#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
CBLN4	140689	genome.wustl.edu	37	20	54579007	54579007	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06Y-01A-21W-A019-09	TCGA-A8-A06Y-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3bede568-d8b6-44c0-99e0-a9b6c7d4ce80	268a4247-2839-412a-a531-475663b3a6ac	g.chr20:54579007G>A	ENST00000064571.2	-	1	1521	c.221C>T	c.(220-222)tCg>tTg	p.S74L		NM_080617.5	NP_542184.1	Q9NTU7	CBLN4_HUMAN	cerebellin 4 precursor	74	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				protein secretion (GO:0009306)	cell junction (GO:0030054)|extracellular space (GO:0005615)|synapse (GO:0045202)				endometrium(2)|large_intestine(1)|lung(10)|ovary(3)|pancreas(1)	17			Colorectal(105;0.202)			CCGCACCGCCGAGAAGGCGAC	0.642																																						dbGAP											0													124.0	130.0	128.0					20																	54579007		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY358527	CCDS13448.1	20q13	2004-08-19	2004-08-19	2004-08-19	ENSG00000054803	ENSG00000054803			16231	protein-coding gene	gene with protein product		615029	"""cerebellin precursor-like 1"""	CBLNL1			Standard	NM_080617		Approved	dJ885A10.1	uc002xxa.4	Q9NTU7	OTTHUMG00000032782	ENST00000064571.2:c.221C>T	20.37:g.54579007G>A	ENSP00000064571:p.Ser74Leu		A8K0S5	Missense_Mutation	SNP	pfam_C1q,superfamily_Tumour_necrosis_fac-like,smart_C1q,pfscan_C1q,prints_C1q	p.S74L	ENST00000064571.2	37	c.221	CCDS13448.1	20	.	.	.	.	.	.	.	.	.	.	G	33	5.223496	0.95139	.	.	ENSG00000054803	ENST00000064571	T	0.78246	-1.16	5.4	4.46	0.54185	Tumour necrosis factor-like (2);Complement C1q protein (3);	0.117639	0.64402	D	0.000008	D	0.89955	0.6865	M	0.92970	3.365	0.80722	D	1	D	0.76494	0.999	D	0.71870	0.975	D	0.92277	0.5830	10	0.87932	D	0	-4.5187	14.088	0.64971	0.0723:0.0:0.9277:0.0	.	74	Q9NTU7	CBLN4_HUMAN	L	74	ENSP00000064571:S74L	ENSP00000064571:S74L	S	-	2	0	CBLN4	54012414	1.000000	0.71417	0.971000	0.41717	0.993000	0.82548	9.287000	0.95975	1.405000	0.46838	0.655000	0.94253	TCG	CBLN4	-	pfam_C1q,superfamily_Tumour_necrosis_fac-like,smart_C1q,pfscan_C1q	ENSG00000054803		0.642	CBLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBLN4	HGNC	protein_coding	OTTHUMT00000079783.2	51	0.00	0	G	NM_080617		54579007	54579007	-1	no_errors	ENST00000064571	ensembl	human	known	69_37n	missense	21	43.59	17	SNP	1.000	A
CCT6B	10693	genome.wustl.edu	37	17	33269814	33269814	+	Splice_Site	SNP	C	C	T	rs376851436		TCGA-A8-A06Y-01A-21W-A019-09	TCGA-A8-A06Y-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3bede568-d8b6-44c0-99e0-a9b6c7d4ce80	268a4247-2839-412a-a531-475663b3a6ac	g.chr17:33269814C>T	ENST00000314144.5	-	6	841		c.e6+1		CCT6B_ENST00000421975.3_Intron|CCT6B_ENST00000436961.3_Splice_Site	NM_006584.3	NP_006575.2	Q92526	TCPW_HUMAN	chaperonin containing TCP1, subunit 6B (zeta 2)						chaperone-mediated protein complex assembly (GO:0051131)|protein folding (GO:0006457)|protein transport (GO:0015031)|spermatogenesis (GO:0007283)	chaperonin-containing T-complex (GO:0005832)	ATP binding (GO:0005524)|protein transporter activity (GO:0008565)|unfolded protein binding (GO:0051082)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)	20		Ovarian(249;0.17)				GTAACACGCACGTTTTTTCAT	0.338																																						dbGAP											0													63.0	58.0	60.0					17																	33269814		2202	4300	6502	-	-	-	SO:0001630	splice_region_variant	0			D78333	CCDS32617.1, CCDS54105.1, CCDS54106.1	17q	2011-09-02			ENSG00000132141	ENSG00000132141		"""Heat Shock Proteins / Chaperonins"""	1621	protein-coding gene	gene with protein product		610730				8812458, 9013858	Standard	NM_006584		Approved	Cctz2, TSA303	uc002hig.3	Q92526		ENST00000314144.5:c.725+1G>A	17.37:g.33269814C>T			B4DX20|B4DYB0|Q8TC34	Splice_Site	SNP	-	e6+1	ENST00000314144.5	37	c.725+1	CCDS32617.1	17	.	.	.	.	.	.	.	.	.	.	C	10.61	1.398034	0.25205	.	.	ENSG00000132141	ENST00000314144;ENST00000436961	.	.	.	4.23	2.82	0.32997	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.3495	0.32295	0.0:0.8494:0.0:0.1506	.	.	.	.	.	-1	.	.	.	-	.	.	CCT6B	30293927	1.000000	0.71417	1.000000	0.80357	0.459000	0.32528	3.912000	0.56386	0.981000	0.38548	0.591000	0.81541	.	CCT6B	-	-	ENSG00000132141		0.338	CCT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT6B	HGNC	protein_coding	OTTHUMT00000448014.1	78	0.00	0	C	NM_006584	Intron	33269814	33269814	-1	no_errors	ENST00000314144	ensembl	human	known	69_37n	splice_site	58	49.57	57	SNP	1.000	T
CLPX	10845	genome.wustl.edu	37	15	65450966	65450966	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A06Y-01A-21W-A019-09	TCGA-A8-A06Y-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3bede568-d8b6-44c0-99e0-a9b6c7d4ce80	268a4247-2839-412a-a531-475663b3a6ac	g.chr15:65450966T>A	ENST00000300107.3	-	7	1027	c.839A>T	c.(838-840)gAt>gTt	p.D280V		NM_006660.3	NP_006651.2	O76031	CLPX_HUMAN	caseinolytic mitochondrial matrix peptidase chaperone subunit	280					ATP catabolic process (GO:0006200)|positive regulation of peptidase activity (GO:0010952)|protein folding (GO:0006457)|proteolysis involved in cellular protein catabolic process (GO:0051603)	endopeptidase Clp complex (GO:0009368)|mitochondrial endopeptidase Clp complex (GO:0009841)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|metal ion binding (GO:0046872)|peptidase activator activity (GO:0016504)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(4)|prostate(1)|skin(2)	16						TTTTATGTCATCATGAGAAGA	0.358																																						dbGAP											0													195.0	173.0	180.0					15																	65450966		2201	4299	6500	-	-	-	SO:0001583	missense	0			AJ006267	CCDS10202.1	15q22.31	2013-09-12	2013-09-12		ENSG00000166855	ENSG00000166855		"""ATPases / AAA-type"""	2088	protein-coding gene	gene with protein product		615611	"""ClpX (caseinolytic protease X, E. coli) homolog"", ""ClpX caseinolytic protease X homolog (E. coli)"", ""ClpX caseinolytic peptidase X homolog (E. coli)"""			22841477	Standard	NM_006660		Approved		uc002aom.3	O76031	OTTHUMG00000133139	ENST00000300107.3:c.839A>T	15.37:g.65450966T>A	ENSP00000300107:p.Asp280Val		A1L428|A8K8F1|B9EGI8|Q9H4D9	Missense_Mutation	SNP	pfam_ATPase_AAA-2,pfam_Clp_ATPase_C,pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,pfam_Sigma_54_int,smart_AAA+_ATPase,tigrfam_Clp_protease_ATP-bd_su_ClpX	p.D280V	ENST00000300107.3	37	c.839	CCDS10202.1	15	.	.	.	.	.	.	.	.	.	.	T	14.81	2.645724	0.47258	.	.	ENSG00000166855	ENST00000300107;ENST00000546194	T	0.45276	0.9	6.07	6.07	0.98685	.	0.180247	0.64402	D	0.000013	T	0.30792	0.0776	N	0.14661	0.345	0.80722	D	1	B;B	0.23442	0.085;0.009	B;B	0.19666	0.026;0.011	T	0.09574	-1.0668	10	0.72032	D	0.01	.	16.6407	0.85098	0.0:0.0:0.0:1.0	.	280;280	Q9H072;O76031	.;CLPX_HUMAN	V	280	ENSP00000300107:D280V	ENSP00000300107:D280V	D	-	2	0	CLPX	63238019	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.153000	0.64888	2.326000	0.78906	0.533000	0.62120	GAT	CLPX	-	tigrfam_Clp_protease_ATP-bd_su_ClpX	ENSG00000166855		0.358	CLPX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLPX	HGNC	protein_coding	OTTHUMT00000256828.2	97	0.00	0	T	NM_006660		65450966	65450966	-1	no_errors	ENST00000300107	ensembl	human	known	69_37n	missense	24	76.70	79	SNP	1.000	A
CYTH3	9265	genome.wustl.edu	37	7	6210236	6210236	+	Silent	SNP	C	C	T			TCGA-A8-A06Y-01A-21W-A019-09	TCGA-A8-A06Y-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3bede568-d8b6-44c0-99e0-a9b6c7d4ce80	268a4247-2839-412a-a531-475663b3a6ac	g.chr7:6210236C>T	ENST00000350796.3	-	9	889	c.753G>A	c.(751-753)ccG>ccA	p.P251P	CYTH3_ENST00000396741.2_Silent_p.P166P|CYTH3_ENST00000488964.1_5'UTR	NM_004227.3	NP_004218.1	O43739	CYH3_HUMAN	cytohesin 3	251					establishment of epithelial cell polarity (GO:0090162)|Golgi vesicle transport (GO:0048193)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|regulation of cell adhesion (GO:0030155)	cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|urinary_tract(1)	19						CGTCGTCCTCCGGGATCTTAA	0.612																																						dbGAP											0													100.0	91.0	94.0					7																	6210236		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ223957	CCDS5346.1	7p22.1	2014-05-02	2008-08-14	2008-08-14	ENSG00000008256	ENSG00000008256		"""Pleckstrin homology (PH) domain containing"""	9504	protein-coding gene	gene with protein product		605081	"""pleckstrin homology, Sec7 and coiled-coil domains 3"""	PSCD3		9072969	Standard	NM_004227		Approved	GRP1, ARNO3, cytohesin-3	uc003spt.3	O43739	OTTHUMG00000023440	ENST00000350796.3:c.753G>A	7.37:g.6210236C>T			A4D2N8	Silent	SNP	pfam_Sec7,pfam_Pleckstrin_homology,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7	p.P251	ENST00000350796.3	37	c.753	CCDS5346.1	7																																																																																			CYTH3	-	superfamily_Sec7	ENSG00000008256		0.612	CYTH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYTH3	HGNC	protein_coding	OTTHUMT00000207396.2	15	0.00	0	C	NM_004227		6210236	6210236	-1	no_errors	ENST00000350796	ensembl	human	known	69_37n	silent	4	60.00	6	SNP	0.339	T
DKK4	27121	genome.wustl.edu	37	8	42234500	42234500	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A06Y-01A-21W-A019-09	TCGA-A8-A06Y-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3bede568-d8b6-44c0-99e0-a9b6c7d4ce80	268a4247-2839-412a-a531-475663b3a6ac	g.chr8:42234500C>A	ENST00000220812.2	-	1	250	c.64G>T	c.(64-66)Gac>Tac	p.D22Y		NM_014420.2	NP_055235.1	Q9UBT3	DKK4_HUMAN	dickkopf WNT signaling pathway inhibitor 4	22					multicellular organismal development (GO:0007275)|negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)				NS(1)|endometrium(1)|large_intestine(7)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	14	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;2.58e-12)|Lung NSC(13;4.24e-11)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.1)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;3.48e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00523)|Lung(22;0.00597)|LUSC - Lung squamous cell carcinoma(45;0.024)			TTGTTGAAGTCCAGGACCAGA	0.657																																						dbGAP											0													57.0	54.0	55.0					8																	42234500		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF177397	CCDS6130.1	8p11.2-p11.1	2013-05-15	2013-05-15		ENSG00000104371	ENSG00000104371			2894	protein-coding gene	gene with protein product		605417	"""dickkopf (Xenopus laevis) homolog 4"", ""dickkopf homolog 4 (Xenopus laevis)"""			10570958, 11701963	Standard	NM_014420		Approved		uc003xpb.3	Q9UBT3	OTTHUMG00000164167	ENST00000220812.2:c.64G>T	8.37:g.42234500C>A	ENSP00000220812:p.Asp22Tyr		Q3KNX0|Q9Y4C3	Missense_Mutation	SNP	pfam_Dickkopf_N,pfam_Prokineticin_domain	p.D22Y	ENST00000220812.2	37	c.64	CCDS6130.1	8	.	.	.	.	.	.	.	.	.	.	C	13.34	2.207421	0.39003	.	.	ENSG00000104371	ENST00000543914;ENST00000220812	T	0.35048	1.33	5.4	4.51	0.55191	.	0.000000	0.56097	D	0.000035	T	0.46073	0.1374	L	0.34521	1.04	0.39708	D	0.971295	D	0.64830	0.994	D	0.66084	0.941	T	0.49698	-0.8912	10	0.72032	D	0.01	.	12.1113	0.53840	0.0:0.827:0.1729:0.0	.	22	Q9UBT3	DKK4_HUMAN	Y	22	ENSP00000220812:D22Y	ENSP00000220812:D22Y	D	-	1	0	DKK4	42353657	1.000000	0.71417	0.998000	0.56505	0.039000	0.13416	2.501000	0.45389	1.252000	0.44001	-0.302000	0.09304	GAC	DKK4	-	NULL	ENSG00000104371		0.657	DKK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DKK4	HGNC	protein_coding	OTTHUMT00000377563.1	27	0.00	0	C			42234500	42234500	-1	no_errors	ENST00000220812	ensembl	human	known	69_37n	missense	34	36.36	20	SNP	1.000	A
DMD	1756	genome.wustl.edu	37	X	32867884	32867884	+	Silent	SNP	G	G	T			TCGA-A8-A06Y-01A-21W-A019-09	TCGA-A8-A06Y-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3bede568-d8b6-44c0-99e0-a9b6c7d4ce80	268a4247-2839-412a-a531-475663b3a6ac	g.chrX:32867884G>T	ENST00000357033.4	-	3	353	c.147C>A	c.(145-147)cgC>cgA	p.R49R	DMD_ENST00000288447.4_Silent_p.R41R|DMD_ENST00000378677.2_Silent_p.R45R|snoU13_ENST00000459244.1_RNA	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	49	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.		Missing (in BMD).		cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GGTCTAGGAGGCGCCTCCCAT	0.388																																						dbGAP											0													90.0	85.0	87.0					X																	32867884		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.147C>A	X.37:g.32867884G>T			E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Silent	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.R49	ENST00000357033.4	37	c.147	CCDS14233.1	X																																																																																			DMD	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pirsf_Dystrophin/utrophin,pfscan_CH-domain	ENSG00000198947		0.388	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	164	0.00	0	G	NM_004006		32867884	32867884	-1	no_errors	ENST00000357033	ensembl	human	known	69_37n	silent	199	37.22	118	SNP	1.000	T
EXOC6	54536	genome.wustl.edu	37	10	94653227	94653227	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06Y-01A-21W-A019-09	TCGA-A8-A06Y-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3bede568-d8b6-44c0-99e0-a9b6c7d4ce80	268a4247-2839-412a-a531-475663b3a6ac	g.chr10:94653227G>C	ENST00000260762.6	+	2	237	c.223G>C	c.(223-225)Gat>Cat	p.D75H	EXOC6_ENST00000371547.4_Missense_Mutation_p.D91H|EXOC6_ENST00000371552.4_Missense_Mutation_p.D70H|EXOC6_ENST00000371543.1_Missense_Mutation_p.D75H|EXOC6_ENST00000443748.2_Missense_Mutation_p.D75H	NM_019053.4	NP_061926.3	Q8TAG9	EXOC6_HUMAN	exocyst complex component 6	75					cellular protein metabolic process (GO:0044267)|erythrocyte differentiation (GO:0030218)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	exocyst (GO:0000145)|plasma membrane (GO:0005886)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	26		Colorectal(252;0.123)				GGGTTTTGTAGATGCTATTAC	0.313																																						dbGAP											0													107.0	112.0	110.0					10																	94653227		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC028395	CCDS7424.2, CCDS31247.1	10q23.33	2013-01-22	2006-11-07	2006-11-07	ENSG00000138190	ENSG00000138190			23196	protein-coding gene	gene with protein product		609672	"""SEC15-like 1 (S. cerevisiae)"""	SEC15L1		8889548	Standard	NM_001013848		Approved	SEC15L, FLJ1125, DKFZp761I2124, MGC33397, Sec15p, EXOC6A	uc001kig.3	Q8TAG9	OTTHUMG00000018767	ENST00000260762.6:c.223G>C	10.37:g.94653227G>C	ENSP00000260762:p.Asp75His		E9PHI3|Q5VXH8|Q9NZ24	Missense_Mutation	SNP	pfam_Sec15,pirsf_Sec15	p.D91H	ENST00000260762.6	37	c.271	CCDS7424.2	10	.	.	.	.	.	.	.	.	.	.	G	16.06	3.014969	0.54468	.	.	ENSG00000138190	ENST00000371547;ENST00000371552;ENST00000371543;ENST00000443748;ENST00000260762	T;T;T;T;T	0.32023	1.47;1.47;1.47;1.47;1.47	6.06	6.06	0.98353	.	0.043926	0.85682	D	0.000000	T	0.55986	0.1955	M	0.78801	2.425	0.50039	D	0.99984	B;D;B;B;B	0.67145	0.204;0.996;0.197;0.197;0.121	B;P;B;B;B	0.58013	0.043;0.831;0.114;0.114;0.079	T	0.57370	-0.7823	10	0.87932	D	0	-20.5775	20.6397	0.99537	0.0:0.0:1.0:0.0	.	91;75;67;75;70	F2Z2Q3;E7EW84;B4DEZ1;Q8TAG9;E9PHI3	.;.;.;EXOC6_HUMAN;.	H	91;70;75;75;75	ENSP00000360602:D91H;ENSP00000360607:D70H;ENSP00000360598:D75H;ENSP00000396206:D75H;ENSP00000260762:D75H	ENSP00000260762:D75H	D	+	1	0	EXOC6	94643207	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.750000	0.98875	2.880000	0.98712	0.650000	0.86243	GAT	EXOC6	-	pirsf_Sec15	ENSG00000138190		0.313	EXOC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC6	HGNC	protein_coding	OTTHUMT00000049410.2	361	0.00	0	G	NM_019053		94653227	94653227	+1	no_errors	ENST00000371547	ensembl	human	known	69_37n	missense	333	39.60	219	SNP	1.000	C
SPATA31D5P	347127	genome.wustl.edu	37	9	84533988	84533988	+	RNA	SNP	C	C	T	rs201817091	byFrequency	TCGA-A8-A06Y-01A-21W-A019-09	TCGA-A8-A06Y-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3bede568-d8b6-44c0-99e0-a9b6c7d4ce80	268a4247-2839-412a-a531-475663b3a6ac	g.chr9:84533988C>T	ENST00000527857.1	+	0	4010					NR_026851.1				SPATA31 subfamily D, member 5, pseudogene																		GGATGCAGGGCTGGGGACATC	0.502													-|||	115	0.0229633	0.0779	0.0086	5008	,	,		16459	0.0		0.001	False		,,,				2504	0.0051					dbGAP											0																																										-	-	-			0					9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000240632	ENSG00000240632			38602	pseudogene	pseudogene			"""family with sequence similarity 75, member D5"", ""family with sequence similarity 75, member D5, pseudogene"""	FAM75D5			Standard	NR_026851		Approved	FLJ43950, FAM75D5P	uc011lst.2		OTTHUMG00000020087		9.37:g.84533988C>T				RNA	SNP	-	NULL	ENST00000527857.1	37	NULL		9																																																																																			FAM75D5	-	-	ENSG00000240632		0.502	SPATA31D5P-002	KNOWN	basic	processed_transcript	FAM75D5	HGNC	pseudogene	OTTHUMT00000052810.2	21	0.00	0	C	NR_026851		84533988	84533988	+1	no_errors	ENST00000527857	ensembl	human	known	69_37n	rna	3	40.00	2	SNP	0.000	T
GAB3	139716	genome.wustl.edu	37	X	153928295	153928295	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Y-01A-21W-A019-09	TCGA-A8-A06Y-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3bede568-d8b6-44c0-99e0-a9b6c7d4ce80	268a4247-2839-412a-a531-475663b3a6ac	g.chrX:153928295C>T	ENST00000369575.3	-	5	1137	c.1106G>A	c.(1105-1107)cGg>cAg	p.R369Q	GAB3_ENST00000496390.1_5'UTR|GAB3_ENST00000424127.2_Missense_Mutation_p.R370Q	NM_001081573.1|NM_080612.2	NP_001075042.1|NP_542179.1	Q8WWW8	GAB3_HUMAN	GRB2-associated binding protein 3	369					macrophage differentiation (GO:0030225)					NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)	25	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CAAACTAAGCCGCTTGTCTCG	0.373																																						dbGAP											0													159.0	143.0	149.0					X																	153928295		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY057989	CCDS14760.1, CCDS48198.1, CCDS65357.1	Xq28	2013-01-10			ENSG00000160219	ENSG00000160219		"""Pleckstrin homology (PH) domain containing"""	17515	protein-coding gene	gene with protein product	"""DOS/Gab family member 3"", ""Gab3 scaffolding protein"""	300482				11739737	Standard	XM_005274648		Approved		uc004fmk.1	Q8WWW8	OTTHUMG00000024245	ENST00000369575.3:c.1106G>A	X.37:g.153928295C>T	ENSP00000358588:p.Arg369Gln		A6NHF8|E9PB44	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.R370Q	ENST00000369575.3	37	c.1109	CCDS14760.1	X	.	.	.	.	.	.	.	.	.	.	C	20.5	3.994367	0.74703	.	.	ENSG00000160219	ENST00000369575;ENST00000369568;ENST00000424127	T;T;T	0.32988	1.43;1.43;1.43	5.76	5.76	0.90799	.	0.271795	0.37348	N	0.002135	T	0.54886	0.1886	M	0.80982	2.52	0.48185	D	0.999604	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.68621	0.944;0.959;0.944	T	0.52675	-0.8544	10	0.15952	T	0.53	-24.9834	16.214	0.82191	0.0:1.0:0.0:0.0	.	370;370;369	A6NHF8;E9PB44;Q8WWW8	.;.;GAB3_HUMAN	Q	369;370;370	ENSP00000358588:R369Q;ENSP00000358581:R370Q;ENSP00000399588:R370Q	ENSP00000358581:R370Q	R	-	2	0	GAB3	153581489	1.000000	0.71417	1.000000	0.80357	0.676000	0.39594	5.230000	0.65321	2.433000	0.82419	0.468000	0.43344	CGG	GAB3	-	NULL	ENSG00000160219		0.373	GAB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GAB3	HGNC	protein_coding	OTTHUMT00000061192.2	176	0.00	0	C	NM_001081573		153928295	153928295	-1	no_errors	ENST00000424127	ensembl	human	known	69_37n	missense	149	43.77	116	SNP	1.000	T
GABRA1	2554	genome.wustl.edu	37	5	161309644	161309644	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A06Y-01A-21W-A019-09	TCGA-A8-A06Y-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3bede568-d8b6-44c0-99e0-a9b6c7d4ce80	268a4247-2839-412a-a531-475663b3a6ac	g.chr5:161309644C>A	ENST00000428797.2	+	8	995	c.640C>A	c.(640-642)Cgt>Agt	p.R214S	GABRA1_ENST00000437025.2_Missense_Mutation_p.R214S|GABRA1_ENST00000023897.6_Missense_Mutation_p.R214S|GABRA1_ENST00000444819.1_Missense_Mutation_p.R214S|GABRA1_ENST00000393943.4_Missense_Mutation_p.R214S|GABRA1_ENST00000420560.1_Missense_Mutation_p.R214S	NM_001127643.1	NP_001121115.1	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 1	214					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|drug binding (GO:0008144)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(1)|lung(22)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(1)	42	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zaleplon(DB00962)|Zolpidem(DB00425)|Zopiclone(DB01198)	AGATGGATCACGTCTAAACCA	0.413																																						dbGAP											0													160.0	139.0	146.0					5																	161309644		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4357.1	5q34	2012-06-22			ENSG00000022355	ENSG00000022355		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4075	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 1"""	137160				1330891	Standard	NM_000806		Approved	EJM5	uc003lyx.4	P14867	OTTHUMG00000163586	ENST00000428797.2:c.640C>A	5.37:g.161309644C>A	ENSP00000393097:p.Arg214Ser		D3DQK6|Q8N629	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,prints_GABAA_rcpt,prints_GABBAa1_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.R214S	ENST00000428797.2	37	c.640	CCDS4357.1	5	.	.	.	.	.	.	.	.	.	.	C	16.25	3.069921	0.55539	.	.	ENSG00000022355	ENST00000023897;ENST00000428797;ENST00000393943;ENST00000437025;ENST00000420560;ENST00000444819	T;T;T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19;-1.19;-1.19	5.34	5.34	0.76211	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	T	0.77336	0.4115	N	0.05467	-0.045	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.77678	-0.2498	10	0.27785	T	0.31	.	18.3886	0.90474	0.0:1.0:0.0:0.0	.	214	P14867	GBRA1_HUMAN	S	214	ENSP00000023897:R214S;ENSP00000393097:R214S;ENSP00000377517:R214S;ENSP00000415441:R214S;ENSP00000408041:R214S;ENSP00000414232:R214S	ENSP00000023897:R214S	R	+	1	0	GABRA1	161242222	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.892000	0.48625	2.657000	0.90304	0.650000	0.86243	CGT	GABRA1	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_GABAAa_rcpt,tigrfam_Neur_channel	ENSG00000022355		0.413	GABRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRA1	HGNC	protein_coding	OTTHUMT00000252702.2	69	0.00	0	C	NM_000806.5		161309644	161309644	+1	no_errors	ENST00000023897	ensembl	human	known	69_37n	missense	51	41.38	36	SNP	1.000	A
GALNT13	114805	genome.wustl.edu	37	2	155157929	155157929	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A06Y-01A-21W-A019-09	TCGA-A8-A06Y-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3bede568-d8b6-44c0-99e0-a9b6c7d4ce80	268a4247-2839-412a-a531-475663b3a6ac	g.chr2:155157929A>G	ENST00000392825.3	+	9	1550	c.983A>G	c.(982-984)cAa>cGa	p.Q328R	GALNT13_ENST00000409237.1_Missense_Mutation_p.Q328R|GALNT13_ENST00000487047.1_3'UTR	NM_052917.2	NP_443149.2	Q8IUC8	GLT13_HUMAN	polypeptide N-acetylgalactosaminyltransferase 13	328	Catalytic subdomain B.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|lung(37)|ovary(3)|pancreas(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	65						CAGATTTGGCAATGTGGAGGC	0.403																																						dbGAP											0													218.0	212.0	214.0					2																	155157929		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB067505	CCDS2199.1	2q24.1	2014-03-13	2014-03-13		ENSG00000144278	ENSG00000144278	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	23242	protein-coding gene	gene with protein product	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13"", ""polypeptide GalNAc transferase 13"""	608369	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)"""			11572484, 12407114	Standard	XM_005246267		Approved	KIAA1918, GalNAc-T13	uc002tyr.4	Q8IUC8	OTTHUMG00000131917	ENST00000392825.3:c.983A>G	2.37:g.155157929A>G	ENSP00000376570:p.Gln328Arg		Q08ER7|Q68VI8|Q6ZWG1|Q96PX0|Q9UIE5	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.Q328R	ENST00000392825.3	37	c.983	CCDS2199.1	2	.	.	.	.	.	.	.	.	.	.	A	17.60	3.429106	0.62844	.	.	ENSG00000144278	ENST00000392825;ENST00000409237	T;T	0.62788	-0.0;-0.0	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.80944	0.4721	M	0.90145	3.09	0.80722	D	1	P;P;P;P	0.52463	0.953;0.907;0.923;0.907	P;P;P;P	0.61275	0.886;0.669;0.675;0.669	D	0.84829	0.0801	10	0.62326	D	0.03	.	14.5982	0.68422	1.0:0.0:0.0:0.0	.	328;328;328;328	Q8IUC8-2;B3KY85;Q08ER7;Q8IUC8	.;.;.;GLT13_HUMAN	R	328	ENSP00000376570:Q328R;ENSP00000387239:Q328R	ENSP00000376570:Q328R	Q	+	2	0	GALNT13	154866175	1.000000	0.71417	0.998000	0.56505	0.951000	0.60555	9.186000	0.94906	2.105000	0.64084	0.460000	0.39030	CAA	GALNT13	-	NULL	ENSG00000144278		0.403	GALNT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT13	HGNC	protein_coding	OTTHUMT00000254870.2	180	0.00	0	A	NM_052917		155157929	155157929	+1	no_errors	ENST00000409237	ensembl	human	known	69_37n	missense	124	13.29	19	SNP	1.000	G
GATA3	2625	genome.wustl.edu	37	10	8115710	8115711	+	Frame_Shift_Ins	INS	-	-	C	rs104894165		TCGA-A8-A06Y-01A-21W-A019-09	TCGA-A8-A06Y-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3bede568-d8b6-44c0-99e0-a9b6c7d4ce80	268a4247-2839-412a-a531-475663b3a6ac	g.chr10:8115710_8115711insC	ENST00000346208.3	+	6	1511_1512	c.1056_1057insC	c.(1057-1059)cccfs	p.P353fs	GATA3_ENST00000461472.1_3'UTR|GATA3_ENST00000379328.3_Frame_Shift_Ins_p.P354fs			P23771	GATA3_HUMAN	GATA binding protein 3	353					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						AGATTAACAGACCCCTGACTAT	0.406			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																															dbGAP		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	0			GRCh37	CM065214	GATA3	M	rs104894165																																			-	-	-	SO:0001589	frameshift_variant	0			X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.1060dupC	10.37:g.8115714_8115714dupC	ENSP00000341619:p.Pro353fs		Q5VWG7|Q5VWG8|Q96J16	Frame_Shift_Ins	INS	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	p.L354fs	ENST00000346208.3	37	c.1059_1060	CCDS7083.1	10																																																																																			GATA3	-	smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA	ENSG00000107485		0.406	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA3	HGNC	protein_coding	OTTHUMT00000046719.1	109	0.00	0	-	NM_001002295		8115710	8115711	+1	no_errors	ENST00000379328	ensembl	human	known	69_37n	frame_shift_ins	66	47.20	59	INS	1.000:1.000	C
GOLGA5	9950	genome.wustl.edu	37	14	93273140	93273140	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A06Y-01A-21W-A019-09	TCGA-A8-A06Y-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3bede568-d8b6-44c0-99e0-a9b6c7d4ce80	268a4247-2839-412a-a531-475663b3a6ac	g.chr14:93273140G>T	ENST00000163416.2	+	3	860	c.604G>T	c.(604-606)Gtg>Ttg	p.V202L	GOLGA5_ENST00000355976.2_Missense_Mutation_p.V202L	NM_005113.2	NP_005104	Q8TBA6	GOGA5_HUMAN	golgin A5	202					Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein homodimerization activity (GO:0042803)|Rab GTPase binding (GO:0017137)			large_intestine(6)|lung(1)|ovary(2)	9		all_cancers(154;0.0934)		COAD - Colon adenocarcinoma(157;0.222)		AAAGGAAAATGTGTCATCAAA	0.433			T	RET	papillary thyroid																																	dbGAP		Dom	yes		14	14q	9950	"""golgi autoantigen, golgin subfamily a, 5  (PTC5)"""		E	0													103.0	85.0	91.0					14																	93273140		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF085199	CCDS9905.1	14q32.12	2012-05-04	2010-02-12		ENSG00000066455	ENSG00000066455			4428	protein-coding gene	gene with protein product	"""golgi integral membrane protein 5"""	606918	"""golgi autoantigen, golgin subfamily a, 5"""			2734021, 9443391, 15004235	Standard	NM_005113		Approved	ret-II, golgin-84, rfg5, GOLIM5	uc001yaz.1	Q8TBA6	OTTHUMG00000171217	ENST00000163416.2:c.604G>T	14.37:g.93273140G>T	ENSP00000163416:p.Val202Leu		C9JRU1|O95287|Q03962|Q2TS49|Q9UQQ7	Missense_Mutation	SNP	pfam_Golgin_subfamily_A_member_5,superfamily_Prefoldin	p.V202L	ENST00000163416.2	37	c.604	CCDS9905.1	14	.	.	.	.	.	.	.	.	.	.	G	10.02	1.236940	0.22711	.	.	ENSG00000066455	ENST00000163416;ENST00000355976;ENST00000439315	T;T	0.28454	1.62;1.61	5.55	0.842	0.18927	.	0.885835	0.09483	N	0.796086	T	0.20333	0.0489	L	0.36672	1.1	0.09310	N	1	B	0.14012	0.009	B	0.09377	0.004	T	0.28038	-1.0056	10	0.28530	T	0.3	0.6946	4.1483	0.10225	0.2916:0.0:0.3929:0.3155	.	202	Q8TBA6	GOGA5_HUMAN	L	202;202;111	ENSP00000163416:V202L;ENSP00000348252:V202L	ENSP00000163416:V202L	V	+	1	0	GOLGA5	92342893	0.000000	0.05858	0.000000	0.03702	0.237000	0.25408	0.007000	0.13174	0.184000	0.20083	0.557000	0.71058	GTG	GOLGA5	-	NULL	ENSG00000066455		0.433	GOLGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA5	HGNC	protein_coding	OTTHUMT00000412365.1	68	0.00	0	G			93273140	93273140	+1	no_errors	ENST00000163416	ensembl	human	known	69_37n	missense	66	48.44	62	SNP	0.000	T
HIST1H4J	8363	genome.wustl.edu	37	6	27792030	27792030	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A06Y-01A-21W-A019-09	TCGA-A8-A06Y-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3bede568-d8b6-44c0-99e0-a9b6c7d4ce80	268a4247-2839-412a-a531-475663b3a6ac	g.chr6:27792030G>T	ENST00000355057.1	+	1	147	c.128G>T	c.(127-129)gGc>gTc	p.G43V		NM_021968.3	NP_068803.1	P62805	H4_HUMAN	histone cluster 1, H4j	43					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			lung(2)|ovary(1)|pancreas(1)	4						CGCCGCGGCGGCGTGAAGCGC	0.637																																						dbGAP											0													7.0	9.0	8.0					6																	27792030		1947	4061	6008	-	-	-	SO:0001583	missense	0			J00188	CCDS4630.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197238	ENSG00000197238		"""Histones / Replication-dependent"""	4785	protein-coding gene	gene with protein product		602826	"""H4 histone family, member E"", ""histone 1, H4j"""	H4FE		6265100, 9439656, 12408966	Standard	NM_021968		Approved	H4/e, H4F2iv	uc003njp.3	P62805	OTTHUMG00000014487	ENST00000355057.1:c.128G>T	6.37:g.27792030G>T	ENSP00000347168:p.Gly43Val		A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_TAF_TATA-bd,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4	p.G43V	ENST00000355057.1	37	c.128	CCDS4630.1	6	.	.	.	.	.	.	.	.	.	.	.	17.24	3.340444	0.60963	.	.	ENSG00000197238	ENST00000355057	T	0.67345	-0.26	3.77	3.77	0.43336	.	0.000000	0.64402	U	0.000001	T	0.70613	0.3244	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.75955	-0.3135	7	0.87932	D	0	.	13.6149	0.62101	0.0:0.0:1.0:0.0	.	.	.	.	V	43	ENSP00000347168:G43V	ENSP00000347168:G43V	G	+	2	0	HIST1H4J	27900009	1.000000	0.71417	0.976000	0.42696	0.171000	0.22731	9.241000	0.95402	2.038000	0.60285	0.484000	0.47621	GGC	HIST1H4J	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4	ENSG00000197238		0.637	HIST1H4J-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H4J	HGNC	protein_coding	OTTHUMT00000040155.1	29	0.00	0	G	NM_021968		27792030	27792030	+1	no_errors	ENST00000355057	ensembl	human	known	69_37n	missense	3	75.00	9	SNP	1.000	T
KDM6A	7403	genome.wustl.edu	37	X	44911035	44911035	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A8-A06Y-01A-21W-A019-09	TCGA-A8-A06Y-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3bede568-d8b6-44c0-99e0-a9b6c7d4ce80	268a4247-2839-412a-a531-475663b3a6ac	g.chrX:44911035delT	ENST00000377967.4	+	9	777	c.736delT	c.(736-738)ttafs	p.L246fs	KDM6A_ENST00000536777.1_Frame_Shift_Del_p.L246fs|KDM6A_ENST00000543216.1_Frame_Shift_Del_p.L246fs|KDM6A_ENST00000382899.4_Frame_Shift_Del_p.L246fs	NM_021140.2	NP_066963.2	O15550	KDM6A_HUMAN	lysine (K)-specific demethylase 6A	246	Interaction with SUPT6H. {ECO:0000250}.				canonical Wnt signaling pathway (GO:0060070)|heart morphogenesis (GO:0003007)|histone H3-K4 methylation (GO:0051568)|in utero embryonic development (GO:0001701)|mesodermal cell differentiation (GO:0048333)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|regulation of gene expression (GO:0010468)|respiratory system process (GO:0003016)|somite rostral/caudal axis specification (GO:0032525)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.0?(6)|p.0(4)		NS(1)|breast(7)|central_nervous_system(27)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(24)|kidney(24)|large_intestine(9)|liver(1)|lung(21)|oesophagus(11)|pancreas(2)|prostate(5)|skin(1)|soft_tissue(1)|urinary_tract(29)	170						AGCAACTGTCTTACAACAGTT	0.328			"""D, N, F, S"""		"""renal, oesophageal SCC, MM"""																																Colon(129;1273 1667 15230 27352 52914)	dbGAP		Rec	yes		X	Xp11.2	7403	"""lysine (K)-specific demethylase 6A, UTX"""		"""E, L"""	10	Whole gene deletion(6)|No detectable mRNA/protein(4)	haematopoietic_and_lymphoid_tissue(4)|oesophagus(2)|breast(2)|pancreas(2)											42.0	36.0	38.0					X																	44911035		2199	4293	6492	-	-	-	SO:0001589	frameshift_variant	0			AF000992	CCDS14265.1	Xp11.2	2014-09-17	2009-04-17	2009-04-17	ENSG00000147050	ENSG00000147050		"""Chromatin-modifying enzymes / K-demethylases"", ""Tetratricopeptide (TTC) repeat domain containing"""	12637	protein-coding gene	gene with protein product		300128	"""ubiquitously transcribed tetratricopeptide repeat, X chromosome"""	UTX		9499428, 9381176	Standard	XM_005272655		Approved		uc004dge.4	O15550	OTTHUMG00000021402	ENST00000377967.4:c.736delT	X.37:g.44911035delT	ENSP00000367203:p.Leu246fs		Q52LL9|Q5JVQ7	Frame_Shift_Del	DEL	pfam_JmjC_dom,pfam_TPR-1,smart_TPR_repeat,smart_JmjC_dom,pfscan_JmjC_dom,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.L246fs	ENST00000377967.4	37	c.736	CCDS14265.1	X																																																																																			KDM6A	-	pfscan_TPR-contain_dom	ENSG00000147050		0.328	KDM6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM6A	HGNC	protein_coding	OTTHUMT00000056324.1	32	0.00	0	T	NM_021140		44911035	44911035	+1	no_errors	ENST00000382899	ensembl	human	known	69_37n	frame_shift_del	31	30.43	14	DEL	1.000	-
KIF3B	9371	genome.wustl.edu	37	20	30898744	30898744	+	Silent	SNP	C	C	T			TCGA-A8-A06Y-01A-21W-A019-09	TCGA-A8-A06Y-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3bede568-d8b6-44c0-99e0-a9b6c7d4ce80	268a4247-2839-412a-a531-475663b3a6ac	g.chr20:30898744C>T	ENST00000375712.3	+	2	1331	c.1164C>T	c.(1162-1164)ggC>ggT	p.G388G	KIF3B_ENST00000418717.2_Intron	NM_004798.3	NP_004789.1	O15066	KIF3B_HUMAN	kinesin family member 3B	388	Poly-Gly.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|determination of left/right symmetry (GO:0007368)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic centrosome separation (GO:0007100)|mitotic spindle organization (GO:0007052)|plus-end-directed vesicle transport along microtubule (GO:0072383)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|plus-end kinesin complex (GO:0005873)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|Rho GTPase binding (GO:0017048)			NS(2)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(5)|lung(9)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			AAGGTGGTGGCAGTGGTGGGG	0.562																																						dbGAP											0													50.0	48.0	48.0					20																	30898744		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB002357	CCDS13200.1	20q11.21	2012-08-01			ENSG00000101350	ENSG00000101350		"""Kinesins"""	6320	protein-coding gene	gene with protein product		603754				9205841	Standard	NM_004798		Approved	KIAA0359, FLA8, KLP-11	uc002wxq.3	O15066	OTTHUMG00000032214	ENST00000375712.3:c.1164C>T	20.37:g.30898744C>T			B2RMP4|B4DSR5|E1P5M5	Silent	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.G388	ENST00000375712.3	37	c.1164	CCDS13200.1	20																																																																																			KIF3B	-	NULL	ENSG00000101350		0.562	KIF3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF3B	HGNC	protein_coding	OTTHUMT00000078619.1	115	0.00	0	C	NM_004798		30898744	30898744	+1	no_errors	ENST00000375712	ensembl	human	known	69_37n	silent	126	37.75	77	SNP	1.000	T
MALAT1	378938	genome.wustl.edu	37	11	65273697	65273697	+	lincRNA	DEL	C	C	-			TCGA-A8-A06Y-01A-21W-A019-09	TCGA-A8-A06Y-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3bede568-d8b6-44c0-99e0-a9b6c7d4ce80	268a4247-2839-412a-a531-475663b3a6ac	g.chr11:65273697delC	ENST00000534336.1	+	0	8465					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		TTCTCCTTTTCTCTGCAGGTG	0.453																																						dbGAP											0													66.0	66.0	66.0					11																	65273697		874	1988	2862	-	-	-			0			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65273697delC				RNA	DEL	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			MALAT1	-	-	ENSG00000251562		0.453	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1	52	0.00	0	C	NR_002819		65273697	65273697	+1	no_errors	ENST00000534336	ensembl	human	known	69_37n	rna	65	33.96	36	DEL	0.000	-
MTOR	2475	genome.wustl.edu	37	1	11169377	11169377	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A06Y-01A-21W-A019-09	TCGA-A8-A06Y-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3bede568-d8b6-44c0-99e0-a9b6c7d4ce80	268a4247-2839-412a-a531-475663b3a6ac	g.chr1:11169377T>A	ENST00000361445.4	-	56	7574	c.7498A>T	c.(7498-7500)Att>Ttt	p.I2500F	MTOR_ENST00000376838.1_Missense_Mutation_p.I705F	NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	2500	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	CTGTTAATAATCTGGATAGCT	0.408																																						dbGAP											0													177.0	156.0	163.0					1																	11169377		2203	4300	6503	-	-	-	SO:0001583	missense	0			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.7498A>T	1.37:g.11169377T>A	ENSP00000354558:p.Ile2500Phe		Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_DUF3385_TOR,pfam_FKBP_rapamycin-assoc_FKBP12-bd,pfam_FATC,superfamily_ARM-type_fold,superfamily_Kinase-like_dom,superfamily_FKBP_rapamycin-assoc_FKBP12-bd,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.I2500F	ENST00000361445.4	37	c.7498	CCDS127.1	1	.	.	.	.	.	.	.	.	.	.	T	34	5.335683	0.95758	.	.	ENSG00000198793	ENST00000361445;ENST00000376838;ENST00000455339	T;T;T	0.30182	3.07;2.84;1.54	5.82	5.82	0.92795	Phosphatidylinositol 3-/4-kinase, catalytic (1);	0.047538	0.85682	D	0.000000	T	0.58921	0.2156	M	0.87328	2.875	0.80722	D	1	D	0.71674	0.998	D	0.64506	0.926	T	0.66650	-0.5870	10	0.87932	D	0	-10.0412	13.9151	0.63893	0.0:0.0:0.0:1.0	.	2500	P42345	MTOR_HUMAN	F	2500;705;156	ENSP00000354558:I2500F;ENSP00000366034:I705F;ENSP00000398745:I156F	ENSP00000354558:I2500F	I	-	1	0	MTOR	11091964	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.466000	0.80914	2.223000	0.72356	0.482000	0.46254	ATT	MTOR	-	pfscan_PI3/4_kinase_cat_dom	ENSG00000198793		0.408	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTOR	HGNC	protein_coding	OTTHUMT00000005558.1	101	0.00	0	T	NM_004958		11169377	11169377	-1	no_errors	ENST00000361445	ensembl	human	known	69_37n	missense	17	77.03	57	SNP	1.000	A
NBPF14	25832	genome.wustl.edu	37	1	148009371	148009371	+	Missense_Mutation	SNP	G	G	A	rs200683178	byFrequency	TCGA-A8-A06Y-01A-21W-A019-09	TCGA-A8-A06Y-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3bede568-d8b6-44c0-99e0-a9b6c7d4ce80	268a4247-2839-412a-a531-475663b3a6ac	g.chr1:148009371G>A	ENST00000369219.1	-	16	1952	c.1936C>T	c.(1936-1938)Cgt>Tgt	p.R646C				Q5TI25	NBPFE_HUMAN	neuroblastoma breakpoint family, member 14	646	NBPF 7. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(23)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	42	all_hematologic(923;0.032)					AAGCCAACACGCTGTTGCTCC	0.463													-|||	240	0.0479233	0.1452	0.0216	5008	,	,		115789	0.0069		0.0099	False		,,,				2504	0.0164					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK092351		1q21.1	2013-01-17			ENSG00000122497			"""neuroblastoma breakpoint family"""	25232	protein-coding gene	gene with protein product		614003				8619474, 9110174, 16079250	Standard	NM_015383		Approved	DJ328E19.C1.1	uc021owp.2	Q5TI25	OTTHUMG00000013900	ENST00000369219.1:c.1936C>T	1.37:g.148009371G>A	ENSP00000358221:p.Arg646Cys		Q5TI23|Q8IX76|Q9UJI9	Missense_Mutation	SNP	pfam_NBPF_dom	p.R646C	ENST00000369219.1	37	c.1936		1	.	.	.	.	.	.	.	.	.	.	g	10.67	1.414690	0.25465	.	.	ENSG00000122497	ENST00000369219;ENST00000434489	T	0.07021	3.23	.	.	.	DUF1220 (2);	.	.	.	.	T	0.02610	0.0079	L	0.51422	1.61	0.09310	N	1	B	0.29862	0.259	B	0.26517	0.07	T	0.40553	-0.9557	6	0.66056	D	0.02	.	.	.	.	rs61813402	646	Q5TI25	NBPFE_HUMAN	C	646;236	ENSP00000358221:R646C	ENSP00000358221:R646C	R	-	1	0	NBPF14	146475995	0.885000	0.30320	.	.	.	.	0.748000	0.26305	.	.	.	.	CGT	NBPF14	-	pfam_NBPF_dom	ENSG00000122497		0.463	NBPF14-201	KNOWN	basic|appris_principal	protein_coding	NBPF14	HGNC	protein_coding		401	0.74	3	G	NM_015383		148009371	148009371	-1	no_errors	ENST00000369219	ensembl	human	known	69_37n	missense	49	15.52	9	SNP	0.000	A
NDUFAF5	79133	genome.wustl.edu	37	20	13769239	13769239	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A06Y-01A-21W-A019-09	TCGA-A8-A06Y-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3bede568-d8b6-44c0-99e0-a9b6c7d4ce80	268a4247-2839-412a-a531-475663b3a6ac	g.chr20:13769239T>G	ENST00000378106.5	+	3	387	c.268T>G	c.(268-270)Ttc>Gtc	p.F90V	NDUFAF5_ENST00000463598.1_Missense_Mutation_p.F90V|NDUFAF5_ENST00000475968.1_3'UTR	NM_024120.4	NP_077025.2	Q5TEU4	NDUF5_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 5	90					mitochondrial respiratory chain complex I assembly (GO:0032981)	extrinsic component of mitochondrial inner membrane (GO:0031314)	methyltransferase activity (GO:0008168)										TTTTAGAAATTTCCCCCTTGC	0.299																																						dbGAP											0													134.0	125.0	128.0					20																	13769239		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS13118.1, CCDS33441.1	20p12.1	2012-10-12	2012-05-08	2012-05-08	ENSG00000101247	ENSG00000101247		"""Mitochondrial respiratory chain complex assembly factors"""	15899	protein-coding gene	gene with protein product		612360	"""chromosome 20 open reading frame 7"""	C20orf7		18940309, 21607760	Standard	NM_024120		Approved	dJ842G6.1	uc002wom.3	Q5TEU4	OTTHUMG00000031909	ENST00000378106.5:c.268T>G	20.37:g.13769239T>G	ENSP00000367346:p.Phe90Val		A8K166|Q6GPH3|Q9H6F4	Missense_Mutation	SNP	pfam_Methyltransf_11,pfam_Methyltransf_12,pfam_UbiE/COQ5_MeTrFase,pfam_Put_SAM_MeTrfase	p.F90V	ENST00000378106.5	37	c.268	CCDS13118.1	20	.	.	.	.	.	.	.	.	.	.	T	16.79	3.220206	0.58560	.	.	ENSG00000101247	ENST00000378106;ENST00000536501;ENST00000463598	D;D	0.87887	-2.31;-2.31	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.94295	0.8167	M	0.89414	3.03	0.80722	D	1	D;D;D	0.76494	0.999;0.997;0.982	D;D;P	0.76575	0.988;0.978;0.885	D	0.95179	0.8297	10	0.72032	D	0.01	-5.4557	15.4386	0.75165	0.0:0.0:0.0:1.0	.	90;90;90	Q5TEU4-2;Q5TEU4;B3KR61	.;CT007_HUMAN;.	V	90	ENSP00000367346:F90V;ENSP00000420497:F90V	ENSP00000437325:F90V	F	+	1	0	C20orf7	13717239	1.000000	0.71417	0.973000	0.42090	0.157000	0.22087	6.434000	0.73408	2.124000	0.65301	0.533000	0.62120	TTC	NDUFAF5	-	pfam_Put_SAM_MeTrfase	ENSG00000101247		0.299	NDUFAF5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFAF5	HGNC	protein_coding	OTTHUMT00000078057.2	71	0.00	0	T	NM_001039375		13769239	13769239	+1	no_errors	ENST00000378106	ensembl	human	known	69_37n	missense	78	36.07	44	SNP	1.000	G
NEK11	79858	genome.wustl.edu	37	3	131068491	131068491	+	Missense_Mutation	SNP	G	G	A	rs199921632		TCGA-A8-A06Y-01A-21W-A019-09	TCGA-A8-A06Y-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3bede568-d8b6-44c0-99e0-a9b6c7d4ce80	268a4247-2839-412a-a531-475663b3a6ac	g.chr3:131068491G>A	ENST00000510688.1	+	16	1936	c.1712G>A	c.(1711-1713)aGa>aAa	p.R571K	NEK11_ENST00000429253.2_Silent_p.E603E|RP11-933H2.4_ENST00000502521.1_RNA|NEK11_ENST00000383366.4_Silent_p.E603E|NEK11_ENST00000510769.1_Silent_p.E498E|NEK11_ENST00000508196.1_Silent_p.E603E|RP11-933H2.4_ENST00000513905.1_RNA|NEK11_ENST00000412440.2_Silent_p.E419E	NM_001146003.1	NP_001139475.1			NIMA-related kinase 11											breast(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(14)|stomach(1)|urinary_tract(2)	33						GCGAAGCAGAGATCCGCGAGT	0.473																																						dbGAP											0													103.0	104.0	104.0					3																	131068491		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027148	CCDS3069.1, CCDS46915.1, CCDS54639.1	3q22.1	2012-11-15	2012-11-15		ENSG00000114670	ENSG00000114670			18593	protein-coding gene	gene with protein product		609779	"""NIMA (never in mitosis gene a)- related kinase 11"""				Standard	NM_024800		Approved	FLJ23495	uc003eny.3	Q8NG66	OTTHUMG00000159654	ENST00000510688.1:c.1712G>A	3.37:g.131068491G>A	ENSP00000423458:p.Arg571Lys			Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R571K	ENST00000510688.1	37	c.1712	CCDS54639.1	3	.	.	.	.	.	.	.	.	.	.	G	13.81	2.347778	0.41599	.	.	ENSG00000114670	ENST00000510688	T	0.69926	-0.44	5.59	5.59	0.84812	.	.	.	.	.	T	0.42291	0.1196	.	.	.	0.80722	D	1	B	0.31931	0.347	B	0.32465	0.146	T	0.45381	-0.9265	8	0.02654	T	1	.	9.8457	0.41026	0.1536:0.0:0.8464:0.0	.	571	Q8NG66-4	.	K	571	ENSP00000423458:R571K	ENSP00000423458:R571K	R	+	2	0	NEK11	132551181	1.000000	0.71417	0.924000	0.36721	0.365000	0.29674	2.097000	0.41748	2.621000	0.88768	0.561000	0.74099	AGA	NEK11	-	NULL	ENSG00000114670		0.473	NEK11-006	NOVEL	basic|appris_candidate|CCDS	protein_coding	NEK11	HGNC	protein_coding	OTTHUMT00000356758.1	179	0.00	0	G	NM_024800		131068491	131068491	+1	no_errors	ENST00000510688	ensembl	human	novel	69_37n	missense	123	45.58	103	SNP	1.000	A
OR11H6	122748	genome.wustl.edu	37	14	20692496	20692496	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A06Y-01A-21W-A019-09	TCGA-A8-A06Y-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3bede568-d8b6-44c0-99e0-a9b6c7d4ce80	268a4247-2839-412a-a531-475663b3a6ac	g.chr14:20692496G>T	ENST00000315519.2	+	1	706	c.628G>T	c.(628-630)Gct>Tct	p.A210S		NM_001004480.1	NP_001004480.1	Q8NGC7	O11H6_HUMAN	olfactory receptor, family 11, subfamily H, member 6	210						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(13)|ovary(2)|prostate(1)|skin(2)	29	all_cancers(95;0.00108)		Epithelial(56;1.75e-06)|all cancers(55;1.22e-05)	GBM - Glioblastoma multiforme(265;0.0143)		CTGCATCTCTGCTCCTTCCAC	0.498																																						dbGAP											0													123.0	113.0	117.0					14																	20692496		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32033.1	14q11.2	2013-09-24			ENSG00000176219	ENSG00000176219		"""GPCR / Class A : Olfactory receptors"""	15349	protein-coding gene	gene with protein product							Standard	NM_001004480		Approved		uc010tlc.2	Q8NGC7	OTTHUMG00000170850	ENST00000315519.2:c.628G>T	14.37:g.20692496G>T	ENSP00000319071:p.Ala210Ser		Q6IF08	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.A210S	ENST00000315519.2	37	c.628	CCDS32033.1	14	.	.	.	.	.	.	.	.	.	.	G	11.51	1.660972	0.29515	.	.	ENSG00000176219	ENST00000315519	T	0.00048	8.82	4.83	3.9	0.45041	GPCR, rhodopsin-like superfamily (1);	0.255446	0.27402	N	0.019533	T	0.00109	0.0003	N	0.16903	0.455	0.09310	N	1	B	0.24186	0.099	B	0.34931	0.192	T	0.15665	-1.0429	10	0.49607	T	0.09	.	7.5278	0.27666	0.0:0.1707:0.6202:0.2091	.	210	Q8NGC7	O11H6_HUMAN	S	210	ENSP00000319071:A210S	ENSP00000319071:A210S	A	+	1	0	OR11H6	19762336	0.000000	0.05858	0.572000	0.28498	0.977000	0.68977	0.282000	0.18829	1.179000	0.42884	0.471000	0.43371	GCT	OR11H6	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000176219		0.498	OR11H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR11H6	HGNC	protein_coding	OTTHUMT00000410676.1	103	0.00	0	G			20692496	20692496	+1	no_errors	ENST00000315519	ensembl	human	known	69_37n	missense	56	49.11	55	SNP	0.201	T
PPFIBP2	8495	genome.wustl.edu	37	11	7672916	7672916	+	Silent	SNP	C	C	G			TCGA-A8-A06Y-01A-21W-A019-09	TCGA-A8-A06Y-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3bede568-d8b6-44c0-99e0-a9b6c7d4ce80	268a4247-2839-412a-a531-475663b3a6ac	g.chr11:7672916C>G	ENST00000299492.4	+	23	2665	c.2277C>G	c.(2275-2277)acC>acG	p.T759T	PPFIBP2_ENST00000530582.1_3'UTR|PPFIBP2_ENST00000528883.1_Silent_p.T647T|PPFIBP2_ENST00000530181.1_Silent_p.T616T|PPFIBP2_ENST00000533792.1_Silent_p.T601T	NM_003621.3	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2 (liprin beta 2)	759	SAM 3. {ECO:0000255|PROSITE- ProRule:PRU00184}.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)	DNA binding (GO:0003677)|integrase activity (GO:0008907)			breast(8)|cervix(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		CTGGGGACACCCTGGCTATGC	0.562																																						dbGAP											0													118.0	104.0	109.0					11																	7672916		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AF034803	CCDS31419.1, CCDS58116.1, CCDS58117.1	11p15.4	2013-01-10			ENSG00000166387	ENSG00000166387		"""Sterile alpha motif (SAM) domain containing"""	9250	protein-coding gene	gene with protein product		603142				9624153	Standard	NM_003621		Approved	Cclp1	uc001mfj.5	Q8ND30	OTTHUMG00000165617	ENST00000299492.4:c.2277C>G	11.37:g.7672916C>G			B7Z433|E9PK77|O75337|Q8WW26	Silent	SNP	pfam_SAM_2,pfam_SAM_type1,pfam_Integrase_Tn916-type_DNA-bd_N,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.T759	ENST00000299492.4	37	c.2277	CCDS31419.1	11																																																																																			PPFIBP2	-	pfam_SAM_2,superfamily_SAM/pointed,smart_SAM	ENSG00000166387		0.562	PPFIBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPFIBP2	HGNC	protein_coding	OTTHUMT00000385345.2	127	0.00	0	C	NM_003621		7672916	7672916	+1	no_errors	ENST00000299492	ensembl	human	known	69_37n	silent	79	24.76	26	SNP	0.664	G
PRPF39	55015	genome.wustl.edu	37	14	45579794	45579794	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A06Y-01A-21W-A019-09	TCGA-A8-A06Y-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3bede568-d8b6-44c0-99e0-a9b6c7d4ce80	268a4247-2839-412a-a531-475663b3a6ac	g.chr14:45579794A>C	ENST00000355765.6	+	10	1516	c.1346A>C	c.(1345-1347)gAa>gCa	p.E449A	SNORD127_ENST00000458892.1_RNA	NM_017922.3	NP_060392.3	Q86UA1	PRP39_HUMAN	pre-mRNA processing factor 39	449					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(2)|endometrium(2)|kidney(4)|lung(3)|ovary(1)	12						ACATTTGAAGAATGTGTTCTA	0.338																																						dbGAP											0													42.0	37.0	38.0					14																	45579794		2201	4295	6496	-	-	-	SO:0001583	missense	0			AK000673	CCDS9682.2	14q21.1	2013-10-03	2013-10-03		ENSG00000185246	ENSG00000185246			20314	protein-coding gene	gene with protein product		614907	"""PRP39 pre-mRNA processing factor 39 homolog (yeast)"", ""PRP39 pre-mRNA processing factor 39 homolog (S. cerevisiae)"""				Standard	NM_017922		Approved	FLJ20666, FLJ11128	uc001wvz.4	Q86UA1	OTTHUMG00000140265	ENST00000355765.6:c.1346A>C	14.37:g.45579794A>C	ENSP00000348010:p.Glu449Ala		Q08AL1|Q08AL2|Q9NUU5	Missense_Mutation	SNP	smart_HAT	p.E449A	ENST00000355765.6	37	c.1346	CCDS9682.2	14	.	.	.	.	.	.	.	.	.	.	A	8.499	0.863929	0.17250	.	.	ENSG00000185246	ENST00000355765	T	0.33438	1.41	5.53	5.53	0.82687	Tetratricopeptide-like helical (1);	0.227927	0.44097	D	0.000489	T	0.24928	0.0605	L	0.43152	1.355	0.41859	D	0.990211	B;B	0.21753	0.06;0.06	B;B	0.19666	0.026;0.016	T	0.07809	-1.0753	10	0.15952	T	0.53	-17.3871	11.3498	0.49581	0.8482:0.1518:0.0:0.0	.	53;449	Q86UA1-2;Q86UA1	.;PRP39_HUMAN	A	449	ENSP00000348010:E449A	ENSP00000348010:E449A	E	+	2	0	PRPF39	44649544	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.519000	0.45546	2.107000	0.64212	0.460000	0.39030	GAA	PRPF39	-	NULL	ENSG00000185246		0.338	PRPF39-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF39	HGNC	protein_coding	OTTHUMT00000319683.2	14	0.00	0	A			45579794	45579794	+1	no_errors	ENST00000355765	ensembl	human	known	69_37n	missense	14	39.13	9	SNP	0.999	C
PTHLH	5744	genome.wustl.edu	37	12	28114898	28114898	+	Intron	DEL	T	T	-	rs377014358		TCGA-A8-A06Y-01A-21W-A019-09	TCGA-A8-A06Y-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3bede568-d8b6-44c0-99e0-a9b6c7d4ce80	268a4247-2839-412a-a531-475663b3a6ac	g.chr12:28114898delT	ENST00000545234.1	-	5	1065				PTHLH_ENST00000539239.1_Intron|RP11-993B23.3_ENST00000538113.1_RNA|PTHLH_ENST00000354417.3_Frame_Shift_Del_p.K186fs|PTHLH_ENST00000395872.1_Intron|PTHLH_ENST00000538310.1_Frame_Shift_Del_p.K186fs			P12272	PTHR_HUMAN	parathyroid hormone-like hormone						adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cAMP metabolic process (GO:0046058)|cell-cell signaling (GO:0007267)|endochondral ossification (GO:0001958)|endoderm development (GO:0007492)|epidermis development (GO:0008544)|epithelial cell differentiation (GO:0030855)|female pregnancy (GO:0007565)|lung alveolus development (GO:0048286)|mammary gland bud elongation (GO:0060649)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|nipple sheath formation (GO:0060659)|osteoblast development (GO:0002076)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell proliferation (GO:0008284)|protein processing (GO:0016485)|regulation of gene expression (GO:0010468)|skeletal system development (GO:0001501)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	hormone activity (GO:0005179)|peptide hormone receptor binding (GO:0051428)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|skin(1)|stomach(1)	10	Lung SC(9;0.184)					GTTGTTTTCCTTTTTTTTTTT	0.333																																						dbGAP											0													16.0	16.0	16.0					12																	28114898		875	1991	2866	-	-	-	SO:0001627	intron_variant	0				CCDS8715.1, CCDS44853.1	12p12.1-p11.2	2014-01-07			ENSG00000087494	ENSG00000087494		"""Endogenous ligands"""	9607	protein-coding gene	gene with protein product	"""osteostatin"", ""parathyroid hormone-like hormone preproprotein"", ""parathyroid hormone-related protein preproprotein"""	168470				2708388	Standard	NM_002820		Approved	PTHRP, HHM, PLP, PTHR	uc001ril.3	P12272	OTTHUMG00000169221	ENST00000545234.1:c.524+1382A>-	12.37:g.28114898delT			Q15251|Q6FH74	Frame_Shift_Del	DEL	pfam_PTH/PTH-rel,smart_PTH/PTH-rel	p.K186fs	ENST00000545234.1	37	c.557	CCDS44853.1	12																																																																																			PTHLH	-	NULL	ENSG00000087494		0.333	PTHLH-001	KNOWN	basic|CCDS	protein_coding	PTHLH	HGNC	protein_coding	OTTHUMT00000402913.1	28	0.00	0	T	NM_198965		28114898	28114898	-1	no_errors	ENST00000354417	ensembl	human	known	69_37n	frame_shift_del	22	20.00	6	DEL	0.135	-
RGPD2	729857	genome.wustl.edu	37	2	88083849	88083849	+	Silent	SNP	T	T	C	rs200044571		TCGA-A8-A06Y-01A-21W-A019-09	TCGA-A8-A06Y-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3bede568-d8b6-44c0-99e0-a9b6c7d4ce80	268a4247-2839-412a-a531-475663b3a6ac	g.chr2:88083849T>C	ENST00000398146.3	-	20	2916	c.2694A>G	c.(2692-2694)gaA>gaG	p.E898E	RGPD2_ENST00000420840.2_Silent_p.E890E|RGPD2_ENST00000494592.1_5'Flank|RGPD2_ENST00000327544.6_Silent_p.E155E			P0DJD1	RGPD2_HUMAN	RANBP2-like and GRIP domain containing 2	898					protein targeting to Golgi (GO:0000042)					breast(1)|pancreas(1)	2						TTGACTTAAATTCTGTATTAG	0.343																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0				CCDS42710.1, CCDS42710.2	2p11.2	2013-01-10			ENSG00000185304	ENSG00000185304		"""Tetratricopeptide (TTC) repeat domain containing"""	32415	protein-coding gene	gene with protein product		612705				15710750, 15815621	Standard	NM_001078170		Approved	RGP2, RANBP2L2		P0DJD1	OTTHUMG00000153276	ENST00000398146.3:c.2694A>G	2.37:g.88083849T>C			P0C839|Q68DN6|Q6V1X0	Silent	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR_2,pfam_TPR-1,superfamily_GRIP,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.E898	ENST00000398146.3	37	c.2694	CCDS42710.2	2																																																																																			RGPD2	-	NULL	ENSG00000185304		0.343	RGPD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RGPD2	HGNC	protein_coding	OTTHUMT00000330534.2	12	0.00	0	T	NM_001078170		88083849	88083849	-1	no_errors	ENST00000398146	ensembl	human	known	69_37n	silent	8	40.00	6	SNP	0.992	C
SAMD9	54809	genome.wustl.edu	37	7	92733834	92733834	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06Y-01A-21W-A019-09	TCGA-A8-A06Y-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3bede568-d8b6-44c0-99e0-a9b6c7d4ce80	268a4247-2839-412a-a531-475663b3a6ac	g.chr7:92733834G>A	ENST00000379958.2	-	3	1846	c.1577C>T	c.(1576-1578)tCa>tTa	p.S526L		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	526						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			TGTAAGAAATGAAATCAGTTT	0.408																																						dbGAP											0													88.0	92.0	90.0					7																	92733834		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.1577C>T	7.37:g.92733834G>A	ENSP00000369292:p.Ser526Leu		A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.S526L	ENST00000379958.2	37	c.1577	CCDS34680.1	7	.	.	.	.	.	.	.	.	.	.	G	2.083	-0.410285	0.04799	.	.	ENSG00000205413	ENST00000379958;ENST00000446617	T;T	0.17854	2.25;2.25	3.93	3.05	0.35203	.	0.000000	0.51477	U	0.000098	T	0.11452	0.0279	L	0.28458	0.855	0.29399	N	0.862056	B	0.30033	0.266	B	0.27170	0.077	T	0.12993	-1.0526	10	0.26408	T	0.33	.	10.506	0.44834	0.0983:0.0:0.9017:0.0	.	526	Q5K651	SAMD9_HUMAN	L	526	ENSP00000369292:S526L;ENSP00000414529:S526L	ENSP00000369292:S526L	S	-	2	0	SAMD9	92571770	0.943000	0.32029	1.000000	0.80357	0.980000	0.70556	1.544000	0.36158	0.991000	0.38814	0.603000	0.83216	TCA	SAMD9	-	NULL	ENSG00000205413		0.408	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD9	HGNC	protein_coding	OTTHUMT00000341761.1	244	0.00	0	G	NM_017654		92733834	92733834	-1	no_errors	ENST00000379958	ensembl	human	known	69_37n	missense	214	41.26	151	SNP	1.000	A
SCYL2	55681	genome.wustl.edu	37	12	100676854	100676854	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A8-A06Y-01A-21W-A019-09	TCGA-A8-A06Y-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3bede568-d8b6-44c0-99e0-a9b6c7d4ce80	268a4247-2839-412a-a531-475663b3a6ac	g.chr12:100676854C>T	ENST00000360820.2	+	2	543	c.106C>T	c.(106-108)Cga>Tga	p.R36*	SCYL2_ENST00000550067.1_3'UTR	NM_017988.4	NP_060458.3	Q6P3W7	SCYL2_HUMAN	SCY1-like 2 (S. cerevisiae)	36	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				endosome to lysosome transport (GO:0008333)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of receptor internalization (GO:0002092)|receptor internalization involved in canonical Wnt signaling pathway (GO:2000286)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(4)|lung(15)|ovary(2)|skin(1)	41						TGATGTTGGTCGACACATTGC	0.398																																						dbGAP											0													105.0	101.0	102.0					12																	100676854		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB037781	CCDS9076.1	12q23.1	2005-01-20				ENSG00000136021			19286	protein-coding gene	gene with protein product						10718198	Standard	NM_017988		Approved	KIAA1360	uc001thn.3	Q6P3W7	OTTHUMG00000170319	ENST00000360820.2:c.106C>T	12.37:g.100676854C>T	ENSP00000354061:p.Arg36*		A8KAB5|Q96EF4|Q96ST4|Q9H7V5|Q9NVH3|Q9P2I7	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	p.R36*	ENST00000360820.2	37	c.106	CCDS9076.1	12	.	.	.	.	.	.	.	.	.	.	C	41	8.870298	0.98984	.	.	ENSG00000136021	ENST00000549687;ENST00000360820	.	.	.	5.04	5.04	0.67666	.	0.164390	0.38720	N	0.001592	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13853	T	0.58	.	13.6909	0.62544	0.1544:0.8456:0.0:0.0	.	.	.	.	X	36	.	ENSP00000354061:R36X	R	+	1	2	SCYL2	99200985	0.989000	0.36119	1.000000	0.80357	0.944000	0.59088	2.193000	0.42658	2.490000	0.84030	0.591000	0.81541	CGA	SCYL2	-	pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	ENSG00000136021		0.398	SCYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCYL2	HGNC	protein_coding	OTTHUMT00000408493.2	96	0.00	0	C	NM_017988		100676854	100676854	+1	no_errors	ENST00000360820	ensembl	human	known	69_37n	nonsense	79	37.30	47	SNP	1.000	T
SZT2	23334	genome.wustl.edu	37	1	43908290	43908290	+	Splice_Site	SNP	G	G	A			TCGA-A8-A06Y-01A-21W-A019-09	TCGA-A8-A06Y-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3bede568-d8b6-44c0-99e0-a9b6c7d4ce80	268a4247-2839-412a-a531-475663b3a6ac	g.chr1:43908290G>A	ENST00000562955.1	+	57	7980		c.e57+1		SZT2_ENST00000372442.1_Splice_Site	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)						central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)				NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						AGATGAAAAGGTGCCTGCTGC	0.517																																						dbGAP											0													85.0	87.0	86.0					1																	43908290		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.7980+1G>A	1.37:g.43908290G>A			A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Splice_Site	SNP	-	e57+1	ENST00000562955.1	37	c.7980+1	CCDS30694.2	1	.	.	.	.	.	.	.	.	.	.	G	17.25	3.342612	0.61073	.	.	ENSG00000198198	ENST00000372442	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.114	0.86683	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SZT2	43680877	1.000000	0.71417	0.998000	0.56505	0.851000	0.48451	5.477000	0.66799	2.649000	0.89929	0.655000	0.94253	.	SZT2	-	-	ENSG00000198198		0.517	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SZT2	HGNC	protein_coding	OTTHUMT00000019517.3	207	0.00	0	G	NM_015284	Intron	43908290	43908290	+1	no_errors	ENST00000562955	ensembl	human	known	69_37n	splice_site	24	71.08	59	SNP	1.000	A
TC2N	123036	genome.wustl.edu	37	14	92265374	92265375	+	Silent	DNP	GA	GA	CT			TCGA-A8-A06Y-01A-21W-A019-09	TCGA-A8-A06Y-10A-01W-A021-09	G|A	G|A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3bede568-d8b6-44c0-99e0-a9b6c7d4ce80	268a4247-2839-412a-a531-475663b3a6ac	g.chr14:92265374_92265375GA>CT	ENST00000435962.2	-	6	918_919	c.595_596TC>AG	c.(595-597)TCt>AGt	p.S199S	TC2N_ENST00000556018.1_Silent_p.S199S|TC2N_ENST00000340892.5_Silent_p.S199S|TC2N_ENST00000360594.5_Silent_p.S199S	NM_001128596.1	NP_001122068	Q8N9U0	TAC2N_HUMAN	tandem C2 domains, nuclear	199					regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(5)|skin(1)|upper_aerodigestive_tract(2)	18				COAD - Colon adenocarcinoma(157;0.218)		CCTTGAAGAAGAACTACTGGGT	0.327																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AA243837	CCDS9897.1, CCDS73679.1	14q32.12	2007-10-17	2007-08-17	2007-08-17		ENSG00000165929			19859	protein-coding gene	gene with protein product	"""C2 calcium-dependent domain containing 1"""		"""chromosome 14 open reading frame 47"", ""membrane targeting (tandem) C2 domain containing 1"""	C14orf47, MTAC2D1		11526914	Standard	NM_001128596		Approved	FLJ36557, Tac2-N, C2CD1	uc001xzt.4	Q8N9U0		ENST00000435962.2:c.595_596delinsCT	14.37:g.92265374_92265375delinsCT				Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.S199C|p.S199T	ENST00000435962.2	37	c.596|c.595	CCDS9897.1	14																																																																																			TC2N	-	NULL	ENSG00000165929		0.327	TC2N-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TC2N	HGNC	protein_coding	OTTHUMT00000411778.1	128|124	0.00	0	G|A	NM_152332		92265374|92265375	92265374|92265375	-1	no_errors	ENST00000340892	ensembl	human	known	69_37n	missense	97|96	43.93|43.86	76|75	SNP	0.983|0.952	C|T
TXNDC11	51061	genome.wustl.edu	37	16	11792021	11792021	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A06Y-01A-21W-A019-09	TCGA-A8-A06Y-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3bede568-d8b6-44c0-99e0-a9b6c7d4ce80	268a4247-2839-412a-a531-475663b3a6ac	g.chr16:11792021G>T	ENST00000356957.3	-	8	1255	c.1148C>A	c.(1147-1149)cCt>cAt	p.P383H	TXNDC11_ENST00000283033.5_Missense_Mutation_p.P356H			Q6PKC3	TXD11_HUMAN	thioredoxin domain containing 11	383					cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)			endometrium(3)|large_intestine(5)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	21						GGGATTAAAAGGTATGAACAG	0.507																																						dbGAP											0													127.0	127.0	127.0					16																	11792021		2197	4300	6497	-	-	-	SO:0001583	missense	0			BC013727	CCDS32387.1	16p13.13	2008-09-29				ENSG00000153066			28030	protein-coding gene	gene with protein product	"""EF-hand binding protein 1"""					8619474, 9110174	Standard	XM_005255346		Approved	EFP1	uc002dbg.1	Q6PKC3		ENST00000356957.3:c.1148C>A	16.37:g.11792021G>T	ENSP00000349439:p.Pro383His		O95887|Q6PJA6|Q8N2Q4|Q96K45|Q96K53	Missense_Mutation	SNP	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	p.P383H	ENST00000356957.3	37	c.1148		16	.	.	.	.	.	.	.	.	.	.	G	23.9	4.471681	0.84533	.	.	ENSG00000153066	ENST00000356957;ENST00000283033	T;T	0.56776	0.44;1.52	5.72	5.72	0.89469	.	0.102781	0.64402	D	0.000002	T	0.74160	0.3680	M	0.73962	2.25	0.50632	D	0.999883	D;D	0.89917	1.0;1.0	D;D	0.83275	0.994;0.996	T	0.76121	-0.3075	10	0.87932	D	0	-33.3284	18.8828	0.92364	0.0:0.0:1.0:0.0	.	383;356	Q6PKC3;Q6PKC3-2	TXD11_HUMAN;.	H	383;356	ENSP00000349439:P383H;ENSP00000283033:P356H	ENSP00000283033:P356H	P	-	2	0	TXNDC11	11699522	1.000000	0.71417	0.982000	0.44146	0.995000	0.86356	6.934000	0.75880	2.711000	0.92665	0.655000	0.94253	CCT	TXNDC11	-	NULL	ENSG00000153066		0.507	TXNDC11-002	KNOWN	basic|appris_candidate_longest	protein_coding	TXNDC11	HGNC	protein_coding	OTTHUMT00000437057.1	78	0.00	0	G	NM_015914		11792021	11792021	-1	no_errors	ENST00000356957	ensembl	human	known	69_37n	missense	83	36.64	48	SNP	1.000	T
USP31	57478	genome.wustl.edu	37	16	23085124	23085124	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A06Y-01A-21W-A019-09	TCGA-A8-A06Y-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3bede568-d8b6-44c0-99e0-a9b6c7d4ce80	268a4247-2839-412a-a531-475663b3a6ac	g.chr16:23085124C>A	ENST00000219689.7	-	14	2253	c.2254G>T	c.(2254-2256)Gtc>Ttc	p.V752F	USP31_ENST00000567975.1_5'Flank	NM_020718.3	NP_065769.3	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 31	390	DUSP 3. {ECO:0000255|PROSITE- ProRule:PRU00613}.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	57				GBM - Glioblastoma multiforme(48;0.0187)		TGCGTGCAGACCTCATCTTCT	0.567																																						dbGAP											0													95.0	80.0	85.0					16																	23085124		2197	4300	6497	-	-	-	SO:0001583	missense	0			AB033029	CCDS10607.1	16p12.3	2008-02-05	2005-08-08		ENSG00000103404	ENSG00000103404		"""Ubiquitin-specific peptidases"""	20060	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"""			12838346	Standard	NM_020718		Approved	KIAA1203	uc002dll.3	Q70CQ4	OTTHUMG00000094793	ENST00000219689.7:c.2254G>T	16.37:g.23085124C>A	ENSP00000219689:p.Val752Phe		B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.V752F	ENST00000219689.7	37	c.2254	CCDS10607.1	16	.	.	.	.	.	.	.	.	.	.	C	34	5.353856	0.95830	.	.	ENSG00000103404	ENST00000219689;ENST00000381162	T	0.03920	3.76	5.91	5.91	0.95273	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.64402	D	0.000001	T	0.26774	0.0655	M	0.83953	2.67	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.00353	-1.1795	10	0.87932	D	0	-15.872	19.2867	0.94077	0.0:1.0:0.0:0.0	.	55;752	Q70CQ4-2;Q70CQ4	.;UBP31_HUMAN	F	752;55	ENSP00000219689:V752F	ENSP00000219689:V752F	V	-	1	0	USP31	22992625	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.743000	0.68655	2.793000	0.96121	0.655000	0.94253	GTC	USP31	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000103404		0.567	USP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP31	HGNC	protein_coding	OTTHUMT00000211607.1	37	0.00	0	C	NM_020718		23085124	23085124	-1	no_errors	ENST00000219689	ensembl	human	known	69_37n	missense	46	16.36	9	SNP	1.000	A
WDR6	11180	genome.wustl.edu	37	3	49051381	49051382	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A8-A06Y-01A-21W-A019-09	TCGA-A8-A06Y-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3bede568-d8b6-44c0-99e0-a9b6c7d4ce80	268a4247-2839-412a-a531-475663b3a6ac	g.chr3:49051381_49051382insG	ENST00000608424.1	+	2	2453_2454	c.2414_2415insG	c.(2413-2418)gcggggfs	p.AG805fs	WDR6_ENST00000415265.2_Frame_Shift_Ins_p.AG253fs|WDR6_ENST00000448293.1_Frame_Shift_Ins_p.AG754fs|WDR6_ENST00000395474.3_Frame_Shift_Ins_p.AG835fs			Q9NNW5	WDR6_HUMAN	WD repeat domain 6	805					cell cycle arrest (GO:0007050)|negative regulation of autophagy (GO:0010507)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|liver(1)|lung(9)|ovary(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26				Kidney(197;9.12e-07)|KIRC - Kidney renal clear cell carcinoma(197;1.32e-05)|BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000155)		GTGGTGTCTGCGGGGGGGCGGG	0.639											OREG0015565	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF099100	CCDS2782.2	3p21.31	2013-01-09			ENSG00000178252	ENSG00000178252		"""WD repeat domain containing"""	12758	protein-coding gene	gene with protein product		606031					Standard	NM_018031		Approved		uc003cvj.2	Q9NNW5	OTTHUMG00000133546	ENST00000608424.1:c.2421dupG	3.37:g.49051388_49051388dupG	ENSP00000477389:p.Ala805fs	959	B4DHK2|Q3MIT1|Q9UF63	Frame_Shift_Ins	INS	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_Quino_amine_DH_bsu,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R838fs	ENST00000608424.1	37	c.2504_2505		3																																																																																			WDR6	-	superfamily_WD40_repeat_dom	ENSG00000178252		0.639	WDR6-024	NOVEL	basic|appris_principal	protein_coding	WDR6	HGNC	protein_coding	OTTHUMT00000471652.1	33	0.00	0	-			49051381	49051382	+1	no_errors	ENST00000395474	ensembl	human	known	69_37n	frame_shift_ins	16	15.79	3	INS	1.000:0.007	G
