#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA12	26154	genome.wustl.edu	37	2	215843072	215843072	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr2:215843072G>T	ENST00000272895.7	-	33	5315	c.5096C>A	c.(5095-5097)tCt>tAt	p.S1699Y	ABCA12_ENST00000389661.4_Missense_Mutation_p.S1381Y	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	1699					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)	p.S1699Y(1)		NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		GCTGCTCACAGATAAATCGTC	0.358																																					Ovarian(66;664 1488 5121 34295)	dbGAP											1	Substitution - Missense(1)	breast(1)											149.0	139.0	143.0					2																	215843072		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.5096C>A	2.37:g.215843072G>T	ENSP00000272895:p.Ser1699Tyr		Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.S1699Y	ENST00000272895.7	37	c.5096	CCDS33372.1	2	.	.	.	.	.	.	.	.	.	.	G	23.8	4.464593	0.84425	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.93189	-3.18;-3.18	5.31	5.31	0.75309	.	0.836959	0.10703	N	0.643786	D	0.95522	0.8545	L	0.54323	1.7	0.80722	D	1	D;D	0.64830	0.994;0.964	P;P	0.58721	0.825;0.844	D	0.93902	0.7189	10	0.52906	T	0.07	.	19.3411	0.94342	0.0:0.0:1.0:0.0	.	1699;1381	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	Y	1699;1381	ENSP00000272895:S1699Y;ENSP00000374312:S1381Y	ENSP00000272895:S1699Y	S	-	2	0	ABCA12	215551317	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	6.696000	0.74598	2.631000	0.89168	0.655000	0.94253	TCT	ABCA12	-	NULL	ENSG00000144452		0.358	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA12	HGNC	protein_coding	OTTHUMT00000337111.1	269	0.00	0	G	NM_173076		215843072	215843072	-1	no_errors	ENST00000272895	ensembl	human	known	69_37n	missense	232	24.18	74	SNP	0.995	T
ABCB1	5243	genome.wustl.edu	37	7	87178828	87178828	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr7:87178828C>G	ENST00000265724.3	-	15	1978	c.1561G>C	c.(1561-1563)Gac>Cac	p.D521H	ABCB1_ENST00000543898.1_Missense_Mutation_p.D457H	NM_000927.4	NP_000918.2	P08183	MDR1_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 1	521	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				drug transmembrane transport (GO:0006855)|G2/M transition of mitotic cell cycle (GO:0000086)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|stem cell proliferation (GO:0072089)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)	p.D521H(1)		NS(1)|breast(6)|central_nervous_system(2)|endometrium(14)|kidney(9)|large_intestine(14)|lung(48)|ovary(4)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	111	Esophageal squamous(14;0.00164)				Acebutolol(DB01193)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Adenosine triphosphate(DB00171)|ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Albendazole(DB00518)|Alfentanil(DB00802)|Alitretinoin(DB00523)|Amantadine(DB00915)|Aminohippurate(DB00345)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Amsacrine(DB00276)|Apixaban(DB06605)|Arsenic trioxide(DB01169)|Astemizole(DB00637)|Atazanavir(DB01072)|Atenolol(DB00335)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzocaine(DB01086)|Bepridil(DB01244)|Betamethasone(DB00443)|Biperiden(DB00810)|Boceprevir(DB08873)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Bromocriptine(DB01200)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Canagliflozin(DB08907)|Candesartan(DB00796)|Captopril(DB01197)|Carbamazepine(DB00564)|Carfilzomib(DB08889)|Carvedilol(DB01136)|Caspofungin(DB00520)|Chloroquine(DB00608)|Chlorpromazine(DB00477)|Chlorpropamide(DB00672)|Chlorprothixene(DB01239)|Cilazapril(DB01340)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisplatin(DB00515)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Clofazimine(DB00845)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabigatran etexilate(DB06695)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dipyridamole(DB00975)|Docetaxel(DB01248)|Domperidone(DB01184)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Dronedarone(DB04855)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Etravirine(DB06414)|Ezetimibe(DB00973)|Felodipine(DB01023)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fidaxomicin(DB08874)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluticasone furoate(DB08906)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gemcitabine(DB00441)|Glyburide(DB01016)|Gramicidin D(DB00027)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Imatinib(DB00619)|Imipramine(DB00458)|Indacaterol(DB05039)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketoconazole(DB01026)|Lamivudine(DB00709)|Lamotrigine(DB00555)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lenalidomide(DB00480)|Levetiracetam(DB01202)|Levofloxacin(DB01137)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Liothyronine(DB00279)|Liotrix(DB01583)|Lisinopril(DB00722)|Lomitapide(DB08827)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Mannitol(DB00742)|Maprotiline(DB00934)|Mebendazole(DB00643)|Mefloquine(DB00358)|Megestrol acetate(DB00351)|Meprobamate(DB00371)|Methadone(DB00333)|Methotrexate(DB00563)|Methylprednisolone(DB00959)|Metoprolol(DB00264)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mitomycin(DB00305)|Mitoxantrone(DB01204)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nadolol(DB01203)|Naloxone(DB01183)|Naltrexone(DB00704)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Neostigmine(DB01400)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nizatidine(DB00585)|Norethindrone(DB00717)|Olanzapine(DB00334)|Omeprazole(DB00338)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paroxetine(DB00715)|Pazopanib(DB06589)|Perindopril(DB00790)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Pitavastatin(DB08860)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pravastatin(DB00175)|Prazosin(DB00457)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Progesterone(DB00396)|Promethazine(DB01069)|Propafenone(DB01182)|Propranolol(DB00571)|Protriptyline(DB00344)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reboxetine(DB00234)|Regorafenib(DB08896)|Reserpine(DB00206)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Roxithromycin(DB00778)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Scopolamine(DB00747)|Selegiline(DB01037)|Sertraline(DB01104)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|SOFOSBUVIR(DB08934)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Streptozocin(DB00428)|Sulfinpyrazone(DB01138)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telaprevir(DB05521)|Telmisartan(DB00966)|Temsirolimus(DB06287)|Terazosin(DB01162)|Testosterone(DB00624)|Ticagrelor(DB08816)|Timolol(DB00373)|Tolvaptan(DB06212)|Topotecan(DB01030)|Toremifene(DB00539)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Vecuronium(DB01339)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voacamine(DB04877)|Zidovudine(DB00495)	ACCAGGGTGTCAAATTTCTAC	0.488																																						dbGAP											1	Substitution - Missense(1)	breast(1)											83.0	81.0	81.0					7																	87178828		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14758	CCDS5608.1	7q21.12	2012-03-14	2004-05-12		ENSG00000085563	ENSG00000085563		"""CD molecules"", ""ATP binding cassette transporters / subfamily B"""	40	protein-coding gene	gene with protein product	"""multidrug resistance protein 1"""	171050	"""colchicin sensitivity"""	PGY1, MDR1, CLCS		3027054	Standard	NM_000927		Approved	P-gp, CD243, GP170, ABC20	uc003uiz.2	P08183	OTTHUMG00000023393	ENST00000265724.3:c.1561G>C	7.37:g.87178828C>G	ENSP00000265724:p.Asp521His		A8K294|B5AK60|Q12755|Q14812	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,pfam_ABC_ATPase_put,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.D521H	ENST00000265724.3	37	c.1561	CCDS5608.1	7	.	.	.	.	.	.	.	.	.	.	C	20.2	3.949664	0.73787	.	.	ENSG00000085563	ENST00000543174;ENST00000265724;ENST00000543898	D;D	0.84944	-1.92;-1.92	5.94	5.94	0.96194	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.347323	0.32624	N	0.005850	D	0.89072	0.6611	L	0.42581	1.335	0.49483	D	0.999795	B;D	0.89917	0.359;1.0	B;D	0.79108	0.133;0.992	D	0.89328	0.3645	10	0.87932	D	0	-18.5631	13.5527	0.61740	0.0:0.9293:0.0:0.0707	.	457;521	B5AK60;P08183	.;MDR1_HUMAN	H	302;521;457	ENSP00000265724:D521H;ENSP00000444095:D457H	ENSP00000265724:D521H	D	-	1	0	ABCB1	87016764	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.373000	0.52394	2.820000	0.97059	0.650000	0.86243	GAC	ABCB1	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000085563		0.488	ABCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB1	HGNC	protein_coding	OTTHUMT00000335444.2	360	0.00	0	C	NM_000927		87178828	87178828	-1	no_errors	ENST00000265724	ensembl	human	known	69_37n	missense	145	29.81	62	SNP	1.000	G
AGRN	375790	genome.wustl.edu	37	1	987119	987120	+	Frame_Shift_Ins	INS	-	-	T			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr1:987119_987120insT	ENST00000379370.2	+	33	5625_5626	c.5575_5576insT	c.(5575-5577)aagfs	p.K1859fs		NM_198576.3	NP_940978.2	O00468	AGRIN_HUMAN	agrin	1863					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|clustering of voltage-gated sodium channels (GO:0045162)|extracellular matrix organization (GO:0030198)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuromuscular junction development (GO:0007528)|neurotransmitter receptor metabolic process (GO:0045213)|phototransduction, visible light (GO:0007603)|plasma membrane organization (GO:0007009)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of synaptic growth at neuromuscular junction (GO:0045887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor clustering (GO:0043113)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synapse organization (GO:0050808)	basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acetylcholine receptor regulator activity (GO:0030548)|calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|dystroglycan binding (GO:0002162)|heparan sulfate proteoglycan binding (GO:0043395)|laminin binding (GO:0043236)|sialic acid binding (GO:0033691)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	42	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		GCTGGTGGAGAAGTCAGCGGGG	0.658																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			XM_372195	CCDS30551.1	1p36.33	2014-09-17		2007-02-16	ENSG00000188157	ENSG00000188157		"""Proteoglycans / Extracellular Matrix : Other"""	329	protein-coding gene	gene with protein product	"""agrin proteoglycan"""	103320				1851019, 12270958	Standard	NM_198576		Approved	AGRIN	uc001ack.2	O00468	OTTHUMG00000040778	Exception_encountered	1.37:g.987119_987120insT	ENSP00000368678:p.Lys1859fs		Q5SVA1|Q5SVA2|Q60FE1|Q7KYS8|Q8N4J5|Q96IC1|Q9BTD4	Frame_Shift_Ins	INS	pfam_Laminin_G,pfam_Agrin_NtA,pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,pfam_EGF_laminin,pfam_SEA,pfam_EGF-like_dom,superfamily_TIMP-like_OB-fold,superfamily_ConA-like_lec_gl,smart_FacI_MAC,smart_Fol_N,smart_Prot_inh_Kazal,smart_EGF-like,smart_EGF_laminin,smart_SEA,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Agrin_NtA,pfscan_SEA	p.K1859fs	ENST00000379370.2	37	c.5575_5576	CCDS30551.1	1																																																																																			AGRN	-	superfamily_ConA-like_lec_gl	ENSG00000188157		0.658	AGRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGRN	HGNC	protein_coding	OTTHUMT00000097990.2	9	0.00	0	-	NM_198576		987119	987120	+1	no_errors	ENST00000379370	ensembl	human	known	69_37n	frame_shift_ins	7	30.00	3	INS	1.000:1.000	T
AKR1CL1	340811	genome.wustl.edu	37	10	5200861	5200861	+	IGR	SNP	C	C	A	rs2020172	byFrequency	TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr10:5200861C>A	ENST00000334314.3	-	0	492				AKR1CL1_ENST00000465430.1_Intron			Q5T2L2	AKCL1_HUMAN	aldo-keto reductase family 1, member C-like 1							cytoplasm (GO:0005737)	oxidoreductase activity (GO:0016491)			cervix(1)|endometrium(1)|large_intestine(2)|lung(2)	6						CTTGGACTTGCAGAACTCCAG	0.448													C|||	864	0.172524	0.1732	0.183	5008	,	,		17338	0.0		0.3579	False		,,,				2504	0.1513				Ovarian(129;1623 1737 25446 28757 47467)	dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0					10p15.2	2014-05-06			ENSG00000196326	ENSG00000264006			23469	protein-coding gene	gene with protein product						15164054	Standard	NR_027916		Approved		uc009xhz.2	Q5T2L2	OTTHUMG00000184213		10.37:g.5200861C>A			A6NF66|Q6ZN81	Missense_Mutation	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_Aldo/keto_reductase_subgr	p.C34F	ENST00000334314.3	37	c.101		10	440	0.20146520146520147	99	0.20121951219512196	81	0.22375690607734808	0	0.0	260	0.34300791556728233	C	19.60	3.858582	0.71834	.	.	ENSG00000196326	ENST00000473890	T	0.28454	1.61	3.73	3.73	0.42828	.	0.000000	0.64402	U	0.000012	T	0.00012	0.0000	.	.	.	0.09310	P	1.0	.	.	.	.	.	.	T	0.31752	-0.9932	6	0.87932	D	0	.	13.7685	0.63010	0.0:1.0:0.0:0.0	rs2020172;rs2020172	.	.	.	F	34	ENSP00000417959:C34F	ENSP00000417959:C34F	C	-	2	0	AKR1CL1	5190861	1.000000	0.71417	0.989000	0.46669	0.951000	0.60555	3.694000	0.54742	2.014000	0.59158	0.484000	0.47621	TGC	AKR1CL1	-	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_Aldo/keto_reductase_subgr	ENSG00000196326		0.448	AKR1CL1-201	KNOWN	basic|appris_candidate_longest	protein_coding	AKR1CL1	HGNC	protein_coding		9	0.00	0	C	NR_027916		5200861	5200861	-1	no_errors	ENST00000473890	ensembl	human	novel	69_37n	missense	14	41.67	10	SNP	1.000	A
ANKRD6	22881	genome.wustl.edu	37	6	90337405	90337405	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr6:90337405delA	ENST00000522441.1	+	14	2116	c.1475delA	c.(1474-1476)gagfs	p.E492fs	ANKRD6_ENST00000339746.4_Frame_Shift_Del_p.E492fs|ANKRD6_ENST00000520793.1_Frame_Shift_Del_p.E433fs|ANKRD6_ENST00000369408.5_Frame_Shift_Del_p.E457fs|LYRM2_ENST00000520441.1_Intron|ANKRD6_ENST00000447838.2_Frame_Shift_Del_p.E492fs	NM_001242811.1	NP_001229740.1	Q9Y2G4	ANKR6_HUMAN	ankyrin repeat domain 6	492					negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of JNK cascade (GO:0046330)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(3)|large_intestine(7)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|stomach(2)	21		all_cancers(76;1.22e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;1.83e-05)|Lung NSC(302;0.239)		BRCA - Breast invasive adenocarcinoma(108;0.0209)		CATGAGGGGGAGAAACGACAG	0.537																																						dbGAP											0													69.0	80.0	76.0					6																	90337405		2041	4194	6235	-	-	-	SO:0001589	frameshift_variant	0			AB023174	CCDS47460.1, CCDS56441.1, CCDS56442.1, CCDS56443.1	6q14.2-q16.1	2013-03-20			ENSG00000135299	ENSG00000135299		"""Ankyrin repeat domain containing"""	17280	protein-coding gene	gene with protein product		610583					Standard	NM_001242809		Approved	KIAA0957	uc003pni.4	Q9Y2G4	OTTHUMG00000015202	ENST00000522441.1:c.1475delA	6.37:g.90337405delA	ENSP00000430985:p.Glu492fs		B3KUC3|Q5JUJ4|Q5JUJ5|Q8IUQ8|Q9NU24|Q9UFQ9	Frame_Shift_Del	DEL	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.E492fs	ENST00000522441.1	37	c.1475	CCDS56441.1	6																																																																																			ANKRD6	-	NULL	ENSG00000135299		0.537	ANKRD6-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ANKRD6	HGNC	protein_coding	OTTHUMT00000376594.1	117	0.00	0	A			90337405	90337405	+1	no_errors	ENST00000339746	ensembl	human	known	69_37n	frame_shift_del	39	22.00	11	DEL	1.000	-
APOBEC4	403314	genome.wustl.edu	37	1	183616996	183616996	+	Silent	SNP	G	G	T			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr1:183616996G>T	ENST00000308641.4	-	2	1192	c.921C>A	c.(919-921)ggC>ggA	p.G307G	APOBEC4_ENST00000481562.1_Intron|RGL1_ENST00000304685.4_Intron|RGL1_ENST00000536277.1_Intron	NM_203454.2	NP_982279.1	Q8WW27	ABEC4_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 4 (putative)	307	Leu-rich.				mRNA processing (GO:0006397)		hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines (GO:0016814)|zinc ion binding (GO:0008270)	p.G307G(1)		NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(6)|skin(1)	21						TTGGGTTTTGGCCCATATGCA	0.493																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											140.0	129.0	133.0					1																	183616996		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC021711	CCDS1358.1	1q25.3	2008-02-05	2005-10-27	2005-10-27	ENSG00000173627	ENSG00000173627		"""Apolipoprotein B mRNA editing enzymes"""	32152	protein-coding gene	gene with protein product		609908	"""chromosome 1 open reading frame 169"""	C1orf169		16082223	Standard	NM_203454		Approved	MGC26594, FLJ25691, RP1-127C7.4	uc001gqn.3	Q8WW27	OTTHUMG00000035459	ENST00000308641.4:c.921C>A	1.37:g.183616996G>T			Q8N7F6	Silent	SNP	pfam_APOBEC_N	p.G307	ENST00000308641.4	37	c.921	CCDS1358.1	1																																																																																			APOBEC4	-	NULL	ENSG00000173627		0.493	APOBEC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOBEC4	HGNC	protein_coding	OTTHUMT00000086126.1	153	0.00	0	G	NM_203454		183616996	183616996	-1	no_errors	ENST00000308641	ensembl	human	known	69_37n	silent	75	57.63	102	SNP	0.007	T
ASAP1	50807	genome.wustl.edu	37	8	131172126	131172126	+	Silent	SNP	G	G	A			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr8:131172126G>A	ENST00000518721.1	-	12	1221	c.994C>T	c.(994-996)Cta>Tta	p.L332L	ASAP1_ENST00000357668.1_Silent_p.L332L	NM_001247996.1|NM_018482.3	NP_001234925.1|NP_060952.2	Q9ULH1	ASAP1_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1	332	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cilium morphogenesis (GO:0060271)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)	p.L332L(1)		breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(22)|ovary(6)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	68						CTTTTCTTTAGCAGGTACCCC	0.448																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											198.0	182.0	187.0					8																	131172126		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB033075	CCDS6362.1, CCDS75788.1	8q24.1-q24.2	2013-01-11	2008-09-22	2008-09-22	ENSG00000153317	ENSG00000153317		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2720	protein-coding gene	gene with protein product	"""centaurin, beta 4"""	605953	"""development and differentiation enhancing factor 1"""	DDEF1		9819391	Standard	NM_018482		Approved	PAP, KIAA1249, ZG14P, CENTB4	uc003yta.2	Q9ULH1	OTTHUMG00000164772	ENST00000518721.1:c.994C>T	8.37:g.131172126G>A			B2RNV3	Missense_Mutation	SNP	pfam_ArfGAP,pfam_SH3_domain,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_ArfGAP,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,smart_SH3_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_ArfGAP,prints_ArfGAP,prints_p67phox	p.A152V	ENST00000518721.1	37	c.455	CCDS6362.1	8	.	.	.	.	.	.	.	.	.	.	G	4.979	0.181892	0.09495	.	.	ENSG00000153317	ENST00000524124	.	.	.	5.74	4.86	0.63082	.	.	.	.	.	T	0.63977	0.2557	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60026	-0.7343	4	.	.	.	.	12.1251	0.53913	0.0825:0.0:0.9175:0.0	.	.	.	.	V	152	.	.	A	-	2	0	ASAP1	131241308	1.000000	0.71417	0.985000	0.45067	0.494000	0.33585	2.325000	0.43840	2.873000	0.98535	0.563000	0.77884	GCT	ASAP1	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000153317		0.448	ASAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASAP1	HGNC	protein_coding	OTTHUMT00000380170.1	356	0.00	0	G	NM_018482		131172126	131172126	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000524124	ensembl	human	novel	69_37n	missense	407	12.66	59	SNP	0.999	A
ASZ1	136991	genome.wustl.edu	37	7	117066908	117066908	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr7:117066908G>T	ENST00000284629.2	-	2	249	c.187C>A	c.(187-189)Cag>Aag	p.Q63K		NM_130768.2	NP_570124.1			ankyrin repeat, SAM and basic leucine zipper domain containing 1									p.Q63K(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(3)|skin(1)	24	Lung NSC(10;0.00156)|all_lung(10;0.00175)		STAD - Stomach adenocarcinoma(10;0.000512)			AGGAGCTCCTGGACCAATGAA	0.348																																						dbGAP											1	Substitution - Missense(1)	breast(1)											150.0	158.0	155.0					7																	117066908		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF461259	CCDS5772.1	7q31.2	2013-01-10	2005-03-15	2004-07-16	ENSG00000154438	ENSG00000154438		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	1350	protein-coding gene	gene with protein product		605797	"""ankyrin-like 1"""	C7orf7, ANKL1		12040005, 11279520	Standard	NM_130768		Approved	Orf3, GASZ, ALP1, CT1.19	uc003vjb.2	Q8WWH4	OTTHUMG00000064565	ENST00000284629.2:c.187C>A	7.37:g.117066908G>T	ENSP00000284629:p.Gln63Lys			Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SAM_2,pfam_SAM_type1,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.Q63K	ENST00000284629.2	37	c.187	CCDS5772.1	7	.	.	.	.	.	.	.	.	.	.	G	6.782	0.513225	0.12944	.	.	ENSG00000154438	ENST00000284629;ENST00000428663	T;T	0.60672	0.17;0.17	5.45	-2.12	0.07165	Ankyrin repeat-containing domain (4);	0.619767	0.16276	N	0.221594	T	0.25494	0.0620	N	0.04820	-0.15	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.24119	-1.0169	10	0.08381	T	0.77	-26.0558	6.4744	0.22026	0.0:0.2931:0.4246:0.2824	.	63;63	B7ZM20;Q8WWH4	.;ASZ1_HUMAN	K	63;10	ENSP00000284629:Q63K;ENSP00000402919:Q10K	ENSP00000284629:Q63K	Q	-	1	0	ASZ1	116854144	0.000000	0.05858	0.002000	0.10522	0.954000	0.61252	-1.285000	0.02791	-0.865000	0.04073	0.655000	0.94253	CAG	ASZ1	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000154438		0.348	ASZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASZ1	HGNC	protein_coding	OTTHUMT00000138907.7	92	0.00	0	G	NM_130768		117066908	117066908	-1	no_errors	ENST00000284629	ensembl	human	known	69_37n	missense	90	10.89	11	SNP	0.009	T
ATP6V1C1	528	genome.wustl.edu	37	8	104063354	104063354	+	Silent	SNP	T	T	C			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr8:104063354T>C	ENST00000395862.3	+	5	522	c.363T>C	c.(361-363)atT>atC	p.I121I	ATP6V1C1_ENST00000521514.1_Silent_p.I46I|ATP6V1C1_ENST00000518857.1_Silent_p.I46I|ATP6V1C1_ENST00000518738.1_Silent_p.I121I	NM_001695.4	NP_001686.1	P21283	VATC1_HUMAN	ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1	121					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transporter activity (GO:0005215)	p.I121I(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|urinary_tract(1)	13	Lung NSC(17;0.000427)|all_lung(17;0.000533)		OV - Ovarian serous cystadenocarcinoma(57;3.57e-05)|STAD - Stomach adenocarcinoma(118;0.133)			TGAAAAATATTTCTGAAATAA	0.318																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											47.0	47.0	47.0					8																	104063354		2202	4297	6499	-	-	-	SO:0001819	synonymous_variant	0			X69151	CCDS6296.1	8p22.3	2011-05-24	2006-01-13	2002-05-10	ENSG00000155097	ENSG00000155097	3.6.3.14	"""ATPases / V-type"""	856	protein-coding gene	gene with protein product		603097	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) 42kD"", ""ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C, isoform 1"""	ATP6D, ATP6C		8250920, 14580332	Standard	NM_001695		Approved	VATC, Vma5	uc003ykz.4	P21283	OTTHUMG00000164761	ENST00000395862.3:c.363T>C	8.37:g.104063354T>C				Silent	SNP	pfam_ATPase_V1-cplx_csu	p.I121	ENST00000395862.3	37	c.363	CCDS6296.1	8																																																																																			ATP6V1C1	-	pfam_ATPase_V1-cplx_csu	ENSG00000155097		0.318	ATP6V1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V1C1	HGNC	protein_coding	OTTHUMT00000380101.1	130	0.00	0	T	NM_001695		104063354	104063354	+1	no_errors	ENST00000395862	ensembl	human	known	69_37n	silent	163	23.11	49	SNP	1.000	C
BANK1	55024	genome.wustl.edu	37	4	102992432	102992432	+	Splice_Site	SNP	A	A	G			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr4:102992432A>G	ENST00000322953.4	+	14	2487	c.2213A>G	c.(2212-2214)aAt>aGt	p.N738S	BANK1_ENST00000508653.1_Splice_Site_p.N605S|BANK1_ENST00000444316.2_Splice_Site_p.N708S|BANK1_ENST00000504592.1_Splice_Site_p.N723S|BANK1_ENST00000428908.1_Splice_Site_p.N605S	NM_017935.4	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	738					B cell activation (GO:0042113)			p.N738S(1)		NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|liver(2)|lung(16)|ovary(2)|skin(2)|urinary_tract(1)	44		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		TGTCTTCCAGATAAACTCACC	0.303																																						dbGAP											1	Substitution - Missense(1)	breast(1)											148.0	155.0	153.0					4																	102992432		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0			AB063170	CCDS34038.1, CCDS47115.1, CCDS47116.1	4q23	2013-01-11						"""Ankyrin repeat domain containing"""	18233	protein-coding gene	gene with protein product		610292				11782428, 21208380, 21480188	Standard	NM_017935		Approved	BANK, FLJ20706	uc003hvy.4	Q8NDB2		ENST00000322953.4:c.2213-1A>G	4.37:g.102992432A>G			A8K7W8|B0F3S2|Q8N5K8|Q8NB56|Q8WYN5|Q9NWP2	Missense_Mutation	SNP	superfamily_Ankyrin_rpt-contain_dom	p.N738S	ENST00000322953.4	37	c.2213	CCDS34038.1	4	.	.	.	.	.	.	.	.	.	.	A	12.13	1.844737	0.32606	.	.	ENSG00000153064	ENST00000504592;ENST00000322953;ENST00000428908;ENST00000508653;ENST00000444316	T;T;T;T;T	0.18016	2.92;2.92;2.24;2.24;2.93	4.51	3.33	0.38152	.	0.473087	0.20365	N	0.093777	T	0.07098	0.0180	N	0.08118	0	0.23720	N	0.99702	B;B;B	0.28258	0.205;0.205;0.205	B;B;B	0.24394	0.023;0.053;0.053	T	0.35076	-0.9803	9	.	.	.	.	6.4999	0.22164	0.8907:0.0:0.1093:0.0	.	605;738;723	Q8NDB2-4;Q8NDB2;Q8NDB2-2	.;BANK1_HUMAN;.	S	723;738;605;605;708	ENSP00000421443:N723S;ENSP00000320509:N738S;ENSP00000412748:N605S;ENSP00000422314:N605S;ENSP00000388817:N708S	.	N	+	2	0	BANK1	103211455	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	3.708000	0.54845	0.892000	0.36259	0.477000	0.44152	AAT	BANK1	-	NULL	ENSG00000153064		0.303	BANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BANK1	HGNC	protein_coding	OTTHUMT00000363161.1	228	0.43	1	A	NM_017935	Missense_Mutation	102992432	102992432	+1	no_errors	ENST00000322953	ensembl	human	known	69_37n	missense	200	27.80	77	SNP	1.000	G
BIRC6	57448	genome.wustl.edu	37	2	32640645	32640645	+	Silent	SNP	A	A	G			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr2:32640645A>G	ENST00000421745.2	+	10	2420	c.2286A>G	c.(2284-2286)caA>caG	p.Q762Q		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	762					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)	p.Q734Q(1)|p.Q762Q(1)		NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					CAATAAATCAAGTAGAGGCCT	0.378																																					Pancreas(94;175 1509 16028 18060 45422)	dbGAP											2	Substitution - coding silent(2)	breast(2)											47.0	48.0	48.0					2																	32640645		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.2286A>G	2.37:g.32640645A>G			Q9ULD1	Silent	SNP	pfam_DUF3643,pfam_UBQ-conjugat_E2,pfam_BIR,pfam_UEV_N,superfamily_UBQ-conjugating_enzyme/RWD,superfamily_Galactose-bd-like,superfamily_WD40_repeat_dom,smart_BIR,pfscan_BIR,pfscan_UBQ-conjugat_E2	p.Q762	ENST00000421745.2	37	c.2286	CCDS33175.2	2																																																																																			BIRC6	-	NULL	ENSG00000115760		0.378	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIRC6	HGNC	protein_coding	OTTHUMT00000318769.3	73	0.00	0	A	NM_016252		32640645	32640645	+1	no_errors	ENST00000421745	ensembl	human	known	69_37n	silent	49	15.52	9	SNP	1.000	G
BZW1	9689	genome.wustl.edu	37	2	201682958	201682958	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr2:201682958G>A	ENST00000409600.1	+	8	1116	c.661G>A	c.(661-663)Gcc>Acc	p.A221T	BZW1_ENST00000452790.2_Missense_Mutation_p.A253T|BZW1_ENST00000409226.1_Missense_Mutation_p.A225T	NM_001207067.1|NM_014670.3	NP_001193996.1|NP_055485.2	Q7L1Q6	BZW1_HUMAN	basic leucine zipper and W2 domains 1	221					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.A221T(1)|p.A253T(1)		breast(1)|kidney(2)|large_intestine(1)|lung(2)	6						ACTCTTTCCTGCCAATAAGCA	0.338																																						dbGAP											2	Substitution - Missense(2)	breast(2)											20.0	19.0	19.0					2																	201682958		1787	4053	5840	-	-	-	SO:0001583	missense	0			D13630	CCDS56154.1, CCDS56155.1, CCDS56156.1	2q33	2010-04-09			ENSG00000082153	ENSG00000082153			18380	protein-coding gene	gene with protein product						10964520, 11524015	Standard	NM_001207067		Approved	BZAP45, KIAA0005	uc021vus.1	Q7L1Q6	OTTHUMG00000154560	ENST00000409600.1:c.661G>A	2.37:g.201682958G>A	ENSP00000386474:p.Ala221Thr		B4DLZ8|B4DWF7|Q14281|Q15394|Q9BUY0	Missense_Mutation	SNP	pfam_W2_domain,superfamily_ARM-type_fold,smart_W2_domain	p.A221T	ENST00000409600.1	37	c.661	CCDS56156.1	2	.	.	.	.	.	.	.	.	.	.	G	18.49	3.634347	0.67130	.	.	ENSG00000082153	ENST00000410110;ENST00000409600;ENST00000431249;ENST00000409226;ENST00000452790	T;T;T;T	0.77750	0.89;-1.1;-1.1;-1.12	5.72	5.72	0.89469	.	0.112768	0.64402	D	0.000010	T	0.78188	0.4244	M	0.73962	2.25	0.80722	D	1	P;P;P	0.45594	0.745;0.704;0.862	B;B;B	0.39185	0.231;0.277;0.293	T	0.76868	-0.2800	10	0.25751	T	0.34	-3.4335	20.244	0.98389	0.0:0.0:1.0:0.0	.	225;253;221	B4DWF7;B4DLZ8;Q7L1Q6	.;.;BZW1_HUMAN	T	221;221;137;225;253	ENSP00000387086:A221T;ENSP00000386474:A221T;ENSP00000386837:A225T;ENSP00000394316:A253T	ENSP00000386837:A225T	A	+	1	0	BZW1	201391203	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.772000	0.85439	2.865000	0.98341	0.655000	0.94253	GCC	BZW1	-	NULL	ENSG00000082153		0.338	BZW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BZW1	HGNC	protein_coding	OTTHUMT00000335975.1	91	0.00	0	G	NM_014670		201682958	201682958	+1	no_errors	ENST00000409600	ensembl	human	known	69_37n	missense	58	36.26	33	SNP	1.000	A
C14orf105	55195	genome.wustl.edu	37	14	57947351	57947351	+	Missense_Mutation	SNP	A	A	G			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr14:57947351A>G	ENST00000216445.3	-	5	753	c.617T>C	c.(616-618)cTa>cCa	p.L206P	C14orf105_ENST00000422976.2_Missense_Mutation_p.L205P|C14orf105_ENST00000534126.1_Missense_Mutation_p.L205P	NM_001283057.1|NM_018168.2	NP_001269986.1|NP_060638.2	Q9NVL8	CN105_HUMAN	chromosome 14 open reading frame 105	206								p.L206P(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)	11						CAACATGGTTAGAAGGTCATG	0.378																																						dbGAP											1	Substitution - Missense(1)	breast(1)											253.0	237.0	243.0					14																	57947351		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001512	CCDS9730.1, CCDS61458.1, CCDS61459.1	14q22.2	2012-09-25			ENSG00000100557	ENSG00000100557			20189	protein-coding gene	gene with protein product							Standard	XM_005267806		Approved	FLJ10650	uc001xcy.2	Q9NVL8	OTTHUMG00000140317	ENST00000216445.3:c.617T>C	14.37:g.57947351A>G	ENSP00000216445:p.Leu206Pro		Q53G04	Missense_Mutation	SNP	NULL	p.L206P	ENST00000216445.3	37	c.617	CCDS9730.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.20|14.20	2.463240|2.463240	0.43736|0.43736	.|.	.|.	ENSG00000100557|ENSG00000100557	ENST00000216445;ENST00000422976;ENST00000534126|ENST00000524996	T;T;T|.	0.50277|.	0.75;0.75;0.75|.	5.74|5.74	3.39|3.39	0.38822|0.38822	.|.	0.955489|.	0.08669|.	N|.	0.911273|.	T|.	0.33933|.	0.0880|.	L|L	0.36672|0.36672	1.1|1.1	0.09310|0.09310	N|N	1|1	B;B;B;B;B|.	0.20261|.	0.008;0.023;0.043;0.043;0.043|.	B;B;B;B;B|.	0.21546|.	0.015;0.023;0.035;0.035;0.024|.	T|.	0.19745|.	-1.0296|.	10|.	0.46703|.	T|.	0.11|.	-1.6359|-1.6359	6.3238|6.3238	0.21232|0.21232	0.8003:0.0:0.1997:0.0|0.8003:0.0:0.1997:0.0	.|.	205;205;205;205;206|.	B7ZL43;F5GWJ3;Q17R99;E9PSE9;Q9NVL8|.	.;.;.;.;CN105_HUMAN|.	P|Q	206;205;205|52	ENSP00000216445:L206P;ENSP00000392368:L205P;ENSP00000434003:L205P|.	ENSP00000216445:L206P|.	L|X	-|-	2|1	0|0	C14orf105|C14orf105	57017104|57017104	0.006000|0.006000	0.16342|0.16342	0.021000|0.021000	0.16686|0.16686	0.944000|0.944000	0.59088|0.59088	1.696000|1.696000	0.37773|0.37773	1.000000|1.000000	0.39049|0.39049	0.529000|0.529000	0.55759|0.55759	CTA|TAA	C14orf105	-	NULL	ENSG00000100557		0.378	C14orf105-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C14orf105	HGNC	protein_coding	OTTHUMT00000276921.2	350	0.00	0	A	NM_018168		57947351	57947351	-1	no_errors	ENST00000216445	ensembl	human	known	69_37n	missense	244	17.85	53	SNP	0.002	G
C1orf186	440712	genome.wustl.edu	37	1	206243207	206243207	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr1:206243207G>C	ENST00000331555.5	-	3	693	c.55C>G	c.(55-57)Ctc>Gtc	p.L19V		NM_001007544.1	NP_001007545.1	Q6ZWK4	CA186_HUMAN	chromosome 1 open reading frame 186	19						integral component of membrane (GO:0016021)		p.L19V(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	9			BRCA - Breast invasive adenocarcinoma(75;0.0754)			TGCAGGAAGAGGGACACCACC	0.532																																						dbGAP											1	Substitution - Missense(1)	breast(1)											128.0	112.0	117.0					1																	206243207		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK122631	CCDS73014.1	1q32.1	2014-05-06			ENSG00000196533	ENSG00000263961			25341	protein-coding gene	gene with protein product							Standard	XM_005272738		Approved	FLJ16052	uc001hdt.2	Q6ZWK4	OTTHUMG00000184376	ENST00000331555.5:c.55C>G	1.37:g.206243207G>C	ENSP00000356093:p.Leu19Val			Missense_Mutation	SNP	NULL	p.L19V	ENST00000331555.5	37	c.55	CCDS30995.1	1	.	.	.	.	.	.	.	.	.	.	G	9.937	1.216538	0.22373	.	.	ENSG00000196533	ENST00000331555	.	.	.	3.06	-1.12	0.09808	.	0.743246	0.11085	N	0.601405	T	0.21307	0.0513	L	0.32530	0.975	0.09310	N	1	B	0.25563	0.129	B	0.24848	0.056	T	0.29212	-1.0019	9	0.62326	D	0.03	-31.2944	0.5558	0.00670	0.2469:0.1923:0.3645:0.1963	.	19	Q6ZWK4	CA186_HUMAN	V	19	.	ENSP00000356093:L19V	L	-	1	0	C1orf186	204409830	0.002000	0.14202	0.001000	0.08648	0.152000	0.21847	0.031000	0.13710	-0.228000	0.09869	0.561000	0.74099	CTC	C1orf186	-	NULL	ENSG00000196533		0.532	C1orf186-001	NOVEL	basic|appris_principal|CCDS	protein_coding	C1orf186	HGNC	protein_coding	OTTHUMT00000088002.1	194	0.00	0	G	NM_001007544		206243207	206243207	-1	no_errors	ENST00000331555	ensembl	human	known	69_37n	missense	77	53.61	89	SNP	0.001	C
EQTN	54586	genome.wustl.edu	37	9	27289729	27289729	+	Splice_Site	SNP	G	G	T			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr9:27289729G>T	ENST00000380032.3	-	6	505	c.422C>A	c.(421-423)gCt>gAt	p.A141D	EQTN_ENST00000484994.1_5'Flank|EQTN_ENST00000537675.1_Splice_Site_p.A112D	NM_020641.2	NP_065692.2	Q9NQ60	EQTN_HUMAN	equatorin, sperm acrosome associated	141					acrosomal vesicle exocytosis (GO:0060478)|endocytosis (GO:0006897)|fusion of sperm to egg plasma membrane (GO:0007342)	early endosome (GO:0005769)|inner acrosomal membrane (GO:0002079)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|outer acrosomal membrane (GO:0002081)|plasma membrane (GO:0005886)		p.A141D(1)									TCCATTTATAGCTGTTAAAAC	0.343																																						dbGAP											1	Substitution - Missense(1)	breast(1)											177.0	165.0	169.0					9																	27289729		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AJ278482	CCDS35001.1, CCDS55300.1	9p21	2012-09-20	2012-09-20	2012-09-20	ENSG00000120160	ENSG00000120160			1359	protein-coding gene	gene with protein product	"""Acr formation associated factor"", ""Acrosome formation associated factor"", ""sperm acrosome associated 8"""		"""chromosome 9 open reading frame 11"", ""equatorin"""	C9orf11			Standard	NM_020641		Approved	AFAF, SPACA8, equatorin	uc003zql.3	Q9NQ60	OTTHUMG00000021033	ENST00000380032.3:c.422-1C>A	9.37:g.27289729G>T			B2RPB3|B7ZMK1|Q5TCU1|Q96L22	Missense_Mutation	SNP	NULL	p.A141D	ENST00000380032.3	37	c.422	CCDS35001.1	9	.	.	.	.	.	.	.	.	.	.	G	14.13	2.444995	0.43429	.	.	ENSG00000120160	ENST00000537675;ENST00000380032	T;T	0.40225	1.04;1.04	4.22	1.41	0.22369	.	0.173568	0.27971	N	0.017119	T	0.49490	0.1560	L	0.47190	1.495	0.33603	D	0.602605	D;D	0.89917	1.0;1.0	D;D	0.70935	0.971;0.971	T	0.58674	-0.7595	10	0.72032	D	0.01	.	6.1167	0.20130	0.3194:0.0:0.6806:0.0	.	112;141	B7ZMK1;Q9NQ60	.;AFAF_HUMAN	D	112;141	ENSP00000441630:A112D;ENSP00000369371:A141D	ENSP00000369371:A141D	A	-	2	0	C9orf11	27279729	0.945000	0.32115	0.892000	0.35008	0.571000	0.35966	0.331000	0.19733	0.328000	0.23435	0.655000	0.94253	GCT	C9orf11	-	NULL	ENSG00000120160		0.343	EQTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C9orf11	HGNC	protein_coding	OTTHUMT00000055499.1	228	0.00	0	G	NM_020641	Missense_Mutation	27289729	27289729	-1	no_errors	ENST00000380032	ensembl	human	known	69_37n	missense	108	32.08	51	SNP	0.906	T
CDHR2	54825	genome.wustl.edu	37	5	176017576	176017577	+	Missense_Mutation	DNP	AG	AG	GC			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	A|G	A|G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr5:176017576_176017577AG>GC	ENST00000510636.1	+	28	3701_3702	c.3427_3428AG>GC	c.(3427-3429)AGc>GCc	p.S1143A	CDHR2_ENST00000506348.1_Missense_Mutation_p.S1143A|CDHR2_ENST00000261944.5_Missense_Mutation_p.S1143A	NM_001171976.1	NP_001165447.1	Q9BYE9	CDHR2_HUMAN	cadherin-related family member 2	1143					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|liver(1)|lung(23)|ovary(3)|prostate(5)|skin(4)|urinary_tract(1)	56						CTCCCAGGAGAGCCAGGAGTCA	0.584																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AB047004	CCDS34297.1	5q35.2	2011-07-01	2010-01-25	2010-01-25		ENSG00000074276		"""Cadherins / Cadherin-related"""	18231	protein-coding gene	gene with protein product	"""protocadherin LKC"""		"""protocadherin 24"""	PCDH24		11082270, 12117771	Standard	NM_001171976		Approved	PC-LKC, FLJ20124, FLJ20383, PCLKC	uc003mem.2	Q9BYE9		Exception_encountered	5.37:g.176017576_176017577delinsGC	ENSP00000424565:p.Ser1143Ala		A1L3U4|A6NC80|Q9NXP8	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S1143G|p.S1143T	ENST00000510636.1	37	c.3427|c.3428	CCDS34297.1	5																																																																																			CDHR2	-	NULL	ENSG00000074276		0.584	CDHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDHR2	HGNC	protein_coding	OTTHUMT00000372201.1	155|154	0.00	0	A|G	NM_017675		176017576|176017577	176017576|176017577	+1	no_errors	ENST00000261944	ensembl	human	known	69_37n	missense	34	54.05|54.67	40|41	SNP	0.092|0.001	G|C
CECR1	51816	genome.wustl.edu	37	22	17690423	17690424	+	Frame_Shift_Ins	INS	-	-	C	rs199614299		TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr22:17690423_17690424insC	ENST00000399839.1	-	2	414_415	c.144_145insG	c.(142-147)gggcggfs	p.R49fs	CECR1_ENST00000262607.3_Frame_Shift_Ins_p.R49fs|CECR1_ENST00000449907.2_Frame_Shift_Ins_p.R7fs|CECR1_ENST00000399837.2_Frame_Shift_Ins_p.R49fs	NM_001282227.1|NM_001282228.1	NP_001269156.1|NP_001269157.1	Q9NZK5	CECR1_HUMAN	cat eye syndrome chromosome region, candidate 1	49	Dimerization.				adenosine catabolic process (GO:0006154)|hypoxanthine salvage (GO:0043103)|inosine biosynthetic process (GO:0046103)|multicellular organismal development (GO:0007275)	extracellular space (GO:0005615)	adenosine deaminase activity (GO:0004000)|adenosine receptor binding (GO:0031685)|growth factor activity (GO:0008083)|heparin binding (GO:0008201)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(10)|ovary(2)|prostate(2)|stomach(1)	25		all_epithelial(15;0.0152)|Lung NSC(13;0.0875)|all_lung(157;0.106)				AGCACCAGCCGCCCCCCCAGCC	0.54																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF190746	CCDS13742.1, CCDS13743.1, CCDS63395.1, CCDS74809.1	22q11.2	2008-02-22			ENSG00000093072	ENSG00000093072			1839	protein-coding gene	gene with protein product		607575		IDGFL		10756095	Standard	NM_001282225		Approved	ADGF	uc002zmk.1	Q9NZK5	OTTHUMG00000030726	ENST00000399839.1:c.145dupG	22.37:g.17690430_17690430dupC	ENSP00000382733:p.Arg49fs		A8K9H4|Q6ICF1|Q86UB6|Q8NCJ2|Q96K41	Frame_Shift_Ins	INS	pfam_A/AMP_deaminase_dom,pfam_A_deaminase_N,tigrfam_Ad_deam-like	p.R48fs	ENST00000399839.1	37	c.145_144	CCDS13742.1	22																																																																																			CECR1	-	pfam_A_deaminase_N,tigrfam_Ad_deam-like	ENSG00000093072		0.540	CECR1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	CECR1	HGNC	protein_coding	OTTHUMT00000316079.1	54	0.00	0	-			17690423	17690424	-1	no_errors	ENST00000262607	ensembl	human	known	69_37n	frame_shift_ins	26	13.33	4	INS	0.036:0.052	C
CHD4	1108	genome.wustl.edu	37	12	6709817	6709817	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr12:6709817C>G	ENST00000357008.2	-	8	1109	c.946G>C	c.(946-948)Gat>Cat	p.D316H	CHD4_ENST00000309577.6_Missense_Mutation_p.D316H|CHD4_ENST00000544040.1_Missense_Mutation_p.D309H|CHD4_ENST00000544484.1_Missense_Mutation_p.D313H	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	316					ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)	p.D316H(2)		central_nervous_system(2)	2						GATTCCACATCTAAGTCATCA	0.488																																					Colon(32;586 792 4568 16848 45314)	dbGAP											2	Substitution - Missense(2)	breast(2)											100.0	86.0	91.0					12																	6709817		2203	4300	6503	-	-	-	SO:0001583	missense	0			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.946G>C	12.37:g.6709817C>G	ENSP00000349508:p.Asp316His		Q8IXZ5	Missense_Mutation	SNP	pfam_CHD_C2,pfam_DUF1086,pfam_SNF2_N,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,superfamily_Homeodomain-like,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.D316H	ENST00000357008.2	37	c.946	CCDS8552.1	12	.	.	.	.	.	.	.	.	.	.	C	22.8	4.331143	0.81690	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464;ENST00000545942	D;D;D;D;T	0.90732	-2.72;-2.72;-2.72;-2.72;0.75	4.61	4.61	0.57282	.	0.062052	0.64402	D	0.000007	D	0.94647	0.8274	M	0.70595	2.14	0.80722	D	1	D;D;P	0.89917	1.0;1.0;0.899	D;D;P	0.70016	0.967;0.945;0.639	D	0.94496	0.7705	10	0.49607	T	0.09	-0.778	18.3435	0.90313	0.0:1.0:0.0:0.0	.	316;316;309	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	H	313;309;316;316;290;316	ENSP00000440392:D313H;ENSP00000440542:D309H;ENSP00000312419:D316H;ENSP00000349508:D316H;ENSP00000437506:D316H	ENSP00000312419:D316H	D	-	1	0	CHD4	6580078	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.445000	0.80570	2.477000	0.83638	0.561000	0.74099	GAT	CHD4	-	NULL	ENSG00000111642		0.488	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD4	HGNC	protein_coding		105	0.00	0	C	NM_001273		6709817	6709817	-1	no_errors	ENST00000309577	ensembl	human	known	69_37n	missense	70	39.13	45	SNP	1.000	G
CLEC1A	51267	genome.wustl.edu	37	12	10233932	10233932	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr12:10233932C>G	ENST00000315330.4	-	3	357	c.295G>C	c.(295-297)Gag>Cag	p.E99Q	CLEC1A_ENST00000457018.2_Missense_Mutation_p.E66Q|CLEC1A_ENST00000420265.2_Intron|RN7SKP161_ENST00000411110.1_RNA	NM_016511.2	NP_057595.2	Q8NC01	CLC1A_HUMAN	C-type lectin domain family 1, member A	99					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)	p.E99Q(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	23						GATTGCAACTCTTGGGACGTA	0.418																																						dbGAP											1	Substitution - Missense(1)	breast(1)											128.0	127.0	127.0					12																	10233932		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY358587	CCDS8612.1, CCDS73443.1	12p13.31	2005-02-09				ENSG00000150048		"""C-type lectin domain containing"""	24355	protein-coding gene	gene with protein product		606782				10671229, 11745369	Standard	XM_005253383		Approved	CLEC1, MGC34328	uc001qxb.3	Q8NC01		ENST00000315330.4:c.295G>C	12.37:g.10233932C>G	ENSP00000326407:p.Glu99Gln		Q8IUW7|Q9NZH3	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.E99Q	ENST00000315330.4	37	c.295	CCDS8612.1	12	.	.	.	.	.	.	.	.	.	.	C	0	-2.638696	0.00112	.	.	ENSG00000150048	ENST00000315330;ENST00000457018	T;T	0.17370	2.28;2.28	4.71	1.8	0.24995	.	0.471757	0.17959	N	0.156250	T	0.04724	0.0128	N	0.00661	-1.28	0.19575	N	0.999964	B;B	0.06786	0.0;0.001	B;B	0.06405	0.001;0.002	T	0.40776	-0.9545	10	0.11182	T	0.66	.	13.0001	0.58670	0.0:0.584:0.416:0.0	.	66;99	E9PFB4;Q8NC01	.;CLC1A_HUMAN	Q	99;66	ENSP00000326407:E99Q;ENSP00000415048:E66Q	ENSP00000326407:E99Q	E	-	1	0	CLEC1A	10125199	0.586000	0.26782	0.003000	0.11579	0.007000	0.05969	0.850000	0.27737	0.186000	0.20125	-0.256000	0.11100	GAG	CLEC1A	-	NULL	ENSG00000150048		0.418	CLEC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC1A	HGNC	protein_coding	OTTHUMT00000399924.1	224	0.44	1	C	NM_016511		10233932	10233932	-1	no_errors	ENST00000315330	ensembl	human	known	69_37n	missense	277	10.36	32	SNP	0.014	G
FUK	197258	genome.wustl.edu	37	16	70516652	70516652	+	IGR	SNP	C	C	T			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr16:70516652C>T	ENST00000288078.6	+	0	4081				COG4_ENST00000323786.5_Missense_Mutation_p.V634I	NM_145059.2	NP_659496.2	Q8N0W3	FUK_HUMAN	fucokinase							cytoplasm (GO:0005737)	ATP binding (GO:0005524)|fucokinase activity (GO:0050201)	p.V634I(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(11)|ovary(2)|prostate(2)	23		Ovarian(137;0.0694)				TTGTGGGAGACGGAGAAAAAG	0.582																																						dbGAP											1	Substitution - Missense(1)	breast(1)											279.0	196.0	224.0					16																	70516652		2198	4300	6498	-	-	-	SO:0001628	intergenic_variant	0				CCDS10891.2	16q22.1	2008-02-05			ENSG00000157353	ENSG00000157353	2.7.1.52		29500	protein-coding gene	gene with protein product	"""L-fucose kinase"""	608675				12056818	Standard	XM_006721161		Approved	FLJ39408	uc002eyy.3	Q8N0W3	OTTHUMG00000074085		16.37:g.70516652C>T			Q5PSM3|Q5XKL6|Q6ZRA0|Q96MT9	Missense_Mutation	SNP	pfam_COG_su4,smart_COG_su4	p.V634I	ENST00000288078.6	37	c.1900	CCDS10891.2	16	.	.	.	.	.	.	.	.	.	.	C	11.55	1.673254	0.29693	.	.	ENSG00000103051	ENST00000323786;ENST00000338984;ENST00000526700;ENST00000539961	T	0.44482	0.92	5.51	4.55	0.56014	.	0.222177	0.47455	N	0.000221	T	0.19565	0.0470	N	0.04387	-0.21	0.80722	D	1	B;B;B;B	0.12630	0.003;0.006;0.002;0.003	B;B;B;B	0.09377	0.002;0.004;0.002;0.002	T	0.06661	-1.0814	10	0.15499	T	0.54	-15.977	10.7357	0.46124	0.0:0.8473:0.0:0.1527	.	540;608;630;90	Q8N8L9;Q6PIW8;Q9H9E3;E9PQK0	.;.;COG4_HUMAN;.	I	634;609;90;292	ENSP00000315775:V634I	ENSP00000315775:V634I	V	-	1	0	COG4	69074153	0.954000	0.32549	0.979000	0.43373	0.995000	0.86356	1.978000	0.40598	1.318000	0.45170	0.561000	0.74099	GTC	COG4	-	NULL	ENSG00000103051		0.582	FUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COG4	HGNC	protein_coding	OTTHUMT00000157291.2	81	0.00	0	C	NM_145059		70516652	70516652	-1	no_errors	ENST00000323786	ensembl	human	known	69_37n	missense	29	16.67	6	SNP	0.940	T
CYP4F11	57834	genome.wustl.edu	37	19	16038102	16038102	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr19:16038102G>A	ENST00000402119.4	-	4	871	c.445C>T	c.(445-447)Cgg>Tgg	p.R149W	CYP4F11_ENST00000326742.8_Missense_Mutation_p.R149W|CYP4F11_ENST00000248041.8_Missense_Mutation_p.R149W|CYP4F11_ENST00000591841.1_5'UTR	NM_021187.3	NP_067010.3			cytochrome P450, family 4, subfamily F, polypeptide 11									p.R149W(1)		NS(1)|breast(3)|endometrium(4)|large_intestine(2)|lung(11)|ovary(1)|skin(3)	25						GTCAACATCCGACGGTGGCGG	0.537																																						dbGAP											1	Substitution - Missense(1)	breast(1)											91.0	89.0	90.0					19																	16038102		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF236085	CCDS12337.1	19p13.1	2011-07-29	2003-01-14		ENSG00000171903	ENSG00000171903		"""Cytochrome P450s"""	13265	protein-coding gene	gene with protein product		611517	"""cytochrome P450, subfamily IVF, polypeptide 11"""			10964514, 9068972	Standard	NM_021187		Approved		uc002nbu.2	Q9HBI6		ENST00000402119.4:c.445C>T	19.37:g.16038102G>A	ENSP00000384588:p.Arg149Trp			Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.R149W	ENST00000402119.4	37	c.445	CCDS12337.1	19	.	.	.	.	.	.	.	.	.	.	g	8.784	0.929033	0.18131	.	.	ENSG00000171903	ENST00000402119;ENST00000248041;ENST00000326742	D;D;T	0.81996	-1.56;-1.56;-0.65	2.57	1.45	0.22620	.	0.083689	0.47455	U	0.000226	D	0.86814	0.6023	M	0.91717	3.235	0.53005	D	0.999965	P;P	0.47962	0.882;0.903	P;P	0.47705	0.516;0.555	D	0.86120	0.1568	10	0.87932	D	0	.	8.5265	0.33309	0.0:0.0:0.7687:0.2313	.	149;149	F8W978;Q9HBI6	.;CP4FB_HUMAN	W	149	ENSP00000384588:R149W;ENSP00000248041:R149W;ENSP00000319859:R149W	ENSP00000248041:R149W	R	-	1	2	CYP4F11	15899102	0.489000	0.26004	0.898000	0.35279	0.046000	0.14306	2.054000	0.41335	0.374000	0.24650	0.298000	0.19748	CGG	CYP4F11	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-II	ENSG00000171903		0.537	CYP4F11-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CYP4F11	HGNC	protein_coding	OTTHUMT00000460385.2	95	0.00	0	G	NM_021187		16038102	16038102	-1	no_errors	ENST00000248041	ensembl	human	known	69_37n	missense	44	39.73	29	SNP	0.999	A
DNAH7	56171	genome.wustl.edu	37	2	196889189	196889189	+	Missense_Mutation	SNP	T	T	A			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr2:196889189T>A	ENST00000312428.6	-	8	807	c.707A>T	c.(706-708)gAt>gTt	p.D236V	DNAH7_ENST00000410072.1_Missense_Mutation_p.D236V	NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	236	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)	p.D236V(1)		NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						TGTCTTCTTATCATCTCCTTT	0.308																																						dbGAP											1	Substitution - Missense(1)	breast(1)											93.0	88.0	89.0					2																	196889189		1816	4073	5889	-	-	-	SO:0001583	missense	0			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.707A>T	2.37:g.196889189T>A	ENSP00000311273:p.Asp236Val		B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,superfamily_Signal_recog_particle_SRP9/14,smart_AAA+_ATPase,pfscan_EF_HAND_2	p.D236V	ENST00000312428.6	37	c.707	CCDS42794.1	2	.	.	.	.	.	.	.	.	.	.	T	12.95	2.091888	0.36952	.	.	ENSG00000118997	ENST00000312428;ENST00000410072;ENST00000312446	T;T	0.22539	1.95;2.79	5.03	3.78	0.43462	.	0.139072	0.47093	D	0.000253	T	0.17109	0.0411	L	0.48362	1.52	0.51012	D	0.999907	B	0.16396	0.017	B	0.09377	0.004	T	0.04781	-1.0927	10	0.15952	T	0.53	.	11.4604	0.50206	0.0:0.0:0.1504:0.8496	.	236	Q8WXX0	DYH7_HUMAN	V	236	ENSP00000311273:D236V;ENSP00000386260:D236V	ENSP00000311273:D236V	D	-	2	0	DNAH7	196597434	0.991000	0.36638	0.943000	0.38184	0.597000	0.36814	1.820000	0.39032	2.015000	0.59207	0.533000	0.62120	GAT	DNAH7	-	NULL	ENSG00000118997		0.308	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH7	HGNC	protein_coding	OTTHUMT00000335202.3	299	0.00	0	T	NM_018897		196889189	196889189	-1	no_errors	ENST00000312428	ensembl	human	known	69_37n	missense	281	24.05	89	SNP	0.959	A
DNAH9	1770	genome.wustl.edu	37	17	11687830	11687830	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr17:11687830C>T	ENST00000262442.4	+	41	8103	c.8035C>T	c.(8035-8037)Ctc>Ttc	p.L2679F	DNAH9_ENST00000454412.2_Missense_Mutation_p.L2679F	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	2679	AAA 3. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.L2679F(1)		NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CATCTTCAACCTCAGAGATTT	0.473																																						dbGAP											1	Substitution - Missense(1)	breast(1)											147.0	141.0	143.0					17																	11687830		2203	4300	6503	-	-	-	SO:0001583	missense	0			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.8035C>T	17.37:g.11687830C>T	ENSP00000262442:p.Leu2679Phe		A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.L2679F	ENST00000262442.4	37	c.8035	CCDS11160.1	17	.	.	.	.	.	.	.	.	.	.	C	29.7	5.024904	0.93518	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.52754	0.65;0.65	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.80768	0.4686	H	0.96970	3.915	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.87092	0.2173	10	0.87932	D	0	.	19.5182	0.95174	0.0:1.0:0.0:0.0	.	2679	Q9NYC9	DYH9_HUMAN	F	2679;2679;1261	ENSP00000262442:L2679F;ENSP00000414874:L2679F	ENSP00000262442:L2679F	L	+	1	0	DNAH9	11628555	1.000000	0.71417	0.987000	0.45799	0.999000	0.98932	4.944000	0.63561	2.615000	0.88500	0.643000	0.83706	CTC	DNAH9	-	NULL	ENSG00000007174		0.473	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	HGNC	protein_coding	OTTHUMT00000252756.2	177	0.56	1	C	NM_001372		11687830	11687830	+1	no_errors	ENST00000262442	ensembl	human	known	69_37n	missense	53	37.65	32	SNP	1.000	T
DNHD1	144132	genome.wustl.edu	37	11	6566067	6566067	+	Missense_Mutation	SNP	C	C	T	rs142039183		TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr11:6566067C>T	ENST00000527990.2	+	19	3898	c.3898C>T	c.(3898-3900)Cgc>Tgc	p.R1300C	DNHD1_ENST00000254579.6_Missense_Mutation_p.R1300C			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	1300					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)	p.R1300C(1)		NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		AACCCTGATGCGCATCTCTGT	0.537													C|||	1	0.000199681	0.0	0.0	5008	,	,		22073	0.0		0.001	False		,,,				2504	0.0					dbGAP											1	Substitution - Missense(1)	breast(1)											108.0	93.0	97.0					11																	6566067		692	1591	2283	-	-	-	SO:0001583	missense	0			AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.3898C>T	11.37:g.6566067C>T	ENSP00000436180:p.Arg1300Cys		Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy,superfamily_t-SNARE	p.R1300C	ENST00000527990.2	37	c.3898	CCDS44532.1	11	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	11.02	1.514884	0.27123	.	.	ENSG00000179532	ENST00000254579;ENST00000527990	T;T	0.61980	0.06;0.06	5.67	-0.75	0.11080	Dynein heavy chain, domain-2 (1);	.	.	.	.	T	0.43411	0.1246	L	0.29908	0.895	0.25910	N	0.983244	B	0.14012	0.009	B	0.12837	0.008	T	0.38001	-0.9681	9	0.72032	D	0.01	.	2.5636	0.04778	0.3669:0.3811:0.1:0.152	.	1300	Q96M86	DNHD1_HUMAN	C	1300	ENSP00000254579:R1300C;ENSP00000436180:R1300C	ENSP00000254579:R1300C	R	+	1	0	DNHD1	6522643	0.040000	0.19996	0.168000	0.22838	0.828000	0.46876	0.088000	0.14979	-0.008000	0.14320	0.557000	0.71058	CGC	DNHD1	-	pfam_Dynein_heavy_dom-2	ENSG00000179532		0.537	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	DNHD1	HGNC	protein_coding	OTTHUMT00000384673.2	161	0.00	0	C	NM_144666		6566067	6566067	+1	no_errors	ENST00000254579	ensembl	human	known	69_37n	missense	37	43.08	28	SNP	0.077	T
DOCK5	80005	genome.wustl.edu	37	8	25149578	25149578	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr8:25149578G>A	ENST00000276440.7	+	6	404	c.360G>A	c.(358-360)atG>atA	p.M120I	DOCK5_ENST00000481100.1_Missense_Mutation_p.M120I	NM_024940.6	NP_079216.4	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	120					positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.M120I(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(9)|large_intestine(13)|lung(20)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		TGCAGCAGATGACGTACAGCC	0.483																																					Pancreas(145;34 1887 3271 10937 30165)	dbGAP											1	Substitution - Missense(1)	breast(1)											41.0	38.0	39.0					8																	25149578		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6047.1	8p21.2	2009-04-17			ENSG00000147459	ENSG00000147459			23476	protein-coding gene	gene with protein product						12432077	Standard	NM_024940		Approved	FLJ21034	uc003xeg.3	Q9H7D0	OTTHUMG00000131991	ENST00000276440.7:c.360G>A	8.37:g.25149578G>A	ENSP00000276440:p.Met120Ile		B2RNY0|Q5XKD5|Q6AI11|Q6PJS6|Q6ZTS6	Missense_Mutation	SNP	pfam_DOCK,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_ARM-type_fold,smart_SH3_domain,pfscan_SH3_domain	p.M120I	ENST00000276440.7	37	c.360	CCDS6047.1	8	.	.	.	.	.	.	.	.	.	.	G	18.94	3.729081	0.69074	.	.	ENSG00000147459	ENST00000481100;ENST00000276440	T;T	0.58210	0.35;0.35	5.45	5.45	0.79879	.	0.045833	0.85682	D	0.000000	T	0.52092	0.1713	L	0.55990	1.75	0.58432	D	0.999998	B	0.27997	0.197	B	0.34038	0.174	T	0.44097	-0.9350	10	0.27785	T	0.31	.	16.4996	0.84253	0.0:0.1303:0.8697:0.0	.	120	Q9H7D0	DOCK5_HUMAN	I	120	ENSP00000429737:M120I;ENSP00000276440:M120I	ENSP00000276440:M120I	M	+	3	0	DOCK5	25205495	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	6.529000	0.73812	2.835000	0.97688	0.650000	0.86243	ATG	DOCK5	-	NULL	ENSG00000147459		0.483	DOCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK5	HGNC	protein_coding	OTTHUMT00000254955.2	151	0.00	0	G	NM_024940		25149578	25149578	+1	no_errors	ENST00000276440	ensembl	human	known	69_37n	missense	70	30.00	30	SNP	1.000	A
DROSHA	29102	genome.wustl.edu	37	5	31526495	31526495	+	Missense_Mutation	SNP	A	A	G			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr5:31526495A>G	ENST00000511367.2	-	4	789	c.545T>C	c.(544-546)tTt>tCt	p.F182S	DROSHA_ENST00000442743.1_Missense_Mutation_p.F182S|DROSHA_ENST00000513349.1_Missense_Mutation_p.F182S|DROSHA_ENST00000504361.1_5'Flank|DROSHA_ENST00000344624.3_Missense_Mutation_p.F182S	NM_013235.4	NP_037367.3	Q9NRR4	RNC_HUMAN	drosha, ribonuclease type III	182	Pro-rich.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|gene expression (GO:0010467)|miRNA metabolic process (GO:0010586)|pre-miRNA processing (GO:0031054)|primary miRNA processing (GO:0031053)|ribosome biogenesis (GO:0042254)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA catabolic process (GO:0016075)	nucleoplasm (GO:0005654)	lipopolysaccharide binding (GO:0001530)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)	p.F182S(1)		breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(19)|lung(33)|ovary(2)|skin(1)	66						GAAACTATTAAAACTGGGAGG	0.522																																						dbGAP											1	Substitution - Missense(1)	breast(1)											66.0	65.0	66.0					5																	31526495		1865	4111	5976	-	-	-	SO:0001583	missense	0			AF116910	CCDS47194.1, CCDS47195.1	5q11.2	2010-11-17	2010-10-28	2010-10-28	ENSG00000113360	ENSG00000113360	3.1.26.3		17904	protein-coding gene	gene with protein product	"""drosha, ribonuclease type III"", ""drosha, double-stranded RNA-specific endoribonuclease"""	608828	"""ribonuclease type III, nuclear"""	RNASEN		10713462, 10948199	Standard	NM_013235		Approved	RNASE3L, Etohi2, HSA242976, RN3	uc003jhg.2	Q9NRR4	OTTHUMG00000161976	ENST00000511367.2:c.545T>C	5.37:g.31526495A>G	ENSP00000425979:p.Phe182Ser		E7EMP9|Q7Z5V2|Q86YH0|Q9NW73|Q9Y2V9|Q9Y4Y0	Missense_Mutation	SNP	pfam_RNase_III_dom,pfam_Ds-RNA-bd,superfamily_RNase_III_dom,smart_RNase_III_dom,smart_Ds-RNA-bd,pfscan_Ds-RNA-bd,pfscan_RNase_III_dom	p.F182S	ENST00000511367.2	37	c.545	CCDS47195.1	5	.	.	.	.	.	.	.	.	.	.	A	16.30	3.083423	0.55861	.	.	ENSG00000113360	ENST00000511367;ENST00000344624;ENST00000442743;ENST00000513349;ENST00000265075;ENST00000382188;ENST00000507438	T;T;T;T;T	0.61742	1.08;1.08;0.79;0.79;0.08	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.61887	0.2383	N	0.24115	0.695	0.80722	D	1	D;D;D	0.76494	0.999;0.967;0.967	D;D;D	0.80764	0.994;0.91;0.91	T	0.59010	-0.7534	10	0.23302	T	0.38	-13.8026	14.9429	0.71009	1.0:0.0:0.0:0.0	.	182;182;182	Q9NRR4-2;E7EMP9;Q9NRR4	.;.;RNC_HUMAN	S	182;182;182;182;175;175;182	ENSP00000425979:F182S;ENSP00000339845:F182S;ENSP00000409335:F182S;ENSP00000424161:F182S;ENSP00000430921:F182S	ENSP00000265075:F175S	F	-	2	0	DROSHA	31562252	1.000000	0.71417	0.047000	0.18901	0.963000	0.63663	7.656000	0.83736	1.918000	0.55548	0.533000	0.62120	TTT	DROSHA	-	NULL	ENSG00000113360		0.522	DROSHA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DROSHA	HGNC	protein_coding	OTTHUMT00000366561.3	178	0.00	0	A	NM_013235		31526495	31526495	-1	no_errors	ENST00000344624	ensembl	human	known	69_37n	missense	168	20.38	43	SNP	0.983	G
EDC3	80153	genome.wustl.edu	37	15	74925172	74925172	+	Silent	SNP	C	C	G			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr15:74925172C>G	ENST00000315127.4	-	7	1489	c.1308G>C	c.(1306-1308)cgG>cgC	p.R436R	EDC3_ENST00000426797.3_Silent_p.R436R|EDC3_ENST00000568176.1_Silent_p.R436R	NM_001142444.1|NM_025083.3	NP_001135916.1|NP_079359.2	Q96F86	EDC3_HUMAN	enhancer of mRNA decapping 3	436	YjeF N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00719}.				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)|membrane (GO:0016020)	identical protein binding (GO:0042802)|RNA binding (GO:0003723)	p.R436R(1)		breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	16						GTACTGGTGCCCGGTTCTGGT	0.597											OREG0023286	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Substitution - coding silent(1)	breast(1)											99.0	75.0	83.0					15																	74925172		2197	4296	6493	-	-	-	SO:0001819	synonymous_variant	0			BC011534	CCDS10267.1	15q24.1	2013-05-02	2013-05-02	2006-07-07	ENSG00000179151	ENSG00000179151			26114	protein-coding gene	gene with protein product		609842	"""yjeF domain containing (E.coli)"", ""LSM16 homolog (EDC3, S. cerevisiae)"", ""enhancer of mRNA decapping 3 homolog (S. cerevisiae)"""	YJDC, LSM16		15225602, 17533573, 22483619	Standard	NM_025083		Approved	FLJ21128, hYjeF_N2-15q23, YJEFN2	uc002aym.3	Q96F86	OTTHUMG00000142815	ENST00000315127.4:c.1308G>C	15.37:g.74925172C>G		1156	B3KPH0|D3DW61|Q9H797	Silent	SNP	pfam_YjeF_N,pfam_FDF_dom,superfamily_YjeF_N	p.R436	ENST00000315127.4	37	c.1308	CCDS10267.1	15																																																																																			EDC3	-	pfam_YjeF_N,superfamily_YjeF_N	ENSG00000179151		0.597	EDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDC3	HGNC	protein_coding	OTTHUMT00000286399.1	107	0.00	0	C	NM_025083		74925172	74925172	-1	no_errors	ENST00000315127	ensembl	human	known	69_37n	silent	28	49.09	27	SNP	1.000	G
EML4	27436	genome.wustl.edu	37	2	42557309	42557309	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr2:42557309C>A	ENST00000318522.5	+	23	3170	c.2908C>A	c.(2908-2910)Ctt>Att	p.L970I	EML4_ENST00000402711.2_Missense_Mutation_p.L912I|EML4_ENST00000401738.3_Missense_Mutation_p.L981I|EML4_ENST00000453191.2_Missense_Mutation_p.L234I	NM_019063.3	NP_061936	Q9HC35	EMAL4_HUMAN	echinoderm microtubule associated protein like 4	970					microtubule-based process (GO:0007017)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|mitotic spindle (GO:0072686)			EML4/ALK(543)	NS(2)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	12						CAAAGCCACCCTTCTGGAGGA	0.537			T	ALK	NSCLC																																	dbGAP		Dom	yes		2	2p21	27436	echinoderm microtubule associated protein like 4		E	0													51.0	44.0	46.0					2																	42557309		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF177377	CCDS1807.1, CCDS46266.1	2p21	2013-01-10		2002-02-15	ENSG00000143924	ENSG00000143924		"""WD repeat domain containing"""	1316	protein-coding gene	gene with protein product		607442		C2orf2			Standard	NM_019063		Approved	ROPP120, ELP120	uc002rsi.3	Q9HC35	OTTHUMG00000128603	ENST00000318522.5:c.2908C>A	2.37:g.42557309C>A	ENSP00000320663:p.Leu970Ile		A6H8Y6|B2RBK3|B2RTW7|B5MCW9|Q3SWW0|Q53R29|Q53TW8|Q6PJ45|Q9NV40	Missense_Mutation	SNP	pfam_HELP,pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L970I	ENST00000318522.5	37	c.2908	CCDS1807.1	2	.	.	.	.	.	.	.	.	.	.	C	7.746	0.702390	0.15172	.	.	ENSG00000143924	ENST00000318522;ENST00000402711;ENST00000401738;ENST00000453191	T;T;T;T	0.43688	1.16;1.21;1.21;0.94	5.08	-0.518	0.11943	.	3.032260	0.00799	N	0.001416	T	0.27765	0.0683	N	0.12182	0.205	0.09310	N	1	B;B;B;B	0.06786	0.0;0.0;0.001;0.0	B;B;B;B	0.04013	0.001;0.001;0.001;0.001	T	0.20009	-1.0288	10	0.19147	T	0.46	0.8516	11.5576	0.50757	0.2857:0.2169:0.4975:0.0	.	912;912;981;970	A6H8Y6;B5MCW9;B5MBZ0;Q9HC35	.;.;.;EMAL4_HUMAN	I	970;912;981;234	ENSP00000320663:L970I;ENSP00000385059:L912I;ENSP00000384939:L981I;ENSP00000400590:L234I	ENSP00000320663:L970I	L	+	1	0	EML4	42410813	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.388000	0.07352	-0.108000	0.12066	0.655000	0.94253	CTT	EML4	-	NULL	ENSG00000143924		0.537	EML4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EML4	HGNC	protein_coding	OTTHUMT00000250463.3	44	0.00	0	C	NM_019063		42557309	42557309	+1	no_errors	ENST00000318522	ensembl	human	known	69_37n	missense	21	25.00	7	SNP	0.000	A
EPC1	80314	genome.wustl.edu	37	10	32576025	32576025	+	Splice_Site	SNP	C	C	A			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr10:32576025C>A	ENST00000263062.8	-	7	1422		c.e7+1		EPC1_ENST00000375110.2_Splice_Site|EPC1_ENST00000319778.6_Splice_Site	NM_025209.2	NP_079485.1	Q9H2F5	EPC1_HUMAN	enhancer of polycomb homolog 1 (Drosophila)						chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)		p.?(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(5)|urinary_tract(1)	24		Prostate(175;0.0199)				TGTATTTGTACCTGGGAGAGA	0.438																																						dbGAP											1	Unknown(1)	breast(1)											107.0	106.0	106.0					10																	32576025		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF277374	CCDS7172.1, CCDS60511.1, CCDS73083.1	10p11	2005-12-12			ENSG00000120616	ENSG00000120616			19876	protein-coding gene	gene with protein product		610999				10976108	Standard	NM_025209		Approved	Epl1	uc001iwg.2	Q9H2F5	OTTHUMG00000017925	ENST00000263062.8:c.1152+1G>T	10.37:g.32576025C>A			B4DSC3|D3DRX7|Q5VW54|Q5VW56|Q5VW58|Q8NAQ4|Q8NE21|Q96LF4|Q96RR6|Q9H7T7	Splice_Site	SNP	-	e7+1	ENST00000263062.8	37	c.1152+1	CCDS7172.1	10	.	.	.	.	.	.	.	.	.	.	C	20.9	4.064554	0.76187	.	.	ENSG00000120616	ENST00000375110;ENST00000319778;ENST00000263062	.	.	.	5.59	5.59	0.84812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5994	0.95554	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	EPC1	32616031	1.000000	0.71417	0.997000	0.53966	0.940000	0.58332	7.768000	0.85345	2.633000	0.89246	0.557000	0.71058	.	EPC1	-	-	ENSG00000120616		0.438	EPC1-004	KNOWN	basic|CCDS	protein_coding	EPC1	HGNC	protein_coding	OTTHUMT00000047484.1	130	0.00	0	C		Intron	32576025	32576025	-1	no_errors	ENST00000263062	ensembl	human	known	69_37n	splice_site	110	11.29	14	SNP	1.000	A
EPG5	57724	genome.wustl.edu	37	18	43483981	43483981	+	Silent	SNP	G	G	C	rs202107707		TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr18:43483981G>C	ENST00000282041.5	-	25	4465	c.4431C>G	c.(4429-4431)ccC>ccG	p.P1477P	EPG5_ENST00000585906.1_5'UTR	NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	1477					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)			p.P1477P(1)		NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						ACAAACTGCAGGGTGTGGAAT	0.512																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											113.0	118.0	117.0					18																	43483981		2016	4169	6185	-	-	-	SO:0001819	synonymous_variant	0			AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.4431C>G	18.37:g.43483981G>C			A2BDF3|Q9H8C8	Silent	SNP	NULL	p.P1477	ENST00000282041.5	37	c.4431	CCDS11926.2	18																																																																																			EPG5	-	NULL	ENSG00000152223		0.512	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPG5	HGNC	protein_coding	OTTHUMT00000445081.1	357	0.00	0	G	NM_020964		43483981	43483981	-1	no_errors	ENST00000282041	ensembl	human	known	69_37n	silent	185	28.57	74	SNP	0.895	C
EYA3	2140	genome.wustl.edu	37	1	28339784	28339784	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr1:28339784G>C	ENST00000373871.3	-	9	847	c.607C>G	c.(607-609)Ctt>Gtt	p.L203V	EYA3_ENST00000540618.1_Missense_Mutation_p.L157V|EYA3_ENST00000436342.2_Missense_Mutation_p.L77V|EYA3_ENST00000471498.1_5'UTR|EYA3_ENST00000545175.1_Missense_Mutation_p.L150V|EYA3_ENST00000373863.3_Missense_Mutation_p.L157V|EYA3_ENST00000373864.1_Missense_Mutation_p.L47V	NM_001282561.1|NM_001282562.1	NP_001269490.1|NP_001269491.1	Q99504	EYA3_HUMAN	EYA transcriptional coactivator and phosphatase 3	203					anatomical structure morphogenesis (GO:0009653)|double-strand break repair (GO:0006302)|histone dephosphorylation (GO:0016576)|multicellular organismal development (GO:0007275)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of DNA repair (GO:0045739)|regulation of transcription, DNA-templated (GO:0006355)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.L203V(1)		breast(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	15		Colorectal(325;3.46e-05)|all_lung(284;0.000414)|Lung NSC(340;0.000432)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0484)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;2.8e-06)|STAD - Stomach adenocarcinoma(196;0.00364)|KIRC - Kidney renal clear cell carcinoma(1967;0.00378)|BRCA - Breast invasive adenocarcinoma(304;0.00718)|READ - Rectum adenocarcinoma(331;0.0642)		TTCTGACCAAGAATAGTATAG	0.458																																						dbGAP											1	Substitution - Missense(1)	breast(1)											118.0	112.0	114.0					1																	28339784		2203	4300	6503	-	-	-	SO:0001583	missense	0			U81602	CCDS316.1, CCDS60050.1, CCDS60051.1, CCDS60052.1	1p36	2014-06-19	2014-06-19		ENSG00000158161	ENSG00000158161		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3521	protein-coding gene	gene with protein product		601655	"""eyes absent (Drosophila) homolog 3"", ""eyes absent homolog 3 (Drosophila)"""			9020840	Standard	NM_001990		Approved	DKFZp686C132	uc001bpi.2	Q99504	OTTHUMG00000003916	ENST00000373871.3:c.607C>G	1.37:g.28339784G>C	ENSP00000362978:p.Leu203Val		A8K190|B4DIR7|B4DNZ7|O95463|Q8IVX7|Q99813	Missense_Mutation	SNP	pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,tigrfam_EYA	p.L203V	ENST00000373871.3	37	c.607	CCDS316.1	1	.	.	.	.	.	.	.	.	.	.	G	19.08	3.758390	0.69763	.	.	ENSG00000158161	ENST00000373871;ENST00000436342;ENST00000373864;ENST00000540618;ENST00000545175;ENST00000373863	D;D;D;D;D;D	0.93189	-2.89;-3.18;-3.18;-1.94;-1.94;-1.94	5.45	5.45	0.79879	.	0.061153	0.64402	D	0.000002	D	0.93628	0.7965	N	0.17082	0.46	0.58432	D	0.999993	D;P;P	0.67145	0.996;0.778;0.725	D;B;B	0.75484	0.986;0.262;0.355	D	0.93199	0.6590	10	0.35671	T	0.21	-17.2912	19.6517	0.95819	0.0:0.0:1.0:0.0	.	157;157;203	B4DIR7;Q8IVX7;Q99504	.;.;EYA3_HUMAN	V	203;77;47;157;150;157	ENSP00000362978:L203V;ENSP00000405587:L77V;ENSP00000362971:L47V;ENSP00000442558:L157V;ENSP00000442280:L150V;ENSP00000362970:L157V	ENSP00000362970:L157V	L	-	1	0	EYA3	28212371	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.941000	0.70195	2.719000	0.93026	0.655000	0.94253	CTT	EYA3	-	NULL	ENSG00000158161		0.458	EYA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EYA3	HGNC	protein_coding	OTTHUMT00000011184.1	166	0.00	0	G	NM_001990		28339784	28339784	-1	no_errors	ENST00000373871	ensembl	human	known	69_37n	missense	97	40.61	67	SNP	1.000	C
FADS2	9415	genome.wustl.edu	37	11	61615738	61615738	+	Silent	SNP	C	C	G			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr11:61615738C>G	ENST00000278840.4	+	5	1356	c.726C>G	c.(724-726)ggC>ggG	p.G242G	FADS2_ENST00000521849.1_Silent_p.G242G|FADS2_ENST00000257261.6_Silent_p.G220G|FADS2_ENST00000522056.1_Silent_p.G211G	NM_004265.2	NP_004256.1	O95864	FADS2_HUMAN	fatty acid desaturase 2	242					alpha-linolenic acid metabolic process (GO:0036109)|linoleic acid metabolic process (GO:0043651)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|stearoyl-CoA 9-desaturase activity (GO:0004768)	p.G242G(1)|p.G220G(1)		breast(2)|kidney(2)|large_intestine(4)|liver(1)|lung(2)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	20					Alpha-Linolenic Acid(DB00132)	TTGTTCTGGGCGAATGGCAGC	0.532																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											214.0	167.0	183.0					11																	61615738		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			AF084559	CCDS8012.1, CCDS60807.1, CCDS60808.1	11q12.2	2013-01-25			ENSG00000134824	ENSG00000134824	1.14.19.3	"""Fatty acid desaturases"""	3575	protein-coding gene	gene with protein product	"""delta-6-desaturase"""	606149		LLCDL2			Standard	NM_004265		Approved	FADSD6, D6D, TU13, DES6, SLL0262	uc001nsl.1	O95864	OTTHUMG00000163794	ENST00000278840.4:c.726C>G	11.37:g.61615738C>G			A8K2M6|B7Z634|Q6MZQ7|Q96H07|Q96SV8|Q9H3G3|Q9Y3X4	Silent	SNP	pfam_Fatty_acid_desaturase-1,pfam_Cyt_B5,superfamily_Cyt_B5,pirsf_Fatty_acid/sphinglp_desaturase,pfscan_Cyt_B5	p.G242	ENST00000278840.4	37	c.726	CCDS8012.1	11																																																																																			FADS2	-	pfam_Fatty_acid_desaturase-1,pirsf_Fatty_acid/sphinglp_desaturase	ENSG00000134824		0.532	FADS2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FADS2	HGNC	protein_coding	OTTHUMT00000375586.2	118	0.00	0	C	NM_004265		61615738	61615738	+1	no_errors	ENST00000278840	ensembl	human	known	69_37n	silent	61	22.78	18	SNP	0.953	G
FAM127B	26071	genome.wustl.edu	37	X	134186077	134186077	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chrX:134186077C>T	ENST00000370775.2	-	1	128	c.62G>A	c.(61-63)cGt>cAt	p.R21H	FAM127B_ENST00000520964.1_5'UTR	NM_001078172.1	NP_001071640.1	Q9BWD3	F127B_HUMAN	family with sequence similarity 127, member B	21								p.R21H(1)		breast(3)|endometrium(2)|large_intestine(3)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(192;0.000127)					CCTCCAGCGACGCGCCGCGGG	0.672																																						dbGAP											1	Substitution - Missense(1)	breast(1)											60.0	65.0	64.0					X																	134186077		1977	4112	6089	-	-	-	SO:0001583	missense	0			AL117556	CCDS43998.1	Xq26.3	2014-05-16			ENSG00000203950	ENSG00000203950			24514	protein-coding gene	gene with protein product						9403077, 15716091	Standard	NM_001078172		Approved	DKFZP564B147, MAR8A, CXX1b	uc004eyf.3	Q9BWD3	OTTHUMG00000022466	ENST00000370775.2:c.62G>A	X.37:g.134186077C>T	ENSP00000375267:p.Arg21His		A2A2V9|Q8TBU2	Missense_Mutation	SNP	NULL	p.R21H	ENST00000370775.2	37	c.62	CCDS43998.1	X	.	.	.	.	.	.	.	.	.	.	C	22.0	4.228965	0.79688	.	.	ENSG00000203950	ENST00000370775	T	0.32515	1.45	2.38	2.38	0.29361	.	0.518534	0.14145	U	0.338408	T	0.42720	0.1215	L	0.47716	1.5	0.21579	N	0.99963	D;D	0.76494	0.999;0.997	D;P	0.74674	0.984;0.796	T	0.08330	-1.0727	10	0.46703	T	0.11	.	7.511	0.27573	0.0:1.0:0.0:0.0	.	19;21	Q6IPB9;Q9BWD3	.;F127B_HUMAN	H	21	ENSP00000375267:R21H	ENSP00000375267:R21H	R	-	2	0	FAM127B	134013743	0.159000	0.22864	0.554000	0.28268	0.125000	0.20455	0.385000	0.20685	1.470000	0.48102	0.292000	0.19580	CGT	FAM127B	-	NULL	ENSG00000203950		0.672	FAM127B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM127B	HGNC	protein_coding	OTTHUMT00000058393.2	74	0.00	0	C	NM_001078172		134186077	134186077	-1	no_errors	ENST00000370775	ensembl	human	known	69_37n	missense	27	27.03	10	SNP	0.491	T
ERICH6B	220081	genome.wustl.edu	37	13	46115738	46115738	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr13:46115738C>A	ENST00000298738.2	-	15	2114	c.1950G>T	c.(1948-1950)aaG>aaT	p.K650N	FAM194B_ENST00000504261.1_Intron	NM_182542.2	NP_872348.2	Q5W0A0	ERI6B_HUMAN		650								p.K650N(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)	5						GGACCCGGATCTTCTGGGCTG	0.517																																						dbGAP											1	Substitution - Missense(1)	breast(1)											167.0	159.0	162.0					13																	46115738		692	1591	2283	-	-	-	SO:0001583	missense	0																														ENST00000298738.2:c.1950G>T	13.37:g.46115738C>A	ENSP00000298738:p.Lys650Asn		Q96MB5	Missense_Mutation	SNP	NULL	p.K650N	ENST00000298738.2	37	c.1950	CCDS45045.1	13	.	.	.	.	.	.	.	.	.	.	C	12.95	2.090537	0.36855	.	.	ENSG00000165837	ENST00000298738	T	0.18338	2.22	4.89	3.04	0.35103	.	.	.	.	.	T	0.30792	0.0776	L	0.46157	1.445	0.23010	N	0.998436	D	0.89917	1.0	D	0.87578	0.998	T	0.06881	-1.0802	9	0.87932	D	0	-29.0462	6.6432	0.22921	0.0:0.7516:0.0:0.2484	.	650	Q5W0A0	F194B_HUMAN	N	650	ENSP00000298738:K650N	ENSP00000298738:K650N	K	-	3	2	FAM194B	45013739	0.996000	0.38824	0.822000	0.32727	0.104000	0.19210	0.981000	0.29526	0.516000	0.28340	0.603000	0.83216	AAG	FAM194B	-	NULL	ENSG00000165837		0.517	FAM194B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM194B	HGNC	protein_coding	OTTHUMT00000044781.3	291	0.00	0	C			46115738	46115738	-1	no_errors	ENST00000298738	ensembl	human	known	69_37n	missense	184	18.22	41	SNP	0.913	A
FAM21A	387680	genome.wustl.edu	37	10	51887518	51887518	+	Missense_Mutation	SNP	T	T	G			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr10:51887518T>G	ENST00000282633.5	+	28	3095	c.3050T>G	c.(3049-3051)cTt>cGt	p.L1017R	FAM21A_ENST00000399339.2_Missense_Mutation_p.L929R|FAM21A_ENST00000351071.6_Missense_Mutation_p.L996R|FAM21A_ENST00000314664.7_Missense_Mutation_p.L955R	NM_001005751.1	NP_001005751.1	Q641Q2	FA21A_HUMAN	family with sequence similarity 21, member A	1017					retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|WASH complex (GO:0071203)		p.L1017R(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	15						AGTTTTGATCTTCCAGCTCAG	0.488																																						dbGAP											1	Substitution - Missense(1)	breast(1)											1.0	1.0	1.0					10																	51887518		186	413	599	-	-	-	SO:0001583	missense	0			BC082258	CCDS41527.1	10q11.23	2014-06-19			ENSG00000099290	ENSG00000099290			23416	protein-coding gene	gene with protein product			"""family with sequence similarity 21, member B"""	FAM21B			Standard	XM_005269805		Approved	bA56A21.1, bA98I6.1, FLJ10824	uc001jjb.3	Q641Q2	OTTHUMG00000018225	ENST00000282633.5:c.3050T>G	10.37:g.51887518T>G	ENSP00000282633:p.Leu1017Arg		A2A3S2|A2A3U6|Q6DHY0	Missense_Mutation	SNP	NULL	p.L1017R	ENST00000282633.5	37	c.3050	CCDS41527.1	10	.	.	.	.	.	.	.	.	.	.	t	10.79	1.451033	0.26074	.	.	ENSG00000099290	ENST00000351071;ENST00000314664;ENST00000434114;ENST00000282633;ENST00000399339	.	.	.	4.05	2.68	0.31781	.	1.166710	0.05973	N	0.642767	T	0.54046	0.1834	M	0.72479	2.2	0.23341	N	0.997876	P;P;P;P;D	0.63880	0.935;0.933;0.662;0.887;0.993	P;P;B;B;P	0.61132	0.491;0.576;0.295;0.294;0.884	T	0.42447	-0.9451	9	0.17832	T	0.49	-7.205	3.7344	0.08504	0.2714:0.0:0.1858:0.5429	.	955;996;929;1017;911	E7ESD2;Q641Q2-2;F8W7U3;Q641Q2;Q5T1D7	.;.;.;FA21A_HUMAN;.	R	996;955;911;1017;929	.	ENSP00000282633:L1017R	L	+	2	0	FAM21A	51557524	0.037000	0.19845	1.000000	0.80357	0.844000	0.47949	0.857000	0.27831	1.596000	0.50062	0.155000	0.16302	CTT	FAM21A	-	NULL	ENSG00000099290		0.488	FAM21A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM21A	HGNC	protein_coding	OTTHUMT00000276917.2	30	0.00	0	T	NM_001005751		51887518	51887518	+1	no_errors	ENST00000282633	ensembl	human	known	69_37n	missense	23	14.81	4	SNP	0.785	G
FAM64A	54478	genome.wustl.edu	37	17	6348481	6348481	+	Silent	SNP	C	C	G			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr17:6348481C>G	ENST00000250056.8	+	2	134	c.51C>G	c.(49-51)ctC>ctG	p.L17L	FAM64A_ENST00000572447.1_Silent_p.L17L|FAM64A_ENST00000570337.2_Silent_p.L17L|FAM64A_ENST00000571373.1_Silent_p.L17L|FAM64A_ENST00000572595.2_Silent_p.L17L|FAM64A_ENST00000576056.1_Silent_p.L17L	NM_001195228.1	NP_001182157.1	Q9BSJ6	FA64A_HUMAN	family with sequence similarity 64, member A	17					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)		p.L17L(1)		breast(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7				COAD - Colon adenocarcinoma(228;0.141)		GGAGATCTCTCCAGCACCAGG	0.637																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											26.0	29.0	28.0					17																	6348481		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32541.1, CCDS56016.1	17p13.2	2013-10-11			ENSG00000129195	ENSG00000129195			25483	protein-coding gene	gene with protein product	"""CALM interacting protein expressed in thymus and spleen"""					19383357, 16491119	Standard	NM_019013		Approved	FLJ10156, FLJ10491, CATS	uc002gcw.2	Q9BSJ6	OTTHUMG00000177832	ENST00000250056.8:c.51C>G	17.37:g.6348481C>G			Q96CT4|Q9NVV1|Q9NWB5	Silent	SNP	pfam_DUF1466	p.L17	ENST00000250056.8	37	c.51	CCDS56016.1	17																																																																																			FAM64A	-	pfam_DUF1466	ENSG00000129195		0.637	FAM64A-008	KNOWN	basic|CCDS	protein_coding	FAM64A	HGNC	protein_coding	OTTHUMT00000439156.1	57	0.00	0	C	NM_019013		6348481	6348481	+1	no_errors	ENST00000250056	ensembl	human	known	69_37n	silent	13	48.00	12	SNP	0.001	G
FHOD3	80206	genome.wustl.edu	37	18	34205515	34205516	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr18:34205515_34205516insC	ENST00000359247.4	+	10	999_1000	c.999_1000insC	c.(1000-1002)cccfs	p.P334fs	FHOD3_ENST00000590592.1_Frame_Shift_Ins_p.P334fs|FHOD3_ENST00000257209.4_Frame_Shift_Ins_p.P334fs|FHOD3_ENST00000445677.1_Frame_Shift_Ins_p.P334fs|FHOD3_ENST00000591635.1_Frame_Shift_Ins_p.HP8fs	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	334	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)		p.S336fs*138(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				CCACGGAGCCACCCCCCAGTGG	0.673																																						dbGAP											1	Deletion - Frameshift(1)	large_intestine(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.1005dupC	18.37:g.34205521_34205521dupC	ENSP00000352186:p.Pro334fs		A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Frame_Shift_Ins	INS	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,superfamily_ARM-type_fold,smart_Actin-bd_FH2/DRF_autoreg	p.S335fs	ENST00000359247.4	37	c.999_1000		18																																																																																			FHOD3	-	superfamily_ARM-type_fold	ENSG00000134775		0.673	FHOD3-001	PUTATIVE	basic	protein_coding	FHOD3	HGNC	protein_coding	OTTHUMT00000460884.1	32	0.00	0	-	XM_371114		34205515	34205516	+1	no_errors	ENST00000257209	ensembl	human	known	69_37n	frame_shift_ins	11	15.38	2	INS	0.121:0.999	C
FILIP1	27145	genome.wustl.edu	37	6	76023420	76023420	+	Missense_Mutation	SNP	A	A	G			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr6:76023420A>G	ENST00000237172.7	-	5	2458	c.2128T>C	c.(2128-2130)Ttt>Ctt	p.F710L	FILIP1_ENST00000498523.1_5'UTR|FILIP1_ENST00000370020.1_Missense_Mutation_p.F611L|FILIP1_ENST00000393004.2_Missense_Mutation_p.F710L	NM_015687.2	NP_056502.1	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	710								p.F710L(1)		breast(3)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)	80						TCCAACCGAAATCTGTGTCTC	0.413																																						dbGAP											1	Substitution - Missense(1)	breast(1)											176.0	181.0	180.0					6																	76023420		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033101	CCDS4984.1, CCDS75480.1	6q14.1	2008-02-05			ENSG00000118407	ENSG00000118407			21015	protein-coding gene	gene with protein product		607307				10574462	Standard	XM_005248713		Approved	FILIP, KIAA1275	uc003pia.3	Q7Z7B0	OTTHUMG00000015056	ENST00000237172.7:c.2128T>C	6.37:g.76023420A>G	ENSP00000237172:p.Phe710Leu		B2RMU6|Q5VUL6|Q86TC3|Q8N8B9|Q96SK6|Q9NVI8|Q9ULE5	Missense_Mutation	SNP	pfam_Cortactin-binding_p2_N,prints_Tropomyosin	p.F710L	ENST00000237172.7	37	c.2128	CCDS4984.1	6	.	.	.	.	.	.	.	.	.	.	A	0.133	-1.111526	0.01813	.	.	ENSG00000118407	ENST00000393004;ENST00000237172;ENST00000370020	T;T;T	0.13901	2.55;2.55;2.56	5.45	5.45	0.79879	.	0.178450	0.50627	D	0.000111	T	0.00906	0.0030	N	0.00483	-1.445	0.09310	N	0.999996	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.06405	0.001;0.001;0.002	T	0.44651	-0.9314	10	0.02654	T	1	-19.4767	10.7273	0.46077	0.858:0.0:0.0:0.142	.	710;710;710	A8K2G7;Q7Z7B0;Q7Z7B0-2	.;FLIP1_HUMAN;.	L	710;710;611	ENSP00000376728:F710L;ENSP00000237172:F710L;ENSP00000359037:F611L	ENSP00000237172:F710L	F	-	1	0	FILIP1	76080140	1.000000	0.71417	0.931000	0.37212	0.990000	0.78478	4.296000	0.59055	2.071000	0.62044	0.460000	0.39030	TTT	FILIP1	-	NULL	ENSG00000118407		0.413	FILIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FILIP1	HGNC	protein_coding	OTTHUMT00000041263.1	173	0.00	0	A	XM_029179		76023420	76023420	-1	no_errors	ENST00000237172	ensembl	human	known	69_37n	missense	145	12.12	20	SNP	0.253	G
FRAS1	80144	genome.wustl.edu	37	4	79322001	79322001	+	Missense_Mutation	SNP	A	A	C			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr4:79322001A>C	ENST00000325942.6	+	30	4529	c.4089A>C	c.(4087-4089)gaA>gaC	p.E1363D	FRAS1_ENST00000264895.6_Missense_Mutation_p.E1363D	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	1363					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)	p.E1363D(3)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						CCAGTGCTGAAGAAATCATCT	0.478																																						dbGAP											3	Substitution - Missense(3)	breast(3)											82.0	86.0	84.0					4																	79322001		1923	4128	6051	-	-	-	SO:0001583	missense	0			AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.4089A>C	4.37:g.79322001A>C	ENSP00000326330:p.Glu1363Asp		A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	pfam_Calx_beta,pfam_VWF_C,superfamily_Growth_fac_rcpt,superfamily_Cadherin-like,smart_VWC_out,smart_VWF_C,smart_Furin_repeat,smart_EGF-like,smart_Calx_beta,pfscan_VWF_C	p.E1363D	ENST00000325942.6	37	c.4089	CCDS54772.1	4	.	.	.	.	.	.	.	.	.	.	A	11.75	1.731256	0.30684	.	.	ENSG00000138759	ENST00000325942;ENST00000264895	T;T	0.25749	1.78;1.78	5.32	-2.48	0.06423	.	0.403365	0.25096	N	0.033176	T	0.07548	0.0190	N	0.04724	-0.175	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.24225	-1.0166	10	0.19147	T	0.46	.	1.5847	0.02641	0.3256:0.2308:0.0761:0.3675	.	1363;1363	E9PHH6;A2RRR8	.;.	D	1363	ENSP00000326330:E1363D;ENSP00000264895:E1363D	ENSP00000264895:E1363D	E	+	3	2	FRAS1	79541025	0.914000	0.31030	0.830000	0.32933	0.739000	0.42172	-0.083000	0.11286	-0.239000	0.09710	0.402000	0.26972	GAA	FRAS1	-	NULL	ENSG00000138759		0.478	FRAS1-001	NOVEL	basic|CCDS	protein_coding	FRAS1	HGNC	protein_coding	OTTHUMT00000362706.2	243	0.00	0	A			79322001	79322001	+1	no_errors	ENST00000264895	ensembl	human	known	69_37n	missense	205	15.29	37	SNP	0.967	C
GOLGA5	9950	genome.wustl.edu	37	14	93275676	93275676	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr14:93275676G>C	ENST00000163416.2	+	4	1060	c.804G>C	c.(802-804)aaG>aaC	p.K268N	GOLGA5_ENST00000355976.2_Missense_Mutation_p.K268N	NM_005113.2	NP_005104	Q8TBA6	GOGA5_HUMAN	golgin A5	268					Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein homodimerization activity (GO:0042803)|Rab GTPase binding (GO:0017137)	p.K268N(1)		large_intestine(6)|lung(1)|ovary(2)	9		all_cancers(154;0.0934)		COAD - Colon adenocarcinoma(157;0.222)		GAGTTGAAAAGTGGAATGCTG	0.403			T	RET	papillary thyroid																																	dbGAP		Dom	yes		14	14q	9950	"""golgi autoantigen, golgin subfamily a, 5  (PTC5)"""		E	1	Substitution - Missense(1)	breast(1)											58.0	54.0	55.0					14																	93275676		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF085199	CCDS9905.1	14q32.12	2012-05-04	2010-02-12		ENSG00000066455	ENSG00000066455			4428	protein-coding gene	gene with protein product	"""golgi integral membrane protein 5"""	606918	"""golgi autoantigen, golgin subfamily a, 5"""			2734021, 9443391, 15004235	Standard	NM_005113		Approved	ret-II, golgin-84, rfg5, GOLIM5	uc001yaz.1	Q8TBA6	OTTHUMG00000171217	ENST00000163416.2:c.804G>C	14.37:g.93275676G>C	ENSP00000163416:p.Lys268Asn		C9JRU1|O95287|Q03962|Q2TS49|Q9UQQ7	Missense_Mutation	SNP	pfam_Golgin_subfamily_A_member_5,superfamily_Prefoldin	p.K268N	ENST00000163416.2	37	c.804	CCDS9905.1	14	.	.	.	.	.	.	.	.	.	.	G	11.57	1.677305	0.29783	.	.	ENSG00000066455	ENST00000163416;ENST00000355976;ENST00000439315	T;T	0.57107	0.42;0.42	6.08	2.62	0.31277	.	0.000000	0.51477	D	0.000093	T	0.42517	0.1206	M	0.62723	1.935	0.53688	D	0.999979	B	0.32324	0.364	B	0.27887	0.084	T	0.21449	-1.0245	10	0.27082	T	0.32	-31.8965	7.3445	0.26656	0.1816:0.0:0.6808:0.1376	.	268	Q8TBA6	GOGA5_HUMAN	N	268;268;177	ENSP00000163416:K268N;ENSP00000348252:K268N	ENSP00000163416:K268N	K	+	3	2	GOLGA5	92345429	1.000000	0.71417	1.000000	0.80357	0.454000	0.32378	1.700000	0.37815	0.780000	0.33566	-0.182000	0.12963	AAG	GOLGA5	-	pfam_Golgin_subfamily_A_member_5	ENSG00000066455		0.403	GOLGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA5	HGNC	protein_coding	OTTHUMT00000412365.1	40	0.00	0	G			93275676	93275676	+1	no_errors	ENST00000163416	ensembl	human	known	69_37n	missense	20	37.50	12	SNP	1.000	C
GPLD1	2822	genome.wustl.edu	37	6	24476481	24476481	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr6:24476481G>T	ENST00000230036.1	-	4	368	c.258C>A	c.(256-258)agC>agA	p.S86R	GPLD1_ENST00000474784.1_5'UTR	NM_001503.3	NP_001494.2	P80108	PHLD_HUMAN	glycosylphosphatidylinositol specific phospholipase D1	86					cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to calcium ion (GO:0071277)|cellular response to cholesterol (GO:0071397)|cellular response to drug (GO:0035690)|cellular response to insulin stimulus (GO:0032869)|cellular response to pH (GO:0071467)|cellular response to triglyceride (GO:0071401)|chondrocyte differentiation (GO:0002062)|complement receptor mediated signaling pathway (GO:0002430)|GPI anchor release (GO:0006507)|hematopoietic stem cell migration (GO:0035701)|hematopoietic stem cell migration to bone marrow (GO:0097241)|insulin receptor signaling pathway (GO:0008286)|negative regulation of cell proliferation (GO:0008285)|negative regulation of triglyceride catabolic process (GO:0010897)|ossification (GO:0001503)|phosphatidylcholine metabolic process (GO:0046470)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of high-density lipoprotein particle clearance (GO:0010983)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of secretion (GO:0051047)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cellular response to insulin stimulus (GO:1900076)|response to glucose (GO:0009749)|transepithelial transport (GO:0070633)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|proteinaceous extracellular matrix (GO:0005578)	glycosylphosphatidylinositol phospholipase D activity (GO:0004621)|phospholipase D activity (GO:0004630)|sodium channel regulator activity (GO:0017080)	p.S86R(2)		breast(3)|endometrium(5)|kidney(1)|large_intestine(11)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	32						TCCAGTGAGTGCTCTCAGACA	0.448																																						dbGAP											2	Substitution - Missense(2)	breast(2)											60.0	55.0	57.0					6																	24476481		2203	4298	6501	-	-	-	SO:0001583	missense	0			L11701	CCDS4553.1	6p22.1	2008-02-05			ENSG00000112293	ENSG00000112293			4459	protein-coding gene	gene with protein product		602515				11072085	Standard	NM_001503		Approved		uc003ned.2	P80108	OTTHUMG00000016104	ENST00000230036.1:c.258C>A	6.37:g.24476481G>T	ENSP00000230036:p.Ser86Arg		Q15127|Q15128|Q2M2F2|Q5T3Y0|Q7Z6T8|Q8TCV0|Q8WW82|Q96ID6|Q9H167|Q9H4M1|Q9UJC9	Missense_Mutation	SNP	pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Gprt_PLipase_D	p.S86R	ENST00000230036.1	37	c.258	CCDS4553.1	6	.	.	.	.	.	.	.	.	.	.	G	16.50	3.141520	0.57044	.	.	ENSG00000112293	ENST00000230036;ENST00000378243	T	0.43294	0.95	5.58	-0.928	0.10448	.	0.372063	0.28736	N	0.014308	T	0.08133	0.0203	N	0.21583	0.68	0.29487	N	0.855954	B;B	0.17667	0.023;0.002	B;B	0.16289	0.015;0.01	T	0.31475	-0.9942	10	0.22706	T	0.39	-10.2096	5.4926	0.16785	0.3838:0.2156:0.4006:0.0	.	86;86	P80108-2;P80108	.;PHLD_HUMAN	R	86	ENSP00000230036:S86R	ENSP00000230036:S86R	S	-	3	2	GPLD1	24584460	0.966000	0.33281	0.997000	0.53966	0.959000	0.62525	-0.066000	0.11598	-0.105000	0.12132	-0.448000	0.05591	AGC	GPLD1	-	prints_Gprt_PLipase_D	ENSG00000112293		0.448	GPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPLD1	HGNC	protein_coding	OTTHUMT00000043315.1	151	0.65	1	G	NM_001503		24476481	24476481	-1	no_errors	ENST00000230036	ensembl	human	known	69_37n	missense	95	12.84	14	SNP	0.989	T
GRIN2A	2903	genome.wustl.edu	37	16	10032157	10032157	+	Missense_Mutation	SNP	G	G	C	rs143594020	byFrequency	TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr16:10032157G>C	ENST00000396573.2	-	4	975	c.666C>G	c.(664-666)atC>atG	p.I222M	GRIN2A_ENST00000330684.3_Missense_Mutation_p.I222M|GRIN2A_ENST00000562109.1_Missense_Mutation_p.I222M|GRIN2A_ENST00000535259.1_Missense_Mutation_p.I65M|GRIN2A_ENST00000396575.2_Missense_Mutation_p.I222M|GRIN2A_ENST00000404927.2_Missense_Mutation_p.I222M|GRIN2A_ENST00000566670.1_5'UTR	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	222					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.I222M(1)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CAGAAGAGTGGATCTTCTTCA	0.507																																						dbGAP											1	Substitution - Missense(1)	breast(1)											113.0	101.0	105.0					16																	10032157		2197	4300	6497	-	-	-	SO:0001583	missense	0				CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.666C>G	16.37:g.10032157G>C	ENSP00000379818:p.Ile222Met		O00669|Q17RZ6	Missense_Mutation	SNP	pfam_NMDAR2_C,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.I222M	ENST00000396573.2	37	c.666	CCDS10539.1	16	.	.	.	.	.	.	.	.	.	.	g	15.74	2.922921	0.52653	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	D;D;D;D;D	0.81908	-1.55;-1.55;-1.55;-1.55;-1.55	5.09	2.09	0.27110	Extracellular ligand-binding receptor (1);	0.167346	0.53938	D	0.000050	D	0.87649	0.6230	M	0.73598	2.24	0.38365	D	0.944727	P;P;D	0.53462	0.811;0.939;0.96	P;D;P	0.64321	0.8;0.924;0.827	D	0.85902	0.1435	9	.	.	.	.	8.4795	0.33034	0.3896:0.0:0.6104:0.0	.	65;222;222	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	M	222;222;65;222;222	ENSP00000379818:I222M;ENSP00000385872:I222M;ENSP00000441572:I65M;ENSP00000332549:I222M;ENSP00000379820:I222M	.	I	-	3	3	GRIN2A	9939658	0.934000	0.31675	1.000000	0.80357	0.946000	0.59487	0.065000	0.14466	0.270000	0.21984	0.561000	0.74099	ATC	GRIN2A	-	pfam_ANF_lig-bd_rcpt	ENSG00000183454		0.507	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2A	HGNC	protein_coding	OTTHUMT00000251930.3	79	0.00	0	G			10032157	10032157	-1	no_errors	ENST00000330684	ensembl	human	known	69_37n	missense	43	17.31	9	SNP	1.000	C
HEG1	57493	genome.wustl.edu	37	3	124732481	124732481	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr3:124732481C>A	ENST00000311127.4	-	6	2009	c.1942G>T	c.(1942-1944)Gtt>Ttt	p.V648F	HEG1_ENST00000477536.1_5'UTR	NM_020733.1	NP_065784.1	Q9ULI3	HEG1_HUMAN	heart development protein with EGF-like domains 1	648	Ser-rich.				cardiac atrium morphogenesis (GO:0003209)|cell-cell junction assembly (GO:0007043)|endothelial cell morphogenesis (GO:0001886)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|lymph circulation (GO:0003017)|lymph vessel development (GO:0001945)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|post-embryonic development (GO:0009791)|regulation of body fluid levels (GO:0050878)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)	p.V648F(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(24)|ovary(2)|urinary_tract(4)	47						GTGTCCAGAACAACCGAAGTG	0.517																																						dbGAP											1	Substitution - Missense(1)	breast(1)											76.0	84.0	81.0					3																	124732481		2177	4273	6450	-	-	-	SO:0001583	missense	0			AK074987	CCDS46898.1	3q21.2	2013-03-08	2013-03-08		ENSG00000173706	ENSG00000173706			29227	protein-coding gene	gene with protein product	"""heart of glass"""	614182	"""HEG homolog 1 (zebrafish)"""			10574462, 19151727, 23007647	Standard	NM_020733		Approved	KIAA1237, HEG	uc003ehs.4	Q9ULI3	OTTHUMG00000159486	ENST00000311127.4:c.1942G>T	3.37:g.124732481C>A	ENSP00000311502:p.Val648Phe		Q6NX66|Q8NC40|Q9BSV0	Missense_Mutation	SNP	pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	p.V648F	ENST00000311127.4	37	c.1942	CCDS46898.1	3	.	.	.	.	.	.	.	.	.	.	C	12.29	1.894320	0.33442	.	.	ENSG00000173706	ENST00000311127	D	0.89270	-2.49	5.41	1.62	0.23740	.	0.490245	0.14311	U	0.327672	T	0.71459	0.3342	N	0.08118	0	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.08055	0.003;0.001	T	0.55976	-0.8055	10	0.10111	T	0.7	.	5.2823	0.15682	0.3128:0.301:0.3862:0.0	.	648;648	Q9ULI3-2;Q9ULI3	.;HEG1_HUMAN	F	648	ENSP00000311502:V648F	ENSP00000311502:V648F	V	-	1	0	HEG1	126215171	0.000000	0.05858	0.000000	0.03702	0.270000	0.26580	0.061000	0.14366	0.421000	0.25980	0.563000	0.77884	GTT	HEG1	-	NULL	ENSG00000173706		0.517	HEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEG1	HGNC	protein_coding	OTTHUMT00000355732.2	186	0.00	0	C	XM_087386		124732481	124732481	-1	no_errors	ENST00000311127	ensembl	human	known	69_37n	missense	106	28.86	43	SNP	0.000	A
HFM1	164045	genome.wustl.edu	37	1	91788756	91788756	+	Splice_Site	SNP	C	C	A			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr1:91788756C>A	ENST00000370425.3	-	22	2526	c.2428G>T	c.(2428-2430)Gtt>Ttt	p.V810F	HFM1_ENST00000370424.3_Splice_Site_p.V489F|HFM1_ENST00000294696.5_Splice_Site_p.V42F|HFM1_ENST00000462405.1_5'UTR	NM_001017975.3	NP_001017975.3	A2PYH4	HFM1_HUMAN	HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)	810	SEC63.				resolution of meiotic recombination intermediates (GO:0000712)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.V810F(1)		breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(33)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	75		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		ATCAATGTAACCTATAACATT	0.303																																						dbGAP											1	Substitution - Missense(1)	breast(1)											57.0	61.0	59.0					1																	91788756		2203	4274	6477	-	-	-	SO:0001630	splice_region_variant	0			AB204867	CCDS30769.2	1p22.2	2008-03-26			ENSG00000162669	ENSG00000162669			20193	protein-coding gene	gene with protein product		615684	"""SEC63 domain containing 1"""	SEC63D1		14702039, 17286053	Standard	XM_006710395		Approved	MER3, FLJ39011, FLJ36760	uc001doa.4	A2PYH4	OTTHUMG00000010093	ENST00000370425.3:c.2428-1G>T	1.37:g.91788756C>A			B1B0B6|Q8N9Q0	Missense_Mutation	SNP	pfam_Sec63-dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Sec63-dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.V810F	ENST00000370425.3	37	c.2428	CCDS30769.2	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.59|11.59	1.685399|1.685399	0.29872|0.29872	.|.	.|.	ENSG00000162669|ENSG00000162669	ENST00000370425;ENST00000294696;ENST00000370424;ENST00000370421|ENST00000430465	T;T;T|.	0.59502|.	0.26;0.26;0.26|.	5.18|5.18	3.28|3.28	0.37604|0.37604	Sec63 domain (2);|.	0.213953|.	0.40144|.	N|.	0.001165|.	T|T	0.43656|0.43656	0.1257|0.1257	L|L	0.50333|0.50333	1.59|1.59	0.38754|0.38754	D|D	0.954173|0.954173	B;B;P|.	0.36712|.	0.245;0.362;0.566|.	B;B;B|.	0.40228|.	0.073;0.323;0.315|.	T|T	0.34004|0.34004	-0.9846|-0.9846	10|5	0.33940|.	T|.	0.23|.	.|.	9.9085|9.9085	0.41390|0.41390	0.0:0.7702:0.0:0.2298|0.0:0.7702:0.0:0.2298	.|.	489;65;810|.	A6NGI5;B1B0B5;A2PYH4|.	.;.;HFM1_HUMAN|.	F|C	810;42;489;494|65	ENSP00000359454:V810F;ENSP00000294696:V42F;ENSP00000359453:V489F|.	ENSP00000294696:V42F|.	V|W	-|-	1|3	0|0	HFM1|HFM1	91561344|91561344	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.730000|0.730000	0.41778|0.41778	0.897000|0.897000	0.28390|0.28390	0.552000|0.552000	0.29026|0.29026	0.655000|0.655000	0.94253|0.94253	GTT|TGG	HFM1	-	pfam_Sec63-dom,smart_Sec63-dom	ENSG00000162669		0.303	HFM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HFM1	HGNC	protein_coding	OTTHUMT00000316716.2	45	0.00	0	C	NM_001017975	Missense_Mutation	91788756	91788756	-1	no_errors	ENST00000370425	ensembl	human	known	69_37n	missense	92	19.30	22	SNP	1.000	A
HIF1AN	55662	genome.wustl.edu	37	10	102296311	102296311	+	Silent	SNP	G	G	A			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr10:102296311G>A	ENST00000299163.6	+	2	421	c.321G>A	c.(319-321)aaG>aaA	p.K107K	HIF1AN_ENST00000528044.1_3'UTR	NM_017902.2	NP_060372.2	Q9NWT6	HIF1N_HUMAN	hypoxia inducible factor 1, alpha subunit inhibitor	107	Interaction with VHL.				cellular response to hypoxia (GO:0071456)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|oxidation-reduction process (GO:0055114)|peptidyl-asparagine hydroxylation (GO:0042265)|peptidyl-aspartic acid hydroxylation (GO:0042264)|peptidyl-histidine hydroxylation (GO:0036138)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of vasculogenesis (GO:2001214)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ankyrin repeat binding (GO:0071532)|carboxylic acid binding (GO:0031406)|cofactor binding (GO:0048037)|iron ion binding (GO:0005506)|NF-kappaB binding (GO:0051059)|Notch binding (GO:0005112)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|oxygen sensor activity (GO:0019826)|peptidyl-asparagine 3-dioxygenase activity (GO:0036140)|peptidyl-histidine dioxygenase activity (GO:0036139)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)	p.K107K(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(1)|prostate(2)|urinary_tract(1)	10		Colorectal(252;0.234)		Epithelial(162;6.75e-10)|all cancers(201;4.88e-08)		ATGAGAAGAAGATGGCCAATT	0.448																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											91.0	94.0	93.0					10																	102296311		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK000622	CCDS7498.1	10q24	2008-12-18	2008-12-02		ENSG00000166135	ENSG00000166135	1.14.11.16		17113	protein-coding gene	gene with protein product	"""Peptide-aspartate beta-dioxygenase"""	606615				11641274	Standard	NM_017902		Approved	FLJ20615, DKFZp762F1811, FLJ22027, FIH1	uc001krj.4	Q9NWT6	OTTHUMG00000018911	ENST00000299163.6:c.321G>A	10.37:g.102296311G>A			D3DR69|Q5W147|Q969Q7|Q9NPV5	Silent	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.K107	ENST00000299163.6	37	c.321	CCDS7498.1	10																																																																																			HIF1AN	-	NULL	ENSG00000166135		0.448	HIF1AN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HIF1AN	HGNC	protein_coding	OTTHUMT00000049865.5	101	0.00	0	G	NM_017902		102296311	102296311	+1	no_errors	ENST00000299163	ensembl	human	known	69_37n	silent	47	40.74	33	SNP	1.000	A
HIVEP1	3096	genome.wustl.edu	37	6	12122400	12122400	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr6:12122400C>G	ENST00000379388.2	+	4	2704	c.2372C>G	c.(2371-2373)tCt>tGt	p.S791C		NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	791					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S791C(1)		NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				TTTAAAGATTCTTTCCAGTTT	0.418																																						dbGAP											1	Substitution - Missense(1)	breast(1)											88.0	85.0	86.0					6																	12122400		1891	4112	6003	-	-	-	SO:0001583	missense	0			J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.2372C>G	6.37:g.12122400C>G	ENSP00000368698:p.Ser791Cys		B2RTU3|Q14122|Q5MPB1|Q5VW60	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S791C	ENST00000379388.2	37	c.2372	CCDS43426.1	6	.	.	.	.	.	.	.	.	.	.	C	23.7	4.445177	0.83993	.	.	ENSG00000095951	ENST00000379388	T	0.11712	2.75	6.01	6.01	0.97437	.	0.000000	0.35870	N	0.002929	T	0.28928	0.0718	M	0.74647	2.275	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.00408	-1.1758	9	.	.	.	-23.5283	20.5211	0.99222	0.0:1.0:0.0:0.0	.	791	P15822	ZEP1_HUMAN	C	791	ENSP00000368698:S791C	.	S	+	2	0	HIVEP1	12230386	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.487000	0.81328	2.861000	0.98227	0.650000	0.86243	TCT	HIVEP1	-	NULL	ENSG00000095951		0.418	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP1	HGNC	protein_coding	OTTHUMT00000039870.2	96	0.00	0	C	NM_002114		12122400	12122400	+1	no_errors	ENST00000379388	ensembl	human	known	69_37n	missense	67	30.93	30	SNP	1.000	G
HJURP	55355	genome.wustl.edu	37	2	234750428	234750428	+	Missense_Mutation	SNP	C	C	A	rs140912561		TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr2:234750428C>A	ENST00000411486.2	-	8	1063	c.998G>T	c.(997-999)gGg>gTg	p.G333V	HJURP_ENST00000432087.1_Missense_Mutation_p.G279V|HJURP_ENST00000434039.1_5'Flank|HJURP_ENST00000441687.1_Missense_Mutation_p.G248V	NM_018410.3	NP_060880.3	Q8NCD3	HJURP_HUMAN	Holliday junction recognition protein	333					cell cycle (GO:0007049)|CENP-A containing nucleosome assembly (GO:0034080)|chromosome segregation (GO:0007059)|nucleosome assembly (GO:0006334)|regulation of DNA binding (GO:0051101)|regulation of protein complex assembly (GO:0043254)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|identical protein binding (GO:0042802)	p.G333V(1)		NS(2)|breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(3)|lung(11)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Breast(86;0.00204)|all_lung(227;0.00433)|Renal(207;0.00685)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0719)|Lung SC(224;0.128)		Epithelial(121;2.01e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000186)|Lung(119;0.00521)|LUSC - Lung squamous cell carcinoma(224;0.00829)		TGCCCCTGTCCCTTTCACAGG	0.428																																						dbGAP											1	Substitution - Missense(1)	breast(1)											57.0	59.0	59.0					2																	234750428		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33406.1, CCDS63166.1, CCDS63167.1	2q37.1	2007-12-06			ENSG00000123485	ENSG00000123485			25444	protein-coding gene	gene with protein product		612667				17823411	Standard	NM_001282962		Approved	DKFZp762E1312, URLC9, hFLEG1, FAKTS	uc002vvg.3	Q8NCD3	OTTHUMG00000059125	ENST00000411486.2:c.998G>T	2.37:g.234750428C>A	ENSP00000414109:p.Gly333Val		A8IRH5|B4DWR0|B4DZV4|Q9BUT2|Q9NSL8	Missense_Mutation	SNP	pfam_HJURP,pfam_HJURP_C,pfam_Centromere_Scm3_N	p.G333V	ENST00000411486.2	37	c.998	CCDS33406.1	2	.	.	.	.	.	.	.	.	.	.	T	10.58	1.390790	0.25118	.	.	ENSG00000123485	ENST00000411486;ENST00000432087;ENST00000441687;ENST00000414924	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	4.36	3.2	0.36748	Holliday junction recognition protein, HJURP (1);	1.505550	0.03911	N	0.281860	T	0.27027	0.0662	N	0.08118	0	0.09310	N	1	B;B;B	0.12013	0.004;0.004;0.005	B;B;B	0.20577	0.018;0.018;0.03	T	0.26467	-1.0102	10	0.62326	D	0.03	-0.8974	5.506	0.16854	0.0:0.2406:0.0:0.7594	.	248;279;333	Q8NCD3-3;Q8NCD3-2;Q8NCD3	.;.;HJURP_HUMAN	V	333;279;248;248	ENSP00000414109:G333V;ENSP00000407208:G279V;ENSP00000401944:G248V;ENSP00000393253:G248V	ENSP00000414109:G333V	G	-	2	0	HJURP	234415167	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.216000	0.17585	0.439000	0.26476	-0.254000	0.11334	GGG	HJURP	-	pfam_HJURP	ENSG00000123485		0.428	HJURP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HJURP	HGNC	protein_coding	OTTHUMT00000130996.6	117	0.00	0	C	NM_018410		234750428	234750428	-1	no_errors	ENST00000411486	ensembl	human	known	69_37n	missense	59	14.49	10	SNP	0.000	A
HSPB3	8988	genome.wustl.edu	37	5	53751624	53751624	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr5:53751624C>T	ENST00000302005.1	+	1	180	c.5C>T	c.(4-6)gCa>gTa	p.A2V		NM_006308.2	NP_006299.1	Q12988	HSPB3_HUMAN	heat shock 27kDa protein 3	2					cell death (GO:0008219)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.A2V(1)		breast(1)|large_intestine(4)|prostate(3)	8		Lung NSC(810;0.00104)				TTCACTATGGCAAAAATCATT	0.488																																						dbGAP											1	Substitution - Missense(1)	breast(1)											80.0	80.0	80.0					5																	53751624		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y17782	CCDS3961.1	5q11.2	2011-09-02	2002-08-29		ENSG00000169271	ENSG00000169271		"""Heat shock proteins / HSPB"""	5248	protein-coding gene	gene with protein product		604624	"""heat shock 27kD protein 3"""			8972725, 9858786	Standard	NM_006308		Approved	HSPL27	uc003jph.2	Q12988	OTTHUMG00000096995	ENST00000302005.1:c.5C>T	5.37:g.53751624C>T	ENSP00000303394:p.Ala2Val			Missense_Mutation	SNP	pfam_Hsp20,superfamily_HSP20-like_chaperone,pfscan_Hsp20,prints_Alpha-crystallin/HSP	p.A2V	ENST00000302005.1	37	c.5	CCDS3961.1	5	.	.	.	.	.	.	.	.	.	.	C	13.36	2.213413	0.39102	.	.	ENSG00000169271	ENST00000302005	D	0.91686	-2.89	6.03	4.13	0.48395	.	0.265626	0.31734	N	0.007156	D	0.87470	0.6185	L	0.47716	1.5	0.34647	D	0.72123	P	0.43633	0.813	B	0.37943	0.261	D	0.91013	0.4851	10	0.59425	D	0.04	-17.2996	10.9401	0.47268	0.2352:0.6621:0.1027:0.0	.	2	Q12988	HSPB3_HUMAN	V	2	ENSP00000303394:A2V	ENSP00000303394:A2V	A	+	2	0	HSPB3	53787381	1.000000	0.71417	1.000000	0.80357	0.362000	0.29581	1.695000	0.37763	2.854000	0.98071	0.655000	0.94253	GCA	HSPB3	-	NULL	ENSG00000169271		0.488	HSPB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPB3	HGNC	protein_coding	OTTHUMT00000214074.2	60	0.00	0	C			53751624	53751624	+1	no_errors	ENST00000302005	ensembl	human	known	69_37n	missense	29	17.14	6	SNP	1.000	T
HTR1E	3354	genome.wustl.edu	37	6	87725567	87725567	+	Missense_Mutation	SNP	A	A	T			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr6:87725567A>T	ENST00000305344.5	+	2	1218	c.515A>T	c.(514-516)cAg>cTg	p.Q172L		NM_000865.2	NP_000856.1	P28566	5HT1E_HUMAN	5-hydroxytryptamine (serotonin) receptor 1E, G protein-coupled	172					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.Q172L(1)		breast(3)|endometrium(2)|kidney(3)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(3)	41		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)		BRCA - Breast invasive adenocarcinoma(108;0.055)	Aripiprazole(DB01238)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ketamine(DB01221)|Loxapine(DB00408)|Methysergide(DB00247)|Olanzapine(DB00334)|Quetiapine(DB01224)|Ziprasidone(DB00246)	CCCCCTAGTCAGTGCACCATC	0.522																																						dbGAP											1	Substitution - Missense(1)	breast(1)											107.0	99.0	102.0					6																	87725567		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5006.1	6q14-q15	2013-06-19	2012-02-03		ENSG00000168830	ENSG00000168830		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5291	protein-coding gene	gene with protein product		182132	"""5-hydroxytryptamine (serotonin) receptor 1E"""			1608964	Standard	NM_000865		Approved	5-HT1E	uc003pli.3	P28566	OTTHUMG00000015154	ENST00000305344.5:c.515A>T	6.37:g.87725567A>T	ENSP00000307766:p.Gln172Leu		E1P503|Q9P1Y1	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,prints_7TM_GPCR_Rhodpsn,prints_5HT_rcpt,pfscan_GPCR_Rhodpsn_supfam	p.Q172L	ENST00000305344.5	37	c.515	CCDS5006.1	6	.	.	.	.	.	.	.	.	.	.	A	14.00	2.404203	0.42613	.	.	ENSG00000168830	ENST00000305344;ENST00000369584	T;T	0.35973	1.28;1.28	4.33	4.33	0.51752	GPCR, rhodopsin-like superfamily (1);	0.000000	0.33496	U	0.004859	T	0.17746	0.0426	L	0.39467	1.215	0.40702	D	0.982499	B	0.23990	0.095	B	0.29440	0.102	T	0.04767	-1.0928	10	0.33141	T	0.24	.	13.484	0.61355	1.0:0.0:0.0:0.0	.	172	P28566	5HT1E_HUMAN	L	172	ENSP00000307766:Q172L;ENSP00000358597:Q172L	ENSP00000307766:Q172L	Q	+	2	0	HTR1E	87782286	1.000000	0.71417	1.000000	0.80357	0.789000	0.44602	6.993000	0.76245	1.599000	0.50093	0.332000	0.21555	CAG	HTR1E	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000168830		0.522	HTR1E-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR1E	HGNC	protein_coding	OTTHUMT00000472488.2	89	0.00	0	A	NM_000865		87725567	87725567	+1	no_errors	ENST00000305344	ensembl	human	known	69_37n	missense	28	31.71	13	SNP	1.000	T
HYDIN	54768	genome.wustl.edu	37	16	70969958	70969958	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr16:70969958C>T	ENST00000393567.2	-	45	7205	c.7055G>A	c.(7054-7056)cGa>cAa	p.R2352Q		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	2352					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				TTCCTTTTGTCGCTCCAGCTC	0.507																																						dbGAP											0													3.0	4.0	3.0					16																	70969958		1523	3343	4866	-	-	-	SO:0001583	missense	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.7055G>A	16.37:g.70969958C>T	ENSP00000377197:p.Arg2352Gln		A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	superfamily_PapD-like	p.R2351Q	ENST00000393567.2	37	c.7052	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	C	28.8	4.955144	0.92726	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.01034	5.42	5.49	5.49	0.81192	.	0.000000	0.29806	U	0.011150	T	0.03263	0.0095	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.66097	-0.6008	10	0.49607	T	0.09	.	18.9626	0.92682	0.0:1.0:0.0:0.0	.	2351	F8WD23	.	Q	2352;2351	ENSP00000377197:R2352Q	ENSP00000313052:R2351Q	R	-	2	0	HYDIN	69527459	0.987000	0.35691	0.730000	0.30809	0.843000	0.47879	2.900000	0.48687	2.586000	0.87340	0.609000	0.83330	CGA	HYDIN	-	NULL	ENSG00000157423		0.507	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	27	0.00	0	C			70969958	70969958	-1	no_errors	ENST00000316490	ensembl	human	known	69_37n	missense	15	28.57	6	SNP	0.893	T
IFNA14	3448	genome.wustl.edu	37	9	21239901	21239901	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr9:21239901C>A	ENST00000380222.2	-	1	77	c.34G>T	c.(34-36)Gtg>Ttg	p.V12L		NM_002172.2	NP_002163.2	P01570	IFN14_HUMAN	interferon, alpha 14	12					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|cytokine receptor binding (GO:0005126)|type I interferon receptor binding (GO:0005132)	p.V12L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(7)	11				Lung(24;2.12e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		CTGAGCACCACCAGGGCCATC	0.507																																						dbGAP											1	Substitution - Missense(1)	breast(1)											96.0	95.0	96.0					9																	21239901		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6501.1	9p22	2010-08-24			ENSG00000228083	ENSG00000228083		"""Interferons"""	5420	protein-coding gene	gene with protein product		147579				1385305	Standard	NM_002172		Approved	LEIF2H, IFN-alphaH	uc010mis.3	P01570	OTTHUMG00000019665	ENST00000380222.2:c.34G>T	9.37:g.21239901C>A	ENSP00000369571:p.Val12Leu		Q5VZ56|Q7M4S1	Missense_Mutation	SNP	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	p.V12L	ENST00000380222.2	37	c.34	CCDS6501.1	9	.	.	.	.	.	.	.	.	.	.	c	8.963	0.971001	0.18659	.	.	ENSG00000228083	ENST00000380222	T	0.03152	4.03	3.42	-1.49	0.08718	.	0.851240	0.09947	N	0.735178	T	0.05960	0.0155	M	0.64260	1.97	0.09310	N	0.999999	B	0.09022	0.002	B	0.12837	0.008	T	0.32375	-0.9909	10	0.38643	T	0.18	.	13.4585	0.61212	0.0:0.2848:0.7152:0.0	.	12	P01570	IFN14_HUMAN	L	12	ENSP00000369571:V12L	ENSP00000369571:V12L	V	-	1	0	IFNA14	21229901	0.000000	0.05858	0.027000	0.17364	0.112000	0.19704	-1.870000	0.01641	-0.435000	0.07264	-0.535000	0.04281	GTG	IFNA14	-	pfam_Interferon_alpha/beta/delta	ENSG00000228083		0.507	IFNA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNA14	HGNC	protein_coding	OTTHUMT00000051894.1	149	0.00	0	C	NM_002172		21239901	21239901	-1	no_errors	ENST00000380222	ensembl	human	known	69_37n	missense	95	13.64	15	SNP	0.096	A
IGLV1-40	28825	genome.wustl.edu	37	22	22764392	22764392	+	RNA	SNP	G	G	C	rs143677402	byFrequency	TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr22:22764392G>C	ENST00000390299.2	+	0	185									immunoglobulin lambda variable 1-40																		ACTGGGAGCAGCTCCAACATC	0.617													-|||	2	0.000399361	0.0015	0.0	5008	,	,		16219	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													143.0	147.0	145.0					22																	22764392		1947	4144	6091	-	-	-			0			M94116		22q11.2	2012-02-08			ENSG00000211653	ENSG00000211653		"""Immunoglobulins / IGL locus"""	5877	other	immunoglobulin gene							Standard	NG_000002		Approved				OTTHUMG00000151072		22.37:g.22764392G>C				Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.S45T	ENST00000390299.2	37	c.134		22																																																																																			IGLV1-40	-	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000211653		0.617	IGLV1-40-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGLV1-40	HGNC	IG_V_gene	OTTHUMT00000321176.1	119	0.00	0	G	NG_000002		22764392	22764392	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390299	ensembl	human	known	69_37n	missense	59	15.71	11	SNP	0.219	C
IL4R	3566	genome.wustl.edu	37	16	27367189	27367189	+	Missense_Mutation	SNP	T	T	A			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr16:27367189T>A	ENST00000395762.2	+	8	990	c.731T>A	c.(730-732)aTc>aAc	p.I244N	IL4R_ENST00000380922.3_Missense_Mutation_p.I229N|IL4R_ENST00000543915.2_Missense_Mutation_p.I244N|IL4R_ENST00000565915.1_3'UTR|IL4R_ENST00000170630.2_Missense_Mutation_p.I244N	NM_000418.3	NP_000409.1	P24394	IL4RA_HUMAN	interleukin 4 receptor	244					defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|ovulation (GO:0030728)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|production of molecular mediator involved in inflammatory response (GO:0002532)|regulation of cell proliferation (GO:0042127)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	interleukin-4 receptor activity (GO:0004913)|receptor signaling protein activity (GO:0005057)	p.I244N(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	33						TGCATTGTCATCCTGGCCGTC	0.617																																						dbGAP											1	Substitution - Missense(1)	breast(1)											147.0	114.0	125.0					16																	27367189		2197	4300	6497	-	-	-	SO:0001583	missense	0			X52425	CCDS10629.1, CCDS58441.1	16p12.1-p11.2	2008-05-14			ENSG00000077238	ENSG00000077238		"""Interleukins and interleukin receptors"", ""CD molecules"""	6015	protein-coding gene	gene with protein product		147781				1679753	Standard	NM_000418		Approved	CD124	uc010bxy.4	P24394	OTTHUMG00000097015	ENST00000395762.2:c.731T>A	16.37:g.27367189T>A	ENSP00000379111:p.Ile244Asn		B4E076|B9EKU8|H3BSY5|Q96P01|Q9H181|Q9H182|Q9H183|Q9H184|Q9H185|Q9H186|Q9H187|Q9H188	Missense_Mutation	SNP	pfam_IL4Ra_N,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.I244N	ENST00000395762.2	37	c.731	CCDS10629.1	16	.	.	.	.	.	.	.	.	.	.	T	19.09	3.760029	0.69763	.	.	ENSG00000077238	ENST00000395762;ENST00000543915;ENST00000380922;ENST00000170630	T;T;T;T	0.14022	2.54;2.54;2.61;2.54	4.45	4.45	0.53987	.	1.488650	0.03880	N	0.277038	T	0.38878	0.1057	M	0.71581	2.175	0.30406	N	0.779538	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.67231	0.95;0.95;0.95	T	0.03374	-1.1043	10	0.87932	D	0	-16.8142	10.0189	0.42031	0.0:0.0:0.0:1.0	.	229;244;244	B4E076;B9EGC0;P24394	.;.;IL4RA_HUMAN	N	244;244;229;244	ENSP00000379111:I244N;ENSP00000441667:I244N;ENSP00000370309:I229N;ENSP00000170630:I244N	ENSP00000170630:I244N	I	+	2	0	IL4R	27274690	0.787000	0.28750	0.729000	0.30791	0.030000	0.12068	3.317000	0.51968	1.879000	0.54435	0.459000	0.35465	ATC	IL4R	-	NULL	ENSG00000077238		0.617	IL4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL4R	HGNC	protein_coding	OTTHUMT00000214104.4	149	0.00	0	T			27367189	27367189	+1	no_errors	ENST00000170630	ensembl	human	known	69_37n	missense	52	14.75	9	SNP	0.655	A
ILVBL	10994	genome.wustl.edu	37	19	15228790	15228790	+	Missense_Mutation	SNP	A	A	T			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr19:15228790A>T	ENST00000263383.3	-	10	1227	c.1088T>A	c.(1087-1089)gTc>gAc	p.V363D	ILVBL_ENST00000531635.1_5'Flank|ILVBL_ENST00000534378.1_Missense_Mutation_p.V256D	NM_006844.3	NP_006835.2	A1L0T0	ILVBL_HUMAN	ilvB (bacterial acetolactate synthase)-like	363						integral component of membrane (GO:0016021)|membrane (GO:0016020)	magnesium ion binding (GO:0000287)|thiamine pyrophosphate binding (GO:0030976)|transferase activity (GO:0016740)	p.V363D(1)		NS(3)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(1)	26						GTGGCTGAGGACACGGCCATA	0.542																																						dbGAP											1	Substitution - Missense(1)	breast(1)											126.0	99.0	109.0					19																	15228790		2203	4300	6503	-	-	-	SO:0001583	missense	0			U61263	CCDS12325.1	19p13.1	2008-07-16			ENSG00000105135	ENSG00000105135			6041	protein-coding gene	gene with protein product	"""acetolactate synthase homolog"""	605770				8954801	Standard	NM_006844		Approved	209L8, AHAS, ILV2H, MGC1269, FLJ39061, MGC19535	uc002nam.3	A1L0T0	OTTHUMG00000165630	ENST00000263383.3:c.1088T>A	19.37:g.15228790A>T	ENSP00000263383:p.Val363Asp		O43341|Q96F08|Q99651|Q9BWN5|Q9UEB2	Missense_Mutation	SNP	pfam_Thiamin_PyroP_enz_TPP-bd_dom,pfam_TPP_enzyme-bd_C,pfam_Thiamin_PyroP_enz_cen_dom	p.V363D	ENST00000263383.3	37	c.1088	CCDS12325.1	19	.	.	.	.	.	.	.	.	.	.	A	8.039	0.763387	0.15914	.	.	ENSG00000105135	ENST00000263383	T	0.40476	1.03	5.25	5.25	0.73442	Thiamine pyrophosphate enzyme, central domain (1);	0.061993	0.64402	D	0.000005	T	0.42899	0.1223	L	0.56199	1.76	0.80722	D	1	B	0.24132	0.098	B	0.30572	0.117	T	0.42783	-0.9431	10	0.87932	D	0	-36.9045	13.108	0.59257	1.0:0.0:0.0:0.0	.	363	A1L0T0	ILVBL_HUMAN	D	363	ENSP00000263383:V363D	ENSP00000263383:V363D	V	-	2	0	ILVBL	15089790	1.000000	0.71417	1.000000	0.80357	0.159000	0.22180	4.955000	0.63638	1.990000	0.58119	0.460000	0.39030	GTC	ILVBL	-	pfam_Thiamin_PyroP_enz_cen_dom	ENSG00000105135		0.542	ILVBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ILVBL	HGNC	protein_coding	OTTHUMT00000385439.1	33	0.00	0	A	NM_006844		15228790	15228790	-1	no_errors	ENST00000263383	ensembl	human	known	69_37n	missense	24	17.24	5	SNP	1.000	T
KIAA0319	9856	genome.wustl.edu	37	6	24596446	24596446	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr6:24596446C>G	ENST00000378214.3	-	3	980	c.456G>C	c.(454-456)gaG>gaC	p.E152D	KIAA0319_ENST00000543707.1_Missense_Mutation_p.E152D|KIAA0319_ENST00000535378.1_Missense_Mutation_p.E143D|KIAA0319_ENST00000537886.1_Missense_Mutation_p.E152D|KIAA0319_ENST00000430948.2_Missense_Mutation_p.E107D	NM_001168375.1|NM_014809.3	NP_001161847.1|NP_055624.2	Q5VV43	K0319_HUMAN	KIAA0319	152					negative regulation of dendrite development (GO:2000171)|neuron migration (GO:0001764)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.E152D(1)		breast(3)|endometrium(6)|kidney(3)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	53						ACTCAGACATCTCCTCTAGGC	0.577																																						dbGAP											1	Substitution - Missense(1)	breast(1)											81.0	85.0	84.0					6																	24596446		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002317	CCDS34348.1, CCDS54969.1, CCDS54970.1, CCDS54971.1, CCDS75409.1	6p22.3	2013-12-13			ENSG00000137261	ENSG00000137261			21580	protein-coding gene	gene with protein product	"""neuronal migration"""	609269				9205841, 15514892	Standard	NM_014809		Approved	NMIG	uc003neh.1	Q5VV43	OTTHUMG00000014358	ENST00000378214.3:c.456G>C	6.37:g.24596446C>G	ENSP00000367459:p.Glu152Asp		A7MD37|B2RTU7|B4DHA7|B4DK75|B7ZML3|F5H123|Q9UJC8|Q9Y4G7	Missense_Mutation	SNP	pfam_PKD/REJ-like,superfamily_PKD_dom,smart_MANSC_N,smart_Fibronectin_type3,smart_PKD/Chitinase_dom,pfscan_MANSC,pfscan_PKD_dom	p.E152D	ENST00000378214.3	37	c.456	CCDS34348.1	6	.	.	.	.	.	.	.	.	.	.	C	6.326	0.428339	0.11987	.	.	ENSG00000137261	ENST00000537886;ENST00000535378;ENST00000430948;ENST00000378214;ENST00000543707	T;T;T;T;T	0.08807	3.05;3.07;3.07;3.06;3.06	4.43	1.49	0.22878	.	0.133372	0.33534	N	0.004813	T	0.01765	0.0056	L	0.34521	1.04	0.09310	N	1	B;B;B	0.14805	0.011;0.004;0.003	B;B;B	0.16722	0.016;0.011;0.005	T	0.45190	-0.9278	10	0.37606	T	0.19	-4.9426	5.2937	0.15741	0.0:0.4875:0.3344:0.1781	.	152;143;152	F5H123;Q5VV43-2;Q5VV43	.;.;K0319_HUMAN	D	152;143;107;152;152	ENSP00000439700:E152D;ENSP00000442403:E143D;ENSP00000401086:E107D;ENSP00000367459:E152D;ENSP00000437656:E152D	ENSP00000367459:E152D	E	-	3	2	KIAA0319	24704425	0.003000	0.15002	0.104000	0.21259	0.394000	0.30568	0.338000	0.19858	0.259000	0.21709	0.514000	0.50259	GAG	KIAA0319	-	NULL	ENSG00000137261		0.577	KIAA0319-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0319	HGNC	protein_coding	OTTHUMT00000040009.1	96	0.00	0	C	NM_014809		24596446	24596446	-1	no_errors	ENST00000378214	ensembl	human	known	69_37n	missense	57	18.57	13	SNP	0.046	G
KIAA1045	23349	genome.wustl.edu	37	9	34971433	34971433	+	Silent	SNP	C	C	G			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr9:34971433C>G	ENST00000242315.3	+	2	220	c.138C>G	c.(136-138)ggC>ggG	p.G46G	KIAA1045_ENST00000476115.2_Intron|KIAA1045_ENST00000544237.1_Silent_p.G46G	NM_015297.1	NP_056112.1	Q9UPV7	K1045_HUMAN	KIAA1045	46							metal ion binding (GO:0046872)	p.G46G(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			LUSC - Lung squamous cell carcinoma(32;0.00575)			CCCGCCGTGGCACTGTAGAGG	0.637																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											53.0	62.0	59.0					9																	34971433		2077	4209	6286	-	-	-	SO:0001819	synonymous_variant	0			AB028968	CCDS43796.1	9p13.2	2008-02-05			ENSG00000122733	ENSG00000122733			29180	protein-coding gene	gene with protein product						10470851	Standard	NM_015297		Approved		uc003zvr.3	Q9UPV7	OTTHUMG00000019844	ENST00000242315.3:c.138C>G	9.37:g.34971433C>G			B7Z253|Q58FE9|Q5T662	Silent	SNP	superfamily_Znf_FYVE_PHD	p.G46	ENST00000242315.3	37	c.138	CCDS43796.1	9																																																																																			KIAA1045	-	NULL	ENSG00000122733		0.637	KIAA1045-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1045	HGNC	protein_coding	OTTHUMT00000052256.2	114	0.00	0	C	XM_048592		34971433	34971433	+1	no_errors	ENST00000242315	ensembl	human	known	69_37n	silent	57	17.39	12	SNP	0.423	G
KLF7	8609	genome.wustl.edu	37	2	207945962	207945962	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr2:207945962G>C	ENST00000309446.6	-	4	1260	c.884C>G	c.(883-885)gCc>gGc	p.A295G	KLF7_ENST00000458272.1_Missense_Mutation_p.A105G|KLF7_ENST00000467833.1_5'UTR|KLF7_ENST00000421199.1_Missense_Mutation_p.A262G|KLF7_ENST00000412414.2_Missense_Mutation_p.A267G|KLF7_ENST00000423015.1_Missense_Mutation_p.P228A	NM_003709.3	NP_003700.1	O75840	KLF7_HUMAN	Kruppel-like factor 7 (ubiquitous)	295					axon guidance (GO:0007411)|dendrite morphogenesis (GO:0048813)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.A295G(1)		breast(1)|central_nervous_system(1)|large_intestine(3)|liver(1)|lung(4)|skin(1)	11				LUSC - Lung squamous cell carcinoma(261;0.0856)|Lung(261;0.166)|Epithelial(149;0.173)		CATGTGGAGGGCAAGATGGTC	0.463																																						dbGAP											1	Substitution - Missense(1)	breast(1)											201.0	197.0	198.0					2																	207945962		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB015132	CCDS2373.1, CCDS59438.1, CCDS59439.1, CCDS59440.1	2q32	2013-01-08			ENSG00000118263	ENSG00000118263		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6350	protein-coding gene	gene with protein product		604865				9774444	Standard	NM_003709		Approved	UKLF	uc010zix.2	O75840	OTTHUMG00000132935	ENST00000309446.6:c.884C>G	2.37:g.207945962G>C	ENSP00000309570:p.Ala295Gly		B2RB03|B7Z4F7|C9JF04|E7EWH1|L0R4P2|Q7Z3H8|Q96E51	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A295G	ENST00000309446.6	37	c.884	CCDS2373.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.72|19.72	3.879274|3.879274	0.72294|0.72294	.|.	.|.	ENSG00000118263|ENSG00000118263	ENST00000309446;ENST00000421199;ENST00000412414;ENST00000458272|ENST00000423015	T;T;T;T|.	0.70399|.	-0.48;-0.48;-0.48;3.01|.	5.9|5.9	5.9|5.9	0.94986|0.94986	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.59569|0.59569	0.2203|0.2203	L|L	0.39397|0.39397	1.21|1.21	0.80722|0.80722	D|D	1|1	D;D|B	0.59357|0.19817	0.973;0.985|0.039	P;D|B	0.64877|0.22753	0.899;0.93|0.041	T|T	0.55742|0.55742	-0.8093|-0.8093	10|8	0.72032|0.87932	D|D	0.01|0	.|.	20.2768|20.2768	0.98488|0.98488	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	267;295|228	B7Z4F7;O75840|Q96E51	.;KLF7_HUMAN|.	G|A	295;262;267;105|228	ENSP00000309570:A295G;ENSP00000387510:A262G;ENSP00000403284:A267G;ENSP00000393268:A105G|.	ENSP00000309570:A295G|ENSP00000398572:P228A	A|P	-|-	2|1	0|0	KLF7|KLF7	207654207|207654207	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.957000|0.957000	0.61999|0.61999	9.869000|9.869000	0.99810|0.99810	2.808000|2.808000	0.96608|0.96608	0.650000|0.650000	0.86243|0.86243	GCC|CCC	KLF7	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000118263		0.463	KLF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF7	HGNC	protein_coding	OTTHUMT00000256466.2	307	0.00	0	G	NM_003709		207945962	207945962	-1	no_errors	ENST00000309446	ensembl	human	known	69_37n	missense	222	11.90	30	SNP	1.000	C
KLK1	3816	genome.wustl.edu	37	19	51323272	51323272	+	Silent	SNP	G	G	A			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr19:51323272G>A	ENST00000301420.2	-	4	551	c.516C>T	c.(514-516)ctC>ctT	p.L172L	KLK1_ENST00000448701.2_Silent_p.L70L|CTD-2568A17.5_ENST00000326989.5_lincRNA	NM_002257.2	NP_002248.1	P06870	KLK1_HUMAN	kallikrein 1	172	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)	p.L172L(1)		breast(1)|large_intestine(4)|lung(7)|urinary_tract(1)	13		all_neural(266;0.0199)		OV - Ovarian serous cystadenocarcinoma(262;0.00224)|GBM - Glioblastoma multiforme(134;0.00399)	Aprotinin(DB06692)	CCACACACTGGAGATCATCTG	0.552																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											98.0	78.0	85.0					19																	51323272		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L10038	CCDS12804.1	19q13.3	2008-02-05	2006-10-27			ENSG00000167748	3.4.21.35	"""Kallikreins"""	6357	protein-coding gene	gene with protein product		147910	"""kallikrein 1, renal/pancreas/salivary"""			1684954, 16800724, 16800723	Standard	NM_002257		Approved	Klk6	uc002ptk.1	P06870		ENST00000301420.2:c.516C>T	19.37:g.51323272G>A			Q66US9|Q86U61|Q8TCV8|Q9BS53|Q9NQU4|Q9UD19|Q9UMJ1	Silent	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.L172	ENST00000301420.2	37	c.516	CCDS12804.1	19																																																																																			KLK1	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000167748		0.552	KLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLK1	HGNC	protein_coding	OTTHUMT00000464135.2	50	0.00	0	G	NM_002257		51323272	51323272	-1	no_errors	ENST00000301420	ensembl	human	known	69_37n	silent	20	33.33	10	SNP	0.895	A
LDOC1L	84247	genome.wustl.edu	37	22	44893163	44893163	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr22:44893163G>A	ENST00000341255.3	-	2	783	c.274C>T	c.(274-276)Cga>Tga	p.R92*		NM_032287.2	NP_115663.2	Q6ICC9	LDOCL_HUMAN	leucine zipper, down-regulated in cancer 1-like	92								p.R92*(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(3)|prostate(2)	11		Ovarian(80;0.024)|all_neural(38;0.0416)		LUAD - Lung adenocarcinoma(64;0.0161)		GTCATGGGTCGAGTCCCGTTT	0.607																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											60.0	64.0	62.0					22																	44893163		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			CR456439	CCDS33662.1	22q13.3	2006-09-06			ENSG00000188636	ENSG00000188636			13343	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_032287		Approved	dJ1033E15.2, DKFZp761O17121, Mart6, Mar6	uc003beu.1	Q6ICC9	OTTHUMG00000150465	ENST00000341255.3:c.274C>T	22.37:g.44893163G>A	ENSP00000340434:p.Arg92*		Q6ZTR1	Nonsense_Mutation	SNP	NULL	p.R92*	ENST00000341255.3	37	c.274	CCDS33662.1	22	.	.	.	.	.	.	.	.	.	.	G	40	8.412083	0.98801	.	.	ENSG00000188636	ENST00000341255	.	.	.	3.27	2.2	0.27929	.	0.635593	0.12836	N	0.435208	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	-8.9363	8.3024	0.32023	0.0:0.2443:0.7557:0.0	.	.	.	.	X	92	.	ENSP00000340434:R92X	R	-	1	2	LDOC1L	43271827	0.388000	0.25197	0.082000	0.20525	0.960000	0.62799	0.919000	0.28692	0.913000	0.36797	0.591000	0.81541	CGA	LDOC1L	-	NULL	ENSG00000188636		0.607	LDOC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LDOC1L	HGNC	protein_coding	OTTHUMT00000318222.1	164	0.60	1	G	NM_032287		44893163	44893163	-1	no_errors	ENST00000341255	ensembl	human	known	69_37n	nonsense	46	20.69	12	SNP	0.084	A
LMTK2	22853	genome.wustl.edu	37	7	97822389	97822389	+	Nonsense_Mutation	SNP	C	C	G			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr7:97822389C>G	ENST00000297293.5	+	11	2905	c.2612C>G	c.(2611-2613)tCa>tGa	p.S871*		NM_014916.3	NP_055731.2	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2	871					early endosome to late endosome transport (GO:0045022)|endocytic recycling (GO:0032456)|negative regulation of catalytic activity (GO:0043086)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|myosin VI binding (GO:0070853)|protein phosphatase inhibitor activity (GO:0004864)|protein serine/threonine kinase activity (GO:0004674)	p.S871*(2)		NS(2)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|pancreas(2)|skin(2)|stomach(3)	59	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					GAAATTCTCTCAACTGATGCC	0.547																																						dbGAP											2	Substitution - Nonsense(2)	breast(2)											50.0	49.0	49.0					7																	97822389		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB029002	CCDS5654.1	7q22.1	2014-06-12			ENSG00000164715	ENSG00000164715			17880	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 100"""	610989				15005709	Standard	NM_014916		Approved	KIAA1079, KPI2, KPI-2, cprk, LMR2, BREK, AATYK2, PPP1R100	uc003upd.2	Q8IWU2	OTTHUMG00000154256	ENST00000297293.5:c.2612C>G	7.37:g.97822389C>G	ENSP00000297293:p.Ser871*		A4D272|Q75MG7|Q9UPS3	Nonsense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.S871*	ENST00000297293.5	37	c.2612	CCDS5654.1	7	.	.	.	.	.	.	.	.	.	.	C	40	7.921227	0.98563	.	.	ENSG00000164715	ENST00000297293	.	.	.	5.52	2.72	0.32119	.	0.935893	0.09234	N	0.830183	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	7.0284	0.24952	0.0:0.7059:0.1417:0.1524	.	.	.	.	X	871	.	ENSP00000297293:S871X	S	+	2	0	LMTK2	97660325	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.958000	0.29227	0.373000	0.24621	-0.182000	0.12963	TCA	LMTK2	-	NULL	ENSG00000164715		0.547	LMTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMTK2	HGNC	protein_coding	OTTHUMT00000334560.1	49	0.00	0	C	NM_014916		97822389	97822389	+1	no_errors	ENST00000297293	ensembl	human	known	69_37n	nonsense	26	21.21	7	SNP	0.001	G
LONRF1	91694	genome.wustl.edu	37	8	12594303	12594303	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr8:12594303G>A	ENST00000398246.3	-	6	1427	c.1358C>T	c.(1357-1359)aCt>aTt	p.T453I	LONRF1_ENST00000533751.1_Missense_Mutation_p.T96I|LONRF1_ENST00000530693.1_5'Flank	NM_152271.3	NP_689484.3	Q17RB8	LONF1_HUMAN	LON peptidase N-terminal domain and ring finger 1	453							ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)	p.T453I(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(4)|ovary(1)|upper_aerodigestive_tract(2)	19				READ - Rectum adenocarcinoma(644;0.236)		TTCATTGGGAGTTTCTATTAA	0.318																																						dbGAP											1	Substitution - Missense(1)	breast(1)											68.0	64.0	65.0					8																	12594303		1804	4058	5862	-	-	-	SO:0001583	missense	0			AK074329	CCDS5987.2	8p23.1	2013-01-09			ENSG00000154359	ENSG00000154359		"""RING-type (C3HC4) zinc fingers"""	26302	protein-coding gene	gene with protein product						18253036	Standard	XM_005273685		Approved	FLJ23749, RNF191	uc003wwd.1	Q17RB8	OTTHUMG00000165475	ENST00000398246.3:c.1358C>T	8.37:g.12594303G>A	ENSP00000381298:p.Thr453Ile		B4DM29|B4DU84|Q8TEA0|Q9BSV1	Missense_Mutation	SNP	pfam_Pept_S16_N,pfam_Znf_C3HC4_RING-type,superfamily_PUA-like_domain,smart_TPR_repeat,smart_Znf_RING,smart_Pept_S16_N,pfscan_TPR-contain_dom,pfscan_Znf_RING	p.T453I	ENST00000398246.3	37	c.1358	CCDS5987.2	8	.	.	.	.	.	.	.	.	.	.	G	10.77	1.442956	0.25987	.	.	ENSG00000154359	ENST00000398246;ENST00000533751	D;T	0.85484	-1.99;-1.39	5.13	2.18	0.27775	.	0.582428	0.18210	N	0.148203	T	0.71929	0.3398	N	0.24115	0.695	0.20563	N	0.999889	B	0.06786	0.001	B	0.04013	0.001	T	0.59878	-0.7371	10	0.46703	T	0.11	6.0E-4	5.5915	0.17303	0.069:0.1025:0.3974:0.4312	.	453	Q17RB8	LONF1_HUMAN	I	453;96	ENSP00000381298:T453I;ENSP00000432130:T96I	ENSP00000381298:T453I	T	-	2	0	LONRF1	12638674	0.129000	0.22400	0.265000	0.24526	0.960000	0.62799	1.372000	0.34261	0.324000	0.23333	0.655000	0.94253	ACT	LONRF1	-	NULL	ENSG00000154359		0.318	LONRF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LONRF1	HGNC	protein_coding	OTTHUMT00000251693.2	108	0.00	0	G	NM_152271		12594303	12594303	-1	no_errors	ENST00000398246	ensembl	human	known	69_37n	missense	67	19.28	16	SNP	0.566	A
LRP2	4036	genome.wustl.edu	37	2	170177303	170177303	+	Silent	SNP	C	C	A			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr2:170177303C>A	ENST00000263816.3	-	2	456	c.171G>T	c.(169-171)gcG>gcT	p.A57A	LRP2_ENST00000443831.1_Silent_p.A57A	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	57	LDL-receptor class A 1. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.A57A(2)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CAATTTCATCCGCGTCATCTG	0.488																																						dbGAP											2	Substitution - coding silent(2)	breast(1)|endometrium(1)											142.0	112.0	122.0					2																	170177303		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.171G>T	2.37:g.170177303C>A			O00711|Q16215	Silent	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.A57	ENST00000263816.3	37	c.171	CCDS2232.1	2																																																																																			LRP2	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000081479		0.488	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2	181	0.00	0	C	NM_004525		170177303	170177303	-1	no_errors	ENST00000263816	ensembl	human	known	69_37n	silent	80	41.18	56	SNP	0.002	A
MC2R	4158	genome.wustl.edu	37	18	13885460	13885460	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr18:13885460C>G	ENST00000327606.3	-	2	238	c.58G>C	c.(58-60)Gac>Cac	p.D20H		NM_000529.2	NP_000520.1	Q01718	ACTHR_HUMAN	melanocortin 2 receptor (adrenocorticotropic hormone)	20					G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|neuropeptide signaling pathway (GO:0007218)|placenta development (GO:0001890)|positive regulation of cAMP biosynthetic process (GO:0030819)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	corticotropin receptor activity (GO:0004978)|melanocortin receptor activity (GO:0004977)	p.D20H(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(8)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30					Corticotropin(DB01285)|Cosyntropin(DB01284)	CGAGGACAGTCGGAATTATTT	0.418																																					Colon(141;1584 1782 35999 48227 48692)	dbGAP											1	Substitution - Missense(1)	breast(1)	GRCh37	CM057714	MC2R	M							215.0	178.0	190.0					18																	13885460		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11869.1	18p11.2	2012-08-10			ENSG00000185231	ENSG00000185231		"""GPCR / Class A : Melanocortin receptors"""	6930	protein-coding gene	gene with protein product		607397				8390157	Standard	NM_001291911		Approved	ACTHR	uc002ksp.1	Q01718	OTTHUMG00000131721	ENST00000327606.3:c.58G>C	18.37:g.13885460C>G	ENSP00000333821:p.Asp20His		A8K016|Q3MI45|Q504X6	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_ACTH_rcpt,prints_Melcrt_ACTH_rcpt,prints_7TM_GPCR_Rhodpsn	p.D20H	ENST00000327606.3	37	c.58	CCDS11869.1	18	.	.	.	.	.	.	.	.	.	.	C	15.37	2.814108	0.50527	.	.	ENSG00000185231	ENST00000327606;ENST00000399821	T;D	0.85556	0.31;-2.0	4.39	4.39	0.52855	.	0.000000	0.85682	D	0.000000	D	0.88123	0.6352	M	0.63843	1.955	0.48087	D	0.999585	D	0.67145	0.996	D	0.64595	0.927	D	0.84677	0.0715	10	0.15066	T	0.55	.	10.9532	0.47343	0.0:0.9127:0.0:0.0873	.	20	Q01718	ACTHR_HUMAN	H	20	ENSP00000333821:D20H;ENSP00000382718:D20H	ENSP00000333821:D20H	D	-	1	0	MC2R	13875460	0.990000	0.36364	0.949000	0.38748	0.295000	0.27426	2.855000	0.48333	2.171000	0.68590	0.650000	0.86243	GAC	MC2R	-	prints_ACTH_rcpt	ENSG00000185231		0.418	MC2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MC2R	HGNC	protein_coding	OTTHUMT00000254639.2	149	0.00	0	C			13885460	13885460	-1	no_errors	ENST00000327606	ensembl	human	known	69_37n	missense	111	20.14	28	SNP	0.997	G
MCTP2	55784	genome.wustl.edu	37	15	94882595	94882595	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr15:94882595G>C	ENST00000357742.4	+	4	714	c.714G>C	c.(712-714)ttG>ttC	p.L238F	MCTP2_ENST00000451018.3_Missense_Mutation_p.L238F|MCTP2_ENST00000543482.1_Missense_Mutation_p.L238F|MCTP2_ENST00000331706.4_5'UTR	NM_018349.3	NP_060819.3	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2	238	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)	p.L238L(1)|p.L238F(1)		autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|liver(1)|lung(12)|ovary(1)|pancreas(1)|skin(9)|stomach(2)	49	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			ATAAGAACTTGAACCCAGTAT	0.363																																						dbGAP											2	Substitution - Missense(1)|Substitution - coding silent(1)	large_intestine(1)|breast(1)											113.0	116.0	115.0					15																	94882595		2197	4298	6495	-	-	-	SO:0001583	missense	0			AK002037	CCDS32338.1, CCDS53975.1, CCDS53976.1	15q26.2	2006-02-08				ENSG00000140563			25636	protein-coding gene	gene with protein product						15528213	Standard	NM_018349		Approved	FLJ11175, FLJ33303	uc002btj.3	Q6DN12		ENST00000357742.4:c.714G>C	15.37:g.94882595G>C	ENSP00000350377:p.Leu238Phe		A2RRC2|C6G483|C6G484|Q49AB0|Q8TAX2|Q9NUS2|Q9NUW7	Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_PRibTrfase_C,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.L238F	ENST00000357742.4	37	c.714	CCDS32338.1	15	.	.	.	.	.	.	.	.	.	.	G	18.24	3.581349	0.65992	.	.	ENSG00000140563	ENST00000543482;ENST00000556363;ENST00000451018;ENST00000357742	T;T;T	0.73152	-0.72;-0.72;-0.72	6.03	5.06	0.68205	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.88566	0.6471	H	0.97023	3.925	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.999;1.0;1.0;0.999	D	0.90807	0.4698	10	0.66056	D	0.02	.	12.5296	0.56106	0.0:0.1256:0.7447:0.1297	.	238;238;238;238;238	F5H415;Q6DN12-2;Q6DN12;B7Z6H2;G3V2J2	.;.;MCTP2_HUMAN;.;.	F	238	ENSP00000438521:L238F;ENSP00000395109:L238F;ENSP00000350377:L238F	ENSP00000350377:L238F	L	+	3	2	MCTP2	92683599	0.825000	0.29262	1.000000	0.80357	0.913000	0.54294	-0.085000	0.11250	2.861000	0.98227	0.655000	0.94253	TTG	MCTP2	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	ENSG00000140563		0.363	MCTP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MCTP2	HGNC	protein_coding	OTTHUMT00000415060.3	74	0.00	0	G	NM_018349		94882595	94882595	+1	no_errors	ENST00000357742	ensembl	human	known	69_37n	missense	66	12.00	9	SNP	1.000	C
MDP1	145553	genome.wustl.edu	37	14	24683340	24683340	+	Missense_Mutation	SNP	T	T	C			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr14:24683340T>C	ENST00000288087.7	-	6	532	c.421A>G	c.(421-423)Atc>Gtc	p.I141V	AL136419.6_ENST00000565988.1_RNA|CHMP4A_ENST00000347519.6_5'Flank|TM9SF1_ENST00000530611.1_5'Flank|CHMP4A_ENST00000530996.1_5'Flank|TM9SF1_ENST00000556387.1_5'Flank|CHMP4A_ENST00000609024.1_5'Flank|MDP1_ENST00000532557.1_5'UTR|CHMP4A_ENST00000542700.2_5'Flank|NEDD8-MDP1_ENST00000604306.1_5'Flank|MDP1_ENST00000396833.2_Missense_Mutation_p.H94R|NEDD8-MDP1_ENST00000534348.1_Missense_Mutation_p.I158V	NM_001199822.1|NM_138476.3	NP_001186751.1|NP_612485.2	Q86V88	MGDP1_HUMAN	magnesium-dependent phosphatase 1	141						extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)	p.I141V(1)		breast(2)|large_intestine(2)|lung(3)	7						CCATTCTGGATGTGAATGCAG	0.443																																						dbGAP											1	Substitution - Missense(1)	breast(1)											89.0	89.0	89.0					14																	24683340		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC046912	CCDS9620.1, CCDS55908.1	14q12	2009-07-09			ENSG00000213920	ENSG00000213920			28781	protein-coding gene	gene with protein product	"""fructosamine-6-phosphatase"""					10889041, 16670083	Standard	NM_138476		Approved	MGC5987, FN6Pase		Q86V88	OTTHUMG00000133477	ENST00000288087.7:c.421A>G	14.37:g.24683340T>C	ENSP00000288087:p.Ile141Val		Q86Y84|Q8NAD9	Missense_Mutation	SNP	pfam_NIF,superfamily_HAD-like_dom,tigrfam_MDP_1_eu_arc,tigrfam_HAD_SF_ppase_IIIC	p.I141V	ENST00000288087.7	37	c.421	CCDS9620.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.44|11.44	1.639573|1.639573	0.29157|0.29157	.|.	.|.	ENSG00000213920|ENSG00000213920;ENSG00000255526	ENST00000396833|ENST00000288087;ENST00000534348	.|D;D	.|0.96522	.|-4.04;-4.04	5.25|5.25	2.07|2.07	0.26955|0.26955	.|HAD-like domain (2);	.|0.339958	.|0.16200	.|N	.|0.224961	D|D	0.87124|0.87124	0.6099|0.6099	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	B|B	0.02656|0.02656	0.0|0.0	B|B	0.01281|0.01281	0.0|0.0	T|T	0.74077|0.74077	-0.3781|-0.3781	7|9	0.59425|0.02654	D|T	0.04|1	-5.2382|-5.2382	6.7717|6.7717	0.23596|0.23596	0.0:0.6895:0.0:0.3105|0.0:0.6895:0.0:0.3105	.|.	94|141	Q86V88-3|Q86V88	.|MGDP1_HUMAN	R|V	94|141;158	.|ENSP00000288087:I141V;ENSP00000431482:I158V	ENSP00000380045:H94R|ENSP00000288087:I141V	H|I	-|-	2|1	0|0	MDP1|MDP1;NEDD8-MDP1	23753180|23753180	0.015000|0.015000	0.18098|0.18098	0.028000|0.028000	0.17463|0.17463	0.906000|0.906000	0.53458|0.53458	-0.168000|-0.168000	0.09925|0.09925	0.223000|0.223000	0.20920|0.20920	-0.242000|-0.242000	0.12053|0.12053	CAT|ATC	MDP1	-	pfam_NIF,superfamily_HAD-like_dom,tigrfam_MDP_1_eu_arc	ENSG00000213920		0.443	MDP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MDP1	HGNC	protein_coding	OTTHUMT00000257367.1	64	0.00	0	T	NM_138476		24683340	24683340	-1	no_errors	ENST00000288087	ensembl	human	known	69_37n	missense	32	46.67	28	SNP	0.135	C
MECP2	4204	genome.wustl.edu	37	X	153297782	153297782	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chrX:153297782G>A	ENST00000303391.6	-	3	502	c.253C>T	c.(253-255)Cgc>Tgc	p.R85C	MECP2_ENST00000407218.1_Missense_Mutation_p.R85C|MECP2_ENST00000460227.1_5'Flank|MECP2_ENST00000453960.2_Missense_Mutation_p.R97C	NM_004992.3	NP_004983.1	P51608	MECP2_HUMAN	methyl CpG binding protein 2	85					adult locomotory behavior (GO:0008344)|behavioral fear response (GO:0001662)|cardiolipin metabolic process (GO:0032048)|catecholamine secretion (GO:0050432)|cerebellum development (GO:0021549)|chromatin silencing (GO:0006342)|dendrite development (GO:0016358)|glucocorticoid metabolic process (GO:0008211)|glutamine metabolic process (GO:0006541)|histone acetylation (GO:0016573)|histone methylation (GO:0016571)|inositol metabolic process (GO:0006020)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone methylation (GO:0031061)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|neuron maturation (GO:0042551)|pathogenesis (GO:0009405)|phosphatidylcholine metabolic process (GO:0046470)|positive regulation of cell proliferation (GO:0008284)|positive regulation of synapse assembly (GO:0051965)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|proprioception (GO:0019230)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|sensory perception of pain (GO:0019233)|social behavior (GO:0035176)|startle response (GO:0001964)|synapse assembly (GO:0007416)|transcription, DNA-templated (GO:0006351)|ventricular system development (GO:0021591)|visual learning (GO:0008542)	cytosol (GO:0005829)|extracellular space (GO:0005615)|heterochromatin (GO:0000792)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded methylated DNA binding (GO:0010385)|methyl-CpG binding (GO:0008327)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|siRNA binding (GO:0035197)|transcription corepressor activity (GO:0003714)			breast(2)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(8)|prostate(2)|urinary_tract(1)	23	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ATGATGGAGCGCCGCTGTTTG	0.627																																						dbGAP											0													83.0	83.0	83.0					X																	153297782		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF158180	CCDS14741.1, CCDS48193.1	Xq28	2014-09-17	2014-06-18		ENSG00000169057	ENSG00000169057			6990	protein-coding gene	gene with protein product		300005	"""mental retardation, X-linked 16"", ""mental retardation, X-linked 79"", ""Rett syndrome"", ""methyl CpG binding protein 2 (Rett syndrome)"""	RTT, MRX16, MRX79		1606614, 10508514	Standard	NM_004992		Approved		uc004fjw.2	P51608	OTTHUMG00000024229	ENST00000303391.6:c.253C>T	X.37:g.153297782G>A	ENSP00000301948:p.Arg85Cys		O15233|Q6QHH9|Q7Z384	Missense_Mutation	SNP	pfam_Methyl_CpG_DNA-bd,superfamily_DNA-bd_integrase-typ,superfamily_Ig_E-set,smart_Methyl_CpG_DNA-bd,pirsf_Me_CpG-bd_MeCP2,pfscan_Methyl_CpG_DNA-bd	p.R85C	ENST00000303391.6	37	c.253	CCDS14741.1	X	.	.	.	.	.	.	.	.	.	.	G	28.2	4.898316	0.91962	.	.	ENSG00000169057	ENST00000303391;ENST00000545451;ENST00000453960;ENST00000369964;ENST00000407218	D;D;D	0.96232	-3.95;-3.95;-3.95	5.93	5.93	0.95920	Methyl-CpG DNA binding (1);DNA-binding, integrase-type (1);	0.000000	0.85682	D	0.000000	D	0.96592	0.8888	L	0.32530	0.975	0.80722	D	1	D;D	0.76494	0.999;0.999	D;P	0.64321	0.924;0.84	D	0.97437	1.0019	10	0.87932	D	0	-7.1254	17.9775	0.89131	0.0:0.0:1.0:0.0	.	97;85	P51608-2;P51608	.;MECP2_HUMAN	C	85;85;97;85;85	ENSP00000301948:R85C;ENSP00000395535:R97C;ENSP00000384865:R85C	ENSP00000301948:R85C	R	-	1	0	MECP2	152950976	1.000000	0.71417	0.995000	0.50966	0.996000	0.88848	7.275000	0.78548	2.521000	0.84997	0.529000	0.55759	CGC	MECP2	-	superfamily_DNA-bd_integrase-typ,pirsf_Me_CpG-bd_MeCP2	ENSG00000169057		0.627	MECP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MECP2	HGNC	protein_coding	OTTHUMT00000061144.1	62	0.00	0	G	NM_004992		153297782	153297782	-1	no_errors	ENST00000303391	ensembl	human	known	69_37n	missense	21	25.81	8	SNP	1.000	A
KMT2C	58508	genome.wustl.edu	37	7	152012412	152012412	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr7:152012412C>T	ENST00000262189.6	-	4	619	c.401G>A	c.(400-402)tGc>tAc	p.C134Y	KMT2C_ENST00000355193.2_Missense_Mutation_p.C134Y	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	134					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.C134Y(2)									ACAAAAAGCGCAGAGCTGTTC	0.363																																						dbGAP											2	Substitution - Missense(2)	breast(2)											90.0	85.0	87.0					7																	152012412		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.401G>A	7.37:g.152012412C>T	ENSP00000262189:p.Cys134Tyr		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.C134Y	ENST00000262189.6	37	c.401	CCDS5931.1	7	.	.	.	.	.	.	.	.	.	.	C	22.6	4.316173	0.81469	.	.	ENSG00000055609	ENST00000262189;ENST00000355193;ENST00000452749	D;D	0.96011	-3.86;-3.88	5.68	5.68	0.88126	.	0.000000	0.49305	D	0.000151	D	0.96442	0.8839	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.97114	0.9806	10	0.87932	D	0	.	19.7936	0.96469	0.0:1.0:0.0:0.0	.	134	Q8NEZ4	MLL3_HUMAN	Y	134;134;135	ENSP00000262189:C134Y;ENSP00000347325:C134Y	ENSP00000262189:C134Y	C	-	2	0	MLL3	151643345	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.625000	0.74248	2.677000	0.91161	0.563000	0.77884	TGC	MLL3	-	NULL	ENSG00000055609		0.363	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL3	HGNC	protein_coding	OTTHUMT00000318887.3	176	0.56	1	C			152012412	152012412	-1	no_errors	ENST00000355193	ensembl	human	known	69_37n	missense	101	36.48	58	SNP	1.000	T
MORC1	27136	genome.wustl.edu	37	3	108819288	108819288	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr3:108819288C>G	ENST00000483760.1	-	5	333	c.290G>C	c.(289-291)gGg>gCg	p.G97A	MORC1-AS1_ENST00000480826.1_RNA|MORC1_ENST00000232603.5_Missense_Mutation_p.G97A					MORC family CW-type zinc finger 1									p.G97A(1)		breast(7)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(47)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	105						GCCGTATTGCCCTATGAACTT	0.363																																						dbGAP											1	Substitution - Missense(1)	breast(1)											177.0	176.0	177.0					3																	108819288		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF084946	CCDS2955.1	3q13	2011-10-26	2005-06-15	2005-06-15	ENSG00000114487	ENSG00000114487			7198	protein-coding gene	gene with protein product	"""cancer/testis antigen 33"""	603205	"""microrchidia (mouse) homolog"", ""microrchidia homolog (mouse)"""	MORC		10369865	Standard	NM_014429		Approved	ZCW6, CT33	uc003dxl.3	Q86VD1	OTTHUMG00000159209	ENST00000483760.1:c.290G>C	3.37:g.108819288C>G	ENSP00000417282:p.Gly97Ala			Missense_Mutation	SNP	pfam_Znf_CW,superfamily_ATPase-like_ATP-bd,pfscan_Znf_CW	p.G97A	ENST00000483760.1	37	c.290		3	.	.	.	.	.	.	.	.	.	.	C	22.0	4.227496	0.79576	.	.	ENSG00000114487	ENST00000232603;ENST00000483760	D;D	0.98437	-4.93;-4.93	5.32	5.32	0.75619	ATPase-like, ATP-binding domain (3);	0.000000	0.52532	D	0.000071	D	0.99017	0.9664	M	0.86953	2.85	0.47214	D	0.999353	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.99513	1.0956	10	0.87932	D	0	-13.642	16.5466	0.84448	0.0:1.0:0.0:0.0	.	97;97	E7ERX1;Q86VD1	.;MORC1_HUMAN	A	97	ENSP00000232603:G97A;ENSP00000417282:G97A	ENSP00000232603:G97A	G	-	2	0	MORC1	110301978	0.999000	0.42202	1.000000	0.80357	0.996000	0.88848	4.665000	0.61547	2.773000	0.95371	0.655000	0.94253	GGG	MORC1	-	superfamily_ATPase-like_ATP-bd	ENSG00000114487		0.363	MORC1-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	MORC1	HGNC	protein_coding	OTTHUMT00000353844.1	692	0.00	0	C			108819288	108819288	-1	no_errors	ENST00000232603	ensembl	human	known	69_37n	missense	420	29.77	178	SNP	1.000	G
MYH4	4622	genome.wustl.edu	37	17	10355263	10355263	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr17:10355263C>A	ENST00000255381.2	-	27	3843	c.3733G>T	c.(3733-3735)Gcc>Tcc	p.A1245S	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	1245					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)	p.A1245S(1)		NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						AAGACCTTGGCTTTGGAGACA	0.393																																						dbGAP											1	Substitution - Missense(1)	breast(1)											126.0	104.0	111.0					17																	10355263		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.3733G>T	17.37:g.10355263C>A	ENSP00000255381:p.Ala1245Ser			Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.A1245S	ENST00000255381.2	37	c.3733	CCDS11154.1	17	.	.	.	.	.	.	.	.	.	.	C	8.746	0.920081	0.17982	.	.	ENSG00000141048	ENST00000255381	D	0.83591	-1.74	5.6	5.6	0.85130	Myosin tail (1);	0.000000	0.37178	U	0.002220	T	0.67739	0.2925	N	0.03917	-0.325	0.46564	D	0.999109	B	0.02656	0.0	B	0.09377	0.004	T	0.61831	-0.6982	10	0.20519	T	0.43	.	19.9773	0.97314	0.0:1.0:0.0:0.0	.	1245	Q9Y623	MYH4_HUMAN	S	1245	ENSP00000255381:A1245S	ENSP00000255381:A1245S	A	-	1	0	MYH4	10295988	0.919000	0.31177	1.000000	0.80357	0.941000	0.58515	0.065000	0.14466	2.797000	0.96272	0.650000	0.86243	GCC	MYH4	-	pfam_Myosin_tail,superfamily_Prefoldin	ENSG00000264424		0.393	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	MYH4	HGNC	protein_coding	OTTHUMT00000252731.1	91	0.00	0	C	NM_017533		10355263	10355263	-1	no_errors	ENST00000255381	ensembl	human	known	69_37n	missense	50	20.31	13	SNP	1.000	A
MYO10	4651	genome.wustl.edu	37	5	16680191	16680191	+	Nonsense_Mutation	SNP	G	G	C			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr5:16680191G>C	ENST00000513610.1	-	33	4861	c.4407C>G	c.(4405-4407)taC>taG	p.Y1469*	MYO10_ENST00000274203.9_Nonsense_Mutation_p.Y826*|MYO10_ENST00000505695.1_Nonsense_Mutation_p.Y808*|MYO10_ENST00000515803.1_Nonsense_Mutation_p.Y808*|MYO10_ENST00000427430.2_Nonsense_Mutation_p.Y826*	NM_012334.2	NP_036466.2	Q9HD67	MYO10_HUMAN	myosin X	1469	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|plus-end directed microfilament motor activity (GO:0060002)|spectrin binding (GO:0030507)	p.Y1469Y(1)|p.Y1469*(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	86						GCTTGCGCCCGTACACGGTGA	0.612																																						dbGAP											2	Substitution - Nonsense(1)|Substitution - coding silent(1)	large_intestine(1)|breast(1)											64.0	67.0	66.0					5																	16680191		2091	4211	6302	-	-	-	SO:0001587	stop_gained	0			AF247457	CCDS54834.1	5p15.1-p14.3	2013-01-10				ENSG00000145555		"""Myosins / Myosin superfamily : Class X"", ""Pleckstrin homology (PH) domain containing"""	7593	protein-coding gene	gene with protein product		601481				8884266	Standard	NM_012334		Approved	KIAA0799	uc003jft.4	Q9HD67		ENST00000513610.1:c.4407C>G	5.37:g.16680191G>C	ENSP00000421280:p.Tyr1469*		A7E2D1|O94893|Q8IVX5|Q9NYM7|Q9P110|Q9P111|Q9UHF6	Nonsense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_Pleckstrin_homology,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,pfam_Ras-assoc,superfamily_FERM_central,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_Pleckstrin_homology,smart_MyTH4_dom,smart_Band_41_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_Pleckstrin_homology,prints_Myosin_head_motor_dom	p.Y1469*	ENST00000513610.1	37	c.4407	CCDS54834.1	5	.	.	.	.	.	.	.	.	.	.	G	47	13.199372	0.99726	.	.	ENSG00000145555	ENST00000513610;ENST00000515803;ENST00000274203;ENST00000505695;ENST00000427430	.	.	.	5.46	-2.45	0.06481	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	.	13.3999	0.60876	0.7812:0.0:0.2188:0.0	.	.	.	.	X	1469;808;826;808;826	.	ENSP00000274203:Y826X	Y	-	3	2	MYO10	16733191	0.010000	0.17322	0.982000	0.44146	0.994000	0.84299	-0.746000	0.04829	-0.446000	0.07149	-0.123000	0.14984	TAC	MYO10	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000145555		0.612	MYO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO10	HGNC	protein_coding	OTTHUMT00000366167.1	68	0.00	0	G	NM_012334		16680191	16680191	-1	no_errors	ENST00000513610	ensembl	human	known	69_37n	nonsense	57	18.57	13	SNP	0.990	C
NCKAP5	344148	genome.wustl.edu	37	2	133887640	133887640	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr2:133887640C>G	ENST00000409261.1	-	6	624	c.251G>C	c.(250-252)cGt>cCt	p.R84P	NCKAP5_ENST00000405974.3_Missense_Mutation_p.R84P|NCKAP5_ENST00000317721.6_Missense_Mutation_p.R84P|NCKAP5_ENST00000409213.1_Missense_Mutation_p.R84P	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	84								p.R84H(1)|p.R84P(1)		NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						GCTTTGAAGACGTAAGTGTCT	0.438																																						dbGAP											2	Substitution - Missense(2)	lung(1)|breast(1)											93.0	87.0	89.0					2																	133887640		1927	4137	6064	-	-	-	SO:0001583	missense	0			AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.251G>C	2.37:g.133887640C>G	ENSP00000387128:p.Arg84Pro		B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	NULL	p.R84P	ENST00000409261.1	37	c.251	CCDS46418.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.9|23.9	4.470050|4.470050	0.84533|0.84533	.|.	.|.	ENSG00000176771|ENSG00000176771	ENST00000409261;ENST00000409213;ENST00000317721;ENST00000405974;ENST00000537661;ENST00000542834|ENST00000427594	T;T;T;T|.	0.68765|.	1.6;-0.35;1.6;-0.35|.	6.17|6.17	5.29|5.29	0.74685|0.74685	.|.	.|.	.|.	.|.	.|.	T|T	0.41673|0.41673	0.1169|0.1169	L|L	0.27053|0.27053	0.805|0.805	0.30573|0.30573	N|N	0.763352|0.763352	D;D;D;D|.	0.76494|.	0.999;0.999;0.999;0.999|.	D;D;D;D|.	0.74674|.	0.961;0.952;0.955;0.984|.	T|T	0.43653|0.43653	-0.9378|-0.9378	9|5	0.87932|.	D|.	0|.	.|.	12.9159|12.9159	0.58205|0.58205	0.1623:0.8377:0.0:0.0|0.1623:0.8377:0.0:0.0	.|.	84;59;84;84|.	F5GYX5;O14513-3;O14513-2;O14513|.	.;.;.;NCKP5_HUMAN|.	P|L	84;84;84;84;84;59|80	ENSP00000387128:R84P;ENSP00000386952:R84P;ENSP00000380603:R84P;ENSP00000385692:R84P|.	ENSP00000380603:R84P|.	R|V	-|-	2|1	0|0	NCKAP5|NCKAP5	133604110|133604110	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.988000|0.988000	0.76386|0.76386	6.261000|6.261000	0.72509|0.72509	1.601000|1.601000	0.50113|0.50113	0.655000|0.655000	0.94253|0.94253	CGT|GTC	NCKAP5	-	NULL	ENSG00000176771		0.438	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCKAP5	HGNC	protein_coding	OTTHUMT00000331663.1	179	0.00	0	C	NM_207481		133887640	133887640	-1	no_errors	ENST00000317721	ensembl	human	known	69_37n	missense	107	34.76	57	SNP	1.000	G
NDC80	10403	genome.wustl.edu	37	18	2601425	2601425	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr18:2601425G>C	ENST00000261597.4	+	13	1587	c.1405G>C	c.(1405-1407)Gaa>Caa	p.E469Q		NM_006101.2	NP_006092.1	O14777	NDC80_HUMAN	NDC80 kinetochore complex component	469	Interaction with NEK2 and ZWINT.|Interaction with PSMC2 and SMC1A.|Interaction with the C-terminus of CDCA1 and the SPBC24-SPBC25 subcomplex.				attachment of spindle microtubules to kinetochore (GO:0008608)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)		p.E469Q(1)		NS(1)|biliary_tract(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)|urinary_tract(2)	22						GAATGAAACTGAAGAAGAAAT	0.289																																						dbGAP											1	Substitution - Missense(1)	breast(1)											23.0	25.0	24.0					18																	2601425		2189	4283	6472	-	-	-	SO:0001583	missense	0			AF017790	CCDS11827.1	18p11.31	2013-01-17	2013-01-17	2007-03-02	ENSG00000080986	ENSG00000080986			16909	protein-coding gene	gene with protein product		607272	"""highly expressed in cancer, rich in leucine heptad repeats (yeast)"", ""kinetochore associated 2"", ""NDC80 kinetochore complex component homolog (S. cerevisiae)"""	KNTC2		9315664, 12351790	Standard	NM_006101		Approved	HEC, HEC1, hsNDC80, TID3	uc002kli.3	O14777	OTTHUMG00000131483	ENST00000261597.4:c.1405G>C	18.37:g.2601425G>C	ENSP00000261597:p.Glu469Gln		Q6PJX2	Missense_Mutation	SNP	pfam_Kinetochore_Ndc80,superfamily_t-SNARE	p.E469Q	ENST00000261597.4	37	c.1405	CCDS11827.1	18	.	.	.	.	.	.	.	.	.	.	G	20.4	3.983106	0.74474	.	.	ENSG00000080986	ENST00000261597;ENST00000543946	T	0.60040	0.22	5.1	5.1	0.69264	.	0.099089	0.64402	D	0.000002	T	0.67748	0.2926	L	0.50333	1.59	0.58432	D	0.999999	D	0.71674	0.998	P	0.60682	0.878	T	0.61865	-0.6975	10	0.21014	T	0.42	-17.5501	18.8788	0.92349	0.0:0.0:1.0:0.0	.	469	O14777	NDC80_HUMAN	Q	469	ENSP00000261597:E469Q	ENSP00000261597:E469Q	E	+	1	0	NDC80	2591425	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.208000	0.77907	2.527000	0.85204	0.467000	0.42956	GAA	NDC80	-	superfamily_t-SNARE	ENSG00000080986		0.289	NDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDC80	HGNC	protein_coding	OTTHUMT00000254327.1	89	0.00	0	G	NM_006101		2601425	2601425	+1	no_errors	ENST00000261597	ensembl	human	known	69_37n	missense	81	16.49	16	SNP	1.000	C
NOTCH3	4854	genome.wustl.edu	37	19	15276281	15276281	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr19:15276281C>G	ENST00000263388.2	-	31	5788	c.5713G>C	c.(5713-5715)Gat>Cat	p.D1905H		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1905					forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.D1905H(2)		breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			GTTGAGCCATCTGCCATGCGG	0.577																																						dbGAP											2	Substitution - Missense(2)	breast(2)											70.0	64.0	66.0					19																	15276281		2203	4300	6503	-	-	-	SO:0001583	missense	0			U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.5713G>C	19.37:g.15276281C>G	ENSP00000263388:p.Asp1905His		Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,pfam_Ankyrin_rpt,pfam_Notch_dom,pfam_Notch_NODP_dom,pfam_Notch_NOD_dom,pfam_EGF_extracell,pfam_DUF3454_notch,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,pirsf_Notch,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom,prints_Notch_3,prints_Notch_dom	p.D1905H	ENST00000263388.2	37	c.5713	CCDS12326.1	19	.	.	.	.	.	.	.	.	.	.	C	20.9	4.062973	0.76187	.	.	ENSG00000074181	ENST00000263388	T	0.54479	0.57	4.9	4.9	0.64082	Ankyrin repeat-containing domain (3);	0.000000	0.33309	N	0.005058	T	0.68860	0.3047	L	0.55017	1.72	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.71738	-0.4502	10	0.87932	D	0	.	17.02	0.86431	0.0:1.0:0.0:0.0	.	1905	Q9UM47	NOTC3_HUMAN	H	1905	ENSP00000263388:D1905H	ENSP00000263388:D1905H	D	-	1	0	NOTCH3	15137281	1.000000	0.71417	0.133000	0.22050	0.629000	0.37895	7.183000	0.77697	2.560000	0.86352	0.561000	0.74099	GAT	NOTCH3	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pirsf_Notch,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000074181		0.577	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH3	HGNC	protein_coding	OTTHUMT00000465714.1	110	0.00	0	C	NM_000435		15276281	15276281	-1	no_errors	ENST00000263388	ensembl	human	known	69_37n	missense	43	28.33	17	SNP	0.996	G
HABP2	3026	genome.wustl.edu	37	10	115348779	115348779	+	3'UTR	SNP	G	G	T			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr10:115348779G>T	ENST00000351270.3	+	0	2430				HABP2_ENST00000542051.1_3'UTR|NRAP_ENST00000369360.3_Silent_p.A1689A|NRAP_ENST00000360478.3_Silent_p.A1681A|NRAP_ENST00000359988.3_Silent_p.A1716A|NRAP_ENST00000369358.4_Silent_p.A1724A	NM_004132.3	NP_004123.1	Q14520	HABP2_HUMAN	hyaluronan binding protein 2						cell adhesion (GO:0007155)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	glycosaminoglycan binding (GO:0005539)|serine-type endopeptidase activity (GO:0004252)	p.A1716A(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(8)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	23		Colorectal(252;0.0233)|Breast(234;0.0672)		Epithelial(162;0.00319)|all cancers(201;0.0112)	Hyaluronan(DB08818)	GAATCTCAGTGGCATCTGGGT	0.527																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											168.0	156.0	160.0					10																	115348779		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS7577.1, CCDS53579.1	10q25.3	2008-08-01	2001-11-28		ENSG00000148702	ENSG00000148702			4798	protein-coding gene	gene with protein product	"""plasma hyaluronan binding protein"", ""factor VII activating protein"""	603924	"""hyaluronan-binding protein 2"""			8827452, 12437095	Standard	NM_004132		Approved	HABP, PHBP, HGFAL, FSAP	uc001lai.4	Q14520	OTTHUMG00000019073	ENST00000351270.3:c.*651G>T	10.37:g.115348779G>T			A8K467|B7Z8U5|F5H5M6|O00663	Silent	SNP	pfam_Nebulin_35r-motif,pfam_Znf_LIM,smart_Znf_LIM,smart_Nebulin_35r-motif,pfscan_Znf_LIM,pfscan_Nebulin_35r-motif,prints_Nebulin	p.A1724	ENST00000351270.3	37	c.5172	CCDS7577.1	10																																																																																			NRAP	-	NULL	ENSG00000197893		0.527	HABP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRAP	HGNC	protein_coding	OTTHUMT00000050428.1	108	0.00	0	G	NM_004132		115348779	115348779	-1	no_errors	ENST00000369358	ensembl	human	known	69_37n	silent	31	39.22	20	SNP	0.951	T
OR14I1	401994	genome.wustl.edu	37	1	248844691	248844691	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr1:248844691C>A	ENST00000342623.3	-	1	938	c.915G>T	c.(913-915)aaG>aaT	p.K305N		NM_001004734.1	NP_001004734.1	A6ND48	O14I1_HUMAN	olfactory receptor, family 14, subfamily I, member 1	305						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.K305N(1)		NS(1)|breast(4)|large_intestine(2)|lung(24)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	35						GAAAATATATCTTCACAAAGA	0.348																																						dbGAP											1	Substitution - Missense(1)	breast(1)											49.0	51.0	51.0					1																	248844691		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS31125.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000189181	ENSG00000189181		"""GPCR / Class A : Olfactory receptors"""	19575	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily BU, member 1"""	OR5BU1P, OR5BU1			Standard	NM_001004734		Approved		uc001ieu.1	A6ND48	OTTHUMG00000040378	ENST00000342623.3:c.915G>T	1.37:g.248844691C>A	ENSP00000339726:p.Lys305Asn			Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt	p.K305N	ENST00000342623.3	37	c.915	CCDS31125.1	1	.	.	.	.	.	.	.	.	.	.	.	7.347	0.622135	0.14193	.	.	ENSG00000189181	ENST00000342623	T	0.38887	1.11	3.07	-2.45	0.06481	.	0.302135	0.23250	N	0.050246	T	0.23054	0.0557	N	0.25286	0.73	0.09310	N	1	P	0.43352	0.804	B	0.39660	0.306	T	0.20571	-1.0271	10	0.46703	T	0.11	.	7.4305	0.27124	0.0:0.3915:0.0:0.6085	.	305	A6ND48	O14I1_HUMAN	N	305	ENSP00000339726:K305N	ENSP00000339726:K305N	K	-	3	2	OR14I1	246911314	.	.	0.001000	0.08648	0.010000	0.07245	.	.	-0.490000	0.06707	0.543000	0.68304	AAG	OR14I1	-	NULL	ENSG00000189181		0.348	OR14I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR14I1	HGNC	protein_coding	OTTHUMT00000097128.1	82	0.00	0	C	NM_001004734		248844691	248844691	-1	no_errors	ENST00000342623	ensembl	human	known	69_37n	missense	82	26.13	29	SNP	0.000	A
OR4X2	119764	genome.wustl.edu	37	11	48266965	48266965	+	Missense_Mutation	SNP	A	A	T			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr11:48266965A>T	ENST00000302329.3	+	1	358	c.310A>T	c.(310-312)Att>Ttt	p.I104F		NM_001004727.1	NP_001004727.1	Q8NGF9	OR4X2_HUMAN	olfactory receptor, family 4, subfamily X, member 2	104						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I104F(1)		breast(1)|large_intestine(4)|lung(12)|pancreas(1)|stomach(1)|upper_aerodigestive_tract(1)	20						TGGCACTGAGATTTTCCTGCT	0.507																																						dbGAP											1	Substitution - Missense(1)	breast(1)											131.0	120.0	124.0					11																	48266965		2201	4298	6499	-	-	-	SO:0001583	missense	0			AB065847	CCDS31486.1	11p11.2	2012-08-09			ENSG00000172208	ENSG00000172208		"""GPCR / Class A : Olfactory receptors"""	15184	protein-coding gene	gene with protein product							Standard	NM_001004727		Approved		uc001ngs.1	Q8NGF9	OTTHUMG00000165302	ENST00000302329.3:c.310A>T	11.37:g.48266965A>T	ENSP00000307751:p.Ile104Phe		B2RNK3|Q6IF73|Q96R63	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.I104F	ENST00000302329.3	37	c.310	CCDS31486.1	11	.	.	.	.	.	.	.	.	.	.	A	13.06	2.125627	0.37533	.	.	ENSG00000172208	ENST00000302329	T	0.00397	7.57	5.37	5.37	0.77165	GPCR, rhodopsin-like superfamily (1);	0.341118	0.24965	N	0.034183	T	0.00300	0.0009	L	0.27975	0.815	0.19300	N	0.99998	B	0.33857	0.429	B	0.36885	0.235	T	0.55976	-0.8055	10	0.87932	D	0	.	13.3324	0.60495	1.0:0.0:0.0:0.0	.	104	Q8NGF9	OR4X2_HUMAN	F	104	ENSP00000307751:I104F	ENSP00000307751:I104F	I	+	1	0	OR4X2	48223541	0.000000	0.05858	0.980000	0.43619	0.866000	0.49608	-0.061000	0.11693	2.020000	0.59435	0.528000	0.53228	ATT	OR4X2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000172208		0.507	OR4X2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4X2	HGNC	protein_coding	OTTHUMT00000383376.2	126	0.79	1	A	NM_001004727		48266965	48266965	+1	no_errors	ENST00000302329	ensembl	human	known	69_37n	missense	97	20.49	25	SNP	0.268	T
OTUD1	220213	genome.wustl.edu	37	10	23729805	23729805	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr10:23729805G>T	ENST00000376495.3	+	1	1608	c.1419G>T	c.(1417-1419)atG>atT	p.M473I		NM_001145373.2	NP_001138845.1	Q5VV17	OTUD1_HUMAN	OTU deubiquitinase 1	473					protein K63-linked deubiquitination (GO:0070536)		ubiquitin-specific protease activity (GO:0004843)	p.M473I(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)	5						TGTCTAAAATGTATATTGAAC	0.378																																						dbGAP											1	Substitution - Missense(1)	breast(1)											64.0	57.0	59.0					10																	23729805		692	1591	2283	-	-	-	SO:0001583	missense	0			AK096389	CCDS44366.1	10p12.31	2014-02-24	2014-02-24		ENSG00000165312	ENSG00000165312		"""OTU domain containing"""	27346	protein-coding gene	gene with protein product		612022	"""OTU domain containing 1"""	OTDC1		23827681	Standard	NM_001145373		Approved	DUBA7	uc001irr.2	Q5VV17	OTTHUMG00000017819	ENST00000376495.3:c.1419G>T	10.37:g.23729805G>T	ENSP00000365678:p.Met473Ile			Missense_Mutation	SNP	pfam_OTU,pfscan_OTU	p.M473I	ENST00000376495.3	37	c.1419	CCDS44366.1	10	.	.	.	.	.	.	.	.	.	.	G	18.89	3.719092	0.68844	.	.	ENSG00000165312	ENST00000376495	.	.	.	5.59	5.59	0.84812	.	0.000000	0.85682	U	0.000000	T	0.42449	0.1203	N	0.24115	0.695	0.54753	D	0.99998	P	0.49185	0.92	B	0.39152	0.292	T	0.49437	-0.8940	9	0.66056	D	0.02	-0.0349	19.5838	0.95484	0.0:0.0:1.0:0.0	.	473	Q5VV17	OTUD1_HUMAN	I	473	.	ENSP00000365678:M473I	M	+	3	0	OTUD1	23769811	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.744000	0.85034	2.613000	0.88420	0.655000	0.94253	ATG	OTUD1	-	NULL	ENSG00000165312		0.378	OTUD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTUD1	HGNC	protein_coding	OTTHUMT00000047215.1	62	0.00	0	G	XM_166659		23729805	23729805	+1	no_errors	ENST00000376495	ensembl	human	known	69_37n	missense	23	14.81	4	SNP	1.000	T
PCED1B	91523	genome.wustl.edu	37	12	47629748	47629748	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr12:47629748C>A	ENST00000546455.1	+	4	1633	c.902C>A	c.(901-903)cCc>cAc	p.P301H	RP11-493L12.3_ENST00000547748.1_RNA|PCED1B_ENST00000432328.1_Missense_Mutation_p.P301H			Q96HM7	PED1B_HUMAN	PC-esterase domain containing 1B	301	Pro-rich.						hydrolase activity (GO:0016787)	p.P301H(1)									acataccgccccctgcttggg	0.642																																						dbGAP											1	Substitution - Missense(1)	breast(1)											30.0	33.0	32.0					12																	47629748		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC016154	CCDS8752.1	12q13.11	2012-06-11	2012-06-11	2012-06-11	ENSG00000179715	ENSG00000179715			28255	protein-coding gene	gene with protein product			"""family with sequence similarity 113, member B"""	FAM113B		20056006	Standard	NM_138371		Approved	MGC16044	uc001rpq.3	Q96HM7	OTTHUMG00000169617	ENST00000546455.1:c.902C>A	12.37:g.47629748C>A	ENSP00000446688:p.Pro301His		Q96B20	Missense_Mutation	SNP	superfamily_Esterase_SGNH_hydro-type	p.P301H	ENST00000546455.1	37	c.902	CCDS8752.1	12	.	.	.	.	.	.	.	.	.	.	C	4.860	0.159853	0.09287	.	.	ENSG00000179715	ENST00000546455;ENST00000432328;ENST00000548348;ENST00000330951	T;T	0.38722	1.12;1.12	4.38	2.55	0.30701	.	2.058740	0.02979	N	0.145400	T	0.31009	0.0783	N	0.08118	0	0.09310	N	1	D	0.59767	0.986	P	0.46718	0.525	T	0.28364	-1.0046	10	0.72032	D	0.01	-9.0742	6.1317	0.20209	0.0:0.7094:0.1895:0.101	.	301	Q96HM7	F113B_HUMAN	H	301;301;181;181	ENSP00000446688:P301H;ENSP00000396040:P301H	ENSP00000328560:P181H	P	+	2	0	FAM113B	45916015	0.000000	0.05858	0.007000	0.13788	0.007000	0.05969	0.585000	0.23879	0.782000	0.33613	0.655000	0.94253	CCC	PCED1B	-	NULL	ENSG00000179715		0.642	PCED1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCED1B	HGNC	protein_coding	OTTHUMT00000405079.1	69	0.00	0	C	NM_138371		47629748	47629748	+1	no_errors	ENST00000432328	ensembl	human	known	69_37n	missense	29	34.09	15	SNP	0.007	A
PDXDC2P	283970	genome.wustl.edu	37	16	70058537	70058537	+	RNA	SNP	C	C	G			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr16:70058537C>G	ENST00000531894.1	-	0	935					NR_003610.1		Q6P474	PDXD2_HUMAN	pyridoxal-dependent decarboxylase domain containing 2, pseudogene						carboxylic acid metabolic process (GO:0019752)		carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)	p.R255T(1)									TTCTTTCAATCTCCCAATCTT	0.478																																						dbGAP											1	Substitution - Missense(1)	breast(1)																																								-	-	-			0					16q22.1	2014-03-20	2010-09-02	2010-09-02	ENSG00000196696	ENSG00000196696			27559	pseudogene	pseudogene			"""pyridoxal-dependent decarboxylase domain containing 2"""	PDXDC2			Standard	NR_003610		Approved	DKFZp761H1120	uc010vlq.1	Q6P474	OTTHUMG00000167595		16.37:g.70058537C>G			A8K9Z5	RNA	SNP	-	NULL	ENST00000531894.1	37	NULL		16																																																																																			PDXDC2P	-	-	ENSG00000196696		0.478	PDXDC2P-001	KNOWN	basic|readthrough_transcript	processed_transcript	PDXDC2P	HGNC	processed_transcript	OTTHUMT00000395258.1	304	0.65	2	C			70058537	70058537	-1	no_errors	ENST00000529089	ensembl	human	known	69_37n	rna	153	28.17	60	SNP	1.000	G
PLCZ1	89869	genome.wustl.edu	37	12	18837202	18837202	+	Nonsense_Mutation	SNP	T	T	A			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr12:18837202T>A	ENST00000538330.1	-	10	1330	c.949A>T	c.(949-951)Aga>Tga	p.R317*	PLCZ1_ENST00000435379.1_Nonsense_Mutation_p.R340*|PLCZ1_ENST00000447925.2_Nonsense_Mutation_p.R533*|PLCZ1_ENST00000541695.1_3'UTR|PLCZ1_ENST00000266505.7_Nonsense_Mutation_p.R535*|PLCZ1_ENST00000539875.1_Nonsense_Mutation_p.R342*|PLCZ1_ENST00000534932.1_Nonsense_Mutation_p.R16*					phospholipase C, zeta 1									p.R535*(1)		NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	31	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)					TCATTCCATCTTGGACTAAAA	0.284																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											72.0	75.0	74.0					12																	18837202		2202	4298	6500	-	-	-	SO:0001587	stop_gained	0			AY035866	CCDS8680.1	12p13.31	2013-01-10			ENSG00000139151	ENSG00000139151	3.1.4.11	"""EF-hand domain containing"""	19218	protein-coding gene	gene with protein product		608075				12117804	Standard	NM_033123		Approved	NYD-SP27, PLCzeta	uc021qvx.2	Q86YW0	OTTHUMG00000168937	ENST00000538330.1:c.949A>T	12.37:g.18837202T>A	ENSP00000445880:p.Arg317*			Nonsense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,pfscan_EF_HAND_2,pfscan_C2_membr_targeting,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.R535*	ENST00000538330.1	37	c.1603		12	.	.	.	.	.	.	.	.	.	.	T	39	7.810396	0.98501	.	.	ENSG00000139151	ENST00000534932;ENST00000538330;ENST00000266505;ENST00000447925;ENST00000435379;ENST00000539875	.	.	.	5.15	2.7	0.31948	.	0.676654	0.15700	N	0.248983	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	.	10.425	0.44373	0.0:0.0:0.3277:0.6723	.	.	.	.	X	16;317;535;533;340;342	.	ENSP00000266505:R535X	R	-	1	2	PLCZ1	18728469	0.657000	0.27393	1.000000	0.80357	0.993000	0.82548	0.697000	0.25556	0.945000	0.37605	0.533000	0.62120	AGA	PLCZ1	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	ENSG00000139151		0.284	PLCZ1-002	PUTATIVE	basic|exp_conf	protein_coding	PLCZ1	HGNC	protein_coding	OTTHUMT00000401666.3	150	0.00	0	T	NM_033123		18837202	18837202	-1	no_errors	ENST00000266505	ensembl	human	known	69_37n	nonsense	140	15.66	26	SNP	0.958	A
PLEKHG2	64857	genome.wustl.edu	37	19	39914678	39914678	+	Missense_Mutation	SNP	C	C	A	rs150289778	byFrequency	TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr19:39914678C>A	ENST00000409794.3	+	19	3755	c.2905C>A	c.(2905-2907)Ctt>Att	p.L969I	PLEKHG2_ENST00000458508.2_Missense_Mutation_p.L910I|PLEKHG2_ENST00000409797.2_Intron|PLEKHG2_ENST00000378550.1_Intron|PLEKHG2_ENST00000425673.1_Missense_Mutation_p.L940I|CTB-60E11.4_ENST00000601124.1_lincRNA	NM_022835.2	NP_073746.2	Q9H7P9	PKHG2_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 2	969					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.L969I(1)|p.L927I(1)|p.L910I(1)		breast(3)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|pancreas(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	40	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			GGTGCCGGCTCTTACAACTTT	0.562																																						dbGAP											3	Substitution - Missense(3)	breast(3)											79.0	85.0	83.0					19																	39914678		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK024429	CCDS33022.2	19q13.2	2013-01-11			ENSG00000090924	ENSG00000090924		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	29515	protein-coding gene	gene with protein product		611893				11839748, 18045877	Standard	NM_022835		Approved	CLG, FLJ00018, ARHGEF42	uc010xuz.2	Q9H7P9	OTTHUMG00000152570	ENST00000409794.3:c.2905C>A	19.37:g.39914678C>A	ENSP00000386733:p.Leu969Ile		B8ZZK6|C9J0Y4|Q6DHV6|Q96BU2|Q96D18|Q9H699	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.L969I	ENST00000409794.3	37	c.2905	CCDS33022.2	19	.	.	.	.	.	.	.	.	.	.	C	3.388	-0.124948	0.06795	.	.	ENSG00000090924	ENST00000409794;ENST00000425673;ENST00000458508	T;T;T	0.67523	-0.14;-0.13;-0.27	3.57	-1.89	0.07689	.	1.986640	0.02969	N	0.144144	T	0.45276	0.1334	N	0.14661	0.345	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.17228	-1.0376	10	0.17832	T	0.49	.	5.1751	0.15131	0.2233:0.4367:0.3399:0.0	.	940;969;910	Q9H7P9-3;Q9H7P9;E7ESZ3	.;PKHG2_HUMAN;.	I	969;940;910	ENSP00000386733:L969I;ENSP00000392906:L940I;ENSP00000408857:L910I	ENSP00000386733:L969I	L	+	1	0	PLEKHG2	44606518	0.000000	0.05858	0.005000	0.12908	0.013000	0.08279	-1.847000	0.01675	-0.165000	0.10908	-0.340000	0.08031	CTT	PLEKHG2	-	NULL	ENSG00000090924		0.562	PLEKHG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHG2	HGNC	protein_coding	OTTHUMT00000326802.1	74	0.00	0	C	NM_022835		39914678	39914678	+1	no_errors	ENST00000409794	ensembl	human	known	69_37n	missense	31	26.19	11	SNP	0.016	A
PLXNA2	5362	genome.wustl.edu	37	1	208390491	208390491	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr1:208390491C>G	ENST00000367033.3	-	2	1534	c.777G>C	c.(775-777)caG>caC	p.Q259H		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	259	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)	p.Q259H(1)		NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		GGGTCTCGGGCTGGACAGTGA	0.557																																						dbGAP											1	Substitution - Missense(1)	breast(1)											123.0	126.0	125.0					1																	208390491		2203	4300	6503	-	-	-	SO:0001583	missense	0			X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.777G>C	1.37:g.208390491C>G	ENSP00000356000:p.Gln259His		A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semaphorin/CD100_Ag,pfam_IPT_TIG_rcpt,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.Q259H	ENST00000367033.3	37	c.777	CCDS31013.1	1	.	.	.	.	.	.	.	.	.	.	C	15.68	2.904606	0.52333	.	.	ENSG00000076356	ENST00000367033	T	0.13901	2.55	5.84	3.65	0.41850	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.42086	0.1187	M	0.90198	3.095	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.50491	-0.8822	10	0.87932	D	0	.	11.0336	0.47787	0.0:0.7306:0.0:0.2694	.	313;259	O75051-2;O75051	.;PLXA2_HUMAN	H	259	ENSP00000356000:Q259H	ENSP00000356000:Q259H	Q	-	3	2	PLXNA2	206457114	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	0.853000	0.27777	1.476000	0.48215	0.655000	0.94253	CAG	PLXNA2	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000076356		0.557	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA2	HGNC	protein_coding	OTTHUMT00000088932.6	116	0.00	0	C	NM_025179		208390491	208390491	-1	no_errors	ENST00000367033	ensembl	human	known	69_37n	missense	93	10.58	11	SNP	1.000	G
PM20D2	135293	genome.wustl.edu	37	6	89859096	89859096	+	Missense_Mutation	SNP	A	A	G			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr6:89859096A>G	ENST00000275072.4	+	2	673	c.578A>G	c.(577-579)gAg>gGg	p.E193G		NM_001010853.1	NP_001010853.1	Q8IYS1	P20D2_HUMAN	peptidase M20 domain containing 2	193						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)	p.E193G(1)		breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(2)|skin(1)	12		all_cancers(76;9.47e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.00813)		CCATCACAAGAGAATGCTGCT	0.398																																						dbGAP											1	Substitution - Missense(1)	breast(1)											152.0	152.0	152.0					6																	89859096		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC035036	CCDS34499.1	6q15	2014-07-14	2007-11-14	2007-11-14	ENSG00000146281	ENSG00000146281			21408	protein-coding gene	gene with protein product	"""&#946;-alanyl-lysine dipeptidase"""	615913	"""aminoacylase 1-like 2"""	ACY1L2		24891507	Standard	NM_001010853		Approved	bA63L7.3	uc003pmz.4	Q8IYS1	OTTHUMG00000015193	ENST00000275072.4:c.578A>G	6.37:g.89859096A>G	ENSP00000275072:p.Glu193Gly		B4DYJ2|Q5T7J9|Q6MZV2|Q86XD9	Missense_Mutation	SNP	pfam_Peptidase_M20_dimer,pfam_Peptidase_M20,superfamily_Peptidase_M20_dimer,pirsf_Pept_M20D_amidohydro_pred	p.E193G	ENST00000275072.4	37	c.578	CCDS34499.1	6	.	.	.	.	.	.	.	.	.	.	A	20.3	3.970197	0.74246	.	.	ENSG00000146281	ENST00000275072	T	0.36157	1.27	5.87	5.87	0.94306	.	0.101329	0.64402	D	0.000002	T	0.34542	0.0901	L	0.55481	1.735	0.53688	D	0.999972	P	0.39624	0.681	P	0.50270	0.636	T	0.06881	-1.0802	10	0.18710	T	0.47	-15.5179	16.5764	0.84681	1.0:0.0:0.0:0.0	.	193	Q8IYS1	P20D2_HUMAN	G	193	ENSP00000275072:E193G	ENSP00000275072:E193G	E	+	2	0	PM20D2	89915815	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.564000	0.73969	2.371000	0.80710	0.533000	0.62120	GAG	PM20D2	-	pfam_Peptidase_M20,pirsf_Pept_M20D_amidohydro_pred	ENSG00000146281		0.398	PM20D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PM20D2	HGNC	protein_coding	OTTHUMT00000041477.1	145	0.00	0	A	NM_001010853		89859096	89859096	+1	no_errors	ENST00000275072	ensembl	human	known	69_37n	missense	65	22.62	19	SNP	1.000	G
PPP1R15B	84919	genome.wustl.edu	37	1	204379199	204379199	+	Missense_Mutation	SNP	A	A	T			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr1:204379199A>T	ENST00000367188.4	-	1	1720	c.1341T>A	c.(1339-1341)gaT>gaA	p.D447E	RP11-739N20.2_ENST00000443515.1_RNA	NM_032833.3	NP_116222.3	Q5SWA1	PR15B_HUMAN	protein phosphatase 1, regulatory subunit 15B	447					ER overload response (GO:0006983)|regulation of translation (GO:0006417)|response to hydrogen peroxide (GO:0042542)	protein phosphatase type 1 complex (GO:0000164)	protein serine/threonine phosphatase activity (GO:0004722)	p.D447E(1)		breast(3)|cervix(1)|kidney(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(2)|skin(1)|urinary_tract(3)	34	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)			CCTCATCCCAATCCTCACCTT	0.453																																						dbGAP											1	Substitution - Missense(1)	breast(1)											134.0	134.0	134.0					1																	204379199		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027650	CCDS1445.1	1q32.1	2012-04-17	2011-10-04		ENSG00000158615	ENSG00000158615		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14951	protein-coding gene	gene with protein product		613257	"""protein phosphatase 1, regulatory (inhibitor) subunit 15B"""			11948623	Standard	XM_005245551		Approved	FLJ14744	uc001hav.4	Q5SWA1	OTTHUMG00000036105	ENST00000367188.4:c.1341T>A	1.37:g.204379199A>T	ENSP00000356156:p.Asp447Glu		Q53GQ4|Q658M2|Q6P156|Q96SN1	Missense_Mutation	SNP	pfam_Prot_Pase1_reg-su15B_N,pfam_Prot_Pase1_reg-su15A/B_C	p.D447E	ENST00000367188.4	37	c.1341	CCDS1445.1	1	.	.	.	.	.	.	.	.	.	.	A	17.85	3.490775	0.64074	.	.	ENSG00000158615	ENST00000367188;ENST00000543650	T	0.24538	1.85	4.76	-0.229	0.13094	Protein phosphatase 1, regulatory subunit 15A/B, C-terminal (1);	0.711544	0.13382	N	0.392046	T	0.34745	0.0908	M	0.72118	2.19	0.25742	N	0.985157	P	0.49447	0.924	P	0.50860	0.652	T	0.19844	-1.0293	10	0.45353	T	0.12	-1.688	9.139	0.36892	0.5751:0.0:0.4249:0.0	.	447	Q5SWA1	PR15B_HUMAN	E	447;357	ENSP00000356156:D447E	ENSP00000356156:D447E	D	-	3	2	PPP1R15B	202645822	0.669000	0.27502	0.168000	0.22838	0.946000	0.59487	0.065000	0.14466	-0.247000	0.09597	0.533000	0.62120	GAT	PPP1R15B	-	pfam_Prot_Pase1_reg-su15A/B_C	ENSG00000158615		0.453	PPP1R15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R15B	HGNC	protein_coding	OTTHUMT00000087974.1	23	0.00	0	A	NM_032833		204379199	204379199	-1	no_errors	ENST00000367188	ensembl	human	known	69_37n	missense	18	37.93	11	SNP	0.384	T
PRB3	5544	genome.wustl.edu	37	12	11420173	11420173	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr12:11420173G>A	ENST00000381842.3	-	5	920	c.883C>T	c.(883-885)Caa>Taa	p.Q295*	PRB3_ENST00000279573.7_3'UTR|PRB3_ENST00000538488.1_Nonsense_Mutation_p.Q295*|PRB3_ENST00000440870.3_5'UTR	NM_006249.4	NP_006240.4	Q04118	PRB3_HUMAN	proline-rich protein BstNI subfamily 3	295	Pro-rich.				defense response to Gram-negative bacterium (GO:0050829)	extracellular region (GO:0005576)		p.Q295*(2)		breast(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(5)	25			OV - Ovarian serous cystadenocarcinoma(49;0.201)			CTGCCCCCTTGAGGAGGTGGA	0.587																																						dbGAP											2	Substitution - Nonsense(2)	breast(2)											91.0	103.0	99.0					12																	11420173		2199	4299	6498	-	-	-	SO:0001587	stop_gained	0					12p13.2	2012-10-02				ENSG00000197870			9339	protein-coding gene	gene with protein product		168840				1894623	Standard	NM_006249		Approved	PRG	uc001qzs.3	Q04118		ENST00000381842.3:c.883C>T	12.37:g.11420173G>A	ENSP00000371264:p.Gln295*		Q15188|Q4VAY3|Q4VAY4|Q7M4M9|Q9UCT9	Nonsense_Mutation	SNP	NULL	p.Q295*	ENST00000381842.3	37	c.883		12	.	.	.	.	.	.	.	.	.	.	.	12.38	1.919471	0.33908	.	.	ENSG00000197870	ENST00000381842;ENST00000538488	.	.	.	1.31	1.31	0.21738	.	4.098650	0.01937	U	0.041659	.	.	.	.	.	.	0.20975	A	0.000184087	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.0752	0.19911	0.0:0.0:1.0:0.0	.	.	.	.	X	295	.	ENSP00000371264:Q295X	Q	-	1	0	PRB3	11311440	0.001000	0.12720	0.003000	0.11579	0.034000	0.12701	-0.143000	0.10296	1.047000	0.40274	0.306000	0.20318	CAA	PRB3	-	NULL	ENSG00000197870		0.587	PRB3-201	KNOWN	basic|appris_candidate_longest	protein_coding	PRB3	HGNC	protein_coding		614	0.00	0	G	NM_006249		11420173	11420173	-1	no_errors	ENST00000381842	ensembl	human	known	69_37n	nonsense	426	31.74	199	SNP	0.003	A
PREX2	80243	genome.wustl.edu	37	8	69033181	69033181	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr8:69033181G>C	ENST00000288368.4	+	30	3898	c.3621G>C	c.(3619-3621)aaG>aaC	p.K1207N		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	1207					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)	p.K1207N(1)		NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						TGGAACCAAAGCTGAGTTGTC	0.393																																						dbGAP											1	Substitution - Missense(1)	breast(1)											60.0	59.0	59.0					8																	69033181		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.3621G>C	8.37:g.69033181G>C	ENSP00000288368:p.Lys1207Asn		B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.K1207N	ENST00000288368.4	37	c.3621	CCDS6201.1	8	.	.	.	.	.	.	.	.	.	.	G	14.31	2.497591	0.44455	.	.	ENSG00000046889	ENST00000288368	T	0.36520	1.25	5.83	1.62	0.23740	.	0.000000	0.85682	D	0.000000	T	0.29423	0.0733	L	0.51422	1.61	0.53688	D	0.99997	B	0.33512	0.415	B	0.34301	0.179	T	0.05666	-1.0871	10	0.33940	T	0.23	.	9.0281	0.36243	0.4648:0.0:0.5352:0.0	.	1207	Q70Z35	PREX2_HUMAN	N	1207	ENSP00000288368:K1207N	ENSP00000288368:K1207N	K	+	3	2	PREX2	69195735	0.663000	0.27448	1.000000	0.80357	0.998000	0.95712	0.081000	0.14823	0.626000	0.30322	0.561000	0.74099	AAG	PREX2	-	NULL	ENSG00000046889		0.393	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREX2	HGNC	protein_coding	OTTHUMT00000378620.1	144	0.00	0	G	NM_025170		69033181	69033181	+1	no_errors	ENST00000288368	ensembl	human	known	69_37n	missense	75	14.77	13	SNP	1.000	C
PRKAA2	5563	genome.wustl.edu	37	1	57159438	57159438	+	Splice_Site	SNP	G	G	T			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr1:57159438G>T	ENST00000371244.4	+	5	542	c.476G>T	c.(475-477)gGa>gTa	p.G159V		NM_006252.3	NP_006243.2	P54646	AAPK2_HUMAN	protein kinase, AMP-activated, alpha 2 catalytic subunit	159	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				autophagy (GO:0006914)|carnitine shuttle (GO:0006853)|cell cycle arrest (GO:0007050)|cellular lipid metabolic process (GO:0044255)|cellular response to glucose starvation (GO:0042149)|cellular response to nutrient levels (GO:0031669)|cholesterol biosynthetic process (GO:0006695)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid homeostasis (GO:0055089)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|positive regulation of glycolytic process (GO:0045821)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|regulation of energy homeostasis (GO:2000505)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	[acetyl-CoA carboxylase] kinase activity (GO:0050405)|[hydroxymethylglutaryl-CoA reductase (NADPH)] kinase activity (GO:0047322)|AMP-activated protein kinase activity (GO:0004679)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|histone serine kinase activity (GO:0035174)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)	p.G159V(2)		breast(6)|endometrium(1)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)|stomach(1)	23					Acetylsalicylic acid(DB00945)	TTATTTTTAGGATTATCTAAT	0.328																																						dbGAP											2	Substitution - Missense(2)	breast(2)											74.0	80.0	78.0					1																	57159438		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0			BC069823	CCDS605.1	1p31	2011-08-25			ENSG00000162409	ENSG00000162409			9377	protein-coding gene	gene with protein product		600497		PRKAA		7959015	Standard	NM_006252		Approved	AMPK, AMPKa2	uc001cyk.4	P54646	OTTHUMG00000008282	ENST00000371244.4:c.476-1G>T	1.37:g.57159438G>T			Q9H1E8|Q9UD43	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Kinase-assoc_KA1,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.G159V	ENST00000371244.4	37	c.476	CCDS605.1	1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.701641	0.88924	.	.	ENSG00000162409	ENST00000371244	T	0.80123	-1.34	5.48	5.48	0.80851	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.95133	0.8423	H	0.99682	4.7	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97222	0.9878	9	.	.	.	.	19.7147	0.96110	0.0:0.0:1.0:0.0	.	159	P54646	AAPK2_HUMAN	V	159	ENSP00000360290:G159V	.	G	+	2	0	PRKAA2	56932026	1.000000	0.71417	0.988000	0.46212	0.986000	0.74619	9.294000	0.96088	2.732000	0.93576	0.591000	0.81541	GGA	PRKAA2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000162409		0.328	PRKAA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKAA2	HGNC	protein_coding	OTTHUMT00000022753.2	166	0.60	1	G	NM_006252	Missense_Mutation	57159438	57159438	+1	no_errors	ENST00000371244	ensembl	human	known	69_37n	missense	190	11.21	24	SNP	1.000	T
PSD2	84249	genome.wustl.edu	37	5	139193032	139193032	+	Silent	SNP	C	C	T	rs199679832	byFrequency	TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr5:139193032C>T	ENST00000274710.3	+	3	715	c.510C>T	c.(508-510)agC>agT	p.S170S		NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	170					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)	p.S170S(1)		breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGATGAGAGCGACAGCTGCG	0.652													C|||	4	0.000798722	0.003	0.0	5008	,	,		16408	0.0		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - coding silent(1)	breast(1)											41.0	43.0	42.0					5																	139193032		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.510C>T	5.37:g.139193032C>T			D3DQD3|Q8N3J8	Silent	SNP	pfam_Sec7,pfam_Pleckstrin_homology,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_Pleckstrin_homology,pfscan_Sec7	p.S170	ENST00000274710.3	37	c.510	CCDS4216.1	5																																																																																			PSD2	-	NULL	ENSG00000146005		0.652	PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSD2	HGNC	protein_coding	OTTHUMT00000251339.1	52	0.00	0	C	NM_032289		139193032	139193032	+1	no_errors	ENST00000274710	ensembl	human	known	69_37n	silent	19	45.71	16	SNP	0.490	T
PSG11	5680	genome.wustl.edu	37	19	43529167	43529167	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr19:43529167C>A	ENST00000401740.1	-	2	209	c.106G>T	c.(106-108)Gtc>Ttc	p.V36F	PSG11_ENST00000403486.1_Intron|PSG11_ENST00000320078.7_Missense_Mutation_p.V36F|PSG11_ENST00000306322.7_Intron			Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 11	36	Ig-like V-type.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.V36F(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	26		Prostate(69;0.00682)				TCAATCATGACTTGGGCAGTG	0.458																																						dbGAP											1	Substitution - Missense(1)	breast(1)											193.0	196.0	195.0					19																	43529167		2199	4295	6494	-	-	-	SO:0001583	missense	0			U25988	CCDS12614.2, CCDS12615.2	19q13.2	2013-01-29			ENSG00000243130	ENSG00000243130		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9516	protein-coding gene	gene with protein product	"""pregnancy specific beta-1-glycoprotein 13"""	176401		PSG13, PSG14		7794280	Standard	NM_001113410		Approved	MGC22484	uc002ovm.1	Q9UQ72	OTTHUMG00000151546	ENST00000401740.1:c.106G>T	19.37:g.43529167C>A	ENSP00000384995:p.Val36Phe		B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.V36F	ENST00000401740.1	37	c.106	CCDS12614.2	19	.	.	.	.	.	.	.	.	.	.	c	6.303	0.424041	0.11928	.	.	ENSG00000243130	ENST00000320078;ENST00000401740	T;T	0.01705	4.68;4.68	0.929	-1.86	0.07760	Immunoglobulin-like fold (1);	.	.	.	.	T	0.04998	0.0134	L	0.54323	1.7	0.09310	N	1	P	0.46064	0.872	P	0.61397	0.888	T	0.29058	-1.0024	9	0.66056	D	0.02	.	5.4245	0.16417	0.0:0.5489:0.4511:0.0	.	36	Q9UQ72	PSG11_HUMAN	F	36	ENSP00000319140:V36F;ENSP00000384995:V36F	ENSP00000319140:V36F	V	-	1	0	PSG11	48221007	0.000000	0.05858	0.022000	0.16811	0.017000	0.09413	-0.375000	0.07475	-0.528000	0.06366	0.184000	0.17185	GTC	PSG11	-	NULL	ENSG00000243130		0.458	PSG11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PSG11	HGNC	protein_coding	OTTHUMT00000323079.1	337	0.00	0	C	NM_002785		43529167	43529167	-1	no_errors	ENST00000320078	ensembl	human	known	69_37n	missense	152	53.78	178	SNP	0.031	A
PXDNL	137902	genome.wustl.edu	37	8	52384808	52384808	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr8:52384808C>T	ENST00000356297.4	-	8	851	c.751G>A	c.(751-753)Gtc>Atc	p.V251I	PXDNL_ENST00000543296.1_Missense_Mutation_p.V251I	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	251	Ig-like C2-type 1.				hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.V251I(1)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GTGAAGTAGACGGTATTTCCT	0.433																																						dbGAP											1	Substitution - Missense(1)	breast(1)											169.0	162.0	164.0					8																	52384808		1882	4096	5978	-	-	-	SO:0001583	missense	0				CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.751G>A	8.37:g.52384808C>T	ENSP00000348645:p.Val251Ile		B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_VWF_C,pfam_Leu-rich_rpt,superfamily_Haem_peroxidase,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_VWF_C,prints_Haem_peroxidase_animal_subgr,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,pfscan_Ig-like	p.V251I	ENST00000356297.4	37	c.751	CCDS47855.1	8	.	.	.	.	.	.	.	.	.	.	C	14.99	2.700559	0.48307	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.47869	0.83;0.83	3.84	2.96	0.34315	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.50548	0.1622	L	0.45470	1.425	0.29258	N	0.871515	D	0.56521	0.976	P	0.53102	0.718	T	0.47649	-0.9101	9	0.66056	D	0.02	.	9.0987	0.36656	0.0:0.8872:0.0:0.1128	.	251	A1KZ92	PXDNL_HUMAN	I	251	ENSP00000348645:V251I;ENSP00000444865:V251I	ENSP00000348645:V251I	V	-	1	0	PXDNL	52547361	1.000000	0.71417	0.473000	0.27253	0.054000	0.15201	4.671000	0.61590	0.627000	0.30340	0.485000	0.47835	GTC	PXDNL	-	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000147485		0.433	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDNL	HGNC	protein_coding	OTTHUMT00000377905.1	198	0.00	0	C	NM_144651		52384808	52384808	-1	no_errors	ENST00000356297	ensembl	human	known	69_37n	missense	108	25.00	36	SNP	1.000	T
RAD51	5888	genome.wustl.edu	37	15	41022086	41022086	+	Silent	SNP	A	A	G			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr15:41022086A>G	ENST00000267868.3	+	9	1078	c.810A>G	c.(808-810)gtA>gtG	p.V270V	RAD51_ENST00000532743.1_Silent_p.V271V|RAD51_ENST00000382643.3_Silent_p.V271V|RAD51_ENST00000423169.2_Intron|RAD51_ENST00000557850.1_Silent_p.V173V|RAD51_ENST00000530766.1_Intron	NM_002875.4	NP_002866.2	Q06609	RAD51_HUMAN	RAD51 recombinase	270					ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to ionizing radiation (GO:0071479)|DNA recombinase assembly (GO:0000730)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA unwinding involved in DNA replication (GO:0006268)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|meiotic nuclear division (GO:0007126)|mitotic recombination (GO:0006312)|positive regulation of DNA ligation (GO:0051106)|protein homooligomerization (GO:0051260)|reciprocal meiotic recombination (GO:0007131)|regulation of double-strand break repair via homologous recombination (GO:0010569)	condensed chromosome (GO:0000793)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|lateral element (GO:0000800)|mitochondrion (GO:0005739)|nuclear chromosome (GO:0000228)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|PML body (GO:0016605)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA polymerase binding (GO:0070182)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|single-stranded DNA binding (GO:0003697)|single-stranded DNA-dependent ATPase activity (GO:0043142)	p.V270V(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(1)|lung(1)|ovary(1)	9		all_cancers(109;1.19e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.45e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000421)|COAD - Colon adenocarcinoma(120;0.163)		ATCAGGTGGTAGCTCAAGTGG	0.448								Homologous recombination																														dbGAP											1	Substitution - coding silent(1)	breast(1)											134.0	115.0	122.0					15																	41022086		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D13804	CCDS10062.1, CCDS53931.1, CCDS53932.1	15q15.1	2014-06-12	2013-07-02		ENSG00000051180	ENSG00000051180			9817	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 5"""	179617	"""RAD51 (S. cerevisiae) homolog (E coli RecA homolog)"", ""RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae)"", ""RAD51 homolog (S. cerevisiae)"""	RAD51A, RECA		8358431, 8479919	Standard	NM_002875		Approved	HsRad51, HsT16930, BRCC5	uc010bbx.3	Q06609	OTTHUMG00000130067	ENST00000267868.3:c.810A>G	15.37:g.41022086A>G			B0FXP0|B2R8T6|Q6FHX9|Q6ZNA8|Q9BV60	Silent	SNP	pfam_DNA_recomb/repair_Rad51_C,pfam_DNA_recomb/repair_RecA,superfamily_DNA_repair_Rad51/TF_NusA_a-hlx,smart_AAA+_ATPase,pirsf_DNA_recomb/repair_RecA-like,pfscan_DNA_recomb_RecA/RadB_ATP-bd,pfscan_RecA_monomer-monomer_interface,tigrfam_DNA_recomb/repair_Rad51	p.V271	ENST00000267868.3	37	c.813	CCDS10062.1	15																																																																																			RAD51	-	pfam_DNA_recomb/repair_Rad51_C,pfam_DNA_recomb/repair_RecA,smart_AAA+_ATPase,pirsf_DNA_recomb/repair_RecA-like,pfscan_DNA_recomb_RecA/RadB_ATP-bd,tigrfam_DNA_recomb/repair_Rad51	ENSG00000051180		0.448	RAD51-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RAD51	HGNC	protein_coding	OTTHUMT00000252358.1	95	0.00	0	A	NM_002875, NM_133487		41022086	41022086	+1	no_errors	ENST00000382643	ensembl	human	known	69_37n	silent	43	37.68	26	SNP	1.000	G
RPL41	6171	genome.wustl.edu	37	12	56511292	56511292	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr12:56511292G>C	ENST00000546591.1	+	3	264	c.62G>C	c.(61-63)aGg>aCg	p.R21T	ZC3H10_ENST00000257940.2_5'Flank|RP11-603J24.6_ENST00000550840.1_RNA|RP11-603J24.5_ENST00000550947.1_RNA|RPL41_ENST00000501597.3_Missense_Mutation_p.R21T|RPL41_ENST00000552314.1_3'UTR	NM_001035267.1	NP_001030344.1	P62945	RL41_HUMAN	ribosomal protein L41	21					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)	p.R21T(1)						OV - Ovarian serous cystadenocarcinoma(18;0.12)			AGAAAGATGAGGCAGAGGTCC	0.502																																						dbGAP											1	Substitution - Missense(1)	breast(1)											100.0	91.0	94.0					12																	56511292		1838	4025	5863	-	-	-	SO:0001583	missense	0			AB007186	CCDS44919.1	12q13	2011-04-06			ENSG00000229117	ENSG00000229117		"""L ribosomal proteins"""	10354	protein-coding gene	gene with protein product		613315				1326959, 9582194	Standard	NM_021104		Approved	L41	uc001sjo.3	P62945		ENST00000546591.1:c.62G>C	12.37:g.56511292G>C	ENSP00000449026:p.Arg21Thr		A6NG21|P28751	Missense_Mutation	SNP	pfam_Ribosomal_L41	p.R21T	ENST00000546591.1	37	c.62	CCDS44919.1	12	.	.	.	.	.	.	.	.	.	.	G	16.44	3.123395	0.56613	.	.	ENSG00000229117	ENST00000546591;ENST00000501597	.	.	.	4.48	4.48	0.54585	.	.	.	.	.	T	0.60366	0.2263	.	.	.	0.30930	N	0.727057	P	0.38863	0.65	P	0.47102	0.537	T	0.66256	-0.5969	7	0.87932	D	0	.	16.5308	0.84357	0.0:0.0:1.0:0.0	.	21	P62945	RL41_HUMAN	T	21	.	ENSP00000420821:R21T	R	+	2	0	RPL41	54797559	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.114000	0.71560	2.528000	0.85240	0.650000	0.86243	AGG	RPL41	-	pfam_Ribosomal_L41	ENSG00000229117		0.502	RPL41-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RPL41	HGNC	protein_coding	OTTHUMT00000407819.1	140	0.00	0	G			56511292	56511292	+1	no_errors	ENST00000501597	ensembl	human	known	69_37n	missense	67	48.46	63	SNP	1.000	C
SATL1	340562	genome.wustl.edu	37	X	84363426	84363426	+	5'UTR	SNP	C	C	T			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chrX:84363426C>T	ENST00000395409.3	-	0	548				SATL1_ENST00000332921.5_5'UTR|SATL1_ENST00000509231.1_Silent_p.L183L			Q86VE3	SATL1_HUMAN	spermidine/spermine N1-acetyl transferase-like 1								N-acetyltransferase activity (GO:0008080)			NS(1)|breast(5)|endometrium(2)|large_intestine(3)|lung(13)|skin(3)|stomach(1)|urinary_tract(1)	29						TTGGTTGCCTCAGGACTGGTT	0.547											OREG0019887	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													238.0	158.0	185.0					X																	84363426		2203	4300	6503	-	-	-	SO:0001623	5_prime_UTR_variant	0			BC043215	CCDS35343.1, CCDS35343.2	Xq21	2008-02-05			ENSG00000184788	ENSG00000184788			27992	protein-coding gene	gene with protein product						12477932	Standard	NM_001012980		Approved		uc004een.3	Q86VE3	OTTHUMG00000021931	ENST00000395409.3:c.-13G>A	X.37:g.84363426C>T		1228	A0AVK7|E9PB72|Q5H8V9	Silent	SNP	superfamily_Acyl_CoA_acyltransferase	p.L183	ENST00000395409.3	37	c.549		X																																																																																			SATL1	-	NULL	ENSG00000184788		0.547	SATL1-202	KNOWN	basic|appris_principal	protein_coding	SATL1	HGNC	protein_coding		294	0.00	0	C	XM_291339		84363426	84363426	-1	no_errors	ENST00000509231	ensembl	human	known	69_37n	silent	170	26.09	60	SNP	0.000	T
SCN10A	6336	genome.wustl.edu	37	3	38764954	38764954	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr3:38764954C>G	ENST00000449082.2	-	18	3318	c.3319G>C	c.(3319-3321)Gac>Cac	p.D1107H		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	1107					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.D1107H(1)		NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	TCTTCCAGGTCATCTGCCAGc	0.557																																						dbGAP											1	Substitution - Missense(1)	breast(1)											109.0	92.0	98.0					3																	38764954		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.3319G>C	3.37:g.38764954C>G	ENSP00000390600:p.Asp1107His		A6NDQ1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_asu,prints_PKD_2	p.D1107H	ENST00000449082.2	37	c.3319	CCDS33736.1	3	.	.	.	.	.	.	.	.	.	.	C	12.01	1.809441	0.31961	.	.	ENSG00000185313	ENST00000449082	D	0.84516	-1.86	4.65	3.69	0.42338	Sodium ion transport-associated (1);	0.362148	0.31461	N	0.007611	D	0.90273	0.6958	M	0.71036	2.16	0.09310	N	1	D	0.69078	0.997	D	0.66716	0.946	T	0.82717	-0.0319	10	0.87932	D	0	.	13.0159	0.58757	0.0:0.9065:0.0:0.0935	.	1107	Q9Y5Y9	SCNAA_HUMAN	H	1107	ENSP00000390600:D1107H	ENSP00000390600:D1107H	D	-	1	0	SCN10A	38739958	0.000000	0.05858	0.986000	0.45419	0.197000	0.23852	0.588000	0.23924	2.429000	0.82318	0.555000	0.69702	GAC	SCN10A	-	pfam_Na_trans_assoc	ENSG00000185313		0.557	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN10A	HGNC	protein_coding	OTTHUMT00000109745.3	168	0.00	0	C	NM_006514		38764954	38764954	-1	no_errors	ENST00000449082	ensembl	human	known	69_37n	missense	35	39.66	23	SNP	0.074	G
SDK2	54549	genome.wustl.edu	37	17	71375645	71375645	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr17:71375645G>T	ENST00000392650.3	-	35	4806	c.4806C>A	c.(4804-4806)taC>taA	p.Y1602*	SDK2_ENST00000388726.3_Nonsense_Mutation_p.Y1583*	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	1602	Fibronectin type-III 10. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.Y1602*(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						CCACAGCGTTGTACACGCTCA	0.652																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											68.0	52.0	58.0					17																	71375645		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0			AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.4806C>A	17.37:g.71375645G>T	ENSP00000376421:p.Tyr1602*		A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Nonsense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.Y1602*	ENST00000392650.3	37	c.4806	CCDS45769.1	17	.	.	.	.	.	.	.	.	.	.	G	39	7.731687	0.98459	.	.	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000424778;ENST00000316893	.	.	.	4.61	4.61	0.57282	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.8103	0.88613	0.0:0.0:1.0:0.0	.	.	.	.	X	1226;1602;1583;759;1602	.	ENSP00000324967:Y1602X	Y	-	3	2	SDK2	68887240	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	6.378000	0.73150	2.275000	0.75901	0.561000	0.74099	TAC	SDK2	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000069188		0.652	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK2	HGNC	protein_coding	OTTHUMT00000327598.2	47	0.00	0	G	NM_019064		71375645	71375645	-1	no_errors	ENST00000392650	ensembl	human	known	69_37n	nonsense	17	29.17	7	SNP	1.000	T
SIK1	150094	genome.wustl.edu	37	21	44839340	44839340	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr21:44839340delA	ENST00000270162.6	-	10	1270	c.1138delT	c.(1138-1140)tccfs	p.S380fs		NM_173354.3	NP_775490.2	P57059	SIK1_HUMAN	salt-inducible kinase 1	380					cardiac muscle cell differentiation (GO:0055007)|cell cycle (GO:0007049)|entrainment of circadian clock by photoperiod (GO:0043153)|intracellular signal transduction (GO:0035556)|negative regulation of CREB transcription factor activity (GO:0032792)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of triglyceride biosynthetic process (GO:0010868)|positive regulation of anoikis (GO:2000210)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell differentiation (GO:0045595)|regulation of mitotic cell cycle (GO:0007346)|regulation of myotube differentiation (GO:0010830)|regulation of sodium ion transport (GO:0002028)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|cAMP response element binding protein binding (GO:0008140)|magnesium ion binding (GO:0000287)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)|testis(2)|urinary_tract(1)	21					Dabrafenib(DB08912)	GGGTCGGTGGAAAGACCTTCC	0.637																																						dbGAP											0													48.0	51.0	50.0					21																	44839340		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			BC038504	CCDS33575.1	21q22.3	2008-12-23	2008-12-23	2008-12-23	ENSG00000142178	ENSG00000142178			11142	protein-coding gene	gene with protein product	"""myocardial SNF1-like kinase"""	605705	"""SNF1-like kinase"""	SNF1LK		7893599	Standard	NM_173354		Approved	msk	uc002zdf.2	P57059	OTTHUMG00000086874	ENST00000270162.6:c.1138delT	21.37:g.44839340delA	ENSP00000270162:p.Ser380fs		A6NC84|Q5R2V5|Q6ZNL8|Q86YJ2	Frame_Shift_Del	DEL	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ser/Thr_kinase_SIK1/2,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_cat_dom	p.S380fs	ENST00000270162.6	37	c.1138	CCDS33575.1	21																																																																																			SIK1	-	pirsf_Ser/Thr_kinase_SIK1/2	ENSG00000142178		0.637	SIK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIK1	HGNC	protein_coding	OTTHUMT00000195654.1	34	0.00	0	A	NM_173354		44839340	44839340	-1	no_errors	ENST00000270162	ensembl	human	known	69_37n	frame_shift_del	10	16.67	2	DEL	0.000	-
SLC15A1	6564	genome.wustl.edu	37	13	99339888	99339888	+	Missense_Mutation	SNP	T	T	A			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr13:99339888T>A	ENST00000376503.5	-	21	1829	c.1774A>T	c.(1774-1776)Acc>Tcc	p.T592S		NM_005073.3	NP_005064.1	P46059	S15A1_HUMAN	solute carrier family 15 (oligopeptide transporter), member 1	592					digestion (GO:0007586)|ion transport (GO:0006811)|protein transport (GO:0015031)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	peptide:proton symporter activity (GO:0015333)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)	p.T592S(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	30	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Aminolevulinic acid(DB00855)|Amoxicillin(DB01060)|Ampicillin(DB00415)|Azidocillin(DB08795)|Benazepril(DB00542)|Benzylpenicillin(DB01053)|Captopril(DB01197)|Cefaclor(DB00833)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefdinir(DB00535)|Cefepime(DB01413)|Cefixime(DB00671)|Cefmetazole(DB00274)|Cefotaxime(DB00493)|Cefradine(DB01333)|Ceftazidime(DB00438)|Ceftibuten(DB01415)|Ceftizoxime(DB01332)|Ceftriaxone(DB01212)|Cefuroxime(DB01112)|Cephalexin(DB00567)|Chlorpropamide(DB00672)|Cilazapril(DB01340)|Cloxacillin(DB01147)|Cyclacillin(DB01000)|Dicloxacillin(DB00485)|Enalapril(DB00584)|Fluvastatin(DB01095)|Fosinopril(DB00492)|Glyburide(DB01016)|L-DOPA(DB01235)|Lisinopril(DB00722)|Methyldopa(DB00968)|Midodrine(DB00211)|Moexipril(DB00691)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Oxacillin(DB00713)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Spirapril(DB01348)|Tolbutamide(DB01124)|Trandolapril(DB00519)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	TCGCCACAGGTGAGAAGAAAA	0.458																																						dbGAP											1	Substitution - Missense(1)	breast(1)											130.0	118.0	122.0					13																	99339888		2203	4300	6503	-	-	-	SO:0001583	missense	0			U13173	CCDS9489.1	13q32.3	2013-05-22			ENSG00000088386	ENSG00000088386		"""Solute carriers"""	10920	protein-coding gene	gene with protein product	"""peptide transporter HPEPT1"", ""bA551M18.1.1 (solute carrier family 15 (oligopeptide transporter) member 1)"", ""solute carrier family 15 oligopeptide transporter member 1"""	600544				7896779	Standard	NM_005073		Approved	PEPT1, HPECT1, HPEPT1	uc001vno.3	P46059	OTTHUMG00000017255	ENST00000376503.5:c.1774A>T	13.37:g.99339888T>A	ENSP00000365686:p.Thr592Ser		Q5VW82	Missense_Mutation	SNP	pfam_Oligopeptide_transporter,superfamily_MFS_dom_general_subst_transpt,tigrfam_Pep_H_symport	p.T592S	ENST00000376503.5	37	c.1774	CCDS9489.1	13	.	.	.	.	.	.	.	.	.	.	T	27.9	4.869275	0.91587	.	.	ENSG00000088386	ENST00000376503	T	0.58060	0.36	5.58	5.58	0.84498	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	T	0.72692	0.3492	M	0.77486	2.375	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75071	-0.3447	10	0.51188	T	0.08	-13.7166	14.7442	0.69477	0.0:0.0:0.0:1.0	.	592	P46059	S15A1_HUMAN	S	592	ENSP00000365686:T592S	ENSP00000365686:T592S	T	-	1	0	SLC15A1	98137889	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.421000	0.80204	2.121000	0.65114	0.533000	0.62120	ACC	SLC15A1	-	superfamily_MFS_dom_general_subst_transpt,tigrfam_Pep_H_symport	ENSG00000088386		0.458	SLC15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC15A1	HGNC	protein_coding	OTTHUMT00000045560.3	111	0.00	0	T	NM_005073		99339888	99339888	-1	no_errors	ENST00000376503	ensembl	human	known	69_37n	missense	66	38.53	42	SNP	1.000	A
SLC15A5	729025	genome.wustl.edu	37	12	16397579	16397579	+	Missense_Mutation	SNP	T	T	A			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr12:16397579T>A	ENST00000344941.3	-	4	909	c.910A>T	c.(910-912)Aca>Tca	p.T304S		NM_001170798.1	NP_001164269.1	A6NIM6	S15A5_HUMAN	solute carrier family 15, member 5	304					peptide transport (GO:0015833)|protein transport (GO:0015031)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)	p.T304S(1)		breast(2)|lung(1)	3						AGGAAAAATGTTGTGTCTTCT	0.468																																						dbGAP											1	Substitution - Missense(1)	breast(1)											203.0	168.0	179.0					12																	16397579		692	1591	2283	-	-	-	SO:0001583	missense	0					12p12.3	2013-07-18			ENSG00000188991	ENSG00000188991		"""Solute carriers"""	33455	protein-coding gene	gene with protein product						21044875	Standard	NM_001170798		Approved		uc021qvs.1	A6NIM6	OTTHUMG00000168793	ENST00000344941.3:c.910A>T	12.37:g.16397579T>A	ENSP00000340402:p.Thr304Ser			Missense_Mutation	SNP	pfam_Oligopeptide_transporter,superfamily_MFS_dom_general_subst_transpt	p.T304S	ENST00000344941.3	37	c.910		12	.	.	.	.	.	.	.	.	.	.	T	5.527	0.282105	0.10458	.	.	ENSG00000188991	ENST00000344941	T	0.04049	3.72	4.99	3.8	0.43715	.	0.457973	0.23966	N	0.042801	T	0.03053	0.0090	N	0.03608	-0.345	0.09310	N	1	.	.	.	.	.	.	T	0.40079	-0.9582	8	0.87932	D	0	.	9.9187	0.41450	0.0:0.0786:0.0:0.9214	.	.	.	.	S	304	ENSP00000340402:T304S	ENSP00000340402:T304S	T	-	1	0	SLC15A5	16288846	0.924000	0.31332	0.001000	0.08648	0.007000	0.05969	4.116000	0.57871	0.982000	0.38575	0.533000	0.62120	ACA	SLC15A5	-	pfam_Oligopeptide_transporter	ENSG00000188991		0.468	SLC15A5-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	SLC15A5	HGNC	protein_coding	OTTHUMT00000401119.2	149	0.00	0	T	XM_001129090		16397579	16397579	-1	no_errors	ENST00000344941	ensembl	human	novel	69_37n	missense	83	29.06	34	SNP	0.014	A
SLC22A25	387601	genome.wustl.edu	37	11	62951206	62951206	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr11:62951206C>T	ENST00000306494.6	-	5	913	c.914G>A	c.(913-915)aGg>aAg	p.R305K	SLC22A25_ENST00000403374.2_Missense_Mutation_p.R139K|SLC22A10_ENST00000535888.1_Intron|SLC22A10_ENST00000525620.1_Intron	NM_199352.3	NP_955384.3			solute carrier family 22, member 25									p.R305K(1)		NS(2)|breast(2)|endometrium(4)|kidney(2)|large_intestine(7)|lung(7)|ovary(3)|skin(7)	34						CATTCCATTCCTGTGTGCAGC	0.458																																						dbGAP											1	Substitution - Missense(1)	breast(1)											311.0	280.0	291.0					11																	62951206		2201	4297	6498	-	-	-	SO:0001583	missense	0			AY437532	CCDS31592.1	11q12.3	2014-05-20			ENSG00000196600	ENSG00000196600		"""Solute carriers"""	32935	protein-coding gene	gene with protein product		610792	"""MGI:2442751, MGI:2385316, MGI:3042283, MGI:3645714, MGI:3605624, MGI:2442750"""			17714910	Standard	NM_199352		Approved	UST6, HIMTP, MGC120420	uc001nwr.1	Q6T423	OTTHUMG00000165340	ENST00000306494.6:c.914G>A	11.37:g.62951206C>T	ENSP00000307443:p.Arg305Lys			Missense_Mutation	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.R305K	ENST00000306494.6	37	c.914	CCDS31592.1	11	.	.	.	.	.	.	.	.	.	.	C	13.25	2.180229	0.38511	.	.	ENSG00000196600	ENST00000306494;ENST00000403374	T;T	0.58940	0.3;0.3	2.56	-5.13	0.02884	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.969977	0.08471	N	0.940960	T	0.46112	0.1376	M	0.64404	1.975	0.09310	N	1	B;B	0.20368	0.013;0.044	B;B	0.25140	0.036;0.058	T	0.40194	-0.9576	10	0.19147	T	0.46	.	5.3357	0.15957	0.6105:0.2373:0.1523:0.0	.	303;305	A4IF29;Q6T423	.;S22AP_HUMAN	K	305;139	ENSP00000307443:R305K;ENSP00000384208:R139K	ENSP00000307443:R305K	R	-	2	0	SLC22A25	62707782	0.000000	0.05858	0.037000	0.18230	0.437000	0.31866	-0.729000	0.04920	-0.741000	0.04797	0.121000	0.15741	AGG	SLC22A25	-	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000196600		0.458	SLC22A25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A25	HGNC	protein_coding	OTTHUMT00000383519.3	324	0.00	0	C	NM_199352		62951206	62951206	-1	no_errors	ENST00000306494	ensembl	human	known	69_37n	missense	258	36.14	146	SNP	0.006	T
SLC39A6	25800	genome.wustl.edu	37	18	33691090	33691090	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr18:33691090C>G	ENST00000590986.1	-	9	2336	c.2047G>C	c.(2047-2049)Gaa>Caa	p.E683Q	SLC39A6_ENST00000440549.2_Missense_Mutation_p.E408Q|SLC39A6_ENST00000269187.5_Missense_Mutation_p.E683Q			Q13433	S39A6_HUMAN	solute carrier family 39 (zinc transporter), member 6	683					cellular zinc ion homeostasis (GO:0006882)|transmembrane transport (GO:0055085)|zinc ion transmembrane import (GO:0071578)|zinc ion transmembrane transport (GO:0071577)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|lamellipodium membrane (GO:0031258)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)	p.E683Q(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	41						GAAACATTTTCAGCATAATGA	0.388																																						dbGAP											1	Substitution - Missense(1)	breast(1)											117.0	106.0	109.0					18																	33691090		1892	4121	6013	-	-	-	SO:0001583	missense	0			U41060	CCDS42428.1, CCDS45854.1	18q12.2	2013-05-22				ENSG00000141424		"""Solute carriers"""	18607	protein-coding gene	gene with protein product		608731	"""solute carrier family 39 (metal ion transporter), member 6"""			12659941, 12839489	Standard	NM_012319		Approved	LIV-1	uc010dmy.3	Q13433		ENST00000590986.1:c.2047G>C	18.37:g.33691090C>G	ENSP00000465915:p.Glu683Gln		B4DR49|B4E224|Q8IXR3|Q96HP5	Missense_Mutation	SNP	pfam_ZIP	p.E683Q	ENST00000590986.1	37	c.2047	CCDS42428.1	18	.	.	.	.	.	.	.	.	.	.	C	20.8	4.051831	0.75960	.	.	ENSG00000141424	ENST00000269187;ENST00000440549	T;T	0.49432	0.78;0.78	5.66	5.66	0.87406	.	0.043472	0.85682	D	0.000000	T	0.46347	0.1388	N	0.20530	0.585	0.58432	D	0.999994	B;D	0.57257	0.38;0.979	B;P	0.52957	0.233;0.714	T	0.33420	-0.9869	10	0.33940	T	0.23	-18.1518	17.2434	0.87021	0.0:1.0:0.0:0.0	.	683;408	Q13433;Q13433-2	S39A6_HUMAN;.	Q	683;408	ENSP00000269187:E683Q;ENSP00000401139:E408Q	ENSP00000269187:E683Q	E	-	1	0	SLC39A6	31945088	0.999000	0.42202	1.000000	0.80357	0.993000	0.82548	3.973000	0.56845	2.685000	0.91497	0.455000	0.32223	GAA	SLC39A6	-	pfam_ZIP	ENSG00000141424		0.388	SLC39A6-004	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	SLC39A6	HGNC	protein_coding	OTTHUMT00000444136.1	125	0.00	0	C			33691090	33691090	-1	no_errors	ENST00000269187	ensembl	human	known	69_37n	missense	58	39.80	39	SNP	1.000	G
SLC45A2	51151	genome.wustl.edu	37	5	33982475	33982475	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr5:33982475C>T	ENST00000296589.4	-	2	574	c.428G>A	c.(427-429)aGt>aAt	p.S143N	SLC45A2_ENST00000345083.5_Missense_Mutation_p.S143N|SLC45A2_ENST00000509381.1_Missense_Mutation_p.S143N|SLC45A2_ENST00000342059.3_Intron|SLC45A2_ENST00000382102.3_Missense_Mutation_p.S143N	NM_016180.3	NP_057264	Q9UMX9	S45A2_HUMAN	solute carrier family 45, member 2	143					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)		p.S143N(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(25)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48						CATGGTGACACTTATGGCCCA	0.428																																					Ovarian(31;380 859 8490 22203 49048)	dbGAP											1	Substitution - Missense(1)	breast(1)											101.0	95.0	97.0					5																	33982475		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF172849	CCDS3901.1, CCDS43308.1, CCDS75232.1	5p13.3	2013-08-06	2005-10-06	2005-10-06	ENSG00000164175	ENSG00000164175		"""Solute carriers"""	16472	protein-coding gene	gene with protein product		606202	"""membrane associated transporter"""	MATP		11916009, 11574907	Standard	NM_001012509		Approved	AIM-1, OCA4	uc003jid.3	Q9UMX9	OTTHUMG00000090719	ENST00000296589.4:c.428G>A	5.37:g.33982475C>T	ENSP00000296589:p.Ser143Asn		Q6P2P0|Q9BTM3	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.S143N	ENST00000296589.4	37	c.428	CCDS3901.1	5	.	.	.	.	.	.	.	.	.	.	C	15.70	2.912304	0.52439	.	.	ENSG00000164175	ENST00000296589;ENST00000382102;ENST00000509381;ENST00000345083	D;D;D;D	0.92805	-3.11;-3.11;-3.11;-3.11	5.33	1.12	0.20585	Major facilitator superfamily domain, general substrate transporter (1);	0.635091	0.18153	N	0.150013	D	0.88440	0.6437	L	0.51422	1.61	0.26815	N	0.968913	P;B;B	0.38195	0.622;0.162;0.102	B;B;B	0.42245	0.381;0.189;0.288	T	0.78690	-0.2106	10	0.29301	T	0.29	-27.9162	7.7686	0.28995	0.2861:0.3282:0.3856:0.0	.	143;143;143	D6RGY6;Q9UMX9-4;Q9UMX9	.;.;S45A2_HUMAN	N	143	ENSP00000296589:S143N;ENSP00000371534:S143N;ENSP00000421100:S143N;ENSP00000340444:S143N	ENSP00000296589:S143N	S	-	2	0	SLC45A2	34018232	0.862000	0.29867	0.696000	0.30242	0.973000	0.67179	1.808000	0.38912	0.291000	0.22468	0.643000	0.83706	AGT	SLC45A2	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000164175		0.428	SLC45A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC45A2	HGNC	protein_coding	OTTHUMT00000207443.2	329	0.30	1	C	NM_016180		33982475	33982475	-1	no_errors	ENST00000296589	ensembl	human	known	69_37n	missense	267	24.15	85	SNP	0.999	T
SLC4A8	9498	genome.wustl.edu	37	12	51851241	51851241	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr12:51851241G>T	ENST00000453097.2	+	6	898	c.681G>T	c.(679-681)aaG>aaT	p.K227N	SLC4A8_ENST00000535225.2_Missense_Mutation_p.K174N|SLC4A8_ENST00000394856.1_Missense_Mutation_p.K174N|SLC4A8_ENST00000514353.3_Missense_Mutation_p.K174N|SLC4A8_ENST00000358657.3_Missense_Mutation_p.K254N	NM_001039960.2|NM_001258401.2	NP_001035049.1|NP_001245330.1			solute carrier family 4, sodium bicarbonate cotransporter, member 8									p.K227N(2)|p.K174N(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(18)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(2)|urinary_tract(5)	55				BRCA - Breast invasive adenocarcinoma(357;0.15)		ATGAAAAGAAGAGAAACAACC	0.433																																						dbGAP											3	Substitution - Missense(3)	breast(3)											167.0	147.0	154.0					12																	51851241		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018282	CCDS44890.1, CCDS58232.1, CCDS58233.1, CCDS73470.1	12q13.13	2013-05-22			ENSG00000050438	ENSG00000050438		"""Solute carriers"""	11034	protein-coding gene	gene with protein product		605024				11133997	Standard	NM_001039960		Approved	NBC3	uc001rys.2	Q2Y0W8	OTTHUMG00000169489	ENST00000453097.2:c.681G>T	12.37:g.51851241G>T	ENSP00000405812:p.Lys227Asn			Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Na/HCO3_transpt,tigrfam_HCO3_transpt_euk	p.K227N	ENST00000453097.2	37	c.681	CCDS44890.1	12	.	.	.	.	.	.	.	.	.	.	G	18.50	3.637816	0.67130	.	.	ENSG00000050438	ENST00000535225;ENST00000358657;ENST00000453097;ENST00000394856;ENST00000319957;ENST00000514353;ENST00000547697;ENST00000551071	T;T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31;-0.31	5.29	5.29	0.74685	Bicarbonate transporter, cytoplasmic (2);Phosphotransferase/anion transporter (1);	0.136762	0.64402	D	0.000003	T	0.79112	0.4391	M	0.74467	2.265	0.42341	D	0.992339	P;P;D;B;B;D;D	0.89917	0.942;0.887;1.0;0.095;0.069;0.995;1.0	P;P;D;B;B;D;D	0.83275	0.658;0.578;0.991;0.168;0.444;0.972;0.996	T	0.79110	-0.1938	10	0.45353	T	0.12	.	10.2936	0.43610	0.0902:0.0:0.9098:0.0	.	174;254;174;227;227;227;174	E7EML0;Q2Y0W8-2;F5GZ31;Q2Y0W8;Q2Y0W8-3;Q2Y0W8-6;F8VSA8	.;.;.;S4A8_HUMAN;.;.;.	N	174;254;227;174;227;174;174;174	ENSP00000441520:K174N;ENSP00000351483:K254N;ENSP00000405812:K227N;ENSP00000378325:K174N;ENSP00000442561:K174N	ENSP00000315789:K227N	K	+	3	2	SLC4A8	50137508	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.647000	0.37260	2.635000	0.89317	0.655000	0.94253	AAG	SLC4A8	-	pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,tigrfam_HCO3_transpt_euk	ENSG00000050438		0.433	SLC4A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC4A8	HGNC	protein_coding	OTTHUMT00000404356.1	256	0.00	0	G	NM_004858		51851241	51851241	+1	no_errors	ENST00000453097	ensembl	human	known	69_37n	missense	169	23.18	51	SNP	1.000	T
SLFN5	162394	genome.wustl.edu	37	17	33592271	33592271	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr17:33592271G>C	ENST00000299977.4	+	5	2188	c.2040G>C	c.(2038-2040)tgG>tgC	p.W680C	SLFN5_ENST00000542451.1_3'UTR	NM_144975.3	NP_659412.3	Q08AF3	SLFN5_HUMAN	schlafen family member 5	680					cell differentiation (GO:0030154)	nucleus (GO:0005634)	ATP binding (GO:0005524)	p.A404G(1)|p.W680C(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(8)|liver(2)|lung(6)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	34		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0191)		GAGTTCTCTGGATCTTTCTGG	0.502																																						dbGAP											2	Substitution - Missense(2)	breast(2)											149.0	143.0	145.0					17																	33592271		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX647942	CCDS32619.1	17q12	2006-04-05				ENSG00000166750			28286	protein-coding gene	gene with protein product		614952				9846487	Standard	NM_144975		Approved	MGC19764	uc002hjf.4	Q08AF3		ENST00000299977.4:c.2040G>C	17.37:g.33592271G>C	ENSP00000299977:p.Trp680Cys		Q08AF2|Q8WU54|Q96A82	Missense_Mutation	SNP	pfam_ATPase_AAA-4,pfam_DUF2075	p.W680C	ENST00000299977.4	37	c.2040	CCDS32619.1	17	.	.	.	.	.	.	.	.	.	.	g	10.32	1.318715	0.23994	.	.	ENSG00000166750	ENST00000299977	T	0.28895	1.59	3.14	2.11	0.27256	Domain of unknown function DUF2075 (1);	0.460245	0.16343	N	0.218585	T	0.49915	0.1585	M	0.75615	2.305	0.80722	D	1	D	0.89917	1.0	D	0.70935	0.971	T	0.48410	-0.9038	10	0.87932	D	0	.	7.8547	0.29474	0.0:0.2752:0.7248:0.0	.	680	Q08AF3	SLFN5_HUMAN	C	680	ENSP00000299977:W680C	ENSP00000299977:W680C	W	+	3	0	SLFN5	30616384	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.361000	0.52306	0.600000	0.29862	0.557000	0.71058	TGG	SLFN5	-	pfam_DUF2075	ENSG00000166750		0.502	SLFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLFN5	HGNC	protein_coding	OTTHUMT00000448649.2	131	0.00	0	G	NM_144975		33592271	33592271	+1	no_errors	ENST00000299977	ensembl	human	known	69_37n	missense	63	36.36	36	SNP	1.000	C
SMG1	23049	genome.wustl.edu	37	16	18863734	18863734	+	Silent	SNP	G	G	A			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr16:18863734G>A	ENST00000446231.2	-	32	5231	c.4819C>T	c.(4819-4821)Ctg>Ttg	p.L1607L	SMG1_ENST00000389467.3_Silent_p.L1607L			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	1607	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.|Interaction with SMG8 and SMG9.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.L1603L(1)|p.L1607L(1)		NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						ACTGAAGACAGGTGATACAAC	0.433																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											56.0	55.0	55.0					16																	18863734		1960	4166	6126	-	-	-	SO:0001819	synonymous_variant	0			AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.4819C>T	16.37:g.18863734G>A			O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Silent	SNP	pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.L1607	ENST00000446231.2	37	c.4819	CCDS45430.1	16																																																																																			SMG1	-	superfamily_ARM-type_fold,pfscan_PIK_FAT	ENSG00000157106		0.433	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMG1	HGNC	protein_coding	OTTHUMT00000391817.1	181	0.00	0	G	NM_015092		18863734	18863734	-1	no_errors	ENST00000389467	ensembl	human	known	69_37n	silent	90	18.92	21	SNP	1.000	A
SMTN	6525	genome.wustl.edu	37	22	31484908	31484908	+	Missense_Mutation	SNP	A	A	G			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr22:31484908A>G	ENST00000347557.2	+	6	642	c.424A>G	c.(424-426)Aga>Gga	p.R142G	SMTN_ENST00000358743.1_Missense_Mutation_p.R142G|SMTN_ENST00000333137.7_Missense_Mutation_p.R142G	NM_001207017.1|NM_006932.4	NP_001193946.1|NP_008863.3	P53814	SMTN_HUMAN	smoothelin	142					muscle organ development (GO:0007517)|smooth muscle contraction (GO:0006939)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|structural constituent of muscle (GO:0008307)	p.R142G(2)|p.R134G(1)		breast(2)|endometrium(2)|large_intestine(5)|lung(9)|ovary(3)|pancreas(1)|prostate(3)	25						CAGTGGCTCAAGAGAGGACAG	0.617											OREG0026472	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											3	Substitution - Missense(3)	breast(3)											108.0	93.0	98.0					22																	31484908		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY061972	CCDS13886.1, CCDS13887.1, CCDS13888.1, CCDS74845.1, CCDS74846.1	22q12	2006-01-27			ENSG00000183963	ENSG00000183963			11126	protein-coding gene	gene with protein product		602127				9244445, 8707825	Standard	NM_006932		Approved		uc011ale.2	P53814	OTTHUMG00000151203	ENST00000347557.2:c.424A>G	22.37:g.31484908A>G	ENSP00000328635:p.Arg142Gly	825	O00569|O95769|O95937|Q8N4H8|Q8WWW1|Q8WWW2|Q9P1S8|Q9UIT1|Q9UIT2	Missense_Mutation	SNP	pfam_Smoothelin,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.R142G	ENST00000347557.2	37	c.424	CCDS13886.1	22	.	.	.	.	.	.	.	.	.	.	A	7.031	0.560709	0.13498	.	.	ENSG00000183963	ENST00000358743;ENST00000347557;ENST00000333137;ENST00000329852;ENST00000404496;ENST00000416786;ENST00000431481	T;T;T	0.71579	-0.14;-0.58;-0.58	3.7	1.43	0.22495	.	0.000000	0.37437	N	0.002082	T	0.51227	0.1662	L	0.27053	0.805	0.26697	N	0.97124	B;P;P;P;B;B	0.39480	0.421;0.675;0.651;0.651;0.281;0.403	B;B;B;B;B;B	0.32864	0.107;0.154;0.15;0.107;0.056;0.12	T	0.48843	-0.8999	10	0.72032	D	0.01	-4.5532	9.7761	0.40621	0.6151:0.3848:0.0:0.0	.	198;196;134;142;142;142	E7ETT8;B4E229;B5MC56;E7EWD0;P53814;P53814-5	.;.;.;.;SMTN_HUMAN;.	G	142;142;142;142;134;54;134	ENSP00000351593:R142G;ENSP00000328635:R142G;ENSP00000329532:R142G	ENSP00000329393:R142G	R	+	1	2	SMTN	29814908	0.045000	0.20229	0.175000	0.22980	0.013000	0.08279	0.777000	0.26718	0.263000	0.21812	0.459000	0.35465	AGA	SMTN	-	NULL	ENSG00000183963		0.617	SMTN-001	KNOWN	basic|CCDS	protein_coding	SMTN	HGNC	protein_coding	OTTHUMT00000321766.1	168	0.59	1	A	NM_134270		31484908	31484908	+1	no_errors	ENST00000347557	ensembl	human	known	69_37n	missense	51	39.29	33	SNP	0.308	G
RAB3GAP2	25782	genome.wustl.edu	37	1	220373935	220373935	+	Intron	SNP	C	C	A			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr1:220373935C>A	ENST00000358951.2	-	9	928				SNORA36B_ENST00000410438.1_RNA	NM_012414.3	NP_036546.2	Q9H2M9	RBGPR_HUMAN	RAB3 GTPase activating protein subunit 2 (non-catalytic)						establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of GTPase activity (GO:0043087)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme activator activity (GO:0008047)|enzyme regulator activity (GO:0030234)|GTPase activator activity (GO:0005096)|protein heterodimerization activity (GO:0046982)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(131;0.0443)		TCTATCCAATCATTTTCCCTA	0.333																																						dbGAP											0													74.0	68.0	70.0					1																	220373935		1567	3582	5149	-	-	-	SO:0001627	intron_variant	0			AB020646	CCDS31028.1	1q41	2014-03-03			ENSG00000118873	ENSG00000118873			17168	protein-coding gene	gene with protein product		609275				15696165, 16532399, 24482476	Standard	NM_012414		Approved	RAB3-GAP150, KIAA0839, DKFZP434D245, SPG69	uc010puk.1	Q9H2M9	OTTHUMG00000037139	ENST00000358951.2:c.811+1682G>T	1.37:g.220373935C>A			A6H8V0|O75872|Q9HAB0|Q9UFJ7|Q9UQ15	RNA	SNP	-	NULL	ENST00000358951.2	37	NULL	CCDS31028.1	1																																																																																			SNORA36B	-	-	ENSG00000222370		0.333	RAB3GAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNORA36B	HGNC	protein_coding	OTTHUMT00000090205.2	177	0.00	0	C	NM_012414		220373935	220373935	-1	no_errors	ENST00000410438	ensembl	human	known	69_37n	rna	203	16.12	39	SNP	0.970	A
SQSTM1	8878	genome.wustl.edu	37	5	179251050	179251050	+	Missense_Mutation	SNP	A	A	G			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr5:179251050A>G	ENST00000389805.4	+	3	672	c.494A>G	c.(493-495)aAg>aGg	p.K165R	SQSTM1_ENST00000402874.3_Missense_Mutation_p.K81R|SQSTM1_ENST00000510187.1_Missense_Mutation_p.K165R|SQSTM1_ENST00000376929.3_Missense_Mutation_p.K81R|SQSTM1_ENST00000360718.5_Missense_Mutation_p.K81R	NM_003900.4	NP_003891.1	Q13501	SQSTM_HUMAN	sequestosome 1	165	Interaction with GABRR3. {ECO:0000250}.				apoptotic signaling pathway (GO:0097190)|autophagy (GO:0006914)|cell differentiation (GO:0030154)|endosomal transport (GO:0016197)|immune system process (GO:0002376)|intracellular signal transduction (GO:0035556)|macroautophagy (GO:0016236)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of macroautophagy (GO:0016239)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein heterooligomerization (GO:0051291)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of Ras protein signal transduction (GO:0046578)|response to stress (GO:0006950)|ubiquitin-dependent protein catabolic process (GO:0006511)	aggresome (GO:0016235)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|lysosome (GO:0005764)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|pre-autophagosomal structure (GO:0000407)	identical protein binding (GO:0042802)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|receptor tyrosine kinase binding (GO:0030971)|SH2 domain binding (GO:0042169)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)	p.K165R(1)	SQSTM1/ALK(2)	NS(1)|breast(1)|endometrium(1)|large_intestine(2)|liver(2)|lung(5)|ovary(1)	13	all_cancers(89;0.000205)|all_epithelial(37;7.15e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0395)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGGCACACCAAGCTCGCATTC	0.642																																						dbGAP											1	Substitution - Missense(1)	breast(1)											57.0	54.0	55.0					5																	179251050		2203	4300	6503	-	-	-	SO:0001583	missense	0			U46751	CCDS34317.1, CCDS47355.1	5q35	2008-02-05	2004-04-15		ENSG00000161011	ENSG00000161011			11280	protein-coding gene	gene with protein product		601530	"""Paget disease of bone 3"", ""oxidative stress induced like"""	PDB3, OSIL		8650207, 8551575	Standard	NM_003900		Approved	p62, p60, p62B, A170	uc003mkw.4	Q13501	OTTHUMG00000150643	ENST00000389805.4:c.494A>G	5.37:g.179251050A>G	ENSP00000374455:p.Lys165Arg		A6NFN7|B2R661|B3KUW5|Q13446|Q9BUV7|Q9BVS6|Q9UEU1	Missense_Mutation	SNP	pfam_Znf_ZZ,pfam_OPR_PB1,superfamily_UBA-like,smart_OPR_PB1,smart_Znf_ZZ,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_ZZ	p.K165R	ENST00000389805.4	37	c.494	CCDS34317.1	5	.	.	.	.	.	.	.	.	.	.	A	8.400	0.841743	0.16963	.	.	ENSG00000161011	ENST00000376929;ENST00000514093;ENST00000422245;ENST00000389805;ENST00000504627;ENST00000402874;ENST00000510187;ENST00000360718	D;D;D;D;T;D;D;D	0.87179	-2.22;-2.22;-2.22;-2.22;1.53;-2.22;-2.22;-2.22	5.44	4.23	0.50019	Zinc finger, ZZ-type (2);	0.098778	0.64402	D	0.000002	D	0.86447	0.5935	L	0.36672	1.1	0.37086	D	0.899226	P;D	0.57571	0.773;0.98	B;P	0.57324	0.425;0.818	D	0.88349	0.2980	10	0.72032	D	0.01	-39.9598	8.2244	0.31560	0.5863:0.0:0.0:0.4137	.	165;165	Q13501;E7EMC7	SQSTM_HUMAN;.	R	81;81;81;165;188;81;165;81	ENSP00000366128:K81R;ENSP00000427308:K81R;ENSP00000394534:K81R;ENSP00000374455:K165R;ENSP00000425957:K188R;ENSP00000385553:K81R;ENSP00000424477:K165R;ENSP00000353944:K81R	ENSP00000353944:K81R	K	+	2	0	SQSTM1	179183656	1.000000	0.71417	0.985000	0.45067	0.009000	0.06853	4.712000	0.61888	2.056000	0.61249	0.459000	0.35465	AAG	SQSTM1	-	smart_Znf_ZZ,pfscan_Znf_ZZ	ENSG00000161011		0.642	SQSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SQSTM1	HGNC	protein_coding	OTTHUMT00000319344.1	29	0.00	0	A			179251050	179251050	+1	no_errors	ENST00000389805	ensembl	human	known	69_37n	missense	4	60.00	6	SNP	1.000	G
ST8SIA1	6489	genome.wustl.edu	37	12	22440177	22440177	+	Missense_Mutation	SNP	T	T	A			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr12:22440177T>A	ENST00000396037.4	-	2	768	c.287A>T	c.(286-288)aAa>aTa	p.K96I	ST8SIA1_ENST00000539510.1_5'UTR	NM_003034.3	NP_003025.1	Q92185	SIA8A_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1	96					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|glycosphingolipid biosynthetic process (GO:0006688)|positive regulation of cell proliferation (GO:0008284)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialyltransferase activity (GO:0008373)	p.K96I(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	25						GGAATTCATTTTAGTCATAGC	0.433																																						dbGAP											1	Substitution - Missense(1)	breast(1)											89.0	86.0	87.0					12																	22440177		2203	4300	6503	-	-	-	SO:0001583	missense	0			L32867	CCDS8697.1	12p12.1-p11.2	2013-03-01	2003-01-14	2005-02-07	ENSG00000111728	ENSG00000111728	2.4.99.8	"""Sialyltransferases"""	10869	protein-coding gene	gene with protein product	"""ST8Sia I"""	601123	"""sialyltransferase 8 (alpha-N-acetylneuraminate: alpha-2,8-sialytransferase, GD3 synthase) A"""	SIAT8, SIAT8A		7901202	Standard	NM_003034		Approved		uc001rfo.4	Q92185	OTTHUMG00000169098	ENST00000396037.4:c.287A>T	12.37:g.22440177T>A	ENSP00000379353:p.Lys96Ile		A8K4H6|Q17RL0|Q6PZN5|Q93064	Missense_Mutation	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.K96I	ENST00000396037.4	37	c.287	CCDS8697.1	12	.	.	.	.	.	.	.	.	.	.	T	25.8	4.678751	0.88542	.	.	ENSG00000111728	ENST00000396037;ENST00000540824;ENST00000541868	T;T;T	0.65364	-0.15;1.4;-0.15	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.81616	0.4860	M	0.88906	2.99	0.80722	D	1	D	0.63880	0.993	D	0.72982	0.979	D	0.84776	0.0770	9	.	.	.	-16.2467	14.3522	0.66711	0.0:0.0:0.0:1.0	.	96	Q92185	SIA8A_HUMAN	I	96;47;73	ENSP00000379353:K96I;ENSP00000441707:K47I;ENSP00000440292:K73I	.	K	-	2	0	ST8SIA1	22331444	1.000000	0.71417	0.928000	0.36995	0.995000	0.86356	6.835000	0.75344	2.123000	0.65237	0.533000	0.62120	AAA	ST8SIA1	-	pfam_Glyco_trans_29,pirsf_Sialyl_trans	ENSG00000111728		0.433	ST8SIA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST8SIA1	HGNC	protein_coding	OTTHUMT00000402245.2	120	0.00	0	T	NM_003034		22440177	22440177	-1	no_errors	ENST00000396037	ensembl	human	known	69_37n	missense	64	29.67	27	SNP	0.997	A
SRGAP1	57522	genome.wustl.edu	37	12	64502729	64502729	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr12:64502729G>C	ENST00000355086.3	+	16	2355	c.1831G>C	c.(1831-1833)Gag>Cag	p.E611Q	SRGAP1_ENST00000543397.1_Missense_Mutation_p.E548Q|RP11-196H14.4_ENST00000535806.1_RNA|SRGAP1_ENST00000357825.3_Missense_Mutation_p.E588Q	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	611	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)	p.E611Q(1)		breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		TAATCTCTATGAGAGGGCGCT	0.453																																						dbGAP											1	Substitution - Missense(1)	breast(1)											131.0	115.0	120.0					12																	64502729		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.1831G>C	12.37:g.64502729G>C	ENSP00000347198:p.Glu611Gln		Q9H8A3|Q9P2P2	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_FCH,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Fuc/Ara_isomerase_C,smart_FCH,smart_RhoGAP_dom,smart_SH3_domain,pfscan_FCH,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.E611Q	ENST00000355086.3	37	c.1831	CCDS8967.1	12	.	.	.	.	.	.	.	.	.	.	G	35	5.456919	0.96223	.	.	ENSG00000196935	ENST00000355086;ENST00000357825;ENST00000543397	T;T;T	0.21543	2.0;2.0;2.0	5.2	5.2	0.72013	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.35378	U	0.003260	T	0.40767	0.1130	L	0.49256	1.55	0.80722	D	1	D;P	0.67145	0.996;0.946	D;P	0.64877	0.93;0.786	T	0.02238	-1.1190	9	.	.	.	.	19.6294	0.95694	0.0:0.0:1.0:0.0	.	611;548	Q7Z6B7;G5EA48	SRGP1_HUMAN;.	Q	611;588;548	ENSP00000347198:E611Q;ENSP00000350480:E588Q;ENSP00000437948:E548Q	.	E	+	1	0	SRGAP1	62788996	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.697000	0.98697	2.822000	0.97130	0.650000	0.86243	GAG	SRGAP1	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000196935		0.453	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SRGAP1	HGNC	protein_coding	OTTHUMT00000400896.1	219	0.00	0	G			64502729	64502729	+1	no_errors	ENST00000355086	ensembl	human	known	69_37n	missense	101	41.28	71	SNP	1.000	C
STEAP4	79689	genome.wustl.edu	37	7	87913447	87913447	+	Silent	SNP	A	A	T			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr7:87913447A>T	ENST00000380079.4	-	2	239	c.138T>A	c.(136-138)gtT>gtA	p.V46V	AC003991.3_ENST00000434733.1_RNA|AC003991.3_ENST00000600908.1_RNA|AC003991.3_ENST00000447758.1_RNA|STEAP4_ENST00000414498.1_Silent_p.V46V|STEAP4_ENST00000301959.5_Silent_p.V46V|AC003991.3_ENST00000595121.1_RNA	NM_001205315.1|NM_024636.3	NP_001192244.1|NP_078912.2	Q687X5	STEA4_HUMAN	STEAP family member 4	46					copper ion import (GO:0015677)|fat cell differentiation (GO:0045444)|ferric iron import into cell (GO:0097461)|iron ion homeostasis (GO:0055072)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|metal ion binding (GO:0046872)	p.V46V(1)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(3)	15	Esophageal squamous(14;0.00802)					GACTTCCAAAAACAACAGAAT	0.428																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											94.0	88.0	90.0					7																	87913447		1835	4085	5920	-	-	-	SO:0001819	synonymous_variant	0			AK026806	CCDS43611.1, CCDS56494.1	7q21.13	2014-01-28	2005-06-15	2005-06-15	ENSG00000127954	ENSG00000127954			21923	protein-coding gene	gene with protein product		611098	"""tumor necrosis factor, alpha-induced protein 9"""	TNFAIP9		11443137, 15897894	Standard	NM_024636		Approved	FLJ23153, TIARP, STAMP2	uc003ujs.3	Q687X5	OTTHUMG00000153853	ENST00000380079.4:c.138T>A	7.37:g.87913447A>T			Q658Q9|Q687X4|Q8WWB0|Q9H5R1	Silent	SNP	pfam_Fe3_Rdtase_TM_dom,pfam_NADP_OxRdtase_F420	p.V46	ENST00000380079.4	37	c.138	CCDS43611.1	7																																																																																			STEAP4	-	pfam_NADP_OxRdtase_F420	ENSG00000127954		0.428	STEAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STEAP4	HGNC	protein_coding	OTTHUMT00000332712.4	73	0.00	0	A	NM_024636		87913447	87913447	-1	no_errors	ENST00000380079	ensembl	human	known	69_37n	silent	54	34.15	28	SNP	0.642	T
TAF5L	27097	genome.wustl.edu	37	1	229738621	229738621	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr1:229738621G>C	ENST00000366676.1	-	3	292	c.293C>G	c.(292-294)cCt>cGt	p.P98R	TAF5L_ENST00000366675.3_Missense_Mutation_p.P98R|TAF5L_ENST00000258281.2_Missense_Mutation_p.P98R			O75529	TAF5L_HUMAN	TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa	98					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|transcription from RNA polymerase II promoter (GO:0006366)	STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.P98R(2)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(4)|ovary(1)	11	Breast(184;0.193)|Ovarian(103;0.249)	Prostate(94;0.167)				GACAAAGAGAGGATAGAGGAG	0.418																																						dbGAP											2	Substitution - Missense(2)	breast(2)											56.0	54.0	55.0					1																	229738621		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF069736	CCDS1581.1, CCDS31051.1	1q42.11-q42.3	2013-01-10	2002-08-29		ENSG00000135801	ENSG00000135801		"""WD repeat domain containing"""	17304	protein-coding gene	gene with protein product	"""PCAF associated factor 65 beta"""		"""TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65 kD"""			9674425, 11124703	Standard	XM_005273100		Approved	PAF65B	uc001htq.3	O75529	OTTHUMG00000039463	ENST00000366676.1:c.293C>G	1.37:g.229738621G>C	ENSP00000355636:p.Pro98Arg		Q5TDI5|Q5TDI6|Q8IW31	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_TFIID-su_WD40-assoc_reg,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.P98R	ENST00000366676.1	37	c.293	CCDS1581.1	1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.522701	0.85600	.	.	ENSG00000135801	ENST00000366676;ENST00000258281;ENST00000366675	D;D;D	0.93488	-3.23;-3.23;-2.77	5.62	5.62	0.85841	TFIID subunit, WD40-associated region (1);	0.000000	0.85682	D	0.000000	D	0.94899	0.8351	L	0.36672	1.1	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.77557	0.99;0.955	D	0.93817	0.7115	9	.	.	.	-25.0816	19.6643	0.95887	0.0:0.0:1.0:0.0	.	98;98	O75529-2;O75529	.;TAF5L_HUMAN	R	98	ENSP00000355636:P98R;ENSP00000258281:P98R;ENSP00000355635:P98R	.	P	-	2	0	TAF5L	227805244	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.429000	0.97481	2.642000	0.89623	0.655000	0.94253	CCT	TAF5L	-	pfam_TFIID-su_WD40-assoc_reg	ENSG00000135801		0.418	TAF5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF5L	HGNC	protein_coding	OTTHUMT00000095229.1	41	0.00	0	G	NM_014409		229738621	229738621	-1	no_errors	ENST00000258281	ensembl	human	known	69_37n	missense	43	12.24	6	SNP	1.000	C
TCP11	6954	genome.wustl.edu	37	6	35108559	35108560	+	Frame_Shift_Ins	INS	-	-	G	rs371490655		TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr6:35108559_35108560insG	ENST00000512012.1	-	1	244_245	c.88_89insC	c.(88-90)cagfs	p.Q30fs	TCP11_ENST00000418521.2_Intron|TCP11_ENST00000412155.2_Intron|TCP11_ENST00000510465.1_5'UTR|TCP11_ENST00000244645.3_5'UTR|TCP11_ENST00000311875.5_Frame_Shift_Ins_p.Q43fs|TCP11_ENST00000444780.2_Frame_Shift_Ins_p.Q43fs|TCP11_ENST00000373974.4_Intron|TCP11_ENST00000373979.2_Intron			Q8WWU5	TCP11_HUMAN	t-complex 11, testis-specific	30					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)				breast(1)|kidney(5)|large_intestine(3)|lung(10)|ovary(3)|prostate(1)|skin(4)	27						CTTGTCTTCCTGGGGGGGTCCT	0.639																																						dbGAP											0									,	6,3644		0,6,1819					,	-4.2	0.0			24	2,7854		0,2,3926	no	utr-5,frameshift	TCP11	NM_018679.4,NM_001093728.1	,	0,8,5745	A1A1,A1R,RR		0.0255,0.1644,0.0695	,	,		8,11498				-	-	-	SO:0001589	frameshift_variant	0				CCDS4799.1, CCDS47413.1, CCDS59015.1, CCDS59016.1, CCDS59017.1, CCDS59018.1	6p21.31	2012-09-20	2012-09-20		ENSG00000124678	ENSG00000124678			11658	protein-coding gene	gene with protein product	"""fertilization-promoting peptide receptor"""	186982	"""t-complex 11 (a murine tcp homolog)"", ""t-complex 11 homolog (mouse)"""	D6S230E		1427894, 11756566, 21597245	Standard	NM_001093728		Approved	KIAA0229, FPPR	uc003okd.2	Q8WWU5	OTTHUMG00000014560	ENST00000512012.1:c.89dupC	6.37:g.35108566_35108566dupG	ENSP00000425995:p.Gln30fs		B2RCE9|B3KQ27|B7Z7B5|B7Z7G1|B7Z7H4|B7Z7S8|E7EP29|J3KNG1|Q8NF85|Q9NQZ9|Q9NR39	Frame_Shift_Ins	INS	pfam_Tcp11	p.Q43fs	ENST00000512012.1	37	c.128_127		6																																																																																			TCP11	-	NULL	ENSG00000124678		0.639	TCP11-014	PUTATIVE	basic	protein_coding	TCP11	HGNC	protein_coding	OTTHUMT00000370354.1	33	0.00	0	-	NM_001093728		35108559	35108560	-1	no_errors	ENST00000311875	ensembl	human	known	69_37n	frame_shift_ins	20	16.67	4	INS	0.000:0.004	G
SPATA32	124783	genome.wustl.edu	37	17	43333760	43333760	+	Missense_Mutation	SNP	T	T	C			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr17:43333760T>C	ENST00000331780.4	-	3	186	c.91A>G	c.(91-93)Ata>Gta	p.I31V	MAP3K14-AS1_ENST00000588698.1_RNA|MAP3K14-AS1_ENST00000588504.1_RNA|MAP3K14-AS1_ENST00000590100.1_RNA|MAP3K14-AS1_ENST00000585346.1_RNA|MAP3K14-AS1_ENST00000592422.1_RNA|MAP3K14-AS1_ENST00000591263.1_RNA|SPATA32_ENST00000543122.1_Missense_Mutation_p.I10V|MAP3K14-AS1_ENST00000588160.1_RNA	NM_152343.2	NP_689556.2	Q96LK8	SPT32_HUMAN	spermatogenesis associated 32	31					spermatogenesis (GO:0007283)	perinuclear region of cytoplasm (GO:0048471)		p.I31V(1)									TCCTCTTGTATCTGGTGTTGA	0.552																																						dbGAP											1	Substitution - Missense(1)	breast(1)											235.0	193.0	207.0					17																	43333760		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK058143	CCDS32669.1	17q21.31	2013-10-11	2012-10-08	2012-10-08	ENSG00000184361	ENSG00000184361			26349	protein-coding gene	gene with protein product	"""acrosome expressed 2"""		"""chromosome 17 open reading frame 46"", ""testis expressed 34"""	C17orf46, TEX34		18621766	Standard	NM_152343		Approved	FLJ25414, AEP2, VAD1.2	uc002iis.1	Q96LK8	OTTHUMG00000180363	ENST00000331780.4:c.91A>G	17.37:g.43333760T>C	ENSP00000331532:p.Ile31Val		Q7Z4U1|Q8N6V6	Missense_Mutation	SNP	NULL	p.I31V	ENST00000331780.4	37	c.91	CCDS32669.1	17	.	.	.	.	.	.	.	.	.	.	T	6.534	0.466734	0.12402	.	.	ENSG00000184361	ENST00000331780;ENST00000543122	T;T	0.48201	0.94;0.82	3.15	-4.11	0.03928	.	3.332560	0.00757	N	0.001115	T	0.25644	0.0624	N	0.14661	0.345	0.09310	N	1	B	0.26258	0.145	B	0.21151	0.033	T	0.04678	-1.0934	10	0.26408	T	0.33	-4.9467	3.0075	0.06033	0.4198:0.0:0.2348:0.3454	.	31	Q96LK8	CQ046_HUMAN	V	31;10	ENSP00000331532:I31V;ENSP00000442724:I10V	ENSP00000331532:I31V	I	-	1	0	C17orf46	40689543	0.000000	0.05858	0.000000	0.03702	0.041000	0.13682	-0.277000	0.08502	-0.793000	0.04475	-0.542000	0.04241	ATA	TEX34	-	NULL	ENSG00000184361		0.552	SPATA32-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TEX34	HGNC	protein_coding	OTTHUMT00000450946.1	234	0.00	0	T	NM_152343		43333760	43333760	-1	no_errors	ENST00000331780	ensembl	human	known	69_37n	missense	76	34.48	40	SNP	0.000	C
TGM7	116179	genome.wustl.edu	37	15	43584967	43584967	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr15:43584967C>A	ENST00000452443.2	-	3	383	c.379G>T	c.(379-381)Ggt>Tgt	p.G127C		NM_052955.2	NP_443187.1	Q96PF1	TGM7_HUMAN	transglutaminase 7	127					peptide cross-linking (GO:0018149)		metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.G127C(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(2)|prostate(4)|skin(1)	39		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.14e-07)	L-Glutamine(DB00130)	ACACTGTGACCTTGGCCCTGA	0.463																																						dbGAP											1	Substitution - Missense(1)	breast(1)											128.0	140.0	136.0					15																	43584967		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF363393	CCDS32213.1	15q15.2	2004-07-01				ENSG00000159495		"""Transglutaminases"""	30790	protein-coding gene	gene with protein product	"""transglutaminase Z"""	606776				11390390	Standard	NM_052955		Approved	TGMZ	uc001zrf.1	Q96PF1		ENST00000452443.2:c.379G>T	15.37:g.43584967C>A	ENSP00000389466:p.Gly127Cys			Missense_Mutation	SNP	pfam_Transglutaminase_N,pfam_Transglutaminase_C,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.G127C	ENST00000452443.2	37	c.379	CCDS32213.1	15	.	.	.	.	.	.	.	.	.	.	C	14.89	2.671108	0.47781	.	.	ENSG00000159495	ENST00000452443	D	0.88124	-2.34	5.32	2.35	0.29111	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	6.911960	0.00166	N	0.000002	D	0.89012	0.6594	L	0.52573	1.65	0.09310	N	1	D	0.64830	0.994	P	0.54401	0.751	T	0.72663	-0.4225	10	0.66056	D	0.02	-7.1843	5.472	0.16676	0.163:0.6597:0.0:0.1773	.	127	Q96PF1	TGM7_HUMAN	C	127	ENSP00000389466:G127C	ENSP00000389466:G127C	G	-	1	0	TGM7	41372259	0.009000	0.17119	0.005000	0.12908	0.019000	0.09904	0.976000	0.29462	0.739000	0.32628	-0.314000	0.08810	GGT	TGM7	-	superfamily_Ig_E-set	ENSG00000159495		0.463	TGM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM7	HGNC	protein_coding	OTTHUMT00000432489.1	29	0.00	0	C	NM_052955		43584967	43584967	-1	no_errors	ENST00000452443	ensembl	human	known	69_37n	missense	26	21.21	7	SNP	0.003	A
TLE6	79816	genome.wustl.edu	37	19	2993572	2993572	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr19:2993572C>G	ENST00000246112.4	+	15	1730	c.1529C>G	c.(1528-1530)tCc>tGc	p.S510C	TLE6_ENST00000452088.1_Missense_Mutation_p.S387C	NM_001143986.1	NP_001137458.1	Q9H808	TLE6_HUMAN	transducin-like enhancer of split 6	510					regulation of transcription, DNA-templated (GO:0006355)	cell cortex (GO:0005938)|nucleus (GO:0005634)|protein complex (GO:0043234)		p.S387C(1)|p.S510C(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|urinary_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTCAAGTTCTCCCCCTTTGGT	0.632																																						dbGAP											2	Substitution - Missense(2)	breast(2)											70.0	64.0	66.0					19																	2993572		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK024071	CCDS12100.1, CCDS45910.1	19p13.3	2014-03-07	2014-03-07		ENSG00000104953	ENSG00000104953		"""WD repeat domain containing"""	30788	protein-coding gene	gene with protein product		612399	"""transducin-like enhancer of split 6 (E(sp1) homolog, Drosophila)"""			11486032	Standard	NM_024760		Approved	FLJ14009, GRG6	uc002lwt.2	Q9H808	OTTHUMG00000156793	ENST00000246112.4:c.1529C>G	19.37:g.2993572C>G	ENSP00000246112:p.Ser510Cys		J3KMZ1	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom,prints_Groucho_enhance	p.S510C	ENST00000246112.4	37	c.1529	CCDS45910.1	19	.	.	.	.	.	.	.	.	.	.	C	13.18	2.158911	0.38119	.	.	ENSG00000104953	ENST00000447920;ENST00000246112;ENST00000452088	T;T	0.17528	2.27;2.27	3.37	3.37	0.38596	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	.	.	.	.	T	0.35595	0.0937	M	0.65975	2.015	0.40437	D	0.980005	D;D;D	0.89917	0.999;1.0;0.991	D;D;P	0.69479	0.958;0.964;0.864	T	0.17837	-1.0356	9	0.87932	D	0	-10.8395	10.5061	0.44834	0.0:1.0:0.0:0.0	.	510;368;387	C9JGZ7;Q9Y6S1;Q9H808	.;.;TLE6_HUMAN	C	510;510;387	ENSP00000246112:S510C;ENSP00000406893:S387C	ENSP00000246112:S510C	S	+	2	0	TLE6	2944572	0.988000	0.35896	1.000000	0.80357	0.209000	0.24338	4.067000	0.57527	2.197000	0.70478	0.555000	0.69702	TCC	TLE6	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_Groucho_enhance	ENSG00000104953		0.632	TLE6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TLE6	HGNC	protein_coding	OTTHUMT00000345996.3	70	0.00	0	C	NM_024760		2993572	2993572	+1	no_errors	ENST00000246112	ensembl	human	known	69_37n	missense	15	46.43	13	SNP	1.000	G
THAP8	199745	genome.wustl.edu	37	19	36526357	36526357	+	Silent	SNP	C	C	T			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr19:36526357C>T	ENST00000292894.1	-	4	1354	c.810G>A	c.(808-810)cgG>cgA	p.R270R	CLIP3_ENST00000593074.1_5'Flank|AC002116.7_ENST00000586962.1_RNA|THAP8_ENST00000538849.1_Silent_p.R125R|CLIP3_ENST00000360535.4_5'Flank	NM_152658.2	NP_689871.1	Q8NA92	THAP8_HUMAN	THAP domain containing 8	270							DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R270R(1)		breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(1)|ovary(1)	8	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			CACTGGGGATCCGAGTGTCCA	0.567																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											87.0	81.0	83.0					19																	36526357		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK057453	CCDS33000.1	19q13.13	2013-01-25			ENSG00000161277	ENSG00000161277		"""THAP (C2CH-type zinc finger) domain containing"""	23191	protein-coding gene	gene with protein product		612536				12575992	Standard	NM_152658		Approved	FLJ32891	uc002oda.1	Q8NA92	OTTHUMG00000048138	ENST00000292894.1:c.810G>A	19.37:g.36526357C>T			Q0P5Z7|Q96M21	Silent	SNP	pfam_Znf_C2CH,smart_Znf_C2CH,pfscan_Znf_C2CH	p.R270	ENST00000292894.1	37	c.810	CCDS33000.1	19																																																																																			THAP8	-	NULL	ENSG00000161277		0.567	THAP8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	THAP8	HGNC	protein_coding	OTTHUMT00000379036.1	103	0.00	0	C	NM_152658		36526357	36526357	-1	no_errors	ENST00000292894	ensembl	human	known	69_37n	silent	94	16.81	19	SNP	0.000	T
TNC	3371	genome.wustl.edu	37	9	117825311	117825311	+	Silent	SNP	G	G	A			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr9:117825311G>A	ENST00000350763.4	-	13	4329	c.3918C>T	c.(3916-3918)ggC>ggT	p.G1306G	TNC_ENST00000341037.4_Intron|TNC_ENST00000340094.3_Intron|TNC_ENST00000346706.3_Intron|TNC_ENST00000542877.1_Intron|TNC_ENST00000423613.2_Silent_p.G1306G|TNC_ENST00000345230.3_Intron|TNC_ENST00000535648.1_Intron|TNC_ENST00000537320.1_Intron	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	1306	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)	p.G1306G(1)		NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						AACGCAGGCTGCCAGGAACCG	0.592																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											104.0	73.0	83.0					9																	117825311		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.3918C>T	9.37:g.117825311G>A			C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Silent	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C,superfamily_Fibronectin_type3,smart_EGF-like,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.G1306	ENST00000350763.4	37	c.3918	CCDS6811.1	9																																																																																			TNC	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000041982		0.592	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNC	HGNC	protein_coding	OTTHUMT00000055418.2	116	0.00	0	G	NM_002160		117825311	117825311	-1	no_errors	ENST00000350763	ensembl	human	known	69_37n	silent	59	11.94	8	SNP	0.999	A
TP53	7157	genome.wustl.edu	37	17	7578190	7578190	+	Missense_Mutation	SNP	T	T	C	rs121912666		TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr17:7578190T>C	ENST00000269305.4	-	6	848	c.659A>G	c.(658-660)tAt>tGt	p.Y220C	TP53_ENST00000455263.2_Missense_Mutation_p.Y220C|TP53_ENST00000574684.1_Intron|TP53_ENST00000359597.4_Missense_Mutation_p.Y220C|TP53_ENST00000420246.2_Missense_Mutation_p.Y220C|TP53_ENST00000445888.2_Missense_Mutation_p.Y220C|TP53_ENST00000413465.2_Missense_Mutation_p.Y220C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	220	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:9450901}.|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y220C(278)|p.Y127C(24)|p.Y220S(12)|p.?(11)|p.0?(8)|p.D208fs*1(1)|p.Y220_P223delYEPP(1)|p.V218_E224delVPYEPPE(1)|p.V218_E221delVPYE(1)|p.Y127S(1)|p.V218_Y220delVPY(1)|p.Y220fs*25(1)|p.V216_Y220delVVVPY(1)|p.Y220fs*2(1)|p.V218fs*26(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGCGGCTCATAGGGCACCAC	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	343	Substitution - Missense(315)|Unknown(11)|Whole gene deletion(8)|Deletion - In frame(5)|Deletion - Frameshift(3)|Insertion - Frameshift(1)	ovary(55)|breast(54)|lung(37)|upper_aerodigestive_tract(35)|urinary_tract(19)|oesophagus(19)|large_intestine(17)|liver(17)|central_nervous_system(16)|stomach(15)|haematopoietic_and_lymphoid_tissue(15)|endometrium(14)|soft_tissue(8)|biliary_tract(6)|bone(5)|pancreas(4)|prostate(4)|peritoneum(2)|small_intestine(1)	GRCh37	CM015378|CM951227	TP53	M	rs121912666						102.0	94.0	97.0					17																	7578190		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.659A>G	17.37:g.7578190T>C	ENSP00000269305:p.Tyr220Cys		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.Y220C	ENST00000269305.4	37	c.659	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	22.1	4.248510	0.80024	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99840	-7.08;-7.08;-7.08;-7.08;-7.08;-7.08;-7.08;-7.08	5.28	5.28	0.74379	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.89287	3.02	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.998;0.996;1.0;0.999;0.998;1.0	D	0.96735	0.9542	10	0.87932	D	0	-1.87	13.4753	0.61306	0.0:0.0:0.0:1.0	.	181;220;220;127;220;220;220	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	C	220;220;220;220;220;220;209;127;88;127	ENSP00000410739:Y220C;ENSP00000352610:Y220C;ENSP00000269305:Y220C;ENSP00000398846:Y220C;ENSP00000391127:Y220C;ENSP00000391478:Y220C;ENSP00000425104:Y88C;ENSP00000423862:Y127C	ENSP00000269305:Y220C	Y	-	2	0	TP53	7518915	1.000000	0.71417	0.585000	0.28666	0.993000	0.82548	6.232000	0.72313	2.128000	0.65567	0.460000	0.39030	TAT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	367	0.27	1	T	NM_000546		7578190	7578190	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	161	43.51	124	SNP	0.998	C
TRAF1	7185	genome.wustl.edu	37	9	123671534	123671534	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr9:123671534G>C	ENST00000373887.3	-	7	3451	c.1006C>G	c.(1006-1008)Ctg>Gtg	p.L336V	TRAF1_ENST00000546084.1_Missense_Mutation_p.L214V|TRAF1_ENST00000540010.1_Missense_Mutation_p.L336V	NM_005658.4	NP_005649.1	Q13077	TRAF1_HUMAN	TNF receptor-associated factor 1	336	MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.				apoptotic process (GO:0006915)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein complex assembly (GO:0006461)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.L336V(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(4)|pancreas(1)|skin(2)	22						CACGGCAGCAGCGCATCATAC	0.547																																						dbGAP											1	Substitution - Missense(1)	breast(1)											315.0	298.0	304.0					9																	123671534		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK090468	CCDS6825.1, CCDS55335.1	9q33-q34	2008-02-05			ENSG00000056558	ENSG00000056558			12031	protein-coding gene	gene with protein product		601711				8069916	Standard	NM_001190945		Approved	EBI6	uc010mvl.2	Q13077	OTTHUMG00000020578	ENST00000373887.3:c.1006C>G	9.37:g.123671534G>C	ENSP00000362994:p.Leu336Val		B4DJ77|Q658U1|Q8NF13	Missense_Mutation	SNP	pfam_MATH,superfamily_TRAF-like,smart_MATH,pirsf_TNF_rcpt--assoc_TRAF,pfscan_MATH	p.L336V	ENST00000373887.3	37	c.1006	CCDS6825.1	9	.	.	.	.	.	.	.	.	.	.	G	15.60	2.881234	0.51801	.	.	ENSG00000056558	ENST00000373887;ENST00000540010;ENST00000546084	T;T;T	0.45668	0.89;0.89;0.89	5.58	4.68	0.58851	TRAF-type (1);TRAF-like (1);MATH (3);	0.095287	0.46442	D	0.000285	T	0.42854	0.1221	M	0.62154	1.92	0.39935	D	0.974342	B	0.29766	0.256	B	0.32533	0.147	T	0.36817	-0.9732	10	0.51188	T	0.08	-18.0008	12.1109	0.53838	0.2057:0.0:0.7943:0.0	.	336	Q13077	TRAF1_HUMAN	V	336;336;214	ENSP00000362994:L336V;ENSP00000443183:L336V;ENSP00000438583:L214V	ENSP00000362994:L336V	L	-	1	2	TRAF1	122711355	1.000000	0.71417	0.999000	0.59377	0.627000	0.37826	4.472000	0.60189	0.834000	0.34852	-0.797000	0.03246	CTG	TRAF1	-	pfam_MATH,superfamily_TRAF-like,smart_MATH,pirsf_TNF_rcpt--assoc_TRAF,pfscan_MATH	ENSG00000056558		0.547	TRAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAF1	HGNC	protein_coding	OTTHUMT00000053843.1	70	0.00	0	G	NM_005658		123671534	123671534	-1	no_errors	ENST00000373887	ensembl	human	known	69_37n	missense	16	46.67	14	SNP	0.997	C
TRPC7	57113	genome.wustl.edu	37	5	135692811	135692811	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr5:135692811C>A	ENST00000513104.1	-	2	547	c.265G>T	c.(265-267)Gag>Tag	p.E89*	TRPC7_ENST00000355180.3_Nonsense_Mutation_p.E89*|TRPC7_ENST00000426057.2_Nonsense_Mutation_p.E89*	NM_020389.2	NP_065122.1	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel, subfamily C, member 7	89					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|manganese ion transport (GO:0006828)|platelet activation (GO:0030168)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.E89*(2)		NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(3)	46			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TCTAGGTGCTCGTTGCCCACG	0.607																																						dbGAP											2	Substitution - Nonsense(2)	breast(2)											74.0	82.0	80.0					5																	135692811		2201	4300	6501	-	-	-	SO:0001587	stop_gained	0			AJ272034	CCDS47267.1, CCDS47267.2, CCDS54905.1, CCDS54906.1	5q31.2	2011-12-14			ENSG00000069018	ENSG00000069018		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	20754	protein-coding gene	gene with protein product						11805119, 16382100	Standard	NM_020389		Approved		uc003lbn.2	Q9HCX4	OTTHUMG00000162035	ENST00000513104.1:c.265G>T	5.37:g.135692811C>A	ENSP00000426070:p.Glu89*		A1A4Z4|F5H5U9|Q70T26|Q8IWP7	Nonsense_Mutation	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,pfam_PKD1_2_channel,superfamily_Ankyrin_rpt-contain_dom,superfamily_ARM-type_fold,smart_Ankyrin_rpt,prints_TRPC7_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.E89*	ENST00000513104.1	37	c.265	CCDS47267.2	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	37|37	6.472258|6.472258	0.97594|0.97594	.|.	.|.	ENSG00000069018|ENSG00000069018	ENST00000355180;ENST00000426057;ENST00000513104;ENST00000265193|ENST00000352189;ENST00000378459;ENST00000502753	.|.	.|.	.|.	5.0|5.0	5.0|5.0	0.66597|0.66597	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.74419	.|0.3714	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.73353	.|-0.4009	.|3	0.62326|.	D|.	0.03|.	-22.6878|-22.6878	18.5076|18.5076	0.90902|0.90902	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|L	89|88	.|.	ENSP00000265193:E89X|.	E|R	-|-	1|2	0|0	TRPC7|TRPC7	135720710|135720710	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	7.651000|7.651000	0.83577|0.83577	2.608000|2.608000	0.88229|0.88229	0.561000|0.561000	0.74099|0.74099	GAG|CGA	TRPC7	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,tigrfam_TRP_channel	ENSG00000069018		0.607	TRPC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC7	HGNC	protein_coding	OTTHUMT00000366975.1	53	0.00	0	C	NM_020389		135692811	135692811	-1	no_errors	ENST00000513104	ensembl	human	known	69_37n	nonsense	8	38.46	5	SNP	1.000	A
TTLL13	440307	genome.wustl.edu	37	15	90799441	90799441	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr15:90799441G>A	ENST00000339615.5	+	6	907	c.617G>A	c.(616-618)gGc>gAc	p.G206D	TTLL13_ENST00000438251.1_Missense_Mutation_p.G206D|RP11-697E2.6_ENST00000561573.1_Intron	NM_001029964.2	NP_001025135.2			tubulin tyrosine ligase-like family, member 13									p.G206D(1)		NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)	16	Melanoma(11;0.00551)|Lung NSC(78;0.0178)|all_lung(78;0.0378)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|BRCA - Breast invasive adenocarcinoma(143;0.0323)|Kidney(142;0.0514)			CCAGACAGTGGCTGTCAGGGA	0.532																																						dbGAP											1	Substitution - Missense(1)	breast(1)											102.0	98.0	99.0					15																	90799441		2199	4298	6497	-	-	-	SO:0001583	missense	0			BC036668		15q26.1	2013-02-14				ENSG00000213471		"""Tubulin tyrosine ligase-like family"""	32484	protein-coding gene	gene with protein product						15890843	Standard	NR_104604		Approved	FLJ46079, MGC33417	uc002bpd.1	A6NNM8		ENST00000339615.5:c.617G>A	15.37:g.90799441G>A	ENSP00000345294:p.Gly206Asp			Missense_Mutation	SNP	pfam_Tub_tyr_ligase	p.G206D	ENST00000339615.5	37	c.617	CCDS32328.1	15	.	.	.	.	.	.	.	.	.	.	G	32	5.131296	0.94473	.	.	ENSG00000213471	ENST00000438251;ENST00000339615	T;T	0.12984	2.63;2.63	5.18	5.18	0.71444	.	0.069082	0.64402	D	0.000012	T	0.49338	0.1551	M	0.93763	3.455	0.58432	D	0.999994	D	0.76494	0.999	D	0.75020	0.985	T	0.62553	-0.6830	10	0.87932	D	0	.	17.8611	0.88781	0.0:0.0:1.0:0.0	.	206	A6NNM8-2	.	D	206	ENSP00000413362:G206D;ENSP00000345294:G206D	ENSP00000345294:G206D	G	+	2	0	TTLL13	88600445	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.046000	0.93817	2.705000	0.92388	0.561000	0.74099	GGC	TTLL13	-	pfam_Tub_tyr_ligase	ENSG00000213471		0.532	TTLL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL13	HGNC	protein_coding	OTTHUMT00000435854.1	120	0.00	0	G	NM_001029964		90799441	90799441	+1	no_errors	ENST00000438251	ensembl	human	known	69_37n	missense	29	50.85	30	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179479664	179479664	+	Missense_Mutation	SNP	A	A	G	rs148549746		TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr2:179479664A>G	ENST00000591111.1	-	210	43971	c.43747T>C	c.(43747-43749)Tgg>Cgg	p.W14583R	TTN_ENST00000342175.6_Missense_Mutation_p.W7351R|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.W7284R|TTN_ENST00000460472.2_Missense_Mutation_p.W7159R|TTN-AS1_ENST00000589830.1_RNA|RP11-171I2.4_ENST00000605334.1_lincRNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.W16224R|TTN_ENST00000342992.6_Missense_Mutation_p.W13656R|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000456053.1_RNA			Q8WZ42	TITIN_HUMAN	titin	14583	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.W13656R(2)|p.W7284R(1)|p.W7159R(1)|p.W7351R(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TAGGCATACCATTTGccttcc	0.443													A|||	1	0.000199681	0.0	0.0	5008	,	,		18860	0.0		0.001	False		,,,				2504	0.0					dbGAP											5	Substitution - Missense(5)	breast(5)											108.0	98.0	101.0					2																	179479664		1932	4147	6079	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.43747T>C	2.37:g.179479664A>G	ENSP00000465570:p.Trp14583Arg		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.W13656R	ENST00000591111.1	37	c.40966		2	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	A	13.39	2.223373	0.39300	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.55588	0.51;0.51;0.51;0.51	5.63	5.63	0.86233	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.59115	0.2170	N	0.17278	0.47	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.65796	-0.6081	9	0.87932	D	0	.	16.1307	0.81436	1.0:0.0:0.0:0.0	.	7159;7284;7351;14583	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	R	13656;7159;7351;7284;7159	ENSP00000343764:W13656R;ENSP00000434586:W7159R;ENSP00000340554:W7351R;ENSP00000352154:W7284R	ENSP00000340554:W7351R	W	-	1	0	TTN	179187909	1.000000	0.71417	0.935000	0.37517	0.996000	0.88848	9.199000	0.95003	2.263000	0.75096	0.533000	0.62120	TGG	TTN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.443	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	181	0.00	0	A	NM_133378		179479664	179479664	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	131	31.05	59	SNP	1.000	G
TTN	7273	genome.wustl.edu	37	2	179549456	179549456	+	Missense_Mutation	SNP	G	G	C	rs111645864		TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr2:179549456G>C	ENST00000591111.1	-	129	31848	c.31624C>G	c.(31624-31626)Cca>Gca	p.P10542A	TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P10859A|TTN_ENST00000342992.6_Missense_Mutation_p.P9615A|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	0	Glu-rich.|Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTGGAACTGGTTTCTTTGGC	0.398																																						dbGAP											0													109.0	96.0	100.0					2																	179549456		1821	4076	5897	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.31624C>G	2.37:g.179549456G>C	ENSP00000465570:p.Pro10542Ala		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.P9615A	ENST00000591111.1	37	c.28843		2	.	.	.	.	.	.	.	.	.	.	G	13.05	2.120660	0.37436	.	.	ENSG00000155657	ENST00000342992	T	0.61980	0.06	5.57	4.67	0.58626	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.56761	0.2007	L	0.47016	1.485	0.80722	D	1	B	0.10296	0.003	B	0.08055	0.003	T	0.56890	-0.7904	9	0.87932	D	0	.	14.3361	0.66592	0.0:0.0:0.8518:0.1482	.	10542	Q8WZ42	TITIN_HUMAN	A	9615	ENSP00000343764:P9615A	ENSP00000343764:P9615A	P	-	1	0	TTN	179257701	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	1.876000	0.39588	1.447000	0.47661	0.655000	0.94253	CCA	TTN	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom	ENSG00000155657		0.398	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	207	0.00	0	G	NM_133378		179549456	179549456	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	236	13.24	36	SNP	1.000	C
UTRN	7402	genome.wustl.edu	37	6	145167956	145167956	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr6:145167956G>C	ENST00000367545.3	+	73	10286	c.10286G>C	c.(10285-10287)aGg>aCg	p.R3429T	UTRN_ENST00000367526.4_Missense_Mutation_p.R984T	NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	3429					aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.R3429T(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		GTTCCCAGCAGGCCACAGGTA	0.413																																						dbGAP											1	Substitution - Missense(1)	breast(1)											152.0	134.0	140.0					6																	145167956		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.10286G>C	6.37:g.145167956G>C	ENSP00000356515:p.Arg3429Thr		Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.R3429T	ENST00000367545.3	37	c.10286	CCDS34547.1	6	.	.	.	.	.	.	.	.	.	.	G	15.06	2.721758	0.48728	.	.	ENSG00000152818	ENST00000367545;ENST00000367526	T;T	0.60424	0.19;3.5	5.48	5.48	0.80851	.	0.566376	0.15402	N	0.264267	T	0.36468	0.0968	L	0.29908	0.895	0.35611	D	0.808667	B	0.16396	0.017	B	0.23150	0.044	T	0.25328	-1.0135	10	0.51188	T	0.08	.	17.1184	0.86695	0.0:0.0:1.0:0.0	.	3429	P46939	UTRO_HUMAN	T	3429;984	ENSP00000356515:R3429T;ENSP00000356496:R984T	ENSP00000356496:R984T	R	+	2	0	UTRN	145209649	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.624000	0.54231	2.583000	0.87209	0.591000	0.81541	AGG	UTRN	-	pirsf_Dystrophin/utrophin	ENSG00000152818		0.413	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTRN	HGNC	protein_coding	OTTHUMT00000042551.1	114	0.00	0	G			145167956	145167956	+1	no_errors	ENST00000367545	ensembl	human	known	69_37n	missense	69	19.77	17	SNP	1.000	C
VSTM2A	222008	genome.wustl.edu	37	7	54636842	54636842	+	3'UTR	SNP	T	T	C			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr7:54636842T>C	ENST00000407838.3	+	0	1181				VSTM2A_ENST00000404951.1_Missense_Mutation_p.V287A|GS1-18A18.1_ENST00000456049.1_RNA|VSTM2A_ENST00000498834.1_3'UTR|VSTM2A_ENST00000402613.3_Missense_Mutation_p.V218A	NM_182546.2	NP_872352.2	Q8TAG5	VTM2A_HUMAN	V-set and transmembrane domain containing 2A							extracellular region (GO:0005576)				endometrium(1)|large_intestine(2)|lung(12)|prostate(1)	16			STAD - Stomach adenocarcinoma(5;0.0525)			AAATCGCCTGTAAAATCTACG	0.448																																						dbGAP											0													200.0	158.0	170.0					7																	54636842		692	1591	2283	-	-	-	SO:0001624	3_prime_UTR_variant	0			BC028404	CCDS5512.2, CCDS75604.1	7p11.2	2013-01-11	2007-08-10	2007-08-10	ENSG00000170419	ENSG00000170419		"""Immunoglobulin superfamily / V-set domain containing"""	28499	protein-coding gene	gene with protein product			"""V-set and transmembrane domain containing 2"""	VSTM2		12477932	Standard	XM_006715663		Approved	MGC33530	uc010kzf.3	Q8TAG5	OTTHUMG00000129271	ENST00000407838.3:c.*64T>C	7.37:g.54636842T>C			A4D2E9|B5MC94	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	p.V287A	ENST00000407838.3	37	c.860	CCDS5512.2	7	.	.	.	.	.	.	.	.	.	.	T	14.85	2.658424	0.47467	.	.	ENSG00000170419	ENST00000404951;ENST00000402613	T;T	0.61040	0.14;0.79	6.17	6.17	0.99709	.	.	.	.	.	T	0.67998	0.2953	.	.	.	0.80722	D	1	D	0.69078	0.997	D	0.72625	0.978	T	0.63129	-0.6706	8	0.13108	T	0.6	.	13.214	0.59844	0.0:0.0:0.0:1.0	.	287	B5MCX6	.	A	287;218	ENSP00000384701:V287A;ENSP00000384103:V218A	ENSP00000384103:V218A	V	+	2	0	VSTM2A	54604336	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.942000	0.56614	2.371000	0.80710	0.533000	0.62120	GTA	VSTM2A	-	NULL	ENSG00000170419		0.448	VSTM2A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	VSTM2A	HGNC	protein_coding	OTTHUMT00000318694.1	138	0.00	0	T	NM_182546		54636842	54636842	+1	no_errors	ENST00000404951	ensembl	human	putative	69_37n	missense	120	34.43	63	SNP	1.000	C
WDHD1	11169	genome.wustl.edu	37	14	55411098	55411098	+	Silent	SNP	T	T	G			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr14:55411098T>G	ENST00000360586.3	-	25	3206	c.3141A>C	c.(3139-3141)atA>atC	p.I1047I	WDHD1_ENST00000420358.2_Silent_p.I924I|WDHD1_ENST00000421192.1_Silent_p.I924I|WDHD1_ENST00000359167.4_Silent_p.I565I	NM_007086.3	NP_009017.1	O75717	WDHD1_HUMAN	WD repeat and HMG-box DNA binding protein 1	1047					heterochromatin maintenance (GO:0070829)|regulation of chromosome organization (GO:0033044)|RNA processing (GO:0006396)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA binding (GO:0003723)	p.I1047I(1)		breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(2)	42						TTCCTTCTTTTATTATGTCTG	0.348																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											123.0	122.0	123.0					14																	55411098		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ006266	CCDS9721.1, CCDS41955.1	14q22.2	2013-01-09			ENSG00000198554	ENSG00000198554		"""WD repeat domain containing"""	23170	protein-coding gene	gene with protein product	"""CTF4, chromosome transmission fidelity factor 4 homolog (S. cerevisiae)"""	608126				9175701, 20028748	Standard	NM_007086		Approved	AND-1, CTF4, CHTF4	uc001xbm.2	O75717	OTTHUMG00000140304	ENST00000360586.3:c.3141A>C	14.37:g.55411098T>G			C9JW18|F6W0U7	Silent	SNP	pfam_WD40_repeat,pfam_DUF3639,pfam_TIF2A_beta_prop-like,superfamily_WD40_repeat_dom,superfamily_HMG_superfamily,smart_WD40_repeat,smart_HMG_superfamily,pfscan_HMG_superfamily,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.I1047	ENST00000360586.3	37	c.3141	CCDS9721.1	14																																																																																			WDHD1	-	superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	ENSG00000198554		0.348	WDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDHD1	HGNC	protein_coding	OTTHUMT00000276897.2	253	0.39	1	T	NM_007086		55411098	55411098	-1	no_errors	ENST00000360586	ensembl	human	known	69_37n	silent	205	14.94	36	SNP	1.000	G
CFAP44	55779	genome.wustl.edu	37	3	113063398	113063398	+	Missense_Mutation	SNP	T	T	G			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr3:113063398T>G	ENST00000393845.2	-	23	3293	c.3227A>C	c.(3226-3228)gAg>gCg	p.E1076A		NM_001164496.1	NP_001157968.1												p.E224A(1)		breast(2)|central_nervous_system(3)|endometrium(3)|kidney(5)|large_intestine(7)|lung(26)|prostate(1)|urinary_tract(2)	49						TCCAGGTCCCTCTTTTTCAAA	0.413																																						dbGAP											1	Substitution - Missense(1)	breast(1)											176.0	146.0	155.0					3																	113063398		692	1591	2283	-	-	-	SO:0001583	missense	0																														ENST00000393845.2:c.3227A>C	3.37:g.113063398T>G	ENSP00000377428:p.Glu1076Ala			Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E1076A	ENST00000393845.2	37	c.3227	CCDS54624.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.57|13.57	2.277050|2.277050	0.40294|0.40294	.|.	.|.	ENSG00000206530|ENSG00000206530	ENST00000393845|ENST00000465636	T|.	0.12255|.	2.7|.	4.69|4.69	4.69|4.69	0.59074|0.59074	.|.	5.941120|.	0.00597|.	U|.	0.000361|.	T|T	0.48624|0.48624	0.1510|0.1510	N|N	0.19112|0.19112	0.55|0.55	0.80722|0.80722	D|D	1|1	B|.	0.20988|.	0.05|.	B|.	0.23574|.	0.047|.	T|T	0.43032|0.43032	-0.9416|-0.9416	10|5	0.39692|.	T|.	0.17|.	-8.0413|-8.0413	12.8087|12.8087	0.57628|0.57628	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1076|.	Q96MT7-2|.	.|.	A|S	1076|212	ENSP00000377428:E1076A|.	ENSP00000377428:E1076A|.	E|R	-|-	2|3	0|2	WDR52|WDR52	114546088|114546088	0.995000|0.995000	0.38212|0.38212	0.993000|0.993000	0.49108|0.49108	0.072000|0.072000	0.16883|0.16883	3.717000|3.717000	0.54911|0.54911	2.103000|2.103000	0.63969|0.63969	0.482000|0.482000	0.46254|0.46254	GAG|AGA	WDR52	-	NULL	ENSG00000206530		0.413	WDR52-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR52	HGNC	protein_coding		439	0.00	0	T			113063398	113063398	-1	no_errors	ENST00000393845	ensembl	human	known	69_37n	missense	335	12.07	46	SNP	0.977	G
XPA	7507	genome.wustl.edu	37	9	100437634	100437634	+	3'UTR	DEL	T	T	-			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr9:100437634delT	ENST00000375128.4	-	0	973				XPA_ENST00000485042.1_5'UTR	NM_000380.3	NP_000371.1	P23025	XPA_HUMAN	xeroderma pigmentosum, complementation group A						DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|response to oxidative stress (GO:0006979)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercellular bridge (GO:0045171)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(4)|large_intestine(1)|lung(4)|prostate(1)	11		Acute lymphoblastic leukemia(62;0.158)				AAGATGTTGCTTTTTTTTTTG	0.264			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																													dbGAP	yes	Rec		Xeroderma pigmentosum (A)	9	9q22.3	7507	"""xeroderma pigmentosum, complementation group A"""		E	0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	D14533	CCDS6729.1	9q22.3	2014-09-17			ENSG00000136936	ENSG00000136936			12814	protein-coding gene	gene with protein product		611153					Standard	NM_000380		Approved	XPAC, XP1	uc004axr.4	P23025	OTTHUMG00000020330	ENST00000375128.4:c.*87A>-	9.37:g.100437634delT			Q5T1U9|Q6LCW7|Q6LD02	RNA	DEL	-	NULL	ENST00000375128.4	37	NULL	CCDS6729.1	9																																																																																			XPA	-	-	ENSG00000136936		0.264	XPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPA	HGNC	protein_coding	OTTHUMT00000053332.1	21	0.00	0	T	NM_000380		100437634	100437634	-1	no_errors	ENST00000485042	ensembl	human	known	69_37n	rna	20	13.04	3	DEL	0.004	-
ZC3H12B	340554	genome.wustl.edu	37	X	64722721	64722721	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chrX:64722721G>A	ENST00000338957.4	+	5	2210	c.2143G>A	c.(2143-2145)Gtg>Atg	p.V715M	ZC3H12B_ENST00000423889.3_Missense_Mutation_p.V704M	NM_001010888.3	NP_001010888.3	Q5HYM0	ZC12B_HUMAN	zinc finger CCCH-type containing 12B	715							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)	p.V651M(1)|p.V565M(1)		breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GAGCAACCCCGTGAGGCAAAG	0.607																																						dbGAP											2	Substitution - Missense(2)	breast(2)											45.0	48.0	47.0					X																	64722721		2151	4240	6391	-	-	-	SO:0001583	missense	0			BX647241	CCDS48131.1, CCDS48131.2	Xq12	2012-07-05	2005-06-14	2005-06-14	ENSG00000102053	ENSG00000102053		"""Zinc fingers, CCCH-type domain containing"""	17407	protein-coding gene	gene with protein product	"""MCP induced protein 2"""	300889	"""chromosome X open reading frame 32"""	CXorf32		18178554	Standard	NM_001010888		Approved	MCPIP2	uc010nko.3	Q5HYM0	OTTHUMG00000021719	ENST00000338957.4:c.2143G>A	X.37:g.64722721G>A	ENSP00000340839:p.Val715Met		B2RTQ3|E9PAJ6|Q5H9C0	Missense_Mutation	SNP	pfam_RNase_Zc3h12	p.V715M	ENST00000338957.4	37	c.2143	CCDS48131.2	X	.	.	.	.	.	.	.	.	.	.	G	8.437	0.849928	0.17034	.	.	ENSG00000102053	ENST00000338957;ENST00000423889;ENST00000218172	T;T	0.21734	2.0;1.99	5.79	3.37	0.38596	.	0.424409	0.28742	N	0.014291	T	0.05273	0.0140	N	0.00538	-1.39	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33059	-0.9883	10	0.33141	T	0.24	-20.55	5.8065	0.18442	0.766:0.0:0.084:0.1501	.	704	Q5HYM0	ZC12B_HUMAN	M	715;704;651	ENSP00000340839:V715M;ENSP00000408077:V704M	ENSP00000218172:V651M	V	+	1	0	ZC3H12B	64639446	0.915000	0.31059	0.829000	0.32907	0.894000	0.52154	2.179000	0.42528	0.280000	0.22209	-0.518000	0.04402	GTG	ZC3H12B	-	NULL	ENSG00000102053		0.607	ZC3H12B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H12B	HGNC	protein_coding	OTTHUMT00000378734.2	187	0.00	0	G	XM_293334		64722721	64722721	+1	no_errors	ENST00000338957	ensembl	human	known	69_37n	missense	60	26.83	22	SNP	0.475	A
ZCWPW1	55063	genome.wustl.edu	37	7	100013966	100013966	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr7:100013966G>T	ENST00000398027.2	-	7	840	c.593C>A	c.(592-594)tCc>tAc	p.S198Y	ZCWPW1_ENST00000490721.1_Missense_Mutation_p.S77Y|ZCWPW1_ENST00000360951.4_Missense_Mutation_p.S198Y|ZCWPW1_ENST00000324725.6_Missense_Mutation_p.S77Y	NM_017984.4	NP_060454.3	Q9H0M4	ZCPW1_HUMAN	zinc finger, CW type with PWWP domain 1	198							zinc ion binding (GO:0008270)	p.S198Y(1)		breast(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)	16	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GAGTCTATTGGATTTCTTCTT	0.443																																						dbGAP											1	Substitution - Missense(1)	breast(1)											154.0	143.0	146.0					7																	100013966		1866	4109	5975	-	-	-	SO:0001583	missense	0			AK000919	CCDS43623.1, CCDS59067.1	7q22.1	2012-02-10	2004-11-03		ENSG00000078487	ENSG00000078487			23486	protein-coding gene	gene with protein product			"""zinc finger, CW-type with PWWP domain 1"""			11230166, 14607086, 20826339	Standard	NM_017984		Approved	FLJ10057, DKFZp434N0510, ZCW1	uc003uut.4	Q9H0M4	OTTHUMG00000159537	ENST00000398027.2:c.593C>A	7.37:g.100013966G>T	ENSP00000381109:p.Ser198Tyr		A8MVF5|B4DUQ2|Q8NA98|Q9BUD0|Q9NWF7	Missense_Mutation	SNP	pfam_Znf_CW,pfam_PWWP,smart_PWWP,pfscan_PWWP,pfscan_Znf_CW	p.S198Y	ENST00000398027.2	37	c.593	CCDS43623.1	7	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.690691	0.00738	.	.	ENSG00000078487	ENST00000398027;ENST00000490721;ENST00000360951;ENST00000324725;ENST00000379559	T;T;T;T	0.47528	0.86;0.87;0.84;0.87	5.27	-5.21	0.02815	.	1.738830	0.03103	N	0.161432	T	0.27489	0.0675	N	0.24115	0.695	0.09310	N	1	B;B;B;B;B	0.33583	0.294;0.294;0.294;0.294;0.418	B;B;B;B;B	0.33960	0.084;0.084;0.084;0.084;0.173	T	0.11227	-1.0596	9	.	.	.	4.147	2.0204	0.03508	0.242:0.2735:0.351:0.1335	.	198;158;199;198;77	B4DUQ2;B4DXS7;C9J435;Q9H0M4;Q9H0M4-4	.;.;.;ZCPW1_HUMAN;.	Y	198;77;198;77;199	ENSP00000381109:S198Y;ENSP00000419187:S77Y;ENSP00000354210:S198Y;ENSP00000314880:S77Y	.	S	-	2	0	ZCWPW1	99851902	0.000000	0.05858	0.001000	0.08648	0.151000	0.21798	-0.489000	0.06490	-0.487000	0.06735	-0.302000	0.09304	TCC	ZCWPW1	-	NULL	ENSG00000078487		0.443	ZCWPW1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZCWPW1	HGNC	protein_coding	OTTHUMT00000356083.1	84	0.00	0	G	NM_017984		100013966	100013966	-1	no_errors	ENST00000398027	ensembl	human	known	69_37n	missense	103	21.37	28	SNP	0.000	T
ZFPM2	23414	genome.wustl.edu	37	8	106646518	106646518	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr8:106646518G>T	ENST00000407775.2	+	5	715	c.465G>T	c.(463-465)aaG>aaT	p.K155N	ZFPM2_ENST00000520492.1_Missense_Mutation_p.K23N|ZFPM2_ENST00000517361.1_Missense_Mutation_p.K23N	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	155					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.K155N(1)		NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			CTGGTCCCAAGTGGTTGCTGG	0.433																																						dbGAP											1	Substitution - Missense(1)	breast(1)											83.0	82.0	82.0					8																	106646518		2019	4190	6209	-	-	-	SO:0001583	missense	0			AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.465G>T	8.37:g.106646518G>T	ENSP00000384179:p.Lys155Asn		Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K155N	ENST00000407775.2	37	c.465	CCDS47908.1	8	.	.	.	.	.	.	.	.	.	.	G	14.21	2.468896	0.43839	.	.	ENSG00000169946	ENST00000407775;ENST00000520492;ENST00000520027;ENST00000517361	T;T;T	0.19938	2.11;2.49;2.49	5.56	4.68	0.58851	.	0.158637	0.48286	D	0.000192	T	0.10937	0.0267	N	0.08118	0	0.80722	D	1	P	0.47762	0.9	B	0.39706	0.307	T	0.11567	-1.0582	10	0.42905	T	0.14	.	11.306	0.49336	0.1423:0.0:0.8577:0.0	.	155	Q8WW38	FOG2_HUMAN	N	155;23;23;23	ENSP00000384179:K155N;ENSP00000430757:K23N;ENSP00000428720:K23N	ENSP00000384179:K155N	K	+	3	2	ZFPM2	106715694	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.619000	0.61218	1.449000	0.47699	0.655000	0.94253	AAG	ZFPM2	-	NULL	ENSG00000169946		0.433	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFPM2	HGNC	protein_coding	OTTHUMT00000380614.1	207	0.00	0	G			106646518	106646518	+1	no_errors	ENST00000407775	ensembl	human	known	69_37n	missense	113	26.62	41	SNP	1.000	T
ZNF101	94039	genome.wustl.edu	37	19	19790898	19790898	+	Missense_Mutation	SNP	A	A	T			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr19:19790898A>T	ENST00000592502.1	+	4	1210	c.1100A>T	c.(1099-1101)gAa>gTa	p.E367V	ZNF101_ENST00000415784.2_Missense_Mutation_p.E247V			Q8IZC7	ZN101_HUMAN	zinc finger protein 101	367					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E367V(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(4)|ovary(2)|prostate(1)	17						AAGCCATATGAATGTACAAGG	0.388																																						dbGAP											1	Substitution - Missense(1)	breast(1)											80.0	79.0	79.0					19																	19790898		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK097169	CCDS32971.1	19p13.11	2013-01-08	2004-02-10		ENSG00000181896	ENSG00000181896		"""Zinc fingers, C2H2-type"", ""-"""	12881	protein-coding gene	gene with protein product		603983	"""zinc finger protein 101 (Y2)"""			11441184	Standard	XM_005260165		Approved	HZF12, DKFZp570I0164	uc002nni.2	Q8IZC7	OTTHUMG00000167736	ENST00000592502.1:c.1100A>T	19.37:g.19790898A>T	ENSP00000468049:p.Glu367Val		C9JU83|Q0VDG9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E367V	ENST00000592502.1	37	c.1100	CCDS32971.1	19	.	.	.	.	.	.	.	.	.	.	A	9.991	1.230927	0.22542	.	.	ENSG00000181896	ENST00000318110;ENST00000415440;ENST00000415784	T;T	0.21361	2.01;2.01	0.235	0.235	0.15431	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.19846	0.0477	L	0.43554	1.36	0.09310	N	1	P	0.47841	0.901	P	0.48770	0.589	T	0.12344	-1.0551	8	.	.	.	.	3.0351	0.06119	0.5244:0.4753:1.0E-4:2.0E-4	.	367	Q8IZC7	ZN101_HUMAN	V	367;367;247	ENSP00000319716:E367V;ENSP00000400952:E247V	.	E	+	2	0	ZNF101	19651898	0.000000	0.05858	0.430000	0.26722	0.430000	0.31655	0.118000	0.15605	0.263000	0.21812	0.260000	0.18958	GAA	ZNF101	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000181896		0.388	ZNF101-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF101	HGNC	protein_coding	OTTHUMT00000460559.1	135	0.00	0	A	NM_033204		19790898	19790898	+1	no_errors	ENST00000318110	ensembl	human	known	69_37n	missense	120	35.14	65	SNP	0.031	T
ZNF208	7757	genome.wustl.edu	37	19	22155945	22155945	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr19:22155945G>A	ENST00000397126.4	-	4	2039	c.1891C>T	c.(1891-1893)Cat>Tat	p.H631Y	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	631					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.H531Y(2)|p.H631Y(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				TCTCCAGCATGAATTGCCTTA	0.393																																						dbGAP											3	Substitution - Missense(3)	breast(3)											74.0	82.0	80.0					19																	22155945		2114	4246	6360	-	-	-	SO:0001583	missense	0			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.1891C>T	19.37:g.22155945G>A	ENSP00000380315:p.His631Tyr			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H631Y	ENST00000397126.4	37	c.1891	CCDS54240.1	19	.	.	.	.	.	.	.	.	.	.	G	15.85	2.953527	0.53293	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.67523	-0.27	2.51	2.51	0.30379	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.79997	0.4543	.	.	.	0.36094	D	0.843675	D	0.76494	0.999	D	0.83275	0.996	D	0.84807	0.0788	8	0.87932	D	0	.	11.6684	0.51387	0.0:0.0:1.0:0.0	.	531	O43345	ZN208_HUMAN	Y	631;531	ENSP00000380315:H631Y	ENSP00000380315:H631Y	H	-	1	0	ZNF208	21947785	0.999000	0.42202	0.006000	0.13384	0.013000	0.08279	3.106000	0.50322	0.934000	0.37316	0.306000	0.20318	CAT	ZNF208	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000160321		0.393	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	HGNC	protein_coding	OTTHUMT00000464302.1	218	0.00	0	G	NM_007153		22155945	22155945	-1	no_errors	ENST00000397126	ensembl	human	known	69_37n	missense	235	14.86	41	SNP	0.854	A
ZNF646	9726	genome.wustl.edu	37	16	31092572	31092572	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr16:31092572G>C	ENST00000394979.2	+	1	5350	c.4927G>C	c.(4927-4929)Gag>Cag	p.E1643Q	ZNF646_ENST00000300850.5_Missense_Mutation_p.E1643Q			O15015	ZN646_HUMAN	zinc finger protein 646	1643					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E1643Q(1)		NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(1)|lung(21)|ovary(1)|prostate(4)|skin(3)	49						GAAAGCCCAGGAGGCCCCATC	0.662																																						dbGAP											1	Substitution - Missense(1)	breast(1)											41.0	51.0	48.0					16																	31092572		2196	4298	6494	-	-	-	SO:0001583	missense	0			AB002294	CCDS10702.1	16p11.2	2013-01-08			ENSG00000167395	ENSG00000167395		"""Zinc fingers, C2H2-type"""	29004	protein-coding gene	gene with protein product							Standard	NM_014699		Approved	KIAA0296	uc002eap.3	O15015	OTTHUMG00000047355	ENST00000394979.2:c.4927G>C	16.37:g.31092572G>C	ENSP00000378429:p.Glu1643Gln		Q8IVD8	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E1643Q	ENST00000394979.2	37	c.4927		16	.	.	.	.	.	.	.	.	.	.	G	4.510	0.094562	0.08632	.	.	ENSG00000167395	ENST00000300850;ENST00000394979	T;T	0.08896	3.04;3.07	5.54	1.99	0.26369	.	.	.	.	.	T	0.04815	0.0130	N	0.19112	0.55	0.09310	N	1	B	0.22003	0.063	B	0.18561	0.022	T	0.37384	-0.9708	9	0.39692	T	0.17	-3.1534	2.7428	0.05258	0.3326:0.2554:0.412:0.0	.	1643	O15015-2	.	Q	1643	ENSP00000300850:E1643Q;ENSP00000378429:E1643Q	ENSP00000300850:E1643Q	E	+	1	0	ZNF646	31000073	0.000000	0.05858	0.864000	0.33941	0.555000	0.35460	0.498000	0.22530	1.181000	0.42912	0.655000	0.94253	GAG	ZNF646	-	NULL	ENSG00000167395		0.662	ZNF646-003	KNOWN	basic	protein_coding	ZNF646	HGNC	protein_coding	OTTHUMT00000108510.2	70	0.00	0	G	NM_014699		31092572	31092572	+1	no_errors	ENST00000300850	ensembl	human	known	69_37n	missense	21	43.24	16	SNP	0.004	C
ZNF75D	7626	genome.wustl.edu	37	X	134427720	134427720	+	Missense_Mutation	SNP	T	T	G			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chrX:134427720T>G	ENST00000370766.3	-	3	3056	c.347A>C	c.(346-348)aAt>aCt	p.N116T	ZNF75D_ENST00000370764.1_Missense_Mutation_p.N116T|ZNF75D_ENST00000494295.1_Intron	NM_007131.3	NP_009062.2	P51815	ZN75D_HUMAN	zinc finger protein 75D	116	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.N116T(1)		autonomic_ganglia(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(14)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						CTGTTTGACATTCTGTGGATG	0.468																																						dbGAP											1	Substitution - Missense(1)	breast(1)											90.0	84.0	86.0					X																	134427720		2203	4300	6503	-	-	-	SO:0001583	missense	0			S43109	CCDS14648.1, CCDS55503.1	Xq26	2013-01-09	2008-06-11	2008-06-11	ENSG00000186376	ENSG00000186376		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13145	protein-coding gene	gene with protein product		314997	"""zinc finger protein 75 (D8C6)"""	ZNF82, ZNF75		1505955	Standard	XM_005262469		Approved	ZKSCAN24, D8C6, ZSCAN28	uc004eyo.3	P51815	OTTHUMG00000022482	ENST00000370766.3:c.347A>C	X.37:g.134427720T>G	ENSP00000359802:p.Asn116Thr		A6NK62|B3KRI7|Q5JPG0|Q6LDE0	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.N116T	ENST00000370766.3	37	c.347	CCDS14648.1	X	.	.	.	.	.	.	.	.	.	.	T	2.401	-0.337606	0.05278	.	.	ENSG00000186376	ENST00000370766;ENST00000370764	T;T	0.05139	3.49;3.49	2.98	-0.629	0.11533	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	.	.	.	.	T	0.04543	0.0124	L	0.38733	1.17	0.09310	N	0.999993	B;B	0.24963	0.066;0.115	B;B	0.21708	0.036;0.031	T	0.42413	-0.9453	9	0.33940	T	0.23	.	2.7806	0.05360	0.0:0.3223:0.2511:0.4266	.	116;116	P51815;A6NK62	ZN75D_HUMAN;.	T	116	ENSP00000359802:N116T;ENSP00000359800:N116T	ENSP00000359800:N116T	N	-	2	0	ZNF75D	134255386	0.020000	0.18652	0.166000	0.22797	0.773000	0.43773	-0.533000	0.06157	-0.226000	0.09899	0.414000	0.27820	AAT	ZNF75D	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN	ENSG00000186376		0.468	ZNF75D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF75D	HGNC	protein_coding	OTTHUMT00000058415.1	114	0.00	0	T	NM_007131		134427720	134427720	-1	no_errors	ENST00000370766	ensembl	human	known	69_37n	missense	52	23.53	16	SNP	0.268	G
ZNF841	284371	genome.wustl.edu	37	19	52568812	52568812	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0IJ-01A-11W-A050-09	TCGA-B6-A0IJ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c63f9ddb-6301-400e-a0e8-197eea2efe75	aa5b770f-1e5f-459b-8ef5-cfbbb5ecd737	g.chr19:52568812G>A	ENST00000426391.2	-	5	2526	c.1975C>T	c.(1975-1977)Cgt>Tgt	p.R659C	ZNF841_ENST00000389534.4_Missense_Mutation_p.R775C|ZNF841_ENST00000594295.1_Missense_Mutation_p.R775C|ZNF432_ENST00000598446.1_Intron|ZNF841_ENST00000359973.2_Missense_Mutation_p.R351C|CTC-471J1.2_ENST00000569091.1_RNA			Q6ZN19	ZN841_HUMAN	zinc finger protein 841	659					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R775C(2)|p.R351C(1)|p.R216C(1)		breast(1)|endometrium(4)|kidney(3)|lung(3)	11						GAGCGATAACGGAAGACCTTG	0.433																																						dbGAP											4	Substitution - Missense(4)	breast(4)											53.0	48.0	50.0					19																	52568812		692	1591	2283	-	-	-	SO:0001583	missense	0			AK131409	CCDS46161.1	19q13.41	2013-01-08			ENSG00000197608	ENSG00000197608		"""Zinc fingers, C2H2-type"", ""-"""	27611	protein-coding gene	gene with protein product							Standard	NM_001136499		Approved	LOC284371	uc010ydh.1	Q6ZN19		ENST00000426391.2:c.1975C>T	19.37:g.52568812G>A	ENSP00000415453:p.Arg659Cys		B9EG58|Q6ZN82|Q6ZP71|Q8N9U7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R775C	ENST00000426391.2	37	c.2323		19	.	.	.	.	.	.	.	.	.	.	G	14.20	2.463077	0.43736	.	.	ENSG00000197608	ENST00000389534;ENST00000426391;ENST00000359973	T;T;T	0.18502	2.21;2.21;2.21	2.02	-0.528	0.11905	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.18923	0.0454	N	0.17838	0.53	0.09310	N	1	D;B;D	0.89917	0.999;0.062;1.0	P;B;P	0.58928	0.83;0.012;0.848	T	0.20338	-1.0278	9	0.66056	D	0.02	.	7.8702	0.29561	0.0:0.0:0.4376:0.5624	.	775;351;659	Q6ZN19-3;Q6ZN19-2;Q6ZN19	.;.;ZN841_HUMAN	C	775;659;351	ENSP00000374185:R775C;ENSP00000415453:R659C;ENSP00000353060:R351C	ENSP00000353060:R351C	R	-	1	0	ZNF841	57260624	0.000000	0.05858	0.000000	0.03702	0.600000	0.36913	-1.614000	0.02057	-0.371000	0.08004	0.313000	0.20887	CGT	ZNF841	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197608		0.433	ZNF841-001	PUTATIVE	basic	protein_coding	ZNF841	HGNC	protein_coding	OTTHUMT00000462435.1	56	0.00	0	G	XM_209155		52568812	52568812	-1	no_errors	ENST00000389534	ensembl	human	known	69_37n	missense	31	34.04	16	SNP	0.000	A
