#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCC3	8714	genome.wustl.edu	37	17	48750941	48750941	+	Missense_Mutation	SNP	C	C	A	rs200941858		TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr17:48750941C>A	ENST00000285238.8	+	19	2601	c.2521C>A	c.(2521-2523)Cgc>Agc	p.R841S		NM_003786.3	NP_003777.2	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 3	841	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Doxorubicin(DB00997)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indomethacin(DB00328)|Lamivudine(DB00709)|Leucovorin(DB00650)|Methotrexate(DB00563)|Metyrapone(DB01011)|Nifedipine(DB01115)|Omeprazole(DB00338)|Phenobarbital(DB01174)|Probenecid(DB01032)|Rifampicin(DB01045)|Sulfinpyrazone(DB01138)|Verapamil(DB00661)|Vincristine(DB00541)	CCTGCTGCAGCGCAACGGCTC	0.602																																						dbGAP											0													117.0	102.0	107.0					17																	48750941		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y17151	CCDS32681.1, CCDS45739.1	17q21	2012-03-14			ENSG00000108846	ENSG00000108846		"""ATP binding cassette transporters / subfamily C"""	54	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter 2"""	604323				8894702, 9827529	Standard	NM_003786		Approved	MRP3, cMOAT2, EST90757, MLP2, MOAT-D	uc002isl.3	O15438	OTTHUMG00000162245	ENST00000285238.8:c.2521C>A	17.37:g.48750941C>A	ENSP00000285238:p.Arg841Ser		B2RPA9|D3DTX9|O60265|O60922|O75621|O95078|O95289|O95290|Q86X85|Q9UN52	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1,tigrfam_Multidrug-R_assoc	p.R841S	ENST00000285238.8	37	c.2521	CCDS32681.1	17	.	.	.	.	.	.	.	.	.	.	C	7.415	0.635570	0.14322	.	.	ENSG00000108846	ENST00000285238	T	0.78481	-1.18	4.83	2.75	0.32379	ABC transporter-like (1);	0.225560	0.38217	N	0.001775	T	0.51856	0.1699	N	0.02420	-0.555	0.24640	N	0.993576	B	0.21606	0.058	B	0.18263	0.021	T	0.47484	-0.9114	10	0.40728	T	0.16	-4.2136	10.6447	0.45613	0.0:0.7937:0.1328:0.0735	.	841	O15438	MRP3_HUMAN	S	841	ENSP00000285238:R841S	ENSP00000285238:R841S	R	+	1	0	ABCC3	46105940	0.023000	0.18921	0.089000	0.20774	0.071000	0.16799	2.536000	0.45693	0.665000	0.31066	-0.254000	0.11334	CGC	ABCC3	-	pfscan_ABC_transporter-like,tigrfam_Multidrug-R_assoc	ENSG00000108846		0.602	ABCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC3	HGNC	protein_coding	OTTHUMT00000368083.2	52	0.00	0	C	NM_020038		48750941	48750941	+1	no_errors	ENST00000285238	ensembl	human	known	69_37n	missense	31	20.51	8	SNP	0.882	A
ADAM23	8745	genome.wustl.edu	37	2	207435499	207435499	+	Silent	SNP	G	G	T			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr2:207435499G>T	ENST00000264377.3	+	16	1858	c.1530G>T	c.(1528-1530)gtG>gtT	p.V510V	ADAM23_ENST00000374416.1_Silent_p.V510V|ADAM23_ENST00000374415.3_Silent_p.V510V	NM_003812.2	NP_003803.1	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23	510	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				cell adhesion (GO:0007155)|central nervous system development (GO:0007417)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(6)|kidney(3)|large_intestine(5)|liver(2)|lung(22)|ovary(2)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	51				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		ATGGATACGTGGAAGCTGGGG	0.403																																					Melanoma(194;1127 2130 19620 24042 27855)	dbGAP											0													223.0	201.0	209.0					2																	207435499		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB009672	CCDS2369.1	2q33	2008-06-12	2005-08-18		ENSG00000114948	ENSG00000114948		"""ADAM metallopeptidase domain containing"""	202	protein-coding gene	gene with protein product		603710	"""a disintegrin and metalloproteinase domain 23"""			9693107	Standard	NM_003812		Approved	MDC3	uc002vbq.4	O75077	OTTHUMG00000132919	ENST00000264377.3:c.1530G>T	2.37:g.207435499G>T			A2RU59	Silent	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B	p.V510	ENST00000264377.3	37	c.1530	CCDS2369.1	2																																																																																			ADAM23	-	pfscan_Blood-coag_inhib_Disintegrin	ENSG00000114948		0.403	ADAM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADAM23	HGNC	protein_coding	OTTHUMT00000256431.2	127	0.00	0	G	NM_003812		207435499	207435499	+1	no_errors	ENST00000264377	ensembl	human	known	69_37n	silent	47	17.54	10	SNP	0.999	T
ADAMTSL1	92949	genome.wustl.edu	37	9	18888027	18888027	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr9:18888027C>A	ENST00000380548.4	+	24	4787	c.4448C>A	c.(4447-4449)tCt>tAt	p.S1483Y	ADAMTSL1_ENST00000380545.5_Missense_Mutation_p.S184Y	NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	1483	Ig-like C2-type 4.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		CAGAAGGCATCTTTAGTGATC	0.473																																						dbGAP											0													61.0	58.0	59.0					9																	18888027		1913	4137	6050	-	-	-	SO:0001583	missense	0			AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.4448C>A	9.37:g.18888027C>A	ENSP00000369921:p.Ser1483Tyr		A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.S184Y	ENST00000380548.4	37	c.551	CCDS47954.1	9	.	.	.	.	.	.	.	.	.	.	C	0.063	-1.218948	0.01542	.	.	ENSG00000178031	ENST00000380548;ENST00000380545;ENST00000316239;ENST00000380541;ENST00000380538	T;T;T	0.69306	-0.39;-0.39;-0.39	5.5	4.6	0.57074	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.507098	0.21106	N	0.080071	T	0.56108	0.1963	L	0.53780	1.695	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.09377	0.002;0.004	T	0.41805	-0.9488	10	0.21540	T	0.41	.	6.728	0.23367	0.144:0.7106:0.0:0.1454	.	184;1483	Q8N6G6-6;Q8N6G6	.;ATL1_HUMAN	Y	1483;184;187;187;85	ENSP00000369921:S1483Y;ENSP00000369918:S184Y;ENSP00000369911:S85Y	ENSP00000325584:S187Y	S	+	2	0	ADAMTSL1	18878027	0.986000	0.35501	0.072000	0.20136	0.879000	0.50718	1.992000	0.40737	1.454000	0.47793	0.655000	0.94253	TCT	ADAMTSL1	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000178031		0.473	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	ADAMTSL1	HGNC	protein_coding	OTTHUMT00000401206.1	44	0.00	0	C			18888027	18888027	+1	no_errors	ENST00000388710	ensembl	human	known	69_37n	missense	20	23.08	6	SNP	0.025	A
AMBRA1	55626	genome.wustl.edu	37	11	46564000	46564000	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr11:46564000C>A	ENST00000458649.2	-	7	1985	c.1567G>T	c.(1567-1569)Gaa>Taa	p.E523*	AMBRA1_ENST00000533727.1_Nonsense_Mutation_p.E433*|AMBRA1_ENST00000426438.1_Nonsense_Mutation_p.E523*|AMBRA1_ENST00000314845.3_Nonsense_Mutation_p.E433*|AMBRA1_ENST00000528950.1_Nonsense_Mutation_p.E523*|AMBRA1_ENST00000298834.3_Nonsense_Mutation_p.E523*|AMBRA1_ENST00000534300.1_Nonsense_Mutation_p.E523*			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	523					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		TGGGGAGCTTCCCCACTCAGG	0.557																																						dbGAP											0													61.0	60.0	60.0					11																	46564000		2201	4299	6500	-	-	-	SO:0001587	stop_gained	0			AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.1567G>T	11.37:g.46564000C>A	ENSP00000415327:p.Glu523*		A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Nonsense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E523*	ENST00000458649.2	37	c.1567		11	.	.	.	.	.	.	.	.	.	.	C	38	7.021075	0.98006	.	.	ENSG00000110497	ENST00000314845;ENST00000533727;ENST00000534300;ENST00000426438;ENST00000298834;ENST00000314823;ENST00000458649;ENST00000528950	.	.	.	5.85	5.85	0.93711	.	0.170313	0.52532	D	0.000069	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	20.1605	0.98131	0.0:1.0:0.0:0.0	.	.	.	.	X	433;433;523;523;523;433;523;523	.	ENSP00000298834:E523X	E	-	1	0	AMBRA1	46520576	1.000000	0.71417	0.918000	0.36340	0.779000	0.44077	2.811000	0.47986	2.756000	0.94617	0.655000	0.94253	GAA	AMBRA1	-	NULL	ENSG00000110497		0.557	AMBRA1-005	KNOWN	basic	protein_coding	AMBRA1	HGNC	protein_coding	OTTHUMT00000390103.1	42	0.00	0	C	NM_017749		46564000	46564000	-1	no_errors	ENST00000458649	ensembl	human	known	69_37n	nonsense	35	12.50	5	SNP	0.617	A
ATM	472	genome.wustl.edu	37	11	108196269	108196269	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr11:108196269C>T	ENST00000452508.2	+	47	6994	c.6805C>T	c.(6805-6807)Cag>Tag	p.Q2269*	C11orf65_ENST00000525729.1_Intron|ATM_ENST00000278616.4_Nonsense_Mutation_p.Q2269*			Q13315	ATM_HUMAN	ATM serine/threonine kinase	2269	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	CAAGAACACTCAGGTAAATAC	0.338			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																												dbGAP	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	0													68.0	66.0	67.0					11																	108196269		2201	4298	6499	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.6805C>T	11.37:g.108196269C>T	ENSP00000388058:p.Gln2269*		B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Nonsense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.Q2269*	ENST00000452508.2	37	c.6805	CCDS31669.1	11	.	.	.	.	.	.	.	.	.	.	C	49	15.225135	0.99827	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	.	.	.	5.41	4.49	0.54785	.	0.050798	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	16.4429	0.83907	0.0:0.8683:0.1317:0.0	.	.	.	.	X	2269	.	ENSP00000278616:Q2269X	Q	+	1	0	ATM	107701479	1.000000	0.71417	1.000000	0.80357	0.793000	0.44817	5.368000	0.66133	1.394000	0.46624	-0.175000	0.13238	CAG	ATM	-	pfam_PIK-rel_kinase_FAT,superfamily_ARM-type_fold,pfscan_PIK_FAT	ENSG00000149311		0.338	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	HGNC	protein_coding	OTTHUMT00000389938.1	44	0.00	0	C	NM_000051		108196269	108196269	+1	no_errors	ENST00000278616	ensembl	human	known	69_37n	nonsense	31	39.22	20	SNP	1.000	T
CABS1	85438	genome.wustl.edu	37	4	71201597	71201597	+	Missense_Mutation	SNP	C	C	T	rs182023781	byFrequency	TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr4:71201597C>T	ENST00000273936.5	+	1	915	c.841C>T	c.(841-843)Cgg>Tgg	p.R281W		NM_033122.3	NP_149113.3	Q96KC9	CABS1_HUMAN	calcium-binding protein, spermatid-specific 1	281					spermatogenesis (GO:0007283)	mitochondrial inner membrane (GO:0005743)|motile cilium (GO:0031514)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(4)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						CAAAGATAAACGGGAAGATAC	0.423													C|||	9	0.00179712	0.0	0.0	5008	,	,		21884	0.0089		0.0	False		,,,				2504	0.0					dbGAP											0													98.0	94.0	95.0					4																	71201597		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF380838	CCDS3539.1	4q13.3	2013-10-11	2011-01-25	2011-01-25	ENSG00000145309	ENSG00000145309			30710	protein-coding gene	gene with protein product	"""casein-like phosphoprotein"""		"""chromosome 4 open reading frame 35"""	C4orf35		19208547, 19271754	Standard	NM_033122		Approved	NYD-SP26, FLJ32897, CLPH	uc003hff.3	Q96KC9	OTTHUMG00000129405	ENST00000273936.5:c.841C>T	4.37:g.71201597C>T	ENSP00000273936:p.Arg281Trp		B2RCB5|Q86UE0|Q96M17	Missense_Mutation	SNP	NULL	p.R281W	ENST00000273936.5	37	c.841	CCDS3539.1	4	5	0.0022893772893772895	0	0.0	0	0.0	5	0.008741258741258742	0	0.0	C	3.490	-0.104154	0.06967	.	.	ENSG00000145309	ENST00000273936	T	0.22539	1.95	4.57	0.745	0.18359	.	1.053410	0.07537	N	0.913133	T	0.08980	0.0222	N	0.08118	0	0.09310	N	1	B	0.32653	0.379	B	0.36186	0.219	T	0.37957	-0.9683	10	0.72032	D	0.01	-29.3333	8.1306	0.31024	0.0:0.4444:0.4658:0.0898	.	281	Q96KC9	CABS1_HUMAN	W	281	ENSP00000273936:R281W	ENSP00000273936:R281W	R	+	1	2	CABS1	71236186	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	-1.259000	0.02861	-0.008000	0.14320	-0.878000	0.02970	CGG	CABS1	-	NULL	ENSG00000145309		0.423	CABS1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	CABS1	HGNC	protein_coding	OTTHUMT00000251561.3	46	0.00	0	C	NM_033122		71201597	71201597	+1	no_errors	ENST00000273936	ensembl	human	known	69_37n	missense	30	21.05	8	SNP	0.001	T
CACNA1E	777	genome.wustl.edu	37	1	181767626	181767626	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr1:181767626C>A	ENST00000367573.2	+	48	6598	c.6598C>A	c.(6598-6600)Ctg>Atg	p.L2200M	CACNA1E_ENST00000357570.5_Missense_Mutation_p.L2151M|CACNA1E_ENST00000358338.5_Missense_Mutation_p.L2089M|CACNA1E_ENST00000367567.4_Missense_Mutation_p.L1764M|CACNA1E_ENST00000367570.1_Missense_Mutation_p.L2157M|CACNA1E_ENST00000526775.1_Missense_Mutation_p.L2138M|CACNA1E_ENST00000360108.3_Missense_Mutation_p.L2181M	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	2200					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						CTCCCAAGCTCTGGAGAGCAA	0.622																																						dbGAP											0													56.0	66.0	63.0					1																	181767626		2124	4246	6370	-	-	-	SO:0001583	missense	0			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.6598C>A	1.37:g.181767626C>A	ENSP00000356545:p.Leu2200Met		B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_HAND_2,prints_VDCCAlpha1,prints_VDCC_R_a1su	p.L2200M	ENST00000367573.2	37	c.6598	CCDS55664.1	1	.	.	.	.	.	.	.	.	.	.	C	14.41	2.527162	0.44969	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.97114	-4.16;-4.16;-4.07;-4.16;-4.25;-4.07;-4.07	5.55	5.55	0.83447	.	3.625390	0.00550	N	0.000245	D	0.96706	0.8925	L	0.29908	0.895	0.29871	N	0.826828	P;P	0.37276	0.589;0.589	B;B	0.44224	0.444;0.323	D	0.88309	0.2955	10	0.56958	D	0.05	.	18.3642	0.90385	0.0:1.0:0.0:0.0	.	2138;2157	Q15878-2;Q15878-3	.;.	M	2157;2138;2151;2089;1764;2181;2200	ENSP00000356542:L2157M;ENSP00000434814:L2138M;ENSP00000350183:L2151M;ENSP00000351101:L2089M;ENSP00000356539:L1764M;ENSP00000353222:L2181M;ENSP00000356545:L2200M	ENSP00000350183:L2151M	L	+	1	2	CACNA1E	180034249	0.917000	0.31117	0.914000	0.36105	0.740000	0.42216	2.606000	0.46291	2.618000	0.88619	0.558000	0.71614	CTG	CACNA1E	-	NULL	ENSG00000198216		0.622	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	HGNC	protein_coding	OTTHUMT00000090793.2	40	0.00	0	C	NM_000721		181767626	181767626	+1	no_errors	ENST00000367573	ensembl	human	known	69_37n	missense	24	22.58	7	SNP	0.964	A
CCDC88C	440193	genome.wustl.edu	37	14	91779543	91779543	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr14:91779543C>T	ENST00000389857.6	-	15	2703	c.2617G>A	c.(2617-2619)Gac>Aac	p.D873N		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	873					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				AGCTCCTTGTCCAGCGCGCGG	0.632																																						dbGAP											0													117.0	119.0	118.0					14																	91779543		2119	4231	6350	-	-	-	SO:0001583	missense	0				CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.2617G>A	14.37:g.91779543C>T	ENSP00000374507:p.Asp873Asn		Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Missense_Mutation	SNP	pfam_HOOK,superfamily_Prefoldin,superfamily_Fum_Rdtase/Succ_DH_flav-like_C	p.D873N	ENST00000389857.6	37	c.2617	CCDS45151.1	14	.	.	.	.	.	.	.	.	.	.	C	10.05	1.245345	0.22796	.	.	ENSG00000015133	ENST00000389857	T	0.13089	2.62	5.06	4.17	0.49024	.	0.124530	0.35320	U	0.003287	T	0.12902	0.0313	L	0.51422	1.61	0.80722	D	1	B	0.34103	0.437	B	0.30716	0.119	T	0.06972	-1.0797	10	0.19147	T	0.46	-37.8046	13.5628	0.61799	0.0:0.9244:0.0:0.0756	.	873	Q9P219	DAPLE_HUMAN	N	873	ENSP00000374507:D873N	ENSP00000374507:D873N	D	-	1	0	CCDC88C	90849296	1.000000	0.71417	1.000000	0.80357	0.640000	0.38277	2.402000	0.44521	1.132000	0.42129	0.561000	0.74099	GAC	CCDC88C	-	NULL	ENSG00000015133		0.632	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC88C	HGNC	protein_coding	OTTHUMT00000411650.1	75	0.00	0	C	XM_029353		91779543	91779543	-1	no_errors	ENST00000389857	ensembl	human	known	69_37n	missense	34	16.67	7	SNP	1.000	T
CEP192	55125	genome.wustl.edu	37	18	13056429	13056429	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr18:13056429C>G	ENST00000325971.8	+	17	3645	c.2052C>G	c.(2050-2052)tgC>tgG	p.C684W	CEP192_ENST00000430049.2_Missense_Mutation_p.C805W|CEP192_ENST00000506447.1_Missense_Mutation_p.C1280W			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	684					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						TGCCTCAGTGCCATGCTGGCA	0.557																																						dbGAP											0													95.0	80.0	85.0					18																	13056429		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.2052C>G	18.37:g.13056429C>G	ENSP00000317156:p.Cys684Trp		A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Missense_Mutation	SNP	NULL	p.C1280W	ENST00000325971.8	37	c.3840		18	.	.	.	.	.	.	.	.	.	.	C	5.414	0.261512	0.10239	.	.	ENSG00000101639	ENST00000506447;ENST00000325971;ENST00000399863;ENST00000430049	T;T;T	0.26223	1.75;1.75;1.75	4.71	2.74	0.32292	.	0.205916	0.35124	N	0.003422	T	0.39911	0.1096	L	0.54323	1.7	0.43902	D	0.99653	D;D;D	0.89917	0.998;0.999;1.0	P;D;D	0.70935	0.867;0.947;0.971	T	0.06643	-1.0815	10	0.39692	T	0.17	-7.3495	9.0501	0.36372	0.0:0.726:0.0:0.274	.	805;1280;684	C9JT09;E9PF99;Q8TEP8	.;.;CE192_HUMAN	W	1280;684;684;805	ENSP00000427550:C1280W;ENSP00000317156:C684W;ENSP00000389190:C805W	ENSP00000317156:C684W	C	+	3	2	CEP192	13046429	0.005000	0.15991	0.203000	0.23512	0.007000	0.05969	0.264000	0.18497	0.611000	0.30052	-0.797000	0.03246	TGC	CEP192	-	NULL	ENSG00000101639		0.557	CEP192-201	KNOWN	basic	protein_coding	CEP192	HGNC	protein_coding		77	0.00	0	C	NM_032142		13056429	13056429	+1	no_errors	ENST00000506447	ensembl	human	known	69_37n	missense	26	31.58	12	SNP	0.598	G
CNNM4	26504	genome.wustl.edu	37	2	97427918	97427918	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr2:97427918C>A	ENST00000377075.2	+	1	1280	c.1182C>A	c.(1180-1182)ttC>ttA	p.F394L		NM_020184.3	NP_064569.3	Q6P4Q7	CNNM4_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 4	394	CBS 1. {ECO:0000255|PROSITE- ProRule:PRU00703}.				biomineral tissue development (GO:0031214)|ion transport (GO:0006811)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)			breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)	20						TCCTGGACTTCAACACCATGT	0.502																																						dbGAP											0													107.0	95.0	99.0					2																	97427918		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046812	CCDS2024.2	2q11.2	2014-08-08	2014-08-07		ENSG00000158158	ENSG00000158158			105	protein-coding gene	gene with protein product		607805	"""cyclin M4"""	ACDP4		21393841, 24194943	Standard	XM_005263914		Approved	KIAA1592	uc002swx.3	Q6P4Q7	OTTHUMG00000130532	ENST00000377075.2:c.1182C>A	2.37:g.97427918C>A	ENSP00000366275:p.Phe394Leu		B7Z1U0|C7SQM3|C7SQM4|C7SQM5|Q53RE5|Q9H9G3|Q9HCI0|Q9NRN1	Missense_Mutation	SNP	pfam_DUF21,pfam_Cysta_beta_synth_core,superfamily_cNMP-bd-like,pfscan_cNMP-bd_dom	p.F394L	ENST00000377075.2	37	c.1182	CCDS2024.2	2	.	.	.	.	.	.	.	.	.	.	C	14.37	2.514292	0.44763	.	.	ENSG00000158158	ENST00000377075	T	0.73469	-0.75	4.91	3.81	0.43845	Cystathionine beta-synthase, core (1);	0.000000	0.85682	D	0.000000	D	0.83133	0.5188	M	0.73962	2.25	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	D	0.84394	0.0556	10	0.87932	D	0	-11.5124	9.5849	0.39510	0.0:0.8148:0.0:0.1852	.	394	Q6P4Q7	CNNM4_HUMAN	L	394	ENSP00000366275:F394L	ENSP00000366275:F394L	F	+	3	2	CNNM4	96791645	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	3.295000	0.51794	2.265000	0.75225	0.655000	0.94253	TTC	CNNM4	-	NULL	ENSG00000158158		0.502	CNNM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNNM4	HGNC	protein_coding	OTTHUMT00000252954.1	68	0.00	0	C	NM_020184		97427918	97427918	+1	no_errors	ENST00000377075	ensembl	human	known	69_37n	missense	40	13.04	6	SNP	1.000	A
CNTLN	54875	genome.wustl.edu	37	9	17416099	17416099	+	Missense_Mutation	SNP	T	T	G			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr9:17416099T>G	ENST00000380647.3	+	18	3110	c.3026T>G	c.(3025-3027)gTt>gGt	p.V1009G	CNTLN_ENST00000425824.1_Missense_Mutation_p.V1009G|CNTLN_ENST00000262360.5_Missense_Mutation_p.V1009G			Q9NXG0	CNTLN_HUMAN	centlein, centrosomal protein	1009					centriole-centriole cohesion (GO:0010457)|protein localization to organelle (GO:0033365)	centriole (GO:0005814)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)|protein binding, bridging (GO:0030674)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(6)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53				GBM - Glioblastoma multiforme(50;6.14e-10)		GAATTGTCTGTTAAAGAATAT	0.343																																						dbGAP											0													85.0	81.0	83.0					9																	17416099		1823	4085	5908	-	-	-	SO:0001583	missense	0			AK000283	CCDS43789.1, CCDS47953.1	9p22.2-p22.1	2008-11-11	2008-02-08	2008-02-08	ENSG00000044459	ENSG00000044459			23432	protein-coding gene	gene with protein product		611870	"""chromosome 9 open reading frame 101"", ""chromosome 9 open reading frame 39"""	C9orf101, C9orf39		18086554	Standard	XM_005251492		Approved	FLJ20276, bA340N12.1, OTTHUMG00000019597	uc003zmy.3	Q9NXG0	OTTHUMG00000019599	ENST00000380647.3:c.3026T>G	9.37:g.17416099T>G	ENSP00000370021:p.Val1009Gly		A5Z2X6|Q5VYJ0|Q8N1G9|Q9HAJ5	Missense_Mutation	SNP	superfamily_Prefoldin	p.V1009G	ENST00000380647.3	37	c.3026	CCDS43789.1	9	.	.	.	.	.	.	.	.	.	.	T	14.06	2.422747	0.43020	.	.	ENSG00000044459	ENST00000380647;ENST00000425824;ENST00000262360	T;T;T	0.19394	2.15;2.15;2.4	4.98	1.35	0.21983	.	.	.	.	.	T	0.19046	0.0457	L	0.54323	1.7	0.34950	D	0.751185	P;B;B	0.34724	0.465;0.16;0.16	B;B;B	0.36766	0.232;0.118;0.118	T	0.18085	-1.0348	9	0.30854	T	0.27	.	7.4211	0.27073	0.0:0.2612:0.0:0.7388	.	1009;1009;1009	Q9NXG0;C9J1F9;Q9NXG0-2	CNTLN_HUMAN;.;.	G	1009	ENSP00000370021:V1009G;ENSP00000392798:V1009G;ENSP00000262360:V1009G	ENSP00000262360:V1009G	V	+	2	0	CNTLN	17406099	0.922000	0.31269	0.953000	0.39169	0.975000	0.68041	1.365000	0.34182	0.044000	0.15775	-0.456000	0.05471	GTT	CNTLN	-	NULL	ENSG00000044459		0.343	CNTLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNTLN	HGNC	protein_coding	OTTHUMT00000051793.3	46	0.00	0	T	NM_017738		17416099	17416099	+1	no_errors	ENST00000380647	ensembl	human	known	69_37n	missense	31	18.42	7	SNP	0.877	G
CPNE4	131034	genome.wustl.edu	37	3	131293958	131293958	+	Missense_Mutation	SNP	G	G	T	rs267599609		TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr3:131293958G>T	ENST00000512055.1	-	14	3010	c.884C>A	c.(883-885)tCt>tAt	p.S295Y	CPNE4_ENST00000502818.1_Missense_Mutation_p.S313Y|CPNE4_ENST00000429747.1_Missense_Mutation_p.S295Y|CPNE4_ENST00000512332.1_Missense_Mutation_p.S313Y|CPNE4_ENST00000511604.1_Missense_Mutation_p.S295Y			Q96A23	CPNE4_HUMAN	copine IV	295						extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|liver(1)|lung(16)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	39						GTCCAAGAAAGAATGCATCTT	0.418																																						dbGAP											0													132.0	117.0	123.0					3																	131293958		2203	4300	6503	-	-	-	SO:0001583	missense	0			H29499	CCDS3072.1, CCDS75010.1	3q22.1	2014-09-04			ENSG00000196353	ENSG00000196353			2317	protein-coding gene	gene with protein product	"""copine 8"""	604208				9430674, 12670487	Standard	XM_005247107		Approved	COPN4, CPN4	uc003eok.3	Q96A23	OTTHUMG00000159631	ENST00000512055.1:c.884C>A	3.37:g.131293958G>T	ENSP00000421705:p.Ser295Tyr		D3DNC5|Q8TEX1	Missense_Mutation	SNP	pfam_Copine,pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_VWF_A,pfscan_C2_membr_targeting	p.S313Y	ENST00000512055.1	37	c.938	CCDS3072.1	3	.	.	.	.	.	.	.	.	.	.	G	24.1	4.489628	0.84962	.	.	ENSG00000196353	ENST00000512055;ENST00000429747;ENST00000512332;ENST00000511604;ENST00000502818	T;T;T;T;T	0.58358	0.35;0.35;0.34;0.35;0.34	5.73	5.73	0.89815	.	0.101842	0.64402	D	0.000001	T	0.73931	0.3650	M	0.93594	3.435	0.80722	D	1	P;P	0.51537	0.946;0.849	P;P	0.50537	0.576;0.643	T	0.81400	-0.0950	10	0.87932	D	0	-17.4795	19.0305	0.92955	0.0:0.0:1.0:0.0	.	313;295	Q96A23-2;Q96A23	.;CPNE4_HUMAN	Y	295;295;313;295;313	ENSP00000421705:S295Y;ENSP00000411904:S295Y;ENSP00000424853:S313Y;ENSP00000423811:S295Y;ENSP00000421646:S313Y	ENSP00000411904:S295Y	S	-	2	0	CPNE4	132776648	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	8.543000	0.90651	2.861000	0.98227	0.655000	0.94253	TCT	CPNE4	-	NULL	ENSG00000196353		0.418	CPNE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE4	HGNC	protein_coding	OTTHUMT00000356583.4	80	0.00	0	G	NM_130808		131293958	131293958	-1	no_errors	ENST00000502818	ensembl	human	known	69_37n	missense	89	11.00	11	SNP	1.000	T
CSMD3	114788	genome.wustl.edu	37	8	113988070	113988070	+	Silent	SNP	A	A	G			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr8:113988070A>G	ENST00000297405.5	-	7	1582	c.1338T>C	c.(1336-1338)caT>caC	p.H446H	CSMD3_ENST00000455883.2_Intron|CSMD3_ENST00000352409.3_Silent_p.H446H|CSMD3_ENST00000343508.3_Silent_p.H406H	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	446						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CAATACCTCTATGAGTAACAA	0.398										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												dbGAP											0													175.0	174.0	174.0					8																	113988070		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.1338T>C	8.37:g.113988070A>G			Q96PZ3	Silent	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.H446	ENST00000297405.5	37	c.1338	CCDS6315.1	8																																																																																			CSMD3	-	NULL	ENSG00000164796		0.398	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	115	0.00	0	A	NM_052900		113988070	113988070	-1	no_errors	ENST00000297405	ensembl	human	known	69_37n	silent	69	45.24	57	SNP	1.000	G
DPH2	1802	genome.wustl.edu	37	1	44436697	44436697	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr1:44436697G>A	ENST00000255108.3	+	3	492	c.320G>A	c.(319-321)gGc>gAc	p.G107D	DPH2_ENST00000396758.2_Missense_Mutation_p.G107D|DPH2_ENST00000529729.1_3'UTR|DPH2_ENST00000412950.2_Intron	NM_001384.4	NP_001375.2	Q9BQC3	DPH2_HUMAN	DPH2 homolog (S. cerevisiae)	107					peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)	cytoplasm (GO:0005737)				autonomic_ganglia(1)|kidney(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(2)|skin(1)	19	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)				ATACATTTTGGCCCTGCCTGC	0.582																																						dbGAP											0													44.0	40.0	41.0					1																	44436697		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF053003	CCDS504.1, CCDS41314.1	1p34	2008-02-05	2005-06-03	2005-06-03	ENSG00000132768	ENSG00000132768			3004	protein-coding gene	gene with protein product		603456	"""diptheria toxin resistance protein required for diphthamide biosynthesis-like 2 (S. cerevisiae)"", ""DPH2-like 2 (S. cerevisiae)"""	DPH2L2		9782084, 15485916	Standard	XM_005270559		Approved		uc001ckz.3	Q9BQC3	OTTHUMG00000008295	ENST00000255108.3:c.320G>A	1.37:g.44436697G>A	ENSP00000255108:p.Gly107Asp		A8MVC9|B2RDE3|B4DNI8|O60623	Missense_Mutation	SNP	pfam_DPH1/DPH2,tigrfam_DPH1/DPH2,tigrfam_DHP2_eu	p.G107D	ENST00000255108.3	37	c.320	CCDS504.1	1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.964007	0.92791	.	.	ENSG00000132768	ENST00000255108;ENST00000396758	T;T	0.71461	-0.57;-0.57	4.65	4.65	0.58169	.	0.000000	0.85682	D	0.000000	D	0.87120	0.6098	M	0.90309	3.105	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90153	0.4222	10	0.87932	D	0	-17.4283	17.7155	0.88335	0.0:0.0:1.0:0.0	.	107;107	A8MVC9;Q9BQC3	.;DPH2_HUMAN	D	107	ENSP00000255108:G107D;ENSP00000379981:G107D	ENSP00000255108:G107D	G	+	2	0	DPH2	44209284	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.815000	0.75242	2.398000	0.81561	0.651000	0.88453	GGC	DPH2	-	pfam_DPH1/DPH2,tigrfam_DPH1/DPH2,tigrfam_DHP2_eu	ENSG00000132768		0.582	DPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPH2	HGNC	protein_coding	OTTHUMT00000022832.1	50	0.00	0	G	NM_001384		44436697	44436697	+1	no_errors	ENST00000255108	ensembl	human	known	69_37n	missense	17	37.93	11	SNP	1.000	A
FAM20B	9917	genome.wustl.edu	37	1	179019422	179019422	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr1:179019422G>A	ENST00000263733.4	+	3	722	c.386G>A	c.(385-387)cGa>cAa	p.R129Q		NM_014864.3	NP_055679.1	O75063	XYLK_HUMAN	family with sequence similarity 20, member B	129						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			breast(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(3)	14						AGGTATAGCCGAGACCATGTG	0.483																																						dbGAP											0													269.0	223.0	239.0					1																	179019422		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007944	CCDS1328.1	1q25.2	2013-04-29			ENSG00000116199	ENSG00000116199			23017	protein-coding gene	gene with protein product	"""glycosaminoglycan xylosylkinase"""	611063				9455484, 19473117	Standard	NM_014864		Approved	KIAA0475, GXK1	uc001gmc.3	O75063	OTTHUMG00000035073	ENST00000263733.4:c.386G>A	1.37:g.179019422G>A	ENSP00000263733:p.Arg129Gln		Q5W0C3|Q5W0C4	Missense_Mutation	SNP	pfam_DUF1193	p.R129Q	ENST00000263733.4	37	c.386	CCDS1328.1	1	.	.	.	.	.	.	.	.	.	.	G	37	5.980466	0.97168	.	.	ENSG00000116199	ENST00000440702;ENST00000263733	D	0.90620	-2.7	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	D	0.96009	0.8700	M	0.86502	2.82	0.80722	D	1	D	0.69078	0.997	D	0.67725	0.953	D	0.96022	0.9010	10	0.87932	D	0	-29.5343	20.139	0.98050	0.0:0.0:1.0:0.0	.	129	O75063	XYLK_HUMAN	Q	129	ENSP00000263733:R129Q	ENSP00000263733:R129Q	R	+	2	0	FAM20B	177286045	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.459000	0.97638	2.764000	0.94973	0.655000	0.94253	CGA	FAM20B	-	NULL	ENSG00000116199		0.483	FAM20B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM20B	HGNC	protein_coding	OTTHUMT00000084922.1	122	0.00	0	G	NM_014864		179019422	179019422	+1	no_errors	ENST00000263733	ensembl	human	known	69_37n	missense	59	10.61	7	SNP	1.000	A
GREM2	64388	genome.wustl.edu	37	1	240656696	240656696	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr1:240656696G>A	ENST00000318160.4	-	2	346	c.80C>T	c.(79-81)gCg>gTg	p.A27V		NM_022469.3	NP_071914.3	Q9H772	GREM2_HUMAN	gremlin 2, DAN family BMP antagonist	27					BMP signaling pathway (GO:0030509)|cytokine-mediated signaling pathway (GO:0019221)|determination of dorsal identity (GO:0048263)|embryonic body morphogenesis (GO:0010172)|regulation of cytokine activity (GO:0060300)|sequestering of BMP from receptor via BMP binding (GO:0038098)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	heparin binding (GO:0008201)			endometrium(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	10		all_cancers(173;0.0196)	OV - Ovarian serous cystadenocarcinoma(106;0.0123)			GATGGCGCCCGCCGGCCGGTT	0.622																																						dbGAP											0													13.0	15.0	14.0					1																	240656696		2150	4226	6376	-	-	-	SO:0001583	missense	0			AK024848	CCDS31070.1	1q43	2013-02-26	2013-02-26		ENSG00000180875	ENSG00000180875			17655	protein-coding gene	gene with protein product	"""protein related to DAN and cerberus"""	608832	"""gremlin 2, cysteine knot superfamily, homolog (Xenopus laevis)"", ""gremlin 2"""			15039429	Standard	XM_005273226		Approved	Prdc, FLJ21195, CKTSF1B2, DAND3	uc001hys.3	Q9H772	OTTHUMG00000039909	ENST00000318160.4:c.80C>T	1.37:g.240656696G>A	ENSP00000318650:p.Ala27Val		Q86UD9	Missense_Mutation	SNP	pfam_DAN,pfam_Cys_knot,smart_Cys_knot_C,pirsf_Gremlin_precursor,pfscan_Cys_knot_C	p.A27V	ENST00000318160.4	37	c.80	CCDS31070.1	1	.	.	.	.	.	.	.	.	.	.	G	15.49	2.849099	0.51270	.	.	ENSG00000180875	ENST00000318160	T	0.31769	1.48	5.15	3.29	0.37713	.	0.238371	0.35677	U	0.003041	T	0.19208	0.0461	L	0.44542	1.39	0.37482	D	0.916045	P	0.42337	0.776	B	0.28465	0.09	T	0.10019	-1.0648	10	0.34782	T	0.22	-26.5117	9.6324	0.39787	0.1615:0.0:0.8385:0.0	.	27	Q9H772	GREM2_HUMAN	V	27	ENSP00000318650:A27V	ENSP00000318650:A27V	A	-	2	0	GREM2	238723319	0.989000	0.36119	0.951000	0.38953	0.986000	0.74619	2.820000	0.48057	0.573000	0.29400	0.557000	0.71058	GCG	GREM2	-	pirsf_Gremlin_precursor	ENSG00000180875		0.622	GREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GREM2	HGNC	protein_coding	OTTHUMT00000096286.1	26	0.00	0	G	NM_022469		240656696	240656696	-1	no_errors	ENST00000318160	ensembl	human	known	69_37n	missense	14	22.22	4	SNP	0.971	A
GTF2A1	2957	genome.wustl.edu	37	14	81658982	81658982	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr14:81658982G>T	ENST00000553612.1	-	7	1217	c.814C>A	c.(814-816)Caa>Aaa	p.Q272K	GTF2A1_ENST00000434192.2_Missense_Mutation_p.Q233K	NM_001278940.1|NM_015859.3	NP_001265869.1|NP_056943.1	P52655	TF2AA_HUMAN	general transcription factor IIA, 1, 19/37kDa	272					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIIA complex (GO:0005672)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(234;0.0287)		CCATCAACTTGTAAGACCAAT	0.488																																						dbGAP											0													133.0	122.0	126.0					14																	81658982		2203	4300	6503	-	-	-	SO:0001583	missense	0			X75383	CCDS9873.1, CCDS9874.1	14q31	2010-03-23	2002-08-29					"""General transcription factors"""	4646	protein-coding gene	gene with protein product		600520	"""glucose regulated protein, 58kD pseudogene"""			8224848	Standard	NM_015859		Approved	TFIIA	uc001xvf.2	P52655		ENST00000553612.1:c.814C>A	14.37:g.81658982G>T	ENSP00000452454:p.Gln272Lys		Q3KNQ9	Missense_Mutation	SNP	pfam_TFIIA_asu/bsu,superfamily_TFIIA_b-brl,superfamily_TFIIA_a-hlx	p.Q272K	ENST00000553612.1	37	c.814	CCDS9873.1	14	.	.	.	.	.	.	.	.	.	.	G	21.5	4.158771	0.78226	.	.	ENSG00000165417	ENST00000553612;ENST00000344860;ENST00000434192	T;T	0.79247	-1.25;-1.25	5.26	4.37	0.52481	.	0.000000	0.85682	D	0.000000	D	0.88243	0.6384	M	0.87269	2.87	0.51482	D	0.999927	P	0.44776	0.843	P	0.61722	0.893	D	0.89109	0.3495	10	0.51188	T	0.08	-8.5056	14.082	0.64929	0.0728:0.0:0.9272:0.0	.	272	P52655	TF2AA_HUMAN	K	272;233;233	ENSP00000452454:Q272K;ENSP00000409492:Q233K	ENSP00000298173:Q272K	Q	-	1	0	GTF2A1	80728735	1.000000	0.71417	0.931000	0.37212	0.996000	0.88848	8.022000	0.88759	1.342000	0.45619	0.561000	0.74099	CAA	GTF2A1	-	pfam_TFIIA_asu/bsu	ENSG00000165417		0.488	GTF2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2A1	HGNC	protein_coding	OTTHUMT00000413309.1	89	0.00	0	G	NM_015859		81658982	81658982	-1	no_errors	ENST00000553612	ensembl	human	known	69_37n	missense	27	27.03	10	SNP	1.000	T
HHLA1	10086	genome.wustl.edu	37	8	133101771	133101771	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr8:133101771A>G	ENST00000414222.1	-	7	523	c.524T>C	c.(523-525)aTc>aCc	p.I175T	HHLA1_ENST00000434736.2_Missense_Mutation_p.I211T	NM_001145095.1	NP_001138567.1	C9JL84	HHLA1_HUMAN	HERV-H LTR-associating 1	175						extracellular region (GO:0005576)				endometrium(6)|kidney(1)|lung(2)|skin(1)|stomach(2)	12						ACCTGAGAGGATGGAGGTTGA	0.413																																						dbGAP											0													155.0	137.0	143.0					8																	133101771		692	1591	2283	-	-	-	SO:0001583	missense	0			AF110315		8q24	2011-03-01			ENSG00000132297	ENSG00000132297			4904	protein-coding gene	gene with protein product		604109		PLA2L		10329003	Standard	NM_001145095		Approved		uc011liy.1	C9JL84	OTTHUMG00000140390	ENST00000414222.1:c.524T>C	8.37:g.133101771A>G	ENSP00000388322:p.Ile175Thr			Missense_Mutation	SNP	NULL	p.I175T	ENST00000414222.1	37	c.524		8	.	.	.	.	.	.	.	.	.	.	A	20.6	4.024557	0.75390	.	.	ENSG00000132297	ENST00000414222;ENST00000434736	.	.	.	5.43	5.43	0.79202	.	.	.	.	.	T	0.65471	0.2694	L	0.34521	1.04	0.36534	D	0.870928	D	0.76494	0.999	D	0.65443	0.935	T	0.74009	-0.3802	8	0.87932	D	0	.	14.9676	0.71208	1.0:0.0:0.0:0.0	.	175	C9JL84	HHLA1_HUMAN	T	175;211	.	ENSP00000388322:I175T	I	-	2	0	HHLA1	133170953	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.171000	0.77595	2.197000	0.70478	0.533000	0.62120	ATC	HHLA1	-	NULL	ENSG00000132297		0.413	HHLA1-201	KNOWN	basic|appris_principal	protein_coding	HHLA1	HGNC	protein_coding		72	0.00	0	A	XR_017860		133101771	133101771	-1	no_errors	ENST00000414222	ensembl	human	known	69_37n	missense	71	21.11	19	SNP	1.000	G
HTR1F	3355	genome.wustl.edu	37	3	88039993	88039993	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr3:88039993G>A	ENST00000319595.4	+	1	148	c.94G>A	c.(94-96)Ggg>Agg	p.G32R		NM_000866.3	NP_000857.1	P30939	5HT1F_HUMAN	5-hydroxytryptamine (serotonin) receptor 1F, G protein-coupled	32					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.G32W(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(8;0.147)	Lung NSC(201;0.0283)		LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00664)	Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Ketamine(DB01221)|Methysergide(DB00247)|Mianserin(DB06148)|Naratriptan(DB00952)|Rizatriptan(DB00953)|Sumatriptan(DB00669)|Zolmitriptan(DB00315)	CACTCTGTCTGGGCTGGCACT	0.418																																						dbGAP											1	Substitution - Missense(1)	lung(1)											144.0	141.0	142.0					3																	88039993		2203	4300	6503	-	-	-	SO:0001583	missense	0			L05597	CCDS2920.1	3p12	2012-08-08	2012-02-03		ENSG00000179097	ENSG00000179097		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5292	protein-coding gene	gene with protein product		182134	"""5-hydroxytryptamine (serotonin) receptor 1F"""			8384716, 8380639	Standard	NM_000866		Approved	HTR1EL, 5-HT1F	uc003dqr.2	P30939	OTTHUMG00000159008	ENST00000319595.4:c.94G>A	3.37:g.88039993G>A	ENSP00000322924:p.Gly32Arg			Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_5HT1F_rcpt,prints_7TM_GPCR_Rhodpsn,prints_5HT_rcpt	p.G32R	ENST00000319595.4	37	c.94	CCDS2920.1	3	.	.	.	.	.	.	.	.	.	.	G	10.13	1.264726	0.23136	.	.	ENSG00000179097	ENST00000319595	T	0.37411	1.2	5.5	3.51	0.40186	.	0.483444	0.21515	N	0.073311	T	0.16599	0.0399	N	0.08118	0	0.09310	N	1	B	0.29508	0.246	B	0.27608	0.081	T	0.10132	-1.0643	10	0.39692	T	0.17	.	6.0339	0.19694	0.1766:0.0:0.6596:0.1638	.	32	P30939	5HT1F_HUMAN	R	32	ENSP00000322924:G32R	ENSP00000322924:G32R	G	+	1	0	HTR1F	88122683	0.993000	0.37304	0.384000	0.26145	0.987000	0.75469	2.669000	0.46825	1.334000	0.45468	0.585000	0.79938	GGG	HTR1F	-	prints_7TM_GPCR_Rhodpsn	ENSG00000179097		0.418	HTR1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR1F	HGNC	protein_coding	OTTHUMT00000352890.1	70	0.00	0	G	NM_000866		88039993	88039993	+1	no_errors	ENST00000319595	ensembl	human	known	69_37n	missense	39	20.41	10	SNP	0.001	A
IL17B	27190	genome.wustl.edu	37	5	148756493	148756493	+	Silent	SNP	G	G	A			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr5:148756493G>A	ENST00000261796.3	-	2	167	c.117C>T	c.(115-117)gcC>gcT	p.A39A	RP11-394O4.3_ENST00000521756.1_RNA|IL17B_ENST00000505432.1_5'UTR	NM_014443.2	NP_055258.1	Q9UHF5	IL17B_HUMAN	interleukin 17B	39					cell-cell signaling (GO:0007267)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|prostate(1)|urinary_tract(1)	8			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGGGCCAGGGGCCAGGGGCC	0.627																																						dbGAP											0													55.0	58.0	57.0					5																	148756493		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF184969	CCDS4297.1	5q33.1	2011-07-14			ENSG00000127743	ENSG00000127743		"""Interleukins and interleukin receptors"""	5982	protein-coding gene	gene with protein product	"""neuronal interleukin-17-related factor"""	604627				10639155	Standard	NM_014443		Approved	IL-17B, ZCYTO7, IL-20, MGC138900, MGC138901, NIRF	uc003lqo.3	Q9UHF5	OTTHUMG00000130051	ENST00000261796.3:c.117C>T	5.37:g.148756493G>A			Q14CE5	Silent	SNP	pfam_Interleukin-17,prints_Interleukin-17_chordata	p.A39	ENST00000261796.3	37	c.117	CCDS4297.1	5																																																																																			IL17B	-	pfam_Interleukin-17	ENSG00000127743		0.627	IL17B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL17B	HGNC	protein_coding	OTTHUMT00000252330.1	25	0.00	0	G	NM_014443		148756493	148756493	-1	no_errors	ENST00000261796	ensembl	human	known	69_37n	silent	21	32.26	10	SNP	0.734	A
KIAA1210	57481	genome.wustl.edu	37	X	118221586	118221586	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chrX:118221586G>T	ENST00000402510.2	-	11	3606	c.3607C>A	c.(3607-3609)Caa>Aaa	p.Q1203K		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	1203										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						GAAAAGATTTGCTGTGCCATA	0.468																																						dbGAP											0													41.0	37.0	38.0					X																	118221586		1873	4096	5969	-	-	-	SO:0001583	missense	0			AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.3607C>A	X.37:g.118221586G>T	ENSP00000384670:p.Gln1203Lys		B7ZCI8|Q5JPN4	Missense_Mutation	SNP	NULL	p.Q1203K	ENST00000402510.2	37	c.3607	CCDS48156.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.51|15.51	2.854804|2.854804	0.51376|0.51376	.|.	.|.	ENSG00000248857|ENSG00000250423	ENST00000440399|ENST00000402510	.|T	.|0.13420	.|2.59	4.53|4.53	2.68|2.68	0.31781|0.31781	.|.	.|.	.|.	.|.	.|.	T|T	0.10809|0.10809	0.0264|0.0264	L|L	0.42245|0.42245	1.32|1.32	0.09310|0.09310	N|N	1|1	.|P	.|0.40332	.|0.713	.|B	.|0.36464	.|0.225	T|T	0.20472|0.20472	-1.0274|-1.0274	5|9	.|0.20519	.|T	.|0.43	.|.	8.637|8.637	0.33955|0.33955	0.0:0.0:0.5845:0.4155|0.0:0.0:0.5845:0.4155	.|.	.|1203	.|Q9ULL0	.|K1210_HUMAN	E|K	609|1203	.|ENSP00000384670:Q1203K	.|ENSP00000384670:Q1203K	A|Q	-|-	2|1	0|0	KIAA1210|RP13-347D8.6	118105614|118105614	0.011000|0.011000	0.17503|0.17503	0.008000|0.008000	0.14137|0.14137	0.773000|0.773000	0.43773|0.43773	0.979000|0.979000	0.29500|0.29500	0.583000|0.583000	0.29574|0.29574	0.600000|0.600000	0.82982|0.82982	GCA|CAA	KIAA1210	-	NULL	ENSG00000250423		0.468	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1210	HGNC	protein_coding	OTTHUMT00000371251.2	56	0.00	0	G	NM_020721		118221586	118221586	-1	no_errors	ENST00000402510	ensembl	human	known	69_37n	missense	23	17.86	5	SNP	0.007	T
KIF5C	3800	genome.wustl.edu	37	2	149798136	149798136	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr2:149798136G>A	ENST00000435030.1	+	5	777	c.409G>A	c.(409-411)Gag>Aag	p.E137K	KIF5C_ENST00000414838.2_Missense_Mutation_p.E42K			O60282	KIF5C_HUMAN	kinesin family member 5C	137	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mRNA transport (GO:0051028)|organelle organization (GO:0006996)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(221;0.108)		TTCCTATTTTGAGATCTACTT	0.363																																						dbGAP											0													104.0	94.0	97.0					2																	149798136		1809	4058	5867	-	-	-	SO:0001583	missense	0			AB011103	CCDS74586.1	2q23	2008-02-05			ENSG00000168280	ENSG00000168280		"""Kinesins"""	6325	protein-coding gene	gene with protein product		604593				7514426	Standard	NM_004522		Approved		uc010zbu.2	O60282	OTTHUMG00000153779	ENST00000435030.1:c.409G>A	2.37:g.149798136G>A	ENSP00000393379:p.Glu137Lys		O95079|Q2YDC5	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E137K	ENST00000435030.1	37	c.409		2	.	.	.	.	.	.	.	.	.	.	G	35	5.560498	0.96527	.	.	ENSG00000168280	ENST00000435030;ENST00000414838;ENST00000334436	D;D	0.87029	-2.2;-2.2	5.37	5.37	0.77165	Kinesin, motor domain (4);	0.099893	0.64402	D	0.000002	D	0.93739	0.7999	.	.	.	0.80722	D	1	D	0.76494	0.999	D	0.70935	0.971	D	0.94047	0.7314	9	0.87932	D	0	.	19.3071	0.94167	0.0:0.0:1.0:0.0	.	137	O60282	KIF5C_HUMAN	K	137;42;40	ENSP00000393379:E137K;ENSP00000410115:E42K	ENSP00000334176:E40K	E	+	1	0	KIF5C	149506382	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.657000	0.98554	2.793000	0.96121	0.563000	0.77884	GAG	KIF5C	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000168280		0.363	KIF5C-001	KNOWN	basic|appris_principal	protein_coding	KIF5C	HGNC	protein_coding	OTTHUMT00000332562.3	112	0.00	0	G	NM_004522		149798136	149798136	+1	no_errors	ENST00000435030	ensembl	human	known	69_37n	missense	70	17.65	15	SNP	1.000	A
MFSD3	113655	genome.wustl.edu	37	8	145736012	145736012	+	Missense_Mutation	SNP	C	C	T	rs138616461	byFrequency	TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr8:145736012C>T	ENST00000301327.4	+	3	1122	c.862C>T	c.(862-864)Cgc>Tgc	p.R288C	CTD-2517M22.17_ENST00000580385.1_RNA|RECQL4_ENST00000532237.1_5'Flank	NM_138431.1	NP_612440.1	Q96ES6	MFSD3_HUMAN	major facilitator superfamily domain containing 3	288	Leu-rich.				transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(1)|kidney(1)|lung(4)	8	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			GTCGGTGCTGCGCTTCCGCCT	0.622													C|||	3	0.000599042	0.0	0.0014	5008	,	,		18566	0.0		0.001	False		,,,				2504	0.001					dbGAP											0													88.0	98.0	95.0					8																	145736012		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS6431.1	8q24.3	2005-11-17			ENSG00000167700	ENSG00000167700			25157	protein-coding gene	gene with protein product							Standard	NM_138431		Approved		uc003zdi.1	Q96ES6	OTTHUMG00000165177	ENST00000301327.4:c.862C>T	8.37:g.145736012C>T	ENSP00000301327:p.Arg288Cys			Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.R288C	ENST00000301327.4	37	c.862	CCDS6431.1	8	2	9.157509157509158E-4	0	0.0	1	0.0027624309392265192	0	0.0	1	0.0013192612137203166	C	8.270	0.813258	0.16537	.	.	ENSG00000167700	ENST00000301327	T	0.58210	0.35	5.24	-1.27	0.09347	Major facilitator superfamily domain, general substrate transporter (1);	1.535990	0.03813	N	0.266178	T	0.46464	0.1394	L	0.54323	1.7	0.09310	N	1	P	0.45283	0.855	B	0.42112	0.376	T	0.30679	-0.9970	10	0.38643	T	0.18	-7.3923	3.2715	0.06883	0.2905:0.368:0.0:0.3415	.	288	Q96ES6	MFSD3_HUMAN	C	288	ENSP00000301327:R288C	ENSP00000301327:R288C	R	+	1	0	MFSD3	145706820	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.125000	0.03257	-0.652000	0.05408	-0.254000	0.11334	CGC	MFSD3	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000167700		0.622	MFSD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFSD3	HGNC	protein_coding	OTTHUMT00000382478.2	37	0.00	0	C	NM_138431		145736012	145736012	+1	no_errors	ENST00000301327	ensembl	human	known	69_37n	missense	11	55.56	15	SNP	0.000	T
MIR522	574495	genome.wustl.edu	37	19	54255733	54255733	+	RNA	SNP	G	G	C			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr19:54255733G>C	ENST00000385071.1	+	0	87				MIR527_ENST00000385244.1_RNA|MIR519A1_ENST00000385257.1_RNA|RNU6-751P_ENST00000516382.1_RNA	NR_030217.1				microRNA 522																		GTTACTGTTTGAGAAAAGCAA	0.418																																						dbGAP											0													113.0	107.0	109.0					19																	54255733		1568	3582	5150	-	-	-			0					19q13.42	2011-09-12		2008-12-18	ENSG00000207806	ENSG00000207806		"""ncRNAs / Micro RNAs"""	32127	non-coding RNA	RNA, micro				MIRN522			Standard	NR_030217		Approved	hsa-mir-522	uc021vat.1				19.37:g.54255733G>C				RNA	SNP	-	NULL	ENST00000385071.1	37	NULL		19																																																																																			MIR519A1	-	-	ENSG00000207992		0.418	MIR522-201	KNOWN	basic	miRNA	MIR519A1	HGNC	miRNA		145	0.00	0	G	NR_030217		54255733	54255733	+1	no_errors	ENST00000385257	ensembl	human	known	69_37n	rna	84	11.58	11	SNP	0.041	C
KMT2D	8085	genome.wustl.edu	37	12	49427620	49427622	+	In_Frame_Del	DEL	TGG	TGG	-			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	TGG	TGG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr12:49427620_49427622delTGG	ENST00000301067.7	-	39	10865_10867	c.10866_10868delCCA	c.(10864-10869)tcccag>tcg	p.Q3623del	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3623	Gln-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										CCGGGGACTCTGGGAAGGGCTGA	0.621																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.10866_10868delCCA	12.37:g.49427620_49427622delTGG	ENSP00000301067:p.Gln3623del		O14687	In_Frame_Del	DEL	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.Q3623in_frame_del	ENST00000301067.7	37	c.10868_10866	CCDS44873.1	12																																																																																			MLL2	-	NULL	ENSG00000167548		0.621	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLL2	HGNC	protein_coding	OTTHUMT00000390183.2	23	0.00	0	TGG			49427620	49427622	-1	no_errors	ENST00000301067	ensembl	human	known	69_37n	in_frame_del	9	25.00	3	DEL	1.000:1.000:0.994	-
MNT	4335	genome.wustl.edu	37	17	2297393	2297393	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr17:2297393delC	ENST00000174618.4	-	4	1156	c.751delG	c.(751-753)gatfs	p.D252fs	MNT_ENST00000575394.1_Intron|MNT_ENST00000575374.1_5'Flank	NM_020310.2	NP_064706.1	Q99583	MNT_HUMAN	MAX network transcriptional repressor	252	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cell aging (GO:0007569)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of cell cycle (GO:0051726)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			endometrium(4)|large_intestine(5)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	12				Colorectal(2;1.37e-05)|READ - Rectum adenocarcinoma(2;8.68e-05)		TTCTTGTCATCCACGTTGGGG	0.672																																						dbGAP											0													77.0	64.0	68.0					17																	2297393		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			Y13444	CCDS11018.1	17p13.3	2013-11-15	2013-11-15		ENSG00000070444	ENSG00000070444		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	7188	protein-coding gene	gene with protein product	"""myc antagonist"", ""Max-interacting protein"""	603039	"""MAX binding protein"", ""MNT, MAX dimerization protein"""			9598315	Standard	NM_020310		Approved	ROX, MXD6, MAD6, bHLHd3	uc002fur.3	Q99583	OTTHUMG00000090603	ENST00000174618.4:c.751delG	17.37:g.2297393delC	ENSP00000174618:p.Asp252fs		A8K6D1|D3DTI7|Q1ED38	Frame_Shift_Del	DEL	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.D251fs	ENST00000174618.4	37	c.751	CCDS11018.1	17																																																																																			MNT	-	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	ENSG00000070444		0.672	MNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MNT	HGNC	protein_coding	OTTHUMT00000207158.1	21	0.00	0	C	NM_020310		2297393	2297393	-1	no_errors	ENST00000174618	ensembl	human	known	69_37n	frame_shift_del	6	25.00	2	DEL	1.000	-
MUC21	394263	genome.wustl.edu	37	6	30954618	30954618	+	Silent	SNP	T	T	C			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr6:30954618T>C	ENST00000376296.3	+	2	907	c.666T>C	c.(664-666)gcT>gcC	p.A222A	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	222	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						CCAATGGGGCTGGCACAGCCA	0.637																																						dbGAP											0													149.0	149.0	149.0					6																	30954618		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.666T>C	6.37:g.30954618T>C			B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Silent	SNP	NULL	p.A222	ENST00000376296.3	37	c.666	CCDS34388.1	6																																																																																			MUC21	-	NULL	ENSG00000204544		0.637	MUC21-001	KNOWN	basic|CCDS	protein_coding	MUC21	HGNC	protein_coding	OTTHUMT00000128579.3	54	0.00	0	T	NM_001010909		30954618	30954618	+1	no_errors	ENST00000376296	ensembl	human	known	69_37n	silent	21	55.32	26	SNP	0.000	C
NDUFAF1	51103	genome.wustl.edu	37	15	41687079	41687079	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr15:41687079C>T	ENST00000260361.4	-	3	1118	c.737G>A	c.(736-738)gGa>gAa	p.G246E		NM_016013.3	NP_057097.2	Q9Y375	CIA30_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 1	246					mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|mitochondrial respiratory chain complex I (GO:0005747)	unfolded protein binding (GO:0051082)			endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	12		all_cancers(109;5.07e-19)|all_epithelial(112;2.43e-16)|Lung NSC(122;1.81e-11)|all_lung(180;4.81e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;8e-17)|GBM - Glioblastoma multiforme(113;1.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.114)		CCAGTAGGGTCCCCCGCGGGT	0.488																																						dbGAP											0													83.0	78.0	80.0					15																	41687079		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF151823	CCDS10075.1	15q11.2-q21.3	2012-10-12	2012-05-08		ENSG00000137806	ENSG00000137806		"""Mitochondrial respiratory chain complex assembly factors"""	18828	protein-coding gene	gene with protein product		606934				11935339, 10810093	Standard	NM_016013		Approved	CIA30, CGI-65	uc001znx.3	Q9Y375	OTTHUMG00000130340	ENST00000260361.4:c.737G>A	15.37:g.41687079C>T	ENSP00000260361:p.Gly246Glu		Q9BVZ5	Missense_Mutation	SNP	pfam_NADH-UbQ_OxRdtase-assoc_prot30,superfamily_Galactose-bd-like	p.G246E	ENST00000260361.4	37	c.737	CCDS10075.1	15	.	.	.	.	.	.	.	.	.	.	C	31	5.102889	0.94245	.	.	ENSG00000137806	ENST00000260361	T	0.77877	-1.13	5.52	5.52	0.82312	NADH:ubiquinone oxidoreductase intermediate-associated protein 30 (1);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	D	0.90487	0.7020	M	0.88704	2.975	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91434	0.5168	10	0.72032	D	0.01	-5.6254	19.8551	0.96755	0.0:1.0:0.0:0.0	.	246	Q9Y375	CIA30_HUMAN	E	246	ENSP00000260361:G246E	ENSP00000260361:G246E	G	-	2	0	NDUFAF1	39474371	1.000000	0.71417	0.688000	0.30117	0.892000	0.51952	7.578000	0.82498	2.770000	0.95276	0.551000	0.68910	GGA	NDUFAF1	-	pfam_NADH-UbQ_OxRdtase-assoc_prot30,superfamily_Galactose-bd-like	ENSG00000137806		0.488	NDUFAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFAF1	HGNC	protein_coding	OTTHUMT00000252692.2	39	0.00	0	C	NM_016013		41687079	41687079	-1	no_errors	ENST00000260361	ensembl	human	known	69_37n	missense	24	22.58	7	SNP	1.000	T
OR4Q3	441669	genome.wustl.edu	37	14	20216051	20216051	+	Silent	SNP	C	C	A			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr14:20216051C>A	ENST00000331723.1	+	1	465	c.465C>A	c.(463-465)atC>atA	p.I155I		NM_172194.1	NP_751944.1	Q8NH05	OR4Q3_HUMAN	olfactory receptor, family 4, subfamily Q, member 3	155						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(4)|endometrium(3)|kidney(2)|large_intestine(1)|lung(28)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GGGGTTTTATCCACTCTATCA	0.498																																						dbGAP											0													96.0	97.0	97.0					14																	20216051		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			AF179768	CCDS32020.1	14p13	2012-08-09				ENSG00000182652		"""GPCR / Class A : Olfactory receptors"""	15426	protein-coding gene	gene with protein product				OR4Q4			Standard	NM_172194		Approved	C14orf13	uc010tkt.2	Q8NH05		ENST00000331723.1:c.465C>A	14.37:g.20216051C>A			Q6IEX4	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.I155	ENST00000331723.1	37	c.465	CCDS32020.1	14																																																																																			OR4Q3	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000182652		0.498	OR4Q3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4Q3	HGNC	protein_coding	OTTHUMT00000409818.2	140	0.00	0	C			20216051	20216051	+1	no_errors	ENST00000331723	ensembl	human	known	69_37n	silent	32	52.94	36	SNP	0.001	A
PCDHB2	56133	genome.wustl.edu	37	5	140476000	140476000	+	Silent	SNP	G	G	T	rs141231979	byFrequency	TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr5:140476000G>T	ENST00000194155.4	+	1	1774	c.1626G>T	c.(1624-1626)gcG>gcT	p.A542A		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	542	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A542A(2)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCTCCCCGGCGTTGAGCAGCG	0.706																																						dbGAP											2	Substitution - coding silent(2)	large_intestine(1)|kidney(1)											39.0	44.0	42.0					5																	140476000		2200	4298	6498	-	-	-	SO:0001819	synonymous_variant	0			AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.1626G>T	5.37:g.140476000G>T			Q4KMU1	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A542	ENST00000194155.4	37	c.1626	CCDS4244.1	5																																																																																			PCDHB2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000112852		0.706	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB2	HGNC	protein_coding	OTTHUMT00000251801.2	55	0.00	0	G	NM_018936		140476000	140476000	+1	no_errors	ENST00000194155	ensembl	human	known	69_37n	silent	20	16.67	4	SNP	0.745	T
PCLO	27445	genome.wustl.edu	37	7	82544944	82544944	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr7:82544944C>T	ENST00000333891.9	-	7	12695	c.12358G>A	c.(12358-12360)Gag>Aag	p.E4120K	PCLO_ENST00000423517.2_Missense_Mutation_p.E4120K|PCLO_ENST00000437081.1_Missense_Mutation_p.E840K	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						AGCTTTAACTCGTAAGGATCC	0.433																																						dbGAP											0													75.0	70.0	71.0					7																	82544944		1871	4106	5977	-	-	-	SO:0001583	missense	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.12358G>A	7.37:g.82544944C>T	ENSP00000334319:p.Glu4120Lys			Missense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_Ca-dep,pfam_PDZ,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_PDZ	p.E4120K	ENST00000333891.9	37	c.12358	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	C	22.0	4.230073	0.79688	.	.	ENSG00000186472	ENST00000333891;ENST00000423517;ENST00000437081	T;T	0.21361	2.01;2.02	5.57	5.57	0.84162	.	.	.	.	.	T	0.48314	0.1493	M	0.68593	2.085	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.994;0.998;0.998	T	0.45556	-0.9253	9	0.87932	D	0	.	19.5537	0.95331	0.0:1.0:0.0:0.0	.	4051;4120;4120	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	K	4120;4120;840	ENSP00000334319:E4120K;ENSP00000388393:E4120K	ENSP00000334319:E4120K	E	-	1	0	PCLO	82382880	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.818000	0.86416	2.614000	0.88457	0.557000	0.71058	GAG	PCLO	-	NULL	ENSG00000186472		0.433	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	74	0.00	0	C	NM_014510		82544944	82544944	-1	no_errors	ENST00000333891	ensembl	human	known	69_37n	missense	43	14.00	7	SNP	1.000	T
PGR	5241	genome.wustl.edu	37	11	100933223	100933223	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr11:100933223C>T	ENST00000325455.5	-	4	3620	c.2167G>A	c.(2167-2169)Gag>Aag	p.E723K	PGR_ENST00000263463.5_Intron|PGR_ENST00000534013.1_Missense_Mutation_p.E129K	NM_000926.4|NM_001202474.1|NM_001271162.1	NP_000917.3|NP_001189403.1|NP_001258091.1	P06401	PRGR_HUMAN	progesterone receptor	723	Steroid-binding.				cell-cell signaling (GO:0007267)|epithelial cell maturation (GO:0002070)|gene expression (GO:0010467)|negative regulation of gene expression (GO:0010629)|ovulation from ovarian follicle (GO:0001542)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone receptor signaling pathway (GO:0050847)|regulation of epithelial cell proliferation (GO:0050678)|signal transduction (GO:0007165)|tertiary branching involved in mammary gland duct morphogenesis (GO:0060748)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mitochondrial outer membrane (GO:0005741)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	36		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	Allylestrenol(DB01431)|Danazol(DB01406)|Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluticasone Propionate(DB00588)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Megestrol acetate(DB00351)|Mifepristone(DB00834)|Norelgestromin(DB06713)|Norethindrone(DB00717)|Norgestimate(DB00957)|Progesterone(DB00396)|Spironolactone(DB00421)	AGTTGCCTCTCGCCTAGTTGA	0.358																																					Pancreas(124;2271 2354 21954 22882)	dbGAP											0													167.0	155.0	159.0					11																	100933223		2203	4300	6503	-	-	-	SO:0001583	missense	0			M15716	CCDS8310.1, CCDS59229.1	11q22-q23	2013-01-16			ENSG00000082175	ENSG00000082175		"""Nuclear hormone receptors"""	8910	protein-coding gene	gene with protein product		607311					Standard	NM_000926		Approved	PR, NR3C3	uc001pgh.2	P06401	OTTHUMG00000167531	ENST00000325455.5:c.2167G>A	11.37:g.100933223C>T	ENSP00000325120:p.Glu723Lys		A7LQ08|A7X8B0|B4E3T0|Q8TDS3|Q9UPF7	Missense_Mutation	SNP	pfam_Progest_rcpt,pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Progest_rcpt,prints_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt	p.E723K	ENST00000325455.5	37	c.2167	CCDS8310.1	11	.	.	.	.	.	.	.	.	.	.	C	34	5.355431	0.95854	.	.	ENSG00000082175	ENST00000325455;ENST00000534013	D;D	0.97186	-4.28;-4.28	5.97	5.97	0.96955	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.98707	0.9566	M	0.86420	2.815	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.991	D	0.99187	1.0869	10	0.87932	D	0	.	20.4388	0.99107	0.0:1.0:0.0:0.0	.	723;104	P06401;A7LQ08	PRGR_HUMAN;.	K	723;129	ENSP00000325120:E723K;ENSP00000436561:E129K	ENSP00000325120:E723K	E	-	1	0	PGR	100438433	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.478000	0.81082	2.836000	0.97738	0.655000	0.94253	GAG	PGR	-	superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Str_hrmn_rcpt	ENSG00000082175		0.358	PGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGR	HGNC	protein_coding	OTTHUMT00000394934.1	93	0.00	0	C			100933223	100933223	-1	no_errors	ENST00000325455	ensembl	human	known	69_37n	missense	40	20.00	10	SNP	1.000	T
PIK3CA	5290	genome.wustl.edu	37	3	178921553	178921553	+	Missense_Mutation	SNP	T	T	A	rs121913284		TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr3:178921553T>A	ENST00000263967.3	+	5	1192	c.1035T>A	c.(1033-1035)aaT>aaA	p.N345K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	345	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.N345K(44)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	CCTACGTGAATGTAAATATTC	0.308		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	44	Substitution - Missense(44)	breast(27)|endometrium(6)|large_intestine(6)|central_nervous_system(5)											67.0	66.0	66.0					3																	178921553		1807	4074	5881	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1035T>A	3.37:g.178921553T>A	ENSP00000263967:p.Asn345Lys		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.N345K	ENST00000263967.3	37	c.1035	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	T	16.01	3.002090	0.54254	.	.	ENSG00000121879	ENST00000263967	T	0.70164	-0.46	5.41	3.03	0.35002	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (1);	0.000000	0.85682	D	0.000000	T	0.77745	0.4176	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.75465	-0.3308	10	0.49607	T	0.09	-21.0442	9.7159	0.40274	0.0:0.1415:0.0:0.8585	.	345	P42336	PK3CA_HUMAN	K	345	ENSP00000263967:N345K	ENSP00000263967:N345K	N	+	3	2	PIK3CA	180404247	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.030000	0.41108	0.441000	0.26529	0.402000	0.26972	AAT	PIK3CA	-	superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_C2_dom	ENSG00000121879		0.308	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	43	0.00	0	T			178921553	178921553	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	28	39.13	18	SNP	1.000	A
PKD1L2	114780	genome.wustl.edu	37	16	81193423	81193423	+	RNA	SNP	C	C	A			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr16:81193423C>A	ENST00000525539.1	-	0	3700				PKD1L2_ENST00000533478.1_RNA	NM_052892.3	NP_443124.3	Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						GGCAGCTCATCTGTAGGAAAG	0.582																																						dbGAP											0													28.0	30.0	29.0					16																	81193423		2027	4185	6212	-	-	-			0			AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81193423C>A			Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Splice_Site	SNP	-	NULL	ENST00000525539.1	37	c.NULL		16																																																																																			PKD1L2	-	-	ENSG00000166473		0.582	PKD1L2-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	PKD1L2	HGNC	polymorphic_pseudogene	OTTHUMT00000387972.2	36	0.00	0	C			81193423	81193423	-1	no_coding_region	ENST00000299598	ensembl	human	known	69_37n	splice_site	16	20.00	4	SNP	0.978	A
PKN1	5585	genome.wustl.edu	37	19	14574672	14574672	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr19:14574672A>G	ENST00000242783.6	+	11	1693	c.1528A>G	c.(1528-1530)Atc>Gtc	p.I510V	PKN1_ENST00000342216.4_Missense_Mutation_p.I516V	NM_002741.3	NP_002732.3	Q16512	PKN1_HUMAN	protein kinase N1	510					activation of JUN kinase activity (GO:0007257)|epithelial cell migration (GO:0010631)|histone H3-T11 phosphorylation (GO:0035407)|hyperosmotic response (GO:0006972)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|GTP-Rho binding (GO:0017049)|histone binding (GO:0042393)|histone deacetylase binding (GO:0042826)|histone kinase activity (H3-T11 specific) (GO:0035402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)			breast(3)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)	31						GCAGATGAACATCGATGTCGC	0.677																																					NSCLC(185;2539 2965 10733 52867)	dbGAP											0													37.0	42.0	40.0					19																	14574672		2198	4291	6489	-	-	-	SO:0001583	missense	0			S75546	CCDS42513.1, CCDS42514.1	19p13.12	2008-05-14	2004-07-01	2004-07-01	ENSG00000123143	ENSG00000123143			9405	protein-coding gene	gene with protein product		601032	"""protein kinase C-like 1"""	PRKCL1		9570957	Standard	NM_002741		Approved	DBK, PRK1, PKN, MGC46204, PAK1	uc002myq.3	Q16512	OTTHUMG00000039611	ENST00000242783.6:c.1528A>G	19.37:g.14574672A>G	ENSP00000242783:p.Ile510Val		A8K7W5|B2R9R4|B3KVN3|Q15143|Q504U4|Q8IUV5|Q9UD44	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_HR1_rho-bd,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_HR1_rho-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_HR1_rho-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_cat_dom	p.I516V	ENST00000242783.6	37	c.1546	CCDS42513.1	19	.	.	.	.	.	.	.	.	.	.	A	10.13	1.265633	0.23136	.	.	ENSG00000123143	ENST00000242783;ENST00000342216	T;T	0.39592	1.07;1.07	3.9	3.9	0.45041	.	0.085679	0.47455	U	0.000221	T	0.35711	0.0941	L	0.50333	1.59	0.31807	N	0.627691	B;B	0.17038	0.02;0.012	B;B	0.15484	0.013;0.006	T	0.41413	-0.9510	10	0.38643	T	0.18	-12.7223	10.7207	0.46038	1.0:0.0:0.0:0.0	.	516;510	Q16512-2;Q16512	.;PKN1_HUMAN	V	510;516	ENSP00000242783:I510V;ENSP00000343325:I516V	ENSP00000242783:I510V	I	+	1	0	PKN1	14435672	1.000000	0.71417	0.989000	0.46669	0.493000	0.33554	5.386000	0.66238	1.639000	0.50556	0.397000	0.26171	ATC	PKN1	-	NULL	ENSG00000123143		0.677	PKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKN1	HGNC	protein_coding	OTTHUMT00000095510.1	22	0.00	0	A	NM_002741, NM_213560		14574672	14574672	+1	no_errors	ENST00000342216	ensembl	human	known	69_37n	missense	12	33.33	6	SNP	1.000	G
PLCE1	51196	genome.wustl.edu	37	10	95993811	95993811	+	Splice_Site	SNP	G	G	C			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr10:95993811G>C	ENST00000371380.3	+	5	2191	c.1956G>C	c.(1954-1956)agG>agC	p.R652S	PLCE1_ENST00000371385.3_Splice_Site_p.R344S|PLCE1_ENST00000260766.3_Splice_Site_p.R652S|PLCE1_ENST00000371375.1_Splice_Site_p.R344S			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	652	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				CTTGCAATAGGTCAAGAAAAG	0.373																																						dbGAP											0													52.0	51.0	51.0					10																	95993811		1884	4102	5986	-	-	-	SO:0001630	splice_region_variant	0				CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.1956-1G>C	10.37:g.95993811G>C			A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_Ras-assoc,pfam_RasGRF_CDC25,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_Ras_GEF_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_RasGRF_CDC25,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,smart_Ras-assoc,pfscan_C2_membr_targeting,pfscan_Ras-assoc,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,pfscan_RasGRF_CDC25,prints_Pinositol_PLipase_C	p.R652S	ENST00000371380.3	37	c.1956	CCDS41552.1	10	.	.	.	.	.	.	.	.	.	.	G	19.55	3.849087	0.71603	.	.	ENSG00000138193	ENST00000260766;ENST00000371380;ENST00000371385;ENST00000371375	T;T;T;T	0.26957	1.7;1.7;1.7;1.7	5.77	4.85	0.62838	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.105145	0.64402	D	0.000005	T	0.40886	0.1135	L	0.43152	1.355	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.91635	0.999;0.997;0.984	T	0.02208	-1.1195	9	.	.	.	.	12.928	0.58270	0.1274:0.0:0.8726:0.0	.	652;344;652	B7ZM61;Q9P212-2;Q9P212	.;.;PLCE1_HUMAN	S	652;652;344;344	ENSP00000260766:R652S;ENSP00000360431:R652S;ENSP00000360438:R344S;ENSP00000360426:R344S	.	R	+	3	2	PLCE1	95983801	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	1.828000	0.39111	2.890000	0.99128	0.650000	0.86243	AGG	PLCE1	-	pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25	ENSG00000138193		0.373	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCE1	HGNC	protein_coding	OTTHUMT00000049469.3	54	0.00	0	G	NM_016341	Missense_Mutation	95993811	95993811	+1	no_errors	ENST00000371380	ensembl	human	known	69_37n	missense	20	33.33	10	SNP	1.000	C
POLR1B	84172	genome.wustl.edu	37	2	113325615	113325615	+	Silent	SNP	G	G	A			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr2:113325615G>A	ENST00000263331.5	+	11	2398	c.1818G>A	c.(1816-1818)ctG>ctA	p.L606L	POLR1B_ENST00000537335.1_Silent_p.L395L|POLR1B_ENST00000417433.2_Silent_p.L550L|POLR1B_ENST00000541869.1_Silent_p.L644L|POLR1B_ENST00000409894.3_Silent_p.L423L	NM_019014.4	NP_061887.2	Q9H9Y6	RPA2_HUMAN	polymerase (RNA) I polypeptide B, 128kDa	606					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)			breast(3)|endometrium(9)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42						AACCAAGTCTGTACCCAGGAT	0.428																																					Ovarian(16;256 576 9537 23969 41147)	dbGAP											0													199.0	178.0	185.0					2																	113325615		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001678	CCDS2097.1, CCDS46395.1, CCDS62988.1, CCDS62989.1, CCDS62990.1	2q13	2013-01-21			ENSG00000125630	ENSG00000125630		"""RNA polymerase subunits"""	20454	protein-coding gene	gene with protein product		602000					Standard	NM_001137604		Approved	Rpo1-2, FLJ21921, FLJ10816, RPA2	uc002thw.2	Q9H9Y6	OTTHUMG00000131314	ENST00000263331.5:c.1818G>A	2.37:g.113325615G>A			B7Z6Y7|B7Z823|F5GZX4|F8W898|Q2TAM4|Q585T5|Q6ZRR2|Q9H9D3	Silent	SNP	pfam_DNA-dir_RNA_pol_su2_6,pfam_RNA_pol_bsu_protrusion,pfam_RNA_pol_Rpb2_3,pfam_RNA_pol_Rpb2_7,pfam_RNA_pol_Rpa2-specific,pfam_RNA_pol_Rpb2_2,pfam_RNA_pol_Rpb2_5	p.L644	ENST00000263331.5	37	c.1932	CCDS2097.1	2																																																																																			POLR1B	-	pfam_RNA_pol_Rpa2-specific	ENSG00000125630		0.428	POLR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR1B	HGNC	protein_coding	OTTHUMT00000254083.1	85	0.00	0	G	NM_019014		113325615	113325615	+1	no_errors	ENST00000541869	ensembl	human	known	69_37n	silent	63	20.25	16	SNP	1.000	A
PPP2R3A	5523	genome.wustl.edu	37	3	135721399	135721399	+	Silent	SNP	G	G	A			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr3:135721399G>A	ENST00000264977.3	+	2	1676	c.1059G>A	c.(1057-1059)ttG>ttA	p.L353L	PPP2R3A_ENST00000490467.1_Intron	NM_001190447.1|NM_002718.4	NP_001177376.1|NP_002709.2	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'', alpha	353					eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein catabolic process (GO:0045732)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|somite development (GO:0061053)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	protein phosphatase type 2A complex (GO:0000159)	calcium ion binding (GO:0005509)|protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						CTATTGAATTGCAAAATGACA	0.403																																						dbGAP											0													80.0	78.0	78.0					3																	135721399		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L12146	CCDS3087.1, CCDS3088.1, CCDS54642.1	3q22.2-q22.3	2013-01-10	2010-06-18	2002-04-26	ENSG00000073711	ENSG00000073711	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""EF-hand domain containing"""	9307	protein-coding gene	gene with protein product		604944	"""protein phosphatase 2 (formerly 2A), regulatory subunit B'' (PR 72), alpha isoform and (PR 130), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', alpha"""	PPP2R3		8392071	Standard	NM_002718		Approved		uc003eqv.2	Q06190	OTTHUMG00000159766	ENST00000264977.3:c.1059G>A	3.37:g.135721399G>A			A8KAE7|B4DNU1|B7ZAE3|Q06189|Q9NPQ5	Silent	SNP	pfscan_EF_HAND_2	p.L353	ENST00000264977.3	37	c.1059	CCDS3087.1	3																																																																																			PPP2R3A	-	NULL	ENSG00000073711		0.403	PPP2R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R3A	HGNC	protein_coding	OTTHUMT00000357232.1	72	0.00	0	G	NM_002718		135721399	135721399	+1	no_errors	ENST00000264977	ensembl	human	known	69_37n	silent	48	36.00	27	SNP	0.008	A
PRDM5	11107	genome.wustl.edu	37	4	121698355	121698355	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr4:121698355G>A	ENST00000264808.3	-	13	1765	c.1525C>T	c.(1525-1527)Cgg>Tgg	p.R509W	PRDM5_ENST00000515109.1_Missense_Mutation_p.R478W|PRDM5_ENST00000428209.2_Missense_Mutation_p.R478W	NM_018699.2	NP_061169.2	Q9NQX1	PRDM5_HUMAN	PR domain containing 5	509					histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|mitotic cell cycle (GO:0000278)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(17)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						GTGTGGCTCCGGATATGAACT	0.373																																						dbGAP											0													142.0	131.0	135.0					4																	121698355		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF272897	CCDS3716.1, CCDS75187.1, CCDS75188.1	4q25-q26	2013-01-08			ENSG00000138738	ENSG00000138738		"""Zinc fingers, C2H2-type"""	9349	protein-coding gene	gene with protein product		614161					Standard	XM_005262706		Approved	PFM2	uc003idn.3	Q9NQX1	OTTHUMG00000132970	ENST00000264808.3:c.1525C>T	4.37:g.121698355G>A	ENSP00000264808:p.Arg509Trp		Q0VAI9|Q0VAJ0|Q6NXQ7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_SET_dom,smart_Znf_C2H2-like,pirsf_Znf_PRDM5,pfscan_SET_dom,pfscan_Znf_C2H2	p.R509W	ENST00000264808.3	37	c.1525	CCDS3716.1	4	.	.	.	.	.	.	.	.	.	.	G	19.79	3.893751	0.72639	.	.	ENSG00000138738	ENST00000264808;ENST00000515109;ENST00000428209	T;T;T	0.34275	1.79;1.37;1.79	5.36	4.52	0.55395	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.63663	0.2530	M	0.90425	3.115	0.80722	D	1	B;D;P	0.89917	0.021;1.0;0.484	B;D;B	0.97110	0.002;1.0;0.028	T	0.68773	-0.5320	10	0.87932	D	0	-11.6548	9.0932	0.36623	0.0738:0.0:0.7808:0.1454	.	478;478;509	Q0VAI9;Q9NQX1-2;Q9NQX1	.;.;PRDM5_HUMAN	W	509;478;478	ENSP00000264808:R509W;ENSP00000422309:R478W;ENSP00000404832:R478W	ENSP00000264808:R509W	R	-	1	2	PRDM5	121917805	1.000000	0.71417	0.995000	0.50966	0.975000	0.68041	4.198000	0.58419	1.264000	0.44198	0.655000	0.94253	CGG	PRDM5	-	smart_Znf_C2H2-like,pirsf_Znf_PRDM5,pfscan_Znf_C2H2	ENSG00000138738		0.373	PRDM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM5	HGNC	protein_coding	OTTHUMT00000256528.2	101	0.00	0	G			121698355	121698355	-1	no_errors	ENST00000264808	ensembl	human	known	69_37n	missense	68	13.92	11	SNP	1.000	A
RALGAPA2	57186	genome.wustl.edu	37	20	20553660	20553660	+	Silent	SNP	G	G	A			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr20:20553660G>A	ENST00000202677.7	-	21	2767	c.2760C>T	c.(2758-2760)ctC>ctT	p.L920L		NM_020343.3	NP_065076.2	Q2PPJ7	RGPA2_HUMAN	Ral GTPase activating protein, alpha subunit 2 (catalytic)	920					activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	54						GCCAACCAGTGAGGCTCCCCC	0.498																																						dbGAP											0													45.0	46.0	45.0					20																	20553660		1915	4126	6041	-	-	-	SO:0001819	synonymous_variant	0			AL078634, DQ310704	CCDS46584.1	20p11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000188559	ENSG00000188559			16207	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 74"""	C20orf74		16490346, 19520869	Standard	NM_020343		Approved	dJ1049G11.4, AS250, KIAA1272, RapGAPalpha2	uc002wrz.3	Q2PPJ7	OTTHUMG00000032010	ENST00000202677.7:c.2760C>T	20.37:g.20553660G>A			Q4VXU6|Q5JUA3|Q5JUA4|Q5T9K3|Q96CX9|Q9BQT7|Q9H9D9|Q9ULE8	Missense_Mutation	SNP	pfam_Rap_GAP,superfamily_ARM-type_fold,pfscan_Rap_GAP	p.S737L	ENST00000202677.7	37	c.2210	CCDS46584.1	20	.	.	.	.	.	.	.	.	.	.	G	2.510	-0.313118	0.05422	.	.	ENSG00000188559	ENST00000430436	.	.	.	5.93	1.45	0.22620	.	.	.	.	.	T	0.43500	0.1250	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.29579	-1.0007	4	.	.	.	.	2.3824	0.04357	0.1868:0.1082:0.4833:0.2218	.	.	.	.	L	737	.	.	S	-	2	0	RALGAPA2	20501660	0.985000	0.35326	0.955000	0.39395	0.232000	0.25224	0.144000	0.16135	0.810000	0.34279	-0.140000	0.14226	TCA	RALGAPA2	-	NULL	ENSG00000188559		0.498	RALGAPA2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	RALGAPA2	HGNC	protein_coding	OTTHUMT00000471941.1	43	0.00	0	G	NM_020343		20553660	20553660	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000430436	ensembl	human	known	69_37n	missense	32	10.81	4	SNP	0.992	A
RANBP2	5903	genome.wustl.edu	37	2	109380485	109380487	+	In_Frame_Del	DEL	GAT	GAT	-			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	GAT	GAT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr2:109380485_109380487delGAT	ENST00000283195.6	+	20	3616_3618	c.3490_3492delGAT	c.(3490-3492)gatdel	p.D1168del		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	1168					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						TGCCCATGGGGATGATGATGATG	0.424																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.3490_3492delGAT	2.37:g.109380494_109380496delGAT	ENSP00000283195:p.Asp1168del		Q13074|Q15280|Q53TE2|Q59FH7	In_Frame_Del	DEL	pfam_Ran_bind_dom,pfam_Znf_RanBP2,pfam_IR1-M,pfam_Cyclophilin-like_PPIase_dom,pfam_TPR-1,superfamily_Cyclophilin-like_PPIase_dom,smart_TPR_repeat,smart_Ran_bind_dom,smart_Znf_RanBP2,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Znf_RanBP2,pfscan_Cyclophilin-like_PPIase_dom,pfscan_Ran_bind_dom,prints_Cyclophilin-like_PPIase_dom	p.D1167in_frame_del	ENST00000283195.6	37	c.3490_3492	CCDS2079.1	2																																																																																			RANBP2	-	NULL	ENSG00000153201		0.424	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RANBP2	HGNC	protein_coding	OTTHUMT00000253594.1	28	0.00	0	GAT	NM_006267		109380485	109380487	+1	no_errors	ENST00000283195	ensembl	human	known	69_37n	in_frame_del	18	10.00	2	DEL	1.000:1.000:0.985	-
RNA5-8SP6	100873336	genome.wustl.edu	37	Y	10037863	10037863	+	RNA	DEL	C	C	-	rs373540942		TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chrY:10037863delC	ENST00000515896.1	+	0	100									RNA, 5.8S ribosomal pseudogene 6																		ATCGACACTTCGAACGCACTT	0.552																																						dbGAP											0																																										-	-	-			0					Yp11.2	2012-08-07	2012-08-07	2012-08-07	ENSG00000251705	ENSG00000251705			41960	pseudogene	RNA, pseudogene			"""RNA, 5.8S ribosomal 6"""	RN5-8S6			Standard	NG_033474		Approved						Y.37:g.10037863delC				RNA	DEL	-	NULL	ENST00000515896.1	37	NULL		Y																																																																																			RNA5-8SP6	-	-	ENSG00000251705		0.552	RNA5-8SP6-201	KNOWN	basic	rRNA	RNA5-8SP6	HGNC	rRNA		18	0.00	0	C			10037863	10037863	+1	no_errors	ENST00000515896	ensembl	human	known	69_37n	rna	10	21.43	3	DEL	1.000	-
SAGE1	55511	genome.wustl.edu	37	X	134994548	134994548	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chrX:134994548G>A	ENST00000370709.3	+	18	2590	c.2590G>A	c.(2590-2592)Gaa>Aaa	p.E864K	SAGE1_ENST00000537770.1_Missense_Mutation_p.E488K|SAGE1_ENST00000324447.3_Missense_Mutation_p.E864K|SAGE1_ENST00000535938.1_Missense_Mutation_p.E864K			Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1	864						nucleus (GO:0005634)				breast(5)|endometrium(5)|large_intestine(10)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	55	Acute lymphoblastic leukemia(192;0.000127)					ACAATTTGTTGAATTTACCAT	0.348																																						dbGAP											0													125.0	120.0	122.0					X																	134994548		2202	4300	6502	-	-	-	SO:0001583	missense	0			AJ278111	CCDS14652.1	Xq26	2009-03-25			ENSG00000181433	ENSG00000181433			30369	protein-coding gene	gene with protein product	"""cancer/testis antigen 14"""	300359				10919659	Standard	NM_018666		Approved	SAGE, CT14	uc004ezh.3	Q9NXZ1	OTTHUMG00000022496	ENST00000370709.3:c.2590G>A	X.37:g.134994548G>A	ENSP00000359743:p.Glu864Lys		Q5JNW0	Missense_Mutation	SNP	NULL	p.E864K	ENST00000370709.3	37	c.2590	CCDS14652.1	X	.	.	.	.	.	.	.	.	.	.	G	12.76	2.035036	0.35893	.	.	ENSG00000181433	ENST00000324447;ENST00000535938;ENST00000537770;ENST00000370709	T;T;T;T	0.34472	1.36;1.36;1.37;1.36	2.15	1.06	0.20224	.	0.731706	0.13194	N	0.406475	T	0.24586	0.0596	L	0.31065	0.9	0.26935	N	0.966373	B;B	0.20550	0.046;0.003	B;B	0.15484	0.013;0.004	T	0.22661	-1.0210	10	0.54805	T	0.06	.	8.8107	0.34965	0.0:0.0:0.7772:0.2228	.	488;864	F5H2Z8;Q9NXZ1	.;SAGE1_HUMAN	K	864;864;488;864	ENSP00000323191:E864K;ENSP00000445959:E864K;ENSP00000438276:E488K;ENSP00000359743:E864K	ENSP00000323191:E864K	E	+	1	0	SAGE1	134822214	1.000000	0.71417	0.930000	0.37139	0.642000	0.38348	1.026000	0.30103	1.055000	0.40461	0.179000	0.17066	GAA	SAGE1	-	NULL	ENSG00000181433		0.348	SAGE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAGE1	HGNC	protein_coding	OTTHUMT00000058448.1	88	0.00	0	G	NM_018666		134994548	134994548	+1	no_errors	ENST00000324447	ensembl	human	known	69_37n	missense	46	13.21	7	SNP	0.995	A
SCN2A	6326	genome.wustl.edu	37	2	166201270	166201270	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr2:166201270G>T	ENST00000375437.2	+	16	3058	c.2768G>T	c.(2767-2769)tGg>tTg	p.W923L	SCN2A_ENST00000283256.6_Missense_Mutation_p.W923L|SCN2A_ENST00000375427.2_Missense_Mutation_p.W923L|SCN2A_ENST00000357398.3_Missense_Mutation_p.W923L	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	923					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.W923*(1)		NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CTCCCACGCTGGCACATGCAT	0.493																																						dbGAP											1	Substitution - Nonsense(1)	large_intestine(1)											239.0	213.0	222.0					2																	166201270		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.2768G>T	2.37:g.166201270G>T	ENSP00000364586:p.Trp923Leu		A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.W923L	ENST00000375437.2	37	c.2768	CCDS33314.1	2	.	.	.	.	.	.	.	.	.	.	G	29.1	4.973143	0.92919	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.98381	-4.9;-4.9;-4.9;-4.9	5.42	5.42	0.78866	Ion transport (1);	0.138819	0.35320	N	0.003287	D	0.99133	0.9701	M	0.88906	2.99	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.91635	0.999;0.999	D	0.99612	1.0981	10	0.87932	D	0	.	19.2493	0.93917	0.0:0.0:1.0:0.0	.	923;923	Q99250-2;Q99250	.;SCN2A_HUMAN	L	923	ENSP00000364586:W923L;ENSP00000349973:W923L;ENSP00000283256:W923L;ENSP00000364576:W923L	ENSP00000283256:W923L	W	+	2	0	SCN2A	165909516	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.714000	0.98744	2.542000	0.85734	0.650000	0.86243	TGG	SCN2A	-	pfam_Ion_trans_dom	ENSG00000136531		0.493	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN2A	HGNC	protein_coding	OTTHUMT00000102659.2	143	0.00	0	G	NM_021007		166201270	166201270	+1	no_errors	ENST00000283256	ensembl	human	known	69_37n	missense	52	22.39	15	SNP	1.000	T
SLC38A4	55089	genome.wustl.edu	37	12	47163175	47163175	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr12:47163175G>A	ENST00000447411.1	-	14	1542	c.1336C>T	c.(1336-1338)Cga>Tga	p.R446*	SLC38A4_ENST00000266579.4_Nonsense_Mutation_p.R446*	NM_001143824.1	NP_001137296.1	Q969I6	S38A4_HUMAN	solute carrier family 38, member 4	446					amino acid transport (GO:0006865)|ion transport (GO:0006811)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|symporter activity (GO:0015293)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|skin(1)	21	Lung SC(27;0.192)|Renal(347;0.236)					CTGAAGGGTCGTTTGGGAAAT	0.363																																						dbGAP											0													143.0	133.0	136.0					12																	47163175		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF193836	CCDS8750.1	12q13	2013-05-22				ENSG00000139209		"""Solute carriers"""	14679	protein-coding gene	gene with protein product		608065				11414754	Standard	NM_018018		Approved	PAAT, NAT3, ATA3	uc001rpj.2	Q969I6		ENST00000447411.1:c.1336C>T	12.37:g.47163175G>A	ENSP00000389843:p.Arg446*		A8K553	Nonsense_Mutation	SNP	pfam_AA_transpt_TM	p.R446*	ENST00000447411.1	37	c.1336	CCDS8750.1	12	.	.	.	.	.	.	.	.	.	.	G	42	9.731944	0.99249	.	.	ENSG00000139209	ENST00000447411;ENST00000266579	.	.	.	5.66	4.51	0.55191	.	0.217160	0.48286	D	0.000185	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	-16.5079	13.115	0.59295	0.0:0.0:0.1342:0.8657	.	.	.	.	X	446	.	ENSP00000266579:R446X	R	-	1	2	SLC38A4	45449442	1.000000	0.71417	0.984000	0.44739	0.938000	0.57974	2.866000	0.48420	0.976000	0.38417	-0.546000	0.04227	CGA	SLC38A4	-	pfam_AA_transpt_TM	ENSG00000139209		0.363	SLC38A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC38A4	HGNC	protein_coding	OTTHUMT00000404574.1	48	0.00	0	G			47163175	47163175	-1	no_errors	ENST00000266579	ensembl	human	known	69_37n	nonsense	34	17.07	7	SNP	0.997	A
SFSWAP	6433	genome.wustl.edu	37	12	132241104	132241104	+	Silent	SNP	A	A	C			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr12:132241104A>C	ENST00000261674.4	+	11	1776	c.1635A>C	c.(1633-1635)gcA>gcC	p.A545A	RP11-495K9.5_ENST00000537032.1_lincRNA|SFSWAP_ENST00000541286.1_Silent_p.A545A	NM_004592.3	NP_004583.2	Q12872	SFSWA_HUMAN	splicing factor, suppressor of white-apricot family	545					mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	RNA binding (GO:0003723)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(8)|ovary(1)|skin(2)	25						CTGAAGACGCAGCCGAGGTGG	0.607																																						dbGAP											0													69.0	63.0	65.0					12																	132241104		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U08377	CCDS9273.1, CCDS58290.1	12q24.33	2014-04-14	2014-04-14	2010-09-15	ENSG00000061936	ENSG00000061936			10790	protein-coding gene	gene with protein product		601945	"""splicing factor, arginine/serine-rich 8 (suppressor-of-white-apricot, Drosophila homolog)"", ""splicing factor, arginine/serine-rich 8 (suppressor-of-white-apricot homolog, Drosophila)"", ""splicing factor, suppressor of white-apricot homolog (Drosophila)"""	SFRS8		8940107	Standard	NM_004592		Approved	SWAP	uc010tbn.2	Q12872	OTTHUMG00000168319	ENST00000261674.4:c.1635A>C	12.37:g.132241104A>C			B2RN45|B7ZM97|F5H6B8|Q6PJF7	Missense_Mutation	SNP	pfam_Surp,superfamily_Surp,smart_Surp,pfscan_Surp	p.Q185P	ENST00000261674.4	37	c.554	CCDS9273.1	12	.	.	.	.	.	.	.	.	.	.	A	7.236	0.600230	0.13939	.	.	ENSG00000061936	ENST00000537164	.	.	.	5.34	-10.7	0.00240	.	.	.	.	.	T	0.15219	0.0367	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.09729	-1.0661	4	.	.	.	1.2332	3.3284	0.07075	0.5271:0.1904:0.1081:0.1744	.	.	.	.	P	185	.	.	Q	+	2	0	SFSWAP	130807057	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.389000	0.01058	-2.259000	0.00693	-1.044000	0.02363	CAG	SFSWAP	-	NULL	ENSG00000061936		0.607	SFSWAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SFSWAP	HGNC	protein_coding	OTTHUMT00000399276.1	34	0.00	0	A	NM_004592		132241104	132241104	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000537164	ensembl	human	putative	69_37n	missense	16	30.43	7	SNP	0.000	C
SLC4A4	8671	genome.wustl.edu	37	4	72205101	72205101	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr4:72205101G>A	ENST00000264485.5	+	4	385	c.268G>A	c.(268-270)Gaa>Aaa	p.E90K	SLC4A4_ENST00000351898.6_Missense_Mutation_p.E90K|SLC4A4_ENST00000512686.1_Missense_Mutation_p.E46K|SLC4A4_ENST00000425175.1_Missense_Mutation_p.E90K|SLC4A4_ENST00000340595.3_Missense_Mutation_p.E46K|SLC4A4_ENST00000514331.1_3'UTR	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	90					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	TCCTGCTGCAGAACGCATCCG	0.562																																						dbGAP											0													176.0	184.0	182.0					4																	72205101		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.268G>A	4.37:g.72205101G>A	ENSP00000264485:p.Glu90Lys		C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Na/HCO3_transpt,tigrfam_HCO3_transpt_euk	p.E90K	ENST00000264485.5	37	c.268	CCDS43236.1	4	.	.	.	.	.	.	.	.	.	.	G	27.0	4.789933	0.90367	.	.	ENSG00000080493	ENST00000264485;ENST00000425175;ENST00000351898;ENST00000512686;ENST00000340595	T;T;T;T;T	0.79454	-1.22;-1.23;-0.86;-0.09;-1.27	5.49	5.49	0.81192	.	0.050224	0.85682	D	0.000000	D	0.88599	0.6480	M	0.77616	2.38	0.80722	D	1	P;D;D;D;P	0.76494	0.956;0.968;0.997;0.999;0.94	P;P;D;D;P	0.85130	0.624;0.835;0.961;0.997;0.624	D	0.88110	0.2825	10	0.46703	T	0.11	.	19.3765	0.94512	0.0:0.0:1.0:0.0	.	90;90;46;46;90	A5JJ20;Q9Y6R1-4;Q9Y6R1-2;Q9Y6R1-3;Q9Y6R1	.;.;.;.;S4A4_HUMAN	K	90;90;90;46;46	ENSP00000264485:E90K;ENSP00000393557:E90K;ENSP00000307349:E90K;ENSP00000422400:E46K;ENSP00000344272:E46K	ENSP00000264485:E90K	E	+	1	0	SLC4A4	72423965	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	8.010000	0.88615	2.566000	0.86566	0.591000	0.81541	GAA	SLC4A4	-	NULL	ENSG00000080493		0.562	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC4A4	HGNC	protein_coding	OTTHUMT00000362090.1	58	0.00	0	G	NM_003759		72205101	72205101	+1	no_errors	ENST00000425175	ensembl	human	known	69_37n	missense	27	25.00	9	SNP	1.000	A
TET2	54790	genome.wustl.edu	37	4	106190872	106190872	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr4:106190872G>C	ENST00000540549.1	+	9	5010	c.4150G>C	c.(4150-4152)Gac>Cac	p.D1384H	TET2_ENST00000380013.4_Missense_Mutation_p.D1384H|TET2_ENST00000545826.1_3'UTR|TET2_ENST00000513237.1_Missense_Mutation_p.D1405H			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	1384					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		TGCCCACAGAGACTTGCACAA	0.502			"""Mis N, F"""		MDS																																	dbGAP		Rec	yes		4	4q24	54790	tet oncogene family member 2		L	0													80.0	71.0	74.0					4																	106190872		692	1591	2283	-	-	-	SO:0001583	missense	0			AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.4150G>C	4.37:g.106190872G>C	ENSP00000442788:p.Asp1384His		B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Missense_Mutation	SNP	NULL	p.D1384H	ENST00000540549.1	37	c.4150	CCDS47120.1	4	.	.	.	.	.	.	.	.	.	.	G	28.7	4.946647	0.92593	.	.	ENSG00000168769	ENST00000540549;ENST00000513237;ENST00000380013	T;T;T	0.47869	0.83;0.83;0.83	5.62	5.62	0.85841	Methylcytosine dioxygenase TET, double-stranded beta helix fold domain (1);	.	.	.	.	T	0.74884	0.3775	M	0.86502	2.82	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.78912	-0.2017	9	0.87932	D	0	-17.1519	19.6702	0.95909	0.0:0.0:1.0:0.0	.	1405;1384	E7EQS8;Q6N021	.;TET2_HUMAN	H	1384;1405;1384	ENSP00000442788:D1384H;ENSP00000425443:D1405H;ENSP00000369351:D1384H	ENSP00000369351:D1384H	D	+	1	0	TET2	106410321	1.000000	0.71417	0.718000	0.30602	0.901000	0.52897	9.681000	0.98653	2.664000	0.90586	0.655000	0.94253	GAC	TET2	-	NULL	ENSG00000168769		0.502	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	TET2	HGNC	protein_coding	OTTHUMT00000253952.2	42	0.00	0	G	NM_017628		106190872	106190872	+1	no_errors	ENST00000380013	ensembl	human	known	69_37n	missense	21	22.22	6	SNP	1.000	C
SPATA4	132851	genome.wustl.edu	37	4	177116659	177116659	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr4:177116659C>G	ENST00000280191.2	-	1	163	c.55G>C	c.(55-57)Gac>Cac	p.D19H	SPATA4_ENST00000515234.1_5'Flank	NM_144644.2	NP_653245.2	Q8NEY3	SPAT4_HUMAN	spermatogenesis associated 4	19						cytoplasm (GO:0005737)				NS(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(10)	22		Breast(14;0.0011)|Prostate(90;0.0129)|Melanoma(52;0.0133)|Renal(120;0.0376)|all_hematologic(60;0.124)		all cancers(43;2.9e-20)|Epithelial(43;1.99e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.58e-09)|GBM - Glioblastoma multiforme(59;0.000162)|STAD - Stomach adenocarcinoma(60;0.000543)|LUSC - Lung squamous cell carcinoma(193;0.096)		GGTGACTTGTCTAGGGCTGCC	0.612																																						dbGAP											0													113.0	101.0	105.0					4																	177116659		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY040204	CCDS3826.1	4q34.2	2008-02-05			ENSG00000150628	ENSG00000150628			17333	protein-coding gene	gene with protein product		609879					Standard	NM_144644		Approved	TSARG2, SPEF1B	uc003iuo.1	Q8NEY3	OTTHUMG00000160788	ENST00000280191.2:c.55G>C	4.37:g.177116659C>G	ENSP00000280191:p.Asp19His		Q8NCS5|Q8WW15	Missense_Mutation	SNP	pfam_DUF1042,pfam_CAMSAP_CH,superfamily_CH-domain	p.D19H	ENST00000280191.2	37	c.55	CCDS3826.1	4	.	.	.	.	.	.	.	.	.	.	C	12.06	1.824373	0.32237	.	.	ENSG00000150628	ENST00000280191	T	0.45668	0.89	4.42	-5.94	0.02247	.	1.373870	0.04919	N	0.454625	T	0.18173	0.0436	N	0.08118	0	0.09310	N	0.999999	B	0.18166	0.026	B	0.08055	0.003	T	0.13388	-1.0511	10	0.62326	D	0.03	-0.7205	1.7094	0.02889	0.4074:0.3003:0.1186:0.1736	.	19	Q8NEY3	SPAT4_HUMAN	H	19	ENSP00000280191:D19H	ENSP00000280191:D19H	D	-	1	0	SPATA4	177353653	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.781000	0.01774	-1.645000	0.01515	-0.302000	0.09304	GAC	SPATA4	-	NULL	ENSG00000150628		0.612	SPATA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA4	HGNC	protein_coding	OTTHUMT00000362326.1	64	0.00	0	C	NM_144644		177116659	177116659	-1	no_errors	ENST00000280191	ensembl	human	known	69_37n	missense	21	16.00	4	SNP	0.000	G
TIGD7	91151	genome.wustl.edu	37	16	3349850	3349850	+	Silent	SNP	A	A	T			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr16:3349850A>T	ENST00000396862.1	-	2	2593	c.765T>A	c.(763-765)gtT>gtA	p.V255V	TIGD7_ENST00000268674.2_Silent_p.V255V|TIGD7_ENST00000574598.1_5'Flank	NM_033208.3	NP_149985.2	Q6NT04	TIGD7_HUMAN	tigger transposable element derived 7	255	DDE.					nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12						tggtgaaccaaacatctttac	0.343																																						dbGAP											0													103.0	109.0	107.0					16																	3349850		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AF251050	CCDS10500.1	16p13.11	2008-02-05			ENSG00000140993	ENSG00000140993			18331	protein-coding gene	gene with protein product		612969					Standard	NM_033208		Approved	Sancho	uc002cus.3	Q6NT04	OTTHUMG00000129325	ENST00000396862.1:c.765T>A	16.37:g.3349850A>T			Q9BXZ0	Silent	SNP	pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_CenpB_DNA-bd_dom,pfam_HTH_Psq,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_HTH_Psq	p.V255	ENST00000396862.1	37	c.765	CCDS10500.1	16																																																																																			TIGD7	-	pfam_DDE_SF_endonuclease_CENPB-like	ENSG00000140993		0.343	TIGD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGD7	HGNC	protein_coding	OTTHUMT00000251465.1	48	0.00	0	A	NM_033208		3349850	3349850	-1	no_errors	ENST00000268674	ensembl	human	known	69_37n	silent	61	11.59	8	SNP	0.565	T
TRIM33	51592	genome.wustl.edu	37	1	114944055	114944055	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr1:114944055A>G	ENST00000358465.2	-	17	3006	c.2923T>C	c.(2923-2925)Tgc>Cgc	p.C975R	TRIM33_ENST00000369543.2_Missense_Mutation_p.C975R|TRIM33_ENST00000476908.1_5'Flank|TRIM33_ENST00000450349.2_Missense_Mutation_p.C607R	NM_015906.3	NP_056990.3	Q9UPN9	TRI33_HUMAN	tripartite motif containing 33	975	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.				gene expression (GO:0010467)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	co-SMAD binding (GO:0070410)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|R-SMAD binding (GO:0070412)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	48	all_epithelial(7;0.000132)|all_lung(7;0.00106)|Lung SC(450;0.184)	all_cancers(81;3.03e-08)|all_epithelial(167;3.24e-08)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AATTCATGGCAATAGAGGTAA	0.403			T	RET	papillary thyroid																																	dbGAP		Dom	yes		1	1p13	51592	""" tripartite motif-containing 33 (PTC7,TIF1G)"""		E	0													72.0	70.0	71.0					1																	114944055		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF220136	CCDS872.1, CCDS873.1	1p13.1	2014-02-17	2011-01-25		ENSG00000197323	ENSG00000197323		"""Tripartite motif containing / Tripartite motif containing"", ""Zinc fingers, PHD-type"", ""RING-type (C3HC4) zinc fingers"""	16290	protein-coding gene	gene with protein product	"""transcriptional intermediary factor 1 gamma"", ""ret-fused gene 7"""	605769	"""tripartite motif-containing 33"""			11331580, 10022127	Standard	XM_005270936		Approved	TIF1GAMMA, FLJ11429, KIAA1113, TIFGAMMA, RFG7, TF1G, TIF1G, PTC7	uc001eew.3	Q9UPN9	OTTHUMG00000011891	ENST00000358465.2:c.2923T>C	1.37:g.114944055A>G	ENSP00000351250:p.Cys975Arg		O95855|Q5TG72|Q5TG73|Q5TG74|Q9C017|Q9UJ79	Missense_Mutation	SNP	pfam_Bromodomain,pfam_Znf_B-box,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Bromodomain,prints_Bromodomain,pfscan_Znf_B-box,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_Bromodomain	p.C975R	ENST00000358465.2	37	c.2923	CCDS872.1	1	.	.	.	.	.	.	.	.	.	.	A	25.8	4.670369	0.88348	.	.	ENSG00000197323	ENST00000358465;ENST00000369543;ENST00000450349	T;T;T	0.27402	1.67;1.67;1.67	5.86	5.86	0.93980	Bromodomain (5);	0.000000	0.85682	D	0.000000	T	0.36358	0.0964	L	0.28504	0.86	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;0.999	T	0.31223	-0.9951	10	0.87932	D	0	-7.5357	16.5602	0.84551	1.0:0.0:0.0:0.0	.	607;607;975;975	E7EN20;B3KN30;Q9UPN9-2;Q9UPN9	.;.;.;TRI33_HUMAN	R	975;975;607	ENSP00000351250:C975R;ENSP00000358556:C975R;ENSP00000412077:C607R	ENSP00000351250:C975R	C	-	1	0	TRIM33	114745578	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.846000	0.92159	2.367000	0.80283	0.528000	0.53228	TGC	TRIM33	-	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain	ENSG00000197323		0.403	TRIM33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM33	HGNC	protein_coding	OTTHUMT00000032854.1	41	0.00	0	A	NM_015906		114944055	114944055	-1	no_errors	ENST00000358465	ensembl	human	known	69_37n	missense	31	24.39	10	SNP	1.000	G
TTPAL	79183	genome.wustl.edu	37	20	43113021	43113021	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr20:43113021G>A	ENST00000372904.3	+	4	633	c.490G>A	c.(490-492)Gcc>Acc	p.A164T	TTPAL_ENST00000262605.4_Missense_Mutation_p.A164T|TTPAL_ENST00000372906.2_Intron	NM_024331.4	NP_077307.2	Q9BTX7	TTPAL_HUMAN	tocopherol (alpha) transfer protein-like	164	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.					intracellular (GO:0005622)|membrane (GO:0016020)	transporter activity (GO:0005215)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|ovary(2)|skin(5)	18						AAACATCCGAGCCATATACTT	0.358																																						dbGAP											0													87.0	82.0	84.0					20																	43113021		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC003071	CCDS13332.2	20q13.12	2008-06-23	2008-06-23	2008-06-23	ENSG00000124120	ENSG00000124120			16114	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 121"""	C20orf121			Standard	NM_024331		Approved	dJ179M20.3	uc002xmd.2	Q9BTX7	OTTHUMG00000032536	ENST00000372904.3:c.490G>A	20.37:g.43113021G>A	ENSP00000361995:p.Ala164Thr		E1P5X3|Q5QPC1|Q9H1G2|Q9NQG8	Missense_Mutation	SNP	pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_CRAL/TRIO_N_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,prints_CRAL-bd_toc_tran	p.A164T	ENST00000372904.3	37	c.490	CCDS13332.2	20	.	.	.	.	.	.	.	.	.	.	G	35	5.470305	0.96274	.	.	ENSG00000124120	ENST00000262605;ENST00000372904;ENST00000456317	T;T;D	0.84516	-1.04;-1.04;-1.86	5.9	5.9	0.94986	Cellular retinaldehyde-binding/triple function, C-terminal (5);	0.044331	0.85682	D	0.000000	D	0.85358	0.5678	L	0.48935	1.535	0.80722	D	1	P	0.44344	0.833	P	0.45195	0.473	D	0.84606	0.0675	10	0.45353	T	0.12	-21.6666	20.2626	0.98452	0.0:0.0:1.0:0.0	.	164	Q9BTX7	TTPAL_HUMAN	T	164	ENSP00000262605:A164T;ENSP00000361995:A164T;ENSP00000412720:A164T	ENSP00000262605:A164T	A	+	1	0	TTPAL	42546435	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	9.845000	0.99498	2.802000	0.96397	0.650000	0.86243	GCC	TTPAL	-	pfam_CRAL-TRIO_dom,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	ENSG00000124120		0.358	TTPAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTPAL	HGNC	protein_coding	OTTHUMT00000106886.2	64	0.00	0	G	NM_024331		43113021	43113021	+1	no_errors	ENST00000262605	ensembl	human	known	69_37n	missense	48	15.79	9	SNP	1.000	A
TWF2	11344	genome.wustl.edu	37	3	52265497	52265497	+	Missense_Mutation	SNP	C	C	A	rs200379551		TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr3:52265497C>A	ENST00000305533.5	-	4	584	c.341G>T	c.(340-342)gGt>gTt	p.G114V	TWF2_ENST00000499914.2_Missense_Mutation_p.G114V|TLR9_ENST00000494383.1_5'Flank|TLR9_ENST00000597542.1_5'UTR	NM_007284.3	NP_009215.1	Q6IBS0	TWF2_HUMAN	twinfilin actin-binding protein 2	114	ADF-H 1. {ECO:0000255|PROSITE- ProRule:PRU00599}.				barbed-end actin filament capping (GO:0051016)|cell projection organization (GO:0030030)|cellular response to growth factor stimulus (GO:0071363)|cellular response to retinoic acid (GO:0071300)|negative regulation of actin filament polymerization (GO:0030837)|positive regulation of axon extension (GO:0045773)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of microvillus length (GO:0032532)|sequestering of actin monomers (GO:0042989)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|myofibril (GO:0030016)|perinuclear region of cytoplasm (GO:0048471)|stereocilium (GO:0032420)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|poly(A) RNA binding (GO:0044822)|protein kinase C binding (GO:0005080)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|stomach(1)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;2.43e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GATGTGGCCACCTCCAAACTC	0.592											OREG0015610	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													183.0	168.0	173.0					3																	52265497		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y17169	CCDS2849.1	3p21.1	2013-04-25	2013-04-25	2006-11-13	ENSG00000247596	ENSG00000247596			9621	protein-coding gene	gene with protein product		607433	"""protein tyrosine kinase 9-like (A6-related protein)"", ""PTK9L protein tyrosine kinase 9-like (A6-related protein)"", ""twinfilin, actin-binding protein, homolog 2 (Drosophila)"""	PTK9L		10406962, 12807912	Standard	NM_007284		Approved	A6RP, A6r		Q6IBS0	OTTHUMG00000158105	ENST00000305533.5:c.341G>T	3.37:g.52265497C>A	ENSP00000303908:p.Gly114Val	983	Q9Y3F5	Missense_Mutation	SNP	pfam_Actin-bd_cofilin/tropomyosin,smart_Actin-bd_cofilin/tropomyosin	p.G114V	ENST00000305533.5	37	c.341	CCDS2849.1	3	.	.	.	.	.	.	.	.	.	.	C	25.3	4.625649	0.87560	.	.	ENSG00000247596	ENST00000305533;ENST00000499914	T;T	0.44083	0.93;0.93	5.43	5.43	0.79202	Actin-binding, cofilin/tropomyosin type (3);	.	.	.	.	T	0.68238	0.2979	M	0.86178	2.8	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.79108	0.97;0.992	T	0.73375	-0.4002	9	0.72032	D	0.01	.	15.5765	0.76392	0.1383:0.8617:0.0:0.0	.	114;114	D6RG15;Q6IBS0	.;TWF2_HUMAN	V	114	ENSP00000303908:G114V;ENSP00000426464:G114V	ENSP00000303908:G114V	G	-	2	0	TWF2	52240537	1.000000	0.71417	0.983000	0.44433	0.977000	0.68977	6.031000	0.70911	2.537000	0.85549	0.462000	0.41574	GGT	TWF2	-	pfam_Actin-bd_cofilin/tropomyosin,smart_Actin-bd_cofilin/tropomyosin	ENSG00000247596		0.592	TWF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TWF2	HGNC	protein_coding	OTTHUMT00000350199.2	33	0.00	0	C			52265497	52265497	-1	no_errors	ENST00000305533	ensembl	human	known	69_37n	missense	28	20.00	7	SNP	0.996	A
TYW1B	441250	genome.wustl.edu	37	7	72286035	72286035	+	RNA	SNP	G	G	A			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr7:72286035G>A	ENST00000435769.2	-	0	283				TYW1B_ENST00000438904.2_RNA|TYW1B_ENST00000438125.1_RNA			Q6NUM6	TYW1B_HUMAN	tRNA-yW synthesizing protein 1 homolog B (S. cerevisiae)						tRNA processing (GO:0008033)		4 iron, 4 sulfur cluster binding (GO:0051539)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity (GO:0016491)										GGACGTAACTGCTTCAGCAAG	0.378																																						dbGAP											0													155.0	131.0	138.0					7																	72286035		692	1591	2283	-	-	-			0			BC068520	CCDS69309.1	7q11.23	2011-08-11	2009-07-28		ENSG00000254184	ENSG00000277149			33908	protein-coding gene	gene with protein product	"""radical S-adenosyl methionine and flavodoxin domains 1"", ""non-protein coding RNA 69"", ""long intergenic non-protein coding RNA 69"""		"""tRNA-yW synthesizing protein 1 homolog B (non-protein coding)"""				Standard	NM_001145440		Approved	RSAFD2, MGC87315, NCRNA00069, LINC00069	uc011kej.2	Q6NUM6	OTTHUMG00000157067		7.37:g.72286035G>A			A6NG09|B4DFY2|Q3KQX2	RNA	SNP	-	NULL	ENST00000435769.2	37	NULL		7																																																																																			TYW1B	-	-	ENSG00000254184		0.378	TYW1B-001	KNOWN	basic	polymorphic_pseudogene	TYW1B	HGNC	polymorphic_pseudogene	OTTHUMT00000347346.2	118	0.00	0	G	NM_001145440		72286035	72286035	-1	no_errors	ENST00000437915	ensembl	human	known	69_37n	rna	57	16.18	11	SNP	0.831	A
WDR66	144406	genome.wustl.edu	37	12	122413496	122413496	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr12:122413496G>C	ENST00000288912.4	+	19	3765	c.2911G>C	c.(2911-2913)Gac>Cac	p.D971H		NM_144668.5	NP_653269.3	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	971							calcium ion binding (GO:0005509)	p.D971N(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(13)|ovary(2)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		TCAAGGCATCGACACAATGGA	0.443																																					Esophageal Squamous(85;849 1794 49757 52143)	dbGAP											1	Substitution - Missense(1)	lung(1)											117.0	107.0	110.0					12																	122413496		1942	4139	6081	-	-	-	SO:0001583	missense	0			AL833930	CCDS41853.1, CCDS53840.1	12q24.31	2014-07-31			ENSG00000158023	ENSG00000158023		"""WD repeat domain containing"""	28506	protein-coding gene	gene with protein product						17967944	Standard	NM_001178003		Approved	MGC33630, CaM-IP4	uc009zxk.3	Q8TBY9	OTTHUMG00000168948	ENST00000288912.4:c.2911G>C	12.37:g.122413496G>C	ENSP00000288912:p.Asp971His		C9J1W2|Q8IYA3|Q8N898|Q8NDE7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.D971H	ENST00000288912.4	37	c.2911	CCDS41853.1	12	.	.	.	.	.	.	.	.	.	.	G	11.44	1.638596	0.29157	.	.	ENSG00000158023	ENST00000288912	T	0.05996	3.36	5.05	5.05	0.67936	.	0.113604	0.64402	D	0.000019	T	0.11495	0.0280	M	0.66939	2.045	0.80722	D	1	P	0.42871	0.792	B	0.43575	0.424	T	0.00613	-1.1644	10	0.72032	D	0.01	.	11.4766	0.50302	0.1319:0.0:0.8681:0.0	.	971	Q8TBY9	WDR66_HUMAN	H	971	ENSP00000288912:D971H	ENSP00000288912:D971H	D	+	1	0	WDR66	120897879	1.000000	0.71417	0.246000	0.24233	0.078000	0.17371	4.166000	0.58203	2.341000	0.79615	0.561000	0.74099	GAC	WDR66	-	NULL	ENSG00000158023		0.443	WDR66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR66	HGNC	protein_coding	OTTHUMT00000401700.1	87	0.00	0	G	NM_144668		122413496	122413496	+1	no_errors	ENST00000288912	ensembl	human	known	69_37n	missense	49	19.67	12	SNP	0.835	C
CFAP43	80217	genome.wustl.edu	37	10	105948072	105948072	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr10:105948072C>A	ENST00000278064.2	-	13	1761	c.1436G>T	c.(1435-1437)aGa>aTa	p.R479I	WDR96_ENST00000357060.3_Missense_Mutation_p.R548I|WDR96_ENST00000428666.1_Missense_Mutation_p.R549I																NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(14)|lung(21)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CAACCTGCTTCTCCCTGCTTC	0.453																																						dbGAP											0													178.0	143.0	155.0					10																	105948072		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000278064.2:c.1436G>T	10.37:g.105948072C>A	ENSP00000278064:p.Arg479Ile			Missense_Mutation	SNP	superfamily_WD40_repeat_dom,superfamily_Quino_amine_DH_bsu	p.R548I	ENST00000278064.2	37	c.1643		10	.	.	.	.	.	.	.	.	.	.	C	13.11	2.139588	0.37728	.	.	ENSG00000197748	ENST00000357060;ENST00000428666;ENST00000278064	T;T;T	0.15256	2.44;2.44;2.46	5.94	3.09	0.35607	WD40 repeat-like-containing domain (1);	0.133152	0.34700	N	0.003760	T	0.28400	0.0702	L	0.57536	1.79	0.40266	D	0.978233	D;P	0.71674	0.998;0.514	D;B	0.65443	0.935;0.108	T	0.08659	-1.0711	10	0.17832	T	0.49	.	7.867	0.29543	0.0:0.7629:0.0:0.2371	.	549;548	B4DHB6;Q8NDM7	.;WDR96_HUMAN	I	548;549;479	ENSP00000349568:R548I;ENSP00000400289:R549I;ENSP00000278064:R479I	ENSP00000278064:R479I	R	-	2	0	WDR96	105938062	0.987000	0.35691	0.905000	0.35620	0.097000	0.18754	0.670000	0.25157	1.527000	0.49086	0.561000	0.74099	AGA	WDR96	-	superfamily_WD40_repeat_dom	ENSG00000197748		0.453	WDR96-003	KNOWN	basic	protein_coding	WDR96	HGNC	protein_coding	OTTHUMT00000050200.1	77	0.00	0	C			105948072	105948072	-1	no_errors	ENST00000357060	ensembl	human	known	69_37n	missense	50	27.54	19	SNP	0.871	A
XRN1	54464	genome.wustl.edu	37	3	142090130	142090130	+	Nonsense_Mutation	SNP	C	C	A	rs140150868		TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr3:142090130C>A	ENST00000264951.4	-	26	3136	c.3019G>T	c.(3019-3021)Gag>Tag	p.E1007*	XRN1_ENST00000392981.2_Nonsense_Mutation_p.E1007*	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	1007					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						AACACATCCTCTTGGCTATTT	0.313																																						dbGAP											0													88.0	87.0	87.0					3																	142090130		2202	4300	6502	-	-	-	SO:0001587	stop_gained	0			AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.3019G>T	3.37:g.142090130C>A	ENSP00000264951:p.Glu1007*		Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Nonsense_Mutation	SNP	pfam_Put_53exo,pirsf_5_3_exoribonuclease_1	p.E1007*	ENST00000264951.4	37	c.3019	CCDS3123.1	3	.	.	.	.	.	.	.	.	.	.	C	37	6.175915	0.97348	.	.	ENSG00000114127	ENST00000264951;ENST00000392981	.	.	.	5.28	4.4	0.53042	.	0.184247	0.47455	D	0.000224	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11794	T	0.64	-16.1067	15.6486	0.77073	0.1383:0.8617:0.0:0.0	.	.	.	.	X	1007	.	ENSP00000264951:E1007X	E	-	1	0	XRN1	143572820	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.230000	0.78097	1.334000	0.45468	0.563000	0.77884	GAG	XRN1	-	pirsf_5_3_exoribonuclease_1	ENSG00000114127		0.313	XRN1-001	KNOWN	basic|CCDS	protein_coding	XRN1	HGNC	protein_coding	OTTHUMT00000354087.2	115	0.00	0	C	NM_019001		142090130	142090130	-1	no_errors	ENST00000264951	ensembl	human	known	69_37n	nonsense	109	10.66	13	SNP	1.000	A
ZC3H15	55854	genome.wustl.edu	37	2	187370543	187370543	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr2:187370543A>G	ENST00000337859.6	+	8	1168	c.941A>G	c.(940-942)tAc>tGc	p.Y314C	ZC3H15_ENST00000544130.1_Missense_Mutation_p.Y109C	NM_018471.2	NP_060941.2	Q8WU90	ZC3HF_HUMAN	zinc finger CCCH-type containing 15	314					cytokine-mediated signaling pathway (GO:0019221)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|skin(1)	15			OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Epithelial(96;0.0922)|all cancers(119;0.233)			GATACCCGCTACACCCAGGGA	0.408																																						dbGAP											0													103.0	100.0	101.0					2																	187370543		2018	4179	6197	-	-	-	SO:0001583	missense	0				CCDS42791.1	2q32.1	2012-07-05			ENSG00000065548	ENSG00000065548		"""Zinc fingers, CCCH-type domain containing"""	29528	protein-coding gene	gene with protein product	"""likely ortholog of mouse immediate early response, erythropoietin 4"""					10880228	Standard	NM_018471		Approved	LEREPO4	uc002upo.3	Q8WU90	OTTHUMG00000154251	ENST00000337859.6:c.941A>G	2.37:g.187370543A>G	ENSP00000338788:p.Tyr314Cys		B4DMW2|D3DPG7|Q5QTQ4|Q8WZ06|Q9NUZ3|Q9NZ37|Q9P079	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.Y314C	ENST00000337859.6	37	c.941	CCDS42791.1	2	.	.	.	.	.	.	.	.	.	.	A	14.93	2.681345	0.47991	.	.	ENSG00000065548	ENST00000337859;ENST00000544130;ENST00000536434	T	0.33865	1.39	6.17	6.17	0.99709	.	0.051927	0.85682	D	0.000000	T	0.40670	0.1126	M	0.75264	2.295	0.80722	D	1	P	0.35612	0.512	B	0.29440	0.102	T	0.39078	-0.9631	10	0.56958	D	0.05	-2.0012	16.8222	0.85835	1.0:0.0:0.0:0.0	.	314	Q8WU90	ZC3HF_HUMAN	C	314;109;314	ENSP00000338788:Y314C	ENSP00000338788:Y314C	Y	+	2	0	ZC3H15	187078788	1.000000	0.71417	0.525000	0.27900	0.553000	0.35397	6.219000	0.72231	2.371000	0.80710	0.533000	0.62120	TAC	ZC3H15	-	NULL	ENSG00000065548		0.408	ZC3H15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H15	HGNC	protein_coding	OTTHUMT00000334547.2	122	0.00	0	A	NM_018471		187370543	187370543	+1	no_errors	ENST00000337859	ensembl	human	known	69_37n	missense	44	16.98	9	SNP	0.988	G
ZNF546	339327	genome.wustl.edu	37	19	40521493	40521493	+	Silent	SNP	G	G	A	rs572702979		TCGA-AR-A255-01A-11D-A167-09	TCGA-AR-A255-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	505f1398-0bd8-4f1c-a142-651605158bf3	b9cf1b28-7656-4648-a3de-714e4a154c3e	g.chr19:40521493G>A	ENST00000347077.4	+	7	2532	c.2316G>A	c.(2314-2316)acG>acA	p.T772T	ZNF546_ENST00000596894.1_Intron|ZNF546_ENST00000600094.1_Silent_p.T746T	NM_178544.3	NP_848639.2	Q86UE3	ZN546_HUMAN	zinc finger protein 546	772					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(15)|lung(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)	34	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					TAGTTCACACGGGTGAGAAAC	0.388													G|||	1	0.000199681	0.0	0.0	5008	,	,		21388	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													61.0	58.0	59.0					19																	40521493		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC045649	CCDS12548.1	19q13.2	2013-01-08				ENSG00000187187		"""Zinc fingers, C2H2-type"", ""-"""	28671	protein-coding gene	gene with protein product				ZNF49		12477932	Standard	XM_005258853		Approved	MGC43537	uc002oms.2	Q86UE3		ENST00000347077.4:c.2316G>A	19.37:g.40521493G>A			A8K913	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T772	ENST00000347077.4	37	c.2316	CCDS12548.1	19																																																																																			ZNF546	-	pfscan_Znf_C2H2	ENSG00000187187		0.388	ZNF546-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF546	HGNC	protein_coding	OTTHUMT00000462495.2	36	0.00	0	G	NM_178544		40521493	40521493	+1	no_errors	ENST00000347077	ensembl	human	known	69_37n	silent	26	35.00	14	SNP	0.985	A
