#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABAT	18	genome.wustl.edu	37	16	8868872	8868872	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr16:8868872G>A	ENST00000396600.2	+	13	2018	c.1080G>A	c.(1078-1080)atG>atA	p.M360I	ABAT_ENST00000569156.1_Missense_Mutation_p.M360I|ABAT_ENST00000567812.1_Missense_Mutation_p.M375I|ABAT_ENST00000268251.8_Missense_Mutation_p.M360I|ABAT_ENST00000425191.2_Missense_Mutation_p.M360I	NM_000663.4	NP_000654.2	P80404	GABT_HUMAN	4-aminobutyrate aminotransferase	360					behavioral response to cocaine (GO:0048148)|copulation (GO:0007620)|gamma-aminobutyric acid catabolic process (GO:0009450)|locomotory behavior (GO:0007626)|negative regulation of blood pressure (GO:0045776)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to iron ion (GO:0010039)|response to nicotine (GO:0035094)|synaptic transmission (GO:0007268)	4-aminobutyrate transaminase complex (GO:0032144)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	(S)-3-amino-2-methylpropionate transaminase activity (GO:0047298)|4-aminobutyrate transaminase activity (GO:0003867)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|succinate-semialdehyde dehydrogenase binding (GO:0032145)	p.M360I(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	26					L-Alanine(DB00160)|Phenelzine(DB00780)|Pyruvic acid(DB00119)|Valproic Acid(DB00313)|Vigabatrin(DB01080)	AGAAGATGATGACTGGGGGCT	0.572																																						dbGAP											1	Substitution - Missense(1)	breast(1)											126.0	96.0	106.0					16																	8868872		2197	4300	6497	-	-	-	SO:0001583	missense	0			L32961	CCDS10534.1	16p13.2	2011-01-10			ENSG00000183044	ENSG00000183044	2.6.1.19		23	protein-coding gene	gene with protein product	"""4-aminobutyrate transaminase"""	137150				7721088	Standard	NM_020686		Approved	GABAT	uc002czc.4	P80404	OTTHUMG00000048201	ENST00000396600.2:c.1080G>A	16.37:g.8868872G>A	ENSP00000379845:p.Met360Ile		A8K386|Q16260|Q8N5W2|Q96BG2|Q99800	Missense_Mutation	SNP	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase_major_dom,tigrfam_4NH2But_aminotransferase_euk	p.M360I	ENST00000396600.2	37	c.1080	CCDS10534.1	16	.	.	.	.	.	.	.	.	.	.	G	11.92	1.784026	0.31593	.	.	ENSG00000183044	ENST00000268251;ENST00000396600;ENST00000425191	T;T;T	0.75154	-0.91;-0.91;-0.91	5.79	5.79	0.91817	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.169387	0.64402	D	0.000004	T	0.55481	0.1923	N	0.03177	-0.4	0.51233	D	0.999919	B	0.06786	0.001	B	0.09377	0.004	T	0.50684	-0.8799	10	0.27785	T	0.31	-0.1474	19.0289	0.92946	0.0:0.0:1.0:0.0	.	360	P80404	GABT_HUMAN	I	360	ENSP00000268251:M360I;ENSP00000379845:M360I;ENSP00000411916:M360I	ENSP00000268251:M360I	M	+	3	0	ABAT	8776373	1.000000	0.71417	0.998000	0.56505	0.624000	0.37722	5.362000	0.66098	2.746000	0.94184	0.561000	0.74099	ATG	ABAT	-	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase_major_dom,tigrfam_4NH2But_aminotransferase_euk	ENSG00000183044		0.572	ABAT-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ABAT	HGNC	protein_coding	OTTHUMT00000433620.2	47	0.00	0	G	NM_020686		8868872	8868872	+1	no_errors	ENST00000268251	ensembl	human	known	69_37n	missense	27	15.62	5	SNP	1.000	A
ABCB4	5244	genome.wustl.edu	37	7	87042989	87042989	+	Silent	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr7:87042989C>T	ENST00000265723.4	-	22	2838	c.2727G>A	c.(2725-2727)ttG>ttA	p.L909L	ABCB4_ENST00000545634.1_Silent_p.L909L|ABCB4_ENST00000453593.1_Silent_p.L909L|ABCB4_ENST00000358400.3_Silent_p.L909L|ABCB4_ENST00000359206.3_Silent_p.L909L	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	909	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)	p.L909L(1)		breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	TTTCCTGGGTCAAAGACACAA	0.348																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											135.0	140.0	138.0					7																	87042989		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.2727G>A	7.37:g.87042989C>T			A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Silent	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,pfam_ABC_ATPase_put,pfam_Zeta_toxin_domain,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.L909	ENST00000265723.4	37	c.2727	CCDS5606.1	7																																																																																			ABCB4	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1	ENSG00000005471		0.348	ABCB4-002	KNOWN	basic|CCDS	protein_coding	ABCB4	HGNC	protein_coding	OTTHUMT00000336083.1	255	0.00	0	C	NM_000443		87042989	87042989	-1	no_errors	ENST00000265723	ensembl	human	known	69_37n	silent	210	13.93	34	SNP	1.000	T
APOB	338	genome.wustl.edu	37	2	21231741	21231741	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr2:21231741C>G	ENST00000233242.1	-	26	8126	c.7999G>C	c.(7999-8001)Gaa>Caa	p.E2667Q		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	2667					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.E2667Q(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACTTTCATTTCTACAAAGTCA	0.398																																						dbGAP											1	Substitution - Missense(1)	breast(1)											146.0	154.0	152.0					2																	21231741		2202	4300	6502	-	-	-	SO:0001583	missense	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.7999G>C	2.37:g.21231741C>G	ENSP00000233242:p.Glu2667Gln		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.E2667Q	ENST00000233242.1	37	c.7999	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	C	14.53	2.564292	0.45694	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00995	5.46	4.91	4.91	0.64330	.	0.107611	0.40222	N	0.001149	T	0.03348	0.0097	M	0.66939	2.045	0.80722	D	1	D	0.57899	0.981	P	0.52109	0.69	T	0.50406	-0.8832	10	0.72032	D	0.01	.	18.111	0.89536	0.0:1.0:0.0:0.0	.	2667	P04114	APOB_HUMAN	Q	2667	ENSP00000233242:E2667Q	ENSP00000233242:E2667Q	E	-	1	0	APOB	21085246	1.000000	0.71417	0.925000	0.36789	0.981000	0.71138	3.792000	0.55476	2.264000	0.75181	0.561000	0.74099	GAA	APOB	-	NULL	ENSG00000084674		0.398	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1	106	0.00	0	C			21231741	21231741	-1	no_errors	ENST00000233242	ensembl	human	known	69_37n	missense	64	20.99	17	SNP	0.981	G
ALMS1P	200420	genome.wustl.edu	37	2	73912256	73912256	+	RNA	SNP	G	G	A	rs368610477		TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr2:73912256G>A	ENST00000450720.1	+	0	1154					NR_003683.2		Q96L16	ALM1L_HUMAN	Alstrom syndrome 1 pseudogene						endosomal transport (GO:0016197)|regulation of stress fiber assembly (GO:0051492)												GCCTGGGAAGGTTTTCTAATC	0.507																																						dbGAP											0													16.0	17.0	16.0					2																	73912256		692	1591	2283	-	-	-			0			BC014492		2p13.2	2008-01-31	2008-01-31	2008-01-31	ENSG00000163016	ENSG00000163016			29586	pseudogene	pseudogene			"""Alstrom syndrome 1-like"""	ALMS1L		12477932	Standard	NR_003683		Approved		uc010yrl.2	Q96L16	OTTHUMG00000152773		2.37:g.73912256G>A				RNA	SNP	-	NULL	ENST00000450720.1	37	NULL		2																																																																																			ALMS1P	-	-	ENSG00000163016		0.507	ALMS1P-002	KNOWN	basic	processed_transcript	ALMS1P	HGNC	pseudogene	OTTHUMT00000339824.1	29	0.00	0	G	NR_003683		73912256	73912256	+1	no_errors	ENST00000450720	ensembl	human	known	69_37n	rna	21	19.23	5	SNP	0.001	A
AFF3	3899	genome.wustl.edu	37	2	100209770	100209770	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr2:100209770C>G	ENST00000409236.2	-	13	2465	c.2353G>C	c.(2353-2355)Gag>Cag	p.E785Q	AFF3_ENST00000317233.4_Missense_Mutation_p.E785Q|AFF3_ENST00000356421.2_Missense_Mutation_p.E810Q|AFF3_ENST00000409579.1_Missense_Mutation_p.E810Q			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	785					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)	p.E810Q(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						ACCCCTGGCTCCTGGGGCAGG	0.577																																						dbGAP											1	Substitution - Missense(1)	breast(1)											58.0	59.0	59.0					2																	100209770		2203	4300	6503	-	-	-	SO:0001583	missense	0			U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.2353G>C	2.37:g.100209770C>G	ENSP00000387207:p.Glu785Gln		B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Missense_Mutation	SNP	pfam_TF_AF4/FMR2	p.E810Q	ENST00000409236.2	37	c.2428	CCDS42723.1	2	.	.	.	.	.	.	.	.	.	.	C	13.56	2.274615	0.40194	.	.	ENSG00000144218	ENST00000317233;ENST00000356421;ENST00000409579;ENST00000409236;ENST00000433370;ENST00000444786	T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09	5.5	5.5	0.81552	.	0.224204	0.31335	N	0.007831	T	0.73337	0.3574	L	0.48935	1.535	0.40947	D	0.984512	D;D;P	0.71674	0.97;0.998;0.937	P;D;P	0.72625	0.8;0.978;0.504	T	0.67612	-0.5626	10	0.20519	T	0.43	.	19.3822	0.94542	0.0:1.0:0.0:0.0	.	938;785;810	B7Z4I6;P51826;P51826-2	.;AFF3_HUMAN;.	Q	785;810;810;785;785;938	ENSP00000317421:E785Q;ENSP00000348793:E810Q;ENSP00000386834:E810Q;ENSP00000387207:E785Q	ENSP00000317421:E785Q	E	-	1	0	AFF3	99576202	1.000000	0.71417	1.000000	0.80357	0.254000	0.26022	4.244000	0.58728	2.596000	0.87737	0.561000	0.74099	GAG	AFF3	-	pfam_TF_AF4/FMR2	ENSG00000144218		0.577	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFF3	HGNC	protein_coding	OTTHUMT00000328982.3	41	0.00	0	C	NM_002285		100209770	100209770	-1	no_errors	ENST00000356421	ensembl	human	known	69_37n	missense	19	32.14	9	SNP	1.000	G
APOL2	23780	genome.wustl.edu	37	22	36624084	36624084	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr22:36624084G>C	ENST00000249066.6	-	6	856	c.380C>G	c.(379-381)tCt>tGt	p.S127C	APOL2_ENST00000451256.2_Missense_Mutation_p.S239C|APOL2_ENST00000358502.5_Missense_Mutation_p.S127C	NM_145637.1	NP_663612.1	Q9BQE5	APOL2_HUMAN	apolipoprotein L, 2	127					acute-phase response (GO:0006953)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|maternal process involved in female pregnancy (GO:0060135)|multicellular organismal development (GO:0007275)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|membrane (GO:0016020)	high-density lipoprotein particle binding (GO:0008035)|lipid binding (GO:0008289)|receptor binding (GO:0005102)	p.S127C(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(1)|skin(1)|urinary_tract(2)	9						CAGGATGCCAGAGGTAGTGCC	0.572																																						dbGAP											1	Substitution - Missense(1)	breast(1)											83.0	91.0	88.0					22																	36624084		2201	4300	6501	-	-	-	SO:0001583	missense	0			AF324224	CCDS43014.1	22q12.3	2013-09-20			ENSG00000128335	ENSG00000128335		"""Apolipoproteins"""	619	protein-coding gene	gene with protein product	"""apolipoprotein L-II"""	607252				10591208, 11374903	Standard	NM_145637		Approved	APOL-II	uc003apa.3	Q9BQE5	OTTHUMG00000150634	ENST00000249066.6:c.380C>G	22.37:g.36624084G>C	ENSP00000249066:p.Ser127Cys		B0QYK7|O95915|Q59GW9|Q5TH96|Q969T6|Q9BT28|Q9UGT1|Q9UH10	Missense_Mutation	SNP	pfam_ApoL	p.S127C	ENST00000249066.6	37	c.380	CCDS43014.1	22	.	.	.	.	.	.	.	.	.	.	G	17.24	3.339368	0.60963	.	.	ENSG00000128335	ENST00000358502;ENST00000249066;ENST00000451256;ENST00000529194	T;T;T;T	0.08807	3.05;3.05;3.05;3.05	3.66	3.66	0.41972	.	0.211349	0.42420	D	0.000703	T	0.26304	0.0642	M	0.83223	2.63	0.30149	N	0.803197	D;D	0.71674	0.994;0.998	D;D	0.64321	0.924;0.924	T	0.07443	-1.0772	10	0.54805	T	0.06	.	11.0305	0.47769	0.0:0.0:1.0:0.0	.	239;127	B4E1T5;Q9BQE5	.;APOL2_HUMAN	C	127;127;239;127	ENSP00000351292:S127C;ENSP00000249066:S127C;ENSP00000403153:S239C;ENSP00000431231:S127C	ENSP00000249066:S127C	S	-	2	0	APOL2	34954030	0.760000	0.28428	0.925000	0.36789	0.009000	0.06853	4.754000	0.62191	2.053000	0.61076	0.411000	0.27672	TCT	APOL2	-	pfam_ApoL	ENSG00000128335		0.572	APOL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	APOL2	HGNC	protein_coding	OTTHUMT00000319279.1	48	0.00	0	G	NM_145637		36624084	36624084	-1	no_errors	ENST00000249066	ensembl	human	known	69_37n	missense	24	29.41	10	SNP	0.900	C
ASCC3	10973	genome.wustl.edu	37	6	101054655	101054655	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr6:101054655C>G	ENST00000369162.2	-	32	5349	c.5005G>C	c.(5005-5007)Gat>Cat	p.D1669H		NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3	1669	Helicase C-terminal 2. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)	p.D1669H(1)		breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		GTTTTTCCATCATAGTATTCT	0.313																																						dbGAP											1	Substitution - Missense(1)	breast(1)											46.0	54.0	51.0					6																	101054655		2200	4293	6493	-	-	-	SO:0001583	missense	0			AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.5005G>C	6.37:g.101054655C>G	ENSP00000358159:p.Asp1669His		E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Missense_Mutation	SNP	pfam_Sec63-dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_AAA+_ATPase,smart_Helicase_C,smart_Sec63-dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.D1669H	ENST00000369162.2	37	c.5005	CCDS5046.1	6	.	.	.	.	.	.	.	.	.	.	C	22.4	4.283769	0.80803	.	.	ENSG00000112249	ENST00000369162	D	0.93189	-3.18	5.78	5.78	0.91487	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.98207	0.9407	H	0.97291	3.975	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99041	1.0824	10	0.87932	D	0	.	20.0172	0.97481	0.0:1.0:0.0:0.0	.	1669	Q8N3C0	HELC1_HUMAN	H	1669	ENSP00000358159:D1669H	ENSP00000358159:D1669H	D	-	1	0	ASCC3	101161376	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.682000	0.84083	2.723000	0.93209	0.585000	0.79938	GAT	ASCC3	-	pfam_Helicase_C,smart_Helicase_C,pfscan_Helicase_C	ENSG00000112249		0.313	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASCC3	HGNC	protein_coding	OTTHUMT00000041632.2	119	0.00	0	C	NM_006828		101054655	101054655	-1	no_errors	ENST00000369162	ensembl	human	known	69_37n	missense	108	12.80	16	SNP	1.000	G
ATIC	471	genome.wustl.edu	37	2	216197123	216197124	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr2:216197123_216197124insA	ENST00000236959.9	+	8	1033_1034	c.707_708insA	c.(706-711)ggatttfs	p.F237fs	ATIC_ENST00000435675.1_Frame_Shift_Ins_p.F236fs|ATIC_ENST00000540518.1_Frame_Shift_Ins_p.F178fs	NM_004044.6	NP_004035.2	P31939	PUR9_HUMAN	5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase	237					'de novo' IMP biosynthetic process (GO:0006189)|brainstem development (GO:0003360)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|dihydrofolate metabolic process (GO:0046452)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|organ regeneration (GO:0031100)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to inorganic substance (GO:0010035)|small molecule metabolic process (GO:0044281)|tetrahydrofolate biosynthetic process (GO:0046654)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	IMP cyclohydrolase activity (GO:0003937)|phosphoribosylaminoimidazolecarboxamide formyltransferase activity (GO:0004643)|protein homodimerization activity (GO:0042803)	p.F237fs*45(1)	ATIC/ALK(24)	large_intestine(2)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	8		Renal(323;0.229)		Epithelial(149;2.02e-06)|all cancers(144;0.000316)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.0097)	Methotrexate(DB00563)|Pemetrexed(DB00642)|Tetrahydrofolic acid(DB00116)	GGAGCCCCTGGATTTATAAACT	0.421			T	ALK	ALCL																																	dbGAP		Dom	yes		2	2q35	471	5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase		L	1	Insertion - Frameshift(1)	breast(1)																																								-	-	-	SO:0001589	frameshift_variant	0				CCDS2398.1	2q35	2010-04-27			ENSG00000138363	ENSG00000138363	2.1.2.3, 3.5.4.10		794	protein-coding gene	gene with protein product	"""phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase"""	601731				8567683, 9378707	Standard	NM_004044		Approved	PURH, AICARFT, IMPCHASE	uc002vex.4	P31939	OTTHUMG00000133023	ENST00000236959.9:c.708dupA	2.37:g.216197124_216197124dupA	ENSP00000236959:p.Phe237fs		A8K202|E9PBU3|Q13856|Q53S28	Frame_Shift_Ins	INS	pfam_AICARFT_IMPCHas,pfam_MGS-like_dom,superfamily_Cytidine_deaminase-like,superfamily_MGS-like_dom,smart_MGS-like_dom,smart_AICARFT_IMPCHas,pirsf_AICARFT_IMPCHas,tigrfam_AICARFT_IMPCHas	p.F237fs	ENST00000236959.9	37	c.707_708	CCDS2398.1	2																																																																																			ATIC	-	pfam_AICARFT_IMPCHas,superfamily_Cytidine_deaminase-like,smart_AICARFT_IMPCHas,pirsf_AICARFT_IMPCHas,tigrfam_AICARFT_IMPCHas	ENSG00000138363		0.421	ATIC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATIC	HGNC	protein_coding	OTTHUMT00000256610.1	128	0.00	0	-	NM_004044		216197123	216197124	+1	no_errors	ENST00000236959	ensembl	human	known	69_37n	frame_shift_ins	92	14.02	15	INS	1.000:0.833	A
AVPR1B	553	genome.wustl.edu	37	1	206231046	206231046	+	Silent	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr1:206231046C>T	ENST00000367126.4	+	2	1644	c.1179C>T	c.(1177-1179)ctC>ctT	p.L393L		NM_000707.3	NP_000698.1	P47901	V1BR_HUMAN	arginine vasopressin receptor 1B	393					activation of phospholipase C activity (GO:0007202)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	protein kinase C binding (GO:0005080)|vasopressin receptor activity (GO:0005000)	p.L393L(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(3)|prostate(1)|skin(2)	20			BRCA - Breast invasive adenocarcinoma(75;0.0312)		Desmopressin(DB00035)|Terlipressin(DB02638)|Vasopressin(DB00067)	GCCTCAGCCTCAGCCTAACCC	0.657																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											25.0	30.0	28.0					1																	206231046		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D31833	CCDS73015.1	1q32	2014-05-06			ENSG00000198049	ENSG00000198049		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	896	protein-coding gene	gene with protein product		600264		AVPR3		7929452, 8586456	Standard	NM_000707		Approved		uc001hds.2	P47901	OTTHUMG00000184377	ENST00000367126.4:c.1179C>T	1.37:g.206231046C>T			B0M0J6|Q5TZ00	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_supfam,prints_Vprs_rcpt_V1B,prints_Vasoprsn_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Vprs_V1A_rcpt	p.L393	ENST00000367126.4	37	c.1179	CCDS30994.1	1																																																																																			AVPR1B	-	prints_Vprs_rcpt_V1B	ENSG00000198049		0.657	AVPR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AVPR1B	HGNC	protein_coding	OTTHUMT00000087996.1	9	0.00	0	C	NM_000707		206231046	206231046	+1	no_errors	ENST00000367126	ensembl	human	known	69_37n	silent	31	18.42	7	SNP	0.978	T
BAIAP2L1	55971	genome.wustl.edu	37	7	97933661	97933661	+	Silent	SNP	G	G	A	rs555687728		TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr7:97933661G>A	ENST00000005260.8	-	12	1484	c.1269C>T	c.(1267-1269)acC>acT	p.T423T		NM_018842.4	NP_061330.2	Q9UHR4	BI2L1_HUMAN	BAI1-associated protein 2-like 1	423					filopodium assembly (GO:0046847)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of actin filament polymerization (GO:0030838)|response to bacterium (GO:0009617)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)	p.T423T(1)		NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)	23	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		STAD - Stomach adenocarcinoma(171;0.215)			ACAAGTTCACGGTGCTGATGC	0.537													G|||	1	0.000199681	0.0	0.0	5008	,	,		18777	0.0		0.0	False		,,,				2504	0.001					dbGAP											1	Substitution - coding silent(1)	breast(1)											119.0	99.0	105.0					7																	97933661		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF119666	CCDS34687.1	7q22.1	2012-10-04			ENSG00000006453	ENSG00000006453			21649	protein-coding gene	gene with protein product		611877					Standard	NM_018842		Approved	IRTKS	uc003upj.3	Q9UHR4	OTTHUMG00000165117	ENST00000005260.8:c.1269C>T	7.37:g.97933661G>A			A4D268|Q75L21|Q75L22|Q96CV4|Q9H5F5|Q9Y2M8	Silent	SNP	pfam_IRSp53/MIM_homology_IMD,pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.T423	ENST00000005260.8	37	c.1269	CCDS34687.1	7																																																																																			BAIAP2L1	-	NULL	ENSG00000006453		0.537	BAIAP2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAIAP2L1	HGNC	protein_coding	OTTHUMT00000334681.1	60	0.00	0	G	NM_018842		97933661	97933661	-1	no_errors	ENST00000005260	ensembl	human	known	69_37n	silent	40	14.89	7	SNP	0.001	A
BIRC6	57448	genome.wustl.edu	37	2	32836564	32836564	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr2:32836564G>A	ENST00000421745.2	+	73	14443	c.14309G>A	c.(14308-14310)tGt>tAt	p.C4770Y		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	4770					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)	p.C4770Y(1)|p.C4742Y(1)		NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					ATGGCCCAATGTGAGGAGTGG	0.423																																					Pancreas(94;175 1509 16028 18060 45422)	dbGAP											2	Substitution - Missense(2)	breast(2)											111.0	101.0	105.0					2																	32836564		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.14309G>A	2.37:g.32836564G>A	ENSP00000393596:p.Cys4770Tyr		Q9ULD1	Missense_Mutation	SNP	pfam_DUF3643,pfam_UBQ-conjugat_E2,pfam_BIR,pfam_UEV_N,superfamily_UBQ-conjugating_enzyme/RWD,superfamily_Galactose-bd-like,superfamily_WD40_repeat_dom,smart_BIR,pfscan_BIR,pfscan_UBQ-conjugat_E2	p.C4770Y	ENST00000421745.2	37	c.14309	CCDS33175.2	2	.	.	.	.	.	.	.	.	.	.	G	26.1	4.702991	0.88924	.	.	ENSG00000115760	ENST00000421745	T	0.76186	-1.0	4.76	4.76	0.60689	Ubiquitin-conjugating enzyme/RWD-like (1);	0.000000	0.85682	D	0.000000	D	0.86393	0.5922	M	0.76838	2.35	0.80722	D	1	D	0.69078	0.997	D	0.77557	0.99	D	0.88362	0.2988	10	0.66056	D	0.02	.	17.794	0.88564	0.0:0.0:1.0:0.0	.	4770	Q9NR09	BIRC6_HUMAN	Y	4770	ENSP00000393596:C4770Y	ENSP00000393596:C4770Y	C	+	2	0	BIRC6	32690068	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	9.776000	0.99001	2.172000	0.68678	0.555000	0.69702	TGT	BIRC6	-	NULL	ENSG00000115760		0.423	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIRC6	HGNC	protein_coding	OTTHUMT00000318769.3	146	0.00	0	G	NM_016252		32836564	32836564	+1	no_errors	ENST00000421745	ensembl	human	known	69_37n	missense	71	28.28	28	SNP	1.000	A
BOD1L1	259282	genome.wustl.edu	37	4	13601173	13601173	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr4:13601173C>T	ENST00000040738.5	-	10	7486	c.7351G>A	c.(7351-7353)Gag>Aag	p.E2451K		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	2451						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.E2451K(1)									AAAGTGCTCTCTTTCTGTCCT	0.488											OREG0016115	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Substitution - Missense(1)	breast(1)											170.0	153.0	159.0					4																	13601173		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.7351G>A	4.37:g.13601173C>T	ENSP00000040738:p.Glu2451Lys	688	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	NULL	p.E2451K	ENST00000040738.5	37	c.7351	CCDS3411.2	4	.	.	.	.	.	.	.	.	.	.	C	11.62	1.693903	0.30052	.	.	ENSG00000038219	ENST00000040738	T	0.07567	3.18	4.19	-1.07	0.09968	.	1.198430	0.06443	N	0.726302	T	0.05044	0.0135	N	0.14661	0.345	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.43442	-0.9391	10	0.66056	D	0.02	.	4.1769	0.10356	0.0:0.279:0.3347:0.3863	.	2451	Q8NFC6	BOD1L_HUMAN	K	2451	ENSP00000040738:E2451K	ENSP00000040738:E2451K	E	-	1	0	BOD1L	13210271	0.000000	0.05858	0.000000	0.03702	0.046000	0.14306	-0.101000	0.10973	-0.253000	0.09514	0.650000	0.86243	GAG	BOD1L1	-	NULL	ENSG00000038219		0.488	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1L1	HGNC	protein_coding	OTTHUMT00000207321.1	264	0.00	0	C	NM_148894		13601173	13601173	-1	no_errors	ENST00000040738	ensembl	human	known	69_37n	missense	149	24.37	48	SNP	0.000	T
CCDC175	729665	genome.wustl.edu	37	14	60041705	60041705	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr14:60041705C>T	ENST00000537690.2	-	2	254	c.199G>A	c.(199-201)Gct>Act	p.A67T	CCDC175_ENST00000281581.4_Missense_Mutation_p.A67T	NM_001164399.1	NP_001157871.1	P0C221	CC175_HUMAN	coiled-coil domain containing 175	67								p.A67T(1)									AAGATCTTAGCTTCTTCATTA	0.279																																						dbGAP											1	Substitution - Missense(1)	breast(1)											92.0	79.0	83.0					14																	60041705		692	1582	2274	-	-	-	SO:0001583	missense	0				CCDS53898.1	14q23.1	2012-09-24	2012-09-24	2012-09-24	ENSG00000151838	ENSG00000151838			19847	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 38"""	C14orf38			Standard	NM_001164399		Approved		uc021rtw.1	P0C221		ENST00000537690.2:c.199G>A	14.37:g.60041705C>T	ENSP00000453940:p.Ala67Thr		G3V5J7	Missense_Mutation	SNP	superfamily_Prefoldin	p.A67T	ENST00000537690.2	37	c.199	CCDS53898.1	14	.	.	.	.	.	.	.	.	.	.	C	16.11	3.030727	0.54790	.	.	ENSG00000151838	ENST00000555041	.	.	.	5.31	4.41	0.53225	.	0.245015	0.29053	N	0.013282	T	0.44973	0.1319	L	0.54323	1.7	0.23780	N	0.996868	.	.	.	.	.	.	T	0.32666	-0.9898	6	.	.	.	-6.995	10.1213	0.42623	0.0:0.9076:0.0:0.0924	.	.	.	.	T	67	.	.	A	-	1	0	C14orf38	59111458	0.876000	0.30132	0.984000	0.44739	0.254000	0.26022	0.506000	0.22658	2.779000	0.95612	0.591000	0.81541	GCT	C14orf38	-	NULL	ENSG00000151838		0.279	CCDC175-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf38	HGNC	protein_coding	OTTHUMT00000471273.1	170	0.00	0	C	NM_001164399		60041705	60041705	-1	no_errors	ENST00000281581	ensembl	human	known	69_37n	missense	90	23.08	27	SNP	0.982	T
NRDE2	55051	genome.wustl.edu	37	14	90778838	90778838	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr14:90778838C>G	ENST00000354366.3	-	4	689	c.457G>C	c.(457-459)Gag>Cag	p.E153Q	NRDE2_ENST00000357904.3_5'UTR	NM_017970.3	NP_060440.2	Q9H7Z3	NRDE2_HUMAN	NRDE-2, necessary for RNA interference, domain containing	153								p.E153Q(1)									TGAATGTCCTCAAGCCAAACA	0.463																																						dbGAP											1	Substitution - Missense(1)	breast(1)											152.0	138.0	143.0					14																	90778838		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000870	CCDS9890.1	14q32.11	2012-12-14	2012-09-25	2012-09-25	ENSG00000119720	ENSG00000119720			20186	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 102"""	C14orf102			Standard	NM_017970		Approved	FLJ14051	uc001xyi.2	Q9H7Z3	OTTHUMG00000171020	ENST00000354366.3:c.457G>C	14.37:g.90778838C>G	ENSP00000346335:p.Glu153Gln		B4DH71|Q4G0A7|Q9NWH6	Missense_Mutation	SNP	pfam_NRDE-2	p.E153Q	ENST00000354366.3	37	c.457	CCDS9890.1	14	.	.	.	.	.	.	.	.	.	.	C	15.07	2.725095	0.48833	.	.	ENSG00000119720	ENST00000354366	T	0.24908	1.83	5.14	5.14	0.70334	.	0.049938	0.85682	D	0.000000	T	0.42381	0.1200	M	0.67953	2.075	0.80722	D	1	D	0.57899	0.981	P	0.52109	0.69	T	0.30592	-0.9973	10	0.48119	T	0.1	-34.9673	18.968	0.92704	0.0:1.0:0.0:0.0	.	153	Q9H7Z3	CN102_HUMAN	Q	153	ENSP00000346335:E153Q	ENSP00000346335:E153Q	E	-	1	0	C14orf102	89848591	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	6.793000	0.75130	2.547000	0.85894	0.549000	0.68633	GAG	C14orf102	-	NULL	ENSG00000119720		0.463	NRDE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf102	HGNC	protein_coding	OTTHUMT00000411264.1	94	0.00	0	C	NM_017970		90778838	90778838	-1	no_errors	ENST00000354366	ensembl	human	known	69_37n	missense	66	19.28	16	SNP	1.000	G
C2orf16	84226	genome.wustl.edu	37	2	27803414	27803414	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr2:27803414G>C	ENST00000408964.2	+	1	4026	c.3975G>C	c.(3973-3975)aaG>aaC	p.K1325N	ZNF512_ENST00000556601.1_5'Flank|AC074091.1_ENST00000408604.1_RNA|ZNF512_ENST00000413371.2_5'Flank|ZNF512_ENST00000355467.4_5'Flank|ZNF512_ENST00000379717.1_5'Flank|ZNF512_ENST00000416005.2_5'Flank|RP11-158I13.2_ENST00000505973.1_RNA	NM_032266.3	NP_115642.3	Q68DN1	CB016_HUMAN	chromosome 2 open reading frame 16	1325						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)		p.K1325N(2)		breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(33)|urinary_tract(1)	47	Acute lymphoblastic leukemia(172;0.155)					TAAGAAGGAAGAGGATTGGAG	0.418																																						dbGAP											2	Substitution - Missense(2)	breast(2)											67.0	64.0	65.0					2																	27803414		1864	4104	5968	-	-	-	SO:0001583	missense	0			AL136898	CCDS42666.1	2p23.3	2013-09-20			ENSG00000221843	ENSG00000221843			25275	protein-coding gene	gene with protein product	"""P-S-E-R-S-H-H-S repeats containing"""						Standard	NM_032266		Approved	DKFZp434G118	uc002rkz.4	Q68DN1	OTTHUMG00000159099	ENST00000408964.2:c.3975G>C	2.37:g.27803414G>C	ENSP00000386190:p.Lys1325Asn		B9EIQ4|Q53S01|Q8ND64|Q9H088	Missense_Mutation	SNP	NULL	p.K1325N	ENST00000408964.2	37	c.3975	CCDS42666.1	2	.	.	.	.	.	.	.	.	.	.	G	11.88	1.771575	0.31320	.	.	ENSG00000221843	ENST00000408964	T	0.54279	0.58	5.01	0.692	0.18050	.	.	.	.	.	T	0.38692	0.1050	N	0.14661	0.345	0.09310	N	1	P	0.44816	0.844	P	0.49421	0.61	T	0.18493	-1.0335	9	0.45353	T	0.12	.	3.7996	0.08753	0.3382:0.1824:0.4795:0.0	.	1325	Q68DN1	CB016_HUMAN	N	1325	ENSP00000386190:K1325N	ENSP00000386190:K1325N	K	+	3	2	C2orf16	27656918	0.001000	0.12720	0.180000	0.23079	0.763000	0.43281	-0.320000	0.08028	0.129000	0.18514	0.563000	0.77884	AAG	C2orf16	-	NULL	ENSG00000221843		0.418	C2orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf16	HGNC	protein_coding	OTTHUMT00000353292.1	71	0.00	0	G	NM_032266		27803414	27803414	+1	no_errors	ENST00000408964	ensembl	human	known	69_37n	missense	52	27.78	20	SNP	0.029	C
MRPL30	51263	genome.wustl.edu	37	2	99811355	99811355	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr2:99811355G>C	ENST00000338148.3	+	4	472	c.274G>C	c.(274-276)Gaa>Caa	p.E92Q	C2orf15_ENST00000512183.2_Missense_Mutation_p.E92Q|MRPL30_ENST00000409145.1_Missense_Mutation_p.E92Q|MRPL30_ENST00000410042.1_Missense_Mutation_p.E92Q|MRPL30_ENST00000465432.1_3'UTR	NM_145212.3	NP_660213.1	Q8TCC3	RM30_HUMAN	mitochondrial ribosomal protein L30	92						mitochondrion (GO:0005739)|ribosome (GO:0005840)		p.E92Q(1)		breast(1)|endometrium(1)|kidney(1)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	10						GCTTGGATTAGAAAAAGTATG	0.269																																						dbGAP											1	Substitution - Missense(1)	breast(1)											46.0	50.0	49.0					2																	99811355		2200	4296	6496	-	-	-	SO:0001583	missense	0			AB051342	CCDS2041.1	2q11.2	2012-09-13			ENSG00000185414	ENSG00000185414		"""Mitochondrial ribosomal proteins / large subunits"""	14036	protein-coding gene	gene with protein product		611838					Standard	NM_145212		Approved	MRP-L28, RPML28	uc002szv.3	Q8TCC3	OTTHUMG00000130642	ENST00000338148.3:c.274G>C	2.37:g.99811355G>C	ENSP00000338057:p.Glu92Gln		A6NIC6|D3DVI0|D3DVI3|Q0D2Q7|Q6ZTP4|Q96Q69|Q9P0N0	Missense_Mutation	SNP	pfam_Ribosomal_L30_ferredoxin-like,superfamily_Ribosomal_L30_ferredoxin-like	p.E122Q	ENST00000338148.3	37	c.364	CCDS2041.1	2	.	.	.	.	.	.	.	.	.	.	G	1.738	-0.492397	0.04322	.	.	ENSG00000241962;ENSG00000241962;ENSG00000185414;ENSG00000185414;ENSG00000185414;ENSG00000185414	ENST00000512183;ENST00000308644;ENST00000410042;ENST00000338148;ENST00000409145;ENST00000409841	T;T;T	0.44881	0.91;0.91;0.91	4.24	-3.07	0.05363	Ribosomal protein L30, ferredoxin-like fold domain (3);	0.865236	0.10212	N	0.702011	T	0.22244	0.0536	N	0.03608	-0.345	0.09310	N	1	B;B	0.13594	0.008;0.002	B;B	0.17433	0.018;0.004	T	0.26258	-1.0108	10	0.10111	T	0.7	-3.5943	22.1265	0.99967	0.0:0.8246:0.1754:0.0	.	92;92	Q8TCC3;Q8TCC3-3	RM30_HUMAN;.	Q	92;105;92;92;92;92	ENSP00000420959:E92Q;ENSP00000338057:E92Q;ENSP00000386752:E92Q	ENSP00000312464:E105Q	E	+	1	0	C2orf15;MRPL30	99177787	0.999000	0.42202	0.673000	0.29887	0.230000	0.25150	0.751000	0.26348	-0.809000	0.04381	-0.951000	0.02657	GAA	C2orf15	-	pfam_Ribosomal_L30_ferredoxin-like,superfamily_Ribosomal_L30_ferredoxin-like	ENSG00000241962		0.269	MRPL30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf15	HGNC	protein_coding	OTTHUMT00000253130.2	173	0.00	0	G			99811355	99811355	+1	no_errors	ENST00000424491	ensembl	human	known	69_37n	missense	110	25.68	38	SNP	0.343	C
PRR27	401137	genome.wustl.edu	37	4	71024408	71024408	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr4:71024408G>C	ENST00000344526.5	+	3	628	c.439G>C	c.(439-441)Gag>Cag	p.E147Q	C4orf40_ENST00000502294.1_Missense_Mutation_p.E147Q|C4orf40_ENST00000502441.2_3'UTR	NM_214711.3	NP_999876.2	Q6MZM9	PRR27_HUMAN		147	Ala/Pro-rich.					extracellular vesicular exosome (GO:0070062)		p.E147Q(1)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12						TGTAGCAGCTGAGCCTGCTGC	0.617																																						dbGAP											1	Substitution - Missense(1)	breast(1)											29.0	35.0	33.0					4																	71024408		2199	4292	6491	-	-	-	SO:0001583	missense	0																														ENST00000344526.5:c.439G>C	4.37:g.71024408G>C	ENSP00000343172:p.Glu147Gln		A8MXP0|Q6MZR6	Missense_Mutation	SNP	NULL	p.E147Q	ENST00000344526.5	37	c.439	CCDS3535.1	4	.	.	.	.	.	.	.	.	.	.	G	9.747	1.166553	0.21621	.	.	ENSG00000187533	ENST00000502294;ENST00000344526	T;T	0.31510	1.49;1.49	3.52	0.215	0.15253	.	.	.	.	.	T	0.16938	0.0407	N	0.19112	0.55	0.09310	N	1	B	0.19073	0.033	B	0.16289	0.015	T	0.25537	-1.0129	9	0.29301	T	0.29	0.2678	6.7298	0.23377	0.0:0.1703:0.4815:0.3482	.	147	Q6MZM9	CD040_HUMAN	Q	147	ENSP00000426249:E147Q;ENSP00000343172:E147Q	ENSP00000343172:E147Q	E	+	1	0	C4orf40	71058997	0.000000	0.05858	0.011000	0.14972	0.014000	0.08584	-0.099000	0.11007	0.089000	0.17243	-0.241000	0.12123	GAG	C4orf40	-	NULL	ENSG00000187533		0.617	C4orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4orf40	HGNC	protein_coding	OTTHUMT00000251558.1	64	0.00	0	G			71024408	71024408	+1	no_errors	ENST00000344526	ensembl	human	known	69_37n	missense	30	34.78	16	SNP	0.005	C
C4orf3	401152	genome.wustl.edu	37	4	120221638	120221638	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr4:120221638C>G	ENST00000504110.1	-	1	438	c.53G>C	c.(52-54)cGa>cCa	p.R18P	C4orf3_ENST00000399075.4_Missense_Mutation_p.R151P	NM_001001701.3	NP_001001701.2	Q8WVX3	CD003_HUMAN	chromosome 4 open reading frame 3	18						integral component of membrane (GO:0016021)		p.R151P(1)|p.R151Q(1)		breast(1)|large_intestine(1)|lung(4)	6						GCTAAAGCCTCGCCGCTCCCG	0.567																																						dbGAP											2	Substitution - Missense(2)	lung(1)|breast(1)											137.0	147.0	144.0					4																	120221638		2009	4155	6164	-	-	-	SO:0001583	missense	0				CCDS43266.1, CCDS54798.1	4q26	2012-02-24			ENSG00000164096	ENSG00000164096			19225	protein-coding gene	gene with protein product	"""HCV F-transactivated protein 1"""						Standard	NM_001001701		Approved		uc021xrf.1	Q8WVX3	OTTHUMG00000161333	ENST00000504110.1:c.53G>C	4.37:g.120221638C>G	ENSP00000427214:p.Arg18Pro		Q6J203	Missense_Mutation	SNP	NULL	p.R151P	ENST00000504110.1	37	c.452	CCDS43266.1	4	.	.	.	.	.	.	.	.	.	.	C	11.68	1.710767	0.30322	.	.	ENSG00000164096	ENST00000399075;ENST00000504110	T;T	0.38722	1.12;1.18	4.91	3.12	0.35913	.	0.765424	0.10409	N	0.678157	T	0.59689	0.2212	.	.	.	0.28224	N	0.926387	D	0.67145	0.996	D	0.65443	0.935	T	0.62426	-0.6857	8	0.72032	D	0.01	-1.6494	8.222	0.31547	0.1795:0.6475:0.173:0.0	.	18	Q8WVX3	CD003_HUMAN	P	151;18	ENSP00000382026:R151P;ENSP00000427214:R18P	ENSP00000382026:R151P	R	-	2	0	C4orf3	120441086	0.033000	0.19621	0.381000	0.26106	0.193000	0.23685	0.171000	0.16685	0.528000	0.28580	0.563000	0.77884	CGA	C4orf3	-	NULL	ENSG00000164096		0.567	C4orf3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4orf3	HGNC	protein_coding	OTTHUMT00000364576.3	65	0.00	0	C	NM_001001701		120221638	120221638	-1	no_errors	ENST00000399075	ensembl	human	known	69_37n	missense	40	29.82	17	SNP	0.535	G
C7	730	genome.wustl.edu	37	5	40936479	40936479	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr5:40936479C>T	ENST00000313164.9	+	5	679	c.320C>T	c.(319-321)tCt>tTt	p.S107F		NM_000587.2	NP_000578.2	P10643	CO7_HUMAN	complement component 7	107	LDL-receptor class A. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cellular sodium ion homeostasis (GO:0006883)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)		p.S107F(1)					Ovarian(839;0.0112)				AATGGGGATTCTGACTGTGAT	0.443																																						dbGAP											1	Substitution - Missense(1)	breast(1)											120.0	118.0	118.0					5																	40936479		2016	4192	6208	-	-	-	SO:0001583	missense	0			J03507	CCDS47201.1	5p13.1	2014-09-17			ENSG00000112936	ENSG00000112936		"""Complement system"""	1346	protein-coding gene	gene with protein product		217070					Standard	NM_000587		Approved		uc003jmh.3	P10643	OTTHUMG00000150340	ENST00000313164.9:c.320C>T	5.37:g.40936479C>T	ENSP00000322061:p.Ser107Phe		Q6P3T5|Q92489	Missense_Mutation	SNP	pfam_MACPF,pfam_Sushi_SCR_CCP,pfam_LDrepeatLR_classA_rpt,pfam_Thrombospondin_1_rpt,superfamily_Complement_control_module,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,smart_Sushi_SCR_CCP,smart_FacI_MAC,pfscan_LDrepeatLR_classA_rpt,pfscan_Sushi_SCR_CCP,pfscan_Thrombospondin_1_rpt,prints_MAC_perforin	p.S107F	ENST00000313164.9	37	c.320	CCDS47201.1	5	.	.	.	.	.	.	.	.	.	.	C	16.26	3.074145	0.55646	.	.	ENSG00000112936	ENST00000313164;ENST00000440677;ENST00000515157	D	0.95518	-3.73	5.02	4.09	0.47781	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.438068	0.25302	N	0.031654	D	0.90672	0.7074	N	0.04655	-0.195	0.24599	N	0.993786	D	0.54397	0.966	P	0.55161	0.77	T	0.82661	-0.0347	10	0.40728	T	0.16	-17.5825	7.9027	0.29744	0.308:0.5588:0.1332:0.0	.	107	P10643	CO7_HUMAN	F	107	ENSP00000322061:S107F	ENSP00000322061:S107F	S	+	2	0	C7	40972236	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	3.322000	0.52007	2.779000	0.95612	0.491000	0.48974	TCT	C7	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt,prints_MAC_perforin	ENSG00000112936		0.443	C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7	HGNC	protein_coding	OTTHUMT00000317680.1	120	0.00	0	C			40936479	40936479	+1	no_errors	ENST00000313164	ensembl	human	known	69_37n	missense	79	13.19	12	SNP	1.000	T
C7orf62	219557	genome.wustl.edu	37	7	88423641	88423641	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr7:88423641C>G	ENST00000297203.2	-	2	801	c.616G>C	c.(616-618)Gac>Cac	p.D206H	ZNF804B_ENST00000333190.4_Intron	NM_152706.3	NP_689919.1	Q8TBZ9	CG062_HUMAN	chromosome 7 open reading frame 62	206								p.D206H(1)		NS(1)|breast(1)|endometrium(3)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	30						AGGAGTAGGTCAGGTGCAACT	0.403																																						dbGAP											1	Substitution - Missense(1)	breast(1)											184.0	154.0	164.0					7																	88423641		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC028365	CCDS34678.1	7q21.13	2013-10-11			ENSG00000164645	ENSG00000164645			22402	protein-coding gene	gene with protein product						12690205	Standard	NM_152706		Approved	MGC26647	uc003ujv.3	Q8TBZ9	OTTHUMG00000153859	ENST00000297203.2:c.616G>C	7.37:g.88423641C>G	ENSP00000297203:p.Asp206His			Missense_Mutation	SNP	NULL	p.D206H	ENST00000297203.2	37	c.616	CCDS34678.1	7	.	.	.	.	.	.	.	.	.	.	C	15.65	2.896228	0.52121	.	.	ENSG00000164645	ENST00000297203	T	0.16073	2.37	6.17	6.17	0.99709	.	0.182248	0.50627	D	0.000109	T	0.22589	0.0545	N	0.14661	0.345	0.38781	D	0.954772	D	0.58268	0.982	P	0.57620	0.824	T	0.02950	-1.1090	10	0.72032	D	0.01	-14.2522	16.3795	0.83443	0.0:1.0:0.0:0.0	.	206	Q8TBZ9	CG062_HUMAN	H	206	ENSP00000297203:D206H	ENSP00000297203:D206H	D	-	1	0	C7orf62	88261577	0.808000	0.29022	0.988000	0.46212	0.075000	0.17131	1.240000	0.32731	2.941000	0.99782	0.655000	0.94253	GAC	C7orf62	-	NULL	ENSG00000164645		0.403	C7orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf62	HGNC	protein_coding	OTTHUMT00000332714.1	179	0.00	0	C	NM_152706		88423641	88423641	-1	no_errors	ENST00000297203	ensembl	human	known	69_37n	missense	150	19.79	37	SNP	1.000	G
CCDC180	100499483	genome.wustl.edu	37	9	100074413	100074413	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr9:100074413G>C	ENST00000357054.1	+	18	1763	c.828G>C	c.(826-828)aaG>aaC	p.K276N	CCDC180_ENST00000460482.2_3'UTR|CCDC180_ENST00000395220.1_Missense_Mutation_p.K276N|CCDC180_ENST00000411667.2_Missense_Mutation_p.K137N|CCDC180_ENST00000375202.2_Missense_Mutation_p.K137N|RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000529487.1_Missense_Mutation_p.K137N			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	276						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.K137N(1)|p.K276N(1)									AAAGAGCCAAGAGGGAAAAAG	0.557																																						dbGAP											2	Substitution - Missense(2)	breast(2)											116.0	118.0	117.0					9																	100074413		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.828G>C	9.37:g.100074413G>C	ENSP00000349562:p.Lys276Asn		Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Missense_Mutation	SNP	NULL	p.K137N	ENST00000357054.1	37	c.411		9	.	.	.	.	.	.	.	.	.	.	G	5.999	0.368147	0.11352	.	.	ENSG00000197816	ENST00000357054;ENST00000395220;ENST00000375202;ENST00000411667;ENST00000541524;ENST00000529487	T;T;T;T;T	0.18810	3.06;2.19;3.07;2.7;3.07	5.19	0.992	0.19819	.	1.234140	0.05503	N	0.558795	T	0.16214	0.0390	L	0.51422	1.61	0.09310	N	1	P;P;P;P	0.36535	0.557;0.557;0.557;0.557	B;B;B;B	0.31101	0.124;0.124;0.124;0.124	T	0.26503	-1.0101	10	0.17369	T	0.5	-8.2284	5.2624	0.15582	0.1844:0.3585:0.4571:0.0	.	137;276;137;276	F5H149;B7ZMG3;Q9P1Z9-2;Q9P1Z9	.;.;.;CI174_HUMAN	N	276;276;137;137;160;137	ENSP00000349562:K276N;ENSP00000378646:K276N;ENSP00000364348:K137N;ENSP00000414000:K137N;ENSP00000434727:K137N	ENSP00000349562:K276N	K	+	3	2	C9orf174	99114234	0.020000	0.18652	0.044000	0.18714	0.165000	0.22458	0.559000	0.23485	0.407000	0.25591	-0.211000	0.12701	AAG	C9orf174	-	NULL	ENSG00000197816		0.557	CCDC180-201	KNOWN	basic	protein_coding	C9orf174	HGNC	protein_coding		57	0.00	0	G	NM_020893		100074413	100074413	+1	no_errors	ENST00000375202	ensembl	human	known	69_37n	missense	46	11.54	6	SNP	0.009	C
CABIN1	23523	genome.wustl.edu	37	22	24515498	24515498	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr22:24515498G>T	ENST00000398319.2	+	28	4850	c.4465G>T	c.(4465-4467)Gag>Tag	p.E1489*	CABIN1_ENST00000263119.5_Nonsense_Mutation_p.E1489*|CABIN1_ENST00000405822.2_Nonsense_Mutation_p.E1410*	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	1489					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)	p.E1489*(1)		breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						CCTCCCAGGGGAGCCAGTGGC	0.662																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											45.0	50.0	48.0					22																	24515498		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.4465G>T	22.37:g.24515498G>T	ENSP00000381364:p.Glu1489*		G5E9F3|Q6PHY0|Q9Y460	Nonsense_Mutation	SNP	pfam_MEF2_binding,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E1489*	ENST00000398319.2	37	c.4465	CCDS13823.1	22	.	.	.	.	.	.	.	.	.	.	G	46	12.492888	0.99672	.	.	ENSG00000099991	ENST00000263119;ENST00000405822;ENST00000398319	.	.	.	5.43	5.43	0.79202	.	0.109676	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	18.6621	0.91474	0.0:0.0:1.0:0.0	.	.	.	.	X	1489;1410;1489	.	ENSP00000263119:E1489X	E	+	1	0	CABIN1	22845498	1.000000	0.71417	0.975000	0.42487	0.791000	0.44710	9.429000	0.97481	2.731000	0.93534	0.650000	0.86243	GAG	CABIN1	-	NULL	ENSG00000099991		0.662	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CABIN1	HGNC	protein_coding	OTTHUMT00000320161.2	9	0.00	0	G	NM_012295		24515498	24515498	+1	no_errors	ENST00000263119	ensembl	human	known	69_37n	nonsense	13	23.53	4	SNP	1.000	T
CACNA1G	8913	genome.wustl.edu	37	17	48650139	48650139	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr17:48650139C>G	ENST00000359106.5	+	6	971	c.971C>G	c.(970-972)tCa>tGa	p.S324*	CACNA1G_ENST00000360761.4_Nonsense_Mutation_p.S324*|CACNA1G_ENST00000507896.1_Nonsense_Mutation_p.S324*|CACNA1G_ENST00000514079.1_Nonsense_Mutation_p.S324*|CACNA1G_ENST00000507609.1_Nonsense_Mutation_p.S324*|CACNA1G_ENST00000513689.2_Nonsense_Mutation_p.S324*|CACNA1G_ENST00000416767.4_Nonsense_Mutation_p.S324*|CACNA1G_ENST00000515165.1_Nonsense_Mutation_p.S324*|CACNA1G_ENST00000514181.1_Nonsense_Mutation_p.S324*|CACNA1G_ENST00000507336.1_Nonsense_Mutation_p.S324*|CACNA1G_ENST00000515411.1_Nonsense_Mutation_p.S324*|CACNA1G_ENST00000512389.1_Nonsense_Mutation_p.S324*|CACNA1G_ENST00000510115.1_Nonsense_Mutation_p.S324*|CACNA1G_ENST00000503485.1_Nonsense_Mutation_p.S324*|CACNA1G_ENST00000510366.1_Nonsense_Mutation_p.S324*|CACNA1G_ENST00000358244.5_Nonsense_Mutation_p.S324*|CACNA1G_ENST00000514717.1_Nonsense_Mutation_p.S324*|CACNA1G_ENST00000507510.2_Nonsense_Mutation_p.S324*|CACNA1G_ENST00000429973.2_Nonsense_Mutation_p.S324*|CACNA1G_ENST00000505165.1_Nonsense_Mutation_p.S324*|CACNA1G_ENST00000352832.5_Nonsense_Mutation_p.S324*|CACNA1G_ENST00000442258.2_Nonsense_Mutation_p.S324*|CACNA1G_ENST00000513964.1_Nonsense_Mutation_p.S324*|CACNA1G_ENST00000354983.4_Nonsense_Mutation_p.S324*|CACNA1G_ENST00000502264.1_Nonsense_Mutation_p.S324*|CACNA1G_ENST00000515765.1_Nonsense_Mutation_p.S324*	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	324					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)	p.S324*(4)		breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	ACCAACTGCTCAGCGGGGGAG	0.612																																						dbGAP											4	Substitution - Nonsense(4)	breast(4)											59.0	66.0	64.0					17																	48650139		2099	4202	6301	-	-	-	SO:0001587	stop_gained	0			AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.971C>G	17.37:g.48650139C>G	ENSP00000352011:p.Ser324*		D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Nonsense_Mutation	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_VDCCAlpha1	p.S324*	ENST00000359106.5	37	c.971	CCDS45730.1	17	.	.	.	.	.	.	.	.	.	.	c	35	5.540296	0.96474	.	.	ENSG00000006283	ENST00000360761;ENST00000352832;ENST00000416767;ENST00000354983;ENST00000442258;ENST00000502264;ENST00000512389;ENST00000513964;ENST00000514717;ENST00000510366;ENST00000503485;ENST00000507510;ENST00000507336;ENST00000513689;ENST00000507609;ENST00000510115;ENST00000515165;ENST00000514181;ENST00000515765;ENST00000514079;ENST00000358244;ENST00000359106;ENST00000429973;ENST00000515411;ENST00000505165;ENST00000507896	.	.	.	5.55	5.55	0.83447	.	0.055041	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	.	19.4957	0.95072	0.0:1.0:0.0:0.0	.	.	.	.	X	324	.	ENSP00000339302:S324X	S	+	2	0	CACNA1G	46005138	0.992000	0.36948	0.967000	0.41034	0.923000	0.55619	3.040000	0.49799	2.616000	0.88540	0.511000	0.50034	TCA	CACNA1G	-	pfam_Ion_trans_dom	ENSG00000006283		0.612	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	CACNA1G	HGNC	protein_coding	OTTHUMT00000367895.1	12	0.00	0	C	NM_018896		48650139	48650139	+1	no_errors	ENST00000359106	ensembl	human	known	69_37n	nonsense	64	14.67	11	SNP	0.993	G
CACNA2D2	9254	genome.wustl.edu	37	3	50415439	50415439	+	Splice_Site	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr3:50415439C>G	ENST00000479441.1	-	15	1478	c.1479G>C	c.(1477-1479)ctG>ctC	p.L493L	CACNA2D2_ENST00000395083.1_Splice_Site_p.L493L|CACNA2D2_ENST00000424201.2_Splice_Site_p.L493L|CACNA2D2_ENST00000266039.3_Splice_Site_p.L493L|CACNA2D2_ENST00000360963.3_Splice_Site_p.L424L|CACNA2D2_ENST00000429770.1_Splice_Site_p.L493L|CACNA2D2_ENST00000423994.2_Splice_Site_p.L493L|CACNA2D2_ENST00000435965.1_Splice_Site_p.L493L			Q9NY47	CA2D2_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 2	493	Cache.				energy reserve metabolic process (GO:0006112)|muscle fiber development (GO:0048747)|neuromuscular junction development (GO:0007528)|positive regulation of organ growth (GO:0046622)|regulation of insulin secretion (GO:0050796)|regulation of multicellular organism growth (GO:0040014)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.L493L(1)		breast(3)|cervix(1)|endometrium(4)|large_intestine(4)|lung(8)|ovary(2)|prostate(4)|skin(4)|urinary_tract(1)	31				BRCA - Breast invasive adenocarcinoma(193;0.000365)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)	Amiodarone(DB01118)|Bepridil(DB01244)|Felodipine(DB01023)|Gabapentin(DB00996)|Isradipine(DB00270)|Nitrendipine(DB01054)|Spironolactone(DB00421)	GAGGCCTTACCAGTGCATCCT	0.617																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											115.0	100.0	105.0					3																	50415439		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF040709	CCDS33763.1, CCDS54588.1, CCDS63647.1	3p21.3	2004-02-27			ENSG00000007402	ENSG00000007402		"""Calcium channel subunits"""	1400	protein-coding gene	gene with protein product	"""gene 26"""	607082					Standard	XM_005265581		Approved	KIAA0558	uc003daq.3	Q9NY47	OTTHUMG00000156887	ENST00000479441.1:c.1479+1G>C	3.37:g.50415439C>G			A7MD15|Q9NY48|Q9UEW0|Q9Y268	Silent	SNP	pfam_VWA_N,pfam_VDCC_a2/dsu,pfam_Cache_domain,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.L493	ENST00000479441.1	37	c.1479	CCDS54588.1	3																																																																																			CACNA2D2	-	pfam_Cache_domain	ENSG00000007402		0.617	CACNA2D2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	CACNA2D2	HGNC	protein_coding	OTTHUMT00000346457.1	42	0.00	0	C	NM_006030	Silent	50415439	50415439	-1	no_errors	ENST00000435965	ensembl	human	known	69_37n	silent	14	33.33	7	SNP	1.000	G
CADPS	8618	genome.wustl.edu	37	3	62423808	62423808	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr3:62423808C>T	ENST00000383710.4	-	28	4097	c.3748G>A	c.(3748-3750)Gag>Aag	p.E1250K	CADPS_ENST00000357948.3_Missense_Mutation_p.E1171K|CADPS_ENST00000283269.9_Missense_Mutation_p.E1211K	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	1250	Mediates targeting and association with DCVs. {ECO:0000250}.			E -> G (in Ref. 1; AAM61861 and 5; CAD38751). {ECO:0000305}.	catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)	p.E1211K(1)|p.E1250K(1)		breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		TACATCTCCTCATTGACCTTA	0.453																																						dbGAP											2	Substitution - Missense(2)	breast(2)											95.0	90.0	91.0					3																	62423808		2203	4300	6503	-	-	-	SO:0001583	missense	0			U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.3748G>A	3.37:g.62423808C>T	ENSP00000373215:p.Glu1250Lys		A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Missense_Mutation	SNP	pfam_Ca-dep_secretion_activator,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.E1250K	ENST00000383710.4	37	c.3748	CCDS46858.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.1|28.1	4.893928|4.893928	0.91889|0.91889	.|.	.|.	ENSG00000163618|ENSG00000163618	ENST00000383709;ENST00000383710;ENST00000357948;ENST00000283269|ENST00000473635	T;T;T|.	0.34667|.	1.35;1.35;1.35|.	5.65|5.65	5.65|5.65	0.86999|0.86999	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.75642|0.75642	0.3877|0.3877	M|M	0.67953|0.67953	2.075|2.075	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.64830|.	0.969;0.974;0.972;0.994|.	P;D;P;D|.	0.70487|.	0.709;0.969;0.86;0.947|.	T|T	0.73196|0.73196	-0.4059|-0.4059	10|5	0.26408|.	T|.	0.33|.	.|.	19.7806|19.7806	0.96414|0.96414	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1171;1211;1250;1255|.	Q9ULU8-2;Q9ULU8-3;Q9ULU8;Q9ULU8-4|.	.;.;CAPS1_HUMAN;.|.	K|I	1256;1250;1171;1211|241	ENSP00000373215:E1250K;ENSP00000350632:E1171K;ENSP00000283269:E1211K|.	ENSP00000283269:E1211K|.	E|M	-|-	1|3	0|0	CADPS|CADPS	62398848|62398848	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.770000|7.770000	0.85390|0.85390	2.668000|2.668000	0.90789|0.90789	0.644000|0.644000	0.83932|0.83932	GAG|ATG	CADPS	-	NULL	ENSG00000163618		0.453	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	CADPS	HGNC	protein_coding	OTTHUMT00000351951.5	75	0.00	0	C	NM_003716, NM_183393, NM_183394		62423808	62423808	-1	no_errors	ENST00000383710	ensembl	human	known	69_37n	missense	48	23.81	15	SNP	1.000	T
CATSPER4	378807	genome.wustl.edu	37	1	26517876	26517876	+	Silent	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr1:26517876C>T	ENST00000456354.2	+	2	379	c.312C>T	c.(310-312)atC>atT	p.I104I		NM_198137.1	NP_937770.1	Q7RTX7	CTSR4_HUMAN	cation channel, sperm associated 4	104					calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sodium ion transport (GO:0006814)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)	acrosomal vesicle (GO:0001669)|CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)	p.I104I(1)		NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|skin(2)	27		all_cancers(24;2.05e-18)|Colorectal(325;0.000147)|Renal(390;0.00211)|all_lung(284;0.00218)|Lung NSC(340;0.00239)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0687)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.52e-26)|Colorectal(126;1.34e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000755)|BRCA - Breast invasive adenocarcinoma(304;0.000995)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00878)|READ - Rectum adenocarcinoma(331;0.0649)		TGCTGGTGATCAATGCCATCA	0.597																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											97.0	79.0	85.0					1																	26517876		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BN000273	CCDS30645.1	1p35.3	2011-07-05			ENSG00000188782	ENSG00000188782		"""Voltage-gated ion channels / Cation channels, sperm associated"""	23220	protein-coding gene	gene with protein product		609121				12932298, 17227845, 16382101	Standard	NM_198137		Approved		uc010oez.2	Q7RTX7	OTTHUMG00000003383	ENST00000456354.2:c.312C>T	1.37:g.26517876C>T			A1A4W6|Q5VY71	Silent	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel	p.I104	ENST00000456354.2	37	c.312	CCDS30645.1	1																																																																																			CATSPER4	-	NULL	ENSG00000188782		0.597	CATSPER4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CATSPER4	HGNC	protein_coding	OTTHUMT00000019849.2	31	0.00	0	C	NM_198137		26517876	26517876	+1	no_errors	ENST00000456354	ensembl	human	known	69_37n	silent	11	42.11	8	SNP	0.094	T
CCR2	729230	genome.wustl.edu	37	3	46399964	46399964	+	Intron	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr3:46399964C>T	ENST00000400888.2	+	1	980				CCR2_ENST00000445132.2_Missense_Mutation_p.L316F|CCR2_ENST00000465202.1_3'UTR|CCR2_ENST00000292301.4_Intron			P41597	CCR2_HUMAN	chemokine (C-C motif) receptor 2						blood vessel remodeling (GO:0001974)|cellular calcium ion homeostasis (GO:0006874)|cellular defense response (GO:0006968)|cellular homeostasis (GO:0019725)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell chemotaxis (GO:0002407)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|JAK-STAT cascade (GO:0007259)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of angiogenesis (GO:0016525)|negative regulation of eosinophil degranulation (GO:0043310)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of astrocyte chemotaxis (GO:2000464)|positive regulation of CD8-positive, alpha-beta T cell extravasation (GO:2000451)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of immune complex clearance by monocytes and macrophages (GO:0090265)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of monocyte extravasation (GO:2000439)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of vascular endothelial growth factor production (GO:0010574)|response to wounding (GO:0009611)|T-helper 17 cell chemotaxis (GO:0035705)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|CCR2 chemokine receptor binding (GO:0031727)|chemokine receptor activity (GO:0004950)|protein homodimerization activity (GO:0042803)	p.L316F(1)|p.?(1)		breast(3)|endometrium(1)|large_intestine(1)|liver(2)|lung(7)	14				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0174)|Kidney(197;0.0206)		CAGAAGGTATCTCTCGGTGTT	0.502																																						dbGAP											2	Substitution - Missense(1)|Unknown(1)	breast(2)											133.0	117.0	122.0					3																	46399964		1568	3582	5150	-	-	-	SO:0001627	intron_variant	0				CCDS43078.1, CCDS46813.1	3p21	2012-08-08			ENSG00000121807	ENSG00000121807		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1603	protein-coding gene	gene with protein product		601267		CMKBR2		8146186	Standard	NM_001123041		Approved	CC-CKR-2, CKR2, MCP-1-R, CD192, FLJ78302	uc003cpn.4	P41597	OTTHUMG00000156466	ENST00000400888.2:c.941+5C>T	3.37:g.46399964C>T			A0AVQ3|B2RMT0|Q4VBL2	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Chemokine_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Chemokine_CCR2	p.L316F	ENST00000400888.2	37	c.946	CCDS43078.1	3	.	.	.	.	.	.	.	.	.	.	C	8.033	0.762123	0.15914	.	.	ENSG00000121807	ENST00000445132	T	0.35421	1.31	4.78	2.74	0.32292	.	.	.	.	.	T	0.47563	0.1452	M	0.90595	3.13	0.23180	N	0.998165	B	0.12013	0.005	B	0.27262	0.078	T	0.49163	-0.8968	9	0.52906	T	0.07	.	9.6291	0.39768	0.2915:0.5785:0.13:0.0	.	316	Q4VBL2	.	F	316	ENSP00000399285:L316F	ENSP00000399285:L316F	L	+	1	0	CCR2	46374968	0.212000	0.23540	0.731000	0.30826	0.243000	0.25628	0.809000	0.27168	1.104000	0.41587	0.460000	0.39030	CTC	CCR2	-	prints_Chemokine_rcpt	ENSG00000121807		0.502	CCR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCR2	HGNC	protein_coding	OTTHUMT00000344292.1	68	0.00	0	C	NM_000647		46399964	46399964	+1	no_errors	ENST00000445132	ensembl	human	known	69_37n	missense	68	18.07	15	SNP	0.046	T
CDC25A	993	genome.wustl.edu	37	3	48224485	48224485	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr3:48224485C>G	ENST00000302506.3	-	5	771	c.363G>C	c.(361-363)agG>agC	p.R121S	RNU7-128P_ENST00000517247.1_RNA|CDC25A_ENST00000351231.3_Missense_Mutation_p.R121S	NM_001789.2	NP_001780.2	P30304	MPIP1_HUMAN	cell division cycle 25A	121					cell proliferation (GO:0008283)|cellular response to UV (GO:0034644)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to radiation (GO:0009314)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)	p.R121S(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	20				BRCA - Breast invasive adenocarcinoma(193;0.000685)|KIRC - Kidney renal clear cell carcinoma(197;0.00596)|Kidney(197;0.00684)		CAGAATGGCTCCTCTTCAGAG	0.398																																						dbGAP											1	Substitution - Missense(1)	breast(1)											117.0	104.0	109.0					3																	48224485		2203	4300	6503	-	-	-	SO:0001583	missense	0			M81933	CCDS2760.1, CCDS2761.1	3p21	2013-01-17	2013-01-17		ENSG00000164045	ENSG00000164045		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"""	1725	protein-coding gene	gene with protein product		116947	"""cell division cycle 25A"", ""cell division cycle 25 homolog A (S. cerevisiae)"", ""cell division cycle 25 homolog A (S. pombe)"""			1836978	Standard	NM_001789		Approved		uc003csh.1	P30304	OTTHUMG00000133535	ENST00000302506.3:c.363G>C	3.37:g.48224485C>G	ENSP00000303706:p.Arg121Ser		Q8IZH5|Q96IL3|Q9H2F2	Missense_Mutation	SNP	pfam_MPI_Phosphatase,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,pfscan_Rhodanese-like_dom,prints_MPI_Phosphatase	p.R121S	ENST00000302506.3	37	c.363	CCDS2760.1	3	.	.	.	.	.	.	.	.	.	.	C	19.95	3.921843	0.73213	.	.	ENSG00000164045	ENST00000302506;ENST00000351231;ENST00000443342;ENST00000437972	T;T;T;T	0.25250	1.81;1.81;1.81;1.81	6.17	0.846	0.18955	.	0.089434	0.85682	D	0.000000	T	0.41789	0.1174	M	0.64170	1.965	0.37462	D	0.915252	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.33007	-0.9885	10	0.44086	T	0.13	.	9.0626	0.36444	0.0:0.5876:0.0:0.4124	.	121;121	P30304-2;P30304	.;MPIP1_HUMAN	S	121;121;120;121	ENSP00000303706:R121S;ENSP00000343166:R121S;ENSP00000416483:R120S;ENSP00000404285:R121S	ENSP00000303706:R121S	R	-	3	2	CDC25A	48199489	0.998000	0.40836	1.000000	0.80357	0.994000	0.84299	0.157000	0.16402	0.195000	0.20347	0.655000	0.94253	AGG	CDC25A	-	pfam_MPI_Phosphatase	ENSG00000164045		0.398	CDC25A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC25A	HGNC	protein_coding	OTTHUMT00000257512.2	72	0.00	0	C	NM_001789		48224485	48224485	-1	no_errors	ENST00000302506	ensembl	human	known	69_37n	missense	42	22.22	12	SNP	0.996	G
CENPO	79172	genome.wustl.edu	37	2	25039532	25039532	+	Silent	SNP	C	C	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr2:25039532C>A	ENST00000380834.2	+	6	1037	c.612C>A	c.(610-612)ctC>ctA	p.L204L	CENPO_ENST00000395845.2_Intron|CENPO_ENST00000473706.1_Silent_p.L198L|CENPO_ENST00000260662.1_Silent_p.L204L			Q9BU64	CENPO_HUMAN	centromere protein O	204					CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.L204L(1)		breast(2)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					TTGCAGCCCTCCTGACTGGGC	0.493																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											357.0	365.0	362.0					2																	25039532		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK027859	CCDS1714.1, CCDS56113.1	2p23.3	2013-11-05			ENSG00000138092	ENSG00000138092			28152	protein-coding gene	gene with protein product		611504				16622420, 16622419	Standard	NM_024322		Approved	MGC11266, CENP-O	uc002rfp.2	Q9BU64	OTTHUMG00000125525	ENST00000380834.2:c.612C>A	2.37:g.25039532C>A			B2RDC0|D6W536|Q53T55|Q96JV3	Silent	SNP	pfam_Centromere_CenpO	p.L204	ENST00000380834.2	37	c.612	CCDS1714.1	2																																																																																			CENPO	-	NULL	ENSG00000138092		0.493	CENPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPO	HGNC	protein_coding	OTTHUMT00000246856.2	104	0.00	0	C	NM_024322		25039532	25039532	+1	no_errors	ENST00000260662	ensembl	human	known	69_37n	silent	63	20.25	16	SNP	0.278	A
CEP250	11190	genome.wustl.edu	37	20	34082384	34082384	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr20:34082384G>A	ENST00000397527.1	+	24	3787	c.3067G>A	c.(3067-3069)Gat>Aat	p.D1023N	CEP250_ENST00000342580.4_Missense_Mutation_p.D967N	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	1023	Gln/Glu-rich.				centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)	p.D1023N(1)		NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			GGTGGCCCAGGATGACTCCCA	0.567																																						dbGAP											1	Substitution - Missense(1)	breast(1)											76.0	80.0	78.0					20																	34082384		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.3067G>A	20.37:g.34082384G>A	ENSP00000380661:p.Asp1023Asn		E1P5Q3|O14812|O60588|Q9H450	Missense_Mutation	SNP	superfamily_Prefoldin	p.D1023N	ENST00000397527.1	37	c.3067	CCDS13255.1	20	.	.	.	.	.	.	.	.	.	.	G	10.70	1.422919	0.25639	.	.	ENSG00000126001	ENST00000397527;ENST00000342580	T;T	0.09817	2.94;2.94	4.18	0.942	0.19525	.	0.621000	0.14254	N	0.331253	T	0.05640	0.0148	N	0.17082	0.46	0.09310	N	0.999997	B	0.06786	0.001	B	0.09377	0.004	T	0.36601	-0.9741	10	0.37606	T	0.19	.	4.3066	0.10949	0.2698:0.0:0.5714:0.1589	.	1023	Q9BV73	CP250_HUMAN	N	1023;967	ENSP00000380661:D1023N;ENSP00000341541:D967N	ENSP00000341541:D967N	D	+	1	0	CEP250	33545798	0.737000	0.28175	0.066000	0.19879	0.890000	0.51754	1.207000	0.32333	0.116000	0.18110	-0.142000	0.14014	GAT	CEP250	-	NULL	ENSG00000126001		0.567	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP250	HGNC	protein_coding	OTTHUMT00000078877.7	98	0.00	0	G	NM_007186		34082384	34082384	+1	no_errors	ENST00000397527	ensembl	human	known	69_37n	missense	70	12.50	10	SNP	0.104	A
CFHR5	81494	genome.wustl.edu	37	1	196963292	196963292	+	Silent	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr1:196963292G>A	ENST00000256785.4	+	4	622	c.513G>A	c.(511-513)ttG>ttA	p.L171L	CFHR5_ENST00000367414.5_Silent_p.L195L			Q9BXR6	FHR5_HUMAN	complement factor H-related 5	171	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, alternative pathway (GO:0006957)	extracellular region (GO:0005576)		p.L171L(1)		NS(2)|breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|liver(2)|lung(23)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	49						GAGACGTGTTGAAATTCTCCT	0.353																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											97.0	110.0	105.0					1																	196963292		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF295327	CCDS1387.1	1q31.3	2014-09-17		2006-02-28	ENSG00000134389	ENSG00000134389		"""Complement system"""	24668	protein-coding gene	gene with protein product	"""factor H related protein 5"""	608593		CFHL5		11058592, 12041828	Standard	NM_030787		Approved	FHR5, FHR-5	uc001gts.4	Q9BXR6	OTTHUMG00000036517	ENST00000256785.4:c.513G>A	1.37:g.196963292G>A			Q2NKK2	Silent	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.L195	ENST00000256785.4	37	c.585	CCDS1387.1	1																																																																																			CFHR5	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000134389		0.353	CFHR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFHR5	HGNC	protein_coding	OTTHUMT00000088814.2	160	0.00	0	G	NM_030787		196963292	196963292	+1	no_errors	ENST00000367414	ensembl	human	known	69_37n	silent	220	15.71	41	SNP	0.427	A
CLC	1178	genome.wustl.edu	37	19	40225039	40225039	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr19:40225039C>G	ENST00000221804.4	-	3	262	c.187G>C	c.(187-189)Gtc>Ctc	p.V63L		NM_001828.5	NP_001819.2	Q05315	LEG10_HUMAN	Charcot-Leyden crystal galectin	63	Galectin. {ECO:0000255|PROSITE- ProRule:PRU00639}.				multicellular organismal development (GO:0007275)|regulation of activated T cell proliferation (GO:0046006)|regulation of T cell anergy (GO:0002667)|regulation of T cell cytokine production (GO:0002724)|T cell apoptotic process (GO:0070231)	cytosol (GO:0005829)	carbohydrate binding (GO:0030246)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)	p.V63I(1)|p.V63L(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(2)|stomach(1)	12	all_cancers(60;2.99e-06)|all_lung(34;4.7e-08)|Lung NSC(34;5.46e-08)|Ovarian(47;0.06)	Renal(1328;0.000147)|Hepatocellular(1079;0.0202)|Myeloproliferative disorder(2;0.0255)	Epithelial(26;6.43e-25)|OV - Ovarian serous cystadenocarcinoma(5;1.07e-24)|all cancers(26;8.38e-23)	GBM - Glioblastoma multiforme(1328;4.97e-06)|STAD - Stomach adenocarcinoma(1328;0.00655)		CTGTTCATGACCACACGACGA	0.488																																						dbGAP											2	Substitution - Missense(2)	breast(1)|endometrium(1)											234.0	195.0	208.0					19																	40225039		2203	4300	6503	-	-	-	SO:0001583	missense	0			L01664	CCDS33025.1	19q13.1	2013-06-12	2013-06-12		ENSG00000105205	ENSG00000105205		"""Lectins, galactoside-binding"""	2014	protein-coding gene	gene with protein product	"""eosinophil lysophospholipase"", ""lysolecithin acylhydrolase"", ""galectin 10"", ""lectin, galactoside-binding, soluble, 10"""	153310	"""Charcot-Leyden crystal protein"""			1577491, 11834744	Standard	NM_001828		Approved	LGALS10, MGC149659, Gal-10	uc002omh.3	Q05315		ENST00000221804.4:c.187G>C	19.37:g.40225039C>G	ENSP00000221804:p.Val63Leu		C5HZ13|C5HZ14|Q0VDE3	Missense_Mutation	SNP	pfam_Galectin_CRD,superfamily_ConA-like_lec_gl,smart_Galectin_CRD	p.V63L	ENST00000221804.4	37	c.187	CCDS33025.1	19	.	.	.	.	.	.	.	.	.	.	.	12.10	1.837744	0.32513	.	.	ENSG00000105205	ENST00000221804	T	0.28666	1.6	1.3	-1.21	0.09524	Concanavalin A-like lectin/glucanase (1);Galectin, carbohydrate recognition domain (4);Concanavalin A-like lectin/glucanase, subgroup (1);	.	.	.	.	T	0.51907	0.1702	M	0.93763	3.455	0.09310	N	1	D	0.60575	0.988	P	0.57620	0.824	T	0.43686	-0.9376	9	0.87932	D	0	.	3.8379	0.08902	0.0:0.4511:0.0:0.5489	.	63	Q05315	LPPL_HUMAN	L	63	ENSP00000221804:V63L	ENSP00000221804:V63L	V	-	1	0	CLC	44916879	0.006000	0.16342	0.004000	0.12327	0.029000	0.11900	-0.046000	0.11983	-0.166000	0.10890	0.305000	0.20034	GTC	CLC	-	pfam_Galectin_CRD,superfamily_ConA-like_lec_gl,smart_Galectin_CRD	ENSG00000105205		0.488	CLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLC	HGNC	protein_coding	OTTHUMT00000465225.1	97	0.00	0	C	NM_001828		40225039	40225039	-1	no_errors	ENST00000221804	ensembl	human	known	69_37n	missense	79	21.00	21	SNP	0.002	G
CIC	23152	genome.wustl.edu	37	19	42791541	42791541	+	Silent	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr19:42791541C>G	ENST00000575354.2	+	4	562	c.522C>G	c.(520-522)ctC>ctG	p.L174L	CIC_ENST00000160740.3_Silent_p.L174L|CIC_ENST00000572681.2_Silent_p.L1083L	NM_015125.3	NP_055940.3	Q96RK0	CIC_HUMAN	capicua transcriptional repressor	174					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.L174L(1)		autonomic_ganglia(1)|breast(5)|central_nervous_system(32)|endometrium(10)|kidney(2)|large_intestine(7)|lung(9)|ovary(7)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	82		Prostate(69;0.00682)				CCCAGTCCCTCAGTGCCCTAC	0.612			"""Mis, F, S"""		oligodendroglioma																																	dbGAP		Rec	yes		19	19q13.2	23152	capicua homolog		O	1	Substitution - coding silent(1)	breast(1)											120.0	121.0	121.0					19																	42791541		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB002304	CCDS12601.1	19q13.2	2013-03-15	2013-03-15		ENSG00000079432	ENSG00000079432			14214	protein-coding gene	gene with protein product		612082	"""capicua (Drosophila) homolog"", ""capicua homolog (Drosophila)"""			12393275, 15981098	Standard	NM_015125		Approved	KIAA0306	uc002otf.1	Q96RK0		ENST00000575354.2:c.522C>G	19.37:g.42791541C>G			Q7LGI1|Q9UEG5|Q9Y6T1	Silent	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.L174	ENST00000575354.2	37	c.522	CCDS12601.1	19																																																																																			CIC	-	NULL	ENSG00000079432		0.612	CIC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CIC	HGNC	protein_coding	OTTHUMT00000438532.2	36	0.00	0	C			42791541	42791541	+1	no_errors	ENST00000160740	ensembl	human	known	69_37n	silent	27	18.18	6	SNP	0.998	G
CLUAP1	23059	genome.wustl.edu	37	16	3558457	3558457	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr16:3558457C>G	ENST00000576634.1	+	4	532	c.388C>G	c.(388-390)Ctt>Gtt	p.L130V	CLUAP1_ENST00000341633.5_Missense_Mutation_p.L130V|LA16c-306E5.3_ENST00000574423.2_RNA|CLUAP1_ENST00000571025.1_Missense_Mutation_p.L130V|CLUAP1_ENST00000572600.1_5'Flank|CLUAP1_ENST00000417763.2_5'UTR	NM_015041.2	NP_055856.1	Q96AJ1	CLUA1_HUMAN	clusterin associated protein 1	130					cilium assembly (GO:0042384)	centrosome (GO:0005813)|cilium (GO:0005929)|intracellular membrane-bounded organelle (GO:0043231)|intraciliary transport particle B (GO:0030992)|nucleus (GO:0005634)		p.L130V(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(1)|ovary(1)|pancreas(1)|urinary_tract(2)	16						CAAGTTTGATCTTGGCTCAAA	0.463																																						dbGAP											1	Substitution - Missense(1)	breast(1)											132.0	113.0	119.0					16																	3558457		2197	4300	6497	-	-	-	SO:0001583	missense	0			BC017070	CCDS32381.1, CCDS45398.1	16p13.3	2014-07-18				ENSG00000103351		"""Intraflagellar transport homologs"""	19009	protein-coding gene	gene with protein product	"""flagellar associated protein 22, qilin-like protein, homolog (Chlamydomonas)"", ""cilia and flagella associated protein 22"""					15480429, 9734811, 19253336	Standard	NM_015041		Approved	FLJ13297, KIAA0643, FAP22, CFAP22	uc002cvk.2	Q96AJ1		ENST00000576634.1:c.388C>G	16.37:g.3558457C>G	ENSP00000460850:p.Leu130Val		O75138|Q65ZA3|Q9H8R4|Q9H8T1	Missense_Mutation	SNP	pfam_Clusterin-associated_protein-1,superfamily_CH-domain	p.L130V	ENST00000576634.1	37	c.388	CCDS32381.1	16	.	.	.	.	.	.	.	.	.	.	C	7.810	0.715413	0.15306	.	.	ENSG00000103351	ENST00000341633	T	0.46819	0.86	4.89	4.89	0.63831	.	0.201917	0.41500	D	0.000876	T	0.35393	0.0930	L	0.31371	0.925	0.80722	D	1	P	0.37207	0.587	B	0.40659	0.336	T	0.09207	-1.0685	10	0.17832	T	0.49	-14.4315	9.2237	0.37393	0.0:0.9007:0.0:0.0993	.	130	Q96AJ1	CLUA1_HUMAN	V	130	ENSP00000344392:L130V	ENSP00000344392:L130V	L	+	1	0	CLUAP1	3498458	0.998000	0.40836	0.990000	0.47175	0.223000	0.24884	2.870000	0.48451	2.268000	0.75426	0.467000	0.42956	CTT	CLUAP1	-	pfam_Clusterin-associated_protein-1	ENSG00000103351		0.463	CLUAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLUAP1	HGNC	protein_coding	OTTHUMT00000437883.2	120	0.00	0	C	NM_024793		3558457	3558457	+1	no_errors	ENST00000576634	ensembl	human	known	69_37n	missense	96	19.33	23	SNP	0.999	G
CMYA5	202333	genome.wustl.edu	37	5	79032398	79032398	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr5:79032398G>A	ENST00000446378.2	+	2	7841	c.7810G>A	c.(7810-7812)Gag>Aag	p.E2604K		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	2604					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)		p.E2604K(2)		NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		CATGCTCGCAGAGGCTCACCC	0.403																																						dbGAP											2	Substitution - Missense(2)	breast(2)											61.0	62.0	61.0					5																	79032398		1856	4109	5965	-	-	-	SO:0001583	missense	0			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.7810G>A	5.37:g.79032398G>A	ENSP00000394770:p.Glu2604Lys		A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3	p.E2604K	ENST00000446378.2	37	c.7810	CCDS47238.1	5	.	.	.	.	.	.	.	.	.	.	G	10.46	1.355570	0.24598	.	.	ENSG00000164309	ENST00000446378	T	0.29142	1.58	5.05	3.23	0.37069	.	0.529823	0.17475	N	0.172952	T	0.20941	0.0504	L	0.38175	1.15	0.09310	N	1	B	0.12630	0.006	B	0.14578	0.011	T	0.16482	-1.0401	10	0.18710	T	0.47	.	8.0798	0.30737	0.1884:0.0:0.8116:0.0	.	2604	Q8N3K9	CMYA5_HUMAN	K	2604	ENSP00000394770:E2604K	ENSP00000394770:E2604K	E	+	1	0	CMYA5	79068154	0.946000	0.32159	0.122000	0.21767	0.002000	0.02628	2.981000	0.49329	1.371000	0.46172	-0.291000	0.09656	GAG	CMYA5	-	NULL	ENSG00000164309		0.403	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMYA5	HGNC	protein_coding	OTTHUMT00000369497.1	115	0.00	0	G	NM_153610		79032398	79032398	+1	no_errors	ENST00000446378	ensembl	human	known	69_37n	missense	75	16.67	15	SNP	0.020	A
CNKSR1	10256	genome.wustl.edu	37	1	26510895	26510895	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr1:26510895C>T	ENST00000374253.5	+	12	1064	c.1025C>T	c.(1024-1026)tCt>tTt	p.S342F	CNKSR1_ENST00000361530.6_Missense_Mutation_p.S335F|CNKSR1_ENST00000531191.1_Missense_Mutation_p.S77F	NM_006314.2	NP_006305.2	Q969H4	CNKR1_HUMAN	connector enhancer of kinase suppressor of Ras 1	342	Pro-rich.				Ras protein signal transduction (GO:0007265)|Rho protein signal transduction (GO:0007266)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|plasma membrane (GO:0005886)	protein binding, bridging (GO:0030674)	p.S335F(1)		breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	28		Colorectal(325;3.46e-05)|all_lung(284;0.000116)|Lung NSC(340;0.000154)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.72e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|BRCA - Breast invasive adenocarcinoma(304;0.000959)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00823)|READ - Rectum adenocarcinoma(331;0.0649)		CTGACAGACTCTGCCTCCCTT	0.652																																					NSCLC(180;1396 2109 28270 30756 34275)	dbGAP											1	Substitution - Missense(1)	breast(1)											33.0	36.0	35.0					1																	26510895		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF100153	CCDS276.1, CCDS72732.1	1p35.3	2013-01-10			ENSG00000142675	ENSG00000142675		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19700	protein-coding gene	gene with protein product		603272				9814705	Standard	NM_006314		Approved	CNK1, KSR, CNK	uc001blm.4	Q969H4	OTTHUMG00000007541	ENST00000374253.5:c.1025C>T	1.37:g.26510895C>T	ENSP00000363371:p.Ser342Phe		B1AMW9|O95381	Missense_Mutation	SNP	pfam_CRIC_domain_Chordata,pfam_Pleckstrin_homology,pfam_SAM_type1,superfamily_SAM/pointed,superfamily_PDZ,smart_SAM,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_SAM	p.S342F	ENST00000374253.5	37	c.1025		1	.	.	.	.	.	.	.	.	.	.	C	13.46	2.242617	0.39598	.	.	ENSG00000142675	ENST00000361530;ENST00000374253;ENST00000531191	T;T;T	0.11495	2.77;2.77;2.77	4.2	4.2	0.49525	.	0.894418	0.09731	N	0.763183	T	0.11024	0.0269	L	0.29908	0.895	0.36478	D	0.867695	B;B	0.26318	0.146;0.146	B;B	0.31290	0.127;0.055	T	0.13361	-1.0512	10	0.87932	D	0	-11.7934	10.3704	0.44051	0.0:0.801:0.199:0.0	.	342;335	Q969H4;Q53GM7	CNKR1_HUMAN;.	F	335;342;77	ENSP00000354609:S335F;ENSP00000363371:S342F;ENSP00000431817:S77F	ENSP00000354609:S335F	S	+	2	0	CNKSR1	26383482	0.006000	0.16342	0.610000	0.28997	0.032000	0.12392	1.001000	0.29783	2.636000	0.89361	0.603000	0.83216	TCT	CNKSR1	-	NULL	ENSG00000142675		0.652	CNKSR1-007	KNOWN	basic	protein_coding	CNKSR1	HGNC	protein_coding	OTTHUMT00000089943.2	67	0.00	0	C	NM_006314		26510895	26510895	+1	no_errors	ENST00000374253	ensembl	human	known	69_37n	missense	34	20.93	9	SNP	0.697	T
CNKSR1	10256	genome.wustl.edu	37	1	26513679	26513679	+	Silent	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr1:26513679C>T	ENST00000374253.5	+	15	1389	c.1350C>T	c.(1348-1350)ctC>ctT	p.L450L	CNKSR1_ENST00000361530.6_Silent_p.L443L|CNKSR1_ENST00000531191.1_Silent_p.L185L	NM_006314.2	NP_006305.2	Q969H4	CNKR1_HUMAN	connector enhancer of kinase suppressor of Ras 1	450	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				Ras protein signal transduction (GO:0007265)|Rho protein signal transduction (GO:0007266)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|plasma membrane (GO:0005886)	protein binding, bridging (GO:0030674)	p.L443L(1)		breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	28		Colorectal(325;3.46e-05)|all_lung(284;0.000116)|Lung NSC(340;0.000154)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.72e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|BRCA - Breast invasive adenocarcinoma(304;0.000959)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00823)|READ - Rectum adenocarcinoma(331;0.0649)		CTGAGGGCCTCATCAATGTCT	0.532																																					NSCLC(180;1396 2109 28270 30756 34275)	dbGAP											1	Substitution - coding silent(1)	breast(1)											93.0	99.0	97.0					1																	26513679		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF100153	CCDS276.1, CCDS72732.1	1p35.3	2013-01-10			ENSG00000142675	ENSG00000142675		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19700	protein-coding gene	gene with protein product		603272				9814705	Standard	NM_006314		Approved	CNK1, KSR, CNK	uc001blm.4	Q969H4	OTTHUMG00000007541	ENST00000374253.5:c.1350C>T	1.37:g.26513679C>T			B1AMW9|O95381	Silent	SNP	pfam_CRIC_domain_Chordata,pfam_Pleckstrin_homology,pfam_SAM_type1,superfamily_SAM/pointed,superfamily_PDZ,smart_SAM,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_SAM	p.L450	ENST00000374253.5	37	c.1350		1																																																																																			CNKSR1	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000142675		0.532	CNKSR1-007	KNOWN	basic	protein_coding	CNKSR1	HGNC	protein_coding	OTTHUMT00000089943.2	127	0.00	0	C	NM_006314		26513679	26513679	+1	no_errors	ENST00000374253	ensembl	human	known	69_37n	silent	82	16.33	16	SNP	0.997	T
CNKSR1	10256	genome.wustl.edu	37	1	26514740	26514740	+	Silent	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr1:26514740C>G	ENST00000374253.5	+	17	1530	c.1491C>G	c.(1489-1491)ctC>ctG	p.L497L	CNKSR1_ENST00000361530.6_Silent_p.L490L|CNKSR1_ENST00000531191.1_Silent_p.L232L|CATSPER4_ENST00000456354.2_5'Flank	NM_006314.2	NP_006305.2	Q969H4	CNKR1_HUMAN	connector enhancer of kinase suppressor of Ras 1	497	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				Ras protein signal transduction (GO:0007265)|Rho protein signal transduction (GO:0007266)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|plasma membrane (GO:0005886)	protein binding, bridging (GO:0030674)	p.L490L(1)		breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	28		Colorectal(325;3.46e-05)|all_lung(284;0.000116)|Lung NSC(340;0.000154)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.72e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|BRCA - Breast invasive adenocarcinoma(304;0.000959)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00823)|READ - Rectum adenocarcinoma(331;0.0649)		TGCGTCATCTCATTACCTGCA	0.582																																					NSCLC(180;1396 2109 28270 30756 34275)	dbGAP											1	Substitution - coding silent(1)	breast(1)											98.0	94.0	95.0					1																	26514740		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF100153	CCDS276.1, CCDS72732.1	1p35.3	2013-01-10			ENSG00000142675	ENSG00000142675		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19700	protein-coding gene	gene with protein product		603272				9814705	Standard	NM_006314		Approved	CNK1, KSR, CNK	uc001blm.4	Q969H4	OTTHUMG00000007541	ENST00000374253.5:c.1491C>G	1.37:g.26514740C>G			B1AMW9|O95381	Silent	SNP	pfam_CRIC_domain_Chordata,pfam_Pleckstrin_homology,pfam_SAM_type1,superfamily_SAM/pointed,superfamily_PDZ,smart_SAM,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_SAM	p.L497	ENST00000374253.5	37	c.1491		1																																																																																			CNKSR1	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000142675		0.582	CNKSR1-007	KNOWN	basic	protein_coding	CNKSR1	HGNC	protein_coding	OTTHUMT00000089943.2	61	0.00	0	C	NM_006314		26514740	26514740	+1	no_errors	ENST00000374253	ensembl	human	known	69_37n	silent	34	20.93	9	SNP	0.981	G
CNTN2	6900	genome.wustl.edu	37	1	205031020	205031020	+	Missense_Mutation	SNP	C	C	G	rs545256650		TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr1:205031020C>G	ENST00000331830.4	+	9	1285	c.1001C>G	c.(1000-1002)tCg>tGg	p.S334W	AL583832.1_ENST00000515887.1_RNA	NM_005076.3	NP_005067.1	Q02246	CNTN2_HUMAN	contactin 2 (axonal)	334	Ig-like C2-type 4.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex GABAergic interneuron migration (GO:0021853)|clustering of voltage-gated potassium channels (GO:0045163)|establishment of protein localization to juxtaparanode region of axon (GO:0071206)|learning (GO:0007612)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|positive regulation of protein processing (GO:0010954)|presynaptic membrane organization (GO:0097090)|receptor internalization (GO:0031623)|regulation of astrocyte differentiation (GO:0048710)|regulation of axon diameter (GO:0031133)|regulation of neuronal synaptic plasticity (GO:0048168)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|juxtaparanode region of axon (GO:0044224)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated potassium channel complex (GO:0008076)	carbohydrate binding (GO:0030246)|identical protein binding (GO:0042802)	p.S334W(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(11)|lung(23)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	54	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			AAAGTGATCTCGGACACAGAG	0.587											OREG0014144	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Melanoma(183;2548 2817 37099 41192)	dbGAP											1	Substitution - Missense(1)	breast(1)											52.0	56.0	55.0					1																	205031020		2203	4300	6503	-	-	-	SO:0001583	missense	0			X67734	CCDS1449.1	1q32.1	2013-02-11			ENSG00000184144	ENSG00000184144		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2172	protein-coding gene	gene with protein product		190197		TAX, AXT		8307567, 8586965	Standard	NM_005076		Approved	TAG-1, TAX1	uc001hbr.3	Q02246	OTTHUMG00000037105	ENST00000331830.4:c.1001C>G	1.37:g.205031020C>G	ENSP00000330633:p.Ser334Trp	2149	P78432|Q5T054	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.S334W	ENST00000331830.4	37	c.1001	CCDS1449.1	1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.130528	0.77549	.	.	ENSG00000184144	ENST00000331830	T	0.69040	-0.37	4.95	4.01	0.46588	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.163229	0.29053	N	0.013289	T	0.80243	0.4587	M	0.73753	2.245	0.58432	D	0.999993	D;D;D	0.76494	0.998;0.998;0.999	D;D;D	0.70016	0.967;0.967;0.967	T	0.82530	-0.0411	10	0.87932	D	0	.	14.0712	0.64861	0.1523:0.8477:0.0:0.0	.	334;334;225	A1L3A3;Q02246;Q68DA2	.;CNTN2_HUMAN;.	W	334	ENSP00000330633:S334W	ENSP00000330633:S334W	S	+	2	0	CNTN2	203297643	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.896000	0.56266	1.010000	0.39314	0.557000	0.71058	TCG	CNTN2	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000184144		0.587	CNTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN2	HGNC	protein_coding	OTTHUMT00000090080.3	17	0.00	0	C	NM_005076		205031020	205031020	+1	no_errors	ENST00000331830	ensembl	human	known	69_37n	missense	23	23.33	7	SNP	1.000	G
CNTRL	11064	genome.wustl.edu	37	9	123880758	123880758	+	Silent	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr9:123880758G>A	ENST00000373855.1	+	12	1850	c.1590G>A	c.(1588-1590)caG>caA	p.Q530Q	CNTRL_ENST00000373850.1_5'UTR|CNTRL_ENST00000373865.2_3'UTR|CNTRL_ENST00000238341.5_Silent_p.Q530Q			Q7Z7A1	CNTRL_HUMAN	centriolin	530					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)		p.Q530Q(1)		haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						CCGGAAAGCAGAAGGAGATTA	0.393																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											118.0	120.0	119.0					9																	123880758		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.1590G>A	9.37:g.123880758G>A			A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Silent	SNP	pfam_Leu-rich_rpt,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Leu-rich_rpt_typical-subtyp	p.Q530	ENST00000373855.1	37	c.1590	CCDS35118.1	9																																																																																			CNTRL	-	superfamily_Prefoldin	ENSG00000119397		0.393	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTRL	HGNC	protein_coding	OTTHUMT00000250216.1	126	0.00	0	G	NM_007018		123880758	123880758	+1	no_errors	ENST00000238341	ensembl	human	known	69_37n	silent	88	26.67	32	SNP	0.997	A
COL14A1	7373	genome.wustl.edu	37	8	121256230	121256230	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr8:121256230C>T	ENST00000297848.3	+	20	2732	c.2462C>T	c.(2461-2463)tCc>tTc	p.S821F	COL14A1_ENST00000247781.3_Missense_Mutation_p.S726F|COL14A1_ENST00000309791.4_Missense_Mutation_p.S821F|COL14A1_ENST00000432943.2_3'UTR	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1									p.S821F(1)		NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			GTCAGCGTCTCCGCTCCTGGA	0.483																																						dbGAP											1	Substitution - Missense(1)	breast(1)											118.0	121.0	120.0					8																	121256230		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.2462C>T	8.37:g.121256230C>T	ENSP00000297848:p.Ser821Phe			Missense_Mutation	SNP	pfam_VWF_A,pfam_Fibronectin_type3,pfam_Collagen,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.S821F	ENST00000297848.3	37	c.2462	CCDS34938.1	8	.	.	.	.	.	.	.	.	.	.	C	20.8	4.043768	0.75732	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781;ENST00000434620	T;T;T;T	0.54279	0.58;0.58;0.58;0.58	5.79	5.79	0.91817	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.063243	0.64402	D	0.000003	T	0.77644	0.4161	M	0.87038	2.855	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.70487	0.969;0.942	T	0.80476	-0.1366	10	0.72032	D	0.01	.	20.04	0.97581	0.0:1.0:0.0:0.0	.	821;821	Q05707-2;Q05707	.;COEA1_HUMAN	F	821;821;726;634	ENSP00000311809:S821F;ENSP00000297848:S821F;ENSP00000247781:S726F;ENSP00000409461:S634F	ENSP00000247781:S726F	S	+	2	0	COL14A1	121325411	1.000000	0.71417	0.979000	0.43373	0.870000	0.49936	5.049000	0.64244	2.733000	0.93635	0.655000	0.94253	TCC	COL14A1	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000187955		0.483	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL14A1	HGNC	protein_coding	OTTHUMT00000313657.2	75	0.00	0	C	NM_021110		121256230	121256230	+1	no_errors	ENST00000297848	ensembl	human	known	69_37n	missense	38	20.83	10	SNP	0.997	T
COX20	116228	genome.wustl.edu	37	1	245006509	245006509	+	3'UTR	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr1:245006509G>A	ENST00000411948.2	+	0	781				HNRNPU-AS1_ENST00000475997.1_RNA|COX20_ENST00000498262.1_3'UTR|HNRNPU-AS1_ENST00000489705.1_RNA|COX20_ENST00000366528.3_3'UTR	NM_198076.4	NP_932342.1	Q5RI15	COX20_HUMAN	COX20 cytochrome C oxidase assembly factor							integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)											CAATGTAAACGAAGTTAAGAT	0.353																																						dbGAP											0													38.0	52.0	48.0					1																	245006509		2143	4275	6418	-	-	-	SO:0001624	3_prime_UTR_variant	0			BC062419	CCDS31080.1	1q44	2013-05-24	2013-05-23	2012-02-24	ENSG00000203667	ENSG00000203667		"""Mitochondrial respiratory chain complex assembly factors"""	26970	protein-coding gene	gene with protein product		614698	"""family with sequence similarity 36, member A"", ""COX20 Cox2 chaperone homolog (S. cerevisiae)"""	FAM36A		22356826, 23125284	Standard	NM_198076		Approved	FLJ43269	uc001iar.3	Q5RI15	OTTHUMG00000040401	ENST00000411948.2:c.*31G>A	1.37:g.245006509G>A			Q8WV86	RNA	SNP	-	NULL	ENST00000411948.2	37	NULL	CCDS31080.1	1																																																																																			COX20	-	-	ENSG00000203667		0.353	COX20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COX20	HGNC	protein_coding	OTTHUMT00000097174.1	86	0.00	0	G	NM_198076		245006509	245006509	+1	no_errors	ENST00000391839	ensembl	human	known	69_37n	rna	90	21.05	24	SNP	0.000	A
CPEB2	132864	genome.wustl.edu	37	4	15054051	15054051	+	Silent	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr4:15054051C>G	ENST00000507071.1	+	6	966	c.879C>G	c.(877-879)ctC>ctG	p.L293L	RP11-665G4.1_ENST00000502344.1_RNA|CPEB2_ENST00000538197.1_Silent_p.L738L|RP11-665G4.1_ENST00000513384.1_RNA|CPEB2_ENST00000259997.5_Silent_p.L301L|CPEB2_ENST00000345451.3_Silent_p.L263L|CPEB2_ENST00000541112.1_Silent_p.L730L|CPEB2_ENST00000442003.2_Silent_p.L711L|CPEB2_ENST00000382401.3_Silent_p.L266L|CPEB2_ENST00000382395.3_Silent_p.L271L			Q7Z5Q1	CPEB2_HUMAN	cytoplasmic polyadenylation element binding protein 2	293					cellular response to arsenic-containing substance (GO:0071243)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|cellular response to oxidative stress (GO:0034599)|negative regulation of cytoplasmic translation (GO:2000766)|negative regulation of cytoplasmic translational elongation (GO:1900248)|negative regulation of GTPase activity (GO:0034260)	cytoplasm (GO:0005737)|messenger ribonucleoprotein complex (GO:1990124)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ribosomal large subunit binding (GO:0043023)|ribosomal small subunit binding (GO:0043024)|ribosome binding (GO:0043022)|translation repressor activity, nucleic acid binding (GO:0000900)	p.L293L(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(4)|prostate(1)|skin(3)	14						GTTCTTCCCTCTTTCCAATAG	0.353																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											226.0	215.0	219.0					4																	15054051		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY247744	CCDS56325.1, CCDS56326.1	4p15.33	2013-02-12			ENSG00000137449	ENSG00000137449		"""RNA binding motif (RRM) containing"""	21745	protein-coding gene	gene with protein product		610605				12672660	Standard	NM_182485		Approved		uc003gnk.2	Q7Z5Q1	OTTHUMG00000090669	ENST00000507071.1:c.879C>G	4.37:g.15054051C>G			E7EPM3|F5H160|Q3B8N6|Q3MI89|Q3MI90|Q3MI92|Q7Z5Q0	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.L738	ENST00000507071.1	37	c.2214		4																																																																																			CPEB2	-	NULL	ENSG00000137449		0.353	CPEB2-001	KNOWN	basic|appris_candidate	protein_coding	CPEB2	HGNC	protein_coding	OTTHUMT00000207349.2	367	0.00	0	C	XM_059607		15054051	15054051	+1	no_errors	ENST00000538197	ensembl	human	known	69_37n	silent	291	15.61	54	SNP	1.000	G
CRTAP	10491	genome.wustl.edu	37	3	33175749	33175749	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr3:33175749G>A	ENST00000320954.6	+	6	1243	c.1144G>A	c.(1144-1146)Gat>Aat	p.D382N	CRTAP_ENST00000449224.1_Missense_Mutation_p.D339N	NM_006371.4	NP_006362.1	O75718	CRTAP_HUMAN	cartilage associated protein	382					chaperone-mediated protein folding (GO:0061077)|extracellular matrix organization (GO:0030198)|negative regulation of post-translational protein modification (GO:1901874)|peptidyl-proline hydroxylation to 3-hydroxy-L-proline (GO:0018400)|protein stabilization (GO:0050821)|spermatogenesis (GO:0007283)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular space (GO:0005615)|macromolecular complex (GO:0032991)|proteinaceous extracellular matrix (GO:0005578)	protein complex binding (GO:0032403)	p.D382N(1)		breast(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	9						TATAATGGATGATGATGAGGT	0.418																																						dbGAP											1	Substitution - Missense(1)	breast(1)											158.0	141.0	147.0					3																	33175749		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ006470	CCDS2657.1	3p22	2014-09-17			ENSG00000170275	ENSG00000170275			2379	protein-coding gene	gene with protein product	"""leprecan-like 3"""	605497				9217321, 10429950	Standard	NM_006371		Approved	CASP, LEPREL3	uc003cfl.4	O75718	OTTHUMG00000130746	ENST00000320954.6:c.1144G>A	3.37:g.33175749G>A	ENSP00000323696:p.Asp382Asn		B2RBL6	Missense_Mutation	SNP	NULL	p.D382N	ENST00000320954.6	37	c.1144	CCDS2657.1	3	.	.	.	.	.	.	.	.	.	.	G	18.30	3.593328	0.66219	.	.	ENSG00000170275	ENST00000320954;ENST00000539684;ENST00000449224	T;T	0.60797	0.22;0.16	4.96	4.96	0.65561	.	0.134329	0.47852	D	0.000215	T	0.51517	0.1679	L	0.56280	1.765	0.58432	D	0.999994	B;B	0.23540	0.087;0.04	B;B	0.23018	0.043;0.016	T	0.49390	-0.8945	10	0.36615	T	0.2	-1.0037	12.0117	0.53291	0.0799:0.0:0.9201:0.0	.	339;382	C9JP16;O75718	.;CRTAP_HUMAN	N	382;369;339	ENSP00000323696:D382N;ENSP00000409997:D339N	ENSP00000323696:D382N	D	+	1	0	CRTAP	33150753	1.000000	0.71417	0.995000	0.50966	0.975000	0.68041	7.169000	0.77578	2.469000	0.83416	0.462000	0.41574	GAT	CRTAP	-	NULL	ENSG00000170275		0.418	CRTAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRTAP	HGNC	protein_coding	OTTHUMT00000253246.3	202	0.49	1	G			33175749	33175749	+1	no_errors	ENST00000320954	ensembl	human	known	69_37n	missense	144	20.00	36	SNP	1.000	A
CTNNA1	1495	genome.wustl.edu	37	5	138223329	138223329	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr5:138223329G>C	ENST00000302763.7	+	9	1384	c.1294G>C	c.(1294-1296)Gag>Cag	p.E432Q	CTNNA1_ENST00000518825.1_Missense_Mutation_p.E432Q|CTNNA1_ENST00000540387.1_Missense_Mutation_p.E62Q|CTNNA1_ENST00000355078.5_Missense_Mutation_p.E329Q|CTNNA1_ENST00000520400.1_3'UTR	NM_001903.2	NP_001894.2	P35221	CTNA1_HUMAN	catenin (cadherin-associated protein), alpha 1, 102kDa	432					adherens junction organization (GO:0034332)|aging (GO:0007568)|apical junction assembly (GO:0043297)|axon regeneration (GO:0031103)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular protein localization (GO:0034613)|cellular response to indole-3-methanol (GO:0071681)|epithelial cell-cell adhesion (GO:0090136)|establishment or maintenance of cell polarity (GO:0007163)|gap junction assembly (GO:0016264)|male gonad development (GO:0008584)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell motility (GO:2000146)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|negative regulation of neuroblast proliferation (GO:0007406)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of smoothened signaling pathway (GO:0045880)|protein heterooligomerization (GO:0051291)|response to estrogen (GO:0043627)	acrosomal vesicle (GO:0001669)|actin cytoskeleton (GO:0015629)|catenin complex (GO:0016342)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|gamma-catenin binding (GO:0045295)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|vinculin binding (GO:0017166)	p.E432Q(1)		NS(1)|breast(7)|cervix(2)|endometrium(4)|kidney(6)|large_intestine(16)|lung(9)|oesophagus(2)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	52			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			CAAATTGATTGAGGTAAGTGA	0.363																																						dbGAP											1	Substitution - Missense(1)	breast(1)											137.0	131.0	133.0					5																	138223329		2203	4300	6503	-	-	-	SO:0001583	missense	0			D13866	CCDS34243.1, CCDS75315.1	5q31.2	2008-02-05	2002-08-29			ENSG00000044115			2509	protein-coding gene	gene with protein product		116805	"""catenin (cadherin-associated protein), alpha 1 (102kD)"""			1924379	Standard	XM_005271898		Approved	CAP102	uc003ldh.3	P35221		ENST00000302763.7:c.1294G>C	5.37:g.138223329G>C	ENSP00000304669:p.Glu432Gln		Q12795|Q8N1C0	Missense_Mutation	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.E432Q	ENST00000302763.7	37	c.1294	CCDS34243.1	5	.	.	.	.	.	.	.	.	.	.	G	17.83	3.486332	0.63962	.	.	ENSG00000044115	ENST00000355078;ENST00000302763;ENST00000537034;ENST00000541863;ENST00000518825;ENST00000518381;ENST00000522013;ENST00000523298;ENST00000517533;ENST00000523685;ENST00000521683;ENST00000519116;ENST00000540387	T;T;T;T;T;T;T;T;T;T;T	0.54479	0.57;0.57;0.57;0.57;0.57;0.57;0.57;0.57;0.57;0.57;0.57	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.51702	0.1690	L	0.43152	1.355	0.80722	D	1	P;P;P	0.45428	0.858;0.463;0.81	B;B;B	0.44133	0.442;0.172;0.301	T	0.50866	-0.8777	10	0.38643	T	0.18	-22.4355	18.4839	0.90821	0.0:0.0:1.0:0.0	.	432;309;432	G3XAM7;B4DKT9;P35221	.;.;CTNA1_HUMAN	Q	329;432;432;417;432;62;62;62;62;62;62;62;62	ENSP00000347190:E329Q;ENSP00000304669:E432Q;ENSP00000427821:E432Q;ENSP00000429738:E62Q;ENSP00000430379:E62Q;ENSP00000428044:E62Q;ENSP00000431118:E62Q;ENSP00000430240:E62Q;ENSP00000430981:E62Q;ENSP00000428894:E62Q;ENSP00000438476:E62Q	ENSP00000304669:E432Q	E	+	1	0	CTNNA1	138251228	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	9.869000	0.99810	2.463000	0.83235	0.655000	0.94253	GAG	CTNNA1	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin	ENSG00000044115		0.363	CTNNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNA1	HGNC	protein_coding	OTTHUMT00000373868.1	147	0.00	0	G	NM_001903		138223329	138223329	+1	no_errors	ENST00000302763	ensembl	human	known	69_37n	missense	89	18.92	21	SNP	1.000	C
CTTNBP2NL	55917	genome.wustl.edu	37	1	112999921	112999921	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr1:112999921C>T	ENST00000271277.6	+	6	2032	c.1807C>T	c.(1807-1809)Cat>Tat	p.H603Y	CTTNBP2NL_ENST00000607039.1_3'UTR	NM_018704.2	NP_061174.1	Q9P2B4	CT2NL_HUMAN	CTTNBP2 N-terminal like	603					negative regulation of transmembrane transport (GO:0034763)|negative regulation of transporter activity (GO:0032410)|protein dephosphorylation (GO:0006470)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	protein phosphatase 2A binding (GO:0051721)	p.H603Y(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	29		all_cancers(81;0.00064)|all_epithelial(167;0.000415)|all_lung(203;0.00045)|Lung NSC(69;0.000705)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GACCAAAACTCATTCCCAGGC	0.517																																						dbGAP											1	Substitution - Missense(1)	breast(1)											93.0	90.0	91.0					1																	112999921		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037854	CCDS845.1	1p13.2	2008-02-05			ENSG00000143079	ENSG00000143079			25330	protein-coding gene	gene with protein product		615100				10718198	Standard	NM_018704		Approved	DKFZp547A023	uc001ebx.3	Q9P2B4	OTTHUMG00000011154	ENST00000271277.6:c.1807C>T	1.37:g.112999921C>T	ENSP00000271277:p.His603Tyr		B3KMS5|Q96B40	Missense_Mutation	SNP	pfam_Cortactin-binding_p2_N	p.H603Y	ENST00000271277.6	37	c.1807	CCDS845.1	1	.	.	.	.	.	.	.	.	.	.	C	11.58	1.679810	0.29783	.	.	ENSG00000143079	ENST00000271277	T	0.23552	1.9	5.72	5.72	0.89469	.	0.222920	0.39274	N	0.001408	T	0.07234	0.0183	N	0.14661	0.345	0.29952	N	0.820166	B	0.32573	0.376	B	0.29176	0.099	T	0.12041	-1.0563	10	0.51188	T	0.08	-8.4166	12.7952	0.57556	0.0:0.9208:0.0:0.0792	.	603	Q9P2B4	CT2NL_HUMAN	Y	603	ENSP00000271277:H603Y	ENSP00000271277:H603Y	H	+	1	0	CTTNBP2NL	112801444	0.189000	0.23263	0.949000	0.38748	0.890000	0.51754	2.297000	0.43593	2.706000	0.92434	0.455000	0.32223	CAT	CTTNBP2NL	-	NULL	ENSG00000143079		0.517	CTTNBP2NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTTNBP2NL	HGNC	protein_coding	OTTHUMT00000030686.1	58	0.00	0	C	NM_018704		112999921	112999921	+1	no_errors	ENST00000271277	ensembl	human	known	69_37n	missense	30	33.33	15	SNP	0.912	T
CYP1B1	1545	genome.wustl.edu	37	2	38298053	38298053	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr2:38298053G>C	ENST00000260630.3	-	3	1845	c.1444C>G	c.(1444-1446)Ctc>Gtc	p.L482V	CYP1B1_ENST00000407341.1_Missense_Mutation_p.L482V|CYP1B1_ENST00000494864.1_5'UTR	NM_000104.3	NP_000095	Q16678	CP1B1_HUMAN	cytochrome P450, family 1, subfamily B, polypeptide 1	482					angiogenesis (GO:0001525)|arachidonic acid metabolic process (GO:0019369)|blood vessel morphogenesis (GO:0048514)|cell adhesion (GO:0007155)|cellular aromatic compound metabolic process (GO:0006725)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to organic cyclic compound (GO:0071407)|collagen fibril organization (GO:0030199)|endothelial cell migration (GO:0043542)|endothelial cell-cell adhesion (GO:0071603)|epoxygenase P450 pathway (GO:0019373)|estrogen metabolic process (GO:0008210)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|membrane lipid catabolic process (GO:0046466)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nitric oxide biosynthetic process (GO:0006809)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of gene expression involved in extracellular matrix organization (GO:1901313)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to toxic substance (GO:0009636)|retinal blood vessel morphogenesis (GO:0061304)|retinal metabolic process (GO:0042574)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|toxin metabolic process (GO:0009404)|trabecular meshwork development (GO:0002930)|visual perception (GO:0007601)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)	p.L482V(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)	13		all_hematologic(82;0.21)			Amodiaquine(DB00613)|Arsenic trioxide(DB01169)|Biotin(DB00121)|Caffeine(DB00201)|Clozapine(DB00363)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Flutamide(DB00499)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Melatonin(DB01065)|Mitoxantrone(DB01204)|Omeprazole(DB00338)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Primaquine(DB01087)|Procarbazine(DB01168)|Progesterone(DB00396)|Propofol(DB00818)|Tamoxifen(DB00675)|Testosterone(DB00624)|Theophylline(DB00277)	GAGATGAAGAGAAAAAGCTGC	0.468																																						dbGAP											1	Substitution - Missense(1)	breast(1)											73.0	74.0	74.0					2																	38298053		2203	4300	6503	-	-	-	SO:0001583	missense	0			U56438	CCDS1793.1	2p22.2	2008-02-05	2003-01-14		ENSG00000138061	ENSG00000138061		"""Cytochrome P450s"""	2597	protein-coding gene	gene with protein product		601771	"""cytochrome P450, subfamily I (dioxin-inducible), polypeptide 1 (glaucoma 3, primary infantile)"""	GLC3A		8175734, 15128046	Standard	NM_000104		Approved	CP1B	uc002rqo.2	Q16678	OTTHUMG00000100970	ENST00000260630.3:c.1444C>G	2.37:g.38298053G>C	ENSP00000260630:p.Leu482Val		Q5TZW8|Q93089|Q9H316	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450	p.L482V	ENST00000260630.3	37	c.1444	CCDS1793.1	2	.	.	.	.	.	.	.	.	.	.	G	22.9	4.355154	0.82243	.	.	ENSG00000138061	ENST00000260630;ENST00000407341	T;T	0.70986	-0.53;-0.53	5.95	5.95	0.96441	.	0.061056	0.64402	D	0.000002	D	0.82440	0.5037	M	0.83603	2.65	0.54753	D	0.999982	D	0.56746	0.977	P	0.59595	0.86	D	0.84507	0.0620	10	0.87932	D	0	.	12.7851	0.57500	0.0:0.0:0.8365:0.1635	.	482	Q53TK1	.	V	482	ENSP00000260630:L482V;ENSP00000384972:L482V	ENSP00000260630:L482V	L	-	1	0	CYP1B1	38151557	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	6.073000	0.71245	2.824000	0.97209	0.655000	0.94253	CTC	CYP1B1	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV	ENSG00000138061		0.468	CYP1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP1B1	HGNC	protein_coding	OTTHUMT00000218580.3	100	0.00	0	G	NM_000104		38298053	38298053	-1	no_errors	ENST00000260630	ensembl	human	known	69_37n	missense	66	22.09	19	SNP	1.000	C
ACKR3	57007	genome.wustl.edu	37	2	237489685	237489685	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr2:237489685G>A	ENST00000272928.3	+	2	887	c.577G>A	c.(577-579)Gag>Aag	p.E193K		NM_020311.2	NP_064707.1	P25106	ACKR3_HUMAN	atypical chemokine receptor 3	193					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|receptor internalization (GO:0031623)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell surface (GO:0009986)|coated pit (GO:0005905)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C-X-C chemokine binding (GO:0019958)|C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|scavenger receptor activity (GO:0005044)	p.E193K(1)									GTCCAACAATGAGACCTACTG	0.592																																						dbGAP											1	Substitution - Missense(1)	breast(1)											145.0	131.0	136.0					2																	237489685		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC008459	CCDS2516.1	2q37.3	2013-07-17	2013-07-16	2013-07-16	ENSG00000144476	ENSG00000144476		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : Atypical"""	23692	protein-coding gene	gene with protein product		610376	"""chemokine orphan receptor 1"", ""chemokine (C-X-C motif) receptor 7"""	CMKOR1, CXCR7		16107333, 16148	Standard	NM_020311		Approved	RDC1, GPR159	uc002vwd.3	P25106	OTTHUMG00000133295	ENST00000272928.3:c.577G>A	2.37:g.237489685G>A	ENSP00000272928:p.Glu193Lys		A8K6J4|Q53RV4|Q8NE10|Q92938|Q92986	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_RDC1_rcpt,prints_7TM_GPCR_Rhodpsn,prints_ATII_rcpt,prints_P2_purnocptor,prints_Frt_met_rcpt	p.E193K	ENST00000272928.3	37	c.577	CCDS2516.1	2	.	.	.	.	.	.	.	.	.	.	G	25.1	4.603829	0.87157	.	.	ENSG00000144476	ENST00000447924;ENST00000272928	T;T	0.37235	1.21;1.21	5.7	5.7	0.88788	GPCR, rhodopsin-like superfamily (1);	0.123069	0.53938	D	0.000041	T	0.37865	0.1019	N	0.25485	0.75	0.46654	D	0.999143	D	0.57257	0.979	P	0.49085	0.6	T	0.05632	-1.0873	10	0.38643	T	0.18	.	19.8471	0.96713	0.0:0.0:1.0:0.0	.	193	P25106	CXCR7_HUMAN	K	193	ENSP00000405945:E193K;ENSP00000272928:E193K	ENSP00000272928:E193K	E	+	1	0	CXCR7	237154424	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	5.456000	0.66665	2.688000	0.91661	0.655000	0.94253	GAG	CXCR7	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_RDC1_rcpt	ENSG00000144476		0.592	ACKR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXCR7	HGNC	protein_coding	OTTHUMT00000257079.2	20	0.00	0	G	NM_020311		237489685	237489685	+1	no_errors	ENST00000272928	ensembl	human	known	69_37n	missense	13	27.78	5	SNP	1.000	A
CYP2A13	1553	genome.wustl.edu	37	19	41601698	41601698	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr19:41601698G>A	ENST00000330436.3	+	9	1337	c.1337G>A	c.(1336-1338)aGa>aAa	p.R446K		NM_000766.4	NP_000757.2	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 13	446					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.R446K(1)		breast(3)|endometrium(6)|kidney(4)|large_intestine(8)|lung(13)|ovary(3)|prostate(3)|skin(2)	42					Methoxsalen(DB00553)|Nicotine(DB00184)|Testosterone(DB00624)	GGCCTGGCCAGAATGGAGCTC	0.557																																						dbGAP											1	Substitution - Missense(1)	breast(1)											163.0	150.0	154.0					19																	41601698		2203	4300	6503	-	-	-	SO:0001583	missense	0			U22028	CCDS12571.1	19q13.2	2013-11-11	2003-01-14		ENSG00000197838	ENSG00000197838		"""Cytochrome P450s"""	2608	protein-coding gene	gene with protein product		608055	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 13"""			7668294, 15128046	Standard	NM_000766		Approved	CPAD, CYP2A	uc002opt.4	Q16696	OTTHUMG00000182762	ENST00000330436.3:c.1337G>A	19.37:g.41601698G>A	ENSP00000332679:p.Arg446Lys		Q53YR8|Q6R569|Q6R570|Q9H2X2	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-I_CYP2A-like,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV	p.R446K	ENST00000330436.3	37	c.1337	CCDS12571.1	19	.	.	.	.	.	.	.	.	.	.	.	18.22	3.576540	0.65878	.	.	ENSG00000197838	ENST00000330436	T	0.69040	-0.37	4.18	3.1	0.35709	.	0.000000	0.85682	U	0.000000	T	0.54498	0.1862	N	0.25992	0.78	0.29993	N	0.816727	B	0.20988	0.05	B	0.30105	0.111	T	0.56902	-0.7902	10	0.51188	T	0.08	.	11.5106	0.50490	0.0924:0.0:0.9076:0.0	.	446	Q16696	CP2AD_HUMAN	K	446	ENSP00000332679:R446K	ENSP00000332679:R446K	R	+	2	0	CYP2A13	46293538	0.543000	0.26434	0.885000	0.34714	0.981000	0.71138	3.719000	0.54926	0.987000	0.38709	0.568000	0.79292	AGA	CYP2A13	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV	ENSG00000197838		0.557	CYP2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2A13	HGNC	protein_coding	OTTHUMT00000463505.1	106	0.00	0	G	NM_000766		41601698	41601698	+1	no_errors	ENST00000330436	ensembl	human	known	69_37n	missense	92	17.12	19	SNP	0.981	A
DDX43	55510	genome.wustl.edu	37	6	74104715	74104715	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr6:74104715G>T	ENST00000370336.4	+	1	245	c.87G>T	c.(85-87)agG>agT	p.R29S	snoU13_ENST00000459178.1_RNA|OOEP_ENST00000370363.1_5'UTR|DDX43_ENST00000539829.1_Missense_Mutation_p.R29S	NM_018665.2	NP_061135.2	Q9NXZ2	DDX43_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 43	29					ATP catabolic process (GO:0006200)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)	p.R29S(1)		NS(1)|breast(2)|central_nervous_system(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	24						CGCCAGAGAGGAGGCCGGCGG	0.642																																						dbGAP											1	Substitution - Missense(1)	breast(1)											59.0	66.0	64.0					6																	74104715		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4977.1	6q13	2014-01-21			ENSG00000080007	ENSG00000080007		"""DEAD-boxes"""	18677	protein-coding gene	gene with protein product	"""cancer/testis antigen 13"""	606286				10919659	Standard	NM_018665		Approved	HAGE, DKFZp434H2114, CT13	uc003pgw.3	Q9NXZ2	OTTHUMG00000015033	ENST00000370336.4:c.87G>T	6.37:g.74104715G>T	ENSP00000359361:p.Arg29Ser		B4E0C8|Q6NXR1	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_KH_dom_type_1,smart_KH_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_KH_dom_type_1,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.R29S	ENST00000370336.4	37	c.87	CCDS4977.1	6	.	.	.	.	.	.	.	.	.	.	G	13.93	2.385301	0.42308	.	.	ENSG00000080007	ENST00000370336;ENST00000539829	T;T	0.45668	2.46;0.89	3.88	3.88	0.44766	.	0.501149	0.16061	N	0.231485	T	0.15565	0.0375	L	0.48642	1.525	0.09310	N	1	B	0.22003	0.063	B	0.19666	0.026	T	0.13764	-1.0497	10	0.09338	T	0.73	-1.9888	11.6361	0.51204	0.0:0.0:1.0:0.0	.	29	Q9NXZ2	DDX43_HUMAN	S	29	ENSP00000359361:R29S;ENSP00000441636:R29S	ENSP00000359361:R29S	R	+	3	2	DDX43	74161436	0.064000	0.20934	0.051000	0.19133	0.023000	0.10783	1.237000	0.32695	2.445000	0.82738	0.455000	0.32223	AGG	DDX43	-	NULL	ENSG00000080007		0.642	DDX43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX43	HGNC	protein_coding	OTTHUMT00000041219.3	22	0.00	0	G	NM_018665		74104715	74104715	+1	no_errors	ENST00000370336	ensembl	human	known	69_37n	missense	10	28.57	4	SNP	0.057	T
DMBT1	1755	genome.wustl.edu	37	10	124380755	124380755	+	Missense_Mutation	SNP	C	C	T	rs545733226		TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr10:124380755C>T	ENST00000338354.3	+	41	5186	c.5080C>T	c.(5080-5082)Cgg>Tgg	p.R1694W	DMBT1_ENST00000368955.3_Missense_Mutation_p.R1684W|DMBT1_ENST00000368956.2_Missense_Mutation_p.R1066W|DMBT1_ENST00000344338.3_Missense_Mutation_p.R1684W|DMBT1_ENST00000330163.4_Missense_Mutation_p.R1066W|DMBT1_ENST00000368909.3_Missense_Mutation_p.R1694W|DMBT1_ENST00000359586.6_Intron			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	1694	SRCR 13. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)	p.R1694W(2)|p.R1823W(1)		breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				AGGAAATGCCCGGTTTGGCCA	0.617													C|||	1	0.000199681	0.0	0.0	5008	,	,		17018	0.0		0.001	False		,,,				2504	0.0				Ovarian(182;93 2026 18125 22222 38972)	dbGAP											3	Substitution - Missense(3)	breast(3)											149.0	152.0	151.0					10																	124380755		1970	4155	6125	-	-	-	SO:0001583	missense	0				CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.5080C>T	10.37:g.124380755C>T	ENSP00000342210:p.Arg1694Trp		A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	pfam_Srcr_rcpt,pfam_CUB,pfam_Zona_pellucida_Endoglin/CD105,superfamily_Srcr_rcpt-rel,superfamily_CUB,smart_Srcr_rcpt-rel,smart_CUB,smart_Zona_pellucida_Endoglin/CD105,pfscan_CUB,pfscan_Srcr_rcpt,pfscan_Zona_pellucida_Endoglin/CD105,prints_Srcr_rcpt	p.R1823W	ENST00000338354.3	37	c.5467		10	.	.	.	.	.	.	.	.	.	.	-	8.348	0.830224	0.16749	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000327438;ENST00000344338;ENST00000339712;ENST00000330163;ENST00000368909;ENST00000368955;ENST00000368956	T;T;T;T;T;T	0.16897	2.31;2.31;2.31;2.31;2.31;2.31	3.79	0.769	0.18492	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	3.705740	0.01089	N	0.005157	T	0.31513	0.0799	L	0.39692	1.235	0.20926	N	0.999822	D;D;D;D;B;D	0.89917	1.0;1.0;1.0;1.0;0.089;1.0	D;D;D;D;B;D	0.76575	0.988;0.971;0.959;0.978;0.013;0.985	T	0.10894	-1.0610	10	0.38643	T	0.18	.	5.4603	0.16614	0.2775:0.5574:0.0:0.1651	.	1694;943;1823;1066;1684;1694	Q9UGM3-5;Q9UGM3-8;Q9UGM3-6;Q9UGM3-2;Q9UGM3-3;Q9UGM3	.;.;.;.;.;DMBT1_HUMAN	W	1694;1823;1694;1694;1694;1694;1066;1684;1066;1066;1694;1684;1066	ENSP00000342210:R1694W;ENSP00000343175:R1684W;ENSP00000327747:R1066W;ENSP00000357905:R1694W;ENSP00000357951:R1684W;ENSP00000357952:R1066W	ENSP00000331522:R1066W	R	+	1	2	DMBT1	124370745	0.000000	0.05858	0.030000	0.17652	0.177000	0.22998	-1.007000	0.03667	0.039000	0.15632	-0.377000	0.06932	CGG	DMBT1	-	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt	ENSG00000187908		0.617	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	DMBT1	HGNC	protein_coding	OTTHUMT00000050792.2	62	0.00	0	C	NM_004406		124380755	124380755	+1	no_errors	ENST00000368915	ensembl	human	known	69_37n	missense	37	27.45	14	SNP	0.102	T
DMXL1	1657	genome.wustl.edu	37	5	118482538	118482538	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr5:118482538C>G	ENST00000311085.8	+	16	2656	c.2576C>G	c.(2575-2577)tCa>tGa	p.S859*	DMXL1_ENST00000539542.1_Nonsense_Mutation_p.S859*	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	859								p.S859*(1)		breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		ACAGGCAGCTCACCTAATGGA	0.323																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											98.0	97.0	97.0					5																	118482538		2201	4299	6500	-	-	-	SO:0001587	stop_gained	0			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.2576C>G	5.37:g.118482538C>G	ENSP00000309690:p.Ser859*			Nonsense_Mutation	SNP	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S859*	ENST00000311085.8	37	c.2576	CCDS4125.1	5	.	.	.	.	.	.	.	.	.	.	C	37	6.450283	0.97577	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	.	.	.	5.3	-0.27	0.12926	.	0.693021	0.15383	N	0.265215	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	-2.5548	5.3755	0.16162	0.1415:0.4259:0.0:0.4326	.	.	.	.	X	859	.	ENSP00000309690:S859X	S	+	2	0	DMXL1	118510437	0.000000	0.05858	0.574000	0.28523	0.958000	0.62258	0.019000	0.13444	0.005000	0.14708	-0.194000	0.12790	TCA	DMXL1	-	superfamily_WD40_repeat_dom	ENSG00000172869		0.323	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMXL1	HGNC	protein_coding	OTTHUMT00000250862.1	176	0.00	0	C	NM_005509		118482538	118482538	+1	no_errors	ENST00000539542	ensembl	human	known	69_37n	nonsense	124	32.61	60	SNP	0.513	G
DMXL1	1657	genome.wustl.edu	37	5	118569138	118569138	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr5:118569138G>C	ENST00000311085.8	+	38	8459	c.8379G>C	c.(8377-8379)atG>atC	p.M2793I	DMXL1_ENST00000505312.1_3'UTR|DMXL1_ENST00000539542.1_Missense_Mutation_p.M2814I	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	2793								p.M2793I(1)		breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		TTACAAGAATGAGATTTAACT	0.338																																						dbGAP											1	Substitution - Missense(1)	breast(1)											90.0	87.0	88.0					5																	118569138		2202	4299	6501	-	-	-	SO:0001583	missense	0			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.8379G>C	5.37:g.118569138G>C	ENSP00000309690:p.Met2793Ile			Missense_Mutation	SNP	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.M2814I	ENST00000311085.8	37	c.8442	CCDS4125.1	5	.	.	.	.	.	.	.	.	.	.	G	10.36	1.328049	0.24080	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	T;T	0.01178	5.22;5.22	5.84	5.84	0.93424	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.043124	0.85682	D	0.000000	T	0.00524	0.0017	N	0.00368	-1.59	0.43617	D	0.995998	B;B	0.09022	0.002;0.001	B;B	0.12156	0.007;0.002	T	0.68546	-0.5380	10	0.19590	T	0.45	-14.4958	13.3588	0.60644	0.0716:0.0:0.9284:0.0	.	2814;2793	F5H269;Q9Y485	.;DMXL1_HUMAN	I	2793;2814	ENSP00000309690:M2793I;ENSP00000439479:M2814I	ENSP00000309690:M2793I	M	+	3	0	DMXL1	118597037	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.871000	0.48459	2.771000	0.95319	0.655000	0.94253	ATG	DMXL1	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000172869		0.338	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMXL1	HGNC	protein_coding	OTTHUMT00000250862.1	184	0.00	0	G	NM_005509		118569138	118569138	+1	no_errors	ENST00000539542	ensembl	human	known	69_37n	missense	125	25.15	42	SNP	1.000	C
DNAH14	127602	genome.wustl.edu	37	1	225334811	225334811	+	Intron	SNP	G	G	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr1:225334811G>T	ENST00000445597.2	+	18	3537				DNAH14_ENST00000430092.1_Silent_p.V1583V|DNAH14_ENST00000439375.2_Silent_p.V1583V			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14						microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.V1583V(1)		NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						AAAAGATAGTGAGAAAATTTT	0.313																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											115.0	94.0	100.0					1																	225334811		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.3537+2481G>T	1.37:g.225334811G>T			A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Silent	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,superfamily_Tautomerase,smart_AAA+_ATPase	p.V1583	ENST00000445597.2	37	c.4749		1																																																																																			DNAH14	-	smart_AAA+_ATPase	ENSG00000185842		0.313	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	DNAH14	HGNC	protein_coding	OTTHUMT00000331217.3	238	0.00	0	G	XM_059166		225334811	225334811	+1	no_errors	ENST00000430092	ensembl	human	known	69_37n	silent	217	12.50	31	SNP	1.000	T
DNAH3	55567	genome.wustl.edu	37	16	21078621	21078621	+	Silent	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr16:21078621C>T	ENST00000261383.3	-	24	3500	c.3501G>A	c.(3499-3501)aaG>aaA	p.K1167K	DNAH3_ENST00000415178.1_Silent_p.K1167K	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1167	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.K1167K(2)		NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		AGAATAGTCTCTTCTTCTCCA	0.448																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											82.0	84.0	83.0					16																	21078621		2201	4300	6501	-	-	-	SO:0001819	synonymous_variant	0			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.3501G>A	16.37:g.21078621C>T			O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Silent	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_Prefoldin,smart_AAA+_ATPase	p.K1167	ENST00000261383.3	37	c.3501	CCDS10594.1	16																																																																																			DNAH3	-	pfam_Dynein_heavy_dom-2	ENSG00000158486		0.448	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	HGNC	protein_coding	OTTHUMT00000207361.1	129	0.00	0	C	NM_017539		21078621	21078621	-1	no_errors	ENST00000261383	ensembl	human	known	69_37n	silent	91	12.50	13	SNP	1.000	T
DNAH6	1768	genome.wustl.edu	37	2	84880876	84880876	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr2:84880876G>A	ENST00000237449.6	+	33	5520	c.5512G>A	c.(5512-5514)Gat>Aat	p.D1838N	DNAH6_ENST00000389394.3_Missense_Mutation_p.D1838N|DNAH6_ENST00000398278.2_Missense_Mutation_p.D1838N			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	1838	AAA 2. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.D1838N(1)		NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						GATCATCAGTGATGGGCCAGT	0.418																																						dbGAP											1	Substitution - Missense(1)	breast(1)											152.0	128.0	135.0					2																	84880876		692	1591	2283	-	-	-	SO:0001583	missense	0			U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.5512G>A	2.37:g.84880876G>A	ENSP00000237449:p.Asp1838Asn		A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.D1838N	ENST00000237449.6	37	c.5512	CCDS46348.1	2	.	.	.	.	.	.	.	.	.	.	G	28.9	4.959486	0.92791	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	T;T;T	0.74947	-0.89;-0.89;-0.89	5.24	5.24	0.73138	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	.	.	.	.	D	0.92208	0.7529	H	0.98721	4.31	0.50813	D	0.999896	D	0.89917	1.0	D	0.97110	1.0	D	0.95356	0.8451	9	0.87932	D	0	.	17.5984	0.88018	0.0:0.0:1.0:0.0	.	1838	Q9C0G6	DYH6_HUMAN	N	1838	ENSP00000374045:D1838N;ENSP00000381326:D1838N;ENSP00000237449:D1838N	ENSP00000237449:D1838N	D	+	1	0	DNAH6	84734387	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.210000	0.95106	2.451000	0.82905	0.544000	0.68410	GAT	DNAH6	-	pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	ENSG00000115423		0.418	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH6	HGNC	protein_coding	OTTHUMT00000328537.2	121	0.00	0	G	NM_001370		84880876	84880876	+1	no_errors	ENST00000237449	ensembl	human	known	69_37n	missense	70	27.08	26	SNP	1.000	A
DNAH9	1770	genome.wustl.edu	37	17	11522991	11522991	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr17:11522991C>G	ENST00000262442.4	+	6	1311	c.1243C>G	c.(1243-1245)Ctc>Gtc	p.L415V	DNAH9_ENST00000454412.2_Missense_Mutation_p.L415V	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	415	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.L415V(1)		NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		AAGGGAGAATCTCCACACTTA	0.463																																						dbGAP											1	Substitution - Missense(1)	breast(1)											150.0	146.0	147.0					17																	11522991		2203	4300	6503	-	-	-	SO:0001583	missense	0			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.1243C>G	17.37:g.11522991C>G	ENSP00000262442:p.Leu415Val		A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.L415V	ENST00000262442.4	37	c.1243	CCDS11160.1	17	.	.	.	.	.	.	.	.	.	.	C	15.74	2.923438	0.52653	.	.	ENSG00000007174	ENST00000262442;ENST00000454412	T;T	0.60548	0.18;0.18	5.98	3.93	0.45458	Dynein heavy chain, domain-1 (1);	0.077400	0.53938	N	0.000056	T	0.52125	0.1715	L	0.55834	1.745	0.80722	D	1	P	0.39737	0.685	B	0.37888	0.26	T	0.46871	-0.9160	10	0.25751	T	0.34	.	14.9816	0.71316	0.2609:0.7391:0.0:0.0	.	415	Q9NYC9	DYH9_HUMAN	V	415	ENSP00000262442:L415V;ENSP00000414874:L415V	ENSP00000262442:L415V	L	+	1	0	DNAH9	11463716	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	5.326000	0.65875	0.813000	0.34350	0.591000	0.81541	CTC	DNAH9	-	pfam_Dynein_heavy_dom-1	ENSG00000007174		0.463	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	HGNC	protein_coding	OTTHUMT00000252756.2	95	0.00	0	C	NM_001372		11522991	11522991	+1	no_errors	ENST00000262442	ensembl	human	known	69_37n	missense	41	32.79	20	SNP	1.000	G
DNMT1	1786	genome.wustl.edu	37	19	10260162	10260162	+	Silent	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr19:10260162G>A	ENST00000340748.4	-	25	2740	c.2505C>T	c.(2503-2505)atC>atT	p.I835I	DNMT1_ENST00000540357.1_Silent_p.I835I|DNMT1_ENST00000359526.4_Silent_p.I851I			P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1	835	BAH 1. {ECO:0000255|PROSITE- ProRule:PRU00370}.				cellular response to amino acid stimulus (GO:0071230)|chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|gene silencing (GO:0016458)|maintenance of DNA methylation (GO:0010216)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methyl-CpG binding (GO:0008327)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.I835I(1)		breast(5)|endometrium(8)|kidney(5)|large_intestine(21)|lung(11)|ovary(2)|pancreas(1)|prostate(10)|skin(5)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)	GGGCTTTGTAGATGACTTTCA	0.562																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											194.0	201.0	198.0					19																	10260162		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X63692	CCDS12228.1, CCDS45958.1	19p13.2	2014-09-17				ENSG00000130816	2.1.1.37		2976	protein-coding gene	gene with protein product		126375		DNMT		1594447	Standard	NM_001379		Approved	MCMT, CXXC9	uc010xlc.2	P26358		ENST00000340748.4:c.2505C>T	19.37:g.10260162G>A			A0AV63|B7ZLW6|Q9UHG5|Q9ULA2|Q9UMZ6	Silent	SNP	pirsf_DNA_C5-MeTrfase_1_euk,pfam_C5_MeTfrase,pfam_BAH_dom,pfam_Cytosine_MeTrfase1_RFD,pfam_DMAP1-bd,pfam_Znf_CXXC,smart_BAH_dom,prints_C5_MeTfrase,pfscan_BAH_dom,pfscan_Znf_CXXC	p.I851	ENST00000340748.4	37	c.2553	CCDS12228.1	19																																																																																			DNMT1	-	pirsf_DNA_C5-MeTrfase_1_euk,pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	ENSG00000130816		0.562	DNMT1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	DNMT1	HGNC	protein_coding	OTTHUMT00000451166.1	58	0.00	0	G	NM_001379		10260162	10260162	-1	no_errors	ENST00000359526	ensembl	human	known	69_37n	silent	56	13.85	9	SNP	0.026	A
DRG1	4733	genome.wustl.edu	37	22	31822619	31822619	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr22:31822619C>G	ENST00000331457.4	+	7	893	c.732C>G	c.(730-732)atC>atG	p.I244M		NM_004147.3	NP_004138.1	Q9Y295	DRG1_HUMAN	developmentally regulated GTP binding protein 1	244	OBG-type G. {ECO:0000255|PROSITE- ProRule:PRU01047}.				multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|polysome (GO:0005844)	GTP binding (GO:0005525)|identical protein binding (GO:0042802)|transcription factor binding (GO:0008134)	p.I244M(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|urinary_tract(1)	11						TCCCCTGTATCTATGTGTTAA	0.423																																						dbGAP											1	Substitution - Missense(1)	breast(1)											151.0	143.0	146.0					22																	31822619		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ005940	CCDS13897.1	22q12.2	2010-02-26	2001-11-28		ENSG00000185721	ENSG00000185721			3029	protein-coding gene	gene with protein product		603952	"""developmentally regulated GTP-binding protein 1"""	NEDD3		7929244, 1449490	Standard	NM_004147		Approved		uc003aku.3	Q9Y295	OTTHUMG00000030792	ENST00000331457.4:c.732C>G	22.37:g.31822619C>G	ENSP00000329715:p.Ile244Met		B2RDS8|Q6FGP8|Q8WW69|Q9UGF2	Missense_Mutation	SNP	pfam_TGS,pfam_GTP_binding_domain,pfam_Fe2_transport_prot_B_N,superfamily_TGS-like,prints_GTP_binding_domain,tigrfam_Small_GTP-bd_dom	p.I244M	ENST00000331457.4	37	c.732	CCDS13897.1	22	.	.	.	.	.	.	.	.	.	.	C	15.69	2.906955	0.52333	.	.	ENSG00000185721	ENST00000331457	T	0.22539	1.95	5.8	0.321	0.15883	.	0.000000	0.85682	D	0.000000	T	0.33294	0.0858	M	0.78223	2.4	0.58432	D	0.999999	P	0.42584	0.784	P	0.50708	0.648	T	0.13818	-1.0495	10	0.72032	D	0.01	-13.7565	8.9613	0.35849	0.0:0.5399:0.0:0.4601	.	244	Q9Y295	DRG1_HUMAN	M	244	ENSP00000329715:I244M	ENSP00000329715:I244M	I	+	3	3	DRG1	30152619	0.993000	0.37304	0.999000	0.59377	0.987000	0.75469	0.269000	0.18589	0.113000	0.18004	-0.142000	0.14014	ATC	DRG1	-	NULL	ENSG00000185721		0.423	DRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DRG1	HGNC	protein_coding	OTTHUMT00000075680.5	324	0.00	0	C	NM_004147		31822619	31822619	+1	no_errors	ENST00000331457	ensembl	human	known	69_37n	missense	247	18.75	57	SNP	0.998	G
EIF3E	3646	genome.wustl.edu	37	8	109215698	109215698	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr8:109215698C>T	ENST00000220849.5	-	11	1158	c.1096G>A	c.(1096-1098)Gaa>Aaa	p.E366K	EIF3E_ENST00000519030.1_Missense_Mutation_p.E273K|EIF3E_ENST00000519517.1_Intron	NM_001568.2	NP_001559.1			eukaryotic translation initiation factor 3, subunit E									p.E366K(1)	EIF3E/RSPO2(6)	NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(57;6.84e-10)			CTTTCAGCTTCTTCTGGAGTC	0.323																																					GBM(15;360 410 8460 34179 52246)	dbGAP											1	Substitution - Missense(1)	breast(1)											143.0	136.0	138.0					8																	109215698		2203	4300	6503	-	-	-	SO:0001583	missense	0			U94175	CCDS6308.1	8q22-q23	2010-03-10	2007-07-27	2007-07-27	ENSG00000104408	ENSG00000104408			3277	protein-coding gene	gene with protein product		602210	"""eukaryotic translation initiation factor 3, subunit 6 48kDa"""	INT6, EIF3S6		9403073, 9295280	Standard	NM_001568		Approved	eIF3-p48, eIF3e	uc003ymu.3	P60228	OTTHUMG00000164858	ENST00000220849.5:c.1096G>A	8.37:g.109215698C>T	ENSP00000220849:p.Glu366Lys			Missense_Mutation	SNP	pfam_eIF3_su6_N,pfam_PCI_dom,smart_PCI_dom,pirsf_Transl_init_fac_3_su6_euk	p.E366K	ENST00000220849.5	37	c.1096	CCDS6308.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.433472|5.433472	0.96150|0.96150	.|.	.|.	ENSG00000104408|ENSG00000104408	ENST00000220849;ENST00000519030|ENST00000522352	T;T|.	0.35789|.	1.29;1.29|.	5.7|5.7	5.7|5.7	0.88788|0.88788	Winged helix-turn-helix transcription repressor DNA-binding (1);Proteasome component (PCI) domain (2);|.	0.045022|.	0.85682|.	D|.	0.000000|.	T|T	0.76772|0.76772	0.4034|0.4034	M|M	0.72894|0.72894	2.215|2.215	0.80722|0.80722	D|D	1|1	B|.	0.27286|.	0.174|.	B|.	0.41174|.	0.349|.	T|T	0.74856|0.74856	-0.3522|-0.3522	10|5	0.54805|.	T|.	0.06|.	-22.1408|-22.1408	19.8276|19.8276	0.96624|0.96624	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	366|.	P60228|.	EIF3E_HUMAN|.	K|K	366;273|76	ENSP00000220849:E366K;ENSP00000428796:E273K|.	ENSP00000220849:E366K|.	E|R	-|-	1|2	0|0	EIF3E|EIF3E	109284874|109284874	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.818000|7.818000	0.86416|0.86416	2.697000|2.697000	0.92050|0.92050	0.585000|0.585000	0.79938|0.79938	GAA|AGA	EIF3E	-	pfam_PCI_dom,smart_PCI_dom,pirsf_Transl_init_fac_3_su6_euk	ENSG00000104408		0.323	EIF3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF3E	HGNC	protein_coding	OTTHUMT00000380612.2	332	0.00	0	C	NM_001568		109215698	109215698	-1	no_errors	ENST00000220849	ensembl	human	known	69_37n	missense	271	17.63	58	SNP	1.000	T
ERC2	26059	genome.wustl.edu	37	3	56173584	56173584	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr3:56173584C>G	ENST00000288221.6	-	6	1681	c.1426G>C	c.(1426-1428)Gag>Cag	p.E476Q		NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2	476						cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)		p.E476Q(2)		breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		GTAAGTGACTCTTTGAGCACT	0.418																																						dbGAP											2	Substitution - Missense(2)	breast(2)											148.0	131.0	136.0					3																	56173584		1917	4153	6070	-	-	-	SO:0001583	missense	0			AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.1426G>C	3.37:g.56173584C>G	ENSP00000288221:p.Glu476Gln		Q2T9F6|Q86TK4	Missense_Mutation	SNP	pfam_CAZ_cplx_RIM-bd_prot,superfamily_Prefoldin	p.E476Q	ENST00000288221.6	37	c.1426	CCDS46851.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.2|29.2	4.989829|4.989829	0.93106|0.93106	.|.	.|.	ENSG00000187672|ENSG00000187672	ENST00000288221|ENST00000492584	T|T	0.48836|0.78126	0.8|-1.15	5.99|5.99	5.99|5.99	0.97316|0.97316	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.89217|0.89217	0.6652|0.6652	M|M	0.83223|0.83223	2.63|2.63	0.58432|0.58432	D|D	0.999997|0.999997	D|.	0.62365|.	0.991|.	D|.	0.74023|.	0.982|.	D|D	0.89561|0.89561	0.3806|0.3806	10|7	0.72032|0.87932	D|D	0.01|0	-19.1254|-19.1254	20.4777|20.4777	0.99188|0.99188	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	476|.	O15083|.	ERC2_HUMAN|.	Q|N	476|114	ENSP00000288221:E476Q|ENSP00000417280:K114N	ENSP00000288221:E476Q|ENSP00000417280:K114N	E|K	-|-	1|3	0|2	ERC2|ERC2	56148624|56148624	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.970000|0.970000	0.65996|0.65996	7.818000|7.818000	0.86416|0.86416	2.840000|2.840000	0.97914|0.97914	0.655000|0.655000	0.94253|0.94253	GAG|AAG	ERC2	-	pfam_CAZ_cplx_RIM-bd_prot,superfamily_Prefoldin	ENSG00000187672		0.418	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERC2	HGNC	protein_coding	OTTHUMT00000350884.2	203	0.00	0	C	NM_015576		56173584	56173584	-1	no_errors	ENST00000288221	ensembl	human	known	69_37n	missense	190	11.63	25	SNP	1.000	G
ESYT1	23344	genome.wustl.edu	37	12	56522358	56522358	+	Silent	SNP	C	C	T	rs80169445		TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr12:56522358C>T	ENST00000394048.5	+	1	519	c.255C>T	c.(253-255)ctC>ctT	p.L85L	ESYT1_ENST00000267113.4_Silent_p.L85L|ESYT1_ENST00000541590.1_Silent_p.L85L|RP11-603J24.5_ENST00000549438.1_RNA|RP11-603J24.5_ENST00000550947.1_RNA	NM_001184796.1|NM_015292.2	NP_001171725.1|NP_056107.1	Q9BSJ8	ESYT1_HUMAN	extended synaptotagmin-like protein 1	85					lipid transport (GO:0006869)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)	p.L85L(1)		breast(2)|endometrium(2)|large_intestine(4)|lung(10)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	28						TCTTCGGCCTCGCCCTCTACC	0.632													C|||	1	0.000199681	0.0	0.0	5008	,	,		16444	0.001		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - coding silent(1)	lung(1)											120.0	115.0	116.0					12																	56522358		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK074368	CCDS8904.1, CCDS53801.1	12q13.2	2014-07-02	2009-06-23	2009-06-23		ENSG00000139641		"""Synaptotagmins"""	29534	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member A"""	FAM62A		9872452, 10350628, 17672888	Standard	NM_015292		Approved	MBC2, KIAA0747	uc001sjr.3	Q9BSJ8		ENST00000394048.5:c.255C>T	12.37:g.56522358C>T			A0FGR7|A8K2S2|O94848|Q6PJN4|Q9H6J1|Q9H6W2|Q9Y416	Silent	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,prints_C2_dom,pfscan_C2_membr_targeting	p.L85	ENST00000394048.5	37	c.255	CCDS8904.1	12																																																																																			ESYT1	-	NULL	ENSG00000139641		0.632	ESYT1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ESYT1	HGNC	protein_coding	OTTHUMT00000407906.1	83	0.00	0	C	NM_015292		56522358	56522358	+1	no_errors	ENST00000267113	ensembl	human	known	69_37n	silent	51	13.56	8	SNP	1.000	T
ETF1	2107	genome.wustl.edu	37	5	137846256	137846256	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr5:137846256C>G	ENST00000360541.5	-	9	1302	c.1081G>C	c.(1081-1083)Gag>Cag	p.E361Q	ETF1_ENST00000503014.1_Missense_Mutation_p.E347Q|ETF1_ENST00000499810.2_Missense_Mutation_p.E328Q	NM_004730.3	NP_004721.1	P62495	ERF1_HUMAN	eukaryotic translation termination factor 1	361					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein methylation (GO:0006479)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational termination (GO:0006415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|RNA binding (GO:0003723)|translation release factor activity (GO:0003747)|translation release factor activity, codon specific (GO:0016149)|translation termination factor activity (GO:0008079)	p.E361Q(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)|urinary_tract(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TCACATACCTCTTTGTCTGTG	0.398																																						dbGAP											1	Substitution - Missense(1)	breast(1)											144.0	131.0	135.0					5																	137846256		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF095901	CCDS4207.1, CCDS75313.1, CCDS75314.1	5q31.2	2008-02-05			ENSG00000120705	ENSG00000120705			3477	protein-coding gene	gene with protein product	"""sup45 (yeast omnipotent suppressor 45) homolog-like 1"", ""polypeptide chain release factor 1"""	600285		SUP45L1, ERF1, ERF		1546371, 7990965	Standard	NM_004730		Approved	eRF1, TB3-1, RF1	uc003ldc.5	P62495	OTTHUMG00000129199	ENST00000360541.5:c.1081G>C	5.37:g.137846256C>G	ENSP00000353741:p.Glu361Gln		B2R6B4|D3DQC1|P46055|Q5M7Z7|Q96CG1	Missense_Mutation	SNP	pfam_eRF1_2,pfam_eRF1_3,pfam_eRF1_1_Pelota,superfamily_Release_factor_eRF1/aRF1_N,tigrfam_Peptide_chain-rel_eRF1/aRF1	p.E361Q	ENST00000360541.5	37	c.1081	CCDS4207.1	5	.	.	.	.	.	.	.	.	.	.	C	18.28	3.590096	0.66105	.	.	ENSG00000120705	ENST00000499810;ENST00000360541;ENST00000503014	.	.	.	5.93	5.06	0.68205	eRF1 domain 3 (1);	0.000000	0.85682	D	0.000000	T	0.80391	0.4614	M	0.90019	3.08	0.80722	D	1	B;B	0.31054	0.112;0.306	B;B	0.43701	0.428;0.324	T	0.81302	-0.0994	9	0.49607	T	0.09	-8.1678	16.7575	0.85503	0.0:0.8706:0.1294:0.0	.	347;361	B7Z7P8;P62495	.;ERF1_HUMAN	Q	328;361;347	.	ENSP00000353741:E361Q	E	-	1	0	ETF1	137874155	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.471000	0.80985	1.480000	0.48289	0.655000	0.94253	GAG	ETF1	-	pfam_eRF1_3,tigrfam_Peptide_chain-rel_eRF1/aRF1	ENSG00000120705		0.398	ETF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETF1	HGNC	protein_coding	OTTHUMT00000251276.2	210	0.00	0	C	NM_004730		137846256	137846256	-1	no_errors	ENST00000360541	ensembl	human	known	69_37n	missense	166	16.16	32	SNP	1.000	G
ETV3	2117	genome.wustl.edu	37	1	157106111	157106111	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr1:157106111C>T	ENST00000368192.4	-	2	98	c.34G>A	c.(34-36)Gaa>Aaa	p.E12K	ETV3_ENST00000326786.4_Missense_Mutation_p.E12K|ETV3_ENST00000460850.1_5'UTR	NM_001145312.1	NP_001138784.1	P41162	ETV3_HUMAN	ets variant 3	12					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.E12K(2)		breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|prostate(2)	9	Hepatocellular(266;0.158)	Prostate(1639;0.174)				CCACCTCCTTCTGGCTTTTCC	0.468																																						dbGAP											2	Substitution - Missense(2)	breast(2)											317.0	282.0	294.0					1																	157106111		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC022868	CCDS1164.1, CCDS44250.1	1q21-q23	2008-09-12	2008-09-12		ENSG00000117036	ENSG00000117036			3492	protein-coding gene	gene with protein product		164873	"""ets variant gene 3, ETS family transcriptional repressor"", ""ets variant gene 3"""			8020980	Standard	NM_005240		Approved	PE-1	uc001fqr.2	P41162	OTTHUMG00000034298	ENST00000368192.4:c.34G>A	1.37:g.157106111C>T	ENSP00000357175:p.Glu12Lys		B4E3M7|Q8TAC8|Q9BX30	Missense_Mutation	SNP	pfam_Ets,smart_Ets,pfscan_Ets,prints_Ets	p.E12K	ENST00000368192.4	37	c.34	CCDS44250.1	1	.	.	.	.	.	.	.	.	.	.	C	10.70	1.424937	0.25639	.	.	ENSG00000117036	ENST00000368192;ENST00000326786	T;T	0.17691	2.49;2.26	5.1	5.1	0.69264	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.405904	0.23606	N	0.046387	T	0.02688	0.0081	N	0.03608	-0.345	0.43191	D	0.995025	B;B	0.18310	0.0;0.027	B;B	0.12837	0.0;0.008	T	0.42832	-0.9428	10	0.17369	T	0.5	.	10.9469	0.47306	0.0:0.9138:0.0:0.0862	.	12;12	P41162-2;P41162	.;ETV3_HUMAN	K	12	ENSP00000357175:E12K;ENSP00000327316:E12K	ENSP00000327316:E12K	E	-	1	0	ETV3	155372735	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.088000	0.50175	2.658000	0.90341	0.650000	0.86243	GAA	ETV3	-	NULL	ENSG00000117036		0.468	ETV3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ETV3	HGNC	protein_coding	OTTHUMT00000082843.2	169	0.00	0	C	NM_005240		157106111	157106111	-1	no_errors	ENST00000368192	ensembl	human	known	69_37n	missense	156	14.75	27	SNP	1.000	T
EVPL	2125	genome.wustl.edu	37	17	74004251	74004251	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr17:74004251C>G	ENST00000301607.3	-	22	5288	c.5035G>C	c.(5035-5037)Gag>Cag	p.E1679Q	EVPL_ENST00000586740.1_Missense_Mutation_p.E1701Q|TEN1-CDK3_ENST00000567351.1_RNA	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	1679	Globular 2.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)	p.E1679Q(1)		breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						AGGTTGGTCTCTCGCGTCTGG	0.627																																						dbGAP											1	Substitution - Missense(1)	breast(1)											86.0	74.0	78.0					17																	74004251		2203	4300	6503	-	-	-	SO:0001583	missense	0			U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.5035G>C	17.37:g.74004251C>G	ENSP00000301607:p.Glu1679Gln		A0AUV5	Missense_Mutation	SNP	pfam_Plectin_repeat,superfamily_Ferritin/RR-like,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.E1679Q	ENST00000301607.3	37	c.5035	CCDS11737.1	17	.	.	.	.	.	.	.	.	.	.	C	18.71	3.681218	0.68042	.	.	ENSG00000167880	ENST00000301607	T	0.68624	-0.34	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.81692	0.4876	M	0.71581	2.175	0.53688	D	0.999972	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	D	0.83892	0.0285	10	0.72032	D	0.01	-40.5097	18.3996	0.90511	0.0:1.0:0.0:0.0	.	1701;1679	B7ZLH8;Q92817	.;EVPL_HUMAN	Q	1679	ENSP00000301607:E1679Q	ENSP00000301607:E1679Q	E	-	1	0	EVPL	71515846	1.000000	0.71417	0.945000	0.38365	0.986000	0.74619	7.487000	0.81328	2.343000	0.79666	0.561000	0.74099	GAG	EVPL	-	smart_Plectin_repeat	ENSG00000167880		0.627	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVPL	HGNC	protein_coding	OTTHUMT00000449483.1	23	0.00	0	C	NM_001988		74004251	74004251	-1	no_errors	ENST00000301607	ensembl	human	known	69_37n	missense	10	33.33	5	SNP	1.000	G
EXO1	9156	genome.wustl.edu	37	1	242042051	242042052	+	Splice_Site	INS	-	-	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr1:242042051_242042052insT	ENST00000366548.3	+	13	2108_2109	c.1515_1516insT	c.(1516-1518)ttt>Tttt	p.F506fs	EXO1_ENST00000518483.1_Splice_Site_p.F506fs|EXO1_ENST00000348581.5_Splice_Site_p.F506fs	NM_130398.3	NP_569082.2	Q9UQ84	EXO1_HUMAN	exonuclease 1	506					DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|isotype switching (GO:0045190)|meiotic nuclear division (GO:0007126)|mismatch repair (GO:0006298)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	5'-3' exodeoxyribonuclease activity (GO:0035312)|5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|double-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0051908)|exonuclease activity (GO:0004527)|flap endonuclease activity (GO:0048256)|metal ion binding (GO:0046872)|RNA-DNA hybrid ribonuclease activity (GO:0004523)|single-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0045145)|structure-specific DNA binding (GO:0043566)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(3)|lung(29)|ovary(2)|skin(1)|stomach(2)|urinary_tract(2)	45	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)			TTTTTATTAGGTTTTTTTGCAG	0.337								Editing and processing nucleases																														dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0			AF042282	CCDS1620.1, CCDS44336.1	1q42-q43	2008-07-18			ENSG00000174371	ENSG00000174371			3511	protein-coding gene	gene with protein product	"""rad2 nuclease family member, homolog of S. cerevisiae exonuclease 1"""	606063				9685493, 9788596	Standard	NM_003686		Approved	HEX1, hExoI	uc001hzh.3	Q9UQ84	OTTHUMG00000039965	ENST00000366548.3:c.1515-1->T	1.37:g.242042058_242042058dupT			O60545|O75214|O75466|Q5T396|Q96IJ1|Q9UG38|Q9UNW0	Frame_Shift_Ins	INS	pfam_XPG/RAD2_endonuclease,pfam_XPG_DNA_repair_N,superfamily_5-3_exonuclease_C,smart_XPG_DNA_repair_N,smart_XPG/RAD2_endonuclease,smart_HhH2,prints_XPGC_Rad_DNA_repair	p.C507fs	ENST00000366548.3	37	c.1515_1516	CCDS1620.1	1																																																																																			EXO1	-	NULL	ENSG00000174371		0.337	EXO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EXO1	HGNC	protein_coding	OTTHUMT00000096405.1	180	0.00	0	-	NM_006027	Frame_Shift_Ins	242042051	242042052	+1	no_errors	ENST00000348581	ensembl	human	known	69_37n	frame_shift_ins	191	16.96	39	INS	1.000:1.000	T
EZH2	2146	genome.wustl.edu	37	7	148508733	148508733	+	Nonsense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr7:148508733G>C	ENST00000460911.1	-	16	2004	c.1916C>G	c.(1915-1917)tCa>tGa	p.S639*	EZH2_ENST00000478654.1_Nonsense_Mutation_p.S588*|EZH2_ENST00000483967.1_Nonsense_Mutation_p.S630*|EZH2_ENST00000476773.1_Nonsense_Mutation_p.S588*|EZH2_ENST00000320356.2_Nonsense_Mutation_p.S644*|EZH2_ENST00000541220.1_Nonsense_Mutation_p.S588*|EZH2_ENST00000350995.2_Nonsense_Mutation_p.S600*			Q15910	EZH2_HUMAN	enhancer of zeste 2 polycomb repressive complex 2 subunit	639	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				cellular response to hydrogen peroxide (GO:0070301)|cerebellar cortex development (GO:0021695)|chromatin organization (GO:0006325)|DNA methylation (GO:0006306)|G1 to G0 transition (GO:0070314)|histone H3-K27 methylation (GO:0070734)|negative regulation of epidermal cell differentiation (GO:0045605)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|protein localization to chromatin (GO:0071168)|regulation of cell proliferation (GO:0042127)|regulation of circadian rhythm (GO:0042752)|regulation of gliogenesis (GO:0014013)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)	p.S644*(1)|p.S600*(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(313)|kidney(3)|large_intestine(8)|liver(1)|lung(23)|parathyroid(2)|skin(3)|upper_aerodigestive_tract(3)	359	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00239)			ACAGTATTCTGAGATGAATTC	0.373			Mis		DLBCL																																	dbGAP		Rec?	yes		7	7q35-q36	2146	enhancer of zeste homolog 2		L	2	Substitution - Nonsense(2)	breast(2)											95.0	89.0	91.0					7																	148508733		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS5891.1, CCDS5892.1, CCDS56516.1, CCDS56517.1, CCDS56518.1	7q35-q36	2014-09-17	2014-05-28		ENSG00000106462	ENSG00000106462		"""Chromatin-modifying enzymes / K-methyltransferases"""	3527	protein-coding gene	gene with protein product		601573	"""enhancer of zeste (Drosophila) homolog 2"", ""enhancer of zeste homolog 2 (Drosophila)"""			8954776, 17172412	Standard	NM_152998		Approved	EZH1, ENX-1, KMT6, KMT6A	uc003wfb.2	Q15910	OTTHUMG00000158973	ENST00000460911.1:c.1916C>G	7.37:g.148508733G>C	ENSP00000419711:p.Ser639*		B2RAQ1|B3KS30|B7Z1D6|B7Z7L6|Q15755|Q75MG3|Q92857|Q96FI6	Nonsense_Mutation	SNP	pfam_SET_dom,pfam_EZH2_WD-Binding,superfamily_Homeodomain-like,smart_SANT/Myb,smart_SET_dom,pfscan_SET_dom	p.S644*	ENST00000460911.1	37	c.1931	CCDS56516.1	7	.	.	.	.	.	.	.	.	.	.	g	41	8.948334	0.99014	.	.	ENSG00000106462	ENST00000478654;ENST00000320356;ENST00000460911;ENST00000350995;ENST00000541220;ENST00000476773;ENST00000483967	.	.	.	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	19.7096	0.96089	0.0:0.0:1.0:0.0	.	.	.	.	X	588;644;639;600;588;588;630	.	ENSP00000320147:S644X	S	-	2	0	EZH2	148139666	1.000000	0.71417	0.991000	0.47740	0.999000	0.98932	9.553000	0.98118	2.652000	0.90054	0.655000	0.94253	TCA	EZH2	-	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	ENSG00000106462		0.373	EZH2-008	KNOWN	basic|appris_candidate|CCDS	protein_coding	EZH2	HGNC	protein_coding	OTTHUMT00000352744.1	207	0.00	0	G	NM_004456		148508733	148508733	-1	no_errors	ENST00000320356	ensembl	human	known	69_37n	nonsense	111	23.97	35	SNP	1.000	C
DENND6A	201627	genome.wustl.edu	37	3	57632137	57632137	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr3:57632137G>A	ENST00000311128.5	-	10	917	c.847C>T	c.(847-849)Cag>Tag	p.Q283*	RP11-755B10.2_ENST00000470427.1_RNA	NM_152678.2	NP_689891.1	Q8IWF6	DEN6A_HUMAN	DENN/MADD domain containing 6A	283					positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of Rab GTPase activity (GO:0032851)	cytoplasm (GO:0005737)|recycling endosome (GO:0055037)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.Q283*(1)									CAGAGCATCTGACTATGAAGG	0.438																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											68.0	64.0	66.0					3																	57632137		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK074156	CCDS33773.1	3p14.3	2013-10-11	2012-10-03	2012-10-03	ENSG00000174839	ENSG00000174839		"""DENN/MADD domain containing"""	26635	protein-coding gene	gene with protein product			"""family with sequence similarity 116, member A"""	FAM116A		21330364	Standard	NM_152678		Approved	FLJ34969, AFI1A	uc003dja.3	Q8IWF6	OTTHUMG00000158639	ENST00000311128.5:c.847C>T	3.37:g.57632137G>A	ENSP00000311401:p.Gln283*		Q7Z5T4|Q8N235|Q8TEG8	Nonsense_Mutation	SNP	pfam_Afi1_N,pfam_Secretory_pathway_prot_Avl9,pfam_DENN_dom	p.Q283*	ENST00000311128.5	37	c.847	CCDS33773.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.1|29.1	4.973417|4.973417	0.92919|0.92919	.|.	.|.	ENSG00000174839|ENSG00000174839	ENST00000311128|ENST00000477344	.|.	.|.	.|.	6.01|6.01	6.01|6.01	0.97437|0.97437	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.50326	.|0.1609	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.38200	.|-0.9672	.|4	0.30078|0.02654	T|T	0.28|1	-19.9441|-19.9441	20.5141|20.5141	0.99211|0.99211	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|L	283|51	.|.	ENSP00000311401:Q283X|ENSP00000419334:S51L	Q|S	-|-	1|2	0|0	FAM116A|FAM116A	57607177|57607177	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	8.959000|8.959000	0.93110|0.93110	2.850000|2.850000	0.98022|0.98022	0.655000|0.655000	0.94253|0.94253	CAG|TCA	FAM116A	-	pfam_Afi1_N,pfam_DENN_dom	ENSG00000174839		0.438	DENND6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM116A	HGNC	protein_coding	OTTHUMT00000351594.1	66	0.00	0	G	NM_152678		57632137	57632137	-1	no_errors	ENST00000311128	ensembl	human	known	69_37n	nonsense	47	14.55	8	SNP	1.000	A
FAM155A	728215	genome.wustl.edu	37	13	108518200	108518200	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr13:108518200C>T	ENST00000375915.2	-	1	883	c.745G>A	c.(745-747)Gat>Aat	p.D249N		NM_001080396.2	NP_001073865.1	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	249						integral component of membrane (GO:0016021)		p.D249N(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						AGCACCACATCCAGACTGCAG	0.498																																						dbGAP											1	Substitution - Missense(1)	breast(1)											138.0	126.0	130.0					13																	108518200		2203	4300	6503	-	-	-	SO:0001583	missense	0			L10374	CCDS32006.1	13q33.3	2008-04-15			ENSG00000204442	ENSG00000204442			33877	protein-coding gene	gene with protein product							Standard	NM_001080396		Approved		uc001vql.3	B1AL88	OTTHUMG00000017326	ENST00000375915.2:c.745G>A	13.37:g.108518200C>T	ENSP00000365080:p.Asp249Asn		B2RUV1|B7Z334	Missense_Mutation	SNP	NULL	p.D249N	ENST00000375915.2	37	c.745	CCDS32006.1	13	.	.	.	.	.	.	.	.	.	.	C	18.71	3.681564	0.68042	.	.	ENSG00000204442	ENST00000375915	T	0.14266	2.52	5.9	5.9	0.94986	.	0.117723	0.53938	D	0.000046	T	0.33469	0.0864	L	0.46157	1.445	0.52501	D	0.999953	D	0.76494	0.999	D	0.74674	0.984	T	0.00516	-1.1694	10	0.66056	D	0.02	.	19.2604	0.93966	0.0:1.0:0.0:0.0	.	249	B1AL88	F155A_HUMAN	N	249	ENSP00000365080:D249N	ENSP00000365080:D249N	D	-	1	0	FAM155A	107316201	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.435000	0.80391	2.793000	0.96121	0.563000	0.77884	GAT	FAM155A	-	NULL	ENSG00000204442		0.498	FAM155A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM155A	HGNC	protein_coding	OTTHUMT00000045736.2	53	0.00	0	C	NM_001080396		108518200	108518200	-1	no_errors	ENST00000375915	ensembl	human	known	69_37n	missense	33	15.38	6	SNP	1.000	T
FAM214A	56204	genome.wustl.edu	37	15	52901363	52901363	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr15:52901363C>G	ENST00000261844.7	-	6	1900	c.1748G>C	c.(1747-1749)aGa>aCa	p.R583T	FAM214A_ENST00000546305.2_Missense_Mutation_p.R590T	NM_019600.2	NP_062546.2	Q32MH5	F214A_HUMAN	family with sequence similarity 214, member A	583								p.R583T(1)									ACACTGATTTCTTGTTTGATG	0.313																																						dbGAP											1	Substitution - Missense(1)	breast(1)											66.0	65.0	65.0					15																	52901363		1814	4071	5885	-	-	-	SO:0001583	missense	0			AB037791	CCDS45263.1, CCDS66773.1	15q21.2-q21.3	2011-12-01	2011-12-01	2011-12-01	ENSG00000047346	ENSG00000047346			25609	protein-coding gene	gene with protein product			"""KIAA1370"""	KIAA1370		10718198	Standard	XM_005254547		Approved	FLJ10980	uc002acg.4	Q32MH5		ENST00000261844.7:c.1748G>C	15.37:g.52901363C>G	ENSP00000261844:p.Arg583Thr		A8KA52|B4DEP5|B4DF40|F5H8G0|Q32MH6|Q4G0R7|Q5XJ16|Q6PDA3|Q9NV24|Q9P2H7	Missense_Mutation	SNP	NULL	p.R583T	ENST00000261844.7	37	c.1748	CCDS45263.1	15	.	.	.	.	.	.	.	.	.	.	C	13.73	2.323129	0.41096	.	.	ENSG00000047346	ENST00000261844;ENST00000399202;ENST00000534964;ENST00000546305	T;T	0.34275	1.38;1.37	5.68	5.68	0.88126	.	0.435447	0.28104	N	0.016592	T	0.30293	0.0760	N	0.08118	0	0.38122	D	0.937892	P;P	0.43662	0.814;0.717	P;B	0.45558	0.485;0.291	T	0.37526	-0.9702	10	0.72032	D	0.01	.	19.7923	0.96464	0.0:1.0:0.0:0.0	.	590;583	F5H8G0;Q32MH5	.;K1370_HUMAN	T	583;583;582;590	ENSP00000261844:R583T;ENSP00000443598:R590T	ENSP00000261844:R583T	R	-	2	0	KIAA1370	50688655	0.993000	0.37304	0.493000	0.27502	0.942000	0.58702	1.285000	0.33261	2.693000	0.91896	0.655000	0.94253	AGA	FAM214A	-	NULL	ENSG00000047346		0.313	FAM214A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM214A	HGNC	protein_coding	OTTHUMT00000419914.1	105	0.00	0	C	NM_019600		52901363	52901363	-1	no_errors	ENST00000261844	ensembl	human	known	69_37n	missense	117	15.83	22	SNP	1.000	G
FBXO21	23014	genome.wustl.edu	37	12	117603392	117603392	+	Silent	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr12:117603392C>T	ENST00000330622.5	-	9	1223	c.1224G>A	c.(1222-1224)ctG>ctA	p.L408L	FBXO21_ENST00000427718.2_Silent_p.L408L			O94952	FBX21_HUMAN	F-box protein 21	408					protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	ubiquitin ligase complex (GO:0000151)	DNA binding (GO:0003677)|ubiquitin-protein transferase activity (GO:0004842)	p.L408L(1)		breast(4)|endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|pancreas(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	29	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0291)		GCGAGTCTCTCAGGAGCTGGT	0.507																																					GBM(168;452 2038 13535 17701 43680)	dbGAP											1	Substitution - coding silent(1)	breast(1)											112.0	103.0	106.0					12																	117603392		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB020682	CCDS9184.1, CCDS44989.1	12q24.23	2004-06-15	2004-06-15					"""F-boxes /  ""other"""""	13592	protein-coding gene	gene with protein product		609095	"""F-box only protein 21"""			10048485, 10531035	Standard	NM_033624		Approved	FBX21, KIAA0875	uc001twk.3	O94952	OTTHUMG00000169495	ENST00000330622.5:c.1224G>A	12.37:g.117603392C>T			B3KMF0|Q5BJG0|Q9H087	Missense_Mutation	SNP	pfam_Hemimethylated_DNA-bd_dom,superfamily_Hemimethylated_DNA-bd_dom,tigrfam_Hemimethylated_DNA-bd_dom	p.E292K	ENST00000330622.5	37	c.874	CCDS9184.1	12	.	.	.	.	.	.	.	.	.	.	C	9.492	1.100977	0.20552	.	.	ENSG00000135108	ENST00000550180	.	.	.	6.08	0.272	0.15645	.	.	.	.	.	T	0.56046	0.1959	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49409	-0.8943	4	.	.	.	-16.7364	9.28	0.37722	0.0:0.4113:0.4149:0.1738	.	.	.	.	K	292	.	.	E	-	1	0	FBXO21	116087775	0.998000	0.40836	0.870000	0.34147	0.927000	0.56198	0.598000	0.24074	0.113000	0.18004	-0.137000	0.14449	GAG	FBXO21	-	NULL	ENSG00000135108		0.507	FBXO21-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FBXO21	HGNC	protein_coding	OTTHUMT00000404409.1	74	0.00	0	C	NM_033624		117603392	117603392	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000550180	ensembl	human	novel	69_37n	missense	39	27.78	15	SNP	0.872	T
FBXO3	26273	genome.wustl.edu	37	11	33790504	33790504	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr11:33790504G>C	ENST00000265651.3	-	3	269	c.251C>G	c.(250-252)tCt>tGt	p.S84C	FBXO3_ENST00000534136.1_Missense_Mutation_p.S84C|FBXO3_ENST00000530401.1_Missense_Mutation_p.S79C|FBXO3_ENST00000526785.1_5'UTR|FBXO3_ENST00000533103.1_5'UTR|FBXO3_ENST00000448981.2_Missense_Mutation_p.S84C	NM_012175.3	NP_036307.2	Q9UK99	FBX3_HUMAN	F-box protein 3	84					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin-protein transferase activity (GO:0004842)	p.S84C(1)		NS(1)|breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|pancreas(1)|stomach(1)	13		Lung NSC(402;0.0804)		BRCA - Breast invasive adenocarcinoma(625;0.00315)|Lung(977;0.00488)|LUSC - Lung squamous cell carcinoma(625;0.008)		TCCTACATCAGAGTAAGTATC	0.343																																						dbGAP											1	Substitution - Missense(1)	breast(1)											189.0	184.0	186.0					11																	33790504		2202	4298	6500	-	-	-	SO:0001583	missense	0			AK001943	CCDS7887.1, CCDS44566.1	11p13	2006-07-07	2004-06-15		ENSG00000110429	ENSG00000110429		"""F-boxes /  ""other"""""	13582	protein-coding gene	gene with protein product		609089	"""F-box only protein 3"""			10531037	Standard	NM_033406		Approved	FBX3, FBA	uc001muz.3	Q9UK99	OTTHUMG00000166244	ENST00000265651.3:c.251C>G	11.37:g.33790504G>C	ENSP00000265651:p.Ser84Cys		B3KY16|D3DR05|Q86X90|Q9H0V2|Q9NUX2	Missense_Mutation	SNP	pfam_ApaG_domain,pfam_F-box_dom_cyclin-like,superfamily_ApaG_domain,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_Cell_wall_assmbl_KNR4-like,pfscan_ApaG_domain,pfscan_F-box_dom_cyclin-like	p.S84C	ENST00000265651.3	37	c.251	CCDS7887.1	11	.	.	.	.	.	.	.	.	.	.	G	17.42	3.384229	0.61845	.	.	ENSG00000110429	ENST00000265651;ENST00000321458;ENST00000530401;ENST00000534136;ENST00000448981	T;T;T;T	0.46451	0.87;0.87;0.87;0.88	5.69	3.75	0.43078	F-box domain, Skp2-like (1);	0.684752	0.15375	N	0.265601	T	0.31606	0.0802	L	0.29908	0.895	0.37571	D	0.919456	P;P;P	0.48640	0.763;0.763;0.913	B;B;B	0.41202	0.35;0.35;0.339	T	0.34675	-0.9819	10	0.66056	D	0.02	-10.129	10.4509	0.44522	0.0746:0.1359:0.7895:0.0	.	79;84;84	Q9UK99-3;Q9UK99-2;Q9UK99	.;.;FBX3_HUMAN	C	84;81;79;84;84	ENSP00000265651:S84C;ENSP00000433781:S79C;ENSP00000431745:S84C;ENSP00000408836:S84C	ENSP00000265651:S84C	S	-	2	0	FBXO3	33747080	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.432000	0.52824	1.500000	0.48636	0.655000	0.94253	TCT	FBXO3	-	superfamily_F-box_dom_cyclin-like	ENSG00000110429		0.343	FBXO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO3	HGNC	protein_coding	OTTHUMT00000388665.1	319	0.00	0	G	NM_012175		33790504	33790504	-1	no_errors	ENST00000265651	ensembl	human	known	69_37n	missense	212	27.65	81	SNP	1.000	C
FKTN	2218	genome.wustl.edu	37	9	108370197	108370197	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr9:108370197G>C	ENST00000223528.2	+	6	869	c.745G>C	c.(745-747)Gag>Cag	p.E249Q	FKTN_ENST00000357998.5_Missense_Mutation_p.E249Q|FKTN_ENST00000540160.1_Missense_Mutation_p.E249Q|FKTN_ENST00000448551.2_Missense_Mutation_p.E249Q|FKTN_ENST00000602661.1_Missense_Mutation_p.E249Q	NM_006731.2	NP_006722.2	O75072	FKTN_HUMAN	fukutin	249					muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|negative regulation of JNK cascade (GO:0046329)|nervous system development (GO:0007399)|regulation of protein glycosylation (GO:0060049)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	transferase activity (GO:0016740)	p.E249Q(1)		breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	25						TAGGTTTATTGAGTGTAGGTA	0.358																																						dbGAP											1	Substitution - Missense(1)	breast(1)											92.0	90.0	90.0					9																	108370197		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6766.1	9q31-q33	2014-09-17	2007-11-21	2007-11-21	ENSG00000106692	ENSG00000106692			3622	protein-coding gene	gene with protein product		607440	"""Fukuyama type congenital muscular dystrophy (fukutin)"""	FCMD		8275093, 17036286, 17044012	Standard	NM_001079802		Approved	LGMD2M	uc004bcs.3	O75072	OTTHUMG00000020425	ENST00000223528.2:c.745G>C	9.37:g.108370197G>C	ENSP00000223528:p.Glu249Gln		B4DUX9|J3KP13|Q3MIJ1|Q96TE1|Q9P295	Missense_Mutation	SNP	pfam_LicD,superfamily_Hedgehog_sig/DD-Pept_Zn-bd_dom	p.E249Q	ENST00000223528.2	37	c.745	CCDS6766.1	9	.	.	.	.	.	.	.	.	.	.	G	26.9	4.781222	0.90282	.	.	ENSG00000106692	ENST00000223528;ENST00000540160;ENST00000357998;ENST00000374705	D;D;D;D	0.92348	-2.71;-1.85;-3.02;-1.86	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	D	0.95815	0.8638	M	0.71581	2.175	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.974;0.974	D	0.95734	0.8777	10	0.62326	D	0.03	-6.7615	18.6276	0.91347	0.0:0.0:1.0:0.0	.	249;249;249	B4E2W4;B4DUX9;O75072	.;.;FKTN_HUMAN	Q	249;249;249;226	ENSP00000223528:E249Q;ENSP00000439423:E249Q;ENSP00000350687:E249Q;ENSP00000363837:E226Q	ENSP00000223528:E249Q	E	+	1	0	FKTN	107410018	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.164000	0.89661	2.637000	0.89404	0.655000	0.94253	GAG	FKTN	-	superfamily_Hedgehog_sig/DD-Pept_Zn-bd_dom	ENSG00000106692		0.358	FKTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKTN	HGNC	protein_coding	OTTHUMT00000053505.1	171	0.00	0	G	NM_006731		108370197	108370197	+1	no_errors	ENST00000223528	ensembl	human	known	69_37n	missense	113	15.67	21	SNP	1.000	C
LINC00957	255031	genome.wustl.edu	37	7	44080613	44080613	+	lincRNA	SNP	C	C	T	rs193206514		TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr7:44080613C>T	ENST00000441052.1	+	0	1298				RASA4CP_ENST00000446874.1_RNA					long intergenic non-protein coding RNA 957																		GGGTCCAGCTCCACGTACTTC	0.642													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15937	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-			0			BC014556		7p13	2013-06-04			ENSG00000235314	ENSG00000235314		"""Long non-coding RNAs"""	22332	non-coding RNA	RNA, long non-coding							Standard	NR_015401		Approved				OTTHUMG00000155351		7.37:g.44080613C>T				RNA	SNP	-	NULL	ENST00000441052.1	37	NULL		7																																																																																			AC017116.8	-	-	ENSG00000235314		0.642	LINC00957-001	KNOWN	basic	lincRNA	FLJ35390	Clone_based_vega_gene	lincRNA	OTTHUMT00000339589.1	71	0.00	0	C			44080613	44080613	+1	no_errors	ENST00000416824	ensembl	human	known	69_37n	rna	50	13.79	8	SNP	1.000	T
FLNC	2318	genome.wustl.edu	37	7	128491678	128491678	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr7:128491678C>G	ENST00000325888.8	+	35	6099	c.5838C>G	c.(5836-5838)atC>atG	p.I1946M	RP11-309L24.2_ENST00000469965.1_RNA|FLNC_ENST00000346177.6_Missense_Mutation_p.I1913M	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1946					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)	p.I1946M(1)		biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						CAGCCAAGATCACAGGTGAGG	0.592																																						dbGAP											1	Substitution - Missense(1)	breast(1)											60.0	65.0	63.0					7																	128491678		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.5838C>G	7.37:g.128491678C>G	ENSP00000327145:p.Ile1946Met		B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.I1946M	ENST00000325888.8	37	c.5838	CCDS43644.1	7	.	.	.	.	.	.	.	.	.	.	C	19.82	3.899230	0.72754	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.93189	-3.18;-3.18	5.7	5.7	0.88788	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.96454	0.8843	M	0.88377	2.95	0.52099	D	0.999946	D;D	0.76494	0.987;0.999	P;D	0.65684	0.877;0.937	D	0.96451	0.9334	10	0.87932	D	0	.	9.9031	0.41359	0.1382:0.7906:0.0:0.0712	.	1913;1946	Q14315-2;Q14315	.;FLNC_HUMAN	M	1946;1913	ENSP00000327145:I1946M;ENSP00000344002:I1913M	ENSP00000327145:I1946M	I	+	3	3	FLNC	128278914	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	1.887000	0.39698	2.688000	0.91661	0.655000	0.94253	ATC	FLNC	-	superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000128591		0.592	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	HGNC	protein_coding	OTTHUMT00000059948.3	19	0.00	0	C			128491678	128491678	+1	no_errors	ENST00000325888	ensembl	human	known	69_37n	missense	10	33.33	5	SNP	1.000	G
FRY	10129	genome.wustl.edu	37	13	32721440	32721440	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr13:32721440C>T	ENST00000380250.3	+	12	1697	c.1201C>T	c.(1201-1203)Cga>Tga	p.R401*		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	401						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.R401*(1)		NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		CAAGATGGCTCGAGTTGCACT	0.408																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											100.0	94.0	96.0					13																	32721440		1862	4105	5967	-	-	-	SO:0001587	stop_gained	0			AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.1201C>T	13.37:g.32721440C>T	ENSP00000369600:p.Arg401*		Q9Y3N6	Nonsense_Mutation	SNP	superfamily_ARM-type_fold	p.R401*	ENST00000380250.3	37	c.1201	CCDS41875.1	13	.	.	.	.	.	.	.	.	.	.	C	44	11.106422	0.99516	.	.	ENSG00000073910	ENST00000380250;ENST00000267067	.	.	.	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.4345	0.94786	0.0:1.0:0.0:0.0	.	.	.	.	X	401;329	.	ENSP00000267067:R329X	R	+	1	2	FRY	31619440	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.805000	0.62561	2.677000	0.91161	0.561000	0.74099	CGA	FRY	-	superfamily_ARM-type_fold	ENSG00000073910		0.408	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRY	HGNC	protein_coding	OTTHUMT00000044405.1	164	0.00	0	C	NM_023037		32721440	32721440	+1	no_errors	ENST00000380250	ensembl	human	known	69_37n	nonsense	81	35.71	45	SNP	1.000	T
RAD54B	25788	genome.wustl.edu	37	8	95423541	95423541	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr8:95423541G>C	ENST00000336148.5	-	4	431	c.307C>G	c.(307-309)Cat>Gat	p.H103D		NM_012415.3	NP_036547.1	Q9Y620	RA54B_HUMAN	RAD54 homolog B (S. cerevisiae)	103					ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair via homologous recombination (GO:0000724)|mitotic recombination (GO:0006312)|reciprocal meiotic recombination (GO:0007131)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|RNA helicase activity (GO:0003724)	p.H103D(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(10)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)			GGAGCCGAATGAACTACAATT	0.313								Direct reversal of damage;Homologous recombination																														dbGAP											1	Substitution - Missense(1)	breast(1)											50.0	51.0	51.0					8																	95423541		2202	4298	6500	-	-	-	SO:0001583	missense	0			AF112481	CCDS6262.1, CCDS56546.1, CCDS75768.1	8q22.1	2014-08-08			ENSG00000197275	ENSG00000197275			17228	protein-coding gene	gene with protein product		604289				10362364, 10851248	Standard	NM_012415		Approved	RDH54	uc003ygk.3	Q9Y620	OTTHUMG00000133658	ENST00000336148.5:c.307C>G	8.37:g.95423541G>C	ENSP00000336606:p.His103Asp		F6WBS8	Nonsense_Mutation	SNP	NULL	p.S126*	ENST00000336148.5	37	c.377	CCDS6262.1	8	.	.	.	.	.	.	.	.	.	.	G	10.71	1.426078	0.25726	.	.	ENSG00000197275	ENST00000336148;ENST00000523839	D;T	0.88201	-2.35;1.37	5.32	1.29	0.21616	.	0.886462	0.09937	N	0.736393	T	0.80737	0.4680	L	0.48642	1.525	0.09310	N	1	B	0.18610	0.029	B	0.16722	0.016	T	0.60949	-0.7161	10	0.12103	T	0.63	-5.0963	2.3358	0.04247	0.307:0.1194:0.4521:0.1215	.	103	Q9Y620	RA54B_HUMAN	D	103	ENSP00000336606:H103D;ENSP00000428554:H103D	ENSP00000336606:H103D	H	-	1	0	RAD54B	95492717	0.099000	0.21834	0.178000	0.23040	0.113000	0.19764	0.095000	0.15127	0.200000	0.20447	0.460000	0.39030	CAT	FSBP	-	NULL	ENSG00000265817		0.313	RAD54B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FSBP	HGNC	protein_coding	OTTHUMT00000257806.3	183	0.00	0	G	NM_012415		95423541	95423541	-1	no_errors	ENST00000517506	ensembl	human	known	69_37n	nonsense	91	28.91	37	SNP	0.000	C
CMTR1	23070	genome.wustl.edu	37	6	37447030	37447030	+	Splice_Site	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr6:37447030C>T	ENST00000373451.4	+	23	2538	c.2374C>T	c.(2374-2376)Cac>Tac	p.H792Y		NM_015050.2	NP_055865.1	Q8N1G2	CMTR1_HUMAN	cap methyltransferase 1	792	Interaction with POLR2A.				7-methylguanosine mRNA capping (GO:0006370)|cap1 mRNA methylation (GO:0097309)|mRNA methylation (GO:0080009)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA (nucleoside-2'-O-)-methyltransferase activity (GO:0004483)|nucleic acid binding (GO:0003676)	p.H792Y(1)									TGCCCCATTTCAGTAAGTAGC	0.517																																						dbGAP											1	Substitution - Missense(1)	breast(1)											94.0	83.0	87.0					6																	37447030		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC031890	CCDS4835.1	6p21.2	2013-07-23	2013-07-23	2013-07-23	ENSG00000137200	ENSG00000137200	2.1.1.57	"""G patch domain containing"""	21077	protein-coding gene	gene with protein product			"""KIAA0082"", ""FtsJ methyltransferase domain containing 2"""	KIAA0082, FTSJD2		20713356	Standard	NM_015050		Approved	MTr1, ISG95	uc003ons.3	Q8N1G2	OTTHUMG00000014624	ENST00000373451.4:c.2375+1C>T	6.37:g.37447030C>T			A8K949|Q14670|Q96FJ9	Missense_Mutation	SNP	pfam_rRNA_MeTrfase_FtsJ_dom,pfam_G_patch_dom,smart_G_patch_dom,smart_WW_Rsp5_WWP,pfscan_G_patch_dom	p.H792Y	ENST00000373451.4	37	c.2374	CCDS4835.1	6	.	.	.	.	.	.	.	.	.	.	C	9.076	0.998054	0.19043	.	.	ENSG00000137200	ENST00000373451;ENST00000373420	.	.	.	5.82	5.82	0.92795	.	0.094722	0.64402	D	0.000001	T	0.34513	0.0900	N	0.22421	0.69	0.54753	D	0.999988	B	0.02656	0.0	B	0.04013	0.001	T	0.19877	-1.0292	9	0.17369	T	0.5	-20.8142	18.6692	0.91504	0.0:1.0:0.0:0.0	.	792	Q8N1G2	MTR1_HUMAN	Y	792;199	.	ENSP00000362519:H199Y	H	+	1	0	FTSJD2	37555008	1.000000	0.71417	1.000000	0.80357	0.665000	0.39181	5.677000	0.68142	2.757000	0.94681	0.655000	0.94253	CAC	FTSJD2	-	NULL	ENSG00000137200		0.517	CMTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FTSJD2	HGNC	protein_coding	OTTHUMT00000040408.1	81	0.00	0	C	NM_015050	Missense_Mutation	37447030	37447030	+1	no_errors	ENST00000373451	ensembl	human	known	69_37n	missense	46	24.59	15	SNP	1.000	T
GABRB3	2562	genome.wustl.edu	37	15	26866582	26866582	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr15:26866582C>T	ENST00000311550.5	-	4	451	c.340G>A	c.(340-342)Gac>Aac	p.D114N	GABRB3_ENST00000541819.2_Missense_Mutation_p.D170N|GABRB3_ENST00000299267.4_Missense_Mutation_p.D114N|GABRB3_ENST00000400188.3_Missense_Mutation_p.D43N|GABRB3_ENST00000545868.1_Missense_Mutation_p.D29N	NM_000814.5|NM_001278631.1	NP_000805.1|NP_001265560.1	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 3	114					cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|cochlea development (GO:0090102)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|GABA-gated chloride ion channel activity (GO:0022851)	p.D114N(2)|p.D170N(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(41)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	68		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Fospropofol(DB06716)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ivermectin(DB00602)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Piperazine(DB00592)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CATAGCTGGTCAGCCACTCGA	0.443																																						dbGAP											3	Substitution - Missense(3)	breast(3)											104.0	101.0	102.0					15																	26866582		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS10018.1, CCDS10019.1, CCDS53920.1, CCDS53921.1	15q12	2012-06-22			ENSG00000166206	ENSG00000166206		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4083	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 3"""	137192					Standard	NM_000814		Approved		uc001zaz.3	P28472	OTTHUMG00000129231	ENST00000311550.5:c.340G>A	15.37:g.26866582C>T	ENSP00000308725:p.Asp114Asn		B7Z2W1|B7Z825|F5H3D2|H7BYV8|Q14352|Q96FM5	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_GABAAb_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.D114N	ENST00000311550.5	37	c.340	CCDS10019.1	15	.	.	.	.	.	.	.	.	.	.	C	23.2	4.388028	0.82902	.	.	ENSG00000166206	ENST00000311550;ENST00000541819;ENST00000299267;ENST00000400188;ENST00000545868;ENST00000555094	T;T;T;T;T;T	0.78924	-1.22;-1.22;-1.22;-1.22;-1.22;-1.22	5.81	5.81	0.92471	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	T	0.80352	0.4607	L	0.28115	0.83	0.80722	D	1	P;P;D	0.54397	0.928;0.928;0.966	P;P;P	0.58391	0.614;0.614;0.838	T	0.81138	-0.1069	10	0.54805	T	0.06	.	19.0679	0.93119	0.0:1.0:0.0:0.0	.	170;114;114	F5H7N0;P28472-2;P28472	.;.;GBRB3_HUMAN	N	114;170;114;43;29;29	ENSP00000308725:D114N;ENSP00000442408:D170N;ENSP00000299267:D114N;ENSP00000383049:D43N;ENSP00000439169:D29N;ENSP00000452272:D29N	ENSP00000299267:D114N	D	-	1	0	GABRB3	24417675	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.665000	0.83852	2.752000	0.94435	0.467000	0.42956	GAC	GABRB3	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel	ENSG00000166206		0.443	GABRB3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRB3	HGNC	protein_coding	OTTHUMT00000251352.2	125	0.00	0	C			26866582	26866582	-1	no_errors	ENST00000299267	ensembl	human	known	69_37n	missense	65	26.97	24	SNP	1.000	T
GBE1	2632	genome.wustl.edu	37	3	81692075	81692075	+	Silent	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr3:81692075G>A	ENST00000429644.2	-	7	1492	c.849C>T	c.(847-849)gtC>gtT	p.V283V	GBE1_ENST00000489715.1_Silent_p.V242V	NM_000158.3	NP_000149	Q04446	GLGB_HUMAN	glucan (1,4-alpha-), branching enzyme 1	283					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	1,4-alpha-glucan branching enzyme activity (GO:0003844)|cation binding (GO:0043169)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)	p.V283V(2)		breast(1)|endometrium(5)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Lung NSC(201;0.0117)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0654)|Epithelial(33;0.00305)|LUSC - Lung squamous cell carcinoma(29;0.00646)|BRCA - Breast invasive adenocarcinoma(55;0.00813)|Lung(72;0.0129)|KIRC - Kidney renal clear cell carcinoma(39;0.212)|Kidney(39;0.247)		CATCTAAGAGGACTATGATAC	0.403									Glycogen Storage Disease, type IV																													dbGAP											2	Substitution - coding silent(2)	breast(2)											106.0	97.0	100.0					3																	81692075		1887	4118	6005	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Andersen Disease, Brancher deficiency		CCDS54612.1	3p12.2	2013-09-20	2008-08-01		ENSG00000114480	ENSG00000114480	2.4.1.18		4180	protein-coding gene	gene with protein product	"""glycogen branching enzyme"", ""Andersen disease"", ""glycogen storage disease type IV"""	607839				8463281	Standard	NM_000158		Approved		uc021xav.1	Q04446	OTTHUMG00000158978	ENST00000429644.2:c.849C>T	3.37:g.81692075G>A			B3KWV3|Q96EN0	Silent	SNP	pfam_A-amylase_b_C,pfam_Glyco_hydro_13_cat_dom,pfam_Glyco_hydro_13_N,superfamily_Glycoside_hydrolase_SF,superfamily_Ig_E-set,smart_Glyco_hydro_13_sub_cat_dom	p.V283	ENST00000429644.2	37	c.849	CCDS54612.1	3																																																																																			GBE1	-	pfam_Glyco_hydro_13_cat_dom,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom	ENSG00000114480		0.403	GBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBE1	HGNC	protein_coding	OTTHUMT00000352760.2	131	0.00	0	G			81692075	81692075	-1	no_errors	ENST00000429644	ensembl	human	known	69_37n	silent	70	24.73	23	SNP	1.000	A
GCC2	9648	genome.wustl.edu	37	2	109088057	109088057	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr2:109088057C>A	ENST00000309863.6	+	6	2986	c.2272C>A	c.(2272-2274)Cag>Aag	p.Q758K		NM_181453.3	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain containing 2	758					Golgi ribbon formation (GO:0090161)|late endosome to Golgi transport (GO:0034499)|microtubule anchoring (GO:0034453)|microtubule organizing center organization (GO:0031023)|protein localization to Golgi apparatus (GO:0034067)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|recycling endosome to Golgi transport (GO:0071955)|regulation of protein exit from endoplasmic reticulum (GO:0070861)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	identical protein binding (GO:0042802)	p.Q758K(1)		breast(8)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	54						TGTTAAAACTCAGTTGTATGG	0.338																																						dbGAP											1	Substitution - Missense(1)	breast(1)											55.0	63.0	60.0					2																	109088057		2201	4299	6500	-	-	-	SO:0001583	missense	0			BC020645	CCDS33268.1	2q12.3	2008-02-05	2004-03-05		ENSG00000135968	ENSG00000135968			23218	protein-coding gene	gene with protein product		612711	"""GRIP and coiled-coil domain-containing 2"""			12446665	Standard	NM_181453		Approved	GCC185, KIAA0336	uc002tec.3	Q8IWJ2	OTTHUMG00000153214	ENST00000309863.6:c.2272C>A	2.37:g.109088057C>A	ENSP00000307939:p.Gln758Lys		A6H8X8|O15045|Q4ZG46|Q8TDH3|Q9H2G8	Missense_Mutation	SNP	pfam_GRIP,superfamily_GRIP,superfamily_tRNA-bd_arm,smart_GRIP,pfscan_GRIP	p.Q758K	ENST00000309863.6	37	c.2272	CCDS33268.1	2	.	.	.	.	.	.	.	.	.	.	C	15.83	2.948970	0.53186	.	.	ENSG00000135968	ENST00000309863;ENST00000409896;ENST00000393318	T	0.35048	1.33	5.5	5.5	0.81552	.	0.361742	0.26715	N	0.022880	T	0.59582	0.2204	M	0.71581	2.175	0.49213	D	0.999765	D	0.69078	0.997	D	0.77004	0.989	T	0.50558	-0.8814	10	0.18276	T	0.48	.	19.762	0.96323	0.0:1.0:0.0:0.0	.	758	Q8IWJ2	GCC2_HUMAN	K	758;721;502	ENSP00000307939:Q758K	ENSP00000307939:Q758K	Q	+	1	0	GCC2	108454489	0.941000	0.31946	1.000000	0.80357	0.998000	0.95712	4.339000	0.59322	2.741000	0.93983	0.650000	0.86243	CAG	GCC2	-	NULL	ENSG00000135968		0.338	GCC2-014	KNOWN	basic|appris_principal|CCDS	protein_coding	GCC2	HGNC	protein_coding	OTTHUMT00000358516.3	110	0.00	0	C	NM_014635		109088057	109088057	+1	no_errors	ENST00000309863	ensembl	human	known	69_37n	missense	83	23.15	25	SNP	1.000	A
GLYCTK	132158	genome.wustl.edu	37	3	52327124	52327124	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr3:52327124G>C	ENST00000436784.2	+	5	1614	c.1554G>C	c.(1552-1554)ttG>ttC	p.L518F	GLYCTK-AS1_ENST00000493616.1_RNA|GLYCTK_ENST00000354773.4_3'UTR|GLYCTK_ENST00000461183.1_Missense_Mutation_p.V276L|GLYCTK_ENST00000305690.8_Missense_Mutation_p.V360L|GLYCTK_ENST00000473032.1_Missense_Mutation_p.V198L|GLYCTK_ENST00000471180.1_Missense_Mutation_p.V233L|MIR135A1_ENST00000385191.1_RNA			Q8IVS8	GLCTK_HUMAN	glycerate kinase	518					protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|glycerate kinase activity (GO:0008887)	p.L518F(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|urinary_tract(1)	9				BRCA - Breast invasive adenocarcinoma(193;3.56e-05)|Kidney(197;0.00171)|KIRC - Kidney renal clear cell carcinoma(197;0.00194)|OV - Ovarian serous cystadenocarcinoma(275;0.235)		CCCACCTCTTGTTCCTGCGGC	0.572																																						dbGAP											1	Substitution - Missense(1)	breast(1)											92.0	88.0	90.0					3																	52327124		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2852.1, CCDS46841.1	3p21.1	2008-01-22			ENSG00000168237	ENSG00000168237	2.7.1.31		24247	protein-coding gene	gene with protein product		610516				16753811	Standard	NM_145262		Approved	HBEBP4, HBEBP2	uc003ddo.3	Q8IVS8	OTTHUMG00000158380	ENST00000436784.2:c.1554G>C	3.37:g.52327124G>C	ENSP00000389175:p.Leu518Phe		Q0P630|Q2EZ43|Q6Y2K6|Q7Z6G5|Q86YR8|Q8TED2|Q8WTY2	Missense_Mutation	SNP	pfam_MOFRL	p.L518F	ENST00000436784.2	37	c.1554	CCDS2852.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.25|15.25	2.778997|2.778997	0.49891|0.49891	.|.	.|.	ENSG00000168237|ENSG00000168237	ENST00000436784;ENST00000411757|ENST00000461183;ENST00000473032;ENST00000305690;ENST00000471180	T|T;T;T;T	0.58506|0.42513	0.33|0.97;1.39;1.59;1.0	5.73|5.73	0.867|0.867	0.19085|0.19085	MOFRL domain (1);|.	0.176751|.	0.41097|.	D|.	0.000949|.	T|T	0.35128|0.35128	0.0921|0.0921	M|M	0.79475|0.79475	2.455|2.455	0.80722|0.80722	D|D	1|1	P|B	0.50943|0.02656	0.94|0.0	B|B	0.42163|0.06405	0.378|0.002	T|T	0.14420|0.14420	-1.0473|-1.0473	10|9	0.66056|0.27082	D|T	0.02|0.32	-9.6737|-9.6737	1.2462|1.2462	0.01973|0.01973	0.2719:0.1009:0.4193:0.208|0.2719:0.1009:0.4193:0.208	.|.	518|360	Q8IVS8|Q8IVS8-4	GLCTK_HUMAN|.	F|L	518;452|276;198;360;233	ENSP00000389175:L518F|ENSP00000417264:V276L;ENSP00000418951:V198L;ENSP00000301965:V360L;ENSP00000417526:V233L	ENSP00000390266:L452F|ENSP00000301965:V360L	L|V	+|+	3|1	2|0	GLYCTK|GLYCTK	52302164|52302164	1.000000|1.000000	0.71417|0.71417	0.726000|0.726000	0.30738|0.30738	0.988000|0.988000	0.76386|0.76386	1.186000|1.186000	0.32078|0.32078	-0.114000|-0.114000	0.11936|0.11936	0.655000|0.655000	0.94253|0.94253	TTG|GTT	GLYCTK	-	NULL	ENSG00000168237		0.572	GLYCTK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	GLYCTK	HGNC	protein_coding	OTTHUMT00000350835.1	56	0.00	0	G	NM_145262		52327124	52327124	+1	no_errors	ENST00000436784	ensembl	human	known	69_37n	missense	22	15.38	4	SNP	0.964	C
GMFB	2764	genome.wustl.edu	37	14	54947649	54947649	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr14:54947649G>A	ENST00000358056.3	-	5	494	c.226C>T	c.(226-228)Caa>Taa	p.Q76*	GMFB_ENST00000554908.1_3'UTR|GMFB_ENST00000553566.1_5'Flank	NM_004124.2	NP_004115.1	P60983	GMFB_HUMAN	glia maturation factor, beta	76	ADF-H. {ECO:0000255|PROSITE- ProRule:PRU00599}.				learning (GO:0007612)|locomotory behavior (GO:0007626)|negative regulation of protein kinase activity (GO:0006469)|nervous system development (GO:0007399)|positive regulation of catalytic activity (GO:0043085)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	intracellular (GO:0005622)	enzyme activator activity (GO:0008047)|protein kinase inhibitor activity (GO:0004860)|signal transducer activity (GO:0004871)	p.Q76*(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)	8						TCATCATGTTGATATTTATAA	0.353																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											73.0	74.0	74.0					14																	54947649		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0			M86492	CCDS9718.1	14q22.2	2010-07-06			ENSG00000197045	ENSG00000197045			4373	protein-coding gene	gene with protein product		601713				1712830	Standard	NM_004124		Approved	GMF	uc021rtf.1	P60983	OTTHUMG00000140307	ENST00000358056.3:c.226C>T	14.37:g.54947649G>A	ENSP00000350757:p.Gln76*		B2R499|P17774|Q9BS35	Nonsense_Mutation	SNP	pfam_Actin-bd_cofilin/tropomyosin,smart_Actin-bd_cofilin/tropomyosin,pirsf_GMF-beta	p.Q76*	ENST00000358056.3	37	c.226	CCDS9718.1	14	.	.	.	.	.	.	.	.	.	.	G	32	5.179149	0.94846	.	.	ENSG00000197045	ENST00000358056;ENST00000354747;ENST00000553333	.	.	.	5.36	5.36	0.76844	.	0.056577	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	-4.3786	19.4568	0.94895	0.0:0.0:1.0:0.0	.	.	.	.	X	76;76;89	.	ENSP00000346789:Q76X	Q	-	1	0	GMFB	54017399	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.010000	0.57117	2.673000	0.90976	0.650000	0.86243	CAA	GMFB	-	pfam_Actin-bd_cofilin/tropomyosin,smart_Actin-bd_cofilin/tropomyosin,pirsf_GMF-beta	ENSG00000197045		0.353	GMFB-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	GMFB	HGNC	protein_coding	OTTHUMT00000276903.2	195	0.51	1	G	NM_004124		54947649	54947649	-1	no_errors	ENST00000358056	ensembl	human	known	69_37n	nonsense	168	13.85	27	SNP	1.000	A
GNPTAB	79158	genome.wustl.edu	37	12	102153831	102153831	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr12:102153831C>T	ENST00000299314.7	-	16	3488	c.3226G>A	c.(3226-3228)Gaa>Aaa	p.E1076K		NM_024312.4	NP_077288.2	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits	1076					carbohydrate phosphorylation (GO:0046835)|cell differentiation (GO:0030154)|lysosome organization (GO:0007040)|protein secretion (GO:0009306)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity (GO:0003976)	p.E1076K(1)		NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	37						TAGTAGGATTCCTGAGTTGGT	0.373																																						dbGAP											1	Substitution - Missense(1)	breast(1)											202.0	185.0	191.0					12																	102153831		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY687932	CCDS9088.1	12q23.3	2013-01-10				ENSG00000111670		"""EF-hand domain containing"""	29670	protein-coding gene	gene with protein product		607840		GNPTA		10574462, 16116615	Standard	NM_024312		Approved	KIAA1208, MGC4170	uc001tit.3	Q3T906	OTTHUMG00000170444	ENST00000299314.7:c.3226G>A	12.37:g.102153831C>T	ENSP00000299314:p.Glu1076Lys		A2RRQ9|Q3ZQK2|Q6IPW5|Q86TQ2|Q96N13|Q9ULL2	Missense_Mutation	SNP	pfam_DMAP1-bd,pfam_Notch_dom,pfam_DUF3184,superfamily_Notch_dom,smart_Notch_dom,pfscan_EF_HAND_2,pfscan_Notch_dom	p.E1076K	ENST00000299314.7	37	c.3226	CCDS9088.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.7|20.7	4.030680|4.030680	0.75504|0.75504	.|.	.|.	ENSG00000111670|ENSG00000111670	ENST00000299314|ENST00000550718	D|.	0.96967|.	-4.19|.	5.71|5.71	5.71|5.71	0.89125|0.89125	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.82121|0.82121	0.4968|0.4968	M|M	0.81112|0.81112	2.525|2.525	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.83275|.	0.996|.	T|T	0.81906|0.81906	-0.0718|-0.0718	10|5	0.87932|.	D|.	0|.	-28.2123|-28.2123	19.8677|19.8677	0.96824|0.96824	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1076|.	Q3T906|.	GNPTA_HUMAN|.	K|E	1076|13	ENSP00000299314:E1076K|.	ENSP00000299314:E1076K|.	E|G	-|-	1|2	0|0	GNPTAB|GNPTAB	100677962|100677962	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.056000|0.056000	0.15407|0.15407	7.463000|7.463000	0.80869|0.80869	2.709000|2.709000	0.92574|0.92574	0.655000|0.655000	0.94253|0.94253	GAA|GGA	GNPTAB	-	NULL	ENSG00000111670		0.373	GNPTAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNPTAB	HGNC	protein_coding	OTTHUMT00000409182.1	245	0.00	0	C			102153831	102153831	-1	no_errors	ENST00000299314	ensembl	human	known	69_37n	missense	171	27.85	66	SNP	1.000	T
GPR64	10149	genome.wustl.edu	37	X	19027881	19027881	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chrX:19027881C>T	ENST00000379869.3	-	18	1448	c.1285G>A	c.(1285-1287)Gac>Aac	p.D429N	GPR64_ENST00000357544.3_Missense_Mutation_p.D399N|GPR64_ENST00000379873.2_Missense_Mutation_p.D429N|GPR64_ENST00000360279.4_Missense_Mutation_p.D407N|GPR64_ENST00000356606.4_Missense_Mutation_p.D415N|GPR64_ENST00000379876.1_Missense_Mutation_p.D405N|GPR64_ENST00000357991.3_Missense_Mutation_p.D426N|GPR64_ENST00000340581.3_Missense_Mutation_p.D399N|GPR64_ENST00000354791.3_Missense_Mutation_p.D413N|GPR64_ENST00000379878.3_Missense_Mutation_p.D413N	NM_001079858.2|NM_005756.3	NP_001073327.1|NP_005747.2	Q8IZP9	GPR64_HUMAN	G protein-coupled receptor 64	429					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)|spermatogenesis (GO:0007283)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.D426N(1)		breast(5)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(18)|stomach(1)|urinary_tract(1)	42	Hepatocellular(33;0.183)					AGGCCAATGTCATCCACTACT	0.418																																						dbGAP											1	Substitution - Missense(1)	breast(1)											124.0	105.0	111.0					X																	19027881		2203	4300	6503	-	-	-	SO:0001583	missense	0			X81892	CCDS14191.1, CCDS43921.1, CCDS43922.1, CCDS43923.1, CCDS55376.1, CCDS55377.1, CCDS55378.1, CCDS55379.1	Xp22.13	2014-08-08			ENSG00000173698	ENSG00000173698		"""-"", ""GPCR / Class B : Orphans"""	4516	protein-coding gene	gene with protein product	"""epididymal protein 6"""	300572				9739419, 9150425	Standard	NM_005756		Approved	HE6, TM7LN2, EDDM6	uc004cyx.3	Q8IZP9	OTTHUMG00000021223	ENST00000379869.3:c.1285G>A	X.37:g.19027881C>T	ENSP00000369198:p.Asp429Asn		B1AWB3|B1AWB4|B1AWB6|B1AWB7|O00406|Q14CE0|Q8IWT2|Q8IZE4|Q8IZE5|Q8IZE6|Q8IZE7|Q8IZP3|Q8IZP4	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.D429N	ENST00000379869.3	37	c.1285	CCDS43923.1	X	.	.	.	.	.	.	.	.	.	.	C	17.13	3.309930	0.60414	.	.	ENSG00000173698	ENST00000379873;ENST00000379878;ENST00000354791;ENST00000379876;ENST00000357544;ENST00000379869;ENST00000360279;ENST00000357991;ENST00000356606;ENST00000340581	T;T;T;T;T;T;T;T;T;T	0.32988	1.44;1.55;1.56;1.57;1.57;1.6;1.57;1.6;1.59;1.43	6.02	5.15	0.70609	.	0.420651	0.22588	N	0.058134	T	0.19927	0.0479	L	0.29908	0.895	0.24173	N	0.995612	B;B;B;B;B;B;B;B;B;B;B	0.19445	0.013;0.002;0.009;0.001;0.001;0.036;0.009;0.009;0.009;0.003;0.021	B;B;B;B;B;B;B;B;B;B;B	0.21360	0.005;0.014;0.034;0.014;0.014;0.034;0.034;0.034;0.034;0.006;0.015	T	0.07947	-1.0746	10	0.30854	T	0.27	.	6.0472	0.19766	0.1713:0.6736:0.0:0.1551	.	399;391;399;405;413;429;407;415;426;429;413	Q14CE0;Q8IZP9-8;Q8IZP9-7;Q8IZP9-5;Q8IZP9-3;Q8IZP9-9;Q8IZP9-6;Q8IZP9-4;Q8IZP9-2;Q8IZP9;Q14CE1	.;.;.;.;.;.;.;.;.;GPR64_HUMAN;.	N	429;413;413;405;399;429;407;426;415;399	ENSP00000369202:D429N;ENSP00000369207:D413N;ENSP00000346845:D413N;ENSP00000369205:D405N;ENSP00000350152:D399N;ENSP00000369198:D429N;ENSP00000353421:D407N;ENSP00000350680:D426N;ENSP00000349015:D415N;ENSP00000344972:D399N	ENSP00000344972:D399N	D	-	1	0	GPR64	18937802	0.983000	0.35010	1.000000	0.80357	0.998000	0.95712	1.083000	0.30815	2.549000	0.85964	0.600000	0.82982	GAC	GPR64	-	NULL	ENSG00000173698		0.418	GPR64-003	KNOWN	basic|CCDS	protein_coding	GPR64	HGNC	protein_coding	OTTHUMT00000055970.2	211	0.00	0	C			19027881	19027881	-1	no_errors	ENST00000379869	ensembl	human	known	69_37n	missense	124	25.30	42	SNP	1.000	T
GREB1	9687	genome.wustl.edu	37	2	11720882	11720882	+	Silent	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr2:11720882C>T	ENST00000381486.2	+	7	1125	c.825C>T	c.(823-825)ttC>ttT	p.F275F	GREB1_ENST00000263834.5_Silent_p.F275F|GREB1_ENST00000389825.3_Silent_p.F165F|GREB1_ENST00000234142.5_Silent_p.F275F|GREB1_ENST00000381483.2_Silent_p.F275F	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	275						integral component of membrane (GO:0016021)		p.F275F(3)		breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		CGGCTGTTTTCAACGGCAAAG	0.537																																					Ovarian(39;850 945 2785 23371 33093)	dbGAP											3	Substitution - coding silent(3)	breast(3)											92.0	89.0	90.0					2																	11720882		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.825C>T	2.37:g.11720882C>T			A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Silent	SNP	NULL	p.F275	ENST00000381486.2	37	c.825	CCDS42655.1	2																																																																																			GREB1	-	NULL	ENSG00000196208		0.537	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GREB1	HGNC	protein_coding	OTTHUMT00000280490.1	58	0.00	0	C	NM_014668		11720882	11720882	+1	no_errors	ENST00000234142	ensembl	human	known	69_37n	silent	50	13.79	8	SNP	1.000	T
GTF2H3	2967	genome.wustl.edu	37	12	124144425	124144425	+	Silent	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr12:124144425C>T	ENST00000543341.2	+	11	799	c.768C>T	c.(766-768)ttC>ttT	p.F256F	GTF2H3_ENST00000228955.7_Silent_p.F215F	NM_001271867.1|NM_001516.3	NP_001258796.1|NP_001507.2	Q13889	TF2H3_HUMAN	general transcription factor IIH, polypeptide 3, 34kDa	256					7-methylguanosine mRNA capping (GO:0006370)|ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|gene expression (GO:0010467)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|translation (GO:0006412)|viral process (GO:0016032)	core TFIIH complex (GO:0000439)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|translation factor activity, nucleic acid binding (GO:0008135)	p.F256F(1)		breast(2)|endometrium(1)|large_intestine(4)|lung(2)|urinary_tract(1)	10	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.1e-05)|Epithelial(86;0.000388)|all cancers(50;0.00362)		CTGCTTGCTTCTGTCATCGAA	0.408								Nucleotide excision repair (NER)																													Melanoma(176;111 2022 3038 14733 36962)	dbGAP											1	Substitution - coding silent(1)	breast(1)											146.0	134.0	138.0					12																	124144425		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z30093	CCDS9252.1, CCDS61275.1, CCDS73544.1	12q24.31	2012-11-05	2002-08-29		ENSG00000111358	ENSG00000111358		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	4657	protein-coding gene	gene with protein product		601750	"""general transcription factor IIH, polypeptide 3 (34kD subunit)"""			8194529	Standard	NM_001516		Approved	BTF2, TFIIH, P34	uc001ufo.2	Q13889	OTTHUMG00000168697	ENST00000543341.2:c.768C>T	12.37:g.124144425C>T			B2R819|B4DNZ6|Q7L0G0|Q96AT7	Silent	SNP	pfam_TF_Tfb4,tigrfam_TF_Tfb4	p.F256	ENST00000543341.2	37	c.768	CCDS9252.1	12																																																																																			GTF2H3	-	pfam_TF_Tfb4,tigrfam_TF_Tfb4	ENSG00000111358		0.408	GTF2H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2H3	HGNC	protein_coding	OTTHUMT00000400641.2	216	0.00	0	C	NM_001516		124144425	124144425	+1	no_errors	ENST00000543341	ensembl	human	known	69_37n	silent	136	26.88	50	SNP	1.000	T
HDLBP	3069	genome.wustl.edu	37	2	242186244	242186244	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr2:242186244C>G	ENST00000391975.1	-	16	2100	c.1873G>C	c.(1873-1875)Gag>Cag	p.E625Q	HDLBP_ENST00000427183.2_Missense_Mutation_p.E592Q|HDLBP_ENST00000476807.1_5'Flank|AC104841.1_ENST00000578965.1_RNA|HDLBP_ENST00000391976.2_Missense_Mutation_p.E625Q|HDLBP_ENST00000310931.4_Missense_Mutation_p.E625Q	NM_203346.3	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein	625	KH 7. {ECO:0000255|PROSITE- ProRule:PRU00117}.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)	cytoplasm (GO:0005737)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)	p.E625Q(1)		breast(7)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		ATAATGGTCTCTGAATTGCTA	0.473																																						dbGAP											1	Substitution - Missense(1)	breast(1)											180.0	177.0	178.0					2																	242186244		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2547.1, CCDS58760.1	2q37.3	2008-07-18	2008-07-18		ENSG00000115677	ENSG00000115677			4857	protein-coding gene	gene with protein product		142695	"""vigilin"""	VGL		1318310, 8390966	Standard	NM_005336		Approved	HBP	uc002waz.3	Q00341	OTTHUMG00000133391	ENST00000391975.1:c.1873G>C	2.37:g.242186244C>G	ENSP00000375836:p.Glu625Gln		B4DTQ2|E7EM71|Q53QU2|Q9UCY3	Missense_Mutation	SNP	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	p.E625Q	ENST00000391975.1	37	c.1873	CCDS2547.1	2	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	21.9|21.9|21.9	4.221691|4.221691|4.221691	0.79464|0.79464|0.79464	.|.|.	.|.|.	ENSG00000115677|ENSG00000115677|ENSG00000115677	ENST00000391975;ENST00000391976;ENST00000310931;ENST00000427183;ENST00000452931|ENST00000427487|ENST00000373292	T;T;T;T;T|.|.	0.43688|.|.	0.94;0.94;0.94;0.94;0.94|.|.	6.16|6.16|6.16	6.16|6.16|6.16	0.99307|0.99307|0.99307	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);|.|.	0.000000|.|.	0.85682|.|.	D|.|.	0.000000|.|.	T|T|T	0.74230|0.74230|0.74230	0.3689|0.3689|0.3689	L|L|L	0.57536|0.57536|0.57536	1.79|1.79|1.79	0.80722|0.80722|0.80722	D|D|D	1|1|1	P;P|.|.	0.40602|.|.	0.723;0.562|.|.	P;B|.|.	0.45660|.|.	0.489;0.371|.|.	T|T|T	0.68364|0.68364|0.68364	-0.5428|-0.5428|-0.5428	10|5|5	0.46703|.|.	T|.|.	0.11|.|.	-40.777|-40.777|-40.777	20.8598|20.8598|20.8598	0.99761|0.99761|0.99761	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	592;625|.|.	E7EM71;Q00341|.|.	.;VIGLN_HUMAN|.|.	Q|H|T	625;625;625;592;134|12|433	ENSP00000375836:E625Q;ENSP00000375837:E625Q;ENSP00000312042:E625Q;ENSP00000399139:E592Q;ENSP00000388876:E134Q|.|.	ENSP00000312042:E625Q|.|.	E|Q|R	-|-|-	1|3|2	0|2|0	HDLBP|HDLBP|HDLBP	241834917|241834917|241834917	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.711000|0.711000|0.711000	0.30485|0.30485|0.30485	0.081000|0.081000|0.081000	0.17604|0.17604|0.17604	7.751000|7.751000|7.751000	0.85126|0.85126|0.85126	2.937000|2.937000|2.937000	0.99478|0.99478|0.99478	0.650000|0.650000|0.650000	0.86243|0.86243|0.86243	GAG|CAG|AGA	HDLBP	-	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	ENSG00000115677		0.473	HDLBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDLBP	HGNC	protein_coding	OTTHUMT00000257245.5	109	0.00	0	C	NM_203346		242186244	242186244	-1	no_errors	ENST00000310931	ensembl	human	known	69_37n	missense	53	25.35	18	SNP	1.000	G
HIST1H2AB	8335	genome.wustl.edu	37	6	26033520	26033520	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr6:26033520C>T	ENST00000259791.2	-	1	276	c.277G>A	c.(277-279)Gag>Aag	p.E93K	HIST1H3B_ENST00000244661.2_5'Flank	NM_003513.2	NP_003504.2	P04908	H2A1B_HUMAN	histone cluster 1, H2ab	93						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.E93K(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	8						TTATTAAGCTCCTCGTCATTG	0.577																																						dbGAP											1	Substitution - Missense(1)	breast(1)											79.0	82.0	81.0					6																	26033520		2203	4300	6503	-	-	-	SO:0001583	missense	0			X00089	CCDS4574.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000137259	ENSG00000278463		"""Histones / Replication-dependent"""	4734	protein-coding gene	gene with protein product		602795	"""H2A histone family, member M"", ""histone 1, H2ab"""	H2AFM		9439656, 9119399, 12408966	Standard	NM_003513		Approved	H2A/m	uc003nft.1	P04908	OTTHUMG00000014420	ENST00000259791.2:c.277G>A	6.37:g.26033520C>T	ENSP00000259791:p.Glu93Lys		P28001|Q76P63	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.E93K	ENST00000259791.2	37	c.277	CCDS4574.1	6	.	.	.	.	.	.	.	.	.	.	c	17.71	3.457132	0.63401	.	.	ENSG00000137259	ENST00000259791	T	0.51325	0.71	5.35	5.35	0.76521	Histone-fold (2);Histone H2A (1);	0.000000	0.35646	U	0.003073	T	0.66307	0.2776	.	.	.	0.46011	D	0.998819	D	0.89917	1.0	D	0.91635	0.999	T	0.70022	-0.4986	9	0.87932	D	0	.	18.4224	0.90595	0.0:1.0:0.0:0.0	.	93	P04908	H2A1B_HUMAN	K	93	ENSP00000259791:E93K	ENSP00000259791:E93K	E	-	1	0	HIST1H2AB	26141499	1.000000	0.71417	1.000000	0.80357	0.025000	0.11179	7.493000	0.81493	2.648000	0.89879	0.561000	0.74099	GAG	HIST1H2AB	-	superfamily_Histone-fold,smart_Histone_H2A	ENSG00000137259		0.577	HIST1H2AB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2AB	HGNC	protein_coding	OTTHUMT00000040082.1	40	0.00	0	C	NM_003513		26033520	26033520	-1	no_errors	ENST00000259791	ensembl	human	known	69_37n	missense	19	20.83	5	SNP	1.000	T
HMCN1	83872	genome.wustl.edu	37	1	186113455	186113455	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr1:186113455G>A	ENST00000271588.4	+	90	14304	c.14075G>A	c.(14074-14076)tGc>tAc	p.C4692Y	HMCN1_ENST00000367492.2_Missense_Mutation_p.C4692Y	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4692	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.C4692Y(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						ATGCAAGTTTGCAATGAAAGA	0.378																																						dbGAP											1	Substitution - Missense(1)	breast(1)											126.0	128.0	127.0					1																	186113455		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.14075G>A	1.37:g.186113455G>A	ENSP00000271588:p.Cys4692Tyr		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd,pfam_Thrombospondin_1_rpt,superfamily_Green_fluorescent_prot-like,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like	p.C4692Y	ENST00000271588.4	37	c.14075	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.223250	0.79464	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	D;D	0.96491	-4.03;-4.03	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	D	0.99061	0.9678	H	0.98407	4.225	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99016	1.0816	10	0.87932	D	0	.	19.8788	0.96888	0.0:0.0:1.0:0.0	.	4692	Q96RW7	HMCN1_HUMAN	Y	4692	ENSP00000271588:C4692Y;ENSP00000356462:C4692Y	ENSP00000271588:C4692Y	C	+	2	0	HMCN1	184380078	1.000000	0.71417	0.999000	0.59377	0.788000	0.44548	9.139000	0.94554	2.708000	0.92522	0.650000	0.86243	TGC	HMCN1	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000143341		0.378	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	80	0.00	0	G	NM_031935		186113455	186113455	+1	no_errors	ENST00000271588	ensembl	human	known	69_37n	missense	50	39.76	33	SNP	1.000	A
HLX	3142	genome.wustl.edu	37	1	221054582	221054582	+	Silent	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr1:221054582C>G	ENST00000366903.6	+	2	2140	c.639C>G	c.(637-639)ctC>ctG	p.L213L	HLA-AS1_ENST00000552026.1_RNA|HLX_ENST00000549319.1_5'Flank	NM_021958.3	NP_068777.1	Q14774	HLX_HUMAN	H2.0-like homeobox	213					cell differentiation (GO:0030154)|embryonic digestive tract morphogenesis (GO:0048557)|enteric nervous system development (GO:0048484)|liver development (GO:0001889)|multicellular organismal development (GO:0007275)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|positive regulation of cell proliferation (GO:0008284)|positive regulation of organ growth (GO:0046622)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.L213L(1)		breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(9)|lung(11)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(131;0.00914)		GGGTGCACCTCTCAGGCCTGC	0.572																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											111.0	120.0	117.0					1																	221054582		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC033808	CCDS1527.1	1q41	2011-06-20	2007-07-26	2007-07-26	ENSG00000136630	ENSG00000136630		"""Homeoboxes / ANTP class : NKL subclass"""	4978	protein-coding gene	gene with protein product		142995	"""H2.0 (Drosophila)-like homeo box 1"", ""H2.0-like homeobox 1 (Drosophila)"", ""H2.0-like homeobox 1"""	HLX1		1676597, 7806220	Standard	NM_021958		Approved	HB24	uc001hmv.4	Q14774	OTTHUMG00000037352	ENST00000366903.6:c.639C>G	1.37:g.221054582C>G			B2R8A8|Q15988|Q59HE7|Q9NZ75	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_HTH_motif,prints_Homeobox_metazoa	p.L213	ENST00000366903.6	37	c.639	CCDS1527.1	1																																																																																			HLX	-	NULL	ENSG00000136630		0.572	HLX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLX	HGNC	protein_coding	OTTHUMT00000090902.3	121	0.00	0	C	NM_021958		221054582	221054582	+1	no_errors	ENST00000366903	ensembl	human	known	69_37n	silent	112	15.79	21	SNP	0.927	G
HOXA2	3199	genome.wustl.edu	37	7	27140466	27140466	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr7:27140466G>A	ENST00000222718.5	-	2	1320	c.1010C>T	c.(1009-1011)tCa>tTa	p.S337L	HOTAIRM1_ENST00000428939.3_RNA|HOTAIRM1_ENST00000425358.2_RNA|HOTAIRM1_ENST00000429611.3_RNA|HOTAIRM1_ENST00000593300.1_RNA|HOTAIRM1_ENST00000434063.3_RNA	NM_006735.3	NP_006726.1	O43364	HXA2_HUMAN	homeobox A2	337					anterior/posterior pattern specification (GO:0009952)|brain segmentation (GO:0035284)|cell fate determination (GO:0001709)|dorsal/ventral pattern formation (GO:0009953)|embryonic viscerocranium morphogenesis (GO:0048703)|middle ear morphogenesis (GO:0042474)|motor neuron axon guidance (GO:0008045)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoblast development (GO:0002076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|rhombomere 2 development (GO:0021568)|rhombomere 3 morphogenesis (GO:0021658)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S337L(1)		breast(3)|cervix(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(1)	22						AACTGCATCTGAAAGCTGCAG	0.498																																						dbGAP											1	Substitution - Missense(1)	breast(1)											81.0	81.0	81.0					7																	27140466		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5403.1	7p15.2	2011-06-20	2005-12-22		ENSG00000105996	ENSG00000105996		"""Homeoboxes / ANTP class : HOXL subclass"""	5103	protein-coding gene	gene with protein product		604685	"""homeo box A2"""	HOX1K		1358459	Standard	NM_006735		Approved		uc003syh.3	O43364	OTTHUMG00000023208	ENST00000222718.5:c.1010C>T	7.37:g.27140466G>A	ENSP00000222718:p.Ser337Leu		A1L4K3|B2RMW3	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.S337L	ENST00000222718.5	37	c.1010	CCDS5403.1	7	.	.	.	.	.	.	.	.	.	.	G	21.5	4.156448	0.78114	.	.	ENSG00000105996	ENST00000222718	T	0.12569	2.67	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.39860	0.1094	M	0.85197	2.74	0.80722	D	1	D	0.64830	0.994	P	0.59056	0.851	T	0.45702	-0.9243	10	0.87932	D	0	.	18.386	0.90466	0.0:0.0:1.0:0.0	.	337	O43364	HXA2_HUMAN	L	337	ENSP00000222718:S337L	ENSP00000222718:S337L	S	-	2	0	HOXA2	27106991	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.386000	0.97228	2.492000	0.84095	0.655000	0.94253	TCA	HOXA2	-	NULL	ENSG00000105996		0.498	HOXA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXA2	HGNC	protein_coding	OTTHUMT00000358508.2	50	0.00	0	G			27140466	27140466	-1	no_errors	ENST00000222718	ensembl	human	known	69_37n	missense	22	15.38	4	SNP	1.000	A
HSPA4	3308	genome.wustl.edu	37	5	132403197	132403197	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr5:132403197C>G	ENST00000304858.2	+	3	543	c.254C>G	c.(253-255)tCt>tGt	p.S85C		NM_002154.3	NP_002145.3	P34932	HSP74_HUMAN	heat shock 70kDa protein 4	85					chaperone-mediated protein complex assembly (GO:0051131)|protein import into mitochondrial outer membrane (GO:0045040)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)	p.S85C(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(10)|stomach(1)	32			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GCAGAAAAATCTAACCTTGCA	0.348																																					Colon(114;1299 1588 6063 12302 48757)	dbGAP											1	Substitution - Missense(1)	breast(1)											107.0	104.0	105.0					5																	132403197		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023420	CCDS4166.1	5q31.1	2011-09-07	2002-08-29		ENSG00000170606	ENSG00000170606		"""Heat shock proteins / HSP70"""	5237	protein-coding gene	gene with protein product	"""hsp70 RY"""	601113	"""heat shock 70kD protein 4"""			8335910	Standard	NM_002154		Approved	HS24/P52, HSPH2	uc003kyj.3	P34932	OTTHUMG00000129012	ENST00000304858.2:c.254C>G	5.37:g.132403197C>G	ENSP00000302961:p.Ser85Cys		O95756|Q2TAL4|Q9BUK9	Missense_Mutation	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.S85C	ENST00000304858.2	37	c.254	CCDS4166.1	5	.	.	.	.	.	.	.	.	.	.	C	19.88	3.908330	0.72868	.	.	ENSG00000170606	ENST00000304858;ENST00000321956;ENST00000537974	T	0.01076	5.37	5.97	5.97	0.96955	.	0.385373	0.30859	N	0.008737	T	0.03827	0.0108	M	0.70595	2.14	0.36162	D	0.848157	P	0.45078	0.85	P	0.47786	0.557	T	0.22977	-1.0201	10	0.66056	D	0.02	-7.9699	16.6654	0.85252	0.1302:0.8698:0.0:0.0	.	85	P34932	HSP74_HUMAN	C	85	ENSP00000302961:S85C	ENSP00000302961:S85C	S	+	2	0	HSPA4	132431096	0.799000	0.28903	0.972000	0.41901	0.993000	0.82548	2.418000	0.44662	2.836000	0.97738	0.655000	0.94253	TCT	HSPA4	-	pfam_Hsp_70_fam	ENSG00000170606		0.348	HSPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA4	HGNC	protein_coding	OTTHUMT00000251011.1	214	0.00	0	C	NM_002154, NM_198431		132403197	132403197	+1	no_errors	ENST00000304858	ensembl	human	known	69_37n	missense	130	24.28	42	SNP	0.974	G
HTR2A	3356	genome.wustl.edu	37	13	47409694	47409694	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr13:47409694C>A	ENST00000378688.4	-	3	825	c.694G>T	c.(694-696)Gat>Tat	p.D232Y	HTR2A_ENST00000543956.1_Missense_Mutation_p.D148Y|HTR2A_ENST00000542664.1_Missense_Mutation_p.D232Y			P28223	5HT2A_HUMAN	5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled	232					activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|artery smooth muscle contraction (GO:0014824)|behavioral response to cocaine (GO:0048148)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|memory (GO:0007613)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|positive regulation of vasoconstriction (GO:0045907)|protein localization to cytoskeleton (GO:0044380)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|regulation of hormone secretion (GO:0046883)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|sleep (GO:0030431)|synaptic transmission (GO:0007268)|temperature homeostasis (GO:0001659)|urinary bladder smooth muscle contraction (GO:0014832)	cell body fiber (GO:0070852)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.D232Y(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(10)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36		all_lung(13;7.2e-10)|Lung NSC(96;3.77e-07)|Breast(56;2.06e-05)|Prostate(109;0.00116)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Myeloproliferative disorder(33;0.0333)		GBM - Glioblastoma multiforme(144;4.67e-05)|COAD - Colon adenocarcinoma(199;0.224)	Acepromazine(DB01614)|Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinitapride(DB08810)|Cisapride(DB00604)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyclobenzaprine(DB00924)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Donepezil(DB00843)|Doxepin(DB01142)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Paroxetine(DB00715)|Pergolide(DB01186)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	ACAAAGTTATCATCGGCGAGT	0.433																																						dbGAP											1	Substitution - Missense(1)	breast(1)											80.0	77.0	78.0					13																	47409694		2203	4300	6503	-	-	-	SO:0001583	missense	0			X57830	CCDS9405.1, CCDS53867.1	13q14-q21	2012-08-08	2012-02-03		ENSG00000102468	ENSG00000102468		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5293	protein-coding gene	gene with protein product		182135	"""5-hydroxytryptamine (serotonin) receptor 2A"""	HTR2		8035173	Standard	NM_000621		Approved	5-HT2A	uc010acr.4	P28223	OTTHUMG00000016881	ENST00000378688.4:c.694G>T	13.37:g.47409694C>A	ENSP00000367959:p.Asp232Tyr		B2RAC5|B4DZ79|F5GWE8|Q5T8C0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_5HT2A_rcpt,prints_7TM_GPCR_Rhodpsn,prints_5HT_rcpt	p.D232Y	ENST00000378688.4	37	c.694	CCDS9405.1	13	.	.	.	.	.	.	.	.	.	.	C	15.54	2.863192	0.51482	.	.	ENSG00000102468	ENST00000378688;ENST00000543956;ENST00000542664	T;T;T	0.61980	0.06;0.06;0.06	5.97	5.1	0.69264	GPCR, rhodopsin-like superfamily (1);	0.215462	0.48286	D	0.000196	T	0.75354	0.3838	M	0.74467	2.265	0.38378	D	0.945049	P;P	0.51147	0.942;0.916	P;P	0.57009	0.785;0.811	T	0.79196	-0.1903	10	0.62326	D	0.03	.	16.3978	0.83621	0.0:0.8691:0.1309:0.0	.	148;232	F5GWE8;P28223	.;5HT2A_HUMAN	Y	232;148;232	ENSP00000367959:D232Y;ENSP00000441861:D148Y;ENSP00000437737:D232Y	ENSP00000367959:D232Y	D	-	1	0	HTR2A	46307695	1.000000	0.71417	0.958000	0.39756	0.736000	0.42039	2.020000	0.41010	2.835000	0.97688	0.591000	0.81541	GAT	HTR2A	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000102468		0.433	HTR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR2A	HGNC	protein_coding	OTTHUMT00000044835.3	58	0.00	0	C	NM_000621		47409694	47409694	-1	no_errors	ENST00000378688	ensembl	human	known	69_37n	missense	29	23.68	9	SNP	0.888	A
HUWE1	10075	genome.wustl.edu	37	X	53661226	53661226	+	Missense_Mutation	SNP	A	A	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chrX:53661226A>T	ENST00000342160.3	-	7	986	c.529T>A	c.(529-531)Ttt>Att	p.F177I	HUWE1_ENST00000218328.8_Missense_Mutation_p.F177I|HUWE1_ENST00000262854.6_Missense_Mutation_p.F177I			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	177					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.F177I(2)		NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						GCAAGTCCAAAGCCATTCTCC	0.458																																						dbGAP											2	Substitution - Missense(2)	breast(2)											245.0	186.0	206.0					X																	53661226		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.529T>A	X.37:g.53661226A>T	ENSP00000340648:p.Phe177Ile		O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	pfam_E3_Ub_ligase_DUF913,pfam_HECT,pfam_E3_Ub_ligase_DUF908,pfam_WWE-dom,pfam_UBA/transl_elong_EF1B_N,superfamily_HECT,superfamily_UBA-like,superfamily_ARM-type_fold,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.F177I	ENST00000342160.3	37	c.529	CCDS35301.1	X	.	.	.	.	.	.	.	.	.	.	A	35	5.467484	0.96257	.	.	ENSG00000086758	ENST00000342160;ENST00000262854;ENST00000218328;ENST00000432528	T;T;T	0.66638	1.12;1.12;-0.22	5.78	5.78	0.91487	E3 ubiquitin ligase, domain of unknown function DUF908 (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.78246	0.4253	M	0.68593	2.085	0.58432	D	0.999997	D	0.63880	0.993	P	0.62382	0.901	T	0.80656	-0.1285	10	0.72032	D	0.01	.	13.952	0.64123	1.0:0.0:0.0:0.0	.	177	Q7Z6Z7	HUWE1_HUMAN	I	177	ENSP00000340648:F177I;ENSP00000262854:F177I;ENSP00000218328:F177I	ENSP00000218328:F177I	F	-	1	0	HUWE1	53677951	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.783000	0.91813	1.939000	0.56221	0.481000	0.45027	TTT	HUWE1	-	pfam_E3_Ub_ligase_DUF908,superfamily_ARM-type_fold	ENSG00000086758		0.458	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	HGNC	protein_coding	OTTHUMT00000056766.1	213	0.00	0	A	XM_497119		53661226	53661226	-1	no_errors	ENST00000262854	ensembl	human	known	69_37n	missense	131	30.32	57	SNP	1.000	T
HYDIN	54768	genome.wustl.edu	37	16	70969882	70969882	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr16:70969882C>T	ENST00000393567.2	-	45	7281	c.7131G>A	c.(7129-7131)atG>atA	p.M2377I		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	2377					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.M2328I(1)|p.M2376I(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GAGATTTCTTCATGGGGGGCT	0.522																																						dbGAP											2	Substitution - Missense(2)	breast(2)											2.0	2.0	2.0					16																	70969882		1095	2495	3590	-	-	-	SO:0001583	missense	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.7131G>A	16.37:g.70969882C>T	ENSP00000377197:p.Met2377Ile		A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	superfamily_PapD-like	p.M2376I	ENST00000393567.2	37	c.7128	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	C	10.12	1.261828	0.23051	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.00801	5.68	5.49	-6.32	0.01995	.	2.667490	0.02838	U	0.127618	T	0.00695	0.0023	N	0.08118	0	0.41228	D	0.986558	B	0.06786	0.001	B	0.08055	0.003	T	0.47861	-0.9084	10	0.36615	T	0.2	.	9.4966	0.38993	0.0:0.2213:0.1828:0.5959	.	2376	F8WD23	.	I	2377;2376	ENSP00000377197:M2377I	ENSP00000313052:M2376I	M	-	3	0	HYDIN	69527383	0.000000	0.05858	0.003000	0.11579	0.006000	0.05464	-1.930000	0.01557	-0.958000	0.03622	0.609000	0.83330	ATG	HYDIN	-	NULL	ENSG00000157423		0.522	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	39	0.00	0	C			70969882	70969882	-1	no_errors	ENST00000316490	ensembl	human	known	69_37n	missense	25	21.88	7	SNP	0.000	T
IARS	3376	genome.wustl.edu	37	9	95033329	95033329	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr9:95033329C>G	ENST00000375643.3	-	12	1409	c.1143G>C	c.(1141-1143)ttG>ttC	p.L381F	IARS_ENST00000447699.2_Missense_Mutation_p.L271F|IARS_ENST00000443024.2_Missense_Mutation_p.L381F|IARS_ENST00000375629.3_5'UTR	NM_013417.2	NP_038203.2	P41252	SYIC_HUMAN	isoleucyl-tRNA synthetase	381					gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|osteoblast differentiation (GO:0001649)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)	p.L381F(1)		breast(3)|endometrium(2)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	35					L-Isoleucine(DB00167)	CTTGTTCCTTCAAAGTCCTGA	0.368																																						dbGAP											1	Substitution - Missense(1)	breast(1)											173.0	160.0	165.0					9																	95033329		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB209234	CCDS6694.1	9q21	2011-07-01	2007-02-26		ENSG00000196305	ENSG00000196305	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	5330	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 1, cytoplasmic"""	600709				8812440	Standard	NM_002161		Approved	ILRS, IARS1	uc004aru.4	P41252	OTTHUMG00000020219	ENST00000375643.3:c.1143G>C	9.37:g.95033329C>G	ENSP00000364794:p.Leu381Phe		A8KAE9|Q5TCD0|Q7Z3T4|Q9H588	Missense_Mutation	SNP	pfam_aa-tRNA-synth_Ia,pfam_V/L/I-tRNA-synth_anticodon-bd,pfam_Methionyl/Leucyl_tRNA_Synth,superfamily_Val/Leu/Ile-tRNA-synth_edit,superfamily_tRNAsynth_1a_anticodon-bd,prints_Ile-tRNA-synt,tigrfam_Ile-tRNA-synt	p.L381F	ENST00000375643.3	37	c.1143	CCDS6694.1	9	.	.	.	.	.	.	.	.	.	.	C	19.09	3.760811	0.69763	.	.	ENSG00000196305	ENST00000375643;ENST00000443024;ENST00000447699;ENST00000375660	D;D;D	0.87887	-2.31;-2.31;-2.31	6.08	-1.51	0.08664	Valyl/Leucyl/Isoleucyl-tRNA synthetase, class Ia, editing domain (2);Aminoacyl-tRNA synthetase, class Ia (1);	0.079496	0.53938	D	0.000056	D	0.94486	0.8225	H	0.99104	4.43	0.80722	D	1	D;D	0.59767	0.972;0.986	D;D	0.73380	0.98;0.956	D	0.89359	0.3666	10	0.87932	D	0	-11.3208	3.6961	0.08365	0.0971:0.4318:0.105:0.3661	.	381;226	P41252;Q6P0M4	SYIC_HUMAN;.	F	381;381;271;381	ENSP00000364794:L381F;ENSP00000406448:L381F;ENSP00000415020:L271F	ENSP00000364794:L381F	L	-	3	2	IARS	94073150	0.999000	0.42202	0.608000	0.28969	0.983000	0.72400	0.735000	0.26115	-0.141000	0.11374	-0.345000	0.07892	TTG	IARS	-	pfam_aa-tRNA-synth_Ia,superfamily_Val/Leu/Ile-tRNA-synth_edit,tigrfam_Ile-tRNA-synt	ENSG00000196305		0.368	IARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IARS	HGNC	protein_coding	OTTHUMT00000053059.2	186	0.00	0	C	NM_002161		95033329	95033329	-1	no_errors	ENST00000375643	ensembl	human	known	69_37n	missense	103	32.68	50	SNP	0.993	G
IFNAR1	3454	genome.wustl.edu	37	21	34717589	34717589	+	Silent	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr21:34717589C>T	ENST00000270139.3	+	6	863	c.711C>T	c.(709-711)gtC>gtT	p.V237V	IFNAR1_ENST00000442357.2_Silent_p.V237V|IFNAR1_ENST00000416947.2_Silent_p.V168V	NM_000629.2	NP_000620.2	P17181	INAR1_HUMAN	interferon (alpha, beta and omega) receptor 1	237	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to virus (GO:0009615)|T cell activation (GO:0042110)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	type I interferon receptor activity (GO:0004905)	p.V237V(1)		breast(2)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|skin(2)	14					"""""""Interferon Alfa-2a(DB00034)|""""Interferon Alfa-2b(DB00105)|Interferon alfa-n1(DB00011)|Interferon alfa-n3(DB00018)|Interferon alfacon-1(DB00069)|Interferon beta-1a(DB00060)|Interferon beta-1b(DB00068)|Natural alpha interferon(DB05258)|Peginterferon alfa-2a(DB00008)|Peginterferon alfa-2b(DB00022)"""	ATATAGAAGTCAGTGTCCAAA	0.348																																					Esophageal Squamous(73;817 1211 32990 35667 42746)	dbGAP											1	Substitution - coding silent(1)	breast(1)											110.0	103.0	106.0					21																	34717589		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS13624.1	21q22.1	2008-05-02			ENSG00000142166	ENSG00000142166		"""Interferons"""	5432	protein-coding gene	gene with protein product		107450		IFNAR		8181059	Standard	NM_000629		Approved	IFRC	uc002yrn.3	P17181	OTTHUMG00000065126	ENST00000270139.3:c.711C>T	21.37:g.34717589C>T			B2R6L9|B4DNT3|D3DSF0|Q53GW9|Q53H11|Q6PKD7|Q7M4L2|Q8WTZ2	Silent	SNP	pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3,pirsf_Interferon_alpha/beta_rcpt-1	p.V237	ENST00000270139.3	37	c.711	CCDS13624.1	21																																																																																			IFNAR1	-	superfamily_Fibronectin_type3,pirsf_Interferon_alpha/beta_rcpt-1	ENSG00000142166		0.348	IFNAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNAR1	HGNC	protein_coding	OTTHUMT00000139823.4	288	0.00	0	C			34717589	34717589	+1	no_errors	ENST00000270139	ensembl	human	known	69_37n	silent	170	26.41	61	SNP	0.000	T
IL23R	149233	genome.wustl.edu	37	1	67666482	67666482	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr1:67666482C>G	ENST00000347310.5	+	5	725	c.554C>G	c.(553-555)tCa>tGa	p.S185*	C1orf141_ENST00000371007.2_Intron|IL23R_ENST00000371002.1_Nonsense_Mutation_p.S185*	NM_144701.2	NP_653302.2	Q5VWK5	IL23R_HUMAN	interleukin 23 receptor	185	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|interleukin-23-mediated signaling pathway (GO:0038155)|negative regulation of interleukin-10 production (GO:0032693)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of NK T cell activation (GO:0051135)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat4 protein (GO:0042520)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|regulation of tyrosine phosphorylation of Stat1 protein (GO:0042510)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)	interleukin-23 receptor complex (GO:0072536)|receptor complex (GO:0043235)		p.S185*(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	21						TCCACTGATTCATTACAAGGT	0.368																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											136.0	135.0	135.0					1																	67666482		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF461422	CCDS637.1	1p31.2	2008-02-05			ENSG00000162594	ENSG00000162594			19100	protein-coding gene	gene with protein product		607562				12023369	Standard	NM_144701		Approved	IL-23R	uc001ddo.3	Q5VWK5	OTTHUMG00000009092	ENST00000347310.5:c.554C>G	1.37:g.67666482C>G	ENSP00000321345:p.Ser185*		C9JGX4|Q4VGP1|Q4VGP2|Q4VGP3|Q4VGP4|Q4VGP5|Q4VGP6|Q5VWK7|Q8IW84|Q8NFQ9|Q96AS1	Nonsense_Mutation	SNP	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.S185*	ENST00000347310.5	37	c.554	CCDS637.1	1	.	.	.	.	.	.	.	.	.	.	C	37	6.135089	0.97315	.	.	ENSG00000162594	ENST00000347310;ENST00000431791;ENST00000441823;ENST00000416525;ENST00000540911;ENST00000371002;ENST00000543799	.	.	.	5.95	3.94	0.45596	.	0.627359	0.16381	N	0.216887	.	.	.	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-18.5521	10.9558	0.47356	0.3408:0.6592:0.0:0.0	.	.	.	.	X	185;44;44;44;44;185;140	.	ENSP00000321345:S185X	S	+	2	0	IL23R	67439070	0.032000	0.19561	0.159000	0.22649	0.910000	0.53928	0.970000	0.29383	1.484000	0.48361	0.655000	0.94253	TCA	IL23R	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000162594		0.368	IL23R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL23R	HGNC	protein_coding	OTTHUMT00000025199.2	123	0.00	0	C	NM_144701		67666482	67666482	+1	no_errors	ENST00000347310	ensembl	human	known	69_37n	nonsense	77	15.38	14	SNP	0.005	G
INSR	3643	genome.wustl.edu	37	19	7163183	7163183	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr19:7163183G>A	ENST00000302850.5	-	9	2031	c.1889C>T	c.(1888-1890)tCa>tTa	p.S630L	AC010311.1_ENST00000581768.1_RNA|INSR_ENST00000341500.5_Missense_Mutation_p.S630L	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor	630	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)	p.S630L(2)		breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	GTTAGACACTGAGATTGGATC	0.537																																						dbGAP											2	Substitution - Missense(2)	breast(2)											141.0	150.0	147.0					19																	7163183		2203	4300	6503	-	-	-	SO:0001583	missense	0			M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.1889C>T	19.37:g.7163183G>A	ENSP00000303830:p.Ser630Leu		Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Missense_Mutation	SNP	pirsf_Tyr_kinase_insulin-like_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,superfamily_Fibronectin_type3,smart_Furin_repeat,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom	p.S630L	ENST00000302850.5	37	c.1889	CCDS12176.1	19	.	.	.	.	.	.	.	.	.	.	G	17.60	3.430683	0.62844	.	.	ENSG00000171105	ENST00000302850;ENST00000341500	T;T	0.74632	-0.86;-0.86	4.45	4.45	0.53987	Fibronectin, type III (3);	0.000000	0.38272	U	0.001745	D	0.85457	0.5701	M	0.85299	2.745	0.58432	D	0.999999	P;D;D	0.65815	0.948;0.995;0.981	P;D;P	0.64237	0.608;0.923;0.711	D	0.85800	0.1373	10	0.35671	T	0.21	.	14.9538	0.71094	0.0:0.0:1.0:0.0	.	621;630;630	Q86WY9;P06213-2;P06213	.;.;INSR_HUMAN	L	630	ENSP00000303830:S630L;ENSP00000342838:S630L	ENSP00000303830:S630L	S	-	2	0	INSR	7114183	1.000000	0.71417	0.841000	0.33234	0.277000	0.26821	7.588000	0.82629	2.178000	0.69098	0.655000	0.94253	TCA	INSR	-	pirsf_Tyr_kinase_insulin-like_rcpt,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000171105		0.537	INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INSR	HGNC	protein_coding	OTTHUMT00000458544.1	133	0.00	0	G			7163183	7163183	-1	no_errors	ENST00000302850	ensembl	human	known	69_37n	missense	78	22.77	23	SNP	0.996	A
KAL1	3730	genome.wustl.edu	37	X	8591691	8591691	+	Missense_Mutation	SNP	T	T	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chrX:8591691T>G	ENST00000262648.3	-	3	425	c.276A>C	c.(274-276)gaA>gaC	p.E92D		NM_000216.2	NP_000207.2	P23352	KALM_HUMAN	Kallmann syndrome 1 sequence	92					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)	extracellular space (GO:0005615)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.E92D(1)		breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|liver(1)|lung(6)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(1)	32						GGTCCCCTGATTCCTTGCAGG	0.428																																						dbGAP											1	Substitution - Missense(1)	breast(1)											111.0	81.0	92.0					X																	8591691		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14130.1	Xp22.32	2013-02-11			ENSG00000011201	ENSG00000011201		"""WAP four-disulfide core domain containing"", ""Fibronectin type III domain containing"""	6211	protein-coding gene	gene with protein product	"""anosmin-1"", ""WAP four-disulfide core domain 19"""	300836		KAL, ADMLX		11463336	Standard	NM_000216		Approved	KALIG-1, WFDC19	uc004csf.3	P23352	OTTHUMG00000021107	ENST00000262648.3:c.276A>C	X.37:g.8591691T>G	ENSP00000262648:p.Glu92Asp		B2RPF8	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Whey_acidic_protein_4-diS_core,superfamily_Fibronectin_type3,superfamily_Whey_acidic_protein_4-diS_core,smart_Whey_acidic_protein_4-diS_core,smart_Fibronectin_type3,pfscan_Fibronectin_type3,prints_4-disulphide_core	p.E92D	ENST00000262648.3	37	c.276	CCDS14130.1	X	.	.	.	.	.	.	.	.	.	.	T	5.308	0.242154	0.10077	.	.	ENSG00000011201	ENST00000262648	T	0.77098	-1.07	4.55	-8.54	0.00912	.	0.484729	0.22760	N	0.055979	T	0.58666	0.2138	L	0.51422	1.61	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.40156	-0.9578	10	0.46703	T	0.11	.	1.576	0.02624	0.1169:0.2804:0.2542:0.3484	.	92	P23352	KALM_HUMAN	D	92	ENSP00000262648:E92D	ENSP00000262648:E92D	E	-	3	2	KAL1	8551691	1.000000	0.71417	0.001000	0.08648	0.215000	0.24574	0.346000	0.19997	-2.426000	0.00560	-0.371000	0.07208	GAA	KAL1	-	NULL	ENSG00000011201		0.428	KAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAL1	HGNC	protein_coding	OTTHUMT00000055692.1	219	0.00	0	T	NM_000216		8591691	8591691	-1	no_errors	ENST00000262648	ensembl	human	known	69_37n	missense	118	27.16	44	SNP	0.007	G
KCNH5	27133	genome.wustl.edu	37	14	63473099	63473099	+	Silent	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr14:63473099G>A	ENST00000322893.7	-	3	557	c.289C>T	c.(289-291)Ctg>Ttg	p.L97L	KCNH5_ENST00000394968.1_Silent_p.L39L|KCNH5_ENST00000420622.2_Silent_p.L97L|KCNH5_ENST00000394964.2_Silent_p.L39L	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	97	PAC. {ECO:0000255|PROSITE- ProRule:PRU00141}.				potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.L97L(1)|p.L39L(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		TTCTTGTACAGAAGAACTTCA	0.358																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											92.0	90.0	91.0					14																	63473099		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.289C>T	14.37:g.63473099G>A			C9JP98	Silent	SNP	pfam_Ion_trans_dom,pfam_Ion_trans_2,pfam_cNMP-bd_dom,pfam_PAS_fold,superfamily_cNMP-bd-like,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS-assoc_C,tigrfam_PAS	p.L97	ENST00000322893.7	37	c.289	CCDS9756.1	14																																																																																			KCNH5	-	pfam_PAS_fold,smart_PAC,pfscan_PAS-assoc_C,tigrfam_PAS	ENSG00000140015		0.358	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH5	HGNC	protein_coding	OTTHUMT00000411747.1	237	0.00	0	G	NM_139318		63473099	63473099	-1	no_errors	ENST00000322893	ensembl	human	known	69_37n	silent	142	23.24	43	SNP	1.000	A
KIAA0196	9897	genome.wustl.edu	37	8	126073342	126073342	+	Silent	SNP	C	C	T	rs189993679		TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr8:126073342C>T	ENST00000318410.7	-	12	1852	c.1503G>A	c.(1501-1503)ctG>ctA	p.L501L	KIAA0196_ENST00000517845.1_Silent_p.L353L	NM_014846.3	NP_055661.3	Q12768	STRUM_HUMAN	KIAA0196	501					cell death (GO:0008219)|endosomal transport (GO:0016197)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|WASH complex (GO:0071203)		p.L501L(1)		NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	42	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			AAGCTTGTATCAGTTGTACAG	0.383																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											91.0	81.0	84.0					8																	126073342		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0				CCDS6355.1	8q24.13	2014-05-09			ENSG00000164961	ENSG00000164961			28984	protein-coding gene	gene with protein product	"""strumpellin"""	610657	"""spastic paraplegia 8 (autosomal dominant)"""	SPG8		9973294, 17160902, 23085491	Standard	NM_014846		Approved		uc003yrt.3	Q12768	OTTHUMG00000164991	ENST00000318410.7:c.1503G>A	8.37:g.126073342C>T			A8K4R7|Q3KQX5|Q8TBQ2	Silent	SNP	pfam_WASH_strumpellin,superfamily_Ig_E-set	p.L501	ENST00000318410.7	37	c.1503	CCDS6355.1	8																																																																																			KIAA0196	-	pfam_WASH_strumpellin	ENSG00000164961		0.383	KIAA0196-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0196	HGNC	protein_coding	OTTHUMT00000381369.1	229	0.00	0	C	NM_014846		126073342	126073342	-1	no_errors	ENST00000318410	ensembl	human	known	69_37n	silent	155	16.22	30	SNP	0.949	T
KIF13A	63971	genome.wustl.edu	37	6	17855684	17855684	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr6:17855684G>C	ENST00000259711.6	-	6	583	c.478C>G	c.(478-480)Ctt>Gtt	p.L160V	KIF13A_ENST00000378826.2_Missense_Mutation_p.L160V|KIF13A_ENST00000378814.5_Missense_Mutation_p.L160V|KIF13A_ENST00000378843.2_Missense_Mutation_p.L160V|KIF13A_ENST00000378816.5_Missense_Mutation_p.L160V	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	160	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.L160V(2)		breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			GGGTCTAAAAGATCCCGAACT	0.328																																						dbGAP											2	Substitution - Missense(2)	breast(2)											65.0	66.0	66.0					6																	17855684		1804	4069	5873	-	-	-	SO:0001583	missense	0			AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.478C>G	6.37:g.17855684G>C	ENSP00000259711:p.Leu160Val		A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_KIF1B,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.L160V	ENST00000259711.6	37	c.478	CCDS47381.1	6	.	.	.	.	.	.	.	.	.	.	G	28.6	4.937049	0.92458	.	.	ENSG00000137177	ENST00000378814;ENST00000259711;ENST00000378826;ENST00000378843;ENST00000378816	D;D;D;D;D	0.97114	-4.25;-4.25;-4.25;-4.25;-4.25	5.86	5.86	0.93980	Kinesin, motor domain (4);	0.000000	0.85682	D	0.000000	D	0.99211	0.9726	H	0.97315	3.98	0.80722	D	1	D;D;D;D	0.89917	1.0;0.997;1.0;0.997	D;D;D;D	0.97110	1.0;0.995;1.0;0.995	D	0.99007	1.0813	10	0.87932	D	0	.	20.1802	0.98196	0.0:0.0:1.0:0.0	.	160;160;160;160	Q9H1H9-4;Q9H1H9-2;Q9H1H9;Q9H1H9-3	.;.;KI13A_HUMAN;.	V	160	ENSP00000368091:L160V;ENSP00000259711:L160V;ENSP00000368103:L160V;ENSP00000368120:L160V;ENSP00000368093:L160V	ENSP00000259711:L160V	L	-	1	0	KIF13A	17963663	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.777000	0.95525	0.655000	0.94253	CTT	KIF13A	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000137177		0.328	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF13A	HGNC	protein_coding	OTTHUMT00000039954.4	112	0.00	0	G			17855684	17855684	-1	no_errors	ENST00000259711	ensembl	human	known	69_37n	missense	65	25.29	22	SNP	1.000	C
KIF4A	24137	genome.wustl.edu	37	X	69615617	69615617	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chrX:69615617G>C	ENST00000374403.3	+	21	2411	c.2329G>C	c.(2329-2331)Gat>Cat	p.D777H	KIF4A_ENST00000374388.3_Missense_Mutation_p.D777H|RNY4P23_ENST00000364507.1_RNA	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	777	Interaction with PRC1.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)	p.D777H(1)		breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						CCTGGCTCAAGATGTGGCTCA	0.433																																						dbGAP											1	Substitution - Missense(1)	breast(1)											69.0	63.0	65.0					X																	69615617		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.2329G>C	X.37:g.69615617G>C	ENSP00000363524:p.Asp777His		B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.D777H	ENST00000374403.3	37	c.2329	CCDS14401.1	X	.	.	.	.	.	.	.	.	.	.	g	26.0	4.690928	0.88735	.	.	ENSG00000090889	ENST00000374388;ENST00000374403;ENST00000544650	T;T	0.70164	-0.46;-0.41	5.3	5.3	0.74995	.	0.090322	0.48286	D	0.000193	T	0.64260	0.2582	N	0.20685	0.6	0.51482	D	0.999927	D	0.63880	0.993	P	0.54431	0.752	T	0.63028	-0.6728	9	.	.	.	.	16.9292	0.86186	0.0:0.0:1.0:0.0	.	777	O95239	KIF4A_HUMAN	H	777;777;79	ENSP00000363509:D777H;ENSP00000363524:D777H	.	D	+	1	0	KIF4A	69532342	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	8.822000	0.92013	2.464000	0.83262	0.591000	0.81541	GAT	KIF4A	-	NULL	ENSG00000090889		0.433	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF4A	HGNC	protein_coding	OTTHUMT00000057068.1	109	0.00	0	G	NM_012310		69615617	69615617	+1	no_errors	ENST00000374403	ensembl	human	known	69_37n	missense	83	23.15	25	SNP	1.000	C
KIF5B	3799	genome.wustl.edu	37	10	32322814	32322814	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr10:32322814C>A	ENST00000302418.4	-	12	1721	c.1264G>T	c.(1264-1266)Gaa>Taa	p.E422*		NM_004521.2	NP_004512.1	P33176	KINH_HUMAN	kinesin family member 5B	422					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cellular protein metabolic process (GO:0044267)|cytoplasm organization (GO:0007028)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|regulation of membrane potential (GO:0042391)|stress granule disassembly (GO:0035617)|vesicle transport along microtubule (GO:0047496)	ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|vesicle (GO:0031982)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)	p.E422*(1)	KIF5B/ALK(8)|KIF5B/RET(79)	NS(2)|breast(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)	35		Prostate(175;0.0137)				ATTTCTTCTTCACACTTTCTT	0.338			T	"""RET, ALK"""	NSCLC																																	dbGAP		Dom	yes		10	10p11.22	3799	kinesin family member 5B		E	1	Substitution - Nonsense(1)	breast(1)											172.0	163.0	166.0					10																	32322814		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			X65873	CCDS7171.1	10p11.22	2007-02-13			ENSG00000170759	ENSG00000170759		"""Kinesins"""	6324	protein-coding gene	gene with protein product		602809		KNS1		1607388	Standard	NM_004521		Approved	KNS	uc001iwe.4	P33176	OTTHUMG00000017913	ENST00000302418.4:c.1264G>T	10.37:g.32322814C>A	ENSP00000307078:p.Glu422*		A0AVB2|Q5VZ85	Nonsense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E422*	ENST00000302418.4	37	c.1264	CCDS7171.1	10	.	.	.	.	.	.	.	.	.	.	C	42	9.467548	0.99180	.	.	ENSG00000170759	ENST00000302418	.	.	.	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	17.9923	0.89172	0.0:1.0:0.0:0.0	.	.	.	.	X	422	.	ENSP00000307078:E422X	E	-	1	0	KIF5B	32362820	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.792000	0.85828	2.236000	0.73375	0.460000	0.39030	GAA	KIF5B	-	NULL	ENSG00000170759		0.338	KIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF5B	HGNC	protein_coding	OTTHUMT00000047467.1	398	0.00	0	C	NM_004521		32322814	32322814	-1	no_errors	ENST00000302418	ensembl	human	known	69_37n	nonsense	287	22.22	82	SNP	1.000	A
KRT84	3890	genome.wustl.edu	37	12	52778990	52778990	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr12:52778990C>G	ENST00000257951.3	-	1	446	c.380G>C	c.(379-381)gGa>gCa	p.G127A	RP3-416H24.4_ENST00000547174.1_RNA	NM_033045.3	NP_149034.2	Q9NSB2	KRT84_HUMAN	keratin 84	127	Head.				hair follicle development (GO:0001942)|nail development (GO:0035878)|regulation of keratinocyte differentiation (GO:0045616)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of epidermis (GO:0030280)	p.G127A(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(1)|lung(10)|skin(3)	27	all_hematologic(5;0.12)			BRCA - Breast invasive adenocarcinoma(357;0.189)		TCCAACCCCTCCAACTCTGTA	0.587																																						dbGAP											1	Substitution - Missense(1)	breast(1)											168.0	164.0	166.0					12																	52778990		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y19209	CCDS8825.1	12q13	2013-06-25	2006-07-17	2006-07-17	ENSG00000161849	ENSG00000161849		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6461	protein-coding gene	gene with protein product	"""hard keratin type II 4"""	602766	"""keratin, hair, basic, 4"""	KRTHB4		2431943, 16831889	Standard	NM_033045		Approved	Hb-4	uc001sah.1	Q9NSB2	OTTHUMG00000169634	ENST00000257951.3:c.380G>C	12.37:g.52778990C>G	ENSP00000257951:p.Gly127Ala		B2RA43|Q6ISB0|Q701L6	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II,prints_Keratin_I	p.G127A	ENST00000257951.3	37	c.380	CCDS8825.1	12	.	.	.	.	.	.	.	.	.	.	C	18.17	3.564618	0.65651	.	.	ENSG00000161849	ENST00000257951	D	0.95656	-3.77	5.15	5.15	0.70609	.	0.000000	0.48767	D	0.000178	D	0.97589	0.9210	M	0.80332	2.49	0.50632	D	0.999883	D	0.89917	1.0	D	0.87578	0.998	D	0.96764	0.9563	10	0.37606	T	0.19	.	17.7465	0.88422	0.0:1.0:0.0:0.0	.	127	Q9NSB2	KRT84_HUMAN	A	127	ENSP00000257951:G127A	ENSP00000257951:G127A	G	-	2	0	KRT84	51065257	0.115000	0.22152	0.999000	0.59377	0.694000	0.40290	2.684000	0.46951	2.849000	0.98006	0.609000	0.83330	GGA	KRT84	-	NULL	ENSG00000161849		0.587	KRT84-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT84	HGNC	protein_coding	OTTHUMT00000405187.1	70	0.00	0	C	NM_033045		52778990	52778990	-1	no_errors	ENST00000257951	ensembl	human	known	69_37n	missense	57	14.93	10	SNP	1.000	G
KRT71	112802	genome.wustl.edu	37	12	52943869	52943869	+	Silent	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr12:52943869C>T	ENST00000267119.5	-	2	669	c.600G>A	c.(598-600)gtG>gtA	p.V200V		NM_033448.2	NP_258259.1	Q3SY84	K2C71_HUMAN	keratin 71	200	Coil 1B.|Rod.				hair follicle morphogenesis (GO:0031069)|intermediate filament organization (GO:0045109)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.V200V(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	22				BRCA - Breast invasive adenocarcinoma(357;0.194)		AGTCCAGCCTCACCCTGTCCC	0.587																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											187.0	167.0	174.0					12																	52943869		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ308600	CCDS8831.1	12q13.13	2013-01-16			ENSG00000139648	ENSG00000139648		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28927	protein-coding gene	gene with protein product		608245				11982755, 12648212, 16831889	Standard	NM_033448		Approved	KRT6IRS, KRT6IRS1, K6IRS1	uc001sao.3	Q3SY84	OTTHUMG00000167831	ENST00000267119.5:c.600G>A	12.37:g.52943869C>T			B3KVC1|Q3SY85|Q96DU2	Silent	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.V200	ENST00000267119.5	37	c.600	CCDS8831.1	12																																																																																			KRT71	-	pfam_F	ENSG00000139648		0.587	KRT71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT71	HGNC	protein_coding	OTTHUMT00000396487.1	101	0.00	0	C	NM_033448		52943869	52943869	-1	no_errors	ENST00000267119	ensembl	human	known	69_37n	silent	76	24.00	24	SNP	0.940	T
KTN1	3895	genome.wustl.edu	37	14	56116507	56116507	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr14:56116507C>T	ENST00000395314.3	+	22	2449	c.2381C>T	c.(2380-2382)tCt>tTt	p.S794F	KTN1_ENST00000438792.2_Missense_Mutation_p.S794F|Y_RNA_ENST00000363872.1_RNA|KTN1_ENST00000554507.1_Missense_Mutation_p.S89F|KTN1_ENST00000395308.1_Missense_Mutation_p.S794F|KTN1_ENST00000395309.3_Missense_Mutation_p.S794F|KTN1_ENST00000395311.1_Missense_Mutation_p.S794F|KTN1_ENST00000416613.1_Missense_Mutation_p.S794F|KTN1_ENST00000413890.2_Missense_Mutation_p.S794F	NM_001079521.1	NP_001072989.1	Q86UP2	KTN1_HUMAN	kinectin 1 (kinesin receptor)	794					microtubule-based movement (GO:0007018)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.S794F(1)		breast(4)|central_nervous_system(1)|large_intestine(8)|lung(1)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	19						TCTTTTGCCTCTCTAGTTGAA	0.303			T	RET	papillary thryoid																																	dbGAP		Dom	yes		14	14q22.1	3895	kinectin 1 (kinesin receptor)		E	1	Substitution - Missense(1)	breast(1)											96.0	90.0	92.0					14																	56116507		2202	4294	6496	-	-	-	SO:0001583	missense	0				CCDS41957.1, CCDS41958.1, CCDS41959.1	14q22.1	2008-05-02			ENSG00000126777	ENSG00000126777			6467	protein-coding gene	gene with protein product		600381				9605849	Standard	NM_001079521		Approved	KIAA0004, CG1	uc001xcc.3	Q86UP2	OTTHUMG00000140312	ENST00000395314.3:c.2381C>T	14.37:g.56116507C>T	ENSP00000378725:p.Ser794Phe		B4DZ88|Q13999|Q14707|Q15387|Q17RZ5|Q5GGW3|Q86W57	Missense_Mutation	SNP	NULL	p.S794F	ENST00000395314.3	37	c.2381	CCDS41957.1	14	.	.	.	.	.	.	.	.	.	.	C	18.16	3.562461	0.65538	.	.	ENSG00000126777	ENST00000413890;ENST00000395309;ENST00000438792;ENST00000395314;ENST00000395308;ENST00000395311;ENST00000416613;ENST00000554507;ENST00000554890	T;T;T;T;T;T;T;T	0.50548	1.3;1.32;1.3;1.32;1.3;1.3;1.32;0.74	5.02	5.02	0.67125	.	0.316812	0.22598	N	0.057997	T	0.65101	0.2659	M	0.67397	2.05	0.42547	D	0.993092	P;P;P;P;P	0.49696	0.901;0.927;0.81;0.699;0.901	P;P;P;P;P	0.57846	0.82;0.828;0.632;0.694;0.784	T	0.68538	-0.5382	10	0.66056	D	0.02	-1.4011	18.7053	0.91635	0.0:1.0:0.0:0.0	.	794;89;794;794;794	B4DZ88;G3V4Y7;Q86UP2-2;Q17RZ5;Q86UP2	.;.;.;.;KTN1_HUMAN	F	794;794;794;794;794;794;794;89;80	ENSP00000394992:S794F;ENSP00000378720:S794F;ENSP00000391964:S794F;ENSP00000378725:S794F;ENSP00000378719:S794F;ENSP00000378722:S794F;ENSP00000388807:S794F;ENSP00000452073:S89F	ENSP00000378719:S794F	S	+	2	0	KTN1	55186260	0.995000	0.38212	1.000000	0.80357	0.542000	0.35054	5.072000	0.64389	2.475000	0.83589	0.467000	0.42956	TCT	KTN1	-	NULL	ENSG00000126777		0.303	KTN1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KTN1	HGNC	protein_coding	OTTHUMT00000276912.2	330	0.00	0	C			56116507	56116507	+1	no_errors	ENST00000395309	ensembl	human	known	69_37n	missense	283	14.24	47	SNP	0.999	T
LAIR1	3903	genome.wustl.edu	37	19	54871673	54871673	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr19:54871673G>C	ENST00000391742.2	-	4	523	c.371C>G	c.(370-372)tCt>tGt	p.S124C	LAIR1_ENST00000434277.2_Missense_Mutation_p.S123C|LAIR1_ENST00000463489.1_5'UTR|LAIR1_ENST00000474878.1_Intron|LAIR1_ENST00000348231.4_Intron|LAIR1_ENST00000313038.6_Missense_Mutation_p.S117C|LAIR1_ENST00000391743.3_Missense_Mutation_p.S106C			Q6GTX8	LAIR1_HUMAN	leukocyte-associated immunoglobulin-like receptor 1	124					immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S124C(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(9)|ovary(4)|prostate(1)|stomach(3)	26	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0573)		CGGGCCTCCAGAGGTTTCTGT	0.617																																						dbGAP											1	Substitution - Missense(1)	breast(1)											64.0	68.0	67.0					19																	54871673		2189	4298	6487	-	-	-	SO:0001583	missense	0			AF013249	CCDS12891.1, CCDS12892.1, CCDS74448.1, CCDS74449.1, CCDS74450.1	19q13.4	2013-01-29	2006-03-23		ENSG00000167613	ENSG00000167613		"""Leukocyte-associated Ig like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6477	protein-coding gene	gene with protein product		602992	"""leukocyte-associated Ig-like receptor 1"""			9285412	Standard	XM_005258924		Approved	CD305	uc002qfk.1	Q6GTX8	OTTHUMG00000065545	ENST00000391742.2:c.371C>G	19.37:g.54871673G>C	ENSP00000375622:p.Ser124Cys			Missense_Mutation	SNP	smart_Ig_sub	p.S124C	ENST00000391742.2	37	c.371	CCDS12891.1	19	.	.	.	.	.	.	.	.	.	.	.	6.285	0.420769	0.11928	.	.	ENSG00000167613	ENST00000391743;ENST00000391742;ENST00000434277;ENST00000313038;ENST00000444687	T;T;T;T;T	0.59224	6.77;6.84;6.86;6.81;0.28	1.95	-1.84	0.07809	.	.	.	.	.	T	0.57577	0.2063	L	0.60455	1.87	0.09310	N	1	P;D;P;P	0.56287	0.931;0.975;0.913;0.931	P;P;B;B	0.55161	0.77;0.555;0.339;0.416	T	0.50276	-0.8847	9	0.62326	D	0.03	.	2.1457	0.03787	0.3332:0.0:0.4175:0.2493	.	124;106;123;124	Q6GTX8-4;A8MZ84;D3YTC8;Q6GTX8	.;.;.;LAIR1_HUMAN	C	106;124;123;117;14	ENSP00000375623:S106C;ENSP00000375622:S124C;ENSP00000391003:S123C;ENSP00000319204:S117C;ENSP00000392722:S14C	ENSP00000319204:S117C	S	-	2	0	LAIR1	59563485	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.788000	0.04614	-0.333000	0.08476	0.479000	0.44913	TCT	LAIR1	-	NULL	ENSG00000167613		0.617	LAIR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAIR1	HGNC	protein_coding	OTTHUMT00000140506.1	108	0.00	0	G			54871673	54871673	-1	no_errors	ENST00000391742	ensembl	human	known	69_37n	missense	78	15.22	14	SNP	0.000	C
LAMC1	3915	genome.wustl.edu	37	1	183094653	183094653	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr1:183094653C>G	ENST00000258341.4	+	15	3026	c.2769C>G	c.(2767-2769)ttC>ttG	p.F923L	LAMC1_ENST00000466964.1_3'UTR	NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	923	Laminin EGF-like 9. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.F923L(1)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						ACCCTGGATTCTACAATCTGC	0.473																																						dbGAP											1	Substitution - Missense(1)	breast(1)											138.0	106.0	117.0					1																	183094653		2203	4300	6503	-	-	-	SO:0001583	missense	0			J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.2769C>G	1.37:g.183094653C>G	ENSP00000258341:p.Phe923Leu		Q5VYE7	Missense_Mutation	SNP	pfam_Laminin_N,pfam_EGF_laminin,pfam_Laminin_B_type_IV,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.F923L	ENST00000258341.4	37	c.2769	CCDS1351.1	1	.	.	.	.	.	.	.	.	.	.	C	17.68	3.448382	0.63178	.	.	ENSG00000135862	ENST00000258341	T	0.63913	-0.07	5.51	5.51	0.81932	EGF-like, laminin (4);	0.137168	0.64402	D	0.000002	T	0.71298	0.3323	M	0.93016	3.37	0.80722	D	1	B	0.29136	0.234	B	0.30029	0.11	T	0.74904	-0.3505	10	0.62326	D	0.03	.	13.677	0.62460	0.0:0.926:0.0:0.074	.	923	P11047	LAMC1_HUMAN	L	923	ENSP00000258341:F923L	ENSP00000258341:F923L	F	+	3	2	LAMC1	181361276	1.000000	0.71417	1.000000	0.80357	0.581000	0.36288	4.430000	0.59907	2.583000	0.87209	0.563000	0.77884	TTC	LAMC1	-	pfam_EGF_laminin,smart_EGF_laminin,pfscan_EGF_laminin	ENSG00000135862		0.473	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC1	HGNC	protein_coding	OTTHUMT00000085954.2	52	0.00	0	C	NM_002293		183094653	183094653	+1	no_errors	ENST00000258341	ensembl	human	known	69_37n	missense	62	17.33	13	SNP	1.000	G
LMAN2	10960	genome.wustl.edu	37	5	176778543	176778543	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr5:176778543G>C	ENST00000303127.7	-	1	310	c.106C>G	c.(106-108)Ctt>Gtt	p.L36V	LMAN2_ENST00000515209.1_Missense_Mutation_p.L36V|LMAN2_ENST00000506310.1_5'UTR	NM_006816.2	NP_006807.1	Q12907	LMAN2_HUMAN	lectin, mannose-binding 2	36					positive regulation of phagocytosis (GO:0050766)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|glycoprotein binding (GO:0001948)|heat shock protein binding (GO:0031072)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)	p.L36V(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|upper_aerodigestive_tract(1)	16	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AACAACAAAAGAAGAAAGAGA	0.602																																						dbGAP											1	Substitution - Missense(1)	breast(1)											54.0	54.0	54.0					5																	176778543		2203	4300	6503	-	-	-	SO:0001583	missense	0			U10362	CCDS4417.1	5q35	2008-02-05		2003-07-04	ENSG00000169223	ENSG00000169223			16986	protein-coding gene	gene with protein product		609551	"""chromosome 5 open reading frame 8"""	C5orf8		12609988	Standard	NM_006816		Approved	GP36B, VIP36	uc003mge.3	Q12907	OTTHUMG00000130860	ENST00000303127.7:c.106C>G	5.37:g.176778543G>C	ENSP00000303366:p.Leu36Val		Q53HH1	Missense_Mutation	SNP	pfam_Lectin_leg,superfamily_ConA-like_lec_gl	p.L36V	ENST00000303127.7	37	c.106	CCDS4417.1	5	.	.	.	.	.	.	.	.	.	.	G	5.261	0.233593	0.09969	.	.	ENSG00000169223	ENST00000303127;ENST00000515209;ENST00000514458;ENST00000502560	T;T;T;T	0.68181	-0.26;-0.29;-0.31;-0.27	5.35	2.58	0.30949	.	0.532223	0.18500	N	0.139398	T	0.39963	0.1098	N	0.08118	0	0.09310	N	1	B;B	0.28880	0.226;0.141	B;B	0.25884	0.064;0.022	T	0.19095	-1.0316	10	0.22706	T	0.39	.	7.4223	0.27079	0.0777:0.0:0.6264:0.2959	.	36;36	Q12907;D6RBV2	LMAN2_HUMAN;.	V	36	ENSP00000303366:L36V;ENSP00000423998:L36V;ENSP00000424132:L36V;ENSP00000425229:L36V	ENSP00000303366:L36V	L	-	1	0	LMAN2	176711149	0.000000	0.05858	0.012000	0.15200	0.083000	0.17756	0.031000	0.13710	0.385000	0.24970	-0.182000	0.12963	CTT	LMAN2	-	NULL	ENSG00000169223		0.602	LMAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMAN2	HGNC	protein_coding	OTTHUMT00000253434.1	38	0.00	0	G	NM_006816		176778543	176778543	-1	no_errors	ENST00000303127	ensembl	human	known	69_37n	missense	20	16.67	4	SNP	0.129	C
LPO	4025	genome.wustl.edu	37	17	56321423	56321423	+	Missense_Mutation	SNP	T	T	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr17:56321423T>G	ENST00000262290.4	+	3	461	c.145T>G	c.(145-147)Ttc>Gtc	p.F49V	LPO_ENST00000582328.1_Intron|LPO_ENST00000421678.2_Intron|LPO_ENST00000543544.1_Intron	NM_006151.2	NP_006142.1	P22079	PERL_HUMAN	lactoperoxidase	49					defense response to bacterium (GO:0042742)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|hydrogen peroxide catabolic process (GO:0042744)|response to oxidative stress (GO:0006979)|thiocyanate metabolic process (GO:0018969)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|thiocyanate peroxidase activity (GO:0036393)	p.F49V(1)		breast(5)|cervix(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30						CAACAAGGCCTTCCTGGACTC	0.547																																						dbGAP											1	Substitution - Missense(1)	breast(1)											146.0	108.0	121.0					17																	56321423		2203	4300	6503	-	-	-	SO:0001583	missense	0			M58151	CCDS32689.1, CCDS54149.1	17q23.1	2008-02-05				ENSG00000167419	1.11.1.7		6678	protein-coding gene	gene with protein product		150205				2222811, 8964511	Standard	NM_006151		Approved	SPO	uc002ivt.3	P22079		ENST00000262290.4:c.145T>G	17.37:g.56321423T>G	ENSP00000262290:p.Phe49Val		A5JUY4|E7EMJ3|Q13408|Q3KNQ2	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.F49V	ENST00000262290.4	37	c.145	CCDS32689.1	17	.	.	.	.	.	.	.	.	.	.	T	20.5	3.998201	0.74818	.	.	ENSG00000167419	ENST00000262290	T	0.70045	-0.45	5.23	5.23	0.72850	.	0.151460	0.43416	N	0.000564	T	0.69196	0.3084	M	0.68952	2.095	0.80722	D	1	D	0.55605	0.972	P	0.49752	0.621	T	0.67848	-0.5564	10	0.26408	T	0.33	.	11.7952	0.52096	0.0:0.0:0.0:1.0	.	49	P22079	PERL_HUMAN	V	49	ENSP00000262290:F49V	ENSP00000262290:F49V	F	+	1	0	LPO	53676422	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.592000	0.53993	2.099000	0.63709	0.459000	0.35465	TTC	LPO	-	NULL	ENSG00000167419		0.547	LPO-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LPO	HGNC	protein_coding	OTTHUMT00000443961.1	36	0.00	0	T			56321423	56321423	+1	no_errors	ENST00000262290	ensembl	human	known	69_37n	missense	70	19.54	17	SNP	1.000	G
LRRFIP1	9208	genome.wustl.edu	37	2	238664814	238664814	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr2:238664814G>C	ENST00000392000.4	+	9	848	c.731G>C	c.(730-732)aGa>aCa	p.R244T	LRRFIP1_ENST00000308482.9_Missense_Mutation_p.R372T|LRRFIP1_ENST00000244815.5_Missense_Mutation_p.R220T|LRRFIP1_ENST00000289175.6_Missense_Mutation_p.R188T	NM_001137552.1	NP_001131024.1	Q32MZ4	LRRF1_HUMAN	leucine rich repeat (in FLII) interacting protein 1	244					innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|protein homodimerization activity (GO:0042803)	p.R372T(1)|p.R244T(1)|p.R220T(1)		NS(1)|breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	29		Breast(86;0.00257)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;9.75e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.01e-10)|Kidney(56;4.85e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.31e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000151)|Lung(119;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0325)|COAD - Colon adenocarcinoma(134;0.228)		CTGAAGCAAAGAGAGGAAATG	0.433																																						dbGAP											3	Substitution - Missense(3)	breast(3)											54.0	53.0	53.0					2																	238664814		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ223075	CCDS2521.1, CCDS46551.1, CCDS46552.1, CCDS46553.1	2q37.3	2010-09-30			ENSG00000124831	ENSG00000124831			6702	protein-coding gene	gene with protein product	"""GC-binding factor 2"""	603256				9705290, 9525888, 16199883	Standard	NM_004735		Approved	FLAP-1, FLIIAP1, TRIP, GCF-2, HUFI-1	uc002vxe.3	Q32MZ4	OTTHUMG00000133339	ENST00000392000.4:c.731G>C	2.37:g.238664814G>C	ENSP00000375857:p.Arg244Thr		E9PGZ2|O75766|O75799|Q32MZ5|Q53T49|Q6PKG2|Q9Y607	Missense_Mutation	SNP	pfam_Leu-rich_rep_flightless-int_pr	p.R244T	ENST00000392000.4	37	c.731	CCDS46552.1	2	.	.	.	.	.	.	.	.	.	.	G	22.1	4.243526	0.79912	.	.	ENSG00000124831	ENST00000308482;ENST00000289175;ENST00000391999;ENST00000244815;ENST00000392000	T;T;T;T	0.57595	0.39;0.39;0.39;0.39	4.9	4.9	0.64082	.	0.207551	0.48286	D	0.000186	T	0.71298	0.3323	M	0.83118	2.625	0.58432	D	0.999998	B;P;P;P;B	0.50443	0.053;0.859;0.935;0.699;0.379	B;P;P;P;B	0.56916	0.145;0.776;0.809;0.542;0.349	T	0.77146	-0.2695	10	0.72032	D	0.01	-29.8896	17.0791	0.86593	0.0:0.0:1.0:0.0	.	188;188;244;220;372	B4DPC0;Q32MZ4-3;Q32MZ4;Q32MZ4-2;E9PGZ2	.;.;LRRF1_HUMAN;.;.	T	372;188;362;220;244	ENSP00000310109:R372T;ENSP00000289175:R188T;ENSP00000244815:R220T;ENSP00000375857:R244T	ENSP00000244815:R220T	R	+	2	0	LRRFIP1	238329553	1.000000	0.71417	0.955000	0.39395	0.796000	0.44982	7.095000	0.76952	2.284000	0.76573	0.561000	0.74099	AGA	LRRFIP1	-	pfam_Leu-rich_rep_flightless-int_pr	ENSG00000124831		0.433	LRRFIP1-003	KNOWN	basic|CCDS	protein_coding	LRRFIP1	HGNC	protein_coding	OTTHUMT00000317198.1	91	0.00	0	G	NM_004735		238664814	238664814	+1	no_errors	ENST00000392000	ensembl	human	known	69_37n	missense	68	12.82	10	SNP	1.000	C
MED13	9969	genome.wustl.edu	37	17	60040145	60040145	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr17:60040145G>A	ENST00000397786.2	-	21	5108	c.5032C>T	c.(5032-5034)Cct>Tct	p.P1678S		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	1678					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.P1678S(1)		breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						ATATGAGGAGGAAGAGTCTGG	0.373																																						dbGAP											1	Substitution - Missense(1)	breast(1)											171.0	163.0	165.0					17																	60040145		1877	4100	5977	-	-	-	SO:0001583	missense	0			AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.5032C>T	17.37:g.60040145G>A	ENSP00000380888:p.Pro1678Ser		B2RU05|O60334	Missense_Mutation	SNP	pfam_Mediator_Med13,pfam_Mediator_Med13_N_met/fun	p.P1678S	ENST00000397786.2	37	c.5032	CCDS42366.1	17	.	.	.	.	.	.	.	.	.	.	G	25.6	4.654244	0.88056	.	.	ENSG00000108510	ENST00000397786;ENST00000262436	D	0.82433	-1.61	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	D	0.91236	0.7238	M	0.78456	2.415	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91763	0.5421	10	0.54805	T	0.06	-8.2521	18.3975	0.90504	0.0:0.0:1.0:0.0	.	1678	Q9UHV7	MED13_HUMAN	S	1678;1677	ENSP00000380888:P1678S	ENSP00000262436:P1677S	P	-	1	0	MED13	57394927	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.471000	0.97696	2.340000	0.79590	0.563000	0.77884	CCT	MED13	-	pfam_Mediator_Med13	ENSG00000108510		0.373	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED13	HGNC	protein_coding	OTTHUMT00000445461.1	140	0.00	0	G	NM_005121		60040145	60040145	-1	no_errors	ENST00000397786	ensembl	human	known	69_37n	missense	108	13.60	17	SNP	1.000	A
MEST	4232	genome.wustl.edu	37	7	130140330	130140330	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr7:130140330C>G	ENST00000223215.4	+	8	825	c.604C>G	c.(604-606)Ccc>Gcc	p.P202A	MEST_ENST00000378576.4_Missense_Mutation_p.P193A|MEST_ENST00000462132.1_3'UTR|hsa-mir-335_ENST00000604666.1_RNA|MEST_ENST00000437945.1_Missense_Mutation_p.P202A|MEST_ENST00000416162.2_Missense_Mutation_p.P193A|MEST_ENST00000341441.5_Missense_Mutation_p.P193A|MEST_ENST00000393187.1_Missense_Mutation_p.P193A	NM_001253900.1|NM_002402.3	NP_001240829.1|NP_002393.2	Q5EB52	MEST_HUMAN	mesoderm specific transcript	202					mesoderm development (GO:0007498)|regulation of lipid storage (GO:0010883)|response to retinoic acid (GO:0032526)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)	p.P202A(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(2)	12	Melanoma(18;0.0435)					TGTGCTGTCACCCATCCTCAC	0.478																																					Colon(126;2182 2305 6517 35181)	dbGAP											1	Substitution - Missense(1)	breast(1)											80.0	67.0	72.0					7																	130140330		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5822.1, CCDS5823.1, CCDS59081.1	7q32	2014-08-22	2012-12-07		ENSG00000106484	ENSG00000106484			7028	protein-coding gene	gene with protein product	"""Paternally-expressed gene 1"""	601029	"""mesoderm specific transcript (mouse) homolog"", ""mesoderm specific transcript homolog (mouse)"""			8884280	Standard	NM_002402		Approved	PEG1	uc003vqg.3	Q5EB52	OTTHUMG00000156661	ENST00000223215.4:c.604C>G	7.37:g.130140330C>G	ENSP00000223215:p.Pro202Ala		B2R6S1|O14973|O15007|Q6AI49|Q92571	Missense_Mutation	SNP	pfam_AB_hydrolase_1,pfam_DUF1057,prints_Epox_hydrolase-like	p.P202A	ENST00000223215.4	37	c.604	CCDS5822.1	7	.	.	.	.	.	.	.	.	.	.	C	18.58	3.654025	0.67472	.	.	ENSG00000106484	ENST00000341441;ENST00000427521;ENST00000416162;ENST00000378576;ENST00000393187;ENST00000421001;ENST00000223215;ENST00000437945	T;T;T;T;T;T;T;T	0.66280	3.83;-0.2;3.83;3.83;3.83;0.92;3.83;3.83	5.98	5.98	0.97165	.	0.190794	0.56097	D	0.000023	T	0.75125	0.3807	L	0.58810	1.83	0.80722	D	1	B;D;D;D	0.71674	0.099;0.998;0.996;0.99	B;D;P;P	0.67725	0.101;0.953;0.887;0.896	T	0.68108	-0.5496	10	0.22706	T	0.39	.	18.993	0.92801	0.0:1.0:0.0:0.0	.	188;202;202;193	B4DQW6;C9JW74;Q5EB52;Q5EB52-3	.;.;MEST_HUMAN;.	A	193;193;193;193;193;193;202;202	ENSP00000342749:P193A;ENSP00000409505:P193A;ENSP00000408933:P193A;ENSP00000367839:P193A;ENSP00000376884:P193A;ENSP00000407222:P193A;ENSP00000223215:P202A;ENSP00000401657:P202A	ENSP00000223215:P202A	P	+	1	0	MEST	129927566	0.998000	0.40836	0.997000	0.53966	0.939000	0.58152	3.656000	0.54467	2.839000	0.97877	0.650000	0.86243	CCC	MEST	-	pfam_AB_hydrolase_1	ENSG00000106484		0.478	MEST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEST	HGNC	protein_coding	OTTHUMT00000345183.2	124	0.00	0	C	NM_002402		130140330	130140330	+1	no_errors	ENST00000223215	ensembl	human	known	69_37n	missense	69	19.77	17	SNP	1.000	G
MGA	23269	genome.wustl.edu	37	15	42057208	42057208	+	Silent	SNP	C	C	G	rs547913855		TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr15:42057208C>G	ENST00000570161.1	+	22	7869	c.7869C>G	c.(7867-7869)ctC>ctG	p.L2623L	MGA_ENST00000219905.7_Silent_p.L2623L|MGA_ENST00000389936.4_Silent_p.L2584L|MGA_ENST00000566586.1_Silent_p.L2414L|MGA_ENST00000545763.1_Silent_p.L2414L			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.L2672L(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CTCCTGATCTCTTAGAATCTG	0.478													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19833	0.0		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - coding silent(1)	breast(1)											200.0	198.0	198.0					15																	42057208		1960	4166	6126	-	-	-	SO:0001819	synonymous_variant	0			AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.7869C>G	15.37:g.42057208C>G			Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	pfam_TF_T-box,pfam_HLH_DNA-bd,superfamily_p53-like_TF_DNA-bd,superfamily_HLH_DNA-bd,smart_TF_T-box,smart_HLH_DNA-bd,prints_TF_T-box,pfscan_HLH_DNA-bd,pfscan_TF_T-box	p.L2623	ENST00000570161.1	37	c.7869	CCDS55959.1	15																																																																																			MGA	-	NULL	ENSG00000174197		0.478	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MGA	HGNC	protein_coding	OTTHUMT00000420229.1	111	0.00	0	C	NM_001164273.1		42057208	42057208	+1	no_errors	ENST00000219905	ensembl	human	known	69_37n	silent	74	19.57	18	SNP	0.970	G
MFAP1	4236	genome.wustl.edu	37	15	44105315	44105315	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr15:44105315C>G	ENST00000267812.3	-	6	989	c.757G>C	c.(757-759)Gaa>Caa	p.E253Q		NM_005926.2	NP_005917.2	P55081	MFAP1_HUMAN	microfibrillar-associated protein 1	253					extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|microfibril (GO:0001527)	poly(A) RNA binding (GO:0044822)	p.E253Q(1)		breast(2)|endometrium(1)|kidney(1)|lung(6)|skin(2)|upper_aerodigestive_tract(3)	15		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.33e-07)		TTGTTCTCTTCCAGCTCTTTT	0.423																																						dbGAP											1	Substitution - Missense(1)	breast(1)											257.0	239.0	245.0					15																	44105315		2198	4298	6496	-	-	-	SO:0001583	missense	0				CCDS10105.1	15q15-q21	2014-05-20			ENSG00000140259	ENSG00000140259			7032	protein-coding gene	gene with protein product		600215				7835894	Standard	NM_005926		Approved		uc001zth.1	P55081	OTTHUMG00000060145	ENST00000267812.3:c.757G>C	15.37:g.44105315C>G	ENSP00000267812:p.Glu253Gln		Q86TG6	Missense_Mutation	SNP	pfam_MFAP1_C	p.E253Q	ENST00000267812.3	37	c.757	CCDS10105.1	15	.	.	.	.	.	.	.	.	.	.	C	17.92	3.507805	0.64410	.	.	ENSG00000140259	ENST00000267812	.	.	.	5.24	5.24	0.73138	.	0.048272	0.85682	D	0.000000	T	0.50429	0.1615	N	0.20685	0.6	0.80722	D	1	P	0.37207	0.587	B	0.43052	0.406	T	0.40308	-0.9570	9	0.24483	T	0.36	-15.0203	18.9862	0.92771	0.0:1.0:0.0:0.0	.	253	P55081	MFAP1_HUMAN	Q	253	.	ENSP00000267812:E253Q	E	-	1	0	MFAP1	41892607	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.263000	0.78421	2.884000	0.98904	0.655000	0.94253	GAA	MFAP1	-	pfam_MFAP1_C	ENSG00000140259		0.423	MFAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFAP1	HGNC	protein_coding	OTTHUMT00000133491.2	296	0.00	0	C	NM_005926		44105315	44105315	-1	no_errors	ENST00000267812	ensembl	human	known	69_37n	missense	269	10.63	32	SNP	1.000	G
MIR193BHG	100129781	genome.wustl.edu	37	16	14397846	14397846	+	lincRNA	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr16:14397846G>C	ENST00000570945.1	+	0	310				MIR193B_ENST00000384907.1_RNA																							TCGGGGTTTTGAGGGCGAGAT	0.577																																						dbGAP											0													169.0	169.0	169.0					16																	14397846		1568	3582	5150	-	-	-			0																															16.37:g.14397846G>C				RNA	SNP	-	NULL	ENST00000570945.1	37	NULL		16																																																																																			MIR193B	-	-	ENSG00000207639		0.577	RP11-65J21.3-001	KNOWN	basic	lincRNA	MIR193B	HGNC	lincRNA	OTTHUMT00000436878.1	173	0.00	0	G			14397846	14397846	+1	no_errors	ENST00000384907	ensembl	human	known	69_37n	rna	129	10.42	15	SNP	1.000	C
MIR521-1	574494	genome.wustl.edu	37	19	54254548	54254548	+	RNA	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr19:54254548G>C	ENST00000384902.1	+	0	87				MIR519A1_ENST00000385257.1_RNA|MIR527_ENST00000385244.1_RNA|RNU6-751P_ENST00000516382.1_RNA|MIR522_ENST00000385071.1_RNA	NR_030216.1				microRNA 521-1																		GTTACGCTTTGAGAAAAGCAT	0.398																																						dbGAP											0													85.0	80.0	82.0					19																	54254548		1568	3582	5150	-	-	-			0					19q13.42	2011-09-12		2008-12-18	ENSG00000207634	ENSG00000207634		"""ncRNAs / Micro RNAs"""	32126	non-coding RNA	RNA, micro				MIRN521-1			Standard	NR_030216		Approved	hsa-mir-521-1	uc021vas.1				19.37:g.54254548G>C				RNA	SNP	-	NULL	ENST00000384902.1	37	NULL		19																																																																																			MIR522	-	-	ENSG00000207806		0.398	MIR521-1-201	KNOWN	basic	miRNA	MIR522	HGNC	miRNA		134	0.00	0	G	NR_030216		54254548	54254548	+1	no_errors	ENST00000385071	ensembl	human	known	69_37n	rna	146	15.12	26	SNP	0.069	C
MRPS35	60488	genome.wustl.edu	37	12	27877070	27877070	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr12:27877070C>T	ENST00000081029.3	+	5	544	c.473C>T	c.(472-474)tCa>tTa	p.S158L	MRPS35_ENST00000538315.1_Missense_Mutation_p.S158L	NM_021821.3	NP_068593.2	Q9Y2Q9	RT28_HUMAN	mitochondrial ribosomal protein S35	0						mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)	p.S158L(1)		breast(1)|endometrium(1)|kidney(1)|lung(2)|urinary_tract(1)	6	Lung SC(9;0.0873)					GATTATGTTTCATCAGGACCA	0.368																																						dbGAP											1	Substitution - Missense(1)	breast(1)											83.0	77.0	79.0					12																	27877070		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF182422	CCDS8714.1, CCDS53769.1	12p11	2012-09-13			ENSG00000061794	ENSG00000061794		"""Mitochondrial ribosomal proteins / small subunits"""	16635	protein-coding gene	gene with protein product		611995				11279123	Standard	NM_021821		Approved	MRPS28, MDS023	uc001rih.3	P82673	OTTHUMG00000169215	ENST00000081029.3:c.473C>T	12.37:g.27877070C>T	ENSP00000081029:p.Ser158Leu		B2RDZ7|Q96Q21	Missense_Mutation	SNP	pfam_Ribosomal_S24/S35_mit	p.S158L	ENST00000081029.3	37	c.473	CCDS8714.1	12	.	.	.	.	.	.	.	.	.	.	C	16.25	3.071326	0.55646	.	.	ENSG00000061794	ENST00000081029;ENST00000321446;ENST00000538315	T;T	0.48201	0.87;0.82	5.73	5.73	0.89815	Ribosomal protein S24/S35, mitochondrial, conserved domain (1);	0.000000	0.85682	D	0.000000	T	0.46698	0.1406	L	0.58810	1.83	0.80722	D	1	P;B	0.38395	0.629;0.188	B;B	0.38327	0.212;0.271	T	0.36163	-0.9759	10	0.12103	T	0.63	-7.4619	18.8814	0.92357	0.0:1.0:0.0:0.0	.	158;158	P82673-2;P82673	.;RT35_HUMAN	L	158	ENSP00000081029:S158L;ENSP00000445390:S158L	ENSP00000081029:S158L	S	+	2	0	MRPS35	27768337	0.998000	0.40836	0.917000	0.36280	0.993000	0.82548	3.434000	0.52841	2.698000	0.92095	0.655000	0.94253	TCA	MRPS35	-	pfam_Ribosomal_S24/S35_mit	ENSG00000061794		0.368	MRPS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS35	HGNC	protein_coding	OTTHUMT00000402897.1	130	0.00	0	C	NM_021821		27877070	27877070	+1	no_errors	ENST00000081029	ensembl	human	known	69_37n	missense	83	21.50	23	SNP	1.000	T
MTMR6	9107	genome.wustl.edu	37	13	25827981	25827981	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr13:25827981G>A	ENST00000381801.5	-	11	2028	c.1267C>T	c.(1267-1269)Ctt>Ttt	p.L423F	MTMR6_ENST00000540661.1_Missense_Mutation_p.L423F	NM_004685.3	NP_004676.3	Q9Y217	MTMR6_HUMAN	myotubularin related protein 6	423	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|potassium ion transmembrane transport (GO:0071805)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	calcium-activated potassium channel activity (GO:0015269)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)	p.L423F(1)|p.L423I(1)		breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(5)|stomach(3)	36		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.00927)|Epithelial(112;0.0474)|OV - Ovarian serous cystadenocarcinoma(117;0.164)		TGGATCTGAAGAAGAAATGCT	0.398																																						dbGAP											2	Substitution - Missense(2)	lung(1)|breast(1)											100.0	98.0	98.0					13																	25827981		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF072928	CCDS9313.1	13q12	2011-06-09			ENSG00000139505	ENSG00000139505		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7453	protein-coding gene	gene with protein product		603561				9736772	Standard	NM_004685		Approved		uc001uqf.4	Q9Y217	OTTHUMG00000016606	ENST00000381801.5:c.1267C>T	13.37:g.25827981G>A	ENSP00000371221:p.Leu423Phe		B2RBB5|B3KSB4|Q5JRG6|Q86TB7|Q86YH4|Q96P80	Missense_Mutation	SNP	pfam_Myotub-related,smart_Tyr_Pase_cat	p.L423F	ENST00000381801.5	37	c.1267	CCDS9313.1	13	.	.	.	.	.	.	.	.	.	.	G	15.19	2.760569	0.49468	.	.	ENSG00000139505	ENST00000540661;ENST00000541021;ENST00000381801	D;D	0.90788	-2.73;-2.73	5.71	4.85	0.62838	Myotubularin phosphatase domain (1);	0.058899	0.64402	D	0.000001	D	0.89959	0.6866	M	0.68728	2.09	0.58432	D	0.999998	B;B	0.31459	0.217;0.324	B;B	0.32624	0.071;0.149	D	0.88822	0.3299	10	0.59425	D	0.04	.	15.9776	0.80083	0.0:0.0:0.8642:0.1358	.	423;423	Q9Y217;Q9Y217-2	MTMR6_HUMAN;.	F	423	ENSP00000443161:L423F;ENSP00000371221:L423F	ENSP00000371221:L423F	L	-	1	0	MTMR6	24725981	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.862000	0.69560	1.363000	0.46019	0.650000	0.86243	CTT	MTMR6	-	smart_Tyr_Pase_cat	ENSG00000139505		0.398	MTMR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR6	HGNC	protein_coding	OTTHUMT00000044225.1	116	0.00	0	G	NM_004685		25827981	25827981	-1	no_errors	ENST00000381801	ensembl	human	known	69_37n	missense	82	29.91	35	SNP	1.000	A
MUC17	140453	genome.wustl.edu	37	7	100678770	100678770	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr7:100678770C>G	ENST00000306151.4	+	3	4137	c.4073C>G	c.(4072-4074)tCa>tGa	p.S1358*		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1358	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.S1358*(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					AGCATCCTTTCAACAACTCCT	0.458																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											235.0	233.0	234.0					7																	100678770		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.4073C>G	7.37:g.100678770C>G	ENSP00000302716:p.Ser1358*		O14761|Q685J2|Q8TDH7	Nonsense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.S1358*	ENST00000306151.4	37	c.4073	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	c	38	6.678614	0.97755	.	.	ENSG00000169876	ENST00000306151	.	.	.	0.579	0.579	0.17397	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	.	.	.	.	.	.	.	.	X	1358	.	ENSP00000302716:S1358X	S	+	2	0	MUC17	100465490	0.004000	0.15560	0.004000	0.12327	0.011000	0.07611	0.111000	0.15458	0.635000	0.30488	0.134000	0.15878	TCA	MUC17	-	NULL	ENSG00000169876		0.458	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	126	0.00	0	C	NM_001040105		100678770	100678770	+1	no_errors	ENST00000306151	ensembl	human	known	69_37n	nonsense	126	16.00	24	SNP	0.003	G
MUC2	4583	genome.wustl.edu	37	11	1092240	1092240	+	Silent	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr11:1092240G>A	ENST00000441003.2	+	30	4086	c.4059G>A	c.(4057-4059)caG>caA	p.Q1353Q	MUC2_ENST00000359061.5_Silent_p.Q1354Q|MUC2_ENST00000361558.6_Silent_p.Q19Q|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	1353					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.Q1354Q(1)|p.Q1353Q(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	AGCTAGGCCAGAAGGTGCAGT	0.522																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											129.0	143.0	139.0					11																	1092240		2152	4241	6393	-	-	-	SO:0001819	synonymous_variant	0			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4059G>A	11.37:g.1092240G>A			Q14878	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,superfamily_Prot_inh_PMP,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.Q1353	ENST00000441003.2	37	c.4059		11																																																																																			MUC2	-	NULL	ENSG00000198788		0.522	MUC2-001	KNOWN	basic|appris_principal	protein_coding	MUC2	HGNC	protein_coding	OTTHUMT00000345894.2	148	0.00	0	G	NM_002457		1092240	1092240	+1	no_errors	ENST00000441003	ensembl	human	known	69_37n	silent	92	24.59	30	SNP	0.545	A
MYH15	22989	genome.wustl.edu	37	3	108112937	108112937	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr3:108112937C>T	ENST00000273353.3	-	37	5316	c.5260G>A	c.(5260-5262)Gaa>Aaa	p.E1754K		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	1754						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.E1754K(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						ACCACCTCTTCAGCTTCTTTC	0.498																																						dbGAP											1	Substitution - Missense(1)	breast(1)											108.0	111.0	110.0					3																	108112937		2004	4183	6187	-	-	-	SO:0001583	missense	0			AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.5260G>A	3.37:g.108112937C>T	ENSP00000273353:p.Glu1754Lys			Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_Prefoldin,superfamily_Lambda_DNA-bd_dom,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	p.E1754K	ENST00000273353.3	37	c.5260	CCDS43127.1	3	.	.	.	.	.	.	.	.	.	.	C	23.3	4.402555	0.83230	.	.	ENSG00000144821	ENST00000273353	T	0.80738	-1.41	5.68	1.75	0.24633	Myosin tail (1);	.	.	.	.	D	0.86506	0.5949	M	0.89287	3.02	0.34473	D	0.703051	P	0.39216	0.664	P	0.50708	0.648	D	0.87121	0.2191	9	0.87932	D	0	.	7.2483	0.26135	0.0:0.6667:0.1321:0.2012	.	1754	Q9Y2K3	MYH15_HUMAN	K	1754	ENSP00000273353:E1754K	ENSP00000273353:E1754K	E	-	1	0	MYH15	109595627	0.451000	0.25705	0.001000	0.08648	0.063000	0.16089	1.335000	0.33839	0.035000	0.15519	0.650000	0.86243	GAA	MYH15	-	pfam_Myosin_tail	ENSG00000144821		0.498	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH15	HGNC	protein_coding	OTTHUMT00000353935.1	79	0.00	0	C	XM_036988		108112937	108112937	-1	no_errors	ENST00000273353	ensembl	human	known	69_37n	missense	39	35.00	21	SNP	0.991	T
MYH4	4622	genome.wustl.edu	37	17	10366411	10366411	+	Silent	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr17:10366411G>C	ENST00000255381.2	-	10	1010	c.900C>G	c.(898-900)ctC>ctG	p.L300L	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	300	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)	p.L300L(1)		NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						TCTTACCAATGAGCTCTGGTT	0.378																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											93.0	92.0	92.0					17																	10366411		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.900C>G	17.37:g.10366411G>C				Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L300	ENST00000255381.2	37	c.900	CCDS11154.1	17																																																																																			MYH4	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000264424		0.378	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	MYH4	HGNC	protein_coding	OTTHUMT00000252731.1	285	0.00	0	G	NM_017533		10366411	10366411	-1	no_errors	ENST00000255381	ensembl	human	known	69_37n	silent	133	25.28	45	SNP	0.408	C
MYO16	23026	genome.wustl.edu	37	13	109777624	109777624	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr13:109777624G>A	ENST00000357550.2	+	29	3675	c.3634G>A	c.(3634-3636)Gac>Aac	p.D1212N	MYO16_ENST00000457511.2_Missense_Mutation_p.D724N|MYO16_ENST00000356711.2_Missense_Mutation_p.D1212N	NM_001198950.1	NP_001185879.1			myosin XVI									p.D1212N(1)		NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			CCGGGAAAATGACCGGCTCCG	0.478																																						dbGAP											1	Substitution - Missense(1)	breast(1)											64.0	59.0	61.0					13																	109777624		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.3634G>A	13.37:g.109777624G>A	ENSP00000350160:p.Asp1212Asn			Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Myosin_head_motor_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.D1212N	ENST00000357550.2	37	c.3634	CCDS32008.1	13	.	.	.	.	.	.	.	.	.	.	G	23.7	4.442399	0.83993	.	.	ENSG00000041515	ENST00000356711;ENST00000357550;ENST00000457511	T;T;T	0.51071	0.72;0.72;0.72	5.75	5.75	0.90469	.	0.000000	0.42420	U	0.000718	T	0.50701	0.1631	M	0.76328	2.33	0.58432	D	0.999992	P;P	0.41450	0.75;0.647	B;B	0.36766	0.232;0.146	T	0.54132	-0.8339	9	.	.	.	.	18.948	0.92628	0.0:0.0:1.0:0.0	.	724;1212	F8W883;Q9Y6X6	.;MYO16_HUMAN	N	1212;1212;724	ENSP00000349145:D1212N;ENSP00000350160:D1212N;ENSP00000401633:D724N	.	D	+	1	0	MYO16	108575625	1.000000	0.71417	0.986000	0.45419	0.925000	0.55904	6.846000	0.75399	2.716000	0.92895	0.655000	0.94253	GAC	MYO16	-	NULL	ENSG00000041515		0.478	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO16	HGNC	protein_coding	OTTHUMT00000045746.1	76	0.00	0	G	NM_015011		109777624	109777624	+1	no_errors	ENST00000356711	ensembl	human	known	69_37n	missense	38	25.49	13	SNP	1.000	A
MYOM2	9172	genome.wustl.edu	37	8	2000284	2000284	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr8:2000284C>A	ENST00000262113.4	+	3	257	c.116C>A	c.(115-117)tCc>tAc	p.S39Y	MYOM2_ENST00000523438.1_Intron	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	39					muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)	p.S39Y(1)		autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		AGGCGAGCTTCCACCCAGGCA	0.542																																						dbGAP											1	Substitution - Missense(1)	breast(1)											221.0	195.0	204.0					8																	2000284		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.116C>A	8.37:g.2000284C>A	ENSP00000262113:p.Ser39Tyr		Q7Z3Y2	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.S39Y	ENST00000262113.4	37	c.116	CCDS5957.1	8	.	.	.	.	.	.	.	.	.	.	C	11.39	1.624355	0.28889	.	.	ENSG00000036448	ENST00000262113	T	0.53640	0.61	4.71	2.82	0.32997	.	1.837430	0.02965	N	0.143677	T	0.47002	0.1422	L	0.47716	1.5	0.09310	N	0.999999	B	0.33448	0.412	B	0.37833	0.259	T	0.43572	-0.9383	10	0.72032	D	0.01	.	5.9304	0.19136	0.1865:0.7146:0.0:0.0989	.	39	P54296	MYOM2_HUMAN	Y	39	ENSP00000262113:S39Y	ENSP00000262113:S39Y	S	+	2	0	MYOM2	1987691	0.001000	0.12720	0.001000	0.08648	0.003000	0.03518	1.229000	0.32600	1.209000	0.43321	0.655000	0.94253	TCC	MYOM2	-	NULL	ENSG00000036448		0.542	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOM2	HGNC	protein_coding	OTTHUMT00000251249.1	45	0.00	0	C	NM_003970		2000284	2000284	+1	no_errors	ENST00000262113	ensembl	human	known	69_37n	missense	20	27.59	8	SNP	0.001	A
MYRIP	25924	genome.wustl.edu	37	3	40291811	40291811	+	Missense_Mutation	SNP	G	G	T	rs142475398		TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr3:40291811G>T	ENST00000302541.6	+	14	2703	c.2361G>T	c.(2359-2361)agG>agT	p.R787S	MYRIP_ENST00000425621.1_Missense_Mutation_p.R722S|MYRIP_ENST00000444716.1_Missense_Mutation_p.R787S|MYRIP_ENST00000396217.3_Missense_Mutation_p.R698S|MYRIP_ENST00000459828.1_3'UTR|MYRIP_ENST00000539167.1_Missense_Mutation_p.R600S	NM_001284423.1|NM_001284426.1|NM_015460.2	NP_001271352.1|NP_001271355.1|NP_056275.2	Q8NFW9	MYRIP_HUMAN	myosin VIIA and Rab interacting protein	787	Actin-binding.				intracellular protein transport (GO:0006886)|positive regulation of insulin secretion (GO:0032024)	actin cytoskeleton (GO:0015629)|dense core granule (GO:0031045)|exocyst (GO:0000145)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|synapse (GO:0045202)	zinc ion binding (GO:0008270)	p.R787S(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(2)|lung(10)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)		AGAAGCAAAGGACCCAGGTGT	0.438																																						dbGAP											1	Substitution - Missense(1)	breast(1)											132.0	141.0	138.0					3																	40291811		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF396687	CCDS2689.1, CCDS68390.1, CCDS68391.1, CCDS68392.1	3p21.33	2010-08-20			ENSG00000170011	ENSG00000170011		"""A-kinase anchor proteins"""	19156	protein-coding gene	gene with protein product	"""synaptotagmin-like protein homologue lacking C2 domains-c"", ""rab effector MYRIP"", ""Slp homologue lacking C2 domains"""	611790				11964381, 12221080	Standard	NM_001284425		Approved	DKFZp586F1018, exophilin-8, MyRIP, SLAC2-C, SLAC2C	uc003cka.3	Q8NFW9	OTTHUMG00000131392	ENST00000302541.6:c.2361G>T	3.37:g.40291811G>T	ENSP00000301972:p.Arg787Ser		B3KWM3|B3KWW4|B7Z2H1|B7Z9V3|G3XAI8|Q32M41|Q32M42|Q569F7|Q8IUF5|Q9Y3V4	Missense_Mutation	SNP	pfam_Myelin-assoc_OBP,superfamily_Znf_FYVE_PHD,pfscan_Rab-bd_domain	p.R787S	ENST00000302541.6	37	c.2361	CCDS2689.1	3	.	.	.	.	.	.	.	.	.	.	G	15.01	2.705616	0.48412	.	.	ENSG00000170011	ENST00000444716;ENST00000302541;ENST00000425621;ENST00000396217;ENST00000539167	T;T;T;T;T	0.22336	1.96;1.96;1.96;1.96;1.96	5.59	3.76	0.43208	Myelin-associated oligodendrocytic basic protein (MOBP) (1);	0.503267	0.23249	N	0.050278	T	0.12433	0.0302	N	0.20530	0.585	0.32380	N	0.55474	B;P;P	0.45827	0.203;0.867;0.807	B;B;B	0.42738	0.052;0.382;0.396	T	0.13629	-1.0502	9	.	.	.	.	4.6159	0.12427	0.0823:0.1518:0.6089:0.157	.	698;722;787	Q32M42;G3XAI8;Q8NFW9	.;.;MYRIP_HUMAN	S	787;787;722;698;600	ENSP00000398665:R787S;ENSP00000301972:R787S;ENSP00000389323:R722S;ENSP00000379519:R698S;ENSP00000438297:R600S	.	R	+	3	2	MYRIP	40266815	1.000000	0.71417	0.999000	0.59377	0.908000	0.53690	1.632000	0.37102	0.694000	0.31654	0.561000	0.74099	AGG	MYRIP	-	pfam_Myelin-assoc_OBP	ENSG00000170011		0.438	MYRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYRIP	HGNC	protein_coding	OTTHUMT00000254181.2	184	0.00	0	G	NM_015460		40291811	40291811	+1	no_errors	ENST00000302541	ensembl	human	known	69_37n	missense	97	26.52	35	SNP	0.999	T
NAT9	26151	genome.wustl.edu	37	17	72767888	72767888	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr17:72767888C>T	ENST00000357814.3	-	7	672	c.599G>A	c.(598-600)aGa>aAa	p.R200K	NAT9_ENST00000578822.1_Missense_Mutation_p.R205K|NAT9_ENST00000582870.1_Missense_Mutation_p.R204K|NAT9_ENST00000583757.1_3'UTR|NAT9_ENST00000580301.1_Missense_Mutation_p.R199K|NAT9_ENST00000580632.1_Missense_Mutation_p.R200K|NAT9_ENST00000581136.1_Missense_Mutation_p.R195K|NAT9_ENST00000580216.1_5'Flank	NM_015654.3	NP_056469.2	Q9BTE0	NAT9_HUMAN	N-acetyltransferase 9 (GCN5-related, putative)	200						protein complex (GO:0043234)	N-acetyltransferase activity (GO:0008080)	p.R200K(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)	8						CGACCCATCTCTGTAAGGCTT	0.582																																						dbGAP											1	Substitution - Missense(1)	breast(1)											53.0	49.0	50.0					17																	72767888		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK123115	CCDS11706.1	17q25.2	2011-11-25	2008-09-24		ENSG00000109065	ENSG00000109065			23133	protein-coding gene	gene with protein product			"""N-acetyltransferase 9"""			14608357	Standard	NM_015654		Approved	DKFZP564C103	uc002jlq.3	Q9BTE0		ENST00000357814.3:c.599G>A	17.37:g.72767888C>T	ENSP00000350467:p.Arg200Lys		B2R7F0|Q9BTD0|Q9Y3T3	Missense_Mutation	SNP	pfam_GNAT_dom,pfam_FR47,superfamily_Acyl_CoA_acyltransferase	p.R200K	ENST00000357814.3	37	c.599	CCDS11706.1	17	.	.	.	.	.	.	.	.	.	.	C	10.53	1.376143	0.24857	.	.	ENSG00000109065	ENST00000357814	T	0.42131	0.98	4.98	4.01	0.46588	.	0.213216	0.38959	N	0.001516	T	0.33789	0.0875	L	0.60455	1.87	0.50813	D	0.999893	B;B	0.34329	0.449;0.02	B;B	0.32805	0.153;0.016	T	0.11591	-1.0581	10	0.30854	T	0.27	-2.8562	5.9461	0.19219	0.1304:0.6481:0.1425:0.079	.	199;200	Q9BTE0-2;Q9BTE0	.;NAT9_HUMAN	K	200	ENSP00000350467:R200K	ENSP00000350467:R200K	R	-	2	0	NAT9	70279483	0.048000	0.20356	0.045000	0.18777	0.594000	0.36715	3.133000	0.50531	1.229000	0.43630	0.655000	0.94253	AGA	NAT9	-	NULL	ENSG00000109065		0.582	NAT9-001	KNOWN	basic|CCDS	protein_coding	NAT9	HGNC	protein_coding	OTTHUMT00000443700.1	24	0.00	0	C	NM_015654		72767888	72767888	-1	no_errors	ENST00000357814	ensembl	human	known	69_37n	missense	11	54.17	13	SNP	0.480	T
NAV1	89796	genome.wustl.edu	37	1	201759887	201759887	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr1:201759887C>G	ENST00000367296.4	+	13	3734	c.3314C>G	c.(3313-3315)tCt>tGt	p.S1105C	NAV1_ENST00000367297.4_Missense_Mutation_p.S1097C|IPO9-AS1_ENST00000413035.1_RNA|NAV1_ENST00000367300.3_Missense_Mutation_p.S1048C|NAV1_ENST00000469130.1_3'UTR|NAV1_ENST00000367302.1_Missense_Mutation_p.S1061C|NAV1_ENST00000367295.1_Missense_Mutation_p.S714C|NAV1_ENST00000295624.6_Missense_Mutation_p.S1105C	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	1105					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)		p.S1105C(1)		breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						TCTCAGCTTTCTGCCAATGTG	0.443																																						dbGAP											1	Substitution - Missense(1)	breast(1)											125.0	118.0	120.0					1																	201759887		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.3314C>G	1.37:g.201759887C>G	ENSP00000356265:p.Ser1105Cys		A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Missense_Mutation	SNP	smart_AAA+_ATPase	p.S1105C	ENST00000367296.4	37	c.3314	CCDS1414.2	1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	22.7|22.7|22.7	4.325145|4.325145|4.325145	0.81580|0.81580|0.81580	.|.|.	.|.|.	ENSG00000134369|ENSG00000134369|ENSG00000134369	ENST00000430015|ENST00000438083|ENST00000367302;ENST00000367296;ENST00000295624;ENST00000367297;ENST00000367300;ENST00000391966;ENST00000367295	.|.|D;D;D;D;D;D	.|.|0.94000	.|.|-3.33;-3.33;-3.33;-3.33;-3.33;-3.33	5.91|5.91|5.91	5.91|5.91|5.91	0.95273|0.95273|0.95273	.|.|.	.|.|0.241879	.|.|0.42964	.|.|D	.|.|0.000628	D|D|D	0.96182|0.96182|0.96182	0.8755|0.8755|0.8755	M|M|M	0.61703|0.61703|0.61703	1.905|1.905|1.905	0.36488|0.36488|0.36488	D|D|D	0.868269|0.868269|0.868269	.|.|D;D;D;D;D	.|.|0.89917	.|.|1.0;0.999;0.995;1.0;1.0	.|.|D;D;D;D;D	.|.|0.85130	.|.|0.964;0.964;0.982;0.997;0.974	D|D|D	0.97894|0.97894|0.97894	1.0299|1.0299|1.0299	5|5|10	.|.|0.87932	.|.|D	.|.|0	-15.2671|-15.2671|-15.2671	18.0846|18.0846|18.0846	0.89453|0.89453|0.89453	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	.|.|1097;714;1105;605;1105	.|.|Q8NEY1-6;Q8NEY1-5;Q8NEY1;A8MYI2;Q8NEY1-3	.|.|.;.;NAV1_HUMAN;.;.	L|V|C	654|88|1061;1105;1105;1097;1048;605;714	.|.|ENSP00000356271:S1061C;ENSP00000356265:S1105C;ENSP00000295624:S1105C;ENSP00000356266:S1097C;ENSP00000356269:S1048C;ENSP00000356264:S714C	.|.|ENSP00000295624:S1105C	F|L|S	+|+|+	3|1|2	2|2|0	NAV1|NAV1|NAV1	200026510|200026510|200026510	0.992000|0.992000|0.992000	0.36948|0.36948|0.36948	0.972000|0.972000|0.972000	0.41901|0.41901|0.41901	0.990000|0.990000|0.990000	0.78478|0.78478|0.78478	6.010000|6.010000|6.010000	0.70753|0.70753|0.70753	2.813000|2.813000|2.813000	0.96785|0.96785|0.96785	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	TTC|CTG|TCT	NAV1	-	NULL	ENSG00000134369		0.443	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NAV1	HGNC	protein_coding	OTTHUMT00000087013.1	132	0.00	0	C	NM_020443		201759887	201759887	+1	no_errors	ENST00000367296	ensembl	human	known	69_37n	missense	161	43.71	125	SNP	0.942	G
NBEAL1	65065	genome.wustl.edu	37	2	203990152	203990152	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr2:203990152G>C	ENST00000449802.1	+	19	3006	c.2673G>C	c.(2671-2673)caG>caC	p.Q891H		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	891								p.Q891H(1)		NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						GTGAAGGACAGATTCCTGAAG	0.378																																						dbGAP											1	Substitution - Missense(1)	breast(1)											126.0	120.0	122.0					2																	203990152		692	1591	2283	-	-	-	SO:0001583	missense	0			AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.2673G>C	2.37:g.203990152G>C	ENSP00000399903:p.Gln891His		A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q891H	ENST00000449802.1	37	c.2673	CCDS46495.1	2	.	.	.	.	.	.	.	.	.	.	G	11.19	1.567143	0.28003	.	.	ENSG00000144426	ENST00000449802;ENST00000340268	T	0.32988	1.43	5.56	3.71	0.42584	.	.	.	.	.	T	0.25005	0.0607	L	0.46157	1.445	0.25994	N	0.982207	P	0.36027	0.533	B	0.33799	0.17	T	0.11324	-1.0592	9	0.39692	T	0.17	.	7.6242	0.28202	0.0764:0.0:0.6335:0.2901	.	891	Q6ZS30	NBEL1_HUMAN	H	891	ENSP00000399903:Q891H	ENSP00000344985:Q891H	Q	+	3	2	NBEAL1	203698397	0.554000	0.26522	0.982000	0.44146	0.785000	0.44390	0.696000	0.25541	0.778000	0.33520	0.655000	0.94253	CAG	NBEAL1	-	NULL	ENSG00000144426		0.378	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL1	HGNC	protein_coding	OTTHUMT00000333982.4	175	0.00	0	G			203990152	203990152	+1	no_errors	ENST00000449802	ensembl	human	known	69_37n	missense	110	26.67	40	SNP	0.978	C
NBR1	4077	genome.wustl.edu	37	17	41362092	41362092	+	Silent	SNP	G	G	A	rs569034474		TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr17:41362092G>A	ENST00000422280.1	+	21	3359	c.2900G>A	c.(2899-2901)tGa>tAa	p.*967*	TMEM106A_ENST00000541594.1_5'Flank|TMEM106A_ENST00000331615.3_5'Flank|TMEM106A_ENST00000536052.1_5'Flank|NBR1_ENST00000590996.1_Silent_p.*967*|TMEM106A_ENST00000588659.1_5'Flank|NBR1_ENST00000389312.4_Silent_p.*967*|NBR1_ENST00000341165.6_Silent_p.*967*	NM_031858.2	NP_114064.1	Q14596	NBR1_HUMAN	neighbor of BRCA1 gene 1	0					macroautophagy (GO:0016236)|negative regulation of osteoblast differentiation (GO:0045668)|protein oligomerization (GO:0051259)|regulation of bone mineralization (GO:0030500)|regulation of stress-activated MAPK cascade (GO:0032872)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)	mitogen-activated protein kinase binding (GO:0051019)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)	p.*967*(1)		NS(1)|breast(1)|cervix(1)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	24		Breast(137;0.00086)		BRCA - Breast invasive adenocarcinoma(366;0.0934)		CAACGCTATTGAGGAGTGACC	0.413													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16282	0.0		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - coding silent(1)	breast(1)											71.0	62.0	65.0					17																	41362092		1568	3582	5150	-	-	-	SO:0001819	synonymous_variant	0			X76952	CCDS45694.1	17q21.31	2008-02-01	2005-02-15	2005-02-16		ENSG00000188554			6746	protein-coding gene	gene with protein product		166945	"""membrane component, chromosome 17, surface marker 2 (ovarian carcinoma antigen CA125)"""	M17S2		8069304	Standard	XM_006721903		Approved	CA125, KIAA0049, 1A1-3B	uc010whv.2	Q14596		ENST00000422280.1:c.2900G>A	17.37:g.41362092G>A			Q13173|Q15026|Q5J7Q8|Q96GB6|Q9NRF7	Silent	SNP	pfam_OPR_PB1,pfam_Znf_ZZ,superfamily_UBA-like,smart_OPR_PB1,smart_Znf_ZZ,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_ZZ	p.*967	ENST00000422280.1	37	c.2900	CCDS45694.1	17																																																																																			NBR1	-	NULL	ENSG00000188554		0.413	NBR1-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NBR1	HGNC	protein_coding	OTTHUMT00000453461.1	63	0.00	0	G	NM_005899		41362092	41362092	+1	no_errors	ENST00000341165	ensembl	human	known	69_37n	silent	27	32.50	13	SNP	1.000	A
NDNL2	56160	genome.wustl.edu	37	15	29561244	29561244	+	Silent	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr15:29561244G>A	ENST00000332303.4	-	1	789	c.666C>T	c.(664-666)ctC>ctT	p.L222L	FAM189A1_ENST00000261275.4_Intron	NM_138704.3	NP_619649.1	Q96MG7	MAGG1_HUMAN	necdin-like 2	222	Interaction with NSMCE1.|MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				DNA recombination (GO:0006310)|DNA repair (GO:0006281)|positive regulation of protein ubiquitination (GO:0031398)|regulation of growth (GO:0040008)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Smc5-Smc6 complex (GO:0030915)		p.L222L(1)		breast(3)|large_intestine(2)|lung(3)	8		all_lung(180;4.69e-11)|Breast(32;0.0013)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00736)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		CCTCAGTAATGAGTTTCTTTG	0.542																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											63.0	69.0	67.0					15																	29561244		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF490510	CCDS10023.1	15q13.1	2008-02-01			ENSG00000185115	ENSG00000185115			7677	protein-coding gene	gene with protein product		608243				18086888	Standard	NM_138704		Approved	HCA4, MAGEG1, MAGEL3, NSE3, NSMCE3	uc001zco.3	Q96MG7	OTTHUMG00000129261	ENST00000332303.4:c.666C>T	15.37:g.29561244G>A			Q8IW16|Q8TEI6|Q9H214	Silent	SNP	pfam_MAGE,pfscan_MAGE	p.L222	ENST00000332303.4	37	c.666	CCDS10023.1	15																																																																																			NDNL2	-	pfam_MAGE,pfscan_MAGE	ENSG00000185115		0.542	NDNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDNL2	HGNC	protein_coding	OTTHUMT00000251370.1	47	0.00	0	G	NM_138704		29561244	29561244	-1	no_errors	ENST00000332303	ensembl	human	known	69_37n	silent	37	13.95	6	SNP	0.129	A
NF1	4763	genome.wustl.edu	37	17	29667654	29667654	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr17:29667654C>G	ENST00000358273.4	+	47	7436	c.7053C>G	c.(7051-7053)ttC>ttG	p.F2351L	NF1_ENST00000356175.3_Missense_Mutation_p.F2330L|NF1_ENST00000444181.2_Missense_Mutation_p.F144L|NF1_ENST00000417592.2_Missense_Mutation_p.F64L	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	2351					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)|p.F2351L(2)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TCCGTATATTCAATGACAAGG	0.388			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												dbGAP	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	13	Whole gene deletion(8)|Unknown(3)|Substitution - Missense(2)	soft_tissue(7)|autonomic_ganglia(2)|breast(2)|lung(1)|central_nervous_system(1)											81.0	73.0	76.0					17																	29667654		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.7053C>G	17.37:g.29667654C>G	ENSP00000351015:p.Phe2351Leu		O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,superfamily_CRAL-TRIO_dom,smart_RasGAP,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_RasGAP	p.F2351L	ENST00000358273.4	37	c.7053	CCDS42292.1	17	.	.	.	.	.	.	.	.	.	.	C	19.41	3.822143	0.71028	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735;ENST00000444181;ENST00000417592	T;T;T;T	0.56611	2.9;3.05;2.73;0.45	6.04	5.08	0.68730	Armadillo-type fold (2);	0.000000	0.85682	D	0.000000	T	0.71484	0.3345	M	0.78456	2.415	0.58432	D	0.999999	P;B	0.52577	0.954;0.369	D;B	0.66351	0.943;0.064	T	0.72754	-0.4198	10	0.40728	T	0.16	.	15.3128	0.74048	0.0:0.9332:0.0:0.0668	.	2330;2351	P21359-2;P21359	.;NF1_HUMAN	L	2351;2330;1996;144;64	ENSP00000351015:F2351L;ENSP00000348498:F2330L;ENSP00000389907:F1996L;ENSP00000396481:F144L	ENSP00000348498:F2330L	F	+	3	2	NF1	26691780	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.884000	0.48562	1.576000	0.49790	0.585000	0.79938	TTC	NF1	-	superfamily_ARM-type_fold	ENSG00000196712		0.388	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	HGNC	protein_coding	OTTHUMT00000256351.2	117	0.00	0	C	NM_000267		29667654	29667654	+1	no_errors	ENST00000358273	ensembl	human	known	69_37n	missense	56	30.00	24	SNP	1.000	G
NPC1	4864	genome.wustl.edu	37	18	21127971	21127971	+	Splice_Site	SNP	C	C	G	rs369753548		TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr18:21127971C>G	ENST00000269228.5	-	11	2310	c.1756G>C	c.(1756-1758)Gag>Cag	p.E586Q	NPC1_ENST00000540608.1_5'UTR|NPC1_ENST00000412552.2_Intron	NM_000271.4	NP_000262.2	O15118	NPC1_HUMAN	Niemann-Pick disease, type C1	586					adult walking behavior (GO:0007628)|autophagy (GO:0006914)|bile acid metabolic process (GO:0008206)|cellular response to low-density lipoprotein particle stimulus (GO:0071404)|cellular response to steroid hormone stimulus (GO:0071383)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endocytosis (GO:0006897)|establishment of protein localization to membrane (GO:0090150)|lysosomal transport (GO:0007041)|membrane raft organization (GO:0031579)|negative regulation of cell death (GO:0060548)|negative regulation of macroautophagy (GO:0016242)|protein glycosylation (GO:0006486)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|membrane raft (GO:0045121)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	cholesterol binding (GO:0015485)|hedgehog receptor activity (GO:0008158)|receptor activity (GO:0004872)|sterol transporter activity (GO:0015248)|transmembrane signaling receptor activity (GO:0004888)	p.E586Q(1)		breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(10)|lung(13)|ovary(2)|stomach(1)	38	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)					GTGACTCACTCTTTTTCCCAG	0.448																																						dbGAP											1	Substitution - Missense(1)	breast(1)											164.0	157.0	159.0					18																	21127971		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF002020	CCDS11878.1	18q11.2	2014-06-17			ENSG00000141458	ENSG00000141458			7897	protein-coding gene	gene with protein product		607623				8446622	Standard	NM_000271		Approved		uc002kum.4	O15118	OTTHUMG00000131873	ENST00000269228.5:c.1757+1G>C	18.37:g.21127971C>G			B4DET3|Q9P130	Missense_Mutation	SNP	pfam_Patched,pfam_MMPL-typ,pfscan_SSD,tigrfam_NP_C_type	p.E586Q	ENST00000269228.5	37	c.1756	CCDS11878.1	18	.	.	.	.	.	.	.	.	.	.	C	19.41	3.821691	0.71028	.	.	ENSG00000141458	ENST00000269228;ENST00000540608	D	0.92099	-2.97	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	D	0.90652	0.7068	M	0.62209	1.925	0.80722	D	1	B	0.26935	0.164	B	0.22880	0.042	D	0.87047	0.2144	10	0.21014	T	0.42	-32.0077	19.8731	0.96858	0.0:1.0:0.0:0.0	.	586	O15118	NPC1_HUMAN	Q	586;431	ENSP00000269228:E586Q	ENSP00000269228:E586Q	E	-	1	0	NPC1	19381969	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.696000	0.61774	2.699000	0.92147	0.563000	0.77884	GAG	NPC1	-	pfam_Patched,tigrfam_NP_C_type	ENSG00000141458		0.448	NPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPC1	HGNC	protein_coding	OTTHUMT00000254823.2	87	0.00	0	C	NM_000271	Missense_Mutation	21127971	21127971	-1	no_errors	ENST00000269228	ensembl	human	known	69_37n	missense	64	31.18	29	SNP	1.000	G
NTRK2	4915	genome.wustl.edu	37	9	87342871	87342871	+	Missense_Mutation	SNP	G	G	A	rs200996090		TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr9:87342871G>A	ENST00000323115.4	+	8	1509	c.1156G>A	c.(1156-1158)Gat>Aat	p.D386N	NTRK2_ENST00000395882.1_Missense_Mutation_p.D386N|NTRK2_ENST00000395866.2_Missense_Mutation_p.D230N|NTRK2_ENST00000277120.3_Missense_Mutation_p.D386N|NTRK2_ENST00000376213.1_Missense_Mutation_p.D386N|NTRK2_ENST00000304053.6_Missense_Mutation_p.D386N|NTRK2_ENST00000376214.1_Missense_Mutation_p.D386N|NTRK2_ENST00000376208.1_Missense_Mutation_p.D386N|NTRK2_ENST00000359847.3_Missense_Mutation_p.D386N			Q16620	NTRK2_HUMAN	neurotrophic tyrosine kinase, receptor, type 2	386					activation of adenylate cyclase activity (GO:0007190)|aging (GO:0007568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|central nervous system neuron development (GO:0021954)|cerebral cortex development (GO:0021987)|circadian rhythm (GO:0007623)|feeding behavior (GO:0007631)|glutamate secretion (GO:0014047)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mechanoreceptor differentiation (GO:0042490)|negative regulation of anoikis (GO:2000811)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular junction development (GO:0007528)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system neuron development (GO:0048935)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|regulation of dendrite development (GO:0050773)|regulation of neurotransmitter secretion (GO:0046928)|regulation of protein kinase B signaling (GO:0051896)|regulation of Rac GTPase activity (GO:0032314)|response to auditory stimulus (GO:0010996)|retinal rod cell development (GO:0046548)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasculogenesis (GO:0001570)	cell surface (GO:0009986)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|endosome (GO:0005768)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|brain-derived neurotrophic factor binding (GO:0048403)|brain-derived neurotrophic factor-activated receptor activity (GO:0060175)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)	p.D386N(3)		breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	46					Amitriptyline(DB00321)	TGGAATTGACGATGGTGAGTA	0.423										TSP Lung(25;0.17)																												dbGAP											3	Substitution - Missense(3)	breast(3)											88.0	85.0	86.0					9																	87342871		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF410902	CCDS6671.1, CCDS35050.1, CCDS35051.1, CCDS35052.1, CCDS35053.1	9q22.1	2013-01-11			ENSG00000148053	ENSG00000148053	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8032	protein-coding gene	gene with protein product		600456				7789988	Standard	NM_001018065		Approved	TRKB	uc004anz.1	Q16620	OTTHUMG00000020120	ENST00000323115.4:c.1156G>A	9.37:g.87342871G>A	ENSP00000314586:p.Asp386Asn		B1ANZ4|B4DFV9|Q16675|Q59GJ1|Q8WXJ5|Q8WXJ6|Q8WXJ7	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,pfam_LRR-contain_N,superfamily_Kinase-like_dom,smart_LRR-contain_N,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_Tyr_kinase_NGF_rcpt,prints_Tyr_kin_neurotrophic_rcpt_2	p.D386N	ENST00000323115.4	37	c.1156	CCDS35050.1	9	.	.	.	.	.	.	.	.	.	.	G	3.018	-0.202504	0.06219	.	.	ENSG00000148053	ENST00000376214;ENST00000376213;ENST00000395882;ENST00000376208;ENST00000304053;ENST00000277120;ENST00000323115;ENST00000359847;ENST00000395866	T;T;T;T;T;T;T;T;T	0.74106	-0.81;-0.81;-0.45;-0.44;-0.42;-0.81;-0.81;-0.45;-0.44	5.37	3.48	0.39840	.	0.716141	0.13917	N	0.353818	T	0.62392	0.2424	L	0.39898	1.24	0.28711	N	0.903558	P;B;P;P;B;B;P;P	0.48407	0.529;0.423;0.651;0.758;0.001;0.02;0.91;0.844	B;B;B;B;B;B;B;B	0.41894	0.049;0.093;0.093;0.091;0.001;0.002;0.369;0.187	T	0.51988	-0.8635	10	0.09843	T	0.71	.	9.9232	0.41476	0.0723:0.0:0.7848:0.1429	.	230;386;386;386;386;386;432;386	B4DFV9;Q16620-3;Q16620-5;Q5VWE5;Q16620;Q16620-4;Q59GJ1;Q16620-2	.;.;.;.;NTRK2_HUMAN;.;.;.	N	386;386;386;386;386;386;386;386;230	ENSP00000365387:D386N;ENSP00000365386:D386N;ENSP00000379221:D386N;ENSP00000365381:D386N;ENSP00000306167:D386N;ENSP00000277120:D386N;ENSP00000314586:D386N;ENSP00000352906:D386N;ENSP00000379207:D230N	ENSP00000277120:D386N	D	+	1	0	NTRK2	86532691	0.944000	0.32072	0.221000	0.23827	0.728000	0.41692	2.856000	0.48341	0.600000	0.29862	-0.237000	0.12165	GAT	NTRK2	-	NULL	ENSG00000148053		0.423	NTRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTRK2	HGNC	protein_coding	OTTHUMT00000052882.1	100	0.00	0	G			87342871	87342871	+1	no_errors	ENST00000277120	ensembl	human	known	69_37n	missense	74	25.25	25	SNP	0.870	A
NUP160	23279	genome.wustl.edu	37	11	47828648	47828648	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr11:47828648G>C	ENST00000378460.2	-	19	2466	c.2420C>G	c.(2419-2421)tCt>tGt	p.S807C	RNA5SP340_ENST00000517132.1_RNA|NUP160_ENST00000530326.1_Missense_Mutation_p.S693C|NUP160_ENST00000528071.1_Missense_Mutation_p.S693C	NM_015231.1	NP_056046.1	Q12769	NU160_HUMAN	nucleoporin 160kDa	807					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)	p.S807C(1)		NS(1)|biliary_tract(2)|breast(7)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(6)|prostate(2)|skin(2)|urinary_tract(2)	53						TAAAGCACCAGAGTCTGTTAA	0.363																																						dbGAP											1	Substitution - Missense(1)	breast(1)											133.0	123.0	127.0					11																	47828648		2201	4298	6499	-	-	-	SO:0001583	missense	0			D83781	CCDS31484.1	11p11.12	2008-07-21	2002-08-29		ENSG00000030066	ENSG00000030066			18017	protein-coding gene	gene with protein product		607614	"""nucleoporin 160kD"""			11684705	Standard	NM_015231		Approved	KIAA0197, FLJ22583	uc001ngm.3	Q12769	OTTHUMG00000166534	ENST00000378460.2:c.2420C>G	11.37:g.47828648G>C	ENSP00000367721:p.Ser807Cys		B4DYE8|B4E2J9|Q08AD3|Q7Z5X6|Q96GB3|Q9H660	Missense_Mutation	SNP	pfam_Nucleoporin_Nup160	p.S807C	ENST00000378460.2	37	c.2420	CCDS31484.1	11	.	.	.	.	.	.	.	.	.	.	G	19.89	3.910935	0.72983	.	.	ENSG00000030066	ENST00000378460;ENST00000530326;ENST00000528071	T;T;T	0.50548	1.32;0.75;0.74	5.97	5.97	0.96955	.	0.182932	0.47852	D	0.000204	T	0.60051	0.2239	L	0.51422	1.61	0.80722	D	1	D	0.71674	0.998	P	0.58721	0.844	T	0.57969	-0.7719	10	0.52906	T	0.07	.	17.1653	0.86814	0.0:0.0:1.0:0.0	.	807	Q12769	NU160_HUMAN	C	807;693;693	ENSP00000367721:S807C;ENSP00000433590:S693C;ENSP00000432367:S693C	ENSP00000367721:S807C	S	-	2	0	NUP160	47785224	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.855000	0.69510	2.833000	0.97629	0.585000	0.79938	TCT	NUP160	-	NULL	ENSG00000030066		0.363	NUP160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP160	HGNC	protein_coding	OTTHUMT00000390239.2	217	0.00	0	G	NM_015231		47828648	47828648	-1	no_errors	ENST00000378460	ensembl	human	known	69_37n	missense	161	17.44	34	SNP	0.993	C
NUP210L	91181	genome.wustl.edu	37	1	154072563	154072563	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr1:154072563G>C	ENST00000368559.3	-	14	1947	c.1876C>G	c.(1876-1878)Ctt>Gtt	p.L626V	NUP210L_ENST00000271854.3_Missense_Mutation_p.L626V	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	626					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)		p.L626V(1)		NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			GTATGGCCAAGAGATTTAGCT	0.428																																						dbGAP											1	Substitution - Missense(1)	breast(1)											196.0	185.0	189.0					1																	154072563		1948	4148	6096	-	-	-	SO:0001583	missense	0			AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.1876C>G	1.37:g.154072563G>C	ENSP00000357547:p.Leu626Val		E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation	SNP	pfam_Big_2,superfamily_Invasin/intimin_cell_adhesion,smart_Big_2	p.L626V	ENST00000368559.3	37	c.1876	CCDS41399.1	1	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.445288	0.00178	.	.	ENSG00000143552	ENST00000368559;ENST00000271854	T;T	0.05319	3.74;3.46	5.15	-0.785	0.10950	.	0.308756	0.23206	N	0.050729	T	0.01124	0.0037	N	0.25647	0.755	0.09310	N	1	B;B	0.21071	0.051;0.028	B;B	0.12156	0.007;0.007	T	0.47222	-0.9134	10	0.23891	T	0.37	-11.8947	6.5658	0.22511	0.3039:0.2233:0.4727:0.0	.	626;626	E7EP56;Q5VU65	.;P210L_HUMAN	V	626	ENSP00000357547:L626V;ENSP00000271854:L626V	ENSP00000271854:L626V	L	-	1	0	NUP210L	152339187	0.000000	0.05858	0.001000	0.08648	0.013000	0.08279	0.032000	0.13732	-0.034000	0.13713	-0.361000	0.07541	CTT	NUP210L	-	NULL	ENSG00000143552		0.428	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP210L	HGNC	protein_coding	OTTHUMT00000087270.3	156	0.00	0	G	NM_207308		154072563	154072563	-1	no_errors	ENST00000368559	ensembl	human	known	69_37n	missense	132	21.43	36	SNP	0.001	C
OR4D10	390197	genome.wustl.edu	37	11	59245488	59245488	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr11:59245488G>C	ENST00000530162.1	+	1	643	c.586G>C	c.(586-588)Gaa>Caa	p.E196Q		NM_001004705.1	NP_001004705.1	Q8NGI6	OR4DA_HUMAN	olfactory receptor, family 4, subfamily D, member 10	196						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E196Q(1)|p.E194Q(1)		NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TTTCATACTTGAACTACTAAT	0.463																																						dbGAP											2	Substitution - Missense(2)	breast(2)											81.0	83.0	82.0					11																	59245488		2201	4295	6496	-	-	-	SO:0001583	missense	0			AB065808	CCDS53636.1	11q12.1	2012-10-03		2004-03-10	ENSG00000254466	ENSG00000254466		"""GPCR / Class A : Olfactory receptors"""	15173	protein-coding gene	gene with protein product				OR4D10P			Standard	NM_001004705		Approved	OST711	uc001nnz.1	Q8NGI6	OTTHUMG00000167341	ENST00000530162.1:c.586G>C	11.37:g.59245488G>C	ENSP00000436424:p.Glu196Gln		B2RNH6	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.E196Q	ENST00000530162.1	37	c.586	CCDS53636.1	11	.	.	.	.	.	.	.	.	.	.	G	10.10	1.257211	0.22965	.	.	ENSG00000254466	ENST00000530162	T	0.00237	8.47	4.41	4.41	0.53225	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00328	0.0010	M	0.64567	1.98	0.09310	N	1	B	0.28128	0.201	B	0.38683	0.279	T	0.46233	-0.9206	9	0.72032	D	0.01	.	15.9301	0.79651	0.0:0.0:1.0:0.0	.	196	Q8NGI6	OR4DA_HUMAN	Q	196	ENSP00000436424:E196Q	ENSP00000436424:E196Q	E	+	1	0	OR4D10	59002064	0.000000	0.05858	0.027000	0.17364	0.008000	0.06430	0.569000	0.23638	2.157000	0.67596	0.561000	0.74099	GAA	OR4D10	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000254466		0.463	OR4D10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4D10	HGNC	protein_coding	OTTHUMT00000394235.1	120	0.00	0	G	NM_001004705		59245488	59245488	+1	no_errors	ENST00000530162	ensembl	human	known	69_37n	missense	65	25.29	22	SNP	0.015	C
OR10G8	219869	genome.wustl.edu	37	11	123901064	123901064	+	Silent	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr11:123901064C>T	ENST00000431524.1	+	1	768	c.735C>T	c.(733-735)atC>atT	p.I245I		NM_001004464.1	NP_001004464.1	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G, member 8	245						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I245I(1)		breast(1)|endometrium(7)|large_intestine(2)|lung(21)|ovary(1)|prostate(5)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	44		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		CCCACTGTATCGTGGTCCTTT	0.537																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											154.0	131.0	139.0					11																	123901064		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0			AB065755	CCDS31704.1	11q24.1	2012-08-09			ENSG00000234560	ENSG00000234560		"""GPCR / Class A : Olfactory receptors"""	14845	protein-coding gene	gene with protein product							Standard	NM_001004464		Approved		uc001pzp.1	Q8NGN5	OTTHUMG00000165968	ENST00000431524.1:c.735C>T	11.37:g.123901064C>T			B2RNJ3|Q6IEV2	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.I245	ENST00000431524.1	37	c.735	CCDS31704.1	11																																																																																			OR10G8	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000234560		0.537	OR10G8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10G8	HGNC	protein_coding	OTTHUMT00000387270.1	162	0.00	0	C	NM_001004464		123901064	123901064	+1	no_errors	ENST00000431524	ensembl	human	known	69_37n	silent	49	39.51	32	SNP	0.000	T
OR7C1	26664	genome.wustl.edu	37	19	14910073	14910073	+	Silent	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr19:14910073C>G	ENST00000248073.2	-	1	950	c.876G>C	c.(874-876)ctG>ctC	p.L292L	OR7A5_ENST00000601611.1_Intron	NM_198944.1	NP_945182.1	O76099	OR7C1_HUMAN	olfactory receptor, family 7, subfamily C, member 1	292					spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L292L(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(2)|ovary(2)|prostate(1)	18						CCGTGTTCCTCAGGCTGTAGA	0.512																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											86.0	85.0	85.0					19																	14910073		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X89676	CCDS12317.1	19p13.1	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8373	protein-coding gene	gene with protein product				OR7C4			Standard	NM_198944		Approved	OR19-5	uc010xnz.2	O76099		ENST00000248073.2:c.876G>C	19.37:g.14910073C>G			Q15621|Q6IFP2|Q96R94	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L292	ENST00000248073.2	37	c.876	CCDS12317.1	19																																																																																			OR7C1	-	prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	ENSG00000127530		0.512	OR7C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7C1	HGNC	protein_coding	OTTHUMT00000466519.1	56	0.00	0	C			14910073	14910073	-1	no_errors	ENST00000248073	ensembl	human	known	69_37n	silent	56	16.42	11	SNP	0.420	G
OTOGL	283310	genome.wustl.edu	37	12	80626730	80626730	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr12:80626730C>G	ENST00000547103.1	+	8	649	c.643C>G	c.(643-645)Ctt>Gtt	p.L215V	OTOGL_ENST00000458043.2_Missense_Mutation_p.L215V			Q3ZCN5	OTOGL_HUMAN	otogelin-like	215	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.				L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)	p.L215V(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						TGACTACATTCTTGTGAAAAC	0.398																																						dbGAP											1	Substitution - Missense(1)	breast(1)											93.0	87.0	89.0					12																	80626730		1854	4101	5955	-	-	-	SO:0001583	missense	0			AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.643C>G	12.37:g.80626730C>G	ENSP00000447211:p.Leu215Val		F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_AbfB,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.L215V	ENST00000547103.1	37	c.643		12	.	.	.	.	.	.	.	.	.	.	C	15.16	2.751791	0.49362	.	.	ENSG00000165899	ENST00000547103;ENST00000458043	T;T	0.59502	0.26;0.26	5.92	-0.118	0.13547	.	.	.	.	.	T	0.43299	0.1241	L	0.32530	0.975	0.42488	D	0.992882	.	.	.	.	.	.	T	0.17048	-1.0382	7	0.07644	T	0.81	.	10.0742	0.42351	0.0:0.5424:0.0:0.4576	.	.	.	.	V	215	ENSP00000447211:L215V;ENSP00000400895:L215V	ENSP00000400895:L215V	L	+	1	0	OTOGL	79150861	0.993000	0.37304	0.990000	0.47175	0.628000	0.37860	0.447000	0.21710	-0.076000	0.12775	-0.806000	0.03193	CTT	OTOGL	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000165899		0.398	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	OTOGL	HGNC	protein_coding	OTTHUMT00000407438.1	121	0.00	0	C	NM_173591		80626730	80626730	+1	no_errors	ENST00000458043	ensembl	human	known	69_37n	missense	102	24.44	33	SNP	1.000	G
PARP6	56965	genome.wustl.edu	37	15	72545819	72545819	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr15:72545819C>G	ENST00000569795.1	-	16	1905	c.1218G>C	c.(1216-1218)caG>caC	p.Q406H	PARP6_ENST00000413097.2_5'UTR|PARP6_ENST00000287196.9_Missense_Mutation_p.Q406H|PARP6_ENST00000260376.7_Missense_Mutation_p.Q406H			Q2NL67	PARP6_HUMAN	poly (ADP-ribose) polymerase family, member 6	406	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.						NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.Q406H(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(8)|skin(1)|urinary_tract(1)	18						ACTTGTCCATCTGTTTCTTGA	0.488																																						dbGAP											1	Substitution - Missense(1)	breast(1)											127.0	123.0	124.0					15																	72545819		1926	4142	6068	-	-	-	SO:0001583	missense	0			AL390093	CCDS10241.2	15q22	2010-02-16			ENSG00000137817	ENSG00000137817		"""Poly (ADP-ribose) polymerases"""	26921	protein-coding gene	gene with protein product						15273990	Standard	XM_005254557		Approved	pART17	uc002auc.3	Q2NL67	OTTHUMG00000133443	ENST00000569795.1:c.1218G>C	15.37:g.72545819C>G	ENSP00000456348:p.Gln406His		Q9H7C5|Q9H9X6|Q9HAF3|Q9NPS6|Q9UFG4	Missense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.Q406H	ENST00000569795.1	37	c.1218	CCDS10241.2	15	.	.	.	.	.	.	.	.	.	.	C	19.46	3.832358	0.71258	.	.	ENSG00000137817	ENST00000419739;ENST00000287196;ENST00000260376;ENST00000413097	.	.	.	5.76	4.84	0.62591	Poly(ADP-ribose) polymerase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.64305	0.2586	L	0.40543	1.245	0.80722	D	1	D;D;D	0.61697	0.989;0.98;0.99	D;D;D	0.72982	0.962;0.965;0.979	T	0.58885	-0.7557	9	0.12766	T	0.61	-6.0572	13.6272	0.62173	0.0:0.9261:0.0:0.0739	.	406;406;338	Q0VDG0;Q2NL67;A0PJ50	.;PARP6_HUMAN;.	H	406;406;406;251	.	ENSP00000260376:Q406H	Q	-	3	2	PARP6	70332873	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.011000	0.57124	1.431000	0.47355	0.655000	0.94253	CAG	PARP6	-	pfscan_Poly(ADP-ribose)pol_cat_dom	ENSG00000137817		0.488	PARP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP6	HGNC	protein_coding	OTTHUMT00000257315.2	146	0.00	0	C	NM_020214		72545819	72545819	-1	no_errors	ENST00000287196	ensembl	human	known	69_37n	missense	95	16.67	19	SNP	1.000	G
PCDHA9	9752	genome.wustl.edu	37	5	140358575	140358575	+	Silent	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr5:140358575G>C	ENST00000532602.1	+	2	3469	c.2436G>C	c.(2434-2436)ctG>ctC	p.L812L	PCDHA4_ENST00000530339.1_Silent_p.L809L|PCDHA7_ENST00000525929.1_Silent_p.L799L|PCDHA6_ENST00000529310.1_Silent_p.L812L|PCDHA6_ENST00000527624.1_Silent_p.L548L|PCDHAC1_ENST00000253807.2_Silent_p.L825L|PCDHA1_ENST00000504120.2_Silent_p.L812L|PCDHA1_ENST00000394633.3_Silent_p.L548L|PCDHA10_ENST00000506939.2_Silent_p.L547L|PCDHA5_ENST00000529619.1_Silent_p.L798L|PCDHA11_ENST00000398640.2_Silent_p.L811L|PCDHA8_ENST00000531613.1_Silent_p.L812L|PCDHA3_ENST00000522353.2_Silent_p.L812L|PCDHA2_ENST00000526136.1_Silent_p.L810L|PCDHA10_ENST00000307360.5_Silent_p.L810L|PCDHA13_ENST00000409494.1_Silent_p.L812L|PCDHA13_ENST00000289272.2_Silent_p.L812L|PCDHA4_ENST00000512229.2_Silent_p.L809L|PCDHA12_ENST00000398631.2_Silent_p.L803L|PCDHAC2_ENST00000289269.5_Silent_p.L869L|PCDHA5_ENST00000529859.1_Silent_p.L798L	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	812	5 X 4 AA repeats of P-X-X-P.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L812L(6)|p.L810L(2)|p.L809L(1)|p.L547L(1)|p.L825L(1)|p.L799L(1)|p.L811L(1)|p.L803L(1)|p.L798L(1)|p.L869L(1)		breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGCCTCCCTGAGAGCAGGCA	0.468																																					Melanoma(55;1800 1972 14909)	dbGAP											16	Substitution - coding silent(16)	breast(16)											95.0	93.0	94.0					5																	140358575		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.2436G>C	5.37:g.140358575G>C			O15053|Q2M3S5	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.L869	ENST00000532602.1	37	c.2607	CCDS54920.1	5																																																																																			PCDHAC2	-	NULL	ENSG00000243232		0.468	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHAC2	HGNC	protein_coding	OTTHUMT00000372896.2	66	0.00	0	G	NM_031857		140358575	140358575	+1	no_errors	ENST00000289269	ensembl	human	known	69_37n	silent	40	23.08	12	SNP	0.997	C
PCDHB8	56128	genome.wustl.edu	37	5	140560003	140560003	+	Silent	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr5:140560003C>T	ENST00000239444.2	+	1	2633	c.2388C>T	c.(2386-2388)ttC>ttT	p.F796F	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	796					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.F796F(1)		NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCTTTGGTTTCAGCCTTCAGT	0.303																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											57.0	61.0	59.0					5																	140560003		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.2388C>T	5.37:g.140560003C>T			B9EGV1	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.F796	ENST00000239444.2	37	c.2388	CCDS4250.1	5																																																																																			PCDHB8	-	NULL	ENSG00000120322		0.303	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB8	HGNC	protein_coding	OTTHUMT00000251816.2	111	0.00	0	C	NM_019120		140560003	140560003	+1	no_errors	ENST00000239444	ensembl	human	known	69_37n	silent	85	15.84	16	SNP	0.001	T
PCDHGA11	56105	genome.wustl.edu	37	5	140801497	140801497	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr5:140801497G>C	ENST00000398587.2	+	1	736	c.703G>C	c.(703-705)Gat>Cat	p.D235H	PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA11_ENST00000518882.1_Missense_Mutation_p.D235H|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron	NM_018914.2|NM_032092.1	NP_061737.1|NP_114481.1	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11	235	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D235H(1)		breast(3)|endometrium(8)|kidney(3)|large_intestine(9)|lung(22)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTGGTCCTCGATGTAAATGA	0.522																																						dbGAP											1	Substitution - Missense(1)	breast(1)											81.0	84.0	83.0					5																	140801497		2028	4209	6237	-	-	-	SO:0001583	missense	0			AF152505	CCDS47294.1, CCDS54930.1, CCDS75345.1	5q31	2010-01-26			ENSG00000253873	ENSG00000253873		"""Cadherins / Protocadherins : Clustered"""	8698	other	protocadherin		606298				10380929	Standard	NM_018914		Approved	PCDH-GAMMA-A11		Q9Y5H2	OTTHUMG00000164055	ENST00000398587.2:c.703G>C	5.37:g.140801497G>C	ENSP00000381589:p.Asp235His		B7ZVY8|Q9Y5D8|Q9Y5D9	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.D235H	ENST00000398587.2	37	c.703	CCDS47294.1	5	.	.	.	.	.	.	.	.	.	.	g	21.3	4.128845	0.77549	.	.	ENSG00000253873	ENST00000398587;ENST00000518882	T;T	0.74632	-0.86;-0.86	6.02	6.02	0.97574	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.29403	U	0.012250	D	0.93664	0.7976	H	0.99842	4.835	0.45261	D	0.998261	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96016	0.9005	10	0.87932	D	0	.	20.1477	0.98083	0.0:0.0:1.0:0.0	.	235;235;235	Q9Y5H2;Q9Y5H2-3;Q9Y5H2-2	PCDGB_HUMAN;.;.	H	235	ENSP00000381589:D235H;ENSP00000428333:D235H	ENSP00000381589:D235H	D	+	1	0	PCDHGA11	140781681	1.000000	0.71417	0.900000	0.35374	0.918000	0.54935	9.823000	0.99369	2.857000	0.98124	0.650000	0.86243	GAT	PCDHGA11	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000253873		0.522	PCDHGA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA11	HGNC	protein_coding	OTTHUMT00000376974.1	23	0.00	0	G	NM_018914		140801497	140801497	+1	no_errors	ENST00000398587	ensembl	human	known	69_37n	missense	19	24.00	6	SNP	1.000	C
PCYOX1L	78991	genome.wustl.edu	37	5	148743738	148743738	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr5:148743738G>T	ENST00000274569.4	+	3	497	c.435G>T	c.(433-435)caG>caT	p.Q145H	PCYOX1L_ENST00000514349.1_Missense_Mutation_p.Q55H	NM_024028.3	NP_076933.3	Q8NBM8	PCYXL_HUMAN	prenylcysteine oxidase 1 like	145					prenylcysteine catabolic process (GO:0030328)	extracellular region (GO:0005576)|membrane (GO:0016020)	prenylcysteine oxidase activity (GO:0001735)	p.Q145H(1)		breast(2)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	11			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGAGGCTGCAGATGTGGGTGG	0.597																																					Ovarian(62;1136 1477 27277 27495)	dbGAP											1	Substitution - Missense(1)	breast(1)											106.0	101.0	103.0					5																	148743738		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4296.1	5q33.1	2008-02-05			ENSG00000145882	ENSG00000145882			28477	protein-coding gene	gene with protein product						12477932	Standard	NM_024028		Approved	MGC3265	uc003lqk.2	Q8NBM8	OTTHUMG00000130052	ENST00000274569.4:c.435G>T	5.37:g.148743738G>T	ENSP00000274569:p.Gln145His		Q7Z4S2|Q8NCY5|Q8NF69|Q9BTE8|Q9BWS3	Missense_Mutation	SNP	pfam_Prenylcys_lyase,pirsf_Prenylcysteine_Oxase	p.Q145H	ENST00000274569.4	37	c.435	CCDS4296.1	5	.	.	.	.	.	.	.	.	.	.	G	12.24	1.880075	0.33162	.	.	ENSG00000145882	ENST00000274569;ENST00000514349	T;T	0.13778	2.56;2.56	5.74	4.87	0.63330	Prenylcysteine lyase (1);	0.000000	0.85682	D	0.000000	T	0.23451	0.0567	L	0.28344	0.845	0.80722	D	1	D;P;P	0.76494	0.999;0.529;0.856	D;B;B	0.87578	0.998;0.211;0.395	T	0.03840	-1.0999	10	0.22706	T	0.39	-21.6784	14.6262	0.68624	0.0702:0.0:0.9298:0.0	.	27;55;145	B3KXF9;E7EVZ5;Q8NBM8	.;.;PCYXL_HUMAN	H	145;55	ENSP00000274569:Q145H;ENSP00000428512:Q55H	ENSP00000274569:Q145H	Q	+	3	2	PCYOX1L	148723931	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.451000	0.73481	1.427000	0.47276	0.491000	0.48974	CAG	PCYOX1L	-	pfam_Prenylcys_lyase,pirsf_Prenylcysteine_Oxase	ENSG00000145882		0.597	PCYOX1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCYOX1L	HGNC	protein_coding	OTTHUMT00000252331.2	123	0.00	0	G	NM_024028		148743738	148743738	+1	no_errors	ENST00000274569	ensembl	human	known	69_37n	missense	68	22.73	20	SNP	1.000	T
PES1	23481	genome.wustl.edu	37	22	30975192	30975192	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr22:30975192C>T	ENST00000405677.1	-	15	1979	c.1036G>A	c.(1036-1038)Gag>Aag	p.E346K	PES1_ENST00000335214.6_Missense_Mutation_p.E480K|PES1_ENST00000402281.1_Missense_Mutation_p.E346K|PES1_ENST00000354694.7_Missense_Mutation_p.E485K|PES1_ENST00000402284.3_Missense_Mutation_p.E468K	NM_001282328.1	NP_001269257.1			pescadillo ribosomal biogenesis factor 1									p.E485K(1)		breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(12)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	29						gaaccagcctctgcatcttcc	0.567																																						dbGAP											1	Substitution - Missense(1)	breast(1)											47.0	48.0	48.0					22																	30975192		2203	4300	6503	-	-	-	SO:0001583	missense	0			U78310	CCDS13880.1, CCDS58802.1, CCDS74842.1	22q12.1	2012-02-23	2012-02-23		ENSG00000100029	ENSG00000100029			8848	protein-coding gene	gene with protein product		605819	"""pescadillo (zebrafish) homolog 1, containing BRCT domain"", ""pescadillo homolog 1, containing BRCT domain (zebrafish)"""			8985183, 10591208, 17353269	Standard	NM_014303		Approved	PES	uc003aij.2	O00541	OTTHUMG00000151077	ENST00000405677.1:c.1036G>A	22.37:g.30975192C>T	ENSP00000385654:p.Glu346Lys			Missense_Mutation	SNP	pfam_Pescadillo,pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.E485K	ENST00000405677.1	37	c.1453		22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.00|11.00	1.510408|1.510408	0.27036|0.27036	.|.	.|.	ENSG00000100029|ENSG00000100029	ENST00000354694;ENST00000402281;ENST00000405677;ENST00000402284;ENST00000335214|ENST00000441668	T;T;T;T;T|.	0.33654|.	1.4;1.4;1.4;1.4;1.4|.	3.73|3.73	3.73|3.73	0.42828|0.42828	.|.	0.647066|.	0.15094|.	N|.	0.280896|.	T|T	0.67258|0.67258	0.2874|0.2874	L|L	0.49126|0.49126	1.545|1.545	0.80722|0.80722	D|D	1|1	B;B;B;B|.	0.29301|.	0.155;0.155;0.241;0.155|.	B;B;B;B|.	0.23419|.	0.021;0.034;0.046;0.021|.	T|T	0.66630|0.66630	-0.5875|-0.5875	10|5	0.27785|.	T|.	0.31|.	-13.8869|-13.8869	15.9654|15.9654	0.79966|0.79966	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	485;468;480;485|.	B2RDF2;B5MCF9;O00541-2;O00541|.	.;.;.;PESC_HUMAN|.	K|K	485;346;346;468;480|91	ENSP00000346725:E485K;ENSP00000384366:E346K;ENSP00000385654:E346K;ENSP00000384252:E468K;ENSP00000334612:E480K|.	ENSP00000334612:E480K|.	E|R	-|-	1|2	0|0	PES1|PES1	29305192|29305192	0.703000|0.703000	0.27826|0.27826	0.019000|0.019000	0.16419|0.16419	0.248000|0.248000	0.25809|0.25809	5.027000|5.027000	0.64109|0.64109	2.026000|2.026000	0.59711|0.59711	0.563000|0.563000	0.77884|0.77884	GAG|AGA	PES1	-	NULL	ENSG00000100029		0.567	PES1-002	PUTATIVE	basic|exp_conf	protein_coding	PES1	HGNC	protein_coding	OTTHUMT00000321189.2	109	0.00	0	C	NM_014303		30975192	30975192	-1	no_errors	ENST00000354694	ensembl	human	known	69_37n	missense	88	15.38	16	SNP	0.985	T
PEX5L	51555	genome.wustl.edu	37	3	179597907	179597907	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr3:179597907C>A	ENST00000467460.1	-	5	645	c.315G>T	c.(313-315)ttG>ttT	p.L105F	PEX5L_ENST00000465751.1_Missense_Mutation_p.L81F|PEX5L_ENST00000467440.2_Intron|PEX5L_ENST00000468741.1_5'UTR|PEX5L-AS1_ENST00000466064.1_RNA|PEX5L_ENST00000392649.3_Intron|PEX5L_ENST00000476138.1_Missense_Mutation_p.L62F|PEX5L_ENST00000485199.1_Missense_Mutation_p.L70F|PEX5L_ENST00000263962.8_Missense_Mutation_p.L103F|PEX5L_ENST00000472994.1_Missense_Mutation_p.L46F|PEX5L_ENST00000464614.1_Intron	NM_001256751.1|NM_016559.2	NP_001243680.1|NP_057643.1	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like	105					maintenance of protein location (GO:0045185)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, docking (GO:0016560)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of membrane potential (GO:0042391)	cytosol (GO:0005829)|dendrite (GO:0030425)|peroxisomal membrane (GO:0005778)|receptor complex (GO:0043235)	peroxisome matrix targeting signal-1 binding (GO:0005052)|peroxisome targeting sequence binding (GO:0000268)|small GTPase binding (GO:0031267)	p.L105F(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)			AGCCAGTGGTCAATACTACCA	0.398																																						dbGAP											1	Substitution - Missense(1)	breast(1)											125.0	115.0	118.0					3																	179597907		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ245503	CCDS3236.1, CCDS58861.1, CCDS58862.1, CCDS58863.1, CCDS58864.1, CCDS58865.1, CCDS58866.1, CCDS58867.1	3q27.1	2013-01-10			ENSG00000114757	ENSG00000114757		"""Tetratricopeptide (TTC) repeat domain containing"""	30024	protein-coding gene	gene with protein product		611058				11463335	Standard	NM_016559		Approved	PEX5R, PXR2	uc003fki.2	Q8IYB4	OTTHUMG00000157363	ENST00000467460.1:c.315G>T	3.37:g.179597907C>A	ENSP00000419975:p.Leu105Phe		B7Z2A5|B7Z305|B7Z318|B7Z5Z5|B7Z8P2|E7EUV8|E7EUZ0|E9PEC1|E9PH97|Q9NQD1|Q9P2U3|Q9P2U4	Missense_Mutation	SNP	pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.L105F	ENST00000467460.1	37	c.315	CCDS3236.1	3	.	.	.	.	.	.	.	.	.	.	C	16.58	3.162501	0.57368	.	.	ENSG00000114757	ENST00000467460;ENST00000263962;ENST00000485199;ENST00000382596;ENST00000476138;ENST00000472994;ENST00000465751;ENST00000469198;ENST00000463761	D;D;D;D;D;D	0.93712	-3.27;-3.27;-3.16;-3.2;-3.21;-3.22	5.23	4.35	0.52113	.	0.000000	0.64402	D	0.000002	D	0.93621	0.7963	L	0.32530	0.975	0.80722	D	1	D;D;D;D;D	0.89917	0.998;0.998;1.0;1.0;0.999	D;D;D;D;D	0.91635	0.996;0.996;0.999;0.999;0.997	D	0.92654	0.6135	10	0.42905	T	0.14	-9.6009	10.8904	0.46992	0.0:0.834:0.0:0.166	.	46;81;103;70;105	E7EUZ0;E9PH97;Q8IYB4-2;Q8IYB4-3;Q8IYB4	.;.;.;.;PEX5R_HUMAN	F	105;103;70;103;62;46;81;94;129	ENSP00000419975:L105F;ENSP00000263962:L103F;ENSP00000418440:L70F;ENSP00000420555:L62F;ENSP00000418054:L46F;ENSP00000419348:L81F	ENSP00000263962:L103F	L	-	3	2	PEX5L	181080601	1.000000	0.71417	0.985000	0.45067	0.538000	0.34931	0.980000	0.29513	1.303000	0.44873	0.650000	0.86243	TTG	PEX5L	-	NULL	ENSG00000114757		0.398	PEX5L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PEX5L	HGNC	protein_coding	OTTHUMT00000348577.1	255	0.00	0	C	NM_016559		179597907	179597907	-1	no_errors	ENST00000467460	ensembl	human	known	69_37n	missense	173	26.38	62	SNP	1.000	A
PIBF1	10464	genome.wustl.edu	37	13	73491243	73491244	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr13:73491243_73491244insT	ENST00000326291.6	+	13	2007_2008	c.1669_1670insT	c.(1669-1671)cttfs	p.L557fs		NM_006346.2	NP_006337.2	Q8WXW3	PIBF1_HUMAN	progesterone immunomodulatory binding factor 1	557						centrosome (GO:0005813)				breast(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24		Prostate(6;0.00191)|Breast(118;0.0736)|Acute lymphoblastic leukemia(28;0.0865)		GBM - Glioblastoma multiforme(99;0.000664)		TGAAAGGGTTCTTTTTTCCTAC	0.302																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF330046	CCDS31991.1	13q21.33	2014-02-20	2007-10-17	2007-10-17	ENSG00000083535	ENSG00000083535			23352	protein-coding gene	gene with protein product	"""progesterone-induced blocking factor 1"""	607532	"""chromosome 13 open reading frame 24"""	C13orf24		11935316	Standard	NM_006346		Approved	CEP90	uc001vjc.3	Q8WXW3	OTTHUMG00000017071	ENST00000326291.6:c.1675dupT	13.37:g.73491249_73491249dupT	ENSP00000317144:p.Leu557fs		O95664|Q6U9V2|Q6UG50|Q86V07|Q96SF4	Frame_Shift_Ins	INS	superfamily_t-SNARE	p.S559fs	ENST00000326291.6	37	c.1669_1670	CCDS31991.1	13																																																																																			PIBF1	-	NULL	ENSG00000083535		0.302	PIBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIBF1	HGNC	protein_coding	OTTHUMT00000045255.1	299	0.00	0	-	NM_006346		73491243	73491244	+1	no_errors	ENST00000326291	ensembl	human	known	69_37n	frame_shift_ins	121	30.86	54	INS	1.000:1.000	T
PIK3C2G	5288	genome.wustl.edu	37	12	18499655	18499655	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr12:18499655G>C	ENST00000266497.5	+	10	1548	c.1510G>C	c.(1510-1512)Gat>Cat	p.D504H	PIK3C2G_ENST00000538779.1_Missense_Mutation_p.D504H|PIK3C2G_ENST00000535651.1_Missense_Mutation_p.D504H|PIK3C2G_ENST00000433979.1_Missense_Mutation_p.D504H			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	504	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.				chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)	p.D504H(2)		breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				CTTTTATGCAGATTTTCAGCC	0.428																																						dbGAP											2	Substitution - Missense(2)	breast(2)											175.0	172.0	173.0					12																	18499655		1936	4133	6069	-	-	-	SO:0001583	missense	0			AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.1510G>C	12.37:g.18499655G>C	ENSP00000266497:p.Asp504His		A1L3U0	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_Phox,pfam_PI3K_Ras-bd_dom,pfam_C2_Ca-dep,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Phox,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,smart_Phox,smart_C2_Ca-dep,pfscan_Phox,pfscan_PI3/4_kinase_cat_dom	p.D504H	ENST00000266497.5	37	c.1510	CCDS44839.1	12	.	.	.	.	.	.	.	.	.	.	G	15.69	2.907839	0.52333	.	.	ENSG00000139144	ENST00000535651;ENST00000433979;ENST00000266497;ENST00000538779	T;T;T;T	0.64085	1.28;-0.06;-0.06;-0.08	3.98	3.09	0.35607	Phosphoinositide 3-kinase, C2 (1);	16.619300	0.00628	N	0.000469	T	0.79215	0.4408	M	0.72894	2.215	0.42460	D	0.992788	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.985;0.994;0.978	T	0.63910	-0.6530	10	0.72032	D	0.01	-21.7365	8.2239	0.31558	0.1954:0.0:0.8046:0.0	.	503;504;504	B7ZLY6;F5H369;O75747	.;.;P3C2G_HUMAN	H	504	ENSP00000443850:D504H;ENSP00000404845:D504H;ENSP00000266497:D504H;ENSP00000445381:D504H	ENSP00000266497:D504H	D	+	1	0	PIK3C2G	18390922	0.994000	0.37717	1.000000	0.80357	0.976000	0.68499	1.602000	0.36783	1.252000	0.44001	0.555000	0.69702	GAT	PIK3C2G	-	NULL	ENSG00000139144		0.428	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	PIK3C2G	HGNC	protein_coding	OTTHUMT00000401316.1	180	0.00	0	G	NM_004570		18499655	18499655	+1	no_errors	ENST00000538779	ensembl	human	known	69_37n	missense	141	25.00	47	SNP	1.000	C
PKN3	29941	genome.wustl.edu	37	9	131476875	131476875	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr9:131476875G>T	ENST00000291906.4	+	12	1909	c.1516G>T	c.(1516-1518)Gag>Tag	p.E506*		NM_013355.3	NP_037487.2	Q6P5Z2	PKN3_HUMAN	protein kinase N3	506	Pro-rich.				epithelial cell migration (GO:0010631)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)	p.E506*(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24						CTTGGGTGAAGAGATGACACC	0.607																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											59.0	62.0	61.0					9																	131476875		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB019692	CCDS6908.1	9q34.13	2008-02-05			ENSG00000160447	ENSG00000160447			17999	protein-coding gene	gene with protein product		610714				10441506	Standard	NM_013355		Approved	PKNbeta	uc004bvw.3	Q6P5Z2	OTTHUMG00000020757	ENST00000291906.4:c.1516G>T	9.37:g.131476875G>T	ENSP00000291906:p.Glu506*		Q9UM03	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_HR1_rho-bd,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_HR1_rho-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_HR1_rho-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_cat_dom	p.E506*	ENST00000291906.4	37	c.1516	CCDS6908.1	9	.	.	.	.	.	.	.	.	.	.	G	42	9.807081	0.99268	.	.	ENSG00000160447	ENST00000291906	.	.	.	4.91	4.91	0.64330	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	.	13.6066	0.62050	0.0:0.0:1.0:0.0	.	.	.	.	X	506	.	ENSP00000291906:E506X	E	+	1	0	PKN3	130516696	0.991000	0.36638	0.725000	0.30721	0.286000	0.27126	3.641000	0.54360	2.284000	0.76573	0.563000	0.77884	GAG	PKN3	-	NULL	ENSG00000160447		0.607	PKN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKN3	HGNC	protein_coding	OTTHUMT00000054487.1	49	0.00	0	G	NM_013355		131476875	131476875	+1	no_errors	ENST00000291906	ensembl	human	known	69_37n	nonsense	34	19.05	8	SNP	0.941	T
PKN3	29941	genome.wustl.edu	37	9	131479161	131479161	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr9:131479161G>A	ENST00000291906.4	+	16	2337	c.1944G>A	c.(1942-1944)atG>atA	p.M648I	PKN3_ENST00000485301.1_3'UTR	NM_013355.3	NP_037487.2	Q6P5Z2	PKN3_HUMAN	protein kinase N3	648	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				epithelial cell migration (GO:0010631)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)	p.M648I(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24						GTGACCTCATGATGCAGATCC	0.607																																						dbGAP											1	Substitution - Missense(1)	breast(1)											232.0	180.0	198.0					9																	131479161		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB019692	CCDS6908.1	9q34.13	2008-02-05			ENSG00000160447	ENSG00000160447			17999	protein-coding gene	gene with protein product		610714				10441506	Standard	NM_013355		Approved	PKNbeta	uc004bvw.3	Q6P5Z2	OTTHUMG00000020757	ENST00000291906.4:c.1944G>A	9.37:g.131479161G>A	ENSP00000291906:p.Met648Ile		Q9UM03	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_HR1_rho-bd,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_HR1_rho-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_HR1_rho-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_cat_dom	p.M648I	ENST00000291906.4	37	c.1944	CCDS6908.1	9	.	.	.	.	.	.	.	.	.	.	G	19.93	3.918968	0.73098	.	.	ENSG00000160447	ENST00000291906	T	0.64618	-0.11	5.35	5.35	0.76521	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.46112	0.1376	N	0.10645	0.015	0.80722	D	1	B	0.18310	0.027	B	0.21151	0.033	T	0.46176	-0.9210	9	0.87932	D	0	.	16.5984	0.84802	0.0:0.0:1.0:0.0	.	648	Q6P5Z2	PKN3_HUMAN	I	648	ENSP00000291906:M648I	ENSP00000291906:M648I	M	+	3	0	PKN3	130518982	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.180000	0.94867	2.503000	0.84419	0.558000	0.71614	ATG	PKN3	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000160447		0.607	PKN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKN3	HGNC	protein_coding	OTTHUMT00000054487.1	94	0.00	0	G	NM_013355		131479161	131479161	+1	no_errors	ENST00000291906	ensembl	human	known	69_37n	missense	56	25.33	19	SNP	1.000	A
PLEKHA4	57664	genome.wustl.edu	37	19	49348692	49348692	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr19:49348692G>A	ENST00000263265.6	-	16	2233	c.1678C>T	c.(1678-1680)Ccg>Tcg	p.P560S	PLEKHA4_ENST00000355496.5_Missense_Mutation_p.P535S	NM_020904.2	NP_065955.2	Q9H4M7	PKHA4_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4	560						cytoplasm (GO:0005737)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)	p.P560S(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	30		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;0.000108)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.00027)|all cancers(93;0.00084)|GBM - Glioblastoma multiforme(486;0.0244)|Epithelial(262;0.0364)		GAGACCCTCGGAGACCCAAGA	0.582																																						dbGAP											1	Substitution - Missense(1)	breast(1)											83.0	88.0	87.0					19																	49348692		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY007233	CCDS12737.1, CCDS54291.1	19q13.33	2013-01-10	2002-01-14			ENSG00000105559		"""Pleckstrin homology (PH) domain containing"""	14339	protein-coding gene	gene with protein product		607769	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 4"""			11001876	Standard	NM_020904		Approved	PEPP1	uc002pkx.3	Q9H4M7		ENST00000263265.6:c.1678C>T	19.37:g.49348692G>A	ENSP00000263265:p.Pro560Ser		Q8N4M8|Q8N658	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.P560S	ENST00000263265.6	37	c.1678	CCDS12737.1	19	.	.	.	.	.	.	.	.	.	.	g	15.61	2.884024	0.51908	.	.	ENSG00000105559	ENST00000263265;ENST00000355496	T;T	0.25912	1.77;1.77	4.97	4.97	0.65823	.	0.459579	0.20142	N	0.098360	T	0.20901	0.0503	L	0.29908	0.895	0.32103	N	0.590286	B;P	0.43094	0.221;0.799	B;B	0.38562	0.244;0.276	T	0.20706	-1.0267	10	0.72032	D	0.01	.	14.5344	0.67950	0.0:0.0:1.0:0.0	.	535;560	Q9H4M7-2;Q9H4M7	.;PKHA4_HUMAN	S	560;535	ENSP00000263265:P560S;ENSP00000347683:P535S	ENSP00000263265:P560S	P	-	1	0	PLEKHA4	54040504	1.000000	0.71417	0.989000	0.46669	0.680000	0.39746	3.862000	0.56009	2.702000	0.92279	0.544000	0.68410	CCG	PLEKHA4	-	NULL	ENSG00000105559		0.582	PLEKHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHA4	HGNC	protein_coding	OTTHUMT00000466216.1	70	0.00	0	G			49348692	49348692	-1	no_errors	ENST00000263265	ensembl	human	known	69_37n	missense	56	21.13	15	SNP	0.997	A
PLG	5340	genome.wustl.edu	37	6	161128786	161128786	+	Silent	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr6:161128786G>A	ENST00000308192.9	+	3	303	c.240G>A	c.(238-240)agG>agA	p.R80R	PLG_ENST00000462918.1_3'UTR|PLG_ENST00000366924.2_Silent_p.R80R	NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen	80	PAN. {ECO:0000255|PROSITE- ProRule:PRU00315}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.R80R(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	CTGAAAACAGGAAGTCCTCCA	0.388																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											178.0	173.0	175.0					6																	161128786		2203	4297	6500	-	-	-	SO:0001819	synonymous_variant	0			M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.240G>A	6.37:g.161128786G>A			Q15146|Q5TEH4|Q6PA00	Silent	SNP	pirsf_Pept_S1A_plasmin,pfam_Kringle,pfam_Peptidase_S1_S6,pfam_PAN-1_domain,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_Pan_app,smart_Kringle,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_Pan_app,pfscan_Kringle,pfscan_Peptidase_S1_S6	p.R80	ENST00000308192.9	37	c.240	CCDS5279.1	6																																																																																			PLG	-	pirsf_Pept_S1A_plasmin,pfam_PAN-1_domain,superfamily_Kringle-like,smart_Pan_app,pfscan_Pan_app	ENSG00000122194		0.388	PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLG	HGNC	protein_coding	OTTHUMT00000042959.2	351	0.00	0	G	NM_000301		161128786	161128786	+1	no_errors	ENST00000308192	ensembl	human	known	69_37n	silent	218	19.26	52	SNP	1.000	A
PLG	5340	genome.wustl.edu	37	6	161160215	161160215	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr6:161160215G>C	ENST00000308192.9	+	16	2056	c.1993G>C	c.(1993-1995)Gat>Cat	p.D665H		NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen	665	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.D665H(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	CACACGAAAAGATATTGCCTT	0.478																																						dbGAP											1	Substitution - Missense(1)	breast(1)											141.0	129.0	133.0					6																	161160215		2203	4300	6503	-	-	-	SO:0001583	missense	0			M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.1993G>C	6.37:g.161160215G>C	ENSP00000308938:p.Asp665His		Q15146|Q5TEH4|Q6PA00	Missense_Mutation	SNP	pirsf_Pept_S1A_plasmin,pfam_Kringle,pfam_Peptidase_S1_S6,pfam_PAN-1_domain,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_Pan_app,smart_Kringle,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_Pan_app,pfscan_Kringle,pfscan_Peptidase_S1_S6	p.D665H	ENST00000308192.9	37	c.1993	CCDS5279.1	6	.	.	.	.	.	.	.	.	.	.	.	19.30	3.801931	0.70682	.	.	ENSG00000122194	ENST00000308192;ENST00000316325	D	0.97598	-4.45	5.23	5.23	0.72850	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.41194	U	0.000940	D	0.99187	0.9718	H	0.98738	4.315	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98863	1.0763	10	0.56958	D	0.05	.	16.58	0.84712	0.0:0.0:1.0:0.0	.	665	P00747	PLMN_HUMAN	H	665;65	ENSP00000308938:D665H	ENSP00000308938:D665H	D	+	1	0	PLG	161080205	1.000000	0.71417	0.052000	0.19188	0.011000	0.07611	7.416000	0.80143	2.439000	0.82584	0.655000	0.94253	GAT	PLG	-	pirsf_Pept_S1A_plasmin,pfam_Peptidase_S1_S6,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_Peptidase_S1_S6	ENSG00000122194		0.478	PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLG	HGNC	protein_coding	OTTHUMT00000042959.2	132	0.00	0	G	NM_000301		161160215	161160215	+1	no_errors	ENST00000308192	ensembl	human	known	69_37n	missense	82	10.87	10	SNP	0.999	C
PML	5371	genome.wustl.edu	37	15	74324915	74324915	+	Silent	SNP	C	C	T	rs543631733	byFrequency	TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr15:74324915C>T	ENST00000268058.3	+	5	1353	c.1257C>T	c.(1255-1257)ccC>ccT	p.P419P	PML_ENST00000564428.1_Intron|PML_ENST00000565898.1_Intron|PML_ENST00000395132.2_Intron|PML_ENST00000436891.3_Silent_p.P419P|PML_ENST00000567543.1_Intron|PML_ENST00000569965.1_Silent_p.P419P|PML_ENST00000354026.6_Intron|PML_ENST00000563500.1_Intron|PML_ENST00000359928.4_Intron|PML_ENST00000569477.1_Silent_p.P419P|PML_ENST00000435786.2_Silent_p.P419P|PML_ENST00000569161.1_3'UTR|PML_ENST00000268059.6_Silent_p.P419P|PML_ENST00000395135.3_Silent_p.P419P	NM_033238.2	NP_150241.2	P29590	PML_HUMAN	promyelocytic leukemia	419				P -> A (in Ref. 2; AAA60351/AAA60388/ AAA60390, 4; AAA60352 and 5; AAG50182/ AAG50184/AAG50185). {ECO:0000305}.	activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to interleukin-4 (GO:0071353)|cellular senescence (GO:0090398)|circadian regulation of gene expression (GO:0032922)|common-partner SMAD protein phosphorylation (GO:0007182)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|entrainment of circadian clock by photoperiod (GO:0043153)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|maintenance of protein location in nucleus (GO:0051457)|myeloid cell differentiation (GO:0030099)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation in response to oxidative stress (GO:0032938)|negative regulation of viral release from host cell (GO:1902187)|PML body organization (GO:0030578)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of histone deacetylation (GO:0031065)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)|regulation of calcium ion transport into cytosol (GO:0010522)|regulation of circadian rhythm (GO:0042752)|regulation of double-strand break repair (GO:2000779)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of protein phosphorylation (GO:0001932)|regulation of transcription, DNA-templated (GO:0006355)|response to cytokine (GO:0034097)|response to gamma radiation (GO:0010332)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|retinoic acid receptor signaling pathway (GO:0048384)|SMAD protein import into nucleus (GO:0007184)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extrinsic component of endoplasmic reticulum membrane (GO:0042406)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	cobalt ion binding (GO:0050897)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|SUMO binding (GO:0032183)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.P419P(3)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	31						CTTTGCAGCCCGAGGAGGCAG	0.627			T	"""RARA, PAX5"""	"""APL, ALL"""								C|||	2	0.000399361	0.0	0.0	5008	,	,		18614	0.002		0.0	False		,,,				2504	0.0					dbGAP		Dom	yes		15	15q22	5371	promyelocytic leukemia		L	3	Substitution - coding silent(3)	breast(3)											38.0	37.0	38.0					15																	74324915		2198	4297	6495	-	-	-	SO:0001819	synonymous_variant	0			AB208950	CCDS10255.1, CCDS10256.1, CCDS10257.1, CCDS10258.1, CCDS45297.1, CCDS45298.1, CCDS45299.1, CCDS45300.1, CCDS58386.1	15q24.1	2011-04-21			ENSG00000140464	ENSG00000140464		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9113	protein-coding gene	gene with protein product		102578					Standard	NM_033244		Approved	MYL, TRIM19, RNF71	uc002awv.3	P29590	OTTHUMG00000137607	ENST00000268058.3:c.1257C>T	15.37:g.74324915C>T			E9PBR7|P29591|P29592|P29593|Q00755|Q15959|Q59FP9|Q8WUA0|Q96S41|Q9BPW2|Q9BWP7|Q9BZX6|Q9BZX7|Q9BZX8|Q9BZX9|Q9BZY0|Q9BZY2|Q9BZY3	Nonsense_Mutation	SNP	pfam_DUF3583	p.R191*	ENST00000268058.3	37	c.571	CCDS10255.1	15																																																																																			PML	-	pfam_DUF3583	ENSG00000140464		0.627	PML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PML	HGNC	protein_coding	OTTHUMT00000269021.3	17	0.00	0	C	NM_002675		74324915	74324915	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000565239	ensembl	human	novel	69_37n	nonsense	13	27.78	5	SNP	0.028	T
PNCK	139728	genome.wustl.edu	37	X	152937598	152937598	+	Silent	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chrX:152937598G>A	ENST00000370150.1	-	4	436	c.258C>T	c.(256-258)ctC>ctT	p.L86L	PNCK_ENST00000340888.3_Silent_p.L86L|PNCK_ENST00000475172.1_5'UTR|PNCK_ENST00000370145.4_Silent_p.L103L|PNCK_ENST00000447676.2_Silent_p.L169L|PNCK_ENST00000370142.1_Silent_p.L86L|PNCK_ENST00000393831.2_Silent_p.L86L			Q6P2M8	KCC1B_HUMAN	pregnancy up-regulated nonubiquitous CaM kinase	86	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)	p.L86L(1)|p.L103L(1)|p.L115L(1)		breast(2)|lung(3)|skin(1)	6	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TGGCCAGGTAGAGGTGGGAAG	0.637																																						dbGAP											3	Substitution - coding silent(3)	breast(3)											95.0	70.0	79.0					X																	152937598		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC033746	CCDS35503.2, CCDS48189.1	Xq28	2013-10-14	2013-10-14		ENSG00000130822	ENSG00000130822			13415	protein-coding gene	gene with protein product		300680	"""pregnancy upregulated non-ubiquitously expressed CaM kinase"", ""pregnancy up-regulated non-ubiquitously expressed CaM kinase"""			12477932	Standard	NM_001039582		Approved	MGC45419, CaMK1b	uc011myu.2	Q6P2M8	OTTHUMG00000024216	ENST00000370150.1:c.258C>T	X.37:g.152937598G>A			B4DJR8|B4E1A6|B7WPG0|D3DWU7|Q8N4R0	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom	p.S93F	ENST00000370150.1	37	c.278		X	.	.	.	.	.	.	.	.	.	.	g	13.13	2.146238	0.37923	.	.	ENSG00000130822	ENST00000418241	T	0.52295	0.67	5.01	-3.36	0.04913	.	.	.	.	.	T	0.49150	0.1540	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53201	-0.8472	6	0.87932	D	0	-15.5739	6.7283	0.23369	0.1524:0.5789:0.1666:0.1021	.	.	.	.	F	93	ENSP00000411267:S93F	ENSP00000391264:S76F	S	-	2	0	PNCK	152590792	0.316000	0.24580	0.856000	0.33681	0.891000	0.51852	-0.357000	0.07651	-0.966000	0.03587	-1.192000	0.01694	TCT	PNCK	-	NULL	ENSG00000130822		0.637	PNCK-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal	protein_coding	PNCK	HGNC	protein_coding	OTTHUMT00000061044.2	29	0.00	0	G	NM_198452		152937598	152937598	-1	no_errors	ENST00000433470	ensembl	human	known	69_37n	missense	16	30.43	7	SNP	0.976	A
PRMT2	3275	genome.wustl.edu	37	21	48080771	48080771	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr21:48080771C>G	ENST00000397637.1	+	8	1811	c.857C>G	c.(856-858)tCa>tGa	p.S286*	PRMT2_ENST00000451211.2_Intron|PRMT2_ENST00000440086.1_Intron|PRMT2_ENST00000291705.6_Intron|PRMT2_ENST00000397638.2_Nonsense_Mutation_p.S286*|PRMT2_ENST00000458387.2_Intron|PRMT2_ENST00000355680.3_Nonsense_Mutation_p.S286*			P55345	ANM2_HUMAN	protein arginine methyltransferase 2	286	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				developmental cell growth (GO:0048588)|histone arginine methylation (GO:0034969)|histone methylation (GO:0016571)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|protein methylation (GO:0006479)|regulation of androgen receptor signaling pathway (GO:0060765)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (GO:0042054)|histone-arginine N-methyltransferase activity (GO:0008469)|peroxisome proliferator activated receptor binding (GO:0042975)|progesterone receptor binding (GO:0033142)|protein homodimerization activity (GO:0042803)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|retinoic acid receptor binding (GO:0042974)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.S286*(1)		NS(1)|breast(3)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16	Breast(49;0.247)	Lung NSC(3;0.245)		Epithelial(3;1.03e-07)|OV - Ovarian serous cystadenocarcinoma(3;4.68e-07)|all cancers(3;7.48e-07)|Colorectal(79;0.167)|Lung(125;0.203)|LUSC - Lung squamous cell carcinoma(216;0.23)|READ - Rectum adenocarcinoma(84;0.248)		GAGTTTTTTTCAAAGCCCAAG	0.418																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											135.0	138.0	137.0					21																	48080771		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U80213	CCDS13737.1, CCDS56219.1, CCDS56220.1, CCDS68230.1, CCDS68231.1, CCDS74806.1	21q22.3	2014-06-12	2006-02-16	2006-02-16	ENSG00000160310	ENSG00000160310	2.1.1.125	"""Protein arginine methyltransferases"""	5186	protein-coding gene	gene with protein product		601961	"""HMT1 (hnRNP methyltransferase, S. cerevisiae)-like 1"", ""HMT1 hnRNP methyltransferase-like 1 (S. cerevisiae)"""	HRMT1L1		9545638	Standard	XM_005261111		Approved	MGC111373	uc002zjy.3	P55345	OTTHUMG00000048806	ENST00000397637.1:c.857C>G	21.37:g.48080771C>G	ENSP00000380759:p.Ser286*		B7U630|B7U631|B7U632|P78350|Q498Y5|Q5U7D4|Q6FHF0|Q99781|Q9BW15|Q9UMC2	Nonsense_Mutation	SNP	pfam_SH3_domain,pfam_Arg_MeTrfase,pfam_SH3_2,pfam_Small_mtfrase_dom,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_tRNA_Trfase_Trm5/Tyw2,superfamily_SH3_domain,smart_SH3_domain,prints_SH3_domain,pfscan_SH3_domain	p.S286*	ENST00000397637.1	37	c.857	CCDS13737.1	21	.	.	.	.	.	.	.	.	.	.	.	46	12.304876	0.99655	.	.	ENSG00000160310	ENST00000355680;ENST00000397638;ENST00000397637	.	.	.	5.29	5.29	0.74685	.	0.362255	0.28360	N	0.015640	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-9.7024	16.8046	0.85623	0.0:1.0:0.0:0.0	.	.	.	.	X	286	.	.	S	+	2	0	PRMT2	46905199	0.999000	0.42202	0.997000	0.53966	0.978000	0.69477	3.719000	0.54926	2.647000	0.89833	0.655000	0.94253	TCA	PRMT2	-	pfam_Arg_MeTrfase	ENSG00000160310		0.418	PRMT2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRMT2	HGNC	protein_coding	OTTHUMT00000207401.1	194	0.00	0	C	NM_001535		48080771	48080771	+1	no_errors	ENST00000355680	ensembl	human	known	69_37n	nonsense	138	23.33	42	SNP	0.998	G
PTEN	5728	genome.wustl.edu	37	10	89692900	89692900	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr10:89692900G>C	ENST00000371953.3	+	5	1741	c.384G>C	c.(382-384)aaG>aaC	p.K128N		NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	128	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.?(5)|p.R55fs*1(5)|p.K128N(4)|p.K128_R130del(3)|p.Y27fs*1(2)|p.A121_F145del(1)|p.G127fs*5(1)|p.F56fs*2(1)|p.K128fs*47(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AAGCTGGAAAGGGACGAACTG	0.413		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																												dbGAP	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	60	Whole gene deletion(37)|Deletion - Frameshift(10)|Unknown(5)|Substitution - Missense(4)|Deletion - In frame(4)	prostate(17)|central_nervous_system(12)|skin(6)|lung(5)|ovary(5)|haematopoietic_and_lymphoid_tissue(4)|endometrium(4)|breast(4)|cervix(1)|soft_tissue(1)|urinary_tract(1)											142.0	131.0	135.0					10																	89692900		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.384G>C	10.37:g.89692900G>C	ENSP00000361021:p.Lys128Asn		B2R904|F2YHV0|O00633|O02679|Q6ICT7	Missense_Mutation	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Tyr_Pase_cat,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tyr/Dual-specificity_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.K128N	ENST00000371953.3	37	c.384	CCDS31238.1	10	.	.	.	.	.	.	.	.	.	.	G	23.9	4.468213	0.84533	.	.	ENSG00000171862	ENST00000371953	D	0.85484	-1.99	5.22	4.3	0.51218	Phosphatase tensin type (1);Dual specificity phosphatase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.94591	0.8257	H	0.96430	3.82	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.95797	0.8829	9	.	.	.	-9.6267	14.1332	0.65268	0.0736:0.0:0.9264:0.0	.	128	P60484	PTEN_HUMAN	N	128	ENSP00000361021:K128N	.	K	+	3	2	PTEN	89682880	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.598000	0.82745	1.149000	0.42402	0.655000	0.94253	AAG	PTEN	-	pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tyr/Dual-specificity_Pase,pfscan_Phosphatase_tensin-typ	ENSG00000171862		0.413	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTEN	HGNC	protein_coding	OTTHUMT00000049241.1	211	0.00	0	G	NM_000314		89692900	89692900	+1	no_errors	ENST00000371953	ensembl	human	known	69_37n	missense	92	32.35	44	SNP	1.000	C
PTPN2	5771	genome.wustl.edu	37	18	12836858	12836858	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr18:12836858C>G	ENST00000309660.5	-	3	286	c.193G>C	c.(193-195)Gag>Cag	p.E65Q	PTPN2_ENST00000589086.1_5'UTR|PTPN2_ENST00000591115.1_Missense_Mutation_p.E65Q|PTPN2_ENST00000327283.3_Missense_Mutation_p.E65Q|PTPN2_ENST00000353319.4_Missense_Mutation_p.E65Q|PTPN2_ENST00000591497.1_Missense_Mutation_p.E36Q	NM_002828.3	NP_002819.2	P17706	PTN2_HUMAN	protein tyrosine phosphatase, non-receptor type 2	65	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				B cell differentiation (GO:0030183)|cytokine-mediated signaling pathway (GO:0019221)|erythrocyte differentiation (GO:0030218)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemotaxis (GO:0050922)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of interleukin-2-mediated signaling pathway (GO:1902206)|negative regulation of interleukin-4-mediated signaling pathway (GO:1902215)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|negative regulation of lipid storage (GO:0010888)|negative regulation of macrophage colony-stimulating factor signaling pathway (GO:1902227)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of positive thymic T cell selection (GO:1902233)|negative regulation of prolactin signaling pathway (GO:1902212)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|negative regulation of tyrosine phosphorylation of Stat1 protein (GO:0042512)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|negative regulation of tyrosine phosphorylation of Stat6 protein (GO:0042527)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of gluconeogenesis (GO:0045722)|regulation of hepatocyte growth factor receptor signaling pathway (GO:1902202)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|T cell differentiation (GO:0030217)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|syntaxin binding (GO:0019905)	p.E65Q(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|prostate(1)|skin(3)	13		Lung NSC(161;8.94e-06)				TAATCATTCTCAGCATTTTGC	0.323																																						dbGAP											1	Substitution - Missense(1)	breast(1)											185.0	166.0	173.0					18																	12836858		2203	4300	6503	-	-	-	SO:0001583	missense	0			M25393	CCDS11863.1, CCDS11864.1, CCDS11865.1, CCDS59306.1	18p11.3-p11.2	2011-06-09			ENSG00000175354	ENSG00000175354		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9650	protein-coding gene	gene with protein product		176887		PTPT		2164224	Standard	NM_002828		Approved	TCELLPTP, TC-PTP, TCPTP	uc002krp.3	P17706	OTTHUMG00000131702	ENST00000309660.5:c.193G>C	18.37:g.12836858C>G	ENSP00000311857:p.Glu65Gln		A8K955|A8MXU3|K7ENG3|Q96AU5|Q96HR2	Missense_Mutation	SNP	pirsf_Tyr_Pase_non-rcpt_typ-1/2,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.E65Q	ENST00000309660.5	37	c.193	CCDS11865.1	18	.	.	.	.	.	.	.	.	.	.	C	19.02	3.745286	0.69418	.	.	ENSG00000175354	ENST00000327283;ENST00000353319;ENST00000341361;ENST00000309660	D;D;D	0.83506	-1.73;-1.73;-1.73	5.96	5.96	0.96718	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.53938	D	0.000041	T	0.79387	0.4437	L	0.35593	1.075	0.58432	D	0.999999	B;B;B;B;B	0.34329	0.266;0.112;0.032;0.449;0.137	B;B;B;B;B	0.34824	0.19;0.053;0.088;0.173;0.088	T	0.78858	-0.2038	10	0.66056	D	0.02	.	20.422	0.99049	0.0:1.0:0.0:0.0	.	65;65;42;65;65	P17706;P17706-2;Q59F91;Q96AU5;A8K3N4	PTN2_HUMAN;.;.;.;.	Q	65;65;42;65	ENSP00000320298:E65Q;ENSP00000320546:E65Q;ENSP00000311857:E65Q	ENSP00000311857:E65Q	E	-	1	0	PTPN2	12826858	1.000000	0.71417	0.995000	0.50966	0.894000	0.52154	7.304000	0.78882	2.832000	0.97577	0.655000	0.94253	GAG	PTPN2	-	pirsf_Tyr_Pase_non-rcpt_typ-1/2,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000175354		0.323	PTPN2-002	KNOWN	basic|CCDS	protein_coding	PTPN2	HGNC	protein_coding	OTTHUMT00000254613.3	304	0.00	0	C	NM_002828, NM_080422, NM_080423		12836858	12836858	-1	no_errors	ENST00000309660	ensembl	human	known	69_37n	missense	158	23.19	48	SNP	1.000	G
RAC2	5880	genome.wustl.edu	37	22	37628023	37628023	+	Silent	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr22:37628023G>A	ENST00000249071.6	-	4	358	c.237C>T	c.(235-237)ctC>ctT	p.L79L	RAC2_ENST00000405484.1_Silent_p.L72L|RAC2_ENST00000406508.1_Silent_p.L35L	NM_002872.3	NP_002863.1	P15153	RAC2_HUMAN	ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)	79					actin filament organization (GO:0007015)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|bone resorption (GO:0045453)|cell projection assembly (GO:0030031)|G-protein coupled receptor signaling pathway (GO:0007186)|lymphocyte aggregation (GO:0071593)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of neutrophil chemotaxis (GO:0090023)|regulation of cell-substrate adhesion (GO:0010810)|regulation of hydrogen peroxide metabolic process (GO:0010310)|regulation of neutrophil migration (GO:1902622)|regulation of respiratory burst (GO:0060263)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.L79L(1)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(2)|upper_aerodigestive_tract(1)	12					Dextromethorphan(DB00514)	AGAAGCAGATGAGGAAGACGT	0.642																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											78.0	62.0	67.0					22																	37628023		2129	4130	6259	-	-	-	SO:0001819	synonymous_variant	0			M64595	CCDS13945.1	22q13.1	2014-09-17			ENSG00000128340	ENSG00000128340		"""Endogenous ligands"""	9802	protein-coding gene	gene with protein product		602049				2674130	Standard	NM_002872		Approved	EN-7	uc003arc.3	P15153	OTTHUMG00000150540	ENST00000249071.6:c.237C>T	22.37:g.37628023G>A			Q9UDJ4	Silent	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.L79	ENST00000249071.6	37	c.237	CCDS13945.1	22																																																																																			RAC2	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000128340		0.642	RAC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAC2	HGNC	protein_coding	OTTHUMT00000318812.1	43	0.00	0	G			37628023	37628023	-1	no_errors	ENST00000249071	ensembl	human	known	69_37n	silent	19	24.00	6	SNP	1.000	A
RAD50	10111	genome.wustl.edu	37	5	131925407	131925407	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr5:131925407G>A	ENST00000265335.6	+	9	1717	c.1330G>A	c.(1330-1332)Gag>Aag	p.E444K	RAD50_ENST00000378823.3_Missense_Mutation_p.E305K			Q92878	RAD50_HUMAN	RAD50 homolog (S. cerevisiae)	444					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|reciprocal meiotic recombination (GO:0007131)|regulation of mitotic recombination (GO:0000019)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	membrane (GO:0016020)|Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|nuclease activity (GO:0004518)|protein binding, bridging (GO:0030674)|zinc ion binding (GO:0008270)	p.E305K(1)|p.E444K(1)		breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AAGAATAATTGAGTTAAAATC	0.333								Homologous recombination																														dbGAP											2	Substitution - Missense(2)	breast(2)											75.0	78.0	77.0					5																	131925407		2203	4299	6502	-	-	-	SO:0001583	missense	0			Z75311	CCDS34233.1	5q23-q31	2008-05-30	2001-11-28		ENSG00000113522	ENSG00000113522			9816	protein-coding gene	gene with protein product		604040	"""RAD50 (S. cerevisiae) homolog"""			8756642, 9705271	Standard	NM_005732		Approved	hRad50, RAD50-2	uc003kxi.3	Q92878	OTTHUMG00000059613	ENST00000265335.6:c.1330G>A	5.37:g.131925407G>A	ENSP00000265335:p.Glu444Lys		B9EGF5|O43254|Q6GMT7|Q6P5X3|Q9UP86	Missense_Mutation	SNP	pfam_Rad50_Zn_hook,superfamily_Prefoldin,pfscan_Zn_hook_Rad50,tigrfam_Rad50	p.E444K	ENST00000265335.6	37	c.1330	CCDS34233.1	5	.	.	.	.	.	.	.	.	.	.	G	18.72	3.684238	0.68157	.	.	ENSG00000113522	ENST00000378823;ENST00000265335;ENST00000453394	T;T;T	0.06528	3.5;3.72;3.29	5.51	5.51	0.81932	.	0.043626	0.85682	D	0.000000	T	0.09555	0.0235	M	0.62723	1.935	0.80722	D	1	B	0.24368	0.102	B	0.24006	0.05	T	0.18178	-1.0345	10	0.07990	T	0.79	-19.4438	18.7706	0.91890	0.0:0.0:1.0:0.0	.	444	Q92878	RAD50_HUMAN	K	305;444;444	ENSP00000368100:E305K;ENSP00000265335:E444K;ENSP00000400049:E444K	ENSP00000265335:E444K	E	+	1	0	RAD50	131953306	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.464000	0.80887	2.747000	0.94245	0.650000	0.86243	GAG	RAD50	-	tigrfam_Rad50	ENSG00000113522		0.333	RAD50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD50	HGNC	protein_coding	OTTHUMT00000132566.5	179	0.00	0	G	NM_005732		131925407	131925407	+1	no_errors	ENST00000265335	ensembl	human	known	69_37n	missense	138	18.34	31	SNP	1.000	A
RASA3	22821	genome.wustl.edu	37	13	114781703	114781703	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr13:114781703C>G	ENST00000334062.7	-	13	1372	c.1251G>C	c.(1249-1251)ttG>ttC	p.L417F	RASA3_ENST00000389544.4_Missense_Mutation_p.L385F	NM_007368.2	NP_031394.2	Q14644	RASA3_HUMAN	RAS p21 protein activator 3	417	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				calcium ion transmembrane transport (GO:0070588)|intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	calcium-release channel activity (GO:0015278)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)	p.L417L(1)|p.L417F(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			CTCCGTCTTTCAACTTCACAG	0.517																																						dbGAP											2	Substitution - Missense(1)|Substitution - coding silent(1)	lung(1)|breast(1)											162.0	138.0	146.0					13																	114781703		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32016.1	13q34	2013-01-10			ENSG00000185989	ENSG00000185989		"""Pleckstrin homology (PH) domain containing"""	20331	protein-coding gene	gene with protein product		605182				7637787, 9382842	Standard	NM_007368		Approved	GAP1IP4BP, GAPIII	uc001vui.3	Q14644	OTTHUMG00000017399	ENST00000334062.7:c.1251G>C	13.37:g.114781703C>G	ENSP00000335029:p.Leu417Phe		A6NL15|F8W6X8|Q8IUY2	Missense_Mutation	SNP	pfam_RasGAP,pfam_C2_Ca-dep,pfam_Znf_Btk_motif,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_RasGAP,smart_Pleckstrin_homology,smart_Znf_Btk_motif,prints_Znf_Btk_motif,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_Znf_Btk_motif,pfscan_RasGAP	p.L417F	ENST00000334062.7	37	c.1251	CCDS32016.1	13	.	.	.	.	.	.	.	.	.	.	C	11.35	1.613193	0.28712	.	.	ENSG00000185989	ENST00000334062;ENST00000389544	T;T	0.80824	-1.42;-1.42	4.67	0.136	0.14780	Rho GTPase activation protein (1);Ras GTPase-activating protein (4);	0.000000	0.64402	D	0.000001	D	0.89822	0.6826	M	0.92833	3.35	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87807	0.2629	9	.	.	.	.	9.1209	0.36786	0.0:0.3487:0.0:0.6513	.	417	Q14644	RASA3_HUMAN	F	417;385	ENSP00000335029:L417F;ENSP00000374195:L385F	.	L	-	3	2	RASA3	113799805	0.997000	0.39634	0.048000	0.18961	0.121000	0.20230	0.233000	0.17911	-0.253000	0.09514	-0.218000	0.12543	TTG	RASA3	-	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,smart_RasGAP,pfscan_RasGAP	ENSG00000185989		0.517	RASA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASA3	HGNC	protein_coding	OTTHUMT00000045957.2	195	0.00	0	C	NM_007368		114781703	114781703	-1	no_errors	ENST00000334062	ensembl	human	known	69_37n	missense	142	18.86	33	SNP	0.982	G
RC3H2	54542	genome.wustl.edu	37	9	125616341	125616341	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr9:125616341G>A	ENST00000373670.1	-	17	3607	c.3007C>T	c.(3007-3009)Cag>Tag	p.Q1003*	RC3H2_ENST00000357244.2_Nonsense_Mutation_p.Q1003*|RC3H2_ENST00000423239.2_Nonsense_Mutation_p.Q1003*			Q9HBD1	RC3H2_HUMAN	ring finger and CCCH-type domains 2	1003					B cell homeostasis (GO:0001782)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymph node development (GO:0048535)|multicellular organism growth (GO:0035264)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|post-embryonic development (GO:0009791)|posttranscriptional regulation of gene expression (GO:0010608)|protein polyubiquitination (GO:0000209)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Q1003*(1)		breast(3)|central_nervous_system(1)|endometrium(6)|large_intestine(4)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33						GCCTCTCTCTGAAGAAGTAAT	0.393																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											88.0	81.0	83.0					9																	125616341		1862	4104	5966	-	-	-	SO:0001587	stop_gained	0			AK000308	CCDS43874.1, CCDS48014.1	9q34	2013-01-18	2010-09-15	2007-02-06	ENSG00000056586	ENSG00000056586		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	21461	protein-coding gene	gene with protein product		615231	"""membrane associated DNA binding protein"", ""ring finger and CCCH-type zinc finger domains 2"""	MNAB		10938276	Standard	NM_001100588		Approved	FLJ20301, FLJ20713, RNF164	uc010mwc.1	Q9HBD1	OTTHUMG00000020632	ENST00000373670.1:c.3007C>T	9.37:g.125616341G>A	ENSP00000362774:p.Gln1003*		Q4VXB1|Q5JPD7|Q86ST6|Q8N3D6|Q96F27|Q9H5J2|Q9HBD2|Q9NWN9|Q9NXE1	Nonsense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_RING,smart_Znf_CCCH,pfscan_Znf_RING	p.Q1003*	ENST00000373670.1	37	c.3007	CCDS43874.1	9	.	.	.	.	.	.	.	.	.	.	G	41	8.852959	0.98978	.	.	ENSG00000056586	ENST00000373670;ENST00000357244;ENST00000373663;ENST00000423239	.	.	.	6.07	5.17	0.71159	.	0.149549	0.47093	D	0.000259	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-0.5338	13.2274	0.59922	0.0743:0.0:0.9257:0.0	.	.	.	.	X	1003;1003;874;1003	.	ENSP00000349783:Q1003X	Q	-	1	0	RC3H2	124656162	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.166000	0.64965	2.885000	0.99019	0.655000	0.94253	CAG	RC3H2	-	NULL	ENSG00000056586		0.393	RC3H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RC3H2	HGNC	protein_coding	OTTHUMT00000053966.1	176	0.00	0	G	NM_018835		125616341	125616341	-1	no_errors	ENST00000357244	ensembl	human	known	69_37n	nonsense	88	33.83	45	SNP	1.000	A
RDH11	51109	genome.wustl.edu	37	14	68156953	68156953	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr14:68156953G>A	ENST00000381346.4	-	5	750	c.640C>T	c.(640-642)Cag>Tag	p.Q214*	RP11-1012A1.4_ENST00000553306.1_Silent_p.P44P|RDH11_ENST00000428130.2_Intron|RDH11_ENST00000553384.1_Nonsense_Mutation_p.Q201*|RP11-1012A1.4_ENST00000554493.1_5'UTR	NM_001252650.1|NM_016026.3	NP_001239579.1|NP_057110.3	Q8TC12	RDH11_HUMAN	retinol dehydrogenase 11 (all-trans/9-cis/11-cis)	214					adaptation of rhodopsin mediated signaling (GO:0016062)|phototransduction, visible light (GO:0007603)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|photoreceptor inner segment (GO:0001917)	NADP-retinol dehydrogenase activity (GO:0052650)|retinol dehydrogenase activity (GO:0004745)	p.Q214*(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(3)|ovary(1)	12				all cancers(60;0.00047)|OV - Ovarian serous cystadenocarcinoma(108;0.00206)|BRCA - Breast invasive adenocarcinoma(234;0.00924)	Vitamin A(DB00162)	GCCAGTTCCTGGGTGAAGAGG	0.512																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											132.0	114.0	121.0					14																	68156953		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF151840	CCDS32104.1, CCDS58326.1	14q24.1	2013-10-15	2006-05-09		ENSG00000072042	ENSG00000072042	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	17964	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 1"", ""androgen-regulated short-chain dehydrogenase/reductase 1"""	607849	"""retinol dehydrogenase 11 (all-trans and 9-cis)"""			12226107, 8018917, 19027726	Standard	NM_016026		Approved	MDT1, SDR7C1, ARSDR1	uc001xjv.4	Q8TC12	OTTHUMG00000171196	ENST00000381346.4:c.640C>T	14.37:g.68156953G>A	ENSP00000370750:p.Gln214*		A6NDK3|A8K062|B2RB26|B4DDW0|Q0QD40|Q6IAH5|Q9NRW0|Q9Y391	Nonsense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,pfam_Epimerase_deHydtase,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.Q214*	ENST00000381346.4	37	c.640	CCDS32104.1	14	.	.	.	.	.	.	.	.	.	.	G	18.36	3.606598	0.66445	.	.	ENSG00000072042	ENST00000381346;ENST00000553384;ENST00000554035;ENST00000557273;ENST00000557726	.	.	.	5.51	1.27	0.21489	.	0.635998	0.16653	N	0.205143	.	.	.	.	.	.	0.27325	N	0.956949	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	.	16.001	0.80292	0.0:0.0:0.3189:0.6811	.	.	.	.	X	214;201;113;127;162	.	ENSP00000370750:Q214X	Q	-	1	0	RDH11	67226706	0.999000	0.42202	0.103000	0.21229	0.988000	0.76386	1.457000	0.35212	-0.059000	0.13154	-0.284000	0.09977	CAG	RDH11	-	pfam_Epimerase_deHydtase,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	ENSG00000072042		0.512	RDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RDH11	HGNC	protein_coding	OTTHUMT00000412257.3	112	0.00	0	G			68156953	68156953	-1	no_errors	ENST00000381346	ensembl	human	known	69_37n	nonsense	76	10.47	9	SNP	0.495	A
ROBO1	6091	genome.wustl.edu	37	3	78710205	78710205	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr3:78710205G>C	ENST00000464233.1	-	16	2408	c.2295C>G	c.(2293-2295)atC>atG	p.I765M	ROBO1_ENST00000467549.1_Missense_Mutation_p.I729M|ROBO1_ENST00000495273.1_Missense_Mutation_p.I729M|ROBO1_ENST00000436010.2_Missense_Mutation_p.I726M	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	765	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)	p.I765M(1)|p.I742M(1)|p.I769M(1)|p.I729M(1)		breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		TGGCAAACTTGATTTCACTAT	0.353																																						dbGAP											4	Substitution - Missense(4)	breast(4)											94.0	88.0	90.0					3																	78710205		1834	4089	5923	-	-	-	SO:0001583	missense	0			AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.2295C>G	3.37:g.78710205G>C	ENSP00000420321:p.Ile765Met		B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.I765M	ENST00000464233.1	37	c.2295	CCDS54611.1	3	.	.	.	.	.	.	.	.	.	.	G	15.23	2.772207	0.49680	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	T;T;T;T	0.55234	0.53;0.53;0.53;0.53	5.24	1.97	0.26223	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.165135	0.53938	D	0.000057	T	0.47691	0.1459	M	0.62723	1.935	0.36228	D	0.852445	B;B;B;P;B;B	0.39717	0.343;0.002;0.003;0.684;0.003;0.003	B;B;B;P;B;B	0.44561	0.373;0.007;0.007;0.453;0.011;0.016	T	0.47849	-0.9085	9	.	.	.	.	2.5921	0.04845	0.1575:0.2394:0.4933:0.1098	.	729;729;765;729;729;726	Q9Y6N7-3;Q1RMC7;Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	.;.;ROBO1_HUMAN;.;.;.	M	726;729;765;729;729;769	ENSP00000406043:I726M;ENSP00000420321:I765M;ENSP00000420637:I729M;ENSP00000417992:I729M	.	I	-	3	3	ROBO1	78792895	1.000000	0.71417	0.999000	0.59377	0.978000	0.69477	1.022000	0.30052	-0.002000	0.14469	0.561000	0.74099	ATC	ROBO1	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000169855		0.353	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO1	HGNC	protein_coding	OTTHUMT00000352610.1	251	0.00	0	G	NM_002941		78710205	78710205	-1	no_errors	ENST00000464233	ensembl	human	known	69_37n	missense	165	21.43	45	SNP	1.000	C
RSAD1	55316	genome.wustl.edu	37	17	48557311	48557311	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr17:48557311G>C	ENST00000258955.2	+	3	425	c.340G>C	c.(340-342)Gag>Cag	p.E114Q		NM_018346.1	NP_060816.1	Q9HA92	RSAD1_HUMAN	radical S-adenosyl methionine domain containing 1	114					porphyrin-containing compound biosynthetic process (GO:0006779)	mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|coproporphyrinogen oxidase activity (GO:0004109)|metal ion binding (GO:0046872)	p.E114Q(1)		breast(1)|endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	16	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			TGCTGTCCTGGAGGCTGTGGC	0.602											OREG0024566	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Substitution - Missense(1)	breast(1)											47.0	55.0	52.0					17																	48557311		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK002026	CCDS11569.1	17q21.33	2004-11-08			ENSG00000136444	ENSG00000136444			25634	protein-coding gene	gene with protein product						12477932	Standard	NM_018346		Approved	FLJ11164	uc002iqw.1	Q9HA92	OTTHUMG00000162126	ENST00000258955.2:c.340G>C	17.37:g.48557311G>C	ENSP00000258955:p.Glu114Gln	955	B4DMW0|Q53HV8|Q86VC4|Q9BRY7|Q9NUS7	Missense_Mutation	SNP	pfam_HemN_C_dom,pfam_rSAM,smart_Elp3/MiaB/NifB,tigrfam_Coprogen_oxidase_HemN-rel	p.E114Q	ENST00000258955.2	37	c.340	CCDS11569.1	17	.	.	.	.	.	.	.	.	.	.	G	19.34	3.808392	0.70797	.	.	ENSG00000136444	ENST00000258955	T	0.24538	1.85	4.64	4.64	0.57946	Elongator protein 3/MiaB/NifB (1);Radical SAM, alpha/beta horseshoe (1);Radical SAM (1);	0.059118	0.64402	D	0.000004	T	0.36248	0.0960	L	0.48174	1.505	0.48696	D	0.999694	P;P	0.46859	0.885;0.752	P;B	0.52031	0.688;0.342	T	0.03910	-1.0993	10	0.36615	T	0.2	-24.3325	17.2877	0.87146	0.0:0.0:1.0:0.0	.	114;114	B4DEV9;Q9HA92	.;RSAD1_HUMAN	Q	114	ENSP00000258955:E114Q	ENSP00000258955:E114Q	E	+	1	0	RSAD1	45912310	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.374000	0.79633	2.397000	0.81536	0.491000	0.48974	GAG	RSAD1	-	pfam_rSAM,smart_Elp3/MiaB/NifB,tigrfam_Coprogen_oxidase_HemN-rel	ENSG00000136444		0.602	RSAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSAD1	HGNC	protein_coding	OTTHUMT00000367413.1	52	0.00	0	G	NM_018346		48557311	48557311	+1	no_errors	ENST00000258955	ensembl	human	known	69_37n	missense	164	12.23	23	SNP	1.000	C
RTL1	388015	genome.wustl.edu	37	14	101347967	101347967	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr14:101347967C>A	ENST00000534062.1	-	1	3217	c.3159G>T	c.(3157-3159)atG>atT	p.M1053I	MIR433_ENST00000384837.1_RNA|MIR127_ENST00000384876.1_RNA|MIR431_ENST00000385266.1_RNA|MIR432_ENST00000606207.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	1053					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)		p.M1053I(1)		breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						CGATGGGTATCATGGCCAGCA	0.557																																						dbGAP											1	Substitution - Missense(1)	breast(1)											305.0	265.0	277.0					14																	101347967		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.3159G>T	14.37:g.101347967C>A	ENSP00000435342:p.Met1053Ile		E9PKS8	Missense_Mutation	SNP	pfam_Retrotrans_gag,superfamily_Peptidase_aspartic	p.M1053I	ENST00000534062.1	37	c.3159	CCDS53910.1	14	.	.	.	.	.	.	.	.	.	.	C	6.010	0.370262	0.11352	.	.	ENSG00000254656	ENST00000534062	T	0.21361	2.01	3.31	-1.13	0.09775	.	.	.	.	.	T	0.09247	0.0228	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.37776	-0.9691	9	0.22706	T	0.39	.	8.281	0.31900	0.0:0.462:0.4361:0.102	.	1053	E9PKS8	.	I	1053	ENSP00000435342:M1053I	ENSP00000435342:M1053I	M	-	3	0	RTL1	100417720	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.117000	0.10708	-0.548000	0.06199	-1.164000	0.01763	ATG	RTL1	-	NULL	ENSG00000254656		0.557	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTL1	HGNC	protein_coding	OTTHUMT00000395127.1	82	0.00	0	C	NM_001134888		101347967	101347967	-1	no_errors	ENST00000534062	ensembl	human	known	69_37n	missense	34	19.05	8	SNP	0.000	A
RYR2	6262	genome.wustl.edu	37	1	237713931	237713931	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr1:237713931G>A	ENST00000366574.2	+	27	3471	c.3154G>A	c.(3154-3156)Gag>Aag	p.E1052K	RYR2_ENST00000542537.1_Missense_Mutation_p.E1036K|RYR2_ENST00000360064.6_Missense_Mutation_p.E1050K	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1052	4 X approximate repeats.|B30.2/SPRY 2. {ECO:0000255|PROSITE- ProRule:PRU00548}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.E1050K(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CAGCCTCCGCGAGGCTGTGCG	0.493																																						dbGAP											1	Substitution - Missense(1)	breast(1)											92.0	92.0	92.0					1																	237713931		1924	4142	6066	-	-	-	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.3154G>A	1.37:g.237713931G>A	ENSP00000355533:p.Glu1052Lys		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.E1050K	ENST00000366574.2	37	c.3148	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.351545	0.95830	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.93247	-3.19;-3.19;-3.19	5.14	5.14	0.70334	B30.2/SPRY domain (1);Ryanodine receptor Ryr (1);	0.000000	0.53938	U	0.000049	D	0.95172	0.8435	M	0.90759	3.145	0.80722	D	1	D	0.54047	0.964	P	0.44518	0.452	D	0.96305	0.9224	10	0.87932	D	0	.	18.6043	0.91261	0.0:0.0:1.0:0.0	.	1052	Q92736	RYR2_HUMAN	K	1052;1050;1036	ENSP00000355533:E1052K;ENSP00000353174:E1050K;ENSP00000443798:E1036K	ENSP00000353174:E1050K	E	+	1	0	RYR2	235780554	1.000000	0.71417	0.932000	0.37286	0.790000	0.44656	7.875000	0.87205	2.393000	0.81446	0.563000	0.77884	GAG	RYR2	-	pfam_Ryanodine_rcpt,pfscan_B30.2/SPRY	ENSG00000198626		0.493	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	194	0.00	0	G	NM_001035		237713931	237713931	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	missense	174	11.68	23	SNP	1.000	A
RYR3	6263	genome.wustl.edu	37	15	33928729	33928729	+	Silent	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr15:33928729C>T	ENST00000389232.4	+	27	3604	c.3534C>T	c.(3532-3534)ttC>ttT	p.F1178F	RYR3_ENST00000415757.3_Silent_p.F1178F	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	1178	4 X approximate repeats.|B30.2/SPRY 2. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.F1178F(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AACTTGCCTTCGCTGACTACG	0.493																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											144.0	145.0	145.0					15																	33928729		2135	4253	6388	-	-	-	SO:0001819	synonymous_variant	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.3534C>T	15.37:g.33928729C>T			O15175|Q15412	Silent	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.F1178	ENST00000389232.4	37	c.3534	CCDS45210.1	15																																																																																			RYR3	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000198838		0.493	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	93	0.00	0	C			33928729	33928729	+1	no_errors	ENST00000389232	ensembl	human	known	69_37n	silent	44	25.42	15	SNP	0.827	T
S100A13	6284	genome.wustl.edu	37	1	153598799	153598799	+	Silent	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr1:153598799G>C	ENST00000392623.1	-	2	340	c.150C>G	c.(148-150)ctC>ctG	p.L50L	S100A13_ENST00000368699.1_Silent_p.L50L|S100A1_ENST00000368696.3_5'Flank|S100A13_ENST00000440685.2_Silent_p.L50L|RP1-178F15.5_ENST00000497086.1_RNA|S100A1_ENST00000368698.3_5'Flank|S100A13_ENST00000392622.1_Silent_p.L50L|S100A1_ENST00000292169.1_5'Flank|S100A13_ENST00000491177.1_5'UTR|S100A13_ENST00000339556.4_Silent_p.L50L	NM_001024212.1	NP_001019383.1	Q99584	S10AD_HUMAN	S100 calcium binding protein A13	50	EF-hand.				cytokine secretion (GO:0050663)|interleukin-1 alpha secretion (GO:0050703)|mast cell degranulation (GO:0043303)|positive regulation of cell proliferation (GO:0008284)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of cell shape (GO:0008360)|response to copper ion (GO:0046688)|response to electrical stimulus (GO:0051602)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mast cell granule (GO:0042629)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|copper ion binding (GO:0005507)|fibroblast growth factor binding (GO:0017134)|lipid binding (GO:0008289)|protein homodimerization activity (GO:0042803)|RAGE receptor binding (GO:0050786)|zinc ion binding (GO:0008270)	p.L50L(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(4)	7	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)		Amlexanox(DB01025)|Olopatadine(DB00768)	TGCCTACCTTGAGCAGATGGG	0.527																																					NSCLC(156;1296 1989 17590 30930 49554)	dbGAP											1	Substitution - coding silent(1)	breast(1)											225.0	220.0	222.0					1																	153598799		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK097132	CCDS30874.1	1q21	2008-02-05	2001-11-28		ENSG00000189171	ENSG00000189171		"""S100 calcium binding proteins"""	10490	protein-coding gene	gene with protein product		601989	"""S100 calcium-binding protein A13"""			8985590	Standard	XM_005245434		Approved		uc001fch.3	Q99584	OTTHUMG00000036641	ENST00000392623.1:c.150C>G	1.37:g.153598799G>C			Q52PI9|Q6FGF8	Silent	SNP	pfam_S100_Ca-bd_sub	p.L50	ENST00000392623.1	37	c.150	CCDS30874.1	1																																																																																			S100A13	-	pfam_S100_Ca-bd_sub	ENSG00000189171		0.527	S100A13-203	KNOWN	basic|appris_principal|CCDS	protein_coding	S100A13	HGNC	protein_coding	OTTHUMT00000089109.3	37	0.00	0	G	NM_005979		153598799	153598799	-1	no_errors	ENST00000339556	ensembl	human	known	69_37n	silent	31	22.50	9	SNP	1.000	C
SEMA6D	80031	genome.wustl.edu	37	15	48059233	48059233	+	Splice_Site	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr15:48059233G>C	ENST00000316364.5	+	17	2147		c.e17-1		SEMA6D_ENST00000389432.2_Splice_Site|SEMA6D_ENST00000536845.2_Splice_Site|SEMA6D_ENST00000354744.4_Splice_Site|SEMA6D_ENST00000358066.4_Intron|SEMA6D_ENST00000558816.1_Intron|SEMA6D_ENST00000537942.1_Intron|SEMA6D_ENST00000558014.1_Intron|SEMA6D_ENST00000355997.3_Intron|SEMA6D_ENST00000389428.3_Intron|SEMA6D_ENST00000389433.2_Intron	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D						axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.?(1)		biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		AATTCTTTTAGAAATTTTGCC	0.254																																						dbGAP											1	Unknown(1)	breast(1)											58.0	63.0	61.0					15																	48059233		2198	4297	6495	-	-	-	SO:0001630	splice_region_variant	0			AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.1709-1G>C	15.37:g.48059233G>C			A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Splice_Site	SNP	-	e16-1	ENST00000316364.5	37	c.1709-1	CCDS32225.1	15	.	.	.	.	.	.	.	.	.	.	G	17.34	3.363738	0.61513	.	.	ENSG00000137872	ENST00000536845;ENST00000316364;ENST00000389432;ENST00000354744	.	.	.	5.36	5.36	0.76844	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3562	0.94414	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SEMA6D	45846525	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.942000	0.92970	2.810000	0.96702	0.650000	0.86243	.	SEMA6D	-	-	ENSG00000137872		0.254	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SEMA6D	HGNC	protein_coding	OTTHUMT00000416868.1	278	0.00	0	G	NM_024966	Intron	48059233	48059233	+1	no_errors	ENST00000316364	ensembl	human	known	69_37n	splice_site	226	20.70	59	SNP	1.000	C
SERPINA11	256394	genome.wustl.edu	37	14	94912879	94912879	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr14:94912879C>A	ENST00000334708.3	-	3	770	c.706G>T	c.(706-708)Gag>Tag	p.E236*	RP11-349I1.2_ENST00000536735.1_RNA	NM_001080451.1	NP_001073920.1	Q86U17	SPA11_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11	236					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.E418*(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(14)|skin(1)|upper_aerodigestive_tract(1)	24				COAD - Colon adenocarcinoma(157;0.211)		GAAGTCCTCTCATCCACAAAG	0.483																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											155.0	145.0	148.0					14																	94912879		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BX248259	CCDS32149.1	14q32.13	2014-02-18	2005-08-18		ENSG00000186910	ENSG00000186910		"""Serine (or cysteine) peptidase inhibitors"""	19193	protein-coding gene	gene with protein product			"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11"""			15014966, 24172014	Standard	NM_001080451		Approved		uc001ydd.1	Q86U17	OTTHUMG00000171348	ENST00000334708.3:c.706G>T	14.37:g.94912879C>A	ENSP00000335024:p.Glu236*		B2RV07	Nonsense_Mutation	SNP	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	p.E236*	ENST00000334708.3	37	c.706	CCDS32149.1	14	.	.	.	.	.	.	.	.	.	.	C	14.74	2.624940	0.46840	.	.	ENSG00000186910	ENST00000334708	.	.	.	5.01	3.1	0.35709	.	0.825313	0.10492	N	0.668290	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.2164	0.43170	0.0:0.6676:0.259:0.0734	.	.	.	.	X	236	.	ENSP00000335024:E236X	E	-	1	0	SERPINA11	93982632	0.000000	0.05858	0.002000	0.10522	0.039000	0.13416	0.353000	0.20130	1.044000	0.40200	0.555000	0.69702	GAG	SERPINA11	-	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	ENSG00000186910		0.483	SERPINA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINA11	HGNC	protein_coding	OTTHUMT00000413091.1	96	0.00	0	C	NM_001080451		94912879	94912879	-1	no_errors	ENST00000334708	ensembl	human	known	69_37n	nonsense	55	12.70	8	SNP	0.299	A
SETDB1	9869	genome.wustl.edu	37	1	150933151	150933151	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr1:150933151G>C	ENST00000271640.5	+	16	2803	c.2613G>C	c.(2611-2613)gaG>gaC	p.E871D	SETDB1_ENST00000459773.1_3'UTR|SETDB1_ENST00000368969.4_Missense_Mutation_p.E871D	NM_001145415.1|NM_012432.3	NP_001138887.1|NP_036564.3	Q15047	SETB1_HUMAN	SET domain, bifurcated 1	871	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				bone development (GO:0060348)|histone H3-K9 trimethylation (GO:0036124)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)	p.E871D(1)		NS(1)|large_intestine(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			AAGGATATGAGAGTGATGCCC	0.488																																						dbGAP											1	Substitution - Missense(1)	breast(1)											146.0	128.0	134.0					1																	150933151		2203	4300	6503	-	-	-	SO:0001583	missense	0			D31891	CCDS972.1, CCDS44217.1, CCDS58026.1	1q21	2013-01-23			ENSG00000143379	ENSG00000143379		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Tudor domain containing"""	10761	protein-coding gene	gene with protein product	"""tudor domain containing 21"""	604396				10343109	Standard	NM_001145415		Approved	KG1T, KIAA0067, ESET, KMT1E, TDRD21	uc001evu.2	Q15047	OTTHUMG00000035003	ENST00000271640.5:c.2613G>C	1.37:g.150933151G>C	ENSP00000271640:p.Glu871Asp		A6NEW2|Q5SZD8|Q5SZD9|Q5SZE0|Q5SZE7|Q96GM9	Missense_Mutation	SNP	pfam_SET_dom,pfam_Pre-SET_dom,pfam_Methyl_CpG_DNA-bd,superfamily_DNA-bd_integrase-typ,smart_Tudor,smart_Methyl_CpG_DNA-bd,smart_Pre-SET_Zn-bd_sub,smart_SET_dom,pfscan_Methyl_CpG_DNA-bd,pfscan_SET_dom,pfscan_Pre-SET_dom,pfscan_Post-SET_dom	p.E871D	ENST00000271640.5	37	c.2613	CCDS44217.1	1	.	.	.	.	.	.	.	.	.	.	G	19.85	3.903840	0.72754	.	.	ENSG00000143379	ENST00000271640;ENST00000368969;ENST00000498193	D;D;T	0.89746	-2.56;-2.55;0.93	5.58	1.09	0.20402	SET domain (3);	0.000000	0.85682	D	0.000000	D	0.87103	0.6094	L	0.38175	1.15	0.80722	D	1	D;D;D	0.76494	0.999;0.996;0.997	D;D;D	0.80764	0.994;0.986;0.992	D	0.86909	0.2059	10	0.72032	D	0.01	.	11.2453	0.48993	0.2912:0.0:0.7088:0.0	.	871;871;871	E9PRF4;Q15047-3;Q15047	.;.;SETB1_HUMAN	D	871	ENSP00000271640:E871D;ENSP00000357965:E871D;ENSP00000432348:E871D	ENSP00000271640:E871D	E	+	3	2	SETDB1	149199775	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.737000	0.55060	0.322000	0.23283	0.462000	0.41574	GAG	SETDB1	-	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	ENSG00000143379		0.488	SETDB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SETDB1	HGNC	protein_coding	OTTHUMT00000084717.2	79	0.00	0	G			150933151	150933151	+1	no_errors	ENST00000271640	ensembl	human	known	69_37n	missense	69	10.39	8	SNP	1.000	C
SGOL2	151246	genome.wustl.edu	37	2	201437093	201437093	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr2:201437093G>C	ENST00000357799.4	+	7	2122	c.2024G>C	c.(2023-2025)aGa>aCa	p.R675T		NM_001160033.1|NM_001160046.1|NM_152524.5	NP_001153505.1|NP_001153518.1|NP_689737.4	Q562F6	SGOL2_HUMAN	shugoshin-like 2 (S. pombe)	675					meiotic sister chromatid cohesion, centromeric (GO:0051754)|mitotic cell cycle (GO:0000278)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic cohesin complex (GO:0030892)|nucleus (GO:0005634)		p.R675T(1)		NS(2)|breast(2)|cervix(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	46						CTTTCTACTAGAGATAATGAA	0.348																																						dbGAP											1	Substitution - Missense(1)	breast(1)											59.0	55.0	56.0					2																	201437093		1818	4071	5889	-	-	-	SO:0001583	missense	0			AY094614	CCDS42796.1	2q33.2	2008-02-05			ENSG00000163535	ENSG00000163535			30812	protein-coding gene	gene with protein product		612425					Standard	NM_001160046		Approved	TRIPIN, FLJ25211	uc002uvw.2	Q562F6	OTTHUMG00000154535	ENST00000357799.4:c.2024G>C	2.37:g.201437093G>C	ENSP00000350447:p.Arg675Thr		Q53RR9|Q53T20|Q86XY4|Q8IWK2|Q8IZK1|Q8N1Q5|Q96LQ3	Missense_Mutation	SNP	NULL	p.R675T	ENST00000357799.4	37	c.2024	CCDS42796.1	2	.	.	.	.	.	.	.	.	.	.	G	0.053	-1.243458	0.01481	.	.	ENSG00000163535	ENST00000357799	T	0.13657	2.57	5.25	0.149	0.14863	.	1.035800	0.07584	N	0.920789	T	0.07683	0.0193	N	0.24115	0.695	0.09310	N	1	B;B;B	0.17667	0.023;0.023;0.023	B;B;B	0.18561	0.022;0.022;0.022	T	0.44190	-0.9344	10	0.15066	T	0.55	3.6971	3.3255	0.07066	0.2599:0.0:0.3698:0.3703	.	675;675;675	B7Z7S9;Q562F6-2;Q562F6	.;.;SGOL2_HUMAN	T	675	ENSP00000350447:R675T	ENSP00000350447:R675T	R	+	2	0	SGOL2	201145338	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-1.340000	0.02650	0.099000	0.17552	0.585000	0.79938	AGA	SGOL2	-	NULL	ENSG00000163535		0.348	SGOL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGOL2	HGNC	protein_coding	OTTHUMT00000335834.1	42	0.00	0	G	NM_152524		201437093	201437093	+1	no_errors	ENST00000357799	ensembl	human	known	69_37n	missense	36	23.40	11	SNP	0.000	C
SIK3	23387	genome.wustl.edu	37	11	116732606	116732606	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr11:116732606G>A	ENST00000292055.4	-	17	1983	c.1948C>T	c.(1948-1950)Cag>Tag	p.Q650*	SIK3_ENST00000488337.1_5'UTR|SIK3_ENST00000434315.2_Nonsense_Mutation_p.Q549*|SIK3_ENST00000375288.1_Silent_p.F81F|SIK3_ENST00000375300.1_Nonsense_Mutation_p.Q708*|SIK3_ENST00000542607.1_Nonsense_Mutation_p.Q650*|SIK3_ENST00000446921.2_Nonsense_Mutation_p.Q708*	NM_025164.3	NP_079440.3	Q9Y2K2	SIK3_HUMAN	SIK family kinase 3	650	Gln-rich.				protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.Q756*(1)		breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	57						CATGCAGCCTGAAGAGGTGGA	0.448																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											71.0	65.0	67.0					11																	116732606		2201	4296	6497	-	-	-	SO:0001587	stop_gained	0			AB023216	CCDS8379.1, CCDS60974.1, CCDS8379.2	11q23.3	2010-02-17			ENSG00000160584	ENSG00000160584			29165	protein-coding gene	gene with protein product		614776				10231032, 8889548	Standard	NM_025164		Approved	FLJ12240, L19, KIAA0999, QSK	uc001ppy.3	Q9Y2K2	OTTHUMG00000066628	ENST00000292055.4:c.1948C>T	11.37:g.116732606G>A	ENSP00000292055:p.Gln650*		A1A5A8|Q59FY2|Q5M9N1|Q6P3R6|Q8IYM8|Q9HA50	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_cat_dom	p.Q708*	ENST00000292055.4	37	c.2122	CCDS8379.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	44|44	10.601352|10.601352	0.99435|0.99435	.|.	.|.	ENSG00000160584|ENSG00000160584	ENST00000375300;ENST00000292055;ENST00000542607;ENST00000434315|ENST00000445177;ENST00000446921	.|.	.|.	.|.	6.08|6.08	6.08|6.08	0.98989|0.98989	.|.	0.000000|.	0.39274|.	U|.	0.001403|.	.|T	.|0.77384	.|0.4122	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.73773	.|-0.3877	.|4	0.59425|.	D|.	0.04|.	.|.	20.6647|20.6647	0.99678|0.99678	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|L	708;650;650;549|749;672	.|.	ENSP00000292055:Q650X|.	Q|S	-|-	1|2	0|0	SIK3|SIK3	116237816|116237816	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	6.858000|6.858000	0.75461|0.75461	2.890000|2.890000	0.99128|0.99128	0.655000|0.655000	0.94253|0.94253	CAG|TCA	SIK3	-	NULL	ENSG00000160584		0.448	SIK3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	SIK3	HGNC	protein_coding		70	0.00	0	G	NM_025164		116732606	116732606	-1	no_errors	ENST00000375300	ensembl	human	known	69_37n	nonsense	34	30.61	15	SNP	1.000	A
SIPA1L2	57568	genome.wustl.edu	37	1	232649933	232649933	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr1:232649933C>T	ENST00000366630.1	-	2	1511	c.1153G>A	c.(1153-1155)Gag>Aag	p.E385K	SIPA1L2_ENST00000262861.4_Missense_Mutation_p.E385K			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	385					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)	p.E385K(1)		NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				TTGAGGTCCTCCTTGCTCCCT	0.517																																						dbGAP											1	Substitution - Missense(1)	breast(1)											130.0	128.0	129.0					1																	232649933		1967	4142	6109	-	-	-	SO:0001583	missense	0			AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.1153G>A	1.37:g.232649933C>T	ENSP00000355589:p.Glu385Lys		Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Missense_Mutation	SNP	pfam_DUF3401,pfam_Rap_GAP,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP	p.E385K	ENST00000366630.1	37	c.1153	CCDS41474.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.293151	0.95546	.	.	ENSG00000116991	ENST00000366630;ENST00000262861	D;D	0.82711	-1.64;-1.64	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	D	0.90755	0.7098	M	0.73217	2.22	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	D	0.91020	0.4856	10	0.72032	D	0.01	-41.5108	19.3561	0.94414	0.0:1.0:0.0:0.0	.	385	Q9P2F8	SI1L2_HUMAN	K	385	ENSP00000355589:E385K;ENSP00000262861:E385K	ENSP00000262861:E385K	E	-	1	0	SIPA1L2	230716556	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.651000	0.83577	2.810000	0.96702	0.650000	0.86243	GAG	SIPA1L2	-	NULL	ENSG00000116991		0.517	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIPA1L2	HGNC	protein_coding	OTTHUMT00000092318.1	45	0.00	0	C	XM_045839		232649933	232649933	-1	no_errors	ENST00000262861	ensembl	human	known	69_37n	missense	59	11.94	8	SNP	1.000	T
SLC15A5	729025	genome.wustl.edu	37	12	16430463	16430463	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr12:16430463C>T	ENST00000344941.3	-	1	156	c.157G>A	c.(157-159)Gag>Aag	p.E53K		NM_001170798.1	NP_001164269.1	A6NIM6	S15A5_HUMAN	solute carrier family 15, member 5	53					peptide transport (GO:0015833)|protein transport (GO:0015031)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)	p.E53K(1)		breast(2)|lung(1)	3						GTGAACCTCTCACACAGCTCC	0.428																																						dbGAP											1	Substitution - Missense(1)	breast(1)											149.0	129.0	135.0					12																	16430463		692	1590	2282	-	-	-	SO:0001583	missense	0					12p12.3	2013-07-18			ENSG00000188991	ENSG00000188991		"""Solute carriers"""	33455	protein-coding gene	gene with protein product						21044875	Standard	NM_001170798		Approved		uc021qvs.1	A6NIM6	OTTHUMG00000168793	ENST00000344941.3:c.157G>A	12.37:g.16430463C>T	ENSP00000340402:p.Glu53Lys			Missense_Mutation	SNP	pfam_Oligopeptide_transporter,superfamily_MFS_dom_general_subst_transpt	p.E53K	ENST00000344941.3	37	c.157		12	.	.	.	.	.	.	.	.	.	.	C	27.8	4.862574	0.91511	.	.	ENSG00000188991	ENST00000344941	T	0.80738	-1.41	5.36	5.36	0.76844	.	.	.	.	.	D	0.90438	0.7006	M	0.85710	2.77	0.51482	D	0.999929	.	.	.	.	.	.	D	0.91694	0.5368	7	0.72032	D	0.01	.	19.0855	0.93201	0.0:1.0:0.0:0.0	.	.	.	.	K	53	ENSP00000340402:E53K	ENSP00000340402:E53K	E	-	1	0	SLC15A5	16321730	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.408000	0.80041	2.509000	0.84616	0.655000	0.94253	GAG	SLC15A5	-	superfamily_MFS_dom_general_subst_transpt	ENSG00000188991		0.428	SLC15A5-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	SLC15A5	HGNC	protein_coding	OTTHUMT00000401119.2	113	0.00	0	C	XM_001129090		16430463	16430463	-1	no_errors	ENST00000344941	ensembl	human	novel	69_37n	missense	83	28.45	33	SNP	1.000	T
SLC22A17	51310	genome.wustl.edu	37	14	23816808	23816808	+	Silent	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr14:23816808C>T	ENST00000206544.8	-	7	1413	c.1077G>A	c.(1075-1077)gtG>gtA	p.V359V	SLC22A17_ENST00000354772.3_Silent_p.V359V|SLC22A17_ENST00000397260.3_Silent_p.V248V|SLC22A17_ENST00000474057.1_5'UTR|SLC22A17_ENST00000397267.1_Silent_p.V359V	NM_020372.2	NP_065105.2	Q8WUG5	S22AH_HUMAN	solute carrier family 22, member 17	359					ion transport (GO:0006811)|iron ion homeostasis (GO:0055072)|siderophore transport (GO:0015891)	integral component of organelle membrane (GO:0031301)|integral component of plasma membrane (GO:0005887)|vacuole (GO:0005773)	transmembrane signaling receptor activity (GO:0004888)|transmembrane transporter activity (GO:0022857)	p.V359V(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	15	all_cancers(95;7.12e-06)			GBM - Glioblastoma multiforme(265;0.00643)		CAAATCGGTCCACGGTGACCC	0.632																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											50.0	57.0	55.0					14																	23816808		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ243653	CCDS9593.1, CCDS9594.2	14q11.2	2013-05-22	2008-01-11		ENSG00000092096	ENSG00000092096		"""Solute carriers"""	23095	protein-coding gene	gene with protein product	"""neutrophil gelatinase-associated lipocalin receptor"""	611461				16377569	Standard	NM_016609		Approved	BOCT, BOIT, NGALR	uc001wjl.3	Q8WUG5	OTTHUMG00000028740	ENST00000206544.8:c.1077G>A	14.37:g.23816808C>T			A4UA13|A8MUT0|Q2TAB0|Q5BKY8|Q86U04|Q9H1D3|Q9NQD5	Silent	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.V359	ENST00000206544.8	37	c.1077	CCDS9593.1	14																																																																																			SLC22A17	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000092096		0.632	SLC22A17-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC22A17	HGNC	protein_coding	OTTHUMT00000157223.3	15	0.00	0	C	NM_020372		23816808	23816808	-1	no_errors	ENST00000206544	ensembl	human	known	69_37n	silent	18	18.18	4	SNP	1.000	T
SLC4A11	83959	genome.wustl.edu	37	20	3210899	3210899	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr20:3210899C>G	ENST00000380056.3	-	12	1518	c.1471G>C	c.(1471-1473)Gag>Cag	p.E491Q	SLC4A11_ENST00000380059.3_Missense_Mutation_p.E518Q|SLC4A11_ENST00000539553.2_Missense_Mutation_p.E475Q|SLC4A11_ENST00000488544.1_5'Flank	NM_032034.3	NP_114423.1	Q8NBS3	S4A11_HUMAN	solute carrier family 4, sodium borate transporter, member 11	491	Membrane (bicarbonate transporter).				bicarbonate transport (GO:0015701)|borate transmembrane transport (GO:0035445)|borate transport (GO:0046713)|cellular cation homeostasis (GO:0030003)|fluid transport (GO:0042044)|proton transport (GO:0015992)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	bicarbonate transmembrane transporter activity (GO:0015106)|borate transmembrane transporter activity (GO:0046715)|hydrogen ion channel activity (GO:0015252)|inorganic anion exchanger activity (GO:0005452)|protein dimerization activity (GO:0046983)|sodium channel activity (GO:0005272)|symporter activity (GO:0015293)	p.E491Q(1)|p.E518Q(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(4)|soft_tissue(1)|urinary_tract(1)	40						ATGATCTCCTCCGTCGACCTG	0.637																																					NSCLC(190;922 2139 10266 10292 38692)	dbGAP											2	Substitution - Missense(2)	breast(2)											79.0	72.0	74.0					20																	3210899		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF336127	CCDS13052.1, CCDS54445.1, CCDS54446.1	20p13	2014-02-14	2007-08-03		ENSG00000088836	ENSG00000088836		"""Solute carriers"""	16438	protein-coding gene	gene with protein product		610206	"""corneal endothelial dystrophy 2 (autosomal recessive)"", ""solute carrier family 4, sodium bicarbonate transporter-like, member 11"", ""corneal dystrophy and perceptive deafness 1"""	CHED2, CDPD1		10843999, 11302728, 16767101	Standard	NM_001174089		Approved	dJ794I6.2, BTR1, NaBC1, FECD4	uc010zqe.2	Q8NBS3	OTTHUMG00000031740	ENST00000380056.3:c.1471G>C	20.37:g.3210899C>G	ENSP00000369396:p.Glu491Gln		B4DKC8|B4DKX9|G3V1M3|Q2TB62|Q2TB63|Q9BXF4|Q9NTW9	Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_PTS_EIIA_2,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk	p.E518Q	ENST00000380056.3	37	c.1552	CCDS13052.1	20	.	.	.	.	.	.	.	.	.	.	C	23.6	4.434572	0.83885	.	.	ENSG00000088836	ENST00000380059;ENST00000380056;ENST00000539553	T;T;T	0.79141	-1.24;-1.24;-1.24	5.21	5.21	0.72293	Bicarbonate transporter, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.85296	0.5664	L	0.48174	1.505	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.86736	0.1951	10	0.87932	D	0	.	18.3498	0.90335	0.0:1.0:0.0:0.0	.	475;518;491	G3V1M3;B4DKC8;Q8NBS3	.;.;S4A11_HUMAN	Q	518;491;475	ENSP00000369399:E518Q;ENSP00000369396:E491Q;ENSP00000441370:E475Q	ENSP00000369396:E491Q	E	-	1	0	SLC4A11	3158899	1.000000	0.71417	0.736000	0.30914	0.589000	0.36550	4.688000	0.61715	2.431000	0.82371	0.563000	0.77884	GAG	SLC4A11	-	pfam_HCO3_transpt_C,prints_HCO3_transpt_euk	ENSG00000088836		0.637	SLC4A11-002	KNOWN	basic|CCDS	protein_coding	SLC4A11	HGNC	protein_coding	OTTHUMT00000077728.1	10	0.00	0	C			3210899	3210899	-1	no_errors	ENST00000380059	ensembl	human	known	69_37n	missense	13	23.53	4	SNP	0.999	G
SLC6A8	6535	genome.wustl.edu	37	X	152958473	152958473	+	Intron	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chrX:152958473C>T	ENST00000253122.5	+	5	1253				SLC6A8_ENST00000485324.1_3'UTR|SLC6A8_ENST00000430077.2_Intron	NM_001142805.1|NM_005629.3	NP_001136277.1|NP_005620.1	P48029	SC6A8_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 8						cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|creatine transmembrane transport (GO:1902598)|creatine transport (GO:0015881)|muscle contraction (GO:0006936)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	creatine transmembrane transporter activity (GO:0005308)|creatine:sodium symporter activity (GO:0005309)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	13	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				Creatine(DB00148)	CCACAGCCTCCGCTGAGCAGC	0.662																																						dbGAP											0													61.0	50.0	54.0					X																	152958473		2203	4299	6502	-	-	-	SO:0001627	intron_variant	0				CCDS14726.1, CCDS48190.1	Xq28	2013-07-19	2013-07-19		ENSG00000130821	ENSG00000130821		"""Solute carriers"""	11055	protein-coding gene	gene with protein product	"""creatine transporter"""	300036	"""solute carrier family 6 (neurotransmitter transporter, creatine), member 8"""			7774949	Standard	NM_001142805		Approved	CRTR, CT1	uc004fib.3	P48029	OTTHUMG00000024208	ENST00000253122.5:c.778-23C>T	X.37:g.152958473C>T			B2KY47|B4DIA3|E9PFC0|Q13032|Q66I36	RNA	SNP	-	NULL	ENST00000253122.5	37	NULL	CCDS14726.1	X																																																																																			SLC6A8	-	-	ENSG00000130821		0.662	SLC6A8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A8	HGNC	protein_coding	OTTHUMT00000061003.1	27	0.00	0	C			152958473	152958473	+1	no_errors	ENST00000485324	ensembl	human	known	69_37n	rna	22	21.43	6	SNP	0.000	T
SNX2	6643	genome.wustl.edu	37	5	122154620	122154620	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr5:122154620G>C	ENST00000379516.2	+	11	1222	c.1114G>C	c.(1114-1116)Gag>Cag	p.E372Q	SNX2_ENST00000510372.1_3'UTR|SNX2_ENST00000514949.1_Missense_Mutation_p.E255Q	NM_003100.2	NP_003091.2	O60749	SNX2_HUMAN	sorting nexin 2	372					endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|protein complex (GO:0043234)|retromer complex (GO:0030904)	epidermal growth factor receptor binding (GO:0005154)|insulin receptor binding (GO:0005158)|leptin receptor binding (GO:1990460)|phosphatidylinositol binding (GO:0035091)|transferrin receptor binding (GO:1990459)	p.E372Q(1)		NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(2)|prostate(1)|skin(1)	19		all_cancers(142;1.14e-44)|all_lung(232;1.03e-13)|Lung NSC(810;2.5e-13)|Breast(839;0.000812)|Myeloproliferative disorder(839;0.0122)|Prostate(80;0.0235)|all_hematologic(541;0.0592)|all_neural(839;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	all cancers(49;2.13e-24)|Epithelial(69;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(64;5.6e-11)|BRCA - Breast invasive adenocarcinoma(61;0.00013)|GBM - Glioblastoma multiforme(465;0.000357)|COAD - Colon adenocarcinoma(49;0.000887)|Lung(113;0.0109)		AGAGGTTGAGGAGAAGATAGA	0.403																																						dbGAP											1	Substitution - Missense(1)	breast(1)											136.0	126.0	129.0					5																	122154620		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF043453	CCDS34217.1, CCDS64234.1	5q23.2	2011-05-03			ENSG00000205302	ENSG00000205302		"""Sorting nexins"""	11173	protein-coding gene	gene with protein product		605929				9819414	Standard	NM_003100		Approved		uc003kte.4	O60749	OTTHUMG00000163020	ENST00000379516.2:c.1114G>C	5.37:g.122154620G>C	ENSP00000368831:p.Glu372Gln		B3KN44|B4DEK4|B7Z408|O43650|P82862|Q53XK8|Q597H6|Q9BTS8	Missense_Mutation	SNP	pfam_Vps5_C,pfam_Sorting_nexin_N,pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.E372Q	ENST00000379516.2	37	c.1114	CCDS34217.1	5	.	.	.	.	.	.	.	.	.	.	G	28.8	4.948181	0.92593	.	.	ENSG00000205302	ENST00000379516;ENST00000514949	T;T	0.61392	0.11;0.11	5.7	5.7	0.88788	Vps5 C-terminal (1);	0.096936	0.64402	D	0.000001	T	0.72128	0.3422	M	0.78049	2.395	0.80722	D	1	B	0.26635	0.155	B	0.42593	0.392	T	0.72093	-0.4394	10	0.87932	D	0	-6.4112	19.8247	0.96612	0.0:0.0:1.0:0.0	.	372	O60749	SNX2_HUMAN	Q	372;255	ENSP00000368831:E372Q;ENSP00000421663:E255Q	ENSP00000368831:E372Q	E	+	1	0	SNX2	122182519	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	9.796000	0.99103	2.696000	0.92011	0.655000	0.94253	GAG	SNX2	-	pfam_Vps5_C	ENSG00000205302		0.403	SNX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX2	HGNC	protein_coding	OTTHUMT00000371392.1	177	0.00	0	G	NM_003100		122154620	122154620	+1	no_errors	ENST00000379516	ensembl	human	known	69_37n	missense	111	18.98	26	SNP	1.000	C
SPTA1	6708	genome.wustl.edu	37	1	158654937	158654937	+	Silent	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr1:158654937G>A	ENST00000368147.4	-	2	405	c.225C>T	c.(223-225)atC>atT	p.I75I		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	75					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.I75I(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TATCGGTTAAGATATTGACTT	0.438																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											118.0	113.0	115.0					1																	158654937		1924	4143	6067	-	-	-	SO:0001819	synonymous_variant	0			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.225C>T	1.37:g.158654937G>A			Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Silent	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_HAND_2,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.I75	ENST00000368147.4	37	c.225	CCDS41423.1	1																																																																																			SPTA1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000163554		0.438	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3	180	0.00	0	G	NM_003126		158654937	158654937	-1	no_errors	ENST00000368148	ensembl	human	known	69_37n	silent	147	21.39	40	SNP	0.002	A
STK17A	9263	genome.wustl.edu	37	7	43663366	43663366	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr7:43663366G>C	ENST00000319357.5	+	6	978	c.799G>C	c.(799-801)Gat>Cat	p.D267H		NM_004760.2	NP_004751.2	Q9UEE5	ST17A_HUMAN	serine/threonine kinase 17a	267	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fibroblast apoptotic process (GO:2000271)|protein phosphorylation (GO:0006468)|regulation of reactive oxygen species metabolic process (GO:2000377)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.D267H(1)		autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|prostate(1)|skin(2)	11						CTTAGGCAATGATAAACAAGA	0.328																																						dbGAP											1	Substitution - Missense(1)	breast(1)											99.0	99.0	99.0					7																	43663366		2202	4294	6496	-	-	-	SO:0001583	missense	0			AB011420	CCDS5470.1	7p13	2008-05-15	2007-02-12		ENSG00000164543	ENSG00000164543			11395	protein-coding gene	gene with protein product	"""death-associated protein kinase-related 1"""	604726	"""serine/threonine kinase 17a (apoptosis-inducing)"""			9786912	Standard	NM_004760		Approved	DRAK1	uc003tih.3	Q9UEE5	OTTHUMG00000022825	ENST00000319357.5:c.799G>C	7.37:g.43663366G>C	ENSP00000319192:p.Asp267His		A4D1V6|Q8IVC8	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D267H	ENST00000319357.5	37	c.799	CCDS5470.1	7	.	.	.	.	.	.	.	.	.	.	G	18.67	3.673724	0.67928	.	.	ENSG00000164543	ENST00000319357	T	0.43294	0.95	4.97	-6.4	0.01944	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.435168	0.18933	N	0.127176	T	0.46483	0.1395	L	0.43646	1.37	0.80722	D	1	D	0.54772	0.968	P	0.56788	0.806	T	0.58792	-0.7574	10	0.72032	D	0.01	.	18.133	0.89608	0.1634:0.0:0.8366:0.0	.	267	Q9UEE5	ST17A_HUMAN	H	267	ENSP00000319192:D267H	ENSP00000319192:D267H	D	+	1	0	STK17A	43629891	0.995000	0.38212	0.125000	0.21846	0.964000	0.63967	2.393000	0.44442	-1.083000	0.03097	-0.455000	0.05494	GAT	STK17A	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000164543		0.328	STK17A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK17A	HGNC	protein_coding	OTTHUMT00000250902.1	247	0.00	0	G	NM_004760		43663366	43663366	+1	no_errors	ENST00000319357	ensembl	human	known	69_37n	missense	184	21.70	51	SNP	0.987	C
STK17B	9262	genome.wustl.edu	37	2	197002326	197002326	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr2:197002326C>T	ENST00000263955.4	-	8	1250	c.964G>A	c.(964-966)Gaa>Aaa	p.E322K	STK17B_ENST00000409228.1_Missense_Mutation_p.E322K	NM_004226.3	NP_004217.1	O94768	ST17B_HUMAN	serine/threonine kinase 17b	322					apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of fibroblast apoptotic process (GO:2000271)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.E322K(1)		breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(10)	15			OV - Ovarian serous cystadenocarcinoma(117;0.141)			GTCTTGTCTTCAGAGGACCTT	0.423																																						dbGAP											1	Substitution - Missense(1)	breast(1)											129.0	128.0	128.0					2																	197002326		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011421	CCDS2315.1	2q33.1	2008-02-05	2007-02-12		ENSG00000081320	ENSG00000081320			11396	protein-coding gene	gene with protein product	"""death-associated protein kinase-related 2"""	604727	"""serine/threonine kinase 17b (apoptosis-inducing)"""			9786912	Standard	NM_004226		Approved	DRAK2	uc002utk.3	O94768	OTTHUMG00000132735	ENST00000263955.4:c.964G>A	2.37:g.197002326C>T	ENSP00000263955:p.Glu322Lys			Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E322K	ENST00000263955.4	37	c.964	CCDS2315.1	2	.	.	.	.	.	.	.	.	.	.	C	26.5	4.741376	0.89573	.	.	ENSG00000081320	ENST00000263955;ENST00000409228	T;T	0.67523	-0.27;-0.27	4.84	4.84	0.62591	Protein kinase-like domain (1);	0.000000	0.51477	D	0.000089	T	0.66366	0.2782	N	0.24115	0.695	0.43122	D	0.994848	D	0.63046	0.992	P	0.58210	0.835	T	0.64076	-0.6492	10	0.27082	T	0.32	.	16.2963	0.82776	0.0:1.0:0.0:0.0	.	322	O94768	ST17B_HUMAN	K	322	ENSP00000263955:E322K;ENSP00000386853:E322K	ENSP00000263955:E322K	E	-	1	0	STK17B	196710571	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	4.867000	0.63013	2.520000	0.84964	0.650000	0.86243	GAA	STK17B	-	superfamily_Kinase-like_dom	ENSG00000081320		0.423	STK17B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK17B	HGNC	protein_coding	OTTHUMT00000256092.2	184	0.00	0	C			197002326	197002326	-1	no_errors	ENST00000263955	ensembl	human	known	69_37n	missense	97	27.61	37	SNP	1.000	T
SVEP1	79987	genome.wustl.edu	37	9	113233667	113233667	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr9:113233667G>A	ENST00000401783.2	-	16	3311	c.2975C>T	c.(2974-2976)tCa>tTa	p.S992L	SVEP1_ENST00000467821.1_5'UTR|SVEP1_ENST00000374469.1_Missense_Mutation_p.S969L|SVEP1_ENST00000302728.8_Missense_Mutation_p.S992L	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	992					cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)	p.S992L(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						TCTCAGCACTGAGCCTGGTCT	0.433																																						dbGAP											1	Substitution - Missense(1)	breast(1)											72.0	70.0	71.0					9																	113233667		1929	4141	6070	-	-	-	SO:0001583	missense	0			AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.2975C>T	9.37:g.113233667G>A	ENSP00000384917:p.Ser992Leu		Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_EGF-like_dom,pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_Hyalin,pfam_VWF_A,pfam_Pentaxin,pfam_EGF_extracell,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Complement_control_module,superfamily_Growth_fac_rcpt,smart_VWF_A,smart_Sushi_SCR_CCP,smart_EGF-like_Ca-bd,smart_EGF-like,smart_Pentaxin,pfscan_EG-like_dom,pfscan_Hyalin,pfscan_Sushi_SCR_CCP,pfscan_VWF_A,prints_Pentaxin	p.S992L	ENST00000401783.2	37	c.2975	CCDS48004.1	9	.	.	.	.	.	.	.	.	.	.	G	33	5.281761	0.95489	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000302728	T;T;T	0.62498	0.02;0.02;0.02	5.49	5.49	0.81192	Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	T	0.72269	0.3439	L	0.32530	0.975	0.51012	D	0.999904	D;D	0.76494	0.993;0.999	D;D	0.80764	0.977;0.994	T	0.73688	-0.3904	10	0.56958	D	0.05	.	19.3773	0.94517	0.0:0.0:1.0:0.0	.	992;992	E9PBN8;Q4LDE5	.;SVEP1_HUMAN	L	992;969;992	ENSP00000384917:S992L;ENSP00000363593:S969L;ENSP00000304118:S992L	ENSP00000304118:S992L	S	-	2	0	SVEP1	112273488	1.000000	0.71417	0.958000	0.39756	0.957000	0.61999	9.204000	0.95041	2.583000	0.87209	0.650000	0.86243	TCA	SVEP1	-	superfamily_Growth_fac_rcpt	ENSG00000165124		0.433	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SVEP1	HGNC	protein_coding		124	0.00	0	G			113233667	113233667	-1	no_errors	ENST00000401783	ensembl	human	known	69_37n	missense	95	24.00	30	SNP	1.000	A
SYCP1	6847	genome.wustl.edu	37	1	115420781	115420781	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr1:115420781G>C	ENST00000369522.3	+	12	1108	c.868G>C	c.(868-870)Gag>Cag	p.E290Q	SYCP1_ENST00000369518.1_Missense_Mutation_p.E290Q	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	290					chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)	p.E290Q(1)	RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATTTCTGCTAGAGGAATCCAG	0.254																																						dbGAP											1	Substitution - Missense(1)	breast(1)											40.0	47.0	45.0					1																	115420781		2155	4253	6408	-	-	-	SO:0001583	missense	0			D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.868G>C	1.37:g.115420781G>C	ENSP00000358535:p.Glu290Gln		O14963|Q5VXJ6	Missense_Mutation	SNP	pfam_SCP-1	p.E290Q	ENST00000369522.3	37	c.868	CCDS879.1	1	.	.	.	.	.	.	.	.	.	.	G	1.900	-0.453308	0.04540	.	.	ENSG00000198765	ENST00000369522;ENST00000536734;ENST00000455987;ENST00000369518	T;T;T	0.56611	0.45;0.45;0.45	4.96	3.02	0.34903	.	0.452975	0.24191	N	0.040702	T	0.13372	0.0324	N	0.21194	0.64	0.24394	N	0.99473	B;B	0.16802	0.019;0.019	B;B	0.17433	0.018;0.018	T	0.29058	-1.0024	10	0.13853	T	0.58	-4.4206	7.0648	0.25145	0.1151:0.4378:0.4472:0.0	.	290;290	B7ZLS9;Q15431	.;SYCP1_HUMAN	Q	290	ENSP00000358535:E290Q;ENSP00000410011:E290Q;ENSP00000358531:E290Q	ENSP00000358531:E290Q	E	+	1	0	SYCP1	115222304	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.741000	0.47426	0.551000	0.29008	0.655000	0.94253	GAG	SYCP1	-	pfam_SCP-1	ENSG00000198765		0.254	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP1	HGNC	protein_coding	OTTHUMT00000033386.1	150	0.00	0	G	NM_003176		115420781	115420781	+1	no_errors	ENST00000369518	ensembl	human	known	69_37n	missense	78	35.54	43	SNP	1.000	C
SYNE1	23345	genome.wustl.edu	37	6	152671773	152671773	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr6:152671773C>T	ENST00000367255.5	-	71	12314	c.11713G>A	c.(11713-11715)Gac>Aac	p.D3905N	SYNE1_ENST00000341594.5_Missense_Mutation_p.D3829N|SYNE1_ENST00000265368.4_Missense_Mutation_p.D3905N|SYNE1_ENST00000423061.1_Missense_Mutation_p.D3890N|SYNE1_ENST00000448038.1_Missense_Mutation_p.D3890N	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3905					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.D3905N(2)|p.D3890N(1)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTGCACAGGTCCTGGTAATCA	0.423										HNSCC(10;0.0054)																												dbGAP											3	Substitution - Missense(3)	breast(3)											147.0	132.0	137.0					6																	152671773		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.11713G>A	6.37:g.152671773C>T	ENSP00000356224:p.Asp3905Asn		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.D3905N	ENST00000367255.5	37	c.11713	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	C	17.99	3.523890	0.64747	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.49139	0.79;0.79;0.79;0.79;1.34	6.03	4.26	0.50523	.	0.422499	0.22808	N	0.055394	T	0.38957	0.1060	L	0.43152	1.355	0.80722	D	1	D;D;D;P	0.53462	0.96;0.96;0.96;0.897	P;P;P;P	0.57244	0.816;0.816;0.816;0.645	T	0.14755	-1.0461	10	0.19590	T	0.45	.	12.9753	0.58534	0.0:0.8692:0.0:0.1308	.	3905;3905;3905;3890	B7ZBC3;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	N	3905;3890;3905;3890;3829	ENSP00000356224:D3905N;ENSP00000396024:D3890N;ENSP00000265368:D3905N;ENSP00000390975:D3890N;ENSP00000341887:D3829N	ENSP00000265368:D3905N	D	-	1	0	SYNE1	152713466	1.000000	0.71417	0.997000	0.53966	0.486000	0.33341	3.049000	0.49869	0.881000	0.35993	0.655000	0.94253	GAC	SYNE1	-	pfam_Spectrin_repeat,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_Spectrin/alpha-actinin	ENSG00000131018		0.423	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	177	0.00	0	C	NM_182961		152671773	152671773	-1	no_errors	ENST00000265368	ensembl	human	known	69_37n	missense	85	38.41	53	SNP	1.000	T
TANK	10010	genome.wustl.edu	37	2	162087994	162087994	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr2:162087994C>G	ENST00000392749.2	+	7	1272	c.1033C>G	c.(1033-1035)Ctg>Gtg	p.L345V	AC009299.2_ENST00000445372.1_RNA|TANK_ENST00000402568.1_Intron|TANK_ENST00000259075.2_Missense_Mutation_p.L345V|AC009299.2_ENST00000421122.2_RNA|TANK_ENST00000406287.1_Intron|TANK_ENST00000405852.1_Missense_Mutation_p.L345V	NM_001199135.1	NP_001186064.1	Q92844	TANK_HUMAN	TRAF family member-associated NFKB activator	345					I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)	p.L345V(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)	21						CTTCCCACTTCTGGACCCATC	0.433																																						dbGAP											1	Substitution - Missense(1)	breast(1)											68.0	65.0	66.0					2																	162087994		2203	4300	6503	-	-	-	SO:0001583	missense	0			U59863	CCDS2215.1, CCDS46436.1	2q24-q31	2008-02-05			ENSG00000136560	ENSG00000136560			11562	protein-coding gene	gene with protein product		603893		TRAF2		8710854, 8855313	Standard	NM_004180		Approved	I-TRAF	uc002ubr.2	Q92844	OTTHUMG00000132037	ENST00000392749.2:c.1033C>G	2.37:g.162087994C>G	ENSP00000376505:p.Leu345Val		D3DPB5|Q7Z4J6|Q92885	Missense_Mutation	SNP	NULL	p.L345V	ENST00000392749.2	37	c.1033	CCDS2215.1	2	.	.	.	.	.	.	.	.	.	.	C	10.19	1.280803	0.23392	.	.	ENSG00000136560	ENST00000259075;ENST00000392749;ENST00000405852;ENST00000437623;ENST00000439442	T;T;T;T;T	0.29655	2.0;2.0;1.56;1.57;1.99	5.57	2.75	0.32379	.	0.334193	0.27881	N	0.017463	T	0.15565	0.0375	N	0.08118	0	0.80722	D	1	B	0.19817	0.039	B	0.17722	0.019	T	0.05784	-1.0864	10	0.33141	T	0.24	0.6055	11.0967	0.48147	0.0:0.6923:0.2422:0.0655	.	345	Q92844	TANK_HUMAN	V	345;345;345;236;100	ENSP00000259075:L345V;ENSP00000376505:L345V;ENSP00000385487:L345V;ENSP00000412556:L236V;ENSP00000387439:L100V	ENSP00000259075:L345V	L	+	1	2	TANK	161796240	1.000000	0.71417	0.999000	0.59377	0.919000	0.55068	3.761000	0.55242	0.374000	0.24650	-0.237000	0.12165	CTG	TANK	-	NULL	ENSG00000136560		0.433	TANK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TANK	HGNC	protein_coding	OTTHUMT00000324232.1	65	0.00	0	C	NM_133484		162087994	162087994	+1	no_errors	ENST00000259075	ensembl	human	known	69_37n	missense	49	10.91	6	SNP	1.000	G
TCF20	6942	genome.wustl.edu	37	22	42610881	42610881	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr22:42610881G>C	ENST00000359486.3	-	1	567	c.431C>G	c.(430-432)tCt>tGt	p.S144C	TCF20_ENST00000335626.4_Missense_Mutation_p.S144C	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	144					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						GCCAAGGCCAGAGTGCTGTGC	0.582																																						dbGAP											0													103.0	90.0	94.0					22																	42610881		2203	4300	6503	-	-	-	SO:0001583	missense	0			U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.431C>G	22.37:g.42610881G>C	ENSP00000352463:p.Ser144Cys		A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Missense_Mutation	SNP	smart_Znf_PHD	p.S144C	ENST00000359486.3	37	c.431	CCDS14033.1	22	.	.	.	.	.	.	.	.	.	.	G	19.10	3.761035	0.69763	.	.	ENSG00000100207	ENST00000359486;ENST00000335626	T;T	0.36699	1.24;1.24	5.52	5.52	0.82312	.	0.000000	0.64402	D	0.000003	T	0.49423	0.1556	N	0.24115	0.695	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.993	T	0.52990	-0.8501	10	0.66056	D	0.02	-13.8316	19.4234	0.94730	0.0:0.0:1.0:0.0	.	144;144	Q9UGU0-2;Q9UGU0	.;TCF20_HUMAN	C	144	ENSP00000352463:S144C;ENSP00000335561:S144C	ENSP00000335561:S144C	S	-	2	0	TCF20	40940825	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.165000	0.94761	2.583000	0.87209	0.655000	0.94253	TCT	TCF20	-	NULL	ENSG00000100207		0.582	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCF20	HGNC	protein_coding	OTTHUMT00000320531.1	29	0.00	0	G	NM_181492		42610881	42610881	-1	no_errors	ENST00000359486	ensembl	human	known	69_37n	missense	21	16.00	4	SNP	1.000	C
TF	7018	genome.wustl.edu	37	3	133476751	133476751	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr3:133476751G>C	ENST00000402696.3	+	8	1494	c.1009G>C	c.(1009-1011)Gag>Cag	p.E337Q	TF_ENST00000264998.3_Missense_Mutation_p.E210Q	NM_001063.3	NP_001054	P02787	TRFE_HUMAN	transferrin	337	Transferrin-like 1. {ECO:0000255|PROSITE- ProRule:PRU00741}.				blood coagulation (GO:0007596)|cellular iron ion homeostasis (GO:0006879)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|retina homeostasis (GO:0001895)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basal part of cell (GO:0045178)|basal plasma membrane (GO:0009925)|blood microparticle (GO:0072562)|cell surface (GO:0009986)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|secretory granule lumen (GO:0034774)|vesicle (GO:0031982)	ferric iron binding (GO:0008199)	p.E337Q(2)		NS(1)|autonomic_ganglia(1)|breast(3)|endometrium(7)|large_intestine(13)|liver(2)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49					Aluminium(DB01370)|Bismuth Subsalicylate(DB01294)|Gallium nitrate(DB05260)|Iron Dextran(DB00893)	CCTGGGCTATGAGTATGTCAC	0.537																																						dbGAP											2	Substitution - Missense(2)	breast(2)											83.0	76.0	78.0					3																	133476751		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3080.1	3q21	2012-10-02			ENSG00000091513	ENSG00000091513			11740	protein-coding gene	gene with protein product		190000				6585826	Standard	NM_001063		Approved	PRO1557, PRO2086	uc003epv.2	P02787	OTTHUMG00000150356	ENST00000402696.3:c.1009G>C	3.37:g.133476751G>C	ENSP00000385834:p.Glu337Gln		O43890|Q1HBA5|Q9NQB8|Q9UHV0	Missense_Mutation	SNP	pfam_Peptidase_S60,smart_Peptidase_S60,pirsf_Transferrin,prints_Peptidase_S60	p.E337Q	ENST00000402696.3	37	c.1009	CCDS3080.1	3	.	.	.	.	.	.	.	.	.	.	G	9.479	1.097772	0.20552	.	.	ENSG00000091513	ENST00000402696;ENST00000264998	T;T	0.36157	1.27;1.27	5.1	-3.17	0.05202	.	0.948679	0.08974	N	0.866829	T	0.30823	0.0777	L	0.49256	1.55	0.09310	N	1	B	0.17852	0.024	B	0.22386	0.039	T	0.38499	-0.9658	10	0.32370	T	0.25	-13.386	11.3979	0.49854	0.1469:0.5699:0.2833:0.0	.	337	P02787	TRFE_HUMAN	Q	337;210	ENSP00000385834:E337Q;ENSP00000264998:E210Q	ENSP00000264998:E210Q	E	+	1	0	TF	134959441	0.000000	0.05858	0.001000	0.08648	0.792000	0.44763	-0.855000	0.04295	-0.342000	0.08363	0.561000	0.74099	GAG	TF	-	pfam_Peptidase_S60,smart_Peptidase_S60,pirsf_Transferrin,prints_Peptidase_S60	ENSG00000091513		0.537	TF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TF	HGNC	protein_coding	OTTHUMT00000317775.1	91	0.00	0	G	NM_001063		133476751	133476751	+1	no_errors	ENST00000402696	ensembl	human	known	69_37n	missense	47	28.79	19	SNP	0.000	C
THEM5	284486	genome.wustl.edu	37	1	151820278	151820278	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr1:151820278C>G	ENST00000368817.5	-	5	767	c.636G>C	c.(634-636)caG>caC	p.Q212H	AL450992.2_ENST00000434182.1_RNA	NM_182578.3	NP_872384	Q8N1Q8	ACO15_HUMAN	thioesterase superfamily member 5	212					cardiolipin acyl-chain remodeling (GO:0035965)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)	mitochondrial matrix (GO:0005759)	palmitoyl-CoA hydrolase activity (GO:0016290)	p.Q212H(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(2)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			TGTAAAGCTTCTGGTCCTCAA	0.567																																						dbGAP											1	Substitution - Missense(1)	breast(1)											129.0	117.0	121.0					1																	151820278		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095283	CCDS1005.1	1q21.3	2008-02-05			ENSG00000196407	ENSG00000196407			26755	protein-coding gene	gene with protein product		615653					Standard	NM_182578		Approved	FLJ37964	uc021oyw.1	Q8N1Q8	OTTHUMG00000013070	ENST00000368817.5:c.636G>C	1.37:g.151820278C>G	ENSP00000357807:p.Gln212His		Q5T1C3	Missense_Mutation	SNP	pfam_Thioestr_supf	p.Q212H	ENST00000368817.5	37	c.636	CCDS1005.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.59|12.59	1.982491|1.982491	0.34942|0.34942	.|.	.|.	ENSG00000196407|ENSG00000196407	ENST00000368817|ENST00000453881	T|.	0.22539|.	1.95|.	5.19|5.19	3.2|3.2	0.36748|0.36748	Thioesterase superfamily (1);|.	0.361985|.	0.28730|.	N|.	0.014339|.	T|T	0.27765|0.27765	0.0683|0.0683	L|L	0.41027|0.41027	1.25|1.25	0.29129|0.29129	N|N	0.879791|0.879791	B|.	0.15930|.	0.015|.	B|.	0.17433|.	0.018|.	T|T	0.12041|0.12041	-1.0563|-1.0563	10|5	0.66056|.	D|.	0.02|.	-16.9436|-16.9436	11.9687|11.9687	0.53051|0.53051	0.0:0.6667:0.3333:0.0|0.0:0.6667:0.3333:0.0	.|.	212|.	Q8N1Q8|.	THEM5_HUMAN|.	H|T	212|159	ENSP00000357807:Q212H|.	ENSP00000357807:Q212H|.	Q|R	-|-	3|2	2|0	THEM5|THEM5	150086902|150086902	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.726000|0.726000	0.41606|0.41606	1.069000|1.069000	0.30641|0.30641	1.165000|1.165000	0.42670|0.42670	0.655000|0.655000	0.94253|0.94253	CAG|AGA	THEM5	-	pfam_Thioestr_supf	ENSG00000196407		0.567	THEM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THEM5	HGNC	protein_coding	OTTHUMT00000036678.2	95	0.00	0	C	NM_182578		151820278	151820278	-1	no_errors	ENST00000368817	ensembl	human	known	69_37n	missense	65	25.29	22	SNP	1.000	G
TLR8	51311	genome.wustl.edu	37	X	12938975	12938975	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chrX:12938975G>A	ENST00000218032.6	+	2	1903	c.1816G>A	c.(1816-1818)Gaa>Aaa	p.E606K	TLR8_ENST00000311912.5_Missense_Mutation_p.E624K	NM_138636.4	NP_619542.1	Q9NR97	TLR8_HUMAN	toll-like receptor 8	606					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|immunoglobulin mediated immune response (GO:0016064)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|regulation of cytokine secretion (GO:0050707)|response to virus (GO:0009615)|toll-like receptor 8 signaling pathway (GO:0034158)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|receptor activity (GO:0004872)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)	p.E624K(1)		breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50					Imiquimod(DB00724)	GTATAACCTGGAAAGCAAGTC	0.333																																						dbGAP											1	Substitution - Missense(1)	breast(1)											55.0	55.0	55.0					X																	12938975		2202	4298	6500	-	-	-	SO:0001583	missense	0			AF246971	CCDS14152.1, CCDS14153.1	Xp22	2009-11-23			ENSG00000101916	ENSG00000101916		"""CD molecules"""	15632	protein-coding gene	gene with protein product		300366				11022119	Standard	NM_138636		Approved	CD288	uc004cve.3	Q9NR97	OTTHUMG00000021145	ENST00000218032.6:c.1816G>A	X.37:g.12938975G>A	ENSP00000218032:p.Glu606Lys		B3Y654|D1CS70|D1CS76|Q495P4|Q6UXL6|Q9NYG9	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_TIR_dom,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.E606K	ENST00000218032.6	37	c.1816	CCDS14152.1	X	.	.	.	.	.	.	.	.	.	.	G	0.052	-1.248374	0.01469	.	.	ENSG00000101916	ENST00000218032;ENST00000311912	T;T	0.78924	-1.22;-1.22	5.97	0.842	0.18927	.	1.849390	0.03077	N	0.158006	T	0.59059	0.2166	N	0.10809	0.05	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.44050	-0.9353	10	0.17369	T	0.5	.	6.1623	0.20370	0.5426:0.1289:0.3285:0.0	.	606;624	Q9NR97;D1CS70	TLR8_HUMAN;.	K	606;624	ENSP00000218032:E606K;ENSP00000312082:E624K	ENSP00000218032:E606K	E	+	1	0	TLR8	12848896	0.000000	0.05858	0.000000	0.03702	0.040000	0.13550	-0.198000	0.09505	0.047000	0.15862	-1.005000	0.02491	GAA	TLR8	-	NULL	ENSG00000101916		0.333	TLR8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR8	HGNC	protein_coding	OTTHUMT00000055784.2	95	0.00	0	G	NM_016610		12938975	12938975	+1	no_errors	ENST00000218032	ensembl	human	known	69_37n	missense	73	12.05	10	SNP	0.000	A
TMEM132D	121256	genome.wustl.edu	37	12	129563234	129563234	+	Nonsense_Mutation	SNP	T	T	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr12:129563234T>A	ENST00000422113.2	-	8	2286	c.1960A>T	c.(1960-1962)Aag>Tag	p.K654*	TMEM132D_ENST00000389441.4_Nonsense_Mutation_p.K192*	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	654					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)		p.K654*(1)		NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		GTGATGGTCTTTTCAGCGAGG	0.567																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											151.0	127.0	135.0					12																	129563234		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.1960A>T	12.37:g.129563234T>A	ENSP00000408581:p.Lys654*		Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Nonsense_Mutation	SNP	NULL	p.K654*	ENST00000422113.2	37	c.1960	CCDS9266.1	12	.	.	.	.	.	.	.	.	.	.	T	43	10.209332	0.99360	.	.	ENSG00000151952	ENST00000389441;ENST00000422113	.	.	.	5.06	5.06	0.68205	.	0.123052	0.51477	D	0.000095	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-42.205	14.8074	0.69968	0.0:0.0:0.0:1.0	.	.	.	.	X	192;654	.	.	K	-	1	0	TMEM132D	128129187	1.000000	0.71417	0.979000	0.43373	0.905000	0.53344	5.952000	0.70282	1.894000	0.54839	0.460000	0.39030	AAG	TMEM132D	-	NULL	ENSG00000151952		0.567	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132D	HGNC	protein_coding	OTTHUMT00000399592.1	66	0.00	0	T	NM_133448		129563234	129563234	-1	no_errors	ENST00000422113	ensembl	human	known	69_37n	nonsense	39	20.41	10	SNP	1.000	A
TMEM196	256130	genome.wustl.edu	37	7	19761719	19761719	+	Silent	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr7:19761719C>G	ENST00000405764.3	-	4	1194	c.498G>C	c.(496-498)ctG>ctC	p.L166L	TMEM196_ENST00000433641.1_3'UTR|TMEM196_ENST00000422233.1_3'UTR|TMEM196_ENST00000405844.1_3'UTR|TMEM196_ENST00000493519.1_Silent_p.L98L|AC004543.1_ENST00000408649.2_RNA	NM_152774.3	NP_689987.3	Q5HYL7	TM196_HUMAN	transmembrane protein 196	172						integral component of membrane (GO:0016021)		p.L98L(2)|p.L166L(1)		breast(1)|large_intestine(1)|lung(4)	6						CATTAAATATCAGCTGTGGTC	0.318																																						dbGAP											3	Substitution - coding silent(3)	breast(2)|large_intestine(1)											152.0	133.0	139.0					7																	19761719		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0				CCDS34607.2	7p15.3	2007-11-21			ENSG00000173452	ENSG00000173452			22431	protein-coding gene	gene with protein product							Standard	NM_152774		Approved	MGC42090	uc011jyg.2	Q5HYL7	OTTHUMG00000152504	ENST00000405764.3:c.498G>C	7.37:g.19761719C>G			Q8N6I6	Silent	SNP	NULL	p.L166	ENST00000405764.3	37	c.498	CCDS34607.2	7																																																																																			TMEM196	-	NULL	ENSG00000173452		0.318	TMEM196-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM196	HGNC	protein_coding	OTTHUMT00000326499.1	386	0.00	0	C	NM_152774		19761719	19761719	-1	no_errors	ENST00000405764	ensembl	human	known	69_37n	silent	245	22.22	70	SNP	0.997	G
TMTC2	160335	genome.wustl.edu	37	12	83289848	83289848	+	Silent	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr12:83289848C>T	ENST00000321196.3	+	3	1613	c.906C>T	c.(904-906)ctC>ctT	p.L302L	TMTC2_ENST00000549919.1_Silent_p.L296L|TMTC2_ENST00000548305.1_Silent_p.L302L	NM_152588.1	NP_689801.1	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat containing 2	302					calcium ion homeostasis (GO:0055074)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)		p.L302L(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|urinary_tract(1)	39						TGCCTCTGCTCAAAACAGTTT	0.488																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											129.0	115.0	120.0					12																	83289848		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK074634	CCDS9025.1	12q21.31	2014-06-09			ENSG00000179104	ENSG00000179104		"""Tetratricopeptide (TTC) repeat domain containing"""	25440	protein-coding gene	gene with protein product		615856				24764305	Standard	NM_152588		Approved	DKFZp762A217	uc001szt.3	Q8N394	OTTHUMG00000169736	ENST00000321196.3:c.906C>T	12.37:g.83289848C>T			B2RCU7|Q8N2K8	Silent	SNP	pfam_TPR-1,pfam_TPR_2,pfam_DUF1736,pfam_TPR-4,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.L302	ENST00000321196.3	37	c.906	CCDS9025.1	12																																																																																			TMTC2	-	pfam_DUF1736	ENSG00000179104		0.488	TMTC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMTC2	HGNC	protein_coding	OTTHUMT00000405663.1	101	0.00	0	C	NM_152588		83289848	83289848	+1	no_errors	ENST00000321196	ensembl	human	known	69_37n	silent	86	24.56	28	SNP	0.930	T
TNFSF4	7292	genome.wustl.edu	37	1	173157704	173157704	+	Nonsense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr1:173157704G>C	ENST00000281834.3	-	2	294	c.158C>G	c.(157-159)tCa>tGa	p.S53*	TNFSF4_ENST00000488053.1_5'UTR|TNFSF4_ENST00000367718.1_Nonsense_Mutation_p.S3*	NM_003326.3	NP_003317.1	P23510	TNFL4_HUMAN	tumor necrosis factor (ligand) superfamily, member 4	53					acute inflammatory response (GO:0002526)|CD4-positive, alpha-beta T cell costimulation (GO:0035783)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to nitrogen dioxide (GO:0035714)|cellular response to prostaglandin E stimulus (GO:0071380)|chemokine (C-C motif) ligand 11 production (GO:0071954)|cholesterol metabolic process (GO:0008203)|defense response to nematode (GO:0002215)|immune response (GO:0006955)|memory T cell activation (GO:0035709)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of regulatory T cell differentiation (GO:0045590)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of B cell activation (GO:0050871)|positive regulation of CD4-positive, alpha-beta T cell costimulation (GO:1900281)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of cell proliferation (GO:0008284)|positive regulation of immunoglobulin mediated immune response (GO:0002891)|positive regulation of immunoglobulin secretion (GO:0051024)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-4-dependent isotype switching to IgE isotypes (GO:2000572)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of memory T cell activation (GO:2000568)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of T cell cytokine production (GO:0002726)|positive regulation of T-helper 2 cell activation (GO:2000570)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of type 2 immune response (GO:0002830)|regulation of adaptive immune response (GO:0002819)|regulation of inflammatory response (GO:0050727)|response to nitrogen dioxide (GO:0035713)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation (GO:0042098)|T-helper 2 cell activation (GO:0035712)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	receptor binding (GO:0005102)|tumor necrosis factor receptor superfamily binding (GO:0032813)	p.S53*(1)		breast(2)|central_nervous_system(2)|endometrium(1)|large_intestine(2)|lung(3)|skin(1)|urinary_tract(1)	12						ATACCGATGTGATACCTGAGG	0.323																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											86.0	99.0	94.0					1																	173157704		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			D90224	CCDS1306.1, CCDS72985.1	1q25	2008-07-31	2008-07-31		ENSG00000117586	ENSG00000117586		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11934	protein-coding gene	gene with protein product		603594	"""tax-transcriptionally activated glycoprotein 1, 34kD"""	TXGP1		1996093, 8076595	Standard	XM_005245475		Approved	OX-40L, gp34, CD252	uc001giw.3	P23510	OTTHUMG00000034838	ENST00000281834.3:c.158C>G	1.37:g.173157704G>C	ENSP00000281834:p.Ser53*		Q5JZA5|Q8IV74|Q9HCN9	Nonsense_Mutation	SNP	pfam_TNF,superfamily_Tumour_necrosis_fac-like,smart_TNF	p.S53*	ENST00000281834.3	37	c.158	CCDS1306.1	1	.	.	.	.	.	.	.	.	.	.	G	10.93	1.491211	0.26774	.	.	ENSG00000117586	ENST00000367718;ENST00000281834;ENST00000545292	.	.	.	3.51	2.58	0.30949	.	0.497340	0.18547	N	0.138028	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	0.0038	8.2627	0.31795	0.0:0.0:0.7635:0.2365	.	.	.	.	X	3;53;3	.	ENSP00000281834:S53X	S	-	2	0	TNFSF4	171424327	0.033000	0.19621	0.001000	0.08648	0.044000	0.14063	1.415000	0.34748	1.033000	0.39918	-0.182000	0.12963	TCA	TNFSF4	-	NULL	ENSG00000117586		0.323	TNFSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFSF4	HGNC	protein_coding	OTTHUMT00000084271.1	230	0.00	0	G			173157704	173157704	-1	no_errors	ENST00000281834	ensembl	human	known	69_37n	nonsense	187	12.62	27	SNP	0.001	C
TRAPPC1	58485	genome.wustl.edu	37	17	7834854	7834854	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr17:7834854G>C	ENST00000303731.4	-	2	255	c.140C>G	c.(139-141)tCg>tGg	p.S47W	CNTROB_ENST00000565740.1_5'Flank|KCNAB3_ENST00000303790.2_5'Flank|CNTROB_ENST00000380262.3_5'Flank|RP11-1099M24.7_ENST00000573621.1_5'Flank|TRAPPC1_ENST00000540486.1_Missense_Mutation_p.S47W|CNTROB_ENST00000563694.1_5'Flank|CNTROB_ENST00000380255.3_5'Flank	NM_021210.4	NP_067033.1	Q9Y5R8	TPPC1_HUMAN	trafficking protein particle complex 1	47					ER to Golgi vesicle-mediated transport (GO:0006888)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|TRAPP complex (GO:0030008)		p.S47W(1)		breast(1)|lung(2)	3		Prostate(122;0.173)				GCTGACAAACGAGCGGATAGA	0.562																																						dbGAP											1	Substitution - Missense(1)	breast(1)											71.0	66.0	67.0					17																	7834854		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF129332	CCDS11125.1	17p13.1	2011-10-10			ENSG00000170043	ENSG00000170043		"""Trafficking protein particle complex"""	19894	protein-coding gene	gene with protein product		610969				10582700	Standard	NM_021210		Approved	MUM2, BET5	uc002gjo.2	Q9Y5R8	OTTHUMG00000108171	ENST00000303731.4:c.140C>G	17.37:g.7834854G>C	ENSP00000302783:p.Ser47Trp		D3DTR0	Missense_Mutation	SNP	pfam_Sybindin,superfamily_Longin-like_dom	p.S47W	ENST00000303731.4	37	c.140	CCDS11125.1	17	.	.	.	.	.	.	.	.	.	.	G	27.8	4.865169	0.91511	.	.	ENSG00000170043	ENST00000303731;ENST00000540486	T;T	0.51325	0.71;0.71	5.65	5.65	0.86999	Longin-like (1);	0.000000	0.85682	D	0.000000	T	0.73497	0.3594	M	0.85777	2.775	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.76884	-0.2794	10	0.87932	D	0	-23.5704	18.8623	0.92278	0.0:0.0:1.0:0.0	.	47	Q9Y5R8	TPPC1_HUMAN	W	47	ENSP00000302783:S47W;ENSP00000441130:S47W	ENSP00000302783:S47W	S	-	2	0	TRAPPC1	7775579	1.000000	0.71417	0.972000	0.41901	0.991000	0.79684	8.462000	0.90374	2.824000	0.97209	0.655000	0.94253	TCG	TRAPPC1	-	pfam_Sybindin,superfamily_Longin-like_dom	ENSG00000170043		0.562	TRAPPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAPPC1	HGNC	protein_coding	OTTHUMT00000226975.2	41	0.00	0	G	NM_021210		7834854	7834854	-1	no_errors	ENST00000303731	ensembl	human	known	69_37n	missense	16	20.00	4	SNP	1.000	C
TOP3A	7156	genome.wustl.edu	37	17	18205698	18205698	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr17:18205698C>A	ENST00000321105.5	-	7	908	c.694G>T	c.(694-696)Gag>Tag	p.E232*	TOP3A_ENST00000540524.1_5'Flank|TOP3A_ENST00000542570.1_Nonsense_Mutation_p.E137*	NM_004618.3	NP_004609.1	Q13472	TOP3A_HUMAN	topoisomerase (DNA) III alpha	232					DNA topological change (GO:0006265)|meiotic nuclear division (GO:0007126)	chromosome (GO:0005694)|nucleus (GO:0005634)|PML body (GO:0016605)	DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|zinc ion binding (GO:0008270)	p.E232*(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)|skin(6)|stomach(2)|urinary_tract(1)	36						GCCAGCACCTCAGGAAAAATC	0.522																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											40.0	46.0	44.0					17																	18205698		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U43431	CCDS11194.1	17p12-p11.2	2014-02-18			ENSG00000177302	ENSG00000177302			11992	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 7"""	601243		TOP3		9450867	Standard	NM_004618		Approved	ZGRF7	uc002gsx.1	Q13472	OTTHUMG00000059391	ENST00000321105.5:c.694G>T	17.37:g.18205698C>A	ENSP00000321636:p.Glu232*		A8KA61|B4DK80|D3DXC7|Q13473	Nonsense_Mutation	SNP	pfam_Topo_IA_cen,pfam_Znf_GRF,pfam_Toprim_domain,pfam_Topo_IA_Znf,superfamily_Topo_IA_core_domain,superfamily_Znf_CCHC,smart_Toprim_domain,smart_Topo_IA_2,smart_Topo_IA_DNA-bd,prints_Topo_IA	p.E232*	ENST00000321105.5	37	c.694	CCDS11194.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.493924|5.493924	0.96339|0.96339	.|.	.|.	ENSG00000177302|ENSG00000177302	ENST00000321105;ENST00000542570|ENST00000412083	.|.	.|.	.|.	6.07|6.07	4.04|4.04	0.47022|0.47022	.|.	0.322385|.	0.37577|.	N|.	0.002033|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.25751|.	T|.	0.34|.	-25.5299|-25.5299	11.6105|11.6105	0.51057|0.51057	0.1269:0.5993:0.2738:0.0|0.1269:0.5993:0.2738:0.0	.|.	.|.	.|.	.|.	X|L	232;137|211	.|.	ENSP00000321636:E232X|.	E|X	-|-	1|2	0|2	TOP3A|TOP3A	18146423|18146423	0.322000|0.322000	0.24634|0.24634	0.909000|0.909000	0.35828|0.35828	0.996000|0.996000	0.88848|0.88848	1.585000|1.585000	0.36600|0.36600	0.849000|0.849000	0.35215|0.35215	0.655000|0.655000	0.94253|0.94253	GAG|TGA	TOP3A	-	pfam_Topo_IA_cen,superfamily_Topo_IA_core_domain,smart_Topo_IA_2	ENSG00000177302		0.522	TOP3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOP3A	HGNC	protein_coding	OTTHUMT00000132052.2	47	0.00	0	C			18205698	18205698	-1	no_errors	ENST00000321105	ensembl	human	known	69_37n	nonsense	25	35.90	14	SNP	0.981	A
TTC3	7267	genome.wustl.edu	37	21	38516840	38516840	+	Silent	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr21:38516840C>T	ENST00000399017.2	+	21	4535	c.1788C>T	c.(1786-1788)ctC>ctT	p.L596L	TTC3_ENST00000355666.1_Silent_p.L596L|TTC3_ENST00000354749.2_Silent_p.L596L|TTC3_ENST00000479930.1_3'UTR|TTC3_ENST00000540756.1_Silent_p.L286L	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	596					negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.L596L(1)		breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				TAGAAGCTCTCAATCACTTTG	0.353																																					Ovarian(38;194 1649 35661)	dbGAP											1	Substitution - coding silent(1)	breast(1)											109.0	106.0	107.0					21																	38516840		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.1788C>T	21.37:g.38516840C>T			A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	Silent	SNP	pfam_Znf_C3HC4_RING-type,superfamily_DEATH-like,smart_TPR_repeat,smart_Znf_RING,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Znf_RING	p.L596	ENST00000399017.2	37	c.1788	CCDS13651.1	21																																																																																			TTC3	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000182670		0.353	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC3	HGNC	protein_coding	OTTHUMT00000194776.1	222	0.00	0	C			38516840	38516840	+1	no_errors	ENST00000354749	ensembl	human	known	69_37n	silent	130	24.86	43	SNP	0.578	T
TTN	7273	genome.wustl.edu	37	2	179584439	179584439	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr2:179584439C>T	ENST00000591111.1	-	80	23053	c.22829G>A	c.(22828-22830)aGa>aAa	p.R7610K	TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.R7927K|TTN_ENST00000342992.6_Missense_Mutation_p.R6683K|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin	13160	Ig-like 58.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R6683K(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGACAATTCTCTTCCATCTTT	0.428																																						dbGAP											1	Substitution - Missense(1)	breast(1)											152.0	140.0	144.0					2																	179584439		1894	4120	6014	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.22829G>A	2.37:g.179584439C>T	ENSP00000465570:p.Arg7610Lys		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.R6683K	ENST00000591111.1	37	c.20048		2	.	.	.	.	.	.	.	.	.	.	C	10.09	1.255967	0.22965	.	.	ENSG00000155657	ENST00000342992	T	0.64803	-0.12	6.08	2.73	0.32206	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.39989	0.1099	N	0.04162	-0.26	0.23712	N	0.997046	B	0.02656	0.0	B	0.04013	0.001	T	0.37709	-0.9694	9	0.87932	D	0	.	10.7149	0.46006	0.0:0.6997:0.0:0.3003	.	7610	Q8WZ42	TITIN_HUMAN	K	6683	ENSP00000343764:R6683K	ENSP00000343764:R6683K	R	-	2	0	TTN	179292684	0.047000	0.20315	0.993000	0.49108	0.986000	0.74619	0.232000	0.17891	0.814000	0.34374	-0.345000	0.07892	AGA	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000155657		0.428	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	217	0.00	0	C	NM_133378		179584439	179584439	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	140	18.13	31	SNP	0.125	T
TTYH2	94015	genome.wustl.edu	37	17	72249933	72249933	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr17:72249933G>C	ENST00000269346.4	+	13	1559	c.1485G>C	c.(1483-1485)gaG>gaC	p.E495D	TTYH2_ENST00000441391.2_Missense_Mutation_p.E174D|TTYH2_ENST00000529107.1_Missense_Mutation_p.E474D	NM_032646.5	NP_116035.5	Q9BSA4	TTYH2_HUMAN	tweety family member 2	495						chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)	p.E495D(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(14)|ovary(3)|pancreas(1)|stomach(3)|upper_aerodigestive_tract(1)	36						CACGCTACGAGAACGTGCCAC	0.562																																						dbGAP											1	Substitution - Missense(1)	breast(1)											162.0	130.0	141.0					17																	72249933		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32717.1, CCDS45770.1	17q25.1	2013-09-02	2013-09-02		ENSG00000141540	ENSG00000141540			13877	protein-coding gene	gene with protein product		608855	"""tweety (Drosophila) homolog 2"", ""tweety homolog 2 (Drosophila)"""			11597145	Standard	XM_005257824		Approved	C17orf29	uc002jkc.3	Q9BSA4	OTTHUMG00000166018	ENST00000269346.4:c.1485G>C	17.37:g.72249933G>C	ENSP00000269346:p.Glu495Asp		B3KX97|Q3B7H8|Q3B7R9|Q6AWB4|Q8NBB7|Q96PK1	Missense_Mutation	SNP	pfam_Tweety	p.E495D	ENST00000269346.4	37	c.1485	CCDS32717.1	17	.	.	.	.	.	.	.	.	.	.	G	19.48	3.836011	0.71373	.	.	ENSG00000141540	ENST00000269346;ENST00000529107;ENST00000441391	T;T;T	0.46819	0.86;0.86;0.86	4.77	1.15	0.20763	.	0.000000	0.85682	D	0.000000	T	0.63117	0.2484	M	0.78801	2.425	0.42356	D	0.992391	D;D	0.89917	1.0;1.0	D;D	0.85130	0.994;0.997	T	0.62982	-0.6738	10	0.87932	D	0	-26.4703	7.1356	0.25527	0.423:0.0:0.577:0.0	.	474;495	B4DKD1;Q9BSA4	.;TTYH2_HUMAN	D	495;474;174	ENSP00000269346:E495D;ENSP00000433089:E474D;ENSP00000394576:E174D	ENSP00000269346:E495D	E	+	3	2	TTYH2	69761528	1.000000	0.71417	0.999000	0.59377	0.905000	0.53344	1.500000	0.35682	0.420000	0.25954	0.563000	0.77884	GAG	TTYH2	-	NULL	ENSG00000141540		0.562	TTYH2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	TTYH2	HGNC	protein_coding	OTTHUMT00000387459.1	38	0.00	0	G			72249933	72249933	+1	no_errors	ENST00000269346	ensembl	human	known	69_37n	missense	25	16.67	5	SNP	1.000	C
TYW5	129450	genome.wustl.edu	37	2	200797832	200797832	+	Silent	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr2:200797832G>C	ENST00000354611.4	-	8	1171	c.906C>G	c.(904-906)gtC>gtG	p.V302V	C2orf69_ENST00000491721.1_Intron|TYW5_ENST00000452512.2_5'UTR	NM_001039693.2	NP_001034782.1	A2RUC4	TYW5_HUMAN	tRNA-yW synthesizing protein 5	302					wybutosine biosynthetic process (GO:0031591)		iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)	p.V302V(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(1)	8						GAATGTGTAGGACCATTCGTC	0.403																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											157.0	144.0	148.0					2																	200797832		1895	4126	6021	-	-	-	SO:0001819	synonymous_variant	0			AK095272	CCDS42795.1	2q33.1	2011-05-09	2011-05-09	2011-05-09	ENSG00000162971	ENSG00000162971			26754	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 60"""	C2orf60		20739293	Standard	NM_001039693		Approved	FLJ37953	uc002uvi.4	A2RUC4	OTTHUMG00000132770	ENST00000354611.4:c.906C>G	2.37:g.200797832G>C			B2RNE3|Q8N1R2	Silent	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.V302	ENST00000354611.4	37	c.906	CCDS42795.1	2																																																																																			TYW5	-	NULL	ENSG00000162971		0.403	TYW5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYW5	HGNC	protein_coding	OTTHUMT00000256144.3	186	0.53	1	G	NM_001039693		200797832	200797832	-1	no_errors	ENST00000354611	ensembl	human	known	69_37n	silent	103	28.97	42	SNP	0.961	C
UACA	55075	genome.wustl.edu	37	15	70959869	70959869	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr15:70959869C>G	ENST00000322954.6	-	16	3339	c.3154G>C	c.(3154-3156)Gag>Cag	p.E1052Q	UACA_ENST00000539319.1_Missense_Mutation_p.E943Q|UACA_ENST00000560441.1_Missense_Mutation_p.E1037Q|UACA_ENST00000379983.2_Missense_Mutation_p.E1039Q	NM_018003.2	NP_060473.2	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and ankyrin repeats	1052					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of protein import into nucleus (GO:0042307)|response to UV (GO:0009411)	apoptosome (GO:0043293)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)		p.E1052Q(1)|p.E1039Q(1)		breast(2)|endometrium(7)|kidney(4)|large_intestine(13)|lung(17)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	50						TGAGACTTCTCAATGAGAACT	0.348																																						dbGAP											2	Substitution - Missense(2)	breast(2)											115.0	106.0	109.0					15																	70959869		2198	4298	6496	-	-	-	SO:0001583	missense	0			AF322916	CCDS10235.1, CCDS32280.1	15q22-q24	2013-01-10			ENSG00000137831	ENSG00000137831		"""Ankyrin repeat domain containing"""	15947	protein-coding gene	gene with protein product		612516				11162650, 10997877	Standard	NM_001008224		Approved	FLJ10128, KIAA1561	uc002asr.3	Q9BZF9	OTTHUMG00000133363	ENST00000322954.6:c.3154G>C	15.37:g.70959869C>G	ENSP00000314556:p.Glu1052Gln		G3XAG2|Q14DD3|Q8N3B8|Q96NH6|Q9HCL1|Q9NWC6	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_Prefoldin,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_T_SNARE_dom,prints_Ankyrin_rpt	p.E1052Q	ENST00000322954.6	37	c.3154	CCDS10235.1	15	.	.	.	.	.	.	.	.	.	.	C	18.15	3.558954	0.65538	.	.	ENSG00000137831	ENST00000322954;ENST00000379983;ENST00000539319	T;T;T	0.38560	1.13;1.14;1.61	5.82	5.82	0.92795	.	0.180741	0.38605	N	0.001639	T	0.67449	0.2894	M	0.76002	2.32	0.49915	D	0.999834	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.998;0.999	T	0.66945	-0.5795	10	0.54805	T	0.06	-13.0551	20.093	0.97828	0.0:1.0:0.0:0.0	.	943;1052;1052;1039	F5H2B9;B7ZKM6;Q9BZF9;G3XAG2	.;.;UACA_HUMAN;.	Q	1052;1039;943	ENSP00000314556:E1052Q;ENSP00000369319:E1039Q;ENSP00000438667:E943Q	ENSP00000314556:E1052Q	E	-	1	0	UACA	68746923	0.992000	0.36948	0.273000	0.24645	0.833000	0.47200	2.976000	0.49289	2.756000	0.94617	0.561000	0.74099	GAG	UACA	-	NULL	ENSG00000137831		0.348	UACA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UACA	HGNC	protein_coding	OTTHUMT00000257199.2	273	0.00	0	C			70959869	70959869	-1	no_errors	ENST00000322954	ensembl	human	known	69_37n	missense	185	30.45	81	SNP	0.995	G
UHRF1BP1L	23074	genome.wustl.edu	37	12	100451418	100451418	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr12:100451418C>T	ENST00000279907.7	-	15	3567	c.3355G>A	c.(3355-3357)Gac>Aac	p.D1119N	UHRF1BP1L_ENST00000545232.2_Missense_Mutation_p.D769N	NM_015054.1	NP_055869.1	A0JNW5	UH1BL_HUMAN	UHRF1 binding protein 1-like	1119								p.D1119N(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(21)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	50						ATCATGCTGTCAAGTGAAATG	0.373																																						dbGAP											1	Substitution - Missense(1)	breast(1)											118.0	110.0	113.0					12																	100451418		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS31882.1, CCDS31883.1	12q23.1	2011-04-15	2008-08-15		ENSG00000111647	ENSG00000111647			29102	protein-coding gene	gene with protein product							Standard	XM_005268737		Approved	KIAA0701	uc001tgq.3	A0JNW5	OTTHUMG00000170195	ENST00000279907.7:c.3355G>A	12.37:g.100451418C>T	ENSP00000279907:p.Asp1119Asn		A0PJE5|O75183|Q8NDL1|Q96C30|Q9BTS5|Q9H0F1	Missense_Mutation	SNP	NULL	p.D1119N	ENST00000279907.7	37	c.3355	CCDS31882.1	12	.	.	.	.	.	.	.	.	.	.	C	29.2	4.982535	0.93044	.	.	ENSG00000111647	ENST00000279907;ENST00000545232	T;T	0.21031	2.03;2.03	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.51618	0.1685	M	0.77103	2.36	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.51655	-0.8678	10	0.87932	D	0	-12.1905	20.1979	0.98245	0.0:1.0:0.0:0.0	.	1119	A0JNW5	UH1BL_HUMAN	N	1119;769	ENSP00000279907:D1119N;ENSP00000444824:D769N	ENSP00000279907:D1119N	D	-	1	0	UHRF1BP1L	98975549	1.000000	0.71417	1.000000	0.80357	0.763000	0.43281	6.614000	0.74197	2.846000	0.97976	0.650000	0.86243	GAC	UHRF1BP1L	-	NULL	ENSG00000111647		0.373	UHRF1BP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UHRF1BP1L	HGNC	protein_coding	OTTHUMT00000407875.1	266	0.00	0	C	NM_001006947		100451418	100451418	-1	no_errors	ENST00000279907	ensembl	human	known	69_37n	missense	199	22.87	59	SNP	1.000	T
WDFY3	23001	genome.wustl.edu	37	4	85758097	85758097	+	Silent	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr4:85758097C>T	ENST00000295888.4	-	7	968	c.561G>A	c.(559-561)caG>caA	p.Q187Q	WDFY3_ENST00000322366.6_Silent_p.Q187Q	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	187					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)	p.Q187H(1)|p.Q187Q(1)		breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CAAAAACTTTCTGGAGTAGTC	0.403																																						dbGAP											2	Substitution - Missense(1)|Substitution - coding silent(1)	breast(2)											91.0	79.0	83.0					4																	85758097		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.561G>A	4.37:g.85758097C>T			Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Silent	SNP	pfam_BEACH_dom,pfam_Znf_FYVE,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Znf_FYVE_PHD,superfamily_ConA-like_lec_gl,superfamily_Cyclin-like,superfamily_ARM-type_fold,smart_WD40_repeat,smart_Znf_FYVE,pfscan_BEACH_dom,pfscan_Znf_FYVE-rel,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q187	ENST00000295888.4	37	c.561	CCDS3609.1	4																																																																																			WDFY3	-	NULL	ENSG00000163625		0.403	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY3	HGNC	protein_coding	OTTHUMT00000252811.2	89	0.00	0	C	NM_014991		85758097	85758097	-1	no_errors	ENST00000295888	ensembl	human	known	69_37n	silent	35	25.53	12	SNP	1.000	T
WDR3	10885	genome.wustl.edu	37	1	118485115	118485115	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr1:118485115C>G	ENST00000349139.5	+	10	1092	c.1045C>G	c.(1045-1047)Ctg>Gtg	p.L349V		NM_006784.2	NP_006775.1	Q9UNX4	WDR3_HUMAN	WD repeat domain 3	349						nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.L349V(1)		breast(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(9)|liver(2)|lung(22)|prostate(2)|upper_aerodigestive_tract(1)	49	Esophageal squamous(2;0.162)	all_cancers(81;2.72e-05)|Acute lymphoblastic leukemia(138;1e-08)|all_epithelial(167;4.4e-07)|all_lung(203;1.7e-06)|Lung NSC(69;1.98e-05)|Prostate(1639;0.00955)|Breast(1374;0.244)		OV - Ovarian serous cystadenocarcinoma(397;1.39e-08)|Epithelial(280;1.82e-07)|all cancers(265;2.04e-05)|Lung(183;0.0525)|BRCA - Breast invasive adenocarcinoma(282;0.0695)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.185)		TGAAATGAGTCTGCAAGATGA	0.333																																						dbGAP											1	Substitution - Missense(1)	breast(1)											97.0	100.0	99.0					1																	118485115		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF083217	CCDS898.1	1p12	2013-01-09			ENSG00000065183	ENSG00000065183		"""WD repeat domain containing"""	12755	protein-coding gene	gene with protein product		604737				10395803	Standard	NM_006784		Approved	FLJ12796, UTP12, DIP2	uc010oxe.1	Q9UNX4	OTTHUMG00000012197	ENST00000349139.5:c.1045C>G	1.37:g.118485115C>G	ENSP00000308179:p.Leu349Val			Missense_Mutation	SNP	pfam_WD40_repeat,pfam_SSU_processome_Utp12,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.L349V	ENST00000349139.5	37	c.1045	CCDS898.1	1	.	.	.	.	.	.	.	.	.	.	C	19.38	3.817172	0.70912	.	.	ENSG00000065183	ENST00000349139	T	0.51817	0.69	5.3	4.39	0.52855	WD40/YVTN repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.42539	0.1207	M	0.81112	2.525	0.80722	D	1	D	0.53312	0.959	P	0.47744	0.556	T	0.46148	-0.9212	10	0.19147	T	0.46	-8.3855	14.4311	0.67251	0.0:0.9284:0.0:0.0716	.	349	Q9UNX4	WDR3_HUMAN	V	349	ENSP00000308179:L349V	ENSP00000308179:L349V	L	+	1	2	WDR3	118286638	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	1.161000	0.31773	1.358000	0.45922	0.650000	0.86243	CTG	WDR3	-	pfscan_WD40_repeat_dom	ENSG00000065183		0.333	WDR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR3	HGNC	protein_coding	OTTHUMT00000033720.2	201	0.00	0	C	NM_006784		118485115	118485115	+1	no_errors	ENST00000349139	ensembl	human	known	69_37n	missense	94	37.75	57	SNP	1.000	G
ZC2HC1C	79696	genome.wustl.edu	37	14	75537978	75537978	+	Silent	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr14:75537978G>C	ENST00000524913.1	+	2	1191	c.702G>C	c.(700-702)ctG>ctC	p.L234L	ZC2HC1C_ENST00000439583.2_Silent_p.L234L|ZC2HC1C_ENST00000238686.8_Silent_p.L234L|ZC2HC1C_ENST00000526748.1_Intron|ACYP1_ENST00000555463.1_5'Flank	NM_024643.2	NP_078919.2	Q53FD0	ZC21C_HUMAN	zinc finger, C2HC-type containing 1C	234							metal ion binding (GO:0046872)	p.L234L(1)									AGATTCTCCTGAGGGGAAAGC	0.493																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											68.0	70.0	69.0					14																	75537978		1873	4114	5987	-	-	-	SO:0001819	synonymous_variant	0			AK026746	CCDS41972.1, CCDS45138.1	14q24.3	2013-01-10	2012-02-03	2012-02-03	ENSG00000119703	ENSG00000119703		"""Zinc fingers, C2HC-type containing"""	20354	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 140"", ""family with sequence similarity 164, member C"""	C14orf140, FAM164C			Standard	XM_005268062		Approved		uc001xrh.3	Q53FD0	OTTHUMG00000167439	ENST00000524913.1:c.702G>C	14.37:g.75537978G>C			E9PJQ0|Q9BTA8|Q9H5S9	Nonstop_Mutation	SNP	NULL	p.*101S	ENST00000524913.1	37	c.302	CCDS41972.1	14	.	.	.	.	.	.	.	.	.	.	G	6.927	0.540659	0.13250	.	.	ENSG00000119703	ENST00000532198	.	.	.	4.18	0.156	0.14910	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-7.3508	0.7865	0.01049	0.2397:0.1728:0.3605:0.227	.	.	.	.	S	101	.	.	X	+	2	2	FAM164C	74607731	0.852000	0.29690	0.955000	0.39395	0.993000	0.82548	-0.025000	0.12413	-0.074000	0.12820	0.650000	0.86243	TGA	ZC2HC1C	-	NULL	ENSG00000119703		0.493	ZC2HC1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC2HC1C	HGNC	protein_coding	OTTHUMT00000394616.4	116	0.00	0	G	NM_001042430		75537978	75537978	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000532198	ensembl	human	putative	69_37n	nonstop	79	16.84	16	SNP	0.791	C
ZCCHC9	84240	genome.wustl.edu	37	5	80600664	80600664	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr5:80600664G>C	ENST00000254037.2	+	1	3243	c.88G>C	c.(88-90)Gag>Cag	p.E30Q	ZCCHC9_ENST00000438268.2_Missense_Mutation_p.E30Q|ZCCHC9_ENST00000506458.1_Intron|ZCCHC9_ENST00000380199.5_Missense_Mutation_p.E30Q|ZCCHC9_ENST00000407610.3_Missense_Mutation_p.E30Q			Q8N567	ZCHC9_HUMAN	zinc finger, CCHC domain containing 9	30					negative regulation of phosphatase activity (GO:0010923)		poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.E30Q(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)	13		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;8.18e-45)|Epithelial(54;2.72e-39)|all cancers(79;7.33e-34)		GGGATCCTTTGAGGGAACAAG	0.433																																						dbGAP											1	Substitution - Missense(1)	breast(1)											112.0	105.0	108.0					5																	80600664		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC014841	CCDS4054.1	5q14.1	2013-01-09			ENSG00000131732	ENSG00000131732		"""Zinc fingers, CCHC domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25424	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 41"""					12477932	Standard	NM_032280		Approved	DKFZp761J139, PPP1R41	uc003khi.3	Q8N567	OTTHUMG00000119014	ENST00000254037.2:c.88G>C	5.37:g.80600664G>C	ENSP00000254037:p.Glu30Gln		B2RAE7|Q9H027	Missense_Mutation	SNP	pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_CCHC,pfscan_Znf_CCHC	p.E30Q	ENST00000254037.2	37	c.88	CCDS4054.1	5	.	.	.	.	.	.	.	.	.	.	G	13.53	2.265971	0.40095	.	.	ENSG00000131732	ENST00000254037;ENST00000407610;ENST00000380199;ENST00000438268	T;T;T;T	0.45668	0.89;0.89;0.89;0.89	5.33	3.47	0.39725	.	0.413394	0.25651	N	0.029201	T	0.37517	0.1006	L	0.47716	1.5	0.24756	N	0.992954	B	0.13594	0.008	B	0.08055	0.003	T	0.21415	-1.0246	10	0.38643	T	0.18	-11.9067	15.2156	0.73264	0.0:0.2527:0.7473:0.0	.	30	Q8N567	ZCHC9_HUMAN	Q	30	ENSP00000254037:E30Q;ENSP00000385047:E30Q;ENSP00000369546:E30Q;ENSP00000412637:E30Q	ENSP00000254037:E30Q	E	+	1	0	ZCCHC9	80636420	0.697000	0.27767	0.151000	0.22473	0.877000	0.50540	0.682000	0.25335	0.552000	0.29026	0.655000	0.94253	GAG	ZCCHC9	-	NULL	ENSG00000131732		0.433	ZCCHC9-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZCCHC9	HGNC	protein_coding	OTTHUMT00000239213.1	90	0.00	0	G	NM_032280		80600664	80600664	+1	no_errors	ENST00000254037	ensembl	human	known	69_37n	missense	46	19.30	11	SNP	0.956	C
ZFHX2	85446	genome.wustl.edu	37	14	24003176	24003176	+	Silent	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr14:24003176G>C	ENST00000419474.3	-	2	1714	c.1359C>G	c.(1357-1359)ctC>ctG	p.L453L	RP11-66N24.4_ENST00000556354.1_RNA|RP11-66N24.4_ENST00000553985.1_RNA|RP11-66N24.4_ENST00000554403.1_RNA	NM_033400.2	NP_207646.2	Q9C0A1	ZFHX2_HUMAN	zinc finger homeobox 2	453					adult behavior (GO:0030534)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.L453L(1)		NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	5						TGGGACACTTGAGTGTCTTGC	0.582																																						dbGAP											1	Substitution - coding silent(1)	breast(1)																																								-	-	-	SO:0001819	synonymous_variant	0			AB051549	CCDS55907.1	14q11.2	2012-03-09			ENSG00000136367	ENSG00000136367		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	20152	protein-coding gene	gene with protein product			"""zinc finger protein 409"""	ZNF409		11214970, 10470851	Standard	NM_033400		Approved	KIAA1762, KIAA1056, ZFH-5	uc010tno.2	Q9C0A1	OTTHUMG00000156894	ENST00000419474.3:c.1359C>G	14.37:g.24003176G>C			Q9UPU6	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.L453	ENST00000419474.3	37	c.1359	CCDS55907.1	14																																																																																			ZFHX2	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000136367		0.582	ZFHX2-001	KNOWN	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	ZFHX2	HGNC	protein_coding	OTTHUMT00000346484.3	16	0.00	0	G	NM_014894		24003176	24003176	-1	no_errors	ENST00000419474	ensembl	human	known	69_37n	silent	13	27.78	5	SNP	1.000	C
ZKSCAN2	342357	genome.wustl.edu	37	16	25251806	25251806	+	Silent	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr16:25251806C>T	ENST00000328086.7	-	7	3038	c.2235G>A	c.(2233-2235)aaG>aaA	p.K745K	CTD-2547G23.2_ENST00000569456.1_RNA	NM_001012981.4	NP_001012999.3	Q63HK3	ZKSC2_HUMAN	zinc finger with KRAB and SCAN domains 2	745					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(15)|ovary(3)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	36				GBM - Glioblastoma multiforme(48;0.0378)		TGTAGGGTCTCTTCCCCACAA	0.483																																						dbGAP											0													88.0	81.0	83.0					16																	25251806		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AK026852	CCDS32410.1	16p12.1	2013-01-09	2007-02-20	2007-02-20		ENSG00000155592		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	25677	protein-coding gene	gene with protein product			"""zinc finger protein 694"""	ZNF694			Standard	NM_001012981		Approved	FLJ23199, ZSCAN34	uc002dod.4	Q63HK3		ENST00000328086.7:c.2235G>A	16.37:g.25251806C>T			A1L3B4|Q6ZN77	Silent	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.K745	ENST00000328086.7	37	c.2235	CCDS32410.1	16																																																																																			ZKSCAN2	-	NULL	ENSG00000155592		0.483	ZKSCAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZKSCAN2	HGNC	protein_coding	OTTHUMT00000435739.1	118	0.84	1	C	NM_001012981		25251806	25251806	-1	no_errors	ENST00000328086	ensembl	human	known	69_37n	silent	68	21.84	19	SNP	0.988	T
ZNF131	7690	genome.wustl.edu	37	5	43161888	43161888	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr5:43161888G>C	ENST00000399534.1	+	5	953	c.909G>C	c.(907-909)tgG>tgC	p.W303C	ZNF131_ENST00000505606.2_Missense_Mutation_p.W269C|ZNF131_ENST00000509156.1_Missense_Mutation_p.W303C|ZNF131_ENST00000509931.1_Intron|ZNF131_ENST00000509634.1_Missense_Mutation_p.W269C|ZNF131_ENST00000306938.4_Missense_Mutation_p.W269C			P52739	ZN131_HUMAN	zinc finger protein 131	303					regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.W269C(1)		breast(2)|endometrium(2)|kidney(1)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	17						AGAGCGCATGGAAACAGCACC	0.373																																						dbGAP											1	Substitution - Missense(1)	breast(1)											81.0	73.0	76.0					5																	43161888		1888	4109	5997	-	-	-	SO:0001583	missense	0			U09410	CCDS43313.1	5p12	2013-01-09	2006-06-13		ENSG00000172262	ENSG00000172262		"""Zinc fingers, C2H2-type"", ""-"", ""BTB/POZ domain containing"""	12915	protein-coding gene	gene with protein product	"""zinc finger and BTB domain containing 35"""	604073	"""zinc finger protein 131 (clone pHZ-10)"""				Standard	XM_005248359		Approved	ZBTB35, pHZ-10	uc003jnk.3	P52739	OTTHUMG00000162223	ENST00000399534.1:c.909G>C	5.37:g.43161888G>C	ENSP00000382450:p.Trp303Cys		B4DRL3|Q6PIF0	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.W303C	ENST00000399534.1	37	c.909		5	.	.	.	.	.	.	.	.	.	.	G	15.46	2.841176	0.51057	.	.	ENSG00000172262	ENST00000509156;ENST00000306938;ENST00000399534;ENST00000505606;ENST00000509634	T;T;T;T;T	0.22539	1.95;1.95;1.95;1.95;1.95	5.42	5.42	0.78866	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.070556	0.56097	D	0.000036	T	0.23289	0.0563	N	0.11818	0.18	0.58432	D	0.999998	D;D	0.69078	0.997;0.99	P;P	0.60173	0.87;0.799	T	0.04723	-1.0931	9	.	.	.	-5.0034	13.5072	0.61491	0.0748:0.0:0.9252:0.0	.	303;269	P52739;P52739-2	ZN131_HUMAN;.	C	303;269;303;269;269	ENSP00000426504:W303C;ENSP00000305804:W269C;ENSP00000382450:W303C;ENSP00000423945:W269C;ENSP00000421246:W269C	.	W	+	3	0	ZNF131	43197645	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.526000	0.53509	2.545000	0.85829	0.650000	0.86243	TGG	ZNF131	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000172262		0.373	ZNF131-201	KNOWN	basic|appris_principal	protein_coding	ZNF131	HGNC	protein_coding	OTTHUMT00000367982.1	72	0.00	0	G	NM_003432		43161888	43161888	+1	no_errors	ENST00000399534	ensembl	human	known	69_37n	missense	47	20.34	12	SNP	1.000	C
ZNF197	10168	genome.wustl.edu	37	3	44685697	44685697	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr3:44685697G>C	ENST00000396058.1	+	5	3242	c.3075G>C	c.(3073-3075)gaG>gaC	p.E1025D	ZNF197_ENST00000383744.4_Intron|RP11-944L7.4_ENST00000457331.1_RNA|ZNF197_ENST00000344387.4_Missense_Mutation_p.E1025D|ZNF197_ENST00000383745.2_Intron			O14709	ZN197_HUMAN	zinc finger protein 197	1025					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E1025D(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(1)	25				KIRC - Kidney renal clear cell carcinoma(197;0.0478)|Kidney(197;0.0598)		CCAAGATTGAGATTCAGAAAA	0.333																																						dbGAP											1	Substitution - Missense(1)	breast(1)											40.0	42.0	41.0					3																	44685697		2154	4285	6439	-	-	-	SO:0001583	missense	0			AF011573	CCDS2717.1, CCDS33743.1	3p21	2013-01-09	2003-10-07		ENSG00000186448	ENSG00000186448		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12988	protein-coding gene	gene with protein product			"""zinc finger protein 166"""	ZNF166		9380504, 8353497	Standard	XM_005264783		Approved	P18, D3S1363E, ZKSCAN9, ZSCAN41	uc003cnm.3	O14709	OTTHUMG00000133089	ENST00000396058.1:c.3075G>C	3.37:g.44685697G>C	ENSP00000379370:p.Glu1025Asp		B2RAH8|Q86VG0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.E1025D	ENST00000396058.1	37	c.3075	CCDS2717.1	3	.	.	.	.	.	.	.	.	.	.	G	5.361	0.251861	0.10185	.	.	ENSG00000186448	ENST00000344387;ENST00000396058	T;T	0.06142	3.34;3.34	3.61	2.72	0.32119	.	.	.	.	.	T	0.04543	0.0124	N	0.14661	0.345	0.23762	N	0.996912	B	0.24483	0.104	B	0.18561	0.022	T	0.38373	-0.9664	9	0.44086	T	0.13	.	11.208	0.48782	0.0:0.188:0.812:0.0	.	1025	O14709	ZN197_HUMAN	D	1025	ENSP00000345809:E1025D;ENSP00000379370:E1025D	ENSP00000345809:E1025D	E	+	3	2	ZNF197	44660701	0.019000	0.18553	0.927000	0.36925	0.213000	0.24496	0.167000	0.16602	1.071000	0.40834	0.557000	0.71058	GAG	ZNF197	-	NULL	ENSG00000186448		0.333	ZNF197-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF197	HGNC	protein_coding	OTTHUMT00000256747.4	86	0.00	0	G	NM_006991		44685697	44685697	+1	no_errors	ENST00000344387	ensembl	human	known	69_37n	missense	63	26.74	23	SNP	0.985	C
ZNF22	7570	genome.wustl.edu	37	10	45499194	45499194	+	Silent	SNP	C	C	T			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr10:45499194C>T	ENST00000298299.3	+	2	971	c.378C>T	c.(376-378)ctC>ctT	p.L126L	C10orf25_ENST00000298298.1_5'Flank|CEP164P1_ENST00000456938.2_RNA	NM_006963.4	NP_008894.2	P17026	ZNF22_HUMAN	zinc finger protein 22	126					odontogenesis (GO:0042476)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.L126L(1)		NS(1)|breast(2)|endometrium(1)|kidney(2)|lung(2)	8		Prostate(175;0.0352)|all_neural(218;0.202)				GCTCAAATCTCATTCAGCACC	0.453																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											77.0	77.0	77.0					10																	45499194		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC041139	CCDS7211.1	10q11	2013-01-08	2012-07-12		ENSG00000165512	ENSG00000165512		"""Zinc fingers, C2H2-type"""	13012	protein-coding gene	gene with protein product		194529					Standard	NM_006963		Approved	KOX15, HKR-T1, ZNF422, Zfp422	uc001jbw.3	P17026	OTTHUMG00000018064	ENST00000298299.3:c.378C>T	10.37:g.45499194C>T			Q5T741|Q96FM4	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L126	ENST00000298299.3	37	c.378	CCDS7211.1	10																																																																																			ZNF22	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000165512		0.453	ZNF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF22	HGNC	protein_coding	OTTHUMT00000047761.1	94	0.00	0	C	NM_006963		45499194	45499194	+1	no_errors	ENST00000298299	ensembl	human	known	69_37n	silent	92	13.21	14	SNP	0.961	T
ZNF254	9534	genome.wustl.edu	37	19	24309129	24309129	+	Silent	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr19:24309129G>A	ENST00000357002.4	+	4	442	c.327G>A	c.(325-327)ctG>ctA	p.L109L	ZNF254_ENST00000342944.6_Silent_p.L24L	NM_001278661.1|NM_001278662.1|NM_001278664.1|NM_001278677.1|NM_001278678.1|NM_203282.2	NP_001265590.1|NP_001265591.1|NP_001265593.1|NP_001265606.1|NP_001265607.1|NP_975011.3	O75437	ZN254_HUMAN	zinc finger protein 254	109					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L109L(1)					all_cancers(12;0.086)|all_lung(12;0.00528)|Lung NSC(12;0.00731)|all_epithelial(12;0.0186)				AAGCAATACTGAGAAGATATG	0.328																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											53.0	57.0	55.0					19																	24309129		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			AF054180	CCDS32983.1, CCDS62622.1, CCDS62623.1, CCDS74323.1, CCDS74324.1	19p13	2013-01-08				ENSG00000213096		"""Zinc fingers, C2H2-type"", ""-"""	13047	protein-coding gene	gene with protein product		604768	"""zinc finger protein 539"""	ZNF91L, ZNF539		9653160	Standard	NM_001278661		Approved	HD-ZNF1, BMZF-5	uc002nru.3	O75437		ENST00000357002.4:c.327G>A	19.37:g.24309129G>A			A4QPC0|Q86XL7	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L109	ENST00000357002.4	37	c.327	CCDS32983.1	19																																																																																			ZNF254	-	NULL	ENSG00000213096		0.328	ZNF254-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF254	HGNC	protein_coding	OTTHUMT00000466453.1	175	0.00	0	G	NM_004876		24309129	24309129	+1	no_errors	ENST00000357002	ensembl	human	known	69_37n	silent	171	16.59	34	SNP	0.002	A
ZNF224	7767	genome.wustl.edu	37	19	44611829	44611829	+	Missense_Mutation	SNP	C	C	G	rs3746323	byFrequency	TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr19:44611829C>G	ENST00000336976.6	+	6	1770	c.1516C>G	c.(1516-1518)Cac>Gac	p.H506D	AC084219.4_ENST00000592946.1_RNA	NM_013398.2	NP_037530.2	Q9NZL3	ZN224_HUMAN	zinc finger protein 224	506			H -> D (in dbSNP:rs3746323).		negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nuclear membrane (GO:0031965)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(2)|ovary(2)|prostate(1)|stomach(2)|urinary_tract(1)	19		Prostate(69;0.0435)				TCAGAGAGTTCACACTGGAGA	0.418													C|||	3	0.000599042	0.0	0.0	5008	,	,		21645	0.003		0.0	False		,,,				2504	0.0					dbGAP											0													78.0	80.0	80.0					19																	44611829		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF187990	CCDS33046.1	19q13.2	2013-01-08	2004-02-13			ENSG00000267680		"""Zinc fingers, C2H2-type"", ""-"""	13017	protein-coding gene	gene with protein product		194555	"""zinc finger protein 255"", ""zinc finger protein 27"""	ZNF255, ZNF27			Standard	NM_013398		Approved	BMZF-2, KOX22	uc002oyh.2	Q9NZL3		ENST00000336976.6:c.1516C>G	19.37:g.44611829C>G	ENSP00000337368:p.His506Asp		A6NFW9|P17033|Q86V10|Q8IZC8|Q9UID9|Q9Y2P6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H506D	ENST00000336976.6	37	c.1516	CCDS33046.1	19	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	c	22.4	4.284340	0.80803	.	.	ENSG00000186019	ENST00000336976	T	0.67698	-0.28	3.26	3.26	0.37387	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.87229	0.6125	H	0.97491	4.015	0.32578	N	0.528916	D	0.69078	0.997	D	0.72075	0.976	D	0.91479	0.5203	9	0.87932	D	0	.	13.7722	0.63034	0.0:1.0:0.0:0.0	rs3746323;rs52834933;rs3746323	506	Q9NZL3	ZN224_HUMAN	D	506	ENSP00000337368:H506D	ENSP00000337368:H506D	H	+	1	0	ZNF224	49303669	0.883000	0.30277	0.086000	0.20670	0.891000	0.51852	2.209000	0.42806	1.823000	0.53134	0.591000	0.81541	CAC	ZNF224	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000267680		0.418	ZNF224-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF224	HGNC	protein_coding	OTTHUMT00000460477.1	111	0.00	0	C	NM_013398		44611829	44611829	+1	no_errors	ENST00000336976	ensembl	human	known	69_37n	missense	168	12.50	24	SNP	0.993	G
ZNF304	57343	genome.wustl.edu	37	19	57868151	57868151	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr19:57868151G>C	ENST00000282286.5	+	3	1087	c.914G>C	c.(913-915)aGa>aCa	p.R305T	ZNF304_ENST00000443917.2_Missense_Mutation_p.R352T|ZNF304_ENST00000598744.1_Missense_Mutation_p.R263T|ZNF304_ENST00000391705.3_Missense_Mutation_p.R305T			Q9HCX3	ZN304_HUMAN	zinc finger protein 304	305					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R305T(1)|p.R305I(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)	26		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)		ACTGGAAAAAGACACTATACA	0.438																																						dbGAP											2	Substitution - Missense(2)	large_intestine(1)|breast(1)											84.0	80.0	81.0					19																	57868151		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ276316	CCDS12950.1, CCDS74462.1	19q13.4	2013-01-08				ENSG00000131845		"""Zinc fingers, C2H2-type"", ""-"""	13505	protein-coding gene	gene with protein product		613840					Standard	XM_005259090		Approved		uc010ygw.2	Q9HCX3		ENST00000282286.5:c.914G>C	19.37:g.57868151G>C	ENSP00000282286:p.Arg305Thr			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R352T	ENST00000282286.5	37	c.1055	CCDS12950.1	19	.	.	.	.	.	.	.	.	.	.	g	11.33	1.606576	0.28623	.	.	ENSG00000131845	ENST00000282286;ENST00000391705;ENST00000443917	T;T;T	0.14640	2.49;2.49;2.49	3.92	-1.01	0.10169	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.30978	0.0782	M	0.78285	2.405	0.09310	N	1	D;D	0.76494	0.999;0.999	D;D	0.78314	0.922;0.991	T	0.10019	-1.0648	9	0.87932	D	0	.	5.0485	0.14496	0.2667:0.2895:0.4438:0.0	.	305;352	Q9HCX3;E7EQD3	ZN304_HUMAN;.	T	305;305;352	ENSP00000282286:R305T;ENSP00000375586:R305T;ENSP00000401642:R352T	ENSP00000282286:R305T	R	+	2	0	ZNF304	62559963	0.000000	0.05858	0.000000	0.03702	0.371000	0.29859	0.264000	0.18497	-0.041000	0.13558	0.580000	0.79431	AGA	ZNF304	-	pfscan_Znf_C2H2	ENSG00000131845		0.438	ZNF304-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF304	HGNC	protein_coding	OTTHUMT00000465785.1	131	0.00	0	G			57868151	57868151	+1	no_errors	ENST00000443917	ensembl	human	known	69_37n	missense	106	23.19	32	SNP	0.004	C
ZNF462	58499	genome.wustl.edu	37	9	109687510	109687510	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr9:109687510C>G	ENST00000277225.5	+	3	1606	c.1317C>G	c.(1315-1317)ttC>ttG	p.F439L	ZNF462_ENST00000441147.2_5'Flank|ZNF462_ENST00000457913.1_Missense_Mutation_p.F439L			Q96JM2	ZN462_HUMAN	zinc finger protein 462	439					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.F439L(1)		NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						TGAATAGGTTCCAGTGCCCCT	0.463																																						dbGAP											1	Substitution - Missense(1)	breast(1)											141.0	137.0	139.0					9																	109687510		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.1317C>G	9.37:g.109687510C>G	ENSP00000277225:p.Phe439Leu		Q5T0T4|Q8N408	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.F439L	ENST00000277225.5	37	c.1317	CCDS35096.1	9	.	.	.	.	.	.	.	.	.	.	C	14.25	2.478090	0.44044	.	.	ENSG00000148143	ENST00000277225;ENST00000457913	T;T	0.11385	2.78;3.38	5.73	4.84	0.62591	Zinc finger, C2H2-like (1);	0.046557	0.85682	D	0.000000	T	0.08492	0.0211	N	0.19112	0.55	0.80722	D	1	B;B	0.31910	0.346;0.271	B;B	0.35470	0.128;0.203	T	0.37842	-0.9688	9	.	.	.	.	13.0332	0.58854	0.0:0.9256:0.0:0.0744	.	439;439	Q96JM2-3;Q96JM2	.;ZN462_HUMAN	L	439	ENSP00000277225:F439L;ENSP00000414570:F439L	.	F	+	3	2	ZNF462	108727331	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.900000	0.39828	1.434000	0.47414	0.561000	0.74099	TTC	ZNF462	-	smart_Znf_C2H2-like	ENSG00000148143		0.463	ZNF462-001	KNOWN	basic|CCDS	protein_coding	ZNF462	HGNC	protein_coding	OTTHUMT00000053532.2	133	0.00	0	C	NM_021224		109687510	109687510	+1	no_errors	ENST00000457913	ensembl	human	known	69_37n	missense	70	17.44	15	SNP	1.000	G
ZNF608	57507	genome.wustl.edu	37	5	124080411	124080411	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr5:124080411G>A	ENST00000306315.5	-	1	707	c.272C>T	c.(271-273)tCt>tTt	p.S91F	ZNF608_ENST00000504926.1_5'Flank	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	91							metal ion binding (GO:0046872)	p.S91F(1)		breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		CTGGGGAGCAGAGGCCTGAAC	0.498																																						dbGAP											1	Substitution - Missense(1)	breast(1)											86.0	81.0	83.0					5																	124080411		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.272C>T	5.37:g.124080411G>A	ENSP00000307746:p.Ser91Phe		A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	Missense_Mutation	SNP	NULL	p.S91F	ENST00000306315.5	37	c.272	CCDS34219.1	5	.	.	.	.	.	.	.	.	.	.	G	16.48	3.134983	0.56828	.	.	ENSG00000168916	ENST00000306315;ENST00000509799;ENST00000513986	T	0.54279	0.58	5.44	5.44	0.79542	.	0.000000	0.64402	D	0.000011	T	0.62502	0.2433	L	0.59436	1.845	0.45129	D	0.998141	P	0.52692	0.955	P	0.51135	0.66	T	0.63808	-0.6553	10	0.54805	T	0.06	-13.3114	19.2512	0.93926	0.0:0.0:1.0:0.0	.	91	Q9ULD9	ZN608_HUMAN	F	91	ENSP00000307746:S91F	ENSP00000307746:S91F	S	-	2	0	ZNF608	124108310	1.000000	0.71417	0.993000	0.49108	0.947000	0.59692	2.799000	0.47892	2.719000	0.93026	0.655000	0.94253	TCT	ZNF608	-	NULL	ENSG00000168916		0.498	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF608	HGNC	protein_coding	OTTHUMT00000371300.1	245	0.00	0	G	XM_114432		124080411	124080411	-1	no_errors	ENST00000306315	ensembl	human	known	69_37n	missense	171	19.34	41	SNP	1.000	A
ZNF677	342926	genome.wustl.edu	37	19	53740966	53740966	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr19:53740966C>G	ENST00000598513.1	-	5	1164	c.1014G>C	c.(1012-1014)caG>caC	p.Q338H	CTD-2245F17.6_ENST00000596041.1_RNA|ZNF677_ENST00000333952.4_Missense_Mutation_p.Q338H	NM_182609.2	NP_872415.1	Q86XU0	ZN677_HUMAN	zinc finger protein 677	338					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q338H(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(13)|lung(6)|ovary(1)|pancreas(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(134;0.00352)		TATGCATCCTCTGATGACTTG	0.403																																						dbGAP											1	Substitution - Missense(1)	breast(1)											94.0	87.0	90.0					19																	53740966		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC050038	CCDS12861.1	19q13.42	2013-01-08				ENSG00000197928		"""Zinc fingers, C2H2-type"", ""-"""	28730	protein-coding gene	gene with protein product	"""hypothetical protein MGC48625"""					12477932	Standard	NM_182609		Approved	MGC48625	uc002qbg.1	Q86XU0		ENST00000598513.1:c.1014G>C	19.37:g.53740966C>G	ENSP00000469391:p.Gln338His			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q338H	ENST00000598513.1	37	c.1014	CCDS12861.1	19	.	.	.	.	.	.	.	.	.	.	C	7.641	0.680906	0.14907	.	.	ENSG00000197928	ENST00000333952	T	0.18502	2.21	2.21	0.0732	0.14389	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	1.154450	0.06847	N	0.796755	T	0.23451	0.0567	L	0.58101	1.795	0.09310	N	1	D	0.58620	0.983	P	0.49451	0.611	T	0.24048	-1.0171	10	0.59425	D	0.04	.	6.0591	0.19828	0.0:0.7099:0.0:0.2901	.	338	Q86XU0	ZN677_HUMAN	H	338	ENSP00000334394:Q338H	ENSP00000334394:Q338H	Q	-	3	2	ZNF677	58432778	0.004000	0.15560	0.281000	0.24762	0.576000	0.36127	0.075000	0.14686	0.083000	0.17047	0.655000	0.94253	CAG	ZNF677	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197928		0.403	ZNF677-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF677	HGNC	protein_coding	OTTHUMT00000464189.1	206	0.00	0	C	NM_182609		53740966	53740966	-1	no_errors	ENST00000333952	ensembl	human	known	69_37n	missense	172	17.31	36	SNP	0.298	G
ZNF692	55657	genome.wustl.edu	37	1	249151646	249151646	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr1:249151646G>A	ENST00000306601.4	-	4	428	c.262C>T	c.(262-264)Cat>Tat	p.H88Y	ZNF692_ENST00000451251.1_Missense_Mutation_p.H93Y|ZNF692_ENST00000366471.3_Missense_Mutation_p.H88Y|ZNF692_ENST00000366469.5_Missense_Mutation_p.H88Y|ZNF692_ENST00000468455.1_5'UTR|AL672294.1_ENST00000417047.1_RNA|ZNF692_ENST00000427146.1_Missense_Mutation_p.H88Y	NM_017865.3	NP_060335.2	Q9BU19	ZN692_HUMAN	zinc finger protein 692	88					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(6)|lung(7)|stomach(1)	17	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	OV - Ovarian serous cystadenocarcinoma(106;0.00805)			CTGTGGGCATGAGACAAGAGC	0.627																																						dbGAP											0													42.0	48.0	46.0					1																	249151646		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC002948	CCDS31127.1, CCDS44348.1, CCDS53487.1	1q44	2013-01-08			ENSG00000171163	ENSG00000171163		"""Zinc fingers, C2H2-type"""	26049	protein-coding gene	gene with protein product						12477932	Standard	NM_001136036		Approved	FLJ20531, Zfp692	uc001ifc.2	Q9BU19	OTTHUMG00000040423	ENST00000306601.4:c.262C>T	1.37:g.249151646G>A	ENSP00000305483:p.His88Tyr		B4DXZ0|Q5SRA5|Q5SRA6|Q9HBC9|Q9NW93|Q9NWY6|Q9UF97	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H93Y	ENST00000306601.4	37	c.277	CCDS31127.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.43|17.43	3.388449|3.388449	0.61956|0.61956	.|.	.|.	ENSG00000171163|ENSG00000171163	ENST00000306601;ENST00000427146;ENST00000366471;ENST00000366469;ENST00000451251;ENST00000496231|ENST00000366470	T;T;T;T;T|.	0.26810|.	1.98;1.71;1.71;1.96;1.95|.	4.12|4.12	4.12|4.12	0.48240|0.48240	.|.	0.000000|.	0.64402|.	D|.	0.000009|.	T|T	0.67543|0.67543	0.2904|0.2904	M|M	0.69823|0.69823	2.125|2.125	0.35190|0.35190	D|D	0.773314|0.773314	D;D;D|.	0.61697|.	0.982;0.99;0.982|.	P;D;P|.	0.65573|.	0.865;0.936;0.865|.	T|T	0.75883|0.75883	-0.3160|-0.3160	10|6	0.87932|0.51188	D|T	0|0.08	-20.5306|-20.5306	12.1676|12.1676	0.54139|0.54139	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	93;88;88|.	B4DXZ0;Q9BU19-2;Q9BU19|.	.;.;ZN692_HUMAN|.	Y|S	88;88;88;88;93;88|88	ENSP00000305483:H88Y;ENSP00000390044:H88Y;ENSP00000355427:H88Y;ENSP00000355425:H88Y;ENSP00000391200:H93Y|.	ENSP00000305483:H88Y|ENSP00000355426:P88S	H|P	-|-	1|1	0|0	ZNF692|ZNF692	247118269|247118269	0.968000|0.968000	0.33430|0.33430	0.346000|0.346000	0.25655|0.25655	0.599000|0.599000	0.36880|0.36880	3.249000|3.249000	0.51437|0.51437	2.582000|2.582000	0.87167|0.87167	0.637000|0.637000	0.83480|0.83480	CAT|CCA	ZNF692	-	NULL	ENSG00000171163		0.627	ZNF692-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF692	HGNC	protein_coding	OTTHUMT00000097298.1	26	0.00	0	G	NM_017865		249151646	249151646	-1	no_errors	ENST00000451251	ensembl	human	known	69_37n	missense	36	18.18	8	SNP	0.284	A
ZNF700	90592	genome.wustl.edu	37	19	12059255	12059255	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AN-A0XW-01A-11D-A10G-09	TCGA-AN-A0XW-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	200dba9e-201b-4634-a2cf-666e1f6710dc	42b25d03-4d22-4b23-82a5-4369aa21c4a1	g.chr19:12059255C>G	ENST00000254321.5	+	4	559	c.416C>G	c.(415-417)tCa>tGa	p.S139*	ZNF763_ENST00000590798.1_Intron|ZNF700_ENST00000482090.1_Nonsense_Mutation_p.S121*|ZNF763_ENST00000591944.1_Intron|ZNF763_ENST00000538752.1_Intron|CTD-2006C1.12_ENST00000586394.1_RNA	NM_001271848.1|NM_144566.1	NP_001258777.1|NP_653167.1	Q9H0M5	ZN700_HUMAN	zinc finger protein 700	139					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S139*(1)	ZNF700/MAST1_ENST00000251472(2)	breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(13)|pancreas(1)|prostate(1)|urinary_tract(1)	33						ATAGGTAACTCATCTTTTAAT	0.408																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											185.0	181.0	182.0					19																	12059255		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AL136732	CCDS32915.1, CCDS74289.1	19p13.2	2013-01-08			ENSG00000196757	ENSG00000196757		"""Zinc fingers, C2H2-type"", ""-"""	25292	protein-coding gene	gene with protein product							Standard	NM_144566		Approved	DKFZp434I1610	uc031rjk.1	Q9H0M5	OTTHUMG00000156421	ENST00000254321.5:c.416C>G	19.37:g.12059255C>G	ENSP00000254321:p.Ser139*		B9EGU4	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S139*	ENST00000254321.5	37	c.416	CCDS32915.1	19	.	.	.	.	.	.	.	.	.	.	c	16.54	3.153227	0.57259	.	.	ENSG00000196757	ENST00000254321	.	.	.	0.672	0.672	0.17935	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	7.1436	0.25570	0.0:0.9999:0.0:1.0E-4	.	.	.	.	X	139	.	ENSP00000254321:S139X	S	+	2	0	ZNF700	11920255	0.000000	0.05858	0.018000	0.16275	0.220000	0.24768	0.669000	0.25142	0.623000	0.30267	0.305000	0.20034	TCA	ZNF700	-	NULL	ENSG00000196757		0.408	ZNF700-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF700	HGNC	protein_coding	OTTHUMT00000344126.2	182	0.00	0	C	NM_144566		12059255	12059255	+1	no_errors	ENST00000254321	ensembl	human	known	69_37n	nonsense	239	12.45	34	SNP	0.028	G
