)|Lung(2;0.0267)			GAACGACTACGAGGCCTTCTA	0.393																																						dbGAP											0													88.0	80.0	82.0					18																	23901109		1886	4117	6003	-	-	-	SO:0001583	missense	0			Y09321	CCDS42421.1	18q11.1	2008-08-01	2002-08-29	2001-12-07		ENSG00000141384			11538	protein-coding gene	gene with protein product	"""TATA box binding protein (TBP)-associated factor 4B"""	601689	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, C2, 105kD"""	TAF2C2		8858156, 10849440	Standard	XM_005258339		Approved	TAFII105	uc002kvu.4	Q92750		ENST00000269142.5:c.2078G>A	18.37:g.23901109G>A	ENSP00000269142:p.Arg693Gln		Q29YA4|Q29YA5	Missense_Mutation	SNP	pfam_TAF4,pfam_TAFH_NHR1,superfamily_Histone-fold,smart_TAFH_NHR1,pfscan_TAFH_NHR1	p.R693Q	ENST00000269142.5	37	c.2078	CCDS42421.1	18	.	.	.	.	.	.	.	.	.	.	G	12.76	2.033544	0.35893	.	.	ENSG00000141384	ENST00000418698;ENST00000269142	T	0.35973	1.28	4.68	3.8	0.43715	Histone-fold (2);Transcription initiation factor TFIID component TAF4 (1);	0.147917	0.46442	D	0.000282	T	0.36991	0.0987	N	0.21373	0.66	0.80722	D	1	D;D	0.63880	0.993;0.992	P;P	0.57911	0.829;0.656	T	0.05818	-1.0862	10	0.20046	T	0.44	-7.8714	13.1177	0.59309	0.0781:0.0:0.9219:0.0	.	693;698	Q92750;A4PBF7	TAF4B_HUMAN;.	Q	696;693	ENSP00000269142:R693Q	ENSP00000269142:R693Q	R	+	2	0	TAF4B	22155107	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	4.163000	0.58183	1.336000	0.45506	0.591000	0.81541	CGA	TAF4B	-	pfam_TAF4,superfamily_Histone-fold	ENSG00000141384		0.393	TAF4B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TAF4B	HGNC	protein_coding	OTTHUMT00000446260.3	11	0.00	0	G	NM_005640		23901109	23901109	+1	no_errors	ENST00000269142	ensembl	human	known	69_37n	missense	17	26.09	6	SNP	1.000	A
TBC1D3P2	440452	genome.wustl.edu	37	17	60351416	60351416	+	3'UTR	SNP	T	T	A			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr17:60351416T>A	ENST00000602932.1	-	0	275				TBC1D3P2_ENST00000581291.1_RNA																							TTTTCGTATTTCATAATGATG	0.537																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0																														ENST00000602932.1:c.*35A>T	17.37:g.60351416T>A				RNA	SNP	-	NULL	ENST00000602932.1	37	NULL		17	.	.	.	.	.	.	.	.	.	.	.	2.772	-0.255431	0.05829	.	.	ENSG00000188755	ENST00000339120	.	.	.	.	.	.	.	0.320210	0.31358	U	0.007790	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	.	.	.	.	.	.	.	X	21	.	ENSP00000339793:K21X	K	-	1	0	AC053481.1	57706198	0.707000	0.27866	0.112000	0.21494	0.113000	0.19764	0.927000	0.28818	0.056000	0.16144	0.055000	0.15244	AAA	TBC1D3P2	-	-	ENSG00000188755		0.537	RP11-51L5.7-001	KNOWN	basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	TBC1D3P2	HGNC	protein_coding	OTTHUMT00000467667.1	133	0.00	0	T			60351416	60351416	-1	no_errors	ENST00000339120	ensembl	human	known	69_37n	rna	87	33.83	45	SNP	0.114	A
TBC1D9B	23061	genome.wustl.edu	37	5	179290741	179290741	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr5:179290741T>C	ENST00000356834.3	-	22	3497	c.3460A>G	c.(3460-3462)Atg>Gtg	p.M1154V	TBC1D9B_ENST00000355235.3_Missense_Mutation_p.M1137V|TBC1D9B_ENST00000519746.1_Missense_Mutation_p.M313V|TBC1D9B_ENST00000444477.2_Missense_Mutation_p.M295V|TBC1D9B_ENST00000518085.1_5'UTR	NM_198868.2	NP_942568.2	Q66K14	TBC9B_HUMAN	TBC1 domain family, member 9B (with GRAM domain)	1154						integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	28	all_cancers(89;0.000197)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0236)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TAGGAGGACATGGACATGTCG	0.657																																						dbGAP											0													84.0	81.0	82.0					5																	179290741		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014576	CCDS4450.1, CCDS43408.1	5q35.3	2013-01-10			ENSG00000197226	ENSG00000197226		"""EF-hand domain containing"""	29097	protein-coding gene	gene with protein product						9734811	Standard	NM_198868		Approved	KIAA0676	uc003mlh.3	Q66K14	OTTHUMG00000130911	ENST00000356834.3:c.3460A>G	5.37:g.179290741T>C	ENSP00000349291:p.Met1154Val		D3DWQ5|D3DWQ6|O75163|Q53EY0|Q6MZI2|Q96H49	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_GRAM,superfamily_Rab-GTPase-TBC_dom,smart_GRAM,smart_Rab-GTPase-TBC_dom,pfscan_EF_HAND_2,pfscan_Rab-GTPase-TBC_dom	p.M1154V	ENST00000356834.3	37	c.3460	CCDS43408.1	5	.	.	.	.	.	.	.	.	.	.	T	10.76	1.440031	0.25900	.	.	ENSG00000197226	ENST00000356834;ENST00000355235;ENST00000519746;ENST00000444477;ENST00000544438	T;T;T;T	0.46451	0.87;0.87;0.87;0.87	5.25	1.57	0.23409	.	0.258350	0.38436	N	0.001689	T	0.27349	0.0671	L	0.29908	0.895	0.39621	D	0.970024	B;B;B;B;B	0.10296	0.0;0.0;0.0;0.0;0.003	B;B;B;B;B	0.08055	0.001;0.002;0.001;0.002;0.003	T	0.06023	-1.0850	10	0.38643	T	0.18	-16.987	8.2364	0.31629	0.0:0.2961:0.0:0.7039	.	1136;1137;1154;353;228	A1L3A9;Q66K14-2;Q66K14;B3KM54;F5H5B8	.;.;TBC9B_HUMAN;.;.	V	1154;1137;313;295;228	ENSP00000349291:M1154V;ENSP00000347375:M1137V;ENSP00000430293:M313V;ENSP00000401585:M295V	ENSP00000347375:M1137V	M	-	1	0	TBC1D9B	179223347	1.000000	0.71417	0.999000	0.59377	0.889000	0.51656	1.575000	0.36493	0.029000	0.15352	0.459000	0.35465	ATG	TBC1D9B	-	NULL	ENSG00000197226		0.657	TBC1D9B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBC1D9B	HGNC	protein_coding	OTTHUMT00000253501.3	22	0.00	0	T	NM_015043		179290741	179290741	-1	no_errors	ENST00000356834	ensembl	human	known	69_37n	missense	16	36.00	9	SNP	1.000	C
TFAP2A	7020	genome.wustl.edu	37	6	10415192	10415192	+	Silent	SNP	G	G	A			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr6:10415192G>A	ENST00000482890.1	-	2	379	c.27C>T	c.(25-27)atC>atT	p.I9I	TFAP2A_ENST00000379604.2_Silent_p.I9I|TFAP2A-AS1_ENST00000443546.1_RNA|TFAP2A_ENST00000379613.3_Silent_p.I11I|TFAP2A_ENST00000319516.4_Intron|TFAP2A_ENST00000379608.3_5'Flank|TFAP2A-AS1_ENST00000420777.1_RNA			P05549	AP2A_HUMAN	transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)	9					anterior neuropore closure (GO:0021506)|basement membrane organization (GO:0071711)|bone morphogenesis (GO:0060349)|cellular response to iron ion (GO:0071281)|cornea development in camera-type eye (GO:0061303)|embryonic body morphogenesis (GO:0010172)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|embryonic pattern specification (GO:0009880)|epidermis morphogenesis (GO:0048730)|eyelid development in camera-type eye (GO:0061029)|face morphogenesis (GO:0060325)|forebrain neuron development (GO:0021884)|inner ear morphogenesis (GO:0042472)|keratinocyte development (GO:0003334)|kidney development (GO:0001822)|lens induction in camera-type eye (GO:0060235)|metanephric nephron development (GO:0072210)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell development (GO:0014032)|oculomotor nerve formation (GO:0021623)|optic cup structural organization (GO:0003409)|optic vesicle morphogenesis (GO:0003404)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of tooth mineralization (GO:0070172)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell differentiation (GO:0045595)|regulation of neuron differentiation (GO:0045664)|retina layer formation (GO:0010842)|sensory perception of sound (GO:0007605)|sympathetic nervous system development (GO:0048485)|transcription from RNA polymerase II promoter (GO:0006366)|trigeminal nerve development (GO:0021559)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	13	Breast(50;0.0427)|Ovarian(93;0.0991)	all_hematologic(90;0.107)				CCTCGTACTTGATATTATCCG	0.577											OREG0017182	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													148.0	119.0	129.0					6																	10415192		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X52611	CCDS4510.1, CCDS34337.1, CCDS43422.1	6p24.3	2013-09-19	2001-11-28		ENSG00000137203	ENSG00000137203			11742	protein-coding gene	gene with protein product		107580	"""transcription factor AP-2 alpha (activating enhancer-binding protein 2 alpha)"""	TFAP2, AP2TF		1916817, 3063603	Standard	NM_001032280		Approved	AP-2	uc003myr.3	P05549	OTTHUMG00000014235	ENST00000482890.1:c.27C>T	6.37:g.10415192G>A		664	Q13777|Q5TAV5|Q8N1C6	Silent	SNP	pfam_TF_AP2_C,prints_TF_AP2_C,prints_TF_AP2_alpha_N	p.I9	ENST00000482890.1	37	c.27	CCDS4510.1	6																																																																																			TFAP2A	-	NULL	ENSG00000137203		0.577	TFAP2A-007	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	TFAP2A	HGNC	protein_coding	OTTHUMT00000353619.2	27	0.00	0	G	NM_003220		10415192	10415192	-1	no_errors	ENST00000379604	ensembl	human	known	69_37n	silent	16	30.43	7	SNP	1.000	A
TCP10L2	401285	genome.wustl.edu	37	6	167591956	167591956	+	Nonsense_Mutation	SNP	C	C	T	rs2297462	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr6:167591956C>T	ENST00000366832.2	+	5	714	c.583C>T	c.(583-585)Caa>Taa	p.Q195*		NM_001145121.1	NP_001138593.1	B9ZVM9	TCP2L_HUMAN	t-complex 10-like 2	195										endometrium(1)|kidney(2)|lung(3)	6						CGGGAGACGTCAAGACAGAAG	0.507																																						dbGAP											0													36.0	52.0	47.0					6																	167591956		686	1565	2251	-	-	-	SO:0001587	stop_gained	0				CCDS47514.1	6q27	2012-09-20	2012-09-20		ENSG00000166984	ENSG00000166984			21254	protein-coding gene	gene with protein product			"""t-complex 10-like 2 (mouse)"""				Standard	NM_001145121		Approved	bA517H2.3	uc010kkp.3	B9ZVM9	OTTHUMG00000016014	ENST00000366832.2:c.583C>T	6.37:g.167591956C>T	ENSP00000355797:p.Gln195*			Nonsense_Mutation	SNP	NULL	p.Q195*	ENST00000366832.2	37	c.583	CCDS47514.1	6	.	.	.	.	.	.	.	.	.	.	c	14.81	2.646554	0.47258	.	.	ENSG00000166984	ENST00000366832	.	.	.	2.27	2.27	0.28462	.	.	.	.	.	.	.	.	.	.	.	0.09310	P	0.99999891782	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	.	8.058	0.30617	0.0:1.0:0.0:0.0	.	.	.	.	X	195	.	ENSP00000283507:Q195X	Q	+	1	0	TCP10L2	167511946	0.001000	0.12720	0.008000	0.14137	0.023000	0.10783	1.093000	0.30939	1.277000	0.44412	0.162000	0.16502	CAA	TCP10L2	-	NULL	ENSG00000166984		0.507	TCP10L2-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	TCP10L2	HGNC	protein_coding	OTTHUMT00000043112.5	72	0.00	0	C	XR_040749		167591956	167591956	+1	no_errors	ENST00000283507	ensembl	human	known	69_37n	nonsense	37	15.91	7	SNP	0.005	T
TLN2	83660	genome.wustl.edu	37	15	63032864	63032864	+	Silent	SNP	C	C	G			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr15:63032864C>G	ENST00000561311.1	+	31	4151	c.3921C>G	c.(3919-3921)ctC>ctG	p.L1307L	TLN2_ENST00000306829.6_Silent_p.L1307L			Q9Y4G6	TLN2_HUMAN	talin 2	1307					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						TAGGGAACCTCAAGAATATCT	0.498																																						dbGAP											0													96.0	89.0	91.0					15																	63032864		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.3921C>G	15.37:g.63032864C>G			A6NLB8	Silent	SNP	pfam_Talin_cent,pfam_ILWEQ,pfam_Vinculin-bd_dom,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ,pfscan_FERM_domain,pfscan_ILWEQ	p.L1307	ENST00000561311.1	37	c.3921	CCDS32261.1	15																																																																																			TLN2	-	superfamily_Vinculin/catenin	ENSG00000171914		0.498	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN2	HGNC	protein_coding	OTTHUMT00000257878.2	47	0.00	0	C			63032864	63032864	+1	no_errors	ENST00000306829	ensembl	human	known	69_37n	silent	39	36.07	22	SNP	1.000	G
TMEM216	51259	genome.wustl.edu	37	11	61165731	61165732	+	Intron	INS	-	-	A	rs33963896|rs11382548	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr11:61165731_61165732insA	ENST00000515837.2	+	5	1376				TMEM216_ENST00000334888.5_Splice_Site|TMEM216_ENST00000398979.3_Intron			Q9P0N5	TM216_HUMAN	transmembrane protein 216						cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)				endometrium(1)|large_intestine(2)|lung(1)|prostate(2)	6						TTTCTGCCATCGTATGGACAGG	0.47													A|-|A|deletion	4286	0.855831	0.7436	0.879	5008	,	,		22226	0.9762		0.8688	False		,,,				2504	0.8538					dbGAP											0									,,	2866,898		1118,630,134					,,	3.6	1.0		dbSNP_126	83	6842,1124		2944,954,85	no	frameshift-near-splice,frameshift-near-splice,intron	TMEM216	NM_016499.5,NM_001173991.2,NM_001173990.2	,,	4062,1584,219	A1A1,A1R,RR		14.11,23.8576,17.2379	,,	,,		9708,2022				-	-	-	SO:0001627	intron_variant	0				CCDS53640.1	11q13.1	2014-09-17			ENSG00000187049	ENSG00000187049			25018	protein-coding gene	gene with protein product		613277	"""cerebello-oculo-renal syndrome 2"", ""Meckel syndrome, type 2"""	CORS2, MKS2		11042152, 20036350, 20512146	Standard	NM_016499		Approved	MGC13379, HSPC244, JBTS2	uc021qkf.1	Q9P0N5		ENST00000515837.2:c.432-10->A	11.37:g.61165731_61165732insA			A8MZ23|B7Z8N1	Splice_Site	INS	-	e5-1	ENST00000515837.2	37	c.432-2_432-1	CCDS53640.1	11																																																																																			TMEM216	-	-	ENSG00000187049		0.470	TMEM216-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TMEM216	HGNC	protein_coding	OTTHUMT00000398430.1	10	0	0	0	NM_016499		61165731	61165732	+1	no_errors	ENST00000334888	ensembl	human	known	69_37n	splice_site_ins	1	93.75	15	INS	0.960:1.000	A
TMEM232	642987	genome.wustl.edu	37	5	109961091	109961091	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr5:109961091G>C	ENST00000455884.2	-	7	695	c.645C>G	c.(643-645)atC>atG	p.I215M	TMEM232_ENST00000515518.2_5'UTR|TMEM232_ENST00000429839.2_Missense_Mutation_p.I215M			C9JQI7	TM232_HUMAN	transmembrane protein 232	215						integral component of membrane (GO:0016021)				breast(1)|kidney(2)	3						CATTTGAAAAGATGTTTGGAT	0.323																																						dbGAP											0													102.0	85.0	90.0					5																	109961091		692	1590	2282	-	-	-	SO:0001583	missense	0			AK125070	CCDS47253.1, CCDS47253.2	5q22.1	2014-02-12	2009-10-02		ENSG00000186952	ENSG00000186952			37270	protein-coding gene	gene with protein product							Standard	NM_001039763		Approved	FLJ43080	uc011cvh.2	C9JQI7	OTTHUMG00000163297	ENST00000455884.2:c.645C>G	5.37:g.109961091G>C	ENSP00000401477:p.Ile215Met		B4DKF4	Missense_Mutation	SNP	NULL	p.I215M	ENST00000455884.2	37	c.645	CCDS47253.2	5	.	.	.	.	.	.	.	.	.	.	G	15.29	2.790948	0.50102	.	.	ENSG00000186952	ENST00000429839;ENST00000455884;ENST00000511883	.	.	.	5.52	3.7	0.42460	.	0.216330	0.37219	N	0.002195	T	0.53578	0.1805	L	0.50333	1.59	0.25797	N	0.98455	D;D;D	0.89917	0.989;1.0;0.971	P;D;P	0.76071	0.885;0.987;0.718	T	0.41822	-0.9487	8	.	.	.	-7.2175	8.931	0.35670	0.076:0.0:0.7764:0.1476	.	215;215;97	C9JQI7;C9JQI7-2;E9PFK0	TM232_HUMAN;.;.	M	215	.	.	I	-	3	3	TMEM232	109988990	1.000000	0.71417	0.998000	0.56505	0.950000	0.60333	2.123000	0.41996	0.783000	0.33636	0.591000	0.81541	ATC	TMEM232	-	NULL	ENSG00000186952		0.323	TMEM232-001	NOVEL	basic|appris_principal|CCDS	protein_coding	TMEM232	HGNC	protein_coding	OTTHUMT00000372488.2	28	0.00	0	G	NM_001039763		109961091	109961091	-1	no_errors	ENST00000429839	ensembl	human	known	69_37n	missense	25	37.50	15	SNP	1.000	C
TYK2	7297	genome.wustl.edu	37	19	10467350	10467350	+	Silent	SNP	G	G	A			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr19:10467350G>A	ENST00000525621.1	-	18	2992	c.2511C>T	c.(2509-2511)tcC>tcT	p.S837S	TYK2_ENST00000264818.6_Silent_p.S837S|TYK2_ENST00000524462.1_Silent_p.S652S	NM_003331.4	NP_003322.3	P29597	TYK2_HUMAN	tyrosine kinase 2	837	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine-mediated signaling pathway (GO:0019221)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(11)|kidney(6)|large_intestine(3)|lung(19)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			GCTGTGGGCAGGAGGGCTCGG	0.632																																						dbGAP											0													82.0	58.0	66.0					19																	10467350		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0				CCDS12236.1	19p13.2	2014-09-17			ENSG00000105397	ENSG00000105397	2.7.10.1		12440	protein-coding gene	gene with protein product		176941				2156206	Standard	NM_003331		Approved	JTK1	uc002moc.4	P29597	OTTHUMG00000166373	ENST00000525621.1:c.2511C>T	19.37:g.10467350G>A			Q6QB10|Q96CH0	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_FERM_central,smart_Band_41_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_FERM_domain,pfscan_Prot_kinase_cat_dom,prints_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_Tyr_kinase_non-rcpt_TYK2_N	p.S837	ENST00000525621.1	37	c.2511	CCDS12236.1	19																																																																																			TYK2	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_Prot_kinase_cat_dom	ENSG00000105397		0.632	TYK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYK2	HGNC	protein_coding	OTTHUMT00000389443.1	85	0.00	0	G			10467350	10467350	-1	no_errors	ENST00000264818	ensembl	human	known	69_37n	silent	59	30.59	26	SNP	0.019	A
UNC5A	90249	genome.wustl.edu	37	5	176295946	176295946	+	Silent	SNP	C	C	T	rs200656095		TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr5:176295946C>T	ENST00000329542.4	+	5	976	c.702C>T	c.(700-702)tcC>tcT	p.S234S	UNC5A_ENST00000261961.3_Silent_p.S194S	NM_133369.2	NP_588610.2	Q6ZN44	UNC5A_HUMAN	unc-5 homolog A (C. elegans)	234	Ig-like C2-type.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(4)|kidney(3)|large_intestine(2)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	34	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCAGCGCCTCCGCTGCTGTCA	0.682													C|||	1	0.000199681	0.0	0.0	5008	,	,		20122	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													49.0	41.0	44.0					5																	176295946		2201	4295	6496	-	-	-	SO:0001819	synonymous_variant	0			AB075856	CCDS34299.1	5q35.3	2013-01-11	2001-11-28		ENSG00000113763	ENSG00000113763		"""Immunoglobulin superfamily / I-set domain containing"""	12567	protein-coding gene	gene with protein product		607869	"""unc5 (C.elegans homolog) a"""				Standard	XM_006714927		Approved	KIAA1976, UNC5H1	uc003mey.3	Q6ZN44	OTTHUMG00000163225	ENST00000329542.4:c.702C>T	5.37:g.176295946C>T			B2RXE6|Q8TF26|Q96GP4	Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,pfam_Ig_I-set,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like	p.R200C	ENST00000329542.4	37	c.598	CCDS34299.1	5	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	5.363	0.252264	0.10185	.	.	ENSG00000113763	ENST00000509580	.	.	.	4.52	-9.05	0.00730	.	.	.	.	.	T	0.32704	0.0838	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41270	-0.9518	4	.	.	.	-22.8871	1.1438	0.01771	0.2548:0.3271:0.1623:0.2558	.	.	.	.	C	200	.	.	R	+	1	0	UNC5A	176228552	0.000000	0.05858	0.011000	0.14972	0.611000	0.37282	-13.392000	0.00001	-2.992000	0.00279	-1.421000	0.01109	CGC	UNC5A	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000113763		0.682	UNC5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC5A	HGNC	protein_coding	OTTHUMT00000372166.1	45	0.00	0	C	XM_030300		176295946	176295946	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000509580	ensembl	human	novel	69_37n	missense	19	34.48	10	SNP	0.104	T
USP32P2	220594	genome.wustl.edu	37	17	18420698	18420698	+	RNA	SNP	C	C	T			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr17:18420698C>T	ENST00000425211.1	-	0	1779				USP32P2_ENST00000412260.1_RNA																							AAAAAGCACTCGGATCAAAAC	0.458																																						dbGAP											0																																										-	-	-			0																															17.37:g.18420698C>T				RNA	SNP	-	NULL	ENST00000425211.1	37	NULL		17																																																																																			USP32P2	-	-	ENSG00000233327		0.458	CTD-2303H24.2-001	KNOWN	basic|readthrough_transcript	processed_transcript	USP32P2	HGNC	processed_transcript	OTTHUMT00000473021.1	47	0.00	0	C			18420698	18420698	-1	no_errors	ENST00000412260	ensembl	human	known	69_37n	rna	14	74.14	43	SNP	0.995	T
USP7	7874	genome.wustl.edu	37	16	8996318	8996318	+	Nonsense_Mutation	SNP	G	G	A	rs374224337		TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr16:8996318G>A	ENST00000344836.4	-	17	2059	c.1861C>T	c.(1861-1863)Cga>Tga	p.R621*	USP7_ENST00000381886.4_Nonsense_Mutation_p.R605*|USP7_ENST00000535863.1_Nonsense_Mutation_p.R522*	NM_003470.2	NP_003461.2	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7 (herpes virus-associated)	621					maintenance of DNA methylation (GO:0010216)|multicellular organismal development (GO:0007275)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|protein deubiquitination (GO:0016579)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|transcription-coupled nucleotide-excision repair (GO:0006283)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|p53 binding (GO:0002039)|protein C-terminus binding (GO:0008022)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(13)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	48						GGCCACAATCGAATTTGATCT	0.333																																						dbGAP											0													71.0	63.0	66.0					16																	8996318		2197	4300	6497	-	-	-	SO:0001587	stop_gained	0			Z72499	CCDS32385.1, CCDS66941.1	16p13.3	2008-04-11	2005-08-08			ENSG00000187555		"""Ubiquitin-specific peptidases"""	12630	protein-coding gene	gene with protein product		602519	"""ubiquitin specific protease 7 (herpes virus-associated)"""	HAUSP		12838346, 9925944	Standard	NM_003470		Approved		uc002czl.2	Q93009		ENST00000344836.4:c.1861C>T	16.37:g.8996318G>A	ENSP00000343535:p.Arg621*		A6NMY8|B7Z815|H0Y3G8	Nonsense_Mutation	SNP	pfam_Peptidase_C19,pfam_MATH,pfam_Pept_C19_dom,superfamily_TRAF-like,smart_MATH,pfscan_MATH,pfscan_Peptidase_C19	p.R621*	ENST00000344836.4	37	c.1861	CCDS32385.1	16	.	.	.	.	.	.	.	.	.	.	G	42	9.580930	0.99211	.	.	ENSG00000187555	ENST00000344836;ENST00000381886;ENST00000535863;ENST00000544549	.	.	.	5.05	4.05	0.47172	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.4608	0.61225	0.0:0.0:0.7004:0.2996	.	.	.	.	X	621;629;522;522	.	ENSP00000343535:R621X	R	-	1	2	USP7	8903819	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.282000	0.51693	1.182000	0.42928	0.555000	0.69702	CGA	USP7	-	NULL	ENSG00000187555		0.333	USP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP7	HGNC	protein_coding	OTTHUMT00000434268.2	24	0.00	0	G			8996318	8996318	-1	no_errors	ENST00000344836	ensembl	human	known	69_37n	nonsense	16	33.33	8	SNP	1.000	A
ZBTB33	10009	genome.wustl.edu	37	X	119388921	119388921	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chrX:119388921C>T	ENST00000326624.2	+	2	1879	c.1651C>T	c.(1651-1653)Cag>Tag	p.Q551*	ZBTB33_ENST00000557385.1_Nonsense_Mutation_p.Q551*	NM_006777.3	NP_006768.1	Q86T24	KAISO_HUMAN	zinc finger and BTB domain containing 33	551	Interaction with CTNND1. {ECO:0000250}.|Required for DNA-binding. {ECO:0000250}.				intracellular signal transduction (GO:0035556)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(2)|endometrium(6)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	26						GCGAAGGTATCAGTGTTTGGC	0.418																																						dbGAP											0													144.0	128.0	133.0					X																	119388921		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC042753	CCDS14596.1	Xq23	2013-01-09			ENSG00000177485	ENSG00000177485		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	16682	protein-coding gene	gene with protein product		300329					Standard	NM_001184742		Approved	ZNF-kaiso, kaiso, WUGSC:H_DJ525N14.1, KAISO, ZNF348	uc004esn.1	Q86T24	OTTHUMG00000171159	ENST00000326624.2:c.1651C>T	X.37:g.119388921C>T	ENSP00000314153:p.Gln551*		B2R5U6|O00319|Q7Z361|Q8IVP6|Q8N3P0	Nonsense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.Q551*	ENST00000326624.2	37	c.1651	CCDS14596.1	X	.	.	.	.	.	.	.	.	.	.	C	38	6.869194	0.97897	.	.	ENSG00000177485;ENSG00000177485;ENSG00000258974	ENST00000326624;ENST00000540105;ENST00000557385	.	.	.	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	4.0E-4	17.3434	0.87303	0.0:1.0:0.0:0.0	.	.	.	.	X	551	.	ENSP00000314153:Q551X	Q	+	1	0	ZBTB33;AC002086.1	119272949	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	7.487000	0.81328	2.308000	0.77769	0.513000	0.50165	CAG	ZBTB33	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000177485		0.418	ZBTB33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB33	HGNC	protein_coding	OTTHUMT00000058085.2	61	0.00	0	C	NM_006777		119388921	119388921	+1	no_errors	ENST00000326624	ensembl	human	known	69_37n	nonsense	45	31.82	21	SNP	1.000	T
ZBTB14	7541	genome.wustl.edu	37	18	5291276	5291276	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr18:5291276T>C	ENST00000357006.4	-	4	1269	c.931A>G	c.(931-933)Aca>Gca	p.T311A	ZBTB14_ENST00000400143.3_Missense_Mutation_p.T311A	NM_001143823.2|NM_001243704.1	NP_001137295.1|NP_001230633.1	O43829	ZBT14_HUMAN	zinc finger and BTB domain containing 14	311					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)										AAACCTTTTGTGCACATTTCA	0.478																																						dbGAP											0													121.0	116.0	117.0					18																	5291276		2203	4300	6503	-	-	-	SO:0001583	missense	0			D89859	CCDS11837.1	18p11.31	2013-09-19	2013-01-08	2013-01-08	ENSG00000198081	ENSG00000198081		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12860	protein-coding gene	gene with protein product		602126	"""zinc finger protein 161 homolog (mouse)"", ""zinc finger protein 161"", ""ZFP161 zinc finger protein"""	ZFP161		9244432	Standard	NM_001243702		Approved	ZNF478	uc010dkp.3	O43829	OTTHUMG00000131563	ENST00000357006.4:c.931A>G	18.37:g.5291276T>C	ENSP00000349503:p.Thr311Ala		O00403|Q2TB80	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.T311A	ENST00000357006.4	37	c.931	CCDS11837.1	18	.	.	.	.	.	.	.	.	.	.	T	6.837	0.523564	0.13066	.	.	ENSG00000198081	ENST00000357006;ENST00000400143	T;T	0.07114	3.22;3.22	5.8	5.8	0.92144	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.305652	0.35096	N	0.003445	T	0.06234	0.0161	N	0.16903	0.455	0.37234	D	0.905834	B	0.02656	0.0	B	0.01281	0.0	T	0.24225	-1.0166	10	0.54805	T	0.06	-20.9717	10.4819	0.44698	0.0:0.0723:0.0:0.9277	.	311	O43829	ZF161_HUMAN	A	311	ENSP00000349503:T311A;ENSP00000383009:T311A	ENSP00000349503:T311A	T	-	1	0	ZFP161	5281276	1.000000	0.71417	0.481000	0.27354	0.985000	0.73830	3.504000	0.53347	2.206000	0.71126	0.528000	0.53228	ACA	ZFP161	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198081		0.478	ZBTB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP161	HGNC	protein_coding	OTTHUMT00000254425.1	93	0.00	0	T	NM_003409		5291276	5291276	-1	no_errors	ENST00000357006	ensembl	human	known	69_37n	missense	59	33.71	30	SNP	0.965	C
ZNF397	84307	genome.wustl.edu	37	18	32825849	32825849	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr18:32825849G>A	ENST00000330501.7	+	4	1333	c.1180G>A	c.(1180-1182)Gag>Aag	p.E394K	ZNF397_ENST00000261333.6_Intron|ZNF397_ENST00000592264.1_Intron|ZNF397_ENST00000355632.4_Intron|ZNF397_ENST00000589420.1_Intron	NM_001135178.2	NP_001128650.1	Q8NF99	ZN397_HUMAN	zinc finger protein 397	394					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|large_intestine(3)|lung(5)|skin(1)	12						TCACACTGGTGAGAAACCTTA	0.383																																						dbGAP											0													44.0	47.0	46.0					18																	32825849		692	1591	2283	-	-	-	SO:0001583	missense	0			BC006172	CCDS32814.1, CCDS45852.1	18p12	2013-01-09	2003-07-22			ENSG00000186812		"""-"", ""Zinc fingers, C2H2-type"""	18818	protein-coding gene	gene with protein product		609601	"""zinc finger protein 47"""	ZNF47			Standard	NM_032347		Approved	ZSCAN15, MGC13250	uc010dmp.3	Q8NF99		ENST00000330501.7:c.1180G>A	18.37:g.32825849G>A	ENSP00000331577:p.Glu394Lys		Q9BRM2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.E394K	ENST00000330501.7	37	c.1180	CCDS45852.1	18	.	.	.	.	.	.	.	.	.	.	G	24.8	4.565917	0.86439	.	.	ENSG00000186812	ENST00000330501	T	0.24350	1.86	4.21	4.21	0.49690	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.32287	U	0.006314	T	0.42607	0.1210	L	0.48260	1.515	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.14476	-1.0471	9	.	.	.	.	14.4242	0.67204	0.0:0.0:1.0:0.0	.	394	Q8NF99	ZN397_HUMAN	K	394	ENSP00000331577:E394K	.	E	+	1	0	ZNF397	31079847	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.601000	0.98297	2.357000	0.79964	0.305000	0.20034	GAG	ZNF397	-	pfscan_Znf_C2H2	ENSG00000186812		0.383	ZNF397-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF397	HGNC	protein_coding	OTTHUMT00000442398.1	33	0.00	0	G	NM_032347		32825849	32825849	+1	no_errors	ENST00000330501	ensembl	human	known	69_37n	missense	15	44.44	12	SNP	1.000	A
ZNF469	84627	genome.wustl.edu	37	16	88502482	88502482	+	Silent	SNP	C	C	T	rs3812953	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr16:88502482C>T	ENST00000437464.1	+	2	8520	c.8520C>T	c.(8518-8520)cgC>cgT	p.R2840R	ZNF469_ENST00000565624.1_Silent_p.R2868R	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	2840					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						CAGGCGGTCGCTTGACTAGAA	0.602													C|||	2354	0.470048	0.3457	0.5231	5008	,	,		15669	0.4514		0.4682	False		,,,				2504	0.6217					dbGAP											0													12.0	16.0	15.0					16																	88502482		692	1587	2279	-	-	-	SO:0001819	synonymous_variant	0			AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.8520C>T	16.37:g.88502482C>T				Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R2840	ENST00000437464.1	37	c.8520	CCDS45544.1	16																																																																																			ZNF469	-	NULL	ENSG00000225614		0.602	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF469	HGNC	protein_coding		68	0.00	0	C	NG_012236		88502482	88502482	+1	no_errors	ENST00000437464	ensembl	human	known	69_37n	silent	35	14.63	6	SNP	0.149	T
ZNF687	57592	genome.wustl.edu	37	1	151260644	151260644	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr1:151260644G>C	ENST00000368879.2	+	2	1975	c.1877G>C	c.(1876-1878)gGa>gCa	p.G626A		NM_020832.1	NP_065883.1	Q8N1G0	ZN687_HUMAN	zinc finger protein 687	626					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|ovary(1)|upper_aerodigestive_tract(2)	32	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			CCTGTCTCTGGACCTCTGGCC	0.617																																						dbGAP											0													59.0	53.0	55.0					1																	151260644		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS992.1	1q21.2	2008-05-02			ENSG00000143373	ENSG00000143373			29277	protein-coding gene	gene with protein product		610568				10718198	Standard	NM_020832		Approved	KIAA1441	uc001exq.3	Q8N1G0	OTTHUMG00000012347	ENST00000368879.2:c.1877G>C	1.37:g.151260644G>C	ENSP00000357874:p.Gly626Ala		D3DV17|Q68DQ8|Q9H937|Q9P2A7	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G626A	ENST00000368879.2	37	c.1877		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.009|0.009	-1.822284|-1.822284	0.00589|0.00589	.|.	.|.	ENSG00000143373|ENSG00000143373	ENST00000426871|ENST00000336715;ENST00000324048;ENST00000368879	.|T;T;T	.|0.00873	.|5.59;5.59;5.94	4.4|4.4	3.46|3.46	0.39613|0.39613	.|.	.|0.499336	.|0.15040	.|N	.|0.283920	T|T	0.00109|0.00109	0.0003|0.0003	N|N	0.01576|0.01576	-0.805|-0.805	0.09310|0.09310	N|N	0.999996|0.999996	.|P;P;B	.|0.36837	.|0.571;0.495;0.01	.|B;B;B	.|0.30855	.|0.121;0.084;0.009	T|T	0.02398|0.02398	-1.1165|-1.1165	5|10	.|0.07482	.|T	.|0.82	.|.	4.4878|4.4878	0.11799|0.11799	0.1753:0.2024:0.6223:0.0|0.1753:0.2024:0.6223:0.0	.|.	.|626;626;626	.|Q8N1G0-2;Q8N1G0;F8WCX2	.|.;ZN687_HUMAN;.	H|A	229|626	.|ENSP00000336620:G626A;ENSP00000319829:G626A;ENSP00000357874:G626A	.|ENSP00000319829:G626A	D|G	+|+	1|2	0|0	ZNF687|ZNF687	149527268|149527268	0.000000|0.000000	0.05858|0.05858	0.558000|0.558000	0.28319|0.28319	0.004000|0.004000	0.04260|0.04260	-0.071000|-0.071000	0.11505|0.11505	1.402000|1.402000	0.46780|0.46780	0.655000|0.655000	0.94253|0.94253	GAC|GGA	ZNF687	-	NULL	ENSG00000143373		0.617	ZNF687-201	KNOWN	basic	protein_coding	ZNF687	HGNC	protein_coding		50	0.00	0	G	NM_020832		151260644	151260644	+1	no_errors	ENST00000324048	ensembl	human	known	69_37n	missense	43	28.33	17	SNP	0.131	C
ZNF705B	100132396	genome.wustl.edu	37	8	7808219	7808219	+	Missense_Mutation	SNP	A	A	T	rs2740676	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr8:7808219A>T	ENST00000400120.3	+	6	550	c.268A>T	c.(268-270)Ata>Tta	p.I90L	ZNF705B_ENST00000443676.1_Missense_Mutation_p.I90L	NM_001193630.1	NP_001180559.1	P0CI00	Z705B_HUMAN	zinc finger protein 705B	90					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.I90L(4)		kidney(2)|lung(2)	4						AAAACACATGATATCCATGCA	0.328													a|||	611	0.122005	0.3215	0.098	5008	,	,		8921	0.0476		0.0368	False		,,,				2504	0.0337					dbGAP											4	Substitution - Missense(4)	kidney(4)																																								-	-	-	SO:0001583	missense	0				CCDS55194.1	8p23.1	2013-01-08			ENSG00000215356	ENSG00000215356		"""Zinc fingers, C2H2-type"", ""-"""	32284	protein-coding gene	gene with protein product							Standard	NM_001193630		Approved		uc010lro.1	P0CI00	OTTHUMG00000165401	ENST00000400120.3:c.268A>T	8.37:g.7808219A>T	ENSP00000382987:p.Ile90Leu		A8K971|A8MY01	Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.I90L	ENST00000400120.3	37	c.268	CCDS55194.1	8	.	.	.	.	.	.	.	.	.	.	A	5.923	0.354401	0.11239	.	.	ENSG00000215356	ENST00000400120;ENST00000443676	T;T	0.10477	2.87;2.87	1.03	-0.278	0.12894	.	.	.	.	.	T	0.04182	0.0116	N	0.12182	0.205	0.80722	P	0.0	P	0.42692	0.787	B	0.38056	0.264	T	0.36016	-0.9765	8	0.13470	T	0.59	.	4.1796	0.10369	0.5061:0.0:0.4939:0.0	.	90	P0CI00	Z705L_HUMAN	L	90	ENSP00000382987:I90L;ENSP00000411618:I90L	ENSP00000382987:I90L	I	+	1	0	ZNF705B	7845629	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	0.124000	0.15728	-0.074000	0.12820	0.155000	0.16302	ATA	ZNF705B	-	NULL	ENSG00000215356		0.328	ZNF705B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF705B	HGNC	protein_coding	OTTHUMT00000383804.1	87	0.00	0	A	NM_001193630		7808219	7808219	+1	no_errors	ENST00000400120	ensembl	human	known	69_37n	missense	19	17.39	4	SNP	0.000	T
ZNF777	27153	genome.wustl.edu	37	7	149152835	149152835	+	Silent	SNP	G	G	C			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr7:149152835G>C	ENST00000247930.4	-	2	602	c.279C>G	c.(277-279)ctC>ctG	p.L93L		NM_015694.2	NP_056509.2	Q9ULD5	ZN777_HUMAN	zinc finger protein 777	93					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(5)|lung(17)|ovary(1)|skin(2)|urinary_tract(1)	26	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			GGGGGCCCTGGAGAGAAGTCT	0.607																																						dbGAP											0													82.0	93.0	89.0					7																	149152835		1877	4109	5986	-	-	-	SO:0001819	synonymous_variant	0			AB033111	CCDS43675.1	7q36.1	2013-01-08			ENSG00000196453	ENSG00000196453		"""Zinc fingers, C2H2-type"", ""-"""	22213	protein-coding gene	gene with protein product							Standard	NM_015694		Approved	KIAA1285	uc003wfv.3	Q9ULD5	OTTHUMG00000158967	ENST00000247930.4:c.279C>G	7.37:g.149152835G>C			Q8N2R2|Q8N659	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,pfam_DUF3669_Znf,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L93	ENST00000247930.4	37	c.279	CCDS43675.1	7																																																																																			ZNF777	-	NULL	ENSG00000196453		0.607	ZNF777-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF777	HGNC	protein_coding	OTTHUMT00000352708.1	20	0.00	0	G	NM_015694		149152835	149152835	-1	no_errors	ENST00000247930	ensembl	human	known	69_37n	silent	11	56.00	14	SNP	0.331	C
ZNF799	90576	genome.wustl.edu	37	19	12501313	12501313	+	Silent	SNP	G	G	C			TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr19:12501313G>C	ENST00000430385.3	-	4	2099	c.1899C>G	c.(1897-1899)ctC>ctG	p.L633L	CTD-3105H18.14_ENST00000435033.1_Intron|ZNF799_ENST00000419318.1_Silent_p.L601L	NM_001080821.2	NP_001074290.1	Q96GE5	ZN799_HUMAN	zinc finger protein 799	633					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(2)	19						GCAAGGAACTGAGAGAAGCAA	0.358																																						dbGAP											0													95.0	100.0	99.0					19																	12501313		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			BC009517	CCDS45989.1	19p13.2	2013-01-08			ENSG00000196466	ENSG00000196466		"""Zinc fingers, C2H2-type"", ""-"""	28071	protein-coding gene	gene with protein product			"""zinc finger protein 842"""	ZNF842			Standard	NM_001080821		Approved	HIT-40, MGC71805	uc002mts.4	Q96GE5	OTTHUMG00000156408	ENST00000430385.3:c.1899C>G	19.37:g.12501313G>C				Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L633	ENST00000430385.3	37	c.1899	CCDS45989.1	19																																																																																			ZNF799	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196466		0.358	ZNF799-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF799	HGNC	protein_coding	OTTHUMT00000344099.2	67	0.00	0	G	NM_001080821		12501313	12501313	-1	no_errors	ENST00000430385	ensembl	human	known	69_37n	silent	37	45.59	31	SNP	0.008	C
ZNRD1-AS1	80862	genome.wustl.edu	37	6	30025285	30025285	+	RNA	SNP	C	C	T	rs6911634	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr6:30025285C>T	ENST00000431012.1	-	0	386				ZNRD1-AS1_ENST00000437417.1_RNA|ZNRD1-AS1_ENST00000376797.3_RNA|ZNRD1-AS1_ENST00000452229.1_RNA|ZNRD1-AS1_ENST00000421692.1_RNA|ZNRD1-AS1_ENST00000448093.1_RNA|ZNRD1-AS1_ENST00000420251.1_RNA|ZNRD1-AS1_ENST00000425604.1_RNA|ZNRD1-AS1_ENST00000422224.1_RNA			Q2KJ03	ZRAS1_HUMAN	ZNRD1 antisense RNA 1																		CTTCTACGCTCTGGGTTGTTT	0.363													T|||	837	0.167133	0.2943	0.1081	5008	,	,		20099	0.1548		0.0805	False		,,,				2504	0.1391					dbGAP											0																																										-	-	-			0			AF032110		6p21.33	2014-08-14	2012-08-15	2010-11-25	ENSG00000204623	ENSG00000204623		"""Long non-coding RNAs"""	13924	non-coding RNA	RNA, long non-coding		615714	"""chromosome 6 open reading frame 12"", ""non-protein coding RNA 171"", ""ZNRD1 antisense RNA (non-protein coding)"", ""ZNRD1 antisense RNA 1 (non-protein coding)"""	C6orf12, NCRNA00171, ZNRD1AS, ZNRD1-AS		9553157, 11130983, 25110835	Standard	NR_026751		Approved	HTEX4, Em:AB023056.3	uc003rto.3	Q2KJ03	OTTHUMG00000031109		6.37:g.30025285C>T				RNA	SNP	-	NULL	ENST00000431012.1	37	NULL		6																																																																																			ZNRD1-AS1	-	-	ENSG00000204623		0.363	ZNRD1-AS1-005	KNOWN	basic|exp_conf	antisense	ZNRD1-AS1	HGNC	antisense	OTTHUMT00000253082.1	40	0.00	0	C	NR_026751		30025285	30025285	-1	no_errors	ENST00000421692	ensembl	human	known	69_37n	rna	70	12.50	10	SNP	0.009	T
ZNRD1	30834	genome.wustl.edu	37	6	30029109	30029109	+	5'UTR	SNP	C	C	G	rs372190606|rs7770557	byFrequency	TCGA-A7-A3IZ-01A-11D-A20S-09	TCGA-A7-A3IZ-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6b27faf2-1488-45a4-b1ff-fec511f1fb58	46160082-58d4-47f5-a49a-505ca987fd79	g.chr6:30029109C>G	ENST00000332435.5	+	0	79				ZNRD1-AS1_ENST00000437417.1_RNA|ZNRD1-AS1_ENST00000376797.3_RNA|ZNRD1-AS1_ENST00000452229.1_RNA|ZNRD1-AS1_ENST00000421692.1_RNA|ZNRD1_ENST00000463141.1_3'UTR|ZNRD1_ENST00000376782.2_5'UTR|ZNRD1-AS1_ENST00000448093.1_RNA|ZNRD1-AS1_ENST00000420251.1_RNA|ZNRD1-AS1_ENST00000431012.1_RNA|ZNRD1_ENST00000376785.2_5'UTR|ZNRD1-AS1_ENST00000425604.1_RNA|ZNRD1-AS1_ENST00000422224.1_RNA|ZNRD1_ENST00000359374.4_5'UTR	NM_170783.2	NP_740753.1	Q9P1U0	RPA12_HUMAN	zinc ribbon domain containing 1						nucleobase-containing compound metabolic process (GO:0006139)|termination of RNA polymerase I transcription (GO:0006363)	DNA-directed RNA polymerase I complex (GO:0005736)	DNA-directed RNA polymerase activity (GO:0003899)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)										GGTTCCAAGTCCTTTAGTACC	0.637													C|||	835	0.166733	0.2943	0.1081	5008	,	,		17201	0.1528		0.0805	False		,,,				2504	0.1391					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AF024617	CCDS4670.1	6p21	2011-02-18	2006-04-04		ENSG00000066379	ENSG00000066379			13182	protein-coding gene	gene with protein product		607525	"""zinc ribbon domain containing, 1"""			8938444, 10662553	Standard	NM_170783		Approved	hZR14, HTEX-6, tctex-6, RPA12	uc003npa.3	Q9P1U0	OTTHUMG00000031149	ENST00000332435.5:c.-193C>G	6.37:g.30029109C>G				RNA	SNP	-	NULL	ENST00000332435.5	37	NULL	CCDS4670.1	6																																																																																			ZNRD1-AS1	-	-	ENSG00000204623		0.637	ZNRD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNRD1-AS1	HGNC	protein_coding	OTTHUMT00000076272.2	18	0.00	0	C			30029109	30029109	-1	no_errors	ENST00000437417	ensembl	human	known	69_37n	rna	12	25.00	4	SNP	0.000	G
