#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADH1A	124	genome.wustl.edu	37	4	100205585	100205585	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A0J8-01A-21D-A045-09	TCGA-AO-A0J8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24ba5501-8097-4af6-b12c-bb6dcbe10cac	a6efdded-0dee-4407-a1b2-bdfdb1649a07	g.chr4:100205585C>G	ENST00000209668.2	-	5	651	c.538G>C	c.(538-540)Ggt>Cgt	p.G180R	ADH1A_ENST00000511656.1_5'Flank|RP11-696N14.1_ENST00000500358.2_RNA	NM_000667.3	NP_000658.1	P07327	ADH1A_HUMAN	alcohol dehydrogenase 1A (class I), alpha polypeptide	180					alcohol metabolic process (GO:0006066)|drug metabolic process (GO:0017144)|ethanol oxidation (GO:0006069)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(1)	25				OV - Ovarian serous cystadenocarcinoma(123;9.56e-08)	Ethanol(DB00898)|Fomepizole(DB01213)	GACCCATAACCAGTTGAAAAT	0.458																																						dbGAP											0													99.0	95.0	97.0					4																	100205585		2203	4300	6503	-	-	-	SO:0001583	missense	0			M12963	CCDS3648.1	4q23	2009-12-04			ENSG00000187758	ENSG00000187758	1.1.1.1	"""Alcohol dehydrogenases"""	249	protein-coding gene	gene with protein product		103700		ADH1		3006456	Standard	NM_000667		Approved		uc003hur.2	P07327	OTTHUMG00000131026	ENST00000209668.2:c.538G>C	4.37:g.100205585C>G	ENSP00000209668:p.Gly180Arg		A8K3E3|Q17R68	Missense_Mutation	SNP	pfam_ADH_GroES-like,pfam_ADH_C,superfamily_GroES-like,smart_PKS_ER	p.G180R	ENST00000209668.2	37	c.538	CCDS3648.1	4	.	.	.	.	.	.	.	.	.	.	C	18.90	3.721726	0.68959	.	.	ENSG00000187758	ENST00000209668	T	0.30448	1.53	2.59	2.59	0.31030	GroES-like (1);	0.000000	0.85682	D	0.000000	T	0.73321	0.3572	H	0.99855	4.85	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85774	0.1357	10	0.87932	D	0	-20.2101	13.5501	0.61728	0.0:1.0:0.0:0.0	.	180	P07327	ADH1A_HUMAN	R	180	ENSP00000209668:G180R	ENSP00000209668:G180R	G	-	1	0	ADH1A	100424608	1.000000	0.71417	0.999000	0.59377	0.878000	0.50629	6.853000	0.75435	1.430000	0.47334	0.460000	0.39030	GGT	ADH1A	-	superfamily_GroES-like,smart_PKS_ER	ENSG00000187758		0.458	ADH1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADH1A	HGNC	protein_coding	OTTHUMT00000253669.1	224	0.00	0	C	NM_000667		100205585	100205585	-1	no_errors	ENST00000209668	ensembl	human	known	69_37n	missense	120	32.96	59	SNP	1.000	G
ATP6V0A2	23545	genome.wustl.edu	37	12	124229203	124229203	+	Silent	SNP	G	G	A			TCGA-AO-A0J8-01A-21D-A045-09	TCGA-AO-A0J8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24ba5501-8097-4af6-b12c-bb6dcbe10cac	a6efdded-0dee-4407-a1b2-bdfdb1649a07	g.chr12:124229203G>A	ENST00000330342.3	+	12	1634	c.1386G>A	c.(1384-1386)gtG>gtA	p.V462V		NM_012463.3	NP_036595.2	Q9Y487	VPP2_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a2	462					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|immune response (GO:0006955)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	hydrogen ion transmembrane transporter activity (GO:0015078)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(10)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	26	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.000625)|all cancers(50;0.00775)		TGTTCTCAGTGTACACTGGCC	0.542																																						dbGAP											0													137.0	121.0	127.0					12																	124229203		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF112972	CCDS9254.1	12q24.31	2010-04-21	2006-01-20		ENSG00000185344	ENSG00000185344		"""ATPases / V-type"""	18481	protein-coding gene	gene with protein product	"""infantile malignant osteopetrosis"""	611716	"""infantile malignant osteopetrosis"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 2"", ""ATPase, H+ transporting, lysosomal V0 subunit A2"""			2247090, 18157129	Standard	NM_012463		Approved	TJ6, a2, TJ6s, TJ6M, ATP6a2, J6B7, ATP6N1D, Vph1, Stv1	uc001ufr.3	Q9Y487	OTTHUMG00000168723	ENST00000330342.3:c.1386G>A	12.37:g.124229203G>A			A8K026|Q6NUM0	Silent	SNP	pfam_ATPase_V0/A0_a	p.V462	ENST00000330342.3	37	c.1386	CCDS9254.1	12																																																																																			ATP6V0A2	-	pfam_ATPase_V0/A0_a	ENSG00000185344		0.542	ATP6V0A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V0A2	HGNC	protein_coding	OTTHUMT00000400765.2	80	0.00	0	G	NM_012463		124229203	124229203	+1	no_errors	ENST00000330342	ensembl	human	known	69_37n	silent	118	31.40	54	SNP	0.999	A
CDH1	999	genome.wustl.edu	37	16	68857485	68857485	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AO-A0J8-01A-21D-A045-09	TCGA-AO-A0J8-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24ba5501-8097-4af6-b12c-bb6dcbe10cac	a6efdded-0dee-4407-a1b2-bdfdb1649a07	g.chr16:68857485delT	ENST00000261769.5	+	13	2311	c.2120delT	c.(2119-2121)attfs	p.I707fs	CDH1_ENST00000562836.1_3'UTR|CDH1_ENST00000422392.2_Frame_Shift_Del_p.I646fs|RP11-354M1.2_ENST00000563916.1_RNA	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	707					adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)			NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		GGATTGCAAATTCCTGCCATT	0.488			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	0													76.0	79.0	78.0					16																	68857485		2198	4300	6498	-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.2120delT	16.37:g.68857485delT	ENSP00000261769:p.Ile707fs		A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Frame_Shift_Del	DEL	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P708fs	ENST00000261769.5	37	c.2120	CCDS10869.1	16																																																																																			CDH1	-	NULL	ENSG00000039068		0.488	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	151	0.00	0	T	NM_004360		68857485	68857485	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	frame_shift_del	32	39.66	23	DEL	0.048	-
DACT1	51339	genome.wustl.edu	37	14	59113588	59113588	+	Silent	SNP	C	C	T			TCGA-AO-A0J8-01A-21D-A045-09	TCGA-AO-A0J8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24ba5501-8097-4af6-b12c-bb6dcbe10cac	a6efdded-0dee-4407-a1b2-bdfdb1649a07	g.chr14:59113588C>T	ENST00000335867.4	+	4	2271	c.2247C>T	c.(2245-2247)taC>taT	p.Y749Y	DACT1_ENST00000556859.1_Silent_p.Y468Y|DACT1_ENST00000541264.2_Silent_p.Y468Y|DACT1_ENST00000395153.3_Silent_p.Y712Y			Q9NYF0	DACT1_HUMAN	dishevelled-binding antagonist of beta-catenin 1	749					dendrite morphogenesis (GO:0048813)|embryonic hindgut morphogenesis (GO:0048619)|gastrulation with mouth forming second (GO:0001702)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of catenin import into nucleus (GO:0035412)|regulation of protein stability (GO:0031647)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|synapse organization (GO:0050808)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|protein kinase A binding (GO:0051018)|protein kinase C binding (GO:0005080)			endometrium(7)|kidney(3)|large_intestine(11)|lung(27)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	53						AGAGCAATTACACCACCAACT	0.612																																						dbGAP											0													110.0	105.0	106.0					14																	59113588		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF251079	CCDS9736.1, CCDS41961.1	14q22.3	2013-05-15	2013-05-15		ENSG00000165617	ENSG00000165617			17748	protein-coding gene	gene with protein product		607861	"""dapper homolog 1, antagonist of beta-catenin (xenopus)"", ""dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis)"""			11970895	Standard	NM_001079520		Approved	DAPPER1, THYEX3, HDPR1, DAPPER, FRODO	uc001xdw.3	Q9NYF0	OTTHUMG00000140324	ENST00000335867.4:c.2247C>T	14.37:g.59113588C>T			A8MYJ2|Q86TY0	Silent	SNP	NULL	p.Y749	ENST00000335867.4	37	c.2247	CCDS9736.1	14																																																																																			DACT1	-	NULL	ENSG00000165617		0.612	DACT1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DACT1	HGNC	protein_coding	OTTHUMT00000325515.1	220	0.00	0	C	NM_016651		59113588	59113588	+1	no_errors	ENST00000335867	ensembl	human	known	69_37n	silent	50	32.43	24	SNP	1.000	T
CLMN	79789	genome.wustl.edu	37	14	95688048	95688048	+	Missense_Mutation	SNP	T	T	C			TCGA-AO-A0J8-01A-21D-A045-09	TCGA-AO-A0J8-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24ba5501-8097-4af6-b12c-bb6dcbe10cac	a6efdded-0dee-4407-a1b2-bdfdb1649a07	g.chr14:95688048T>C	ENST00000298912.4	-	4	417	c.304A>G	c.(304-306)Aag>Gag	p.K102E		NM_024734.3	NP_079010.2	Q96JQ2	CLMN_HUMAN	calmin (calponin-like, transmembrane)	102	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				negative regulation of cell proliferation (GO:0008285)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(17)|prostate(3)|skin(3)	44				Epithelial(152;0.193)		TCCAAAAACTTAAGTGCTTTC	0.398																																						dbGAP											0													125.0	113.0	117.0					14																	95688048		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033014	CCDS9933.1	14q32.13	2012-10-02			ENSG00000165959	ENSG00000165959			19972	protein-coding gene	gene with protein product		611121				11386753	Standard	NM_024734		Approved	FLJ12383, KIAA1188, KIAA0500	uc001yef.2	Q96JQ2	OTTHUMG00000171629	ENST00000298912.4:c.304A>G	14.37:g.95688048T>C	ENSP00000298912:p.Lys102Glu		B2RAR7|Q9H713|Q9HA23|Q9HA57|Q9UFP4|Q9ULN2	Missense_Mutation	SNP	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.K102E	ENST00000298912.4	37	c.304	CCDS9933.1	14	.	.	.	.	.	.	.	.	.	.	T	22.3	4.265732	0.80358	.	.	ENSG00000165959	ENST00000298912;ENST00000555336;ENST00000555615	T;T;T	0.60171	0.21;0.21;0.21	5.19	5.19	0.71726	Calponin homology domain (5);	0.162127	0.29451	N	0.012112	T	0.54143	0.1840	N	0.16708	0.43	0.80722	D	1	D	0.53462	0.96	P	0.52454	0.699	T	0.61549	-0.7040	10	0.72032	D	0.01	.	15.3782	0.74630	0.0:0.0:0.0:1.0	.	102	Q96JQ2	CLMN_HUMAN	E	102;34;34	ENSP00000298912:K102E;ENSP00000451705:K34E;ENSP00000452525:K34E	ENSP00000298912:K102E	K	-	1	0	CLMN	94757801	0.987000	0.35691	0.998000	0.56505	0.987000	0.75469	1.695000	0.37763	2.090000	0.63153	0.459000	0.35465	AAG	CLMN	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000165959		0.398	CLMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLMN	HGNC	protein_coding	OTTHUMT00000414518.2	58	0.00	0	T			95688048	95688048	-1	no_errors	ENST00000298912	ensembl	human	known	69_37n	missense	89	40.00	60	SNP	1.000	C
DOCK11	139818	genome.wustl.edu	37	X	117752580	117752580	+	Silent	SNP	G	G	C			TCGA-AO-A0J8-01A-21D-A045-09	TCGA-AO-A0J8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24ba5501-8097-4af6-b12c-bb6dcbe10cac	a6efdded-0dee-4407-a1b2-bdfdb1649a07	g.chrX:117752580G>C	ENST00000276202.7	+	31	3423	c.3360G>C	c.(3358-3360)ctG>ctC	p.L1120L	DOCK11_ENST00000276204.6_Silent_p.L1120L	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	1120					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						GTCTACTTCTGAGGGAAACTT	0.333																																						dbGAP											0													111.0	95.0	101.0					X																	117752580		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.3360G>C	X.37:g.117752580G>C			A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Silent	SNP	pfam_DOCK,pfam_DUF3398,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.L1120	ENST00000276202.7	37	c.3360	CCDS35373.1	X																																																																																			DOCK11	-	NULL	ENSG00000147251		0.333	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	DOCK11	HGNC	protein_coding	OTTHUMT00000356002.1	222	0.00	0	G	NM_144658		117752580	117752580	+1	no_errors	ENST00000276202	ensembl	human	known	69_37n	silent	172	32.81	84	SNP	1.000	C
FAAH	2166	genome.wustl.edu	37	1	46871162	46871162	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A0J8-01A-21D-A045-09	TCGA-AO-A0J8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24ba5501-8097-4af6-b12c-bb6dcbe10cac	a6efdded-0dee-4407-a1b2-bdfdb1649a07	g.chr1:46871162C>T	ENST00000243167.8	+	4	647	c.563C>T	c.(562-564)cCa>cTa	p.P188L	FAAH_ENST00000493735.1_3'UTR	NM_001441.2	NP_001432.2	O00519	FAAH1_HUMAN	fatty acid amide hydrolase	188					fatty acid catabolic process (GO:0009062)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|organelle membrane (GO:0031090)	acylglycerol lipase activity (GO:0047372)|carbon-nitrogen ligase activity, with glutamine as amido-N-donor (GO:0016884)|fatty acid amide hydrolase activity (GO:0017064)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	22	Acute lymphoblastic leukemia(166;0.155)				Propofol(DB00818)|Thiopental(DB00599)	ACCAATGTTCCACAGTCCATG	0.647																																						dbGAP											0													91.0	90.0	90.0					1																	46871162		2203	4300	6503	-	-	-	SO:0001583	missense	0			U82535	CCDS535.1	1p35-p34	2008-02-05			ENSG00000117480	ENSG00000117480			3553	protein-coding gene	gene with protein product		602935				9122178	Standard	NM_001441		Approved	FAAH-1	uc001cpu.2	O00519	OTTHUMG00000007811	ENST00000243167.8:c.563C>T	1.37:g.46871162C>T	ENSP00000243167:p.Pro188Leu		D3DQ19|Q52M86|Q5TDF8	Missense_Mutation	SNP	pfam_Amidase,superfamily_Amidase_dom,pirsf_Amidase_fun	p.P188L	ENST00000243167.8	37	c.563	CCDS535.1	1	.	.	.	.	.	.	.	.	.	.	C	18.29	3.592385	0.66219	.	.	ENSG00000117480	ENST00000243167	T	0.68765	-0.35	4.25	3.33	0.38152	Amidase signature domain (2);	0.000000	0.85682	D	0.000000	D	0.85622	0.5739	H	0.95402	3.665	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	D	0.88808	0.3290	10	0.87932	D	0	-22.0123	12.4419	0.55629	0.0:0.9176:0.0:0.0824	.	188	O00519	FAAH1_HUMAN	L	188	ENSP00000243167:P188L	ENSP00000243167:P188L	P	+	2	0	FAAH	46643749	0.992000	0.36948	0.939000	0.37840	0.433000	0.31745	5.680000	0.68168	0.997000	0.38969	0.313000	0.20887	CCA	FAAH	-	pfam_Amidase,superfamily_Amidase_dom,pirsf_Amidase_fun	ENSG00000117480		0.647	FAAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAAH	HGNC	protein_coding	OTTHUMT00000021443.1	38	0.00	0	C	NM_001441		46871162	46871162	+1	no_errors	ENST00000243167	ensembl	human	known	69_37n	missense	28	41.67	20	SNP	0.999	T
FAAH	2166	genome.wustl.edu	37	1	46874199	46874199	+	Silent	SNP	G	G	C	rs548663541		TCGA-AO-A0J8-01A-21D-A045-09	TCGA-AO-A0J8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24ba5501-8097-4af6-b12c-bb6dcbe10cac	a6efdded-0dee-4407-a1b2-bdfdb1649a07	g.chr1:46874199G>C	ENST00000243167.8	+	8	1104	c.1020G>C	c.(1018-1020)ccG>ccC	p.P340P	FAAH_ENST00000493735.1_3'UTR	NM_001441.2	NP_001432.2	O00519	FAAH1_HUMAN	fatty acid amide hydrolase	340					fatty acid catabolic process (GO:0009062)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|organelle membrane (GO:0031090)	acylglycerol lipase activity (GO:0047372)|carbon-nitrogen ligase activity, with glutamine as amido-N-donor (GO:0016884)|fatty acid amide hydrolase activity (GO:0017064)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	22	Acute lymphoblastic leukemia(166;0.155)				Propofol(DB00818)|Thiopental(DB00599)	TGCCCTCCCCGGCCATGAGGC	0.617																																						dbGAP											0													181.0	190.0	187.0					1																	46874199		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U82535	CCDS535.1	1p35-p34	2008-02-05			ENSG00000117480	ENSG00000117480			3553	protein-coding gene	gene with protein product		602935				9122178	Standard	NM_001441		Approved	FAAH-1	uc001cpu.2	O00519	OTTHUMG00000007811	ENST00000243167.8:c.1020G>C	1.37:g.46874199G>C			D3DQ19|Q52M86|Q5TDF8	Silent	SNP	pfam_Amidase,superfamily_Amidase_dom,pirsf_Amidase_fun	p.P340	ENST00000243167.8	37	c.1020	CCDS535.1	1																																																																																			FAAH	-	pfam_Amidase,superfamily_Amidase_dom,pirsf_Amidase_fun	ENSG00000117480		0.617	FAAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAAH	HGNC	protein_coding	OTTHUMT00000021443.1	74	0.00	0	G	NM_001441		46874199	46874199	+1	no_errors	ENST00000243167	ensembl	human	known	69_37n	silent	42	43.24	32	SNP	0.011	C
FAM199X	139231	genome.wustl.edu	37	X	103430808	103430808	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A0J8-01A-21D-A045-09	TCGA-AO-A0J8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24ba5501-8097-4af6-b12c-bb6dcbe10cac	a6efdded-0dee-4407-a1b2-bdfdb1649a07	g.chrX:103430808C>T	ENST00000493442.1	+	3	645	c.479C>T	c.(478-480)cCa>cTa	p.P160L	FAM199X_ENST00000299906.5_3'UTR	NM_207318.3	NP_997201.1	Q6PEV8	F199X_HUMAN	family with sequence similarity 199, X-linked	160										breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(1)	11						CCCAGTATTCCAAGTTCACCT	0.423																																						dbGAP											0													137.0	127.0	130.0					X																	103430808		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC016683	CCDS35364.1	Xq22	2010-02-11	2010-02-11	2010-02-11	ENSG00000123575	ENSG00000123575			25195	protein-coding gene	gene with protein product			"""chromosome X open reading frame 39"""	CXorf39			Standard	NM_207318		Approved		uc004elw.3	Q6PEV8	OTTHUMG00000022126	ENST00000493442.1:c.479C>T	X.37:g.103430808C>T	ENSP00000417581:p.Pro160Leu		Q8WVP6|Q96AV3	Missense_Mutation	SNP	NULL	p.P160L	ENST00000493442.1	37	c.479	CCDS35364.1	X	.	.	.	.	.	.	.	.	.	.	C	25.3	4.627129	0.87560	.	.	ENSG00000123575	ENST00000493442	.	.	.	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.76456	0.3990	M	0.64997	1.995	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.76454	-0.2953	8	.	.	.	-7.6373	16.7174	0.85400	0.0:1.0:0.0:0.0	.	160	Q6PEV8	F199X_HUMAN	L	160	.	.	P	+	2	0	FAM199X	103317464	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.721000	0.84768	2.237000	0.73441	0.600000	0.82982	CCA	FAM199X	-	NULL	ENSG00000123575		0.423	FAM199X-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM199X	HGNC	protein_coding	OTTHUMT00000057764.1	202	0.00	0	C	NM_207318		103430808	103430808	+1	no_errors	ENST00000493442	ensembl	human	known	69_37n	missense	145	31.60	67	SNP	1.000	T
MBD6	114785	genome.wustl.edu	37	12	57922155	57922155	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AO-A0J8-01A-21D-A045-09	TCGA-AO-A0J8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24ba5501-8097-4af6-b12c-bb6dcbe10cac	a6efdded-0dee-4407-a1b2-bdfdb1649a07	g.chr12:57922155C>T	ENST00000355673.3	+	10	2988	c.2632C>T	c.(2632-2634)Cga>Tga	p.R878*	MBD6_ENST00000431731.2_Nonsense_Mutation_p.R878*	NM_052897.3	NP_443129.3	Q96DN6	MBD6_HUMAN	methyl-CpG binding domain protein 6	878						chromocenter (GO:0010369)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|urinary_tract(1)	31						AGCCCGGGGCCGAAAGCCTGG	0.652																																						dbGAP											0													16.0	21.0	19.0					12																	57922155		2091	4241	6332	-	-	-	SO:0001587	stop_gained	0			AB067474	CCDS8944.1	12q13.2	2008-02-05				ENSG00000166987			20445	protein-coding gene	gene with protein product						12529184	Standard	NM_052897		Approved	KIAA1887	uc001soj.1	Q96DN6		ENST00000355673.3:c.2632C>T	12.37:g.57922155C>T	ENSP00000347896:p.Arg878*		Q8N3M0|Q8NA81|Q96Q00	Nonsense_Mutation	SNP	superfamily_DNA-bd_integrase-typ,smart_Methyl_CpG_DNA-bd,pfscan_Methyl_CpG_DNA-bd	p.R878*	ENST00000355673.3	37	c.2632	CCDS8944.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	41|41	8.867622|8.867622	0.98984|0.98984	.|.	.|.	ENSG00000166987|ENSG00000166987	ENST00000552163|ENST00000355673;ENST00000431731;ENST00000300263	.|.	.|.	.|.	5.04|5.04	4.14|4.14	0.48551|0.48551	.|.	.|0.153995	.|0.28420	.|N	.|0.015405	T|.	0.25901|.	0.0631|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.29305|.	-1.0016|.	3|.	.|0.02654	.|T	.|1	-2.6372|-2.6372	10.8843|10.8843	0.46957|0.46957	0.1879:0.8121:0.0:0.0|0.1879:0.8121:0.0:0.0	.|.	.|.	.|.	.|.	L|X	112|878;878;342	.|.	.|ENSP00000300263:R342X	P|R	+|+	2|1	0|2	MBD6|MBD6	56208422|56208422	0.999000|0.999000	0.42202|0.42202	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	1.249000|1.249000	0.32839|0.32839	1.477000|1.477000	0.48234|0.48234	0.645000|0.645000	0.84053|0.84053	CCG|CGA	MBD6	-	NULL	ENSG00000166987		0.652	MBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD6	HGNC	protein_coding	OTTHUMT00000407250.1	24	0.00	0	C			57922155	57922155	+1	no_errors	ENST00000355673	ensembl	human	known	69_37n	nonsense	6	45.45	5	SNP	1.000	T
MIR520A	574467	genome.wustl.edu	37	19	54194212	54194212	+	RNA	SNP	G	G	A	rs534597914		TCGA-AO-A0J8-01A-21D-A045-09	TCGA-AO-A0J8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24ba5501-8097-4af6-b12c-bb6dcbe10cac	a6efdded-0dee-4407-a1b2-bdfdb1649a07	g.chr19:54194212G>A	ENST00000384862.1	+	0	78				MIR1283-1_ENST00000408494.1_RNA	NR_030189.1				microRNA 520a																		GGACTGTTTCGGTTTGAGTAA	0.463													G|||	1	0.000199681	0.0	0.0014	5008	,	,		14700	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													123.0	116.0	118.0					19																	54194212		1568	3582	5150	-	-	-			0					19q13.42	2011-09-12		2008-12-18	ENSG00000207594	ENSG00000207594		"""ncRNAs / Micro RNAs"""	32099	non-coding RNA	RNA, micro				MIRN520A			Standard	NR_030189		Approved	hsa-mir-520a	uc021uzs.1				19.37:g.54194212G>A				RNA	SNP	-	NULL	ENST00000384862.1	37	NULL		19																																																																																			MIR520A	-	-	ENSG00000207594		0.463	MIR520A-201	KNOWN	basic	miRNA	MIR520A	HGNC	miRNA		447	0.00	0	G	NR_030189		54194212	54194212	+1	no_errors	ENST00000384862	ensembl	human	known	69_37n	rna	216	28.00	84	SNP	0.001	A
MMS19	64210	genome.wustl.edu	37	10	99223754	99223754	+	Missense_Mutation	SNP	T	T	A	rs145105854		TCGA-AO-A0J8-01A-21D-A045-09	TCGA-AO-A0J8-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24ba5501-8097-4af6-b12c-bb6dcbe10cac	a6efdded-0dee-4407-a1b2-bdfdb1649a07	g.chr10:99223754T>A	ENST00000438925.2	-	19	2108	c.1773A>T	c.(1771-1773)caA>caT	p.Q591H	MMS19_ENST00000327277.7_Missense_Mutation_p.Q227H|MMS19_ENST00000327238.10_Missense_Mutation_p.Q493H|MMS19_ENST00000355839.6_Missense_Mutation_p.Q548H|MMS19_ENST00000370782.2_Missense_Mutation_p.Q591H	NM_022362.4	NP_071757.4	Q96T76	MMS19_HUMAN	MMS19 nucleotide excision repair homolog (S. cerevisiae)	591					cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|iron-sulfur cluster assembly (GO:0016226)|nucleotide-excision repair (GO:0006289)|phosphorelay signal transduction system (GO:0000160)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	CIA complex (GO:0097361)|cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|membrane (GO:0016020)|MMXD complex (GO:0071817)|nucleus (GO:0005634)|spindle (GO:0005819)	estrogen receptor binding (GO:0030331)|protein binding, bridging (GO:0030674)|receptor signaling complex scaffold activity (GO:0030159)|transcription coactivator activity (GO:0003713)			endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|stomach(1)	16		Colorectal(252;0.0846)		Epithelial(162;3.33e-10)|all cancers(201;2.74e-08)		CGTCACTGGATTGTGCAACCA	0.443								Direct reversal of damage			OREG0020414	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													78.0	62.0	68.0					10																	99223754		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF007151	CCDS7464.1, CCDS73177.1	10q24-q25	2007-08-15	2007-08-15	2007-08-15	ENSG00000155229	ENSG00000155229			13824	protein-coding gene	gene with protein product	"""MET18 homolog (S. cerevisiae)"""	614777		MMS19L		11071939	Standard	NM_022362		Approved	MET18, hMMS19	uc001kns.4	Q96T76	OTTHUMG00000018857	ENST00000438925.2:c.1773A>T	10.37:g.99223754T>A	ENSP00000412698:p.Gln591His	1342	B0QZ75|B3KPE5|B4DQX2|B4E2I3|D3DR55|F8W9Y2|Q17RZ8|Q5T455|Q66K82|Q7L4W8|Q969Z1|Q96DF1|Q96MR1|Q96RK5|Q96SK1|Q9BUE2|Q9BYS9	Missense_Mutation	SNP	pfam_Tscrpt_MMS19_N,superfamily_ARM-type_fold	p.Q591H	ENST00000438925.2	37	c.1773	CCDS7464.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.47|15.47	2.843384|2.843384	0.51057|0.51057	.|.	.|.	ENSG00000155229|ENSG00000155229	ENST00000434538|ENST00000438925;ENST00000370782;ENST00000327238;ENST00000422291;ENST00000327277;ENST00000327253;ENST00000355839	.|T;T;T;T;T	.|0.66995	.|-0.04;-0.04;-0.24;-0.04;-0.04	5.3|5.3	-0.165|-0.165	0.13355|0.13355	.|Armadillo-like helical (1);Armadillo-type fold (1);	.|0.672821	.|0.15651	.|N	.|0.251394	T|T	0.36166|0.36166	0.0957|0.0957	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|B;B;B;B;B	.|0.17038	.|0.003;0.02;0.003;0.001;0.006	.|B;B;B;B;B	.|0.10450	.|0.002;0.005;0.004;0.002;0.002	T|T	0.12811|0.12811	-1.0533|-1.0533	5|10	.|0.39692	.|T	.|0.17	.|.	0.639|0.639	0.00807|0.00807	0.21:0.2962:0.2441:0.2497|0.21:0.2962:0.2441:0.2497	.|.	.|612;493;548;591;548	.|B4DQX2;Q96T76-5;F8W9Y2;Q96T76;B4E2I3	.|.;.;.;MMS19_HUMAN;.	I|H	166|591;591;493;570;227;176;548	.|ENSP00000412698:Q591H;ENSP00000359818:Q591H;ENSP00000320059:Q493H;ENSP00000322236:Q227H;ENSP00000348097:Q548H	.|ENSP00000320059:Q493H	N|Q	-|-	2|3	0|2	MMS19|MMS19	99213744|99213744	0.000000|0.000000	0.05858|0.05858	0.038000|0.038000	0.18304|0.18304	0.973000|0.973000	0.67179|0.67179	-0.140000|-0.140000	0.10342|0.10342	0.316000|0.316000	0.23135|0.23135	-0.375000|-0.375000	0.07067|0.07067	AAT|CAA	MMS19	-	superfamily_ARM-type_fold	ENSG00000155229		0.443	MMS19-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MMS19	HGNC	protein_coding	OTTHUMT00000049706.2	134	0.00	0	T			99223754	99223754	-1	no_errors	ENST00000370782	ensembl	human	known	69_37n	missense	33	50.75	34	SNP	0.000	A
MUC4	4585	genome.wustl.edu	37	3	195506387	195506387	+	Missense_Mutation	SNP	G	G	T	rs201542091	byFrequency	TCGA-AO-A0J8-01A-21D-A045-09	TCGA-AO-A0J8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24ba5501-8097-4af6-b12c-bb6dcbe10cac	a6efdded-0dee-4407-a1b2-bdfdb1649a07	g.chr3:195506387G>T	ENST00000463781.3	-	2	12523	c.12064C>A	c.(12064-12066)Cct>Act	p.P4022T	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P4022T	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.P4022T(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCTGAGGAAGGGCTGGTGACA	0.582													.|||	113	0.0225639	0.0189	0.0159	5008	,	,		11226	0.0089		0.0447	False		,,,				2504	0.0235					dbGAP											1	Substitution - Missense(1)	endometrium(1)											19.0	15.0	16.0					3																	195506387		649	1304	1953	-	-	-	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12064C>A	3.37:g.195506387G>T	ENSP00000417498:p.Pro4022Thr		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.P4022T	ENST00000463781.3	37	c.12064	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	g	2.915	-0.224485	0.06061	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.29655	1.56;1.56	.	.	.	.	0.000000	0.25517	N	0.030134	T	0.14700	0.0355	N	0.14661	0.345	0.09310	N	1	D	0.55385	0.971	P	0.46026	0.501	T	0.33007	-0.9885	8	.	.	.	.	6.041	0.19734	0.0:0.6792:0.3208:0.0	.	3894	E7ESK3	.	T	4022	ENSP00000417498:P4022T;ENSP00000420243:P4022T	.	P	-	1	0	MUC4	196991166	0.004000	0.15560	0.000000	0.03702	0.004000	0.04260	-2.457000	0.01001	-2.083000	0.00867	-2.366000	0.00237	CCT	MUC4	-	NULL	ENSG00000145113		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	8	0.00	0	G	NM_018406		195506387	195506387	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	missense	37	30.43	21	SNP	0.001	T
NDFIP1	80762	genome.wustl.edu	37	5	141515313	141515313	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A0J8-01A-21D-A045-09	TCGA-AO-A0J8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24ba5501-8097-4af6-b12c-bb6dcbe10cac	a6efdded-0dee-4407-a1b2-bdfdb1649a07	g.chr5:141515313C>T	ENST00000253814.4	+	4	771	c.301C>T	c.(301-303)Cgg>Tgg	p.R101W		NM_030571.3	NP_085048.1	Q9BT67	NFIP1_HUMAN	Nedd4 family interacting protein 1	101					cellular iron ion homeostasis (GO:0006879)|negative regulation of gene expression (GO:0010629)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-4 production (GO:0032713)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of protein transport (GO:0051224)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transporter activity (GO:0032410)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein ubiquitination (GO:0031398)|regulation of isotype switching to IgG isotypes (GO:0048302)|regulation of lymphocyte differentiation (GO:0045619)|regulation of myeloid leukocyte differentiation (GO:0002761)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	cell cortex (GO:0005938)|endosome (GO:0005768)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	signal transducer activity (GO:0004871)			large_intestine(3)|lung(1)|ovary(1)	5		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTTTGTGGGTCGGGATGATTT	0.363																																						dbGAP											0													189.0	177.0	181.0					5																	141515313		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC004317	CCDS4273.1	5q31.3	2008-02-05			ENSG00000131507	ENSG00000131507			17592	protein-coding gene	gene with protein product		612050				11042109, 11748237	Standard	NM_030571		Approved	N4WBP5, MGC10924	uc003lmi.4	Q9BT67	OTTHUMG00000129659	ENST00000253814.4:c.301C>T	5.37:g.141515313C>T	ENSP00000253814:p.Arg101Trp		B2RDB8|D3DQF0|Q658T8|Q8N2E3|Q8N2F9	Missense_Mutation	SNP	pfam_NEDD4/BSD2	p.R101W	ENST00000253814.4	37	c.301	CCDS4273.1	5	.	.	.	.	.	.	.	.	.	.	C	18.97	3.735193	0.69189	.	.	ENSG00000131507	ENST00000253814	.	.	.	5.56	3.53	0.40419	.	0.000000	0.85682	D	0.000000	T	0.74222	0.3688	L	0.59436	1.845	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.74315	-0.3705	9	0.39692	T	0.17	-23.7543	14.5924	0.68378	0.3626:0.6374:0.0:0.0	.	101	Q9BT67	NFIP1_HUMAN	W	101	.	ENSP00000253814:R101W	R	+	1	2	NDFIP1	141495497	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	3.814000	0.55643	1.293000	0.44690	0.484000	0.47621	CGG	NDFIP1	-	pfam_NEDD4/BSD2	ENSG00000131507		0.363	NDFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDFIP1	HGNC	protein_coding	OTTHUMT00000251859.2	467	0.21	1	C	NM_030571		141515313	141515313	+1	no_errors	ENST00000253814	ensembl	human	known	69_37n	missense	423	35.12	229	SNP	0.988	T
NR2E1	7101	genome.wustl.edu	37	6	108492770	108492770	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A0J8-01A-21D-A045-09	TCGA-AO-A0J8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24ba5501-8097-4af6-b12c-bb6dcbe10cac	a6efdded-0dee-4407-a1b2-bdfdb1649a07	g.chr6:108492770G>A	ENST00000368986.4	+	2	842	c.134G>A	c.(133-135)cGa>cAa	p.R45Q	NR2E1_ENST00000368983.3_Missense_Mutation_p.R82Q	NM_003269.3	NP_003260.1	Q9Y466	NR2E1_HUMAN	nuclear receptor subfamily 2, group E, member 1	45					aggressive behavior (GO:0002118)|amygdala development (GO:0021764)|anterior commissure morphogenesis (GO:0021960)|behavioral fear response (GO:0001662)|cell fate commitment (GO:0045165)|cerebral cortex neuron differentiation (GO:0021895)|dentate gyrus development (GO:0021542)|extracellular matrix organization (GO:0030198)|forebrain generation of neurons (GO:0021872)|gene expression (GO:0010467)|glial cell migration (GO:0008347)|layer formation in cerebral cortex (GO:0021819)|long-term synaptic potentiation (GO:0060291)|negative regulation of apoptotic process (GO:0043066)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|olfactory bulb development (GO:0021772)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle (GO:0045787)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of stem cell proliferation (GO:2000648)|regulation of cell migration involved in sprouting angiogenesis (GO:0090049)|regulation of dendrite morphogenesis (GO:0048814)|regulation of timing of neuron differentiation (GO:0060164)|retina development in camera-type eye (GO:0060041)|social behavior (GO:0035176)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|visual perception (GO:0007601)	nucleoplasm (GO:0005654)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(16)|prostate(1)|skin(3)	30		all_cancers(87;8.13e-05)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00866)|Colorectal(196;0.0637)		BRCA - Breast invasive adenocarcinoma(108;0.013)|Epithelial(106;0.0521)|all cancers(137;0.068)|OV - Ovarian serous cystadenocarcinoma(136;0.0689)		CGGAGCATCCGAAGGAATAGG	0.557																																						dbGAP											0													111.0	123.0	119.0					6																	108492770		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y13276	CCDS5063.1, CCDS69165.1	6q21	2013-01-16			ENSG00000112333	ENSG00000112333		"""Nuclear hormone receptors"""	7973	protein-coding gene	gene with protein product		603849		TLX		9628820	Standard	NM_003269		Approved	TLL, XTLL	uc003psg.3	Q9Y466	OTTHUMG00000015319	ENST00000368986.4:c.134G>A	6.37:g.108492770G>A	ENSP00000357982:p.Arg45Gln		Q6ZMP8	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.R45Q	ENST00000368986.4	37	c.134	CCDS5063.1	6	.	.	.	.	.	.	.	.	.	.	G	36	5.701414	0.96812	.	.	ENSG00000112333	ENST00000368986;ENST00000368983	D;D	0.97041	-4.22;-4.22	5.53	5.53	0.82687	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (4);	0.000000	0.85682	D	0.000000	D	0.97433	0.9160	L	0.52759	1.655	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.96295	0.9217	10	0.30078	T	0.28	.	19.0647	0.93106	0.0:0.0:1.0:0.0	.	45	Q9Y466	NR2E1_HUMAN	Q	45;82	ENSP00000357982:R45Q;ENSP00000357979:R82Q	ENSP00000357979:R82Q	R	+	2	0	NR2E1	108599463	1.000000	0.71417	0.998000	0.56505	0.917000	0.54804	9.229000	0.95273	2.612000	0.88384	0.655000	0.94253	CGA	NR2E1	-	pfam_Znf_hrmn_rcpt,smart_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt,prints_Znf_hrmn_rcpt	ENSG00000112333		0.557	NR2E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR2E1	HGNC	protein_coding	OTTHUMT00000041712.2	84	0.00	0	G			108492770	108492770	+1	no_errors	ENST00000368986	ensembl	human	known	69_37n	missense	33	56.00	42	SNP	1.000	A
PDZD2	23037	genome.wustl.edu	37	5	31799549	31799549	+	Missense_Mutation	SNP	A	A	G			TCGA-AO-A0J8-01A-21D-A045-09	TCGA-AO-A0J8-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24ba5501-8097-4af6-b12c-bb6dcbe10cac	a6efdded-0dee-4407-a1b2-bdfdb1649a07	g.chr5:31799549A>G	ENST00000438447.1	+	2	582	c.194A>G	c.(193-195)gAa>gGa	p.E65G	PDZD2_ENST00000282493.3_Missense_Mutation_p.E65G			O15018	PDZD2_HUMAN	PDZ domain containing 2	65					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						AGCCCCCCCGAAATGGAGATC	0.567																																						dbGAP											0													112.0	110.0	111.0					5																	31799549		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.194A>G	5.37:g.31799549A>G	ENSP00000402033:p.Glu65Gly		Q9BXD4	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.E65G	ENST00000438447.1	37	c.194	CCDS34137.1	5	.	.	.	.	.	.	.	.	.	.	A	6.149	0.395732	0.11638	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.66638	-0.22;-0.22	5.67	3.25	0.37280	PDZ/DHR/GLGF (1);	0.474474	0.17669	N	0.166059	T	0.43366	0.1244	N	0.14661	0.345	0.35810	D	0.823767	B	0.09022	0.002	B	0.09377	0.004	T	0.31530	-0.9940	10	0.26408	T	0.33	.	4.9867	0.14192	0.6759:0.2103:0.1138:0.0	.	65	O15018	PDZD2_HUMAN	G	65	ENSP00000402033:E65G;ENSP00000282493:E65G	ENSP00000282493:E65G	E	+	2	0	PDZD2	31835306	1.000000	0.71417	0.029000	0.17559	0.314000	0.28054	5.594000	0.67557	0.408000	0.25621	0.533000	0.62120	GAA	PDZD2	-	superfamily_PDZ	ENSG00000133401		0.567	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD2	HGNC	protein_coding	OTTHUMT00000366608.1	126	0.00	0	A			31799549	31799549	+1	no_errors	ENST00000282493	ensembl	human	known	69_37n	missense	58	36.26	33	SNP	0.824	G
PNLIPRP1	5407	genome.wustl.edu	37	10	118354350	118354350	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A0J8-01A-21D-A045-09	TCGA-AO-A0J8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24ba5501-8097-4af6-b12c-bb6dcbe10cac	a6efdded-0dee-4407-a1b2-bdfdb1649a07	g.chr10:118354350G>A	ENST00000528052.1	+	5	510	c.439G>A	c.(439-441)Gtg>Atg	p.V147M	PNLIPRP1_ENST00000358834.4_Missense_Mutation_p.V147M|PNLIPRP1_ENST00000534537.1_Missense_Mutation_p.V147M			P54315	LIPR1_HUMAN	pancreatic lipase-related protein 1	147					lipid metabolic process (GO:0006629)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|triglyceride lipase activity (GO:0004806)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	38				all cancers(201;0.0161)		GGGCGCCCAGGTGGCCCAGAT	0.602																																						dbGAP											0													81.0	67.0	72.0					10																	118354350		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC025784	CCDS7595.1	10q26.12	2006-07-04			ENSG00000187021	ENSG00000187021			9156	protein-coding gene	gene with protein product		604422				1379598	Standard	NM_006229		Approved	PLRP1	uc001lco.1	P54315	OTTHUMG00000019109	ENST00000528052.1:c.439G>A	10.37:g.118354350G>A	ENSP00000433933:p.Val147Met		Q68D83|Q68DR6|Q8TAU2|Q9BS82	Missense_Mutation	SNP	pfam_Lipase_N,pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_LipOase_LH2,pirsf_Lipoprotein_lipase_LIPH,pfscan_LipOase_LH2,prints_Lipase_panc,prints_Lipase	p.V147M	ENST00000528052.1	37	c.439	CCDS7595.1	10	.	.	.	.	.	.	.	.	.	.	G	18.41	3.618636	0.66787	.	.	ENSG00000187021	ENST00000531984;ENST00000358834;ENST00000528052;ENST00000534537	D;D;D;D	0.93604	-3.25;-3.25;-3.25;-3.25	4.94	4.02	0.46733	Lipase, N-terminal (1);	0.092295	0.45606	D	0.000349	D	0.92512	0.7622	M	0.84219	2.685	0.80722	D	1	P	0.45827	0.867	B	0.41466	0.358	D	0.91616	0.5307	10	0.62326	D	0.03	-13.4032	8.9023	0.35501	0.0838:0.1532:0.763:0.0	.	147	P54315	LIPR1_HUMAN	M	147	ENSP00000436123:V147M;ENSP00000351695:V147M;ENSP00000433933:V147M;ENSP00000434159:V147M	ENSP00000351695:V147M	V	+	1	0	PNLIPRP1	118344340	0.986000	0.35501	1.000000	0.80357	0.988000	0.76386	0.061000	0.14366	1.205000	0.43262	0.655000	0.94253	GTG	PNLIPRP1	-	pfam_Lipase_N,pirsf_Lipoprotein_lipase_LIPH,prints_Lipase	ENSG00000187021		0.602	PNLIPRP1-011	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	PNLIPRP1	HGNC	protein_coding	OTTHUMT00000384633.1	94	0.00	0	G	NM_006229		118354350	118354350	+1	no_errors	ENST00000358834	ensembl	human	known	69_37n	missense	41	32.79	20	SNP	1.000	A
POTEA	340441	genome.wustl.edu	37	8	43197031	43197031	+	RNA	SNP	G	G	T			TCGA-AO-A0J8-01A-21D-A045-09	TCGA-AO-A0J8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24ba5501-8097-4af6-b12c-bb6dcbe10cac	a6efdded-0dee-4407-a1b2-bdfdb1649a07	g.chr8:43197031G>T	ENST00000522175.2	+	0	1061							Q6S8J7	POTEA_HUMAN	POTE ankyrin domain family, member A									p.K399N(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(27)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						GGCCTGAAAAGAAATCTAATG	0.229																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											17.0	16.0	16.0					8																	43197031		1738	3954	5692	-	-	-			0			AY462869		8p11.1	2013-01-11	2008-11-26	2008-11-26	ENSG00000188877	ENSG00000188877		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33893	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 3"""	608915	"""ANKRD26-like family A, member 1"""	A26A1			Standard	NM_001002920		Approved	POTE8, POTE-8, CT104.3	uc003xpz.1	Q6S8J7	OTTHUMG00000164111		8.37:g.43197031G>T			A6ND17|A6ND71|Q6S8J6	RNA	SNP	-	NULL	ENST00000522175.2	37	NULL		8																																																																																			POTEA	-	-	ENSG00000188877		0.229	POTEA-003	KNOWN	basic	processed_transcript	POTEA	HGNC	pseudogene	OTTHUMT00000383492.1	121	0.00	0	G	NM_001002920		43197031	43197031	+1	no_errors	ENST00000522175	ensembl	human	known	69_37n	rna	72	27.27	27	SNP	0.522	T
PSEN2	5664	genome.wustl.edu	37	1	227077759	227077759	+	Missense_Mutation	SNP	A	A	G			TCGA-AO-A0J8-01A-21D-A045-09	TCGA-AO-A0J8-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24ba5501-8097-4af6-b12c-bb6dcbe10cac	a6efdded-0dee-4407-a1b2-bdfdb1649a07	g.chr1:227077759A>G	ENST00000366783.3	+	9	1247	c.811A>G	c.(811-813)Aaa>Gaa	p.K271E	PSEN2_ENST00000366782.1_Missense_Mutation_p.K304E|PSEN2_ENST00000391872.2_Missense_Mutation_p.K304E|PSEN2_ENST00000422240.2_Missense_Mutation_p.K271E|PSEN2_ENST00000472139.2_Missense_Mutation_p.K127E|PSEN2_ENST00000340188.4_Intron	NM_000447.2|NM_012486.2	NP_000438.2|NP_036618.2	P49810	PSN2_HUMAN	presenilin 2	271					amyloid precursor protein catabolic process (GO:0042987)|anagen (GO:0042640)|apoptotic signaling pathway (GO:0097190)|beta-amyloid metabolic process (GO:0050435)|brain morphogenesis (GO:0048854)|calcium ion transport (GO:0006816)|cardiac muscle contraction (GO:0060048)|cell fate specification (GO:0001708)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic limb morphogenesis (GO:0030326)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|forebrain development (GO:0030900)|hematopoietic progenitor cell differentiation (GO:0002244)|intracellular signal transduction (GO:0035556)|locomotion (GO:0040011)|lung alveolus development (GO:0048286)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|memory (GO:0007613)|myeloid leukocyte differentiation (GO:0002573)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of protein binding (GO:0032091)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of protein phosphorylation (GO:0001933)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|positive regulation of coagulation (GO:0050820)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|protein processing (GO:0016485)|protein transport (GO:0015031)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of synaptic plasticity (GO:0048167)|response to hypoxia (GO:0001666)|somitogenesis (GO:0001756)|T cell activation involved in immune response (GO:0002286)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cell cortex (GO:0005938)|cell surface (GO:0009986)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary rootlet (GO:0035253)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|kinetochore (GO:0000776)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nuclear inner membrane (GO:0005637)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|Z disc (GO:0030018)	aspartic-type endopeptidase activity (GO:0004190)|endopeptidase activity (GO:0004175)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|urinary_tract(1)	20		Prostate(94;0.0771)				GCTGTGTCCCAAAGGGCCTCT	0.562																																						dbGAP											0													134.0	118.0	123.0					1																	227077759		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC006365	CCDS1556.1, CCDS44324.1	1q42.13	2014-09-17	2014-02-24		ENSG00000143801	ENSG00000143801			9509	protein-coding gene	gene with protein product		600759	"""Alzheimer disease 4"""	AD4		7638621	Standard	NM_000447		Approved	AD3L, STM2, PS2	uc009xeo.1	P49810	OTTHUMG00000037563	ENST00000366783.3:c.811A>G	1.37:g.227077759A>G	ENSP00000355747:p.Lys271Glu		A8K8D4|B1AP21|Q96P32	Missense_Mutation	SNP	pfam_Peptidase_A22A,smart_Peptidase_A22,prints_Pept_A22A_PS2,prints_Peptidase_A22A	p.K304E	ENST00000366783.3	37	c.910	CCDS1556.1	1	.	.	.	.	.	.	.	.	.	.	A	31	5.083913	0.94050	.	.	ENSG00000143801	ENST00000366783;ENST00000422240;ENST00000460775;ENST00000366782;ENST00000391872;ENST00000472139	D;D;D;D;D;D	0.99548	-6.14;-6.14;-6.14;-6.14;-6.14;-6.14	4.95	4.95	0.65309	.	0.000000	0.85682	D	0.000000	D	0.99579	0.9848	M	0.89095	3.005	0.80722	D	1	P;D	0.60575	0.578;0.988	P;P	0.62560	0.574;0.904	D	0.97900	1.0302	10	0.72032	D	0.01	.	14.915	0.70789	1.0:0.0:0.0:0.0	.	271;271	A8K8D4;P49810	.;PSN2_HUMAN	E	271;271;98;304;304;127	ENSP00000355747:K271E;ENSP00000403737:K271E;ENSP00000427912:K98E;ENSP00000355746:K304E;ENSP00000375745:K304E;ENSP00000427806:K127E	ENSP00000355746:K304E	K	+	1	0	PSEN2	225144382	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	9.205000	0.95048	1.991000	0.58162	0.460000	0.39030	AAA	PSEN2	-	pfam_Peptidase_A22A,smart_Peptidase_A22,prints_Peptidase_A22A	ENSG00000143801		0.562	PSEN2-001	KNOWN	basic|CCDS	protein_coding	PSEN2	HGNC	protein_coding	OTTHUMT00000091539.1	136	0.00	0	A	NM_000447		227077759	227077759	+1	no_errors	ENST00000391872	ensembl	human	known	69_37n	missense	271	21.08	74	SNP	1.000	G
RUNX1	861	genome.wustl.edu	37	21	36252994	36252995	+	Frame_Shift_Ins	INS	-	-	C	rs373498347		TCGA-AO-A0J8-01A-21D-A045-09	TCGA-AO-A0J8-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24ba5501-8097-4af6-b12c-bb6dcbe10cac	a6efdded-0dee-4407-a1b2-bdfdb1649a07	g.chr21:36252994_36252995insC	ENST00000344691.4	-	2	1863_1864	c.286_287insG	c.(286-288)gatfs	p.D96fs	RUNX1_ENST00000358356.5_Frame_Shift_Ins_p.D96fs|RUNX1_ENST00000399240.1_Frame_Shift_Ins_p.D96fs|RUNX1_ENST00000325074.5_Frame_Shift_Ins_p.D111fs|RUNX1_ENST00000437180.1_Frame_Shift_Ins_p.D123fs|RUNX1_ENST00000300305.3_Frame_Shift_Ins_p.D123fs|RUNX1_ENST00000486278.2_Frame_Shift_Ins_p.D99fs	NM_001001890.2	NP_001001890.1	Q01196	RUNX1_HUMAN	runt-related transcription factor 1	96	Runt. {ECO:0000255|PROSITE- ProRule:PRU00399}.				behavioral response to pain (GO:0048266)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system development (GO:0007417)|definitive hemopoiesis (GO:0060216)|embryonic hemopoiesis (GO:0035162)|hair follicle morphogenesis (GO:0031069)|hematopoietic stem cell proliferation (GO:0071425)|hemopoiesis (GO:0030097)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|myeloid cell differentiation (GO:0030099)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of granulocyte differentiation (GO:0030853)|peripheral nervous system neuron development (GO:0048935)|positive regulation of angiogenesis (GO:0045766)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of progesterone secretion (GO:2000872)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hair follicle cell proliferation (GO:0071336)|regulation of signal transduction (GO:0009966)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(5)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(428)|large_intestine(3)|lung(6)|oesophagus(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	452						ATCTGGAACATCCCCTAGGGCC	0.46			T	"""RPL22, MDS1, EVI1, CBFA2T3, CBFA2T1, ETV6, LAF4"""	"""AML, preB- ALL, T-ALL"""																																	dbGAP		Dom	yes		21	21q22.3	861	runt-related transcription factor 1  (AML1)		L	0			GRCh37	CM086911	RUNX1	M																																				-	-	-	SO:0001589	frameshift_variant	0			X79549	CCDS13639.1, CCDS42922.1, CCDS46646.1	21q22.3	2014-09-17	2008-07-29		ENSG00000159216	ENSG00000159216			10471	protein-coding gene	gene with protein product	"""aml1 oncogene"""	151385	"""acute myeloid leukemia 1"""	AML1, CBFA2		1427868, 7835892	Standard	NM_001001890		Approved	PEBP2A2, AMLCR1	uc010gmv.3	Q01196	OTTHUMG00000086299	ENST00000344691.4:c.287dupG	21.37:g.36252998_36252998dupC	ENSP00000340690:p.Asp96fs		A8MV94|B2RMS4|D3DSG1|O60472|O60473|O76047|O76089|Q13081|Q13755|Q13756|Q13757|Q13758|Q13759|Q15341|Q15343|Q16122|Q16284|Q16285|Q16286|Q16346|Q16347|Q92479	Frame_Shift_Ins	INS	pfam_AML1/Runt_N,pfam_RunxI,superfamily_p53-like_TF_DNA-bd,pirsf_TF_Runt-rel_RUNX,pfscan_AML1/Runt_N,prints_AML1_Runt	p.D123fs	ENST00000344691.4	37	c.368_367	CCDS42922.1	21																																																																																			RUNX1	-	pfam_AML1/Runt_N,superfamily_p53-like_TF_DNA-bd,pirsf_TF_Runt-rel_RUNX,pfscan_AML1/Runt_N,prints_AML1_Runt	ENSG00000159216		0.460	RUNX1-001	KNOWN	basic|CCDS	protein_coding	RUNX1	HGNC	protein_coding	OTTHUMT00000194230.1	107	0.00	0	-			36252994	36252995	-1	no_errors	ENST00000300305	ensembl	human	known	69_37n	frame_shift_ins	96	36.00	54	INS	0.999:1.000	C
SLC41A2	84102	genome.wustl.edu	37	12	105322236	105322236	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A0J8-01A-21D-A045-09	TCGA-AO-A0J8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24ba5501-8097-4af6-b12c-bb6dcbe10cac	a6efdded-0dee-4407-a1b2-bdfdb1649a07	g.chr12:105322236C>T	ENST00000258538.3	-	1	197	c.70G>A	c.(70-72)Gta>Ata	p.V24I		NM_032148.3	NP_115524.3	Q96JW4	S41A2_HUMAN	solute carrier family 41 (magnesium transporter), member 2	24					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	22						GTCCAATCTACAAAACCTCCT	0.358																																					Esophageal Squamous(195;176 2919 4272 35572)	dbGAP											0													52.0	43.0	46.0					12																	105322236		692	1591	2283	-	-	-	SO:0001583	missense	0			BC036734	CCDS9100.2	12q24.11	2013-07-17	2013-07-17		ENSG00000136052	ENSG00000136052		"""Solute carriers"""	31045	protein-coding gene	gene with protein product		610802	"""solute carrier family 41, member 2"""				Standard	NM_032148		Approved	DKFZP434K0427	uc001tla.3	Q96JW4	OTTHUMG00000156965	ENST00000258538.3:c.70G>A	12.37:g.105322236C>T	ENSP00000258538:p.Val24Ile		Q3KP68|Q9H0E5	Missense_Mutation	SNP	pfam_MgtE_Mg_transptr_membr	p.V24I	ENST00000258538.3	37	c.70	CCDS9100.2	12	.	.	.	.	.	.	.	.	.	.	C	12.90	2.075272	0.36662	.	.	ENSG00000136052	ENST00000258538;ENST00000415674;ENST00000411411;ENST00000449866;ENST00000433540;ENST00000424946;ENST00000417469	T;T;T;T	0.30981	1.51;1.51;1.51;1.51	6.17	4.35	0.52113	.	0.348813	0.27927	N	0.017286	T	0.32734	0.0839	M	0.62723	1.935	0.37818	D	0.928289	B	0.06786	0.001	B	0.04013	0.001	T	0.30504	-0.9976	10	0.56958	D	0.05	-2.7342	13.5052	0.61479	0.0:0.8722:0.0:0.1278	.	24	Q96JW4	S41A2_HUMAN	I	24	ENSP00000258538:V24I;ENSP00000396429:V24I;ENSP00000407898:V24I;ENSP00000414526:V24I	ENSP00000258538:V24I	V	-	1	0	SLC41A2	103846366	1.000000	0.71417	0.998000	0.56505	0.146000	0.21551	2.076000	0.41548	1.632000	0.50472	-0.140000	0.14226	GTA	SLC41A2	-	NULL	ENSG00000136052		0.358	SLC41A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC41A2	HGNC	protein_coding	OTTHUMT00000346850.3	111	0.00	0	C	NM_032148		105322236	105322236	-1	no_errors	ENST00000258538	ensembl	human	known	69_37n	missense	47	42.68	35	SNP	1.000	T
SLC9A7	84679	genome.wustl.edu	37	X	46618330	46618330	+	Silent	SNP	C	C	A			TCGA-AO-A0J8-01A-21D-A045-09	TCGA-AO-A0J8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24ba5501-8097-4af6-b12c-bb6dcbe10cac	a6efdded-0dee-4407-a1b2-bdfdb1649a07	g.chrX:46618330C>A	ENST00000328306.4	-	1	160	c.135G>T	c.(133-135)ggG>ggT	p.G45G		NM_001257291.1|NM_032591.2	NP_001244220.1|NP_115980.1	Q96T83	SL9A7_HUMAN	solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7	45					ion transport (GO:0006811)|potassium ion transmembrane transport (GO:0071805)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|recycling endosome membrane (GO:0055038)|trans-Golgi network (GO:0005802)	potassium:proton antiporter activity (GO:0015386)|protein homodimerization activity (GO:0042803)|sodium:proton antiporter activity (GO:0015385)			breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)|skin(1)	21						CCGCCGCCGCCCCAGAGGAGG	0.736																																					Pancreas(118;454 1696 1930 13865 39976)	dbGAP											0													9.0	8.0	9.0					X																	46618330		2179	4258	6437	-	-	-	SO:0001819	synonymous_variant	0			AF298591	CCDS14269.1, CCDS75967.1	Xp11.3	2013-05-22	2012-03-22		ENSG00000065923	ENSG00000065923		"""Solute carriers"""	17123	protein-coding gene	gene with protein product		300368	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 7"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 7"""			11279194	Standard	NM_001257291		Approved	NHE7	uc004dgv.2	Q96T83	OTTHUMG00000021428	ENST00000328306.4:c.135G>T	X.37:g.46618330C>A			O75827|Q5JXP9	Silent	SNP	pfam_Cation/H_exchanger,prints_Na/H_exchanger_6,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.G45	ENST00000328306.4	37	c.135	CCDS14269.1	X																																																																																			SLC9A7	-	prints_Na/H_exchanger_6	ENSG00000065923		0.736	SLC9A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A7	HGNC	protein_coding	OTTHUMT00000056370.1	9	0.00	0	C	NM_032591		46618330	46618330	-1	no_errors	ENST00000328306	ensembl	human	known	69_37n	silent	5	44.44	4	SNP	1.000	A
AL133247.2	0	genome.wustl.edu	37	2	31754431	31754432	+	RNA	INS	-	-	C	rs34552434		TCGA-AO-A0J8-01A-21D-A045-09	TCGA-AO-A0J8-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24ba5501-8097-4af6-b12c-bb6dcbe10cac	a6efdded-0dee-4407-a1b2-bdfdb1649a07	g.chr2:31754431_31754432insC	ENST00000435713.1	+	0	255				SRD5A2_ENST00000405650.1_RNA																							AAATGCAAATGCAAGTGCTGGG	0.465																																						dbGAP											0																																										-	-	-			0																															2.37:g.31754432_31754432dupC				RNA	INS	-	NULL	ENST00000435713.1	37	NULL		2																																																																																			SRD5A2	-	-	ENSG00000049319		0.465	AL133247.2-001	KNOWN	basic|exp_conf	antisense	SRD5A2	HGNC	antisense	OTTHUMT00000325125.1	232	0.00	0	-			31754431	31754432	-1	no_errors	ENST00000233139	ensembl	human	known	69_37n	rna	60	37.50	36	INS	0.991:0.955	C
TPD52	7163	genome.wustl.edu	37	8	80992644	80992644	+	Silent	SNP	C	C	T			TCGA-AO-A0J8-01A-21D-A045-09	TCGA-AO-A0J8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24ba5501-8097-4af6-b12c-bb6dcbe10cac	a6efdded-0dee-4407-a1b2-bdfdb1649a07	g.chr8:80992644C>T	ENST00000379097.3	-	1	407	c.45G>A	c.(43-45)ccG>ccA	p.P15P	TPD52_ENST00000520527.1_Silent_p.P15P|TPD52_ENST00000448733.2_Silent_p.P15P|TPD52_ENST00000379096.5_Intron|TPD52_ENST00000518937.1_Intron|TPD52_ENST00000517427.1_Silent_p.P15P|TPD52_ENST00000537855.1_Silent_p.P15P|TPD52_ENST00000519303.2_Intron	NM_001025252.1	NP_001020423.1	P55327	TPD52_HUMAN	tumor protein D52	15					anatomical structure morphogenesis (GO:0009653)|B cell differentiation (GO:0030183)|positive regulation of cell proliferation (GO:0008284)|secretion (GO:0046903)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	8	all_epithelial(4;1.13e-09)|Lung NSC(7;9.71e-07)|all_lung(9;3.75e-06)	Lung NSC(129;3.55e-06)|all_lung(136;1.53e-05)|Acute lymphoblastic leukemia(644;0.158)	BRCA - Breast invasive adenocarcinoma(6;0.00181)|Epithelial(68;0.0149)|all cancers(69;0.0612)			CAAAATCAAACGGGGACTGGT	0.438																																						dbGAP											0													81.0	77.0	78.0					8																	80992644		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U18914	CCDS34912.1, CCDS47879.1, CCDS55249.1, CCDS75757.1, CCDS75758.1, CCDS75759.1	8q21.13	2014-06-24			ENSG00000076554	ENSG00000076554			12005	protein-coding gene	gene with protein product		604068				7796418	Standard	NM_001287144		Approved	D52, hD52, N8L	uc003ybr.1	P55327	OTTHUMG00000164565	ENST00000379097.3:c.45G>A	8.37:g.80992644C>T			B7Z414|C9J502|D0UFD1|D0UFD2|D0UFD3|D0UFD4|D0UFD5|E5RKB4|Q13056|Q53EK8|Q6FGP3|Q6FGS3|Q86YZ2|Q9UCX8	Silent	SNP	pfam_TPD52,pfam_Ribosomal_S28_mit,superfamily_NA-bd_OB-fold-like	p.P15	ENST00000379097.3	37	c.45	CCDS34912.1	8																																																																																			TPD52	-	NULL	ENSG00000076554		0.438	TPD52-006	KNOWN	basic|CCDS	protein_coding	TPD52	HGNC	protein_coding	OTTHUMT00000379539.2	121	0.00	0	C	NM_005079		80992644	80992644	-1	no_errors	ENST00000537855	ensembl	human	known	69_37n	silent	96	40.74	66	SNP	0.059	T
TSC22D1	8848	genome.wustl.edu	37	13	45148149	45148149	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AO-A0J8-01A-21D-A045-09	TCGA-AO-A0J8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24ba5501-8097-4af6-b12c-bb6dcbe10cac	a6efdded-0dee-4407-a1b2-bdfdb1649a07	g.chr13:45148149G>A	ENST00000458659.2	-	1	2552	c.2062C>T	c.(2062-2064)Cag>Tag	p.Q688*	TSC22D1_ENST00000501704.2_Intron|TSC22D1_ENST00000460842.1_5'Flank	NM_183422.3	NP_904358.2	Q15714	T22D1_HUMAN	TSC22 domain family, member 1	688	Gln-rich.				negative regulation of apoptotic process (GO:0043066)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_hematologic(4;8.74e-08)|Acute lymphoblastic leukemia(4;1.78e-07)|Lung NSC(96;2.21e-05)|Breast(139;0.000625)|Prostate(109;0.000947)|Hepatocellular(98;0.0202)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;0.000522)|BRCA - Breast invasive adenocarcinoma(63;0.118)		CCCTGTGGCTGAGCCACAGGA	0.577																																						dbGAP											0													41.0	45.0	44.0					13																	45148149		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AJ222700	CCDS9392.1, CCDS31966.1, CCDS58291.1, CCDS73565.1	13q14	2008-02-05	2005-03-01	2005-03-03	ENSG00000102804	ENSG00000102804			16826	protein-coding gene	gene with protein product		607715	"""transforming growth factor beta 1 induced transcript 4"""	TGFB1I4		8651929, 9022669	Standard	NM_183422		Approved	TSC22, MGC17597	uc001uzn.4	Q15714	OTTHUMG00000016838	ENST00000458659.2:c.2062C>T	13.37:g.45148149G>A	ENSP00000397435:p.Gln688*		B3KRL7|B9EGI0|O00666|Q6AHX5|Q6IBU1|Q8NCN1|Q96JS5	Nonsense_Mutation	SNP	pfam_TSC-22_Dip_Bun	p.Q688*	ENST00000458659.2	37	c.2062	CCDS31966.1	13	.	.	.	.	.	.	.	.	.	.	G	43	10.158751	0.99349	.	.	ENSG00000102804	ENST00000458659	.	.	.	4.74	4.74	0.60224	.	0.000000	0.53938	D	0.000056	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	.	16.897	0.86102	0.0:0.0:1.0:0.0	.	.	.	.	X	688	.	ENSP00000397435:Q688X	Q	-	1	0	TSC22D1	44046149	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	6.263000	0.72521	2.466000	0.83321	0.491000	0.48974	CAG	TSC22D1	-	NULL	ENSG00000102804		0.577	TSC22D1-001	KNOWN	basic|CCDS	protein_coding	TSC22D1	HGNC	protein_coding	OTTHUMT00000044743.2	18	0.00	0	G	NM_006022		45148149	45148149	-1	no_errors	ENST00000458659	ensembl	human	known	69_37n	nonsense	20	28.57	8	SNP	1.000	A
TUBBP5	643224	genome.wustl.edu	37	9	141071078	141071078	+	RNA	SNP	A	A	G	rs201043758	byFrequency	TCGA-AO-A0J8-01A-21D-A045-09	TCGA-AO-A0J8-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24ba5501-8097-4af6-b12c-bb6dcbe10cac	a6efdded-0dee-4407-a1b2-bdfdb1649a07	g.chr9:141071078A>G	ENST00000503395.1	+	0	1735									tubulin, beta pseudogene 5									p.M233V(7)									GTCTGCTACCATGAGTGGGGT	0.552																																						dbGAP											7	Substitution - Missense(7)	endometrium(4)|kidney(2)|ovary(1)																																								-	-	-			0			AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141071078A>G				RNA	SNP	-	NULL	ENST00000503395.1	37	NULL		9																																																																																			TUBBP5	-	-	ENSG00000159247		0.552	TUBBP5-003	KNOWN	basic	processed_transcript	TUBBP5	HGNC	pseudogene	OTTHUMT00000373087.1	44	0.00	0	A	NR_027156		141071078	141071078	+1	no_errors	ENST00000290377	ensembl	human	known	69_37n	rna	15	21.05	4	SNP	1.000	G
WBSCR17	64409	genome.wustl.edu	37	7	70597969	70597969	+	Missense_Mutation	SNP	G	G	T			TCGA-AO-A0J8-01A-21D-A045-09	TCGA-AO-A0J8-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24ba5501-8097-4af6-b12c-bb6dcbe10cac	a6efdded-0dee-4407-a1b2-bdfdb1649a07	g.chr7:70597969G>T	ENST00000333538.5	+	1	815	c.181G>T	c.(181-183)Gat>Tat	p.D61Y		NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	61					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				CCCCATCCAGGATGCGGTCCT	0.726																																						dbGAP											0													17.0	18.0	18.0					7																	70597969		2198	4292	6490	-	-	-	SO:0001583	missense	0			AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.181G>T	7.37:g.70597969G>T	ENSP00000329654:p.Asp61Tyr		Q8NFV9|Q9NTA8	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.D61Y	ENST00000333538.5	37	c.181	CCDS5540.1	7	.	.	.	.	.	.	.	.	.	.	G	21.8	4.201124	0.79015	.	.	ENSG00000185274	ENST00000333538	T	0.56444	0.46	4.97	4.97	0.65823	.	0.552811	0.15945	N	0.237013	T	0.47746	0.1462	L	0.29908	0.895	0.58432	D	0.999992	P	0.39624	0.681	B	0.40782	0.34	T	0.53107	-0.8485	10	0.62326	D	0.03	.	17.4061	0.87474	0.0:0.0:1.0:0.0	.	61	Q6IS24	GLTL3_HUMAN	Y	61	ENSP00000329654:D61Y	ENSP00000329654:D61Y	D	+	1	0	WBSCR17	70235905	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.639000	0.83342	2.581000	0.87130	0.655000	0.94253	GAT	WBSCR17	-	NULL	ENSG00000185274		0.726	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBSCR17	HGNC	protein_coding	OTTHUMT00000252006.1	11	0.00	0	G	NM_022479		70597969	70597969	+1	no_errors	ENST00000333538	ensembl	human	known	69_37n	missense	15	40.00	10	SNP	1.000	T
ZNF613	79898	genome.wustl.edu	37	19	52448195	52448195	+	Silent	SNP	C	C	T			TCGA-AO-A0J8-01A-21D-A045-09	TCGA-AO-A0J8-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24ba5501-8097-4af6-b12c-bb6dcbe10cac	a6efdded-0dee-4407-a1b2-bdfdb1649a07	g.chr19:52448195C>T	ENST00000293471.6	+	6	1738	c.1059C>T	c.(1057-1059)ttC>ttT	p.F353F	ZNF613_ENST00000601794.1_3'UTR|ZNF613_ENST00000391794.4_Silent_p.F317F	NM_001031721.3	NP_001026891.2	Q6PF04	ZN613_HUMAN	zinc finger protein 613	353					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	19		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.0183)		ACAAAGCATTCCGCTGGAAAT	0.458																																						dbGAP											0													97.0	97.0	97.0					19																	52448195		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK027565	CCDS12844.1, CCDS33089.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	25827	protein-coding gene	gene with protein product						12477932	Standard	NM_001031721		Approved	FLJ13590	uc002pxz.2	Q6PF04		ENST00000293471.6:c.1059C>T	19.37:g.52448195C>T			Q96SS9	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F353	ENST00000293471.6	37	c.1059	CCDS33089.1	19																																																																																			ZNF613	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000176024		0.458	ZNF613-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF613	HGNC	protein_coding	OTTHUMT00000461104.2	250	0.00	0	C	NM_024840		52448195	52448195	+1	no_errors	ENST00000293471	ensembl	human	known	69_37n	silent	109	34.73	58	SNP	0.998	T
