#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
PXYLP1	92370	genome.wustl.edu	37	3	141011671	141011671	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr3:141011671delC	ENST00000286353.4	+	6	1204	c.1067delC	c.(1066-1068)accfs	p.T356fs	ACPL2_ENST00000393007.1_Frame_Shift_Del_p.T340fs|ACPL2_ENST00000502783.1_Frame_Shift_Del_p.T318fs|RP11-438D8.2_ENST00000507698.1_RNA|ACPL2_ENST00000393010.2_Frame_Shift_Del_p.T356fs|ACPL2_ENST00000508812.1_Frame_Shift_Del_p.T347fs|ACPL2_ENST00000504264.1_Frame_Shift_Del_p.T339fs	NM_001037172.1|NM_001282728.1	NP_001032249.1|NP_001269657.1	Q8TE99	PXYP1_HUMAN		356						extracellular region (GO:0005576)	acid phosphatase activity (GO:0003993)			endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|prostate(2)|skin(2)	23						CTGAACCAAACCATCGGCCGG	0.527																																						dbGAP											0													126.0	102.0	110.0					3																	141011671		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0																														ENST00000286353.4:c.1067delC	3.37:g.141011671delC	ENSP00000286353:p.Thr356fs		D3DNF5|Q49AJ2|W0TR04	Frame_Shift_Del	DEL	pfam_His_Pase_superF_clade-2	p.I357fs	ENST00000286353.4	37	c.1067	CCDS3116.1	3																																																																																			ACPL2	-	pfam_His_Pase_superF_clade-2	ENSG00000155893		0.527	ACPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACPL2	HGNC	protein_coding	OTTHUMT00000359533.2	49	0.00	0	C			141011671	141011671	+1	no_errors	ENST00000286353	ensembl	human	known	69_37n	frame_shift_del	35	18.18	8	DEL	0.827	-
ANLN	54443	genome.wustl.edu	37	7	36447401	36447401	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr7:36447401G>A	ENST00000265748.2	+	5	1153	c.932G>A	c.(931-933)gGa>gAa	p.G311E	ANLN_ENST00000396068.2_Missense_Mutation_p.G311E|ANLN_ENST00000495714.1_3'UTR	NM_018685.2	NP_061155.2	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein	311	Interaction with F-actin.				hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|regulation of exit from mitosis (GO:0007096)|septin ring assembly (GO:0000921)	actin cytoskeleton (GO:0015629)|actomyosin contractile ring (GO:0005826)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	actin binding (GO:0003779)			breast(2)|endometrium(5)|kidney(5)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(2)	45						AGTTGTGAGGGACAAAATCCT	0.388																																						dbGAP											0													82.0	88.0	86.0					7																	36447401		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF273437	CCDS5447.1, CCDS64628.1	7p15-p14	2013-01-10	2006-08-22		ENSG00000011426	ENSG00000011426		"""Pleckstrin homology (PH) domain containing"""	14082	protein-coding gene	gene with protein product			"""anillin (Drosophila Scraps homolog), actin binding protein"", ""anillin, actin binding protein (scraps homolog, Drosophila)"""			10931866	Standard	NM_001284301		Approved	ANILLIN, Scraps, scra	uc003tff.3	Q9NQW6	OTTHUMG00000023143	ENST00000265748.2:c.932G>A	7.37:g.36447401G>A	ENSP00000265748:p.Gly311Glu		Q5CZ78|Q6NSK5|Q9H8Y4|Q9NVN9|Q9NVP0	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.G311E	ENST00000265748.2	37	c.932	CCDS5447.1	7	.	.	.	.	.	.	.	.	.	.	G	1.657	-0.512378	0.04200	.	.	ENSG00000011426	ENST00000265748;ENST00000396068	T;T	0.11712	2.78;2.75	4.46	-6.53	0.01866	.	1.536870	0.03584	N	0.230603	T	0.05640	0.0148	L	0.29908	0.895	0.09310	N	1	B;B;B;B	0.31383	0.215;0.215;0.321;0.215	B;B;B;B	0.26517	0.07;0.07;0.066;0.03	T	0.37103	-0.9720	10	0.02654	T	1	0.3057	7.6101	0.28124	0.0:0.2059:0.4693:0.3248	.	188;311;311;311	B4DSL6;A8K5D9;Q9NQW6-2;Q9NQW6	.;.;.;ANLN_HUMAN	E	311	ENSP00000265748:G311E;ENSP00000379380:G311E	ENSP00000265748:G311E	G	+	2	0	ANLN	36413926	0.246000	0.23909	0.016000	0.15963	0.194000	0.23727	-0.170000	0.09897	-1.248000	0.02503	-0.505000	0.04504	GGA	ANLN	-	NULL	ENSG00000011426		0.388	ANLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANLN	HGNC	protein_coding	OTTHUMT00000218582.3	64	0.00	0	G	NM_018685		36447401	36447401	+1	no_errors	ENST00000265748	ensembl	human	known	69_37n	missense	54	31.65	25	SNP	0.198	A
BNC2	54796	genome.wustl.edu	37	9	16552753	16552753	+	Silent	SNP	C	C	T			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr9:16552753C>T	ENST00000380672.4	-	5	501	c.444G>A	c.(442-444)aaG>aaA	p.K148K	BNC2_ENST00000380667.2_Silent_p.K81K|BNC2_ENST00000545497.1_Silent_p.K53K|BNC2_ENST00000380666.2_Silent_p.K148K	NM_017637.5	NP_060107.3			basonuclin 2											NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		GCGTGCTGAGCTTATCCAAGG	0.507																																						dbGAP											0													94.0	85.0	88.0					9																	16552753		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.444G>A	9.37:g.16552753C>T				Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K148	ENST00000380672.4	37	c.444	CCDS6482.2	9																																																																																			BNC2	-	NULL	ENSG00000173068		0.507	BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BNC2	HGNC	protein_coding	OTTHUMT00000216901.5	37	0.00	0	C	NM_017637		16552753	16552753	-1	no_errors	ENST00000380672	ensembl	human	known	69_37n	silent	47	24.19	15	SNP	1.000	T
BPIFA4P	317716	genome.wustl.edu	37	20	31787199	31787199	+	RNA	SNP	C	C	T			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr20:31787199C>T	ENST00000375465.3	+	0	230					NR_026760.1		Q86YQ2	LATH_HUMAN	BPI fold containing family A, member 4, pseudogene							extracellular region (GO:0005576)	lipid binding (GO:0008289)										TTGAGTAGTGCCTTCGATGGT	0.522																																						dbGAP											0													146.0	128.0	133.0					20																	31787199		692	1591	2283	-	-	-			0			AY180924		20q11.21	2013-01-24			ENSG00000183566	ENSG00000183566		"""BPI fold containing"""	20469	pseudogene	pseudogene	"""breast cancer and salivary gland expression gene"", ""PLUNC family pseudogene"""	607627				12538848, 21787333	Standard	NR_026760		Approved	BASE	uc002wyq.2	Q86YQ2	OTTHUMG00000032251		20.37:g.31787199C>T				RNA	SNP	-	NULL	ENST00000375465.3	37	NULL		20																																																																																			BPIFA4P	-	-	ENSG00000183566		0.522	BPIFA4P-003	KNOWN	basic	processed_transcript	BPIFA4P	HGNC	pseudogene	OTTHUMT00000469705.1	71	0.00	0	C	NR_026760		31787199	31787199	+1	no_errors	ENST00000375465	ensembl	human	known	69_37n	rna	53	28.00	21	SNP	0.000	T
CA13	377677	genome.wustl.edu	37	8	86178919	86178919	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr8:86178919G>A	ENST00000321764.3	+	4	739	c.437G>A	c.(436-438)gGa>gAa	p.G146E	CA13_ENST00000517298.1_3'UTR	NM_198584.2	NP_940986.1	Q8N1Q1	CAH13_HUMAN	carbonic anhydrase XIII	146					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|myelin sheath (GO:0043209)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(6)	7					Zonisamide(DB00909)	GCTGTCTTGGGAGTGTTTTTA	0.413																																						dbGAP											0													119.0	105.0	110.0					8																	86178919		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC052602	CCDS6236.1	8q21	2004-05-10				ENSG00000185015		"""Carbonic anhydrases"""	14914	protein-coding gene	gene with protein product		611436				14600151	Standard	NM_198584		Approved	CAXIII, FLJ37995, MGC59868	uc003ydg.2	Q8N1Q1		ENST00000321764.3:c.437G>A	8.37:g.86178919G>A	ENSP00000318912:p.Gly146Glu			Missense_Mutation	SNP	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	p.G146E	ENST00000321764.3	37	c.437	CCDS6236.1	8	.	.	.	.	.	.	.	.	.	.	G	23.0	4.359271	0.82353	.	.	ENSG00000185015	ENST00000321764	T	0.71222	-0.55	5.49	5.49	0.81192	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.047393	0.85682	D	0.000000	D	0.89143	0.6631	H	0.97214	3.96	0.80722	D	1	D	0.76494	0.999	D	0.68765	0.96	D	0.92304	0.5852	10	0.87932	D	0	-13.3783	14.7683	0.69657	0.0:0.1452:0.8548:0.0	.	146	Q8N1Q1	CAH13_HUMAN	E	146	ENSP00000318912:G146E	ENSP00000318912:G146E	G	+	2	0	CA13	86366171	1.000000	0.71417	0.995000	0.50966	0.944000	0.59088	5.245000	0.65405	2.739000	0.93911	0.655000	0.94253	GGA	CA13	-	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	ENSG00000185015		0.413	CA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CA13	HGNC	protein_coding	OTTHUMT00000381066.1	98	0.00	0	G	NM_198584		86178919	86178919	+1	no_errors	ENST00000321764	ensembl	human	known	69_37n	missense	141	15.06	25	SNP	0.998	A
CARD9	64170	genome.wustl.edu	37	9	139265795	139265795	+	Silent	SNP	G	G	A			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr9:139265795G>A	ENST00000371732.5	-	3	468	c.303C>T	c.(301-303)cgC>cgT	p.R101R	CARD9_ENST00000315908.7_Silent_p.R101R|CARD9_ENST00000371734.3_Silent_p.R101R	NM_052813.4	NP_434700.2	Q9H257	CARD9_HUMAN	caspase recruitment domain family, member 9	101			R -> C (in CANDF2). {ECO:0000269|PubMed:24131138}.		defense response to Gram-positive bacterium (GO:0050830)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of apoptotic process (GO:0042981)|regulation of interleukin-2 biosynthetic process (GO:0045076)|regulation of interleukin-6 biosynthetic process (GO:0045408)|regulation of tumor necrosis factor biosynthetic process (GO:0042534)|response to drug (GO:0042493)|response to exogenous dsRNA (GO:0043330)|response to fungus (GO:0009620)|response to muramyl dipeptide (GO:0032495)|response to peptidoglycan (GO:0032494)	cytoplasm (GO:0005737)	CARD domain binding (GO:0050700)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)|prostate(3)|skin(1)	15		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;4.58e-06)|Epithelial(140;5.65e-06)		TGGAGAAGACGCGGGCCGGCT	0.682																																						dbGAP											0													22.0	21.0	21.0					9																	139265795		2190	4296	6486	-	-	-	SO:0001819	synonymous_variant	0			AF311287	CCDS6997.1, CCDS48057.1	9q34	2014-09-17			ENSG00000187796	ENSG00000187796			16391	protein-coding gene	gene with protein product		607212				11053425	Standard	NM_052813		Approved		uc004chg.3	Q9H257	OTTHUMG00000020925	ENST00000371732.5:c.303C>T	9.37:g.139265795G>A			Q5SXM5|Q5SXM6|Q9H854	Silent	SNP	pfam_CARD,superfamily_DEATH-like,pfscan_CARD	p.R101	ENST00000371732.5	37	c.303	CCDS6997.1	9																																																																																			CARD9	-	superfamily_DEATH-like	ENSG00000187796		0.682	CARD9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD9	HGNC	protein_coding	OTTHUMT00000055053.1	53	0.00	0	G	NM_052813		139265795	139265795	-1	no_errors	ENST00000371732	ensembl	human	known	69_37n	silent	60	16.67	12	SNP	0.022	A
CCDC108	255101	genome.wustl.edu	37	2	219897223	219897223	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr2:219897223G>A	ENST00000341552.5	-	6	697	c.614C>T	c.(613-615)aCg>aTg	p.T205M	CCDC108_ENST00000453220.1_Missense_Mutation_p.T205M|CCDC108_ENST00000409865.3_Missense_Mutation_p.T194M|CCDC108_ENST00000441968.1_Missense_Mutation_p.T205M|CCDC108_ENST00000410037.1_Missense_Mutation_p.T140M	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	205						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GATGGGGAGCGTGAGGGTTAT	0.617																																						dbGAP											0													61.0	46.0	51.0					2																	219897223		2203	4300	6503	-	-	-	SO:0001583	missense	0			NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.614C>T	2.37:g.219897223G>A	ENSP00000340776:p.Thr205Met		A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Missense_Mutation	SNP	superfamily_PapD-like,pfscan_Major_sperm	p.T205M	ENST00000341552.5	37	c.614	CCDS2430.2	2	.	.	.	.	.	.	.	.	.	.	G	17.22	3.334842	0.60853	.	.	ENSG00000181378	ENST00000341552;ENST00000441968;ENST00000453220;ENST00000409865;ENST00000410037;ENST00000441164;ENST00000457968	T;T;T;T;T;T	0.50277	3.32;3.32;3.32;3.05;3.06;0.75	5.37	2.61	0.31194	.	0.161178	0.29178	N	0.012912	T	0.62950	0.2470	M	0.72894	2.215	0.22424	N	0.999119	D;D	0.89917	1.0;1.0	D;D	0.71870	0.958;0.975	T	0.54159	-0.8335	10	0.66056	D	0.02	-2.1075	10.06	0.42268	0.2168:0.0:0.7832:0.0	.	194;205	E9PG25;Q6ZU64	.;CC108_HUMAN	M	205;205;205;194;140;139;194	ENSP00000340776:T205M;ENSP00000413377:T205M;ENSP00000409117:T205M;ENSP00000386945:T194M;ENSP00000386258:T140M;ENSP00000393483:T194M	ENSP00000340776:T205M	T	-	2	0	CCDC108	219605467	0.614000	0.27017	0.211000	0.23655	0.989000	0.77384	1.309000	0.33539	0.655000	0.30866	-0.140000	0.14226	ACG	CCDC108	-	NULL	ENSG00000181378		0.617	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC108	HGNC	protein_coding	OTTHUMT00000256598.4	36	0.00	0	G	NM_194302		219897223	219897223	-1	no_errors	ENST00000341552	ensembl	human	known	69_37n	missense	32	20.00	8	SNP	0.099	A
CEACAM18	729767	genome.wustl.edu	37	19	51981843	51981843	+	5'Flank	SNP	G	G	T			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr19:51981843G>T	ENST00000396477.4	+	0	0				CEACAM18_ENST00000451626.1_Nonsense_Mutation_p.E44*	NM_001278392.1	NP_001265321.1	A8MTB9	CEA18_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 18											breast(1)|endometrium(4)|large_intestine(3)|lung(8)|skin(1)	17		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		GGGAGCAGAGGAGGTGGCTGT	0.642																																						dbGAP											0													26.0	31.0	29.0					19																	51981843		1977	4151	6128	-	-	-	SO:0001631	upstream_gene_variant	0					19q13.41	2013-01-29				ENSG00000213822		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31949	protein-coding gene	gene with protein product							Standard	NM_001278392		Approved		uc002pwv.1	A8MTB9			19.37:g.51981843G>T	Exception_encountered		C9JN24	Nonsense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.E44*	ENST00000396477.4	37	c.130		19	.	.	.	.	.	.	.	.	.	.	.	16.86	3.239070	0.58995	.	.	ENSG00000213822	ENST00000451626	.	.	.	2.49	1.35	0.21983	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	6.8262	0.23885	0.0:0.2931:0.7069:0.0	.	.	.	.	X	44	.	ENSP00000402203:E44X	E	+	1	0	CEACAM18	56673655	0.008000	0.16893	0.035000	0.18076	0.033000	0.12548	0.554000	0.23407	0.575000	0.29434	0.563000	0.77884	GAG	CEACAM18	-	NULL	ENSG00000213822		0.642	CEACAM18-001	PUTATIVE	not_organism_supported|basic|appris_candidate	protein_coding	CEACAM18	HGNC	protein_coding	OTTHUMT00000323114.2	56	0.00	0	G			51981843	51981843	+1	no_errors	ENST00000451626	ensembl	human	known	69_37n	nonsense	47	27.69	18	SNP	0.033	T
CLCNKA	1187	genome.wustl.edu	37	1	16360190	16360190	+	3'UTR	SNP	A	A	C	rs28418375		TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr1:16360190A>C	ENST00000331433.4	+	0	2120				CLCNKA_ENST00000464764.1_3'UTR|CLCNKA_ENST00000375692.1_3'UTR|CLCNKA_ENST00000420078.1_3'UTR			P51800	CLCKA_HUMAN	chloride channel, voltage-sensitive Ka						excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|metal ion binding (GO:0046872)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(1)	19		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	Niflumic Acid(DB04552)	ACCCCAGCTGACCTGGTACTG	0.552																																						dbGAP											0													39.0	41.0	41.0					1																	16360190		2202	4295	6497	-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS167.1, CCDS41269.1, CCDS57973.1	1p36	2012-09-26	2012-02-23		ENSG00000186510	ENSG00000186510		"""Ion channels / Chloride channels : Voltage-sensitive"""	2026	protein-coding gene	gene with protein product		602024	"""chloride channel Ka"""			8544406	Standard	NM_004070		Approved	hClC-Ka	uc001axu.3	P51800	OTTHUMG00000009529	ENST00000331433.4:c.*37A>C	1.37:g.16360190A>C			B4DPD3|E7EPH6|Q5T5P8|Q5T5Q4|Q7Z6D1|Q86VT1	RNA	SNP	-	NULL	ENST00000331433.4	37	NULL	CCDS167.1	1																																																																																			CLCNKA	-	-	ENSG00000186510		0.552	CLCNKA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLCNKA	HGNC	protein_coding	OTTHUMT00000026326.1	35	0.00	0	A			16360190	16360190	+1	no_errors	ENST00000464764	ensembl	human	known	69_37n	rna	33	13.16	5	SNP	0.000	C
CFHR3	10878	genome.wustl.edu	37	1	196757919	196757919	+	Intron	SNP	T	T	C			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr1:196757919T>C	ENST00000367425.4	+	4	705				CFHR3_ENST00000391985.3_Intron|CFHR3_ENST00000471440.2_Missense_Mutation_p.C220R	NM_021023.5	NP_066303.2	Q02985	FHR3_HUMAN	complement factor H-related 3							blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	18						AAGTTGTACATGTCGGGGGAG	0.378																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			X68679	CCDS30958.1, CCDS53453.1	1q32	2014-09-17		2006-02-28	ENSG00000116785	ENSG00000116785		"""Complement system"""	16980	protein-coding gene	gene with protein product	"""complement factor H related 3"""	605336		CFHL3		8428964, 10380701	Standard	NM_021023		Approved	FHR-3, HLF4, FHR3, DOWN16	uc001gtl.3	Q02985	OTTHUMG00000035929	ENST00000367425.4:c.613+391T>C	1.37:g.196757919T>C			B4DPR0|Q9UJ16	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.C220R	ENST00000367425.4	37	c.658	CCDS30958.1	1	.	.	.	.	.	.	.	.	.	.	T	3.267	-0.150022	0.06585	.	.	ENSG00000116785	ENST00000471440	T	0.33654	1.4	1.38	0.0509	0.14296	.	.	.	.	.	T	0.23410	0.0566	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.26916	-1.0089	8	0.87932	D	0	.	3.4586	0.07524	0.0:0.238:0.0:0.762	.	220	Q6NSD3	.	R	220	ENSP00000436258:C220R	ENSP00000356397:C220R	C	+	1	0	CFHR3	195024542	0.001000	0.12720	0.000000	0.03702	0.004000	0.04260	0.915000	0.28638	0.032000	0.15435	-0.993000	0.02533	TGT	CFHR3	-	NULL	ENSG00000116785		0.378	CFHR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFHR3	HGNC	protein_coding	OTTHUMT00000087505.2	51	0.00	0	T	NM_021023		196757919	196757919	+1	no_errors	ENST00000367427	ensembl	human	known	69_37n	missense	55	14.06	9	SNP	0.000	C
CPEB3	22849	genome.wustl.edu	37	10	93999919	93999920	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr10:93999919_93999920insG	ENST00000265997.4	-	2	360_361	c.188_189insC	c.(187-189)ccgfs	p.P63fs	CPEB3_ENST00000412050.4_Frame_Shift_Ins_p.P63fs	NM_014912.4	NP_055727.3	Q8NE35	CPEB3_HUMAN	cytoplasmic polyadenylation element binding protein 3	63	Pro-rich.				3'-UTR-mediated mRNA destabilization (GO:0061158)|cellular response to amino acid stimulus (GO:0071230)|long-term memory (GO:0007616)|negative regulation of cytoplasmic translational elongation (GO:1900248)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translation (GO:0017148)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of mRNA polyadenylation (GO:1900365)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|regulation of dendritic spine development (GO:0060998)|regulation of synaptic plasticity (GO:0048167)|translation (GO:0006412)	apical dendrite (GO:0097440)|CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuron projection (GO:0043005)|nucleus (GO:0005634)|synapse (GO:0045202)	mRNA 3'-UTR AU-rich region binding (GO:0035925)|mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|translation factor activity, nucleic acid binding (GO:0008135)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(5)|skin(2)|upper_aerodigestive_tract(2)	18		Colorectal(252;0.0869)				CGTTGGGGGCCGGGGGGGCAGC	0.693																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB023157	CCDS31246.1, CCDS53553.1	10q23.33	2013-02-12			ENSG00000107864	ENSG00000107864		"""RNA binding motif (RRM) containing"""	21746	protein-coding gene	gene with protein product		610606				10231032, 12672660	Standard	NM_014912		Approved	KIAA0940	uc001khw.2	Q8NE35	OTTHUMG00000018756	ENST00000265997.4:c.189dupC	10.37:g.93999926_93999926dupG	ENSP00000265997:p.Pro63fs		Q5T389|Q9NQJ7|Q9Y2E9	Frame_Shift_Ins	INS	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.A64fs	ENST00000265997.4	37	c.189_188	CCDS31246.1	10																																																																																			CPEB3	-	NULL	ENSG00000107864		0.693	CPEB3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CPEB3	HGNC	protein_coding	OTTHUMT00000049387.2	43	0.00	0	-	NM_014912		93999919	93999920	-1	no_errors	ENST00000265997	ensembl	human	known	69_37n	frame_shift_ins	48	18.64	11	INS	1.000:1.000	G
CTNNA2	1496	genome.wustl.edu	37	2	80874927	80874927	+	Missense_Mutation	SNP	G	G	A	rs529691509		TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr2:80874927G>A	ENST00000402739.4	+	18	2797	c.2792G>A	c.(2791-2793)cGa>cAa	p.R931Q	CTNNA2_ENST00000496558.1_Missense_Mutation_p.R883Q|CTNNA2_ENST00000540488.1_Missense_Mutation_p.R838Q|CTNNA2_ENST00000343114.3_Missense_Mutation_p.R562Q|CTNNA2_ENST00000466387.1_Missense_Mutation_p.R883Q|CTNNA2_ENST00000541047.1_Missense_Mutation_p.R883Q|CTNNA2_ENST00000361291.4_Missense_Mutation_p.R917Q	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	931					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)	p.G932A(1)|p.R883P(1)		breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						CGAGTTCGACGAGGTTCTCAG	0.438																																						dbGAP											2	Substitution - Missense(2)	skin(2)											130.0	129.0	129.0					2																	80874927		1848	4090	5938	-	-	-	SO:0001583	missense	0				CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.2792G>A	2.37:g.80874927G>A	ENSP00000384638:p.Arg931Gln		B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.R917Q	ENST00000402739.4	37	c.2750		2	.	.	.	.	.	.	.	.	.	.	G	35	5.439588	0.96168	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488;ENST00000343114	T;T;T;T;T;T;T	0.51574	0.86;0.86;0.82;0.7;0.86;0.74;2.09	5.94	5.94	0.96194	.	0.000000	0.64402	D	0.000002	T	0.65637	0.2710	L	0.54323	1.7	0.58432	D	0.999994	D;D;D;D	0.89917	0.995;1.0;1.0;1.0	P;D;D;D	0.68353	0.794;0.957;0.956;0.956	T	0.59799	-0.7386	9	.	.	.	.	20.3658	0.98878	0.0:0.0:1.0:0.0	.	515;931;838;883	F6KRI5;P26232;P26232-3;P26232-2	.;CTNA2_HUMAN;.;.	Q	883;883;917;931;883;838;562	ENSP00000418191:R883Q;ENSP00000419295:R883Q;ENSP00000355398:R917Q;ENSP00000384638:R931Q;ENSP00000444675:R883Q;ENSP00000441705:R838Q;ENSP00000341500:R562Q	.	R	+	2	0	CTNNA2	80728438	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.820000	0.97059	0.650000	0.86243	CGA	CTNNA2	-	NULL	ENSG00000066032		0.438	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	CTNNA2	HGNC	protein_coding	OTTHUMT00000328511.4	22	0.00	0	G	NM_004389		80874927	80874927	+1	no_errors	ENST00000361291	ensembl	human	known	69_37n	missense	15	25.00	5	SNP	1.000	A
EIF4A2	1974	genome.wustl.edu	37	3	186501401	186501401	+	Start_Codon_SNP	SNP	T	T	A			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr3:186501401T>A	ENST00000323963.5	+	1	66	c.2T>A	c.(1-3)aTg>aAg	p.M1K	RP11-573D15.9_ENST00000577781.1_RNA|SNORA63_ENST00000363548.1_RNA|EIF4A2_ENST00000356531.5_5'UTR|EIF4A2_ENST00000440191.2_Start_Codon_SNP_p.M1K|SNORD2_ENST00000459163.1_RNA			Q14240	IF4A2_HUMAN	eukaryotic translation initiation factor 4A2	1					cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|urinary_tract(1)	28	all_cancers(143;2.68e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.07e-20)	GBM - Glioblastoma multiforme(93;0.0704)		TTTCGGATCATGTCTGGTGGC	0.562			T	BCL6	NHL																																	dbGAP		Dom	yes		3	3q27.3	1974	"""eukaryotic translation initiation factor 4A, isoform 2"""		L	0													140.0	141.0	140.0					3																	186501401		2203	4300	6503	-	-	-	SO:0001582	initiator_codon_variant	0			D30655	CCDS3282.1	3q28	2012-02-23	2010-02-10		ENSG00000156976	ENSG00000156976	3.6.1.1	"""DEAD-boxes"""	3284	protein-coding gene	gene with protein product		601102	"""eukaryotic translation initiation factor 4A, isoform 2"""	EIF4F		8521730	Standard	NM_001967		Approved	DDX2B, EIF4A, BM-010	uc003fqs.3	Q14240	OTTHUMG00000156564	ENST00000323963.5:c.2T>A	3.37:g.186501401T>A	ENSP00000326381:p.Met1Lys		D3DNU9|Q53XJ6|Q96B90|Q96EA8	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.M1K	ENST00000323963.5	37	c.2	CCDS3282.1	3	.	.	.	.	.	.	.	.	.	.	T	18.85	3.712270	0.68730	.	.	ENSG00000156976	ENST00000441007;ENST00000445596;ENST00000323963;ENST00000440191	T;T;T	0.31510	1.49;1.73;1.73	4.48	4.48	0.54585	.	0.582234	0.17875	N	0.159042	T	0.40791	0.1131	.	.	.	0.80722	D	1	B;B	0.18863	0.031;0.018	B;B	0.40782	0.34;0.184	T	0.44498	-0.9324	9	0.87932	D	0	-22.1754	12.0441	0.53469	0.0:0.0:0.0:1.0	.	1;1	Q14240-2;Q14240	.;IF4A2_HUMAN	K	1	ENSP00000415878:M1K;ENSP00000326381:M1K;ENSP00000398370:M1K	ENSP00000326381:M1K	M	+	2	0	EIF4A2	187984095	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.178000	0.77657	2.002000	0.58637	0.460000	0.39030	ATG	EIF4A2	-	NULL	ENSG00000156976		0.562	EIF4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF4A2	HGNC	protein_coding	OTTHUMT00000344609.1	87	0.00	0	T	NM_001967	Missense_Mutation	186501401	186501401	+1	no_errors	ENST00000440191	ensembl	human	known	69_37n	missense	60	18.92	14	SNP	1.000	A
ELK1	2002	genome.wustl.edu	37	X	47498441	47498441	+	Silent	SNP	C	C	T			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chrX:47498441C>T	ENST00000247161.3	-	3	606	c.507G>A	c.(505-507)ccG>ccA	p.P169P	ELK1_ENST00000592066.1_Silent_p.P115P|ELK1_ENST00000376983.3_Silent_p.P169P|ELK1_ENST00000343894.4_Intron	NM_005229.4	NP_005220.2	P19419	ELK1_HUMAN	ELK1, member of ETS oncogene family	169					cell differentiation (GO:0030154)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|skin(2)	10						GGGGTGGCTGCGGCTGCAGAG	0.677																																						dbGAP											0													19.0	15.0	17.0					X																	47498441		2192	4272	6464	-	-	-	SO:0001819	synonymous_variant	0			M25269	CCDS14283.1, CCDS59165.1	Xp11.23	2010-07-20			ENSG00000126767	ENSG00000126767			3321	protein-coding gene	gene with protein product		311040				2539641	Standard	NM_001114123		Approved		uc010nhv.4	P19419	OTTHUMG00000021452	ENST00000247161.3:c.507G>A	X.37:g.47498441C>T			B2R7H4|O75606|O95058|Q969X8|Q9UJM4	Silent	SNP	pfam_Ets,smart_Ets,pfscan_Ets,prints_Ets	p.P169	ENST00000247161.3	37	c.507	CCDS14283.1	X																																																																																			ELK1	-	NULL	ENSG00000126767		0.677	ELK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ELK1	HGNC	protein_coding	OTTHUMT00000056436.1	122	0.00	0	C	NM_005229		47498441	47498441	-1	no_errors	ENST00000247161	ensembl	human	known	69_37n	silent	66	29.79	28	SNP	0.946	T
F8	2157	genome.wustl.edu	37	X	154194831	154194831	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chrX:154194831C>T	ENST00000360256.4	-	8	1341	c.1141G>A	c.(1141-1143)Gat>Aat	p.D381N	F8_ENST00000483822.1_5'Flank	NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	381					acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	GAGTTGTCATCATCAAACCTG	0.423																																						dbGAP											0													206.0	157.0	174.0					X																	154194831		2203	4300	6503	-	-	-	SO:0001583	missense	0			M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.1141G>A	X.37:g.154194831C>T	ENSP00000353393:p.Asp381Asn		Q14286|Q5HY69	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.D381N	ENST00000360256.4	37	c.1141	CCDS35457.1	X	.	.	.	.	.	.	.	.	.	.	C	12.62	1.992342	0.35131	.	.	ENSG00000185010	ENST00000360256	D	0.98567	-5.0	4.92	4.02	0.46733	.	0.828480	0.10909	N	0.620823	D	0.96321	0.8800	L	0.50333	1.59	0.09310	N	0.99999	P	0.42871	0.792	B	0.42798	0.398	D	0.90115	0.4195	10	0.17369	T	0.5	0.0038	9.0905	0.36607	0.1646:0.6788:0.1566:0.0	.	381	P00451	FA8_HUMAN	N	381	ENSP00000353393:D381N	ENSP00000353393:D381N	D	-	1	0	F8	153848025	0.832000	0.29368	0.667000	0.29798	0.950000	0.60333	3.695000	0.54749	0.925000	0.37094	0.529000	0.55759	GAT	F8	-	NULL	ENSG00000185010		0.423	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F8	HGNC	protein_coding	OTTHUMT00000058869.4	87	0.00	0	C			154194831	154194831	-1	no_errors	ENST00000360256	ensembl	human	known	69_37n	missense	80	18.37	18	SNP	0.572	T
FAM193B	54540	genome.wustl.edu	37	5	176958509	176958509	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr5:176958509G>A	ENST00000443375.2	-	7	2508	c.950C>T	c.(949-951)cCg>cTg	p.P317L	FAM193B_ENST00000508298.1_Intron|FAM193B_ENST00000329540.5_5'UTR|FAM193B_ENST00000514747.1_Intron			Q96PV7	F193B_HUMAN	family with sequence similarity 193, member B	430	Pro-rich.					cytoplasm (GO:0005737)|nucleus (GO:0005634)				kidney(1)|large_intestine(3)	4						CCGACTCGTCGGGGCAGCGGG	0.672																																						dbGAP											0													7.0	7.0	7.0					5																	176958509		1795	4037	5832	-	-	-	SO:0001583	missense	0				CCDS54954.1	5q35	2010-02-17			ENSG00000146067	ENSG00000146067			25524	protein-coding gene	gene with protein product		615813				11572484	Standard	NR_024019		Approved	KIAA1931, FLJ10404	uc003mhu.3	Q96PV7	OTTHUMG00000163396	ENST00000443375.2:c.950C>T	5.37:g.176958509G>A	ENSP00000410098:p.Pro317Leu		E9PET5|Q9NW00	Missense_Mutation	SNP	NULL	p.P317L	ENST00000443375.2	37	c.950		5	.	.	.	.	.	.	.	.	.	.	G	25.1	4.603983	0.87157	.	.	ENSG00000146067	ENST00000443375	T	0.55760	0.5	5.07	5.07	0.68467	.	.	.	.	.	T	0.75140	0.3809	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.79203	-0.1900	8	0.72032	D	0.01	-4.6348	18.457	0.90724	0.0:0.0:1.0:0.0	.	317	E9PEZ8	.	L	317	ENSP00000410098:P317L	ENSP00000410098:P317L	P	-	2	0	FAM193B	176891115	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.823000	0.99369	2.347000	0.79759	0.563000	0.77884	CCG	FAM193B	-	NULL	ENSG00000146067		0.672	FAM193B-202	KNOWN	basic	protein_coding	FAM193B	HGNC	protein_coding		44	0.00	0	G	NM_019057		176958509	176958509	-1	no_errors	ENST00000443375	ensembl	human	known	69_37n	missense	24	38.46	15	SNP	1.000	A
FASN	2194	genome.wustl.edu	37	17	80040424	80040424	+	Silent	SNP	G	G	A			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr17:80040424G>A	ENST00000306749.2	-	34	6116	c.5898C>T	c.(5896-5898)ggC>ggT	p.G1966G	FASN_ENST00000579758.1_5'UTR	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	1966	Beta-ketoacyl reductase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	TGAAGACGCCGCCCACGGGCC	0.701																																					Colon(59;314 1043 11189 28578 32273)	dbGAP											0													18.0	23.0	21.0					17																	80040424		2195	4293	6488	-	-	-	SO:0001819	synonymous_variant	0			U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.5898C>T	17.37:g.80040424G>A			Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Silent	SNP	pfam_Acyl_transferase,pfam_Ketoacyl_synth_N,pfam_Thioesterase,pfam_PKS_KR,pfam_DH_sc/Rdtase_SDR,pfam_Ketoacyl_synth_C,pfam_ADH_C,pfam_Acyl_carrier_prot-like,pfam_Methyltransf_12,pfam_Methyltransf_11,superfamily_Thiolase-like,superfamily_Acyl_Trfase/lysoPLipase,superfamily_GroES-like,superfamily_Acyl_carrier_prot-like,superfamily_Malonyl_transacylase_ACP-bd,smart_PKS_Beta-ketoAc_synthase_dom,smart_PKS_acyl_transferase,smart_PKS_dehydratase,smart_PKS_ER,smart_PKS/FAS_KR,smart_PKS_PP-bd,pfscan_Acyl_carrier_prot-like	p.G1966	ENST00000306749.2	37	c.5898	CCDS11801.1	17																																																																																			FASN	-	pfam_PKS_KR,pfam_DH_sc/Rdtase_SDR,smart_PKS/FAS_KR	ENSG00000169710		0.701	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FASN	HGNC	protein_coding	OTTHUMT00000442369.1	51	0.00	0	G	NM_004104		80040424	80040424	-1	no_errors	ENST00000306749	ensembl	human	known	69_37n	silent	38	15.56	7	SNP	0.103	A
FCRL5	83416	genome.wustl.edu	37	1	157490260	157490260	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr1:157490260C>T	ENST00000361835.3	-	12	2750	c.2593G>A	c.(2593-2595)Ggg>Agg	p.G865R	FCRL5_ENST00000356953.4_Missense_Mutation_p.G865R|FCRL5_ENST00000461387.1_5'UTR	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	865					negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				AGCAGTGCCCCCGCAGCAAGG	0.632																																						dbGAP											0													30.0	29.0	29.0					1																	157490260		2198	4295	6493	-	-	-	SO:0001583	missense	0			AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.2593G>A	1.37:g.157490260C>T	ENSP00000354691:p.Gly865Arg		A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.G865R	ENST00000361835.3	37	c.2593	CCDS1165.1	1	.	.	.	.	.	.	.	.	.	.	C	15.72	2.915935	0.52546	.	.	ENSG00000143297	ENST00000361835;ENST00000356953	T;T	0.48836	0.8;0.81	4.72	2.83	0.33086	.	.	.	.	.	T	0.31513	0.0799	L	0.43152	1.355	0.09310	N	0.999999	D;D	0.61697	0.99;0.964	P;P	0.53360	0.724;0.614	T	0.08086	-1.0739	9	0.62326	D	0.03	.	6.534	0.22341	0.0:0.7209:0.1811:0.098	.	865;865	A6NJE8;Q96RD9	.;FCRL5_HUMAN	R	865	ENSP00000354691:G865R;ENSP00000349434:G865R	ENSP00000349434:G865R	G	-	1	0	FCRL5	155756884	0.000000	0.05858	0.001000	0.08648	0.258000	0.26162	0.349000	0.20055	0.579000	0.29504	0.460000	0.39030	GGG	FCRL5	-	NULL	ENSG00000143297		0.632	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL5	HGNC	protein_coding	OTTHUMT00000046263.1	27	0.00	0	C	NM_031281		157490260	157490260	-1	no_errors	ENST00000356953	ensembl	human	known	69_37n	missense	27	20.59	7	SNP	0.001	T
FOLH1	2346	genome.wustl.edu	37	11	49204790	49204790	+	Silent	SNP	A	A	G	rs76509850	byFrequency	TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr11:49204790A>G	ENST00000256999.2	-	7	1091	c.831T>C	c.(829-831)taT>taC	p.Y277Y	FOLH1_ENST00000533034.1_Silent_p.Y262Y|FOLH1_ENST00000343844.4_5'UTR|FOLH1_ENST00000340334.7_Silent_p.Y262Y|FOLH1_ENST00000356696.3_Silent_p.Y277Y	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	277	NAALADase.				folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	GCCTATAAGCATATTCTGAAA	0.343																																						dbGAP											0													61.0	61.0	61.0					11																	49204790		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.831T>C	11.37:g.49204790A>G			A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Silent	SNP	pfam_TFR-like_dimer_dom,pfam_Protease-assoc_domain,pfam_Peptidase_M28,superfamily_TFR-like_dimer_dom	p.Y277	ENST00000256999.2	37	c.831	CCDS7946.1	11																																																																																			FOLH1	-	NULL	ENSG00000086205		0.343	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOLH1	HGNC	protein_coding	OTTHUMT00000390896.1	49	0.00	0	A	NM_004476		49204790	49204790	-1	no_errors	ENST00000256999	ensembl	human	known	69_37n	silent	36	10.00	4	SNP	1.000	G
GJC2	57165	genome.wustl.edu	37	1	228345773	228345773	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr1:228345773C>T	ENST00000366714.2	+	2	489	c.314C>T	c.(313-315)gCg>gTg	p.A105V		NM_020435.3	NP_065168.2	Q5T442	CXG2_HUMAN	gap junction protein, gamma 2, 47kDa	105					cell death (GO:0008219)|cell-cell signaling (GO:0007267)|response to toxic substance (GO:0009636)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)	gap junction channel activity (GO:0005243)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	7		Prostate(94;0.0405)				CTGGCCCGTGCGTCTGAGCAG	0.766																																						dbGAP											0													21.0	18.0	19.0					1																	228345773		2196	4292	6488	-	-	-	SO:0001583	missense	0			AF014643	CCDS1569.1	1q41-q42	2009-01-02	2007-12-14	2007-11-06	ENSG00000198835	ENSG00000198835		"""Ion channels / Gap junction proteins (connexins)"""	17494	protein-coding gene	gene with protein product	"""connexin 47"""	608803	"""gap junction protein, alpha 12, 47kDa"""	GJA12		19056803	Standard	NM_020435		Approved	CX47, CX46.6, SPG44	uc001hsk.3	Q5T442	OTTHUMG00000039771	ENST00000366714.2:c.314C>T	1.37:g.228345773C>T	ENSP00000355675:p.Ala105Val		O43440|Q7Z7J2|Q8IWJ9	Missense_Mutation	SNP	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin	p.A105V	ENST00000366714.2	37	c.314	CCDS1569.1	1	.	.	.	.	.	.	.	.	.	.	C	11.32	1.605093	0.28623	.	.	ENSG00000198835	ENST00000366714	D	0.99113	-5.44	4.23	2.33	0.28932	Connexin, N-terminal (1);	0.538297	0.16965	N	0.192337	D	0.94912	0.8355	N	0.08118	0	0.09310	N	1	B	0.15473	0.013	B	0.12837	0.008	D	0.89666	0.3880	10	0.30854	T	0.27	.	9.9931	0.41883	0.0:0.8334:0.0:0.1666	.	105	Q5T442	CXG2_HUMAN	V	105	ENSP00000355675:A105V	ENSP00000355675:A105V	A	+	2	0	GJC2	226412396	0.028000	0.19301	0.012000	0.15200	0.026000	0.11368	1.469000	0.35343	0.437000	0.26423	0.491000	0.48974	GCG	GJC2	-	pfam_Connexin_N	ENSG00000198835		0.766	GJC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GJC2	HGNC	protein_coding	OTTHUMT00000095985.1	12	0.00	0	C	NM_020435		228345773	228345773	+1	no_errors	ENST00000366714	ensembl	human	known	69_37n	missense	7	41.67	5	SNP	0.001	T
GNB5	10681	genome.wustl.edu	37	15	52416711	52416711	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr15:52416711C>T	ENST00000261837.7	-	12	1200	c.1135G>A	c.(1135-1137)Ggg>Agg	p.G379R	CTD-2184D3.7_ENST00000557898.1_RNA|CTD-2184D3.6_ENST00000559825.1_lincRNA|GNB5_ENST00000358784.7_Missense_Mutation_p.G337R|GNB5_ENST00000396335.4_Missense_Mutation_p.G267R|GNB5_ENST00000559348.1_5'UTR	NM_016194.3	NP_057278.2	O14775	GBB5_HUMAN	guanine nucleotide binding protein (G protein), beta 5	379					GTP catabolic process (GO:0006184)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	chaperone binding (GO:0051087)|G-protein gamma-subunit binding (GO:0031682)|GTPase activity (GO:0003924)|signal transducer activity (GO:0004871)			large_intestine(1)|lung(1)	2				all cancers(107;0.0163)		AAAGCAGTCCCATCGGGGGAA	0.507																																						dbGAP											0													98.0	99.0	99.0					15																	52416711		2195	4293	6488	-	-	-	SO:0001583	missense	0			AF017656	CCDS10149.1, CCDS45261.1	15q21.1	2013-01-10			ENSG00000069966	ENSG00000069966		"""WD repeat domain containing"""	4401	protein-coding gene	gene with protein product		604447				9606987	Standard	NM_016194		Approved	GB5	uc031qrz.1	O14775	OTTHUMG00000131892	ENST00000261837.7:c.1135G>A	15.37:g.52416711C>T	ENSP00000261837:p.Gly379Arg		B2RBR5|Q9HAU9|Q9UFT3	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_Guanine_nucleotide-bd_bsu,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Gprotein_B,prints_G-protein_beta_WD-40_rep	p.G379R	ENST00000261837.7	37	c.1135	CCDS10149.1	15	.	.	.	.	.	.	.	.	.	.	C	33	5.263863	0.95399	.	.	ENSG00000069966	ENST00000261837;ENST00000396335;ENST00000544480;ENST00000358784	T	0.01871	4.59	5.98	5.98	0.97165	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.19366	0.0465	M	0.89968	3.075	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.00324	-1.1817	10	0.87932	D	0	-28.3143	20.5177	0.99214	0.0:1.0:0.0:0.0	.	379;267	O14775;O14775-3	GBB5_HUMAN;.	R	379;337;177;267	ENSP00000261837:G379R	ENSP00000261837:G379R	G	-	1	0	GNB5	50204003	1.000000	0.71417	0.992000	0.48379	0.746000	0.42486	7.647000	0.83462	2.853000	0.98044	0.644000	0.83932	GGG	GNB5	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_Guanine_nucleotide-bd_bsu,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000069966		0.507	GNB5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GNB5	HGNC	protein_coding	OTTHUMT00000254842.1	75	0.00	0	C			52416711	52416711	-1	no_errors	ENST00000261837	ensembl	human	known	69_37n	missense	52	14.75	9	SNP	1.000	T
KCNU1	157855	genome.wustl.edu	37	8	36788602	36788602	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr8:36788602G>T	ENST00000399881.3	+	25	2907	c.2870G>T	c.(2869-2871)gGa>gTa	p.G957V	KCNU1_ENST00000518904.1_3'UTR	NM_001031836.2	NP_001027006.2	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	957					multicellular organism reproduction (GO:0032504)|potassium ion transmembrane transport (GO:0071805)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	large conductance calcium-activated potassium channel activity (GO:0060072)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(31)|ovary(1)|urinary_tract(1)	57				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		CTCTTGTCTGGAAGAAACCGG	0.438																																						dbGAP											0													138.0	132.0	134.0					8																	36788602		1910	4126	6036	-	-	-	SO:0001583	missense	0			BC028701	CCDS55220.1	8p11.2	2012-07-05				ENSG00000215262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18867	protein-coding gene	gene with protein product		615215				16382103	Standard	NM_001031836		Approved	KCa5.1, Slo3, KCNMC1, Kcnma3	uc010lvw.3	A8MYU2		ENST00000399881.3:c.2870G>T	8.37:g.36788602G>T	ENSP00000382770:p.Gly957Val			Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_Ion_trans_2,prints_K_chnl_Ca-activ_BK_asu	p.G957V	ENST00000399881.3	37	c.2870	CCDS55220.1	8	.	.	.	.	.	.	.	.	.	.	G	14.57	2.574354	0.45902	.	.	ENSG00000215262	ENST00000399881	T	0.30714	1.52	5.28	2.36	0.29203	.	0.521868	0.13665	U	0.371264	T	0.26231	0.0640	L	0.57536	1.79	0.09310	N	1	P	0.40875	0.731	B	0.38428	0.273	T	0.18745	-1.0327	10	0.54805	T	0.06	-6.6255	4.2027	0.10475	0.0849:0.3128:0.4557:0.1466	.	957	A8MYU2	KCNU1_HUMAN	V	957	ENSP00000382770:G957V	ENSP00000382770:G957V	G	+	2	0	KCNU1	36907760	0.000000	0.05858	0.004000	0.12327	0.007000	0.05969	0.125000	0.15749	0.597000	0.29811	0.555000	0.69702	GGA	KCNU1	-	NULL	ENSG00000215262		0.438	KCNU1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	KCNU1	HGNC	protein_coding	OTTHUMT00000376631.1	70	0.00	0	G	NM_001031836		36788602	36788602	+1	no_errors	ENST00000399881	ensembl	human	known	69_37n	missense	150	11.24	19	SNP	0.001	T
KRT1	3848	genome.wustl.edu	37	12	53069280	53069280	+	Silent	SNP	G	G	A			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr12:53069280G>A	ENST00000252244.3	-	9	1690	c.1632C>T	c.(1630-1632)ggC>ggT	p.G544G		NM_006121.3	NP_006112.3	P04264	K2C1_HUMAN	keratin 1	544	Gly/Ser-rich.|Tail.				complement activation, lectin pathway (GO:0001867)|establishment of skin barrier (GO:0061436)|fibrinolysis (GO:0042730)|negative regulation of inflammatory response (GO:0050728)|regulation of angiogenesis (GO:0045765)|response to oxidative stress (GO:0006979)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(7)|skin(3)	39						cgccgccgccgccacctccag	0.692																																						dbGAP											0													11.0	12.0	12.0					12																	53069280		2196	4286	6482	-	-	-	SO:0001819	synonymous_variant	0			X69725	CCDS8836.1	12q13.13	2014-06-05	2008-08-01		ENSG00000167768	ENSG00000167768		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6412	protein-coding gene	gene with protein product		139350	"""epidermolytic hyperkeratosis 1"""	EHK1		2461420, 2470667, 16831889	Standard	NM_006121		Approved	KRT1A	uc001sau.1	P04264	OTTHUMG00000169749	ENST00000252244.3:c.1632C>T	12.37:g.53069280G>A			B2RA01|P85925|P86104|Q14720|Q6GSJ0|Q9H298	Silent	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.G544	ENST00000252244.3	37	c.1632	CCDS8836.1	12																																																																																			KRT1	-	NULL	ENSG00000167768		0.692	KRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT1	HGNC	protein_coding	OTTHUMT00000405706.1	84	0.00	0	G	NM_006121		53069280	53069280	-1	no_errors	ENST00000252244	ensembl	human	known	69_37n	silent	76	16.48	15	SNP	0.001	A
LILRA4	23547	genome.wustl.edu	37	19	54848688	54848689	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr19:54848688_54848689insG	ENST00000291759.4	-	5	990_991	c.934_935insC	c.(934-936)ctgfs	p.L312fs	AC008984.2_ENST00000507363.1_RNA	NM_012276.3	NP_036408.3	P59901	LIRA4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 4	312	Ig-like C2-type 3.				immune system process (GO:0002376)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(13)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	32	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0565)		CAGGATGTCCAGGGGGTCACTG	0.673																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF041261	CCDS12890.1	19q13.4	2013-01-11			ENSG00000239961	ENSG00000239961		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15503	protein-coding gene	gene with protein product		607517				10941842	Standard	NM_012276		Approved	ILT7, CD85g	uc002qfj.3	P59901	OTTHUMG00000065355	ENST00000291759.4:c.935dupC	19.37:g.54848693_54848693dupG	ENSP00000291759:p.Leu312fs		Q32MC4	Frame_Shift_Ins	INS	smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt,pfscan_Ig-like	p.L312fs	ENST00000291759.4	37	c.935_934	CCDS12890.1	19																																																																																			LILRA4	-	smart_Ig_sub,pirsf_A1B_glyco/leuk_Ig-like_rcpt,pfscan_Ig-like	ENSG00000239961		0.673	LILRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LILRA4	HGNC	protein_coding	OTTHUMT00000140229.2	95	0.00	0	-	NM_012276		54848688	54848689	-1	no_errors	ENST00000291759	ensembl	human	known	69_37n	frame_shift_ins	65	26.14	23	INS	0.979:0.982	G
LILRB1	10859	genome.wustl.edu	37	19	55146043	55146043	+	Intron	SNP	C	C	T			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr19:55146043C>T	ENST00000396331.1	+	11	1717				LILRB1_ENST00000396327.3_Intron|LILRB1_ENST00000434867.2_Intron|LILRB1_ENST00000396332.4_Intron|LILRB1_ENST00000324602.7_Intron|LILRB1_ENST00000396321.2_Intron|LILRB1_ENST00000448689.1_Intron|LILRB1_ENST00000396315.1_Intron|LILRB1_ENST00000418536.2_Intron|LILRB1_ENST00000427581.2_Intron|LILRB1_ENST00000462628.1_3'UTR|LILRB1_ENST00000396317.1_Intron	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1						cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		acacagtaggcgctcaTTTCA	0.562										HNSCC(37;0.09)																												dbGAP											0													22.0	14.0	17.0					19																	55146043		2198	4275	6473	-	-	-	SO:0001627	intron_variant	0			AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.1361-49C>T	19.37:g.55146043C>T			A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	RNA	SNP	-	NULL	ENST00000396331.1	37	NULL	CCDS42617.1	19																																																																																			LILRB1	-	-	ENSG00000104972		0.562	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB1	HGNC	protein_coding	OTTHUMT00000140796.4	72	0.00	0	C			55146043	55146043	+1	no_errors	ENST00000462628	ensembl	human	known	69_37n	rna	52	14.75	9	SNP	0.001	T
MAOB	4129	genome.wustl.edu	37	X	43626803	43626803	+	Silent	SNP	G	G	T			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chrX:43626803G>T	ENST00000378069.4	-	15	1620	c.1473C>A	c.(1471-1473)ggC>ggA	p.G491G	MAOB_ENST00000536181.1_Silent_p.G475G|MAOB_ENST00000538942.1_3'UTR	NM_000898.4	NP_000889.3	P27338	AOFB_HUMAN	monoamine oxidase B	491					negative regulation of serotonin secretion (GO:0014063)|positive regulation of dopamine metabolic process (GO:0045964)|response to aluminum ion (GO:0010044)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|primary amine oxidase activity (GO:0008131)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(2)|skin(5)	21					Amantadine(DB00915)|Amphetamine(DB00182)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Procaine(DB00721)|Rasagiline(DB01367)|Selegiline(DB01037)|Sertraline(DB01104)|Tranylcypromine(DB00752)|Zonisamide(DB00909)	GCCTGAGCAGGCCTGGCACGG	0.527																																						dbGAP											0													106.0	84.0	92.0					X																	43626803		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS14261.1	Xp11.4-p11.3	2008-02-05			ENSG00000069535	ENSG00000069535	1.4.3.4		6834	protein-coding gene	gene with protein product		309860					Standard	NM_000898		Approved		uc004dfz.4	P27338	OTTHUMG00000021388	ENST00000378069.4:c.1473C>A	X.37:g.43626803G>T			B2R6R3|B7Z5H3|D3DWC3|Q7Z6S2	Silent	SNP	pfam_Amino_oxidase,pfam_FAD-dep_OxRdtase,pfam_FAD_bind_dom,pfam_Pyr_OxRdtase_NAD-bd_dom,pfam_mOase_FAD-bd,prints_Flavin_amine_oxidase	p.G491	ENST00000378069.4	37	c.1473	CCDS14261.1	X																																																																																			MAOB	-	NULL	ENSG00000069535		0.527	MAOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAOB	HGNC	protein_coding	OTTHUMT00000056303.1	96	0.00	0	G	NM_000898		43626803	43626803	-1	no_errors	ENST00000378069	ensembl	human	known	69_37n	silent	67	31.63	31	SNP	0.592	T
MBL1P	8512	genome.wustl.edu	37	10	81680252	81680252	+	RNA	SNP	A	A	G			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr10:81680252A>G	ENST00000480805.1	+	0	319					NR_002724.2				mannose-binding lectin (protein A) 1, pseudogene																		CCCAAGGGGGAAAAGGGAGAG	0.577																																						dbGAP											0																																										-	-	-			0			AF019382		10q22.3	2012-11-02	2009-12-02	2009-12-02	ENSG00000242600	ENSG00000242600		"""Collectins"""	6921	pseudogene	pseudogene			"""mannose-binding lectin (protein A) 1, pseudogene 1"""	MBL1P1		9501312	Standard	NR_002724		Approved	COLEC3P	uc001kbg.1		OTTHUMG00000018595		10.37:g.81680252A>G				RNA	SNP	-	NULL	ENST00000480805.1	37	NULL		10																																																																																			MBL1P	-	-	ENSG00000242600		0.577	MBL1P-001	KNOWN	basic	processed_transcript	MBL1P	HGNC	pseudogene	OTTHUMT00000049017.1	55	0.00	0	A			81680252	81680252	+1	no_errors	ENST00000480805	ensembl	human	known	69_37n	rna	47	12.73	7	SNP	1.000	G
MEP1A	4224	genome.wustl.edu	37	6	46797126	46797126	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr6:46797126C>T	ENST00000230588.4	+	10	971	c.962C>T	c.(961-963)tCg>tTg	p.S321L		NM_005588.2	NP_005579.2	Q16819	MEP1A_HUMAN	meprin A, alpha (PABA peptide hydrolase)	321	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				digestion (GO:0007586)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|meprin A complex (GO:0017090)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42			Lung(136;0.192)			AGCACCAGCTCGGGGTCCGCG	0.542																																						dbGAP											0													92.0	96.0	95.0					6																	46797126		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4918.1	6p12-p11	2010-10-18			ENSG00000112818	ENSG00000112818	3.4.24.18		7015	protein-coding gene	gene with protein product		600388				7774936	Standard	NM_005588		Approved	PPHA	uc010jzh.1	Q16819	OTTHUMG00000014790	ENST00000230588.4:c.962C>T	6.37:g.46797126C>T	ENSP00000230588:p.Ser321Leu		A2RRM4|B0AZP9|B2RCS2|Q8TDC9|Q9H1R1	Missense_Mutation	SNP	pirsf_Pept_M12A_Meprin,pfam_Peptidase_M12A,pfam_MATH,pfam_MAM_dom,pfam_EGF-like_dom,superfamily_TRAF-like,superfamily_ConA-like_lec_gl,smart_Peptidase_Metallo,smart_MAM_dom,smart_MATH,prints_Peptidase_M12A,prints_MAM_dom,pfscan_EG-like_dom,pfscan_MATH,pfscan_MAM_dom	p.S321L	ENST00000230588.4	37	c.962	CCDS4918.1	6	.	.	.	.	.	.	.	.	.	.	C	8.030	0.761468	0.15914	.	.	ENSG00000112818	ENST00000230588	T	0.02345	4.33	5.37	-0.286	0.12862	Concanavalin A-like lectin/glucanase (1);MAM domain (5);	0.528054	0.22001	N	0.066019	T	0.00998	0.0033	M	0.62016	1.91	0.09310	N	1	B;B	0.23185	0.081;0.045	B;B	0.16722	0.016;0.016	T	0.44772	-0.9306	10	0.49607	T	0.09	2.9901	2.5656	0.04782	0.1144:0.4819:0.1117:0.292	.	349;321	B7ZL91;Q16819	.;MEP1A_HUMAN	L	321	ENSP00000230588:S321L	ENSP00000230588:S321L	S	+	2	0	MEP1A	46905085	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	0.040000	0.13905	-0.288000	0.09051	0.650000	0.86243	TCG	MEP1A	-	pirsf_Pept_M12A_Meprin,pfam_MAM_dom,superfamily_ConA-like_lec_gl,smart_MAM_dom,prints_MAM_dom,pfscan_MAM_dom	ENSG00000112818		0.542	MEP1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEP1A	HGNC	protein_coding	OTTHUMT00000040803.1	44	0.00	0	C	NM_005588		46797126	46797126	+1	no_errors	ENST00000230588	ensembl	human	known	69_37n	missense	51	23.88	16	SNP	0.000	T
NSUN4	387338	genome.wustl.edu	37	1	46807697	46807697	+	Intron	SNP	C	C	T	rs17357621	byFrequency	TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr1:46807697C>T	ENST00000474844.1	+	1	743				NSUN4_ENST00000537428.1_Intron|NSUN4_ENST00000498008.1_3'UTR|NSUN4_ENST00000536062.1_Intron	NM_199044.3	NP_950245.2	Q96CB9	NSUN4_HUMAN	NOP2/Sun domain family, member 4						rRNA methylation (GO:0031167)	mitochondrial large ribosomal subunit (GO:0005762)	methyltransferase activity (GO:0008168)|rRNA binding (GO:0019843)			endometrium(2)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)	8	Acute lymphoblastic leukemia(166;0.155)					GAAACTGGACCCATGATTTCG	0.597											OREG0013457	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	661	0.131989	0.1331	0.1484	5008	,	,		17176	0.0179		0.2724	False		,,,				2504	0.092					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK021577	CCDS534.1, CCDS57996.1	1p34	2012-02-24	2009-11-23		ENSG00000117481	ENSG00000117481		"""NOP2/Sun domain containing"""	31802	protein-coding gene	gene with protein product	"""sperm head and tail associated protein"""	615394	"""NOL1/NOP2/Sun domain family 4"", ""NOL1/NOP2/Sun domain family, member 4"""				Standard	NM_199044		Approved	MGC22960, SHTAP	uc001cpr.2	Q96CB9	OTTHUMG00000007808	ENST00000474844.1:c.93+1106C>T	1.37:g.46807697C>T		942	A8K6S6|B3KQ50|B4DHA4|Q5TDF7|Q96AN8|Q9HAJ8	RNA	SNP	-	NULL	ENST00000474844.1	37	NULL	CCDS534.1	1																																																																																			NSUN4	-	-	ENSG00000117481		0.597	NSUN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSUN4	HGNC	protein_coding	OTTHUMT00000021427.1	64	0.00	0	C	NM_199044		46807697	46807697	+1	no_errors	ENST00000498008	ensembl	human	known	69_37n	rna	42	10.42	5	SNP	0.009	T
PAQR7	164091	genome.wustl.edu	37	1	26189712	26189712	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr1:26189712delC	ENST00000374296.3	-	2	1285	c.619delG	c.(619-621)gagfs	p.E207fs	RP1-125I3.2_ENST00000455431.1_RNA	NM_178422.5	NP_848509.1	Q86WK9	MPRA_HUMAN	progestin and adipoQ receptor family member VII	207					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|response to steroid hormone (GO:0048545)|steroid hormone mediated signaling pathway (GO:0043401)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)			breast(3)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	9		Colorectal(325;3.46e-05)|Lung NSC(340;0.00038)|all_lung(284;0.00051)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0505)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.16e-25)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000724)|BRCA - Breast invasive adenocarcinoma(304;0.000965)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0136)|READ - Rectum adenocarcinoma(331;0.0649)		GAGGGCACCTCCTGGCATGTG	0.572																																					Esophageal Squamous(111;1206 1556 18433 19151 38418)	dbGAP											0													84.0	73.0	77.0					1																	26189712		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS267.1	1p35.3	2012-08-10			ENSG00000182749	ENSG00000182749			23146	protein-coding gene	gene with protein product	"""membrane progestin receptor alpha"""	607779					Standard	NM_178422		Approved	mSR, MPRA	uc001bkx.3	Q86WK9	OTTHUMG00000007373	ENST00000374296.3:c.619delG	1.37:g.26189712delC	ENSP00000363414:p.Glu207fs		A2A2D3|Q5XKF9|Q86VE4	Frame_Shift_Del	DEL	pfam_HlyIII-related	p.E207fs	ENST00000374296.3	37	c.619	CCDS267.1	1																																																																																			PAQR7	-	pfam_HlyIII-related	ENSG00000182749		0.572	PAQR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAQR7	HGNC	protein_coding	OTTHUMT00000019312.1	36	0.00	0	C	NM_178422		26189712	26189712	-1	no_errors	ENST00000374296	ensembl	human	known	69_37n	frame_shift_del	11	15.38	2	DEL	1.000	-
OR6P1	128366	genome.wustl.edu	37	1	158532977	158532977	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr1:158532977G>T	ENST00000334632.1	-	1	417	c.418C>A	c.(418-420)Ctg>Atg	p.L140M		NM_001160325.1	NP_001153797.1	Q8NGX9	OR6P1_HUMAN	olfactory receptor, family 6, subfamily P, member 1	140						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(4)|lung(1)	6						CGAGTGGCCAGACTGGAAGGC	0.517																																						dbGAP											0													59.0	57.0	58.0					1																	158532977		692	1591	2283	-	-	-	SO:0001583	missense	0			BK004193	CCDS53391.1	1q23.1	2012-08-09			ENSG00000186440	ENSG00000186440		"""GPCR / Class A : Olfactory receptors"""	15036	protein-coding gene	gene with protein product							Standard	NM_001160325		Approved		uc010pim.2	Q8NGX9	OTTHUMG00000019633	ENST00000334632.1:c.418C>A	1.37:g.158532977G>T	ENSP00000334721:p.Leu140Met		Q6IFR9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L140M	ENST00000334632.1	37	c.418	CCDS53391.1	1	.	.	.	.	.	.	.	.	.	.	G	3.737	-0.054391	0.07362	.	.	ENSG00000186440	ENST00000334632	T	0.39229	1.09	5.11	-1.49	0.08718	GPCR, rhodopsin-like superfamily (1);	0.205916	0.23828	N	0.044165	T	0.16727	0.0402	L	0.58810	1.83	0.09310	N	1	B	0.31769	0.339	B	0.37346	0.247	T	0.26883	-1.0090	10	0.62326	D	0.03	.	2.3548	0.04293	0.2266:0.3439:0.3124:0.117	.	140	Q8NGX9	OR6P1_HUMAN	M	140	ENSP00000334721:L140M	ENSP00000334721:L140M	L	-	1	2	OR6P1	156799601	0.000000	0.05858	0.004000	0.12327	0.001000	0.01503	-2.790000	0.00767	-0.463000	0.06973	0.591000	0.81541	CTG	OR6P1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000186440		0.517	OR6P1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6P1	HGNC	protein_coding	OTTHUMT00000051848.1	28	0.00	0	G			158532977	158532977	-1	no_errors	ENST00000334632	ensembl	human	known	69_37n	missense	29	17.14	6	SNP	0.000	T
PNN	5411	genome.wustl.edu	37	14	39649964	39649965	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	AA	AA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr14:39649964_39649965delAA	ENST00000216832.4	+	9	1118_1119	c.1051_1052delAA	c.(1051-1053)aaafs	p.K351fs	PNN_ENST00000557680.1_Intron	NM_002687.3	NP_002678	Q9H307	PININ_HUMAN	pinin, desmosome associated protein	351	Glu-rich.				cell adhesion (GO:0007155)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			breast(2)|endometrium(5)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(2)|stomach(1)	27	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0119)		tgatgcagagaaagaacaggag	0.441																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U77718	CCDS9671.1	14q21.1	2010-07-02			ENSG00000100941	ENSG00000100941			9162	protein-coding gene	gene with protein product		603154				8922384	Standard	NM_002687		Approved	memA	uc001wuw.4	Q9H307	OTTHUMG00000028821	ENST00000216832.4:c.1051_1052delAA	14.37:g.39649964_39649965delAA	ENSP00000216832:p.Lys351fs		B4DZX8|O60899|Q53EM7|Q6P5X4|Q7KYL1|Q99738|Q9UHZ9|Q9UQR9	Frame_Shift_Del	DEL	pfam_Pinin_SDK_N,pfam_Pinin_SDK_MemA	p.K351fs	ENST00000216832.4	37	c.1051_1052	CCDS9671.1	14																																																																																			PNN	-	NULL	ENSG00000100941		0.441	PNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNN	HGNC	protein_coding	OTTHUMT00000276776.2	45	0.00	0	AA	NM_002687		39649964	39649965	+1	no_errors	ENST00000216832	ensembl	human	known	69_37n	frame_shift_del	33	13.16	5	DEL	1.000:1.000	-
PRPF3	9129	genome.wustl.edu	37	1	150307463	150307463	+	Silent	SNP	G	G	A			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr1:150307463G>A	ENST00000324862.6	+	7	951	c.786G>A	c.(784-786)ggG>ggA	p.G262G	PRPF3_ENST00000414970.2_Silent_p.G213G|PRPF3_ENST00000543398.1_Silent_p.G127G|PRPF3_ENST00000467329.1_3'UTR	NM_004698.2	NP_004689.1	O43395	PRPF3_HUMAN	pre-mRNA processing factor 3	262					mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U4/U6 x U5 tri-snRNP complex (GO:0046540)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Lung NSC(24;5.57e-29)|Breast(34;0.000844)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)	Colorectal(1306;0.0149)		ATGAGCAAGGGCGCACTGTAG	0.458																																					Ovarian(168;1070 2670 5178 20729)	dbGAP											0													98.0	82.0	87.0					1																	150307463		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF001947	CCDS951.1	1q21.1	2013-07-16	2013-06-10		ENSG00000117360	ENSG00000117360			17348	protein-coding gene	gene with protein product		607301	"""retinitis pigmentosa 18 (autosomal dominant)"", ""PRP3 pre-mRNA processing factor 3 homolog (yeast)"", ""PRP3 pre-mRNA processing factor 3 homolog (S. cerevisiae)"""	RP18			Standard	NM_004698		Approved	Prp3, hPrp3, SNRNP90	uc001eum.4	O43395	OTTHUMG00000012807	ENST00000324862.6:c.786G>A	1.37:g.150307463G>A			B4DSY9|O43446|Q5VT54	Silent	SNP	pfam_Pre-mRNA_splic_Prp3,pfam_DUF1115,pfam_PWI,superfamily_PWI,smart_PWI	p.G262	ENST00000324862.6	37	c.786	CCDS951.1	1																																																																																			PRPF3	-	NULL	ENSG00000117360		0.458	PRPF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF3	HGNC	protein_coding	OTTHUMT00000035836.1	41	0.00	0	G	NM_004698		150307463	150307463	+1	no_errors	ENST00000324862	ensembl	human	known	69_37n	silent	48	18.64	11	SNP	0.982	A
PRRC2C	23215	genome.wustl.edu	37	1	171526403	171526403	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr1:171526403G>A	ENST00000338920.4	+	19	5383	c.5146G>A	c.(5146-5148)Gaa>Aaa	p.E1716K	PRRC2C_ENST00000426496.2_Missense_Mutation_p.E1716K|PRRC2C_ENST00000367742.3_Missense_Mutation_p.E1718K|PRRC2C_ENST00000392078.3_Missense_Mutation_p.E1718K	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	1716					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										GAATGCAAATGAAAAAGGAAG	0.398																																						dbGAP											0													44.0	50.0	48.0					1																	171526403		1629	2851	4480	-	-	-	SO:0001583	missense	0			AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.5146G>A	1.37:g.171526403G>A	ENSP00000343629:p.Glu1716Lys		Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Missense_Mutation	SNP	pfam_BAT2_N	p.E1718K	ENST00000338920.4	37	c.5152	CCDS1296.2	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.68|18.68	3.676121|3.676121	0.67928|0.67928	.|.	.|.	ENSG00000117523|ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080|ENST00000495585	T;T;T;T|.	0.01947|.	4.54;4.54;4.54;4.54|.	5.89|5.89	5.89|5.89	0.94794|0.94794	.|.	0.000000|.	0.47852|.	D|.	0.000210|.	T|T	0.66538|0.66538	0.2799|0.2799	L|L	0.54323|0.54323	1.7|1.7	0.58432|0.58432	D|D	0.999999|0.999999	P|.	0.43231|.	0.801|.	P|.	0.46320|.	0.512|.	T|T	0.60637|0.60637	-0.7224|-0.7224	10|5	0.27785|.	T|.	0.31|.	.|.	20.3242|20.3242	0.98691|0.98691	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1716|.	Q9Y520-4|.	.|.	K|I	1718;1717;1716;1718;1716;1473|263	ENSP00000375928:E1718K;ENSP00000410219:E1716K;ENSP00000356716:E1718K;ENSP00000343629:E1716K|.	ENSP00000343629:E1716K|.	E|M	+|+	1|3	0|0	PRRC2C|PRRC2C	169793027|169793027	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.979000|0.979000	0.70002|0.70002	8.832000|8.832000	0.92079|0.92079	2.817000|2.817000	0.96982|0.96982	0.549000|0.549000	0.68633|0.68633	GAA|ATG	PRRC2C	-	NULL	ENSG00000117523		0.398	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRRC2C	HGNC	protein_coding	OTTHUMT00000314826.4	48	0.00	0	G	NM_015172		171526403	171526403	+1	no_errors	ENST00000392078	ensembl	human	known	69_37n	missense	58	12.12	8	SNP	1.000	A
PSG5	5673	genome.wustl.edu	37	19	43687592	43687592	+	Intron	SNP	T	T	C			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr19:43687592T>C	ENST00000366175.3	-	2	561				PSG5_ENST00000599812.1_Intron|PSG5_ENST00000401992.1_5'UTR|PSG5_ENST00000407356.1_Intron|PSG5_ENST00000404580.1_Intron|PSG5_ENST00000407568.1_Intron|PSG5_ENST00000342951.6_Intron			Q15238	PSG5_HUMAN	pregnancy specific beta-1-glycoprotein 5						female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(18)|prostate(1)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(69;0.00899)				CCTGAGTGTGTGTCTCTCGCT	0.468																																						dbGAP											0													92.0	89.0	90.0					19																	43687592		875	1990	2865	-	-	-	SO:0001627	intron_variant	0				CCDS12617.1	19q13.2	2013-01-29			ENSG00000204941	ENSG00000204941		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9522	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1 glycoprotein"", ""pregnancy-specific beta 1 glycoprotein"""	176394				2735907	Standard	NM_002781		Approved	FL-NCA-3, PSG	uc002ovx.3	Q15238	OTTHUMG00000151539	ENST00000366175.3:c.430+1341A>G	19.37:g.43687592T>C			Q15239|Q96QJ1|Q9UQ75	Silent	SNP	pfam_Ig_V-set	p.T154	ENST00000366175.3	37	c.462	CCDS12617.1	19																																																																																			PSG5	-	NULL	ENSG00000204941		0.468	PSG5-001	KNOWN	basic|CCDS	protein_coding	PSG5	HGNC	protein_coding	OTTHUMT00000323055.1	54	0.00	0	T	NM_002781		43687592	43687592	-1	no_errors	ENST00000401992	ensembl	human	putative	69_37n	silent	38	24.00	12	SNP	0.000	C
RGAG1	57529	genome.wustl.edu	37	X	109696711	109696711	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chrX:109696711G>A	ENST00000465301.2	+	3	3112	c.2866G>A	c.(2866-2868)Gcc>Acc	p.A956T	RGAG1_ENST00000540313.1_Missense_Mutation_p.A956T	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	956										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						ATTAATGAGAGCCCCGGCCTC	0.517																																						dbGAP											0													119.0	121.0	120.0					X																	109696711		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.2866G>A	X.37:g.109696711G>A	ENSP00000419786:p.Ala956Thr		Q9P2M8	Missense_Mutation	SNP	NULL	p.A956T	ENST00000465301.2	37	c.2866	CCDS14552.1	X	.	.	.	.	.	.	.	.	.	.	G	0.149	-1.093288	0.01858	.	.	ENSG00000243978	ENST00000465301;ENST00000540313	T;T	0.46063	0.88;0.88	3.89	-1.35	0.09114	.	.	.	.	.	T	0.32255	0.0823	M	0.68593	2.085	0.09310	N	1	B	0.16396	0.017	B	0.14578	0.011	T	0.34104	-0.9842	8	.	.	.	0.3722	0.6596	0.00840	0.307:0.2876:0.2409:0.1645	.	956	Q8NET4	RGAG1_HUMAN	T	956	ENSP00000419786:A956T;ENSP00000441452:A956T	.	A	+	1	0	RGAG1	109583367	0.001000	0.12720	0.000000	0.03702	0.006000	0.05464	-0.410000	0.07151	-0.474000	0.06862	-0.318000	0.08688	GCC	RGAG1	-	NULL	ENSG00000243978		0.517	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGAG1	HGNC	protein_coding	OTTHUMT00000057906.2	86	0.00	0	G	NM_020769		109696711	109696711	+1	no_errors	ENST00000465301	ensembl	human	known	69_37n	missense	59	22.37	17	SNP	0.001	A
RPS6KA2	6196	genome.wustl.edu	37	6	166923827	166923827	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr6:166923827G>T	ENST00000265678.4	-	4	540	c.317C>A	c.(316-318)tCg>tAg	p.S106*	RPS6KA2_ENST00000503859.1_Nonsense_Mutation_p.S114*|MIR1913_ENST00000411026.1_RNA|RPS6KA2_ENST00000366863.2_5'UTR|RPS6KA2_ENST00000481261.2_Nonsense_Mutation_p.S17*|RPS6KA2_ENST00000510118.1_Nonsense_Mutation_p.S131*|RPS6KA2_ENST00000405189.3_Nonsense_Mutation_p.S17*	NM_021135.4	NP_066958.2	Q15349	KS6A2_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 2	106	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|brain renin-angiotensin system (GO:0002035)|cardiac muscle cell apoptotic process (GO:0010659)|cellular response to carbohydrate stimulus (GO:0071322)|heart contraction (GO:0060047)|heart development (GO:0007507)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of meiosis (GO:0045835)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oocyte maturation (GO:0001556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of gene expression (GO:0010628)|regulation of protein processing (GO:0070613)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ribosomal protein S6 kinase activity (GO:0004711)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)		CTCCATCTTCGATCTCACTCG	0.403																																						dbGAP											0													105.0	99.0	101.0					6																	166923827		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			L07598	CCDS5294.1, CCDS34570.1	6q27	2011-04-05	2002-08-29		ENSG00000071242	ENSG00000071242			10431	protein-coding gene	gene with protein product		601685	"""ribosomal protein S6 kinase, 90kD, polypeptide 2"""			8141249	Standard	NM_001006932		Approved	RSK, RSK3, HU-2	uc003qvc.1	Q15349	OTTHUMG00000016007	ENST00000265678.4:c.317C>A	6.37:g.166923827G>T	ENSP00000265678:p.Ser106*		B3KTK9|Q15419|Q59GJ3|Q5TI68|Q96J38|Q9UJN5	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Ribosomal_S6_kinase_II,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S131*	ENST00000265678.4	37	c.392	CCDS5294.1	6	.	.	.	.	.	.	.	.	.	.	G	37	6.613177	0.97705	.	.	ENSG00000071242	ENST00000265678;ENST00000510118;ENST00000503859;ENST00000481261;ENST00000405189;ENST00000507350;ENST00000512860;ENST00000507371;ENST00000506565;ENST00000511034	.	.	.	4.27	4.27	0.50696	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	.	14.1912	0.65639	0.0:0.0:1.0:0.0	.	.	.	.	X	106;131;114;17;17;17;17;90;131;17	.	ENSP00000265678:S106X	S	-	2	0	RPS6KA2	166843817	1.000000	0.71417	0.064000	0.19789	0.768000	0.43524	8.263000	0.89864	1.926000	0.55796	0.491000	0.48974	TCG	RPS6KA2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_cat_dom	ENSG00000071242		0.403	RPS6KA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS6KA2	HGNC	protein_coding	OTTHUMT00000043075.3	28	0.00	0	G	NM_021135		166923827	166923827	-1	no_errors	ENST00000510118	ensembl	human	known	69_37n	nonsense	42	22.22	12	SNP	0.885	T
SMAD6	4091	genome.wustl.edu	37	15	67073407	67073407	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr15:67073407G>A	ENST00000288840.5	+	4	2056	c.1025G>A	c.(1024-1026)cGc>cAc	p.R342H	SMAD6_ENST00000338426.4_Missense_Mutation_p.R81H	NM_005585.4	NP_005576.3	O43541	SMAD6_HUMAN	SMAD family member 6	342	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				BMP signaling pathway (GO:0030509)|cell-substrate adhesion (GO:0031589)|fat cell differentiation (GO:0045444)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|response to estrogen (GO:0043627)|response to laminar fluid shear stress (GO:0034616)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|zygotic specification of dorsal/ventral axis (GO:0007352)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|co-SMAD binding (GO:0070410)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, inhibitory cytoplasmic mediator activity (GO:0030617)|type I activin receptor binding (GO:0070698)|type I transforming growth factor beta receptor binding (GO:0034713)|ubiquitin protein ligase binding (GO:0031625)			lung(1)|skin(1)	2						CACCGGACGCGCGTGGGCCGC	0.682																																					Esophageal Squamous(179;72 2004 22333 39628 47290)	dbGAP											0													39.0	29.0	33.0					15																	67073407		2200	4299	6499	-	-	-	SO:0001583	missense	0			BC012986	CCDS10221.1	15q22.31	2014-09-11	2006-11-06	2004-05-26	ENSG00000137834	ENSG00000137834		"""SMADs"""	6772	protein-coding gene	gene with protein product		602931	"""MAD, mothers against decapentaplegic homolog 6 (Drosophila)"", ""SMAD, mothers against DPP homolog 6 (Drosophila)"""	MADH7, MADH6		9256479	Standard	NR_027654		Approved	HsT17432	uc002aqf.3	O43541	OTTHUMG00000133218	ENST00000288840.5:c.1025G>A	15.37:g.67073407G>A	ENSP00000288840:p.Arg342His		A9J6M5|O43654|Q15799|Q7Z7L4|Q96E31|Q9UKZ3	Missense_Mutation	SNP	pfam_SMAD_dom_Dwarfin-type,pfam_MAD_homology1_Dwarfin-type,superfamily_SMAD_FHA_domain,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,smart_SMAD_dom_Dwarfin-type,pfscan_MAD_homology_MH1,pfscan_SMAD_dom_Dwarfin-type	p.R342H	ENST00000288840.5	37	c.1025	CCDS10221.1	15	.	.	.	.	.	.	.	.	.	.	G	33	5.224519	0.95139	.	.	ENSG00000137834	ENST00000288840;ENST00000338426	D;D	0.99014	-5.33;-4.87	5.6	5.6	0.85130	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.99420	0.9795	M	0.88241	2.94	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98945	1.0792	10	0.87932	D	0	.	19.5989	0.95551	0.0:0.0:1.0:0.0	.	81;342	O43541-2;O43541	.;SMAD6_HUMAN	H	342;81	ENSP00000288840:R342H;ENSP00000345054:R81H	ENSP00000288840:R342H	R	+	2	0	SMAD6	64860461	1.000000	0.71417	0.953000	0.39169	0.988000	0.76386	9.735000	0.98825	2.639000	0.89480	0.561000	0.74099	CGC	SMAD6	-	pfam_SMAD_dom_Dwarfin-type,superfamily_SMAD_FHA_domain,smart_SMAD_dom_Dwarfin-type,pfscan_SMAD_dom_Dwarfin-type	ENSG00000137834		0.682	SMAD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMAD6	HGNC	protein_coding	OTTHUMT00000256953.2	102	0.00	0	G	NM_005585		67073407	67073407	+1	no_errors	ENST00000288840	ensembl	human	known	69_37n	missense	106	19.70	26	SNP	1.000	A
TGS1	96764	genome.wustl.edu	37	8	56737254	56737254	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr8:56737254G>A	ENST00000260129.5	+	13	3031	c.2554G>A	c.(2554-2556)Gaa>Aaa	p.E852K		NM_024831.6	NP_079107.6	Q96RS0	TGS1_HUMAN	trimethylguanosine synthase 1	852					7-methylguanosine cap hypermethylation (GO:0036261)|7-methylguanosine RNA capping (GO:0009452)|cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|regulation of transcription, DNA-templated (GO:0006355)|ribonucleoprotein complex biogenesis (GO:0022613)|ribonucleoprotein complex import into nucleus (GO:0071167)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)	RNA trimethylguanosine synthase activity (GO:0071164)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		all_lung(136;0.119)|all_epithelial(80;0.125)|Lung NSC(129;0.147)	Epithelial(17;0.00027)|all cancers(17;0.00251)			ACCAGCCTCTGAAACCTAACT	0.408																																					Esophageal Squamous(34;275 823 4842 34837 48447)	dbGAP											0													96.0	85.0	89.0					8																	56737254		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY028423	CCDS34894.1	8q11	2010-06-25	2010-06-25	2006-11-27	ENSG00000137574	ENSG00000137574	2.1.1.-		17843	protein-coding gene	gene with protein product		606461	"""nuclear receptor coactivator 6 interacting protein"", ""trimethylguanosine synthase homolog (S. cerevisiae)"""	NCOA6IP		11517327, 11983179, 19307714	Standard	NM_024831		Approved	PIMT	uc003xsj.4	Q96RS0	OTTHUMG00000164294	ENST00000260129.5:c.2554G>A	8.37:g.56737254G>A	ENSP00000260129:p.Glu852Lys		A6NJQ5|Q5GH23|Q8TDG9|Q96QU3|Q9H5V3	Missense_Mutation	SNP	pfam_RNA_cap_Gua-N2-MeTrfase,pfam_RNA_methylase_dom,pfam_tRNA_Trfase_Trm5/Tyw2	p.E852K	ENST00000260129.5	37	c.2554	CCDS34894.1	8	.	.	.	.	.	.	.	.	.	.	G	17.81	3.479762	0.63849	.	.	ENSG00000137574	ENST00000260129	T	0.11169	2.8	5.79	3.86	0.44501	.	0.640032	0.14296	N	0.328635	T	0.07279	0.0184	L	0.36672	1.1	0.25623	N	0.986374	P	0.35507	0.506	B	0.27796	0.083	T	0.30534	-0.9975	10	0.66056	D	0.02	-27.523	4.1262	0.10128	0.0839:0.1614:0.5872:0.1675	.	852	Q96RS0	TGS1_HUMAN	K	852	ENSP00000260129:E852K	ENSP00000260129:E852K	E	+	1	0	TGS1	56899808	0.995000	0.38212	0.998000	0.56505	0.979000	0.70002	0.256000	0.18351	1.417000	0.47077	0.655000	0.94253	GAA	TGS1	-	NULL	ENSG00000137574		0.408	TGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGS1	HGNC	protein_coding	OTTHUMT00000378152.1	68	0.00	0	G	NM_024831		56737254	56737254	+1	no_errors	ENST00000260129	ensembl	human	known	69_37n	missense	43	24.56	14	SNP	1.000	A
TMEM14B	81853	genome.wustl.edu	37	6	10756854	10756854	+	3'UTR	SNP	C	C	T			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr6:10756854C>T	ENST00000379542.5	+	0	615				TMEM14B_ENST00000481240.1_Intron|RP11-637O19.3_ENST00000480294.1_Intron|TMEM14B_ENST00000491103.1_3'UTR|TMEM14B_ENST00000473276.1_3'UTR|SYCP2L_ENST00000543878.1_Intron|TMEM14B_ENST00000379530.3_3'UTR|TMEM14B_ENST00000467317.1_Intron	NM_030969.3	NP_112231.3	Q9NUH8	TM14B_HUMAN	transmembrane protein 14B							integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(2)|skin(2)	11	Ovarian(93;0.107)|Breast(50;0.137)	all_hematologic(90;0.135)				TTGCATCTGACATTTTACCTA	0.373																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AL024498	CCDS4515.1, CCDS47372.1, CCDS75395.1, CCDS75396.1, CCDS75397.1	6p25.1-p23	2008-08-12			ENSG00000137210	ENSG00000137210			21384	protein-coding gene	gene with protein product							Standard	NM_030969		Approved	MGC1223	uc003mzk.4	Q9NUH8	OTTHUMG00000014246	ENST00000379542.5:c.*103C>T	6.37:g.10756854C>T			Q5THN7|Q5THN8|Q96IX7|Q9BVN8	RNA	SNP	-	NULL	ENST00000379542.5	37	NULL	CCDS4515.1	6																																																																																			TMEM14B	-	-	ENSG00000137210		0.373	TMEM14B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM14B	HGNC	protein_coding	OTTHUMT00000039836.1	17	0.00	0	C	NM_030969		10756854	10756854	+1	no_errors	ENST00000486421	ensembl	human	known	69_37n	rna	12	36.84	7	SNP	0.019	T
TSHZ3	57616	genome.wustl.edu	37	19	31769937	31769937	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr19:31769937C>T	ENST00000240587.4	-	2	1089	c.762G>A	c.(760-762)tgG>tgA	p.W254*		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	254					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					GAGGCTTGGACCAGCGCTTGG	0.572																																						dbGAP											0													230.0	202.0	212.0					19																	31769937		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.762G>A	19.37:g.31769937C>T	ENSP00000240587:p.Trp254*		Q9H0G6|Q9P254	Nonsense_Mutation	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.W254*	ENST00000240587.4	37	c.762	CCDS12421.2	19	.	.	.	.	.	.	.	.	.	.	C	37	6.506022	0.97620	.	.	ENSG00000121297	ENST00000240587	.	.	.	5.52	4.48	0.54585	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.0722	15.7506	0.77983	0.1377:0.8623:0.0:0.0	.	.	.	.	X	254	.	ENSP00000240587:W254X	W	-	3	0	TSHZ3	36461777	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.484000	0.81180	1.295000	0.44724	0.655000	0.94253	TGG	TSHZ3	-	NULL	ENSG00000121297		0.572	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ3	HGNC	protein_coding	OTTHUMT00000316743.2	45	0.00	0	C	NM_020856		31769937	31769937	-1	no_errors	ENST00000240587	ensembl	human	known	69_37n	nonsense	43	15.69	8	SNP	1.000	T
UBE2QL1	134111	genome.wustl.edu	37	5	6449081	6449081	+	Silent	SNP	C	C	T			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr5:6449081C>T	ENST00000399816.3	+	1	346	c.75C>T	c.(73-75)ttC>ttT	p.F25F		NM_001145161.2	NP_001138633.1	A1L167	U2QL1_HUMAN	ubiquitin-conjugating enzyme E2Q family-like 1	25					protein ubiquitination (GO:0016567)		acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)			breast(1)|endometrium(1)	2						AGAGCCTGTTCGACTGGAACG	0.617																																						dbGAP											0													240.0	226.0	230.0					5																	6449081		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AK057805	CCDS47189.1	5p15.31	2010-02-17			ENSG00000215218	ENSG00000215218			37269	protein-coding gene	gene with protein product		615832					Standard	NM_001145161		Approved	FLJ25076	uc003jdp.4	A1L167	OTTHUMG00000161683	ENST00000399816.3:c.75C>T	5.37:g.6449081C>T				Silent	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.F25	ENST00000399816.3	37	c.75	CCDS47189.1	5																																																																																			UBE2QL1	-	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	ENSG00000215218		0.617	UBE2QL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2QL1	HGNC	protein_coding	OTTHUMT00000365717.1	41	0.00	0	C	NM_001145161		6449081	6449081	+1	no_errors	ENST00000399816	ensembl	human	known	69_37n	silent	23	39.47	15	SNP	1.000	T
UBE4B	10277	genome.wustl.edu	37	1	10221207	10221207	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr1:10221207A>G	ENST00000253251.8	+	22	3513	c.2674A>G	c.(2674-2676)Aag>Gag	p.K892E	RNU6-828P_ENST00000364876.1_RNA|UBE4B_ENST00000377157.3_Missense_Mutation_p.K776E|UBE4B_ENST00000343090.6_Missense_Mutation_p.K1021E					ubiquitination factor E4B											NS(3)|breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(14)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	48		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		CAGCTCCGGGAAGCAGTTTGT	0.458																																						dbGAP											0													110.0	107.0	108.0					1																	10221207		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF091093	CCDS110.1, CCDS41245.1	1p36.1	2013-01-28	2011-05-19		ENSG00000130939	ENSG00000130939		"""U-box domain containing"""	12500	protein-coding gene	gene with protein product		613565	"""ubiquitination factor E4B (homologous to yeast UFD2)"", ""ubiquitination factor E4B (UFD2 homolog, yeast)"""			9734811, 10089879	Standard	NM_006048		Approved	UBOX3, E4, UFD2, KIAA0684	uc001aqs.4	O95155	OTTHUMG00000001797	ENST00000253251.8:c.2674A>G	1.37:g.10221207A>G	ENSP00000253251:p.Lys892Glu			Missense_Mutation	SNP	pfam_Ub_conjug_fac_E4_core,pfam_Ubox_domain,smart_Ubox_domain	p.K1021E	ENST00000253251.8	37	c.3061	CCDS110.1	1	.	.	.	.	.	.	.	.	.	.	A	17.61	3.433194	0.62844	.	.	ENSG00000130939	ENST00000253251;ENST00000377157;ENST00000343090	T;T;T	0.39997	1.05;1.05;1.05	5.4	5.4	0.78164	Ubiquitin conjugation factor E4, core (1);	0.000000	0.85682	D	0.000000	T	0.41488	0.1161	L	0.42529	1.33	0.58432	D	0.999998	P;P	0.48162	0.906;0.774	P;P	0.49085	0.6;0.465	T	0.21793	-1.0235	10	0.06891	T	0.86	-24.7241	15.4578	0.75330	1.0:0.0:0.0:0.0	.	1021;892	O95155;O95155-2	UBE4B_HUMAN;.	E	892;776;1021	ENSP00000253251:K892E;ENSP00000366362:K776E;ENSP00000343001:K1021E	ENSP00000253251:K892E	K	+	1	0	UBE4B	10143794	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	9.332000	0.96446	2.053000	0.61076	0.460000	0.39030	AAG	UBE4B	-	pfam_Ub_conjug_fac_E4_core	ENSG00000130939		0.458	UBE4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE4B	HGNC	protein_coding	OTTHUMT00000005017.1	69	0.00	0	A	NM_006048		10221207	10221207	+1	no_errors	ENST00000343090	ensembl	human	known	69_37n	missense	43	20.37	11	SNP	1.000	G
ZNF268	10795	genome.wustl.edu	37	12	133780523	133780523	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr12:133780523C>T	ENST00000536435.2	+	6	2581	c.2251C>T	c.(2251-2253)Ccc>Tcc	p.P751S	ZNF268_ENST00000537565.1_Missense_Mutation_p.P590S|ZNF268_ENST00000541009.2_3'UTR|ZNF268_ENST00000536899.2_3'UTR|ZNF268_ENST00000542986.2_3'UTR|ZNF268_ENST00000228289.5_Missense_Mutation_p.P751S	NM_001165885.1|NM_003415.2	NP_001159357.1|NP_003406.1	Q14587	ZN268_HUMAN	zinc finger protein 268	751					cell differentiation (GO:0030154)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein heterodimerization activity (GO:0043497)|regulation of transcription, DNA-templated (GO:0006355)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(3)|endometrium(4)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(1)|skin(1)	24	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.000215)|all_epithelial(31;0.096)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		AGGAGAAAATCCCTATGAATG	0.438																																						dbGAP											0													31.0	32.0	31.0					12																	133780523		692	1591	2283	-	-	-	SO:0001583	missense	0			X78926	CCDS45012.1, CCDS53851.1, CCDS53852.1, CCDS53853.1, CCDS53854.1, CCDS59239.1, CCDS59240.1	12q24.33	2013-01-08				ENSG00000090612		"""Zinc fingers, C2H2-type"", ""-"""	13061	protein-coding gene	gene with protein product		604753				7865130	Standard	NM_003415		Approved	HZF3	uc010tcf.2	Q14587	OTTHUMG00000167946	ENST00000536435.2:c.2251C>T	12.37:g.133780523C>T	ENSP00000444412:p.Pro751Ser		Q8TDG8|Q96RH4|Q9BZJ9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P751S	ENST00000536435.2	37	c.2251	CCDS45012.1	12	.	.	.	.	.	.	.	.	.	.	C	15.30	2.791619	0.50102	.	.	ENSG00000090612	ENST00000541009;ENST00000228289;ENST00000537565;ENST00000541019	T;T	0.55930	0.49;2.32	4.17	4.17	0.49024	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.64800	0.2631	L	0.54908	1.71	0.09310	N	1	D;D	0.76494	0.999;0.999	D;D	0.72625	0.978;0.972	T	0.52704	-0.8540	8	.	.	.	.	9.829	0.40930	0.0:0.8988:0.0:0.1012	.	751;590	Q14587;Q14587-2	ZN268_HUMAN;.	S	751;751;590;590	ENSP00000228289:P751S;ENSP00000445713:P590S	.	P	+	1	0	ZNF268	.	0.002000	0.14202	0.122000	0.21767	0.985000	0.73830	1.661000	0.37408	2.147000	0.66899	0.655000	0.94253	CCC	ZNF268	-	pfscan_Znf_C2H2	ENSG00000090612		0.438	ZNF268-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF268	HGNC	protein_coding	OTTHUMT00000397191.2	32	0.00	0	C	NM_152943		133780523	133780523	+1	no_errors	ENST00000228289	ensembl	human	known	69_37n	missense	24	17.24	5	SNP	0.121	T
ZNF573	126231	genome.wustl.edu	37	19	38284083	38284083	+	Intron	SNP	C	C	T			TCGA-AR-A5QN-01A-12D-A28B-09	TCGA-AR-A5QN-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b786e544-43c3-4fe3-a81e-5c1cf5f7c82d	dff99bc6-c494-4862-9fc9-10e8f8d98628	g.chr19:38284083C>T	ENST00000392138.1	-	2	240				CTD-2554C21.1_ENST00000591908.1_RNA|ZNF573_ENST00000480587.2_Intron			Q86YE8	ZN573_HUMAN	zinc finger protein 573						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|cervix(3)|endometrium(2)|large_intestine(8)|liver(1)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)|Lung(45;0.0813)|LUSC - Lung squamous cell carcinoma(53;0.146)			TACTCCTCGCCGCAGGGCACT	0.537																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK074539	CCDS12508.1, CCDS54260.1, CCDS59381.1	19q13.12	2013-09-20			ENSG00000189144	ENSG00000189144		"""Zinc fingers, C2H2-type"", ""-"""	26420	protein-coding gene	gene with protein product						12477932	Standard	NM_152360		Approved	FLJ30921	uc002ohe.3	Q86YE8	OTTHUMG00000048183	ENST00000392138.1:c.99-21747G>A	19.37:g.38284083C>T			B7WPE1|K7EJ45|Q6P1P1|Q7Z7Q3|Q8N2Q1|Q96BM3|Q96NH0	RNA	SNP	-	NULL	ENST00000392138.1	37	NULL		19																																																																																			ZNF573	-	-	ENSG00000189144		0.537	ZNF573-004	KNOWN	basic	protein_coding	ZNF573	HGNC	protein_coding	OTTHUMT00000109615.1	31	0.00	0	C	NM_152360		38284083	38284083	-1	no_errors	ENST00000587684	ensembl	human	known	69_37n	rna	16	27.27	6	SNP	0.003	T
