#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCD3	5825	genome.wustl.edu	37	1	94983203	94983203	+	3'UTR	SNP	C	C	T	rs698951	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr1:94983203C>T	ENST00000370214.4	+	0	2522				ABCD3_ENST00000484213.1_3'UTR|ABCD3_ENST00000394233.2_3'UTR	NM_002858.3	NP_002849.1	P28288	ABCD3_HUMAN	ATP-binding cassette, sub-family D (ALD), member 3						ATP catabolic process (GO:0006200)|fatty acid beta-oxidation (GO:0006635)|peroxisome organization (GO:0007031)|transmembrane transport (GO:0055085)|very long-chain fatty acid catabolic process (GO:0042760)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(2)|lung(10)|ovary(1)|pancreas(1)|skin(2)	26		all_lung(203;0.000434)|Lung NSC(277;0.0019)		all cancers(265;0.0261)|Epithelial(280;0.165)		TATACAGTGGCAGATTTCTTT	0.353													C|||	2059	0.411142	0.5938	0.1931	5008	,	,		19696	0.506		0.2346	False		,,,				2504	0.4029					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			M81182	CCDS749.1, CCDS44175.1	1p21.3	2012-05-16			ENSG00000117528	ENSG00000117528		"""ATP binding cassette transporters / subfamily D"""	67	protein-coding gene	gene with protein product		170995		PXMP1		1301993, 8449508	Standard	NM_002858		Approved	PMP70, ZWS2	uc001dqn.4	P28288	OTTHUMG00000010717	ENST00000370214.4:c.*518C>T	1.37:g.94983203C>T			D3DT46|Q15271|Q6NUN5|Q96DA3|Q9H529	RNA	SNP	-	NULL	ENST00000370214.4	37	NULL	CCDS749.1	1																																																																																			ABCD3	-	-	ENSG00000117528		0.353	ABCD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCD3	HGNC	protein_coding	OTTHUMT00000029597.1	49	0.00	0	C	NM_002858		94983203	94983203	+1	no_errors	ENST00000464165	ensembl	human	known	69_37n	rna	34	12.82	5	SNP	0.983	T
AKR1CL1	340811	genome.wustl.edu	37	10	5200861	5200861	+	IGR	SNP	C	C	A	rs2020172	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr10:5200861C>A	ENST00000334314.3	-	0	492				AKR1CL1_ENST00000465430.1_Intron			Q5T2L2	AKCL1_HUMAN	aldo-keto reductase family 1, member C-like 1							cytoplasm (GO:0005737)	oxidoreductase activity (GO:0016491)			cervix(1)|endometrium(1)|large_intestine(2)|lung(2)	6						CTTGGACTTGCAGAACTCCAG	0.448													C|||	864	0.172524	0.1732	0.183	5008	,	,		17338	0.0		0.3579	False		,,,				2504	0.1513				Ovarian(129;1623 1737 25446 28757 47467)	dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0					10p15.2	2014-05-06			ENSG00000196326	ENSG00000264006			23469	protein-coding gene	gene with protein product						15164054	Standard	NR_027916		Approved		uc009xhz.2	Q5T2L2	OTTHUMG00000184213		10.37:g.5200861C>A			A6NF66|Q6ZN81	Missense_Mutation	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_Aldo/keto_reductase_subgr	p.C34F	ENST00000334314.3	37	c.101		10	440	0.20146520146520147	99	0.20121951219512196	81	0.22375690607734808	0	0.0	260	0.34300791556728233	C	19.60	3.858582	0.71834	.	.	ENSG00000196326	ENST00000473890	T	0.28454	1.61	3.73	3.73	0.42828	.	0.000000	0.64402	U	0.000012	T	0.00012	0.0000	.	.	.	0.09310	P	1.0	.	.	.	.	.	.	T	0.31752	-0.9932	6	0.87932	D	0	.	13.7685	0.63010	0.0:1.0:0.0:0.0	rs2020172;rs2020172	.	.	.	F	34	ENSP00000417959:C34F	ENSP00000417959:C34F	C	-	2	0	AKR1CL1	5190861	1.000000	0.71417	0.989000	0.46669	0.951000	0.60555	3.694000	0.54742	2.014000	0.59158	0.484000	0.47621	TGC	AKR1CL1	-	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_Aldo/keto_reductase_subgr	ENSG00000196326		0.448	AKR1CL1-201	KNOWN	basic|appris_candidate_longest	protein_coding	AKR1CL1	HGNC	protein_coding		48	0.00	0	C	NR_027916		5200861	5200861	-1	no_errors	ENST00000473890	ensembl	human	novel	69_37n	missense	17	22.73	5	SNP	1.000	A
ALDH1A1	216	genome.wustl.edu	37	9	75545879	75545879	+	Silent	SNP	C	C	T			TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr9:75545879C>T	ENST00000297785.3	-	3	282	c.228G>A	c.(226-228)ccG>ccA	p.P76P	ALDH1A1_ENST00000482210.1_5'UTR|ALDH1A1_ENST00000376939.1_Silent_p.P76P	NM_000689.4	NP_000680.2	P00352	AL1A1_HUMAN	aldehyde dehydrogenase 1 family, member A1	76					cellular aldehyde metabolic process (GO:0006081)|ethanol oxidation (GO:0006069)|positive regulation of Ras GTPase activity (GO:0032320)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|androgen binding (GO:0005497)|Ras GTPase activator activity (GO:0005099)|retinal dehydrogenase activity (GO:0001758)			breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)	17					Tretinoin(DB00755)|Vitamin A(DB00162)	TAGTACGCCACGGGGATCCAA	0.463																																						dbGAP											0													85.0	88.0	87.0					9																	75545879		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			K03000	CCDS6644.1	9q21.13	2010-08-05			ENSG00000165092	ENSG00000165092	1.2.1.36, 1.2.1.3	"""Aldehyde dehydrogenases"""	402	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 1"""	100640		PUMB1, ALDH1		1709013	Standard	NM_000689		Approved	RALDH1	uc004ajd.3	P00352	OTTHUMG00000020019	ENST00000297785.3:c.228G>A	9.37:g.75545879C>T			O00768|Q5SYR1	Silent	SNP	pfam_Aldehyde_DH_dom,pfam_Acyl-CoA_reduct_LuxC,superfamily_Ald_DH/histidinol_DH	p.P76	ENST00000297785.3	37	c.228	CCDS6644.1	9																																																																																			ALDH1A1	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	ENSG00000165092		0.463	ALDH1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1A1	HGNC	protein_coding	OTTHUMT00000052679.1	17	0.00	0	C			75545879	75545879	-1	no_errors	ENST00000297785	ensembl	human	known	69_37n	silent	17	22.73	5	SNP	0.961	T
ANKRD62	342850	genome.wustl.edu	37	18	12094031	12094031	+	Silent	SNP	G	G	T	rs11664969	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr18:12094031G>T	ENST00000587848.2	+	1	180	c.15G>T	c.(13-15)ggG>ggT	p.G5G	ANKRD62_ENST00000314074.8_5'Flank			A6NC57	ANR62_HUMAN	ankyrin repeat domain 62	5										breast(2)|haematopoietic_and_lymphoid_tissue(1)	3						AGGTCAGGGGGTCGTTCCTGG	0.587													G|||	1472	0.29393	0.1278	0.3285	5008	,	,		10958	0.5347		0.2445	False		,,,				2504	0.2965					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			BX648696	CCDS67439.1	18p11.21	2014-01-21			ENSG00000181626	ENSG00000181626		"""Ankyrin repeat domain containing"""	35241	protein-coding gene	gene with protein product							Standard	XM_003959949		Approved	DKFZp779B1634	uc031rhk.1	A6NC57	OTTHUMG00000180673	ENST00000587848.2:c.15G>T	18.37:g.12094031G>T				Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.G5	ENST00000587848.2	37	c.15		18																																																																																			ANKRD62	-	NULL	ENSG00000181626		0.587	ANKRD62-003	PUTATIVE	basic|appris_candidate_longest	protein_coding	ANKRD62	HGNC	protein_coding	OTTHUMT00000452521.2	27	0.00	0	G	XM_001715728		12094031	12094031	+1	no_errors	ENST00000586406	ensembl	human	known	69_37n	silent	22	15.38	4	SNP	0.000	T
ANO3	63982	genome.wustl.edu	37	11	26484602	26484602	+	Silent	SNP	G	G	A	rs375037623		TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr11:26484602G>A	ENST00000256737.3	+	4	1191	c.339G>A	c.(337-339)acG>acA	p.T113T	ANO3_ENST00000537978.1_Silent_p.T97T|ANO3_ENST00000531646.1_Silent_p.T113T|ANO3_ENST00000525139.1_Silent_p.T97T	NM_031418.2	NP_113606.2	Q9BYT9	ANO3_HUMAN	anoctamin 3	113					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phospholipid scramblase activity (GO:0017128)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68						AGGATTACACGGATGAATCAG	0.308																																						dbGAP											0													70.0	62.0	65.0					11																	26484602		2203	4291	6494	-	-	-	SO:0001819	synonymous_variant	0			AJ300461	CCDS31447.1	11p14.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000134343	ENSG00000134343		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	14004	protein-coding gene	gene with protein product	"""transmembrane protein 16C (eight membrane-spanning domains)"""	610110	"""chromosome 11 open reading frame 25"", ""transmembrane protein 16C"""	C11orf25, TMEM16C		12739008, 15067359, 23200863, 24692353	Standard	NM_031418		Approved	GENX-3947, DYT23	uc001mqt.4	Q9BYT9	OTTHUMG00000166096	ENST00000256737.3:c.339G>A	11.37:g.26484602G>A			B7Z3F5	Silent	SNP	pfam_Anoctamin	p.T113	ENST00000256737.3	37	c.339	CCDS31447.1	11																																																																																			ANO3	-	NULL	ENSG00000134343		0.308	ANO3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANO3	HGNC	protein_coding	OTTHUMT00000387806.1	76	0.00	0	G	NM_031418		26484602	26484602	+1	no_errors	ENST00000256737	ensembl	human	known	69_37n	silent	57	30.49	25	SNP	0.669	A
ARHGAP25	9938	genome.wustl.edu	37	2	69002760	69002760	+	Intron	SNP	C	C	T	rs10445945	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr2:69002760C>T	ENST00000295381.3	+	2	680				ARHGAP25_ENST00000467265.1_Intron|ARHGAP25_ENST00000497079.1_Intron|ARHGAP25_ENST00000544262.1_Intron|ARHGAP25_ENST00000409220.1_Intron|ARHGAP25_ENST00000409202.3_Intron|ARHGAP25_ENST00000456116.2_Intron|ARHGAP25_ENST00000409030.3_Intron	NM_001007231.2	NP_001007232.2	P42331	RHG25_HUMAN	Rho GTPase activating protein 25						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(20)|ovary(3)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	52						AGCACCAGGACGGGCACTGTG	0.488													T|||	1588	0.317093	0.2247	0.3271	5008	,	,		20204	0.3135		0.3608	False		,,,				2504	0.3937					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			D29642	CCDS33214.1, CCDS46312.1, CCDS33214.2, CCDS54363.1, CCDS54364.1	2p13.3	2013-01-10			ENSG00000163219	ENSG00000163219		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	28951	protein-coding gene	gene with protein product		610587				7584044	Standard	NM_001007231		Approved	KIAA0053	uc010fdg.3	P42331	OTTHUMG00000152621	ENST00000295381.3:c.261+208C>T	2.37:g.69002760C>T			A8K2Y1|B7Z498|E9PFQ7|G5E9G2|Q8IXQ2	Missense_Mutation	SNP	NULL	p.T67M	ENST00000295381.3	37	c.200		2																																																																																			ARHGAP25	-	NULL	ENSG00000163219		0.488	ARHGAP25-201	KNOWN	basic|appris_candidate	protein_coding	ARHGAP25	HGNC	protein_coding		44	0.00	0	C	NM_014882		69002760	69002760	+1	no_errors	ENST00000473986	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	0.000	T
ATAD3B	83858	genome.wustl.edu	37	1	1421991	1421991	+	Missense_Mutation	SNP	G	G	A	rs860213	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr1:1421991G>A	ENST00000308647.7	+	11	1273	c.1157G>A	c.(1156-1158)cGg>cAg	p.R386Q		NM_031921.4	NP_114127.3	Q5T9A4	ATD3B_HUMAN	ATPase family, AAA domain containing 3B	386						mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)			endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(2)|urinary_tract(1)	10	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		CCCATGGGGCGGGAAGGCGTG	0.642													g|||	1934	0.386182	0.5817	0.2824	5008	,	,		17137	0.5764		0.0795	False		,,,				2504	0.3149					dbGAP											0													21.0	21.0	21.0					1																	1421991		2179	4241	6420	-	-	-	SO:0001583	missense	0			AL834179	CCDS30.1	1p36.33	2010-04-21		2007-02-08	ENSG00000160072	ENSG00000160072		"""ATPases / AAA-type"""	24007	protein-coding gene	gene with protein product		612317				10574462	Standard	XM_005244806		Approved	TOB3, KIAA1273	uc001afv.3	Q5T9A4	OTTHUMG00000000577	ENST00000308647.7:c.1157G>A	1.37:g.1421991G>A	ENSP00000311766:p.Arg386Gln		A8K3H1|Q6ZRB5|Q9BUK4|Q9ULE7	Missense_Mutation	SNP	pfam_DUF3523,pfam_ATPase_AAA_core,smart_AAA+_ATPase	p.R386Q	ENST00000308647.7	37	c.1157	CCDS30.1	1	871	0.39880952380952384	335	0.6808943089430894	107	0.2955801104972376	362	0.6328671328671329	67	0.08839050131926121	.	15.87	2.960883	0.53400	.	.	ENSG00000160072	ENST00000360489;ENST00000378737;ENST00000308647	D	0.92699	-3.09	2.07	2.07	0.26955	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	L	0.53249	1.67	0.09310	P	1.0	D;D	0.89917	1.0;1.0	D;D	0.77557	0.982;0.99	T	0.48811	-0.9002	9	0.62326	D	0.03	.	11.3902	0.49809	0.0:0.0:1.0:0.0	rs860213	340;386	Q5T9A4-3;Q5T9A4	.;ATD3B_HUMAN	Q	281;203;386	ENSP00000311766:R386Q	ENSP00000311766:R386Q	R	+	2	0	ATAD3B	1411854	1.000000	0.71417	0.998000	0.56505	0.057000	0.15508	9.075000	0.94004	1.139000	0.42245	0.205000	0.17691	CGG	ATAD3B	-	pfam_ATPase_AAA_core,smart_AAA+_ATPase	ENSG00000160072		0.642	ATAD3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD3B	HGNC	protein_coding	OTTHUMT00000001369.2	52	0.00	0	G	NM_031921		1421991	1421991	+1	no_errors	ENST00000308647	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	1.000	A
B3GNT5	84002	genome.wustl.edu	37	3	182987515	182987515	+	5'UTR	SNP	G	G	A	rs3811732	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr3:182987515G>A	ENST00000326505.3	+	0	459				MCF2L2_ENST00000447025.2_Intron|MCF2L2_ENST00000328913.3_Intron|MCF2L2_ENST00000473233.1_Intron|B3GNT5_ENST00000465010.1_5'UTR|B3GNT5_ENST00000460419.1_5'UTR	NM_032047.4	NP_114436.1	Q9BYG0	B3GN5_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5						cellular protein metabolic process (GO:0044267)|central nervous system development (GO:0007417)|glycolipid biosynthetic process (GO:0009247)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)	beta-galactosyl-N-acetylglucosaminylgalactosylglucosyl-ceramide beta-1,3-acetylglucosaminyltransferase activity (GO:0008457)|galactosyltransferase activity (GO:0008378)|lactosylceramide 1,3-N-acetyl-beta-D-glucosaminyltransferase activity (GO:0047256)|lipopolysaccharide N-acetylglucosaminyltransferase activity (GO:0008917)			endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	8	all_cancers(143;8.52e-13)|Ovarian(172;0.0355)		all cancers(12;4.52e-44)|Epithelial(37;8.82e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			TACGAAACACGAAGTTCTATG	0.363													g|||	982	0.196086	0.0166	0.268	5008	,	,		18884	0.2093		0.3161	False		,,,				2504	0.2505					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AB045278	CCDS3244.1	3q28	2013-02-21			ENSG00000176597	ENSG00000176597	2.4.1.206	"""Beta 3-glycosyltransferases"""	15684	protein-coding gene	gene with protein product	"""lactosylceramide 1,3-N-acetyl-beta-D-glucosaminyltransferase"""	615333				11283017	Standard	XM_005247824		Approved	B3GN-T5, beta3Gn-T5	uc003flk.3	Q9BYG0	OTTHUMG00000158436	ENST00000326505.3:c.-72G>A	3.37:g.182987515G>A			D3DNS5|Q59FE3|Q7L9Z5|Q8WWP9	RNA	SNP	-	NULL	ENST00000326505.3	37	NULL	CCDS3244.1	3																																																																																			B3GNT5	-	-	ENSG00000176597		0.363	B3GNT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GNT5	HGNC	protein_coding	OTTHUMT00000351009.1	43	0.00	0	G	NM_032047		182987515	182987515	+1	no_errors	ENST00000488301	ensembl	human	putative	69_37n	rna	37	15.91	7	SNP	0.000	A
MYRFL	196446	genome.wustl.edu	37	12	70273985	70273985	+	Missense_Mutation	SNP	T	T	G	rs7295793	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr12:70273985T>G	ENST00000552032.2	+	5	683	c.469T>G	c.(469-471)Tca>Gca	p.S157A	MYRFL_ENST00000547771.2_Missense_Mutation_p.S157A			Q96LU7	MRFL_HUMAN	myelin regulatory factor-like	157						integral component of membrane (GO:0016021)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)										TTTTAGAGCCTCATTGCCTCC	0.483											OREG0021989	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	T|||	1179	0.235423	0.2118	0.3127	5008	,	,		18831	0.1597		0.2247	False		,,,				2504	0.3016					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK057785		12q15	2012-12-19	2012-12-19	2012-12-19	ENSG00000166268	ENSG00000166268			26316	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 15"", ""chromosome 12 open reading frame 28"""	C12orf15, C12orf28			Standard	XM_006709961		Approved	FLJ25056, bcm1377		Q96LU7	OTTHUMG00000169438	ENST00000552032.2:c.469T>G	12.37:g.70273985T>G	ENSP00000448753:p.Ser157Ala	1121		Missense_Mutation	SNP	pfam_NDT80_DNA-bd_dom,superfamily_p53-like_TF_DNA-bd	p.S157A	ENST00000552032.2	37	c.469		12																																																																																			C12orf28	-	NULL	ENSG00000166268		0.483	MYRFL-004	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	C12orf28	HGNC	protein_coding	OTTHUMT00000404016.2	25	0.00	0	T	NM_182530		70273985	70273985	+1	no_errors	ENST00000547771	ensembl	human	known	69_37n	missense	29	12.12	4	SNP	0.005	G
ELMSAN1	91748	genome.wustl.edu	37	14	74196792	74196792	+	Intron	SNP	T	T	C	rs8019058	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr14:74196792T>C	ENST00000286523.5	-	4	2532				ELMSAN1_ENST00000394071.2_Intron	NM_194278.3	NP_919254.2	Q6PJG2	EMSA1_HUMAN	ELM2 and Myb/SANT-like domain containing 1						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)										TTAGTCTGCCTACCACACCCA	0.493													C|||	3030	0.605032	0.649	0.4568	5008	,	,		16526	0.8313		0.3917	False		,,,				2504	0.637					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BF971739	CCDS9819.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000156030	ENSG00000156030			19853	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 117"", ""chromosome 14 open reading frame 43"""	C14orf117, C14orf43			Standard	NM_194278		Approved	LSR68	uc001xou.3	Q6PJG2	OTTHUMG00000150359	ENST00000286523.5:c.1750-104A>G	14.37:g.74196792T>C			Q6PK13|Q6PK59|Q6ZS23	Missense_Mutation	SNP	NULL	p.R436G	ENST00000286523.5	37	c.1306	CCDS9819.1	14																																																																																			C14orf43	-	NULL	ENSG00000156030		0.493	ELMSAN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf43	HGNC	protein_coding	OTTHUMT00000317793.1	42	0.00	0	T	NM_194278		74196792	74196792	-1	no_start_codon	ENST00000451078	ensembl	human	known	69_37n	missense	33	15.38	6	SNP	0.000	C
C18orf42	642597	genome.wustl.edu	37	18	5145609	5145609	+	Missense_Mutation	SNP	G	G	T	rs1395063	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr18:5145609G>T	ENST00000434239.3	-	2	333	c.162C>A	c.(160-162)caC>caA	p.H54Q	C18orf42_ENST00000580650.1_Missense_Mutation_p.H61Q	NM_001145194.1	NP_001138666.1	P0CW23	CR042_HUMAN	chromosome 18 open reading frame 42	54																	CCAGTTGGATGTGGTCCCGGT	0.498													G|||	960	0.191693	0.3812	0.2061	5008	,	,		20134	0.0585		0.1521	False		,,,				2504	0.1033					dbGAP											0													249.0	210.0	221.0					18																	5145609		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS54179.1	18p11.31	2012-10-24			ENSG00000231824	ENSG00000231824			28285	protein-coding gene	gene with protein product							Standard	NM_001145194		Approved		uc010wzc.1	P0CW23	OTTHUMG00000178457	ENST00000434239.3:c.162C>A	18.37:g.5145609G>T	ENSP00000399075:p.His54Gln			Missense_Mutation	SNP	pfam_Kinase-A_anchor_RI-RII-bd_dom	p.H54Q	ENST00000434239.3	37	c.162	CCDS54179.1	18	445	0.20375457875457875	226	0.45934959349593496	65	0.17955801104972377	35	0.06118881118881119	119	0.15699208443271767	G	0.435	-0.901531	0.02453	.	.	ENSG00000231824	ENST00000434239	.	.	.	5.32	1.1	0.20463	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.47289	-0.9129	6	0.12766	T	0.61	.	10.1055	0.42530	0.0786:0.3937:0.5277:0.0	rs1395063;rs1395063	54	P0CW23	CR042_HUMAN	Q	54	.	ENSP00000399075:H54Q	H	-	3	2	C18orf42	5135609	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	0.113000	0.15499	0.278000	0.22164	-0.176000	0.13171	CAC	C18orf42	-	NULL	ENSG00000231824		0.498	C18orf42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C18orf42	HGNC	protein_coding	OTTHUMT00000442071.1	69	0.00	0	G	NM_001145194		5145609	5145609	-1	no_errors	ENST00000434239	ensembl	human	known	69_37n	missense	47	11.32	6	SNP	0.000	T
C1orf87	127795	genome.wustl.edu	37	1	60456257	60456257	+	3'UTR	SNP	C	C	T	rs191498814	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr1:60456257C>T	ENST00000371201.3	-	0	1836				C1orf87_ENST00000450089.2_3'UTR|C1orf87_ENST00000486478.1_5'UTR|C1orf87_ENST00000395552.1_3'UTR	NM_152377.2	NP_689590.1	Q8N0U7	CA087_HUMAN	chromosome 1 open reading frame 87								calcium ion binding (GO:0005509)			breast(2)|endometrium(2)|large_intestine(6)|lung(19)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33						ACAATGCCTCCGCCACTACAC	0.443													C|||	21	0.00419329	0.0144	0.0014	5008	,	,		18256	0.0		0.001	False		,,,				2504	0.0				NSCLC(75;811 1386 4923 13371 51772)	dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK124828	CCDS614.1	1p32.1	2014-04-03			ENSG00000162598	ENSG00000162598			28547	protein-coding gene	gene with protein product	"""carcinoma-related EF-hand protein"""					12477932	Standard	NM_152377		Approved	MGC34837, CREF	uc001czs.2	Q8N0U7	OTTHUMG00000008992	ENST00000371201.3:c.*88G>A	1.37:g.60456257C>T			Q6ZU07|Q8IVS0	RNA	SNP	-	NULL	ENST00000371201.3	37	NULL	CCDS614.1	1																																																																																			C1orf87	-	-	ENSG00000162598		0.443	C1orf87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf87	HGNC	protein_coding	OTTHUMT00000024943.1	22	0.00	0	C	NM_152377		60456257	60456257	-1	no_errors	ENST00000486478	ensembl	human	known	69_37n	rna	27	12.90	4	SNP	0.000	T
C9orf89	84270	genome.wustl.edu	37	9	95874070	95874070	+	3'UTR	SNP	G	G	C	rs2027585	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr9:95874070G>C	ENST00000488630.1	+	0	1897				C9orf89_ENST00000375464.2_Intron			Q96LW7	BINCA_HUMAN	chromosome 9 open reading frame 89						negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	CARD domain binding (GO:0050700)			endometrium(1)|kidney(1)|lung(3)|ovary(1)|skin(1)	7						GGCCCCAGGAGGCAGCAGCAA	0.607													G|||	3334	0.665735	0.3949	0.8516	5008	,	,		17279	0.6042		0.8787	False		,,,				2504	0.7444					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK057716	CCDS6702.2	9q22.32	2012-03-16			ENSG00000165233	ENSG00000165233			28148	protein-coding gene	gene with protein product	"""Bcl10-interacting protein with CARD"""					12477932	Standard	XM_005252273		Approved	MGC11115, bA370F5.1, BinCARD	uc004atd.3	Q96LW7	OTTHUMG00000020243	ENST00000488630.1:c.*1894G>C	9.37:g.95874070G>C			Q5BJH8|Q9BSY2	RNA	SNP	-	NULL	ENST00000488630.1	37	NULL		9																																																																																			C9orf89	-	-	ENSG00000165233		0.607	C9orf89-009	KNOWN	basic	processed_transcript	C9orf89	HGNC	protein_coding	OTTHUMT00000053136.1	48	0.00	0	G	NM_032310		95874070	95874070	+1	no_errors	ENST00000488630	ensembl	human	known	69_37n	rna	30	16.67	6	SNP	0.000	C
CALM1	801	genome.wustl.edu	37	14	90870839	90870839	+	Silent	SNP	C	C	T	rs193072150		TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr14:90870839C>T	ENST00000356978.4	+	5	650	c.402C>T	c.(400-402)gaC>gaT	p.D134D	CALM1_ENST00000544280.2_Silent_p.D98D|RP11-471B22.2_ENST00000555853.1_RNA|CALM1_ENST00000553542.1_Silent_p.D98D|CALM1_ENST00000447653.3_Silent_p.D135D	NM_006888.4	NP_008819.1	P62158	CALM_HUMAN	calmodulin 1 (phosphorylase kinase, delta)	134	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|detection of calcium ion (GO:0005513)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nitric oxide metabolic process (GO:0046209)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cyclic nucleotide metabolic process (GO:0030801)|positive regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051343)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of cytokinesis (GO:0032465)|regulation of heart rate (GO:0002027)|regulation of high voltage-gated calcium channel activity (GO:1901841)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|response to corticosterone (GO:0051412)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcomere (GO:0030017)|spindle microtubule (GO:0005876)|spindle pole (GO:0000922)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|N-terminal myristoylation domain binding (GO:0031997)|nitric-oxide synthase regulator activity (GO:0030235)|phospholipase binding (GO:0043274)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|protein phosphatase activator activity (GO:0072542)|protein serine/threonine kinase activator activity (GO:0043539)|thioesterase binding (GO:0031996)|titin binding (GO:0031432)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(1)	10		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.208)	Aprindine(DB01429)|Bepridil(DB01244)|Chlorpromazine(DB00477)|Cinchocaine(DB00527)|Felodipine(DB01023)|Flunarizine(DB04841)|Fluphenazine(DB00623)|Isoflurane(DB00753)|Loperamide(DB00836)|Melatonin(DB01065)|Nicardipine(DB00622)|Nifedipine(DB01115)|Perphenazine(DB00850)|Phenoxybenzamine(DB00925)|Pimozide(DB01100)|Promethazine(DB01069)|Trifluoperazine(DB00831)	TTGATGGAGACGGACAAGTCA	0.398													C|||	1	0.000199681	0.0008	0.0	5008	,	,		21336	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													136.0	128.0	131.0					14																	90870839		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS9892.1	14q32.11	2013-02-25			ENSG00000198668	ENSG00000198668	2.7.11.19	"""EF-hand domain containing"", ""Endogenous ligands"""	1442	protein-coding gene	gene with protein product	"""prepro-calmodulin 1"""	114180		CALML2		6385987	Standard	NM_006888		Approved	CAMI, PHKD, DD132	uc001xyl.2	P62158	OTTHUMG00000171044	ENST00000356978.4:c.402C>T	14.37:g.90870839C>T			P02593|P70667|P99014|Q13942|Q53S29|Q61379|Q61380|Q96HK3	Silent	SNP	pfam_EF-hand,pfam_EF-hand_Ca_insen,smart_EF_hand_Ca-bd,prints_Recoverin,pfscan_EF_HAND_2	p.D134	ENST00000356978.4	37	c.402	CCDS9892.1	14																																																																																			CALM1	-	pfam_EF-hand,pfam_EF-hand_Ca_insen,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	ENSG00000198668		0.398	CALM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CALM1	HGNC	protein_coding	OTTHUMT00000411346.1	32	0.00	0	C			90870839	90870839	+1	no_errors	ENST00000356978	ensembl	human	known	69_37n	silent	25	28.57	10	SNP	0.948	T
CDK18	5129	genome.wustl.edu	37	1	205501181	205501181	+	3'UTR	SNP	T	T	C	rs3820377	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr1:205501181T>C	ENST00000360066.2	+	0	2401				CDK18_ENST00000509056.1_3'UTR	NM_002596.3|NM_212502.2|NM_212503.2	NP_002587.2|NP_997667.1|NP_997668.1	Q07002	CDK18_HUMAN	cyclin-dependent kinase 18								ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(2)|endometrium(2)|large_intestine(2)|lung(10)|stomach(2)|urinary_tract(1)	19						TACGCTTTGCTGGCATGCTTG	0.612													C|||	2461	0.491414	0.4592	0.4496	5008	,	,		17741	0.5833		0.5109	False		,,,				2504	0.4499				Pancreas(180;489 2072 28461 40831 44265)	dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			X66362	CCDS1454.1, CCDS44300.1	1q31-q32	2011-11-08	2009-12-16	2009-12-16	ENSG00000117266	ENSG00000117266		"""Cyclin-dependent kinases"""	8751	protein-coding gene	gene with protein product		169190	"""PCTAIRE protein kinase 3"""	PCTK3		1437147, 19884882	Standard	NM_002596		Approved	PCTAIRE3	uc010pri.2	Q07002	OTTHUMG00000037203	ENST00000360066.2:c.*675T>C	1.37:g.205501181T>C			Q5VXQ2|Q6V3A2|Q6V3A3|Q96F90	RNA	SNP	-	NULL	ENST00000360066.2	37	NULL	CCDS44300.1	1																																																																																			CDK18	-	-	ENSG00000117266		0.612	CDK18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK18	HGNC	protein_coding	OTTHUMT00000090407.2	26	0.00	0	T	NM_002596		205501181	205501181	+1	no_errors	ENST00000509056	ensembl	human	known	69_37n	rna	13	31.58	6	SNP	0.000	C
CELP	1057	genome.wustl.edu	37	9	135962399	135962399	+	RNA	SNP	G	G	A	rs640502	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr9:135962399G>A	ENST00000411440.2	+	0	906					NR_001275.2				carboxyl ester lipase pseudogene																		GGCCACTCCCGTCTCCCCCGA	0.662													G|||	3373	0.673522	0.5567	0.7738	5008	,	,		15744	0.7183		0.7435	False		,,,				2504	0.6421					dbGAP											0																																										-	-	-			0			L14813		9q34.2	2014-03-18	2003-02-28	2003-03-07	ENSG00000170827	ENSG00000170827			1849	pseudogene	pseudogene			"""carboxyl ester lipase-like (bile salt-stimulated lipase-like)"""	CELL		1639390	Standard	NR_001275		Approved		uc011mcu.1		OTTHUMG00000020857		9.37:g.135962399G>A				RNA	SNP	-	NULL	ENST00000411440.2	37	NULL		9																																																																																			CELP	-	-	ENSG00000170827		0.662	CELP-002	KNOWN	basic	processed_transcript	CELP	HGNC	pseudogene	OTTHUMT00000339837.1	40	0.00	0	G	NM_001808		135962399	135962399	+1	no_errors	ENST00000411440	ensembl	human	known	69_37n	rna	47	11.32	6	SNP	0.001	A
COPG1	22820	genome.wustl.edu	37	3	128990708	128990708	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr3:128990708A>T	ENST00000314797.6	+	19	2046	c.1942A>T	c.(1942-1944)Atc>Ttc	p.I648F		NM_016128.3	NP_057212.1	Q9Y678	COPG1_HUMAN	coatomer protein complex, subunit gamma 1	648	Interaction with ZNF289/ARFGAP2.				COPI coating of Golgi vesicle (GO:0048205)|establishment of Golgi localization (GO:0051683)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|organelle transport along microtubule (GO:0072384)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)	structural molecule activity (GO:0005198)										GGAGTATGTCATCCGCTGCAC	0.617																																						dbGAP											0													70.0	56.0	61.0					3																	128990708		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB047846	CCDS33851.1	3q21.3	2012-02-23	2012-02-23	2012-02-23	ENSG00000181789	ENSG00000181789			2236	protein-coding gene	gene with protein product	"""coat protein gamma-cop"""	615525	"""coatomer protein complex, subunit gamma"""	COPG		11056392	Standard	NM_016128		Approved		uc003els.3	Q9Y678	OTTHUMG00000159451	ENST00000314797.6:c.1942A>T	3.37:g.128990708A>T	ENSP00000325002:p.Ile648Phe		A8K6M8|B3KMF6|Q54AC4	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_Coatomer_gsu_app,superfamily_ARM-type_fold,superfamily_Coatomer/clathrin_app_Ig-like,superfamily_Coatomer/calthrin_app_sub_C,pirsf_Coatomer_gsu	p.I648F	ENST00000314797.6	37	c.1942	CCDS33851.1	3	.	.	.	.	.	.	.	.	.	.	A	14.48	2.547817	0.45383	.	.	ENSG00000181789	ENST00000314797	T	0.34472	1.36	5.68	-6.47	0.01902	Coatomer/clathrin adaptor appendage, Ig-like subdomain (1);Coatomer, gamma subunit , appendage (1);Coatomer, gamma subunit, appendage, Ig-like subdomain (1);	0.556457	0.18103	N	0.151623	T	0.28928	0.0718	L	0.38175	1.15	0.39475	D	0.967795	D	0.53312	0.959	P	0.45428	0.48	T	0.45571	-0.9252	10	0.87932	D	0	-10.8087	15.9469	0.79802	0.4313:0.0:0.5687:0.0	.	648	Q9Y678	COPG_HUMAN	F	648	ENSP00000325002:I648F	ENSP00000325002:I648F	I	+	1	0	COPG	130473398	0.999000	0.42202	0.013000	0.15412	0.025000	0.11179	0.642000	0.24735	-1.107000	0.03004	-0.297000	0.09499	ATC	COPG1	-	pfam_Coatomer_gsu_app,superfamily_Coatomer/clathrin_app_Ig-like,pirsf_Coatomer_gsu	ENSG00000181789		0.617	COPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPG1	HGNC	protein_coding	OTTHUMT00000355456.1	38	0.00	0	A	NM_016128		128990708	128990708	+1	no_errors	ENST00000314797	ensembl	human	known	69_37n	missense	17	59.52	25	SNP	0.496	T
CRHR2	1395	genome.wustl.edu	37	7	30728472	30728472	+	5'UTR	SNP	C	C	G	rs917196	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr7:30728472C>G	ENST00000462882.1	-	0	432				CRHR2_ENST00000348438.4_Intron|CRHR2_ENST00000341843.4_5'Flank			Q13324	CRFR2_HUMAN	corticotropin releasing hormone receptor 2						adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|positive regulation of cAMP-mediated signaling (GO:0043950)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	corticotrophin-releasing factor receptor activity (GO:0015056)			breast(2)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						AGAATGTTTACCACCTTCTGC	0.572													G|||	2081	0.415535	0.8601	0.3357	5008	,	,		20659	0.1776		0.2575	False		,,,				2504	0.2791					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0				CCDS5429.1, CCDS56477.1, CCDS56478.1, CCDS75576.1	7p21-p15	2012-08-10			ENSG00000106113	ENSG00000106113		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2358	protein-coding gene	gene with protein product		602034				8536644	Standard	NM_001883		Approved	CRF2, CRF-RB, HM-CRF	uc003tbp.3	Q13324	OTTHUMG00000023218	ENST00000462882.1:c.-251G>C	7.37:g.30728472C>G			B2R967|B3SXS6|B3SXS7|B3SXS8|B3SXT0|F8WA81|O43461|Q4QRJ4|Q99431	RNA	SNP	-	NULL	ENST00000462882.1	37	NULL		7																																																																																			CRHR2	-	-	ENSG00000106113		0.572	CRHR2-004	KNOWN	basic	processed_transcript	CRHR2	HGNC	protein_coding	OTTHUMT00000327787.1	58	0.00	0	C			30728472	30728472	-1	no_errors	ENST00000462882	ensembl	human	known	69_37n	rna	36	10.00	4	SNP	0.006	G
CRHR2	1395	genome.wustl.edu	37	7	30728557	30728557	+	5'UTR	SNP	A	A	G	rs58682124	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr7:30728557A>G	ENST00000462882.1	-	0	347				CRHR2_ENST00000348438.4_Intron|CRHR2_ENST00000341843.4_5'Flank			Q13324	CRFR2_HUMAN	corticotropin releasing hormone receptor 2						adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|positive regulation of cAMP-mediated signaling (GO:0043950)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	corticotrophin-releasing factor receptor activity (GO:0015056)			breast(2)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						GCTGACTTCCATCGTGGGAGC	0.577													A|||	2081	0.415535	0.8601	0.3357	5008	,	,		20412	0.1776		0.2575	False		,,,				2504	0.2791					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0				CCDS5429.1, CCDS56477.1, CCDS56478.1, CCDS75576.1	7p21-p15	2012-08-10			ENSG00000106113	ENSG00000106113		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2358	protein-coding gene	gene with protein product		602034				8536644	Standard	NM_001883		Approved	CRF2, CRF-RB, HM-CRF	uc003tbp.3	Q13324	OTTHUMG00000023218	ENST00000462882.1:c.-336T>C	7.37:g.30728557A>G			B2R967|B3SXS6|B3SXS7|B3SXS8|B3SXT0|F8WA81|O43461|Q4QRJ4|Q99431	RNA	SNP	-	NULL	ENST00000462882.1	37	NULL		7																																																																																			CRHR2	-	-	ENSG00000106113		0.577	CRHR2-004	KNOWN	basic	processed_transcript	CRHR2	HGNC	protein_coding	OTTHUMT00000327787.1	57	0.00	0	A			30728557	30728557	-1	no_errors	ENST00000462882	ensembl	human	known	69_37n	rna	28	15.15	5	SNP	0.000	G
DNM1P51	0	genome.wustl.edu	37	15	84953561	84953561	+	RNA	SNP	G	G	A	rs3803392	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr15:84953561G>A	ENST00000558801.1	-	0	8204									DNM1 pseudogene 51																		GGATGGAGGCGGCCAGGTCTG	0.647													.|||	1891	0.377596	0.4259	0.1527	5008	,	,		9776	0.5665		0.165	False		,,,				2504	0.4959					dbGAP											0																																										-	-	-			0					15q25.2	2013-05-16			ENSG00000259297	ENSG00000235370			48500	pseudogene	pseudogene							Standard			Approved				OTTHUMG00000172438		15.37:g.84953561G>A				RNA	SNP	-	NULL	ENST00000558801.1	37	NULL		15																																																																																			CSPG4P5	-	-	ENSG00000235370		0.647	DNM1P51-001	KNOWN	basic	processed_transcript	CSPG4P5	HGNC	pseudogene	OTTHUMT00000471721.1	90	0.00	0	G			84953561	84953561	-1	no_errors	ENST00000456932	ensembl	human	known	69_37n	rna	62	13.89	10	SNP	0.065	A
CXXC1	30827	genome.wustl.edu	37	18	47813835	47813835	+	Intron	SNP	C	C	T	rs3753067	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr18:47813835C>T	ENST00000285106.6	-	1	718				CXXC1_ENST00000412036.2_Intron|CXXC1_ENST00000587396.1_5'UTR|CXXC1_ENST00000589940.1_Intron	NM_001101654.1|NM_014593.3	NP_001095124.1|NP_055408.2	Q9P0U4	CXXC1_HUMAN	CXXC finger protein 1						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|histone H3-K4 methylation (GO:0051568)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	24						CATAGACTCCCGCCGTTCAGT	0.592											OREG0024981	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	426	0.0850639	0.0106	0.0937	5008	,	,		13359	0.1806		0.0656	False		,,,				2504	0.1012					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC014940	CCDS11945.1, CCDS45866.1	18q12	2014-02-20	2014-02-20		ENSG00000154832	ENSG00000154832		"""Zinc fingers, PHD-type"""	24343	protein-coding gene	gene with protein product	"""CpG binding protein"", ""DNA-binding protein with PHD finger and CXXC domain"", ""zinc finger, CpG binding-type containing 1"""	609150	"""CXXC finger 1 (PHD domain)"""			10799292, 10688657	Standard	NM_014593		Approved	HsT2645, PCCX1, hCGBP, PHF18, CGBP, SPP1, CFP1, ZCGPC1	uc002ler.4	Q9P0U4	OTTHUMG00000132670	ENST00000285106.6:c.3+121G>A	18.37:g.47813835C>T		949	B2RC03|Q8N2W4|Q96BC8|Q9P2V7	RNA	SNP	-	NULL	ENST00000285106.6	37	NULL	CCDS11945.1	18																																																																																			CXXC1	-	-	ENSG00000154832		0.592	CXXC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CXXC1	HGNC	protein_coding	OTTHUMT00000255927.2	100	0.00	0	C	NM_014593		47813835	47813835	-1	no_errors	ENST00000587396	ensembl	human	known	69_37n	rna	62	11.43	8	SNP	0.001	T
DLX4	1748	genome.wustl.edu	37	17	48046696	48046696	+	5'UTR	SNP	T	T	G			TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr17:48046696T>G	ENST00000240306.3	+	0	159				DLX4_ENST00000503410.1_Intron|DLX4_ENST00000505318.2_5'UTR	NM_138281.2	NP_612138.1	Q92988	DLX4_HUMAN	distal-less homeobox 4						multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(3)	10						GAGAGACACTTTCTCCGGGAT	0.652																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0				CCDS11555.1, CCDS45728.1	17q21.33	2011-06-20			ENSG00000108813	ENSG00000108813		"""Homeoboxes / ANTP class : NKL subclass"""	2917	protein-coding gene	gene with protein product		601911		DLX7, DLX9			Standard	NM_138281		Approved	DLX8, BP1	uc002ipv.3	Q92988	OTTHUMG00000161839	ENST00000240306.3:c.-137T>G	17.37:g.48046696T>G			D3DTX2|D3DTX3|O60480|Q13265|Q6PJK0|Q9HBE0	RNA	SNP	-	NULL	ENST00000240306.3	37	NULL	CCDS11555.1	17																																																																																			DLX4	-	-	ENSG00000108813		0.652	DLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLX4	HGNC	protein_coding	OTTHUMT00000366214.1	10	0.00	0	T			48046696	48046696	+1	no_errors	ENST00000505318	ensembl	human	putative	69_37n	rna	5	54.55	6	SNP	0.566	G
DNAH12	201625	genome.wustl.edu	37	3	57414071	57414071	+	Missense_Mutation	SNP	G	G	A	rs4681982	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr3:57414071G>A	ENST00000351747.2	-	35	5468	c.5288C>T	c.(5287-5289)aCa>aTa	p.T1763I		NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	1763			T -> I (in dbSNP:rs4681982).		microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						CTCACTAAATGTACATTGAGT	0.259													A|||	2957	0.590455	0.8336	0.5533	5008	,	,		17500	0.4216		0.4563	False		,,,				2504	0.6002					dbGAP											0													10.0	10.0	10.0					3																	57414071		689	1564	2253	-	-	-	SO:0001583	missense	0			U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.5288C>T	3.37:g.57414071G>A	ENSP00000295937:p.Thr1763Ile		A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.T1763I	ENST00000351747.2	37	c.5288		3	1160	0.5311355311355311	390	0.7926829268292683	199	0.5497237569060773	241	0.42132867132867136	330	0.43535620052770446	A	4.196	0.034973	0.08101	.	.	ENSG00000174844	ENST00000351747	T	0.20598	2.06	1.04	-0.547	0.11836	.	.	.	.	.	T	0.00012	0.0000	N	0.05230	-0.09	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.11792	-1.0573	8	0.48119	T	0.1	.	4.7927	0.13257	0.4541:0.0:0.5459:0.0	rs4681982;rs17736539;rs57979239	1763	Q6ZR08	DYH12_HUMAN	I	1763	ENSP00000295937:T1763I	ENSP00000295937:T1763I	T	-	2	0	DNAH12	57389111	0.097000	0.21791	0.003000	0.11579	0.015000	0.08874	-0.100000	0.10990	-0.772000	0.04602	-0.351000	0.07748	ACA	DNAH12	-	NULL	ENSG00000174844		0.259	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	DNAH12	HGNC	protein_coding		46	0.00	0	G	NM_178504		57414071	57414071	-1	no_errors	ENST00000351747	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	0.004	A
EGFEM1P	93556	genome.wustl.edu	37	3	168546914	168546914	+	RNA	SNP	C	C	T	rs678690	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr3:168546914C>T	ENST00000483846.1	+	0	854					NR_021485.2		Q0D2K5	EGFEM_HUMAN	EGF-like and EMI domain containing 1, pseudogene																		CGGTCCAGCCCGATGAAGTAT	0.443													T|||	2612	0.521565	0.2322	0.6066	5008	,	,		17460	0.878		0.4026	False		,,,				2504	0.6074					dbGAP											0																																										-	-	-			0			AF086185		3q26.2	2010-09-24	2010-09-24	2010-09-24	ENSG00000206120	ENSG00000206120			25149	pseudogene	pseudogene			"""chromosome 3 open reading frame 50"", ""non-protein coding RNA 259"""	C3orf50, NCRNA00259		12477932	Standard	NR_021485		Approved		uc003ffh.4	Q0D2K5	OTTHUMG00000154721		3.37:g.168546914C>T				RNA	SNP	-	NULL	ENST00000483846.1	37	NULL		3																																																																																			EGFEM1P	-	-	ENSG00000206120		0.443	EGFEM1P-007	KNOWN	basic	processed_transcript	EGFEM1P	HGNC	pseudogene	OTTHUMT00000351389.1	57	0.00	0	C	NR_021485		168546914	168546914	+1	no_errors	ENST00000382864	ensembl	human	known	69_37n	rna	35	10.26	4	SNP	1.000	T
NUTM2D	728130	genome.wustl.edu	37	10	89124914	89124914	+	Missense_Mutation	SNP	T	T	A	rs28398769	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr10:89124914T>A	ENST00000381697.2	+	5	2070	c.1472T>A	c.(1471-1473)cTg>cAg	p.L491Q	NUTM2D_ENST00000412718.1_Missense_Mutation_p.L491Q			Q5VT03	NTM2D_HUMAN	NUT family member 2D	491																	CCGGGCCTCCTGAGCTACACT	0.637													t|||	1129	0.225439	0.4667	0.1354	5008	,	,		16510	0.0536		0.2147	False		,,,				2504	0.1513					dbGAP											0													6.0	7.0	7.0					10																	89124914		1677	3815	5492	-	-	-	SO:0001583	missense	0					10q23.31	2013-03-14	2013-03-14	2013-03-14	ENSG00000214562	ENSG00000214562			23447	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member D"""	FAM22D			Standard	NR_075100		Approved		uc001kes.3	Q5VT03	OTTHUMG00000018672	ENST00000381697.2:c.1472T>A	10.37:g.89124914T>A	ENSP00000371116:p.Leu491Gln		A6NGV9	Missense_Mutation	SNP	NULL	p.L491Q	ENST00000381697.2	37	c.1472		10	.	.	.	.	.	.	.	.	.	.	T	14.11	2.438817	0.43326	.	.	ENSG00000214562	ENST00000330762;ENST00000381697;ENST00000381691;ENST00000412718	T;T	0.48201	1.46;0.82	0.628	0.628	0.17681	Nuclear Testis protein, C-terminal (1);	0.000000	0.44902	D	0.000419	T	0.63558	0.2521	.	.	.	0.80722	P	0.0	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.72947	-0.4137	7	0.72032	D	0.01	.	.	.	.	.	491;491	Q5VT03-2;Q5VT03	.;FA22D_HUMAN	Q	562;491;40;491	ENSP00000371116:L491Q;ENSP00000396080:L491Q	ENSP00000328439:L562Q	L	+	2	0	FAM22D	89114894	0.027000	0.19231	0.069000	0.20011	0.636000	0.38137	0.560000	0.23500	0.508000	0.28173	0.164000	0.16699	CTG	FAM22D	-	NULL	ENSG00000214562		0.637	NUTM2D-004	KNOWN	basic|appris_candidate_longest	protein_coding	FAM22D	HGNC	protein_coding	OTTHUMT00000470142.1	19	0.00	0	T	NR_075100		89124914	89124914	+1	no_errors	ENST00000381697	ensembl	human	known	69_37n	missense	13	27.78	5	SNP	0.092	A
FAM86B2	653333	genome.wustl.edu	37	8	12285250	12285250	+	Missense_Mutation	SNP	G	G	A	rs199873615	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr8:12285250G>A	ENST00000262365.4	-	7	807	c.808C>T	c.(808-810)Cgg>Tgg	p.R270W	FAM86B2_ENST00000393715.3_Missense_Mutation_p.R42W|FAM86B2_ENST00000309608.5_Missense_Mutation_p.P147L|FAM86B2_ENST00000351291.4_Missense_Mutation_p.R236W	NM_001137610.1	NP_001131082.1	P0C5J1	F86B2_HUMAN	family with sequence similarity 86, member B2	270										endometrium(1)|kidney(2)	3						TTGTGCTCCCGGCAGGCAGCC	0.607													g|||	517	0.103235	0.0121	0.1081	5008	,	,		11073	0.2252		0.1213	False		,,,				2504	0.0787					dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS59092.1	8p23.1	2011-07-01			ENSG00000145002	ENSG00000145002			32222	protein-coding gene	gene with protein product							Standard	NM_001137610		Approved		uc003wvt.4	P0C5J1	OTTHUMG00000165462	ENST00000262365.4:c.808C>T	8.37:g.12285250G>A	ENSP00000262365:p.Arg270Trp			Missense_Mutation	SNP	pfam_Nicotinamide_N-MeTfrase-like	p.R270W	ENST00000262365.4	37	c.808	CCDS59092.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	12.29|12.29	1.894306|1.894306	0.33442|0.33442	.|.	.|.	ENSG00000145002|ENSG00000145002	ENST00000309608;ENST00000532480|ENST00000393715;ENST00000262365;ENST00000351291;ENST00000527331	T;T|T;T;T;T	0.26373|0.26810	2.12;1.74|1.71;3.26;3.26;3.26	1.82|1.82	0.604|0.604	0.17547|0.17547	.|.	35.965900|.	0.00520|.	U|.	0.000195|.	T|T	0.24353|0.24353	0.0590|0.0590	M|M	0.65498|0.65498	2.005|2.005	0.09310|0.09310	N|N	1|1	.|B	.|0.16396	.|0.017	.|B	.|0.18561	.|0.022	T|T	0.27839|0.27839	-1.0062|-1.0062	8|9	0.87932|0.49607	D|T	0|0.09	.|.	5.3222|5.3222	0.15887|0.15887	0.0:0.0:0.468:0.532|0.0:0.0:0.468:0.532	.|.	.|270	.|P0C5J1	.|F86B2_HUMAN	L|W	147|42;270;236;236	ENSP00000311330:P147L;ENSP00000436338:P147L|ENSP00000377318:R42W;ENSP00000262365:R270W;ENSP00000283479:R236W;ENSP00000432491:R236W	ENSP00000311330:P147L|ENSP00000262365:R270W	P|R	-|-	2|1	0|2	FAM86B2|FAM86B2	12329621|12329621	0.701000|0.701000	0.27806|0.27806	0.012000|0.012000	0.15200|0.15200	0.020000|0.020000	0.10135|0.10135	0.558000|0.558000	0.23469|0.23469	0.945000|0.945000	0.37605|0.37605	0.162000|0.162000	0.16502|0.16502	CCG|CGG	FAM86B2	-	pfam_Nicotinamide_N-MeTfrase-like	ENSG00000145002		0.607	FAM86B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM86B2	HGNC	protein_coding		30	0.00	0	G	XM_928336		12285250	12285250	-1	no_errors	ENST00000262365	ensembl	human	known	69_37n	missense	16	20.00	4	SNP	0.116	A
FCGR3A	2214	genome.wustl.edu	37	1	161565479	161565479	+	Intron	SNP	G	G	A	rs111504845	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr1:161565479G>A	ENST00000540048.1	-	2	94				FCGR2B_ENST00000367962.4_Intron|FCGR2B_ENST00000428605.2_Intron|FCGR2B_ENST00000367960.5_Intron|FCGR2B_ENST00000403078.3_Intron|RP11-25K21.6_ENST00000537821.2_RNA|FCGR2C_ENST00000543859.1_RNA|FCGR2C_ENST00000473530.2_RNA|FCGR2C_ENST00000466542.2_RNA			P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor (CD16a)						Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	aatggagactgggcctgaaaa	0.418													.|||	2213	0.441893	0.3298	0.5144	5008	,	,		18739	0.62		0.331	False		,,,				2504	0.4724					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC036723	CCDS1232.1, CCDS44266.1	1q23	2014-09-17	2005-02-02		ENSG00000203747	ENSG00000203747		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3619	protein-coding gene	gene with protein product		146740	"""Fc fragment of IgG, low affinity IIIa, receptor for (CD16)"""	FCGR3, FCG3		2139735	Standard	NM_001127592		Approved	CD16, CD16a	uc001gar.3	P08637	OTTHUMG00000034466	ENST00000540048.1:c.61+34678C>T	1.37:g.161565479G>A			A2N6W9|Q53FJ0|Q53FL6|Q5EBR4|Q65ZM6|Q6PIJ0	Silent	SNP	NULL	p.L45	ENST00000540048.1	37	c.135		1																																																																																			FCGR2C	-	NULL	ENSG00000244682		0.418	FCGR3A-203	KNOWN	basic|appris_principal	protein_coding	FCGR2C	HGNC	protein_coding		20	0.00	0	G	NM_000569		161565479	161565479	+1	no_start_codon	ENST00000543859	ensembl	human	known	69_37n	silent	15	21.05	4	SNP	0.301	A
FSIP2	401024	genome.wustl.edu	37	2	186625770	186625770	+	Silent	SNP	A	A	G	rs7562137	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr2:186625770A>G	ENST00000424728.1	+	10	1134	c.1134A>G	c.(1132-1134)aaA>aaG	p.K378K	FSIP2_ENST00000343098.5_Silent_p.K467K|FSIP2_ENST00000546113.1_3'UTR			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	378										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						ATTTTACGAAAAAAAACTCAG	0.284													A|||	2706	0.540335	0.5582	0.4928	5008	,	,		15581	0.4702		0.5089	False		,,,				2504	0.6544					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.1134A>G	2.37:g.186625770A>G			Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Silent	SNP	NULL	p.K467	ENST00000424728.1	37	c.1401		2																																																																																			FSIP2	-	NULL	ENSG00000188738		0.284	FSIP2-001	KNOWN	basic	protein_coding	FSIP2	HGNC	protein_coding	OTTHUMT00000332778.3	40	0.00	0	A	NM_173651		186625770	186625770	+1	no_errors	ENST00000343098	ensembl	human	known	69_37n	silent	26	16.13	5	SNP	0.002	G
GADL1	339896	genome.wustl.edu	37	3	30769729	30769729	+	3'UTR	SNP	C	C	A			TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr3:30769729C>A	ENST00000282538.5	-	0	1721				GADL1_ENST00000498387.1_5'UTR	NM_207359.2	NP_997242.2	Q6ZQY3	GADL1_HUMAN	glutamate decarboxylase-like 1						carboxylic acid metabolic process (GO:0019752)		aspartate 1-decarboxylase activity (GO:0004068)|pyridoxal phosphate binding (GO:0030170)|sulfinoalanine decarboxylase activity (GO:0004782)			breast(2)|endometrium(3)|kidney(2)|lung(17)|upper_aerodigestive_tract(1)	25						GGACCAAAGCCACAGCTACAT	0.498																																						dbGAP											0													139.0	137.0	137.0					3																	30769729		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			AK128643	CCDS2649.2	3p23-p22	2009-01-14			ENSG00000144644	ENSG00000144644			27949	protein-coding gene	gene with protein product		615601					Standard	NM_207359		Approved		uc003cep.2	Q6ZQY3	OTTHUMG00000130621	ENST00000282538.5:c.*5G>T	3.37:g.30769729C>A				RNA	SNP	-	NULL	ENST00000282538.5	37	NULL	CCDS2649.2	3																																																																																			GADL1	-	-	ENSG00000144644		0.498	GADL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GADL1	HGNC	protein_coding	OTTHUMT00000253106.2	23	0.00	0	C	NM_207359		30769729	30769729	-1	no_errors	ENST00000498387	ensembl	human	known	69_37n	rna	20	31.03	9	SNP	1.000	A
GALNT2	2590	genome.wustl.edu	37	1	230417408	230417408	+	3'UTR	SNP	T	T	C	rs11620	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr1:230417408T>C	ENST00000366672.4	+	0	3992				GALNT2_ENST00000485438.1_3'UTR|RP5-956O18.3_ENST00000414640.1_RNA	NM_004481.3	NP_004472.1	Q10471	GALT2_HUMAN	polypeptide N-acetylgalactosaminyltransferase 2						cellular protein metabolic process (GO:0044267)|immunoglobulin biosynthetic process (GO:0002378)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(5)|skin(2)	32	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)				GCCCATGCCCTGGGGGCGGCG	0.662													T|||	2508	0.500799	0.5711	0.4452	5008	,	,		12854	0.5109		0.4404	False		,,,				2504	0.4969					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			BC041120	CCDS1582.1	1q41-q42	2014-03-13	2014-03-13		ENSG00000143641	ENSG00000143641	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4124	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 2"""	602274	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)"""			9592121, 7592619	Standard	NM_004481		Approved	GalNAc-T2	uc010pwa.1	Q10471	OTTHUMG00000037771	ENST00000366672.4:c.*2204T>C	1.37:g.230417408T>C			A8K1Y3|B7Z8V8|C5HU00|Q9NPY4	RNA	SNP	-	NULL	ENST00000366672.4	37	NULL	CCDS1582.1	1																																																																																			GALNT2	-	-	ENSG00000143641		0.662	GALNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT2	HGNC	protein_coding	OTTHUMT00000092158.1	42	0.00	0	T	NM_004481		230417408	230417408	+1	no_errors	ENST00000485438	ensembl	human	known	69_37n	rna	36	10.00	4	SNP	0.000	C
TTC41P	253724	genome.wustl.edu	37	12	104286804	104286804	+	IGR	SNP	C	C	T	rs7295499	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr12:104286804C>T								RP11-650K20.3 (48362 upstream) : RP11-642P15.1 (21000 downstream)																							TTCAATCCAGCGTTTGAGAAC	0.448													C|||	2925	0.584065	0.7247	0.4741	5008	,	,		20497	0.5337		0.5795	False		,,,				2504	0.5286					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															12.37:g.104286804C>T				RNA	SNP	-	NULL		37	NULL		12																																																																																			RP11-642P15.1	-	-	ENSG00000214198	0	0.448					GNN	Clone_based_vega_gene			38	0.00	0	C			104286804	104286804	-1	no_errors	ENST00000548520	ensembl	human	known	69_37n	rna	30	11.76	4	SNP	1.000	T
GOLGA8I	283796	genome.wustl.edu	37	15	23264983	23264983	+	Missense_Mutation	SNP	G	G	A	rs74732485	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr15:23264983G>A	ENST00000450802.3	+	17	1603	c.1505G>A	c.(1504-1506)cGt>cAt	p.R502H	AC091565.1_ENST00000459619.1_RNA|RN7SL495P_ENST00000461817.2_RNA	NM_001282468.1|NM_001282472.1|NM_001282484.1|NM_001282490.1|NM_001282493.1|NM_001282494.1	NP_001269397.1|NP_001269401.1|NP_001269413.1|NP_001269419.1|NP_001269422.1|NP_001269423.1	A6NC78	GOG8I_HUMAN	golgin A8 family, member I	502						Golgi apparatus (GO:0005794)|membrane (GO:0016020)											CCAGGGGGCCGTGCCAAAGAT	0.632													.|||	2888	0.576677	0.4244	0.5432	5008	,	,		10210	0.7927		0.502	False		,,,				2504	0.6605					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK093104		15q11.2	2013-01-17	2012-10-05	2012-10-05	ENSG00000153666	ENSG00000277561			26660	other	unknown	"""FLJ35785"""		"""golgi autoantigen, golgin subfamily a, 9 pseudogene"", ""golgin A9, pseudogene"", ""golgin A8 family, member I, pseudogene"""	GOLGA9P, GOLGA8IP			Standard	NR_024074		Approved	FLJ35785	uc001yvh.1	A6NC78	OTTHUMG00000129149	ENST00000450802.3:c.1505G>A	15.37:g.23264983G>A	ENSP00000399637:p.Arg502His			Missense_Mutation	SNP	NULL	p.R502H	ENST00000450802.3	37	c.1505		15	1153	0.5279304029304029	192	0.3902439024390244	173	0.47790055248618785	430	0.7517482517482518	358	0.47229551451187335	.	3.807	-0.040416	0.07497	.	.	ENSG00000153666	ENST00000450802	T	0.06933	3.24	0.829	0.829	0.18847	.	.	.	.	.	T	0.00012	0.0000	.	.	.	.	.	.	.	.	.	.	.	.	T	0.05194	-1.0900	5	0.42905	T	0.14	.	3.1987	0.06643	0.3001:0.0:0.6999:0.0	.	.	.	.	H	502	ENSP00000399637:R502H	ENSP00000399637:R502H	R	+	2	0	GOLGA8IP	20816424	0.783000	0.28701	0.321000	0.25320	0.028000	0.11728	1.052000	0.30429	0.782000	0.33613	0.109000	0.15622	CGT	GOLGA8IP	-	NULL	ENSG00000153666		0.632	GOLGA8I-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	GOLGA8IP	HGNC	protein_coding	OTTHUMT00000251213.2	37	0.00	0	G	NR_024074		23264983	23264983	+1	no_errors	ENST00000450802	ensembl	human	known	69_37n	missense	24	20.00	6	SNP	1.000	A
MROH2A	339766	genome.wustl.edu	37	2	234704318	234704318	+	Missense_Mutation	SNP	A	A	G	rs2361503	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr2:234704318A>G	ENST00000389758.3	+	9	1152	c.986A>G	c.(985-987)gAa>gGa	p.E329G				A6NES4	MRO2A_HUMAN	maestro heat-like repeat family member 2A	359																	CAGATCCTGGAACTGTCAGTC	0.552													A|||	3269	0.652756	0.7791	0.6599	5008	,	,		21529	0.6796		0.5666	False		,,,				2504	0.5378					dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS74674.1	2q37.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000185038	ENSG00000185038		"""maestro heat-like repeat containing"""	27936	protein-coding gene	gene with protein product			"""HEAT repeat containing 7B1"""	HEATR7B1		12477932	Standard	NM_001287395		Approved			A6NES4	OTTHUMG00000059037	ENST00000389758.3:c.986A>G	2.37:g.234704318A>G	ENSP00000374408:p.Glu329Gly			Missense_Mutation	SNP	superfamily_ARM-type_fold	p.E329G	ENST00000389758.3	37	c.986		2	1435	0.657051282051282	366	0.7439024390243902	233	0.643646408839779	401	0.701048951048951	435	0.5738786279683378	A	17.23	3.337455	0.60963	.	.	ENSG00000185038	ENST00000389758	T	0.09073	3.02	5.55	5.55	0.83447	.	0.000000	0.36591	N	0.002512	T	0.00012	0.0000	.	.	.	0.31217	P	0.6979770000000001	.	.	.	.	.	.	T	0.01858	-1.1259	6	0.49607	T	0.09	.	12.0769	0.53649	1.0:0.0:0.0:0.0	rs2361503;rs52811924;rs61429609;rs2361503	.	.	.	G	329	ENSP00000374408:E329G	ENSP00000374408:E329G	E	+	2	0	HEATR7B1	234369057	0.996000	0.38824	0.916000	0.36221	0.568000	0.35870	4.463000	0.60128	2.118000	0.64928	0.402000	0.26972	GAA	HEATR7B1	-	superfamily_ARM-type_fold	ENSG00000185038		0.552	MROH2A-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	HEATR7B1	HGNC	protein_coding	OTTHUMT00000130646.6	61	0.00	0	A	XM_291007		234704318	234704318	+1	no_errors	ENST00000389758	ensembl	human	novel	69_37n	missense	36	10.00	4	SNP	0.964	G
HLA-DRB6	3128	genome.wustl.edu	37	6	32525779	32525779	+	RNA	SNP	G	G	T	rs77527755	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr6:32525779G>T	ENST00000411500.1	-	0	371					NR_001298.1				major histocompatibility complex, class II, DR beta 6 (pseudogene)																		CCTCCGGGATGCCCTTCTGGC	0.597													T|||	783	0.15635	0.1596	0.2133	5008	,	,		4792	0.0645		0.2266	False		,,,				2504	0.1339					dbGAP											0																																										-	-	-			0			L76566		6p21.3	2011-07-08			ENSG00000229391	ENSG00000229391		"""Histocompatibility complex"""	4954	pseudogene	pseudogene						1529427, 10436177	Standard	NR_001298		Approved		uc003obn.1		OTTHUMG00000031028		6.37:g.32525779G>T				RNA	SNP	-	NULL	ENST00000411500.1	37	NULL		6																																																																																			HLA-DRB6	-	-	ENSG00000229391		0.597	HLA-DRB6-002	KNOWN	basic	processed_transcript	HLA-DRB6	HGNC	pseudogene	OTTHUMT00000272900.1	73	0.00	0	G	NR_001298		32525779	32525779	-1	no_errors	ENST00000411500	ensembl	human	known	69_37n	rna	33	13.16	5	SNP	0.000	T
HLA-DRB6	3128	genome.wustl.edu	37	6	32525861	32525861	+	RNA	SNP	C	C	G	rs59057355	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr6:32525861C>G	ENST00000411500.1	-	0	289					NR_001298.1				major histocompatibility complex, class II, DR beta 6 (pseudogene)																		GCTGTCGAAGCGCAGGTTCTC	0.557													C|||	814	0.16254	0.1687	0.2089	5008	,	,		5165	0.0734		0.2366	False		,,,				2504	0.137					dbGAP											0																																										-	-	-			0			L76566		6p21.3	2011-07-08			ENSG00000229391	ENSG00000229391		"""Histocompatibility complex"""	4954	pseudogene	pseudogene						1529427, 10436177	Standard	NR_001298		Approved		uc003obn.1		OTTHUMG00000031028		6.37:g.32525861C>G				RNA	SNP	-	NULL	ENST00000411500.1	37	NULL		6																																																																																			HLA-DRB6	-	-	ENSG00000229391		0.557	HLA-DRB6-002	KNOWN	basic	processed_transcript	HLA-DRB6	HGNC	pseudogene	OTTHUMT00000272900.1	46	0.00	0	C	NR_001298		32525861	32525861	-1	no_errors	ENST00000411500	ensembl	human	known	69_37n	rna	25	13.79	4	SNP	0.014	G
HLA-DMA	3108	genome.wustl.edu	37	6	32920165	32920165	+	Intron	SNP	G	G	A	rs115420072	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr6:32920165G>A	ENST00000374843.4	-	1	174				HLA-DMA_ENST00000395305.3_Intron|XXbac-BPG181M17.5_ENST00000429234.1_Intron|HLA-DMA_ENST00000395303.3_Intron|HLA-DMA_ENST00000464392.1_Intron	NM_006120.3	NP_006111.2	P28067	DMA_HUMAN	major histocompatibility complex, class II, DM alpha						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|chaperone mediated protein folding requiring cofactor (GO:0051085)|immunoglobulin mediated immune response (GO:0016064)|inner ear development (GO:0048839)|peptide antigen assembly with MHC class II protein complex (GO:0002503)|positive regulation of immune response (GO:0050778)|positive regulation of T cell differentiation (GO:0045582)|positive thymic T cell selection (GO:0045059)|protein transport (GO:0015031)	cell surface (GO:0009986)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|multivesicular body (GO:0005771)	MHC class II protein complex binding (GO:0023026)			kidney(1)|large_intestine(2)|lung(8)	11						AATGGGAGAAGTGACCCCATA	0.458													G|||	127	0.0253594	0.0522	0.0389	5008	,	,		20525	0.001		0.0298	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS4761.1	6p21.3	2013-01-11			ENSG00000204257	ENSG00000204257		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4934	protein-coding gene	gene with protein product		142855				1922385	Standard	NM_006120		Approved	D6S222E, RING6	uc003ocm.2	P28067	OTTHUMG00000031173	ENST00000374843.4:c.88+560C>T	6.37:g.32920165G>A			Q29639|Q29640	Missense_Mutation	SNP	pfam_MHC_II_a_N,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_a_N,smart_Ig_C1-set,pfscan_Ig-like	p.T25I	ENST00000374843.4	37	c.74	CCDS4761.1	6	57	0.0260989010989011	23	0.046747967479674794	11	0.03038674033149171	1	0.0017482517482517483	22	0.029023746701846966	G	9.056	0.993275	0.19043	.	.	ENSG00000204257	ENST00000456800	T	0.00808	5.67	3.54	0.559	0.17272	.	.	.	.	.	T	0.00468	0.0015	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.47446	-0.9117	6	0.87932	D	0	.	3.2441	0.06791	0.2846:0.2397:0.4757:0.0	.	.	.	.	I	25	ENSP00000409668:T25I	ENSP00000409668:T25I	T	-	2	0	HLA-DMA	33028143	0.002000	0.14202	0.000000	0.03702	0.003000	0.03518	0.030000	0.13688	0.090000	0.17273	-0.148000	0.13756	ACT	HLA-DMA	-	NULL	ENSG00000204257		0.458	HLA-DMA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-DMA	HGNC	protein_coding	OTTHUMT00000076325.2	55	0.00	0	G	NM_006120		32920165	32920165	-1	no_start_codon:no_stop_codon:bad_bp_length_for_coding_region	ENST00000456800	ensembl	human	known	69_37n	missense	40	13.04	6	SNP	0.000	A
HMCN1	83872	genome.wustl.edu	37	1	185880813	185880813	+	Silent	SNP	G	G	A			TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr1:185880813G>A	ENST00000271588.4	+	6	1030	c.801G>A	c.(799-801)ctG>ctA	p.L267L	HMCN1_ENST00000367492.2_Silent_p.L267L	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	267					response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CAGGGAAGCTGATAAAAAAGG	0.388																																						dbGAP											0													216.0	230.0	225.0					1																	185880813		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.801G>A	1.37:g.185880813G>A			A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd,pfam_Thrombospondin_1_rpt,superfamily_Green_fluorescent_prot-like,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like	p.L267	ENST00000271588.4	37	c.801	CCDS30956.1	1																																																																																			HMCN1	-	NULL	ENSG00000143341		0.388	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	14	0.00	0	G	NM_031935		185880813	185880813	+1	no_errors	ENST00000271588	ensembl	human	known	69_37n	silent	14	22.22	4	SNP	0.998	A
IGKJ5	28946	genome.wustl.edu	37	2	89161547	89161547	+	RNA	SNP	A	A	G	rs232222	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr2:89161547A>G	ENST00000390238.2	-	0	0				IGKJ3_ENST00000390240.2_RNA|IGKJ2_ENST00000390241.2_RNA|IGKJ1_ENST00000390242.2_RNA|IGKJ4_ENST00000390239.2_RNA|AC096579.7_ENST00000430694.1_RNA|AC096579.13_ENST00000452230.1_RNA					immunoglobulin kappa joining 5																		AGGTGTGGAAACCCTGAGGCT	0.453													G|||	1935	0.386382	0.4834	0.4308	5008	,	,		7837	0.376		0.3688	False		,,,				2504	0.2526					dbGAP											0																																										-	-	-			0			J00242		2p11.2	2012-10-05			ENSG00000211593	ENSG00000211593		"""Immunoglobulins / IGK locus"""	5723	other	immunoglobulin gene							Standard	NG_000834		Approved				OTTHUMG00000151676		2.37:g.89161547A>G				RNA	SNP	-	NULL	ENST00000390238.2	37	NULL		2																																																																																			IGKJ5	-	-	ENSG00000231486		0.453	IGKJ5-001	KNOWN	mRNA_start_NF|mRNA_end_NF|cds_start_NF|cds_end_NF|basic|appris_principal	IG_J_gene	IGKJ5	HGNC	IG_J_gene	OTTHUMT00000323474.1	42	0.00	0	A	NG_000834		89161547	89161547	-1	no_errors	ENST00000430694	ensembl	human	known	69_37n	rna	28	12.50	4	SNP	0.000	G
IVNS1ABP	10625	genome.wustl.edu	37	1	185267114	185267114	+	3'UTR	SNP	A	A	G	rs10174	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr1:185267114A>G	ENST00000367498.3	-	0	2604				IVNS1ABP_ENST00000392007.3_3'UTR|IVNS1ABP_ENST00000459929.1_5'UTR	NM_006469.4	NP_006460.2	Q9Y6Y0	NS1BP_HUMAN	influenza virus NS1A binding protein						negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|response to virus (GO:0009615)|RNA splicing (GO:0008380)|transcription from RNA polymerase III promoter (GO:0006383)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|spliceosomal complex (GO:0005681)|transcription factor complex (GO:0005667)				breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|ovary(4)|prostate(2)	29						GTGTACCTCTACTAACCATAA	0.363													A|||	2195	0.438299	0.621	0.3314	5008	,	,		19602	0.247		0.4225	False		,,,				2504	0.4806					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AB020657	CCDS1368.1	1q25.1-q31.1	2013-01-30			ENSG00000116679	ENSG00000116679		"""Kelch-like"", ""BTB/POZ domain containing"""	16951	protein-coding gene	gene with protein product	"""kelch-like family member 39"""	609209				9696811, 10048485	Standard	NM_006469		Approved	NS1-BP, HSPC068, NS-1, KIAA0850, ND1, KLHL39	uc001grl.3	Q9Y6Y0	OTTHUMG00000035384	ENST00000367498.3:c.*53T>C	1.37:g.185267114A>G			A8K8R6|Q1G4T6|Q1G4T7|Q5TF75|Q6NW38|Q7LCG2|Q9NZX0|Q9Y480	RNA	SNP	-	NULL	ENST00000367498.3	37	NULL	CCDS1368.1	1																																																																																			IVNS1ABP	-	-	ENSG00000116679		0.363	IVNS1ABP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IVNS1ABP	HGNC	protein_coding	OTTHUMT00000085774.1	51	0.00	0	A	NM_006469		185267114	185267114	-1	no_errors	ENST00000459929	ensembl	human	known	69_37n	rna	63	10.00	7	SNP	1.000	G
JAGN1	84522	genome.wustl.edu	37	3	9932337	9932337	+	5'UTR	SNP	G	G	C	rs279558|rs11554809	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr3:9932337G>C	ENST00000307768.4	+	0	100				JAGN1_ENST00000489724.1_3'UTR	NM_032492.3	NP_115881.3			jagunal homolog 1 (Drosophila)											breast(1)|central_nervous_system(1)|endometrium(4)|lung(3)|ovary(1)	10	Medulloblastoma(99;0.227)					AATAGGGTCAGTGGGCCGCTT	0.687													G|||	3121	0.623203	0.4614	0.6225	5008	,	,		11718	0.7093		0.6909	False		,,,				2504	0.684					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AK074760	CCDS2588.1	3p25.2	2010-03-23			ENSG00000171135	ENSG00000171135			26926	protein-coding gene	gene with protein product						12477932	Standard	NM_032492		Approved	GL009, FLJ14602	uc003btt.4	Q8N5M9	OTTHUMG00000128523	ENST00000307768.4:c.-70G>C	3.37:g.9932337G>C				RNA	SNP	-	NULL	ENST00000307768.4	37	NULL	CCDS2588.1	3																																																																																			JAGN1	-	-	ENSG00000171135		0.687	JAGN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAGN1	HGNC	protein_coding	OTTHUMT00000250335.1	78	0.00	0	G	NM_032492		9932337	9932337	+1	no_errors	ENST00000489724	ensembl	human	known	69_37n	rna	50	16.67	10	SNP	0.000	C
KRT17	3872	genome.wustl.edu	37	17	39777867	39777867	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr17:39777867G>A	ENST00000311208.8	-	4	879	c.812C>T	c.(811-813)gCc>gTc	p.A271V	JUP_ENST00000540235.1_Missense_Mutation_p.A430V	NM_000422.2	NP_000413.1	Q04695	K1C17_HUMAN	keratin 17	271	Coil 2.|Rod.				epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinization (GO:0031424)|morphogenesis of an epithelium (GO:0002009)|positive regulation of cell growth (GO:0030307)|positive regulation of hair follicle development (GO:0051798)|positive regulation of translation (GO:0045727)|signal transduction (GO:0007165)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	MHC class II protein binding (GO:0042289)|MHC class II receptor activity (GO:0032395)|structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	12		Breast(137;0.000307)				CCAATCCTCGGCATCCTTGCG	0.607																																					Pancreas(92;1242 2086 39193 50508)	dbGAP											0													104.0	94.0	98.0					17																	39777867		2203	4300	6503	-	-	-	SO:0001583	missense	0			X62571	CCDS11402.1	17q21.2	2014-06-12			ENSG00000128422	ENSG00000128422		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6427	protein-coding gene	gene with protein product		148069		PCHC1		7539673, 1281771, 16831889	Standard	NM_000422		Approved		uc002hxh.2	Q04695	OTTHUMG00000133505	ENST00000311208.8:c.812C>T	17.37:g.39777867G>A	ENSP00000308452:p.Ala271Val		A5Z1M9|A5Z1N0|A5Z1N1|A5Z1N2|A6NDV6|A6NKQ2|Q6IP98|Q8N1P6	Missense_Mutation	SNP	pfam_F,pfam_Armadillo,superfamily_ARM-type_fold,superfamily_Prefoldin,smart_Armadillo,pfscan_Armadillo,prints_Keratin_I,prints_Beta-catenin	p.A430V	ENST00000311208.8	37	c.1289	CCDS11402.1	17	.	.	.	.	.	.	.	.	.	.	G	16.06	3.015125	0.54468	.	.	ENSG00000128422;ENSG00000173801	ENST00000311208;ENST00000540235	D;D	0.82081	-1.57;-1.57	3.69	2.7	0.31948	Prefoldin (1);Filament (1);	0.000000	0.46758	D	0.000266	T	0.78444	0.4284	L	0.46885	1.475	0.28758	N	0.901066	B	0.23854	0.092	B	0.33339	0.162	T	0.67975	-0.5531	10	0.24483	T	0.36	.	12.6773	0.56901	0.0:0.0:0.8336:0.1664	.	271	Q04695	K1C17_HUMAN	V	271;430	ENSP00000308452:A271V;ENSP00000441751:A430V	ENSP00000441751:A430V	A	-	2	0	JUP;KRT17	37031393	1.000000	0.71417	0.534000	0.28014	0.840000	0.47671	4.907000	0.63300	0.881000	0.35993	0.561000	0.74099	GCC	JUP	-	pfam_F,superfamily_Prefoldin	ENSG00000173801		0.607	KRT17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JUP	HGNC	protein_coding	OTTHUMT00000257460.1	111	0.00	0	G	NM_000422		39777867	39777867	-1	no_errors	ENST00000540235	ensembl	human	known	69_37n	missense	60	32.58	29	SNP	0.905	A
KANK4	163782	genome.wustl.edu	37	1	62739852	62739852	+	Silent	SNP	G	G	A			TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr1:62739852G>A	ENST00000371153.4	-	3	1302	c.924C>T	c.(922-924)agC>agT	p.S308S	KANK4_ENST00000354381.3_Intron|KANK4_ENST00000371150.1_5'Flank	NM_181712.4	NP_859063.3	Q5T7N3	KANK4_HUMAN	KN motif and ankyrin repeat domains 4	308	Pro-rich.					cytoplasm (GO:0005737)		p.S308S(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(49)|ovary(3)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	81						GTGGAATCTCGCTGATGTTGA	0.587																																						dbGAP											1	Substitution - coding silent(1)	prostate(1)											60.0	52.0	55.0					1																	62739852		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK096259	CCDS620.1	1p31.3	2013-10-11	2008-01-29	2008-01-29	ENSG00000132854	ENSG00000132854		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	27263	protein-coding gene	gene with protein product		614612	"""ankyrin repeat domain 38"""	ANKRD38		17996375, 19554261	Standard	NM_181712		Approved	KIAA0172	uc001dah.4	Q5T7N3	OTTHUMG00000008971	ENST00000371153.4:c.924C>T	1.37:g.62739852G>A			B1ALP7|Q6P9A0|Q86T71|Q86VE6|Q8NAX3	Silent	SNP	pfam_KN_motif,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S308	ENST00000371153.4	37	c.924	CCDS620.1	1																																																																																			KANK4	-	NULL	ENSG00000132854		0.587	KANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KANK4	HGNC	protein_coding	OTTHUMT00000024877.1	30	0.00	0	G	NM_181712		62739852	62739852	-1	no_errors	ENST00000371153	ensembl	human	known	69_37n	silent	21	32.26	10	SNP	0.474	A
KIAA0087	9808	genome.wustl.edu	37	7	26576535	26576535	+	Missense_Mutation	SNP	T	T	C	rs740182	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr7:26576535T>C	ENST00000242109.3	-	2	487	c.254A>G	c.(253-255)aAt>aGt	p.N85S				Q14695	K0087_HUMAN	KIAA0087	85			S -> N (in dbSNP:rs740182). {ECO:0000269|PubMed:12853948}.														CTTCAAAGTATTTCTCGGTCC	0.507													C|||	2443	0.487819	0.6762	0.5994	5008	,	,		20062	0.1974		0.6193	False		,,,				2504	0.318					dbGAP											0																																										-	-	-	SO:0001583	missense	0			BC128257		7p15.2	2013-01-16			ENSG00000122548	ENSG00000122548			22191	other	unknown							Standard	NR_022006		Approved		uc003sya.2	Q14695	OTTHUMG00000023321	ENST00000242109.3:c.254A>G	7.37:g.26576535T>C	ENSP00000242109:p.Asn85Ser		A1A524|Q75MW1	Missense_Mutation	SNP	NULL	p.N85S	ENST00000242109.3	37	c.254		7	1132	0.5183150183150184	340	0.6910569105691057	212	0.585635359116022	120	0.2097902097902098	460	0.6068601583113457	C	4.087	0.014204	0.07959	.	.	ENSG00000122548	ENST00000242109	T	0.39997	1.05	3.67	1.76	0.24704	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.34477	-0.9827	5	0.87932	D	0	.	4.5542	0.12128	0.4286:0.4614:0.0:0.1099	rs740182;rs3735553;rs10387095;rs52791934;rs58044469;rs740182	.	.	.	S	85	ENSP00000242109:N85S	ENSP00000242109:N85S	N	-	2	0	KIAA0087	26543060	0.052000	0.20516	0.002000	0.10522	0.002000	0.02628	0.731000	0.26058	0.146000	0.19002	-0.810000	0.03169	AAT	KIAA0087	-	NULL	ENSG00000122548		0.507	KIAA0087-088	KNOWN	basic|appris_principal	protein_coding	KIAA0087	HGNC	protein_coding	OTTHUMT00000328273.1	102	0.97	1	T	NR_022006		26576535	26576535	-1	no_errors	ENST00000242109	ensembl	human	known	69_37n	missense	54	11.48	7	SNP	0.002	C
CEMIP	57214	genome.wustl.edu	37	15	81225627	81225627	+	Silent	SNP	C	C	T			TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr15:81225627C>T	ENST00000394685.3	+	23	3254	c.2835C>T	c.(2833-2835)ttC>ttT	p.F945F	KIAA1199_ENST00000356249.5_Silent_p.F945F|RP11-351M8.2_ENST00000560873.1_RNA|KIAA1199_ENST00000220244.3_Silent_p.F945F			Q8WUJ3	CEMIP_HUMAN		945					hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						GGCCCTGGTTCAACCAGCTGG	0.542																																						dbGAP											0													102.0	95.0	97.0					15																	81225627		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000394685.3:c.2835C>T	15.37:g.81225627C>T			Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Silent	SNP	pfam_G8_domain,superfamily_Pectin_lyase_fold/virulence	p.F945	ENST00000394685.3	37	c.2835	CCDS10315.1	15																																																																																			KIAA1199	-	superfamily_Pectin_lyase_fold/virulence	ENSG00000103888		0.542	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1199	HGNC	protein_coding	OTTHUMT00000291389.1	62	0.00	0	C			81225627	81225627	+1	no_errors	ENST00000220244	ensembl	human	known	69_37n	silent	32	11.11	4	SNP	1.000	T
KLHL17	339451	genome.wustl.edu	37	1	900505	900505	+	Silent	SNP	G	G	C	rs28705211	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr1:900505G>C	ENST00000338591.3	+	12	1970	c.1863G>C	c.(1861-1863)gtG>gtC	p.V621V	PLEKHN1_ENST00000379410.3_5'Flank|PLEKHN1_ENST00000379409.2_5'Flank|PLEKHN1_ENST00000379407.3_5'Flank	NM_198317.2	NP_938073.1	Q6TDP4	KLH17_HUMAN	kelch-like family member 17	621	Interaction with F-actin. {ECO:0000250}.				actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|protein ubiquitination (GO:0016567)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|dendrite cytoplasm (GO:0032839)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	protein complex scaffold (GO:0032947)			central_nervous_system(1)|kidney(2)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;1.52e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.59e-23)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.000469)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		GTGTGGCGGTGCTGGAGCTGC	0.642													G|||	845	0.16873	0.0174	0.2017	5008	,	,		10946	0.0913		0.2903	False		,,,				2504	0.3047					dbGAP											0													107.0	82.0	90.0					1																	900505		2198	4298	6496	-	-	-	SO:0001819	synonymous_variant	0			AY423763	CCDS30550.1	1p36	2013-01-30	2013-01-30		ENSG00000187961	ENSG00000187961		"""Kelch-like"", ""BTB/POZ domain containing"""	24023	protein-coding gene	gene with protein product	"""actinfilin"""		"""kelch-like 17 (Drosophila)"""			12063253	Standard	NM_198317		Approved		uc001aca.2	Q6TDP4	OTTHUMG00000040721	ENST00000338591.3:c.1863G>C	1.37:g.900505G>C			Q5SV94	Silent	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.V621	ENST00000338591.3	37	c.1863	CCDS30550.1	1																																																																																			KLHL17	-	smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000187961		0.642	KLHL17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL17	HGNC	protein_coding	OTTHUMT00000097875.3	128	0.00	0	G	NM_198317		900505	900505	+1	no_errors	ENST00000338591	ensembl	human	known	69_37n	silent	61	11.43	8	SNP	1.000	C
LAMA3	3909	genome.wustl.edu	37	18	21534701	21534701	+	3'UTR	SNP	C	C	A	rs1051149|rs386801660	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr18:21534701C>A	ENST00000313654.9	+	0	10332				LAMA3_ENST00000588770.1_3'UTR|LAMA3_ENST00000269217.6_3'UTR	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3						cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					TCATTCTTCACTCAGGACACA	0.428													C|||	1801	0.359625	0.2035	0.4337	5008	,	,		16537	0.1776		0.6561	False		,,,				2504	0.4008					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.*89C>A	18.37:g.21534701C>A			B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	RNA	SNP	-	NULL	ENST00000313654.9	37	NULL	CCDS42419.1	18																																																																																			LAMA3	-	-	ENSG00000053747		0.428	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA3	HGNC	protein_coding	OTTHUMT00000254824.3	22	0.00	0	C	NM_000227, NM_198129		21534701	21534701	+1	no_errors	ENST00000588770	ensembl	human	known	69_37n	rna	27	15.62	5	SNP	0.000	A
LAMA3	3909	genome.wustl.edu	37	18	21534703	21534703	+	3'UTR	SNP	C	C	T	rs1051150|rs386801660	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr18:21534703C>T	ENST00000313654.9	+	0	10334				LAMA3_ENST00000588770.1_3'UTR|LAMA3_ENST00000269217.6_3'UTR	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3						cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					ATTCTTCACTCAGGACACAAA	0.418													C|||	1801	0.359625	0.2035	0.4337	5008	,	,		16637	0.1776		0.6561	False		,,,				2504	0.4008					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.*91C>T	18.37:g.21534703C>T			B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	RNA	SNP	-	NULL	ENST00000313654.9	37	NULL	CCDS42419.1	18																																																																																			LAMA3	-	-	ENSG00000053747		0.418	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA3	HGNC	protein_coding	OTTHUMT00000254824.3	23	0.00	0	C	NM_000227, NM_198129		21534703	21534703	+1	no_errors	ENST00000588770	ensembl	human	known	69_37n	rna	26	16.13	5	SNP	0.000	T
LEO1	123169	genome.wustl.edu	37	15	52258527	52258527	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr15:52258527delT	ENST00000299601.5	-	2	293	c.233delA	c.(232-234)gatfs	p.D78fs	LEO1_ENST00000315141.5_Frame_Shift_Del_p.D78fs	NM_138792.2	NP_620147.1	Q8WVC0	LEO1_HUMAN	Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)	78	Asp-rich.				endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of myeloid cell differentiation (GO:0045638)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|skin(1)	14				all cancers(107;0.00264)		AGAGTGATTATCACTACCACT	0.443																																					Esophageal Squamous(40;229 896 18505 32465 43844)|Ovarian(53;886 1123 14462 18432 23189)	dbGAP											0													242.0	216.0	225.0					15																	52258527		2195	4293	6488	-	-	-	SO:0001589	frameshift_variant	0			AY302186	CCDS10146.1, CCDS66767.1	15q21.2	2008-02-05			ENSG00000166477	ENSG00000166477			30401	protein-coding gene	gene with protein product		610507				15632063	Standard	NM_001286430		Approved		uc002abo.3	Q8WVC0	OTTHUMG00000131843	ENST00000299601.5:c.233delA	15.37:g.52258527delT	ENSP00000299601:p.Asp78fs		Q96N99	Frame_Shift_Del	DEL	pfam_Leo1	p.D78fs	ENST00000299601.5	37	c.233	CCDS10146.1	15																																																																																			LEO1	-	NULL	ENSG00000166477		0.443	LEO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEO1	HGNC	protein_coding	OTTHUMT00000254791.2	49	0.00	0	T	NM_138792		52258527	52258527	-1	no_errors	ENST00000299601	ensembl	human	known	69_37n	frame_shift_del	27	30.00	12	DEL	1.000	-
LINC00243	401247	genome.wustl.edu	37	6	30781904	30781904	+	RNA	SNP	G	G	A	rs12210318	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr6:30781904G>A	ENST00000399196.1	-	0	790									long intergenic non-protein coding RNA 243																		TCACTCTCTCGGCATCAGCCT	0.522													G|||	450	0.0898562	0.0454	0.0432	5008	,	,		19469	0.1637		0.1282	False		,,,				2504	0.0675					dbGAP											0																																										-	-	-			0			AK098012		6p21.33	2012-10-12	2011-08-11	2011-08-11	ENSG00000236006	ENSG00000214894		"""Long non-coding RNAs"""	30956	non-coding RNA	RNA, long non-coding			"""chromosome 6 open reading frame 214 (putative)"", ""non-protein coding RNA 243"""	C6orf214, NCRNA00243			Standard	XR_159458		Approved	bQB230F21.2, FLJ40693, bQB10J12.2			OTTHUMG00000031539		6.37:g.30781904G>A				RNA	SNP	-	NULL	ENST00000399196.1	37	NULL		6																																																																																			LINC00243	-	-	ENSG00000214894		0.522	LINC00243-001	KNOWN	basic|exp_conf	processed_transcript	LINC00243	HGNC	processed_transcript	OTTHUMT00000076501.3	28	0.00	0	G			30781904	30781904	-1	no_errors	ENST00000399196	ensembl	human	known	69_37n	rna	14	22.22	4	SNP	0.000	A
LINC00243	401247	genome.wustl.edu	37	6	30781923	30781923	+	RNA	SNP	T	T	C	rs4286818	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr6:30781923T>C	ENST00000399196.1	-	0	771									long intergenic non-protein coding RNA 243																		CTTGTGCCTATACCCACAGGA	0.507													C|||	2045	0.408347	0.1316	0.4755	5008	,	,		18905	0.6508		0.3131	False		,,,				2504	0.5828					dbGAP											0																																										-	-	-			0			AK098012		6p21.33	2012-10-12	2011-08-11	2011-08-11	ENSG00000236006	ENSG00000214894		"""Long non-coding RNAs"""	30956	non-coding RNA	RNA, long non-coding			"""chromosome 6 open reading frame 214 (putative)"", ""non-protein coding RNA 243"""	C6orf214, NCRNA00243			Standard	XR_159458		Approved	bQB230F21.2, FLJ40693, bQB10J12.2			OTTHUMG00000031539		6.37:g.30781923T>C				RNA	SNP	-	NULL	ENST00000399196.1	37	NULL		6																																																																																			LINC00243	-	-	ENSG00000214894		0.507	LINC00243-001	KNOWN	basic|exp_conf	processed_transcript	LINC00243	HGNC	processed_transcript	OTTHUMT00000076501.3	35	0.00	0	T			30781923	30781923	-1	no_errors	ENST00000399196	ensembl	human	known	69_37n	rna	14	30.00	6	SNP	0.000	C
LINC00667	339290	genome.wustl.edu	37	18	5233105	5233105	+	lincRNA	SNP	C	C	G	rs3887348	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr18:5233105C>G	ENST00000579933.1	-	0	746																											GTTTACTTGGCCCTCTGCCTC	0.532													A|||	1972	0.39377	0.6589	0.3271	5008	,	,		17375	0.0734		0.3857	False		,,,				2504	0.4213					dbGAP											0																																										-	-	-			0																															18.37:g.5233105C>G				RNA	SNP	-	NULL	ENST00000579933.1	37	NULL		18																																																																																			LINC00667	-	-	ENSG00000263753		0.532	RP11-835E18.5-001	KNOWN	basic	lincRNA	LINC00667	HGNC	lincRNA	OTTHUMT00000444199.1	22	0.00	0	C			5233105	5233105	+1	no_errors	ENST00000458396	ensembl	human	known	69_37n	rna	17	19.05	4	SNP	1.000	G
MCF2L	23263	genome.wustl.edu	37	13	113698785	113698785	+	Intron	SNP	G	G	A	rs4907577	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr13:113698785G>A	ENST00000375608.3	+	5	426				MCF2L_ENST00000375601.3_Intron|MCF2L_ENST00000535094.2_Intron|MCF2L_ENST00000434480.2_Intron|MCF2L_ENST00000423482.2_Intron|MCF2L_ENST00000397021.1_5'Flank|MCF2L_ENST00000480321.1_3'UTR|MCF2L_ENST00000442652.2_Intron|MCF2L_ENST00000397030.1_Intron|MCF2L_ENST00000375604.2_Intron|MCF2L_ENST00000375597.4_Intron|MCF2L_ENST00000421756.1_Intron			O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming sequence-like						apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular space (GO:0005615)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			kidney(1)|large_intestine(5)|ovary(1)|stomach(1)	8	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				TGATTTTCATGTAAACCTAGG	0.473											OREG0003848	type=REGULATORY REGION|Gene=MCF2L|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	G|||	1221	0.24381	0.2685	0.3026	5008	,	,		21906	0.1319		0.2724	False		,,,				2504	0.2546					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB002360	CCDS9527.2, CCDS45070.1, CCDS9527.3, CCDS45070.2	13q34	2013-01-10			ENSG00000126217	ENSG00000126217		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14576	protein-coding gene	gene with protein product		609499				9205841	Standard	NM_001112732		Approved	KIAA0362, DBS, OST, ARHGEF14	uc010tjr.2	O15068	OTTHUMG00000017377	ENST00000375608.3:c.369-800G>A	13.37:g.113698785G>A		1452	A2A2X1|A2A2X2|A2A3G6|A2A3G8|B4DHD6|B4DIL6|E9PDN8|Q5JU56|Q5VXT1|Q6ZWD4|Q765G8|Q765G9|Q8N679	RNA	SNP	-	NULL	ENST00000375608.3	37	NULL		13																																																																																			MCF2L	-	-	ENSG00000126217		0.473	MCF2L-001	KNOWN	basic	protein_coding	MCF2L	HGNC	protein_coding	OTTHUMT00000045849.4	9	0.00	0	G			113698785	113698785	+1	no_errors	ENST00000480321	ensembl	human	known	69_37n	rna	6	40.00	4	SNP	0.000	A
MCF2L	23263	genome.wustl.edu	37	13	113708697	113708697	+	Intron	SNP	C	C	T	rs7319791	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr13:113708697C>T	ENST00000375608.3	+	6	517				MCF2L_ENST00000375601.3_Intron|MCF2L_ENST00000535094.2_Intron|MCF2L_ENST00000434480.2_Intron|MCF2L_ENST00000423482.2_Intron|MCF2L_ENST00000442652.2_Intron|MCF2L_ENST00000397030.1_Intron|MCF2L_ENST00000375604.2_Intron|MCF2L_ENST00000375597.4_Intron|MCF2L_ENST00000421756.1_Intron			O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming sequence-like						apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular space (GO:0005615)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			kidney(1)|large_intestine(5)|ovary(1)|stomach(1)	8	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				GATGGCCTCACGCACACGGCA	0.552													C|||	1488	0.297125	0.3177	0.3429	5008	,	,		16650	0.128		0.3757	False		,,,				2504	0.3303					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB002360	CCDS9527.2, CCDS45070.1, CCDS9527.3, CCDS45070.2	13q34	2013-01-10			ENSG00000126217	ENSG00000126217		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14576	protein-coding gene	gene with protein product		609499				9205841	Standard	NM_001112732		Approved	KIAA0362, DBS, OST, ARHGEF14	uc010tjr.2	O15068	OTTHUMG00000017377	ENST00000375608.3:c.460-6210C>T	13.37:g.113708697C>T			A2A2X1|A2A2X2|A2A3G6|A2A3G8|B4DHD6|B4DIL6|E9PDN8|Q5JU56|Q5VXT1|Q6ZWD4|Q765G8|Q765G9|Q8N679	RNA	SNP	-	NULL	ENST00000375608.3	37	NULL		13																																																																																			MCF2L	-	-	ENSG00000126217		0.552	MCF2L-001	KNOWN	basic	protein_coding	MCF2L	HGNC	protein_coding	OTTHUMT00000045849.4	54	0.00	0	C			113708697	113708697	+1	no_errors	ENST00000494043	ensembl	human	known	69_37n	rna	50	10.71	6	SNP	0.002	T
MICA	100507436	genome.wustl.edu	37	6	31379931	31379931	+	Missense_Mutation	SNP	G	G	A	rs1063635	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr6:31379931G>A	ENST00000449934.2	+	4	875	c.821G>A	c.(820-822)cGa>cAa	p.R274Q	HCP5_ENST00000414046.2_RNA	NM_001177519.1	NP_001170990.1			MHC class I polypeptide-related sequence A											breast(1)|endometrium(3)|kidney(1)	5		Ovarian(999;0.0253)				AGGATTTGCCGAGGAGAGGAG	0.602													a|||	2921	0.583267	0.7519	0.6196	5008	,	,		19002	0.4226		0.5089	False		,,,				2504	0.5716					dbGAP											0													20.0	19.0	19.0					6																	31379931		692	1591	2283	-	-	-	SO:0001583	missense	0			L14848	CCDS56412.1, CCDS75421.1	6p21.3	2013-01-11			ENSG00000204520	ENSG00000204520		"""Immunoglobulin superfamily / C1-set domain containing"""	7090	protein-coding gene	gene with protein product		600169				8022771	Standard	NM_000247		Approved	PERB11.1	uc003ntk.1	Q29983	OTTHUMG00000031073	ENST00000449934.2:c.821G>A	6.37:g.31379931G>A	ENSP00000413079:p.Arg274Gln			Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like	p.R274Q	ENST00000449934.2	37	c.821	CCDS56412.1	6	.	.	.	.	.	.	.	.	.	.	N	0.751	-0.772915	0.02951	.	.	ENSG00000204520	ENST00000376222;ENST00000364810;ENST00000399172;ENST00000449934;ENST00000421350	T;T	0.02763	4.17;4.17	2.72	-0.104	0.13605	.	0.817674	0.09786	N	0.756012	T	0.00496	0.0016	.	.	.	0.80722	P	0.0	B;B	0.18610	0.029;0.009	B;B	0.14023	0.01;0.003	T	0.46911	-0.9157	8	0.21540	T	0.41	.	1.3364	0.02145	0.2905:0.4047:0.1327:0.1721	rs1063635;rs16899611;rs17794659;rs17845523;rs17858413;rs17884605;rs1063635	136;274	Q5SS58;Q96QC4	.;.	Q	136;274;231;274;165	ENSP00000413079:R274Q;ENSP00000402410:R165Q	ENSP00000365394:R274Q	R	+	2	0	MICA	31487910	0.000000	0.05858	0.012000	0.15200	0.088000	0.18126	-0.399000	0.07250	-0.066000	0.12998	-0.621000	0.04028	CGA	MICA	-	pfam_Ig_C1-set,smart_Ig_C1-set,pfscan_Ig-like	ENSG00000204520		0.602	MICA-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	MICA	HGNC	protein_coding	OTTHUMT00000076101.7	49	0.00	0	G	NM_001177519		31379931	31379931	+1	no_errors	ENST00000364810	ensembl	human	known	69_37n	missense	31	13.89	5	SNP	0.001	A
MOXD2P	100289017	genome.wustl.edu	37	7	141943286	141943286	+	RNA	SNP	A	A	G	rs4587244	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr7:141943286A>G	ENST00000477615.1	-	0	125							A6NHM9	MOXD2_HUMAN	monooxygenase, DBH-like 2, pseudogene								copper ion binding (GO:0005507)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)										TAGTACACGCAAATCCCCGAG	0.547													G|||	1740	0.347444	0.1203	0.3429	5008	,	,		19940	0.6647		0.3072	False		,,,				2504	0.3722					dbGAP											0																																										-	-	-			0					7q34	2010-09-24	2010-09-24	2010-09-24	ENSG00000240268	ENSG00000240268			33605	pseudogene	pseudogene			"""monooxygenase, DBH-like 2 pseudogene"""	MOXD2			Standard	NR_024346		Approved		uc022amw.1	A6NHM9	OTTHUMG00000158566		7.37:g.141943286A>G				RNA	SNP	-	NULL	ENST00000477615.1	37	NULL		7																																																																																			MOXD2P	-	-	ENSG00000240268		0.547	MOXD2P-002	KNOWN	basic	processed_transcript	MOXD2P	HGNC	pseudogene	OTTHUMT00000351330.2	12	0.00	0	A	NR_024346		141943286	141943286	-1	no_errors	ENST00000477615	ensembl	human	known	69_37n	rna	11	26.67	4	SNP	0.094	G
MTL5	9633	genome.wustl.edu	37	11	68475807	68475807	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr11:68475807T>A	ENST00000255087.5	-	10	1679	c.1496A>T	c.(1495-1497)gAg>gTg	p.E499V		NM_004923.3	NP_004914.2	Q9Y4I5	MTL5_HUMAN	metallothionein-like 5, testis-specific (tesmin)	499					cell differentiation (GO:0030154)|cellular metal ion homeostasis (GO:0006875)|multicellular organismal development (GO:0007275)|response to metal ion (GO:0010038)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)	15	Esophageal squamous(3;4.37e-12)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.185)			AGATTTAAACTCAGTGTGGAG	0.413																																						dbGAP											0													116.0	116.0	116.0					11																	68475807		2200	4294	6494	-	-	-	SO:0001583	missense	0			U86074	CCDS8184.1, CCDS44661.1	11q13.2-q13.3	2007-01-03			ENSG00000132749	ENSG00000132749			7446	protein-coding gene	gene with protein product	"""CXC domain containing 2"""	604374				1091092	Standard	XR_428932		Approved	CXCDC2	uc001ooc.3	Q9Y4I5	OTTHUMG00000167891	ENST00000255087.5:c.1496A>T	11.37:g.68475807T>A	ENSP00000255087:p.Glu499Val		A8K8J3|Q4G182|Q6P2E2|Q8NCC8	Missense_Mutation	SNP	pfam_TCR,superfamily_Thionin	p.E499V	ENST00000255087.5	37	c.1496	CCDS8184.1	11	.	.	.	.	.	.	.	.	.	.	T	15.26	2.780923	0.49891	.	.	ENSG00000132749	ENST00000255087	T	0.35236	1.32	5.32	5.32	0.75619	.	0.000000	0.46758	D	0.000263	T	0.54095	0.1837	L	0.57536	1.79	0.80722	D	1	D	0.76494	0.999	D	0.66084	0.941	T	0.55218	-0.8175	10	0.52906	T	0.07	-25.9784	14.256	0.66053	0.0:0.0:0.0:1.0	.	499	Q9Y4I5	MTL5_HUMAN	V	499	ENSP00000255087:E499V	ENSP00000255087:E499V	E	-	2	0	MTL5	68232383	0.792000	0.28813	0.992000	0.48379	0.806000	0.45545	1.644000	0.37228	2.016000	0.59253	0.329000	0.21502	GAG	MTL5	-	NULL	ENSG00000132749		0.413	MTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTL5	HGNC	protein_coding	OTTHUMT00000396844.1	43	0.00	0	T	NM_004923		68475807	68475807	-1	no_errors	ENST00000255087	ensembl	human	known	69_37n	missense	28	20.00	7	SNP	1.000	A
MTRNR2L5	100463289	genome.wustl.edu	37	10	57359697	57359697	+	Missense_Mutation	SNP	C	C	T	rs11004928	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr10:57359697C>T	ENST00000512524.2	+	1	948	c.38C>T	c.(37-39)aCc>aTc	p.T13I	PCDH15_ENST00000373957.3_Intron|RP11-168O22.1_ENST00000457975.2_RNA	NM_001190478.1	NP_001177407.1			MT-RNR2-like 5																		ttactttcaaccagtgaaatt	0.413													C|||	1779	0.355232	0.2057	0.3674	5008	,	,		17367	0.4861		0.329	False		,,,				2504	0.4407					dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS53537.1	10q21.1	2014-02-18			ENSG00000249860	ENSG00000249860			37162	protein-coding gene	gene with protein product	"""humanin-like 5"""					19477263	Standard	NM_001190478		Approved		uc021pra.1	P0CJ72	OTTHUMG00000184965	ENST00000512524.2:c.38C>T	10.37:g.57359697C>T	ENSP00000437910:p.Thr13Ile			Missense_Mutation	SNP	NULL	p.T13I	ENST00000512524.2	37	c.38	CCDS53537.1	10	778	0.35622710622710624	102	0.2073170731707317	124	0.3425414364640884	297	0.5192307692307693	255	0.33641160949868076	.	4.758	0.140908	0.09083	.	.	ENSG00000249860	ENST00000512524	.	.	.	0.66	-1.32	0.09201	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	0.9999999999999881	.	.	.	.	.	.	T	0.45352	-0.9267	4	0.87932	D	0	.	4.253	0.10703	0.0:0.2635:0.0:0.7365	rs11004928;rs59643989	.	.	.	I	13	.	ENSP00000437910:T13I	T	+	2	0	MTRNR2L5	57029703	1.000000	0.71417	0.701000	0.30321	0.141000	0.21300	2.757000	0.47557	-0.387000	0.07809	-0.708000	0.03648	ACC	MTRNR2L5	-	NULL	ENSG00000249860		0.413	MTRNR2L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTRNR2L5	HGNC	protein_coding	OTTHUMT00000469382.1	29	0.00	0	C	NM_001190478		57359697	57359697	+1	no_errors	ENST00000512524	ensembl	human	known	69_37n	missense	9	25.00	3	SNP	1.000	T
MYO15B	80022	genome.wustl.edu	37	17	73601646	73601646	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr17:73601646G>A	ENST00000583560.1	+	5	427	c.427G>A	c.(427-429)Gtc>Atc	p.V143I	MYO15B_ENST00000578382.2_3'UTR			Q96JP2	MY15B_HUMAN	myosin XVB pseudogene	301	Myosin motor.					cytoplasm (GO:0005737)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)										GTGTGGTGCCGTCCTGAGCCA	0.592																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0					17q25.1	2014-07-16			ENSG00000266714	ENSG00000266714		"""Myosins / Myosin superfamily : Class XV"""	14083	pseudogene	pseudogene						11294886	Standard	NR_003587		Approved	MYO15BP	uc002jon.1	Q96JP2	OTTHUMG00000179794	ENST00000583560.1:c.427G>A	17.37:g.73601646G>A	ENSP00000463645:p.Val143Ile			Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.V143I	ENST00000583560.1	37	c.427		17																																																																																			MYO15B	-	pfam_Myosin_head_motor_dom	ENSG00000266714		0.592	MYO15B-009	NOVEL	mRNA_start_NF|mRNA_end_NF|cds_start_NF|cds_end_NF|basic|appris_candidate_longest	protein_coding	MYO15B	Clone_based_vega_gene	protein_coding	OTTHUMT00000448180.1	35	0.00	0	G	NR_003587		73601646	73601646	+1	no_start_codon:no_stop_codon:bad_bp_length_for_coding_region	ENST00000583560	ensembl	human	novel	69_37n	missense	17	51.43	18	SNP	0.916	A
NFE2L3	9603	genome.wustl.edu	37	7	26224737	26224737	+	Silent	SNP	T	T	C			TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr7:26224737T>C	ENST00000056233.3	+	4	1678	c.1419T>C	c.(1417-1419)agT>agC	p.S473S		NM_004289.6	NP_004280.5	Q9Y4A8	NF2L3_HUMAN	nuclear factor, erythroid 2-like 3	473					transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(5)|urinary_tract(7)	29						CAGAACCCAGTAAGCTTTGTC	0.428																																						dbGAP											0													175.0	172.0	173.0					7																	26224737		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB010812	CCDS5396.1	7p15.2	2013-08-23	2013-08-23		ENSG00000050344	ENSG00000050344		"""basic leucine zipper proteins"""	7783	protein-coding gene	gene with protein product		604135	"""nuclear factor (erythroid-derived 2)-like 3"""			10037736	Standard	NM_004289		Approved	Nrf3	uc003sxq.3	Q9Y4A8	OTTHUMG00000023882	ENST00000056233.3:c.1419T>C	7.37:g.26224737T>C			Q6NUS0|Q7Z498|Q86UJ4|Q86VR5|Q9UQA4	Silent	SNP	pfam_bZIP_1,pfam_bZIP_Maf,pfam_bZIP_2,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.S473	ENST00000056233.3	37	c.1419	CCDS5396.1	7																																																																																			NFE2L3	-	NULL	ENSG00000050344		0.428	NFE2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFE2L3	HGNC	protein_coding	OTTHUMT00000214088.1	63	0.00	0	T			26224737	26224737	+1	no_errors	ENST00000056233	ensembl	human	known	69_37n	silent	34	41.38	24	SNP	0.000	C
NINL	22981	genome.wustl.edu	37	20	25433536	25433536	+	3'UTR	SNP	T	T	C	rs2856	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr20:25433536T>C	ENST00000278886.6	-	0	4773				NINL_ENST00000464285.1_5'UTR|NINL_ENST00000422516.1_3'UTR	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like						G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						ACACCATCATTCCTGAGTCCA	0.413													C|||	2742	0.547524	0.4818	0.3617	5008	,	,		15309	0.9107		0.4354	False		,,,				2504	0.5092					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.*551A>G	20.37:g.25433536T>C			A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	RNA	SNP	-	NULL	ENST00000278886.6	37	NULL	CCDS33452.1	20																																																																																			NINL	-	-	ENSG00000101004		0.413	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NINL	HGNC	protein_coding	OTTHUMT00000078445.3	51	0.00	0	T	NM_025176		25433536	25433536	-1	no_errors	ENST00000464285	ensembl	human	known	69_37n	rna	23	20.69	6	SNP	0.621	C
NUP214	8021	genome.wustl.edu	37	9	134021677	134021677	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr9:134021677T>C	ENST00000359428.5	+	13	2075	c.1931T>C	c.(1930-1932)tTg>tCg	p.L644S	RP11-544A12.4_ENST00000587408.1_RNA|RP11-544A12.4_ENST00000590461.1_RNA|NUP214_ENST00000451030.1_Missense_Mutation_p.L644S|NUP214_ENST00000411637.2_Missense_Mutation_p.L633S|RP11-544A12.4_ENST00000587264.1_RNA|RP11-544A12.4_ENST00000415391.2_RNA|RP11-544A12.4_ENST00000589540.1_RNA|RP11-544A12.4_ENST00000588378.1_RNA|RP11-544A12.4_ENST00000589667.1_RNA|RP11-544A12.4_ENST00000586290.1_RNA			P35658	NU214_HUMAN	nucleoporin 214kDa	644	11 X 5 AA approximate repeats.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)			NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		TCCTCAGTCTTGCCCTCACCA	0.498			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																Pancreas(4;24 48 25510 30394 32571)	dbGAP		Dom	yes		9	9q34.1	8021	nucleoporin 214kDa (CAN)		L	0													305.0	258.0	274.0					9																	134021677		2203	4300	6503	-	-	-	SO:0001583	missense	0			X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.1931T>C	9.37:g.134021677T>C	ENSP00000352400:p.Leu644Ser		A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Missense_Mutation	SNP	smart_WD40_repeat	p.L644S	ENST00000359428.5	37	c.1931	CCDS6940.1	9	.	.	.	.	.	.	.	.	.	.	T	4.945	0.175501	0.09391	.	.	ENSG00000126883	ENST00000359428;ENST00000411637;ENST00000451030;ENST00000541375;ENST00000540899;ENST00000438605	T;T;T	0.31769	1.6;1.48;1.56	4.76	3.85	0.44370	.	0.804856	0.10439	N	0.674587	T	0.14313	0.0346	N	0.08118	0	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.22800	-1.0206	10	0.06891	T	0.86	-5.0502	9.3397	0.38071	0.0:0.8967:0.0:0.1033	.	237;633;644	Q5JUP9;P35658-4;P35658	.;.;NU214_HUMAN	S	644;633;644;633;237;73	ENSP00000352400:L644S;ENSP00000396576:L633S;ENSP00000405014:L644S	ENSP00000352400:L644S	L	+	2	0	NUP214	133011498	0.228000	0.23718	0.035000	0.18076	0.482000	0.33219	2.759000	0.47573	1.197000	0.43143	-0.415000	0.06103	TTG	NUP214	-	NULL	ENSG00000126883		0.498	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NUP214	HGNC	protein_coding	OTTHUMT00000054694.2	54	0.00	0	T	NM_005085		134021677	134021677	+1	no_errors	ENST00000451030	ensembl	human	known	69_37n	missense	46	26.98	17	SNP	0.192	C
OR11H7	390441	genome.wustl.edu	37	14	20697600	20697600	+	RNA	SNP	T	T	G	rs12434822	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr14:20697600T>G	ENST00000553765.1	+	0	40							Q8NGC8	O11H7_HUMAN	olfactory receptor, family 11, subfamily H, member 7 (gene/pseudogene)							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										GCAGTTTGTGTTGTTGGGGTT	0.428													T|||	1372	0.273962	0.034	0.3689	5008	,	,		20823	0.3175		0.4095	False		,,,				2504	0.3466					dbGAP											0																																										-	-	-			0					14q11.2	2012-08-09	2008-06-11	2008-06-11	ENSG00000258806	ENSG00000258806		"""GPCR / Class A : Olfactory receptors"""	15350	protein-coding gene	gene with protein product			"""olfactory receptor, family 11, subfamily H, member 7 pseudogene"""	OR11H7P			Standard	NG_004354		Approved			Q8NGC8	OTTHUMG00000170851		14.37:g.20697600T>G				Missense_Mutation	SNP	NULL	p.L14V	ENST00000553765.1	37	c.40		14																																																																																			OR11H7	-	NULL	ENSG00000258806		0.428	OR11H7-001	KNOWN	basic	polymorphic_pseudogene	OR11H7	HGNC	polymorphic_pseudogene	OTTHUMT00000410677.1	68	0.00	0	T			20697600	20697600	+1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000553765	ensembl	human	known	69_37n	missense	51	13.33	8	SNP	0.068	G
ORMDL3	94103	genome.wustl.edu	37	17	38078892	38078892	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr17:38078892C>T	ENST00000394169.1	-	6	1867	c.373G>A	c.(373-375)Gtg>Atg	p.V125M	ORMDL3_ENST00000584220.1_Missense_Mutation_p.V109M|ORMDL3_ENST00000304046.2_Missense_Mutation_p.V125M|ORMDL3_ENST00000579695.1_Missense_Mutation_p.V125M			Q8N138	ORML3_HUMAN	ORMDL sphingolipid biosynthesis regulator 3	125					ceramide metabolic process (GO:0006672)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|SPOTS complex (GO:0035339)				endometrium(3)|kidney(1)|lung(1)	5	Colorectal(19;0.000442)		Lung(15;0.0234)			GTGTTGAGCACAAAATGGATC	0.532																																						dbGAP											0													149.0	137.0	141.0					17																	38078892		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11355.1	17q12	2014-06-16	2014-06-16		ENSG00000172057	ENSG00000172057			16038	protein-coding gene	gene with protein product		610075	"""ORM1 (S. cerevisiae)-like 3"", ""ORM1-like 3 (S. cerevisiae)"""			23066021	Standard	NM_139280		Approved		uc002htj.2	Q8N138	OTTHUMG00000133249	ENST00000394169.1:c.373G>A	17.37:g.38078892C>T	ENSP00000377724:p.Val125Met		B3KS83|Q6UY83	Missense_Mutation	SNP	pfam_ORMDL,pirsf_ORMDL	p.V125M	ENST00000394169.1	37	c.373	CCDS11355.1	17	.	.	.	.	.	.	.	.	.	.	C	9.995	1.231847	0.22626	.	.	ENSG00000172057	ENST00000304046;ENST00000394169	.	.	.	5.39	1.75	0.24633	.	0.220502	0.39274	N	0.001411	T	0.30823	0.0777	N	0.17594	0.5	0.44136	D	0.996928	B	0.13594	0.008	B	0.18263	0.021	T	0.03981	-1.0987	9	0.34782	T	0.22	-18.343	5.7616	0.18203	0.0:0.306:0.132:0.5619	.	125	Q8N138	ORML3_HUMAN	M	125	.	ENSP00000304858:V125M	V	-	1	0	ORMDL3	35332418	0.950000	0.32346	0.998000	0.56505	0.594000	0.36715	0.085000	0.14912	0.048000	0.15891	-0.290000	0.09829	GTG	ORMDL3	-	pfam_ORMDL,pirsf_ORMDL	ENSG00000172057		0.532	ORMDL3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ORMDL3	HGNC	protein_coding	OTTHUMT00000257003.1	42	0.00	0	C	NM_139280		38078892	38078892	-1	no_errors	ENST00000304046	ensembl	human	known	69_37n	missense	24	29.41	10	SNP	1.000	T
POM121	9883	genome.wustl.edu	37	7	72413874	72413874	+	Silent	SNP	T	T	C	rs199633193	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr7:72413874T>C	ENST00000434423.2	+	11	3342	c.3342T>C	c.(3340-3342)aaT>aaC	p.N1114N	POM121_ENST00000446813.1_Silent_p.N849N|POM121_ENST00000358357.3_Silent_p.N849N|POM121_ENST00000395270.1_Silent_p.N849N|POM121_ENST00000257622.4_Silent_p.N849N			Q96HA1	P121A_HUMAN	POM121 transmembrane nucleoporin	1114	Pore side. {ECO:0000255}.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Lung NSC(55;0.163)				TTGGGATCAATGTGGCCACCC	0.642																																						dbGAP											0													28.0	23.0	24.0					7																	72413874		2164	4162	6326	-	-	-	SO:0001819	synonymous_variant	0			AB014518	CCDS5542.1, CCDS59059.1	7q11.23	2013-01-08	2012-03-13		ENSG00000196313	ENSG00000196313		"""-"""	19702	protein-coding gene	gene with protein product		615753	"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""			8335683, 9734811, 17900573	Standard	NM_172020		Approved	KIAA0618, DKFZP586G1822, DKFZP586P2220, POM121A	uc003twk.2	Q96HA1	OTTHUMG00000023527	ENST00000434423.2:c.3342T>C	7.37:g.72413874T>C			A6NFS9|A8CDT4|A8K933|A8MXF9|O75115|Q96DI0|Q9H9X1|Q9Y2N3|Q9Y4S7	Silent	SNP	NULL	p.N1114	ENST00000434423.2	37	c.3342		7																																																																																			POM121	-	NULL	ENSG00000196313		0.642	POM121-001	KNOWN	basic|appris_candidate_longest	protein_coding	POM121	HGNC	protein_coding	OTTHUMT00000347344.1	71	0.00	0	T			72413874	72413874	+1	no_errors	ENST00000434423	ensembl	human	known	69_37n	silent	49	12.50	7	SNP	0.018	C
POTEF	728378	genome.wustl.edu	37	2	130832873	130832873	+	Silent	SNP	G	G	A	rs62165872	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr2:130832873G>A	ENST00000409914.2	-	17	2571	c.2172C>T	c.(2170-2172)gaC>gaT	p.D724D	POTEF_ENST00000357462.5_Silent_p.D724D	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	724	Actin-like.				retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						GGGGGGCATCGTCGCCCGCAA	0.592													.|||	130	0.0259585	0.0174	0.0331	5008	,	,		19488	0.0139		0.0437	False		,,,				2504	0.0266					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.2172C>T	2.37:g.130832873G>A			A6NC34	Silent	SNP	pfam_Actin-like,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Actin-like,prints_Actin-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.D724	ENST00000409914.2	37	c.2172	CCDS46409.1	2																																																																																			POTEF	-	pfam_Actin-like,smart_Actin-like	ENSG00000196604		0.592	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEF	HGNC	protein_coding	OTTHUMT00000331889.2	47	0.00	0	G	NM_001099771		130832873	130832873	-1	no_errors	ENST00000357462	ensembl	human	known	69_37n	silent	41	19.61	10	SNP	1.000	A
PRMT8	56341	genome.wustl.edu	37	12	3702789	3702789	+	3'UTR	SNP	C	C	A	rs7298428	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr12:3702789C>A	ENST00000382622.3	+	0	2016				PRMT8_ENST00000261252.4_3'UTR	NM_019854.4	NP_062828.3	Q9NR22	ANM8_HUMAN	protein arginine methyltransferase 8						histone arginine methylation (GO:0034969)|histone H4-R3 methylation (GO:0043985)|histone methylation (GO:0016571)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|regulation of protein binding (GO:0043393)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	histone methyltransferase activity (H4-R3 specific) (GO:0044020)|histone-arginine N-methyltransferase activity (GO:0008469)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)	37			OV - Ovarian serous cystadenocarcinoma(31;0.0109)|COAD - Colon adenocarcinoma(12;0.0264)			TGTGCGTGTGCGTGCATGTGT	0.473													C|||	626	0.125	0.1914	0.0965	5008	,	,		1464	0.1071		0.1402	False		,,,				2504	0.0583					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF263539	CCDS8521.2, CCDS58200.1	12p13.3	2006-03-03	2006-02-16	2006-02-16	ENSG00000111218	ENSG00000111218		"""Protein arginine methyltransferases"""	5188	protein-coding gene	gene with protein product		610086	"""HMT1 hnRNP methyltransferase-like 3 (S. cerevisiae)"", ""HMT1 hnRNP methyltransferase-like 4 (S. cerevisiae)"""	HRMT1L3, HRMT1L4		16051612	Standard	NM_019854		Approved		uc001qmf.4	Q9NR22	OTTHUMG00000128493	ENST00000382622.3:c.*441C>A	12.37:g.3702789C>A			B2RDP0|Q8TBJ8	RNA	SNP	-	NULL	ENST00000382622.3	37	NULL	CCDS8521.2	12																																																																																			PRMT8	-	-	ENSG00000111218		0.473	PRMT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRMT8	HGNC	protein_coding	OTTHUMT00000250297.2	46	0.00	0	C	NM_019854		3702789	3702789	+1	no_errors	ENST00000261252	ensembl	human	known	69_37n	rna	34	10.53	4	SNP	0.223	A
RAB11FIP5	26056	genome.wustl.edu	37	2	73302777	73302777	+	Missense_Mutation	SNP	G	G	A	rs534699304		TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr2:73302777G>A	ENST00000258098.6	-	5	2074	c.1834C>T	c.(1834-1836)Cgg>Tgg	p.R612W	RAB11FIP5_ENST00000493523.2_5'UTR	NM_015470.2	NP_056285.1	Q9BXF6	RFIP5_HUMAN	RAB11 family interacting protein 5 (class I)	612	FIP-RBD. {ECO:0000255|PROSITE- ProRule:PRU00844}.				cellular response to acidic pH (GO:0071468)|insulin secretion involved in cellular response to glucose stimulus (GO:0035773)|protein transport (GO:0015031)|regulated secretory pathway (GO:0045055)|regulation of protein localization to cell surface (GO:2000008)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|recycling endosome (GO:0055037)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)			biliary_tract(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	23						TCCCGCTCCCGCTGCAGGAGC	0.637													G|||	1	0.000199681	0.0	0.0	5008	,	,		15758	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													44.0	38.0	40.0					2																	73302777		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF334812	CCDS1923.1	2p13	2008-02-05			ENSG00000135631	ENSG00000135631			24845	protein-coding gene	gene with protein product		605536				10048485, 11163216	Standard	NM_015470		Approved	GAF1, KIAA0857, RIP11, pp75	uc002sis.4	Q9BXF6	OTTHUMG00000129779	ENST00000258098.6:c.1834C>T	2.37:g.73302777G>A	ENSP00000258098:p.Arg612Trp		O94939|Q9P0M1	Missense_Mutation	SNP	pfam_Rab-bd_FIP-RBD,pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.R612W	ENST00000258098.6	37	c.1834	CCDS1923.1	2	.	.	.	.	.	.	.	.	.	.	G	14.30	2.494798	0.44352	.	.	ENSG00000135631	ENST00000258098	T	0.51071	0.72	5.04	4.11	0.48088	Rab-binding domain FIP-RBD (2);	0.000000	0.64402	D	0.000002	T	0.61362	0.2341	L	0.50333	1.59	0.49798	D	0.999821	D	0.89917	1.0	D	0.75484	0.986	T	0.63730	-0.6571	10	0.66056	D	0.02	-10.1288	13.6943	0.62567	0.0:0.0:0.7934:0.2065	.	612	Q9BXF6	RFIP5_HUMAN	W	612	ENSP00000258098:R612W	ENSP00000258098:R612W	R	-	1	2	RAB11FIP5	73156285	1.000000	0.71417	1.000000	0.80357	0.031000	0.12232	1.405000	0.34635	2.511000	0.84671	0.650000	0.86243	CGG	RAB11FIP5	-	pfam_Rab-bd_FIP-RBD	ENSG00000135631		0.637	RAB11FIP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB11FIP5	HGNC	protein_coding	OTTHUMT00000251995.1	32	0.00	0	G	NM_015470		73302777	73302777	-1	no_errors	ENST00000258098	ensembl	human	known	69_37n	missense	12	31.58	6	SNP	1.000	A
RNF126P1	376412	genome.wustl.edu	37	17	55123297	55123297	+	RNA	SNP	G	G	A	rs7214370	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr17:55123297G>A	ENST00000567452.1	+	0	459					NR_002818.2				ring finger protein 126 pseudogene 1																		CGGCCGGCACGAAGGCCTCCC	0.706													g|||	1075	0.214657	0.3109	0.1844	5008	,	,		12680	0.1687		0.1909	False		,,,				2504	0.1779					dbGAP											0																																										-	-	-			0			BC033555		17q23.2	2004-04-22				ENSG00000261192		"""RING-type (C3HC4) zinc fingers"""	30340	pseudogene	pseudogene						12477932	Standard	NR_002818		Approved		uc002iuw.3				17.37:g.55123297G>A				RNA	SNP	-	NULL	ENST00000567452.1	37	NULL		17																																																																																			RNF126P1	-	-	ENSG00000261192		0.706	RNF126P1-002	KNOWN	basic	processed_transcript	RNF126P1	HGNC	pseudogene	OTTHUMT00000431453.1	60	0.00	0	G			55123297	55123297	+1	no_errors	ENST00000567452	ensembl	human	known	69_37n	rna	43	10.20	5	SNP	0.916	A
SATB1	6304	genome.wustl.edu	37	3	18392819	18392819	+	Intron	SNP	C	C	T	rs116044839	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr3:18392819C>T	ENST00000338745.6	-	10	3514				SATB1_ENST00000417717.2_Missense_Mutation_p.G621S|SATB1_ENST00000454909.2_Intron|TBC1D5_ENST00000414318.2_Intron	NM_002971.4	NP_002962.1	Q01826	SATB1_HUMAN	SATB homeobox 1						activated T cell proliferation (GO:0050798)|apoptotic process (GO:0006915)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|epidermis development (GO:0008544)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|reflex (GO:0060004)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(2)|endometrium(6)|large_intestine(4)|lung(10)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	32						GGAGCAGCACCGAGCCATGGT	0.572													C|||	224	0.0447284	0.0061	0.0317	5008	,	,		17426	0.002		0.1113	False		,,,				2504	0.0818					dbGAP											0													8.0	7.0	7.0					3																	18392819		862	1957	2819	-	-	-	SO:0001627	intron_variant	0				CCDS2631.1, CCDS56242.1	3p24.3	2011-07-19	2007-02-15		ENSG00000182568	ENSG00000182568		"""Homeoboxes / CUT class"""	10541	protein-coding gene	gene with protein product		602075	"""special AT-rich sequence binding protein 1 (binds to nuclear matrix/scaffold-associating DNA)"""			1505028	Standard	NM_002971		Approved		uc003cbj.3	Q01826	OTTHUMG00000129890	ENST00000338745.6:c.1779+664G>A	3.37:g.18392819C>T			B3KXF1|C9JTR6|Q59EQ0	Missense_Mutation	SNP	prints_Antifreeze_1	p.R3Q	ENST00000338745.6	37	c.8	CCDS2631.1	3	105	0.04807692307692308	4	0.008130081300813009	12	0.03314917127071823	0	0.0	89	0.11741424802110818	C	13.76	2.333025	0.41297	.	.	ENSG00000182568	ENST00000417717	T	0.22945	1.93	5.59	1.75	0.24633	.	0.377495	0.23448	N	0.048077	T	0.00144	0.0004	.	.	.	0.09310	P	0.99999999592112	B	0.24675	0.109	B	0.17979	0.02	T	0.34725	-0.9817	8	0.07990	T	0.79	-16.851	6.3723	0.21489	0.0:0.6464:0.1355:0.218	.	621	Q01826-2	.	S	621	ENSP00000399518:G621S	ENSP00000399518:G621S	G	-	1	0	SATB1	18367823	0.817000	0.29147	0.943000	0.38184	0.997000	0.91878	-0.076000	0.11412	0.039000	0.15632	0.561000	0.74099	GGT	SATB1	-	prints_Antifreeze_1	ENSG00000182568		0.572	SATB1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SATB1	HGNC	protein_coding	OTTHUMT00000252138.4	35	0.00	0	C	NM_001131010		18392819	18392819	-1	no_errors	ENST00000476178	ensembl	human	putative	69_37n	missense	22	15.38	4	SNP	0.998	T
SBNO2	22904	genome.wustl.edu	37	19	1122920	1122920	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr19:1122920C>A	ENST00000361757.3	-	8	990	c.753G>T	c.(751-753)caG>caT	p.Q251H	SBNO2_ENST00000587024.1_Missense_Mutation_p.Q251H|SBNO2_ENST00000438103.2_Missense_Mutation_p.Q194H	NM_014963.2	NP_055778.2	Q9Y2G9	SBNO2_HUMAN	strawberry notch homolog 2 (Drosophila)	251					bone mineralization (GO:0030282)|bone trabecula morphogenesis (GO:0061430)|macrophage activation involved in immune response (GO:0002281)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoclast fusion (GO:0072675)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of inflammatory response (GO:0050727)|transcription, DNA-templated (GO:0006351)					NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGCCTCTAGCTGCAGGGCAG	0.711																																						dbGAP											0													33.0	35.0	35.0					19																	1122920		2106	4176	6282	-	-	-	SO:0001583	missense	0			AK074102	CCDS45894.1, CCDS45895.1	19p13.3	2008-02-05	2006-10-06	2006-10-06		ENSG00000064932			29158	protein-coding gene	gene with protein product		615729	"""KIAA0963"""	KIAA0963		10231032	Standard	NM_014963		Approved	FLJ00173, Stno, Sno	uc002lrk.4	Q9Y2G9		ENST00000361757.3:c.753G>T	19.37:g.1122920C>A	ENSP00000354733:p.Gln251His		A8K8P2|B3KWJ1|O75257|Q3KQX0|Q8TEM0	Missense_Mutation	SNP	NULL	p.Q251H	ENST00000361757.3	37	c.753	CCDS45894.1	19	.	.	.	.	.	.	.	.	.	.	C	20.6	4.016736	0.75161	.	.	ENSG00000064932	ENST00000361757;ENST00000438103;ENST00000250872	D;D	0.99840	-7.08;-7.08	4.54	3.48	0.39840	.	0.208186	0.42548	N	0.000683	D	0.99760	0.9903	M	0.86953	2.85	0.51767	D	0.999937	D;D;D;D	0.89917	1.0;0.995;1.0;1.0	D;D;D;D	0.91635	0.999;0.978;0.999;0.999	D	0.97253	0.9899	10	0.87932	D	0	-42.4631	9.2131	0.37331	0.0:0.8236:0.0:0.1764	.	194;251;251;194	B4DL53;B4DV91;Q9Y2G9;Q9Y2G9-3	.;.;SBNO2_HUMAN;.	H	251;194;257	ENSP00000354733:Q251H;ENSP00000400762:Q194H	ENSP00000250872:Q257H	Q	-	3	2	SBNO2	1073920	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	3.861000	0.56002	2.222000	0.72286	0.549000	0.68633	CAG	SBNO2	-	NULL	ENSG00000064932		0.711	SBNO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SBNO2	HGNC	protein_coding	OTTHUMT00000458065.2	29	0.00	0	C	NM_014963		1122920	1122920	-1	no_errors	ENST00000361757	ensembl	human	known	69_37n	missense	9	35.71	5	SNP	1.000	A
SGSM3	27352	genome.wustl.edu	37	22	40800334	40800334	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr22:40800334C>G	ENST00000248929.9	+	5	430	c.241C>G	c.(241-243)Ctg>Gtg	p.L81V	SGSM3_ENST00000454798.2_Missense_Mutation_p.L14V	NM_015705.4	NP_056520.2			small G protein signaling modulator 3											cervix(1)|endometrium(4)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)|skin(6)	19						GCAGGCCCACCTGGAGTTCAC	0.627																																						dbGAP											0													53.0	49.0	51.0					22																	40800334		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL022238	CCDS14002.1	22q13.1-q13.2	2013-07-09	2007-08-14	2007-08-14	ENSG00000100359	ENSG00000100359		"""Small G protein signaling modulators"""	25228	protein-coding gene	gene with protein product	"""RUN and SH3 containing 3"""	610440	"""RUN and TBC1 domain containing 3"""	RUTBC3		11214971, 17509819	Standard	XM_005261572		Approved	DJ1042K10.2, RUSC3, RabGAP-5, RABGAP5	uc003ayu.1	Q96HU1	OTTHUMG00000151141	ENST00000248929.9:c.241C>G	22.37:g.40800334C>G	ENSP00000248929:p.Leu81Val			Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_Run,pfam_SH3_domain,pfam_SH3_2,superfamily_Rab-GTPase-TBC_dom,superfamily_SH3_domain,smart_Rab-GTPase-TBC_dom,smart_SH3_domain,smart_Run,pfscan_Run,pfscan_SH3_domain,pfscan_Rab-GTPase-TBC_dom	p.L81V	ENST00000248929.9	37	c.241	CCDS14002.1	22	.	.	.	.	.	.	.	.	.	.	C	22.9	4.349167	0.82132	.	.	ENSG00000100359	ENST00000457767;ENST00000248929;ENST00000545416;ENST00000454798	T;T;T	0.20598	2.59;2.45;2.06	5.6	5.6	0.85130	.	0.000000	0.64402	D	0.000001	T	0.47154	0.1430	M	0.77313	2.365	0.80722	D	1	D;D;D;P;P	0.63046	0.96;0.992;0.976;0.901;0.901	P;P;P;P;P	0.60117	0.751;0.837;0.869;0.49;0.49	T	0.42498	-0.9448	10	0.52906	T	0.07	.	19.6251	0.95674	0.0:1.0:0.0:0.0	.	18;14;81;81;81	B4DVE3;B4DMS2;Q96HU1-2;B9A6J5;Q96HU1	.;.;.;.;SGSM3_HUMAN	V	14;81;24;14	ENSP00000399249:L14V;ENSP00000248929:L81V;ENSP00000390998:L14V	ENSP00000248929:L81V	L	+	1	2	SGSM3	39130280	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.684000	0.68197	2.636000	0.89361	0.655000	0.94253	CTG	SGSM3	-	NULL	ENSG00000100359		0.627	SGSM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGSM3	HGNC	protein_coding	OTTHUMT00000321504.2	54	0.00	0	C	NM_015705		40800334	40800334	+1	no_errors	ENST00000248929	ensembl	human	known	69_37n	missense	46	13.21	7	SNP	1.000	G
STEAP3	55240	genome.wustl.edu	37	2	120015164	120015164	+	Intron	SNP	A	A	G	rs111712266	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr2:120015164A>G	ENST00000354888.5	+	5	1689				STEAP3_ENST00000393107.2_Intron|STEAP3_ENST00000450943.2_Silent_p.S439S|STEAP3_ENST00000393106.2_Intron|STEAP3_ENST00000425223.2_Intron|STEAP3_ENST00000393110.2_Intron|STEAP3_ENST00000393108.2_Intron|STEAP3_ENST00000409811.1_Silent_p.S439S	NM_182915.2	NP_878919.2	Q658P3	STEA3_HUMAN	STEAP family member 3, metalloreductase						apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cellular iron ion homeostasis (GO:0006879)|copper ion import (GO:0015677)|exosomal secretion (GO:1990182)|ferric iron import into cell (GO:0097461)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902167)|protein secretion (GO:0009306)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	17						tctgctgctcacttgtgcctg	0.547													G|||	315	0.0628994	0.1036	0.0504	5008	,	,		21506	0.0		0.0895	False		,,,				2504	0.0542					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AY029585	CCDS2125.1, CCDS42738.1	2q14.2	2011-09-30	2011-09-30		ENSG00000115107	ENSG00000115107			24592	protein-coding gene	gene with protein product		609671				12606722	Standard	NM_182915		Approved	TSAP6, dudlin-2, STMP3	uc002tlr.3	Q658P3	OTTHUMG00000131402	ENST00000354888.5:c.1185+2740A>G	2.37:g.120015164A>G			A8K6E3|Q4VBR2|Q4ZG36|Q53SQ8|Q7Z389|Q86SF6|Q8NEW6|Q8TDP3|Q8TF03|Q9NVB5	Silent	SNP	pfam_NADP_OxRdtase_F420,pfam_Fe3_Rdtase_TM_dom	p.S439	ENST00000354888.5	37	c.1317	CCDS2125.1	2																																																																																			STEAP3	-	NULL	ENSG00000115107		0.547	STEAP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	STEAP3	HGNC	protein_coding	OTTHUMT00000254193.1	45	0.00	0	A	NM_018234		120015164	120015164	+1	no_errors	ENST00000409811	ensembl	human	known	69_37n	silent	36	10.00	4	SNP	0.000	G
SUCLG2	8801	genome.wustl.edu	37	3	67411166	67411166	+	Missense_Mutation	SNP	A	A	G	rs902321	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr3:67411166A>G	ENST00000493112.1	-	11	1233	c.1210T>C	c.(1210-1212)Tat>Cat	p.Y404H		NM_001177599.1	NP_001171070.1	Q96I99	SUCB2_HUMAN	succinate-CoA ligase, GDP-forming, beta subunit	0					cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|succinyl-CoA metabolic process (GO:0006104)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|succinate-CoA ligase complex (GDP-forming) (GO:0045244)	ATP binding (GO:0005524)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|succinate-CoA ligase (GDP-forming) activity (GO:0004776)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|skin(1)	10		Renal(2;0.00294)|Lung NSC(201;0.012)|Hepatocellular(537;0.121)		BRCA - Breast invasive adenocarcinoma(55;3.53e-05)|Epithelial(33;0.000153)	Succinic acid(DB00139)	ATGTGCATATAACTTCCTTTT	0.333													A|||	1927	0.384784	0.444	0.3401	5008	,	,		18244	0.4573		0.3807	False		,,,				2504	0.2658					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF058954	CCDS43104.1, CCDS54605.1	3p14.3	2004-05-17			ENSG00000172340	ENSG00000172340	6.2.1.4		11450	protein-coding gene	gene with protein product		603922				9765291	Standard	NM_001177599		Approved		uc003dna.4	Q96I99	OTTHUMG00000158740	ENST00000493112.1:c.1210T>C	3.37:g.67411166A>G	ENSP00000419325:p.Tyr404His		C9JVT2|O95195|Q6NUH7|Q86VX8|Q8WUQ1	Missense_Mutation	SNP	pfam_ATP-grasp_succ-CoA_synth-type,pfam_CoA_ligase,superfamily_Succinyl-CoA_synth-like,tigrfam_Succ_CoA_synthase_bsu	p.Y404H	ENST00000493112.1	37	c.1210	CCDS54605.1	3	904	0.4139194139194139	207	0.42073170731707316	130	0.35911602209944754	272	0.4755244755244755	295	0.3891820580474934	A	6.125	0.391349	0.11581	.	.	ENSG00000172340	ENST00000493112	T	0.74106	-0.81	4.4	3.22	0.36961	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.58432	P	1.0000000000287557E-6	.	.	.	.	.	.	T	0.39522	-0.9610	5	0.87932	D	0	.	7.0674	0.25159	0.8922:0.0:0.1078:0.0	rs902321	.	.	.	H	404	ENSP00000419325:Y404H	ENSP00000419325:Y404H	Y	-	1	0	SUCLG2	67493856	0.002000	0.14202	0.001000	0.08648	0.009000	0.06853	1.298000	0.33412	0.631000	0.30412	0.454000	0.30748	TAT	SUCLG2	-	pfam_CoA_ligase,superfamily_Succinyl-CoA_synth-like	ENSG00000172340		0.333	SUCLG2-002	NOVEL	basic|CCDS	protein_coding	SUCLG2	HGNC	protein_coding	OTTHUMT00000351994.1	53	0.00	0	A	NM_003848		67411166	67411166	-1	no_errors	ENST00000493112	ensembl	human	novel	69_37n	missense	47	11.32	6	SNP	0.001	G
SYT16	83851	genome.wustl.edu	37	14	62550943	62550944	+	Missense_Mutation	DNP	GG	GG	TT	rs376289498		TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr14:62550943_62550944GG>TT	ENST00000430451.2	+	5	1661_1662	c.1464_1465GG>TT	c.(1462-1467)gcGGtt>gcTTtt	p.V489F		NM_031914.2	NP_114120.2	Q17RD7	SYT16_HUMAN	synaptotagmin XVI	489					exocytosis (GO:0006887)					central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	35				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)		GCCCATCTGCGGTTTCTCACAG	0.545																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			BC040924	CCDS45121.1	14q23.2	2014-07-02	2005-07-15	2005-07-15	ENSG00000139973	ENSG00000139973		"""Synaptotagmins"""	23142	protein-coding gene	gene with protein product	"""synaptotagmin XIV-related"", "" chr14 synaptotagmin"""	610950	"""synaptotagmin XIV-like"""	SYT14L		11543631	Standard	NM_031914		Approved	yt14r, CHR14SYT, Strep14	uc001xfu.1	Q17RD7	OTTHUMG00000171106	Exception_encountered	14.37:g.62550943_62550944delinsTT	ENSP00000394700:p.Val489Phe		B4DZH2|B7ZL60|C9J8I3|Q707N2|Q7Z441|Q8IUU0|Q9BQR8	Silent|Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.A488|p.V489F	ENST00000430451.2	37	c.1464|c.1465	CCDS45121.1	14																																																																																			SYT16	-	NULL	ENSG00000139973		0.545	SYT16-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	SYT16	HGNC	protein_coding	OTTHUMT00000411700.1	53	0.00	0	G	NM_031914		62550943|62550944	62550943|62550944	+1	no_errors	ENST00000430451	ensembl	human	novel	69_37n	silent|missense	24	29.41	10	SNP	0.270|0.982	T
TCEB3B	51224	genome.wustl.edu	37	18	44561516	44561516	+	Silent	SNP	C	C	G	rs2571027	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr18:44561516C>G	ENST00000332567.4	-	1	472	c.120G>C	c.(118-120)acG>acC	p.T40T	KATNAL2_ENST00000592005.1_Intron|KATNAL2_ENST00000245121.5_Intron|KATNAL2_ENST00000356157.7_Intron	NM_016427.2	NP_057511.2	Q8IYF1	ELOA2_HUMAN	transcription elongation factor B polypeptide 3B (elongin A2)	40	TFIIS N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00649}.				regulation of DNA-templated transcription, elongation (GO:0032784)|transcription from RNA polymerase II promoter (GO:0006366)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|lung(24)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						GGATGTCTGCCGTCATGGGCA	0.587													C|||	2680	0.535144	0.438	0.6254	5008	,	,		16231	0.6448		0.4433	False		,,,				2504	0.5838					dbGAP											0													40.0	37.0	38.0					18																	44561516		2196	4277	6473	-	-	-	SO:0001819	synonymous_variant	0			BC036022	CCDS11932.1	18q21.1	2009-08-04			ENSG00000206181	ENSG00000206181			30771	protein-coding gene	gene with protein product	"""transcription elongation factor (SIII) elongin A2"", ""elongin A2"""	609522				7660129, 8244996	Standard	NM_016427		Approved	HsT832, TCEB3L	uc002lcr.1	Q8IYF1	OTTHUMG00000132649	ENST00000332567.4:c.120G>C	18.37:g.44561516C>G			Q9P2V9	Silent	SNP	pfam_RNA_pol_II_trans_fac_SIII_A,pfam_TFIIS_N,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub	p.T40	ENST00000332567.4	37	c.120	CCDS11932.1	18																																																																																			TCEB3B	-	pfam_TFIIS_N,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub	ENSG00000206181		0.587	TCEB3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEB3B	HGNC	protein_coding	OTTHUMT00000255900.1	61	0.00	0	C	NM_016427		44561516	44561516	-1	no_errors	ENST00000332567	ensembl	human	known	69_37n	silent	25	21.88	7	SNP	0.000	G
TES	26136	genome.wustl.edu	37	7	115892650	115892650	+	Intron	SNP	T	T	G	rs1048508	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr7:115892650T>G	ENST00000358204.4	+	6	1292				AC002066.1_ENST00000446355.2_RNA|AC073130.3_ENST00000444244.1_RNA|TES_ENST00000393481.2_Intron|TES_ENST00000537767.1_Intron	NM_015641.3	NP_056456.1	Q9UGI8	TES_HUMAN	testis derived transcript (3 LIM domains)						negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|protein complex (GO:0043234)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(4)|lung(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	12	Lung NSC(10;0.0137)|all_lung(10;0.0148)	Breast(660;0.0602)	STAD - Stomach adenocarcinoma(10;0.00878)			GAAAGCAAATTATTCCTACCA	0.368													T|||	2057	0.410743	0.4546	0.3646	5008	,	,		18890	0.5655		0.2962	False		,,,				2504	0.3425					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AJ250865	CCDS5763.1, CCDS5764.1	7q31.2	2004-04-20			ENSG00000135269	ENSG00000135269			14620	protein-coding gene	gene with protein product		606085				10950921	Standard	NM_015641		Approved	DKFZP586B2022, TESS-2, TESTIN	uc003vho.3	Q9UGI8	OTTHUMG00000023092	ENST00000358204.4:c.1077+120T>G	7.37:g.115892650T>G			A4D0U6|Q9GZQ1|Q9HAJ9	Nonsense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.L186*	ENST00000358204.4	37	c.557	CCDS5763.1	7	872	0.3992673992673993	218	0.44308943089430897	120	0.3314917127071823	320	0.5594405594405595	214	0.28232189973614774	T	5.423	0.263145	0.10294	.	.	ENSG00000135269	ENST00000393484	.	.	.	4.55	0.702	0.18110	.	.	.	.	.	.	.	.	.	.	.	0.58432	P	1.0000000000287557E-6	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.2395	0.26088	0.1496:0.0:0.606:0.2444	rs1048508;rs3173914;rs56649237;rs60316171;rs1048508	.	.	.	X	186	.	.	L	+	2	0	TES	115679886	0.000000	0.05858	0.001000	0.08648	0.019000	0.09904	-0.188000	0.09642	0.020000	0.15106	-0.829000	0.03081	TTA	TES	-	NULL	ENSG00000135269		0.368	TES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TES	HGNC	protein_coding	OTTHUMT00000059413.2	25	0.00	0	T	NM_015641		115892650	115892650	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000393484	ensembl	human	putative	69_37n	nonsense	22	18.52	5	SNP	0.001	G
TESK2	10420	genome.wustl.edu	37	1	45810091	45810091	+	3'UTR	SNP	A	A	G	rs9429072	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr1:45810091A>G	ENST00000372086.3	-	0	2537				TESK2_ENST00000538496.1_3'UTR|TESK2_ENST00000486676.1_5'UTR|TESK2_ENST00000372084.1_3'UTR|TESK2_ENST00000341771.6_3'UTR	NM_007170.2	NP_009101.2	Q96S53	TESK2_HUMAN	testis-specific kinase 2						actin cytoskeleton organization (GO:0030036)|focal adhesion assembly (GO:0048041)|protein phosphorylation (GO:0006468)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(1)|lung(9)|ovary(2)|pancreas(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	32	Acute lymphoblastic leukemia(166;0.155)					AGCCATGACCATTACGGCCTC	0.478													G|||	2050	0.409345	0.6112	0.5058	5008	,	,		20887	0.3859		0.2455	False		,,,				2504	0.2607					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AJ132545	CCDS41323.1	1p32	2010-04-27			ENSG00000070759	ENSG00000070759	2.7.12.1		11732	protein-coding gene	gene with protein product		604746				10512679	Standard	NM_007170		Approved		uc001cns.1	Q96S53	OTTHUMG00000007680	ENST00000372086.3:c.*421T>C	1.37:g.45810091A>G			Q5T422|Q5T423|Q8N520|Q9Y3Q6	RNA	SNP	-	NULL	ENST00000372086.3	37	NULL	CCDS41323.1	1																																																																																			TESK2	-	-	ENSG00000070759		0.478	TESK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TESK2	HGNC	protein_coding	OTTHUMT00000020523.1	27	0.00	0	A	NM_007170		45810091	45810091	-1	no_errors	ENST00000486676	ensembl	human	known	69_37n	rna	31	13.89	5	SNP	0.000	G
TIGD3	220359	genome.wustl.edu	37	11	65124038	65124038	+	Silent	SNP	C	C	T			TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr11:65124038C>T	ENST00000309880.5	+	2	966	c.759C>T	c.(757-759)gaC>gaT	p.D253D		NM_145719.2	NP_663771.1	Q6B0B8	TIGD3_HUMAN	tigger transposable element derived 3	253	DDE.					nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(3)|large_intestine(1)|lung(9)|prostate(2)|skin(2)	17						TTGACCGGGACATGGGACAGC	0.637																																						dbGAP											0													68.0	74.0	72.0					11																	65124038		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0				CCDS8101.1	11q13.1	2008-07-21				ENSG00000173825			18334	protein-coding gene	gene with protein product							Standard	NM_145719		Approved		uc001odo.4	Q6B0B8		ENST00000309880.5:c.759C>T	11.37:g.65124038C>T				Silent	SNP	pfam_HTH_CenpB_DNA-bd_dom,pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_Psq,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_HTH_Psq	p.D253	ENST00000309880.5	37	c.759	CCDS8101.1	11																																																																																			TIGD3	-	pfam_DDE_SF_endonuclease_CENPB-like	ENSG00000173825		0.637	TIGD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGD3	HGNC	protein_coding	OTTHUMT00000387310.1	64	0.00	0	C	NM_145719		65124038	65124038	+1	no_errors	ENST00000309880	ensembl	human	known	69_37n	silent	57	19.72	14	SNP	1.000	T
TMEM239	100288797	genome.wustl.edu	37	20	2797015	2797015	+	Missense_Mutation	SNP	G	G	A	rs215561	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr20:2797015G>A	ENST00000361033.1	+	1	68	c.35G>A	c.(34-36)cGt>cAt	p.R12H	TMEM239_ENST00000380585.1_5'UTR|TMEM239_ENST00000554164.1_Intron|TMEM239_ENST00000380593.4_Intron			Q8WW34	TM239_HUMAN	transmembrane protein 239	12						integral component of membrane (GO:0016021)											CTGCCAGGCCGTCCTGGGCGC	0.632													G|||	1611	0.321685	0.0552	0.4654	5008	,	,		11911	0.3234		0.5408	False		,,,				2504	0.3528					dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS54444.1	20p13	2012-10-08				ENSG00000198326			40044	protein-coding gene	gene with protein product							Standard	NM_001167670		Approved		uc002wgx.2	Q8WW34	OTTHUMG00000031713	ENST00000361033.1:c.35G>A	20.37:g.2797015G>A	ENSP00000354312:p.Arg12His		Q5JY54|Q6ZU23	Missense_Mutation	SNP	NULL	p.R12H	ENST00000361033.1	37	c.35		20	824	0.3772893772893773	39	0.07926829268292683	172	0.47513812154696133	191	0.3339160839160839	422	0.5567282321899736	G	0.007	-1.988253	0.00443	.	.	ENSG00000198326	ENST00000508370;ENST00000361033	.	.	.	4.32	-4.15	0.03881	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.06786	0.001	B	0.01281	0.0	T	0.47947	-0.9077	6	0.16420	T	0.52	.	4.9359	0.13941	0.4472:0.2903:0.2625:0.0	rs215561;rs215561	12	Q6ZU23	.	H	12	.	ENSP00000354312:R12H	R	+	2	0	RP5-860F19.6	2745015	0.001000	0.12720	0.005000	0.12908	0.000000	0.00434	-0.839000	0.04368	-0.495000	0.06659	-1.835000	0.00590	CGT	TMEM239	-	NULL	ENSG00000198326		0.632	TMEM239-002	PUTATIVE	basic	protein_coding	TMEM239	HGNC	protein_coding	OTTHUMT00000367615.2	59	0.00	0	G			2797015	2797015	+1	no_errors	ENST00000361033	ensembl	human	known	69_37n	missense	34	15.00	6	SNP	0.000	A
TPTE2P1	646405	genome.wustl.edu	37	13	25541467	25541467	+	RNA	SNP	C	C	T	rs2483380	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr13:25541467C>T	ENST00000429698.1	-	0	282							Q5T6R2	TPT2L_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2 pseudogene 1																		GTCCTACCAGCGATGTTTCAG	0.328													N|||	2069	0.413139	0.3911	0.304	5008	,	,		17090	0.3442		0.4076	False		,,,				2504	0.5971					dbGAP											0																																										-	-	-			0					13q12.12-q12.13	2012-10-03			ENSG00000253771	ENSG00000253771			35196	pseudogene	pseudogene							Standard	NR_026730		Approved		uc010tdh.2	Q5T6R2	OTTHUMG00000016596		13.37:g.25541467C>T			B3KST4|B4DMH9	RNA	SNP	-	NULL	ENST00000429698.1	37	NULL		13																																																																																			TPTE2P1	-	-	ENSG00000253771		0.328	TPTE2P1-003	KNOWN	basic	processed_transcript	TPTE2P1	HGNC	pseudogene	OTTHUMT00000044206.1	39	0.00	0	C			25541467	25541467	-1	no_errors	ENST00000381871	ensembl	human	known	69_37n	rna	54	10.00	6	SNP	0.009	T
TRBV20OR9-2	6962	genome.wustl.edu	37	9	33618497	33618497	+	RNA	SNP	G	G	A	rs2380835	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr9:33618497G>A	ENST00000379435.3	+	0	409									T cell receptor beta variable 20/OR9-2 (non-functional)																		TACATCTGCAGTGCTAGAGAC	0.582											OREG0019139	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	g|||	2141	0.427516	0.1195	0.5058	5008	,	,		16583	0.5228		0.5457	False		,,,				2504	0.5685					dbGAP											0																																										-	-	-			0			L05149		9p21	2012-02-07	2008-09-11		ENSG00000205274	ENSG00000205274		"""T cell receptors / TRB orphons"""	12197	other	T cell receptor gene	"""T-cell receptor, beta variable region 2, orphon"""		"""T cell receptor beta variable 20/OR9-2"""	TCRBV2O		8384723	Standard	NG_001337		Approved	TRBV20/OR9-2, TCRBV20S2, TCRBV2S2O			OTTHUMG00000019781		9.37:g.33618497G>A		841		Missense_Mutation	SNP	pfam_Ig_V-set,pfscan_Ig-like	p.S128N	ENST00000379435.3	37	c.383		9																																																																																			TRBV20OR9-2	-	pfam_Ig_V-set,pfscan_Ig-like	ENSG00000205274		0.582	TRBV20OR9-2-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TRBV20OR9-2	HGNC	TR_V_gene	OTTHUMT00000052089.2	31	0.00	0	G	NG_001337		33618497	33618497	+1	no_stop_codon	ENST00000379435	ensembl	human	known	69_37n	missense	22	15.38	4	SNP	0.167	A
TRIM6	117854	genome.wustl.edu	37	11	5617987	5617987	+	Intron	SNP	G	G	A	rs12272467	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr11:5617987G>A	ENST00000278302.5	+	1	73				TRIM6_ENST00000515022.1_5'Flank|TRIM6_ENST00000506134.1_5'Flank|TRIM6_ENST00000380107.1_Intron|TRIM6_ENST00000507320.1_Intron|AC015691.13_ENST00000394793.2_RNA|TRIM6-TRIM34_ENST00000354852.5_5'UTR|TRIM6_ENST00000380097.3_5'UTR|TRIM6_ENST00000445329.1_5'UTR|HBG2_ENST00000380259.2_Intron	NM_001198645.1|NM_058166.4	NP_001185574.1|NP_477514.1	Q9C030	TRIM6_HUMAN	tripartite motif containing 6						protein trimerization (GO:0070206)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(5)|prostate(2)|stomach(1)	22		Lung NSC(207;2.23e-07)|all_lung(207;1.81e-06)|Medulloblastoma(188;0.00225)|Breast(177;0.0101)|all_neural(188;0.0212)		Epithelial(150;1.12e-45)|BRCA - Breast invasive adenocarcinoma(625;0.00101)|LUSC - Lung squamous cell carcinoma(625;0.192)		GAGCAGAGTCGTGCGTGGTTG	0.547													A|||	2271	0.453474	0.4236	0.5245	5008	,	,		10597	0.4881		0.5099	False		,,,				2504	0.3497					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF220030	CCDS31389.1, CCDS31390.1, CCDS55738.1	11p15	2013-01-09	2011-01-25		ENSG00000121236	ENSG00000121236		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16277	protein-coding gene	gene with protein product		607564	"""tripartite motif-containing 6"""			11331580	Standard	NM_058166		Approved	RNF89		Q9C030	OTTHUMG00000150029	ENST00000278302.5:c.-68+576G>A	11.37:g.5617987G>A			A8K2A7|B4DDQ5|Q86WZ8|Q9HCR1	RNA	SNP	-	NULL	ENST00000278302.5	37	NULL	CCDS31390.1	11																																																																																			TRIM6	-	-	ENSG00000121236		0.547	TRIM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM6	HGNC	protein_coding	OTTHUMT00000143376.2	18	0.00	0	G	NM_001003818		5617987	5617987	+1	no_errors	ENST00000511284	ensembl	human	known	69_37n	rna	15	21.05	4	SNP	0.000	A
VWDE	221806	genome.wustl.edu	37	7	12391319	12391319	+	Missense_Mutation	SNP	G	G	T	rs6967385	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr7:12391319G>T	ENST00000275358.3	-	19	3954	c.3766C>A	c.(3766-3768)Caa>Aaa	p.Q1256K		NM_001135924.1	NP_001129396.1	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	1256			Q -> K (in dbSNP:rs6967385). {ECO:0000269|PubMed:14702039}.			extracellular region (GO:0005576)				breast(4)|endometrium(2)|kidney(1)|skin(1)	8						GTAGTAAATTGATTTACAAAC	0.328													T|||	3139	0.626797	0.9281	0.5893	5008	,	,		17726	0.5942		0.4125	False		,,,				2504	0.5					dbGAP											0													129.0	123.0	125.0					7																	12391319		692	1590	2282	-	-	-	SO:0001583	missense	0				CCDS47544.1	7p21.3	2008-09-23			ENSG00000146530	ENSG00000146530			21897	protein-coding gene	gene with protein product						14702039, 16303743	Standard	NM_001135924		Approved	FLJ14712	uc003ssj.2	Q8N2E2	OTTHUMG00000152315	ENST00000275358.3:c.3766C>A	7.37:g.12391319G>T	ENSP00000275358:p.Gln1256Lys		B7ZM77|Q96SQ3	Missense_Mutation	SNP	pfam_EGF_extracell,pfam_VWF_type-D,superfamily_Cadherin-like,smart_VWF_type-D,smart_EGF-like,pfscan_EG-like_dom	p.Q1256K	ENST00000275358.3	37	c.3766	CCDS47544.1	7	1325	0.6066849816849816	458	0.9308943089430894	205	0.5662983425414365	356	0.6223776223776224	306	0.40369393139841686	T	0.008	-1.919281	0.00498	.	.	ENSG00000146530	ENST00000275358;ENST00000536307	T	0.65732	-0.17	3.06	-1.11	0.09840	.	1.313100	0.05006	N	0.470136	T	0.00012	0.0000	N	0.02721	-0.515	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.40701	-0.9549	9	0.05721	T	0.95	.	0.5757	0.00703	0.1747:0.3048:0.1715:0.3489	rs6967385;rs10334388;rs58096598;rs6967385	1256	Q8N2E2	VWDE_HUMAN	K	1256;710	ENSP00000275358:Q1256K	ENSP00000275358:Q1256K	Q	-	1	0	VWDE	12357844	0.003000	0.15002	0.001000	0.08648	0.006000	0.05464	-0.133000	0.10451	-0.579000	0.05952	-1.202000	0.01658	CAA	VWDE	-	NULL	ENSG00000146530		0.328	VWDE-001	NOVEL	basic|appris_principal|CCDS	protein_coding	VWDE	HGNC	protein_coding	OTTHUMT00000325870.3	36	0.00	0	G	XM_371878		12391319	12391319	-1	no_errors	ENST00000275358	ensembl	human	novel	69_37n	missense	32	27.27	12	SNP	0.002	T
WASH6P	653440	genome.wustl.edu	37	X	155254016	155254016	+	RNA	SNP	T	T	C			TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chrX:155254016T>C	ENST00000461007.1	+	0	2932				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										GTCCACTGGGTGCTTTCTGCC	0.677																																						dbGAP											0																																										-	-	-			0			AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155254016T>C			A6NGF1|Q8N305	RNA	SNP	-	NULL	ENST00000461007.1	37	NULL		X																																																																																			WASH6P	-	-	ENSG00000182484		0.677	WASH6P-016	KNOWN	basic	processed_transcript	WASH6P	HGNC	pseudogene	OTTHUMT00000058840.1	73	0.00	0	T	NG_008380		155254016	155254016	+1	no_errors	ENST00000461007	ensembl	human	known	69_37n	rna	49	10.91	6	SNP	0.002	C
WDR1	9948	genome.wustl.edu	37	4	10076860	10076860	+	3'UTR	SNP	G	G	A	rs9926	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr4:10076860G>A	ENST00000499869.2	-	0	2156				RP11-448G15.3_ENST00000561486.1_RNA|WDR1_ENST00000382451.2_3'UTR|WDR1_ENST00000382452.2_3'UTR|WDR1_ENST00000515743.1_5'UTR|WDR1_ENST00000502702.1_3'UTR			O75083	WDR1_HUMAN	WD repeat domain 1						blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|sensory perception of sound (GO:0007605)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)				endometrium(3)|lung(5)|ovary(2)|pancreas(1)|urinary_tract(1)	12				STAD - Stomach adenocarcinoma(129;0.000703)|Colorectal(103;0.0057)|LUSC - Lung squamous cell carcinoma(721;0.0232)		CTGCAGAGACGAGGGTCATGA	0.498													G|||	675	0.134784	0.0552	0.1556	5008	,	,		17783	0.1399		0.2326	False		,,,				2504	0.1217					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF020260	CCDS54739.1, CCDS54740.1	4p16.1	2013-01-09			ENSG00000071127	ENSG00000071127		"""WD repeat domain containing"""	12754	protein-coding gene	gene with protein product		604734				10036186	Standard	NM_017491		Approved		uc021xlv.1	O75083	OTTHUMG00000160253	ENST00000499869.2:c.*142C>T	4.37:g.10076860G>A			A8K6E9|A8MPU4|O75313|Q8N6E5|Q9UG05|Q9UG78|Q9UQE0	RNA	SNP	-	NULL	ENST00000499869.2	37	NULL	CCDS54740.1	4																																																																																			WDR1	-	-	ENSG00000071127		0.498	WDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR1	HGNC	protein_coding	OTTHUMT00000359877.1	54	0.00	0	G			10076860	10076860	-1	no_errors	ENST00000515743	ensembl	human	known	69_37n	rna	40	11.11	5	SNP	0.000	A
WDR17	116966	genome.wustl.edu	37	4	177041169	177041169	+	Silent	SNP	T	T	C			TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr4:177041169T>C	ENST00000280190.4	+	5	687	c.531T>C	c.(529-531)tgT>tgC	p.C177C	WDR17_ENST00000508596.1_Silent_p.C153C|WDR17_ENST00000507824.2_Silent_p.C177C|WDR17_ENST00000393643.2_Silent_p.C153C			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	177										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		CTGATATCTGTATGTTCAGAT	0.403																																						dbGAP											0													188.0	177.0	181.0					4																	177041169		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.531T>C	4.37:g.177041169T>C			E7EQX0|Q0QD35	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V51A	ENST00000280190.4	37	c.152	CCDS3825.1	4	.	.	.	.	.	.	.	.	.	.	T	0.619	-0.821893	0.02755	.	.	ENSG00000150627	ENST00000505894	.	.	.	5.44	-2.02	0.07388	.	.	.	.	.	T	0.55369	0.1916	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50320	-0.8842	4	.	.	.	-9.1099	10.3538	0.43952	0.0:0.3749:0.0:0.6251	.	.	.	.	A	51	.	.	V	+	2	0	WDR17	177278163	0.930000	0.31532	0.019000	0.16419	0.018000	0.09664	0.035000	0.13797	-0.608000	0.05731	0.533000	0.62120	GTA	WDR17	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000150627		0.403	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR17	HGNC	protein_coding	OTTHUMT00000362334.2	65	0.00	0	T			177041169	177041169	+1	no_start_codon:pseudogene:no_stop_codon	ENST00000505894	ensembl	human	novel	69_37n	missense	26	31.58	12	SNP	0.951	C
ZC3HAV1	56829	genome.wustl.edu	37	7	138764145	138764145	+	Intron	SNP	T	T	C	rs2236425	byFrequency	TCGA-A7-A3J0-01A-11D-A20S-09	TCGA-A7-A3J0-10A-01D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2fe4edb4-9780-457f-95a5-346ca22eac20	e7ddf4f3-409f-496f-be72-e3115f128136	g.chr7:138764145T>C	ENST00000242351.5	-	4	1788				ZC3HAV1_ENST00000464606.1_Silent_p.V514V|ZC3HAV1_ENST00000471652.1_Intron	NM_020119.3	NP_064504.2	Q7Z2W4	ZCCHV_HUMAN	zinc finger CCCH-type, antiviral 1						defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of mRNA catabolic process (GO:0061014)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(4)|skin(1)	37						TTTTATCCACTACTTGACTAG	0.398													C|||	1716	0.342652	0.4682	0.4352	5008	,	,		22148	0.3998		0.1829	False		,,,				2504	0.2127					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BX571742	CCDS5851.1, CCDS55171.1	7q34	2012-07-05			ENSG00000105939	ENSG00000105939		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	23721	protein-coding gene	gene with protein product	"""zinc finger antiviral protein"", "" CCCH-type zinc finger antiviral protein"""	607312				12215647, 12851707	Standard	NM_024625		Approved	ZAP, FLB6421, FLJ13288, MGC48898, ZC3HDC2, ZC3H2, PARP13	uc003vun.3	Q7Z2W4	OTTHUMG00000157471	ENST00000242351.5:c.1471+70A>G	7.37:g.138764145T>C			A4D1R2|A4D1S4|Q8IW57|Q8TAJ3|Q96N79|Q9H8R9|Q9P0Y7	Silent	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_WWE-dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.V514	ENST00000242351.5	37	c.1542	CCDS5851.1	7																																																																																			ZC3HAV1	-	NULL	ENSG00000105939		0.398	ZC3HAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3HAV1	HGNC	protein_coding	OTTHUMT00000348915.1	48	0.00	0	T	NM_020119		138764145	138764145	-1	no_errors	ENST00000464606	ensembl	human	novel	69_37n	silent	24	14.29	4	SNP	0.000	C
