#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABAT	18	genome.wustl.edu	37	16	8860107	8860107	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr16:8860107G>A	ENST00000396600.2	+	9	1521	c.583G>A	c.(583-585)Gag>Aag	p.E195K	ABAT_ENST00000567812.1_Missense_Mutation_p.E210K|ABAT_ENST00000569156.1_Missense_Mutation_p.E195K|ABAT_ENST00000268251.8_Missense_Mutation_p.E195K|ABAT_ENST00000425191.2_Missense_Mutation_p.E195K	NM_000663.4	NP_000654.2	P80404	GABT_HUMAN	4-aminobutyrate aminotransferase	195					behavioral response to cocaine (GO:0048148)|copulation (GO:0007620)|gamma-aminobutyric acid catabolic process (GO:0009450)|locomotory behavior (GO:0007626)|negative regulation of blood pressure (GO:0045776)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to iron ion (GO:0010039)|response to nicotine (GO:0035094)|synaptic transmission (GO:0007268)	4-aminobutyrate transaminase complex (GO:0032144)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	(S)-3-amino-2-methylpropionate transaminase activity (GO:0047298)|4-aminobutyrate transaminase activity (GO:0003867)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|succinate-semialdehyde dehydrogenase binding (GO:0032145)			breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	26					L-Alanine(DB00160)|Phenelzine(DB00780)|Pyruvic acid(DB00119)|Valproic Acid(DB00313)|Vigabatrin(DB01080)	GGAGGAGCTGGAGACGTGCAT	0.567																																						dbGAP											0													68.0	65.0	66.0					16																	8860107		2197	4300	6497	-	-	-	SO:0001583	missense	0			L32961	CCDS10534.1	16p13.2	2011-01-10			ENSG00000183044	ENSG00000183044	2.6.1.19		23	protein-coding gene	gene with protein product	"""4-aminobutyrate transaminase"""	137150				7721088	Standard	NM_020686		Approved	GABAT	uc002czc.4	P80404	OTTHUMG00000048201	ENST00000396600.2:c.583G>A	16.37:g.8860107G>A	ENSP00000379845:p.Glu195Lys		A8K386|Q16260|Q8N5W2|Q96BG2|Q99800	Missense_Mutation	SNP	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase_major_dom,tigrfam_4NH2But_aminotransferase_euk	p.E195K	ENST00000396600.2	37	c.583	CCDS10534.1	16	.	.	.	.	.	.	.	.	.	.	G	15.49	2.847598	0.51164	.	.	ENSG00000183044	ENST00000268251;ENST00000396600;ENST00000425191	T;T;T	0.76316	-1.01;-1.01;-1.01	5.0	5.0	0.66597	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.276244	0.42053	D	0.000766	T	0.73273	0.3566	L	0.47016	1.485	0.45330	D	0.99832	B	0.22983	0.078	B	0.26310	0.068	T	0.68618	-0.5361	10	0.26408	T	0.33	-16.6474	17.3467	0.87311	0.0:0.0:1.0:0.0	.	195	P80404	GABT_HUMAN	K	195	ENSP00000268251:E195K;ENSP00000379845:E195K;ENSP00000411916:E195K	ENSP00000268251:E195K	E	+	1	0	ABAT	8767608	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.694000	0.68272	2.333000	0.79357	0.555000	0.69702	GAG	ABAT	-	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase_major_dom,tigrfam_4NH2But_aminotransferase_euk	ENSG00000183044		0.567	ABAT-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ABAT	HGNC	protein_coding	OTTHUMT00000433620.2	42	0.00	0	G	NM_020686		8860107	8860107	+1	no_errors	ENST00000268251	ensembl	human	known	69_37n	missense	66	28.26	26	SNP	1.000	A
AMBRA1	55626	genome.wustl.edu	37	11	46430198	46430198	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr11:46430198G>A	ENST00000458649.2	-	17	3686	c.3268C>T	c.(3268-3270)Ctt>Ttt	p.L1090F	AMBRA1_ENST00000533727.1_Missense_Mutation_p.L971F|AMBRA1_ENST00000426438.1_Missense_Mutation_p.L1061F|AMBRA1_ENST00000528950.1_Missense_Mutation_p.L1061F|AMBRA1_ENST00000298834.3_Missense_Mutation_p.L1030F|AMBRA1_ENST00000314845.3_Missense_Mutation_p.L1000F|AMBRA1_ENST00000534300.1_Missense_Mutation_p.L1030F			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	1090					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		CGGGGCTGAAGCCCAATGGCA	0.577																																						dbGAP											0													75.0	66.0	69.0					11																	46430198		2202	4299	6501	-	-	-	SO:0001583	missense	0			AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.3268C>T	11.37:g.46430198G>A	ENSP00000415327:p.Leu1090Phe		A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L1090F	ENST00000458649.2	37	c.3268		11	.	.	.	.	.	.	.	.	.	.	G	21.1	4.105267	0.77096	.	.	ENSG00000110497	ENST00000314845;ENST00000533727;ENST00000534300;ENST00000426438;ENST00000298834;ENST00000458649;ENST00000526545;ENST00000528950	T;T;T;T;T;T;T	0.76709	-0.99;-1.04;-0.67;-0.78;-0.67;-0.82;-0.78	5.74	2.88	0.33553	.	0.000000	0.64402	D	0.000001	T	0.80314	0.4600	L	0.32530	0.975	0.44477	D	0.99741	D;D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.85130	0.994;0.997;0.997;0.997;0.997;0.997	T	0.79465	-0.1792	10	0.87932	D	0	.	10.1586	0.42838	0.2667:0.0:0.7333:0.0	.	1090;1061;1030;971;1093;1000	Q9C0C7;Q9C0C7-3;Q9C0C7-2;G3V193;Q9C0C7-5;Q9C0C7-4	AMRA1_HUMAN;.;.;.;.;.	F	1000;971;1030;1061;1030;1090;48;1061	ENSP00000318313:L1000F;ENSP00000433372:L971F;ENSP00000431926:L1030F;ENSP00000410899:L1061F;ENSP00000298834:L1030F;ENSP00000415327:L1090F;ENSP00000433945:L1061F	ENSP00000298834:L1030F	L	-	1	0	AMBRA1	46386774	1.000000	0.71417	0.997000	0.53966	0.957000	0.61999	3.176000	0.50863	0.455000	0.26910	-0.291000	0.09656	CTT	AMBRA1	-	NULL	ENSG00000110497		0.577	AMBRA1-005	KNOWN	basic	protein_coding	AMBRA1	HGNC	protein_coding	OTTHUMT00000390103.1	33	0.00	0	G	NM_017749		46430198	46430198	-1	no_errors	ENST00000458649	ensembl	human	known	69_37n	missense	39	32.76	19	SNP	1.000	A
ANKRD10	55608	genome.wustl.edu	37	13	111532189	111532189	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr13:111532189C>A	ENST00000267339.2	-	6	1192	c.1058G>T	c.(1057-1059)aGt>aTt	p.S353I	ANKRD10_ENST00000375758.5_3'UTR	NM_017664.2	NP_060134.2	Q9NXR5	ANR10_HUMAN	ankyrin repeat domain 10	353										central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(3)	9	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		all cancers(43;0.0882)|BRCA - Breast invasive adenocarcinoma(86;0.188)|Lung(89;0.208)			GCTACTTGGACTCCCGTTCAG	0.552																																						dbGAP											0													116.0	93.0	101.0					13																	111532189		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000100	CCDS9520.1, CCDS66580.1	13q33.3	2013-01-10			ENSG00000088448	ENSG00000088448		"""Ankyrin repeat domain containing"""	20265	protein-coding gene	gene with protein product							Standard	NM_017664		Approved	FLJ20093	uc001vrn.3	Q9NXR5	OTTHUMG00000017349	ENST00000267339.2:c.1058G>T	13.37:g.111532189C>A	ENSP00000267339:p.Ser353Ile		Q5VW12|Q9BV12	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S353I	ENST00000267339.2	37	c.1058	CCDS9520.1	13	.	.	.	.	.	.	.	.	.	.	C	15.75	2.924862	0.52759	.	.	ENSG00000088448	ENST00000267339	T	0.75704	-0.96	5.41	4.56	0.56223	.	0.236935	0.48767	D	0.000170	D	0.85044	0.5607	M	0.74258	2.255	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.86811	0.1998	10	0.87932	D	0	-15.5137	13.9773	0.64282	0.0:0.9271:0.0:0.0729	.	353	Q9NXR5	ANR10_HUMAN	I	353	ENSP00000267339:S353I	ENSP00000267339:S353I	S	-	2	0	ANKRD10	110330190	1.000000	0.71417	0.722000	0.30670	0.255000	0.26057	5.847000	0.69451	1.282000	0.44496	0.650000	0.86243	AGT	ANKRD10	-	NULL	ENSG00000088448		0.552	ANKRD10-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD10	HGNC	protein_coding	OTTHUMT00000045783.1	58	0.00	0	C			111532189	111532189	-1	no_errors	ENST00000267339	ensembl	human	known	69_37n	missense	52	20.00	13	SNP	1.000	A
AP4E1	23431	genome.wustl.edu	37	15	51250849	51250849	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr15:51250849C>T	ENST00000261842.5	+	14	1815	c.1709C>T	c.(1708-1710)aCa>aTa	p.T570I	AP4E1_ENST00000560508.1_Missense_Mutation_p.T495I	NM_001252127.1|NM_007347.4	NP_001239056.1|NP_031373.2	Q9UPM8	AP4E1_HUMAN	adaptor-related protein complex 4, epsilon 1 subunit	570					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	coated pit (GO:0005905)|Golgi apparatus (GO:0005794)|membrane coat (GO:0030117)				breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(5)|skin(2)	27				all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)		TCTTCTAATACAGTTGAGAGA	0.358																																						dbGAP											0													116.0	117.0	117.0					15																	51250849		2196	4294	6490	-	-	-	SO:0001583	missense	0			AB030653	CCDS32240.1, CCDS58362.1	15q21.2	2014-09-17			ENSG00000081014	ENSG00000081014			573	protein-coding gene	gene with protein product		607244				10436028, 21620353	Standard	NM_007347		Approved	AP-4-EPSILON, SPG51	uc001zyx.2	Q9UPM8	OTTHUMG00000172458	ENST00000261842.5:c.1709C>T	15.37:g.51250849C>T	ENSP00000261842:p.Thr570Ile		A0AVD6|A1L4A9|A6NNX7|H0YKX4|Q68D31|Q9Y588	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_Coatomer_bsu_C,superfamily_ARM-type_fold,pirsf_AP4_complex_esu	p.T570I	ENST00000261842.5	37	c.1709	CCDS32240.1	15	.	.	.	.	.	.	.	.	.	.	C	3.036	-0.198489	0.06219	.	.	ENSG00000081014	ENST00000261842	T	0.26067	1.76	4.18	-0.593	0.11667	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	1.388660	0.03920	N	0.283390	T	0.20495	0.0493	L	0.34521	1.04	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.27872	-1.0061	10	0.31617	T	0.26	0.7415	8.5666	0.33543	0.0:0.5058:0.0:0.4942	.	570	Q9UPM8	AP4E1_HUMAN	I	570	ENSP00000261842:T570I	ENSP00000261842:T570I	T	+	2	0	AP4E1	49038141	0.582000	0.26749	0.043000	0.18650	0.838000	0.47535	0.993000	0.29680	0.001000	0.14605	-0.312000	0.09012	ACA	AP4E1	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP4_complex_esu	ENSG00000081014		0.358	AP4E1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	AP4E1	HGNC	protein_coding	OTTHUMT00000418656.1	195	0.00	0	C			51250849	51250849	+1	no_errors	ENST00000261842	ensembl	human	known	69_37n	missense	182	17.65	39	SNP	0.035	T
ARHGEF39	84904	genome.wustl.edu	37	9	35663071	35663071	+	Splice_Site	SNP	C	C	G			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr9:35663071C>G	ENST00000378387.3	-	6	662	c.545G>C	c.(544-546)cGg>cCg	p.R182P	ARHGEF39_ENST00000490970.1_Intron|ARHGEF39_ENST00000343259.3_Intron|ARHGEF39_ENST00000378395.2_Splice_Site_p.R146P	NM_032818.2	NP_116207.2	Q8N4T4	ARG39_HUMAN	Rho guanine nucleotide exchange factor (GEF) 39	182	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				positive regulation of cell migration (GO:0030335)	plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)										TCGGGCAGCCCCTGGAATAAC	0.517																																						dbGAP											0													92.0	84.0	87.0					9																	35663071		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK001187	CCDS6584.2	9p13.3	2012-08-08	2012-08-08	2012-08-08	ENSG00000137135	ENSG00000137135			25909	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 100"""	C9orf100		22327280	Standard	XR_242516		Approved	FLJ14642	uc003zxm.1	Q8N4T4	OTTHUMG00000019869	ENST00000378387.3:c.545-1G>C	9.37:g.35663071C>G			Q49AG0|Q6TPQ2|Q96ST6	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.R182P	ENST00000378387.3	37	c.545	CCDS6584.2	9	.	.	.	.	.	.	.	.	.	.	C	17.52	3.409475	0.62399	.	.	ENSG00000137135	ENST00000378387;ENST00000378395	T;T	0.64438	-0.1;-0.1	5.72	4.64	0.57946	Dbl homology (DH) domain (5);	0.346315	0.28766	N	0.014220	T	0.58793	0.2147	L	0.46157	1.445	0.80722	D	1	P	0.48911	0.917	P	0.47891	0.56	T	0.55256	-0.8169	10	0.33141	T	0.24	.	10.4823	0.44700	0.0:0.8984:0.0:0.1016	.	182	Q8N4T4	CI100_HUMAN	P	182;146	ENSP00000367638:R182P;ENSP00000367648:R146P	ENSP00000367638:R182P	R	-	2	0	C9orf100	35653071	0.993000	0.37304	1.000000	0.80357	0.881000	0.50899	1.020000	0.30027	2.703000	0.92315	0.650000	0.86243	CGG	ARHGEF39	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000137135		0.517	ARHGEF39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF39	HGNC	protein_coding	OTTHUMT00000052330.1	69	0.00	0	C	NM_032818	Missense_Mutation	35663071	35663071	-1	no_errors	ENST00000378387	ensembl	human	known	69_37n	missense	60	16.67	12	SNP	1.000	G
ARID2	196528	genome.wustl.edu	37	12	46287254	46287254	+	Missense_Mutation	SNP	T	T	G			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr12:46287254T>G	ENST00000334344.6	+	19	5371	c.5199T>G	c.(5197-5199)atT>atG	p.I1733M	ARID2_ENST00000457135.1_Missense_Mutation_p.I341M|ARID2_ENST00000479608.1_3'UTR|ARID2_ENST00000422737.1_Missense_Mutation_p.I1584M|ARID2_ENST00000444670.1_Missense_Mutation_p.I1343M	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1733					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		AAAAGGCCATTGTGAATCATC	0.453			"""N, S, F"""		hepatocellular carcinoma																																	dbGAP		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	0													102.0	89.0	93.0					12																	46287254		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.5199T>G	12.37:g.46287254T>G	ENSP00000335044:p.Ile1733Met		Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Missense_Mutation	SNP	pfam_ARID/BRIGHT_DNA-bd,pfam_DNA-bd_RFX,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.I1733M	ENST00000334344.6	37	c.5199	CCDS31783.1	12	.	.	.	.	.	.	.	.	.	.	T	15.65	2.895946	0.52121	.	.	ENSG00000189079	ENST00000334344;ENST00000549153;ENST00000338636;ENST00000422737;ENST00000444670;ENST00000457135	T	0.36520	1.25	5.4	3.01	0.34805	.	0.050777	0.85682	D	0.000000	T	0.50973	0.1647	L	0.59436	1.845	0.48087	D	0.999583	D;D;P	0.76494	0.999;0.999;0.83	D;D;B	0.70016	0.967;0.967;0.294	T	0.49890	-0.8891	10	0.59425	D	0.04	-13.6444	9.6588	0.39943	0.0:0.144:0.0:0.856	.	1733;1343;1733	Q68CP9-3;F8W108;Q68CP9	.;.;ARID2_HUMAN	M	1733;850;850;1584;1343;341	ENSP00000335044:I1733M	ENSP00000335044:I1733M	I	+	3	3	ARID2	44573521	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.411000	0.44600	0.898000	0.36418	0.482000	0.46254	ATT	ARID2	-	NULL	ENSG00000189079		0.453	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID2	HGNC	protein_coding	OTTHUMT00000318380.2	203	0.00	0	T	XM_350875		46287254	46287254	+1	no_errors	ENST00000334344	ensembl	human	known	69_37n	missense	116	20.55	30	SNP	1.000	G
ATP2A1	487	genome.wustl.edu	37	16	28889996	28889996	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr16:28889996G>T	ENST00000357084.3	+	1	271	c.4G>T	c.(4-6)Gag>Tag	p.E2*	ATP2A1_ENST00000536376.1_5'Flank|RP11-22P6.3_ENST00000566956.1_RNA|ATP2A1_ENST00000395503.4_Nonsense_Mutation_p.E2*|RP11-22P6.3_ENST00000561547.1_RNA|SNORA43_ENST00000516652.1_RNA	NM_173201.3	NP_775293.1	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, cardiac muscle, fast twitch 1	2					apoptotic mitochondrial changes (GO:0008637)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|ion transmembrane transport (GO:0034220)|maintenance of mitochondrion location (GO:0051659)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of striated muscle contraction (GO:0045988)|positive regulation of endoplasmic reticulum calcium ion concentration (GO:0032470)|positive regulation of fast-twitch skeletal muscle fiber contraction (GO:0031448)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|regulation of striated muscle contraction (GO:0006942)|relaxation of skeletal muscle (GO:0090076)|response to endoplasmic reticulum stress (GO:0034976)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|H zone (GO:0031673)|I band (GO:0031674)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	38						GAGCACAATGGAGGCCGCTCA	0.602																																						dbGAP											0													51.0	39.0	43.0					16																	28889996		2196	4299	6495	-	-	-	SO:0001587	stop_gained	0				CCDS10643.1, CCDS42139.1, CCDS66997.1	16p12.1	2012-10-22			ENSG00000196296	ENSG00000196296	3.6.3.8	"""ATPases / P-type"""	811	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 1"", ""calcium pump 1"""	108730		ATP2A			Standard	NM_004320		Approved	SERCA1	uc002dro.1	O14983	OTTHUMG00000131760	ENST00000357084.3:c.4G>T	16.37:g.28889996G>T	ENSP00000349595:p.Glu2*		A8K5J9|B3KY17|O14984	Nonsense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,pfam_HAD-SF_hydro-like_3,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,prints_ATPase_P-typ_H-transp,tigrfam_ATPase_P-typ_Ca-transp,tigrfam_ATPase_P-typ_ion-transptr	p.E2*	ENST00000357084.3	37	c.4	CCDS10643.1	16	.	.	.	.	.	.	.	.	.	.	G	31	5.086592	0.94100	.	.	ENSG00000196296	ENST00000357084;ENST00000395503;ENST00000395498	.	.	.	4.54	4.54	0.55810	.	0.059275	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	16.4507	0.83990	0.0:0.0:1.0:0.0	.	.	.	.	X	2;2;39	.	ENSP00000349595:E2X	E	+	1	0	ATP2A1	28797497	1.000000	0.71417	1.000000	0.80357	0.578000	0.36192	8.885000	0.92439	2.260000	0.74910	0.561000	0.74099	GAG	ATP2A1	-	NULL	ENSG00000196296		0.602	ATP2A1-001	KNOWN	basic|CCDS	protein_coding	ATP2A1	HGNC	protein_coding	OTTHUMT00000254686.2	74	0.00	0	G	NM_004320		28889996	28889996	+1	no_errors	ENST00000357084	ensembl	human	known	69_37n	nonsense	72	47.10	65	SNP	1.000	T
BMP10	27302	genome.wustl.edu	37	2	69092930	69092930	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr2:69092930C>T	ENST00000295379.1	-	2	1266	c.1108G>A	c.(1108-1110)Gca>Aca	p.A370T		NM_014482.1	NP_055297.1	O95393	BMP10_HUMAN	bone morphogenetic protein 10	370					activin receptor signaling pathway (GO:0032924)|adult heart development (GO:0007512)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heart trabecula formation (GO:0060347)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell migration (GO:0010596)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation involved in heart morphogenesis (GO:2000138)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction (GO:0055117)|sarcomere organization (GO:0045214)|ventricular cardiac muscle cell development (GO:0055015)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Z disc (GO:0030018)	hormone activity (GO:0005179)|receptor serine/threonine kinase binding (GO:0033612)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(15)|ovary(2)	27						TGGATAATTGCATGCTTTGTG	0.522																																						dbGAP											0													172.0	163.0	166.0					2																	69092930		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF101441	CCDS1890.1	2p13.2	2014-09-17			ENSG00000163217	ENSG00000163217		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	20869	protein-coding gene	gene with protein product		608748				10072785	Standard	NM_014482		Approved		uc002sez.1	O95393	OTTHUMG00000129573	ENST00000295379.1:c.1108G>A	2.37:g.69092930C>T	ENSP00000295379:p.Ala370Thr		Q53R17|Q6NTE0	Missense_Mutation	SNP	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C,prints_Inhibin_asu	p.A370T	ENST00000295379.1	37	c.1108	CCDS1890.1	2	.	.	.	.	.	.	.	.	.	.	C	29.8	5.033049	0.93575	.	.	ENSG00000163217	ENST00000295379	D	0.86497	-2.13	6.07	6.07	0.98685	Transforming growth factor-beta, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.94092	0.8106	M	0.79805	2.47	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93949	0.7230	10	0.87932	D	0	.	19.6321	0.95713	0.0:1.0:0.0:0.0	.	370	O95393	BMP10_HUMAN	T	370	ENSP00000295379:A370T	ENSP00000295379:A370T	A	-	1	0	BMP10	68946434	1.000000	0.71417	0.998000	0.56505	0.960000	0.62799	7.818000	0.86416	2.884000	0.98904	0.655000	0.94253	GCA	BMP10	-	pfam_TGF-b_C,smart_TGF-b_C	ENSG00000163217		0.522	BMP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP10	HGNC	protein_coding	OTTHUMT00000251768.1	251	0.00	0	C	NM_014482		69092930	69092930	-1	no_errors	ENST00000295379	ensembl	human	known	69_37n	missense	73	70.08	171	SNP	1.000	T
BAZ2B	29994	genome.wustl.edu	37	2	160303435	160303435	+	Missense_Mutation	SNP	T	T	C			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr2:160303435T>C	ENST00000392783.2	-	6	1049	c.554A>G	c.(553-555)aAc>aGc	p.N185S	BAZ2B_ENST00000355831.2_Missense_Mutation_p.N185S|BAZ2B_ENST00000343439.5_Missense_Mutation_p.N183S|BAZ2B_ENST00000392782.1_Missense_Mutation_p.N183S	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	185	Ser-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						TACAGATGTGTTGATACCAAT	0.328																																						dbGAP											0													142.0	140.0	141.0					2																	160303435		1855	4107	5962	-	-	-	SO:0001583	missense	0			AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.554A>G	2.37:g.160303435T>C	ENSP00000376534:p.Asn185Ser		D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	SNP	pfam_Bromodomain,pfam_Methyl_CpG_DNA-bd,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_DNA-bd_integrase-typ,superfamily_Znf_FYVE_PHD,superfamily_ARM-type_fold,smart_Methyl_CpG_DNA-bd,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Methyl_CpG_DNA-bd,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.N185S	ENST00000392783.2	37	c.554	CCDS2209.2	2	.	.	.	.	.	.	.	.	.	.	T	12.45	1.941058	0.34283	.	.	ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439;ENST00000546335;ENST00000541068	T;T;T;T	0.11169	2.8;2.8;2.8;2.8	5.84	4.8	0.61643	.	0.214305	0.22290	U	0.062017	T	0.04815	0.0130	N	0.04508	-0.205	0.24034	N	0.996108	B;B;B;B;B;B	0.21309	0.0;0.0;0.054;0.0;0.0;0.0	B;B;B;B;B;B	0.25614	0.001;0.0;0.062;0.001;0.001;0.0	T	0.30966	-0.9960	10	0.46703	T	0.11	-4.9565	3.4259	0.07410	0.0:0.5156:0.0:0.4844	.	183;122;185;183;183;185	Q6MZK7;F5H6H2;Q9UIF8-3;Q9UIF8-2;Q9UIF8-5;Q9UIF8	.;.;.;.;.;BAZ2B_HUMAN	S	183;185;185;183;122;66	ENSP00000376533:N183S;ENSP00000376534:N185S;ENSP00000348087:N185S;ENSP00000339670:N183S	ENSP00000339670:N183S	N	-	2	0	BAZ2B	160011681	0.999000	0.42202	1.000000	0.80357	0.844000	0.47949	1.411000	0.34702	1.067000	0.40740	0.482000	0.46254	AAC	BAZ2B	-	NULL	ENSG00000123636		0.328	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAZ2B	HGNC	protein_coding	OTTHUMT00000255037.2	309	0.00	0	T			160303435	160303435	-1	no_errors	ENST00000392783	ensembl	human	known	69_37n	missense	173	25.11	58	SNP	1.000	C
BNC1	646	genome.wustl.edu	37	15	83926261	83926261	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr15:83926261C>T	ENST00000345382.2	-	5	3003	c.2918G>A	c.(2917-2919)cGa>cAa	p.R973Q	BNC1_ENST00000569704.1_Missense_Mutation_p.R966Q|RP11-382A20.4_ENST00000565495.1_RNA	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	973					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						GTGTCTGTTTCGACTGCGAAC	0.502																																						dbGAP											0													162.0	156.0	158.0					15																	83926261		2203	4300	6503	-	-	-	SO:0001583	missense	0			L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.2918G>A	15.37:g.83926261C>T	ENSP00000307041:p.Arg973Gln		Q15840	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R973Q	ENST00000345382.2	37	c.2918	CCDS10324.1	15	.	.	.	.	.	.	.	.	.	.	C	36	5.813742	0.96975	.	.	ENSG00000169594	ENST00000345382;ENST00000541809	T	0.57595	0.39	5.93	5.93	0.95920	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.74928	0.3781	M	0.75615	2.305	0.58432	D	0.999991	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.987	T	0.75855	-0.3170	10	0.87932	D	0	-15.4338	20.3398	0.98759	0.0:1.0:0.0:0.0	.	966;973	F5GY04;Q01954	.;BNC1_HUMAN	Q	973;966	ENSP00000307041:R973Q	ENSP00000307041:R973Q	R	-	2	0	BNC1	81717265	1.000000	0.71417	0.643000	0.29450	0.998000	0.95712	7.755000	0.85180	2.811000	0.96726	0.557000	0.71058	CGA	BNC1	-	smart_Znf_C2H2-like	ENSG00000169594		0.502	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BNC1	HGNC	protein_coding	OTTHUMT00000304006.1	94	0.00	0	C	NM_001717		83926261	83926261	-1	no_errors	ENST00000345382	ensembl	human	known	69_37n	missense	112	15.15	20	SNP	0.997	T
BNIP3	664	genome.wustl.edu	37	10	133784252	133784252	+	Silent	SNP	G	G	C			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr10:133784252G>C	ENST00000368636.4	-	5	553	c.429C>G	c.(427-429)ctC>ctG	p.L143L	BNIP3_ENST00000540159.1_Silent_p.L143L	NM_004052.2	NP_004043.2	Q12983	BNIP3_HUMAN	BCL2/adenovirus E1B 19kDa interacting protein 3	143					apoptotic process (GO:0006915)|autophagic cell death (GO:0048102)|brown fat cell differentiation (GO:0050873)|cell death (GO:0008219)|cellular response to cobalt ion (GO:0071279)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|granzyme-mediated apoptotic signaling pathway (GO:0008626)|intrinsic apoptotic signaling pathway in response to hypoxia (GO:1990144)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial outer membrane permeabilization (GO:0097345)|mitochondrial protein catabolic process (GO:0035694)|negative regulation of apoptotic process (GO:0043066)|negative regulation of membrane potential (GO:0045837)|negative regulation of mitochondrial fusion (GO:0010637)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of autophagy (GO:0010508)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein complex disassembly (GO:0043243)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|reactive oxygen species metabolic process (GO:0072593)|regulation of mitochondrial membrane permeability (GO:0046902)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|viral process (GO:0016032)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	GTPase binding (GO:0051020)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|skin(1)	7		all_cancers(35;4e-11)|all_epithelial(44;5.07e-08)|Ovarian(717;2.61e-05)|Lung NSC(174;0.00237)|all_lung(145;0.00354)|Breast(234;0.023)|all_neural(114;0.0299)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)		Epithelial(32;1.59e-12)|all cancers(32;3.75e-11)|OV - Ovarian serous cystadenocarcinoma(35;2.57e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		TCCTCATGCTGAGGGTGGCCG	0.537																																						dbGAP											0													77.0	71.0	73.0					10																	133784252		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			U15174	CCDS7663.1	10q26.3	2003-11-05	2002-08-29		ENSG00000176171	ENSG00000176171			1084	protein-coding gene	gene with protein product		603293	"""BCL2/adenovirus E1B 19kD-interacting protein 3"""			7954800	Standard	NM_004052		Approved	Nip3	uc001lkv.1	Q12983	OTTHUMG00000019278	ENST00000368636.4:c.429C>G	10.37:g.133784252G>C			O14620|Q96GP0	Silent	SNP	pfam_BNIP3	p.L143	ENST00000368636.4	37	c.429	CCDS7663.1	10																																																																																			BNIP3	-	pfam_BNIP3	ENSG00000176171		0.537	BNIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BNIP3	HGNC	protein_coding	OTTHUMT00000051039.1	131	0.00	0	G			133784252	133784252	-1	no_errors	ENST00000368636	ensembl	human	known	69_37n	silent	66	37.14	39	SNP	1.000	C
GAS8	2622	genome.wustl.edu	37	16	90095620	90095620	+	Intron	SNP	A	A	G	rs61740023	byFrequency	TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr16:90095620A>G	ENST00000268699.4	+	2	212				GAS8_ENST00000536122.1_Intron|C16orf3_ENST00000408886.2_Missense_Mutation_p.V44A|GAS8_ENST00000540721.1_Intron	NM_001481.2	NP_001472.1	O95995	GAS8_HUMAN	growth arrest-specific 8						cellular protein localization (GO:0034613)|negative regulation of cell proliferation (GO:0008285)|sperm motility (GO:0030317)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile cilium (GO:0031514)				endometrium(3)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.029)		ggggcaggctacggggcaggc	0.672																																						dbGAP											0													25.0	29.0	27.0					16																	90095620		2197	4298	6495	-	-	-	SO:0001627	intron_variant	0			AF050079	CCDS10992.1, CCDS67101.1, CCDS73932.1	16q24.3	2014-07-18	2003-01-16	2003-01-17	ENSG00000141013	ENSG00000141013			4166	protein-coding gene	gene with protein product		605178	"""growth arrest-specific 11"""	GAS11		9790751	Standard	NM_001481		Approved		uc002fqi.1	O95995	OTTHUMG00000138988	ENST00000268699.4:c.90+1490A>G	16.37:g.90095620A>G			B2RCT1|B7Z4U1|G3V1L5|Q2M234	Missense_Mutation	SNP	NULL	p.V44A	ENST00000268699.4	37	c.131	CCDS10992.1	16	.	.	.	.	.	.	.	.	.	.	A	1.744	-0.491041	0.04322	.	.	ENSG00000221819	ENST00000408886	T	0.48836	0.8	.	.	.	.	.	.	.	.	T	0.22322	0.0538	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.21965	-1.0230	4	.	.	.	.	.	.	.	.	.	.	.	A	44	ENSP00000386218:V44A	.	V	-	2	0	C16orf3	88623121	.	.	0.004000	0.12327	0.042000	0.13812	.	.	0.064000	0.16427	0.063000	0.15292	GTA	C16orf3	-	NULL	ENSG00000221819		0.672	GAS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf3	HGNC	protein_coding	OTTHUMT00000272877.2	14	0.00	0	A			90095620	90095620	-1	no_errors	ENST00000408886	ensembl	human	known	69_37n	missense	35	16.67	7	SNP	0.005	G
C17orf97	400566	genome.wustl.edu	37	17	263294	263294	+	Missense_Mutation	SNP	C	C	G	rs35229416|rs71145727	byFrequency	TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr17:263294C>G	ENST00000360127.6	+	2	676	c.660C>G	c.(658-660)gaC>gaG	p.D220E	AC108004.3_ENST00000466740.2_RNA|C17orf97_ENST00000571106.1_Intron	NM_001013672.4	NP_001013694.4	Q6ZQX7	CQ097_HUMAN	chromosome 17 open reading frame 97	220	20 X 10 AA approximative tandem repeat of A-L-K-G-F-H-P-D-P-E.		D -> E (in dbSNP:rs35229416). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.							breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)	14						CCGACCCCGACGCCCTCAAGG	0.672													G|||	2875	0.574081	0.9115	0.4107	5008	,	,		7576	0.5377		0.328	False		,,,				2504	0.5245					dbGAP											0													7.0	16.0	14.0					17																	263294		1659	4162	5821	-	-	-	SO:0001583	missense	0			AK128660, BC057385	CCDS32519.2	17p13.3	2008-08-15			ENSG00000187624	ENSG00000187624			33800	protein-coding gene	gene with protein product						12477932	Standard	NM_001013672		Approved	LOC400566	uc021tna.1	Q6ZQX7	OTTHUMG00000132479	ENST00000360127.6:c.660C>G	17.37:g.263294C>G	ENSP00000353245:p.Asp220Glu		A5D8T6|Q6NSI2|Q6PFW9	Missense_Mutation	SNP	NULL	p.D220E	ENST00000360127.6	37	c.660	CCDS32519.2	17	1068	0.489010989010989	398	0.8089430894308943	137	0.3784530386740331	306	0.534965034965035	227	0.2994722955145119	G	0	-2.690134	0.00100	.	.	ENSG00000187624	ENST00000360127	T	0.27557	1.66	1.46	-2.92	0.05615	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.50996	-0.8761	7	0.02654	T	1	.	1.2875	0.02053	0.1416:0.2806:0.3205:0.2573	.	220	Q6ZQX7-4	.	E	220	ENSP00000353245:D220E	ENSP00000353245:D220E	D	+	3	2	C17orf97	.	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.737000	0.00379	-5.359000	0.00016	-5.120000	0.00001	GAC	C17orf97	-	NULL	ENSG00000187624		0.672	C17orf97-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C17orf97	HGNC	protein_coding	OTTHUMT00000255648.4	10	0.00	0	C	NM_001013672		263294	263294	+1	no_errors	ENST00000360127	ensembl	human	known	69_37n	missense	10	44.44	8	SNP	0.000	G
CACNA1E	777	genome.wustl.edu	37	1	181685256	181685256	+	Missense_Mutation	SNP	T	T	C			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr1:181685256T>C	ENST00000367573.2	+	10	1306	c.1306T>C	c.(1306-1308)Tcc>Ccc	p.S436P	CACNA1E_ENST00000367567.4_Missense_Mutation_p.S43P|CACNA1E_ENST00000367570.1_Missense_Mutation_p.S436P|CACNA1E_ENST00000358338.5_Missense_Mutation_p.S387P|CACNA1E_ENST00000357570.5_Missense_Mutation_p.S387P|CACNA1E_ENST00000526775.1_Missense_Mutation_p.S436P|CACNA1E_ENST00000360108.3_Missense_Mutation_p.S436P	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	436					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						TGTTGATATCTCCTCTGTGGG	0.502																																						dbGAP											0													73.0	82.0	79.0					1																	181685256		1957	4142	6099	-	-	-	SO:0001583	missense	0			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.1306T>C	1.37:g.181685256T>C	ENSP00000356545:p.Ser436Pro		B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_HAND_2,prints_VDCCAlpha1,prints_VDCC_R_a1su	p.S436P	ENST00000367573.2	37	c.1306	CCDS55664.1	1	.	.	.	.	.	.	.	.	.	.	T	14.71	2.618041	0.46736	.	.	ENSG00000198216	ENST00000524607;ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D;D	0.97598	-4.45;-3.99;-4.0;-4.0;-3.99;-4.06;-4.0;-4.0	5.51	5.51	0.81932	.	0.545520	0.20812	N	0.085239	D	0.95124	0.8420	L	0.41710	1.295	0.58432	D	0.999999	P;P	0.46142	0.873;0.655	B;B	0.42882	0.401;0.401	D	0.95190	0.8307	10	0.52906	T	0.07	.	15.5822	0.76452	0.0:0.0:0.0:1.0	.	436;436	Q15878-2;Q15878-3	.;.	P	436;436;436;387;387;43;436;436	ENSP00000432038:S436P;ENSP00000356542:S436P;ENSP00000434814:S436P;ENSP00000350183:S387P;ENSP00000351101:S387P;ENSP00000356539:S43P;ENSP00000353222:S436P;ENSP00000356545:S436P	ENSP00000350183:S387P	S	+	1	0	CACNA1E	179951879	1.000000	0.71417	0.997000	0.53966	0.059000	0.15707	1.462000	0.35266	2.210000	0.71456	0.533000	0.62120	TCC	CACNA1E	-	NULL	ENSG00000198216		0.502	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	HGNC	protein_coding	OTTHUMT00000090793.2	267	0.00	0	T	NM_000721		181685256	181685256	+1	no_errors	ENST00000367573	ensembl	human	known	69_37n	missense	428	10.65	51	SNP	1.000	C
CATSPERD	257062	genome.wustl.edu	37	19	5749187	5749187	+	Missense_Mutation	SNP	T	T	G			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr19:5749187T>G	ENST00000381624.3	+	11	1041	c.980T>G	c.(979-981)aTa>aGa	p.I327R	CATSPERD_ENST00000381614.2_De_novo_Start_InFrame	NM_152784.3	NP_689997.3	Q86XM0	CTSRD_HUMAN	catsper channel auxiliary subunit delta	327					multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)											CCAAGTTCCATAATCAAAGTA	0.463																																						dbGAP											0													78.0	78.0	78.0					19																	5749187		1879	4118	5997	-	-	-	SO:0001583	missense	0			BC043005	CCDS12149.2	19p13.3	2013-10-11	2012-02-22	2012-02-22	ENSG00000174898	ENSG00000174898			28598	protein-coding gene	gene with protein product			"""transmembrane protein 146"""	TMEM146		21224844	Standard	NM_152784		Approved	MGC39581	uc002mda.3	Q86XM0	OTTHUMG00000143036	ENST00000381624.3:c.980T>G	19.37:g.5749187T>G	ENSP00000371037:p.Ile327Arg		Q6ZRP1	Missense_Mutation	SNP	superfamily_WD40_repeat_dom	p.I327R	ENST00000381624.3	37	c.980	CCDS12149.2	19	.	.	.	.	.	.	.	.	.	.	t	13.59	2.283257	0.40394	.	.	ENSG00000174898	ENST00000394548;ENST00000381624	T	0.25414	1.8	3.26	2.23	0.28157	.	1.559730	0.05266	U	0.516547	T	0.26521	0.0648	L	0.34521	1.04	0.09310	N	0.999994	P	0.48503	0.911	P	0.47981	0.563	T	0.18777	-1.0326	10	0.72032	D	0.01	0.5985	5.1725	0.15118	0.0:0.1384:0.0:0.8616	.	327	Q86XM0	TM146_HUMAN	R	253;327	ENSP00000371037:I327R	ENSP00000371037:I327R	I	+	2	0	TMEM146	5700187	0.007000	0.16637	0.000000	0.03702	0.181000	0.23173	2.527000	0.45615	0.636000	0.30508	0.367000	0.22151	ATA	CATSPERD	-	NULL	ENSG00000174898		0.463	CATSPERD-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	CATSPERD	HGNC	protein_coding	OTTHUMT00000286953.2	133	0.00	0	T	NM_152784		5749187	5749187	+1	no_errors	ENST00000381624	ensembl	human	known	69_37n	missense	131	35.78	73	SNP	0.001	G
CCPG1	9236	genome.wustl.edu	37	15	55652817	55652818	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	TC	TC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr15:55652817_55652818delTC	ENST00000310958.6	-	8	1451_1452	c.1153_1154delGA	c.(1153-1155)gaafs	p.E385fs	CCPG1_ENST00000442196.3_Frame_Shift_Del_p.E385fs|DYX1C1-CCPG1_ENST00000565113.1_RNA|CCPG1_ENST00000425574.3_Intron|CCPG1_ENST00000569205.1_Frame_Shift_Del_p.E385fs	NM_001204450.1|NM_001204451.1|NM_004748.4|NM_020739.3	NP_001191379.1|NP_001191380.1|NP_004739.3|NP_065790.2	Q9ULG6	CCPG1_HUMAN	cell cycle progression 1	385					cell cycle (GO:0007049)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001106)	integral component of membrane (GO:0016021)				autonomic_ganglia(1)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|stomach(3)	30				all cancers(107;0.0354)		TCTCTCCAGTTCTCTCTTTAGC	0.421																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF212228	CCDS42039.1, CCDS55966.1, CCDS55967.1	15q21.1	2011-04-20				ENSG00000260916			24227	protein-coding gene	gene with protein product		611326				9383053, 10574462	Standard	NM_004748		Approved	KIAA1254, CPR8	uc010bfk.2	Q9ULG6		ENST00000310958.6:c.1153_1154delGA	15.37:g.55652821_55652822delTC	ENSP00000311656:p.Glu385fs		A0PJH3|A8K9T0|O14712|Q05DG4|Q5U5S7|Q8IYV8|Q9BY53|Q9HA17	Frame_Shift_Del	DEL	NULL	p.E385fs	ENST00000310958.6	37	c.1154_1153	CCDS42039.1	15																																																																																			CCPG1	-	NULL	ENSG00000260916		0.421	CCPG1-001	KNOWN	basic|CCDS	protein_coding	CCPG1	HGNC	protein_coding	OTTHUMT00000419850.1	72	0.00	0	TC	NM_004748		55652817	55652818	-1	no_errors	ENST00000310958	ensembl	human	known	69_37n	frame_shift_del	79	15.96	15	DEL	0.998:0.994	-
CDK13	8621	genome.wustl.edu	37	7	40038962	40038962	+	Missense_Mutation	SNP	T	T	A			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr7:40038962T>A	ENST00000181839.4	+	4	2650	c.2045T>A	c.(2044-2046)aTa>aAa	p.I682K	CDK13_ENST00000484589.1_3'UTR|CDK13_ENST00000340829.5_Missense_Mutation_p.I682K	NM_003718.4|NM_031267.3	NP_003709.3|NP_112557.2	Q14004	CDK13_HUMAN	cyclin-dependent kinase 13	682					alternative mRNA splicing, via spliceosome (GO:0000380)|hemopoiesis (GO:0030097)|multicellular organismal development (GO:0007275)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|positive regulation of cell proliferation (GO:0008284)|regulation of mitosis (GO:0007088)|viral process (GO:0016032)	cyclin K-CDK13 complex (GO:0002945)|extracellular space (GO:0005615)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(2)|prostate(2)|skin(5)|stomach(2)|urinary_tract(1)	49						TTTGATAGAATATGTGGGCCT	0.333																																						dbGAP											0													60.0	66.0	64.0					7																	40038962		2203	4300	6503	-	-	-	SO:0001583	missense	0			M80629	CCDS5461.1, CCDS5462.1	7p14.1	2011-11-08	2009-12-16	2009-12-16	ENSG00000065883	ENSG00000065883		"""Cyclin-dependent kinases"""	1733	protein-coding gene	gene with protein product	"""cholinesterase-related cell division controller"""	603309	"""cell division cycle 2-like 5 (cholinesterase-related cell division controller)"""	CDC2L5		1731328, 19884882	Standard	NM_003718		Approved	CHED, CDC2L, KIAA1791	uc003thh.4	Q14004	OTTHUMG00000023726	ENST00000181839.4:c.2045T>A	7.37:g.40038962T>A	ENSP00000181839:p.Ile682Lys		Q53G78|Q6DKQ9|Q75MH4|Q75MH5|Q96JN4|Q9H4A0|Q9H4A1|Q9UDR4	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.I682K	ENST00000181839.4	37	c.2045	CCDS5461.1	7	.	.	.	.	.	.	.	.	.	.	T	28.4	4.921291	0.92249	.	.	ENSG00000065883	ENST00000181839;ENST00000340829	T;T	0.74632	-0.86;-0.76	5.43	5.43	0.79202	.	.	.	.	.	D	0.84529	0.5492	M	0.68317	2.08	0.80722	D	1	D;D;D	0.89917	0.992;1.0;0.999	D;D;D	0.85130	0.918;0.997;0.96	D	0.84781	0.0773	8	.	.	.	-12.9401	15.4922	0.75615	0.0:0.0:0.0:1.0	.	68;682;682	Q9BVE2;Q14004-2;Q14004	.;.;CDK13_HUMAN	K	682	ENSP00000181839:I682K;ENSP00000340557:I682K	.	I	+	2	0	CDK13	40005487	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.032000	0.88838	2.064000	0.61679	0.523000	0.50628	ATA	CDK13	-	NULL	ENSG00000065883		0.333	CDK13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDK13	HGNC	protein_coding	OTTHUMT00000250726.2	106	0.00	0	T	NM_003718		40038962	40038962	+1	no_errors	ENST00000181839	ensembl	human	known	69_37n	missense	99	18.85	23	SNP	1.000	A
CDK6	1021	genome.wustl.edu	37	7	92355060	92355060	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr7:92355060G>T	ENST00000265734.4	-	4	828	c.417C>A	c.(415-417)caC>caA	p.H139Q	CDK6_ENST00000424848.2_Missense_Mutation_p.H139Q	NM_001259.6	NP_001250.1	Q00534	CDK6_HUMAN	cyclin-dependent kinase 6	139	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				astrocyte development (GO:0014002)|cell cycle arrest (GO:0007050)|cell dedifferentiation (GO:0043697)|cell division (GO:0051301)|dentate gyrus development (GO:0021542)|G1/S transition of mitotic cell cycle (GO:0000082)|generation of neurons (GO:0048699)|gliogenesis (GO:0042063)|hematopoietic stem cell differentiation (GO:0060218)|lateral ventricle development (GO:0021670)|mitotic cell cycle (GO:0000278)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell differentiation (GO:0045596)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular senescence (GO:2000773)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of osteoblast differentiation (GO:0045668)|Notch signaling pathway (GO:0007219)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of gene expression (GO:0010628)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of erythrocyte differentiation (GO:0045646)|regulation of gene expression (GO:0010468)|response to virus (GO:0009615)|T cell differentiation in thymus (GO:0033077)|type B pancreatic cell development (GO:0003323)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|ruffle (GO:0001726)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|urinary_tract(1)	11	all_cancers(62;8.72e-12)|all_epithelial(64;3.65e-10)|Breast(17;0.000675)|all_lung(186;0.0392)|Lung NSC(181;0.053)|all_neural(327;0.219)|all_hematologic(106;0.237)		STAD - Stomach adenocarcinoma(4;6.16e-07)|GBM - Glioblastoma multiforme(5;1.2e-06)|all cancers(6;3.1e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			GCACTACTCGGTGTGAATGAA	0.423			T	MLLT10	ALL																																	dbGAP		Dom	yes		7	7q21-q22	1021	cyclin-dependent kinase 6		L	0													170.0	162.0	164.0					7																	92355060		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5628.1	7q21-q22	2011-11-08			ENSG00000105810	ENSG00000105810		"""Cyclin-dependent kinases"""	1777	protein-coding gene	gene with protein product		603368				1639063	Standard	NM_001259		Approved	PLSTIRE	uc010lez.3	Q00534	OTTHUMG00000131697	ENST00000265734.4:c.417C>A	7.37:g.92355060G>T	ENSP00000265734:p.His139Gln		A4D1G0	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.H139Q	ENST00000265734.4	37	c.417	CCDS5628.1	7	.	.	.	.	.	.	.	.	.	.	G	21.9	4.214141	0.79352	.	.	ENSG00000105810	ENST00000265734;ENST00000424848	T;T	0.63580	-0.05;-0.05	5.89	5.89	0.94794	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.48804	0.1520	N	0.04705	-0.18	0.80722	D	1	P	0.48350	0.909	P	0.51385	0.668	T	0.55335	-0.8157	10	0.72032	D	0.01	-8.8365	7.7288	0.28775	0.1903:0.0:0.8097:0.0	.	139	Q00534	CDK6_HUMAN	Q	139	ENSP00000265734:H139Q;ENSP00000397087:H139Q	ENSP00000265734:H139Q	H	-	3	2	CDK6	92192996	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.864000	0.62990	2.788000	0.95919	0.557000	0.71058	CAC	CDK6	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000105810		0.423	CDK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK6	HGNC	protein_coding	OTTHUMT00000254605.2	205	0.00	0	G			92355060	92355060	-1	no_errors	ENST00000265734	ensembl	human	known	69_37n	missense	102	22.14	29	SNP	1.000	T
CRIPAK	285464	genome.wustl.edu	37	4	1388622	1388623	+	Frame_Shift_Ins	INS	-	-	CA	rs79704405|rs540461234|rs558358960	byFrequency	TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr4:1388622_1388623insCA	ENST00000324803.4	+	1	3283_3284	c.323_324insCA	c.(322-327)ctcacgfs	p.LT108fs		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	108					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.L108H(1)		NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			GCCCGCCTGCTCACGTGCCCAT	0.668														506	0.101038	0.0567	0.1427	5008	,	,		19207	0.0169		0.1759	False		,,,				2504	0.1411					dbGAP											1	Substitution - Missense(1)	pancreas(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.324_325dupCA	4.37:g.1388623_1388624dupCA	ENSP00000323978:p.Leu108fs		Q8NB03	Frame_Shift_Ins	INS	smart_Post-SET_dom	p.C110fs	ENST00000324803.4	37	c.323_324	CCDS3349.1	4																																																																																			CRIPAK	-	smart_Post-SET_dom	ENSG00000179979		0.668	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRIPAK	HGNC	protein_coding	OTTHUMT00000241607.2	8	0.00	0	-	NM_175918		1388622	1388623	+1	no_errors	ENST00000324803	ensembl	human	known	69_37n	frame_shift_ins	7	30.00	3	INS	0.001:0.028	CA
CYP24A1	1591	genome.wustl.edu	37	20	52782317	52782317	+	Silent	SNP	C	C	A			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr20:52782317C>A	ENST00000216862.3	-	5	1089	c.696G>T	c.(694-696)ggG>ggT	p.G232G	CYP24A1_ENST00000395954.3_Silent_p.G90G|CYP24A1_ENST00000395955.3_Silent_p.G232G	NM_000782.4	NP_000773.2	Q07973	CP24A_HUMAN	cytochrome P450, family 24, subfamily A, polypeptide 1	232					osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|response to vitamin D (GO:0033280)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D catabolic process (GO:0042369)|vitamin D metabolic process (GO:0042359)|vitamin D receptor signaling pathway (GO:0070561)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)	1-alpha,25-dihydroxyvitamin D3 24-hydroxylase activity (GO:0030342)|25-hydroxycholecalciferol-24-hydroxylase activity (GO:0008403)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)			breast(2)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Lung NSC(4;1.08e-05)|all_lung(4;2.7e-05)		STAD - Stomach adenocarcinoma(23;0.206)		Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Corticotropin(DB01285)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	CAGCTTCATCCCCTGCATTCT	0.388																																						dbGAP											0													132.0	118.0	123.0					20																	52782317		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U60669	CCDS33491.1, CCDS46616.1	20q13.2-q13.3	2003-02-28	2003-02-14	2003-02-28	ENSG00000019186	ENSG00000019186		"""Cytochrome P450s"""	2602	protein-coding gene	gene with protein product		126065	"""cytochrome P450, subfamily XXIV (vitamin D 24-hydroxylase)"""	CYP24			Standard	NM_000782		Approved	CP24, P450-CC24	uc002xwv.2	Q07973	OTTHUMG00000032773	ENST00000216862.3:c.696G>T	20.37:g.52782317C>A			Q15807|Q32ML3|Q5I2W7	Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_CYP24A_mit,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450	p.G232	ENST00000216862.3	37	c.696	CCDS33491.1	20																																																																																			CYP24A1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000019186		0.388	CYP24A1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP24A1	HGNC	protein_coding	OTTHUMT00000079769.2	122	0.00	0	C			52782317	52782317	-1	no_errors	ENST00000216862	ensembl	human	known	69_37n	silent	176	13.24	27	SNP	0.000	A
DENND2C	163259	genome.wustl.edu	37	1	115168526	115168526	+	Missense_Mutation	SNP	T	T	A			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr1:115168526T>A	ENST00000393274.1	-	4	705	c.80A>T	c.(79-81)cAa>cTa	p.Q27L	DENND2C_ENST00000393277.1_Missense_Mutation_p.Q27L|DENND2C_ENST00000481894.1_5'Flank|DENND2C_ENST00000393276.3_Missense_Mutation_p.Q27L	NM_001256404.1	NP_001243333.1	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C	27					positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|skin(3)	37	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCCTTCCCATTGAGAAATTTT	0.403																																						dbGAP											0													127.0	131.0	130.0					1																	115168526		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS875.1, CCDS58018.1	1p13.2-p13.1	2012-10-03			ENSG00000175984	ENSG00000175984		"""DENN/MADD domain containing"""	24748	protein-coding gene	gene with protein product							Standard	NM_198459		Approved	FLJ37099, DKFZp686G0351, DKFZp779P1149, dJ1156J9.1, RP5-1156J9.1	uc001efd.1	Q68D51	OTTHUMG00000011893	ENST00000393274.1:c.80A>T	1.37:g.115168526T>A	ENSP00000376955:p.Gln27Leu		B1AL26|Q5TCX6|Q6P3R3	Missense_Mutation	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.Q27L	ENST00000393274.1	37	c.80	CCDS58018.1	1	.	.	.	.	.	.	.	.	.	.	T	19.08	3.757732	0.69648	.	.	ENSG00000175984	ENST00000393276;ENST00000393274;ENST00000369540;ENST00000393277	T;T;T	0.11495	3.32;3.51;2.77	5.71	5.71	0.89125	.	0.391734	0.28566	N	0.014895	T	0.09423	0.0232	L	0.56769	1.78	0.50171	D	0.999852	P;B	0.36753	0.568;0.21	B;B	0.39339	0.297;0.208	T	0.01557	-1.1325	10	0.72032	D	0.01	.	16.0314	0.80579	0.0:0.0:0.0:1.0	.	27;27	Q68D51;Q68D51-3	DEN2C_HUMAN;.	L	27	ENSP00000376957:Q27L;ENSP00000376955:Q27L;ENSP00000376958:Q27L	ENSP00000358553:Q27L	Q	-	2	0	DENND2C	114970049	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.442000	0.66575	2.187000	0.69744	0.524000	0.50904	CAA	DENND2C	-	NULL	ENSG00000175984		0.403	DENND2C-005	KNOWN	basic|CCDS	protein_coding	DENND2C	HGNC	protein_coding	OTTHUMT00000314822.1	136	0.73	1	T	NM_198459		115168526	115168526	-1	no_errors	ENST00000393274	ensembl	human	known	69_37n	missense	72	49.30	70	SNP	1.000	A
DNAH12	201625	genome.wustl.edu	37	3	57330424	57330424	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr3:57330424C>G	ENST00000351747.2	-	57	9148	c.8968G>C	c.(8968-8970)Ggt>Cgt	p.G2990R	DNAH12_ENST00000344804.4_Missense_Mutation_p.G577R|DNAH12_ENST00000462713.1_5'UTR	NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	2990	AAA 5. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						ATATAAACACCATCTTCTGGT	0.473																																						dbGAP											0													136.0	117.0	123.0					3																	57330424		692	1591	2283	-	-	-	SO:0001583	missense	0			U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.8968G>C	3.37:g.57330424C>G	ENSP00000295937:p.Gly2990Arg		A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.G2990R	ENST00000351747.2	37	c.8968		3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.17|17.17	3.322422|3.322422	0.60634|0.60634	.|.	.|.	ENSG00000174844|ENSG00000174844	ENST00000351747;ENST00000466540;ENST00000344804|ENST00000462199	T;T;T|.	0.13089|.	2.62;2.62;2.62|.	4.88|4.88	4.88|4.88	0.63580|0.63580	Dynein heavy chain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.91616|0.91616	0.7351|0.7351	H|H	0.99590|0.99590	4.645|4.645	0.44728|0.44728	D|D	0.997724|0.997724	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.998;0.999|.	D|D	0.95496|0.95496	0.8573|0.8573	10|5	0.87932|.	D|.	0|.	.|.	18.4301|18.4301	0.90622|0.90622	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	577;2990|.	Q6ZR08-2;Q6ZR08|.	.;DYH12_HUMAN|.	R|S	2990;635;577|680	ENSP00000295937:G2990R;ENSP00000420359:G635R;ENSP00000340464:G577R|.	ENSP00000340464:G577R|.	G|W	-|-	1|2	0|0	DNAH12|DNAH12	57305464|57305464	1.000000|1.000000	0.71417|0.71417	0.147000|0.147000	0.22382|0.22382	0.016000|0.016000	0.09150|0.09150	7.495000|7.495000	0.81514|0.81514	2.409000|2.409000	0.81822|0.81822	0.655000|0.655000	0.94253|0.94253	GGT|TGG	DNAH12	-	pfam_Dynein_heavy	ENSG00000174844		0.473	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	DNAH12	HGNC	protein_coding		156	0.00	0	C	NM_178504		57330424	57330424	-1	no_errors	ENST00000351747	ensembl	human	known	69_37n	missense	115	43.07	87	SNP	1.000	G
DLG1	1739	genome.wustl.edu	37	3	197024060	197024060	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr3:197024060G>C	ENST00000419354.1	-	2	302	c.16C>G	c.(16-18)Caa>Gaa	p.Q6E	DLG1_ENST00000448528.2_Missense_Mutation_p.Q6E|DLG1_ENST00000485409.1_5'Flank|DLG1_ENST00000346964.2_Missense_Mutation_p.Q6E|DLG1_ENST00000422288.1_Missense_Mutation_p.Q6E|DLG1-AS1_ENST00000414529.1_RNA|DLG1_ENST00000450955.1_Missense_Mutation_p.Q6E|DLG1_ENST00000357674.4_Missense_Mutation_p.Q6E|DLG1_ENST00000314062.3_Missense_Mutation_p.Q6E|DLG1-AS1_ENST00000430666.1_RNA|DLG1_ENST00000392382.2_Missense_Mutation_p.Q6E			Q12959	DLG1_HUMAN	discs, large homolog 1 (Drosophila)	6	L27. {ECO:0000255|PROSITE- ProRule:PRU00365}.				actin filament organization (GO:0007015)|activation of protein kinase activity (GO:0032147)|amyloid precursor protein metabolic process (GO:0042982)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|cortical actin cytoskeleton organization (GO:0030866)|dephosphorylation (GO:0016311)|embryonic skeletal system morphogenesis (GO:0048704)|endothelial cell proliferation (GO:0001935)|establishment or maintenance of cell polarity (GO:0007163)|hard palate development (GO:0060022)|immunological synapse formation (GO:0001771)|lens development in camera-type eye (GO:0002088)|membrane raft organization (GO:0031579)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell proliferation (GO:0042130)|nucleotide phosphorylation (GO:0046939)|peristalsis (GO:0030432)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell proliferation (GO:0008284)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|protein localization to plasma membrane (GO:0072659)|regulation of membrane potential (GO:0042391)|regulation of myelination (GO:0031641)|regulation of sodium ion transmembrane transport (GO:1902305)|reproductive structure development (GO:0048608)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|synaptic transmission (GO:0007268)|T cell activation (GO:0042110)|T cell cytokine production (GO:0002369)|tight junction assembly (GO:0070830)|viral process (GO:0016032)	basal lamina (GO:0005605)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell projection membrane (GO:0031253)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|immunological synapse (GO:0001772)|intercalated disc (GO:0014704)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|membrane raft (GO:0045121)|microtubule (GO:0005874)|MPP7-DLG1-LIN7 complex (GO:0097025)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	cytoskeletal protein binding (GO:0008092)|guanylate kinase activity (GO:0004385)|ion channel binding (GO:0044325)|L27 domain binding (GO:0097016)|mitogen-activated protein kinase kinase binding (GO:0031434)|phosphatase binding (GO:0019902)|phosphoprotein phosphatase activity (GO:0004721)|potassium channel regulator activity (GO:0015459)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	26	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		CTCTCACCTTGCTTCCGGACC	0.403																																						dbGAP											0													109.0	106.0	107.0					3																	197024060		2203	4300	6503	-	-	-	SO:0001583	missense	0			U13897	CCDS3327.1, CCDS43194.1, CCDS56300.1, CCDS56301.1, CCDS75072.1	3q29	2008-12-15	2001-11-28		ENSG00000075711	ENSG00000075711			2900	protein-coding gene	gene with protein product	"""discs large homolog 1"", ""presynaptic protein SAP97"", ""synapse-associated protein 97"""	601014	"""discs, large (Drosophila) homolog 1"""			7937897, 8825652	Standard	NM_004087		Approved	SAP97, SAP-97, hdlg, DLGH1, dJ1061C18.1.1	uc003fxn.4	Q12959	OTTHUMG00000047972	ENST00000419354.1:c.16C>G	3.37:g.197024060G>C	ENSP00000407531:p.Gln6Glu		A5YKK7|B4DGU1|B4DGZ8|B7ZMM0|B9EIQ5|D3DXB8|D3DXB9|E7EWL7|E9PG21|Q12958	Missense_Mutation	SNP	pfam_Guanylate_kin,pfam_PDZ,pfam_MAGUK_PEST_N,pfam_L27_1,pfam_PDZ_assoc,pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_PDZ,smart_L27,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pirsf_M-assoc_guanylate_kinase,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin	p.Q6E	ENST00000419354.1	37	c.16	CCDS43194.1	3	.	.	.	.	.	.	.	.	.	.	G	12.38	1.920663	0.33908	.	.	ENSG00000075711	ENST00000346964;ENST00000359922;ENST00000357674;ENST00000381807;ENST00000314062;ENST00000419354;ENST00000422288;ENST00000448528;ENST00000392382;ENST00000450955;ENST00000456699;ENST00000392380;ENST00000419553;ENST00000436682;ENST00000412364;ENST00000434148	T;T;T;T;T;T;T;T;T;T;T	0.42900	2.64;2.63;2.6;2.64;2.6;2.64;2.64;2.63;0.96;0.96;0.96	4.33	3.43	0.39272	L27 (1);L27-1 (1);	0.537909	0.16686	U	0.203743	T	0.25306	0.0615	N	0.12887	0.27	0.43489	D	0.995727	B;B;B;B	0.16802	0.015;0.006;0.019;0.002	B;B;B;B	0.19666	0.022;0.01;0.026;0.001	T	0.06356	-1.0831	10	0.42905	T	0.14	.	10.1815	0.42970	0.0:0.2018:0.7982:0.0	.	6;6;6;6	Q12959-4;Q12959-3;Q12959;Q12959-2	.;.;DLG1_HUMAN;.	E	6	ENSP00000345731:Q6E;ENSP00000350303:Q6E;ENSP00000321087:Q6E;ENSP00000407531:Q6E;ENSP00000413238:Q6E;ENSP00000391732:Q6E;ENSP00000376187:Q6E;ENSP00000411278:Q6E;ENSP00000396474:Q6E;ENSP00000376185:Q6E;ENSP00000414189:Q6E	ENSP00000321087:Q6E	Q	-	1	0	DLG1	198508457	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	3.017000	0.49615	1.369000	0.46134	0.650000	0.86243	CAA	DLG1	-	pfam_L27_1,pirsf_M-assoc_guanylate_kinase,pfscan_L27	ENSG00000075711		0.403	DLG1-008	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	DLG1	HGNC	protein_coding	OTTHUMT00000258170.2	176	0.00	0	G	NM_004087		197024060	197024060	-1	no_errors	ENST00000346964	ensembl	human	known	69_37n	missense	112	20.00	28	SNP	1.000	C
DOCK9	23348	genome.wustl.edu	37	13	99536130	99536130	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr13:99536130C>A	ENST00000376460.1	-	22	2486	c.2406G>T	c.(2404-2406)tgG>tgT	p.W802C	DOCK9_ENST00000448493.2_Missense_Mutation_p.W814C|DOCK9_ENST00000339416.2_Missense_Mutation_p.W803C|DOCK9_ENST00000442173.1_Missense_Mutation_p.W802C	NM_001130048.1|NM_015296.2	NP_001123520.1|NP_056111.1	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9	803	DHR-1.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(18)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CTCCATCTACCCATTTAATTT	0.383																																						dbGAP											0													61.0	60.0	61.0					13																	99536130		1847	4085	5932	-	-	-	SO:0001583	missense	0			AF527605	CCDS45062.1	13q32.3	2013-01-10			ENSG00000088387	ENSG00000088387		"""Pleckstrin homology (PH) domain containing"""	14132	protein-coding gene	gene with protein product	"""zizimin1"""	607325				12172552, 12432077	Standard	NM_015296		Approved	KIAA1058, ZIZ1	uc001vnt.2	Q9BZ29	OTTHUMG00000017260	ENST00000376460.1:c.2406G>T	13.37:g.99536130C>A	ENSP00000365643:p.Trp802Cys		B3KX25|E9PFM9|Q5JUD4|Q5JUD6|Q5T2Q1|Q5TAN8|Q9BZ25|Q9BZ26|Q9BZ27|Q9BZ28|Q9UPU4	Missense_Mutation	SNP	pfam_DOCK,pfam_DUF3398,pfam_Pleckstrin_homology,superfamily_ARM-type_fold,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.W803C	ENST00000376460.1	37	c.2409	CCDS45062.1	13	.	.	.	.	.	.	.	.	.	.	C	22.3	4.265370	0.80358	.	.	ENSG00000088387	ENST00000376460;ENST00000357329;ENST00000376455;ENST00000400235;ENST00000428223;ENST00000339416;ENST00000448493;ENST00000442173	T;T;T;T	0.14640	2.49;2.49;2.49;2.49	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.46983	0.1421	M	0.88906	2.99	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;0.999;1.0	T	0.55685	-0.8102	10	0.87932	D	0	.	19.2291	0.93831	0.0:1.0:0.0:0.0	.	803;802;802;802;803	A6H8Z6;E9PFM9;B3KX25;Q9BZ29-5;Q9BZ29	.;.;.;.;DOCK9_HUMAN	C	802;803;803;803;802;803;814;802	ENSP00000365643:W802C;ENSP00000341086:W803C;ENSP00000401958:W814C;ENSP00000406883:W802C	ENSP00000341086:W803C	W	-	3	0	DOCK9	98334131	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.445000	0.80570	2.614000	0.88457	0.655000	0.94253	TGG	DOCK9	-	NULL	ENSG00000088387		0.383	DOCK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK9	HGNC	protein_coding	OTTHUMT00000045566.1	160	0.00	0	C	NM_015296		99536130	99536130	-1	no_errors	ENST00000339416	ensembl	human	known	69_37n	missense	90	40.00	60	SNP	1.000	A
DROSHA	29102	genome.wustl.edu	37	5	31526930	31526930	+	Missense_Mutation	SNP	T	T	G	rs569160930		TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr5:31526930T>G	ENST00000511367.2	-	4	354	c.110A>C	c.(109-111)cAa>cCa	p.Q37P	DROSHA_ENST00000442743.1_Missense_Mutation_p.Q37P|DROSHA_ENST00000504361.1_5'UTR|DROSHA_ENST00000513349.1_Missense_Mutation_p.Q37P|DROSHA_ENST00000344624.3_Missense_Mutation_p.Q37P	NM_013235.4	NP_037367.3	Q9NRR4	RNC_HUMAN	drosha, ribonuclease type III	37	Pro-rich.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|gene expression (GO:0010467)|miRNA metabolic process (GO:0010586)|pre-miRNA processing (GO:0031054)|primary miRNA processing (GO:0031053)|ribosome biogenesis (GO:0042254)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA catabolic process (GO:0016075)	nucleoplasm (GO:0005654)	lipopolysaccharide binding (GO:0001530)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)			breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(19)|lung(33)|ovary(2)|skin(1)	66						CCTCAGATTTTGGGGCCTAAA	0.562													T|||	1	0.000199681	0.0	0.0	5008	,	,		13641	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													49.0	53.0	52.0					5																	31526930		1988	4155	6143	-	-	-	SO:0001583	missense	0			AF116910	CCDS47194.1, CCDS47195.1	5q11.2	2010-11-17	2010-10-28	2010-10-28	ENSG00000113360	ENSG00000113360	3.1.26.3		17904	protein-coding gene	gene with protein product	"""drosha, ribonuclease type III"", ""drosha, double-stranded RNA-specific endoribonuclease"""	608828	"""ribonuclease type III, nuclear"""	RNASEN		10713462, 10948199	Standard	NM_013235		Approved	RNASE3L, Etohi2, HSA242976, RN3	uc003jhg.2	Q9NRR4	OTTHUMG00000161976	ENST00000511367.2:c.110A>C	5.37:g.31526930T>G	ENSP00000425979:p.Gln37Pro		E7EMP9|Q7Z5V2|Q86YH0|Q9NW73|Q9Y2V9|Q9Y4Y0	Missense_Mutation	SNP	pfam_RNase_III_dom,pfam_Ds-RNA-bd,superfamily_RNase_III_dom,smart_RNase_III_dom,smart_Ds-RNA-bd,pfscan_Ds-RNA-bd,pfscan_RNase_III_dom	p.Q37P	ENST00000511367.2	37	c.110	CCDS47195.1	5	.	.	.	.	.	.	.	.	.	.	T	12.91	2.078868	0.36662	.	.	ENSG00000113360	ENST00000511367;ENST00000344624;ENST00000442743;ENST00000513349;ENST00000265075;ENST00000382188;ENST00000507438	T;T;T;T;T	0.50548	1.34;1.34;0.76;0.76;0.74	5.04	3.88	0.44766	.	0.301740	0.28465	N	0.015242	T	0.27205	0.0667	N	0.14661	0.345	0.37192	D	0.903975	P;P;P	0.46912	0.886;0.666;0.666	B;B;B	0.37888	0.26;0.099;0.099	T	0.15178	-1.0446	10	0.35671	T	0.21	-13.8678	10.4722	0.44644	0.0:0.0765:0.0:0.9235	.	37;37;37	Q9NRR4-2;E7EMP9;Q9NRR4	.;.;RNC_HUMAN	P	37;37;37;37;30;30;37	ENSP00000425979:Q37P;ENSP00000339845:Q37P;ENSP00000409335:Q37P;ENSP00000424161:Q37P;ENSP00000430921:Q37P	ENSP00000265075:Q30P	Q	-	2	0	DROSHA	31562687	1.000000	0.71417	0.965000	0.40720	0.734000	0.41952	4.572000	0.60886	0.782000	0.33613	0.460000	0.39030	CAA	DROSHA	-	NULL	ENSG00000113360		0.562	DROSHA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DROSHA	HGNC	protein_coding	OTTHUMT00000366561.3	115	0.86	1	T	NM_013235		31526930	31526930	-1	no_errors	ENST00000344624	ensembl	human	known	69_37n	missense	162	25.00	54	SNP	0.988	G
DZIP3	9666	genome.wustl.edu	37	3	108361332	108361332	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr3:108361332C>T	ENST00000361582.3	+	13	1342	c.1112C>T	c.(1111-1113)cCg>cTg	p.P371L	DZIP3_ENST00000463306.1_Missense_Mutation_p.P371L	NM_014648.3	NP_055463.1	Q86Y13	DZIP3_HUMAN	DAZ interacting zinc finger protein 3	371					protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(21)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	45						GATATAAGACCGAAGATCAGT	0.244																																						dbGAP											0													18.0	17.0	17.0					3																	108361332		2089	4106	6195	-	-	-	SO:0001583	missense	0			AF279370	CCDS2952.1	3q13.13	2013-05-22	2013-05-22		ENSG00000198919	ENSG00000198919		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30938	protein-coding gene	gene with protein product	"""human RNA-binding ubiquitin ligase of 138 kDa"", ""protein phosphatase 1, regulatory subunit 66"""	608672	"""DAZ interacting protein 3, zinc finger"""			9734811, 12538761	Standard	NM_014648		Approved	hRUL138, PPP1R66	uc003dxd.3	Q86Y13	OTTHUMG00000159232	ENST00000361582.3:c.1112C>T	3.37:g.108361332C>T	ENSP00000355028:p.Pro371Leu		B3KN01|O75162|Q6P3R9|Q6PH82|Q86Y14|Q86Y15|Q86Y16|Q8IWI0|Q96RS9	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.P371L	ENST00000361582.3	37	c.1112	CCDS2952.1	3	.	.	.	.	.	.	.	.	.	.	C	13.20	2.166163	0.38217	.	.	ENSG00000198919	ENST00000361582;ENST00000479138;ENST00000463306	T;T;T	0.45276	0.9;0.9;0.9	4.93	3.1	0.35709	.	0.156498	0.30575	N	0.009324	T	0.20941	0.0504	N	0.19112	0.55	0.42518	D	0.992997	P;P	0.42161	0.772;0.76	B;B	0.32211	0.142;0.125	T	0.07102	-1.0790	10	0.87932	D	0	-1.5427	6.1738	0.20433	0.0:0.7096:0.1914:0.099	.	371;371	C9J9M8;Q86Y13	.;DZIP3_HUMAN	L	371	ENSP00000355028:P371L;ENSP00000418115:P371L;ENSP00000419981:P371L	ENSP00000355028:P371L	P	+	2	0	DZIP3	109844022	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.889000	0.39718	1.414000	0.47017	0.655000	0.94253	CCG	DZIP3	-	NULL	ENSG00000198919		0.244	DZIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DZIP3	HGNC	protein_coding	OTTHUMT00000353968.1	41	0.00	0	C	NM_014648		108361332	108361332	+1	no_errors	ENST00000361582	ensembl	human	known	69_37n	missense	20	33.33	10	SNP	1.000	T
EMILIN3	90187	genome.wustl.edu	37	20	39993701	39993701	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr20:39993701C>T	ENST00000332312.3	-	2	456	c.264G>A	c.(262-264)tgG>tgA	p.W88*		NM_052846.1	NP_443078.1	Q9NT22	EMIL3_HUMAN	elastin microfibril interfacer 3	88	EMI. {ECO:0000255|PROSITE- ProRule:PRU00384}.					cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)				biliary_tract(1)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(15)|ovary(1)|prostate(2)|skin(3)|urinary_tract(2)	30		Myeloproliferative disorder(115;0.00425)				ACTTGGGCCCCCATCTACACT	0.592																																						dbGAP											0													206.0	158.0	174.0					20																	39993701		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AL031667	CCDS13316.1	20q12	2005-11-06	2004-03-02	2004-03-02	ENSG00000183798	ENSG00000183798		"""EMI domain containing"""	16123	protein-coding gene	gene with protein product	"""chromosome 20 open reading frame 130"""	608929	"""elastin microfibril interfacer 5"""	C20orf130, EMILIN5		12221002	Standard	NM_052846		Approved	dJ620E11.4	uc002xjy.1	Q9NT22	OTTHUMG00000046304	ENST00000332312.3:c.264G>A	20.37:g.39993701C>T	ENSP00000332806:p.Trp88*		Q495S5|Q495S6|Q495S7|Q76KT4	Nonsense_Mutation	SNP	pfam_EMI_domain,pfscan_EMI_domain	p.W88*	ENST00000332312.3	37	c.264	CCDS13316.1	20	.	.	.	.	.	.	.	.	.	.	C	37	6.444284	0.97572	.	.	ENSG00000183798	ENST00000332312	.	.	.	4.48	4.48	0.54585	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-15.4248	17.3473	0.87313	0.0:1.0:0.0:0.0	.	.	.	.	X	88	.	.	W	-	3	0	EMILIN3	39427115	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.153000	0.50685	2.308000	0.77769	0.655000	0.94253	TGG	EMILIN3	-	pfam_EMI_domain,pfscan_EMI_domain	ENSG00000183798		0.592	EMILIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMILIN3	HGNC	protein_coding	OTTHUMT00000106876.2	33	0.00	0	C	XM_029741		39993701	39993701	-1	no_errors	ENST00000332312	ensembl	human	known	69_37n	nonsense	49	14.04	8	SNP	1.000	T
EYS	346007	genome.wustl.edu	37	6	66204693	66204693	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr6:66204693G>A	ENST00000370621.3	-	4	1137	c.611C>T	c.(610-612)cCt>cTt	p.P204L	EYS_ENST00000342421.5_Missense_Mutation_p.P204L|EYS_ENST00000393380.2_Missense_Mutation_p.P204L|EYS_ENST00000370618.3_Missense_Mutation_p.P204L|EYS_ENST00000503581.1_Missense_Mutation_p.P204L|EYS_ENST00000370616.2_Missense_Mutation_p.P204L			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	204	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.P204H(2)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						AGAAAATGGAGGCTGGCAATG	0.398																																						dbGAP											2	Substitution - Missense(2)	large_intestine(2)											47.0	45.0	46.0					6																	66204693		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.611C>T	6.37:g.66204693G>A	ENSP00000359655:p.Pro204Leu		A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF-like_dom,superfamily_ConA-like_lec_gl,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.P204L	ENST00000370621.3	37	c.611		6	.	.	.	.	.	.	.	.	.	.	G	11.84	1.758693	0.31137	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616;ENST00000393380;ENST00000342421;ENST00000370618	D;D;D;D;D;D	0.87650	-2.28;-2.28;-2.28;-2.28;-2.28;-2.28	4.81	1.96	0.26148	.	.	.	.	.	T	0.54565	0.1866	N	0.14661	0.345	0.29240	N	0.872674	B;B;P	0.38551	0.037;0.113;0.636	B;B;B	0.32533	0.018;0.063;0.147	T	0.45527	-0.9255	9	0.49607	T	0.09	.	4.949	0.14004	0.1806:0.0:0.6516:0.1678	.	204;204;204	Q5T1H1-1;Q5T1H1-2;Q5SZM4	.;.;.	L	204	ENSP00000424243:P204L;ENSP00000359655:P204L;ENSP00000359650:P204L;ENSP00000377042:P204L;ENSP00000341818:P204L;ENSP00000359652:P204L	ENSP00000341818:P204L	P	-	2	0	EYS	66261414	0.982000	0.34865	0.702000	0.30337	0.978000	0.69477	1.948000	0.40303	0.155000	0.19261	0.591000	0.81541	CCT	EYS	-	pfam_EGF-like_dom,smart_EGF-like,pfscan_EG-like_dom	ENSG00000188107		0.398	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3	59	0.00	0	G	XM_294050		66204693	66204693	-1	no_errors	ENST00000370616	ensembl	human	known	69_37n	missense	32	20.00	8	SNP	0.974	A
F5	2153	genome.wustl.edu	37	1	169510162	169510162	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr1:169510162C>T	ENST00000367797.3	-	13	4367	c.4166G>A	c.(4165-4167)aGt>aAt	p.S1389N	F5_ENST00000367796.3_Missense_Mutation_p.S1394N	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	1389	35 X 9 AA approximate tandem repeats of [TNP]-L-S-P-D-L-S-Q-T.|B.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	GGGCATCTCACTGAGGTCTGG	0.522																																						dbGAP											0													130.0	142.0	138.0					1																	169510162		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.4166G>A	1.37:g.169510162C>T	ENSP00000356771:p.Ser1389Asn		A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.S1394N	ENST00000367797.3	37	c.4181	CCDS1281.1	1	.	.	.	.	.	.	.	.	.	.	N	0.013	-1.634187	0.00806	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	T;T	0.31510	1.49;1.49	2.88	0.924	0.19418	.	1.079220	0.06946	N	0.813726	T	0.06735	0.0172	L	0.38175	1.15	0.20074	N	0.999935	B	0.30068	0.267	B	0.22386	0.039	T	0.33828	-0.9853	9	0.12103	T	0.63	-1.0889	6.3754	0.21505	0.0:0.7223:0.0:0.2777	.	1389	P12259	FA5_HUMAN	N	1389;1394	ENSP00000356771:S1389N;ENSP00000356770:S1394N	ENSP00000356770:S1394N	S	-	2	0	F5	167776786	0.018000	0.18449	0.001000	0.08648	0.007000	0.05969	0.380000	0.20602	0.261000	0.21753	0.563000	0.77884	AGT	F5	-	NULL	ENSG00000198734		0.522	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	F5	HGNC	protein_coding	OTTHUMT00000083712.1	341	0.00	0	C	NM_000130		169510162	169510162	-1	no_errors	ENST00000367796	ensembl	human	known	69_37n	missense	600	10.98	74	SNP	0.003	T
FAM168A	23201	genome.wustl.edu	37	11	73141811	73141811	+	Nonsense_Mutation	SNP	G	G	C			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr11:73141811G>C	ENST00000064778.4	-	3	359	c.75C>G	c.(73-75)taC>taG	p.Y25*	FAM168A_ENST00000356467.4_Nonsense_Mutation_p.Y25*|FAM168A_ENST00000450446.2_Nonsense_Mutation_p.Y25*			Q92567	F168A_HUMAN	family with sequence similarity 168, member A	25										endometrium(3)|kidney(1)|lung(1)	5						AGGCTGTGGGGTAACCTACAG	0.428																																						dbGAP											0													97.0	97.0	97.0					11																	73141811		1886	4117	6003	-	-	-	SO:0001587	stop_gained	0			BC014932	CCDS41689.1, CCDS66165.1, CCDS73346.1	11q13.4	2008-06-11	2008-06-11	2008-06-11		ENSG00000054965			28999	protein-coding gene	gene with protein product	"""tongue cancer chemotherapy resistance-associated protein 1"""		"""KIAA0280"""	KIAA0280			Standard	XM_005273852		Approved	TCRP1	uc001oty.1	Q92567		ENST00000064778.4:c.75C>G	11.37:g.73141811G>C	ENSP00000064778:p.Tyr25*		A2ICY2|A2ID81|Q86UG2	Nonsense_Mutation	SNP	NULL	p.Y25*	ENST00000064778.4	37	c.75		11	.	.	.	.	.	.	.	.	.	.	G	24.9	4.581086	0.86748	.	.	ENSG00000054965	ENST00000064778;ENST00000450446;ENST00000356467	.	.	.	5.71	3.78	0.43462	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.3825	0.26864	0.2814:0.0:0.7186:0.0	.	.	.	.	X	25	.	ENSP00000064778:Y25X	Y	-	3	2	FAM168A	72819459	0.995000	0.38212	1.000000	0.80357	0.988000	0.76386	0.064000	0.14437	0.714000	0.32081	-0.150000	0.13652	TAC	FAM168A	-	NULL	ENSG00000054965		0.428	FAM168A-003	KNOWN	basic	protein_coding	FAM168A	HGNC	protein_coding	OTTHUMT00000397424.1	267	0.00	0	G	NM_015159		73141811	73141811	-1	no_errors	ENST00000064778	ensembl	human	known	69_37n	nonsense	168	33.07	83	SNP	1.000	C
FAM71E2	284418	genome.wustl.edu	37	19	55871345	55871345	+	Silent	SNP	G	G	C			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr19:55871345G>C	ENST00000424985.3	-	9	1084	c.891C>G	c.(889-891)gcC>gcG	p.A297A	CTD-2105E13.6_ENST00000591954.3_5'Flank	NM_001145402.1	NP_001138874.1	Q8N5Q1	F71E2_HUMAN	family with sequence similarity 71, member E2	297										NS(1)|breast(3)|endometrium(2)|kidney(1)|skin(1)	8						CAGATGTGCAGGCCTGTAGGT	0.597																																						dbGAP											0													30.0	27.0	28.0					19																	55871345		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AL834316		19q13.42	2014-04-02	2007-11-20	2007-11-20	ENSG00000180043	ENSG00000180043			25278	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 16"""	C19orf16			Standard	NM_001145402		Approved	DKFZp434G1729	uc002qkr.2	Q8N5Q1	OTTHUMG00000170357	ENST00000424985.3:c.891C>G	19.37:g.55871345G>C			Q8ND99	Silent	SNP	pfam_DUF3699	p.A297	ENST00000424985.3	37	c.891		19																																																																																			FAM71E2	-	NULL	ENSG00000180043		0.597	FAM71E2-010	NOVEL	basic|appris_principal	protein_coding	FAM71E2	HGNC	protein_coding	OTTHUMT00000409063.4	20	0.00	0	G	NM_001145402		55871345	55871345	-1	no_errors	ENST00000424985	ensembl	human	novel	69_37n	silent	11	26.67	4	SNP	0.000	C
FCRL2	79368	genome.wustl.edu	37	1	157739898	157739898	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr1:157739898G>C	ENST00000361516.3	-	4	401	c.353C>G	c.(352-354)cCc>cGc	p.P118R	FCRL2_ENST00000392274.3_Missense_Mutation_p.P118R|FCRL2_ENST00000368181.4_Intron|FCRL2_ENST00000469986.1_5'Flank	NM_030764.3	NP_110391.2	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2	118	Ig-like C2-type 2.				cell-cell signaling (GO:0007267)|positive regulation of signal transduction (GO:0009967)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|skin(2)	51	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CCCTTCGATGGGCTGGAAGGA	0.517																																						dbGAP											0													46.0	48.0	47.0					1																	157739898		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF319438	CCDS1168.1	1q23.1	2013-01-14	2002-01-14	2005-03-23	ENSG00000132704	ENSG00000132704		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14875	protein-coding gene	gene with protein product		606509	"""SH2 domain-containing phosphatase anchor protein 1"""	SPAP1		11162587	Standard	NM_030764		Approved	FCRH2, IRTA4, CD307b	uc001fre.2	Q96LA5	OTTHUMG00000019399	ENST00000361516.3:c.353C>G	1.37:g.157739898G>C	ENSP00000355157:p.Pro118Arg		A0N0M5|A1L307|A6NMS0|Q6NTA1|Q9BZI4|Q9BZI5|Q9BZI6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.P118R	ENST00000361516.3	37	c.353	CCDS1168.1	1	.	.	.	.	.	.	.	.	.	.	G	19.26	3.792819	0.70452	.	.	ENSG00000132704	ENST00000361516;ENST00000392274	T;T	0.11169	2.8;2.8	4.46	4.46	0.54185	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.34828	U	0.003648	T	0.26702	0.0653	M	0.88775	2.98	0.09310	N	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.995;0.995	T	0.05801	-1.0863	10	0.59425	D	0.04	.	12.8016	0.57588	0.0:0.0:1.0:0.0	.	118;118;118	B4E0W2;B4DVJ9;Q96LA5	.;.;FCRL2_HUMAN	R	118	ENSP00000355157:P118R;ENSP00000376100:P118R	ENSP00000355157:P118R	P	-	2	0	FCRL2	156006522	0.004000	0.15560	0.179000	0.23059	0.477000	0.33069	0.865000	0.27940	2.462000	0.83206	0.591000	0.81541	CCC	FCRL2	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000132704		0.517	FCRL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCRL2	HGNC	protein_coding	OTTHUMT00000051408.2	63	0.00	0	G	NM_030764		157739898	157739898	-1	no_errors	ENST00000361516	ensembl	human	known	69_37n	missense	126	16.00	24	SNP	0.164	C
FLT3LG	2323	genome.wustl.edu	37	19	49982165	49982166	+	Splice_Site	INS	-	-	C			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr19:49982165_49982166insC	ENST00000594009.1	+	5	421_422		c.e5-1		FLT3LG_ENST00000600429.1_Splice_Site|FLT3LG_ENST00000597551.1_Splice_Site|CTD-3148I10.9_ENST00000599536.1_Intron|FLT3LG_ENST00000595510.1_Splice_Site|FLT3LG_ENST00000344019.3_Splice_Site|CTD-3148I10.15_ENST00000595815.1_RNA|FLT3LG_ENST00000596435.1_Intron|FLT3LG_ENST00000204637.2_Splice_Site	NM_001204503.1	NP_001191432.1	P49771	FLT3L_HUMAN	fms-related tyrosine kinase 3 ligand						embryonic hemopoiesis (GO:0035162)|lymphocyte differentiation (GO:0030098)|positive regulation of cell proliferation (GO:0008284)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of protein phosphorylation (GO:0001934)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|intrinsic component of external side of plasma membrane (GO:0031233)|membrane (GO:0016020)	receptor binding (GO:0005102)	p.S118fs*24(1)		large_intestine(2)|lung(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	10		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00154)|GBM - Glioblastoma multiforme(486;0.0246)		CCTGCTCCCAGCCCCCCCCCAG	0.688																																						dbGAP											1	Deletion - Frameshift(1)	upper_aerodigestive_tract(1)																																								-	-	-	SO:0001630	splice_region_variant	0			U04806	CCDS12767.1, CCDS62753.1	19q13.3	2014-01-30				ENSG00000090554		"""Endogenous ligands"""	3766	protein-coding gene	gene with protein product		600007				8145851, 7824267	Standard	NM_001204502		Approved		uc010yau.2	P49771		ENST00000594009.1:c.343-1->C	19.37:g.49982174_49982174dupC			A0AVC2|B9EGH2|Q05C96	Frame_Shift_Ins	INS	pfam_Flt3_lig,superfamily_4_helix_cytokine-like_core	p.S118fs	ENST00000594009.1	37	c.344_343	CCDS12767.1	19																																																																																			FLT3LG	-	pfam_Flt3_lig,superfamily_4_helix_cytokine-like_core	ENSG00000090554		0.688	FLT3LG-007	KNOWN	alternative_3_UTR|alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FLT3LG	HGNC	protein_coding	OTTHUMT00000465305.1	21	0.00	0	-		Intron	49982165	49982166	+1	no_errors	ENST00000204637	ensembl	human	known	69_37n	frame_shift_ins	44	12.00	6	INS	1.000:1.000	C
FMO4	2329	genome.wustl.edu	37	1	171293331	171293331	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr1:171293331G>A	ENST00000367749.3	+	5	706	c.376G>A	c.(376-378)Gat>Aat	p.D126N	FMO4_ENST00000462992.1_3'UTR	NM_002022.1	NP_002013.1	P31512	FMO4_HUMAN	flavin containing monooxygenase 4	126					drug catabolic process (GO:0042737)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	33	all_cancers(6;3.9e-08)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					TGGTCAGTGGGATGTTGTCAC	0.463																																					Pancreas(24;816 862 7754 7993 32832)	dbGAP											0													424.0	395.0	405.0					1																	171293331		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC002780	CCDS1295.1	1q24.3	2011-08-04			ENSG00000076258	ENSG00000076258	1.14.13.8		3772	protein-coding gene	gene with protein product		136131		FMO2		8311461	Standard	NM_002022		Approved		uc001gho.3	P31512	OTTHUMG00000035506	ENST00000367749.3:c.376G>A	1.37:g.171293331G>A	ENSP00000356723:p.Asp126Asn		Q53XR0	Missense_Mutation	SNP	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase,prints_Flavin_mOase_4,prints_Flavin_mOase_1,prints_Flavin_mOase_3	p.D126N	ENST00000367749.3	37	c.376	CCDS1295.1	1	.	.	.	.	.	.	.	.	.	.	G	18.30	3.592744	0.66219	.	.	ENSG00000076258	ENST00000367749	T	0.56275	0.47	5.93	3.05	0.35203	.	0.338839	0.34133	N	0.004230	T	0.28466	0.0704	L	0.49778	1.585	0.45594	D	0.998531	B	0.18741	0.03	B	0.25884	0.064	T	0.08722	-1.0708	10	0.39692	T	0.17	-4.6193	9.6319	0.39785	0.1106:0.122:0.7674:0.0	.	126	P31512	FMO4_HUMAN	N	126	ENSP00000356723:D126N	ENSP00000356723:D126N	D	+	1	0	FMO4	169559955	1.000000	0.71417	0.959000	0.39883	0.963000	0.63663	3.798000	0.55522	0.404000	0.25506	0.655000	0.94253	GAT	FMO4	-	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase	ENSG00000076258		0.463	FMO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMO4	HGNC	protein_coding	OTTHUMT00000086223.1	302	0.00	0	G	NM_002022		171293331	171293331	+1	no_errors	ENST00000367749	ensembl	human	known	69_37n	missense	531	13.92	86	SNP	1.000	A
G3BP2	9908	genome.wustl.edu	37	4	76573867	76573867	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr4:76573867C>A	ENST00000359707.4	-	9	1669	c.884G>T	c.(883-885)cGa>cTa	p.R295L	G3BP2_ENST00000395719.3_Missense_Mutation_p.R295L|G3BP2_ENST00000357854.3_Missense_Mutation_p.R262L	NM_203505.2	NP_987101.1	Q9UN86	G3BP2_HUMAN	GTPase activating protein (SH3 domain) binding protein 2	295					cytoplasmic sequestering of NF-kappaB (GO:0007253)|mRNA transport (GO:0051028)|Ras protein signal transduction (GO:0007265)	cytoplasm (GO:0005737)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|receptor signaling complex scaffold activity (GO:0030159)			breast(3)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	27			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			TTCTCTAGGTCGTTGTTCACG	0.408																																						dbGAP											0													99.0	90.0	93.0					4																	76573867		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014560	CCDS3571.1, CCDS3572.1	4q21.1	2013-02-12	2006-11-01		ENSG00000138757	ENSG00000138757		"""RNA binding motif (RRM) containing"""	30291	protein-coding gene	gene with protein product	"""Ras-GTPase activating protein SH3 domain-binding protein 2"""					9734811, 9575347	Standard	NM_203504		Approved	KIAA0660	uc003his.3	Q9UN86	OTTHUMG00000130097	ENST00000359707.4:c.884G>T	4.37:g.76573867C>A	ENSP00000352738:p.Arg295Leu		A8K6X1|O60606|O75149|Q9UPA1	Missense_Mutation	SNP	pfam_NTF2,pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,pfscan_Nuclear_transport_factor_2_euk	p.R295L	ENST00000359707.4	37	c.884	CCDS3571.1	4	.	.	.	.	.	.	.	.	.	.	C	24.2	4.503010	0.85176	.	.	ENSG00000138757	ENST00000395719;ENST00000359707;ENST00000357854	T;T;T	0.78003	-1.13;-1.13;-1.14	5.96	5.96	0.96718	.	0.050833	0.85682	D	0.000000	D	0.85405	0.5689	M	0.62723	1.935	0.80722	D	1	B;D	0.56287	0.288;0.975	B;P	0.59761	0.083;0.863	T	0.81890	-0.0725	10	0.31617	T	0.26	.	20.3928	0.98949	0.0:1.0:0.0:0.0	.	262;295	Q9UN86-2;Q9UN86	.;G3BP2_HUMAN	L	295;295;262	ENSP00000379069:R295L;ENSP00000352738:R295L;ENSP00000350518:R262L	ENSP00000350518:R262L	R	-	2	0	G3BP2	76792891	1.000000	0.71417	0.996000	0.52242	0.299000	0.27559	6.639000	0.74314	2.813000	0.96785	0.655000	0.94253	CGA	G3BP2	-	NULL	ENSG00000138757		0.408	G3BP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	G3BP2	HGNC	protein_coding	OTTHUMT00000252399.2	216	0.00	0	C	NM_012297		76573867	76573867	-1	no_errors	ENST00000359707	ensembl	human	known	69_37n	missense	124	38.00	76	SNP	1.000	A
GNAS	2778	genome.wustl.edu	37	20	57428536	57428536	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr20:57428536G>A	ENST00000306120.3	+	1	26	c.26G>A	c.(25-27)aGg>aAg	p.R9K	GNAS_ENST00000371075.3_Intron|GNAS_ENST00000371100.4_Silent_p.E72E|GNAS-AS1_ENST00000424094.2_RNA|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000371099.2_Silent_p.E72E|GNAS-AS1_ENST00000598163.1_RNA|GNAS_ENST00000313949.7_Intron|GNAS_ENST00000371102.4_Silent_p.E72E|GNAS_ENST00000371098.2_Intron			P63092	GNAS2_HUMAN	GNAS complex locus	0					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			GACCCCCAGAGGTCTCCAGAC	0.627			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)	dbGAP		Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	0													21.0	24.0	23.0					20																	57428536		1905	4119	6024	-	-	-	SO:0001583	missense	0			M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000306120.3:c.26G>A	20.37:g.57428536G>A	ENSP00000302237:p.Arg9Lys		A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	NULL	p.R9K	ENST00000306120.3	37	c.26		20	.	.	.	.	.	.	.	.	.	.	G	0.009	-1.840392	0.00573	.	.	ENSG00000087460	ENST00000306120	.	.	.	4.55	-6.65	0.01795	.	.	.	.	.	T	0.09598	0.0236	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	T	0.28299	-1.0048	5	0.02654	T	1	.	4.7914	0.13250	0.4838:0.0:0.2745:0.2417	.	.	.	.	K	9	.	ENSP00000302237:R9K	R	+	2	0	GNAS	56861931	0.000000	0.05858	0.003000	0.11579	0.157000	0.22087	-0.602000	0.05680	-1.462000	0.01907	-0.262000	0.10625	AGG	GNAS	-	NULL	ENSG00000087460		0.627	GNAS-050	PUTATIVE	basic	protein_coding	GNAS	HGNC	protein_coding	OTTHUMT00000267987.1	12	0.00	0	G	NM_000516		57428536	57428536	+1	no_errors	ENST00000306120	ensembl	human	putative	69_37n	missense	23	30.30	10	SNP	0.003	A
GP6	51206	genome.wustl.edu	37	19	55525717	55525717	+	3'UTR	SNP	G	G	T			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr19:55525717G>T	ENST00000417454.1	-	0	1619				CTC-550B14.7_ENST00000586845.1_RNA|GP6_ENST00000310373.3_Silent_p.P532P|GP6_ENST00000333884.2_3'UTR|CTC-550B14.7_ENST00000593060.1_RNA	NM_016363.4	NP_057447	Q9HCN6	GPVI_HUMAN	glycoprotein VI (platelet)						blood coagulation (GO:0007596)|enzyme linked receptor protein signaling pathway (GO:0007167)|leukocyte migration (GO:0050900)|platelet activation (GO:0030168)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	collagen binding (GO:0005518)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19			BRCA - Breast invasive adenocarcinoma(297;0.156)	GBM - Glioblastoma multiforme(193;0.0515)		CTAATGTGAAGGGAAGCGGGC	0.428																																						dbGAP											0													102.0	98.0	99.0					19																	55525717		1948	4131	6079	-	-	-	SO:0001624	3_prime_UTR_variant	0			AB035073	CCDS42626.1, CCDS46184.1, CCDS58678.1	19q13.4	2013-01-29			ENSG00000088053	ENSG00000088053		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14388	protein-coding gene	gene with protein product		605546				11027634	Standard	NM_001083899		Approved	GPVI	uc002qil.3	Q9HCN6	OTTHUMG00000159709	ENST00000417454.1:c.*572C>A	19.37:g.55525717G>T			Q9HCN7|Q9UIF2	Silent	SNP	smart_Ig_sub,smart_Ig_sub2	p.P532	ENST00000417454.1	37	c.1596	CCDS46184.1	19																																																																																			GP6	-	NULL	ENSG00000088053		0.428	GP6-001	KNOWN	basic|CCDS	protein_coding	GP6	HGNC	protein_coding	OTTHUMT00000357006.1	123	0.00	0	G			55525717	55525717	-1	no_errors	ENST00000310373	ensembl	human	known	69_37n	silent	118	20.27	30	SNP	0.001	T
GRIA3	2892	genome.wustl.edu	37	X	122387164	122387164	+	Silent	SNP	G	G	A			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chrX:122387164G>A	ENST00000371251.1	+	3	331	c.279G>A	c.(277-279)caG>caA	p.Q93Q	GRIA3_ENST00000542149.1_Silent_p.Q93Q|GRIA3_ENST00000371256.5_Silent_p.Q93Q|GRIA3_ENST00000541091.1_Silent_p.Q77Q|GRIA3_ENST00000479118.1_3'UTR|GRIA3_ENST00000264357.5_Silent_p.Q93Q			P42263	GRIA3_HUMAN	glutamate receptor, ionotropic, AMPA 3	93					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)			breast(2)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|pancreas(2)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	57					Lithium(DB01356)	TCTGCTCCCAGTTCTCGAGAG	0.463																																						dbGAP											0													170.0	134.0	146.0					X																	122387164		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U10301	CCDS14604.1, CCDS14605.1, CCDS76017.1	Xq25	2012-08-29	2012-02-03		ENSG00000125675	ENSG00000125675		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4573	protein-coding gene	gene with protein product		305915	"""glutamate receptor, ionotrophic, AMPA 3"""	GLUR3		1319477, 10644433	Standard	NM_007325		Approved	GluA3, GLURC, MRX94	uc004etr.4	P42263	OTTHUMG00000022685	ENST00000371251.1:c.279G>A	X.37:g.122387164G>A			D3DTF1|Q4VXD5|Q4VXD6|Q9HDA0|Q9HDA1|Q9HDA2|Q9P0H1	Silent	SNP	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.Q93	ENST00000371251.1	37	c.279	CCDS14604.1	X																																																																																			GRIA3	-	pfam_ANF_lig-bd_rcpt	ENSG00000125675		0.463	GRIA3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA3	HGNC	protein_coding	OTTHUMT00000058854.1	217	0.00	0	G	NM_000828		122387164	122387164	+1	no_errors	ENST00000264357	ensembl	human	known	69_37n	silent	97	39.38	63	SNP	1.000	A
GRIK5	2901	genome.wustl.edu	37	19	42566761	42566761	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr19:42566761C>G	ENST00000262895.3	-	4	386	c.387G>C	c.(385-387)caG>caC	p.Q129H	GRIK5_ENST00000301218.4_Missense_Mutation_p.Q129H|GRIK5_ENST00000593562.1_Missense_Mutation_p.Q129H	NM_002088.4	NP_002079.3	Q16478	GRIK5_HUMAN	glutamate receptor, ionotropic, kainate 5	129					cellular response to glucose stimulus (GO:0071333)|establishment of localization in cell (GO:0051649)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|positive regulation of neuron apoptotic process (GO:0043525)|protein retention in ER lumen (GO:0006621)|receptor clustering (GO:0043113)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	35		Prostate(69;0.059)				AGCGAAGGTACTGAAGGCGGG	0.617																																						dbGAP											0													118.0	113.0	115.0					19																	42566761		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12595.1	19q13.2	2012-08-29			ENSG00000105737	ENSG00000105737		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4583	protein-coding gene	gene with protein product		600283		GRIK2		7527545	Standard	NM_002088		Approved	GluK5, KA2	uc002osj.2	Q16478	OTTHUMG00000044573	ENST00000262895.3:c.387G>C	19.37:g.42566761C>G	ENSP00000262895:p.Gln129His		Q8WWG8	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.Q129H	ENST00000262895.3	37	c.387	CCDS12595.1	19	.	.	.	.	.	.	.	.	.	.	C	14.65	2.599656	0.46318	.	.	ENSG00000105737	ENST00000262895;ENST00000301218	D;D	0.83755	-1.76;-1.76	5.1	5.1	0.69264	Extracellular ligand-binding receptor (1);	0.073339	0.56097	D	0.000026	T	0.77598	0.4154	L	0.51422	1.61	0.36308	D	0.857484	B	0.12013	0.005	B	0.10450	0.005	T	0.78122	-0.2327	10	0.59425	D	0.04	.	9.6071	0.39641	0.0:0.9047:0.0:0.0953	.	129	Q16478	GRIK5_HUMAN	H	129	ENSP00000262895:Q129H;ENSP00000301218:Q129H	ENSP00000262895:Q129H	Q	-	3	2	GRIK5	47258601	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.063000	0.30567	2.382000	0.81193	0.643000	0.83706	CAG	GRIK5	-	pfam_ANF_lig-bd_rcpt	ENSG00000105737		0.617	GRIK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK5	HGNC	protein_coding	OTTHUMT00000463453.1	60	0.00	0	C			42566761	42566761	-1	no_errors	ENST00000301218	ensembl	human	known	69_37n	missense	104	15.45	19	SNP	1.000	G
GSTM4	2948	genome.wustl.edu	37	1	110204002	110204002	+	3'UTR	SNP	C	C	T			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr1:110204002C>T	ENST00000369836.4	+	0	1092				GSTM4_ENST00000336075.5_3'UTR|GSTM4_ENST00000326729.5_Intron|GSTM4_ENST00000369833.1_3'UTR|GSTM4_ENST00000495742.1_3'UTR	NM_000850.4	NP_000841.1	Q03013	GSTM4_HUMAN	glutathione S-transferase mu 4						glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|small molecule metabolic process (GO:0044281)|xenobiotic catabolic process (GO:0042178)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	enzyme binding (GO:0019899)|glutathione binding (GO:0043295)|glutathione transferase activity (GO:0004364)|protein homodimerization activity (GO:0042803)			endometrium(3)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	12		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		all cancers(265;0.0123)|Colorectal(144;0.0129)|Epithelial(280;0.0147)|Lung(183;0.0422)|COAD - Colon adenocarcinoma(174;0.0471)|LUSC - Lung squamous cell carcinoma(189;0.227)	Glutathione(DB00143)	TTATTCCCATCTTTACCCCCA	0.552																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			M96234	CCDS806.1, CCDS807.1	1p13.3	2012-06-22	2008-11-26		ENSG00000168765	ENSG00000168765	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4636	protein-coding gene	gene with protein product		138333	"""glutathione S-transferase M4"""			8276420	Standard	NM_000850		Approved		uc001dyf.3	Q03013	OTTHUMG00000011642	ENST00000369836.4:c.*126C>T	1.37:g.110204002C>T			A8K765|Q05465|Q32NC1|Q4JNT8|Q6FH87	RNA	SNP	-	NULL	ENST00000369836.4	37	NULL	CCDS807.1	1																																																																																			GSTM4	-	-	ENSG00000168765		0.552	GSTM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSTM4	HGNC	protein_coding	OTTHUMT00000032187.1	100	0.00	0	C	NM_000850		110204002	110204002	+1	no_errors	ENST00000493395	ensembl	human	known	69_37n	rna	76	23.76	24	SNP	0.001	T
GUSBP11	91316	genome.wustl.edu	37	22	23981121	23981122	+	RNA	INS	-	-	G			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr22:23981121_23981122insG	ENST00000455485.1	-	0	3367_3368				KB-1572G7.3_ENST00000390329.3_RNA|AP000347.4_ENST00000430707.2_RNA			Q6P575	BGP11_HUMAN	glucuronidase, beta pseudogene 11						carbohydrate metabolic process (GO:0005975)		hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)										GGGGTAGTCTTGGGCTGACCTG	0.564																																						dbGAP											0																																										-	-	-			0					22q11.23	2011-06-09			ENSG00000228315	ENSG00000228315			42325	pseudogene	pseudogene							Standard	NR_024448		Approved		uc011aiz.2	Q6P575	OTTHUMG00000150709		22.37:g.23981124_23981124dupG				RNA	INS	-	NULL	ENST00000455485.1	37	NULL		22																																																																																			GUSBP11	-	-	ENSG00000228315		0.564	GUSBP11-005	KNOWN	basic|readthrough_transcript	processed_transcript	GUSBP11	HGNC	processed_transcript	OTTHUMT00000319697.1	245	0.00	0	-			23981121	23981122	-1	no_errors	ENST00000422506	ensembl	human	known	69_37n	rna	331	20.43	85	INS	0.350:0.394	G
HCN1	348980	genome.wustl.edu	37	5	45267191	45267191	+	Splice_Site	SNP	C	C	A			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr5:45267191C>A	ENST00000303230.4	-	7	1840	c.1783G>T	c.(1783-1785)Gga>Tga	p.G595*		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	595					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						ACTAGAGTACCTATTCGATCT	0.408																																						dbGAP											0													120.0	114.0	116.0					5																	45267191		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.1783+1G>T	5.37:g.45267191C>A				Nonsense_Mutation	SNP	pfam_Ion_trans_N,pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG	p.G595*	ENST00000303230.4	37	c.1783	CCDS3952.1	5	.	.	.	.	.	.	.	.	.	.	C	39	7.645667	0.98409	.	.	ENSG00000164588	ENST00000303230	.	.	.	5.91	5.91	0.95273	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2963	0.98556	0.0:1.0:0.0:0.0	.	.	.	.	X	595	.	.	G	-	1	0	HCN1	45302948	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	7.487000	0.81328	2.813000	0.96785	0.655000	0.94253	GGA	HCN1	-	NULL	ENSG00000164588		0.408	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCN1	HGNC	protein_coding	OTTHUMT00000253847.1	117	0.00	0	C	NM_021072	Nonsense_Mutation	45267191	45267191	-1	no_errors	ENST00000303230	ensembl	human	known	69_37n	nonsense	73	39.17	47	SNP	1.000	A
HDLBP	3069	genome.wustl.edu	37	2	242179382	242179382	+	Silent	SNP	G	G	A			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr2:242179382G>A	ENST00000391975.1	-	18	2552	c.2325C>T	c.(2323-2325)acC>acT	p.T775T	HDLBP_ENST00000391976.2_Silent_p.T775T|HDLBP_ENST00000310931.4_Silent_p.T775T|HDLBP_ENST00000427183.2_Silent_p.T742T	NM_203346.3	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein	775	KH 9. {ECO:0000255|PROSITE- ProRule:PRU00117}.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)	cytoplasm (GO:0005737)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)			breast(7)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		TTCCAATGATGGTGATCAGGT	0.622																																						dbGAP											0													116.0	109.0	111.0					2																	242179382		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2547.1, CCDS58760.1	2q37.3	2008-07-18	2008-07-18		ENSG00000115677	ENSG00000115677			4857	protein-coding gene	gene with protein product		142695	"""vigilin"""	VGL		1318310, 8390966	Standard	NM_005336		Approved	HBP	uc002waz.3	Q00341	OTTHUMG00000133391	ENST00000391975.1:c.2325C>T	2.37:g.242179382G>A			B4DTQ2|E7EM71|Q53QU2|Q9UCY3	Missense_Mutation	SNP	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	p.H584Y	ENST00000391975.1	37	c.1750	CCDS2547.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.094|6.094	0.385558|0.385558	0.11524|0.11524	.|.	.|.	ENSG00000115677|ENSG00000115677	ENST00000373292|ENST00000427487	.|.	.|.	.|.	5.08|5.08	-4.1|-4.1	0.03940|0.03940	.|.	.|.	.|.	.|.	.|.	T|T	0.36880|0.36880	0.0983|0.0983	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.38735|0.38735	-0.9647|-0.9647	4|4	.|.	.|.	.|.	-27.4083|-27.4083	1.5563|1.5563	0.02585|0.02585	0.4011:0.2263:0.253:0.1196|0.4011:0.2263:0.253:0.1196	.|.	.|.	.|.	.|.	Y|L	584|177	.|.	.|.	H|P	-|-	1|2	0|0	HDLBP|HDLBP	241828055|241828055	0.631000|0.631000	0.27164|0.27164	0.132000|0.132000	0.22025|0.22025	0.508000|0.508000	0.34012|0.34012	-0.229000|-0.229000	0.09098|0.09098	-0.335000|-0.335000	0.08451|0.08451	0.655000|0.655000	0.94253|0.94253	CAT|CCA	HDLBP	-	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	ENSG00000115677		0.622	HDLBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDLBP	HGNC	protein_coding	OTTHUMT00000257245.5	100	0.00	0	G	NM_203346		242179382	242179382	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000373292	ensembl	human	novel	69_37n	missense	122	15.28	22	SNP	0.827	A
HIST1H3J	8356	genome.wustl.edu	37	6	27858488	27858488	+	Missense_Mutation	SNP	T	T	C			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr6:27858488T>C	ENST00000359303.2	-	1	82	c.83A>G	c.(82-84)aAa>aGa	p.K28R	HIST1H3J_ENST00000479986.1_5'UTR|HIST1H2BO_ENST00000303806.4_5'Flank	NM_003535.2	NP_003526.1	P68431	H31_HUMAN	histone cluster 1, H3j	28					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(3)|ovary(1)|prostate(1)	8						TGGAGCGCTTTTGCGCGCTGC	0.627																																						dbGAP											0													36.0	40.0	39.0					6																	27858488		2202	4299	6501	-	-	-	SO:0001583	missense	0			Z83737	CCDS4638.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197153	ENSG00000197153		"""Histones / Replication-dependent"""	4774	protein-coding gene	gene with protein product		602817	"""H3 histone family, member J"", ""histone 1, H3j"""	H3FJ		9439656, 12408966	Standard	NM_003535		Approved	H3/j	uc003nka.3	P68431	OTTHUMG00000016185	ENST00000359303.2:c.83A>G	6.37:g.27858488T>C	ENSP00000352252:p.Lys28Arg		A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.K28R	ENST00000359303.2	37	c.83	CCDS4638.1	6	.	.	.	.	.	.	.	.	.	.	T	10.90	1.480623	0.26598	.	.	ENSG00000197153	ENST00000359303	T	0.47869	0.83	4.06	4.06	0.47325	.	.	.	.	.	T	0.52224	0.1721	.	.	.	0.41241	D	0.986643	.	.	.	.	.	.	T	0.59316	-0.7477	6	0.87932	D	0	.	12.8321	0.57752	0.0:0.0:0.0:1.0	.	.	.	.	R	28	ENSP00000352252:K28R	ENSP00000352252:K28R	K	-	2	0	HIST1H3J	27966467	1.000000	0.71417	1.000000	0.80357	0.112000	0.19704	7.496000	0.81526	2.071000	0.62044	0.533000	0.62120	AAA	HIST1H3J	-	superfamily_Histone-fold,prints_Histone_H3	ENSG00000197153		0.627	HIST1H3J-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H3J	HGNC	protein_coding	OTTHUMT00000043453.2	22	0.00	0	T	NM_003535		27858488	27858488	-1	no_errors	ENST00000359303	ensembl	human	known	69_37n	missense	49	16.95	10	SNP	1.000	C
HOOK3	84376	genome.wustl.edu	37	8	42873640	42873640	+	Nonstop_Mutation	SNP	A	A	G			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr8:42873640A>G	ENST00000307602.4	+	22	2356	c.2156A>G	c.(2155-2157)tAg>tGg	p.*719W	RP11-598P20.5_ENST00000534420.1_Intron	NM_032410.3	NP_115786.1	Q86VS8	HOOK3_HUMAN	hook microtubule-tethering protein 3	0					cytoplasmic microtubule organization (GO:0031122)|early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|Golgi localization (GO:0051645)|interkinetic nuclear migration (GO:0022027)|lysosome organization (GO:0007040)|microtubule anchoring at centrosome (GO:0034454)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|protein localization to centrosome (GO:0071539)|protein transport (GO:0015031)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|FHF complex (GO:0070695)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule organizing center (GO:0005815)|pericentriolar material (GO:0000242)	identical protein binding (GO:0042802)|microtubule binding (GO:0008017)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	31	Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.000105)|Lung NSC(58;0.000419)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.048)|LUSC - Lung squamous cell carcinoma(45;0.114)			ACAGCAAGGTAGAGAAGTTGT	0.522			T	RET	papillary thyroid																																	dbGAP		Dom	yes		8	8p11.21	84376	hook homolog 3		E	0													67.0	63.0	65.0					8																	42873640		2203	4300	6503	-	-	-	SO:0001578	stop_lost	0			AK090540	CCDS6139.1	8p11.21	2013-08-21	2013-08-21		ENSG00000168172	ENSG00000168172			23576	protein-coding gene	gene with protein product		607825	"""hook homolog 3 (Drosophila)"""			9927460	Standard	NM_032410		Approved	HK3	uc003xpr.3	Q86VS8	OTTHUMG00000165278	ENST00000307602.4:c.2156A>G	8.37:g.42873640A>G	ENSP00000305699:p.*719Trpext*84		D3DSY8|Q8NBH0|Q9BY13	Nonstop_Mutation	SNP	pfam_HOOK,superfamily_t-SNARE	p.*719W	ENST00000307602.4	37	c.2156	CCDS6139.1	8	.	.	.	.	.	.	.	.	.	.	A	11.16	1.556045	0.27827	.	.	ENSG00000168172	ENST00000307602	.	.	.	5.96	5.96	0.96718	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4484	0.83959	1.0:0.0:0.0:0.0	.	.	.	.	W	719	.	.	X	+	2	0	HOOK3	42992797	1.000000	0.71417	1.000000	0.80357	0.234000	0.25298	8.932000	0.92897	2.285000	0.76669	0.533000	0.62120	TAG	HOOK3	-	NULL	ENSG00000168172		0.522	HOOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOOK3	HGNC	protein_coding	OTTHUMT00000383172.2	55	0.00	0	A	NM_032410		42873640	42873640	+1	no_errors	ENST00000307602	ensembl	human	known	69_37n	nonstop	68	19.05	16	SNP	1.000	G
HOXB3	3213	genome.wustl.edu	37	17	46629736	46629737	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr17:46629736_46629737insG	ENST00000470495.1	-	1	1547_1548	c.100_101insC	c.(100-102)caafs	p.Q34fs	HOXB3_ENST00000311626.4_Frame_Shift_Ins_p.Q34fs|HOXB-AS1_ENST00000508688.1_RNA|HOXB3_ENST00000485909.2_Intron|HOXB-AS1_ENST00000502764.2_RNA|HOXB3_ENST00000472863.1_Intron|HOXB3_ENST00000490677.1_Intron|HOXB-AS3_ENST00000465846.2_RNA|HOXB3_ENST00000489475.1_Intron|HOXB-AS1_ENST00000435312.1_RNA|HOXB3_ENST00000498678.1_Frame_Shift_Ins_p.Q34fs|HOXB3_ENST00000460160.1_Intron|HOXB3_ENST00000476342.1_Frame_Shift_Ins_p.Q34fs			P14651	HXB3_HUMAN	homeobox B3	34					angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|cartilage development (GO:0051216)|definitive hemopoiesis (GO:0060216)|embryonic skeletal system morphogenesis (GO:0048704)|face development (GO:0060324)|glossopharyngeal nerve morphogenesis (GO:0021615)|hematopoietic progenitor cell differentiation (GO:0002244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of neurogenesis (GO:0050767)|rhombomere development (GO:0021546)|thyroid gland development (GO:0030878)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(2)|large_intestine(2)|lung(16)|prostate(4)|upper_aerodigestive_tract(1)	30						AAATGGGGGTTGGGGGGGGACA	0.634																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS11528.1	17q21.32	2011-06-20	2005-12-22		ENSG00000120093	ENSG00000120093		"""Homeoboxes / ANTP class : HOXL subclass"""	5114	protein-coding gene	gene with protein product		142966	"""homeo box B3"""	HOX2, HOX2G		1973146, 1358459	Standard	XM_006721854		Approved		uc002ino.3	P14651	OTTHUMG00000159922	ENST00000470495.1:c.101dupC	17.37:g.46629744_46629744dupG	ENSP00000417207:p.Gln34fs		A8K567|B7Z5N8|B7Z5P8|B7ZAD0|D3DTV3|O95615|P17484	Frame_Shift_Ins	INS	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.Q34fs	ENST00000470495.1	37	c.101_100	CCDS11528.1	17																																																																																			HOXB3	-	NULL	ENSG00000120093		0.634	HOXB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXB3	HGNC	protein_coding	OTTHUMT00000358261.1	38	0.00	0	-			46629736	46629737	-1	no_errors	ENST00000311626	ensembl	human	known	69_37n	frame_shift_ins	36	12.20	5	INS	1.000:1.000	G
ITGAV	3685	genome.wustl.edu	37	2	187516748	187516748	+	Silent	SNP	G	G	T			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr2:187516748G>T	ENST00000261023.3	+	15	1711	c.1437G>T	c.(1435-1437)gtG>gtT	p.V479V	ITGAV_ENST00000433736.2_Silent_p.V433V|ITGAV_ENST00000374907.3_Silent_p.V443V|AC017101.10_ENST00000453665.1_RNA	NM_002210.3	NP_002201	P06756	ITAV_HUMAN	integrin, alpha V	479					angiogenesis (GO:0001525)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|apoptotic cell clearance (GO:0043277)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|endodermal cell differentiation (GO:0035987)|entry of symbiont into host cell by promotion of host phagocytosis (GO:0052066)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|negative chemotaxis (GO:0050919)|negative regulation of entry of bacterium into host cell (GO:2000536)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast proliferation (GO:0033690)|regulation of apoptotic cell clearance (GO:2000425)|regulation of phagocytosis (GO:0050764)|substrate adhesion-dependent cell spreading (GO:0034446)|viral entry into host cell (GO:0046718)	alphav-beta3 integrin-IGF-1-IGF1R complex (GO:0035867)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin alphav-beta5 complex (GO:0034684)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	extracellular matrix binding (GO:0050840)|extracellular matrix protein binding (GO:1990430)|fibronectin binding (GO:0001968)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|transforming growth factor beta binding (GO:0050431)|virus receptor activity (GO:0001618)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)	Antithymocyte globulin(DB00098)	GTCTTGAAGTGTACCCTAGCA	0.363																																					Melanoma(58;108 1995 6081)	dbGAP											0													59.0	61.0	60.0					2																	187516748		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2292.1, CCDS46470.1, CCDS46471.1	2q31-q32	2012-04-20	2012-04-20		ENSG00000138448	ENSG00000138448		"""CD molecules"", ""Integrins"""	6150	protein-coding gene	gene with protein product		193210	"""antigen identified by monoclonal antibody L230"", ""vitronectin receptor"", ""integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51)"""	VNRA, MSK8, VTNR		2454952	Standard	NM_001144999		Approved	CD51	uc002upq.4	P06756	OTTHUMG00000132635	ENST00000261023.3:c.1437G>T	2.37:g.187516748G>T			A0AV67|B0LPF4|B7Z883|B7ZLX0|D3DPG8|E7EWZ6|Q53SK4|Q59EB7|Q6LD15	Silent	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.V479	ENST00000261023.3	37	c.1437	CCDS2292.1	2																																																																																			ITGAV	-	pfam_Integrin_alpha-2,smart_Int_alpha_beta-p,prints_Integrin_alpha	ENSG00000138448		0.363	ITGAV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGAV	HGNC	protein_coding	OTTHUMT00000255882.2	143	0.00	0	G	NM_002210		187516748	187516748	+1	no_errors	ENST00000261023	ensembl	human	known	69_37n	silent	151	24.88	50	SNP	0.080	T
ITIH6	347365	genome.wustl.edu	37	X	54785405	54785405	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chrX:54785405C>G	ENST00000218436.6	-	8	1131	c.1102G>C	c.(1102-1104)Gca>Cca	p.A368P		NM_198510.2	NP_940912.1	Q6UXX5	ITIH6_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 6	368	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)										GAAGCAGCTGCCAGCAGAGCT	0.567																																						dbGAP											0													13.0	10.0	11.0					X																	54785405		2179	4246	6425	-	-	-	SO:0001583	missense	0			AY358170	CCDS14361.1	Xp11.22-p11.21	2011-10-26	2011-10-26	2011-10-26	ENSG00000102313	ENSG00000102313			28907	protein-coding gene	gene with protein product			"""inter-alpha (globulin) inhibitor H5-like"""	ITIH5L		12975309	Standard	NM_198510		Approved	UNQ6369	uc004dtj.2	Q6UXX5	OTTHUMG00000021634	ENST00000218436.6:c.1102G>C	X.37:g.54785405C>G	ENSP00000218436:p.Ala368Pro		A6NN03	Missense_Mutation	SNP	pfam_VIT,pfam_ITI_HC_C,pfam_VWF_A,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.A368P	ENST00000218436.6	37	c.1102	CCDS14361.1	X	.	.	.	.	.	.	.	.	.	.	C	14.66	2.602001	0.46423	.	.	ENSG00000102313	ENST00000218436	T	0.08896	3.04	3.77	1.85	0.25348	von Willebrand factor, type A (3);	0.609598	0.15713	U	0.248297	T	0.14485	0.0350	M	0.78049	2.395	0.25677	N	0.985831	B	0.30033	0.266	B	0.40602	0.334	T	0.16958	-1.0385	10	0.33940	T	0.23	.	6.5693	0.22529	0.1764:0.7183:0.0:0.1053	.	368	Q6UXX5	ITH5L_HUMAN	P	368	ENSP00000218436:A368P	ENSP00000218436:A368P	A	-	1	0	ITIH5L	54802130	0.202000	0.23423	0.948000	0.38648	0.801000	0.45260	0.663000	0.25053	0.430000	0.26230	0.589000	0.80489	GCA	ITIH6	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000102313		0.567	ITIH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITIH6	HGNC	protein_coding	OTTHUMT00000056814.2	47	0.00	0	C	NM_198510		54785405	54785405	-1	no_errors	ENST00000218436	ensembl	human	known	69_37n	missense	27	33.33	14	SNP	0.966	G
JMY	133746	genome.wustl.edu	37	5	78610274	78610274	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr5:78610274G>C	ENST00000396137.4	+	9	2721	c.2259G>C	c.(2257-2259)caG>caC	p.Q753H	JMY_ENST00000412001.1_Intron	NM_152405.4	NP_689618.4	Q8N9B5	JMY_HUMAN	junction mediating and regulatory protein, p53 cofactor	753					'de novo' actin filament nucleation (GO:0070060)|actin polymerization-dependent cell motility (GO:0070358)|Arp2/3 complex-mediated actin nucleation (GO:0034314)|cell cycle arrest (GO:0007050)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of apoptotic process (GO:0043065)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			endometrium(4)|kidney(2)|large_intestine(2)|lung(6)|skin(1)|urinary_tract(1)	16		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;4.45e-45)|Epithelial(54;5.85e-40)|all cancers(79;2.89e-35)		CAGAACCCCAGAGCCTTGTGC	0.458																																						dbGAP											0													161.0	172.0	168.0					5																	78610274		2109	4236	6345	-	-	-	SO:0001583	missense	0			AK095189	CCDS4047.3	5q14.1	2010-03-23			ENSG00000152409	ENSG00000152409			28916	protein-coding gene	gene with protein product		604279				10518217	Standard	NM_152405		Approved	FLJ37870	uc003kfx.4	Q8N9B5	OTTHUMG00000131301	ENST00000396137.4:c.2259G>C	5.37:g.78610274G>C	ENSP00000379441:p.Gln753His		A1L4P5|B5MDS2|B5MDT0	Missense_Mutation	SNP	pfscan_WH2_dom	p.Q753H	ENST00000396137.4	37	c.2259	CCDS4047.3	5	.	.	.	.	.	.	.	.	.	.	G	11.26	1.587743	0.28268	.	.	ENSG00000152409	ENST00000282259;ENST00000396137	T	0.73575	-0.76	4.67	-2.38	0.06622	.	0.800384	0.11528	N	0.555024	T	0.65719	0.2718	M	0.62723	1.935	0.27478	N	0.952671	B	0.06786	0.001	B	0.09377	0.004	T	0.52011	-0.8632	10	0.44086	T	0.13	.	6.7713	0.23594	0.3004:0.2141:0.4855:0.0	.	753	Q8N9B5	JMY_HUMAN	H	753	ENSP00000379441:Q753H	ENSP00000282259:Q753H	Q	+	3	2	JMY	78646030	0.771000	0.28555	0.536000	0.28039	0.827000	0.46813	0.499000	0.22546	-1.046000	0.03246	-0.145000	0.13849	CAG	JMY	-	NULL	ENSG00000152409		0.458	JMY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JMY	HGNC	protein_coding	OTTHUMT00000254070.4	161	0.00	0	G	NM_152405		78610274	78610274	+1	no_errors	ENST00000396137	ensembl	human	known	69_37n	missense	100	29.08	41	SNP	0.856	C
KIAA0195	9772	genome.wustl.edu	37	17	73493880	73493881	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr17:73493880_73493881insC	ENST00000314256.7	+	27	3820_3821	c.3426_3427insC	c.(3427-3429)cccfs	p.P1143fs	KIAA0195_ENST00000579208.1_Frame_Shift_Ins_p.P794fs|KIAA0195_ENST00000375248.5_Frame_Shift_Ins_p.P1153fs|AC100787.1_ENST00000579379.1_RNA	NM_014738.4	NP_055553.3	Q12767	K0195_HUMAN	KIAA0195	1143						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(2)|endometrium(5)|kidney(2)|large_intestine(7)|lung(17)|ovary(5)|skin(2)|stomach(1)|urinary_tract(1)	42	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			TGCTGGGGAAGCCCCCCCATAG	0.52																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS32732.1	17q25.1	2012-03-01			ENSG00000177728	ENSG00000177728			28983	protein-coding gene	gene with protein product						8724849	Standard	NM_014738		Approved	TMEM94	uc002jnz.4	Q12767		ENST00000314256.7:c.3433dupC	17.37:g.73493887_73493887dupC	ENSP00000313885:p.Pro1143fs		O75536|Q86XF1	Frame_Shift_Ins	INS	pfam_ATPase_P-typ_cation-transptr_C	p.H1144fs	ENST00000314256.7	37	c.3426_3427	CCDS32732.1	17																																																																																			KIAA0195	-	pfam_ATPase_P-typ_cation-transptr_C	ENSG00000177728		0.520	KIAA0195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0195	HGNC	protein_coding	OTTHUMT00000447303.1	29	0.00	0	-	NM_014738		73493880	73493881	+1	no_errors	ENST00000314256	ensembl	human	known	69_37n	frame_shift_ins	32	11.11	4	INS	1.000:1.000	C
LARP1	23367	genome.wustl.edu	37	5	154173389	154173390	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr5:154173389_154173390insC	ENST00000336314.4	+	6	691_692	c.667_668insC	c.(667-669)gccfs	p.A223fs		NM_015315.3	NP_056130.2	Q6PKG0	LARP1_HUMAN	La ribonucleoprotein domain family, member 1	300					cell proliferation (GO:0008283)|positive regulation of macroautophagy (GO:0016239)|positive regulation of translation (GO:0045727)|TOR signaling (GO:0031929)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation activator activity (GO:0008494)|translation initiation factor binding (GO:0031369)	p.T303fs*19(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CGTGCCCGTGGCCCCCCCCACC	0.644																																						dbGAP											1	Insertion - Frameshift(1)	large_intestine(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AB018274	CCDS4328.1	5q33.2	2014-02-12			ENSG00000155506	ENSG00000155506		"""La ribonucleoprotein domain containing"""	29531	protein-coding gene	gene with protein product		612059				9872452, 10878606	Standard	NM_015315		Approved	LARP, KIAA0731, MGC19556	uc003lvo.4	Q6PKG0	OTTHUMG00000130191	ENST00000336314.4:c.675dupC	5.37:g.154173397_154173397dupC	ENSP00000336721:p.Ala223fs		O94836|Q8N4M2|Q8NB73|Q9UFD7	Frame_Shift_Ins	INS	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,smart_DM15,pfscan_Lupus_La_RNA-bd	p.T226fs	ENST00000336314.4	37	c.667_668	CCDS4328.1	5																																																																																			LARP1	-	NULL	ENSG00000155506		0.644	LARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP1	HGNC	protein_coding	OTTHUMT00000252509.1	31	0.00	0	-	NM_033551		154173389	154173390	+1	no_errors	ENST00000336314	ensembl	human	known	69_37n	frame_shift_ins	45	10.00	5	INS	0.998:0.999	C
MAPRE3	22924	genome.wustl.edu	37	2	27247108	27247108	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr2:27247108C>G	ENST00000233121.2	+	4	610	c.412C>G	c.(412-414)Cct>Gct	p.P138A	MAPRE3_ENST00000405074.3_Missense_Mutation_p.P138A|MAPRE3_ENST00000402218.1_Missense_Mutation_p.P138A			Q9UPY8	MARE3_HUMAN	microtubule-associated protein, RP/EB family, member 3	138					mitotic nuclear division (GO:0007067)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of microtubule plus-end binding (GO:1903033)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)	microtubule binding (GO:0008017)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(3)|upper_aerodigestive_tract(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CGTAGCGCCACCTCCTAACCC	0.542																																						dbGAP											0													49.0	51.0	50.0					2																	27247108		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y11174	CCDS1731.1	2p23.3-p23.1	2008-06-04			ENSG00000084764	ENSG00000084764			6892	protein-coding gene	gene with protein product		605788				9233623	Standard	NM_012326		Approved	RP3, EB3	uc002rhw.3	Q9UPY8	OTTHUMG00000097067	ENST00000233121.2:c.412C>G	2.37:g.27247108C>G	ENSP00000233121:p.Pro138Ala		B7WPK5|O00265|Q6FHB0|Q6FI15|Q9BZP7|Q9BZP8	Missense_Mutation	SNP	pfam_EB1_C,pfam_CH-domain,superfamily_CH-domain,pfscan_CH-domain	p.P138A	ENST00000233121.2	37	c.412	CCDS1731.1	2	.	.	.	.	.	.	.	.	.	.	C	0.282	-0.985496	0.02180	.	.	ENSG00000084764	ENST00000233121;ENST00000405074;ENST00000458529;ENST00000402218	T;T;T;T	0.41065	1.01;1.02;1.04;1.02	5.06	0.979	0.19745	.	0.114530	0.64402	N	0.000011	T	0.19725	0.0474	N	0.20357	0.565	0.39098	D	0.961233	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.22103	-1.0226	10	0.06365	T	0.9	-4.6883	6.6499	0.22957	0.1296:0.29:0.5052:0.0752	.	138;138	Q9UPY8-2;Q9UPY8	.;MARE3_HUMAN	A	138	ENSP00000233121:P138A;ENSP00000383915:P138A;ENSP00000391705:P138A;ENSP00000385715:P138A	ENSP00000233121:P138A	P	+	1	0	MAPRE3	27100612	0.823000	0.29233	0.021000	0.16686	0.004000	0.04260	1.528000	0.35985	-0.099000	0.12263	-0.165000	0.13383	CCT	MAPRE3	-	NULL	ENSG00000084764		0.542	MAPRE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPRE3	HGNC	protein_coding	OTTHUMT00000214183.1	58	0.00	0	C	NM_012326		27247108	27247108	+1	no_errors	ENST00000233121	ensembl	human	known	69_37n	missense	60	16.67	12	SNP	0.401	G
ATP2B2	491	genome.wustl.edu	37	3	10436197	10436197	+	Intron	SNP	C	C	T			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr3:10436197C>T	ENST00000352432.4	-	5	851				MIR885_ENST00000401316.1_RNA|ATP2B2_ENST00000360273.2_Intron|ATP2B2_ENST00000343816.4_Intron|ATP2B2_ENST00000383800.4_Intron|ATP2B2_ENST00000397077.1_Intron			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2						auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						cactacaccccgctgcctcTC	0.602																																					Ovarian(125;1619 1709 15675 19819 38835)	dbGAP											0													27.0	30.0	29.0					3																	10436197		1374	3177	4551	-	-	-	SO:0001627	intron_variant	0			X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.782-6111G>A	3.37:g.10436197C>T			O00766|Q12994|Q16818	RNA	SNP	-	NULL	ENST00000352432.4	37	NULL	CCDS33701.1	3																																																																																			MIR885	-	-	ENSG00000216135		0.602	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	MIR885	HGNC	protein_coding	OTTHUMT00000250576.2	52	0.00	0	C	NM_001683		10436197	10436197	-1	no_errors	ENST00000401316	ensembl	human	known	69_37n	rna	91	22.22	26	SNP	0.999	T
MED12L	116931	genome.wustl.edu	37	3	151127066	151127066	+	Silent	SNP	G	G	A			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr3:151127066G>A	ENST00000474524.1	+	38	5789	c.5751G>A	c.(5749-5751)gcG>gcA	p.A1917A	MED12L_ENST00000273432.4_Intron	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	1917	Gln-rich.					mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TCTTTGCTGCGCAAGCACGGC	0.532																																						dbGAP											0													76.0	79.0	78.0					3																	151127066		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.5751G>A	3.37:g.151127066G>A			Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Silent	SNP	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12,pfam_Mediator_Med12_catenin-bd	p.A1917	ENST00000474524.1	37	c.5751	CCDS33876.1	3																																																																																			MED12L	-	pfam_Mediator_Med12_catenin-bd	ENSG00000144893		0.532	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED12L	HGNC	protein_coding	OTTHUMT00000357707.2	49	0.00	0	G	NM_053002		151127066	151127066	+1	no_errors	ENST00000474524	ensembl	human	known	69_37n	silent	64	18.99	15	SNP	0.992	A
KMT2A	4297	genome.wustl.edu	37	11	118367017	118367017	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr11:118367017delC	ENST00000389506.5	+	20	5590	c.5590delC	c.(5590-5592)cccfs	p.P1865fs	KMT2A_ENST00000534358.1_Frame_Shift_Del_p.P1868fs|KMT2A_ENST00000354520.4_Frame_Shift_Del_p.P1827fs			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	1865					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										GCTGAACCCACCCCCAGGCAT	0.428																																						dbGAP											0													183.0	167.0	172.0					11																	118367017		2200	4296	6496	-	-	-	SO:0001589	frameshift_variant	0			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.5590delC	11.37:g.118367017delC	ENSP00000374157:p.Pro1865fs		E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Frame_Shift_Del	DEL	pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_Bromodomain,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pirsf_MeTrfase_trithorax,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC,pfscan_Bromodomain	p.P1865fs	ENST00000389506.5	37	c.5590	CCDS31686.1	11																																																																																			MLL	-	pirsf_MeTrfase_trithorax	ENSG00000118058		0.428	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL	HGNC	protein_coding	OTTHUMT00000399085.2	341	0.00	0	C	NM_005933		118367017	118367017	+1	no_errors	ENST00000389506	ensembl	human	known	69_37n	frame_shift_del	83	59.31	137	DEL	1.000	-
MYH3	4621	genome.wustl.edu	37	17	10547934	10547934	+	Silent	SNP	A	A	G			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr17:10547934A>G	ENST00000583535.1	-	13	1314	c.1227T>C	c.(1225-1227)aaT>aaC	p.N409N	MYH3_ENST00000226209.7_Silent_p.N409N	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	409	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						TAACGTACTCATTCCCAACTT	0.493																																						dbGAP											0													116.0	110.0	112.0					17																	10547934		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.1227T>C	17.37:g.10547934A>G			Q15492	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.N409	ENST00000583535.1	37	c.1227	CCDS11157.1	17																																																																																			MYH3	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000109063		0.493	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH3	HGNC	protein_coding	OTTHUMT00000252734.2	82	0.00	0	A	NM_002470		10547934	10547934	-1	no_errors	ENST00000226209	ensembl	human	known	69_37n	silent	82	22.02	24	SNP	0.998	G
MYO16	23026	genome.wustl.edu	37	13	109437984	109437984	+	Splice_Site	SNP	C	C	A			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr13:109437984C>A	ENST00000357550.2	+	4	484	c.443C>A	c.(442-444)gCt>gAt	p.A148D	MYO16_ENST00000467639.1_3'UTR|MYO16_ENST00000356711.2_Splice_Site_p.A148D|MYO16_ENST00000251041.5_Splice_Site_p.A148D	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			TTTATCTAGGCTGGAGCCAAT	0.358																																						dbGAP											0													60.0	55.0	57.0					13																	109437984		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.442-1C>A	13.37:g.109437984C>A				Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Myosin_head_motor_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.A148D	ENST00000357550.2	37	c.443	CCDS32008.1	13	.	.	.	.	.	.	.	.	.	.	C	16.88	3.243977	0.58995	.	.	ENSG00000041515	ENST00000356711;ENST00000397258;ENST00000357550;ENST00000251041	T;T;T	0.66280	-0.2;-0.2;-0.2	5.18	5.18	0.71444	Ankyrin repeat-containing domain (4);	0.000000	0.37261	U	0.002164	T	0.71962	0.3402	L	0.46614	1.455	0.80722	D	1	P;D	0.65815	0.897;0.995	P;D	0.65987	0.548;0.94	T	0.70313	-0.4906	9	.	.	.	.	16.2145	0.82195	0.0:1.0:0.0:0.0	.	148;148	Q9Y6X6-2;Q9Y6X6	.;MYO16_HUMAN	D	148	ENSP00000349145:A148D;ENSP00000350160:A148D;ENSP00000251041:A148D	.	A	+	2	0	MYO16	108235985	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	5.434000	0.66526	2.400000	0.81607	0.655000	0.94253	GCT	MYO16	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000041515		0.358	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO16	HGNC	protein_coding	OTTHUMT00000045746.1	162	0.00	0	C	NM_015011	Missense_Mutation	109437984	109437984	+1	no_errors	ENST00000356711	ensembl	human	known	69_37n	missense	177	18.43	40	SNP	1.000	A
NCAPH	23397	genome.wustl.edu	37	2	97007425	97007426	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr2:97007425_97007426insC	ENST00000240423.4	+	2	108_109	c.65_66insC	c.(64-69)caccccfs	p.HP22fs	NCAPH_ENST00000427946.1_Intron|NCAPH_ENST00000455200.1_Frame_Shift_Ins_p.HP11fs	NM_001281710.1|NM_001281711.1|NM_015341.3	NP_001268639.1|NP_001268640.1|NP_056156.2	Q15003	CND2_HUMAN	non-SMC condensin I complex, subunit H	22					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(717;0.0221)				ACGCGAGGACACCCCCACAGTG	0.515																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC024211	CCDS2021.1, CCDS62960.1	2q11.2	2008-02-05	2006-09-04	2006-09-04	ENSG00000121152	ENSG00000121152			1112	protein-coding gene	gene with protein product		602332	"""barren (Drosophila) homolog"", ""barren homolog (Drosophila)"", ""barren homolog 1 (Drosophila)"""	BRRN1		9417923	Standard	NM_015341		Approved	CAP-H, hCAP-H	uc002svz.1	Q15003	OTTHUMG00000130451	ENST00000240423.4:c.70dupC	2.37:g.97007430_97007430dupC	ENSP00000240423:p.His22fs		B4E189|Q8TB87	Frame_Shift_Ins	INS	pfam_Condensin_barren_su2,pirsf_Condensin_barren_su2	p.H24fs	ENST00000240423.4	37	c.65_66	CCDS2021.1	2																																																																																			NCAPH	-	pirsf_Condensin_barren_su2	ENSG00000121152		0.515	NCAPH-001	KNOWN	basic|CCDS	protein_coding	NCAPH	HGNC	protein_coding	OTTHUMT00000252842.2	39	0.00	0	-	NM_015341		97007425	97007426	+1	no_errors	ENST00000240423	ensembl	human	known	69_37n	frame_shift_ins	32	39.62	21	INS	0.001:0.000	C
NFIC	4782	genome.wustl.edu	37	19	3381782	3381782	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr19:3381782C>T	ENST00000443272.2	+	2	154	c.103C>T	c.(103-105)Cag>Tag	p.Q35*	NFIC_ENST00000586919.1_Nonsense_Mutation_p.Q26*|NFIC_ENST00000589123.1_Nonsense_Mutation_p.Q26*|NFIC_ENST00000346156.5_Nonsense_Mutation_p.Q26*|NFIC_ENST00000341919.3_Nonsense_Mutation_p.Q35*|NFIC_ENST00000590282.1_Nonsense_Mutation_p.Q35*|NFIC_ENST00000395111.3_Nonsense_Mutation_p.Q26*	NM_001245002.1	NP_001231931.1	P08651	NFIC_HUMAN	nuclear factor I/C (CCAAT-binding transcription factor)	35					DNA replication (GO:0006260)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleolus (GO:0005730)|nucleus (GO:0005634)	core promoter proximal region DNA binding (GO:0001159)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.8e-05)|Epithelial(107;2.94e-108)|BRCA - Breast invasive adenocarcinoma(158;0.00154)|STAD - Stomach adenocarcinoma(1328;0.191)		GTTCAACCTGCAGGCGCGGAA	0.637																																						dbGAP											0													72.0	74.0	73.0					19																	3381782		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			X12492	CCDS12107.1, CCDS45914.1, CCDS58640.1, CCDS59330.1, CCDS59331.1	19p13.3	2008-02-05				ENSG00000141905			7786	protein-coding gene	gene with protein product		600729		NFI		3398920, 7590749	Standard	NM_205843		Approved	CTF, NF-I, CTF5	uc010xhi.2	P08651		ENST00000443272.2:c.103C>T	19.37:g.3381782C>T	ENSP00000396843:p.Gln35*		A8K1H0|B7Z4U5|B7Z9C3|K7EMU1|P08652|Q14932|Q9UPJ3|Q9UPJ9|Q9UPK0|Q9UPK1	Nonsense_Mutation	SNP	pfam_CTF/NFI,pfam_CTF/NFI_DNA-bd_N,pfam_MAD_homology1_Dwarfin-type,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,pfscan_CTF/NFI_DNA-bd-dom	p.Q35*	ENST00000443272.2	37	c.103	CCDS59330.1	19	.	.	.	.	.	.	.	.	.	.	C	37	6.063704	0.97251	.	.	ENSG00000141905	ENST00000443272;ENST00000395111;ENST00000346156;ENST00000341919;ENST00000343825;ENST00000269778	.	.	.	3.88	3.88	0.44766	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	14.8198	0.70062	0.0:1.0:0.0:0.0	.	.	.	.	X	26;26;26;35;35;35	.	ENSP00000269778:Q35X	Q	+	1	0	NFIC	3332782	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.672000	0.83956	1.879000	0.54435	0.467000	0.42956	CAG	NFIC	-	pfam_CTF/NFI_DNA-bd_N,pfscan_CTF/NFI_DNA-bd-dom	ENSG00000141905		0.637	NFIC-006	KNOWN	basic|appris_principal|CCDS	protein_coding	NFIC	HGNC	protein_coding	OTTHUMT00000452834.1	18	0.00	0	C	NM_005597		3381782	3381782	+1	no_errors	ENST00000443272	ensembl	human	known	69_37n	nonsense	47	16.07	9	SNP	1.000	T
NUP188	23511	genome.wustl.edu	37	9	131760904	131760904	+	Splice_Site	SNP	T	T	A			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr9:131760904T>A	ENST00000372577.2	+	32	3536		c.e32+2			NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						GTGGAAGAGGTGAGGCTGTGC	0.577																																						dbGAP											0													90.0	74.0	79.0					9																	131760904		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.3515+2T>A	9.37:g.131760904T>A			Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Splice_Site	SNP	-	e32+2	ENST00000372577.2	37	c.3515+2	CCDS35156.1	9	.	.	.	.	.	.	.	.	.	.	T	23.8	4.455321	0.84209	.	.	ENSG00000095319	ENST00000356693;ENST00000372577	.	.	.	5.37	5.37	0.77165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5847	0.68315	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	NUP188	130800725	1.000000	0.71417	0.992000	0.48379	0.969000	0.65631	7.330000	0.79181	2.049000	0.60858	0.454000	0.30748	.	NUP188	-	-	ENSG00000095319		0.577	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP188	HGNC	protein_coding	OTTHUMT00000054529.2	47	0.00	0	T		Intron	131760904	131760904	+1	no_errors	ENST00000372577	ensembl	human	known	69_37n	splice_site	49	24.62	16	SNP	1.000	A
NWD1	284434	genome.wustl.edu	37	19	16860608	16860608	+	Silent	SNP	G	G	T			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr19:16860608G>T	ENST00000552788.1	+	4	1155	c.1155G>T	c.(1153-1155)ctG>ctT	p.L385L	NWD1_ENST00000549814.1_Silent_p.L385L|NWD1_ENST00000339803.6_Silent_p.L250L|NWD1_ENST00000379808.3_Silent_p.L385L|NWD1_ENST00000524140.2_Silent_p.L385L|NWD1_ENST00000523826.1_Silent_p.L179L			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	385	NACHT.						ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						CCCGTGGCCTGCTGAAGAGCA	0.622																																						dbGAP											0													32.0	34.0	34.0					19																	16860608		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.1155G>T	19.37:g.16860608G>T			C9J021|Q68CT3	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L385	ENST00000552788.1	37	c.1155		19																																																																																			NWD1	-	NULL	ENSG00000188039		0.622	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	NWD1	HGNC	protein_coding	OTTHUMT00000403569.1	22	0.00	0	G	NM_001007525		16860608	16860608	+1	no_errors	ENST00000379808	ensembl	human	known	69_37n	silent	17	22.73	5	SNP	0.979	T
NXPE4	54827	genome.wustl.edu	37	11	114453663	114453663	+	Silent	SNP	C	C	A			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr11:114453663C>A	ENST00000375478.3	-	3	357	c.177G>T	c.(175-177)ctG>ctT	p.L59L	NXPE4_ENST00000424261.2_5'UTR	NM_001077639.1	NP_001071107.1	Q6UWF7	NXPE4_HUMAN	neurexophilin and PC-esterase domain family, member 4	59						extracellular vesicular exosome (GO:0070062)		p.L59L(1)									TTAATGATATCAGTGGTGTTT	0.418																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											256.0	237.0	243.0					11																	114453663		1943	4141	6084	-	-	-	SO:0001819	synonymous_variant	0			AK000134	CCDS41718.1, CCDS44737.1	11q23.3	2012-06-14	2012-06-11	2012-06-11	ENSG00000137634	ENSG00000137634			23117	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 33"", ""family with sequence similarity 55, member D"""	C11orf33, FAM55D		20056006	Standard	NM_017678		Approved	FLJ20127	uc001ppc.3	Q6UWF7	OTTHUMG00000168291	ENST00000375478.3:c.177G>T	11.37:g.114453663C>A			Q6QDB4|Q9NXP5	Silent	SNP	superfamily_Ig_E-set	p.L59	ENST00000375478.3	37	c.177	CCDS41718.1	11																																																																																			NXPE4	-	NULL	ENSG00000137634		0.418	NXPE4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NXPE4	HGNC	protein_coding	OTTHUMT00000399179.1	489	0.20	1	C	NM_017678		114453663	114453663	-1	no_errors	ENST00000375478	ensembl	human	known	69_37n	silent	218	32.51	105	SNP	0.000	A
OR1E2	8388	genome.wustl.edu	37	17	3337085	3337085	+	Silent	SNP	C	C	A			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr17:3337085C>A	ENST00000248384.1	-	1	50	c.51G>T	c.(49-51)ctG>ctT	p.L17L		NM_003554.1	NP_003545.1	P47887	OR1E2_HUMAN	olfactory receptor, family 1, subfamily E, member 2	17					sensory perception of chemical stimulus (GO:0007606)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)|receptor activity (GO:0004872)			endometrium(3)|large_intestine(3)|lung(3)	9						GTTGGATGGGCAGGCCCAGGA	0.498																																						dbGAP											0													52.0	55.0	54.0					17																	3337085		2202	4288	6490	-	-	-	SO:0001819	synonymous_variant	0			U04686	CCDS11026.1	17p13.3	2012-08-09			ENSG00000127780	ENSG00000127780		"""GPCR / Class A : Olfactory receptors"""	8190	protein-coding gene	gene with protein product				OR1E4		8004088, 9500546	Standard	NM_003554		Approved	OR17-93, OR17-135	uc010vre.2	P47887	OTTHUMG00000090651	ENST00000248384.1:c.51G>T	17.37:g.3337085C>A			O43877|O95632|Q0VAD5|Q0VAD6|Q9UL13	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L17	ENST00000248384.1	37	c.51	CCDS11026.1	17																																																																																			OR1E2	-	NULL	ENSG00000127780		0.498	OR1E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1E2	HGNC	protein_coding	OTTHUMT00000207311.1	458	0.00	0	C			3337085	3337085	-1	no_errors	ENST00000248384	ensembl	human	known	69_37n	silent	253	35.44	140	SNP	0.000	A
OR2L2	26246	genome.wustl.edu	37	1	248202323	248202323	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr1:248202323G>T	ENST00000366479.2	+	1	850	c.754G>T	c.(754-756)Gca>Tca	p.A252S	OR2L13_ENST00000366478.2_Intron	NM_001004686.2	NP_001004686.1	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L, member 2	252						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(28)|ovary(1)|skin(4)|urinary_tract(1)	42	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			CTTCTACTATGCACCCTTTGC	0.507																																						dbGAP											0													188.0	166.0	173.0					1																	248202323		2203	4300	6503	-	-	-	SO:0001583	missense	0			X64978	CCDS31103.1	1q44	2012-08-09			ENSG00000203663	ENSG00000203663		"""GPCR / Class A : Olfactory receptors"""	8266	protein-coding gene	gene with protein product				OR2L4P, OR2L12		1370859	Standard	NM_001004686		Approved	HTPCRH07, HSHTPCRH07	uc001idw.3	Q8NH16	OTTHUMG00000040214	ENST00000366479.2:c.754G>T	1.37:g.248202323G>T	ENSP00000355435:p.Ala252Ser		Q2M3T5	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.A252S	ENST00000366479.2	37	c.754	CCDS31103.1	1	.	.	.	.	.	.	.	.	.	.	.	10.69	1.420324	0.25552	.	.	ENSG00000203663	ENST00000366479	T	0.38240	1.15	1.9	1.9	0.25705	GPCR, rhodopsin-like superfamily (1);	0.590255	0.12675	U	0.448469	T	0.18676	0.0448	N	0.05487	-0.04	0.09310	N	1	B	0.18013	0.025	B	0.21360	0.034	T	0.19943	-1.0290	10	0.66056	D	0.02	.	7.1094	0.25382	0.1509:0.0:0.8491:0.0	.	252	Q8NH16	OR2L2_HUMAN	S	252	ENSP00000355435:A252S	ENSP00000355435:A252S	A	+	1	0	OR2L2	246268946	0.001000	0.12720	0.883000	0.34634	0.202000	0.24057	0.311000	0.19380	0.897000	0.36392	0.194000	0.17425	GCA	OR2L2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000203663		0.507	OR2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L2	HGNC	protein_coding	OTTHUMT00000096871.1	267	0.00	0	G	NM_001004686		248202323	248202323	+1	no_errors	ENST00000366479	ensembl	human	known	69_37n	missense	429	12.24	60	SNP	0.002	T
OR2Y1	134083	genome.wustl.edu	37	5	180166708	180166708	+	Silent	SNP	C	C	T			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr5:180166708C>T	ENST00000307832.2	-	1	391	c.351G>A	c.(349-351)gtG>gtA	p.V117V		NM_001001657.1	NP_001001657.1	Q8NGV0	OR2Y1_HUMAN	olfactory receptor, family 2, subfamily Y, member 1	117						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	all_cancers(89;1.25e-05)|all_epithelial(37;4.36e-06)|Renal(175;0.000159)|Lung NSC(126;0.00317)|all_lung(126;0.0041)|Breast(19;0.114)	all_cancers(40;0.0834)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CAAAGGCCATCACCACCAGGA	0.612																																						dbGAP											0													77.0	64.0	68.0					5																	180166708		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB065676	CCDS34323.1	5q35	2012-08-09			ENSG00000174339	ENSG00000174339		"""GPCR / Class A : Olfactory receptors"""	14837	protein-coding gene	gene with protein product							Standard	NM_001001657		Approved		uc003mmf.1	Q8NGV0	OTTHUMG00000162237	ENST00000307832.2:c.351G>A	5.37:g.180166708C>T			B9EIP1|Q6IFB1|Q96R16	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.V117	ENST00000307832.2	37	c.351	CCDS34323.1	5																																																																																			OR2Y1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000174339		0.612	OR2Y1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2Y1	HGNC	protein_coding	OTTHUMT00000368059.2	189	0.00	0	C	XM_068682		180166708	180166708	-1	no_errors	ENST00000307832	ensembl	human	known	69_37n	silent	87	33.59	44	SNP	0.941	T
OR3A3	8392	genome.wustl.edu	37	17	3324376	3324376	+	Missense_Mutation	SNP	T	T	A			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr17:3324376T>A	ENST00000291231.1	+	1	515	c.515T>A	c.(514-516)aTg>aAg	p.M172K		NM_012373.2	NP_036505.2	P47888	OR3A3_HUMAN	olfactory receptor, family 3, subfamily A, member 3	172					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(3)|prostate(1)	9						ACTGTGGCCATGTCCACGCTC	0.572																																						dbGAP											0													130.0	120.0	123.0					17																	3324376		2203	4298	6501	-	-	-	SO:0001583	missense	0			U04688	CCDS11025.1	17p13.3	2012-08-09			ENSG00000159961	ENSG00000159961		"""GPCR / Class A : Olfactory receptors"""	8284	protein-coding gene	gene with protein product				OR3A6, OR3A7, OR3A8P		8004088, 9500546	Standard	NM_012373		Approved	OR17-201, OR17-137, OR17-16	uc010vrd.2	P47888	OTTHUMG00000090649	ENST00000291231.1:c.515T>A	17.37:g.3324376T>A	ENSP00000291231:p.Met172Lys		Q2VPE4|Q6IFM6|Q9P1Q4|Q9UBE7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.M172K	ENST00000291231.1	37	c.515	CCDS11025.1	17	.	.	.	.	.	.	.	.	.	.	.	3.674	-0.066889	0.07273	.	.	ENSG00000159961	ENST00000291231	T	0.00145	8.67	2.52	2.52	0.30459	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00178	0.0005	L	0.57130	1.785	0.09310	N	1	B	0.12013	0.005	B	0.24848	0.056	T	0.32455	-0.9906	9	0.72032	D	0.01	.	5.9901	0.19456	0.0:0.135:0.0:0.865	.	172	P47888	OR3A3_HUMAN	K	172	ENSP00000291231:M172K	ENSP00000291231:M172K	M	+	2	0	OR3A3	3271126	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	0.237000	0.17985	1.384000	0.46424	0.529000	0.55759	ATG	OR3A3	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000159961		0.572	OR3A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR3A3	HGNC	protein_coding	OTTHUMT00000207309.1	244	0.00	0	T			3324376	3324376	+1	no_errors	ENST00000291231	ensembl	human	known	69_37n	missense	134	27.57	51	SNP	0.009	A
OR52N4	390072	genome.wustl.edu	37	11	5776082	5776082	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr11:5776082G>T	ENST00000317254.3	+	1	160	c.112G>T	c.(112-114)Gtt>Ttt	p.V38F	TRIM5_ENST00000380027.1_Intron	NM_001005175.2	NP_001005175.3	Q8NGI2	O52N4_HUMAN	olfactory receptor, family 52, subfamily N, member 4 (gene/pseudogene)	38						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;1.87e-10)|LUSC - Lung squamous cell carcinoma(625;0.114)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.197)		CTCTATGTATGTTGTGGCTAT	0.443																																						dbGAP											0													153.0	149.0	150.0					11																	5776082		2009	4203	6212	-	-	-	SO:0001583	missense	0			AB065813	CCDS44528.1	11p15.4	2013-10-10	2013-10-10		ENSG00000181074	ENSG00000181074		"""GPCR / Class A : Olfactory receptors"""	15230	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily N, member 4"""				Standard	NM_001005175		Approved		uc001mbu.3	Q8NGI2	OTTHUMG00000066887	ENST00000317254.3:c.112G>T	11.37:g.5776082G>T	ENSP00000323224:p.Val38Phe		B2RNP8|Q6IF77	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.V38F	ENST00000317254.3	37	c.112	CCDS44528.1	11	.	.	.	.	.	.	.	.	.	.	G	11.73	1.727019	0.30593	.	.	ENSG00000181074	ENST00000317254	T	0.03065	4.06	5.93	1.61	0.23674	.	0.539113	0.15409	N	0.263872	T	0.03739	0.0106	L	0.38953	1.18	0.18873	N	0.999982	B	0.28378	0.209	B	0.32090	0.14	T	0.37934	-0.9684	10	0.62326	D	0.03	.	6.0376	0.19716	0.2235:0.3502:0.4263:0.0	.	38	Q8NGI2	O52N4_HUMAN	F	38	ENSP00000323224:V38F	ENSP00000323224:V38F	V	+	1	0	OR52N4	5732658	0.000000	0.05858	0.997000	0.53966	0.990000	0.78478	-1.712000	0.01885	0.829000	0.34733	0.551000	0.68910	GTT	OR52N4	-	pfam_7TM_GPCR_olfarory/Srsx,prints_7TM_GPCR_Rhodpsn	ENSG00000181074		0.443	OR52N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52N4	HGNC	protein_coding	OTTHUMT00000143350.1	220	0.00	0	G	NM_001005175		5776082	5776082	+1	no_errors	ENST00000317254	ensembl	human	known	69_37n	missense	154	21.83	43	SNP	0.291	T
OR5M1	390168	genome.wustl.edu	37	11	56380447	56380447	+	Missense_Mutation	SNP	A	A	C			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr11:56380447A>C	ENST00000526538.1	-	1	531	c.532T>G	c.(532-534)Tac>Gac	p.Y178D		NM_001004740.1	NP_001004740.1	Q8NGP8	OR5M1_HUMAN	olfactory receptor, family 5, subfamily M, member 1	178						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(7)|upper_aerodigestive_tract(1)	12						TCAGCGCAGTAGAAATGATTG	0.453																																						dbGAP											0													61.0	58.0	59.0					11																	56380447		1910	4113	6023	-	-	-	SO:0001583	missense	0			AB065742	CCDS53631.1	11q11	2012-08-09				ENSG00000255012		"""GPCR / Class A : Olfactory receptors"""	8352	protein-coding gene	gene with protein product							Standard	NM_001004740		Approved	OST050	uc001nja.1	Q8NGP8		ENST00000526538.1:c.532T>G	11.37:g.56380447A>C	ENSP00000435416:p.Tyr178Asp		Q6IF60|Q96RB6	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.Y178D	ENST00000526538.1	37	c.532	CCDS53631.1	11	.	.	.	.	.	.	.	.	.	.	A	13.19	2.163075	0.38217	.	.	ENSG00000255012	ENST00000526538	T	0.00202	8.56	3.71	3.71	0.42584	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36200	N	0.002732	T	0.00724	0.0024	M	0.92077	3.27	0.34126	D	0.664737	D	0.89917	1.0	D	0.97110	1.0	T	0.43798	-0.9369	10	0.87932	D	0	-75.7426	11.4861	0.50354	1.0:0.0:0.0:0.0	.	178	Q8NGP8	OR5M1_HUMAN	D	178	ENSP00000435416:Y178D	ENSP00000435416:Y178D	Y	-	1	0	OR5M1	56137023	0.998000	0.40836	0.999000	0.59377	0.233000	0.25261	5.384000	0.66225	1.586000	0.49944	0.232000	0.17820	TAC	OR5M1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000255012		0.453	OR5M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5M1	HGNC	protein_coding	OTTHUMT00000391610.1	107	0.00	0	A	NM_001004740		56380447	56380447	-1	no_errors	ENST00000526538	ensembl	human	known	69_37n	missense	114	21.38	31	SNP	0.999	C
PER3	8863	genome.wustl.edu	37	1	7858698	7858698	+	Missense_Mutation	SNP	T	T	A			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr1:7858698T>A	ENST00000361923.2	+	6	930	c.755T>A	c.(754-756)cTc>cAc	p.L252H	PER3_ENST00000377541.1_Missense_Mutation_p.L252H|PER3_ENST00000377532.3_Missense_Mutation_p.L253H	NM_016831.1	NP_058515.1	P56645	PER3_HUMAN	period circadian clock 3	252					circadian regulation of gene expression (GO:0032922)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(4)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	39	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		CCTTGCTGTCTCACTGTGGTT	0.443																																						dbGAP											0													170.0	139.0	149.0					1																	7858698		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC026102	CCDS89.1, CCDS72695.1	1p36.23	2012-12-13	2012-12-13		ENSG00000049246	ENSG00000049246			8847	protein-coding gene	gene with protein product		603427	"""period (Drosophila) homolog 3"", ""period homolog 3 (Drosophila)"""			9427249	Standard	XM_005263520		Approved		uc001aoo.3	P56645	OTTHUMG00000001216	ENST00000361923.2:c.755T>A	1.37:g.7858698T>A	ENSP00000355031:p.Leu252His		Q5H8X4|Q5H8X5|Q969K6|Q96S77|Q96S78|Q9C0J3|Q9NSP9|Q9UGU8	Missense_Mutation	SNP	pfam_Period_circadian-like_C,pfam_PAS_fold_3,pfam_PAS_fold,smart_PAS,pfscan_PAS	p.L252H	ENST00000361923.2	37	c.755	CCDS89.1	1	.	.	.	.	.	.	.	.	.	.	T	19.39	3.818877	0.71028	.	.	ENSG00000049246	ENST00000377541;ENST00000377532;ENST00000361923	T;T;T	0.55052	0.54;1.74;1.67	4.57	4.57	0.56435	.	0.000000	0.64402	D	0.000002	T	0.72590	0.3479	M	0.81942	2.565	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.999;0.999	T	0.77349	-0.2621	10	0.87932	D	0	.	13.2901	0.60267	0.0:0.0:0.0:1.0	.	252;253;253;252	A2I2N5;A6H8X0;P56645-2;P56645	.;.;.;PER3_HUMAN	H	252;253;252	ENSP00000366764:L252H;ENSP00000366755:L253H;ENSP00000355031:L252H	ENSP00000355031:L252H	L	+	2	0	PER3	7781285	1.000000	0.71417	0.698000	0.30274	0.680000	0.39746	6.834000	0.75339	1.931000	0.55961	0.533000	0.62120	CTC	PER3	-	NULL	ENSG00000049246		0.443	PER3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PER3	HGNC	protein_coding	OTTHUMT00000003607.1	169	0.00	0	T	NM_016831		7858698	7858698	+1	no_errors	ENST00000361923	ensembl	human	known	69_37n	missense	123	24.07	39	SNP	0.981	A
OR6F1	343169	genome.wustl.edu	37	1	247875610	247875610	+	Missense_Mutation	SNP	C	C	A	rs113882491		TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr1:247875610C>A	ENST00000302084.2	-	1	495	c.448G>T	c.(448-450)Gtg>Ttg	p.V150L	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005286.1	NP_001005286.1	Q8NGZ6	OR6F1_HUMAN	olfactory receptor, family 6, subfamily F, member 1	150						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(1)|large_intestine(5)|lung(34)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)	47	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0168)			AAACCACACACCCAGGAGCCC	0.582																																						dbGAP											0													66.0	74.0	71.0					1																	247875610		2203	4300	6503	-	-	-	SO:0001583	missense	0			BK004460	CCDS31095.1	1q44	2012-08-09			ENSG00000169214	ENSG00000169214		"""GPCR / Class A : Olfactory receptors"""	15027	protein-coding gene	gene with protein product							Standard	NM_001005286		Approved	OST731	uc001idj.1	Q8NGZ6	OTTHUMG00000040213	ENST00000302084.2:c.448G>T	1.37:g.247875610C>A	ENSP00000305640:p.Val150Leu		B2RNV6|Q6IF02|Q96R39	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.V150L	ENST00000302084.2	37	c.448	CCDS31095.1	1	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.351217	0.00219	.	.	ENSG00000169214	ENST00000302084	T	0.35236	1.32	3.99	-7.97	0.01139	GPCR, rhodopsin-like superfamily (1);	1.698520	0.03761	N	0.258220	T	0.10508	0.0257	N	0.04162	-0.26	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.26189	-1.0110	10	0.02654	T	1	-10.6238	0.357	0.00358	0.2213:0.2112:0.237:0.3306	.	150	Q8NGZ6	OR6F1_HUMAN	L	150	ENSP00000305640:V150L	ENSP00000305640:V150L	V	-	1	0	OR6F1	245942233	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-6.111000	0.00080	-3.275000	0.00198	-1.936000	0.00505	GTG	OR6F1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000169214		0.582	OR6F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6F1	HGNC	protein_coding	OTTHUMT00000096870.1	123	0.00	0	C	NM_001005286		247875610	247875610	-1	no_errors	ENST00000302084	ensembl	human	known	69_37n	missense	162	19.40	39	SNP	0.000	A
PILRB	29990	genome.wustl.edu	37	7	99956435	99956435	+	Missense_Mutation	SNP	A	A	G			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr7:99956435A>G	ENST00000452089.1	+	7	1246	c.187A>G	c.(187-189)Ata>Gta	p.I63V	PILRB_ENST00000609309.1_Missense_Mutation_p.I63V|STAG3L5P-PVRIG2P-PILRB_ENST00000310771.4_RNA|PILRB_ENST00000444073.1_Missense_Mutation_p.I63V|PILRB_ENST00000610247.1_Missense_Mutation_p.I63V|PILRB_ENST00000448382.1_Intron			Q9UKJ0	PILRB_HUMAN	paired immunoglobin-like type 2 receptor beta	63	Ig-like V-type.		I -> T (in dbSNP:rs11771799).	IVPN -> TAPD (in Ref. 2; CAC19193). {ECO:0000305}.	activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)				endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	13	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GGAGTTAGCCATAGTTCCCAA	0.527																																						dbGAP											0													69.0	70.0	69.0					7																	99956435		2201	4276	6477	-	-	-	SO:0001583	missense	0			AF161081, AJ400845	CCDS43622.1	7q22.1	2014-05-16			ENSG00000121716	ENSG00000121716		"""Immunoglobulin superfamily / V-set domain containing"""	18297	protein-coding gene	gene with protein product		605342				10660620	Standard	NM_178238		Approved	FDFACT1, FDFACT2	uc022ail.1	Q9UKJ0	OTTHUMG00000155363	ENST00000452089.1:c.187A>G	7.37:g.99956435A>G	ENSP00000391748:p.Ile63Val		Q69YF9|Q9HBS0	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	p.I63V	ENST00000452089.1	37	c.187	CCDS43622.1	7	.	.	.	.	.	.	.	.	.	.	A	7.597	0.671896	0.14776	.	.	ENSG00000121716	ENST00000310771;ENST00000420688;ENST00000452089;ENST00000457519;ENST00000443526;ENST00000419749;ENST00000422808;ENST00000444073;ENST00000413850;ENST00000438231	T;T;T;T;T;T;T;T	0.21361	2.01;2.01;2.01;2.01;2.01;2.01;2.01;2.01	2.15	-3.35	0.04928	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.984687	0.08271	N	0.971489	T	0.07458	0.0188	N	0.08118	0	0.09310	N	1	B	0.13145	0.007	B	0.06405	0.002	T	0.37033	-0.9723	9	.	.	.	.	2.2307	0.03995	0.3895:0.0:0.3601:0.2504	.	63	Q9UKJ0	PILRB_HUMAN	V	63;63;63;63;63;63;63;63;168;63	ENSP00000311153:I63V;ENSP00000391748:I63V;ENSP00000411261:I63V;ENSP00000403757:I63V;ENSP00000404321:I63V;ENSP00000389856:I63V;ENSP00000410764:I63V;ENSP00000408425:I63V	.	I	+	1	0	PILRB	99794371	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.496000	0.06436	-0.357000	0.08175	-0.874000	0.02982	ATA	PILRB	-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000121716		0.527	PILRB-008	KNOWN	basic|appris_principal|CCDS	protein_coding	PILRB	HGNC	protein_coding	OTTHUMT00000339923.2	142	0.00	0	A	NM_178238		99956435	99956435	+1	no_errors	ENST00000310771	ensembl	human	known	69_37n	missense	98	28.78	40	SNP	0.000	G
PLCL1	5334	genome.wustl.edu	37	2	198948674	198948674	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr2:198948674C>T	ENST00000428675.1	+	2	831	c.433C>T	c.(433-435)Cgc>Tgc	p.R145C	PLCL1_ENST00000437704.2_Missense_Mutation_p.R47C	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	145	Interaction with PPP1C.|PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	TCAAGCTCTTCGCTGGGAACC	0.438																																						dbGAP											0													66.0	68.0	67.0					2																	198948674		2203	4300	6503	-	-	-	SO:0001583	missense	0			D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.433C>T	2.37:g.198948674C>T	ENSP00000402861:p.Arg145Cys		Q3MJ90|Q53SD3|Q7Z3S3	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,prints_Pinositol_PLipase_C,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y	p.R145C	ENST00000428675.1	37	c.433	CCDS2326.2	2	.	.	.	.	.	.	.	.	.	.	C	17.38	3.376012	0.61735	.	.	ENSG00000115896	ENST00000428675;ENST00000437704	T;T	0.20069	2.1;2.1	5.67	5.67	0.87782	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.64402	D	0.000001	T	0.30448	0.0765	M	0.69463	2.115	0.80722	D	1	P;P	0.51351	0.944;0.944	B;B	0.43194	0.411;0.411	T	0.02958	-1.1089	9	.	.	.	.	20.1421	0.98061	0.0:1.0:0.0:0.0	.	145;71	Q15111;B4DYZ4	PLCL1_HUMAN;.	C	145;47	ENSP00000402861:R145C;ENSP00000414138:R47C	.	R	+	1	0	PLCL1	198656919	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.670000	0.54569	2.836000	0.97738	0.655000	0.94253	CGC	PLCL1	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000115896		0.438	PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCL1	HGNC	protein_coding	OTTHUMT00000340210.1	164	0.00	0	C	NM_006226		198948674	198948674	+1	no_errors	ENST00000428675	ensembl	human	known	69_37n	missense	141	15.57	26	SNP	1.000	T
POTEM	641455	genome.wustl.edu	37	14	20010197	20010197	+	Missense_Mutation	SNP	C	C	T	rs201777669		TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr14:20010197C>T	ENST00000551509.1	-	5	1012	c.961G>A	c.(961-963)Gtc>Atc	p.V321I	RP11-244H18.1_ENST00000547584.1_lincRNA|RNU6-1268P_ENST00000391214.1_RNA	NM_001145442.1	NP_001138914.1	A6NI47	POTEM_HUMAN	POTE ankyrin domain family, member M	321										endometrium(4)|kidney(1)|lung(4)	9						AGAAGGCTGACTATACTTGCC	0.358																																						dbGAP											0													11.0	12.0	12.0					14																	20010197		364	738	1102	-	-	-	SO:0001583	missense	0				CCDS73609.1	14q11.2	2013-01-10			ENSG00000187537	ENSG00000187537		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37096	protein-coding gene	gene with protein product	"""prostate-specific P704P"""					16364570	Standard	NM_001145442		Approved	POTE14beta, P704P, ACT	uc001vwc.3	A6NI47		ENST00000551509.1:c.961G>A	14.37:g.20010197C>T	ENSP00000452296:p.Val321Ile			Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.V321I	ENST00000551509.1	37	c.961	CCDS45076.1	14	.	.	.	.	.	.	.	.	.	.	c	10.89	1.478847	0.26511	.	.	ENSG00000187537	ENST00000551509;ENST00000439503;ENST00000344684	T	0.69685	-0.42	0.906	0.906	0.19314	Ankyrin repeat-containing domain (4);	0.760974	0.10024	U	0.725571	T	0.66157	0.2761	L	0.38649	1.16	0.09310	N	1	D	0.57899	0.981	P	0.60117	0.869	T	0.53599	-0.8416	9	.	.	.	.	5.193	0.15220	0.0:1.0:0.0:0.0	.	321	A6NI47	POTEM_HUMAN	I	321;406;321	ENSP00000452296:V321I	.	V	-	1	0	POTEM	19080197	0.231000	0.23751	0.040000	0.18447	0.081000	0.17604	1.030000	0.30153	0.793000	0.33875	0.184000	0.17185	GTC	POTEM	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000187537		0.358	POTEM-001	NOVEL	basic|appris_principal|CCDS	protein_coding	POTEM	HGNC	protein_coding	OTTHUMT00000409490.3	16	0.00	0	C	NM_001145442		20010197	20010197	-1	no_errors	ENST00000547848	ensembl	human	known	69_37n	missense	7	30.00	3	SNP	0.063	T
PPARG	5468	genome.wustl.edu	37	3	12434181	12434182	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr3:12434181_12434182insA	ENST00000287820.6	+	4	670_671	c.549_550insA	c.(550-552)aaafs	p.K184fs	PPARG_ENST00000397015.2_Frame_Shift_Ins_p.K156fs|PPARG_ENST00000539812.1_Frame_Shift_Ins_p.K154fs|PPARG_ENST00000397026.2_Frame_Shift_Ins_p.K162fs|PPARG_ENST00000397012.2_Frame_Shift_Ins_p.K156fs|PPARG_ENST00000397010.2_Frame_Shift_Ins_p.K156fs|PPARG_ENST00000309576.6_Frame_Shift_Ins_p.K156fs|PPARG_ENST00000397000.1_Frame_Shift_Ins_p.K156fs	NM_015869.4	NP_056953.2	P37231	PPARG_HUMAN	peroxisome proliferator-activated receptor gamma	184					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|brown fat cell differentiation (GO:0050873)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cellular response to insulin stimulus (GO:0032869)|cellular response to lithium ion (GO:0071285)|epithelial cell differentiation (GO:0030855)|fatty acid oxidation (GO:0019395)|G-protein coupled receptor signaling pathway (GO:0007186)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|innate immune response (GO:0045087)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|lipoprotein transport (GO:0042953)|long-chain fatty acid transport (GO:0015909)|low-density lipoprotein particle receptor biosynthetic process (GO:0045713)|monocyte differentiation (GO:0030224)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of cell growth (GO:0030308)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of sequestering of triglyceride (GO:0010891)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ regeneration (GO:0031100)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|placenta development (GO:0001890)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood pressure (GO:0008217)|regulation of cholesterol transporter activity (GO:0060694)|regulation of transcription involved in cell fate commitment (GO:0060850)|response to caffeine (GO:0031000)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to lipid (GO:0033993)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|response to retinoic acid (GO:0032526)|response to vitamin A (GO:0033189)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|white fat cell differentiation (GO:0050872)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|arachidonic acid binding (GO:0050544)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|prostaglandin receptor activity (GO:0004955)|retinoid X receptor binding (GO:0046965)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)		PAX8/PPARG(117)	breast(2)|endometrium(4)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)	20					Balsalazide(DB01014)|Bezafibrate(DB01393)|Glipizide(DB01067)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Mesalazine(DB00244)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Pioglitazone(DB01132)|Repaglinide(DB00912)|Rosiglitazone(DB00412)|Sulfasalazine(DB00795)|Telmisartan(DB00966)	GTCGGATCCACAAAAAAAGTAG	0.361			T	PAX8	follicular thyroid		"""Insulin resistance ; lipodystrophy, familial partial L;diabetes mellitus, insulin-resistantI, with acanthosis nigricans and hypertension"""																															dbGAP		Dom	yes		3	3p25	5468	"""peroxisome proliferative activated receptor, gamma"""	yes	E	0																																										-	-	-	SO:0001589	frameshift_variant	0			X90563	CCDS2609.1, CCDS2610.2	3p25	2013-01-16	2006-10-17		ENSG00000132170	ENSG00000132170		"""Nuclear hormone receptors"""	9236	protein-coding gene	gene with protein product		601487	"""peroxisome proliferative activated receptor, gamma"""			7862171, 9750197	Standard	NM_005037		Approved	PPARG1, PPARG2, NR1C3, PPARgamma	uc003bwx.3	P37231	OTTHUMG00000129764	ENST00000287820.6:c.556dupA	3.37:g.12434188_12434188dupA	ENSP00000287820:p.Lys184fs		A8K3G6|B5BUA1|O00684|O00710|O14515|Q0QJH8|Q15178|Q15179|Q15180|Q15832|Q86U60|Q96J12	Frame_Shift_Ins	INS	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_PPARgamma_N,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_1Cnucl_rcpt,prints_1Cnucl_rcpt_G,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.S185fs	ENST00000287820.6	37	c.549_550	CCDS2609.1	3																																																																																			PPARG	-	pfam_Znf_hrmn_rcpt,smart_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt	ENSG00000132170		0.361	PPARG-002	KNOWN	basic|CCDS	protein_coding	PPARG	HGNC	protein_coding	OTTHUMT00000251979.2	154	0.00	0	-	NM_005037		12434181	12434182	+1	no_errors	ENST00000287820	ensembl	human	known	69_37n	frame_shift_ins	111	27.45	42	INS	1.000:1.000	A
PPEF1	5475	genome.wustl.edu	37	X	18822013	18822013	+	Missense_Mutation	SNP	A	A	C			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chrX:18822013A>C	ENST00000361511.4	+	14	1563	c.1069A>C	c.(1069-1071)Att>Ctt	p.I357L	PPEF1_ENST00000349874.5_Intron|PPEF1_ENST00000359763.6_Missense_Mutation_p.I304L|PPEF1_ENST00000544635.1_Missense_Mutation_p.I292L|PPEF1_ENST00000543630.1_Intron	NM_006240.2|NM_152224.1	NP_006231.2|NP_689410.1	O14829	PPE1_HUMAN	protein phosphatase, EF-hand calcium binding domain 1	357	Catalytic.				detection of stimulus involved in sensory perception (GO:0050906)|phototransduction, visible light (GO:0007603)|protein dephosphorylation (GO:0006470)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)			breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	43	Hepatocellular(33;0.183)					TTCCAAGATTATTGATATTCT	0.398																																						dbGAP											0													114.0	104.0	107.0					X																	18822013		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC036026	CCDS14188.1, CCDS43920.1	Xp22	2013-01-10			ENSG00000086717	ENSG00000086717		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9243	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, alpha isozyme"""	300109		PPEF		9215685, 9326663	Standard	NM_152224		Approved	PPP7CA	uc004cyq.3	O14829	OTTHUMG00000021219	ENST00000361511.4:c.1069A>C	X.37:g.18822013A>C	ENSP00000354871:p.Ile357Leu		A6NHP4|A8K348|O15253|Q9NU21|Q9UJH0	Missense_Mutation	SNP	pfam_Metallo_PEstase_dom,pfam_EF-hand,pfam_PPP_dom,pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,smart_Ser/Thr-sp_prot-phosphatase,smart_EF_hand_Ca-bd,pirsf_Ser/Thr-Pase_EF-hand_contain,pfscan_EF_HAND_2,pfscan_IQ_motif_EF-hand-BS,prints_Ser/Thr-sp_prot-phosphatase	p.I357L	ENST00000361511.4	37	c.1069	CCDS14188.1	X	.	.	.	.	.	.	.	.	.	.	A	8.218	0.801804	0.16397	.	.	ENSG00000086717	ENST00000361511;ENST00000359763;ENST00000544635	T;T;T	0.04706	3.57;3.57;3.57	5.03	-0.294	0.12831	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (2);Metallophosphoesterase domain (1);	0.857445	0.10327	N	0.688049	T	0.02970	0.0088	N	0.25485	0.75	0.09310	N	1	B;B	0.24823	0.001;0.112	B;B	0.17722	0.012;0.019	T	0.47302	-0.9128	10	0.07030	T	0.85	-6.6121	7.5875	0.28002	0.3555:0.1511:0.4934:0.0	.	357;329	O14829;O14829-3	PPE1_HUMAN;.	L	357;304;292	ENSP00000354871:I357L;ENSP00000352806:I304L;ENSP00000441289:I292L	ENSP00000352806:I304L	I	+	1	0	PPEF1	18731934	0.050000	0.20438	0.116000	0.21606	0.900000	0.52787	0.107000	0.15375	-0.040000	0.13580	0.481000	0.45027	ATT	PPEF1	-	pfam_Metallo_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase,pirsf_Ser/Thr-Pase_EF-hand_contain,prints_Ser/Thr-sp_prot-phosphatase	ENSG00000086717		0.398	PPEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPEF1	HGNC	protein_coding	OTTHUMT00000055953.3	255	0.00	0	A	NM_006240		18822013	18822013	+1	no_errors	ENST00000361511	ensembl	human	known	69_37n	missense	119	44.91	97	SNP	0.066	C
PRELID1P1	728666	genome.wustl.edu	37	6	126965295	126965295	+	RNA	SNP	C	C	T			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr6:126965295C>T	ENST00000567272.1	+	0	662									PRELI domain containing 1 pseudogene 1																		AGCTGCAAGGCGAGGCCCCTT	0.527																																						dbGAP											0																																										-	-	-			0					6q22.32	2012-04-23			ENSG00000217325	ENSG00000217325			43886	pseudogene	pseudogene							Standard	NG_022903		Approved				OTTHUMG00000015520		6.37:g.126965295C>T				RNA	SNP	-	NULL	ENST00000567272.1	37	NULL		6																																																																																			PRELID1P1	-	-	ENSG00000217325		0.527	PRELID1P1-002	KNOWN	basic	processed_transcript	PRELID1P1	HGNC	pseudogene	OTTHUMT00000436205.1	76	0.00	0	C	NG_022903		126965295	126965295	+1	no_errors	ENST00000567272	ensembl	human	known	69_37n	rna	55	17.65	12	SNP	1.000	T
PRX	57716	genome.wustl.edu	37	19	40902117	40902117	+	Silent	SNP	G	G	C			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr19:40902117G>C	ENST00000324001.7	-	7	2412	c.2142C>G	c.(2140-2142)gtC>gtG	p.V714V	PRX_ENST00000291825.7_3'UTR	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin	714	55 X 5 AA approximate tandem repeats of [LVMAG]-[PSREQC]-[EDKL]-[LIVMAP]- [AQKHRPE]; that may have a tripeptide spacer of [LV]-P-[KER].				axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			TCATTTCACAGACTTTGGGCA	0.577																																						dbGAP											0													99.0	109.0	106.0					19																	40902117		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.2142C>G	19.37:g.40902117G>C			Q9BXL9|Q9HCF2	Silent	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.V714	ENST00000324001.7	37	c.2142	CCDS33028.1	19																																																																																			PRX	-	NULL	ENSG00000105227		0.577	PRX-001	KNOWN	basic|CCDS	protein_coding	PRX	HGNC	protein_coding	OTTHUMT00000462582.1	58	0.00	0	G	NM_020956		40902117	40902117	-1	no_errors	ENST00000324001	ensembl	human	known	69_37n	silent	66	12.00	9	SNP	0.000	C
RBMS3	27303	genome.wustl.edu	37	3	29804454	29804454	+	Missense_Mutation	SNP	A	A	T			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr3:29804454A>T	ENST00000383767.2	+	6	947	c.611A>T	c.(610-612)tAt>tTt	p.Y204F	RBMS3_ENST00000396583.3_Missense_Mutation_p.Y204F|RBMS3_ENST00000452462.1_Missense_Mutation_p.Y204F|RBMS3_ENST00000445033.1_Missense_Mutation_p.Y204F|RBMS3_ENST00000383766.2_Missense_Mutation_p.Y203F|RBMS3_ENST00000434693.2_Missense_Mutation_p.Y203F|RBMS3_ENST00000273139.9_Missense_Mutation_p.Y204F|RBMS3_ENST00000456853.1_Missense_Mutation_p.Y204F			Q6XE24	RBMS3_HUMAN	RNA binding motif, single stranded interacting protein 3	204	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|large_intestine(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	11		Ovarian(412;0.0956)				AATGGAAAATATCTGAAAACA	0.343																																						dbGAP											0													62.0	62.0	62.0					3																	29804454		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF023259	CCDS33724.1, CCDS33725.1, CCDS33726.1, CCDS54557.1, CCDS54558.1	3p24-p23	2013-02-12	2010-04-20		ENSG00000144642	ENSG00000144642		"""RNA binding motif (RRM) containing"""	13427	protein-coding gene	gene with protein product	"""RNA-binding protein"""	605786	"""RNA binding motif, single stranded interacting protein"""			10675610	Standard	NM_001003793		Approved		uc003cel.3	Q6XE24	OTTHUMG00000155699	ENST00000383767.2:c.611A>T	3.37:g.29804454A>T	ENSP00000373277:p.Tyr204Phe		A8K9S4|B7ZL17|G5E9J9|O75876|Q17RI0|Q6XE23	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,prints_Hud_Sxl_RNA,pfscan_RRM_dom	p.Y204F	ENST00000383767.2	37	c.611	CCDS33724.1	3	.	.	.	.	.	.	.	.	.	.	A	8.910	0.958378	0.18507	.	.	ENSG00000144642	ENST00000434693;ENST00000396583;ENST00000383767;ENST00000445033;ENST00000273139;ENST00000383766;ENST00000452462;ENST00000456853	T;T;T;T;T;T;T;T	0.15603	2.41;2.41;2.41;2.41;2.41;2.41;2.41;2.41	5.72	5.72	0.89469	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.060163	0.64402	D	0.000001	T	0.09642	0.0237	N	0.05259	-0.085	0.45867	D	0.998721	B;B;B;B	0.06786	0.0;0.001;0.0;0.001	B;B;B;B	0.15052	0.005;0.005;0.003;0.012	T	0.27673	-1.0067	9	.	.	.	.	16.2962	0.82776	1.0:0.0:0.0:0.0	.	204;204;203;204	G5E9J9;Q6XE24-2;Q6XE24-3;Q6XE24	.;.;.;RBMS3_HUMAN	F	203;204;204;204;204;203;204;204	ENSP00000395592:Y203F;ENSP00000379828:Y204F;ENSP00000373277:Y204F;ENSP00000391934:Y204F;ENSP00000273139:Y204F;ENSP00000373276:Y203F;ENSP00000397926:Y204F;ENSP00000400519:Y204F	.	Y	+	2	0	RBMS3	29779458	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	4.538000	0.60650	2.304000	0.77564	0.528000	0.53228	TAT	RBMS3	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000144642		0.343	RBMS3-001	KNOWN	basic|CCDS	protein_coding	RBMS3	HGNC	protein_coding	OTTHUMT00000341306.1	102	0.00	0	A	NM_001003792		29804454	29804454	+1	no_errors	ENST00000383767	ensembl	human	known	69_37n	missense	68	43.33	52	SNP	0.997	T
SDCBP	6386	genome.wustl.edu	37	8	59492212	59492212	+	Silent	SNP	G	G	A			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr8:59492212G>A	ENST00000260130.4	+	7	759	c.609G>A	c.(607-609)aaG>aaA	p.K203K	SDCBP_ENST00000523483.1_Silent_p.K223K|SDCBP_ENST00000422546.2_Silent_p.K202K|SDCBP_ENST00000447267.2_Silent_p.K149K|SDCBP_ENST00000413219.2_Silent_p.K203K|SDCBP_ENST00000424270.2_Silent_p.K197K|SDCBP_ENST00000520168.1_Silent_p.K144K|SDCBP_ENST00000447182.2_Silent_p.K202K	NM_001007068.1|NM_001007069.1|NM_005625.3	NP_001007069.1|NP_001007070.1|NP_005616.2	O00560	SDCB1_HUMAN	syndecan binding protein (syntenin)	203	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|intracellular signal transduction (GO:0035556)|positive regulation of JNK cascade (GO:0046330)|positive regulation of phosphorylation (GO:0042327)|protein targeting to membrane (GO:0006612)|Ras protein signal transduction (GO:0007265)|substrate-dependent cell migration, cell extension (GO:0006930)|synaptic transmission (GO:0007268)	adherens junction (GO:0005912)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|interleukin-5 receptor complex (GO:0005895)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	cytoskeletal adaptor activity (GO:0008093)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|interleukin-5 receptor binding (GO:0005137)|protein heterodimerization activity (GO:0046982)|protein N-terminus binding (GO:0047485)|syndecan binding (GO:0045545)			breast(1)|cervix(2)|kidney(1)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(1)	8		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				CCATGCATAAGGATAGCACTG	0.338																																						dbGAP											0													82.0	77.0	79.0					8																	59492212		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF000652	CCDS6172.1, CCDS47862.1, CCDS47863.1	8q12.1	2012-12-04			ENSG00000137575	ENSG00000137575			10662	protein-coding gene	gene with protein product		602217				9391086	Standard	NM_001007067		Approved	SYCL	uc003xtq.3	O00560	OTTHUMG00000164303	ENST00000260130.4:c.609G>A	8.37:g.59492212G>A			B2R5Q7|B4DUH3|B7ZLN2|O00173|O43391|Q14CP2	Silent	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.K203	ENST00000260130.4	37	c.609	CCDS6172.1	8																																																																																			SDCBP	-	superfamily_PDZ,pfscan_PDZ	ENSG00000137575		0.338	SDCBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SDCBP	HGNC	protein_coding	OTTHUMT00000378193.1	121	0.82	1	G	NM_005625		59492212	59492212	+1	no_errors	ENST00000260130	ensembl	human	known	69_37n	silent	99	20.16	25	SNP	1.000	A
SENP7	57337	genome.wustl.edu	37	3	101046584	101046584	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr3:101046584G>A	ENST00000394095.2	-	23	2994	c.2941C>T	c.(2941-2943)Cct>Tct	p.P981S	SENP7_ENST00000314261.7_Missense_Mutation_p.P915S|SENP7_ENST00000394094.2_Missense_Mutation_p.P916S|SENP7_ENST00000394091.1_Missense_Mutation_p.P817S|SENP7_ENST00000348610.3_Missense_Mutation_p.P948S|SENP7_ENST00000394085.3_Missense_Mutation_p.P169S|SENP7_ENST00000358203.3_Missense_Mutation_p.P817S	NM_001282802.1|NM_020654.3	NP_001269731.1|NP_065705.3	Q9BQF6	SENP7_HUMAN	SUMO1/sentrin specific peptidase 7	981	Protease.					intracellular (GO:0005622)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)			breast(2)|endometrium(1)|kidney(1)|large_intestine(16)|lung(15)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						GGAACTTTAGGGCATAGATCC	0.338																																						dbGAP											0													213.0	187.0	196.0					3																	101046584		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2941.2, CCDS43121.1, CCDS63704.1, CCDS63705.1, CCDS63706.1	3q12	2008-02-05	2005-08-17		ENSG00000138468	ENSG00000138468			30402	protein-coding gene	gene with protein product		612846	"""SUMO1/sentrin specific protease 7"""			11214970, 11230166	Standard	NM_001282802		Approved		uc003dut.3	Q9BQF6	OTTHUMG00000149927	ENST00000394095.2:c.2941C>T	3.37:g.101046584G>A	ENSP00000377655:p.Pro981Ser		A1L3A5|A8MW39|B7WNW8|Q7Z3F4|Q96PS5|Q9C0F6|Q9HBT5	Missense_Mutation	SNP	pfam_Peptidase_C48,pfscan_Peptidase_C48	p.P981S	ENST00000394095.2	37	c.2941	CCDS2941.2	3	.	.	.	.	.	.	.	.	.	.	G	21.2	4.119372	0.77323	.	.	ENSG00000138468	ENST00000394095;ENST00000394094;ENST00000314261;ENST00000394091;ENST00000358203;ENST00000394085;ENST00000348610	T;T;T;T;T;T;T	0.28895	1.59;1.59;1.59;1.59;1.59;1.59;1.59	5.33	5.33	0.75918	.	0.107592	0.64402	D	0.000003	T	0.52837	0.1759	L	0.56124	1.755	0.40209	D	0.977606	D;D;D;D;D	0.89917	0.998;0.995;0.997;0.999;1.0	D;P;P;D;D	0.74023	0.939;0.904;0.901;0.976;0.982	T	0.51888	-0.8648	10	0.54805	T	0.06	-3.5253	19.3803	0.94530	0.0:0.0:1.0:0.0	.	817;915;948;981;169	Q9BQF6-4;Q9BQF6-5;Q9BQF6-2;Q9BQF6;Q9BQF6-3	.;.;.;SENP7_HUMAN;.	S	981;916;915;817;817;169;948	ENSP00000377655:P981S;ENSP00000377654:P916S;ENSP00000313624:P915S;ENSP00000377651:P817S;ENSP00000350936:P817S;ENSP00000377647:P169S;ENSP00000342159:P948S	ENSP00000313624:P915S	P	-	1	0	SENP7	102529274	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.585000	0.60977	2.651000	0.90000	0.655000	0.94253	CCT	SENP7	-	pfam_Peptidase_C48,pfscan_Peptidase_C48	ENSG00000138468		0.338	SENP7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SENP7	HGNC	protein_coding	OTTHUMT00000313957.2	303	0.00	0	G	NM_020654		101046584	101046584	-1	no_errors	ENST00000394095	ensembl	human	known	69_37n	missense	218	15.50	40	SNP	1.000	A
SMOX	54498	genome.wustl.edu	37	20	4163027	4163028	+	Frame_Shift_Ins	INS	-	-	G	rs145014650|rs6084654		TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr20:4163027_4163028insG	ENST00000305958.4	+	5	1126_1127	c.901_902insG	c.(901-903)cggfs	p.R301fs	SMOX_ENST00000346595.2_Intron|SMOX_ENST00000379460.2_Frame_Shift_Ins_p.R301fs|SMOX_ENST00000339123.6_Intron|SMOX_ENST00000278795.3_Intron	NM_175839.2	NP_787033.1	Q9NWM0	SMOX_HUMAN	spermine oxidase	301			R -> P (in dbSNP:rs6084654).		cellular nitrogen compound metabolic process (GO:0034641)|oxidation-reduction process (GO:0055114)|polyamine biosynthetic process (GO:0006596)|polyamine catabolic process (GO:0006598)|polyamine metabolic process (GO:0006595)|small molecule metabolic process (GO:0044281)|spermine catabolic process (GO:0046208)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	N1-acetylspermine:oxygen oxidoreductase (N1-acetylspermidine-forming) activity (GO:0052895)|norspermine:oxygen oxidoreductase activity (GO:0052894)|polyamine oxidase activity (GO:0046592)|spermine:oxygen oxidoreductase (spermidine-forming) activity (GO:0052901)	p.R301W(1)		breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(7)|lung(5)|skin(2)|urinary_tract(1)	26					Spermine(DB00127)	AGAGGAGCCCCGGGGGGGCAGG	0.673																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AK000753	CCDS13075.1, CCDS13076.1, CCDS13077.1, CCDS13078.1, CCDS74702.1	20p13	2003-10-15	2003-10-15	2003-10-15	ENSG00000088826	ENSG00000088826			15862	protein-coding gene	gene with protein product		615854	"""chromosome 20 open reading frame 16"""	C20orf16		11454677, 12398765	Standard	NM_175839		Approved	FLJ20746, dJ779E11.1, PAO, PAOh1, MGC1010, SMO	uc002wkp.3	Q9NWM0	OTTHUMG00000031777	ENST00000305958.4:c.908dupG	20.37:g.4163034_4163034dupG	ENSP00000307252:p.Arg301fs		A2A2P5|A2A2P6|A8BE87|D3DVZ4|Q5TE26|Q5TE27|Q6UY28|Q8IX00|Q96LC3|Q96LC4|Q96QT3|Q9BW38|Q9H6H1|Q9NP51|Q9NPY1|Q9NPY2	Frame_Shift_Ins	INS	pfam_Amino_oxidase,pfam_FAD-dep_OxRdtase,pfam_FAD_bind_dom	p.R304fs	ENST00000305958.4	37	c.901_902	CCDS13075.1	20																																																																																			SMOX	-	NULL	ENSG00000088826		0.673	SMOX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	SMOX	HGNC	protein_coding	OTTHUMT00000077806.1	37	0.00	0	-	NM_175842		4163027	4163028	+1	no_errors	ENST00000305958	ensembl	human	known	69_37n	frame_shift_ins	69	10.39	8	INS	0.105:0.064	G
SPECC1	92521	genome.wustl.edu	37	17	20130836	20130836	+	Silent	SNP	C	C	T			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr17:20130836C>T	ENST00000261503.5	+	5	2025	c.1974C>T	c.(1972-1974)atC>atT	p.I658I	SPECC1_ENST00000472876.1_3'UTR|SPECC1_ENST00000395527.4_Silent_p.I658I|SPECC1_ENST00000536879.1_5'UTR|SPECC1_ENST00000584527.1_Silent_p.I76I|AC004702.2_ENST00000580225.1_lincRNA|SPECC1_ENST00000395530.2_Silent_p.I577I|SPECC1_ENST00000395525.3_Silent_p.I577I|SPECC1_ENST00000395529.3_Silent_p.I658I|SPECC1_ENST00000395522.2_Silent_p.I577I	NM_001033553.2	NP_001028725.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1	658					cell adhesion (GO:0007155)	nucleus (GO:0005634)				breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)		ATGCAGAGATCAAAGACATGA	0.418																																						dbGAP											0													79.0	73.0	75.0					17																	20130836		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487			30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793				15602574, 18763323, 15087372	Standard	NM_001033553		Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808	ENST00000261503.5:c.1974C>T	17.37:g.20130836C>T			B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	Missense_Mutation	SNP	pfam_CH-domain,superfamily_CH-domain	p.S163L	ENST00000261503.5	37	c.488	CCDS32590.1	17																																																																																			SPECC1	-	NULL	ENSG00000128487		0.418	SPECC1-018	KNOWN	basic|appris_principal|CCDS	protein_coding	SPECC1	HGNC	protein_coding	OTTHUMT00000441206.1	87	0.00	0	C	NM_152904		20130836	20130836	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000581399	ensembl	human	putative	69_37n	missense	46	11.32	6	SNP	0.297	T
ST8SIA5	29906	genome.wustl.edu	37	18	44336460	44336460	+	Silent	SNP	C	C	T			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr18:44336460C>T	ENST00000315087.7	-	1	672	c.12G>A	c.(10-12)gcG>gcA	p.A4A	ST8SIA5_ENST00000536490.1_Silent_p.A4A|RP11-742D12.2_ENST00000602329.1_RNA|RP11-742D12.2_ENST00000602333.1_RNA|ST8SIA5_ENST00000538168.1_Silent_p.A4A	NM_013305.4	NP_037437.2	O15466	SIA8E_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5	4					carbohydrate metabolic process (GO:0005975)|glycosphingolipid biosynthetic process (GO:0006688)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialyltransferase activity (GO:0008373)			kidney(1)|large_intestine(10)|lung(7)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	22						CCGAGGGGTCCGCGTAGCGCA	0.687																																						dbGAP											0													71.0	69.0	70.0					18																	44336460		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U91641	CCDS11930.1	18q12.3	2013-03-01	2003-01-14	2005-02-07	ENSG00000101638	ENSG00000101638		"""Sialyltransferases"""	17827	protein-coding gene	gene with protein product	"""ST8Sia V"""	607162	"""sialyltransferase 8E (alpha-2, 8-polysialytransferase)"""	SIAT8E		9199191	Standard	XM_005258250		Approved		uc002lcj.1	O15466	OTTHUMG00000132643	ENST00000315087.7:c.12G>A	18.37:g.44336460C>T			B7Z1K9|Q6IAW7	Silent	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.A4	ENST00000315087.7	37	c.12	CCDS11930.1	18																																																																																			ST8SIA5	-	pirsf_Sialyl_trans	ENSG00000101638		0.687	ST8SIA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST8SIA5	HGNC	protein_coding	OTTHUMT00000255892.1	31	0.00	0	C	NM_013305		44336460	44336460	-1	no_errors	ENST00000315087	ensembl	human	known	69_37n	silent	25	28.57	10	SNP	0.936	T
STAT5A	6776	genome.wustl.edu	37	17	40453429	40453429	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr17:40453429G>T	ENST00000345506.4	+	10	1768	c.1126G>T	c.(1126-1128)Gag>Tag	p.E376*	STAT5A_ENST00000546010.2_Nonsense_Mutation_p.E346*|STAT5A_ENST00000452307.2_Nonsense_Mutation_p.E376*|STAT5A_ENST00000588868.1_Nonsense_Mutation_p.E376*|STAT5A_ENST00000590949.1_Nonsense_Mutation_p.E376*	NM_003152.3	NP_003143.2	P42229	STA5A_HUMAN	signal transducer and activator of transcription 5A	376					2-oxoglutarate metabolic process (GO:0006103)|allantoin metabolic process (GO:0000255)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|development of secondary female sexual characteristics (GO:0046543)|development of secondary male sexual characteristics (GO:0046544)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|fatty acid metabolic process (GO:0006631)|female pregnancy (GO:0007565)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|lipid storage (GO:0019915)|luteinization (GO:0001553)|mammary gland epithelium development (GO:0061180)|natural killer cell differentiation (GO:0001779)|negative regulation of erythrocyte differentiation (GO:0045647)|negative regulation of mast cell apoptotic process (GO:0033026)|oxaloacetate metabolic process (GO:0006107)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch development (GO:0048541)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of mast cell differentiation (GO:0060376)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prolactin signaling pathway (GO:0038161)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of cell adhesion (GO:0030155)|regulation of epithelial cell differentiation (GO:0030856)|regulation of multicellular organism growth (GO:0040014)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|succinate metabolic process (GO:0006105)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|taurine metabolic process (GO:0019530)|transcription, DNA-templated (GO:0006351)|valine metabolic process (GO:0006573)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	calcium ion binding (GO:0005509)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	14		all_cancers(22;1.56e-06)|all_epithelial(22;3.17e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.128)		CATCATCAGTGAGCAGCAGGC	0.587																																						dbGAP											0													126.0	108.0	114.0					17																	40453429		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U43185	CCDS11424.1, CCDS74066.1, CCDS74067.1	17q11.2	2013-02-14			ENSG00000126561	ENSG00000126561		"""SH2 domain containing"""	11366	protein-coding gene	gene with protein product		601511		STAT5		7719937, 8631883	Standard	NM_003152		Approved	MGF	uc002hzj.2	P42229	OTTHUMG00000150725	ENST00000345506.4:c.1126G>T	17.37:g.40453429G>T	ENSP00000341208:p.Glu376*		Q1KLZ6	Nonsense_Mutation	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,smart_SH2,pfscan_SH2	p.E376*	ENST00000345506.4	37	c.1126	CCDS11424.1	17	.	.	.	.	.	.	.	.	.	.	G	37	6.515948	0.97629	.	.	ENSG00000126561	ENST00000345506;ENST00000546010;ENST00000540577;ENST00000452307	.	.	.	4.6	4.6	0.57074	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-8.5545	17.4923	0.87708	0.0:0.0:1.0:0.0	.	.	.	.	X	376;346;378;376	.	ENSP00000341208:E376X	E	+	1	0	STAT5A	37706955	1.000000	0.71417	0.994000	0.49952	0.927000	0.56198	9.780000	0.99024	2.122000	0.65172	0.306000	0.20318	GAG	STAT5A	-	pfam_STAT_TF_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000126561		0.587	STAT5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAT5A	HGNC	protein_coding	OTTHUMT00000319804.1	73	0.00	0	G	NM_003152		40453429	40453429	+1	no_errors	ENST00000345506	ensembl	human	known	69_37n	nonsense	39	39.06	25	SNP	1.000	T
SYCP2	10388	genome.wustl.edu	37	20	58453083	58453083	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr20:58453083C>A	ENST00000357552.3	-	32	3184	c.2959G>T	c.(2959-2961)Gga>Tga	p.G987*	SYCP2_ENST00000371001.2_Nonsense_Mutation_p.G987*			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	987					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			CTTGGCTGTCCCTTTTCCAAG	0.284																																						dbGAP											0													86.0	89.0	88.0					20																	58453083		2203	4298	6501	-	-	-	SO:0001587	stop_gained	0			Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.2959G>T	20.37:g.58453083C>A	ENSP00000350162:p.Gly987*		A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Nonsense_Mutation	SNP	NULL	p.G987*	ENST00000357552.3	37	c.2959	CCDS13482.1	20	.	.	.	.	.	.	.	.	.	.	C	38	6.692946	0.97768	.	.	ENSG00000196074	ENST00000371001;ENST00000357552;ENST00000446834	.	.	.	5.06	0.0541	0.14309	.	1.184840	0.05911	N	0.631626	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	-1.54	6.5899	0.22642	0.0:0.4779:0.0:0.5221	.	.	.	.	X	987	.	ENSP00000350162:G987X	G	-	1	0	SYCP2	57886478	0.000000	0.05858	0.011000	0.14972	0.576000	0.36127	0.221000	0.17680	0.207000	0.20607	-0.378000	0.06908	GGA	SYCP2	-	NULL	ENSG00000196074		0.284	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP2	HGNC	protein_coding	OTTHUMT00000079930.3	183	0.00	0	C	NM_014258		58453083	58453083	-1	no_errors	ENST00000357552	ensembl	human	known	69_37n	nonsense	232	14.39	39	SNP	0.001	A
SYT10	341359	genome.wustl.edu	37	12	33592394	33592394	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr12:33592394C>T	ENST00000228567.3	-	1	360	c.64G>A	c.(64-66)Gag>Aag	p.E22K	SYT10_ENST00000535526.1_5'UTR	NM_198992.3	NP_945343.1	Q6XYQ8	SYT10_HUMAN	synaptotagmin X	22					regulation of calcium ion-dependent exocytosis (GO:0017158)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(3)|skin(4)|urinary_tract(1)	42	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)					AAGCACAGCTCGGTGACGATG	0.582																																						dbGAP											0													220.0	201.0	208.0					12																	33592394		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY198413	CCDS8732.1	12p11	2013-01-21			ENSG00000110975	ENSG00000110975		"""Synaptotagmins"""	19266	protein-coding gene	gene with protein product							Standard	NM_198992		Approved		uc001rll.1	Q6XYQ8	OTTHUMG00000169269	ENST00000228567.3:c.64G>A	12.37:g.33592394C>T	ENSP00000228567:p.Glu22Lys		Q495U2	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting,prints_Synaptotagmin,prints_C2_dom	p.E22K	ENST00000228567.3	37	c.64	CCDS8732.1	12	.	.	.	.	.	.	.	.	.	.	C	19.89	3.911663	0.72983	.	.	ENSG00000110975	ENST00000228567	T	0.56275	0.47	4.4	3.49	0.39957	.	0.000000	0.39687	U	0.001290	T	0.47322	0.1439	M	0.66939	2.045	0.80722	D	1	P	0.39601	0.68	B	0.31191	0.125	T	0.56312	-0.8000	10	0.66056	D	0.02	.	13.6929	0.62559	0.0:0.843:0.1569:0.0	.	22	Q6XYQ8	SYT10_HUMAN	K	22	ENSP00000228567:E22K	ENSP00000228567:E22K	E	-	1	0	SYT10	33483661	0.999000	0.42202	0.992000	0.48379	0.997000	0.91878	4.171000	0.58236	1.114000	0.41781	0.650000	0.86243	GAG	SYT10	-	NULL	ENSG00000110975		0.582	SYT10-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SYT10	HGNC	protein_coding	OTTHUMT00000403222.1	112	0.00	0	C	NM_198992		33592394	33592394	-1	no_errors	ENST00000228567	ensembl	human	known	69_37n	missense	97	26.52	35	SNP	1.000	T
TAOK2	9344	genome.wustl.edu	37	16	29994057	29994057	+	Silent	SNP	C	C	T			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr16:29994057C>T	ENST00000308893.4	+	11	1877	c.834C>T	c.(832-834)caC>caT	p.H278H	TAOK2_ENST00000279394.3_Silent_p.H278H|TAOK2_ENST00000543033.1_Silent_p.H278H|TAOK2_ENST00000416441.2_Silent_p.H105H	NM_001252043.1|NM_016151.3	NP_001238972.1|NP_057235.2	Q9UL54	TAOK2_HUMAN	TAO kinase 2	278	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|focal adhesion assembly (GO:0048041)|G2 DNA damage checkpoint (GO:0031572)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein targeting to membrane (GO:0006612)|regulation of cell growth (GO:0001558)|regulation of cell shape (GO:0008360)|response to stress (GO:0006950)|stress-activated MAPK cascade (GO:0051403)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleolus (GO:0005730)|nucleus (GO:0005634)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|mitogen-activated protein kinase kinase binding (GO:0031434)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(3)|skin(1)	22						TCCCCCAGCACCGCTTTGTGC	0.637																																						dbGAP											0													61.0	58.0	59.0					16																	29994057		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AB020688	CCDS10662.1, CCDS10663.1, CCDS58448.1	16p11.2	2008-02-05			ENSG00000149930	ENSG00000149930			16835	protein-coding gene	gene with protein product		613199				10048485, 9786855	Standard	NM_016151		Approved	TAO1, KIAA0881, PSK, PSK1, TAO2, MAP3K17	uc002dva.2	Q9UL54	OTTHUMG00000132111	ENST00000308893.4:c.834C>T	16.37:g.29994057C>T			A5PKY1|A7MCZ2|B2RN35|B7ZM88|O94957|Q6UW73|Q7LC09|Q9NSW2	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.H278	ENST00000308893.4	37	c.834	CCDS10663.1	16																																																																																			TAOK2	-	pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000149930		0.637	TAOK2-002	KNOWN	basic|CCDS	protein_coding	TAOK2	HGNC	protein_coding	OTTHUMT00000255152.2	60	0.00	0	C	NM_016151		29994057	29994057	+1	no_errors	ENST00000308893	ensembl	human	known	69_37n	silent	86	11.34	11	SNP	1.000	T
TBK1	29110	genome.wustl.edu	37	12	64849731	64849731	+	Missense_Mutation	SNP	A	A	T			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr12:64849731A>T	ENST00000331710.5	+	2	420	c.81A>T	c.(79-81)agA>agT	p.R27S		NM_013254.3	NP_037386.1	Q9UHD2	TBK1_HUMAN	TANK-binding kinase 1	27	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				defense response to Gram-positive bacterium (GO:0050830)|defense response to virus (GO:0051607)|dendritic cell proliferation (GO:0044565)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of gene expression (GO:0010629)|negative regulation of type I interferon production (GO:0032480)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|response to virus (GO:0009615)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|type I interferon production (GO:0032606)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)	ATP binding (GO:0005524)|nucleic acid binding (GO:0003676)|phosphoprotein binding (GO:0051219)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)	20				GBM - Glioblastoma multiforme(28;0.0386)		TTCGTGGAAGACATAAGGTTA	0.383																																						dbGAP											0													78.0	74.0	75.0					12																	64849731		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF191838	CCDS8968.1	12q14.2	2006-06-10			ENSG00000183735	ENSG00000183735			11584	protein-coding gene	gene with protein product		604834				10581243, 10783893	Standard	NM_013254		Approved	NAK	uc001ssc.2	Q9UHD2	OTTHUMG00000168796	ENST00000331710.5:c.81A>T	12.37:g.64849731A>T	ENSP00000329967:p.Arg27Ser		A8K4S4|Q8IYV3|Q9NUJ5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.R27S	ENST00000331710.5	37	c.81	CCDS8968.1	12	.	.	.	.	.	.	.	.	.	.	A	19.17	3.776472	0.70107	.	.	ENSG00000183735	ENST00000331710;ENST00000538890;ENST00000540417	T;T;T	0.42131	0.98;3.21;3.21	5.03	1.38	0.22167	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.56978	0.2022	M	0.79614	2.46	0.58432	D	0.999992	D	0.62365	0.991	D	0.78314	0.991	T	0.52335	-0.8589	9	.	.	.	-10.5272	4.6561	0.12618	0.5894:0.1535:0.2572:0.0	.	27	Q9UHD2	TBK1_HUMAN	S	27	ENSP00000329967:R27S;ENSP00000445834:R27S;ENSP00000445628:R27S	.	R	+	3	2	TBK1	63135998	0.999000	0.42202	1.000000	0.80357	0.904000	0.53231	0.830000	0.27462	0.056000	0.16144	0.454000	0.30748	AGA	TBK1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000183735		0.383	TBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBK1	HGNC	protein_coding	OTTHUMT00000401130.1	47	0.00	0	A	NM_013254		64849731	64849731	+1	no_errors	ENST00000331710	ensembl	human	known	69_37n	missense	47	14.29	8	SNP	0.998	T
TDRD12	91646	genome.wustl.edu	37	19	33233785	33233785	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr19:33233785G>T	ENST00000444215.2	+	4	739	c.419G>T	c.(418-420)tGc>tTc	p.C140F	TDRD12_ENST00000421545.2_Missense_Mutation_p.C140F			Q587J7	TDR12_HUMAN	tudor domain containing 12	140					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			NS(1)|breast(1)|endometrium(3)|lung(2)|prostate(1)|skin(1)	9	Esophageal squamous(110;0.137)					ATTGACTTCTGCCGAGACAGT	0.398																																						dbGAP											0													140.0	113.0	121.0					19																	33233785		692	1591	2283	-	-	-	SO:0001583	missense	0			AK023134	CCDS46038.1	19q13.11	2013-01-23				ENSG00000173809		"""Tudor domain containing"""	25044	protein-coding gene	gene with protein product						11441184	Standard	NM_001110822		Approved	ECAT8, FLJ13072	uc002ntq.2	Q587J7		ENST00000444215.2:c.419G>T	19.37:g.33233785G>T	ENSP00000416248:p.Cys140Phe			Missense_Mutation	SNP	pfam_Tudor,pfam_DNA/RNA_helicase_DEAD/DEAH_N	p.C140F	ENST00000444215.2	37	c.419		19	.	.	.	.	.	.	.	.	.	.	G	7.827	0.719038	0.15372	.	.	ENSG00000173809	ENST00000444215;ENST00000421545	T	0.23950	1.88	5.35	4.31	0.51392	.	0.000000	0.64402	D	0.000001	T	0.24774	0.0601	M	0.71581	2.175	0.41615	D	0.988931	P;P	0.46395	0.877;0.689	B;B	0.38562	0.276;0.242	T	0.06267	-1.0836	10	0.54805	T	0.06	-5.9707	7.2643	0.26222	0.1727:0.0:0.8273:0.0	.	140;140	E9PAY0;Q587J7	.;TDR12_HUMAN	F	140	ENSP00000416248:C140F	ENSP00000390621:C140F	C	+	2	0	TDRD12	37925625	1.000000	0.71417	1.000000	0.80357	0.064000	0.16182	3.030000	0.49720	2.496000	0.84212	0.655000	0.94253	TGC	TDRD12	-	NULL	ENSG00000173809		0.398	TDRD12-001	KNOWN	basic|appris_principal	protein_coding	TDRD12	HGNC	protein_coding	OTTHUMT00000435933.1	141	0.00	0	G	NM_001015890		33233785	33233785	+1	no_errors	ENST00000444215	ensembl	human	known	69_37n	missense	167	17.16	35	SNP	1.000	T
TMEM132D	121256	genome.wustl.edu	37	12	129559313	129559313	+	Missense_Mutation	SNP	T	T	A			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr12:129559313T>A	ENST00000422113.2	-	9	2733	c.2407A>T	c.(2407-2409)Aac>Tac	p.N803Y	TMEM132D_ENST00000389441.4_Missense_Mutation_p.N341Y	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	803					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		GTGTTGGGGTTAGCATCGTTT	0.483																																						dbGAP											0													186.0	147.0	160.0					12																	129559313		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.2407A>T	12.37:g.129559313T>A	ENSP00000408581:p.Asn803Tyr		Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	NULL	p.N803Y	ENST00000422113.2	37	c.2407	CCDS9266.1	12	.	.	.	.	.	.	.	.	.	.	T	13.18	2.161318	0.38119	.	.	ENSG00000151952	ENST00000389441;ENST00000422113	T;T	0.14516	2.5;2.5	4.2	3.04	0.35103	.	0.229844	0.36591	N	0.002515	T	0.18676	0.0448	L	0.53249	1.67	0.34326	D	0.687114	D;P	0.56968	0.978;0.939	P;P	0.49999	0.628;0.532	T	0.23261	-1.0193	9	.	.	.	-21.8599	9.5387	0.39237	0.0:0.0857:0.0:0.9143	.	803;341	Q14C87;Q14C87-2	T132D_HUMAN;.	Y	341;803	ENSP00000374092:N341Y;ENSP00000408581:N803Y	.	N	-	1	0	TMEM132D	128125266	0.449000	0.25689	0.026000	0.17262	0.335000	0.28730	1.705000	0.37867	0.586000	0.29626	0.379000	0.24179	AAC	TMEM132D	-	NULL	ENSG00000151952		0.483	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132D	HGNC	protein_coding	OTTHUMT00000399592.1	186	0.00	0	T	NM_133448		129559313	129559313	-1	no_errors	ENST00000422113	ensembl	human	known	69_37n	missense	140	27.08	52	SNP	0.845	A
TMTC4	84899	genome.wustl.edu	37	13	101289953	101289953	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr13:101289953G>A	ENST00000376234.3	-	8	970	c.781C>T	c.(781-783)Ctc>Ttc	p.L261F	TMTC4_ENST00000342624.5_Missense_Mutation_p.L280F|TMTC4_ENST00000462211.1_5'UTR|TMTC4_ENST00000328767.5_Missense_Mutation_p.L150F	NM_001079669.1	NP_001073137.1	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat containing 4	261						integral component of membrane (GO:0016021)		p.L280F(1)		breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					AGCATGCCGAGATTCTGCAAG	0.567																																						dbGAP											1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											58.0	58.0	58.0					13																	101289953		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9497.2, CCDS41904.1, CCDS66575.1	13q32.3	2013-01-10	2006-01-06		ENSG00000125247	ENSG00000125247		"""Tetratricopeptide (TTC) repeat domain containing"""	25904	protein-coding gene	gene with protein product							Standard	XM_005254082		Approved	FLJ14624, FLJ22153	uc001vot.3	Q5T4D3	OTTHUMG00000017289	ENST00000376234.3:c.781C>T	13.37:g.101289953G>A	ENSP00000365408:p.Leu261Phe		A6NLI7|B7Z666|Q5T4D4|Q5T4D5|Q5T4D6|Q8WV63|Q96SU8	Missense_Mutation	SNP	pfam_TPR-1,pfam_DUF1736,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.L280F	ENST00000376234.3	37	c.838	CCDS41904.1	13	.	.	.	.	.	.	.	.	.	.	G	1.403	-0.577582	0.03854	.	.	ENSG00000125247	ENST00000376234;ENST00000342624;ENST00000328767	T;T;T	0.61859	0.07;0.09;0.96	5.6	-11.2	0.00127	.	2.489730	0.01211	N	0.007856	T	0.23886	0.0578	N	0.01352	-0.895	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.06405	0.001;0.002;0.001;0.001	T	0.43637	-0.9379	10	0.31617	T	0.26	.	7.9823	0.30192	0.1387:0.2902:0.4798:0.0913	.	150;261;261;280	B7Z666;Q5T4D3-2;Q5T4D3;Q5T4D3-3	.;.;TMTC4_HUMAN;.	F	261;280;150	ENSP00000365408:L261F;ENSP00000343871:L280F;ENSP00000365409:L150F	ENSP00000365409:L150F	L	-	1	0	TMTC4	100087954	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.895000	0.01606	-4.454000	0.00048	-0.867000	0.03001	CTC	TMTC4	-	NULL	ENSG00000125247		0.567	TMTC4-004	KNOWN	basic|appris_principal|CCDS	protein_coding	TMTC4	HGNC	protein_coding	OTTHUMT00000045649.2	61	0.00	0	G	NM_032813		101289953	101289953	-1	no_errors	ENST00000342624	ensembl	human	known	69_37n	missense	54	22.54	16	SNP	0.000	A
TPR	7175	genome.wustl.edu	37	1	186305686	186305686	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr1:186305686C>A	ENST00000367478.4	-	33	4943	c.4647G>T	c.(4645-4647)aaG>aaT	p.K1549N		NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	1549					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		TTTTTTCTTCCTTTTCAGTTA	0.398			T	NTRK1	papillary thyroid																																	dbGAP		Dom	yes		1	1q25	7175	translocated promoter region		E	0													157.0	136.0	143.0					1																	186305686		1870	4102	5972	-	-	-	SO:0001583	missense	0			U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.4647G>T	1.37:g.186305686C>A	ENSP00000356448:p.Lys1549Asn		Q15655|Q5SWY0|Q99968	Missense_Mutation	SNP	pfam_TPR_MLP1_2,superfamily_Prefoldin,superfamily_tRNA-bd_arm	p.K1549N	ENST00000367478.4	37	c.4647	CCDS41446.1	1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.066417	0.76187	.	.	ENSG00000047410	ENST00000367478	T	0.27720	1.65	5.75	4.79	0.61399	.	0.000000	0.85682	D	0.000000	T	0.53578	0.1805	M	0.77616	2.38	0.49130	D	0.999755	D	0.76494	0.999	D	0.80764	0.994	T	0.56613	-0.7950	10	0.62326	D	0.03	.	9.9848	0.41835	0.0:0.8365:0.0:0.1635	.	1549	P12270	TPR_HUMAN	N	1549	ENSP00000356448:K1549N	ENSP00000356448:K1549N	K	-	3	2	TPR	184572309	0.995000	0.38212	1.000000	0.80357	0.993000	0.82548	0.404000	0.20999	1.300000	0.44818	0.655000	0.94253	AAG	TPR	-	NULL	ENSG00000047410		0.398	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPR	HGNC	protein_coding	OTTHUMT00000086353.2	173	0.00	0	C	NM_003292		186305686	186305686	-1	no_errors	ENST00000367478	ensembl	human	known	69_37n	missense	262	12.67	38	SNP	1.000	A
TTC28	23331	genome.wustl.edu	37	22	28503210	28503210	+	Missense_Mutation	SNP	C	C	T	rs529615602		TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr22:28503210C>T	ENST00000397906.2	-	7	2764	c.2623G>A	c.(2623-2625)Gac>Aac	p.D875N		NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28	875					mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						CGGCCCCTGTCGAGCACAGAC	0.488													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19617	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													62.0	57.0	59.0					22																	28503210		692	1591	2283	-	-	-	SO:0001583	missense	0			AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.2623G>A	22.37:g.28503210C>T	ENSP00000381003:p.Asp875Asn		K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	Missense_Mutation	SNP	pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.D875N	ENST00000397906.2	37	c.2623	CCDS46678.1	22	.	.	.	.	.	.	.	.	.	.	C	23.5	4.424856	0.83667	.	.	ENSG00000100154	ENST00000397906	T	0.75821	-0.97	5.44	5.44	0.79542	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.113469	0.56097	D	0.000021	T	0.79106	0.4390	L	0.54965	1.715	0.80722	D	1	D	0.59767	0.986	P	0.52189	0.692	T	0.79981	-0.1574	10	0.51188	T	0.08	-38.4997	18.2551	0.90017	0.0:1.0:0.0:0.0	.	875	Q96AY4	TTC28_HUMAN	N	875	ENSP00000381003:D875N	ENSP00000381003:D875N	D	-	1	0	TTC28	26833210	1.000000	0.71417	0.960000	0.40013	0.867000	0.49689	7.298000	0.78815	2.536000	0.85505	0.650000	0.86243	GAC	TTC28	-	pfscan_TPR-contain_dom	ENSG00000100154		0.488	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	TTC28	HGNC	protein_coding	OTTHUMT00000320930.2	66	0.00	0	C	XM_929318		28503210	28503210	-1	no_errors	ENST00000397906	ensembl	human	novel	69_37n	missense	39	29.09	16	SNP	1.000	T
TTC5	91875	genome.wustl.edu	37	14	20768886	20768886	+	Silent	SNP	C	C	A			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr14:20768886C>A	ENST00000258821.3	-	3	332	c.276G>T	c.(274-276)ctG>ctT	p.L92L		NM_138376.2	NP_612385.2	Q8N0Z6	TTC5_HUMAN	tetratricopeptide repeat domain 5	92					DNA repair (GO:0006281)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	15	all_cancers(95;0.00092)		Epithelial(56;1.1e-06)|all cancers(55;8.07e-06)	GBM - Glioblastoma multiforme(265;0.0106)		CAGCCTTTGACAGAAGCTCCT	0.532																																						dbGAP											0													134.0	132.0	132.0					14																	20768886		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC008647	CCDS9546.1	14q11.2	2013-01-11			ENSG00000136319	ENSG00000136319		"""Tetratricopeptide (TTC) repeat domain containing"""	19274	protein-coding gene	gene with protein product						11511361	Standard	NM_138376		Approved	Strap	uc001vwt.3	Q8N0Z6	OTTHUMG00000029506	ENST00000258821.3:c.276G>T	14.37:g.20768886C>A			A8MQ18|Q96HF9	Splice_Site	SNP	-	e3+1	ENST00000258821.3	37	c.273+1	CCDS9546.1	14	.	.	.	.	.	.	.	.	.	.	C	14.22	2.470984	0.43942	.	.	ENSG00000136319	ENST00000423949	.	.	.	5.16	-0.115	0.13560	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.9306	0.09283	0.4663:0.2315:0.2283:0.0739	.	.	.	.	.	-1	.	.	.	-	.	.	TTC5	19838726	0.443000	0.25641	0.993000	0.49108	0.996000	0.88848	-0.456000	0.06754	-0.191000	0.10448	0.655000	0.94253	.	TTC5	-	-	ENSG00000136319		0.532	TTC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC5	HGNC	protein_coding	OTTHUMT00000073529.4	106	0.00	0	C	NM_138376		20768886	20768886	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000423949	ensembl	human	novel	69_37n	splice_site	96	25.58	33	SNP	0.980	A
UPF3A	65110	genome.wustl.edu	37	13	115052027	115052027	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr13:115052027G>A	ENST00000375299.3	+	5	610	c.554G>A	c.(553-555)tGt>tAt	p.C185Y	UPF3A_ENST00000475218.2_3'UTR|UPF3A_ENST00000351487.5_Missense_Mutation_p.C152Y	NM_023011.3	NP_075387.1	Q9H1J1	REN3A_HUMAN	UPF3 regulator of nonsense transcripts homolog A (yeast)	185					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleocytoplasmic transport (GO:0006913)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			autonomic_ganglia(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	16	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)	OV - Ovarian serous cystadenocarcinoma(48;0.195)|Epithelial(10;0.2)		GAAACCTACTGTGTGGAGGAA	0.408																																						dbGAP											0													47.0	48.0	48.0					13																	115052027		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF318575	CCDS9543.1, CCDS9544.1	13q34	2010-04-30			ENSG00000169062	ENSG00000169062			20332	protein-coding gene	gene with protein product		605530				11113196, 11163187	Standard	NM_023011		Approved	RENT3A, UPF3, HUPF3A	uc001vup.3	Q9H1J1	OTTHUMG00000017403	ENST00000375299.3:c.554G>A	13.37:g.115052027G>A	ENSP00000364448:p.Cys185Tyr		A2A366|Q5T8C3|Q5T8C9|Q7Z6N3|Q86YK1|Q9BZI8	Missense_Mutation	SNP	pfam_Nonsense_mediated_decay_UPF3	p.C185Y	ENST00000375299.3	37	c.554	CCDS9543.1	13	.	.	.	.	.	.	.	.	.	.	G	15.00	2.702503	0.48307	.	.	ENSG00000169062	ENST00000375299;ENST00000351487	T;T	0.77229	-0.04;-1.08	5.22	1.45	0.22620	Regulator of nonsense-mediated decay, UPF3 (1);	0.193248	0.56097	D	0.000026	T	0.80864	0.4705	M	0.61703	1.905	0.25545	N	0.987149	P;P	0.48407	0.731;0.91	P;P	0.50352	0.502;0.638	T	0.75637	-0.3249	9	.	.	.	-0.9174	17.8537	0.88755	0.0:0.501:0.499:0.0	.	152;185	Q9H1J1-2;Q9H1J1	.;REN3A_HUMAN	Y	185;152	ENSP00000364448:C185Y;ENSP00000329592:C152Y	.	C	+	2	0	UPF3A	114070129	1.000000	0.71417	0.071000	0.20095	0.579000	0.36224	2.938000	0.48987	-0.042000	0.13535	-0.218000	0.12543	TGT	UPF3A	-	pfam_Nonsense_mediated_decay_UPF3	ENSG00000169062		0.408	UPF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UPF3A	HGNC	protein_coding	OTTHUMT00000045968.2	183	0.00	0	G			115052027	115052027	+1	no_errors	ENST00000375299	ensembl	human	known	69_37n	missense	193	17.87	42	SNP	0.998	A
VWA3B	200403	genome.wustl.edu	37	2	98834364	98834364	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr2:98834364C>A	ENST00000477737.1	+	14	2096	c.1892C>A	c.(1891-1893)aCc>aAc	p.T631N		NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	631	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.									NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						CCTATTTATACCATCTCCTTC	0.398																																						dbGAP											0													107.0	98.0	101.0					2																	98834364		1838	4092	5930	-	-	-	SO:0001583	missense	0			AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.1892C>A	2.37:g.98834364C>A	ENSP00000417955:p.Thr631Asn		B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Nonsense_Mutation	SNP	NULL	p.Y41*	ENST00000477737.1	37	c.123	CCDS42718.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.9|20.9	4.065502|4.065502	0.76187|0.76187	.|.	.|.	ENSG00000168658|ENSG00000168658	ENST00000477737|ENST00000473149	T|.	0.22539|.	1.95|.	5.77|5.77	5.77|5.77	0.91146|0.91146	von Willebrand factor, type A (3);|.	0.267081|.	0.30649|.	N|.	0.009166|.	T|.	0.76863|.	0.4047|.	M|M	0.87269|0.87269	2.87|2.87	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.76494|.	0.989;0.999;0.995;0.979|.	P;D;D;P|.	0.69824|.	0.839;0.966;0.948;0.839|.	T|.	0.73503|.	-0.3962|.	10|.	0.46703|0.12766	T|T	0.11|0.61	.|.	16.9083|16.9083	0.86134|0.86134	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	23;631;631;631|.	Q502W6-5;Q502W6;Q502W6-8;Q502W6-6|.	.;VWA3B_HUMAN;.;.|.	N|X	631|41	ENSP00000417955:T631N|.	ENSP00000417955:T631N|ENSP00000436153:Y41X	T|Y	+|+	2|3	0|2	VWA3B|VWA3B	98200796|98200796	1.000000|1.000000	0.71417|0.71417	0.970000|0.970000	0.41538|0.41538	0.583000|0.583000	0.36354|0.36354	4.920000|4.920000	0.63390|0.63390	2.723000|2.723000	0.93209|0.93209	0.655000|0.655000	0.94253|0.94253	ACC|TAC	VWA3B	-	NULL	ENSG00000168658		0.398	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA3B	HGNC	protein_coding	OTTHUMT00000353469.2	171	0.00	0	C	NM_144992		98834364	98834364	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000489630	ensembl	human	known	69_37n	nonsense	164	15.03	29	SNP	0.994	A
VWA5B2	90113	genome.wustl.edu	37	3	183952157	183952157	+	Silent	SNP	G	G	A			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr3:183952157G>A	ENST00000426955.2	+	5	892	c.792G>A	c.(790-792)cgG>cgA	p.R264R	EIF2B5_ENST00000444495.1_Intron|VWA5B2_ENST00000273794.5_Silent_p.R45R	NM_138345.1	NP_612354.1	Q8N398	VW5B2_HUMAN	von Willebrand factor A domain containing 5B2	275										breast(3)|endometrium(4)|kidney(1)|lung(1)|prostate(1)|skin(5)	15						ACTGTGACCGGGCCTTGGAGA	0.612																																						dbGAP											0													31.0	33.0	32.0					3																	183952157		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS54686.1	3q27.1	2008-07-25	2008-07-25		ENSG00000145198	ENSG00000145198			25144	protein-coding gene	gene with protein product						15231747	Standard	NM_138345		Approved	DKFZp761K032, LOC90113	uc011bra.2	Q8N398	OTTHUMG00000156820	ENST00000426955.2:c.792G>A	3.37:g.183952157G>A			B9EGN7	Silent	SNP	NULL	p.R264	ENST00000426955.2	37	c.792	CCDS54686.1	3																																																																																			VWA5B2	-	NULL	ENSG00000145198		0.612	VWA5B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA5B2	HGNC	protein_coding	OTTHUMT00000346004.2	26	0.00	0	G	XM_291077		183952157	183952157	+1	no_errors	ENST00000426955	ensembl	human	known	69_37n	silent	42	16.00	8	SNP	1.000	A
XYLT1	64131	genome.wustl.edu	37	16	17228421	17228421	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr16:17228421C>T	ENST00000261381.6	-	9	2020	c.1936G>A	c.(1936-1938)Gac>Aac	p.D646N	CTD-2576D5.4_ENST00000567344.1_RNA	NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	646					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						AGTGTCACGTCGCTCAGGCTG	0.622																																						dbGAP											0													112.0	95.0	101.0					16																	17228421		2197	4300	6497	-	-	-	SO:0001583	missense	0			AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.1936G>A	16.37:g.17228421C>T	ENSP00000261381:p.Asp646Asn		Q9H1B6	Missense_Mutation	SNP	pfam_XylT_met,pfam_Glyco_trans_14	p.D646N	ENST00000261381.6	37	c.1936	CCDS10569.1	16	.	.	.	.	.	.	.	.	.	.	C	35	5.458257	0.96240	.	.	ENSG00000103489	ENST00000261381	T	0.54071	0.59	5.33	5.33	0.75918	.	0.044642	0.85682	D	0.000000	T	0.74405	0.3712	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.70016	0.967	T	0.78347	-0.2239	10	0.87932	D	0	-39.1663	18.0069	0.89212	0.0:1.0:0.0:0.0	.	646	Q86Y38	XYLT1_HUMAN	N	646	ENSP00000261381:D646N	ENSP00000261381:D646N	D	-	1	0	XYLT1	17135922	1.000000	0.71417	0.985000	0.45067	0.794000	0.44872	7.787000	0.85759	2.489000	0.83994	0.561000	0.74099	GAC	XYLT1	-	pfam_XylT_met	ENSG00000103489		0.622	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XYLT1	HGNC	protein_coding	OTTHUMT00000252241.2	92	0.00	0	C	NM_022166		17228421	17228421	-1	no_errors	ENST00000261381	ensembl	human	known	69_37n	missense	115	31.55	53	SNP	1.000	T
ZBTB7C	201501	genome.wustl.edu	37	18	45566518	45566519	+	Frame_Shift_Ins	INS	-	-	C	rs113275715		TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr18:45566518_45566519insC	ENST00000588982.1	-	3	1461_1462	c.960_961insG	c.(958-963)gggcctfs	p.P321fs	ZBTB7C_ENST00000590800.1_Frame_Shift_Ins_p.P321fs|ZBTB7C_ENST00000535628.2_Frame_Shift_Ins_p.P321fs|ZBTB7C_ENST00000586438.1_Frame_Shift_Ins_p.P321fs|ZBTB7C_ENST00000332053.2_Frame_Shift_Ins_p.P321fs			A1YPR0	ZBT7C_HUMAN	zinc finger and BTB domain containing 7C	321	Pro-rich.						metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(8)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						GGTCCCAGAGGCCCCCCCGGCA	0.624																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			Y14591	CCDS32830.1	18q21.1	2013-01-08		2005-04-07	ENSG00000184828	ENSG00000184828		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	31700	protein-coding gene	gene with protein product			"""zinc finger and BTB domain containing 36"""	ZBTB36			Standard	NM_001039360		Approved	ZNF857C	uc002ldb.3	A1YPR0		ENST00000588982.1:c.961dupG	18.37:g.45566525_45566525dupC	ENSP00000468782:p.Pro321fs		O73453	Frame_Shift_Ins	INS	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.P320fs	ENST00000588982.1	37	c.961_960	CCDS32830.1	18																																																																																			ZBTB7C	-	NULL	ENSG00000184828		0.624	ZBTB7C-025	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZBTB7C	HGNC	protein_coding	OTTHUMT00000450731.1	42	0.00	0	-	NM_001039360		45566518	45566519	-1	no_errors	ENST00000332053	ensembl	human	known	69_37n	frame_shift_ins	26	13.33	4	INS	1.000:0.989	C
ZFHX4	79776	genome.wustl.edu	37	8	77618443	77618443	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr8:77618443C>T	ENST00000521891.2	+	2	2568	c.2120C>T	c.(2119-2121)tCt>tTt	p.S707F	ZFHX4_ENST00000455469.2_Missense_Mutation_p.S707F|ZFHX4_ENST00000518282.1_Missense_Mutation_p.S707F|ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000050961.6_Missense_Mutation_p.S707F	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	707					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TGTAACTACTCTACCACTACC	0.483										HNSCC(33;0.089)																												dbGAP											0													63.0	66.0	65.0					8																	77618443		2198	4300	6498	-	-	-	SO:0001583	missense	0				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.2120C>T	8.37:g.77618443C>T	ENSP00000430497:p.Ser707Phe		G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.S707F	ENST00000521891.2	37	c.2120	CCDS47878.2	8	.	.	.	.	.	.	.	.	.	.	C	15.55	2.865765	0.51588	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.25579	1.79;1.79;1.79;1.79	4.99	4.99	0.66335	Zinc finger, C2H2-like (1);Zinc finger, U1-type (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.44285	U	0.000474	T	0.52709	0.1751	M	0.73372	2.23	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.999;1.0	D;D;D;D	0.97110	0.998;0.998;0.997;1.0	T	0.55108	-0.8192	10	0.87932	D	0	.	18.8304	0.92137	0.0:1.0:0.0:0.0	.	707;707;707;707	Q86UP3;Q86UP3-4;G3V138;Q86UP3-3	ZFHX4_HUMAN;.;.;.	F	707	ENSP00000430497:S707F;ENSP00000399605:S707F;ENSP00000050961:S707F;ENSP00000430848:S707F	ENSP00000050961:S707F	S	+	2	0	ZFHX4	77780998	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.609000	0.82925	2.746000	0.94184	0.650000	0.86243	TCT	ZFHX4	-	smart_Znf_U1,smart_Znf_C2H2-like	ENSG00000091656		0.483	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2	82	0.00	0	C	NM_024721		77618443	77618443	+1	no_errors	ENST00000521891	ensembl	human	known	69_37n	missense	76	20.83	20	SNP	1.000	T
ZFP64	55734	genome.wustl.edu	37	20	50768782	50768782	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr20:50768782G>T	ENST00000216923.4	-	6	2298	c.1949C>A	c.(1948-1950)tCc>tAc	p.S650Y	ZFP64_ENST00000346617.4_Missense_Mutation_p.S596Y|ZFP64_ENST00000477786.1_Intron|ZFP64_ENST00000361387.2_Intron|ZFP64_ENST00000371518.2_Intron|ZFP64_ENST00000371515.4_Missense_Mutation_p.S648Y	NM_018197.2|NM_199426.1	NP_060667.2|NP_955458.1	Q9NPA5	ZF64A_HUMAN	ZFP64 zinc finger protein	650					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(5)|large_intestine(8)|lung(11)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	33						CTGGGAAGAGGAGGAGAAGAC	0.572																																						dbGAP											0													95.0	81.0	86.0					20																	50768782		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001596	CCDS13439.1, CCDS13440.1, CCDS13441.1, CCDS13442.1	20q13.11-q13.13	2013-01-08	2012-11-27		ENSG00000020256	ENSG00000020256		"""Zinc fingers, C2H2-type"""	15940	protein-coding gene	gene with protein product			"""zinc finger protein 338"", ""zinc finger protein 64 homolog (mouse)"", ""zinc finger protein 64"""	ZNF338		9034307	Standard	NM_199427		Approved	FLJ10734, dJ831D17.1, FLJ12628, dJ548G19.1	uc002xwl.3	Q9NPA5	OTTHUMG00000032756	ENST00000216923.4:c.1949C>A	20.37:g.50768782G>T	ENSP00000216923:p.Ser650Tyr		Q9NTS7|Q9NVH4	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S650Y	ENST00000216923.4	37	c.1949	CCDS13440.1	20	.	.	.	.	.	.	.	.	.	.	G	9.245	1.039186	0.19669	.	.	ENSG00000020256	ENST00000216923;ENST00000346617;ENST00000371515;ENST00000546083	T;T;T	0.09630	2.97;3.01;2.96	5.69	4.74	0.60224	.	0.000000	0.51477	D	0.000093	T	0.10809	0.0264	L	0.29908	0.895	0.09310	N	1	B;B;B	0.28324	0.207;0.132;0.132	B;B;B	0.30646	0.118;0.055;0.055	T	0.18871	-1.0323	10	0.87932	D	0	-16.8023	14.6914	0.69087	0.0694:0.0:0.9306:0.0	.	596;648;650	Q9NPA5-2;Q5JWM1;Q9NPA5	.;.;ZF64A_HUMAN	Y	650;596;648;492	ENSP00000216923:S650Y;ENSP00000344615:S596Y;ENSP00000360570:S648Y	ENSP00000216923:S650Y	S	-	2	0	ZFP64	50202189	1.000000	0.71417	0.008000	0.14137	0.018000	0.09664	7.831000	0.86748	1.408000	0.46895	-0.145000	0.13849	TCC	ZFP64	-	NULL	ENSG00000020256		0.572	ZFP64-003	KNOWN	basic|CCDS	protein_coding	ZFP64	HGNC	protein_coding	OTTHUMT00000079744.1	60	0.00	0	G	NM_018197		50768782	50768782	-1	no_errors	ENST00000216923	ensembl	human	known	69_37n	missense	51	10.53	6	SNP	0.078	T
ZNF268	10795	genome.wustl.edu	37	12	133780972	133780974	+	In_Frame_Del	DEL	CTT	CTT	-	rs368166258	byFrequency	TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	CTT	CTT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr12:133780972_133780974delCTT	ENST00000536435.2	+	6	3030_3032	c.2700_2702delCTT	c.(2698-2703)accttc>acc	p.F901del	ZNF268_ENST00000537565.1_In_Frame_Del_p.F740del|ZNF268_ENST00000541009.2_3'UTR|ZNF268_ENST00000536899.2_3'UTR|ZNF268_ENST00000542986.2_3'UTR|ZNF268_ENST00000228289.5_In_Frame_Del_p.F901del	NM_001165885.1|NM_003415.2	NP_001159357.1|NP_003406.1	Q14587	ZN268_HUMAN	zinc finger protein 268	901					cell differentiation (GO:0030154)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein heterodimerization activity (GO:0043497)|regulation of transcription, DNA-templated (GO:0006355)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.F901delF(1)		NS(2)|breast(3)|endometrium(4)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(1)|skin(1)	24	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.000215)|all_epithelial(31;0.096)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		GTGGGAAAACCTTCTCTCAAAAA	0.419														3	0.000599042	0.0	0.0	5008	,	,		21500	0.001		0.001	False		,,,				2504	0.001					dbGAP											1	Deletion - In frame(1)	breast(1)																																								-	-	-	SO:0001651	inframe_deletion	0			X78926	CCDS45012.1, CCDS53851.1, CCDS53852.1, CCDS53853.1, CCDS53854.1, CCDS59239.1, CCDS59240.1	12q24.33	2013-01-08				ENSG00000090612		"""Zinc fingers, C2H2-type"", ""-"""	13061	protein-coding gene	gene with protein product		604753				7865130	Standard	NM_003415		Approved	HZF3	uc010tcf.2	Q14587	OTTHUMG00000167946	ENST00000536435.2:c.2700_2702delCTT	12.37:g.133780972_133780974delCTT	ENSP00000444412:p.Phe901del		Q8TDG8|Q96RH4|Q9BZJ9	In_Frame_Del	DEL	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F901in_frame_del	ENST00000536435.2	37	c.2700_2702	CCDS45012.1	12																																																																																			ZNF268	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000090612		0.419	ZNF268-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF268	HGNC	protein_coding	OTTHUMT00000397191.2	83	0.00	0	CTT	NM_152943		133780972	133780974	+1	no_errors	ENST00000228289	ensembl	human	known	69_37n	in_frame_del	105	11.02	13	DEL	0.001:0.175:0.158	-
ZNF585A	199704	genome.wustl.edu	37	19	37644489	37644489	+	Silent	SNP	A	A	G	rs62110074	byFrequency	TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr19:37644489A>G	ENST00000356958.4	-	5	570	c.312T>C	c.(310-312)caT>caC	p.H104H	ZNF585A_ENST00000588723.1_Intron|ZNF585A_ENST00000355533.2_Silent_p.H49H|ZNF585A_ENST00000392157.2_Silent_p.H49H|ZNF585A_ENST00000292841.5_Silent_p.H49H			Q6P3V2	Z585A_HUMAN	zinc finger protein 585A	104					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|central_nervous_system(1)|endometrium(2)|large_intestine(17)|lung(11)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TACATTGATTATGGTCCCATA	0.323																																						dbGAP											0													117.0	122.0	120.0					19																	37644489		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AK074345	CCDS12499.1, CCDS74353.1	19q13.13	2013-01-08				ENSG00000196967		"""Zinc fingers, C2H2-type"", ""-"""	26305	protein-coding gene	gene with protein product						12477932	Standard	NM_199126		Approved	FLJ23765	uc002ofn.1	Q6P3V2		ENST00000356958.4:c.312T>C	19.37:g.37644489A>G			Q8TE95|Q96MV3	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H104	ENST00000356958.4	37	c.312		19																																																																																			ZNF585A	-	NULL	ENSG00000196967		0.323	ZNF585A-001	KNOWN	basic|appris_principal	protein_coding	ZNF585A	HGNC	protein_coding	OTTHUMT00000457980.2	67	0.00	0	A	NM_152655		37644489	37644489	-1	no_errors	ENST00000356958	ensembl	human	known	69_37n	silent	81	16.49	16	SNP	0.020	G
ZSWIM6	57688	genome.wustl.edu	37	5	60768572	60768572	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0FW-01A-11W-A050-09	TCGA-AN-A0FW-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5afde43a-194c-4876-b244-2132aef2f505	46a8d552-b686-4976-988e-a18128e26017	g.chr5:60768572C>A	ENST00000252744.5	+	2	741	c.741C>A	c.(739-741)aaC>aaA	p.N247K		NM_020928.1	NP_065979.1	Q9HCJ5	ZSWM6_HUMAN	zinc finger, SWIM-type containing 6	247					neuron projection morphogenesis (GO:0048812)|regulation of neuron migration (GO:2001222)		zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)	8						CTGTTTGCAACGTGGCCATCA	0.463																																						dbGAP											0													120.0	102.0	108.0					5																	60768572		692	1591	2283	-	-	-	SO:0001583	missense	0			BC039438	CCDS47215.1	5q12.1	2011-03-17			ENSG00000130449	ENSG00000130449		"""Zinc fingers, SWIM-type"""	29316	protein-coding gene	gene with protein product		615951				10997877, 16427614	Standard	NM_020928		Approved	KIAA1577	uc003jsr.3	Q9HCJ5	OTTHUMG00000162388	ENST00000252744.5:c.741C>A	5.37:g.60768572C>A	ENSP00000252744:p.Asn247Lys			Missense_Mutation	SNP	pfscan_Znf_SWIM,prints_Antifreeze_1	p.N247K	ENST00000252744.5	37	c.741	CCDS47215.1	5	.	.	.	.	.	.	.	.	.	.	C	6.263	0.416665	0.11870	.	.	ENSG00000130449	ENST00000252744	T	0.38077	1.16	5.61	2.9	0.33743	Zinc finger, SWIM-type (1);	.	.	.	.	T	0.16342	0.0393	N	0.12569	0.235	0.49299	D	0.999771	B	0.12630	0.006	B	0.16722	0.016	T	0.09975	-1.0650	9	0.06365	T	0.9	-7.7037	7.6901	0.28563	0.0:0.5573:0.0:0.4427	.	247	Q9HCJ5	ZSWM6_HUMAN	K	247	ENSP00000252744:N247K	ENSP00000252744:N247K	N	+	3	2	ZSWIM6	60804329	0.967000	0.33354	1.000000	0.80357	0.996000	0.88848	0.151000	0.16283	0.430000	0.26230	-0.123000	0.14984	AAC	ZSWIM6	-	pfscan_Znf_SWIM	ENSG00000130449		0.463	ZSWIM6-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ZSWIM6	HGNC	protein_coding	OTTHUMT00000368710.1	128	0.00	0	C	NM_020928		60768572	60768572	+1	no_errors	ENST00000252744	ensembl	human	known	69_37n	missense	89	22.61	26	SNP	1.000	A
