#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AFF3	3899	genome.wustl.edu	37	2	100623894	100623894	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr2:100623894C>T	ENST00000409236.2	-	4	315	c.203G>A	c.(202-204)cGg>cAg	p.R68Q	AFF3_ENST00000356421.2_Missense_Mutation_p.R93Q|AFF3_ENST00000317233.4_Missense_Mutation_p.R68Q|AFF3_ENST00000409579.1_Missense_Mutation_p.R93Q			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	68					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)			NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						GTTCTGGATCCGGTTGGAGAG	0.433																																						dbGAP											0													90.0	94.0	93.0					2																	100623894		2203	4300	6503	-	-	-	SO:0001583	missense	0			U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.203G>A	2.37:g.100623894C>T	ENSP00000387207:p.Arg68Gln		B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Missense_Mutation	SNP	pfam_TF_AF4/FMR2	p.R93Q	ENST00000409236.2	37	c.278	CCDS42723.1	2	.	.	.	.	.	.	.	.	.	.	C	31	5.058243	0.93846	.	.	ENSG00000144218	ENST00000317233;ENST00000356421;ENST00000409579;ENST00000409236;ENST00000433370;ENST00000444786;ENST00000432288;ENST00000432037;ENST00000423966;ENST00000441400;ENST00000424600;ENST00000416492;ENST00000440445	T;T;T;T;T;T;T;T;T;T	0.78364	-1.17;-1.17;-1.17;-1.17;-1.17;-1.17;-1.17;-1.17;-1.17;-1.17	5.34	5.34	0.76211	.	0.372474	0.25068	N	0.033381	D	0.88433	0.6435	M	0.73430	2.235	0.50467	D	0.99987	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.997;0.998;0.997	D	0.89432	0.3717	10	0.87932	D	0	.	19.054	0.93055	0.0:1.0:0.0:0.0	.	222;222;68;93	B7Z4I6;C9JXV5;P51826;P51826-2	.;.;AFF3_HUMAN;.	Q	68;93;93;68;68;222;93;68;68;68;68;68;145	ENSP00000317421:R68Q;ENSP00000348793:R93Q;ENSP00000386834:R93Q;ENSP00000387207:R68Q;ENSP00000406484:R68Q;ENSP00000396582:R68Q;ENSP00000399795:R68Q;ENSP00000411383:R68Q;ENSP00000395068:R68Q;ENSP00000393732:R145Q	ENSP00000317421:R68Q	R	-	2	0	AFF3	99990326	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	7.635000	0.83286	2.493000	0.84123	0.460000	0.39030	CGG	AFF3	-	pfam_TF_AF4/FMR2	ENSG00000144218		0.433	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFF3	HGNC	protein_coding	OTTHUMT00000328982.3	281	0.00	0	C	NM_002285		100623894	100623894	-1	no_errors	ENST00000356421	ensembl	human	known	69_37n	missense	79	37.30	47	SNP	1.000	T
AQP6	363	genome.wustl.edu	37	12	50368232	50368232	+	Silent	SNP	T	T	A			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr12:50368232T>A	ENST00000315520.5	+	2	865	c.528T>A	c.(526-528)atT>atA	p.I176I	AQP6_ENST00000551733.1_Silent_p.I2I	NM_001652.3	NP_001643.2	Q13520	AQP6_HUMAN	aquaporin 6, kidney specific	176					anion transport (GO:0006820)|excretion (GO:0007588)|odontogenesis (GO:0042476)|transmembrane transport (GO:0055085)|transport (GO:0006810)|water transport (GO:0006833)	integral component of plasma membrane (GO:0005887)|transport vesicle membrane (GO:0030658)	anion channel activity (GO:0005253)|water channel activity (GO:0015250)			endometrium(1)|large_intestine(2)|lung(7)|pancreas(1)|skin(2)	13						CCACCATGATTGGGATCTCTG	0.632											OREG0021809	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													68.0	56.0	60.0					12																	50368232		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL137716	CCDS31798.1	12q13	2005-09-20			ENSG00000086159	ENSG00000086159		"""Ion channels / Aquaporins"""	639	protein-coding gene	gene with protein product		601383		AQP2L		8812490	Standard	XM_006719375		Approved		uc001rvr.1	Q13520	OTTHUMG00000133548	ENST00000315520.5:c.528T>A	12.37:g.50368232T>A		969		Silent	SNP	pfam_MIP,superfamily_Aquaporin-like,prints_MIP,prints_Aquaporin_6,tigrfam_Aquaporin	p.I176	ENST00000315520.5	37	c.528	CCDS31798.1	12																																																																																			AQP6	-	pfam_MIP,superfamily_Aquaporin-like,tigrfam_Aquaporin	ENSG00000086159		0.632	AQP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AQP6	HGNC	protein_coding	OTTHUMT00000257528.2	115	0.00	0	T	NM_001652, NM_053286		50368232	50368232	+1	no_errors	ENST00000315520	ensembl	human	known	69_37n	silent	44	26.67	16	SNP	0.975	A
ATG4D	84971	genome.wustl.edu	37	19	10663675	10663675	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr19:10663675C>T	ENST00000309469.4	+	10	1530	c.1357C>T	c.(1357-1359)Cgg>Tgg	p.R453W	ATG4D_ENST00000540862.1_Missense_Mutation_p.R120W|RNU7-140P_ENST00000459546.1_RNA|MIR1238_ENST00000408483.1_RNA	NM_032885.4	NP_116274.3	Q86TL0	ATG4D_HUMAN	autophagy related 4D, cysteine peptidase	453					apoptotic process (GO:0006915)|autophagy (GO:0006914)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	cysteine-type endopeptidase activity (GO:0004197)			NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	19			Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)			GCCCACACTCCGGCTCCCTCG	0.617																																						dbGAP											0													52.0	50.0	51.0					19																	10663675		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ312332	CCDS12241.1	19p13.2	2014-02-12	2012-06-06	2005-09-11	ENSG00000130734	ENSG00000130734			20789	protein-coding gene	gene with protein product		611340	"""AUT-like 4, cysteine endopeptidase (S. cerevisiae)"", ""APG4 autophagy 4 homolog D (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog D (S. cerevisiae)"""	AUTL4, APG4D		12446702	Standard	NM_032885		Approved	APG4-D	uc002mov.3	Q86TL0	OTTHUMG00000180582	ENST00000309469.4:c.1357C>T	19.37:g.10663675C>T	ENSP00000311318:p.Arg453Trp		Q969K0	Missense_Mutation	SNP	pfam_Peptidase_C54	p.R453W	ENST00000309469.4	37	c.1357	CCDS12241.1	19	.	.	.	.	.	.	.	.	.	.	C	14.55	2.567601	0.45694	.	.	ENSG00000130734	ENST00000309469;ENST00000540862	.	.	.	5.19	4.12	0.48240	.	0.621973	0.16006	N	0.234039	T	0.52468	0.1736	L	0.59436	1.845	0.20196	N	0.999927	D;D	0.71674	0.986;0.998	P;P	0.53146	0.513;0.719	T	0.48592	-0.9022	9	0.66056	D	0.02	-27.6584	14.3617	0.66776	0.1589:0.8411:0.0:0.0	.	390;453	B4DGM8;Q86TL0	.;ATG4D_HUMAN	W	453;120	.	ENSP00000311318:R453W	R	+	1	2	ATG4D	10524675	0.998000	0.40836	0.187000	0.23214	0.156000	0.22039	2.810000	0.47979	1.227000	0.43598	0.655000	0.94253	CGG	ATG4D	-	NULL	ENSG00000130734		0.617	ATG4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG4D	HGNC	protein_coding	OTTHUMT00000452022.1	116	0.00	0	C	NM_032885		10663675	10663675	+1	no_errors	ENST00000309469	ensembl	human	known	69_37n	missense	26	42.22	19	SNP	0.130	T
ATM	472	genome.wustl.edu	37	11	108164150	108164151	+	Frame_Shift_Del	DEL	GC	GC	-			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	GC	GC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr11:108164150_108164151delGC	ENST00000452508.2	+	32	4911_4912	c.4722_4723delGC	c.(4720-4725)ttgcgtfs	p.R1575fs	ATM_ENST00000278616.4_Frame_Shift_Del_p.R1575fs			Q13315	ATM_HUMAN	ATM serine/threonine kinase	1575					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	TTAAGGATTTGCGTATTACTCA	0.302			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																												dbGAP	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	0																																										-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.4722_4723delGC	11.37:g.108164150_108164151delGC	ENSP00000388058:p.Arg1575fs		B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Frame_Shift_Del	DEL	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.R1575fs	ENST00000452508.2	37	c.4722_4723	CCDS31669.1	11																																																																																			ATM	-	superfamily_ARM-type_fold	ENSG00000149311		0.302	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	HGNC	protein_coding	OTTHUMT00000389938.1	416	0.00	0	GC	NM_000051		108164150	108164151	+1	no_errors	ENST00000278616	ensembl	human	known	69_37n	frame_shift_del	60	47.90	57	DEL	1.000:1.000	-
ATM	472	genome.wustl.edu	37	11	108164152	108164152	+	Missense_Mutation	SNP	G	G	T	rs550552791		TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr11:108164152G>T	ENST00000452508.2	+	32	4913	c.4724G>T	c.(4723-4725)cGt>cTt	p.R1575L	ATM_ENST00000278616.4_Missense_Mutation_p.R1575L			Q13315	ATM_HUMAN	ATM serine/threonine kinase	1575					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	AAGGATTTGCGTATTACTCAG	0.303			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																												dbGAP	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	0													112.0	120.0	117.0					11																	108164152		2200	4294	6494	-	-	-	SO:0001583	missense	0	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.4724G>T	11.37:g.108164152G>T	ENSP00000388058:p.Arg1575Leu		B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.R1575L	ENST00000452508.2	37	c.4724	CCDS31669.1	11	.	.	.	.	.	.	.	.	.	.	G	24.7	4.559455	0.86335	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	T;T	0.71579	-0.58;-0.58	5.31	4.39	0.52855	Armadillo-type fold (1);	0.050932	0.85682	D	0.000000	T	0.78755	0.4333	M	0.71581	2.175	0.52501	D	0.999956	D	0.59357	0.985	P	0.55615	0.78	T	0.80453	-0.1376	10	0.51188	T	0.08	.	14.1229	0.65201	0.073:0.0:0.927:0.0	.	1575	Q13315	ATM_HUMAN	L	1575	ENSP00000278616:R1575L;ENSP00000388058:R1575L	ENSP00000278616:R1575L	R	+	2	0	ATM	107669362	1.000000	0.71417	0.992000	0.48379	0.991000	0.79684	8.495000	0.90481	1.353000	0.45828	0.655000	0.94253	CGT	ATM	-	superfamily_ARM-type_fold	ENSG00000149311		0.303	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	HGNC	protein_coding	OTTHUMT00000389938.1	438	0.00	0	G	NM_000051		108164152	108164152	+1	no_errors	ENST00000278616	ensembl	human	known	69_37n	missense	63	48.82	62	SNP	0.997	T
ATP10A	57194	genome.wustl.edu	37	15	25925049	25925049	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr15:25925049C>A	ENST00000356865.6	-	21	4050	c.3939G>T	c.(3937-3939)aaG>aaT	p.K1313N		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	1313					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		TCCTGGGGGACTTCCTGGTCA	0.517																																						dbGAP											0													71.0	76.0	74.0					15																	25925049		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.3939G>T	15.37:g.25925049C>A	ENSP00000349325:p.Lys1313Asn		Q4G0S9|Q969I4	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.K1313N	ENST00000356865.6	37	c.3939	CCDS32178.1	15	.	.	.	.	.	.	.	.	.	.	C	10.58	1.389215	0.25118	.	.	ENSG00000206190	ENST00000356865	T	0.48201	0.82	5.43	3.42	0.39159	.	1.434950	0.04178	N	0.326007	T	0.40522	0.1120	L	0.44542	1.39	0.09310	N	1	B	0.30793	0.295	B	0.30943	0.122	T	0.25433	-1.0132	10	0.17369	T	0.5	-4.5035	6.3835	0.21548	0.0:0.6634:0.1504:0.1862	.	1313	O60312	AT10A_HUMAN	N	1313	ENSP00000349325:K1313N	ENSP00000349325:K1313N	K	-	3	2	ATP10A	23476142	0.000000	0.05858	0.255000	0.24374	0.080000	0.17528	0.171000	0.16685	0.537000	0.28751	0.591000	0.81541	AAG	ATP10A	-	NULL	ENSG00000206190		0.517	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10A	HGNC	protein_coding	OTTHUMT00000414830.1	199	0.00	0	C	NM_024490		25925049	25925049	-1	no_errors	ENST00000356865	ensembl	human	known	69_37n	missense	47	33.80	24	SNP	0.002	A
ATP11A	23250	genome.wustl.edu	37	13	113439565	113439565	+	Silent	SNP	G	G	A	rs201361256	byFrequency	TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr13:113439565G>A	ENST00000487903.1	+	2	244	c.156G>A	c.(154-156)tcG>tcA	p.S52S	ATP11A_ENST00000375645.3_Silent_p.S52S|ATP11A_ENST00000375630.2_Silent_p.S52S|ATP11A_ENST00000283558.8_Silent_p.S52S			P98196	AT11A_HUMAN	ATPase, class VI, type 11A	52					phospholipid translocation (GO:0045332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.S52S(1)		NS(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(12)|lung(17)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	51	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				GGATCGTCTCGTCCAAGGTAA	0.562													G|||	2	0.000399361	0.0008	0.0	5008	,	,		19379	0.0		0.0	False		,,,				2504	0.001					dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											149.0	138.0	142.0					13																	113439565		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB028944	CCDS32011.1	13q34	2010-04-20	2007-09-19		ENSG00000068650	ENSG00000068650	3.6.3.1	"""ATPases / P-type"""	13552	protein-coding gene	gene with protein product	"""potential phospholipid-transporting ATPase IH"", ""phospholipid-translocating ATPase"""	605868	"""ATPase, Class VI, type 11A"""			11015572	Standard	NM_032189		Approved	ATPIH, ATPIS, KIAA1021	uc001vsj.4	P98196	OTTHUMG00000017371	ENST00000487903.1:c.156G>A	13.37:g.113439565G>A			Q5VXT2	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.R27H	ENST00000487903.1	37	c.80	CCDS32011.1	13	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	4.333	0.061246	0.08339	.	.	ENSG00000068650	ENST00000418678	.	.	.	4.84	-1.15	0.09709	.	.	.	.	.	T	0.42086	0.1187	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.24225	-1.0166	4	.	.	.	.	2.8946	0.05687	0.1159:0.5095:0.1164:0.2582	.	.	.	.	H	27	.	.	R	+	2	0	ATP11A	112487566	0.976000	0.34144	0.959000	0.39883	0.314000	0.28054	0.072000	0.14617	-0.257000	0.09459	-0.763000	0.03452	CGT	ATP11A	-	tigrfam_ATPase_P-typ_Plipid-transl	ENSG00000068650		0.562	ATP11A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATP11A	HGNC	protein_coding	OTTHUMT00000045834.3	135	0.00	0	G	NM_015205		113439565	113439565	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000418678	ensembl	human	novel	69_37n	missense	11	50.00	11	SNP	0.998	A
ATP8A1	10396	genome.wustl.edu	37	4	42416696	42416696	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr4:42416696C>A	ENST00000381668.5	-	36	3576	c.3345G>T	c.(3343-3345)aaG>aaT	p.K1115N	ATP8A1_ENST00000264449.10_Missense_Mutation_p.K1100N	NM_006095.2	NP_006086.1	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1	1115					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	51					Phosphatidylserine(DB00144)	CGTGGTTCTTCTTAAAGACGT	0.453																																						dbGAP											0													138.0	131.0	134.0					4																	42416696		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF067820	CCDS3466.1, CCDS47049.1	4p13	2010-04-20	2007-09-19		ENSG00000124406	ENSG00000124406		"""ATPases / P-type"""	13531	protein-coding gene	gene with protein product		609542	"""ATPase, aminophospholipid transporter (APLT), Class I, type 8A, member 1"""			10198212, 9548971	Standard	NM_006095		Approved	ATPIA	uc003gwr.2	Q9Y2Q0	OTTHUMG00000099403	ENST00000381668.5:c.3345G>T	4.37:g.42416696C>A	ENSP00000371084:p.Lys1115Asn		Q32M35|Q32M36|Q4W5J7|Q4W5P2	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.K1115N	ENST00000381668.5	37	c.3345	CCDS3466.1	4	.	.	.	.	.	.	.	.	.	.	C	17.17	3.321191	0.60634	.	.	ENSG00000124406	ENST00000381668;ENST00000264449	T;T	0.62639	0.01;0.01	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.53318	0.1789	L	0.47716	1.5	0.80722	D	1	P;B;B	0.41041	0.736;0.004;0.009	B;B;B	0.35550	0.205;0.004;0.004	T	0.60209	-0.7308	10	0.66056	D	0.02	.	12.8448	0.57823	0.0:0.9257:0.0:0.0743	.	1100;1115;1107	Q32M35;Q9Y2Q0;E7EUK4	.;AT8A1_HUMAN;.	N	1115;1100	ENSP00000371084:K1115N;ENSP00000264449:K1100N	ENSP00000264449:K1100N	K	-	3	2	ATP8A1	42111453	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.260000	0.65490	2.636000	0.89361	0.557000	0.71058	AAG	ATP8A1	-	NULL	ENSG00000124406		0.453	ATP8A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATP8A1	HGNC	protein_coding	OTTHUMT00000216861.2	256	0.00	0	C	NM_006095		42416696	42416696	-1	no_errors	ENST00000381668	ensembl	human	known	69_37n	missense	102	11.30	13	SNP	1.000	A
MEDAG	84935	genome.wustl.edu	37	13	31495228	31495228	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr13:31495228A>G	ENST00000380482.4	+	3	791	c.466A>G	c.(466-468)Atc>Gtc	p.I156V	TEX26-AS1_ENST00000586464.1_RNA|TEX26-AS1_ENST00000588726.1_RNA|TEX26-AS1_ENST00000592950.1_RNA|TEX26-AS1_ENST00000590721.1_RNA|TEX26-AS1_ENST00000586973.1_RNA|TEX26-AS1_ENST00000590344.1_RNA|TEX26-AS1_ENST00000588425.1_RNA|TEX26-AS1_ENST00000593246.1_RNA|TEX26-AS1_ENST00000585870.1_RNA|TEX26-AS1_ENST00000451495.2_RNA	NM_032849.3	NP_116238	Q5VYS4	MEDAG_HUMAN	mesenteric estrogen-dependent adipogenesis	156					positive regulation of fat cell differentiation (GO:0045600)	cytoplasm (GO:0005737)											GGACATGGTCATCTCCTCAGT	0.473																																						dbGAP											0													134.0	114.0	121.0					13																	31495228		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB055407	CCDS9338.1	13q12.3	2013-10-11	2012-09-26	2012-09-26	ENSG00000102802	ENSG00000102802			25926	protein-coding gene	gene with protein product	"""mesenteric estrogen-dependent adipose 4"", ""activated in W/Wv mouse stomach 3 homolog"""		"""chromosome 13 open reading frame 33"""	C13orf33		22510272	Standard	NM_032849		Approved	FLJ14834, AWMS3, MEDA-4	uc001uth.4	Q5VYS4	OTTHUMG00000016679	ENST00000380482.4:c.466A>G	13.37:g.31495228A>G	ENSP00000369849:p.Ile156Val		Q8IXF1|Q96K26|Q96NC8	Missense_Mutation	SNP	NULL	p.I156V	ENST00000380482.4	37	c.466	CCDS9338.1	13	.	.	.	.	.	.	.	.	.	.	A	20.5	4.000786	0.74818	.	.	ENSG00000102802	ENST00000380482	T	0.56941	0.43	5.31	5.31	0.75309	.	0.115575	0.56097	D	0.000025	T	0.60779	0.2295	L	0.32530	0.975	0.32322	N	0.562316	D	0.56968	0.978	D	0.70227	0.968	T	0.68988	-0.5264	10	0.54805	T	0.06	-20.9841	12.8466	0.57833	1.0:0.0:0.0:0.0	.	156	Q5VYS4	CM033_HUMAN	V	156	ENSP00000369849:I156V	ENSP00000369849:I156V	I	+	1	0	C13orf33	30393228	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.435000	0.66532	2.034000	0.60081	0.378000	0.23410	ATC	C13orf33	-	NULL	ENSG00000102802		0.473	MEDAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C13orf33	HGNC	protein_coding	OTTHUMT00000044375.1	155	0.00	0	A	NM_032849		31495228	31495228	+1	no_errors	ENST00000380482	ensembl	human	known	69_37n	missense	26	54.39	31	SNP	1.000	G
C14orf159	80017	genome.wustl.edu	37	14	91639748	91639748	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr14:91639748G>A	ENST00000523771.1	+	6	1160	c.557G>A	c.(556-558)gGt>gAt	p.G186D	C14orf159_ENST00000523816.1_Missense_Mutation_p.G186D|C14orf159_ENST00000520328.1_Splice_Site|C14orf159_ENST00000521077.2_Missense_Mutation_p.G191D|C14orf159_ENST00000428926.2_Missense_Mutation_p.G186D|C14orf159_ENST00000518868.1_Missense_Mutation_p.G191D|C14orf159_ENST00000525393.2_Missense_Mutation_p.G62D|C14orf159_ENST00000522322.1_Missense_Mutation_p.G186D|C14orf159_ENST00000256324.10_Missense_Mutation_p.G191D|C14orf159_ENST00000412671.2_Missense_Mutation_p.G191D			Q7Z3D6	CN159_HUMAN	chromosome 14 open reading frame 159	186						mitochondrion (GO:0005739)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	21		all_cancers(154;0.0191)|all_epithelial(191;0.241)		Epithelial(152;0.141)|OV - Ovarian serous cystadenocarcinoma(161;0.207)		TCCCTCGGAGGTGAGCAGGGG	0.612											OREG0022869	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													49.0	42.0	44.0					14																	91639748		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK097294	CCDS32141.1, CCDS41979.1, CCDS45150.1, CCDS66693.1, CCDS73677.1	14q32.11	2012-09-26			ENSG00000133943	ENSG00000133943			20498	protein-coding gene	gene with protein product							Standard	NM_001102367		Approved	FLJ39975	uc001xze.2	Q7Z3D6	OTTHUMG00000164980	ENST00000523771.1:c.557G>A	14.37:g.91639748G>A	ENSP00000429655:p.Gly186Asp	1284	B3KUI7|Q86SW3|Q86SX8|Q86SX9|Q86T08|Q86TV5|Q96GW5|Q9H7G0|Q9H8Y9|Q9H9W6	Splice_Site	SNP	-	e4+1	ENST00000523771.1	37	c.556+1	CCDS32141.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.016|7.016	0.557814|0.557814	0.13436|0.13436	.|.	.|.	ENSG00000133943|ENSG00000133943	ENST00000520328|ENST00000256324;ENST00000522170;ENST00000519950;ENST00000521077;ENST00000518868;ENST00000523816;ENST00000517518;ENST00000525393;ENST00000428926;ENST00000522322;ENST00000523771;ENST00000412671	.|T;T;T;T;T;T;T;T;T;T;T;T	.|0.41400	.|1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	4.29|4.29	1.36|1.36	0.22044|0.22044	.|.	.|0.731867	.|0.13116	.|N	.|0.412573	.|T	.|0.22513	.|0.0543	N|N	0.25890|0.25890	0.77|0.77	0.09310|0.09310	N|N	1|1	.|B;B;B;B;B	.|0.14438	.|0.005;0.0;0.01;0.004;0.004	.|B;B;B;B;B	.|0.19391	.|0.011;0.004;0.025;0.006;0.006	.|T	.|0.22591	.|-1.0212	.|10	.|0.12430	.|T	.|0.62	.|.	2.3458|2.3458	0.04271|0.04271	0.3176:0.0:0.4505:0.2319|0.3176:0.0:0.4505:0.2319	.|.	.|186;62;191;191;191	.|Q7Z3D6;Q8NB88;B3KVU6;Q7Z3D6-2;Q7Z3D6-3	.|CN159_HUMAN;.;.;.;.	.|D	-1|191;191;191;191;191;186;191;62;186;186;186;191	.|ENSP00000256324:G191D;ENSP00000430666:G191D;ENSP00000428296:G191D;ENSP00000430137:G191D;ENSP00000428263:G191D;ENSP00000428974:G186D;ENSP00000428652:G191D;ENSP00000435459:G62D;ENSP00000404343:G186D;ENSP00000427953:G186D;ENSP00000429655:G186D;ENSP00000404196:G191D	.|ENSP00000256324:G191D	.|G	+|+	.|2	.|0	C14orf159|C14orf159	90709501|90709501	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.003000|0.003000	0.03518|0.03518	0.423000|0.423000	0.21313|0.21313	0.512000|0.512000	0.28257|0.28257	0.511000|0.511000	0.50034|0.50034	.|GGT	C14orf159	-	-	ENSG00000133943		0.612	C14orf159-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C14orf159	HGNC	protein_coding	OTTHUMT00000381273.1	46	0.00	0	G	NM_024952		91639748	91639748	+1	no_errors	ENST00000520328	ensembl	human	known	69_37n	splice_site	13	45.83	11	SNP	0.000	A
C17orf102	400591	genome.wustl.edu	37	17	32905986	32905986	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr17:32905986C>T	ENST00000357754.1	-	1	402	c.314G>A	c.(313-315)cGt>cAt	p.R105H	TMEM132E_ENST00000321639.5_5'Flank	NM_207454.2	NP_997337.2	A2RUQ5	CQ102_HUMAN	chromosome 17 open reading frame 102	105										central_nervous_system(1)|cervix(1)|large_intestine(3)|lung(3)|ovary(1)	9						CCATCCCGCACGAAGCTGAGC	0.642																																						dbGAP											0													61.0	69.0	66.0					17																	32905986		1883	4100	5983	-	-	-	SO:0001583	missense	0				CCDS42297.1	17q12	2009-02-11			ENSG00000197322	ENSG00000197322			34412	protein-coding gene	gene with protein product							Standard	NM_207454		Approved	FLJ44815	uc002hie.1	A2RUQ5	OTTHUMG00000156883	ENST00000357754.1:c.314G>A	17.37:g.32905986C>T	ENSP00000350392:p.Arg105His		A5PKX0|Q6ZTB3	Missense_Mutation	SNP	NULL	p.R105H	ENST00000357754.1	37	c.314	CCDS42297.1	17	.	.	.	.	.	.	.	.	.	.	C	8.414	0.844944	0.16963	.	.	ENSG00000197322	ENST00000357754	T	0.39997	1.05	3.63	0.226	0.15353	.	1.098440	0.07226	N	0.861735	T	0.31040	0.0784	N	0.08118	0	0.09310	N	1	D	0.57257	0.979	P	0.47744	0.556	T	0.41270	-0.9518	10	0.87932	D	0	.	11.3266	0.49452	0.0:0.4419:0.5581:0.0	.	105	A2RUQ5	CQ102_HUMAN	H	105	ENSP00000350392:R105H	ENSP00000350392:R105H	R	-	2	0	C17orf102	29930099	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	-0.593000	0.05740	-0.003000	0.14444	-0.122000	0.15005	CGT	C17orf102	-	NULL	ENSG00000197322		0.642	C17orf102-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf102	HGNC	protein_coding	OTTHUMT00000346435.1	282	0.00	0	C	NM_207454		32905986	32905986	-1	no_errors	ENST00000357754	ensembl	human	known	69_37n	missense	14	48.15	13	SNP	0.000	T
FANCD2OS	115795	genome.wustl.edu	37	3	10146188	10146188	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr3:10146188G>A	ENST00000450660.2	-	2	487	c.271C>T	c.(271-273)Ccc>Tcc	p.P91S	FANCD2OS_ENST00000524279.1_Missense_Mutation_p.P91S	NM_001164839.1	NP_001158311.1	Q96PS1	FACOS_HUMAN	FANCD2 opposite strand	91																	ATGGGCTGGGGCTTCCTGACC	0.532																																						dbGAP											0													125.0	115.0	118.0					3																	10146188		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF230334	CCDS2596.1	3p25.3	2012-11-12	2012-11-12	2012-11-12	ENSG00000163705	ENSG00000163705			28623	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 24"""	C3orf24		12477932	Standard	NM_001164839		Approved	MGC40179	uc003buz.3	Q96PS1	OTTHUMG00000128669	ENST00000450660.2:c.271C>T	3.37:g.10146188G>A	ENSP00000429608:p.Pro91Ser			Missense_Mutation	SNP	NULL	p.P91S	ENST00000450660.2	37	c.271	CCDS2596.1	3	.	.	.	.	.	.	.	.	.	.	G	24.6	4.546987	0.86022	.	.	ENSG00000163705	ENST00000524279;ENST00000450660	.	.	.	5.75	5.75	0.90469	.	0.000000	0.64402	D	0.000001	T	0.41026	0.1141	L	0.29908	0.895	0.48341	D	0.999637	P	0.42357	0.777	B	0.32980	0.156	T	0.48375	-0.9041	9	0.87932	D	0	.	17.5055	0.87743	0.0:0.0:1.0:0.0	.	91	Q96PS1	CC024_HUMAN	S	91	.	ENSP00000429608:P91S	P	-	1	0	C3orf24	10121188	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.820000	0.69250	2.742000	0.94016	0.650000	0.86243	CCC	C3orf24	-	NULL	ENSG00000163705		0.532	FANCD2OS-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf24	HGNC	protein_coding	OTTHUMT00000339891.2	105	0.00	0	G	NM_173472		10146188	10146188	-1	no_errors	ENST00000450660	ensembl	human	known	69_37n	missense	58	39.18	38	SNP	1.000	A
CACFD1	11094	genome.wustl.edu	37	9	136333148	136333148	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr9:136333148A>T	ENST00000316948.4	+	4	506	c.426A>T	c.(424-426)aaA>aaT	p.K142N	CACFD1_ENST00000540581.1_Missense_Mutation_p.K142N|CACFD1_ENST00000542192.1_Missense_Mutation_p.K100N|CACFD1_ENST00000291722.7_Missense_Mutation_p.K100N	NM_017586.3	NP_060056.1	Q9UGQ2	FLOWR_HUMAN	calcium channel flower domain containing 1	142					synaptic vesicle endocytosis (GO:0048488)	integral component of synaptic vesicle membrane (GO:0030285)	calcium channel activity (GO:0005262)										CTCTGGGCAAAAAGTGCGTCT	0.637																																						dbGAP											0													59.0	55.0	56.0					9																	136333148		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6974.1, CCDS48051.1, CCDS56591.1, CCDS56592.1	9q34	2012-03-06	2012-03-06	2012-03-06	ENSG00000160325	ENSG00000160325			1365	protein-coding gene	gene with protein product		613104	"""chromosome 9 open reading frame 7"""	C9orf7		19737521	Standard	NM_001242370		Approved	D9S2135, flower	uc011mdh.1	Q9UGQ2	OTTHUMG00000020875	ENST00000316948.4:c.426A>T	9.37:g.136333148A>T	ENSP00000317121:p.Lys142Asn		B7Z3T8|B7Z5E1|F5GXX4|Q5SXD4|Q8NBM6	Missense_Mutation	SNP	pfam_TVP18/Ca-channel_flower	p.K142N	ENST00000316948.4	37	c.426	CCDS6974.1	9	.	.	.	.	.	.	.	.	.	.	A	22.9	4.350624	0.82132	.	.	ENSG00000160325	ENST00000291722;ENST00000535514;ENST00000316948;ENST00000540581;ENST00000542192;ENST00000444798	D;T;T;T;T	0.90563	-2.69;0.74;0.74;0.74;0.74	5.23	-4.33	0.03677	Membrane protein, Golgi apparatus TVP18/Calcium channel flower (1);	0.363645	0.31415	N	0.007688	D	0.94108	0.8111	M	0.79693	2.465	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.997;0.996	D;D;D;P	0.80764	0.966;0.994;0.962;0.801	D	0.92550	0.6049	10	0.87932	D	0	-6.479	16.3259	0.82979	0.2916:0.0:0.7084:0.0	.	100;142;142;100	B7Z5E1;F5GXX4;Q9UGQ2;Q9UGQ2-2	.;.;FLOWR_HUMAN;.	N	100;132;142;142;100;114	ENSP00000291722:K100N;ENSP00000317121:K142N;ENSP00000440832:K142N;ENSP00000444328:K100N;ENSP00000414495:K114N	ENSP00000291722:K100N	K	+	3	2	C9orf7	135322969	0.834000	0.29399	0.858000	0.33744	0.926000	0.56050	0.088000	0.14979	-1.155000	0.02822	0.402000	0.26972	AAA	CACFD1	-	pfam_TVP18/Ca-channel_flower	ENSG00000160325		0.637	CACFD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACFD1	HGNC	protein_coding	OTTHUMT00000054915.1	19	0.00	0	A	NM_017586		136333148	136333148	+1	no_errors	ENST00000540581	ensembl	human	known	69_37n	missense	2	66.67	4	SNP	0.878	T
CCDC157	550631	genome.wustl.edu	37	22	30765506	30765507	+	Frame_Shift_Ins	INS	-	-	CT			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr22:30765506_30765507insCT	ENST00000405659.1	+	4	1043_1044	c.334_335insCT	c.(334-336)cccfs	p.P112fs	CCDC157_ENST00000338306.3_Frame_Shift_Ins_p.P112fs			Q569K6	CC157_HUMAN	coiled-coil domain containing 157	112										central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(1)	15						GGCTGCGGGGCCCTGCATGTCC	0.658																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC018040	CCDS33632.2	22q12.2	2009-03-05			ENSG00000187860	ENSG00000187860			33854	protein-coding gene	gene with protein product							Standard	NM_001017437		Approved		uc011aku.2	Q569K6	OTTHUMG00000151007	Exception_encountered	22.37:g.30765506_30765507insCT	ENSP00000385357:p.Pro112fs		Q0VD76|Q9BYA4	Frame_Shift_Ins	INS	superfamily_Prefoldin,superfamily_t-SNARE	p.C113fs	ENST00000405659.1	37	c.334_335	CCDS33632.2	22																																																																																			CCDC157	-	NULL	ENSG00000187860		0.658	CCDC157-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC157	HGNC	protein_coding	OTTHUMT00000320936.1	38	0.00	0	-	NM_001017437		30765506	30765507	+1	no_errors	ENST00000338306	ensembl	human	known	69_37n	frame_shift_ins	25	52.83	28	INS	1.000:1.000	CT
CELA2A	63036	genome.wustl.edu	37	1	15793991	15793991	+	Silent	SNP	C	C	T			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr1:15793991C>T	ENST00000359621.4	+	7	775	c.750C>T	c.(748-750)tcC>tcT	p.S250S	CELA2B_ENST00000494280.1_3'UTR	NM_033440.2	NP_254275.1	P08217	CEL2A_HUMAN	chymotrypsin-like elastase family, member 2A	250	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)|keratohyalin granule (GO:0036457)	serine hydrolase activity (GO:0017171)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)|ovary(2)|prostate(1)	16						ACAAGCCCTCCGTCTTCACGC	0.627																																						dbGAP											0													99.0	90.0	93.0					1																	15793991		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS157.1	1p36.21	2009-07-09			ENSG00000142615	ENSG00000142615	3.4.21.71		24609	protein-coding gene	gene with protein product	"""elastase 2A"""	609443				3646943, 2834346	Standard	NM_033440		Approved	ELA2A	uc001awk.3	P08217	OTTHUMG00000002258	ENST00000359621.4:c.750C>T	1.37:g.15793991C>T			B2R5I4|Q14243	Silent	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.S250	ENST00000359621.4	37	c.750	CCDS157.1	1																																																																																			CELA2A	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000142615		0.627	CELA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELA2A	HGNC	protein_coding	OTTHUMT00000006445.1	87	0.00	0	C	NM_033440		15793991	15793991	+1	no_errors	ENST00000359621	ensembl	human	known	69_37n	silent	12	47.83	11	SNP	0.987	T
CMPK2	129607	genome.wustl.edu	37	2	6990088	6990088	+	Nonsense_Mutation	SNP	G	G	A	rs199510524		TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr2:6990088G>A	ENST00000256722.5	-	5	1242	c.1243C>T	c.(1243-1245)Cag>Tag	p.Q415*	CMPK2_ENST00000478738.1_5'UTR|CMPK2_ENST00000458098.1_Intron	NM_207315.3	NP_997198.2	Q5EBM0	CMPK2_HUMAN	cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial	415					cellular response to lipopolysaccharide (GO:0071222)|dTDP biosynthetic process (GO:0006233)|dUDP biosynthetic process (GO:0006227)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)|thymidylate kinase activity (GO:0004798)|UMP kinase activity (GO:0033862)			large_intestine(1)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					TCCATCCGCTGGTAGGACATT	0.443																																						dbGAP											0													67.0	67.0	67.0					2																	6990088		1897	4105	6002	-	-	-	SO:0001587	stop_gained	0				CCDS42648.1, CCDS58695.1, CCDS58696.1	2p25.2	2008-01-25			ENSG00000134326	ENSG00000134326	2.7.4.14		27015	protein-coding gene	gene with protein product	"""cytidylate kinase 2"""	611787				17999954	Standard	NM_207315		Approved	TYKi, UMP-CMPK2	uc002qyo.4	Q5EBM0	OTTHUMG00000151629	ENST00000256722.5:c.1243C>T	2.37:g.6990088G>A	ENSP00000256722:p.Gln415*		A2RUB0|A5D8T2|B7ZM18|Q6ZRU2|Q96AL8	Nonsense_Mutation	SNP	pirsf_UMP-CMP_kinase_mit	p.Q415*	ENST00000256722.5	37	c.1243	CCDS42648.1	2	.	.	.	.	.	.	.	.	.	.	G	21.7	4.190684	0.78789	.	.	ENSG00000134326	ENST00000256722	.	.	.	5.69	2.72	0.32119	.	0.569921	0.18730	N	0.132759	.	.	.	.	.	.	0.58432	D	0.999992	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.7382	10.2731	0.43493	0.0:0.0986:0.4933:0.4081	.	.	.	.	X	415	.	ENSP00000256722:Q415X	Q	-	1	0	CMPK2	6907539	1.000000	0.71417	0.970000	0.41538	0.758000	0.43043	2.936000	0.48971	0.837000	0.34925	-0.169000	0.13324	CAG	CMPK2	-	pirsf_UMP-CMP_kinase_mit	ENSG00000134326		0.443	CMPK2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	CMPK2	HGNC	protein_coding	OTTHUMT00000323339.2	319	0.00	0	G	NM_207315		6990088	6990088	-1	no_errors	ENST00000256722	ensembl	human	novel	69_37n	nonsense	85	28.57	34	SNP	0.838	A
CTNNA2	1496	genome.wustl.edu	37	2	80136769	80136769	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr2:80136769C>T	ENST00000402739.4	+	6	907	c.902C>T	c.(901-903)cCg>cTg	p.P301L	CTNNA2_ENST00000496558.1_Missense_Mutation_p.P301L|CTNNA2_ENST00000540488.1_Missense_Mutation_p.P301L|CTNNA2_ENST00000541047.1_Missense_Mutation_p.P301L|CTNNA2_ENST00000361291.4_Missense_Mutation_p.P335L|CTNNA2_ENST00000466387.1_Missense_Mutation_p.P301L	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	301					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						AGGTTCCGGCCGTCCCTGGAG	0.592																																						dbGAP											0													61.0	65.0	64.0					2																	80136769		1982	4196	6178	-	-	-	SO:0001583	missense	0				CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.902C>T	2.37:g.80136769C>T	ENSP00000384638:p.Pro301Leu		B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.P335L	ENST00000402739.4	37	c.1004		2	.	.	.	.	.	.	.	.	.	.	C	32	5.137803	0.94517	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488	T;T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94;0.94	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.69931	0.3166	M	0.87547	2.89	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.999	D;D;D	0.68192	0.956;0.95;0.95	T	0.72279	-0.4340	10	0.46703	T	0.11	.	19.6081	0.95588	0.0:1.0:0.0:0.0	.	301;301;301	P26232;P26232-3;P26232-2	CTNA2_HUMAN;.;.	L	301;301;335;301;301;301	ENSP00000418191:P301L;ENSP00000419295:P301L;ENSP00000355398:P335L;ENSP00000384638:P301L;ENSP00000444675:P301L;ENSP00000441705:P301L	ENSP00000355398:P335L	P	+	2	0	CTNNA2	79990277	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.811000	0.86092	2.652000	0.90054	0.591000	0.81541	CCG	CTNNA2	-	pfam_Vinculin/catenin	ENSG00000066032		0.592	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	CTNNA2	HGNC	protein_coding	OTTHUMT00000328511.4	116	0.00	0	C	NM_004389		80136769	80136769	+1	no_errors	ENST00000361291	ensembl	human	known	69_37n	missense	27	15.62	5	SNP	1.000	T
DMBX1	127343	genome.wustl.edu	37	1	46976927	46976927	+	Silent	SNP	G	G	T			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr1:46976927G>T	ENST00000360032.3	+	3	668	c.654G>T	c.(652-654)ctG>ctT	p.L218L	DMBX1_ENST00000371956.4_Silent_p.L223L	NM_172225.1	NP_757379.1			diencephalon/mesencephalon homeobox 1											endometrium(2)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Acute lymphoblastic leukemia(166;0.155)					GCAAGGGGCTGGGCTGCAAGA	0.677																																						dbGAP											0													7.0	8.0	8.0					1																	46976927		2086	4088	6174	-	-	-	SO:0001819	synonymous_variant	0			AB037699	CCDS536.1	1p34.1	2011-06-20	2004-03-29	2004-03-30	ENSG00000197587	ENSG00000197587		"""Homeoboxes / PRD class"""	19026	protein-coding gene	gene with protein product		607410	"""orthodenticle homolog 3 (Drosophila)"""	OTX3			Standard	NM_147192		Approved	PAXB	uc001cpx.3	Q8NFW5	OTTHUMG00000007982	ENST00000360032.3:c.654G>T	1.37:g.46976927G>T				Silent	SNP	pfam_Homeodomain,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_OAR_dom,pfscan_Homeodomain	p.L223	ENST00000360032.3	37	c.669	CCDS536.1	1																																																																																			DMBX1	-	NULL	ENSG00000197587		0.677	DMBX1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DMBX1	HGNC	protein_coding	OTTHUMT00000021895.1	65	0.00	0	G			46976927	46976927	+1	no_errors	ENST00000371956	ensembl	human	known	69_37n	silent	11	26.67	4	SNP	0.973	T
FABP1	2168	genome.wustl.edu	37	2	88425708	88425708	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr2:88425708C>T	ENST00000295834.3	-	2	325	c.227G>A	c.(226-228)gGg>gAg	p.G76E	FABP1_ENST00000495375.1_5'UTR|FABP1_ENST00000393750.3_Missense_Mutation_p.G76E	NM_001443.2	NP_001434.1	P07148	FABPL_HUMAN	fatty acid binding protein 1, liver	76					cellular lipid metabolic process (GO:0044255)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|intestinal absorption (GO:0050892)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of hydrolase activity (GO:0051345)|small molecule metabolic process (GO:0044281)	apical cortex (GO:0045179)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|peroxisomal matrix (GO:0005782)	antioxidant activity (GO:0016209)|bile acid binding (GO:0032052)|chromatin binding (GO:0003682)|drug binding (GO:0008144)|fatty acid binding (GO:0005504)|long-chain fatty acid transporter activity (GO:0005324)|phospholipid binding (GO:0005543)			kidney(1)|large_intestine(1)|lung(2)|prostate(1)|stomach(1)	6						GACTTTCTCCCCTGTCATTGT	0.522																																						dbGAP											0													294.0	248.0	264.0					2																	88425708		2203	4300	6503	-	-	-	SO:0001583	missense	0			M10617	CCDS2001.1	2p11	2013-03-01			ENSG00000163586	ENSG00000163586		"""Fatty acid binding protein family"""	3555	protein-coding gene	gene with protein product		134650				3012800, 17698986	Standard	NM_001443		Approved	L-FABP	uc002sst.2	P07148	OTTHUMG00000130312	ENST00000295834.3:c.227G>A	2.37:g.88425708C>T	ENSP00000295834:p.Gly76Glu			Missense_Mutation	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_Fatty_acid-bd	p.G76E	ENST00000295834.3	37	c.227	CCDS2001.1	2	.	.	.	.	.	.	.	.	.	.	C	24.9	4.578927	0.86645	.	.	ENSG00000163586	ENST00000295834;ENST00000393750	T;T	0.25749	1.78;1.78	5.4	5.4	0.78164	Calycin-like (1);Cytosolic fatty-acid binding (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.000000	0.85682	D	0.000000	T	0.61173	0.2326	M	0.91196	3.185	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	T	0.70633	-0.4818	10	0.87932	D	0	.	17.7992	0.88581	0.0:1.0:0.0:0.0	.	76;76	A8MW49;P07148	.;FABPL_HUMAN	E	76	ENSP00000295834:G76E;ENSP00000377351:G76E	ENSP00000295834:G76E	G	-	2	0	FABP1	88206823	1.000000	0.71417	0.998000	0.56505	0.965000	0.64279	6.938000	0.75904	2.550000	0.86006	0.558000	0.71614	GGG	FABP1	-	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_Fatty_acid-bd	ENSG00000163586		0.522	FABP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FABP1	HGNC	protein_coding	OTTHUMT00000252660.1	979	0.00	0	C	NM_001443		88425708	88425708	-1	no_errors	ENST00000295834	ensembl	human	known	69_37n	missense	271	29.43	113	SNP	1.000	T
FAM86B2	653333	genome.wustl.edu	37	8	12283473	12283473	+	Silent	SNP	C	C	T			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr8:12283473C>T	ENST00000262365.4	-	8	917	c.918G>A	c.(916-918)gcG>gcA	p.A306A	AC087203.1_ENST00000580058.1_RNA|FAM86B2_ENST00000351291.4_Silent_p.A272A|FAM86B2_ENST00000393715.3_Missense_Mutation_p.G126R|FAM86B2_ENST00000309608.5_3'UTR	NM_001137610.1	NP_001131082.1	P0C5J1	F86B2_HUMAN	family with sequence similarity 86, member B2	306										endometrium(1)|kidney(2)	3						GATGAGCTTCCGCTTCCCATC	0.527																																						dbGAP											0													2.0	2.0	2.0					8																	12283473		521	1081	1602	-	-	-	SO:0001819	synonymous_variant	0				CCDS59092.1	8p23.1	2011-07-01			ENSG00000145002	ENSG00000145002			32222	protein-coding gene	gene with protein product							Standard	NM_001137610		Approved		uc003wvt.4	P0C5J1	OTTHUMG00000165462	ENST00000262365.4:c.918G>A	8.37:g.12283473C>T				Missense_Mutation	SNP	NULL	p.G126R	ENST00000262365.4	37	c.376	CCDS59092.1	8	.	.	.	.	.	.	.	.	.	.	-	0.010	-1.795600	0.00617	.	.	ENSG00000145002	ENST00000393715	T	0.34072	1.38	2.22	-4.44	0.03557	.	.	.	.	.	T	0.12263	0.0298	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.29181	-1.0020	5	0.07175	T	0.84	.	4.0137	0.09634	0.0:0.4192:0.2034:0.3774	.	.	.	.	R	126	ENSP00000377318:G126R	ENSP00000377318:G126R	G	-	1	0	FAM86B2	12327844	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-4.923000	0.00169	-1.939000	0.01044	-1.565000	0.00878	GGA	FAM86B2	-	NULL	ENSG00000145002		0.527	FAM86B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM86B2	HGNC	protein_coding		35	0.00	0	C	XM_928336		12283473	12283473	-1	no_errors	ENST00000393715	ensembl	human	known	69_37n	missense	11	26.67	4	SNP	0.000	T
GLI1	2735	genome.wustl.edu	37	12	57859576	57859576	+	Silent	SNP	C	C	T			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr12:57859576C>T	ENST00000228682.2	+	7	721	c.630C>T	c.(628-630)ccC>ccT	p.P210P	GLI1_ENST00000543426.1_Silent_p.P82P|GLI1_ENST00000546141.1_Silent_p.P169P	NM_005269.2	NP_005260.1	P08151	GLI1_HUMAN	GLI family zinc finger 1	210			P -> A (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		cerebellar cortex morphogenesis (GO:0021696)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral pattern formation (GO:0009953)|epidermal cell differentiation (GO:0009913)|lung development (GO:0030324)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|notochord regression (GO:0060032)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|regulation of smoothened signaling pathway (GO:0008589)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|spermatogenesis (GO:0007283)|ventral midline development (GO:0007418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|primary cilium (GO:0072372)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(8)|lung(22)|ovary(6)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69			GBM - Glioblastoma multiforme(3;3.99e-32)			CCTAGGATCCCCTGTTGGGGA	0.567																																					Pancreas(157;841 1936 10503 41495 50368)	dbGAP											0													97.0	95.0	96.0					12																	57859576		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS8940.1, CCDS53806.1, CCDS53807.1	12q13.2-q13.3	2013-01-25	2009-03-05	2005-01-14		ENSG00000111087		"""Zinc fingers, C2H2-type"""	4317	protein-coding gene	gene with protein product		165220	"""glioma-associated oncogene homolog 1 (zinc finger protein)"", ""glioma-associated oncogene family zinc finger 1"""	GLI		2850480	Standard	NM_005269		Approved		uc001snx.3	P08151		ENST00000228682.2:c.630C>T	12.37:g.57859576C>T			D0EUY3|E9PQQ9|F5H6H8|Q8TDN9	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P210	ENST00000228682.2	37	c.630	CCDS8940.1	12																																																																																			GLI1	-	NULL	ENSG00000111087		0.567	GLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLI1	HGNC	protein_coding	OTTHUMT00000394197.1	344	0.00	0	C	NM_005269		57859576	57859576	+1	no_errors	ENST00000228682	ensembl	human	known	69_37n	silent	97	35.76	54	SNP	0.994	T
GRM6	2916	genome.wustl.edu	37	5	178408823	178408823	+	Silent	SNP	G	G	T			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr5:178408823G>T	ENST00000517717.1	-	11	2507	c.2469C>A	c.(2467-2469)tcC>tcA	p.S823S	RP11-281O15.4_ENST00000519491.1_RNA|GRM6_ENST00000231188.5_Silent_p.S823S			O15303	GRM6_HUMAN	glutamate receptor, metabotropic 6	823					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|detection of light stimulus involved in visual perception (GO:0050908)|detection of visible light (GO:0009584)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|locomotory behavior (GO:0007626)|positive regulation of calcium ion import (GO:0090280)|regulation of synaptic transmission, glutamatergic (GO:0051966)|retina development in camera-type eye (GO:0060041)|synaptic transmission (GO:0007268)	cell projection (GO:0042995)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|new growing cell tip (GO:0035841)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|protein homodimerization activity (GO:0042803)			NS(2)|breast(4)|endometrium(9)|large_intestine(12)|lung(21)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	55	all_cancers(89;0.000828)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.0156)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.245)		TCAGGCTCAAGGACACGGTTA	0.577																																						dbGAP											0													183.0	157.0	166.0					5																	178408823		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U82083	CCDS4442.1	5q35	2014-01-28						"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4598	protein-coding gene	gene with protein product		604096				9215706	Standard	NM_000843		Approved	GPRC1F, mGlu6, MGLUR6, CSNB1B	uc003mjr.3	O15303	OTTHUMG00000130889	ENST00000517717.1:c.2469C>A	5.37:g.178408823G>T				Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_6,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_4,pfscan_GPCR_3_C	p.S823	ENST00000517717.1	37	c.2469	CCDS4442.1	5																																																																																			GRM6	-	pfam_GPCR_3_C,prints_GPCR_3_mtglu_rcpt,pfscan_GPCR_3_C	ENSG00000113262		0.577	GRM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM6	HGNC	protein_coding	OTTHUMT00000253474.2	72	0.00	0	G			178408823	178408823	-1	no_errors	ENST00000231188	ensembl	human	known	69_37n	silent	26	25.71	9	SNP	1.000	T
HADHA	3030	genome.wustl.edu	37	2	26417472	26417472	+	Silent	SNP	C	C	T	rs541069396		TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr2:26417472C>T	ENST00000380649.3	-	16	1785	c.1656G>A	c.(1654-1656)gcG>gcA	p.A552A		NM_000182.4	NP_000173.2	P40939	ECHA_HUMAN	hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit	552					cardiolipin acyl-chain remodeling (GO:0035965)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	mitochondrial fatty acid beta-oxidation multienzyme complex (GO:0016507)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|acetyl-CoA C-acetyltransferase activity (GO:0003985)|enoyl-CoA hydratase activity (GO:0004300)|fatty-acyl-CoA binding (GO:0000062)|long-chain-3-hydroxyacyl-CoA dehydrogenase activity (GO:0016509)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|NAD binding (GO:0051287)			autonomic_ganglia(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(4)|skin(1)	30	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACATCATGGGCGCAAGACACC	0.517													C|||	1	0.000199681	0.0	0.0	5008	,	,		19969	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													91.0	78.0	82.0					2																	26417472		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D16480	CCDS1721.1	2p23	2014-09-17	2010-04-30		ENSG00000084754	ENSG00000084754	1.1.1.211, 4.2.1.17		4801	protein-coding gene	gene with protein product	"""gastrin-binding protein"", ""long-chain-3-hydroxyacyl-CoA dehydrogenase"", ""long-chain 2-enoyl-CoA hydratase"", ""mitochondrial trifunctional protein, alpha subunit"""	600890	"""hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), alpha subunit"""			9605857, 7918661	Standard	NM_000182		Approved	GBP, LCEH, LCHAD, MTPA	uc002rgy.3	P40939	OTTHUMG00000096979	ENST00000380649.3:c.1656G>A	2.37:g.26417472C>T			B2R7L4|B4DYP2|Q16679|Q53T69|Q53TA2|Q96GT7|Q9UQC5	Silent	SNP	pfam_Crotonase_core,pfam_3-OHacyl-CoA_DH_NAD-bd,pfam_3HC_DH_C,superfamily_6-PGluconate_DH_C-like,tigrfam_Fa_ox_alpha_mit	p.A552	ENST00000380649.3	37	c.1656	CCDS1721.1	2																																																																																			HADHA	-	pfam_3HC_DH_C,superfamily_6-PGluconate_DH_C-like,tigrfam_Fa_ox_alpha_mit	ENSG00000084754		0.517	HADHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HADHA	HGNC	protein_coding	OTTHUMT00000214051.1	92	0.00	0	C	NM_000182		26417472	26417472	-1	no_errors	ENST00000380649	ensembl	human	known	69_37n	silent	35	22.22	10	SNP	0.629	T
ITPKB	3707	genome.wustl.edu	37	1	226825450	226825450	+	Splice_Site	SNP	A	A	G			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr1:226825450A>G	ENST00000272117.3	-	6	2554	c.2555T>C	c.(2554-2556)aTc>aCc	p.I852T	ITPKB_ENST00000429204.1_Splice_Site_p.I852T			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	852					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				CCGATAGGCGATCTGGGAATA	0.547											OREG0014299	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Colon(84;110 1851 5306 33547)	dbGAP											0													69.0	66.0	67.0					1																	226825450		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.2554-1T>C	1.37:g.226825450A>G		2315	Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	Missense_Mutation	SNP	pfam_IPK	p.I852T	ENST00000272117.3	37	c.2555	CCDS1555.1	1	.	.	.	.	.	.	.	.	.	.	A	11.83	1.755194	0.31046	.	.	ENSG00000143772	ENST00000272117;ENST00000429204	T;T	0.16196	2.36;2.36	5.52	4.39	0.52855	.	0.569522	0.19980	N	0.101792	T	0.12561	0.0305	N	0.11927	0.2	0.09310	N	1	P	0.40302	0.712	P	0.50192	0.634	T	0.19712	-1.0297	10	0.14252	T	0.57	-5.1344	5.0772	0.14638	0.6692:0.0:0.082:0.2488	.	852	P27987	IP3KB_HUMAN	T	852	ENSP00000272117:I852T;ENSP00000411152:I852T	ENSP00000272117:I852T	I	-	2	0	ITPKB	224892073	0.931000	0.31567	0.019000	0.16419	0.098000	0.18820	1.800000	0.38833	0.951000	0.37770	0.529000	0.55759	ATC	ITPKB	-	pfam_IPK	ENSG00000143772		0.547	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPKB	HGNC	protein_coding	OTTHUMT00000091632.1	45	0.00	0	A	NM_002221	Missense_Mutation	226825450	226825450	-1	no_errors	ENST00000272117	ensembl	human	known	69_37n	missense	4	66.67	8	SNP	0.053	G
KDM4C	23081	genome.wustl.edu	37	9	6814672	6814672	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr9:6814672G>A	ENST00000381309.3	+	4	927	c.362G>A	c.(361-363)cGc>cAc	p.R121H	KDM4C_ENST00000543771.1_Missense_Mutation_p.R121H|KDM4C_ENST00000489243.1_3'UTR|KDM4C_ENST00000536108.1_Intron|KDM4C_ENST00000401787.3_Missense_Mutation_p.R121H|KDM4C_ENST00000535193.1_Missense_Mutation_p.R143H|KDM4C_ENST00000381306.3_Missense_Mutation_p.R121H|KDM4C_ENST00000442236.2_5'UTR	NM_015061.3	NP_055876.2	Q9H3R0	KDM4C_HUMAN	lysine (K)-specific demethylase 4C	121					histone H3-K9 demethylation (GO:0033169)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	androgen receptor binding (GO:0050681)|dioxygenase activity (GO:0051213)|enzyme binding (GO:0019899)|histone demethylase activity (H3-K9 specific) (GO:0032454)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43						GATTTGGAGCGCAAGTACTGG	0.363																																						dbGAP											0													150.0	147.0	148.0					9																	6814672		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018323	CCDS6471.1, CCDS55285.1, CCDS55286.1, CCDS55287.1	9p24-p23	2013-01-23	2009-04-06	2009-04-06	ENSG00000107077	ENSG00000107077		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	17071	protein-coding gene	gene with protein product	"""tudor domain containing 14C"""	605469	"""jumonji domain containing 2C"""	JMJD2C		9872452, 15138608	Standard	NM_015061		Approved	GASC1, KIAA0780, TDRD14C	uc003zkh.3	Q9H3R0	OTTHUMG00000019536	ENST00000381309.3:c.362G>A	9.37:g.6814672G>A	ENSP00000370710:p.Arg121His		B4E1Y4|B7ZL46|F5H347|F5H7P0|O94877|Q2M3M0|Q5JUC9|Q5VYJ2|Q5VYJ3	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_TF_JmjN,superfamily_Znf_FYVE_PHD,superfamily_Chorismate_mutase_type_II,smart_TF_JmjN,smart_JmjC_dom,smart_Znf_PHD,smart_Tudor,pfscan_TF_JmjN,pfscan_JmjC_dom	p.R121H	ENST00000381309.3	37	c.362	CCDS6471.1	9	.	.	.	.	.	.	.	.	.	.	G	35	5.570869	0.96540	.	.	ENSG00000107077	ENST00000535193;ENST00000543771;ENST00000401787;ENST00000381309;ENST00000381306	T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.78566	0.4303	M	0.93507	3.425	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;P;D;D;D	0.87578	0.998;0.991;0.908;0.975;0.976;0.992	D	0.83650	0.0155	10	0.87932	D	0	-0.049	19.9017	0.96988	0.0:0.0:1.0:0.0	.	121;121;121;143;121;121	F5H347;B4E1Y4;B0QZ60;F5H7P0;Q9H3R0;Q9H3R0-2	.;.;.;.;KDM4C_HUMAN;.	H	143;121;121;121;121	ENSP00000442382:R143H;ENSP00000445427:R121H;ENSP00000383990:R121H;ENSP00000370710:R121H;ENSP00000370707:R121H	ENSP00000370707:R121H	R	+	2	0	KDM4C	6804672	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.712000	0.98738	2.707000	0.92482	0.561000	0.74099	CGC	KDM4C	-	NULL	ENSG00000107077		0.363	KDM4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4C	HGNC	protein_coding	OTTHUMT00000051692.1	198	0.00	0	G	NM_015061		6814672	6814672	+1	no_errors	ENST00000381309	ensembl	human	known	69_37n	missense	90	33.33	45	SNP	1.000	A
KPRP	448834	genome.wustl.edu	37	1	152733785	152733785	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr1:152733785C>A	ENST00000606109.1	+	1	1749	c.1721C>A	c.(1720-1722)gCa>gAa	p.A574E	KPRP_ENST00000368773.1_Missense_Mutation_p.A574E			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	574						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			AAAGGGGAAGCAAAGAGTGCT	0.498																																						dbGAP											0													50.0	50.0	50.0					1																	152733785		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.1721C>A	1.37:g.152733785C>A	ENSP00000475216:p.Ala574Glu			Missense_Mutation	SNP	NULL	p.A574E	ENST00000606109.1	37	c.1721	CCDS30862.1	1	.	.	.	.	.	.	.	.	.	.	C	11.02	1.515089	0.27123	.	.	ENSG00000203786	ENST00000368773	T	0.14640	2.49	4.48	-1.9	0.07665	.	1.377990	0.04890	N	0.449373	T	0.03178	0.0093	L	0.34521	1.04	0.09310	N	1	B	0.15141	0.012	B	0.12837	0.008	T	0.47129	-0.9141	10	0.66056	D	0.02	2.936	4.1427	0.10201	0.1682:0.3418:0.0:0.4899	.	574	Q5T749	KPRP_HUMAN	E	574	ENSP00000357762:A574E	ENSP00000357762:A574E	A	+	2	0	KPRP	151000409	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-0.589000	0.05767	-0.223000	0.09943	0.313000	0.20887	GCA	KPRP	-	NULL	ENSG00000203786		0.498	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPRP	HGNC	protein_coding	OTTHUMT00000034522.2	145	0.00	0	C	NM_001025231		152733785	152733785	+1	no_errors	ENST00000368773	ensembl	human	known	69_37n	missense	35	27.08	13	SNP	0.000	A
L3MBTL4	91133	genome.wustl.edu	37	18	6080916	6080917	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr18:6080916_6080917insT	ENST00000284898.6	-	16	1607_1608	c.1407_1408insA	c.(1405-1410)aaaggafs	p.G470fs	RP11-793A3.2_ENST00000577935.1_RNA|L3MBTL4_ENST00000535782.1_Frame_Shift_Ins_p.G283fs|L3MBTL4_ENST00000317931.7_Frame_Shift_Ins_p.G470fs|L3MBTL4_ENST00000400104.3_Frame_Shift_Ins_p.G470fs|L3MBTL4_ENST00000400105.2_Frame_Shift_Ins_p.G470fs	NM_173464.3	NP_775735.2	Q8NA19	LMBL4_HUMAN	l(3)mbt-like 4 (Drosophila)	470					chromatin modification (GO:0016568)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(17)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		Colorectal(10;0.0249)				TCTTCTTTTCCTTTGATTTTCA	0.332																																					Esophageal Squamous(41;748 902 17366 28959 43175)	dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC039316	CCDS11839.2	18p11.31-p11.23	2013-01-10			ENSG00000154655	ENSG00000154655		"""Sterile alpha motif (SAM) domain containing"""	26677	protein-coding gene	gene with protein product						14702039	Standard	NM_173464		Approved	FLJ35936, HsT1031	uc010dkt.3	Q8NA19	OTTHUMG00000131573	ENST00000284898.6:c.1408dupA	18.37:g.6080919_6080919dupT	ENSP00000284898:p.Gly470fs		A8MTL8|Q8IXS3	Frame_Shift_Ins	INS	pfam_Mbt,pfam_SAM_type1,pfam_Znf_C2HC,pfam_SAM_2,superfamily_SAM/pointed,smart_Mbt,smart_SAM,pfscan_Mbt,pfscan_SAM	p.G469fs	ENST00000284898.6	37	c.1408_1407	CCDS11839.2	18																																																																																			L3MBTL4	-	NULL	ENSG00000154655		0.332	L3MBTL4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	L3MBTL4	HGNC	protein_coding	OTTHUMT00000254448.2	78	0.00	0	-	NM_173464		6080916	6080917	-1	no_errors	ENST00000284898	ensembl	human	known	69_37n	frame_shift_ins	16	11.11	2	INS	1.000:1.000	T
LMTK3	114783	genome.wustl.edu	37	19	48994447	48994448	+	Frame_Shift_Ins	INS	-	-	G	rs201324765		TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr19:48994447_48994448insG	ENST00000600059.1	-	14	4510_4511	c.4283_4284insC	c.(4282-4284)ccgfs	p.P1428fs	LMTK3_ENST00000270238.3_Frame_Shift_Ins_p.P1457fs			Q96Q04	LMTK3_HUMAN	lemur tyrosine kinase 3	1428	Pro-rich.				negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(9)|prostate(1)	16		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000114)|all cancers(93;0.000141)|Epithelial(262;0.00854)|GBM - Glioblastoma multiforme(486;0.0231)		AGAAGCACAGCGGGGGGCCTGG	0.728																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB067470	CCDS46136.1	19q13.33	2014-06-12				ENSG00000142235			19295	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 101"""						Standard	NM_001080434		Approved	KIAA1883, LMR3, TYKLM3, PPP1R101	uc002pjk.3	Q96Q04		ENST00000600059.1:c.4284dupC	19.37:g.48994453_48994453dupG	ENSP00000472020:p.Pro1428fs		Q4G0U1	Frame_Shift_Ins	INS	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.L1458fs	ENST00000600059.1	37	c.4371_4370		19																																																																																			LMTK3	-	NULL	ENSG00000142235		0.728	LMTK3-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	LMTK3	HGNC	protein_coding	OTTHUMT00000466137.1	22	0.00	0	-	NM_052895		48994447	48994448	-1	no_errors	ENST00000270238	ensembl	human	known	69_37n	frame_shift_ins	4	33.33	2	INS	1.000:1.000	G
CD302	9936	genome.wustl.edu	37	2	160628389	160628391	+	In_Frame_Del	DEL	TTC	TTC	-			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	TTC	TTC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr2:160628389_160628391delTTC	ENST00000259053.4	-	6	713_715	c.670_672delGAA	c.(670-672)gaadel	p.E224del	LY75_ENST00000553424.1_In_Frame_Del_p.E1809del|LY75-CD302_ENST00000504764.1_In_Frame_Del_p.E1865del|LY75_ENST00000554112.1_In_Frame_Del_p.E1865del|LY75-CD302_ENST00000505052.1_In_Frame_Del_p.E1809del|CD302_ENST00000480212.1_5'UTR|CD302_ENST00000429078.2_In_Frame_Del_p.E166del	NM_001198764.1|NM_014880.4	NP_001185693.1|NP_055695.2	Q8IX05	CD302_HUMAN	CD302 molecule	224					phagocytosis (GO:0006909)	cell cortex (GO:0005938)|filopodium (GO:0030175)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)			endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|prostate(1)|skin(1)	11						GATATTCATTTTCTTCTCCAACT	0.355																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AY314007	CCDS33308.1, CCDS56139.1, CCDS74595.1	2q24.2	2011-08-30	2006-03-28		ENSG00000241399	ENSG00000241399		"""CD molecules"", ""C-type lectin domain containing"""	30843	protein-coding gene	gene with protein product	"""C-type lectin domain family 13, member A"""	612246	"""CD302 antigen"""			7584026, 7584028	Standard	NM_014880		Approved	DCL-1, KIAA0022, BIMLEC, CLEC13A		Q8IX05	OTTHUMG00000154080	ENST00000259053.4:c.670_672delGAA	2.37:g.160628392_160628394delTTC	ENSP00000259053:p.Glu224del		A8K5G4|B4E2T9|Q15009	In_Frame_Del	DEL	pfam_C-type_lectin,pfam_FN_type2_col-bd,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin	p.E1865in_frame_del	ENST00000259053.4	37	c.5595_5593	CCDS33308.1	2																																																																																			LY75	-	NULL	ENSG00000054219		0.355	CD302-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LY75	HGNC	protein_coding	OTTHUMT00000333760.1	328	0.00	0	TTC	NM_014880		160628389	160628391	-1	no_errors	ENST00000554112	ensembl	human	known	69_37n	in_frame_del	82	28.45	33	DEL	1.000:1.000:1.000	-
MIR548M	100313772	genome.wustl.edu	37	X	94318211	94318212	+	RNA	INS	-	-	C	rs368435363		TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chrX:94318211_94318212insC	ENST00000408260.1	-	0	13_14					NR_031667.1				microRNA 548m																		aaatacctttgcaccaacctaa	0.312																																						dbGAP											0																																										-	-	-			0					Xq21.33	2011-09-12		2008-12-18	ENSG00000221187	ENSG00000221187		"""ncRNAs / Micro RNAs"""	35331	non-coding RNA	RNA, micro				MIRN548M			Standard	NR_031667		Approved	hsa-mir-548m	uc022agt.1				X.37:g.94318212_94318212dupC				RNA	INS	-	NULL	ENST00000408260.1	37	NULL		X																																																																																			MIR548M	-	-	ENSG00000221187		0.312	MIR548M-201	KNOWN	basic	miRNA	MIR548M	HGNC	miRNA		83	0.00	0	-	NR_031667		94318211	94318212	-1	no_errors	ENST00000408260	ensembl	human	known	69_37n	rna	7	41.67	5	INS	0.103:0.097	C
KMT2A	4297	genome.wustl.edu	37	11	118350902	118350902	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr11:118350902C>T	ENST00000389506.5	+	6	3583	c.3583C>T	c.(3583-3585)Cag>Tag	p.Q1195*	KMT2A_ENST00000534358.1_Nonsense_Mutation_p.Q1195*|KMT2A_ENST00000354520.4_Nonsense_Mutation_p.Q1195*			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	1195					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										GAGAAAATGTCAGAATCTACA	0.373																																						dbGAP											0													149.0	135.0	140.0					11																	118350902		2200	4296	6496	-	-	-	SO:0001587	stop_gained	0			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.3583C>T	11.37:g.118350902C>T	ENSP00000374157:p.Gln1195*		E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Nonsense_Mutation	SNP	pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_Bromodomain,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pirsf_MeTrfase_trithorax,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC,pfscan_Bromodomain	p.Q1195*	ENST00000389506.5	37	c.3583	CCDS31686.1	11	.	.	.	.	.	.	.	.	.	.	C	42	9.384721	0.99155	.	.	ENSG00000118058	ENST00000534358;ENST00000531904;ENST00000389506;ENST00000354520;ENST00000359313	.	.	.	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	19.5023	0.95100	0.0:1.0:0.0:0.0	.	.	.	.	X	1195;1228;1195;1195;105	.	ENSP00000346516:Q1195X	Q	+	1	0	MLL	117856112	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.378000	0.79679	2.706000	0.92434	0.557000	0.71058	CAG	MLL	-	pirsf_MeTrfase_trithorax,pfscan_Znf_CXXC	ENSG00000118058		0.373	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL	HGNC	protein_coding	OTTHUMT00000399085.2	223	0.00	0	C	NM_005933		118350902	118350902	+1	no_errors	ENST00000389506	ensembl	human	known	69_37n	nonsense	45	48.28	42	SNP	1.000	T
MRPS35	60488	genome.wustl.edu	37	12	27890496	27890496	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr12:27890496C>T	ENST00000538315.1	+	6	556	c.547C>T	c.(547-549)Cga>Tga	p.R183*	MRPS35_ENST00000081029.3_Silent_p.Y219Y	NM_001190864.1	NP_001177793.1	Q9Y2Q9	RT28_HUMAN	mitochondrial ribosomal protein S35	0						mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|lung(2)|urinary_tract(1)	6	Lung SC(9;0.0873)					GGCAGAATTACGATTATGCAG	0.323																																						dbGAP											0													187.0	175.0	179.0					12																	27890496		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0			AF182422	CCDS8714.1, CCDS53769.1	12p11	2012-09-13			ENSG00000061794	ENSG00000061794		"""Mitochondrial ribosomal proteins / small subunits"""	16635	protein-coding gene	gene with protein product		611995				11279123	Standard	NM_021821		Approved	MRPS28, MDS023	uc001rih.3	P82673	OTTHUMG00000169215	ENST00000538315.1:c.547C>T	12.37:g.27890496C>T	ENSP00000445390:p.Arg183*		B2RDZ7|Q96Q21	Nonsense_Mutation	SNP	NULL	p.R183*	ENST00000538315.1	37	c.547	CCDS53769.1	12	.	.	.	.	.	.	.	.	.	.	c	8.242	0.806994	0.16467	.	.	ENSG00000061794	ENST00000538315	.	.	.	5.26	0.0772	0.14407	.	.	.	.	.	.	.	.	.	.	.	0.39657	D	0.970557	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-25.768	8.0004	0.30293	0.0:0.3454:0.0:0.6546	.	.	.	.	X	183	.	ENSP00000445390:R183X	R	+	1	2	MRPS35	27781763	0.997000	0.39634	0.874000	0.34290	0.058000	0.15608	0.197000	0.17197	-0.160000	0.11002	-0.374000	0.07098	CGA	MRPS35	-	NULL	ENSG00000061794		0.323	MRPS35-002	KNOWN	basic|CCDS	protein_coding	MRPS35	HGNC	protein_coding	OTTHUMT00000402899.1	142	0.00	0	C	NM_021821		27890496	27890496	+1	no_errors	ENST00000538315	ensembl	human	known	69_37n	nonsense	59	35.87	33	SNP	0.950	T
NR1D1	9572	genome.wustl.edu	37	17	38251892	38251892	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr17:38251892A>T	ENST00000246672.3	-	5	1683	c.1053T>A	c.(1051-1053)caT>caA	p.H351Q		NM_021724.3	NP_068370.1	P20393	NR1D1_HUMAN	nuclear receptor subfamily 1, group D, member 1	351	Ligand-binding.				cell differentiation (GO:0030154)|cellular response to lipopolysaccharide (GO:0071222)|circadian regulation of gene expression (GO:0032922)|circadian temperature homeostasis (GO:0060086)|gene expression (GO:0010467)|glycogen biosynthetic process (GO:0005978)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of bile acid biosynthetic process (GO:0070859)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasomal protein catabolic process (GO:0010498)|regulation of cholesterol homeostasis (GO:2000188)|regulation of circadian rhythm (GO:0042752)|regulation of fat cell differentiation (GO:0045598)|regulation of gluconeogenesis by regulation of transcription from RNA polymerase II promoter (GO:0035947)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of lipid metabolic process (GO:0019216)|regulation of type B pancreatic cell proliferation (GO:0061469)|response to leptin (GO:0044321)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|heme binding (GO:0020037)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|steroid hormone receptor activity (GO:0003707)|transcription corepressor activity (GO:0003714)|transcription corepressor binding (GO:0001222)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(5)|lung(2)|skin(1)|upper_aerodigestive_tract(2)	11	Colorectal(19;0.000442)					GGGCCTCGTTATGACGCTGGG	0.627																																						dbGAP											0													118.0	106.0	110.0					17																	38251892		2203	4300	6503	-	-	-	SO:0001583	missense	0			X72631	CCDS11361.1	17q11.2	2013-01-16			ENSG00000126368	ENSG00000126368		"""Nuclear hormone receptors"""	7962	protein-coding gene	gene with protein product		602408		THRAL		1971514	Standard	NM_021724		Approved	ear-1, hRev, Rev-ErbAalpha, THRA1	uc002htz.3	P20393	OTTHUMG00000133327	ENST00000246672.3:c.1053T>A	17.37:g.38251892A>T	ENSP00000246672:p.His351Gln		Q0P5Z4|Q15304	Missense_Mutation	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt	p.H351Q	ENST00000246672.3	37	c.1053	CCDS11361.1	17	.	.	.	.	.	.	.	.	.	.	A	13.99	2.400876	0.42613	.	.	ENSG00000126368	ENST00000246672	D	0.90444	-2.67	4.55	-1.43	0.08884	Nuclear hormone receptor, ligand-binding (1);	0.276314	0.30547	N	0.009383	D	0.86070	0.5845	L	0.54323	1.7	0.27789	N	0.942903	P	0.44260	0.83	B	0.43251	0.413	T	0.79438	-0.1803	10	0.30854	T	0.27	.	9.9199	0.41457	0.3971:0.0:0.6029:0.0	.	351	P20393	NR1D1_HUMAN	Q	351	ENSP00000246672:H351Q	ENSP00000246672:H351Q	H	-	3	2	NR1D1	35505418	0.995000	0.38212	0.975000	0.42487	0.927000	0.56198	0.460000	0.21924	-0.175000	0.10725	-0.264000	0.10439	CAT	NR1D1	-	superfamily_Nucl_hormone_rcpt_ligand-bd	ENSG00000126368		0.627	NR1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR1D1	HGNC	protein_coding	OTTHUMT00000257135.1	21	0.00	0	A			38251892	38251892	-1	no_errors	ENST00000246672	ensembl	human	known	69_37n	missense	31	24.39	10	SNP	0.991	T
NRIP1	8204	genome.wustl.edu	37	21	16338239	16338239	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr21:16338239G>A	ENST00000400202.1	-	3	2987	c.2275C>T	c.(2275-2277)Cct>Tct	p.P759S	NRIP1_ENST00000318948.4_Missense_Mutation_p.P759S|AF127577.10_ENST00000446301.1_RNA|NRIP1_ENST00000400199.1_Missense_Mutation_p.P759S			P48552	NRIP1_HUMAN	nuclear receptor interacting protein 1	759	Interaction with ZNF366.|Repression domain 3.				androgen receptor signaling pathway (GO:0030521)|lipid storage (GO:0019915)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ovarian follicle rupture (GO:0001543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|glucocorticoid receptor binding (GO:0035259)|nuclear hormone receptor binding (GO:0035257)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			cervix(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(13)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	39				Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)		TCATCACAAGGCTCAGATTTT	0.413																																						dbGAP											0													117.0	112.0	113.0					21																	16338239		2203	4300	6503	-	-	-	SO:0001583	missense	0			X84373	CCDS13568.1	21q11.2	2008-07-31			ENSG00000180530	ENSG00000180530			8001	protein-coding gene	gene with protein product	"""receptor interacting protein 140"", ""nuclear factor RIP140"""	602490				7641693, 9521594	Standard	NM_003489		Approved	RIP140	uc002yjx.2	P48552	OTTHUMG00000074323	ENST00000400202.1:c.2275C>T	21.37:g.16338239G>A	ENSP00000383063:p.Pro759Ser		Q8IWE8	Missense_Mutation	SNP	NULL	p.P759S	ENST00000400202.1	37	c.2275	CCDS13568.1	21	.	.	.	.	.	.	.	.	.	.	G	22.8	4.334212	0.81801	.	.	ENSG00000180530	ENST00000400199;ENST00000400202;ENST00000318948	T;T;T	0.11604	2.76;2.76;2.76	6.17	6.17	0.99709	.	0.229658	0.38164	N	0.001799	T	0.32041	0.0816	L	0.55481	1.735	0.48236	D	0.999612	D	0.89917	1.0	D	0.74674	0.984	T	0.00048	-1.2203	10	0.56958	D	0.05	-30.703	20.8794	0.99867	0.0:0.0:1.0:0.0	.	759	P48552	NRIP1_HUMAN	S	759	ENSP00000383060:P759S;ENSP00000383063:P759S;ENSP00000327213:P759S	ENSP00000327213:P759S	P	-	1	0	NRIP1	15260110	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.187000	0.77730	2.941000	0.99782	0.655000	0.94253	CCT	NRIP1	-	NULL	ENSG00000180530		0.413	NRIP1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	NRIP1	HGNC	protein_coding	OTTHUMT00000157926.1	421	0.00	0	G	NM_003489		16338239	16338239	-1	no_errors	ENST00000318948	ensembl	human	known	69_37n	missense	124	32.61	60	SNP	1.000	A
TENM1	10178	genome.wustl.edu	37	X	123680767	123680767	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chrX:123680767C>T	ENST00000371130.3	-	15	2671	c.2608G>A	c.(2608-2610)Gac>Aac	p.D870N	TENM1_ENST00000422452.2_Missense_Mutation_p.D870N	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	870					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										TGAGTACTGTCCTTGCCAATG	0.393																																						dbGAP											0													130.0	117.0	121.0					X																	123680767		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.2608G>A	X.37:g.123680767C>T	ENSP00000360171:p.Asp870Asn		B2RTR5|Q5JZ17	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EGF-like,pfscan_EG-like_dom,tigrfam_YD	p.D870N	ENST00000371130.3	37	c.2608	CCDS14609.1	X	.	.	.	.	.	.	.	.	.	.	C	18.29	3.590647	0.66219	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.85339	-1.97;-1.93	5.21	5.21	0.72293	.	0.140951	0.51477	D	0.000095	T	0.81470	0.4829	L	0.45352	1.415	0.58432	D	0.999996	B;B;B	0.27559	0.181;0.009;0.003	B;B;B	0.26969	0.075;0.007;0.002	T	0.78117	-0.2329	10	0.35671	T	0.21	.	17.789	0.88547	0.0:1.0:0.0:0.0	.	869;870;870	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	N	870	ENSP00000360171:D870N;ENSP00000403954:D870N	ENSP00000360171:D870N	D	-	1	0	ODZ1	123508448	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.317000	0.79018	2.389000	0.81357	0.594000	0.82650	GAC	ODZ1	-	NULL	ENSG00000009694		0.393	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ1	HGNC	protein_coding	OTTHUMT00000058985.1	468	0.00	0	C	NM_014253		123680767	123680767	-1	no_errors	ENST00000422452	ensembl	human	known	69_37n	missense	157	13.74	25	SNP	1.000	T
OR51G2	81282	genome.wustl.edu	37	11	4936757	4936757	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr11:4936757C>T	ENST00000322013.3	-	1	165	c.137G>A	c.(136-138)gGc>gAc	p.G46D	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001005238.1	NP_001005238.1	Q8NGK0	O51G2_HUMAN	olfactory receptor, family 51, subfamily G, member 2	46						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(1)|large_intestine(9)|lung(12)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGTGCAGTTGCCCGGGATGGA	0.502																																						dbGAP											0													87.0	81.0	83.0					11																	4936757		2201	4298	6499	-	-	-	SO:0001583	missense	0			AB065794	CCDS31365.1	11p15.4	2012-08-09			ENSG00000176893	ENSG00000176893		"""GPCR / Class A : Olfactory receptors"""	15198	protein-coding gene	gene with protein product							Standard	NM_001005238		Approved		uc001lzr.1	Q8NGK0	OTTHUMG00000066501	ENST00000322013.3:c.137G>A	11.37:g.4936757C>T	ENSP00000322593:p.Gly46Asp		Q6IFH7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.G46D	ENST00000322013.3	37	c.137	CCDS31365.1	11	.	.	.	.	.	.	.	.	.	.	C	14.37	2.515836	0.44763	.	.	ENSG00000176893	ENST00000322013	T	0.37915	1.17	5.49	5.49	0.81192	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46758	D	0.000262	T	0.58694	0.2140	H	0.98802	4.335	0.33852	D	0.632774	B	0.32467	0.372	B	0.31390	0.129	T	0.76830	-0.2814	10	0.72032	D	0.01	.	13.7758	0.63053	0.0:0.8462:0.1538:0.0	.	46	Q8NGK0	O51G2_HUMAN	D	46	ENSP00000322593:G46D	ENSP00000322593:G46D	G	-	2	0	OR51G2	4893333	0.911000	0.30947	0.583000	0.28640	0.950000	0.60333	2.648000	0.46647	2.860000	0.98153	0.655000	0.94253	GGC	OR51G2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000176893		0.502	OR51G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51G2	HGNC	protein_coding	OTTHUMT00000142174.1	170	0.00	0	C	NM_001005238		4936757	4936757	-1	no_errors	ENST00000322013	ensembl	human	known	69_37n	missense	61	40.38	42	SNP	0.684	T
P2RX3	5024	genome.wustl.edu	37	11	57114069	57114069	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr11:57114069G>C	ENST00000263314.2	+	2	205	c.171G>C	c.(169-171)gaG>gaC	p.E57D		NM_002559.3	NP_002550.2	P56373	P2RX3_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 3	57					behavioral response to pain (GO:0048266)|cation transmembrane transport (GO:0098655)|neuromuscular synaptic transmission (GO:0007274)|neuronal action potential (GO:0019228)|peristalsis (GO:0030432)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|regulation of synaptic plasticity (GO:0048167)|response to ATP (GO:0033198)|response to carbohydrate (GO:0009743)|response to cold (GO:0009409)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|sensory perception of taste (GO:0050909)|signal transduction (GO:0007165)|transport (GO:0006810)|urinary bladder smooth muscle contraction (GO:0014832)	dendritic spine (GO:0043197)|Golgi apparatus (GO:0005794)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|extracellular ATP-gated cation channel activity (GO:0004931)|purinergic nucleotide receptor activity (GO:0001614)			endometrium(4)|kidney(2)|large_intestine(4)|lung(15)|prostate(1)	26						CAGCCATTGAGTCCTCGGTGG	0.542																																						dbGAP											0													140.0	104.0	116.0					11																	57114069		2201	4296	6497	-	-	-	SO:0001583	missense	0			Y07683	CCDS7953.1	11q12	2012-01-17			ENSG00000109991	ENSG00000109991		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8534	protein-coding gene	gene with protein product		600843				9221902	Standard	NM_002559		Approved	P2X3	uc001nju.3	P56373	OTTHUMG00000167025	ENST00000263314.2:c.171G>C	11.37:g.57114069G>C	ENSP00000263314:p.Glu57Asp		Q6DK37|Q9UQB6	Missense_Mutation	SNP	pfam_P2X_purnocptor,prints_P2X3_purnocptor,prints_P2X_purnocptor,tigrfam_P2X_purnocptor	p.E57D	ENST00000263314.2	37	c.171	CCDS7953.1	11	.	.	.	.	.	.	.	.	.	.	G	17.71	3.457771	0.63401	.	.	ENSG00000109991	ENST00000439993;ENST00000263314	T	0.04862	3.54	4.66	2.74	0.32292	.	0.000000	0.85682	D	0.000000	T	0.22282	0.0537	M	0.80422	2.495	0.39488	D	0.967991	D	0.89917	1.0	D	0.91635	0.999	T	0.01545	-1.1328	10	0.72032	D	0.01	-33.076	8.6873	0.34245	0.1869:0.0:0.8131:0.0	.	57	P56373	P2RX3_HUMAN	D	57	ENSP00000263314:E57D	ENSP00000263314:E57D	E	+	3	2	P2RX3	56870645	1.000000	0.71417	1.000000	0.80357	0.794000	0.44872	1.628000	0.37060	1.180000	0.42898	0.561000	0.74099	GAG	P2RX3	-	pfam_P2X_purnocptor,tigrfam_P2X_purnocptor	ENSG00000109991		0.542	P2RX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RX3	HGNC	protein_coding	OTTHUMT00000392465.1	130	0.00	0	G	NM_002559		57114069	57114069	+1	no_errors	ENST00000263314	ensembl	human	known	69_37n	missense	30	38.78	19	SNP	1.000	C
PAFAH1B1	5048	genome.wustl.edu	37	17	2575983	2575983	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr17:2575983G>T	ENST00000397195.5	+	7	1054	c.603G>T	c.(601-603)atG>atT	p.M201I	PAFAH1B1_ENST00000572915.2_3'UTR|PAFAH1B1_ENST00000451360.2_Missense_Mutation_p.M30I	NM_000430.3	NP_000421.1			platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa)											endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(1)|skin(1)	11						TAGCCATCATGCCCAATGGAG	0.378																																						dbGAP											0													125.0	109.0	114.0					17																	2575983		2203	4300	6503	-	-	-	SO:0001583	missense	0			L25107	CCDS32528.1	17p13.3	2014-04-04	2010-02-10		ENSG00000007168	ENSG00000007168		"""WD repeat domain containing"""	8574	protein-coding gene	gene with protein product	"""lissencephaly-1"""	601545	"""platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit (45kD)"", ""Miller-Dieker syndrome chromosome region"", ""platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa"", ""platelet-activating factor acetylhydrolase, isoform Ib, subunit 1 (45kDa)"""	MDCR, MDS		8355785, 9063735	Standard	NM_000430		Approved	LIS1, PAFAH	uc002fuw.4	P43034	OTTHUMG00000177574	ENST00000397195.5:c.603G>T	17.37:g.2575983G>T	ENSP00000380378:p.Met201Ile			Missense_Mutation	SNP	pfam_WD40_repeat,pfam_LisH_dimerisation_subgr,superfamily_WD40_repeat_dom,smart_LisH_dimerisation,smart_WD40_repeat,pirsf_Dynein_regulator,pfscan_LisH_dimerisation,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.M201I	ENST00000397195.5	37	c.603	CCDS32528.1	17	.	.	.	.	.	.	.	.	.	.	G	9.379	1.072571	0.20147	.	.	ENSG00000007168	ENST00000397195;ENST00000397193;ENST00000451360	T;T	0.59083	0.29;0.29	5.1	5.1	0.69264	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.41351	0.1155	N	0.04203	-0.255	0.80722	D	1	B;B	0.34290	0.372;0.447	B;B	0.37422	0.14;0.249	T	0.50092	-0.8868	10	0.51188	T	0.08	.	17.8577	0.88771	0.0:0.0:1.0:0.0	.	30;201	B4DF38;P43034	.;LIS1_HUMAN	I	201;30;30	ENSP00000380378:M201I;ENSP00000395628:M30I	ENSP00000380377:M30I	M	+	3	0	PAFAH1B1	2522733	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.768000	0.98965	2.523000	0.85059	0.563000	0.77884	ATG	PAFAH1B1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_Dynein_regulator,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000007168		0.378	PAFAH1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAFAH1B1	HGNC	protein_coding	OTTHUMT00000437797.2	99	0.00	0	G	NM_000430		2575983	2575983	+1	no_errors	ENST00000397195	ensembl	human	known	69_37n	missense	37	15.91	7	SNP	1.000	T
PI4KAP1	728233	genome.wustl.edu	37	22	20383866	20383866	+	RNA	SNP	T	T	G			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr22:20383866T>G	ENST00000430523.3	-	0	2224					NR_003563.1		Q8N8J0	PI4P1_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha pseudogene 1						phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)												GAAGGTCCCCTCCTCAGTAGG	0.597																																						dbGAP											0																																										-	-	-			0					22q11.21	2007-08-14	2007-08-14			ENSG00000274602			33576	pseudogene	pseudogene							Standard	NR_003563		Approved		uc010gsg.2	Q8N8J0			22.37:g.20383866T>G				RNA	SNP	-	NULL	ENST00000430523.3	37	NULL		22																																																																																			PI4KAP1	-	-	ENSG00000215513		0.597	PI4KAP1-005	KNOWN	basic	processed_transcript	PI4KAP1	HGNC	pseudogene	OTTHUMT00000319534.5	10	0.00	0	T			20383866	20383866	-1	no_errors	ENST00000430523	ensembl	human	known	69_37n	rna	7	72.00	18	SNP	0.001	G
PPEF1	5475	genome.wustl.edu	37	X	18768068	18768068	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chrX:18768068C>T	ENST00000361511.4	+	7	888	c.394C>T	c.(394-396)Cag>Tag	p.Q132*	PPEF1_ENST00000359763.6_Intron|PPEF1_ENST00000544635.1_Nonsense_Mutation_p.Q67*|PPEF1_ENST00000349874.5_Nonsense_Mutation_p.Q132*|PPEF1_ENST00000471570.1_3'UTR|PPEF1_ENST00000543630.1_Nonsense_Mutation_p.Q132*	NM_006240.2|NM_152224.1	NP_006231.2|NP_689410.1	O14829	PPE1_HUMAN	protein phosphatase, EF-hand calcium binding domain 1	132	Catalytic.				detection of stimulus involved in sensory perception (GO:0050906)|phototransduction, visible light (GO:0007603)|protein dephosphorylation (GO:0006470)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)			breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	43	Hepatocellular(33;0.183)					CAAGGAACAACAGGTAAGTGG	0.428																																						dbGAP											0													141.0	123.0	129.0					X																	18768068		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC036026	CCDS14188.1, CCDS43920.1	Xp22	2013-01-10			ENSG00000086717	ENSG00000086717		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9243	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, alpha isozyme"""	300109		PPEF		9215685, 9326663	Standard	NM_152224		Approved	PPP7CA	uc004cyq.3	O14829	OTTHUMG00000021219	ENST00000361511.4:c.394C>T	X.37:g.18768068C>T	ENSP00000354871:p.Gln132*		A6NHP4|A8K348|O15253|Q9NU21|Q9UJH0	Nonsense_Mutation	SNP	pfam_Metallo_PEstase_dom,pfam_EF-hand,pfam_PPP_dom,pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,smart_Ser/Thr-sp_prot-phosphatase,smart_EF_hand_Ca-bd,pirsf_Ser/Thr-Pase_EF-hand_contain,pfscan_EF_HAND_2,pfscan_IQ_motif_EF-hand-BS,prints_Ser/Thr-sp_prot-phosphatase	p.Q132*	ENST00000361511.4	37	c.394	CCDS14188.1	X	.	.	.	.	.	.	.	.	.	.	C	19.78	3.891433	0.72524	.	.	ENSG00000086717	ENST00000361511;ENST00000349874;ENST00000543630;ENST00000472826;ENST00000544635	.	.	.	4.93	3.07	0.35406	.	0.291535	0.24818	N	0.035346	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.5885	9.1133	0.36741	0.421:0.579:0.0:0.0	.	.	.	.	X	132;132;132;42;67	.	ENSP00000341892:Q132X	Q	+	1	0	PPEF1	18677989	1.000000	0.71417	0.747000	0.31113	0.088000	0.18126	1.961000	0.40432	0.434000	0.26340	0.600000	0.82982	CAG	PPEF1	-	pfam_PPP_dom,pirsf_Ser/Thr-Pase_EF-hand_contain	ENSG00000086717		0.428	PPEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPEF1	HGNC	protein_coding	OTTHUMT00000055953.3	494	0.00	0	C	NM_006240		18768068	18768068	+1	no_errors	ENST00000361511	ensembl	human	known	69_37n	nonsense	147	39.26	95	SNP	0.747	T
RAD21	5885	genome.wustl.edu	37	8	117875465	117875466	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr8:117875465_117875466delAG	ENST00000297338.2	-	3	464_465	c.177_178delCT	c.(175-180)ctcttafs	p.LL59fs	RAD21_ENST00000523547.1_5'UTR	NM_006265.2	NP_006256.1	O60216	RAD21_HUMAN	RAD21 homolog (S. pombe)	59					apoptotic process (GO:0006915)|chromosome segregation (GO:0007059)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|protein localization to chromatin (GO:0071168)|reciprocal meiotic recombination (GO:0007131)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|stomach(1)	32	all_cancers(13;1.21e-21)|Lung NSC(37;0.000134)|Ovarian(258;0.0172)					ACTCCCAGTAAGAGATGTCCTG	0.371																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC050381	CCDS6321.1	8q24.11	2014-09-17	2001-11-28		ENSG00000164754	ENSG00000164754			9811	protein-coding gene	gene with protein product	"""sister chromatid cohesion 1"""	606462	"""RAD21 (S. pombe) homolog"""			8812457	Standard	NM_006265		Approved	KIAA0078, hHR21, SCC1	uc003yod.3	O60216	OTTHUMG00000164959	ENST00000297338.2:c.177_178delCT	8.37:g.117875467_117875468delAG	ENSP00000297338:p.Leu59fs		A8K0E0|Q15001|Q99568	Frame_Shift_Del	DEL	pfam_Rad21_Rec8_N,pfam_Rad21/Rec8_C_eu,pfam_ScpA	p.L60fs	ENST00000297338.2	37	c.178_177	CCDS6321.1	8																																																																																			RAD21	-	pfam_Rad21_Rec8_N	ENSG00000164754		0.371	RAD21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD21	HGNC	protein_coding	OTTHUMT00000381184.1	445	0.00	0	AG	NM_006265		117875465	117875466	-1	no_errors	ENST00000297338	ensembl	human	known	69_37n	frame_shift_del	293	23.10	88	DEL	1.000:0.978	-
SEPT10	151011	genome.wustl.edu	37	2	110301779	110301779	+	3'UTR	SNP	A	A	C	rs200598502	byFrequency	TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr2:110301779A>C	ENST00000397712.2	-	0	1850				SEPT10_ENST00000334001.6_3'UTR|SEPT10_ENST00000356688.4_Missense_Mutation_p.F519V|SEPT10_ENST00000397714.2_3'UTR|SEPT10_ENST00000468616.1_5'Flank	NM_144710.3	NP_653311.1	Q9P0V9	SEP10_HUMAN	septin 10						cell cycle (GO:0007049)|cell division (GO:0051301)	septin complex (GO:0031105)	GTP binding (GO:0005525)			breast(2)|endometrium(3)|large_intestine(4)|lung(8)|prostate(1)	18						TGTTCACCAAATATAGAAGTG	0.338																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF146760	CCDS42726.1, CCDS46383.1	2q13	2013-01-21			ENSG00000186522	ENSG00000186522		"""Septins"""	14349	protein-coding gene	gene with protein product	"""sept1-like"""	611737				12711328	Standard	NM_144710		Approved	FLJ11619	uc002tew.4	Q9P0V9	OTTHUMG00000154957	ENST00000397712.2:c.*107T>G	2.37:g.110301779A>C			B3KRQ9|Q86VP5|Q9HAH6	Missense_Mutation	SNP	pfam_Cell_div_GTP-bd	p.F519V	ENST00000397712.2	37	c.1555	CCDS46383.1	2	.	.	.	.	.	.	.	.	.	.	A	8.972	0.973228	0.18736	.	.	ENSG00000186522	ENST00000356688	T	0.54279	0.58	5.37	1.66	0.24008	.	1.901300	0.02724	N	0.114273	T	0.40645	0.1125	.	.	.	0.20638	N	0.999879	B	0.06786	0.001	B	0.08055	0.003	T	0.31194	-0.9952	9	0.87932	D	0	.	2.1719	0.03852	0.5923:0.1635:0.0874:0.1567	.	519	B5ME97	.	V	519	ENSP00000349116:F519V	ENSP00000349116:F519V	F	-	1	0	SEPT10	109659068	0.087000	0.21565	0.491000	0.27477	0.028000	0.11728	0.685000	0.25378	0.099000	0.17552	0.482000	0.46254	TTT	SEPT10	-	NULL	ENSG00000186522		0.338	SEPT10-001	KNOWN	basic|CCDS	protein_coding	SEPT10	HGNC	protein_coding	OTTHUMT00000337804.1	68	0.00	0	A	NM_144710		110301779	110301779	-1	no_errors	ENST00000356688	ensembl	human	putative	69_37n	missense	15	28.57	6	SNP	0.348	C
SERPINB7	8710	genome.wustl.edu	37	18	61471507	61471507	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr18:61471507T>A	ENST00000398019.2	+	8	1106	c.781T>A	c.(781-783)Tgg>Agg	p.W261R	SERPINB7_ENST00000540675.1_Missense_Mutation_p.W244R|SERPINB7_ENST00000546027.1_Missense_Mutation_p.W261R|SERPINB7_ENST00000336429.2_Missense_Mutation_p.W261R	NM_003784.3	NP_003775.1	O75635	SPB7_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 7	261					negative regulation of endopeptidase activity (GO:0010951)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of glomerular mesangial cell proliferation (GO:0072126)|positive regulation of platelet-derived growth factor production (GO:0090362)|positive regulation of transforming growth factor beta1 production (GO:0032914)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(14)|prostate(1)|skin(3)	27		Esophageal squamous(42;0.129)				TCTAATGGAATGGACCAATCC	0.318																																						dbGAP											0													42.0	41.0	41.0					18																	61471507		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF027866	CCDS11988.1, CCDS58633.1	18q21.33	2014-02-18	2005-08-18		ENSG00000166396	ENSG00000166396		"""Serine (or cysteine) peptidase inhibitors"""	13902	protein-coding gene	gene with protein product		603357	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 7"""			24172014	Standard	NM_003784		Approved	MEGSIN	uc002ljl.4	O75635	OTTHUMG00000060591	ENST00000398019.2:c.781T>A	18.37:g.61471507T>A	ENSP00000381101:p.Trp261Arg		B4DUW8|F5GZC0|Q1ED45|Q3KPG4	Missense_Mutation	SNP	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	p.W261R	ENST00000398019.2	37	c.781	CCDS11988.1	18	.	.	.	.	.	.	.	.	.	.	T	20.3	3.967559	0.74131	.	.	ENSG00000166396	ENST00000336429;ENST00000398019;ENST00000540675;ENST00000546027	D;D;D;D	0.86366	-2.11;-2.11;-2.11;-2.11	5.92	5.92	0.95590	Serpin domain (3);	0.000000	0.64402	D	0.000012	D	0.94324	0.8176	M	0.92649	3.33	0.43913	D	0.996553	D;D	0.89917	1.0;1.0	D;D	0.83275	0.994;0.996	D	0.94957	0.8105	10	0.87932	D	0	.	9.9523	0.41647	0.0:0.0749:0.0:0.9251	.	244;261	F5GZC0;O75635	.;SPB7_HUMAN	R	261;261;244;261	ENSP00000337212:W261R;ENSP00000381101:W261R;ENSP00000444572:W244R;ENSP00000444861:W261R	ENSP00000337212:W261R	W	+	1	0	SERPINB7	59622487	1.000000	0.71417	0.943000	0.38184	0.988000	0.76386	7.540000	0.82074	2.263000	0.75096	0.533000	0.62120	TGG	SERPINB7	-	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	ENSG00000166396		0.318	SERPINB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB7	HGNC	protein_coding	OTTHUMT00000134007.1	218	0.00	0	T	NM_003784		61471507	61471507	+1	no_errors	ENST00000336429	ensembl	human	known	69_37n	missense	68	62.84	115	SNP	0.992	A
SETX	23064	genome.wustl.edu	37	9	135211712	135211712	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr9:135211712T>C	ENST00000224140.5	-	6	871	c.689A>G	c.(688-690)gAt>gGt	p.D230G	SETX_ENST00000372169.2_Missense_Mutation_p.D230G|SETX_ENST00000393220.1_Missense_Mutation_p.D230G	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	230					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		GTTGGTAGTATCATACATGTG	0.358																																						dbGAP											0													79.0	74.0	75.0					9																	135211712		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.689A>G	9.37:g.135211712T>C	ENSP00000224140:p.Asp230Gly		A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Missense_Mutation	SNP	NULL	p.D230G	ENST00000224140.5	37	c.689	CCDS6947.1	9	.	.	.	.	.	.	.	.	.	.	T	24.0	4.479471	0.84747	.	.	ENSG00000107290	ENST00000224140;ENST00000372169;ENST00000393220	T;T;T	0.63913	-0.07;-0.07;-0.07	6.04	6.04	0.98038	.	0.058476	0.64402	D	0.000004	T	0.68274	0.2983	L	0.29908	0.895	0.44668	D	0.997655	D	0.76494	0.999	D	0.63381	0.914	T	0.71354	-0.4618	10	0.66056	D	0.02	.	15.765	0.78120	0.0:0.0:0.0:1.0	.	230	Q7Z333	SETX_HUMAN	G	230	ENSP00000224140:D230G;ENSP00000361242:D230G;ENSP00000376913:D230G	ENSP00000224140:D230G	D	-	2	0	SETX	134201533	1.000000	0.71417	0.992000	0.48379	0.992000	0.81027	6.179000	0.71974	2.319000	0.78375	0.528000	0.53228	GAT	SETX	-	NULL	ENSG00000107290		0.358	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETX	HGNC	protein_coding	OTTHUMT00000054774.3	278	0.00	0	T	NM_015046		135211712	135211712	-1	no_errors	ENST00000372169	ensembl	human	known	69_37n	missense	104	32.90	51	SNP	0.996	C
SIGLEC9	27180	genome.wustl.edu	37	19	51629052	51629052	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr19:51629052A>G	ENST00000250360.3	+	2	687	c.620A>G	c.(619-621)cAt>cGt	p.H207R	SIGLEC9_ENST00000440804.3_Missense_Mutation_p.H207R	NM_014441.2	NP_055256.1	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9	207	Ig-like C2-type 1.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(3)|lung(25)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	45		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		CCCCAGGACCATGGCACCAGC	0.652																																						dbGAP											0													73.0	70.0	71.0					19																	51629052		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF135027	CCDS12825.1, CCDS56100.1	19q13.3-q13.4	2013-01-29			ENSG00000129450	ENSG00000129450		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10878	protein-coding gene	gene with protein product		605640				10903842	Standard	NM_014441		Approved	CD329	uc002pvu.3	Q9Y336		ENST00000250360.3:c.620A>G	19.37:g.51629052A>G	ENSP00000250360:p.His207Arg		Q6GTU4|Q9BYI9	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like	p.H207R	ENST00000250360.3	37	c.620	CCDS12825.1	19	.	.	.	.	.	.	.	.	.	.	.	15.64	2.894434	0.52121	.	.	ENSG00000129450	ENST00000440804;ENST00000250360	T;T	0.02787	4.16;4.16	2.72	2.72	0.32119	Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.171096	0.27659	N	0.018393	T	0.12092	0.0294	M	0.81179	2.53	0.24235	N	0.995386	D	0.76494	0.999	D	0.77557	0.99	T	0.02004	-1.1231	10	0.66056	D	0.02	.	6.9205	0.24385	1.0:0.0:0.0:0.0	.	207	Q9Y336	SIGL9_HUMAN	R	207	ENSP00000413861:H207R;ENSP00000250360:H207R	ENSP00000250360:H207R	H	+	2	0	SIGLEC9	56320864	0.688000	0.27680	0.616000	0.29078	0.867000	0.49689	3.853000	0.55941	1.102000	0.41551	0.421000	0.28195	CAT	SIGLEC9	-	pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like	ENSG00000129450		0.652	SIGLEC9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SIGLEC9	HGNC	protein_coding	OTTHUMT00000464224.1	162	0.00	0	A	NM_014441		51629052	51629052	+1	no_errors	ENST00000440804	ensembl	human	known	69_37n	missense	38	35.59	21	SNP	0.668	G
SLC15A4	121260	genome.wustl.edu	37	12	129285502	129285502	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr12:129285502C>A	ENST00000266771.5	-	6	1350	c.1311G>T	c.(1309-1311)caG>caT	p.Q437H	SLC15A4_ENST00000544112.1_Missense_Mutation_p.Q100H|SLC15A4_ENST00000545031.1_5'UTR	NM_145648.3	NP_663623.1	Q8N697	S15A4_HUMAN	solute carrier family 15 (oligopeptide transporter), member 4	437					ion transport (GO:0006811)|oligopeptide transport (GO:0006857)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	L-histidine transmembrane transporter activity (GO:0005290)|symporter activity (GO:0015293)			endometrium(4)|kidney(2)|large_intestine(4)|lung(11)|skin(1)	22	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.69e-06)|Epithelial(86;1.17e-05)|all cancers(50;5.07e-05)		TGCCGATGGTCTGATTAATGG	0.423																																						dbGAP											0													124.0	111.0	115.0					12																	129285502		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY038999	CCDS9264.1	12q24.32	2013-07-18	2013-07-18		ENSG00000139370	ENSG00000139370		"""Solute carriers"""	23090	protein-coding gene	gene with protein product		615806	"""solute carrier family 15, member 4"""			11741232	Standard	NM_145648		Approved	PHT1, PTR4	uc001uhu.2	Q8N697	OTTHUMG00000168415	ENST00000266771.5:c.1311G>T	12.37:g.129285502C>A	ENSP00000266771:p.Gln437His		A6H8Y9|B3KTK1|Q71M34|Q7Z5F8|Q8TAH0	Missense_Mutation	SNP	pfam_Oligopeptide_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.Q437H	ENST00000266771.5	37	c.1311	CCDS9264.1	12	.	.	.	.	.	.	.	.	.	.	C	16.68	3.191805	0.58017	.	.	ENSG00000139370	ENST00000266771;ENST00000544112	T;T	0.04502	3.61;3.61	5.49	3.68	0.42216	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	T	0.18759	0.0450	M	0.79011	2.435	0.58432	D	0.999999	D	0.69078	0.997	D	0.72075	0.976	T	0.00531	-1.1686	10	0.35671	T	0.21	.	11.8447	0.52376	0.0:0.8585:0.0:0.1415	.	437	Q8N697	S15A4_HUMAN	H	437;100	ENSP00000266771:Q437H;ENSP00000439946:Q100H	ENSP00000266771:Q437H	Q	-	3	2	SLC15A4	127851455	1.000000	0.71417	0.999000	0.59377	0.182000	0.23217	4.394000	0.59671	0.688000	0.31529	0.650000	0.86243	CAG	SLC15A4	-	pfam_Oligopeptide_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000139370		0.423	SLC15A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC15A4	HGNC	protein_coding	OTTHUMT00000399663.1	79	0.00	0	C	NM_145648		129285502	129285502	-1	no_errors	ENST00000266771	ensembl	human	known	69_37n	missense	40	31.03	18	SNP	1.000	A
SLC20A1	6574	genome.wustl.edu	37	2	113405016	113405016	+	Silent	SNP	C	C	T			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr2:113405016C>T	ENST00000272542.3	+	3	989	c.450C>T	c.(448-450)gtC>gtT	p.V150V	AC079922.3_ENST00000457336.1_lincRNA	NM_005415.4	NP_005406.3	Q8WUM9	S20A1_HUMAN	solute carrier family 20 (phosphate transporter), member 1	150					ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	high-affinity inorganic phosphate:sodium symporter activity (GO:0005316)|inorganic phosphate transmembrane transporter activity (GO:0005315)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|sodium:phosphate symporter activity (GO:0005436)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|skin(1)|urinary_tract(3)	28						AGGAGGGTGTCAAGTGGTCTG	0.428																																						dbGAP											0													189.0	196.0	194.0					2																	113405016		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2099.1	2q13	2013-05-22			ENSG00000144136	ENSG00000144136		"""Solute carriers"""	10946	protein-coding gene	gene with protein product	"""gibbon ape leukemia virus receptor 1"""	137570		GLVR1		8041748	Standard	NM_005415		Approved	PiT-1, Glvr-1	uc002tib.3	Q8WUM9	OTTHUMG00000131317	ENST00000272542.3:c.450C>T	2.37:g.113405016C>T			Q08344|Q6DHX8|Q9UQ82	Silent	SNP	pfam_Phos_transporter	p.V150	ENST00000272542.3	37	c.450	CCDS2099.1	2																																																																																			SLC20A1	-	pfam_Phos_transporter	ENSG00000144136		0.428	SLC20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC20A1	HGNC	protein_coding	OTTHUMT00000254086.2	292	0.00	0	C	NM_005415		113405016	113405016	+1	no_errors	ENST00000272542	ensembl	human	known	69_37n	silent	67	30.21	29	SNP	1.000	T
STIM2	57620	genome.wustl.edu	37	4	27009202	27009202	+	Silent	SNP	C	C	T			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr4:27009202C>T	ENST00000467011.1	+	8	1454	c.1029C>T	c.(1027-1029)agC>agT	p.S343S	STIM2_ENST00000412829.2_Silent_p.S430S|STIM2_ENST00000465503.1_Silent_p.S343S|STIM2_ENST00000382009.3_Silent_p.S430S|STIM2_ENST00000237364.5_Silent_p.S430S|STIM2_ENST00000467087.1_Silent_p.S343S	NM_001169117.1	NP_001162588	Q9P246	STIM2_HUMAN	stromal interaction molecule 2	343					activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|positive regulation of calcium ion transport (GO:0051928)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|store-operated calcium channel activity (GO:0015279)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	25		Breast(46;0.0503)				AACTGAGAAGCAGTTGGTCTG	0.423																																						dbGAP											0													69.0	68.0	69.0					4																	27009202		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB040915	CCDS3440.1, CCDS3440.2, CCDS54751.1, CCDS54752.1	4p15.2	2013-01-10			ENSG00000109689	ENSG00000109689		"""Sterile alpha motif (SAM) domain containing"""	19205	protein-coding gene	gene with protein product		610841				11463338	Standard	NM_020860		Approved		uc003gsh.4	Q9P246	OTTHUMG00000097805	ENST00000467011.1:c.1029C>T	4.37:g.27009202C>T			A6H8L7|B7ZVY0|Q96BF1|Q9BQH2|Q9H8R1	Silent	SNP	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,pfscan_SAM	p.S430	ENST00000467011.1	37	c.1290	CCDS54752.1	4																																																																																			STIM2	-	NULL	ENSG00000109689		0.423	STIM2-003	NOVEL	basic|exp_conf|CCDS	protein_coding	STIM2	HGNC	protein_coding	OTTHUMT00000356861.1	162	0.00	0	C	NM_020860		27009202	27009202	+1	no_errors	ENST00000382009	ensembl	human	known	69_37n	silent	40	24.53	13	SNP	1.000	T
STOX2	56977	genome.wustl.edu	37	4	184932355	184932355	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr4:184932355G>T	ENST00000308497.4	+	3	3799	c.2364G>T	c.(2362-2364)aaG>aaT	p.K788N	STOX2_ENST00000438269.1_Missense_Mutation_p.K788N	NM_020225.1	NP_064610.1	Q9P2F5	STOX2_HUMAN	storkhead box 2	788					embryo development (GO:0009790)|maternal placenta development (GO:0001893)					breast(1)|endometrium(7)|lung(6)	14		all_lung(41;1.89e-12)|Lung NSC(41;3.48e-12)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|all_hematologic(60;0.027)|Prostate(90;0.0283)		all cancers(43;2.85e-26)|Epithelial(43;2.27e-22)|OV - Ovarian serous cystadenocarcinoma(60;3.4e-10)|Colorectal(24;8.23e-06)|GBM - Glioblastoma multiforme(59;1.64e-05)|STAD - Stomach adenocarcinoma(60;3.6e-05)|COAD - Colon adenocarcinoma(29;4.37e-05)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.227)		GGGCAAACAAGAACACAGAGG	0.507																																						dbGAP											0													45.0	49.0	48.0					4																	184932355		1999	4172	6171	-	-	-	SO:0001583	missense	0			AB037813	CCDS47167.1	4q35.1	2014-09-11			ENSG00000173320	ENSG00000173320			25450	protein-coding gene	gene with protein product							Standard	XM_005263142		Approved	DKFZp762K222	uc003ivz.1	Q9P2F5	OTTHUMG00000160618	ENST00000308497.4:c.2364G>T	4.37:g.184932355G>T	ENSP00000311257:p.Lys788Asn		A6H8U4|Q9NPS8	Nonsense_Mutation	SNP	NULL	p.E144*	ENST00000308497.4	37	c.430	CCDS47167.1	4	.	.	.	.	.	.	.	.	.	.	G	14.19	2.462021	0.43736	.	.	ENSG00000173320	ENST00000308497;ENST00000438269	T;T	0.79653	-0.32;-1.29	5.65	-5.05	0.02955	.	0.097324	0.64402	D	0.000001	T	0.65407	0.2688	L	0.29908	0.895	0.28719	N	0.903105	P;B	0.46784	0.884;0.267	B;B	0.40940	0.344;0.058	T	0.65038	-0.6265	10	0.16420	T	0.52	-26.1857	16.6529	0.85221	0.3102:0.0:0.6898:0.0	.	788;788	Q9P2F5-2;Q9P2F5	.;STOX2_HUMAN	N	788	ENSP00000311257:K788N;ENSP00000390127:K788N	ENSP00000311257:K788N	K	+	3	2	STOX2	185169349	0.989000	0.36119	0.023000	0.16930	0.946000	0.59487	0.361000	0.20267	-0.942000	0.03695	-0.150000	0.13652	AAG	STOX2	-	NULL	ENSG00000173320		0.507	STOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STOX2	HGNC	protein_coding	OTTHUMT00000361433.3	127	0.78	1	G	NM_020225		184932355	184932355	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000506529	ensembl	human	known	69_37n	nonsense	24	27.27	9	SNP	0.231	T
TONSL	4796	genome.wustl.edu	37	8	145667517	145667518	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr8:145667517_145667518insC	ENST00000409379.3	-	7	796_797	c.767_768insG	c.(766-768)ggafs	p.G256fs	AC084125.4_ENST00000442850.1_RNA	NM_013432.4	NP_038460.4	Q96HA7	TONSL_HUMAN	tonsoku-like, DNA repair protein	256					cytoplasmic sequestering of transcription factor (GO:0042994)|double-strand break repair via homologous recombination (GO:0000724)|regulation of RNA biosynthetic process (GO:2001141)|replication fork processing (GO:0031297)	cytoplasm (GO:0005737)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|lung(14)|ovary(3)|prostate(1)|skin(1)	26						CCAAAAAGTCTCCCAGGTCTTG	0.594																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS34968.2	8q24.3	2013-01-10	2010-12-02	2010-11-30	ENSG00000160949	ENSG00000160949		"""Ankyrin repeat domain containing"""	7801	protein-coding gene	gene with protein product		604546	"""nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2"""	NFKBIL2		7738005, 11246458	Standard	NM_013432		Approved	IKBR	uc011llg.2	Q96HA7	OTTHUMG00000153122	ENST00000409379.3:c.768dupG	8.37:g.145667520_145667520dupC	ENSP00000386239:p.Gly256fs		B5MDP0|C9JKB1|C9JNV8|Q13006|Q9UGJ2	Frame_Shift_Ins	INS	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_TPR_repeat,smart_Ankyrin_rpt,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR-contain_dom,prints_Ankyrin_rpt	p.D257fs	ENST00000409379.3	37	c.768_767	CCDS34968.2	8																																																																																			TONSL	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000160949		0.594	TONSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TONSL	HGNC	protein_coding	OTTHUMT00000329668.2	15	0.00	0	-	NM_013432		145667517	145667518	-1	no_errors	ENST00000409379	ensembl	human	known	69_37n	frame_shift_ins	4	33.33	2	INS	0.993:1.000	C
TP63	8626	genome.wustl.edu	37	3	189582203	189582203	+	Silent	SNP	C	C	T			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr3:189582203C>T	ENST00000264731.3	+	5	851	c.762C>T	c.(760-762)aaC>aaT	p.N254N	TP63_ENST00000449992.1_Silent_p.N75N|TP63_ENST00000320472.5_Silent_p.N254N|TP63_ENST00000440651.2_Silent_p.N254N|TP63_ENST00000392461.3_Silent_p.N160N|TP63_ENST00000456148.1_Silent_p.N160N|TP63_ENST00000382063.4_Silent_p.N169N|TP63_ENST00000418709.2_Silent_p.N254N|TP63_ENST00000392463.2_Silent_p.N160N|TP63_ENST00000354600.5_Silent_p.N160N|TP63_ENST00000437221.1_Silent_p.N160N|TP63_ENST00000392460.3_Silent_p.N254N	NM_001114978.1|NM_003722.4	NP_001108450.1|NP_003713.3	Q9H3D4	P63_HUMAN	tumor protein p63	254					apoptotic process (GO:0006915)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|cloacal septation (GO:0060197)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|ectoderm and mesoderm interaction (GO:0007499)|embryonic limb morphogenesis (GO:0030326)|epidermal cell division (GO:0010481)|epithelial cell development (GO:0002064)|establishment of planar polarity (GO:0001736)|establishment of skin barrier (GO:0061436)|female genitalia morphogenesis (GO:0048807)|hair follicle morphogenesis (GO:0031069)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organismal aging (GO:0010259)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular senescence (GO:2000773)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mesoderm development (GO:2000381)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|polarized epithelial cell differentiation (GO:0030859)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle G1/S phase transition (GO:1902808)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-anal tail morphogenesis (GO:0036342)|prostatic bud formation (GO:0060513)|protein homotetramerization (GO:0051289)|proximal/distal pattern formation (GO:0009954)|regulation of epidermal cell division (GO:0010482)|regulation of neuron apoptotic process (GO:0043523)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|skeletal system development (GO:0001501)|smooth muscle tissue development (GO:0048745)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|sympathetic nervous system development (GO:0048485)|urinary bladder development (GO:0060157)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|WW domain binding (GO:0050699)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(5)|large_intestine(12)|lung(15)|ovary(2)|skin(9)|upper_aerodigestive_tract(6)	61	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		GTGAATTCAACGAGGGTAAGC	0.498										HNSCC(45;0.13)																												dbGAP											0													57.0	57.0	57.0					3																	189582203		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB010153	CCDS3293.1, CCDS46976.1, CCDS46977.1, CCDS46978.1, CCDS46979.1, CCDS46980.1	3q27-q29	2014-09-17			ENSG00000073282	ENSG00000073282			15979	protein-coding gene	gene with protein product		603273	"""tumor protein p73-like"", ""tumor protein p53-like"", ""tumor protein p53-competing protein"""	TP73L, TP53L, TP53CP		9774969, 9662378, 11181441, 11181451	Standard	NM_003722		Approved	p51, SHFM4, EEC3, p63, p73L, OFC8, KET, p73H, NBP, p53CP	uc003fry.2	Q9H3D4	OTTHUMG00000156313	ENST00000264731.3:c.762C>T	3.37:g.189582203C>T			O75080|O75195|O75922|O76078|Q6VEG2|Q6VEG3|Q6VEG4|Q6VFJ1|Q6VFJ2|Q6VFJ3|Q6VH20|Q7LDI3|Q7LDI4|Q7LDI5|Q96KR0|Q9H3D2|Q9H3D3|Q9H3P8|Q9NPH7|Q9P1B4|Q9P1B5|Q9P1B6|Q9P1B7|Q9UBV9|Q9UE10|Q9UP26|Q9UP27|Q9UP28|Q9UP74	Silent	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_SAM_2,superfamily_p53-like_TF_DNA-bd,superfamily_SAM/pointed,superfamily_p53_tetrameristn,smart_SAM,prints_p53_tumour_suppressor	p.N254	ENST00000264731.3	37	c.762	CCDS3293.1	3																																																																																			TP63	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000073282		0.498	TP63-001	KNOWN	basic|CCDS	protein_coding	TP63	HGNC	protein_coding	OTTHUMT00000343865.1	307	0.00	0	C	NM_003722		189582203	189582203	+1	no_errors	ENST00000264731	ensembl	human	known	69_37n	silent	55	43.88	43	SNP	0.236	T
USPL1	10208	genome.wustl.edu	37	13	31232560	31232561	+	Frame_Shift_Ins	INS	-	-	G	rs202071439		TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr13:31232560_31232561insG	ENST00000255304.4	+	9	2688_2689	c.2346_2347insG	c.(2347-2349)atafs	p.I783fs		NM_005800.4	NP_005791.3	Q5W0Q7	USPL1_HUMAN	ubiquitin specific peptidase like 1	783					Cajal body organization (GO:0030576)|cell proliferation (GO:0008283)|protein desumoylation (GO:0016926)	Cajal body (GO:0015030)|extracellular space (GO:0005615)	SUMO binding (GO:0032183)|SUMO-specific isopeptidase activity (GO:0070140)			breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(15)|pancreas(3)|skin(3)	34		Lung SC(185;0.0257)|Breast(139;0.203)		all cancers(112;0.0306)|Epithelial(112;0.131)|OV - Ovarian serous cystadenocarcinoma(117;0.134)		ATAGAAACACTATAACTGATTT	0.386																																					Ovarian(60;318 1180 1554 28110 31601)	dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			X59131	CCDS9336.1	13q12-q14	2012-11-14	2005-11-24	2005-11-24	ENSG00000132952	ENSG00000132952			20294	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 22"""	C13orf22		22878415	Standard	NM_005800		Approved	bA121O19.1, D13S106E	uc001utc.2	Q5W0Q7	OTTHUMG00000016675	Exception_encountered	13.37:g.31232560_31232561insG	ENSP00000255304:p.Ile783fs		Q14109|Q6AI45|Q8IY30|Q8IYE8	Frame_Shift_Ins	INS	pfscan_Peptidase_C19	p.I782fs	ENST00000255304.4	37	c.2346_2347	CCDS9336.1	13																																																																																			USPL1	-	NULL	ENSG00000132952		0.386	USPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USPL1	HGNC	protein_coding	OTTHUMT00000044369.1	212	0.00	0	-	NM_005800		31232560	31232561	+1	no_errors	ENST00000255304	ensembl	human	known	69_37n	frame_shift_ins	94	35.62	52	INS	0.000:0.000	G
WDR66	144406	genome.wustl.edu	37	12	122437780	122437780	+	Silent	SNP	C	C	T			TCGA-A8-A07P-01A-11W-A019-09	TCGA-A8-A07P-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2b88ff64-bf43-43e8-9ea9-0de571520d72	43c44bf2-cb01-4747-8481-ce0c65be4863	g.chr12:122437780C>T	ENST00000288912.4	+	20	4019	c.3165C>T	c.(3163-3165)ctC>ctT	p.L1055L		NM_144668.5	NP_653269.3	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	1055							calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(13)|ovary(2)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		TTGAGGTGCTCGGTTATACCA	0.448																																					Esophageal Squamous(85;849 1794 49757 52143)	dbGAP											0													101.0	95.0	97.0					12																	122437780		1897	4127	6024	-	-	-	SO:0001819	synonymous_variant	0			AL833930	CCDS41853.1, CCDS53840.1	12q24.31	2014-07-31			ENSG00000158023	ENSG00000158023		"""WD repeat domain containing"""	28506	protein-coding gene	gene with protein product						17967944	Standard	NM_001178003		Approved	MGC33630, CaM-IP4	uc009zxk.3	Q8TBY9	OTTHUMG00000168948	ENST00000288912.4:c.3165C>T	12.37:g.122437780C>T			C9J1W2|Q8IYA3|Q8N898|Q8NDE7	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.L1055	ENST00000288912.4	37	c.3165	CCDS41853.1	12																																																																																			WDR66	-	NULL	ENSG00000158023		0.448	WDR66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR66	HGNC	protein_coding	OTTHUMT00000401700.1	116	0.00	0	C	NM_144668		122437780	122437780	+1	no_errors	ENST00000288912	ensembl	human	known	69_37n	silent	77	28.04	30	SNP	0.444	T
