#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
C10orf12	26148	genome.wustl.edu	37	10	98742433	98742433	+	Missense_Mutation	SNP	A	A	T	rs142155451		TCGA-B6-A0IH-01A-11D-A10Y-09	TCGA-B6-A0IH-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a4488b9-74d9-4eb1-a7ef-c894c32db942	348ca096-ee86-4a96-9a09-a90b24e84060	g.chr10:98742433A>T	ENST00000286067.2	+	1	1393	c.1286A>T	c.(1285-1287)cAg>cTg	p.Q429L		NM_015652.2	NP_056467.2	Q8N655	CJ012_HUMAN	chromosome 10 open reading frame 12	429										NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(3)|prostate(2)|skin(2)|stomach(4)	45		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		GGAGACACCCAGGAGCTAAAT	0.502																																						dbGAP											0													163.0	178.0	173.0					10																	98742433		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC024315	CCDS7452.1	10q24.2	2014-03-11			ENSG00000155640	ENSG00000155640			23420	protein-coding gene	gene with protein product						24550272	Standard	NM_015652		Approved	DKFZP564P1916, FLJ13022	uc001kmv.3	Q8N655	OTTHUMG00000018840	ENST00000286067.2:c.1286A>T	10.37:g.98742433A>T	ENSP00000286067:p.Gln429Leu		Q9H945|Q9Y457	Missense_Mutation	SNP	NULL	p.Q429L	ENST00000286067.2	37	c.1286	CCDS7452.1	10	.	.	.	.	.	.	.	.	.	.	A	1.667	-0.510091	0.04231	.	.	ENSG00000155640	ENST00000286067;ENST00000539886	T	0.07216	3.21	5.76	-1.15	0.09709	.	0.594424	0.13010	N	0.420966	T	0.03564	0.0102	N	0.14661	0.345	0.09310	N	1	B;B	0.11235	0.004;0.002	B;B	0.12837	0.005;0.008	T	0.41805	-0.9488	10	0.27785	T	0.31	0.6046	1.2909	0.02060	0.488:0.1401:0.2363:0.1356	.	263;429	A0PJI9;Q8N655	.;CJ012_HUMAN	L	429;263	ENSP00000286067:Q429L	ENSP00000286067:Q429L	Q	+	2	0	C10orf12	98732423	0.012000	0.17670	0.024000	0.17045	0.032000	0.12392	0.126000	0.15769	-0.115000	0.11915	0.459000	0.35465	CAG	C10orf12	-	NULL	ENSG00000155640		0.502	C10orf12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf12	HGNC	protein_coding	OTTHUMT00000049627.1	61	0.00	0	A	NM_015652		98742433	98742433	+1	no_errors	ENST00000286067	ensembl	human	known	69_37n	missense	53	22.86	16	SNP	0.004	T
CACNA1C	775	genome.wustl.edu	37	12	2786435	2786435	+	Intron	SNP	G	G	T			TCGA-B6-A0IH-01A-11D-A10Y-09	TCGA-B6-A0IH-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a4488b9-74d9-4eb1-a7ef-c894c32db942	348ca096-ee86-4a96-9a09-a90b24e84060	g.chr12:2786435G>T	ENST00000347598.4	+	42	5100				CACNA1C_ENST00000406454.3_Intron|CACNA1C_ENST00000399606.1_Intron|CACNA1C_ENST00000344100.3_Intron|CACNA1C_ENST00000399621.1_Intron|CACNA1C_ENST00000402845.3_Intron|CACNA1C_ENST00000399595.1_Intron|CACNA1C_ENST00000335762.5_Intron|CACNA1C_ENST00000399603.1_Intron|CACNA1C_ENST00000399638.1_Intron|CACNA1C_ENST00000399597.1_Intron|CACNA1C_ENST00000399591.1_Intron|CACNA1C_ENST00000399629.1_Intron|CACNA1C_ENST00000399641.1_Intron|CACNA1C_ENST00000327702.7_Intron|CACNA1C_ENST00000399634.1_Intron|CACNA1C_ENST00000399601.1_Intron|CACNA1C-AS1_ENST00000501371.1_RNA|CACNA1C_ENST00000399617.1_Intron|CACNA1C_ENST00000399644.1_Intron|CACNA1C_ENST00000399649.1_Intron|CACNA1C_ENST00000399655.1_Intron|CACNA1C_ENST00000399637.1_Intron	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit						adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CCTGGTCATTGCCTCTGACCT	0.642																																						dbGAP											0													15.0	17.0	16.0					12																	2786435		1946	4135	6081	-	-	-	SO:0001627	intron_variant	0			AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.5100+48G>T	12.37:g.2786435G>T			B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	RNA	SNP	-	NULL	ENST00000347598.4	37	NULL	CCDS44788.1	12																																																																																			CACNA1C-AS1	-	-	ENSG00000246627		0.642	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1C-AS1	HGNC	protein_coding	OTTHUMT00000317035.1	12	0.00	0	G	NM_000719		2786435	2786435	-1	no_errors	ENST00000501371	ensembl	human	known	69_37n	rna	14	30.00	6	SNP	0.001	T
CYLC2	1539	genome.wustl.edu	37	9	105767619	105767619	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A0IH-01A-11D-A10Y-09	TCGA-B6-A0IH-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a4488b9-74d9-4eb1-a7ef-c894c32db942	348ca096-ee86-4a96-9a09-a90b24e84060	g.chr9:105767619G>T	ENST00000374798.3	+	5	776	c.706G>T	c.(706-708)Gct>Tct	p.A236S	CYLC2_ENST00000487798.1_Missense_Mutation_p.A236S	NM_001340.3	NP_001331.1	Q14093	CYLC2_HUMAN	cylicin, basic protein of sperm head cytoskeleton 2	236	3 X approximate tandem repeats.|31 X 3 AA repeats of K-K-X.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)	41		all_hematologic(171;0.125)				AGAATTACAAGCTGTAAAAGC	0.373																																						dbGAP											0													92.0	89.0	90.0					9																	105767619		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z46788	CCDS35085.1	9q31.2	2008-07-21			ENSG00000155833	ENSG00000155833			2583	protein-coding gene	gene with protein product		604035				7737358	Standard	NM_001340		Approved		uc004bbs.2	Q14093	OTTHUMG00000020396	ENST00000374798.3:c.706G>T	9.37:g.105767619G>T	ENSP00000420256:p.Ala236Ser		B2R8F4|Q5VVJ9	Missense_Mutation	SNP	NULL	p.A236S	ENST00000374798.3	37	c.706	CCDS35085.1	9	.	.	.	.	.	.	.	.	.	.	G	3.054	-0.194777	0.06259	.	.	ENSG00000155833	ENST00000374798;ENST00000487798	T;T	0.14640	2.49;2.49	4.19	-0.258	0.12975	.	2.197340	0.02306	N	0.071653	T	0.05547	0.0146	N	0.03608	-0.345	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.28554	-1.0040	10	0.13108	T	0.6	0.0544	3.2437	0.06789	0.3549:0.0:0.4622:0.1828	.	236	Q14093	CYLC2_HUMAN	S	236	ENSP00000420256:A236S;ENSP00000417674:A236S	ENSP00000420256:A236S	A	+	1	0	CYLC2	104807440	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.007000	0.13174	-0.119000	0.11830	-1.141000	0.01876	GCT	CYLC2	-	NULL	ENSG00000155833		0.373	CYLC2-001	KNOWN	alternative_3_UTR|NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	CYLC2	HGNC	protein_coding	OTTHUMT00000053463.3	175	0.57	1	G	NM_001340		105767619	105767619	+1	no_errors	ENST00000374798	ensembl	human	putative	69_37n	missense	116	26.58	42	SNP	0.001	T
DCHS1	8642	genome.wustl.edu	37	11	6645151	6645151	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0IH-01A-11D-A10Y-09	TCGA-B6-A0IH-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a4488b9-74d9-4eb1-a7ef-c894c32db942	348ca096-ee86-4a96-9a09-a90b24e84060	g.chr11:6645151C>T	ENST00000299441.3	-	21	8167	c.7756G>A	c.(7756-7758)Gtg>Atg	p.V2586M	RP11-732A19.5_ENST00000526456.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	2586	Cadherin 24. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GTGACTGGCACGACTGAGCTT	0.532																																						dbGAP											0													131.0	116.0	121.0					11																	6645151		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.7756G>A	11.37:g.6645151C>T	ENSP00000299441:p.Val2586Met		O15098	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.V2586M	ENST00000299441.3	37	c.7756	CCDS7771.1	11	.	.	.	.	.	.	.	.	.	.	C	15.97	2.990870	0.54041	.	.	ENSG00000166341	ENST00000299441	T	0.53640	0.61	5.03	5.03	0.67393	Cadherin (4);Cadherin-like (1);	0.000000	0.40818	N	0.001003	T	0.66066	0.2752	M	0.62266	1.93	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.63585	-0.6604	10	0.38643	T	0.18	.	17.1275	0.86718	0.0:1.0:0.0:0.0	.	2586	Q96JQ0	PCD16_HUMAN	M	2586	ENSP00000299441:V2586M	ENSP00000299441:V2586M	V	-	1	0	DCHS1	6601727	1.000000	0.71417	0.846000	0.33378	0.305000	0.27757	7.651000	0.83577	2.626000	0.88956	0.650000	0.86243	GTG	DCHS1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000166341		0.532	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS1	HGNC	protein_coding	OTTHUMT00000257258.1	30	0.00	0	C	NM_003737		6645151	6645151	-1	no_errors	ENST00000299441	ensembl	human	known	69_37n	missense	68	11.69	9	SNP	0.996	T
DDX54	79039	genome.wustl.edu	37	12	113599787	113599787	+	Silent	SNP	C	C	T			TCGA-B6-A0IH-01A-11D-A10Y-09	TCGA-B6-A0IH-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a4488b9-74d9-4eb1-a7ef-c894c32db942	348ca096-ee86-4a96-9a09-a90b24e84060	g.chr12:113599787C>T	ENST00000306014.5	-	18	2238	c.2211G>A	c.(2209-2211)aaG>aaA	p.K737K	DDX54_ENST00000549271.1_5'Flank|DDX54_ENST00000314045.7_Silent_p.K737K	NM_024072.3	NP_076977.3	Q8TDD1	DDX54_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 54	737					ATP catabolic process (GO:0006200)|intracellular estrogen receptor signaling pathway (GO:0030520)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						CCACAAACCGCTTCTTCTTAC	0.592																																						dbGAP											0													165.0	141.0	149.0					12																	113599787		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF144056	CCDS31907.1, CCDS44984.1	12q24.11	2006-01-30				ENSG00000123064		"""DEAD-boxes"""	20084	protein-coding gene	gene with protein product		611665				12466272	Standard	NM_001111322		Approved	MGC2835, APR-5, DP97	uc001tuq.4	Q8TDD1	OTTHUMG00000169676	ENST00000306014.5:c.2211G>A	12.37:g.113599787C>T			Q86YT8|Q9BRZ1	Missense_Mutation	SNP	pfam_DBP10CT	p.A140T	ENST00000306014.5	37	c.418	CCDS31907.1	12	.	.	.	.	.	.	.	.	.	.	C	10.64	1.406268	0.25378	.	.	ENSG00000123064	ENST00000546898	.	.	.	4.74	4.74	0.60224	.	.	.	.	.	T	0.61565	0.2357	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59931	-0.7361	4	.	.	.	.	10.9549	0.47351	0.0:0.9124:0.0:0.0876	.	.	.	.	T	140	.	.	A	-	1	0	DDX54	112084170	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	2.736000	0.47385	2.187000	0.69744	0.491000	0.48974	GCG	DDX54	-	pfam_DBP10CT	ENSG00000123064		0.592	DDX54-002	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	DDX54	HGNC	protein_coding	OTTHUMT00000405435.1	145	0.68	1	C	NM_024072		113599787	113599787	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000546898	ensembl	human	putative	69_37n	missense	157	13.26	24	SNP	1.000	T
DUSP13	51207	genome.wustl.edu	37	10	76863684	76863684	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0IH-01A-11D-A10Y-09	TCGA-B6-A0IH-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a4488b9-74d9-4eb1-a7ef-c894c32db942	348ca096-ee86-4a96-9a09-a90b24e84060	g.chr10:76863684G>A	ENST00000491677.2	-	4	801	c.259C>T	c.(259-261)Ccc>Tcc	p.P87S	DUSP13_ENST00000372702.3_3'UTR|DUSP13_ENST00000607009.1_Intron|DUSP13_ENST00000372700.3_Intron|DUSP13_ENST00000607131.1_Missense_Mutation_p.P51S	NM_001007271.1	NP_001007272.1	Q9UII6	DS13B_HUMAN	dual specificity phosphatase 13	0					meiotic nuclear division (GO:0007126)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)		protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	8	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					CTGAGAGGGGGTGTAGGCGCC	0.652																																					NSCLC(174;1655 2059 12324 40663 42963)	dbGAP											0													25.0	25.0	25.0					10																	76863684		2184	4269	6453	-	-	-	SO:0001583	missense	0			AB027004	CCDS7346.1, CCDS31224.1, CCDS53542.1	10q23.1	2013-10-25			ENSG00000079393	ENSG00000079393		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	19681	protein-coding gene	gene with protein product		613191				10585869	Standard	XM_005269883		Approved	BEDP, TMDP, FLJ32450, DUSP13A, DUSP13B	uc001jwu.3	Q6B8I1	OTTHUMG00000018516	ENST00000491677.2:c.259C>T	10.37:g.76863684G>A	ENSP00000436312:p.Pro87Ser		A8K776|A8K782|B3KPY1|B3KXT0|B4DUK0|Q5JSC6|Q6IAR0|Q96GC2	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP,prints_Atypical_DUSP_famA	p.P87S	ENST00000491677.2	37	c.259		10	.	.	.	.	.	.	.	.	.	.	G	8.238	0.806115	0.16467	.	.	ENSG00000079393	ENST00000491677;ENST00000372698	T	0.03801	3.8	3.61	1.69	0.24217	.	0.956927	0.08522	N	0.933281	T	0.02610	0.0079	N	0.14661	0.345	0.09310	N	1	B	0.19817	0.039	B	0.17098	0.017	T	0.44345	-0.9334	10	0.02654	T	1	-3.3261	6.2281	0.20720	0.2393:0.0:0.7607:0.0	.	87	F2Z2C4	.	S	87;51	ENSP00000436312:P87S	ENSP00000361783:P51S	P	-	1	0	DUSP13	76533690	0.000000	0.05858	0.002000	0.10522	0.016000	0.09150	0.293000	0.19029	0.478000	0.27488	0.655000	0.94253	CCC	DUSP13	-	NULL	ENSG00000079393		0.652	DUSP13-201	KNOWN	basic|appris_candidate_longest	protein_coding	DUSP13	HGNC	protein_coding		42	0.00	0	G			76863684	76863684	-1	no_errors	ENST00000491677	ensembl	human	known	69_37n	missense	44	13.73	7	SNP	0.002	A
GRB10	2887	genome.wustl.edu	37	7	50663154	50663154	+	Nonsense_Mutation	SNP	T	T	A			TCGA-B6-A0IH-01A-11D-A10Y-09	TCGA-B6-A0IH-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a4488b9-74d9-4eb1-a7ef-c894c32db942	348ca096-ee86-4a96-9a09-a90b24e84060	g.chr7:50663154T>A	ENST00000401949.1	-	18	2087	c.1618A>T	c.(1618-1620)Aaa>Taa	p.K540*	GRB10_ENST00000406641.1_Nonsense_Mutation_p.K482*|GRB10_ENST00000335866.3_Nonsense_Mutation_p.K482*|GRB10_ENST00000403097.1_Nonsense_Mutation_p.K534*|GRB10_ENST00000357271.5_Nonsense_Mutation_p.K494*|GRB10_ENST00000398810.2_Nonsense_Mutation_p.K482*|GRB10_ENST00000398812.2_Nonsense_Mutation_p.K540*|GRB10_ENST00000439599.1_Nonsense_Mutation_p.K534*|GRB10_ENST00000407526.1_Nonsense_Mutation_p.K482*|GRB10_ENST00000402578.1_Nonsense_Mutation_p.K482*|GRB10_ENST00000402497.1_Nonsense_Mutation_p.K482*			Q13322	GRB10_HUMAN	growth factor receptor-bound protein 10	540	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of phosphorylation (GO:0042326)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of phosphorylation (GO:0042327)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|response to insulin (GO:0032868)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|SH3/SH2 adaptor activity (GO:0005070)	p.K540E(1)		NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(19)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	41	Glioma(55;0.08)|all_neural(89;0.245)					TGGAAATTTTTAATTTTCTGG	0.383									Russell-Silver syndrome																													dbGAP											1	Substitution - Missense(1)	lung(1)											202.0	203.0	203.0					7																	50663154		1832	4080	5912	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	Silver-Russell Dwarfism, Silver-Russell syndrome, SRS, Russel-Silver Dwarfism		CCDS43582.1, CCDS43583.1, CCDS47586.1	7p12.2	2013-02-14			ENSG00000106070	ENSG00000106070		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4564	protein-coding gene	gene with protein product		601523					Standard	NM_005311		Approved		uc003tpi.2	Q13322	OTTHUMG00000150622	ENST00000401949.1:c.1618A>T	7.37:g.50663154T>A	ENSP00000385770:p.Lys540*		A4D258|A7VJ95|A8K0E6|D3DVM9|O00427|O00701|O75222|Q92606|Q92907|Q92948	Nonsense_Mutation	SNP	pfam_BPS-dom,pfam_SH2,pfam_Ras-assoc,pfam_Pleckstrin_homology,smart_Ras-assoc,smart_Pleckstrin_homology,smart_SH2,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SH2,prints_SH2	p.K540*	ENST00000401949.1	37	c.1618	CCDS43582.1	7	.	.	.	.	.	.	.	.	.	.	T	43	9.954763	0.99304	.	.	ENSG00000106070	ENST00000398812;ENST00000439599;ENST00000335866;ENST00000398810;ENST00000402578;ENST00000403097;ENST00000406641;ENST00000357271;ENST00000407526;ENST00000401949;ENST00000398791;ENST00000402497	.	.	.	5.78	5.78	0.91487	.	0.041302	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-22.0624	16.1081	0.81237	0.0:0.0:0.0:1.0	.	.	.	.	X	540;534;482;482;482;534;482;494;482;540;72;482	.	ENSP00000338543:K482X	K	-	1	0	GRB10	50630648	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	8.040000	0.89188	2.194000	0.70268	0.533000	0.62120	AAA	GRB10	-	pfam_SH2,smart_SH2,pfscan_SH2	ENSG00000106070		0.383	GRB10-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GRB10	HGNC	protein_coding	OTTHUMT00000319157.1	237	0.42	1	T			50663154	50663154	-1	no_errors	ENST00000398812	ensembl	human	known	69_37n	nonsense	141	33.95	73	SNP	1.000	A
GTF2IRD2	84163	genome.wustl.edu	37	7	74211389	74211389	+	Missense_Mutation	SNP	T	T	G			TCGA-B6-A0IH-01A-11D-A10Y-09	TCGA-B6-A0IH-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a4488b9-74d9-4eb1-a7ef-c894c32db942	348ca096-ee86-4a96-9a09-a90b24e84060	g.chr7:74211389T>G	ENST00000405086.2	-	16	2651	c.2462A>C	c.(2461-2463)aAc>aCc	p.N821T	GTF2IRD2_ENST00000451013.2_Missense_Mutation_p.N368T	NM_173537.2	NP_775808	Q86UP8	GTD2A_HUMAN	GTF2I repeat domain containing 2	821					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(3)|large_intestine(2)|lung(2)|ovary(2)|skin(1)	11						gggaatgtagttcaggccatc	0.478																																					NSCLC(40;560 1096 7501 40315 49546)	dbGAP											0													110.0	116.0	114.0					7																	74211389		2202	4297	6499	-	-	-	SO:0001583	missense	0			BC047706	CCDS5576.1, CCDS64682.1	7q11.23	2014-05-06			ENSG00000196275	ENSG00000196275			30775	protein-coding gene	gene with protein product	"""transcription factor GTF2IRD2"""	608899				15243160	Standard	NM_173537		Approved	FLJ37938, GTF2IRD2A	uc003ubd.1	Q86UP8	OTTHUMG00000181527	ENST00000405086.2:c.2462A>C	7.37:g.74211389T>G	ENSP00000385491:p.Asn821Thr		A8K5W6|B3KUZ2|Q69G40|Q6EKI8|Q6EKI9|Q6NVW2|Q6P7N8|Q86WX4|Q8ND85|Q8NDE5	Missense_Mutation	SNP	pfam_GTF2I,superfamily_GTF2I,superfamily_RNaseH-like_dom,pfscan_GTF2I	p.N821T	ENST00000405086.2	37	c.2462	CCDS5576.1	7	.	.	.	.	.	.	.	.	.	.	t	9.056	0.993251	0.19043	.	.	ENSG00000196275	ENST00000405086;ENST00000451013	T;T	0.11930	2.92;2.73	1.84	1.84	0.25277	Ribonuclease H-like (1);	.	.	.	.	T	0.16128	0.0388	N	0.19112	0.55	0.80722	D	1	D	0.63880	0.993	D	0.68192	0.956	T	0.10870	-1.0611	9	0.30854	T	0.27	-10.5786	5.8821	0.18862	0.0:0.0:0.0:1.0	.	821	Q86UP8	GTD2A_HUMAN	T	821;368	ENSP00000385491:N821T;ENSP00000406723:N368T	ENSP00000385491:N821T	N	-	2	0	GTF2IRD2	73849325	0.998000	0.40836	0.997000	0.53966	0.956000	0.61745	1.855000	0.39378	1.135000	0.42183	0.363000	0.22086	AAC	GTF2IRD2	-	superfamily_RNaseH-like_dom	ENSG00000196275		0.478	GTF2IRD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2IRD2	HGNC	protein_coding	OTTHUMT00000252712.3	149	0.00	0	T	NM_173537		74211389	74211389	-1	no_errors	ENST00000405086	ensembl	human	known	69_37n	missense	148	34.22	77	SNP	0.998	G
HERC2	8924	genome.wustl.edu	37	15	28357017	28357017	+	Silent	SNP	G	G	A	rs563175513		TCGA-B6-A0IH-01A-11D-A10Y-09	TCGA-B6-A0IH-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a4488b9-74d9-4eb1-a7ef-c894c32db942	348ca096-ee86-4a96-9a09-a90b24e84060	g.chr15:28357017G>A	ENST00000261609.7	-	93	14505	c.14397C>T	c.(14395-14397)atC>atT	p.I4799I		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CTGTAAGTGCGATGCGAGCGT	0.522													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18928	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													111.0	94.0	100.0					15																	28357017		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.14397C>T	15.37:g.28357017G>A				Silent	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_CPH_domain,pfam_Mib_Herc2,pfam_Cyt_B5,pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_HECT,superfamily_Galactose-bd-like,superfamily_Cyt_B5,superfamily_UBA-like,superfamily_CUB,smart_Beta-propeller_rpt_TECPR,smart_Znf_ZZ,smart_HECT,pfscan_HECT,pfscan_Znf_ZZ,pfscan_Reg_chr_condens,pfscan_Cyt_B5,prints_Reg_chr_condens	p.I4799	ENST00000261609.7	37	c.14397	CCDS10021.1	15																																																																																			HERC2	-	smart_HECT	ENSG00000128731		0.522	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC2	HGNC	protein_coding	OTTHUMT00000251358.2	144	0.00	0	G	NM_004667		28357017	28357017	-1	no_errors	ENST00000261609	ensembl	human	known	69_37n	silent	116	29.70	49	SNP	1.000	A
KIAA1024	23251	genome.wustl.edu	37	15	79760670	79760670	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0IH-01A-11D-A10Y-09	TCGA-B6-A0IH-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a4488b9-74d9-4eb1-a7ef-c894c32db942	348ca096-ee86-4a96-9a09-a90b24e84060	g.chr15:79760670G>A	ENST00000305428.3	+	4	2770	c.2695G>A	c.(2695-2697)Gcg>Acg	p.A899T		NM_015206.2	NP_056021.1	Q9UPX6	K1024_HUMAN	KIAA1024	899						integral component of membrane (GO:0016021)				central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(2)|pancreas(2)|prostate(1)	49						GATCGCTGCTGCGGCATGCAC	0.458																																						dbGAP											0													77.0	67.0	70.0					15																	79760670		2196	4293	6489	-	-	-	SO:0001583	missense	0			AB028947	CCDS32306.1	15q25.1	2007-12-12				ENSG00000169330			29172	protein-coding gene	gene with protein product						10470851	Standard	NM_015206		Approved		uc002bew.1	Q9UPX6		ENST00000305428.3:c.2695G>A	15.37:g.79760670G>A	ENSP00000307461:p.Ala899Thr		A7MD43	Missense_Mutation	SNP	pfam_UPF0258	p.A899T	ENST00000305428.3	37	c.2695	CCDS32306.1	15	.	.	.	.	.	.	.	.	.	.	G	20.6	4.009707	0.75046	.	.	ENSG00000169330	ENST00000305428	T	0.52983	0.64	5.67	5.67	0.87782	.	0.106550	0.64402	D	0.000005	T	0.64114	0.2569	L	0.47716	1.5	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.59021	-0.7532	9	.	.	.	.	19.7863	0.96440	0.0:0.0:1.0:0.0	.	899	Q9UPX6	K1024_HUMAN	T	899	ENSP00000307461:A899T	.	A	+	1	0	KIAA1024	77547725	1.000000	0.71417	0.142000	0.22268	0.009000	0.06853	9.398000	0.97281	2.665000	0.90641	0.655000	0.94253	GCG	KIAA1024	-	pfam_UPF0258	ENSG00000169330		0.458	KIAA1024-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1024	HGNC	protein_coding	OTTHUMT00000416718.1	93	0.00	0	G	NM_015206		79760670	79760670	+1	no_errors	ENST00000305428	ensembl	human	known	69_37n	missense	107	30.07	46	SNP	1.000	A
KRT9	3857	genome.wustl.edu	37	17	39726220	39726220	+	Missense_Mutation	SNP	T	T	C			TCGA-B6-A0IH-01A-11D-A10Y-09	TCGA-B6-A0IH-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a4488b9-74d9-4eb1-a7ef-c894c32db942	348ca096-ee86-4a96-9a09-a90b24e84060	g.chr17:39726220T>C	ENST00000246662.4	-	3	838	c.773A>G	c.(772-774)aAt>aGt	p.N258S	KRT9_ENST00000588431.1_Missense_Mutation_p.N25S	NM_000226.3	NP_000217.2	P35527	K1C9_HUMAN	keratin 9	258	Coil 1B.|Rod.				epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		Breast(137;0.000307)				CCGCAGGCCATTGATGTCAGC	0.537																																						dbGAP											0													89.0	92.0	91.0					17																	39726220		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32654.1	17q21.2	2013-06-20	2008-08-01		ENSG00000171403	ENSG00000171403		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6447	protein-coding gene	gene with protein product	"""cytokeratin 9"", ""type I cytoskeletal 9"", ""epidermolytic palmoplantar keratoderma"""	607606				7512862, 16831889	Standard	NM_000226		Approved	EPPK, K9, CK-9	uc002hxe.4	P35527	OTTHUMG00000133599	ENST00000246662.4:c.773A>G	17.37:g.39726220T>C	ENSP00000246662:p.Asn258Ser		O00109|Q0IJ47|Q14665	Missense_Mutation	SNP	pfam_F,prints_Keratin_I	p.N258S	ENST00000246662.4	37	c.773	CCDS32654.1	17	.	.	.	.	.	.	.	.	.	.	T	16.45	3.126028	0.56721	.	.	ENSG00000171403	ENST00000246662	T	0.81415	-1.49	4.76	2.51	0.30379	Filament (1);	0.000000	0.34411	N	0.003991	T	0.76912	0.4054	M	0.74647	2.275	0.23351	N	0.99785	P	0.34934	0.476	B	0.33121	0.158	T	0.67397	-0.5681	10	0.54805	T	0.06	.	9.1371	0.36881	0.0:0.1529:0.0:0.8471	.	258	P35527	K1C9_HUMAN	S	258	ENSP00000246662:N258S	ENSP00000246662:N258S	N	-	2	0	KRT9	36979746	0.993000	0.37304	0.975000	0.42487	0.738000	0.42128	2.202000	0.42743	0.188000	0.20168	-0.512000	0.04463	AAT	KRT9	-	pfam_F,prints_Keratin_I	ENSG00000171403		0.537	KRT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT9	HGNC	protein_coding	OTTHUMT00000257707.1	84	0.00	0	T	NM_000226		39726220	39726220	-1	no_errors	ENST00000246662	ensembl	human	known	69_37n	missense	96	17.24	20	SNP	0.913	C
LCT	3938	genome.wustl.edu	37	2	136579662	136579662	+	Missense_Mutation	SNP	T	T	A	rs370965510		TCGA-B6-A0IH-01A-11D-A10Y-09	TCGA-B6-A0IH-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a4488b9-74d9-4eb1-a7ef-c894c32db942	348ca096-ee86-4a96-9a09-a90b24e84060	g.chr2:136579662T>A	ENST00000264162.2	-	5	924	c.914A>T	c.(913-915)aAt>aTt	p.N305I	AC011893.3_ENST00000437007.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	305	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	TTGGTCTTTATTTATGGCTGT	0.368																																						dbGAP											0													121.0	124.0	123.0					2																	136579662		2203	4300	6503	-	-	-	SO:0001583	missense	0			X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.914A>T	2.37:g.136579662T>A	ENSP00000264162:p.Asn305Ile		Q4ZG58	Missense_Mutation	SNP	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.N305I	ENST00000264162.2	37	c.914	CCDS2178.1	2	.	.	.	.	.	.	.	.	.	.	T	16.82	3.229141	0.58777	.	.	ENSG00000115850	ENST00000264162	T	0.29397	1.57	5.44	3.07	0.35406	.	0.119289	0.53938	D	0.000043	T	0.35158	0.0922	M	0.61703	1.905	0.54753	D	0.999989	P	0.40398	0.716	P	0.45071	0.468	T	0.08229	-1.0732	10	0.56958	D	0.05	-12.8426	8.9227	0.35621	0.0:0.1522:0.0:0.8478	.	305	P09848	LPH_HUMAN	I	305	ENSP00000264162:N305I	ENSP00000264162:N305I	N	-	2	0	LCT	136296132	0.993000	0.37304	0.120000	0.21714	0.994000	0.84299	1.278000	0.33179	0.511000	0.28236	0.533000	0.62120	AAT	LCT	-	NULL	ENSG00000115850		0.368	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCT	HGNC	protein_coding	OTTHUMT00000254657.1	299	0.00	0	T	NM_002299		136579662	136579662	-1	no_errors	ENST00000264162	ensembl	human	known	69_37n	missense	275	10.39	32	SNP	0.774	A
MAGEC3	139081	genome.wustl.edu	37	X	140983081	140983081	+	Silent	SNP	G	G	A			TCGA-B6-A0IH-01A-11D-A10Y-09	TCGA-B6-A0IH-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a4488b9-74d9-4eb1-a7ef-c894c32db942	348ca096-ee86-4a96-9a09-a90b24e84060	g.chrX:140983081G>A	ENST00000298296.1	+	5	936	c.936G>A	c.(934-936)gcG>gcA	p.A312A	MAGEC3_ENST00000483584.1_3'UTR|MAGEC3_ENST00000448920.1_Silent_p.A64A|MAGEC3_ENST00000544766.1_5'UTR|MAGEC3_ENST00000409007.1_5'Flank|MAGEC3_ENST00000443323.2_Intron|MAGEC3_ENST00000536088.1_Intron	NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3	312	MAGE 1. {ECO:0000255|PROSITE- ProRule:PRU00127}.									NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					CAGGGTTCGCGGATGTGCTTT	0.612																																						dbGAP											0													105.0	99.0	101.0					X																	140983081		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.936G>A	X.37:g.140983081G>A			Q3SYA7|Q5JZ43|Q9BZ80	Silent	SNP	pfam_MAGE,pfscan_MAGE	p.A312	ENST00000298296.1	37	c.936	CCDS14676.1	X																																																																																			MAGEC3	-	NULL	ENSG00000165509		0.612	MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC3	HGNC	protein_coding	OTTHUMT00000058606.1	97	0.00	0	G	NM_138702		140983081	140983081	+1	no_errors	ENST00000298296	ensembl	human	known	69_37n	silent	164	11.83	22	SNP	0.000	A
MTM1	4534	genome.wustl.edu	37	X	149814175	149814175	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0IH-01A-11D-A10Y-09	TCGA-B6-A0IH-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a4488b9-74d9-4eb1-a7ef-c894c32db942	348ca096-ee86-4a96-9a09-a90b24e84060	g.chrX:149814175C>T	ENST00000370396.2	+	9	752	c.698C>T	c.(697-699)cCa>cTa	p.P233L	MTM1_ENST00000413012.2_Missense_Mutation_p.P196L|MTM1_ENST00000542741.1_Missense_Mutation_p.P138L|MTM1_ENST00000306167.7_3'UTR|MTM1_ENST00000543350.1_Missense_Mutation_p.P118L	NM_000252.2	NP_000243.1	Q13496	MTM1_HUMAN	myotubularin 1	233	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				endosome to lysosome transport (GO:0008333)|intermediate filament organization (GO:0045109)|mitochondrion distribution (GO:0048311)|mitochondrion morphogenesis (GO:0070584)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|protein transport (GO:0015031)|regulation of vacuole organization (GO:0044088)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	intermediate filament binding (GO:0019215)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Acute lymphoblastic leukemia(192;6.56e-05)					TGGATTCATCCAGAAAATAAG	0.388																																						dbGAP											0													154.0	132.0	140.0					X																	149814175		2203	4300	6503	-	-	-	SO:0001583	missense	0			U46024	CCDS14694.1	Xq27.3-q28	2014-09-17			ENSG00000171100	ENSG00000171100		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7448	protein-coding gene	gene with protein product		300415	"""myotubular myopathy 1"""				Standard	NM_000252		Approved		uc004fef.4	Q13496	OTTHUMG00000024158	ENST00000370396.2:c.698C>T	X.37:g.149814175C>T	ENSP00000359423:p.Pro233Leu		A6NDB1|B7Z491|F2Z330|Q8NEL1	Missense_Mutation	SNP	pfam_Myotub-related,pfam_GRAM,smart_GRAM,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase	p.P233L	ENST00000370396.2	37	c.698	CCDS14694.1	X	.	.	.	.	.	.	.	.	.	.	C	19.21	3.784378	0.70222	.	.	ENSG00000171100	ENST00000370396;ENST00000542741;ENST00000543350;ENST00000413012	D;D;D;D	0.92805	-3.11;-3.11;-3.11;-3.11	5.93	5.93	0.95920	Myotubularin phosphatase domain (1);Myotubularin-related (1);	0.124120	0.64402	D	0.000017	D	0.96836	0.8967	M	0.92691	3.335	0.54753	D	0.99998	P;P	0.49185	0.92;0.646	P;P	0.59703	0.862;0.632	D	0.97169	0.9843	10	0.66056	D	0.02	.	19.2929	0.94110	0.0:1.0:0.0:0.0	.	196;233	B7Z491;Q13496	.;MTM1_HUMAN	L	233;138;118;196	ENSP00000359423:P233L;ENSP00000444015:P138L;ENSP00000439784:P118L;ENSP00000389157:P196L	ENSP00000359423:P233L	P	+	2	0	MTM1	149564833	0.996000	0.38824	0.996000	0.52242	0.986000	0.74619	3.274000	0.51631	2.508000	0.84585	0.594000	0.82650	CCA	MTM1	-	pfam_Myotub-related	ENSG00000171100		0.388	MTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MTM1	HGNC	protein_coding	OTTHUMT00000060847.3	265	0.00	0	C	NM_000252		149814175	149814175	+1	no_errors	ENST00000370396	ensembl	human	known	69_37n	missense	247	12.41	35	SNP	0.997	T
OR1Q1	158131	genome.wustl.edu	37	9	125377831	125377831	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0IH-01A-11D-A10Y-09	TCGA-B6-A0IH-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a4488b9-74d9-4eb1-a7ef-c894c32db942	348ca096-ee86-4a96-9a09-a90b24e84060	g.chr9:125377831G>A	ENST00000297913.2	+	1	884	c.815G>A	c.(814-816)cGc>cAc	p.R272H	RP11-64P14.7_ENST00000431442.1_RNA	NM_012364.1	NP_036496.1	Q15612	OR1Q1_HUMAN	olfactory receptor, family 1, subfamily Q, member 1	272					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(2)	17						ACCAAGGGTCGCATTATAACA	0.532																																						dbGAP											0													66.0	64.0	65.0					9																	125377831		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35125.1	9q33.2	2013-09-20			ENSG00000165202	ENSG00000165202		"""GPCR / Class A : Olfactory receptors"""	8223	protein-coding gene	gene with protein product				OR1Q2, OR1Q3			Standard	NM_012364		Approved	OST226, OR9-A, HSTPCR106, OST226OR9-A, TPCR106	uc011lyy.2	Q15612	OTTHUMG00000020615	ENST00000297913.2:c.815G>A	9.37:g.125377831G>A	ENSP00000297913:p.Arg272His		Q6IFN4|Q8NGR7|Q96R82	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.R272H	ENST00000297913.2	37	c.815	CCDS35125.1	9	.	.	.	.	.	.	.	.	.	.	G	11.62	1.693480	0.30052	.	.	ENSG00000165202	ENST00000297913	T	0.00123	8.7	5.57	5.57	0.84162	GPCR, rhodopsin-like superfamily (1);	0.000000	0.50627	D	0.000117	T	0.00384	0.0012	M	0.62266	1.93	0.09310	N	1	D	0.89917	1.0	D	0.73380	0.98	T	0.57705	-0.7765	10	0.72032	D	0.01	-7.5851	11.9054	0.52708	0.0:0.0:0.8265:0.1734	.	272	Q15612	OR1Q1_HUMAN	H	272	ENSP00000297913:R272H	ENSP00000297913:R272H	R	+	2	0	OR1Q1	124417652	0.002000	0.14202	0.108000	0.21378	0.209000	0.24338	1.140000	0.31516	2.902000	0.99343	0.650000	0.86243	CGC	OR1Q1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000165202		0.532	OR1Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1Q1	HGNC	protein_coding	OTTHUMT00000053946.1	62	0.00	0	G			125377831	125377831	+1	no_errors	ENST00000297913	ensembl	human	known	69_37n	missense	64	15.79	12	SNP	0.092	A
PFKM	5213	genome.wustl.edu	37	12	48535119	48535119	+	Missense_Mutation	SNP	T	T	C			TCGA-B6-A0IH-01A-11D-A10Y-09	TCGA-B6-A0IH-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a4488b9-74d9-4eb1-a7ef-c894c32db942	348ca096-ee86-4a96-9a09-a90b24e84060	g.chr12:48535119T>C	ENST00000312352.7	+	15	1406	c.1367T>C	c.(1366-1368)gTt>gCt	p.V456A	PFKM_ENST00000547587.1_Missense_Mutation_p.V456A|PFKM_ENST00000551804.1_Missense_Mutation_p.V425A|PFKM_ENST00000340802.6_Missense_Mutation_p.V527A|PFKM_ENST00000395233.2_Missense_Mutation_p.V425A|PFKM_ENST00000359794.5_Missense_Mutation_p.V456A	NM_001166687.1	NP_001160159.1	P08237	PFKAM_HUMAN	phosphofructokinase, muscle	456	C-terminal regulatory PFK domain 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 6-phosphate metabolic process (GO:0006002)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|muscle cell cellular homeostasis (GO:0046716)|positive regulation of insulin secretion (GO:0032024)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	6-phosphofructokinase complex (GO:0005945)|apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|sperm principal piece (GO:0097228)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|fructose binding (GO:0070061)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			NS(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	35						TGGAGCTATGTTGGGGGCTGG	0.552																																						dbGAP											0													95.0	91.0	92.0					12																	48535119		2203	4300	6503	-	-	-	SO:0001583	missense	0			M26066	CCDS8760.1, CCDS53786.1	12q13.11	2014-06-13					2.7.1.11		8877	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 122"""	610681	"""phosphofructokinase, polypeptide X"""	PFKX			Standard	NM_001166686		Approved	PFK-1, PPP1R122	uc001rrb.2	P08237		ENST00000312352.7:c.1367T>C	12.37:g.48535119T>C	ENSP00000309438:p.Val456Ala		J3KNX3|Q16814|Q16815|Q6ZTT1	Missense_Mutation	SNP	pfam_Phosphofructokinase_dom,superfamily_Phosphofructokinase_dom,pirsf_6-phosphofructokinase_euk,prints_Phosphofructokinase,tigrfam_6-phosphofructokinase_euk	p.V456A	ENST00000312352.7	37	c.1367	CCDS8760.1	12	.	.	.	.	.	.	.	.	.	.	T	29.3	4.996480	0.93167	.	.	ENSG00000152556	ENST00000340802;ENST00000359794;ENST00000395233;ENST00000551804;ENST00000547587;ENST00000312352;ENST00000546465	D;D;D;D;D;D;D	0.81739	-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53	5.1	5.1	0.69264	Phosphofructokinase domain (2);	0.000000	0.85682	D	0.000000	D	0.92469	0.7609	H	0.96889	3.9	0.80722	D	1	P;B;D	0.67145	0.697;0.257;0.996	P;P;D	0.65010	0.54;0.572;0.931	D	0.94676	0.7861	10	0.66056	D	0.02	-21.972	15.0135	0.71567	0.0:0.0:0.0:1.0	.	425;456;527	P08237-2;P08237;Q6ZTT1	.;K6PF_HUMAN;.	A	527;456;425;425;456;456;71	ENSP00000345771:V527A;ENSP00000352842:V456A;ENSP00000378656:V425A;ENSP00000448177:V425A;ENSP00000449426:V456A;ENSP00000309438:V456A;ENSP00000446519:V71A	ENSP00000309438:V456A	V	+	2	0	PFKM	46821386	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.868000	0.87116	2.279000	0.76181	0.533000	0.62120	GTT	PFKM	-	pfam_Phosphofructokinase_dom,superfamily_Phosphofructokinase_dom,pirsf_6-phosphofructokinase_euk,tigrfam_6-phosphofructokinase_euk	ENSG00000152556		0.552	PFKM-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PFKM	HGNC	protein_coding	OTTHUMT00000406490.1	125	0.00	0	T	NM_000289		48535119	48535119	+1	no_errors	ENST00000312352	ensembl	human	known	69_37n	missense	87	29.60	37	SNP	1.000	C
RFX3	5991	genome.wustl.edu	37	9	3346744	3346745	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-B6-A0IH-01A-11D-A10Y-09	TCGA-B6-A0IH-10A-01D-A110-09	CA	CA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a4488b9-74d9-4eb1-a7ef-c894c32db942	348ca096-ee86-4a96-9a09-a90b24e84060	g.chr9:3346744_3346745delCA	ENST00000382004.3	-	4	448_449	c.137_138delTG	c.(136-138)gtgfs	p.V46fs	RFX3_ENST00000302303.1_Frame_Shift_Del_p.V46fs|RFX3_ENST00000358730.2_Frame_Shift_Del_p.V46fs|RFX3_ENST00000381984.2_Frame_Shift_Del_p.V46fs	NM_001282116.1|NM_134428.1	NP_001269045.1|NP_602304.1	P48380	RFX3_HUMAN	regulatory factor X, 3 (influences HLA class II expression)	46					cell maturation (GO:0048469)|cilium assembly (GO:0042384)|cilium-dependent cell motility (GO:0060285)|endocrine pancreas development (GO:0031018)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type B pancreatic cell development (GO:2000078)|regulation of insulin secretion (GO:0050796)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell maturation (GO:0072560)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(11)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(50;0.00124)|Lung(2;0.0337)		GTACCTGCTGCACAGTCTGTAC	0.416																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AI811824	CCDS6449.1, CCDS6450.1, CCDS75809.1	9p24.2	2008-02-05			ENSG00000080298	ENSG00000080298			9984	protein-coding gene	gene with protein product		601337				8289803	Standard	XM_005251534		Approved		uc003zhr.3	P48380	OTTHUMG00000019456	ENST00000382004.3:c.137_138delTG	9.37:g.3346746_3346747delCA	ENSP00000371434:p.Val46fs		A8K0H5|D3DRH8|D3DRH9|Q5JTL7|Q5JTL8|Q6NW13|Q8WTU4|Q95HL5|Q95HL6	Frame_Shift_Del	DEL	pfam_RFX1_trans_act,pfam_DNA-bd_RFX	p.V46fs	ENST00000382004.3	37	c.138_137	CCDS6449.1	9																																																																																			RFX3	-	pfam_RFX1_trans_act	ENSG00000080298		0.416	RFX3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX3	HGNC	protein_coding	OTTHUMT00000051545.1	187	0.00	0	CA	NM_002919		3346744	3346745	-1	no_errors	ENST00000382004	ensembl	human	known	69_37n	frame_shift_del	208	11.02	26	DEL	0.999:1.000	-
RMI1	80010	genome.wustl.edu	37	9	86617271	86617271	+	Missense_Mutation	SNP	A	A	G			TCGA-B6-A0IH-01A-11D-A10Y-09	TCGA-B6-A0IH-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a4488b9-74d9-4eb1-a7ef-c894c32db942	348ca096-ee86-4a96-9a09-a90b24e84060	g.chr9:86617271A>G	ENST00000325875.3	+	3	1702	c.1370A>G	c.(1369-1371)cAa>cGa	p.Q457R		NM_024945.2	NP_079221.2	Q9H9A7	RMI1_HUMAN	RecQ mediated genome instability 1	457					DNA replication (GO:0006260)|glucose homeostasis (GO:0042593)|multicellular organism growth (GO:0035264)|reduction of food intake in response to dietary excess (GO:0002023)|response to glucose (GO:0009749)	nucleus (GO:0005634)				biliary_tract(1)|central_nervous_system(1)|kidney(2)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	18						AGGAATTCACAAATTTCTAAT	0.294																																						dbGAP											0													33.0	35.0	34.0					9																	86617271		2195	4292	6487	-	-	-	SO:0001583	missense	0			AK022950	CCDS6669.1	9q22.1	2013-06-10	2013-06-10	2006-06-12	ENSG00000178966	ENSG00000178966			25764	protein-coding gene	gene with protein product	"""BLM-Associated Polypeptide, 75 kDa"""	610404	"""chromosome 9 open reading frame 76"", ""RMI1, RecQ mediated genome instability 1, homolog (S. cerevisiae)"""	C9orf76		15775963, 20826341	Standard	NM_024945		Approved	FLJ12888, BLAP75	uc004anq.4	Q9H9A7	OTTHUMG00000020113	ENST00000325875.3:c.1370A>G	9.37:g.86617271A>G	ENSP00000317039:p.Gln457Arg		Q05BX1|Q05CW3|Q5SQG8|Q5SQG9|Q6P1Q4|Q6PI89|Q7Z6L6	Missense_Mutation	SNP	pfam_DUF1767	p.Q457R	ENST00000325875.3	37	c.1370	CCDS6669.1	9	.	.	.	.	.	.	.	.	.	.	A	0.033	-1.322054	0.01320	.	.	ENSG00000178966	ENST00000325875	T	0.32753	1.44	5.2	5.2	0.72013	.	1.330210	0.04953	N	0.460605	T	0.28167	0.0695	L	0.27053	0.805	0.20821	N	0.999847	B	0.27498	0.18	B	0.27715	0.082	T	0.24584	-1.0156	9	.	.	.	-4.1331	13.9363	0.64027	1.0:0.0:0.0:0.0	.	457	Q9H9A7	RMI1_HUMAN	R	457	ENSP00000317039:Q457R	.	Q	+	2	0	RMI1	85807091	0.473000	0.25878	0.205000	0.23548	0.084000	0.17831	4.413000	0.59795	2.079000	0.62486	0.533000	0.62120	CAA	RMI1	-	NULL	ENSG00000178966		0.294	RMI1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RMI1	HGNC	protein_coding	OTTHUMT00000052870.1	72	0.00	0	A	NM_024945		86617271	86617271	+1	no_errors	ENST00000325875	ensembl	human	known	69_37n	missense	39	20.41	10	SNP	0.479	G
RUNX1	861	genome.wustl.edu	37	21	36206716	36206716	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B6-A0IH-01A-11D-A10Y-09	TCGA-B6-A0IH-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a4488b9-74d9-4eb1-a7ef-c894c32db942	348ca096-ee86-4a96-9a09-a90b24e84060	g.chr21:36206716G>A	ENST00000344691.4	-	4	2292	c.715C>T	c.(715-717)Cag>Tag	p.Q239*	RUNX1_ENST00000300305.3_Nonsense_Mutation_p.Q266*|RUNX1_ENST00000325074.5_Nonsense_Mutation_p.Q254*|RUNX1_ENST00000399240.1_Intron|RUNX1_ENST00000358356.5_Nonsense_Mutation_p.Q239*|RUNX1_ENST00000437180.1_Nonsense_Mutation_p.Q266*	NM_001001890.2	NP_001001890.1	Q01196	RUNX1_HUMAN	runt-related transcription factor 1	239	Pro/Ser/Thr-rich.				behavioral response to pain (GO:0048266)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system development (GO:0007417)|definitive hemopoiesis (GO:0060216)|embryonic hemopoiesis (GO:0035162)|hair follicle morphogenesis (GO:0031069)|hematopoietic stem cell proliferation (GO:0071425)|hemopoiesis (GO:0030097)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|myeloid cell differentiation (GO:0030099)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of granulocyte differentiation (GO:0030853)|peripheral nervous system neuron development (GO:0048935)|positive regulation of angiogenesis (GO:0045766)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of progesterone secretion (GO:2000872)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hair follicle cell proliferation (GO:0071336)|regulation of signal transduction (GO:0009966)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.Q266*(1)		breast(5)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(428)|large_intestine(3)|lung(6)|oesophagus(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	452						CCCTGCATCTGACTCTGAGGC	0.642			T	"""RPL22, MDS1, EVI1, CBFA2T3, CBFA2T1, ETV6, LAF4"""	"""AML, preB- ALL, T-ALL"""																																	dbGAP		Dom	yes		21	21q22.3	861	runt-related transcription factor 1  (AML1)		L	1	Substitution - Nonsense(1)	haematopoietic_and_lymphoid_tissue(1)											103.0	99.0	100.0					21																	36206716		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			X79549	CCDS13639.1, CCDS42922.1, CCDS46646.1	21q22.3	2014-09-17	2008-07-29		ENSG00000159216	ENSG00000159216			10471	protein-coding gene	gene with protein product	"""aml1 oncogene"""	151385	"""acute myeloid leukemia 1"""	AML1, CBFA2		1427868, 7835892	Standard	NM_001001890		Approved	PEBP2A2, AMLCR1	uc010gmv.3	Q01196	OTTHUMG00000086299	ENST00000344691.4:c.715C>T	21.37:g.36206716G>A	ENSP00000340690:p.Gln239*		A8MV94|B2RMS4|D3DSG1|O60472|O60473|O76047|O76089|Q13081|Q13755|Q13756|Q13757|Q13758|Q13759|Q15341|Q15343|Q16122|Q16284|Q16285|Q16286|Q16346|Q16347|Q92479	Nonsense_Mutation	SNP	pfam_AML1/Runt_N,pfam_RunxI,superfamily_p53-like_TF_DNA-bd,pirsf_TF_Runt-rel_RUNX,pfscan_AML1/Runt_N,prints_AML1_Runt	p.Q266*	ENST00000344691.4	37	c.796	CCDS42922.1	21	.	.	.	.	.	.	.	.	.	.	G	21.9	4.221164	0.79464	.	.	ENSG00000159216	ENST00000344691;ENST00000300305;ENST00000437180;ENST00000325074;ENST00000399245;ENST00000358356;ENST00000399237	.	.	.	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-19.292	18.4907	0.90846	0.0:0.0:1.0:0.0	.	.	.	.	X	239;266;266;254;242;239;254	.	ENSP00000300305:Q266X	Q	-	1	0	RUNX1	35128586	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.964000	0.76061	2.367000	0.80283	0.603000	0.83216	CAG	RUNX1	-	pirsf_TF_Runt-rel_RUNX	ENSG00000159216		0.642	RUNX1-001	KNOWN	basic|CCDS	protein_coding	RUNX1	HGNC	protein_coding	OTTHUMT00000194230.1	158	0.00	0	G			36206716	36206716	-1	no_errors	ENST00000300305	ensembl	human	known	69_37n	nonsense	263	24.21	84	SNP	1.000	A
SDK2	54549	genome.wustl.edu	37	17	71364597	71364597	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0IH-01A-11D-A10Y-09	TCGA-B6-A0IH-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a4488b9-74d9-4eb1-a7ef-c894c32db942	348ca096-ee86-4a96-9a09-a90b24e84060	g.chr17:71364597C>T	ENST00000392650.3	-	37	5116	c.5116G>A	c.(5116-5118)Gct>Act	p.A1706T	SDK2_ENST00000388726.3_Missense_Mutation_p.A1687T|SDK2_ENST00000410094.1_5'UTR	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	1706	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						CCATCCCCAGCGGCGTTGAAG	0.657																																						dbGAP											0													41.0	32.0	35.0					17																	71364597		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.5116G>A	17.37:g.71364597C>T	ENSP00000376421:p.Ala1706Thr		A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.A1706T	ENST00000392650.3	37	c.5116	CCDS45769.1	17	.	.	.	.	.	.	.	.	.	.	C	34	5.311538	0.95655	.	.	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000424778;ENST00000316893;ENST00000410094	T;T;T	0.58358	0.34;0.34;0.34	5.21	5.21	0.72293	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.80592	0.4652	M	0.93283	3.4	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.85761	0.1349	10	0.66056	D	0.02	.	18.7664	0.91874	0.0:1.0:0.0:0.0	.	1706;1706;1687	Q58EX2-2;Q58EX2;Q58EX2-3	.;SDK2_HUMAN;.	T	1330;1706;1687;863;1706;47	ENSP00000376421:A1706T;ENSP00000373378:A1687T;ENSP00000407098:A863T	ENSP00000324967:A1706T	A	-	1	0	SDK2	68876192	1.000000	0.71417	0.350000	0.25708	0.970000	0.65996	7.691000	0.84191	2.432000	0.82394	0.563000	0.77884	GCT	SDK2	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000069188		0.657	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK2	HGNC	protein_coding	OTTHUMT00000327598.2	33	0.00	0	C	NM_019064		71364597	71364597	-1	no_errors	ENST00000392650	ensembl	human	known	69_37n	missense	61	12.86	9	SNP	1.000	T
SLC22A14	9389	genome.wustl.edu	37	3	38347837	38347837	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0IH-01A-11D-A10Y-09	TCGA-B6-A0IH-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a4488b9-74d9-4eb1-a7ef-c894c32db942	348ca096-ee86-4a96-9a09-a90b24e84060	g.chr3:38347837G>A	ENST00000273173.4	+	1	411	c.320G>A	c.(319-321)gGc>gAc	p.G107D	RNU6-235P_ENST00000362644.1_RNA|SLC22A14_ENST00000448498.1_Missense_Mutation_p.G107D	NM_004803.3	NP_004794.2	Q9Y267	S22AE_HUMAN	solute carrier family 22, member 14	107					organic cation transport (GO:0015695)	integral component of plasma membrane (GO:0005887)	organic cation transmembrane transporter activity (GO:0015101)			central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(5)|prostate(2)|skin(1)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0554)|Kidney(284;0.0696)		CTGGCAGTGGGCCCCCACCTG	0.527																																						dbGAP											0													104.0	96.0	99.0					3																	38347837		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011082	CCDS2677.1	3p21.3	2013-05-22	2008-01-11	2003-10-15	ENSG00000144671	ENSG00000144671		"""Solute carriers"""	8495	protein-coding gene	gene with protein product		604048	"""organic cationic transporter-like 4"", ""solute carrier family 22 (organic cation transporter), member 14"""	ORCTL4		10072596	Standard	NM_004803		Approved	OCTL2	uc003cib.2	Q9Y267	OTTHUMG00000131082	ENST00000273173.4:c.320G>A	3.37:g.38347837G>A	ENSP00000273173:p.Gly107Asp		A0AVS9|A1L4H6|B2RCX3|Q6DJT3	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.G107D	ENST00000273173.4	37	c.320	CCDS2677.1	3	.	.	.	.	.	.	.	.	.	.	G	0.875	-0.730768	0.03135	.	.	ENSG00000144671	ENST00000448498;ENST00000423219;ENST00000273173	T;T	0.36699	1.24;1.24	5.62	-2.3	0.06785	.	1.898060	0.04429	N	0.368827	T	0.24353	0.0590	N	0.16743	0.435	0.09310	N	0.999993	B	0.14012	0.009	B	0.17722	0.019	T	0.27226	-1.0080	10	0.22109	T	0.4	.	12.4608	0.55731	0.5613:0.0:0.4387:0.0	.	107	Q9Y267	S22AE_HUMAN	D	107	ENSP00000396283:G107D;ENSP00000273173:G107D	ENSP00000273173:G107D	G	+	2	0	SLC22A14	38322841	0.000000	0.05858	0.004000	0.12327	0.105000	0.19272	-0.428000	0.06991	-0.383000	0.07858	-0.150000	0.13652	GGC	SLC22A14	-	NULL	ENSG00000144671		0.527	SLC22A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A14	HGNC	protein_coding	OTTHUMT00000253742.3	100	0.00	0	G	NM_004803		38347837	38347837	+1	no_errors	ENST00000273173	ensembl	human	known	69_37n	missense	112	15.56	21	SNP	0.001	A
TANC2	26115	genome.wustl.edu	37	17	61498693	61498693	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0IH-01A-11D-A10Y-09	TCGA-B6-A0IH-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a4488b9-74d9-4eb1-a7ef-c894c32db942	348ca096-ee86-4a96-9a09-a90b24e84060	g.chr17:61498693C>T	ENST00000424789.2	+	25	5354	c.5350C>T	c.(5350-5352)Cca>Tca	p.P1784S	TANC2_ENST00000389520.4_Missense_Mutation_p.P1794S|RP11-269G24.3_ENST00000583552.1_RNA	NM_025185.3	NP_079461.2	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2	1784					in utero embryonic development (GO:0001701)					breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|upper_aerodigestive_tract(3)	44						TCGCTTCTCTCCATCTAGCAA	0.507																																						dbGAP											0													93.0	92.0	93.0					17																	61498693		2047	4184	6231	-	-	-	SO:0001583	missense	0			AB032974	CCDS45754.1	17q23.3	2013-01-11				ENSG00000170921		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30212	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	615047					Standard	NM_025185		Approved	DKFZP564D166, FLJ10215, FLJ11824, KIAA1148, KIAA1636, rols, ROLSA	uc002jal.4	Q9HCD6		ENST00000424789.2:c.5350C>T	17.37:g.61498693C>T	ENSP00000387593:p.Pro1784Ser		Q9HAC3|Q9NW88|Q9NXY9|Q9ULS2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_TPR_repeat,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_Ankyrin_rpt	p.P1784S	ENST00000424789.2	37	c.5350	CCDS45754.1	17	.	.	.	.	.	.	.	.	.	.	C	12.89	2.073722	0.36566	.	.	ENSG00000170921	ENST00000389520;ENST00000424789	T;T	0.65549	-0.16;-0.16	5.06	5.06	0.68205	.	0.064498	0.64402	D	0.000008	T	0.47820	0.1466	N	0.12182	0.205	0.58432	D	0.999999	P	0.51791	0.948	P	0.46237	0.508	T	0.39583	-0.9607	10	0.11182	T	0.66	.	17.1425	0.86757	0.0:1.0:0.0:0.0	.	1784	Q9HCD6	TANC2_HUMAN	S	1794;1784	ENSP00000374171:P1794S;ENSP00000387593:P1784S	ENSP00000374171:P1794S	P	+	1	0	TANC2	58852425	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.892000	0.69790	2.797000	0.96272	0.561000	0.74099	CCA	TANC2	-	NULL	ENSG00000170921		0.507	TANC2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TANC2	HGNC	protein_coding	OTTHUMT00000444765.1	162	0.00	0	C			61498693	61498693	+1	no_errors	ENST00000424789	ensembl	human	known	69_37n	missense	119	20.13	30	SNP	1.000	T
XPO6	23214	genome.wustl.edu	37	16	28157469	28157469	+	Missense_Mutation	SNP	T	T	C			TCGA-B6-A0IH-01A-11D-A10Y-09	TCGA-B6-A0IH-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a4488b9-74d9-4eb1-a7ef-c894c32db942	348ca096-ee86-4a96-9a09-a90b24e84060	g.chr16:28157469T>C	ENST00000304658.5	-	9	1780	c.1280A>G	c.(1279-1281)tAt>tGt	p.Y427C	XPO6_ENST00000565698.1_Missense_Mutation_p.Y413C	NM_015171.3	NP_055986.1	Q96QU8	XPO6_HUMAN	exportin 6	427					protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25						ACTTGTCAGATAGTCCAAAAA	0.363																																						dbGAP											0													185.0	171.0	175.0					16																	28157469		1841	4078	5919	-	-	-	SO:0001583	missense	0			AY026388	CCDS42135.1, CCDS59266.1	16p11.2	2011-04-13	2003-03-11	2003-03-14		ENSG00000169180		"""Exportins"""	19733	protein-coding gene	gene with protein product		608411	"""RAN binding protein 20"""	RANBP20		14592989	Standard	NM_001270940		Approved	KIAA0370, FLJ22519	uc002dpa.2	Q96QU8		ENST00000304658.5:c.1280A>G	16.37:g.28157469T>C	ENSP00000302790:p.Tyr427Cys		A1L3W4|D3DWF9|Q2YDX3|Q53G88|Q68G50|Q76N88|Q96CP8|Q9BT21	Missense_Mutation	SNP	pfam_Exportin-1/Importin-b-like,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.Y427C	ENST00000304658.5	37	c.1280	CCDS42135.1	16	.	.	.	.	.	.	.	.	.	.	T	21.7	4.189447	0.78789	.	.	ENSG00000169180	ENST00000304658	T	0.50813	0.73	5.07	5.07	0.68467	Armadillo-like helical (1);Armadillo-type fold (1);	0.125076	0.56097	D	0.000032	T	0.58991	0.2161	L	0.61218	1.895	0.47737	D	0.999501	D;D	0.69078	0.995;0.997	P;P	0.58077	0.832;0.781	T	0.58624	-0.7604	10	0.36615	T	0.2	-5.5122	12.9249	0.58254	0.0:0.0:0.0:1.0	.	427;427	B7ZM10;Q96QU8	.;XPO6_HUMAN	C	427	ENSP00000302790:Y427C	ENSP00000302790:Y427C	Y	-	2	0	XPO6	28064970	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.847000	0.69451	1.925000	0.55765	0.524000	0.50904	TAT	XPO6	-	superfamily_ARM-type_fold	ENSG00000169180		0.363	XPO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO6	HGNC	protein_coding	OTTHUMT00000433732.1	336	0.00	0	T	XM_055195		28157469	28157469	-1	no_errors	ENST00000304658	ensembl	human	known	69_37n	missense	280	13.00	42	SNP	1.000	C
ZDHHC21	340481	genome.wustl.edu	37	9	14658806	14658806	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0IH-01A-11D-A10Y-09	TCGA-B6-A0IH-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a4488b9-74d9-4eb1-a7ef-c894c32db942	348ca096-ee86-4a96-9a09-a90b24e84060	g.chr9:14658806C>T	ENST00000380916.4	-	7	911	c.445G>A	c.(445-447)Gca>Aca	p.A149T		NM_178566.4	NP_848661.1	Q8IVQ6	ZDH21_HUMAN	zinc finger, DHHC-type containing 21	149					hair follicle development (GO:0001942)|nitric oxide metabolic process (GO:0046209)|peptidyl-L-cysteine S-palmitoylation (GO:0018230)|protein palmitoylation (GO:0018345)|regulation of nitric-oxide synthase activity (GO:0050999)|sebaceous gland development (GO:0048733)|small molecule metabolic process (GO:0044281)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(4)|lung(2)|skin(1)	9				GBM - Glioblastoma multiforme(50;4.31e-06)		AACATCAGTGCGTAGCAAGTA	0.363																																						dbGAP											0													85.0	93.0	90.0					9																	14658806		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF161360	CCDS6475.1	9p22.3	2010-02-09			ENSG00000175893	ENSG00000175893		"""Zinc fingers, DHHC-type"""	20750	protein-coding gene	gene with protein product		614605				19956733	Standard	NM_178566		Approved	HSPC097, DNZ1	uc003zlg.2	Q8IVQ6	OTTHUMG00000019573	ENST00000380916.4:c.445G>A	9.37:g.14658806C>T	ENSP00000370303:p.Ala149Thr		A8KA95|D3DRI7|Q5VWG1	Missense_Mutation	SNP	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	p.A149T	ENST00000380916.4	37	c.445	CCDS6475.1	9	.	.	.	.	.	.	.	.	.	.	C	15.12	2.738076	0.49045	.	.	ENSG00000175893	ENST00000380916	T	0.25250	1.81	5.97	5.03	0.67393	.	0.102449	0.64402	D	0.000003	T	0.09512	0.0234	N	0.02736	-0.51	0.30705	N	0.749848	B	0.02656	0.0	B	0.04013	0.001	T	0.11084	-1.0602	10	0.23302	T	0.38	-4.595	6.7114	0.23280	0.1539:0.707:0.0:0.1391	.	149	Q8IVQ6	ZDH21_HUMAN	T	149	ENSP00000370303:A149T	ENSP00000370303:A149T	A	-	1	0	ZDHHC21	14648806	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.228000	0.51270	2.836000	0.97738	0.655000	0.94253	GCA	ZDHHC21	-	NULL	ENSG00000175893		0.363	ZDHHC21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC21	HGNC	protein_coding	OTTHUMT00000051748.2	128	0.00	0	C	NM_178566		14658806	14658806	-1	no_errors	ENST00000380916	ensembl	human	known	69_37n	missense	80	38.46	50	SNP	1.000	T
