#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCC12	94160	genome.wustl.edu	37	16	48149418	48149418	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr16:48149418C>T	ENST00000311303.3	-	13	2242	c.1897G>A	c.(1897-1899)Gtg>Atg	p.V633M	ABCC12_ENST00000416054.1_Silent_p.P608P|ABCC12_ENST00000448542.1_Missense_Mutation_p.V633M	NM_033226.2	NP_150229.2	Q96J65	MRP9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 12	633	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.					integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.V633M(1)		NS(1)|breast(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|liver(1)|lung(43)|ovary(2)|prostate(3)|skin(7)|urinary_tract(1)	90		all_cancers(37;0.0474)|all_lung(18;0.047)				TGGGCGTCCACGGCCGACAGG	0.632																																						dbGAP											1	Substitution - Missense(1)	breast(1)											115.0	105.0	109.0					16																	48149418		2201	4300	6501	-	-	-	SO:0001583	missense	0			AY040220	CCDS10730.1	16q12.1	2012-03-14			ENSG00000140798	ENSG00000140798		"""ATP binding cassette transporters / subfamily C"""	14640	protein-coding gene	gene with protein product		607041				11435397, 11483364	Standard	NM_033226		Approved	MRP9	uc002efc.1	Q96J65	OTTHUMG00000133143	ENST00000311303.3:c.1897G>A	16.37:g.48149418C>T	ENSP00000311030:p.Val633Met		Q49AL2|Q8TAF0|Q8TEY2	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.V633M	ENST00000311303.3	37	c.1897	CCDS10730.1	16	.	.	.	.	.	.	.	.	.	.	C	15.05	2.718290	0.48622	.	.	ENSG00000140798	ENST00000311303;ENST00000448542;ENST00000449939	D;D	0.86230	-2.09;-2.09	5.24	4.29	0.51040	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.060625	0.64402	N	0.000004	D	0.91287	0.7253	M	0.71036	2.16	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	D	0.91090	0.4906	10	0.87932	D	0	.	8.2816	0.31904	0.1543:0.7648:0.0:0.0809	.	633	Q96J65	MRP9_HUMAN	M	633;633;575	ENSP00000311030:V633M;ENSP00000401855:V633M	ENSP00000311030:V633M	V	-	1	0	ABCC12	46706919	0.997000	0.39634	0.857000	0.33713	0.049000	0.14656	3.627000	0.54252	1.330000	0.45394	0.467000	0.42956	GTG	ABCC12	-	smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000140798		0.632	ABCC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC12	HGNC	protein_coding	OTTHUMT00000256837.1	131	0.00	0	C	NM_033226		48149418	48149418	-1	no_errors	ENST00000311303	ensembl	human	known	69_37n	missense	29	27.50	11	SNP	0.994	T
ABL1	25	genome.wustl.edu	37	9	133750254	133750254	+	Splice_Site	SNP	G	G	C			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr9:133750254G>C	ENST00000318560.5	+	7	1466		c.e7-1			NM_005157.4	NP_005148.2	P00519	ABL1_HUMAN	ABL proto-oncogene 1, non-receptor tyrosine kinase						actin cytoskeleton organization (GO:0030036)|autophagy (GO:0006914)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to dopamine (GO:1903351)|cellular response to oxidative stress (GO:0034599)|DNA damage induced protein phosphorylation (GO:0006975)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mismatch repair (GO:0006298)|mitochondrial depolarization (GO:0051882)|mitotic nuclear division (GO:0007067)|muscle cell differentiation (GO:0042692)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|regulation of response to DNA damage stimulus (GO:2001020)|regulation of transcription, DNA-templated (GO:0006355)|response to oxidative stress (GO:0006979)|signal transduction in response to DNA damage (GO:0042770)	actin cytoskeleton (GO:0015629)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase binding (GO:0051019)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|SH3 domain binding (GO:0017124)|syntaxin binding (GO:0019905)	p.?(1)		breast(3)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1149)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	1195		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Bosutinib(DB06616)|Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Ponatinib(DB08901)|Regorafenib(DB08896)	TCCTTTCTTAGAGATCTTGCT	0.507			"""T, Mis"""	"""BCR, ETV6, NUP214"""	"""CML, ALL, T-ALL"""																																	dbGAP		Dom	yes		9	9q34.1	25	v-abl Abelson murine leukemia viral oncogene homolog 1		L	1	Unknown(1)	breast(1)											127.0	117.0	120.0					9																	133750254		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			M14752	CCDS35165.1, CCDS35166.1	9q34.1	2014-09-17	2014-06-26		ENSG00000097007	ENSG00000097007		"""SH2 domain containing"""	76	protein-coding gene	gene with protein product		189980	"""v-abl Abelson murine leukemia viral oncogene homolog 1"", ""c-abl oncogene 1, receptor tyrosine kinase"", ""c-abl oncogene 1, non-receptor tyrosine kinase"""	ABL		1857987, 12626632	Standard	NM_007313		Approved	JTK7, c-ABL, p150	uc004bzv.3	P00519	OTTHUMG00000020813	ENST00000318560.5:c.1086-1G>C	9.37:g.133750254G>C			A3KFJ3|Q13869|Q13870|Q16133|Q17R61|Q45F09	Splice_Site	SNP	-	e7-1	ENST00000318560.5	37	c.1143-1	CCDS35166.1	9	.	.	.	.	.	.	.	.	.	.	G	18.65	3.668619	0.67814	.	.	ENSG00000097007	ENST00000444970;ENST00000372348;ENST00000318560	.	.	.	5.23	4.33	0.51752	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2786	0.66196	0.0:0.0:0.8501:0.1499	.	.	.	.	.	-1	.	.	.	+	.	.	ABL1	132740075	1.000000	0.71417	0.936000	0.37596	0.831000	0.47069	9.858000	0.99539	1.197000	0.43143	0.655000	0.94253	.	ABL1	-	-	ENSG00000097007		0.507	ABL1-001	KNOWN	basic|CCDS	protein_coding	ABL1	HGNC	protein_coding	OTTHUMT00000054684.1	157	0.00	0	G	NM_007313	Intron	133750254	133750254	+1	no_errors	ENST00000372348	ensembl	human	known	69_37n	splice_site	50	26.47	18	SNP	1.000	C
ADCY2	108	genome.wustl.edu	37	5	7802447	7802447	+	Silent	SNP	C	C	G			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr5:7802447C>G	ENST00000338316.4	+	21	2834	c.2745C>G	c.(2743-2745)ctC>ctG	p.L915L	ADCY2_ENST00000537121.1_Silent_p.L735L	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	915					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)	p.L915L(1)		NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						GCCTTCGGCTCCTGAACGAGA	0.488																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											93.0	93.0	93.0					5																	7802447		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.2745C>G	5.37:g.7802447C>G			B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Silent	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.L915	ENST00000338316.4	37	c.2745	CCDS3872.2	5																																																																																			ADCY2	-	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	ENSG00000078295		0.488	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY2	HGNC	protein_coding	OTTHUMT00000206930.2	161	0.00	0	C	NM_020546		7802447	7802447	+1	no_errors	ENST00000338316	ensembl	human	known	69_37n	silent	50	33.33	25	SNP	0.999	G
ADD1	118	genome.wustl.edu	37	4	2930220	2930220	+	Silent	SNP	G	G	A			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr4:2930220G>A	ENST00000398129.1	+	14	2204	c.2184G>A	c.(2182-2184)ctG>ctA	p.L728L	ADD1_ENST00000398125.1_3'UTR|ADD1_ENST00000446856.1_Silent_p.L728L|ADD1_ENST00000355842.3_3'UTR|ADD1_ENST00000264758.7_Silent_p.L759L|ADD1_ENST00000398123.2_3'UTR|ADD1_ENST00000513328.2_3'UTR|ADD1_ENST00000503455.2_3'UTR			P35611	ADDA_HUMAN	adducin 1 (alpha)	728	Interaction with calmodulin. {ECO:0000255}.				actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cell morphogenesis (GO:0000902)|cell volume homeostasis (GO:0006884)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to retinoic acid (GO:0071300)|endoplasmic reticulum unfolded protein response (GO:0030968)|erythrocyte differentiation (GO:0030218)|hemoglobin metabolic process (GO:0020027)|homeostasis of number of cells within a tissue (GO:0048873)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein binding (GO:0032092)	cytosol (GO:0005829)|dendritic spine (GO:0043197)|F-actin capping protein complex (GO:0008290)|focal adhesion (GO:0005925)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)|transcription factor binding (GO:0008134)	p.L759L(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CGTCCTTTCTGAAGAAGAGCA	0.622																																					Esophageal Squamous(71;505 1201 20414 34538 37449)	dbGAP											1	Substitution - coding silent(1)	breast(1)											57.0	70.0	66.0					4																	2930220		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L07261	CCDS3363.1, CCDS3364.1, CCDS43205.1, CCDS75094.1	4p16.3	2009-04-22			ENSG00000087274	ENSG00000087274			243	protein-coding gene	gene with protein product		102680				1840603	Standard	NM_001119		Approved		uc003gfq.3	P35611	OTTHUMG00000122080	ENST00000398129.1:c.2184G>A	4.37:g.2930220G>A			A2A3N8|A2A3P0|B4DI79|D3DVR3|D3DVR4|D3DVR5|Q13734|Q14729|Q16156|Q86XM2|Q9UJB6	Silent	SNP	pfam_Aldolase_II/adducin_N,superfamily_Aldolase_II/adducin_N	p.L759	ENST00000398129.1	37	c.2277	CCDS43205.1	4																																																																																			ADD1	-	NULL	ENSG00000087274		0.622	ADD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADD1	HGNC	protein_coding	OTTHUMT00000242840.1	37	0.00	0	G	NM_014189		2930220	2930220	+1	no_errors	ENST00000264758	ensembl	human	known	69_37n	silent	26	18.75	6	SNP	1.000	A
AKAP9	10142	genome.wustl.edu	37	7	91712715	91712715	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr7:91712715C>G	ENST00000359028.2	+	34	8653	c.8428C>G	c.(8428-8430)Ctt>Gtt	p.L2810V	AKAP9_ENST00000358100.2_Missense_Mutation_p.L2810V|AKAP9_ENST00000356239.3_Missense_Mutation_p.L2798V			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	2810					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)	p.L2798V(1)|p.L2810V(1)		NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TCCACAAATTCTTGTTAAAAA	0.363			T	BRAF	papillary thyroid																																	dbGAP		Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	2	Substitution - Missense(2)	breast(2)											65.0	65.0	65.0					7																	91712715		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.8428C>G	7.37:g.91712715C>G	ENSP00000351922:p.Leu2810Val		A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	pfam_PACT_domain,superfamily_Prefoldin,superfamily_YbaB-like	p.L2810V	ENST00000359028.2	37	c.8428		7	.	.	.	.	.	.	.	.	.	.	C	1.963	-0.438351	0.04636	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394534	T;T;T;T	0.50813	0.73;0.73;0.73;0.73	4.8	2.85	0.33270	.	0.728996	0.11284	N	0.579948	T	0.31575	0.0801	L	0.39020	1.185	0.09310	N	1	B;B;B;B;B	0.21071	0.051;0.029;0.017;0.013;0.013	B;B;B;B;B	0.17433	0.018;0.018;0.008;0.012;0.012	T	0.28839	-1.0031	10	0.02654	T	1	.	8.6954	0.34293	0.0:0.6328:0.2901:0.0771	.	2802;2802;2810;2798;2790	F5H3X5;Q99996-6;Q99996;Q99996-2;Q99996-3	.;.;AKAP9_HUMAN;.;.	V	2798;2810;2810;2802;644	ENSP00000348573:L2798V;ENSP00000351922:L2810V;ENSP00000350813:L2810V;ENSP00000378042:L644V	ENSP00000348573:L2798V	L	+	1	0	AKAP9	91550651	0.000000	0.05858	0.016000	0.15963	0.284000	0.27059	0.226000	0.17776	1.211000	0.43351	0.591000	0.81541	CTT	AKAP9	-	NULL	ENSG00000127914		0.363	AKAP9-202	KNOWN	basic	protein_coding	AKAP9	HGNC	protein_coding		93	0.00	0	C	NM_005751		91712715	91712715	+1	no_errors	ENST00000359028	ensembl	human	known	69_37n	missense	79	36.29	45	SNP	0.124	G
ALOX12	239	genome.wustl.edu	37	17	6902773	6902773	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr17:6902773G>C	ENST00000251535.6	+	6	848	c.795G>C	c.(793-795)gaG>gaC	p.E265D	RP11-589P10.7_ENST00000572547.1_RNA|AC027763.2_ENST00000399541.2_Intron|AC027763.2_ENST00000575727.1_3'UTR|AC027763.2_ENST00000574377.1_3'UTR	NM_000697.2	NP_000688.2	P18054	LOX12_HUMAN	arachidonate 12-lipoxygenase	265	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				aging (GO:0007568)|arachidonic acid metabolic process (GO:0019369)|cellular component movement (GO:0006928)|cellular response to lipid (GO:0071396)|establishment of skin barrier (GO:0061436)|fatty acid oxidation (GO:0019395)|hepoxilin biosynthetic process (GO:0051122)|hepoxilin metabolic process (GO:0051121)|leukotriene A4 metabolic process (GO:1901751)|linoleic acid metabolic process (GO:0043651)|lipoxin A4 biosynthetic process (GO:2001303)|lipoxin B4 biosynthetic process (GO:2001306)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of platelet aggregation (GO:0090331)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of gene expression (GO:0010628)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of vasodilation (GO:0045909)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|superoxide anion generation (GO:0042554)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|sarcolemma (GO:0042383)	arachidonate 12-lipoxygenase activity (GO:0004052)|hepoxilin A3 synthase activity (GO:0051120)|hepoxilin-epoxide hydrolase activity (GO:0047977)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)	p.E265D(1)		breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)|urinary_tract(1)	19						CTCAACTGGAGAAAGAACTTC	0.552																																						dbGAP											1	Substitution - Missense(1)	breast(1)											121.0	104.0	110.0					17																	6902773		2203	4300	6503	-	-	-	SO:0001583	missense	0			M35418	CCDS11084.1	17p13.1	2010-01-14			ENSG00000108839	ENSG00000108839	1.13.11.31	"""Arachidonate lipoxygenases"""	429	protein-coding gene	gene with protein product	"""platelet 12-LOX"""	152391				1570320	Standard	NM_000697		Approved	12S-LOX	uc002gdx.4	P18054	OTTHUMG00000102088	ENST00000251535.6:c.795G>C	17.37:g.6902773G>C	ENSP00000251535:p.Glu265Asp		O95569|Q6ISF8|Q9UQM4	Missense_Mutation	SNP	pfam_LipOase_C,pfam_LipOase_LH2,superfamily_LipOase_C,superfamily_Lipase_LipOase,smart_LipOase_LH2,prints_LipOase_mml,prints_LipOase_C,pfscan_LipOase_LH2	p.E265D	ENST00000251535.6	37	c.795	CCDS11084.1	17	.	.	.	.	.	.	.	.	.	.	G	10.77	1.445292	0.25987	.	.	ENSG00000108839	ENST00000251535	T	0.08370	3.1	5.13	0.941	0.19519	Lipoxygenase, C-terminal (3);	0.302746	0.36303	N	0.002679	T	0.07728	0.0194	L	0.52573	1.65	0.31986	N	0.60529	B	0.06786	0.001	B	0.11329	0.006	T	0.04885	-1.0920	10	0.56958	D	0.05	-2.2221	6.1358	0.20233	0.2292:0.1418:0.629:0.0	.	265	P18054	LOX12_HUMAN	D	265	ENSP00000251535:E265D	ENSP00000251535:E265D	E	+	3	2	ALOX12	6843497	0.825000	0.29262	0.996000	0.52242	0.298000	0.27526	-0.181000	0.09740	0.420000	0.25954	-0.189000	0.12847	GAG	ALOX12	-	pfam_LipOase_C,superfamily_LipOase_C	ENSG00000108839		0.552	ALOX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALOX12	HGNC	protein_coding	OTTHUMT00000219922.2	189	0.00	0	G			6902773	6902773	+1	no_errors	ENST00000251535	ensembl	human	known	69_37n	missense	43	34.85	23	SNP	0.981	C
ANAPC7	51434	genome.wustl.edu	37	12	110832986	110832986	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr12:110832986C>T	ENST00000455511.3	-	3	430	c.430G>A	c.(430-432)Gaa>Aaa	p.E144K	RP11-478C19.2_ENST00000550231.1_RNA|ANAPC7_ENST00000450008.2_Missense_Mutation_p.E144K	NM_016238.2	NP_057322.2	Q9UJX3	APC7_HUMAN	anaphase promoting complex subunit 7	144					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)	p.E110K(1)		breast(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)	19						GTATAACATTCAGCCATTTTG	0.323																																						dbGAP											1	Substitution - Missense(1)	breast(1)											176.0	160.0	166.0					12																	110832986		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF191340	CCDS9145.2, CCDS44971.1	12q13.12	2013-01-10			ENSG00000196510	ENSG00000196510		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	17380	protein-coding gene	gene with protein product		606949					Standard	NM_016238		Approved	APC7	uc001tqo.2	Q9UJX3	OTTHUMG00000157009	ENST00000455511.3:c.430G>A	12.37:g.110832986C>T	ENSP00000394394:p.Glu144Lys		Q96AC4|Q96GF4|Q9BU24|Q9NT16	Missense_Mutation	SNP	pfam_TPR_2,pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E144K	ENST00000455511.3	37	c.430	CCDS9145.2	12	.	.	.	.	.	.	.	.	.	.	C	16.64	3.180311	0.57800	.	.	ENSG00000196510;ENSG00000196510;ENSG00000258210	ENST00000455511;ENST00000450008;ENST00000550231	T;T	0.73897	1.19;-0.79	5.21	5.21	0.72293	Tetratricopeptide-like helical (1);	0.046141	0.85682	D	0.000000	T	0.54822	0.1882	N	0.14661	0.345	0.80722	D	1	B;B	0.30584	0.286;0.002	B;B	0.18263	0.021;0.002	T	0.57579	-0.7787	10	0.06625	T	0.88	-0.0367	18.8291	0.92130	0.0:1.0:0.0:0.0	.	144;144	Q9UJX3-2;Q9UJX3	.;APC7_HUMAN	K	144;144;43	ENSP00000394394:E144K;ENSP00000402314:E144K	ENSP00000402314:E144K	E	-	1	0	RP11-478C19.2;ANAPC7	109317369	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.455000	0.80726	2.461000	0.83175	0.650000	0.86243	GAA	ANAPC7	-	NULL	ENSG00000196510		0.323	ANAPC7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANAPC7	HGNC	protein_coding	OTTHUMT00000347075.3	298	0.00	0	C	NM_016238		110832986	110832986	-1	no_errors	ENST00000455511	ensembl	human	known	69_37n	missense	270	19.88	67	SNP	1.000	T
AOC4P	90586	genome.wustl.edu	37	17	41020257	41020257	+	RNA	SNP	G	G	A			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr17:41020257G>A	ENST00000585538.1	+	0	1096					NR_002773.1				amine oxidase, copper containing 4, pseudogene																		CAAGGCCCCCGCTTCAGTGTC	0.612																																						dbGAP											0																																										-	-	-			0					17q21.31	2013-06-19			ENSG00000260105	ENSG00000260105			48869	pseudogene	pseudogene						20013028	Standard	NR_002773		Approved				OTTHUMG00000176596		17.37:g.41020257G>A				RNA	SNP	-	NULL	ENST00000585538.1	37	NULL		17																																																																																			AOC4	-	-	ENSG00000260105		0.612	AOC4P-006	KNOWN	basic	processed_transcript	AOC4	Clone_based_vega_gene	pseudogene	OTTHUMT00000452449.1	109	0.00	0	G			41020257	41020257	+1	no_errors	ENST00000585538	ensembl	human	known	69_37n	rna	23	23.33	7	SNP	1.000	A
ARID2	196528	genome.wustl.edu	37	12	46211464	46211464	+	Nonsense_Mutation	SNP	C	C	T	rs146524163		TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr12:46211464C>T	ENST00000334344.6	+	5	602	c.430C>T	c.(430-432)Caa>Taa	p.Q144*	ARID2_ENST00000422737.1_5'UTR	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	144					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q144*(2)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		TTATCTGCGTCAAAGTTATGG	0.333			"""N, S, F"""		hepatocellular carcinoma																																	dbGAP		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	2	Substitution - Nonsense(2)	breast(1)|skin(1)											63.0	61.0	62.0					12																	46211464		2202	4300	6502	-	-	-	SO:0001587	stop_gained	0				CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.430C>T	12.37:g.46211464C>T	ENSP00000335044:p.Gln144*		Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Nonsense_Mutation	SNP	pfam_ARID/BRIGHT_DNA-bd,pfam_DNA-bd_RFX,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.Q144*	ENST00000334344.6	37	c.430	CCDS31783.1	12	.	.	.	.	.	.	.	.	.	.	C	38	6.696470	0.97768	.	.	ENSG00000189079	ENST00000334344	.	.	.	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	-6.519	19.6643	0.95887	0.0:1.0:0.0:0.0	.	.	.	.	X	144	.	ENSP00000335044:Q144X	Q	+	1	0	ARID2	44497731	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.806000	0.86020	2.628000	0.89032	0.650000	0.86243	CAA	ARID2	-	NULL	ENSG00000189079		0.333	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID2	HGNC	protein_coding	OTTHUMT00000318380.2	123	0.00	0	C	XM_350875		46211464	46211464	+1	no_errors	ENST00000334344	ensembl	human	known	69_37n	nonsense	92	28.12	36	SNP	1.000	T
ATM	472	genome.wustl.edu	37	11	108186737	108186737	+	Splice_Site	SNP	G	G	A			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr11:108186737G>A	ENST00000452508.2	+	43	6284		c.e43-1		C11orf65_ENST00000525729.1_Intron|ATM_ENST00000278616.4_Splice_Site			Q13315	ATM_HUMAN	ATM serine/threonine kinase						brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.?(3)		NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	TTTTCTTATAGACTACGAACA	0.383			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																												dbGAP	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	3	Unknown(3)	breast(2)|haematopoietic_and_lymphoid_tissue(1)											89.0	83.0	85.0					11																	108186737		2201	4298	6499	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.6096-1G>A	11.37:g.108186737G>A			B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Splice_Site	SNP	-	e41-1	ENST00000452508.2	37	c.6096-1	CCDS31669.1	11	.	.	.	.	.	.	.	.	.	.	G	13.05	2.121166	0.37436	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	.	.	.	5.24	5.24	0.73138	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.0101	0.86404	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ATM	107691947	1.000000	0.71417	0.752000	0.31206	0.192000	0.23643	9.101000	0.94219	2.447000	0.82792	0.305000	0.20034	.	ATM	-	-	ENSG00000149311		0.383	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	HGNC	protein_coding	OTTHUMT00000389938.1	190	0.00	0	G	NM_000051	Intron	108186737	108186737	+1	no_errors	ENST00000278616	ensembl	human	known	69_37n	splice_site	91	25.81	32	SNP	1.000	A
CCDC175	729665	genome.wustl.edu	37	14	60031832	60031832	+	Missense_Mutation	SNP	T	T	C			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr14:60031832T>C	ENST00000537690.2	-	5	708	c.653A>G	c.(652-654)gAg>gGg	p.E218G	CCDC175_ENST00000556996.1_5'Flank|CCDC175_ENST00000281581.4_Missense_Mutation_p.E218G	NM_001164399.1	NP_001157871.1	P0C221	CC175_HUMAN	coiled-coil domain containing 175	218								p.E218G(1)									CTCCTCTGCCTCTTGAATACA	0.333																																						dbGAP											1	Substitution - Missense(1)	breast(1)											333.0	264.0	285.0					14																	60031832		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS53898.1	14q23.1	2012-09-24	2012-09-24	2012-09-24	ENSG00000151838	ENSG00000151838			19847	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 38"""	C14orf38			Standard	NM_001164399		Approved		uc021rtw.1	P0C221		ENST00000537690.2:c.653A>G	14.37:g.60031832T>C	ENSP00000453940:p.Glu218Gly		G3V5J7	Missense_Mutation	SNP	superfamily_Prefoldin	p.E218G	ENST00000537690.2	37	c.653	CCDS53898.1	14	.	.	.	.	.	.	.	.	.	.	T	8.899	0.955936	0.18507	.	.	ENSG00000151838	ENST00000555041	.	.	.	4.75	0.967	0.19674	.	1.213900	0.05796	N	0.611343	T	0.27629	0.0679	L	0.32530	0.975	0.09310	N	1	.	.	.	.	.	.	T	0.29150	-1.0021	6	.	.	.	-0.6623	4.09	0.09965	0.0:0.1942:0.1793:0.6265	.	.	.	.	G	218	.	.	E	-	2	0	C14orf38	59101585	0.000000	0.05858	0.006000	0.13384	0.014000	0.08584	0.403000	0.20982	0.059000	0.16252	0.459000	0.35465	GAG	C14orf38	-	NULL	ENSG00000151838		0.333	CCDC175-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf38	HGNC	protein_coding	OTTHUMT00000471273.1	635	0.16	1	T	NM_001164399		60031832	60031832	-1	no_errors	ENST00000281581	ensembl	human	known	69_37n	missense	596	21.78	166	SNP	0.007	C
C7orf66	154907	genome.wustl.edu	37	7	108524578	108524578	+	Silent	SNP	C	C	G			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr7:108524578C>G	ENST00000379007.2	-	1	66	c.12G>C	c.(10-12)gtG>gtC	p.V4V		NM_001024607.1	NP_001019778.1	A4D0T2	CG066_HUMAN	chromosome 7 open reading frame 66	4						integral component of membrane (GO:0016021)		p.V4V(1)		breast(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)	15						TGGGTGTCATCACAGCCATCA	0.413																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											161.0	127.0	138.0					7																	108524578		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF103078	CCDS34735.1	7q31.1	2009-03-06			ENSG00000205174	ENSG00000205174			33712	protein-coding gene	gene with protein product							Standard	NM_001024607		Approved		uc003vfo.3	A4D0T2	OTTHUMG00000154867	ENST00000379007.2:c.12G>C	7.37:g.108524578C>G				Silent	SNP	NULL	p.V4	ENST00000379007.2	37	c.12	CCDS34735.1	7																																																																																			C7orf66	-	NULL	ENSG00000205174		0.413	C7orf66-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	C7orf66	HGNC	protein_coding	OTTHUMT00000337420.1	200	0.00	0	C	NM_001024607		108524578	108524578	-1	no_errors	ENST00000379007	ensembl	human	putative	69_37n	silent	107	40.88	74	SNP	0.000	G
CACNA1D	776	genome.wustl.edu	37	3	53839094	53839094	+	Silent	SNP	C	C	T			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr3:53839094C>T	ENST00000350061.5	+	45	6181	c.5670C>T	c.(5668-5670)ttC>ttT	p.F1890F	CACNA1D_ENST00000288139.4_Silent_p.F1910F|CACNA1D_ENST00000544977.1_Silent_p.F269F|CACNA1D_ENST00000422281.2_Silent_p.F1866F	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	1890					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)	p.F1910F(1)		breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CCCAAGGATTCTTGGAGGACG	0.532																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											97.0	94.0	95.0					3																	53839094		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.5670C>T	3.37:g.53839094C>T			B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su,prints_LVDCC_a1dsu	p.F1910	ENST00000350061.5	37	c.5730	CCDS46848.1	3																																																																																			CACNA1D	-	NULL	ENSG00000157388		0.532	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1D	HGNC	protein_coding	OTTHUMT00000350557.1	87	0.00	0	C	NM_000720		53839094	53839094	+1	no_errors	ENST00000288139	ensembl	human	known	69_37n	silent	39	11.36	5	SNP	1.000	T
CACNA1G	8913	genome.wustl.edu	37	17	48681624	48681624	+	Silent	SNP	C	C	T			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr17:48681624C>T	ENST00000359106.5	+	22	4278	c.4278C>T	c.(4276-4278)ttC>ttT	p.F1426F	CACNA1G_ENST00000503485.1_Silent_p.F1426F|CACNA1G_ENST00000510115.1_Silent_p.F1403F|CACNA1G_ENST00000429973.2_Silent_p.F1426F|CACNA1G_ENST00000360761.4_Silent_p.F1403F|CACNA1G_ENST00000507510.2_Silent_p.F1426F|CACNA1G_ENST00000358244.5_Silent_p.F1403F|CACNA1G_ENST00000507609.1_Silent_p.F1426F|CACNA1G_ENST00000513689.2_Silent_p.F1426F|CACNA1G_ENST00000505165.1_Silent_p.F1426F|CACNA1G_ENST00000416767.4_Silent_p.F1426F|CACNA1G_ENST00000514181.1_Silent_p.F1426F|CACNA1G_ENST00000507336.1_Silent_p.F1426F|CACNA1G_ENST00000515165.1_Silent_p.F1426F|CACNA1G_ENST00000512389.1_Silent_p.F1426F|CACNA1G_ENST00000507896.1_Silent_p.F1426F|CACNA1G_ENST00000354983.4_Silent_p.F1403F|CACNA1G_ENST00000510366.1_Silent_p.F1426F|CACNA1G_ENST00000514717.1_Silent_p.F1403F|CACNA1G_ENST00000515411.1_Silent_p.F1426F|CACNA1G_ENST00000352832.5_Silent_p.F1403F|CACNA1G_ENST00000442258.2_Silent_p.F1403F|CACNA1G_ENST00000515765.1_Silent_p.F1426F|CACNA1G_ENST00000514079.1_Silent_p.F1426F|CACNA1G_ENST00000502264.1_Silent_p.F1403F|CACNA1G_ENST00000513964.1_Silent_p.F1426F	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	1426					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)	p.F1426F(3)|p.F1403F(1)		breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	TCATCATTTTCGGCATCTTGG	0.602																																						dbGAP											4	Substitution - coding silent(4)	breast(4)											130.0	138.0	136.0					17																	48681624		2127	4244	6371	-	-	-	SO:0001819	synonymous_variant	0			AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.4278C>T	17.37:g.48681624C>T			D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Silent	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_VDCCAlpha1	p.F1426	ENST00000359106.5	37	c.4278	CCDS45730.1	17																																																																																			CACNA1G	-	pfam_Ion_trans_dom	ENSG00000006283		0.602	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	CACNA1G	HGNC	protein_coding	OTTHUMT00000367895.1	301	0.00	0	C	NM_018896		48681624	48681624	+1	no_errors	ENST00000359106	ensembl	human	known	69_37n	silent	110	14.62	19	SNP	0.997	T
CDK1	983	genome.wustl.edu	37	10	62553685	62553685	+	Silent	SNP	G	G	A			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr10:62553685G>A	ENST00000395284.3	+	8	988	c.846G>A	c.(844-846)ctG>ctA	p.L282L	CDK1_ENST00000448257.2_Silent_p.L282L|CDK1_ENST00000316629.4_Silent_p.L225L|CDK1_ENST00000373809.2_Silent_p.L225L	NM_001786.4	NP_001777.1	P06493	CDK1_HUMAN	cyclin-dependent kinase 1	282	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell aging (GO:0007569)|cell migration (GO:0016477)|cellular response to hydrogen peroxide (GO:0070301)|centrosome cycle (GO:0007098)|chromosome condensation (GO:0030261)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell differentiation (GO:0030855)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|MAPK cascade (GO:0000165)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|mitotic G2 DNA damage checkpoint (GO:0007095)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ regeneration (GO:0031100)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of DNA replication (GO:0045740)|positive regulation of gene expression (GO:0010628)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|pronuclear fusion (GO:0007344)|protein complex assembly (GO:0006461)|protein localization to kinetochore (GO:0034501)|Ras protein signal transduction (GO:0007265)|regulation of embryonic development (GO:0045995)|regulation of Schwann cell differentiation (GO:0014038)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to activity (GO:0014823)|response to amine (GO:0014075)|response to axon injury (GO:0048678)|response to cadmium ion (GO:0046686)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to organic cyclic compound (GO:0014070)|response to toxic substance (GO:0009636)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac muscle cell development (GO:0055015)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|midbody (GO:0030496)|mitochondrion (GO:0005739)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|histone kinase activity (GO:0035173)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)	p.L282L(1)		ovary(1)	1						AAATGGCACTGAATCATCCAT	0.289																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											77.0	80.0	79.0					10																	62553685		2202	4291	6493	-	-	-	SO:0001819	synonymous_variant	0			BC014563	CCDS7260.1, CCDS44408.1	10q21.2	2011-11-08	2009-12-16	2009-12-16	ENSG00000170312	ENSG00000170312		"""Cyclin-dependent kinases"""	1722	protein-coding gene	gene with protein product		116940	"""cell division cycle 2, G1 to S and G2 to M"""	CDC2		3553962, 19884882	Standard	NM_001786		Approved	CDC28A	uc001jld.3	P06493	OTTHUMG00000018290	ENST00000395284.3:c.846G>A	10.37:g.62553685G>A			A8K7C4|C9J497|O60764	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L282	ENST00000395284.3	37	c.846	CCDS44408.1	10																																																																																			CDK1	-	pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	ENSG00000170312		0.289	CDK1-007	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	CDK1	HGNC	protein_coding	OTTHUMT00000048211.2	113	0.00	0	G	NM_001786		62553685	62553685	+1	no_errors	ENST00000395284	ensembl	human	known	69_37n	silent	107	17.05	22	SNP	1.000	A
CST5	1473	genome.wustl.edu	37	20	23860130	23860130	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr20:23860130C>T	ENST00000304710.4	-	1	257	c.184G>A	c.(184-186)Gat>Aat	p.D62N		NM_001900.4	NP_001891.2	P28325	CYTD_HUMAN	cystatin D	62					negative regulation of endopeptidase activity (GO:0010951)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)	p.D62N(1)		breast(1)|kidney(1)|large_intestine(1)|lung(6)|skin(1)|stomach(1)	11						TAGTACTCATCCTTATTAATG	0.562																																						dbGAP											1	Substitution - Missense(1)	breast(1)											234.0	216.0	222.0					20																	23860130		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13162.1	20p11.21	2008-04-15			ENSG00000170367	ENSG00000170367			2477	protein-coding gene	gene with protein product		123858				1939105	Standard	NM_001900		Approved		uc002wtr.1	P28325	OTTHUMG00000032089	ENST00000304710.4:c.184G>A	20.37:g.23860130C>T	ENSP00000307132:p.Asp62Asn		Q5JRF5|Q9UCA0	Missense_Mutation	SNP	pfam_Prot_inh_cystat,smart_Prot_inh_cystat	p.D62N	ENST00000304710.4	37	c.184	CCDS13162.1	20	.	.	.	.	.	.	.	.	.	.	c	12.94	2.089453	0.36855	.	.	ENSG00000170367	ENST00000304710	T	0.27890	1.64	1.87	0.778	0.18543	Proteinase inhibitor I25, cystatin (2);	.	.	.	.	T	0.51719	0.1691	M	0.82193	2.58	0.09310	N	1	D	0.89917	1.0	D	0.83275	0.996	T	0.30268	-0.9984	9	0.46703	T	0.11	.	5.7997	0.18408	0.0:0.6601:0.3399:0.0	.	62	P28325	CYTD_HUMAN	N	62	ENSP00000307132:D62N	ENSP00000307132:D62N	D	-	1	0	CST5	23808130	0.003000	0.15002	0.001000	0.08648	0.002000	0.02628	0.283000	0.18846	0.274000	0.22072	0.448000	0.29417	GAT	CST5	-	pfam_Prot_inh_cystat,smart_Prot_inh_cystat	ENSG00000170367		0.562	CST5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CST5	HGNC	protein_coding	OTTHUMT00000078355.2	144	0.00	0	C	NM_001900		23860130	23860130	-1	no_errors	ENST00000304710	ensembl	human	known	69_37n	missense	34	24.44	11	SNP	0.001	T
DNALI1	7802	genome.wustl.edu	37	1	38024964	38024964	+	Frame_Shift_Del	DEL	G	G	-	rs199737899		TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr1:38024964delG	ENST00000296218.7	+	3	340	c.330delG	c.(328-330)cagfs	p.Q110fs	DNALI1_ENST00000541606.1_Intron	NM_003462.3	NP_003453.2	O14645	IDLC_HUMAN	dynein, axonemal, light intermediate chain 1	88					cellular component movement (GO:0006928)|metabolic process (GO:0008152)|single fertilization (GO:0007338)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|filopodium (GO:0030175)	microtubule motor activity (GO:0003777)			breast(1)|kidney(1)|large_intestine(2)|ovary(1)	5		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GGATCCAGCAGGTGTCCAGCA	0.592																																						dbGAP											0													89.0	80.0	83.0					1																	38024964		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF006386	CCDS420.1	1p35.1	2008-07-18	2006-09-04		ENSG00000163879	ENSG00000163879		"""Axonemal dyneins"""	14353	protein-coding gene	gene with protein product	"""inner dynein arm, homolog of clamydomonas"", ""dJ423B22.5 (axonemal dynein light chain (hp28))"""	602135	"""dynein, axonemal, light intermediate polypeptide 1"""			9284741	Standard	NM_003462		Approved	P28, hp28, dJ423B22.5	uc001cbj.3	O14645	OTTHUMG00000004222	ENST00000296218.7:c.330delG	1.37:g.38024964delG	ENSP00000296218:p.Gln110fs		A8K387|B4DHN6|Q05BL9|Q5HYE2|Q5TGH0|Q7L0I5	Frame_Shift_Del	DEL	pfam_Axonemal_dynein_light_chain	p.V111fs	ENST00000296218.7	37	c.330	CCDS420.1	1																																																																																			DNALI1	-	pfam_Axonemal_dynein_light_chain	ENSG00000163879		0.592	DNALI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNALI1	HGNC	protein_coding	OTTHUMT00000012159.1	35	0.00	0	G	NM_003462		38024964	38024964	+1	no_errors	ENST00000296218	ensembl	human	known	69_37n	frame_shift_del	9	18.18	2	DEL	1.000	-
ELP5	23587	genome.wustl.edu	37	17	7158001	7158001	+	Missense_Mutation	SNP	G	G	C	rs145994083		TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr17:7158001G>C	ENST00000396628.2	+	4	553	c.336G>C	c.(334-336)aaG>aaC	p.K112N	ELP5_ENST00000356683.2_Missense_Mutation_p.K112N|CTDNEP1_ENST00000573600.1_5'Flank|ELP5_ENST00000354429.2_Missense_Mutation_p.K112N|ELP5_ENST00000574993.1_Missense_Mutation_p.K112N|ELP5_ENST00000573657.1_Missense_Mutation_p.K112N|ELP5_ENST00000396627.2_Missense_Mutation_p.K112N|CTDNEP1_ENST00000318988.6_5'Flank|ELP5_ENST00000574255.1_Missense_Mutation_p.K112N|CTDNEP1_ENST00000572043.1_5'Flank|RP1-4G17.5_ENST00000577138.1_Intron	NM_203414.1	NP_981959.1	Q8TE02	ELP5_HUMAN	elongator acetyltransferase complex subunit 5	112					chromatin organization (GO:0006325)|positive regulation of cell migration (GO:0030335)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Elongator holoenzyme complex (GO:0033588)|nucleus (GO:0005634)		p.K112N(2)									CCATGTGCAAGAGGACAGATC	0.562																																						dbGAP											2	Substitution - Missense(2)	breast(2)											133.0	96.0	108.0					17																	7158001		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC002762	CCDS11094.1, CCDS11095.1	17p13.1	2012-08-14	2012-08-08	2012-08-08	ENSG00000170291	ENSG00000170291		"""Elongator acetyltransferase complex subunits"""	30617	protein-coding gene	gene with protein product	"""dermal papilla derived protein 6"", ""S-phase 2 protein"""	615019	"""chromosome 17 open reading frame 81"""	C17orf81		22854966	Standard	NM_203415		Approved	DERP6	uc002gfi.1	Q8TE02	OTTHUMG00000177974	ENST00000396628.2:c.336G>C	17.37:g.7158001G>C	ENSP00000379869:p.Lys112Asn		A8K1M5|D3DTN9|Q659B6|Q7Z2T4|Q8TDR9|Q9BUB2|Q9Y2Q4	Missense_Mutation	SNP	pfam_Histone_acetylation_protein_2	p.K112N	ENST00000396628.2	37	c.336	CCDS11094.1	17	.	.	.	.	.	.	.	.	.	.	G	14.21	2.467338	0.43839	.	.	ENSG00000170291	ENST00000354429;ENST00000396628;ENST00000396627;ENST00000356683	T;T;T;T	0.53206	1.37;1.37;1.37;0.63	5.08	-4.73	0.03259	.	0.653399	0.15740	N	0.246945	T	0.31606	0.0802	L	0.43152	1.355	0.09310	N	1	B;B;P;B	0.35226	0.231;0.302;0.491;0.351	B;B;B;B	0.34652	0.056;0.058;0.171;0.187	T	0.20371	-1.0277	10	0.66056	D	0.02	1.1367	6.2611	0.20901	0.4485:0.224:0.3274:0.0	.	112;112;112;112	Q8TE02-2;Q8TE02-3;A8K1M5;Q8TE02	.;.;.;DERP6_HUMAN	N	112	ENSP00000346412:K112N;ENSP00000379869:K112N;ENSP00000379868:K112N;ENSP00000349111:K112N	ENSP00000346412:K112N	K	+	3	2	C17orf81	7098725	0.002000	0.14202	0.000000	0.03702	0.831000	0.47069	-0.139000	0.10358	-0.779000	0.04560	0.591000	0.81541	AAG	ELP5	-	pfam_Histone_acetylation_protein_2	ENSG00000170291		0.562	ELP5-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ELP5	HGNC	protein_coding	OTTHUMT00000440111.1	135	0.00	0	G	NM_015362		7158001	7158001	+1	no_errors	ENST00000354429	ensembl	human	known	69_37n	missense	30	26.83	11	SNP	0.000	C
EXOC3	11336	genome.wustl.edu	37	5	446329	446329	+	Silent	SNP	G	G	A			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr5:446329G>A	ENST00000512944.1	+	2	198	c.9G>A	c.(7-9)gaG>gaA	p.E3E	EXOC3_ENST00000510441.1_3'UTR|EXOC3_ENST00000315013.5_Silent_p.E3E	NM_007277.4	NP_009208.2	O60645	EXOC3_HUMAN	exocyst complex component 3	14					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|secretory granule membrane (GO:0030667)		p.E3E(1)		breast(2)|cervix(1)|endometrium(4)|large_intestine(1)|lung(13)|ovary(1)|urinary_tract(1)	23		Ovarian(839;0.0563)	Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			CCATGAAGGAGACAGACCGGG	0.552																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											82.0	84.0	83.0					5																	446329		2000	4179	6179	-	-	-	SO:0001819	synonymous_variant	0			BC034427	CCDS54830.1	5p15.33	2013-01-22	2005-11-01	2005-11-01	ENSG00000180104	ENSG00000180104			30378	protein-coding gene	gene with protein product		608186	"""SEC6-like 1 (S. cerevisiae)"""	SEC6L1		8619474	Standard	XM_005248238		Approved	Sec6p	uc003jba.3	O60645	OTTHUMG00000162205	ENST00000512944.1:c.9G>A	5.37:g.446329G>A			Q6P2E8|Q8TEN6|Q8WUW0|Q96DI4	Silent	SNP	pfam_Sec6	p.E3	ENST00000512944.1	37	c.9	CCDS54830.1	5																																																																																			EXOC3	-	NULL	ENSG00000180104		0.552	EXOC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC3	HGNC	protein_coding	OTTHUMT00000367882.1	104	0.00	0	G	NM_007277		446329	446329	+1	no_errors	ENST00000315013	ensembl	human	known	69_37n	silent	34	20.93	9	SNP	1.000	A
FAR1	84188	genome.wustl.edu	37	11	13721953	13721953	+	Silent	SNP	C	C	T			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr11:13721953C>T	ENST00000354817.3	+	3	423	c.279C>T	c.(277-279)ctC>ctT	p.L93L		NM_032228.5	NP_115604.1	Q8WVX9	FACR1_HUMAN	fatty acyl CoA reductase 1	93					cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|glycerophospholipid biosynthetic process (GO:0046474)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|small molecule metabolic process (GO:0044281)|wax biosynthetic process (GO:0010025)	integral component of membrane (GO:0016021)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	fatty-acyl-CoA reductase (alcohol-forming) activity (GO:0080019)|long-chain-fatty-acyl-CoA reductase activity (GO:0050062)	p.L93L(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	13						AACTGGCTCTCAGTGAAGAAG	0.348																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											70.0	76.0	74.0					11																	13721953		2200	4292	6492	-	-	-	SO:0001819	synonymous_variant	0			AK026381	CCDS7813.1	11p15.2	2011-09-14	2008-06-06	2008-06-06	ENSG00000197601	ENSG00000197601	1.2.1.-	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	26222	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 10E, member 1"""		"""male sterility domain containing 2"""	MLSTD2		15220348, 15220349, 19027726	Standard	NM_032228		Approved	FLJ22728, SDR10E1	uc001mld.3	Q8WVX9	OTTHUMG00000165743	ENST00000354817.3:c.279C>T	11.37:g.13721953C>T			D3DQW8|Q5CZA3	Silent	SNP	pfam_Male_sterile_NAD-bd,pfam_Malesterile,pfam_Epimerase_deHydtase	p.L93	ENST00000354817.3	37	c.279	CCDS7813.1	11																																																																																			FAR1	-	pfam_Male_sterile_NAD-bd,pfam_Epimerase_deHydtase	ENSG00000197601		0.348	FAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAR1	HGNC	protein_coding	OTTHUMT00000385990.2	144	0.69	1	C	NM_032228		13721953	13721953	+1	no_errors	ENST00000354817	ensembl	human	known	69_37n	silent	89	15.24	16	SNP	0.730	T
FRMPD2	143162	genome.wustl.edu	37	10	49379163	49379163	+	Silent	SNP	G	G	C			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr10:49379163G>C	ENST00000374201.3	-	26	3614	c.3312C>G	c.(3310-3312)ctC>ctG	p.L1104L	FRMPD2_ENST00000305531.3_Silent_p.L1079L|FRMPD2_ENST00000407470.4_Silent_p.L1072L|FRMPD2_ENST00000463706.1_5'UTR|FRMPD2_ENST00000474573.1_Silent_p.L56L	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	1104	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)	p.L1104L(1)		NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		GATCACTTTTGAGATGGCTGC	0.483																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											2.0	2.0	2.0					10																	49379163		670	1055	1725	-	-	-	SO:0001819	synonymous_variant	0			AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.3312C>G	10.37:g.49379163G>C			B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Silent	SNP	pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_PDZ,superfamily_FERM_central,superfamily_Kinase-like_dom,smart_KIND,smart_Band_41_domain,smart_PDZ,pfscan_FERM_domain,pfscan_PDZ,prints_Band_41_fam	p.L1104	ENST00000374201.3	37	c.3312	CCDS31195.1	10																																																																																			FRMPD2	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000170324		0.483	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMPD2	HGNC	protein_coding	OTTHUMT00000047923.3	97	0.00	0	G	NM_152428		49379163	49379163	-1	no_errors	ENST00000374201	ensembl	human	known	69_37n	silent	78	16.13	15	SNP	0.000	C
GMDS	2762	genome.wustl.edu	37	6	2124947	2124947	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr6:2124947C>G	ENST00000380815.4	-	2	390	c.121G>C	c.(121-123)Gag>Cag	p.E41Q	GMDS_ENST00000530927.1_Missense_Mutation_p.E11Q	NM_001500.3	NP_001491.1	O60547	GMDS_HUMAN	GDP-mannose 4,6-dehydratase	41					'de novo' GDP-L-fucose biosynthetic process (GO:0042351)|GDP-mannose metabolic process (GO:0019673)|Notch signaling pathway (GO:0007219)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	GDP-mannose 4,6-dehydratase activity (GO:0008446)|NADP+ binding (GO:0070401)	p.E41Q(1)	GMDS/PDE8B(2)	breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(2)|lung(8)|prostate(1)	21	Ovarian(93;0.0733)	all_cancers(2;7.64e-19)|all_epithelial(2;3.05e-16)|Colorectal(2;0.00414)|all_hematologic(90;0.00997)|all_lung(73;0.0141)|Lung NSC(90;0.0802)		Epithelial(2;7.61e-06)|all cancers(2;0.000111)|STAD - Stomach adenocarcinoma(2;0.000231)|Colorectal(2;0.00445)|COAD - Colon adenocarcinoma(2;0.0125)|OV - Ovarian serous cystadenocarcinoma(45;0.0563)		AGCAGGAACTCAGCCAGGTAG	0.517																																						dbGAP											1	Substitution - Missense(1)	breast(1)											61.0	56.0	58.0					6																	2124947		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF042377	CCDS4474.1, CCDS58994.1	6p25	2011-09-14			ENSG00000112699	ENSG00000112699	4.2.1.47	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	4369	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 3E, member 1"""	602884				9525924, 19027726	Standard	NM_001500		Approved	GMD, SDR3E1	uc003mtq.3	O60547	OTTHUMG00000016143	ENST00000380815.4:c.121G>C	6.37:g.2124947C>G	ENSP00000370194:p.Glu41Gln		E9PI88|O75357|Q5T954|Q6FH09|Q9UGZ3|Q9UJK9	Missense_Mutation	SNP	pfam_Epimerase_deHydtase,pfam_dTDP_dehydrorham_reduct,tigrfam_GDP_Man_deHydtase	p.E41Q	ENST00000380815.4	37	c.121	CCDS4474.1	6	.	.	.	.	.	.	.	.	.	.	C	24.0	4.478958	0.84747	.	.	ENSG00000112699	ENST00000530927;ENST00000380815	D;D	0.93906	-3.31;-3.31	5.16	5.16	0.70880	NAD-dependent epimerase/dehydratase (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.96944	0.9002	M	0.86573	2.825	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	D	0.97564	1.0100	10	0.87932	D	0	-25.4346	18.6756	0.91528	0.0:1.0:0.0:0.0	.	41	O60547	GMDS_HUMAN	Q	11;41	ENSP00000436726:E11Q;ENSP00000370194:E41Q	ENSP00000370194:E41Q	E	-	1	0	GMDS	2069946	1.000000	0.71417	0.997000	0.53966	0.930000	0.56654	7.393000	0.79851	2.404000	0.81709	0.655000	0.94253	GAG	GMDS	-	pfam_Epimerase_deHydtase,pfam_dTDP_dehydrorham_reduct,tigrfam_GDP_Man_deHydtase	ENSG00000112699		0.517	GMDS-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	GMDS	HGNC	protein_coding	OTTHUMT00000043380.3	163	0.00	0	C			2124947	2124947	-1	no_errors	ENST00000380815	ensembl	human	known	69_37n	missense	66	14.29	11	SNP	1.000	G
GRIA1	2890	genome.wustl.edu	37	5	153065794	153065794	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr5:153065794G>C	ENST00000285900.5	+	8	1382	c.1039G>C	c.(1039-1041)Gaa>Caa	p.E347Q	GRIA1_ENST00000521843.2_Missense_Mutation_p.E278Q|GRIA1_ENST00000518783.1_Missense_Mutation_p.E357Q|GRIA1_ENST00000448073.4_Missense_Mutation_p.E357Q|GRIA1_ENST00000518142.1_Missense_Mutation_p.E267Q|GRIA1_ENST00000340592.5_Missense_Mutation_p.E347Q	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	347					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)	p.E347Q(2)		NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	GGTGCGATTTGAAGGTTTAAC	0.438																																						dbGAP											2	Substitution - Missense(2)	breast(2)											144.0	129.0	134.0					5																	153065794		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.1039G>C	5.37:g.153065794G>C	ENSP00000285900:p.Glu347Gln		B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.E357Q	ENST00000285900.5	37	c.1069	CCDS4322.1	5	.	.	.	.	.	.	.	.	.	.	G	16.33	3.093864	0.56075	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000518142;ENST00000537037;ENST00000340592;ENST00000521843;ENST00000544794;ENST00000518783;ENST00000448073	T;T;T;T;T;T;T	0.22743	1.94;1.94;1.94;1.94;1.94;1.94;1.94	5.23	5.23	0.72850	Extracellular ligand-binding receptor (1);	0.050948	0.85682	D	0.000000	T	0.21103	0.0508	L	0.39245	1.2	0.80722	D	1	P;P;B;P;P;B	0.48998	0.918;0.918;0.011;0.918;0.899;0.045	B;B;B;B;B;B	0.43916	0.436;0.436;0.02;0.436;0.309;0.033	T	0.02852	-1.1102	10	0.12103	T	0.63	.	17.7586	0.88457	0.0:0.0:1.0:0.0	.	357;357;267;357;347;347	E7ESV8;B7Z9G9;B7Z3F6;B7Z2W8;P42261-2;P42261	.;.;.;.;.;GRIA1_HUMAN	Q	347;347;267;301;347;278;278;357;357	ENSP00000285900:E347Q;ENSP00000427920:E267Q;ENSP00000339343:E347Q;ENSP00000427864:E278Q;ENSP00000442108:E278Q;ENSP00000428994:E357Q;ENSP00000415569:E357Q	ENSP00000285900:E347Q	E	+	1	0	GRIA1	153045987	1.000000	0.71417	0.998000	0.56505	0.970000	0.65996	7.200000	0.77838	2.432000	0.82394	0.655000	0.94253	GAA	GRIA1	-	pfam_ANF_lig-bd_rcpt	ENSG00000155511		0.438	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA1	HGNC	protein_coding	OTTHUMT00000252456.3	131	0.00	0	G			153065794	153065794	+1	no_errors	ENST00000448073	ensembl	human	known	69_37n	missense	90	15.89	17	SNP	1.000	C
HIPK1	204851	genome.wustl.edu	37	1	114483438	114483438	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr1:114483438C>G	ENST00000369558.1	+	2	665	c.433C>G	c.(433-435)Ctc>Gtc	p.L145V	HIPK1_ENST00000369555.2_Missense_Mutation_p.L145V|HIPK1_ENST00000369554.2_Missense_Mutation_p.L145V|HIPK1_ENST00000369561.4_Missense_Mutation_p.L145V|HIPK1_ENST00000369559.4_Missense_Mutation_p.L145V|HIPK1_ENST00000426820.2_Missense_Mutation_p.L145V			Q86Z02	HIPK1_HUMAN	homeodomain interacting protein kinase 1	145					anterior/posterior pattern specification (GO:0009952)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|neuron differentiation (GO:0030182)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|retina layer formation (GO:0010842)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.L145V(2)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|prostate(2)	39	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACATCCCCCTCTCATGCTGCA	0.488																																						dbGAP											2	Substitution - Missense(2)	breast(2)											65.0	60.0	62.0					1																	114483438		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB089957	CCDS867.1, CCDS868.1, CCDS869.1, CCDS41370.1	1p13.1	2008-02-05			ENSG00000163349	ENSG00000163349			19006	protein-coding gene	gene with protein product		608003					Standard	NM_198268		Approved	KIAA0630, Myak, MGC26642, Nbak2, MGC33446, MGC33548	uc001eem.3	Q86Z02	OTTHUMG00000011983	ENST00000369558.1:c.433C>G	1.37:g.114483438C>G	ENSP00000358571:p.Leu145Val		A6NJ34|O75125|Q5SQL2|Q5SQL4|Q5SQL5|Q8IYD7|Q8NDN5|Q8NEB6|Q8TBZ1	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L145V	ENST00000369558.1	37	c.433	CCDS867.1	1	.	.	.	.	.	.	.	.	.	.	C	10.33	1.320075	0.23994	.	.	ENSG00000163349	ENST00000426820;ENST00000369559;ENST00000443627;ENST00000369554;ENST00000369555;ENST00000369558;ENST00000369561	T;T;T;T;T;T;T	0.49139	0.79;0.81;0.83;0.81;0.81;0.83;0.82	5.44	5.44	0.79542	.	0.000000	0.56097	D	0.000034	T	0.37461	0.1004	N	0.08118	0	0.80722	D	1	P;D	0.56035	0.635;0.974	B;D	0.70487	0.162;0.969	T	0.34079	-0.9843	10	0.17369	T	0.5	.	19.2883	0.94087	0.0:1.0:0.0:0.0	.	145;145	Q86Z02;Q86Z02-2	HIPK1_HUMAN;.	V	216;145;145;145;145;145;145	ENSP00000407442:L216V;ENSP00000358572:L145V;ENSP00000409673:L145V;ENSP00000358567:L145V;ENSP00000358568:L145V;ENSP00000358571:L145V;ENSP00000358574:L145V	ENSP00000358567:L145V	L	+	1	0	HIPK1	114284961	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.978000	0.70501	2.546000	0.85860	0.650000	0.86243	CTC	HIPK1	-	NULL	ENSG00000163349		0.488	HIPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	HIPK1	HGNC	protein_coding	OTTHUMT00000033127.1	28	0.00	0	C	NM_198268		114483438	114483438	+1	no_errors	ENST00000369558	ensembl	human	known	69_37n	missense	14	33.33	7	SNP	1.000	G
IFIH1	64135	genome.wustl.edu	37	2	163128799	163128799	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr2:163128799C>G	ENST00000263642.2	-	13	2948	c.2553G>C	c.(2551-2553)gaG>gaC	p.E851D		NM_022168.3	NP_071451.2	Q9BYX4	IFIH1_HUMAN	interferon induced with helicase C domain 1	851	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|protein sumoylation (GO:0016925)|regulation of apoptotic process (GO:0042981)|regulation of type III interferon production (GO:0034344)|response to virus (GO:0009615)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|ribonucleoprotein complex binding (GO:0043021)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)	p.E851D(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	39						ACATCATCTTCTCTCGGAAAT	0.418																																						dbGAP											1	Substitution - Missense(1)	breast(1)											111.0	96.0	101.0					2																	163128799		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF095844	CCDS2217.1	2q24.2	2010-02-09			ENSG00000115267	ENSG00000115267			18873	protein-coding gene	gene with protein product	"""helicard"""	606951					Standard	NM_022168		Approved	MDA-5, Hlcd, MDA5, IDDM19	uc002uce.4	Q9BYX4	OTTHUMG00000132055	ENST00000263642.2:c.2553G>C	2.37:g.163128799C>G	ENSP00000263642:p.Glu851Asp		Q2NKL6|Q6DC96|Q86X56|Q96MX8|Q9H3G6	Missense_Mutation	SNP	pfam_RIG-I_C-RD,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_CARD,superfamily_DEATH-like,superfamily_ARM-type_fold,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E851D	ENST00000263642.2	37	c.2553	CCDS2217.1	2	.	.	.	.	.	.	.	.	.	.	C	20.5	3.999766	0.74818	.	.	ENSG00000115267	ENST00000263642;ENST00000543192	T	0.08720	3.06	5.76	5.76	0.90799	Helicase, C-terminal (1);	0.154588	0.64402	D	0.000014	T	0.25494	0.0620	M	0.81179	2.53	0.41014	D	0.985024	D	0.63046	0.992	P	0.59825	0.864	T	0.00540	-1.1681	10	0.62326	D	0.03	-10.7603	11.3572	0.49623	0.0:0.8601:0.0:0.1399	.	851	Q9BYX4	IFIH1_HUMAN	D	851	ENSP00000263642:E851D	ENSP00000263642:E851D	E	-	3	2	IFIH1	162837045	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.997000	0.40786	2.716000	0.92895	0.650000	0.86243	GAG	IFIH1	-	pfscan_Helicase_C	ENSG00000115267		0.418	IFIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFIH1	HGNC	protein_coding	OTTHUMT00000255078.2	247	0.00	0	C	NM_022168		163128799	163128799	-1	no_errors	ENST00000263642	ensembl	human	known	69_37n	missense	163	15.98	31	SNP	1.000	G
IKBKE	9641	genome.wustl.edu	37	1	206658614	206658614	+	Silent	SNP	G	G	A			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr1:206658614G>A	ENST00000367120.3	+	15	1960	c.1587G>A	c.(1585-1587)aaG>aaA	p.K529K	IKBKE_ENST00000537984.1_Silent_p.K444K	NM_001193322.1|NM_014002.3	NP_001180251.1|NP_054721.1	Q14164	IKKE_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon	529	Interaction with DDX3X.				immune response (GO:0006955)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of type I interferon production (GO:0032480)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein phosphorylation (GO:0006468)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|NF-kappaB-inducing kinase activity (GO:0004704)	p.K529K(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|ovary(3)|skin(2)	32	Breast(84;0.137)					AGCTGGTGAAGAGCCGGGATC	0.577																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											59.0	52.0	54.0					1																	206658614		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB016590	CCDS30996.1, CCDS53464.1, CCDS73019.1	1q31	2014-05-06			ENSG00000143466				14552	protein-coding gene	gene with protein product		605048				10421793, 10882136	Standard	NM_001193321		Approved	IKKE, IKK-i, KIAA0151	uc001hdz.2	Q14164	OTTHUMG00000184613	ENST00000367120.3:c.1587G>A	1.37:g.206658614G>A			D3DT78|Q3B754|Q3KR43|Q5JTS6	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.K529	ENST00000367120.3	37	c.1587	CCDS30996.1	1																																																																																			IKBKE	-	NULL	ENSG00000143466		0.577	IKBKE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IKBKE	HGNC	protein_coding	OTTHUMT00000088484.1	92	0.00	0	G			206658614	206658614	+1	no_errors	ENST00000367120	ensembl	human	known	69_37n	silent	24	20.00	6	SNP	0.997	A
INTS8	55656	genome.wustl.edu	37	8	95884207	95884207	+	Missense_Mutation	SNP	T	T	C			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr8:95884207T>C	ENST00000523731.1	+	21	2643	c.2510T>C	c.(2509-2511)aTt>aCt	p.I837T	INTS8_ENST00000447247.1_Missense_Mutation_p.I837T	NM_017864.2	NP_060334.2	Q75QN2	INT8_HUMAN	integrator complex subunit 8	837					snRNA processing (GO:0016180)	integrator complex (GO:0032039)		p.I837T(1)		breast(3)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	28	Breast(36;1.05e-06)					TCTTGGTTAATTATCCAGGCA	0.333																																						dbGAP											1	Substitution - Missense(1)	breast(1)											106.0	99.0	101.0					8																	95884207		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091278	CCDS34925.1	8q22.1	2007-05-03	2006-03-15	2006-03-15	ENSG00000164941	ENSG00000164941			26048	protein-coding gene	gene with protein product		611351	"""chromosome 8 open reading frame 52"""	C8orf52		16239144	Standard	NM_017864		Approved	FLJ20530, INT8, MGC131633	uc003yhb.4	Q75QN2	OTTHUMG00000164695	ENST00000523731.1:c.2510T>C	8.37:g.95884207T>C	ENSP00000430338:p.Ile837Thr		B2RN92|Q5RKZ3|Q6P1R5|Q7Z314|Q9NVS6|Q9NWY7	Missense_Mutation	SNP	NULL	p.I837T	ENST00000523731.1	37	c.2510	CCDS34925.1	8	.	.	.	.	.	.	.	.	.	.	T	11.62	1.692273	0.30052	.	.	ENSG00000164941	ENST00000523731;ENST00000447247	T;T	0.63096	-0.02;-0.02	5.57	5.57	0.84162	Tetratricopeptide-like helical (1);	0.240409	0.48767	D	0.000166	T	0.40473	0.1118	N	0.11560	0.145	0.42273	D	0.99206	B	0.09022	0.002	B	0.08055	0.003	T	0.32534	-0.9903	10	0.23891	T	0.37	-28.0076	10.3961	0.44201	0.0:0.0731:0.0:0.9269	.	837	Q75QN2	INT8_HUMAN	T	837	ENSP00000430338:I837T;ENSP00000398203:I837T	ENSP00000398203:I837T	I	+	2	0	INTS8	95953383	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	4.726000	0.61986	2.247000	0.74100	0.482000	0.46254	ATT	INTS8	-	NULL	ENSG00000164941		0.333	INTS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS8	HGNC	protein_coding	OTTHUMT00000379794.1	199	0.00	0	T	NM_017864		95884207	95884207	+1	no_errors	ENST00000523731	ensembl	human	known	69_37n	missense	212	16.54	42	SNP	1.000	C
JAGN1	84522	genome.wustl.edu	37	3	9934708	9934708	+	Nonsense_Mutation	SNP	C	C	T			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr3:9934708C>T	ENST00000307768.4	+	2	368	c.199C>T	c.(199-201)Cag>Tag	p.Q67*		NM_032492.3	NP_115881.3			jagunal homolog 1 (Drosophila)									p.Q67*(1)		breast(1)|central_nervous_system(1)|endometrium(4)|lung(3)|ovary(1)	10	Medulloblastoma(99;0.227)					GTCACATGATCAGGTGGCCAT	0.498																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											199.0	157.0	171.0					3																	9934708		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK074760	CCDS2588.1	3p25.2	2010-03-23			ENSG00000171135	ENSG00000171135			26926	protein-coding gene	gene with protein product						12477932	Standard	NM_032492		Approved	GL009, FLJ14602	uc003btt.4	Q8N5M9	OTTHUMG00000128523	ENST00000307768.4:c.199C>T	3.37:g.9934708C>T	ENSP00000306106:p.Gln67*			Nonsense_Mutation	SNP	pfam_DUF1352	p.Q67*	ENST00000307768.4	37	c.199	CCDS2588.1	3	.	.	.	.	.	.	.	.	.	.	C	26.4	4.738629	0.89573	.	.	ENSG00000171135	ENST00000307768;ENST00000543379	.	.	.	5.4	5.4	0.78164	.	0.139693	0.47852	D	0.000207	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05351	T	0.99	-15.9149	12.198	0.54309	0.0:0.9207:0.0:0.0793	.	.	.	.	X	67	.	ENSP00000306106:Q67X	Q	+	1	0	JAGN1	9909708	0.996000	0.38824	1.000000	0.80357	0.977000	0.68977	2.652000	0.46682	2.528000	0.85240	0.491000	0.48974	CAG	JAGN1	-	pfam_DUF1352	ENSG00000171135		0.498	JAGN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAGN1	HGNC	protein_coding	OTTHUMT00000250335.1	246	0.00	0	C	NM_032492		9934708	9934708	+1	no_errors	ENST00000307768	ensembl	human	known	69_37n	nonsense	96	23.81	30	SNP	0.986	T
KCNQ2	3785	genome.wustl.edu	37	20	62078142	62078142	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr20:62078142G>C	ENST00000359125.2	-	2	519	c.345C>G	c.(343-345)atC>atG	p.I115M	KCNQ2_ENST00000344425.5_Missense_Mutation_p.I115M|KCNQ2_ENST00000370224.1_Missense_Mutation_p.I115M|KCNQ2_ENST00000357249.2_Missense_Mutation_p.I115M|KCNQ2_ENST00000344462.4_Missense_Mutation_p.I115M|RP11-358D14.2_ENST00000436263.1_RNA|KCNQ2_ENST00000360480.3_Missense_Mutation_p.I115M|KCNQ2_ENST00000359689.1_Missense_Mutation_p.I115M|KCNQ2_ENST00000354587.3_Missense_Mutation_p.I115M	NM_172107.2	NP_742105.1	O43526	KCNQ2_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 2	115					axon guidance (GO:0007411)|nervous system development (GO:0007399)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)	p.I115M(2)		biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|liver(1)|lung(30)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	CATACTCCTTGATGGTGGAAA	0.642																																						dbGAP											2	Substitution - Missense(2)	breast(2)											75.0	74.0	74.0					20																	62078142		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF033348	CCDS13518.1, CCDS13519.1, CCDS13520.1, CCDS13521.1, CCDS46629.1	20q13.33	2012-07-05			ENSG00000075043	ENSG00000075043		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6296	protein-coding gene	gene with protein product		602235		EBN, EBN1		9425895, 16382104	Standard	NM_172107		Approved	Kv7.2, ENB1, BFNC, KCNA11, HNSPC	uc002yex.3	O43526	OTTHUMG00000033049	ENST00000359125.2:c.345C>G	20.37:g.62078142G>C	ENSP00000352035:p.Ile115Met		O43796|O75580|O95845|Q4VXP4|Q4VXR6|Q5VYT8|Q96J59|Q99454	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ankyrin-G_BS,pfam_Ion_trans_dom,pfam_Ion_trans_2,prints_K_chnl_volt-dep_KCNQ2,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.I115M	ENST00000359125.2	37	c.345	CCDS13520.1	20	.	.	.	.	.	.	.	.	.	.	G	15.65	2.896438	0.52121	.	.	ENSG00000075043	ENST00000357249;ENST00000359125;ENST00000370226;ENST00000354587;ENST00000359689;ENST00000430658;ENST00000360480;ENST00000344462;ENST00000370224;ENST00000370222;ENST00000370221;ENST00000344425	D;D;D;D;D;D;D;D;D;D;D;D	0.87966	-2.32;-2.32;-2.32;-2.32;-2.32;-2.32;-2.32;-2.32;-2.32;-2.32;-2.32;-2.32	3.88	3.88	0.44766	.	0.080725	0.49305	D	0.000152	D	0.90748	0.7096	M	0.66939	2.045	0.40895	D	0.984103	D;P;D;D;D;D	0.89917	0.995;0.63;1.0;1.0;1.0;1.0	D;P;D;D;D;D	0.91635	0.947;0.459;0.998;0.999;0.998;0.997	D	0.90294	0.4325	10	0.54805	T	0.06	-0.5478	7.2967	0.26397	0.2675:0.0:0.7325:0.0	.	115;115;115;115;115;115	B4DEP4;Q53Y30;O43526-3;O43526-2;O43526-4;O43526	.;.;.;.;.;KCNQ2_HUMAN	M	115	ENSP00000349789:I115M;ENSP00000352035:I115M;ENSP00000359246:I115M;ENSP00000346601:I115M;ENSP00000352718:I115M;ENSP00000399612:I115M;ENSP00000353668:I115M;ENSP00000339611:I115M;ENSP00000359244:I115M;ENSP00000359242:I115M;ENSP00000359241:I115M;ENSP00000345523:I115M	ENSP00000345523:I115M	I	-	3	3	KCNQ2	61548586	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	1.578000	0.36525	1.724000	0.51502	0.306000	0.20318	ATC	KCNQ2	-	prints_K_chnl_volt-dep_KCNQ2	ENSG00000075043		0.642	KCNQ2-003	KNOWN	basic|CCDS	protein_coding	KCNQ2	HGNC	protein_coding	OTTHUMT00000080353.1	61	0.00	0	G	NM_172109		62078142	62078142	-1	no_errors	ENST00000354587	ensembl	human	known	69_37n	missense	18	21.74	5	SNP	1.000	C
MAP2K4	6416	genome.wustl.edu	37	17	12043202	12043202	+	Splice_Site	SNP	G	G	A			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr17:12043202G>A	ENST00000353533.5	+	10	1149		c.e10+1		MAP2K4_ENST00000415385.3_Splice_Site	NM_003010.2	NP_003001.1	P45985	MP2K4_HUMAN	mitogen-activated protein kinase kinase 4						apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to sorbitol (GO:0072709)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of DNA replication (GO:0045740)|positive regulation of neuron apoptotic process (GO:0043525)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|nucleus (GO:0005634)|perikaryon (GO:0043204)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.0?(10)|p.?(3)		NS(1)|biliary_tract(2)|breast(22)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(26)|lung(15)|ovary(8)|pancreas(11)|skin(3)|stomach(2)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	100		all_cancers(5;0.0413)|Breast(5;0.000625)|all_epithelial(5;0.00978)|all_lung(20;0.0449)|Lung NSC(33;0.163)		Epithelial(2;4.12e-09)|all cancers(2;6.86e-07)|BRCA - Breast invasive adenocarcinoma(2;8.74e-07)|Colorectal(4;5.32e-05)|COAD - Colon adenocarcinoma(4;0.0039)|READ - Rectum adenocarcinoma(10;0.0681)		AGAGCTTCTGGTGAGTGTGGG	0.393			"""D, Mis, N"""		"""pancreatic, breast, colorectal"""																																	dbGAP		Rec	yes		17	17p11.2	6416	mitogen-activated protein kinase kinase 4		E	13	Whole gene deletion(10)|Unknown(3)	breast(5)|ovary(4)|pancreas(2)|biliary_tract(1)|lung(1)											157.0	165.0	162.0					17																	12043202		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			L36870	CCDS11162.1, CCDS62095.1	17p12	2012-03-23			ENSG00000065559	ENSG00000065559	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6844	protein-coding gene	gene with protein product		601335		SERK1		7716521	Standard	NM_003010		Approved	MEK4, JNKK1, PRKMK4, MKK4	uc002gnj.3	P45985		ENST00000353533.5:c.1086+1G>A	17.37:g.12043202G>A			B2R7N7|B3KYB2|D3DTS5|Q5U0B8|Q6FHX4|Q6P9H2|Q6PIE6	Splice_Site	SNP	-	e11+1	ENST00000353533.5	37	c.1119+1	CCDS11162.1	17	.	.	.	.	.	.	.	.	.	.	G	24.4	4.528163	0.85706	.	.	ENSG00000065559	ENST00000353533;ENST00000415385;ENST00000538465;ENST00000536413	.	.	.	5.33	5.33	0.75918	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.9523	0.89057	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MAP2K4	11983927	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	9.263000	0.95617	2.778000	0.95560	0.655000	0.94253	.	MAP2K4	-	-	ENSG00000065559		0.393	MAP2K4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP2K4	HGNC	protein_coding	OTTHUMT00000441226.1	209	0.00	0	G		Intron	12043202	12043202	+1	no_errors	ENST00000415385	ensembl	human	known	69_37n	splice_site	119	21.71	33	SNP	1.000	A
NCKAP5	344148	genome.wustl.edu	37	2	133541462	133541462	+	Silent	SNP	C	C	T			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr2:133541462C>T	ENST00000409261.1	-	14	3295	c.2922G>A	c.(2920-2922)ctG>ctA	p.L974L	NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000317721.6_Silent_p.L974L|NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000473859.1_5'Flank	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	974										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						AAATTCCTTTCAGCAGCGGGG	0.507																																						dbGAP											0													27.0	29.0	28.0					2																	133541462		1881	4095	5976	-	-	-	SO:0001819	synonymous_variant	0			AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.2922G>A	2.37:g.133541462C>T			B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Silent	SNP	NULL	p.L974	ENST00000409261.1	37	c.2922	CCDS46418.1	2																																																																																			NCKAP5	-	NULL	ENSG00000176771		0.507	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCKAP5	HGNC	protein_coding	OTTHUMT00000331663.1	16	0.00	0	C	NM_207481		133541462	133541462	-1	no_errors	ENST00000317721	ensembl	human	known	69_37n	silent	18	18.18	4	SNP	1.000	T
NDNL2	56160	genome.wustl.edu	37	15	29561355	29561355	+	Silent	SNP	G	G	A			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr15:29561355G>A	ENST00000332303.4	-	1	678	c.555C>T	c.(553-555)ctC>ctT	p.L185L	FAM189A1_ENST00000261275.4_Intron	NM_138704.3	NP_619649.1	Q96MG7	MAGG1_HUMAN	necdin-like 2	185	Interaction with NSMCE1.|MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				DNA recombination (GO:0006310)|DNA repair (GO:0006281)|positive regulation of protein ubiquitination (GO:0031398)|regulation of growth (GO:0040008)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Smc5-Smc6 complex (GO:0030915)		p.L185L(1)		breast(3)|large_intestine(2)|lung(3)	8		all_lung(180;4.69e-11)|Breast(32;0.0013)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00736)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		TCATAAAGATGAGCCCTAAGA	0.542																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											53.0	53.0	53.0					15																	29561355		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF490510	CCDS10023.1	15q13.1	2008-02-01			ENSG00000185115	ENSG00000185115			7677	protein-coding gene	gene with protein product		608243				18086888	Standard	NM_138704		Approved	HCA4, MAGEG1, MAGEL3, NSE3, NSMCE3	uc001zco.3	Q96MG7	OTTHUMG00000129261	ENST00000332303.4:c.555C>T	15.37:g.29561355G>A			Q8IW16|Q8TEI6|Q9H214	Silent	SNP	pfam_MAGE,pfscan_MAGE	p.L185	ENST00000332303.4	37	c.555	CCDS10023.1	15																																																																																			NDNL2	-	pfam_MAGE,pfscan_MAGE	ENSG00000185115		0.542	NDNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDNL2	HGNC	protein_coding	OTTHUMT00000251370.1	100	0.00	0	G	NM_138704		29561355	29561355	-1	no_errors	ENST00000332303	ensembl	human	known	69_37n	silent	37	21.28	10	SNP	0.960	A
NEB	4703	genome.wustl.edu	37	2	152406191	152406191	+	Missense_Mutation	SNP	G	G	C	rs369562967		TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr2:152406191G>C	ENST00000172853.10	-	102	15052	c.14905C>G	c.(14905-14907)Cac>Gac	p.H4969D	NEB_ENST00000409198.1_Missense_Mutation_p.H4969D|NEB_ENST00000427231.2_Missense_Mutation_p.H6670D|NEB_ENST00000603639.1_Missense_Mutation_p.H6670D|NEB_ENST00000397345.3_Missense_Mutation_p.H6670D|NEB_ENST00000604864.1_Missense_Mutation_p.H6670D			P20929	NEBU_HUMAN	nebulin	4969					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.H6670D(1)|p.H4969D(1)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TGTTTGAAGTGAGGAGTGTCA	0.498																																						dbGAP											2	Substitution - Missense(2)	breast(2)											136.0	133.0	134.0					2																	152406191		1976	4173	6149	-	-	-	SO:0001583	missense	0			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.14905C>G	2.37:g.152406191G>C	ENSP00000172853:p.His4969Asp		F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom_bac,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,prints_Nebulin,pfscan_Nebulin_35r-motif,pfscan_SH3_domain	p.H6670D	ENST00000172853.10	37	c.20008		2	.	.	.	.	.	.	.	.	.	.	G	11.66	1.705362	0.30232	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000397342;ENST00000413693;ENST00000172853	T;T;T;T;T	0.38722	1.12;1.12;1.12;1.12;1.12	6.16	3.08	0.35506	.	0.594214	0.19564	N	0.111267	T	0.38957	0.1060	L	0.44542	1.39	0.38839	D	0.956011	B;P	0.40066	0.04;0.701	B;P	0.45276	0.102;0.475	T	0.18429	-1.0337	10	0.32370	T	0.25	.	9.5442	0.39271	0.0:0.2111:0.4892:0.2996	.	4969;1400	P20929;Q14215	NEBU_HUMAN;.	D	4969;6670;6670;1018;1400;4969	ENSP00000386259:H4969D;ENSP00000380505:H6670D;ENSP00000416578:H6670D;ENSP00000410961:H1400D;ENSP00000172853:H4969D	ENSP00000172853:H4969D	H	-	1	0	NEB	152114437	0.423000	0.25482	0.988000	0.46212	0.991000	0.79684	0.620000	0.24403	0.899000	0.36444	0.650000	0.86243	CAC	NEB	-	pfam_Nebulin_35r-motif,smart_Nebulin_35r-motif,pfscan_Nebulin_35r-motif	ENSG00000183091		0.498	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding		405	0.00	0	G	NM_004543		152406191	152406191	-1	no_errors	ENST00000397345	ensembl	human	known	69_37n	missense	143	23.94	45	SNP	0.511	C
PDZD2	23037	genome.wustl.edu	37	5	32101067	32101070	+	Intron	DEL	TAAG	TAAG	-			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	TAAG	TAAG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr5:32101067_32101070delTAAG	ENST00000438447.1	+	24	8606				PDZD2_ENST00000513490.1_3'UTR|CTD-2152M20.2_ENST00000503441.1_RNA|PDZD2_ENST00000282493.3_Intron			O15018	PDZD2_HUMAN	PDZ domain containing 2						cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						AGTGCTGTTATAAGTAAGTAAGTG	0.534																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.8219-141TAAG>-	5.37:g.32101075_32101078delTAAG			Q9BXD4	Splice_Site	DEL	-	NULL	ENST00000438447.1	37	c.NULL	CCDS34137.1	5																																																																																			PDZD2	-	-	ENSG00000133401		0.534	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD2	HGNC	protein_coding	OTTHUMT00000366608.1	24	0.00	0	TAAG			32101067	32101070	+1	no_errors	ENST00000397559	ensembl	human	known	69_37n	splice_site_del	5	37.50	3	DEL	0.001:0.002:0.002:0.001	-
RRM2	6241	genome.wustl.edu	37	2	10269010	10269010	+	Silent	SNP	A	A	G			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr2:10269010A>G	ENST00000304567.5	+	8	903	c.834A>G	c.(832-834)aaA>aaG	p.K278K	RRM2_ENST00000360566.2_Silent_p.K338K	NM_001034.3	NP_001025.1	P31350	RIR2_HUMAN	ribonucleotide reductase M2	278					deoxyribonucleoside diphosphate metabolic process (GO:0009186)|deoxyribonucleotide biosynthetic process (GO:0009263)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein heterotetramerization (GO:0051290)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|ribonucleoside-diphosphate reductase activity, thioredoxin disulfide as acceptor (GO:0004748)	p.K278K(1)|p.K338K(1)		NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(7)|skin(1)	19	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.188)|OV - Ovarian serous cystadenocarcinoma(76;0.221)	Cladribine(DB00242)|Gallium nitrate(DB05260)	TGATGTTCAAACACCTGGTAC	0.383																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											101.0	96.0	98.0					2																	10269010		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS1669.1, CCDS54334.1	2p25-p24	2012-10-02	2009-07-10		ENSG00000171848	ENSG00000171848	1.17.4.1		10452	protein-coding gene	gene with protein product		180390	"""ribonucleotide reductase M2 polypeptide"""				Standard	NM_001034		Approved		uc021vdr.1	P31350	OTTHUMG00000090449	ENST00000304567.5:c.834A>G	2.37:g.10269010A>G			B2R9B5|J3KP43|Q5WRU7	Silent	SNP	pfam_Ribonucl_Rdtase_small,superfamily_Ferritin/RR-like	p.K338	ENST00000304567.5	37	c.1014	CCDS1669.1	2																																																																																			RRM2	-	pfam_Ribonucl_Rdtase_small,superfamily_Ferritin/RR-like	ENSG00000171848		0.383	RRM2-013	KNOWN	basic|appris_principal|CCDS	protein_coding	RRM2	HGNC	protein_coding	OTTHUMT00000364902.2	229	0.00	0	A			10269010	10269010	+1	no_errors	ENST00000360566	ensembl	human	known	69_37n	silent	229	21.58	63	SNP	0.998	G
RGPD3	653489	genome.wustl.edu	37	2	107042506	107042506	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr2:107042506G>A	ENST00000409886.3	-	19	2731	c.2644C>T	c.(2644-2646)Cca>Tca	p.P882S	RGPD3_ENST00000304514.7_Missense_Mutation_p.P882S	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	882					protein targeting to Golgi (GO:0000042)			p.P882S(2)		breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						TTATATGCTGGTGACTGACTA	0.308																																						dbGAP											2	Substitution - Missense(2)	breast(2)											15.0	18.0	17.0					2																	107042506		692	1571	2263	-	-	-	SO:0001583	missense	0				CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.2644C>T	2.37:g.107042506G>A	ENSP00000386588:p.Pro882Ser		B8ZZM4	Missense_Mutation	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.P882S	ENST00000409886.3	37	c.2644	CCDS46379.1	2	.	.	.	.	.	.	.	.	.	.	.	13.54	2.268704	0.40095	.	.	ENSG00000153165	ENST00000409886;ENST00000452099;ENST00000304514	T;T	0.27890	1.64;1.64	2.5	2.5	0.30297	.	.	.	.	.	T	0.50514	0.1620	M	0.66939	2.045	0.30064	N	0.810692	D	0.89917	1.0	D	0.79108	0.992	T	0.48234	-0.9053	9	0.62326	D	0.03	-14.9052	10.737	0.46130	0.0:0.0:1.0:0.0	.	882	A6NKT7	RGPD3_HUMAN	S	882;640;882	ENSP00000386588:P882S;ENSP00000303659:P882S	ENSP00000303659:P882S	P	-	1	0	RGPD3	106408938	1.000000	0.71417	1.000000	0.80357	0.804000	0.45430	8.712000	0.91403	1.390000	0.46547	0.186000	0.17326	CCA	RGPD3	-	NULL	ENSG00000153165		0.308	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD3	HGNC	protein_coding	OTTHUMT00000329975.1	300	0.00	0	G	XM_929931		107042506	107042506	-1	no_errors	ENST00000304514	ensembl	human	known	69_37n	missense	321	12.30	45	SNP	1.000	A
SALL2	6297	genome.wustl.edu	37	14	21992915	21992915	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr14:21992915G>A	ENST00000327430.3	-	2	1241	c.947C>T	c.(946-948)tCg>tTg	p.S316L	AE000658.22_ENST00000535893.1_RNA|SALL2_ENST00000538754.1_Intron|SALL2_ENST00000317492.5_Intron|SALL2_ENST00000450879.2_Missense_Mutation_p.S179L	NM_005407.1	NP_005398.1	Q9Y467	SALL2_HUMAN	spalt-like transcription factor 2	316					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S316L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(6)|urinary_tract(2)	43	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		CAGATGAGGCGAGGCAATCAG	0.632																																						dbGAP											1	Substitution - Missense(1)	breast(1)											35.0	39.0	38.0					14																	21992915		2201	4300	6501	-	-	-	SO:0001583	missense	0			AB002358	CCDS32045.1	14q11.1-q12.1	2013-10-17	2013-10-17		ENSG00000165821	ENSG00000165821		"""Zinc fingers, C2H2-type"""	10526	protein-coding gene	gene with protein product		602219	"""sal (Drosophila)-like 2"", ""sal-like 2 (Drosophila)"""			8975705	Standard	XM_005267983		Approved	KIAA0360, Hsal2, ZNF795	uc001wbe.3	Q9Y467	OTTHUMG00000168826	ENST00000327430.3:c.947C>T	14.37:g.21992915G>A	ENSP00000333537:p.Ser316Leu		B2RMX6|B9EGK8|Q8N656|Q9Y4G1	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S316L	ENST00000327430.3	37	c.947	CCDS32045.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.16|13.16	2.153626|2.153626	0.38021|0.38021	.|.	.|.	ENSG00000165821|ENSG00000165821	ENST00000546363|ENST00000327430;ENST00000450879;ENST00000541876	.|T;T	.|0.04502	.|3.71;3.61	4.3|4.3	4.3|4.3	0.51218|0.51218	.|.	.|0.000000	.|0.33180	.|N	.|0.005181	T|T	0.04543|0.04543	0.0124|0.0124	L|L	0.43152|0.43152	1.355|1.355	0.09310|0.09310	N|N	1|1	.|P;P;P;P	.|0.44627	.|0.672;0.672;0.839;0.839	.|B;B;B;B	.|0.29524	.|0.062;0.062;0.103;0.103	T|T	0.39187|0.39187	-0.9626|-0.9626	5|10	.|0.59425	.|D	.|0.04	-15.0327|-15.0327	14.3299|14.3299	0.66548|0.66548	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|179;179;314;316	.|B4DK65;E7EW59;B4DFD9;Q9Y467	.|.;.;.;SALL2_HUMAN	C|L	175|316;179;316	.|ENSP00000333537:S316L;ENSP00000396773:S179L	.|ENSP00000333537:S316L	R|S	-|-	1|2	0|0	SALL2|SALL2	21062755|21062755	1.000000|1.000000	0.71417|0.71417	0.180000|0.180000	0.23079|0.23079	0.920000|0.920000	0.55202|0.55202	4.565000|4.565000	0.60836|0.60836	2.223000|2.223000	0.72356|0.72356	0.655000|0.655000	0.94253|0.94253	CGC|TCG	SALL2	-	NULL	ENSG00000165821		0.632	SALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL2	HGNC	protein_coding	OTTHUMT00000401242.1	69	0.00	0	G	NM_005407		21992915	21992915	-1	no_errors	ENST00000327430	ensembl	human	known	69_37n	missense	23	30.30	10	SNP	0.047	A
SEPT1	1731	genome.wustl.edu	37	16	30393617	30393617	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr16:30393617C>G	ENST00000571393.1	-	3	259	c.73G>C	c.(73-75)Gac>Cac	p.D25H	SEPT1_ENST00000321367.3_Missense_Mutation_p.D72H|SEPT1_ENST00000570039.1_5'Flank|SEPT1_ENST00000605106.1_Missense_Mutation_p.D30H			Q8WYJ6	SEPT1_HUMAN	septin 1	25	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)	septin complex (GO:0031105)	GTP binding (GO:0005525)	p.D25H(1)		breast(2)|endometrium(1)|large_intestine(3)|lung(15)|ovary(1)|skin(1)|urinary_tract(1)	24			Colorectal(24;0.193)			AGCGTGAAGTCAAACCCCTTC	0.592																																						dbGAP											1	Substitution - Missense(1)	breast(1)											88.0	72.0	78.0					16																	30393617		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF308288	CCDS10678.1, CCDS10678.2, CCDS10678.3	16p11.2	2013-01-21		2001-09-10	ENSG00000180096	ENSG00000180096	3.1.5.1	"""Septins"""	2879	protein-coding gene	gene with protein product		612897		DIFF6		8697812	Standard	NM_052838		Approved	PNUTL3	uc002dxy.4	Q8WYJ6	OTTHUMG00000176984	ENST00000571393.1:c.73G>C	16.37:g.30393617C>G	ENSP00000460441:p.Asp25His		B4DVE6|Q658T1|Q8NEZ1|Q96EL4|Q9H285	Missense_Mutation	SNP	pfam_Cell_div_GTP-bd,pfam_Ribosome_biogen_GTPase_RsgA,pirsf_Septin	p.D30H	ENST00000571393.1	37	c.88		16	.	.	.	.	.	.	.	.	.	.	C	33	5.243617	0.95272	.	.	ENSG00000180096	ENST00000321367	.	.	.	5.67	5.67	0.87782	.	0.000000	0.64402	D	0.000016	T	0.68586	0.3017	L	0.33093	0.98	0.80722	D	1	D;D	0.76494	0.994;0.999	D;D	0.75484	0.984;0.986	T	0.70934	-0.4737	9	0.87932	D	0	.	18.5445	0.91042	0.0:1.0:0.0:0.0	.	72;25	B4E0I4;Q8WYJ6	.;SEPT1_HUMAN	H	25	.	ENSP00000324511:D25H	D	-	1	0	SEPT1	30301118	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	2.677000	0.91161	0.655000	0.94253	GAC	SEPT1	-	pfam_Cell_div_GTP-bd,pirsf_Septin	ENSG00000180096		0.592	SEPT1-201	KNOWN	basic	protein_coding	SEPT1	HGNC	protein_coding		138	0.00	0	C	NM_052838		30393617	30393617	-1	no_errors	ENST00000321367	ensembl	human	known	69_37n	missense	28	36.36	16	SNP	1.000	G
SLFN12L	100506736	genome.wustl.edu	37	17	33807200	33807200	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr17:33807200C>T	ENST00000260908.7	-	2	146	c.29G>A	c.(28-30)cGt>cAt	p.R10H	SLFN12L_ENST00000449046.1_Missense_Mutation_p.R41H|SLFN12L_ENST00000361112.4_Missense_Mutation_p.R39H|RP11-686D22.9_ENST00000587076.1_RNA	NM_001195790.1	NP_001182719.1	Q6IEE8	SN12L_HUMAN	schlafen family member 12-like	10						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)	p.R41H(2)|p.R39H(1)		breast(1)|endometrium(4)|kidney(5)|large_intestine(2)|lung(3)|ovary(1)	16						GCCATTTCCACGCAGAAATTC	0.398																																						dbGAP											3	Substitution - Missense(3)	breast(3)											43.0	32.0	35.0					17																	33807200		692	1591	2283	-	-	-	SO:0001583	missense	0			AK172761	CCDS56026.1	17q12	2011-05-24				ENSG00000205045			33920	protein-coding gene	gene with protein product		614956				9846487	Standard	NM_001195790		Approved		uc021tuy.1	Q6IEE8		ENST00000260908.7:c.29G>A	17.37:g.33807200C>T	ENSP00000437635:p.Arg10His		F5H6G3	Missense_Mutation	SNP	pfam_ATPase_AAA-4	p.R41H	ENST00000260908.7	37	c.122	CCDS56026.1	17	.	.	.	.	.	.	.	.	.	.	C	6.368	0.436052	0.12104	.	.	ENSG00000205045	ENST00000260908;ENST00000361112;ENST00000449046	T;T;T	0.03689	3.85;3.93;3.84	2.5	1.38	0.22167	.	.	.	.	.	T	0.01558	0.0050	N	0.08118	0	0.09310	N	1	P	0.38048	0.616	B	0.17433	0.018	T	0.48747	-0.9008	9	0.49607	T	0.09	.	5.6261	0.17482	0.714:0.286:0.0:0.0	.	39	Q6IEE8-2	.	H	10;39;41	ENSP00000437635:R10H;ENSP00000354412:R39H;ENSP00000389348:R41H	ENSP00000437635:R10H	R	-	2	0	SLFN12L	30831313	0.000000	0.05858	0.073000	0.20177	0.030000	0.12068	-1.481000	0.02323	0.196000	0.20367	-1.268000	0.01426	CGT	SLFN12L	-	NULL	ENSG00000205045		0.398	SLFN12L-004	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	SLFN12L	HGNC	protein_coding	OTTHUMT00000395748.2	93	0.00	0	C	XM_496206		33807200	33807200	-1	no_errors	ENST00000449046	ensembl	human	known	69_37n	missense	47	20.34	12	SNP	0.078	T
STK33	65975	genome.wustl.edu	37	11	8435219	8435219	+	Silent	SNP	C	C	T			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr11:8435219C>T	ENST00000447869.1	-	11	2085	c.1167G>A	c.(1165-1167)gtG>gtA	p.V389V	STK33_ENST00000396672.1_Silent_p.V389V|STK33_ENST00000358872.3_Silent_p.V202V|STK33_ENST00000396673.1_Intron|STK33_ENST00000315204.1_Silent_p.V389V|STK33_ENST00000534493.1_Silent_p.V348V|STK33_ENST00000473980.1_5'UTR			Q9BYT3	STK33_HUMAN	serine/threonine kinase 33	389					protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.V389V(2)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|skin(3)	23				Epithelial(150;2.13e-06)|BRCA - Breast invasive adenocarcinoma(625;0.239)		TGGTTGGTCTCACCGAAGAAA	0.363																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											155.0	139.0	145.0					11																	8435219		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AJ303380	CCDS7789.1, CCDS73253.1, CCDS73254.1	11p15.3	2010-03-10			ENSG00000130413	ENSG00000130413			14568	protein-coding gene	gene with protein product		607670				11738831	Standard	NM_030906		Approved		uc001mgj.1	Q9BYT3	OTTHUMG00000140275	ENST00000447869.1:c.1167G>A	11.37:g.8435219C>T			Q658S6|Q8NEF5	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.V389	ENST00000447869.1	37	c.1167	CCDS7789.1	11																																																																																			STK33	-	superfamily_Kinase-like_dom	ENSG00000130413		0.363	STK33-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	STK33	HGNC	protein_coding	OTTHUMT00000276819.2	304	0.00	0	C	NM_030906		8435219	8435219	-1	no_errors	ENST00000315204	ensembl	human	known	69_37n	silent	310	21.12	83	SNP	0.220	T
SWAP70	23075	genome.wustl.edu	37	11	9735179	9735179	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr11:9735179C>T	ENST00000318950.6	+	3	510	c.407C>T	c.(406-408)tCa>tTa	p.S136L	SWAP70_ENST00000447399.2_Intron	NM_015055.2	NP_055870.2	Q9UH65	SWP70_HUMAN	SWAP switching B-cell complex 70kDa subunit	136					isotype switching (GO:0045190)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)	p.S136L(1)		NS(1)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(2)|pancreas(1)	11				all cancers(16;1.21e-10)|Epithelial(150;2.81e-09)|BRCA - Breast invasive adenocarcinoma(625;0.00649)		ATTATTGTGTCAGAAGAGGTA	0.348																																						dbGAP											1	Substitution - Missense(1)	breast(1)											110.0	123.0	119.0					11																	9735179		2201	4294	6495	-	-	-	SO:0001583	missense	0			AB014540	CCDS31426.1, CCDS73257.1	11p15	2013-01-10			ENSG00000133789	ENSG00000133789		"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	17070	protein-coding gene	gene with protein product		604762				9734811, 10681448	Standard	XM_005252829		Approved	KIAA0640, SWAP-70	uc001mhw.3	Q9UH65	OTTHUMG00000165865	ENST00000318950.6:c.407C>T	11.37:g.9735179C>T	ENSP00000315630:p.Ser136Leu		D3DQV1|O75135|Q7LCY6|Q9P061|Q9P0Z8	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_EF_HAND_2,pfscan_Pleckstrin_homology	p.S136L	ENST00000318950.6	37	c.407	CCDS31426.1	11	.	.	.	.	.	.	.	.	.	.	C	16.20	3.057259	0.55325	.	.	ENSG00000133789	ENST00000318950	T	0.10192	2.9	5.82	5.82	0.92795	.	0.251795	0.47455	D	0.000221	T	0.10766	0.0263	N	0.22421	0.69	0.28787	N	0.899521	B	0.06786	0.001	B	0.06405	0.002	T	0.10894	-1.0610	10	0.48119	T	0.1	-2.4658	20.1012	0.97876	0.0:1.0:0.0:0.0	.	136	Q9UH65	SWP70_HUMAN	L	136	ENSP00000315630:S136L	ENSP00000315630:S136L	S	+	2	0	SWAP70	9691755	0.992000	0.36948	0.969000	0.41365	0.944000	0.59088	5.566000	0.67372	2.754000	0.94517	0.650000	0.86243	TCA	SWAP70	-	NULL	ENSG00000133789		0.348	SWAP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SWAP70	HGNC	protein_coding	OTTHUMT00000386766.2	120	0.00	0	C	NM_015055		9735179	9735179	+1	no_errors	ENST00000318950	ensembl	human	known	69_37n	missense	126	23.49	39	SNP	0.934	T
NELFCD	51497	genome.wustl.edu	37	20	57564035	57564035	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr20:57564035G>A	ENST00000344018.3	+	5	517	c.490G>A	c.(490-492)Gaa>Aaa	p.E164K	NELFCD_ENST00000602795.1_Missense_Mutation_p.E173K			Q8IXH7	NELFD_HUMAN	negative elongation factor complex member C/D	164					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	membrane (GO:0016020)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)		p.E164K(1)									TAAACTGGCTGAAGCCCATCC	0.443																																						dbGAP											1	Substitution - Missense(1)	breast(1)											102.0	92.0	95.0					20																	57564035		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF161479	CCDS13473.1, CCDS13473.2	20q13	2013-01-31	2013-01-31	2013-01-31	ENSG00000101158	ENSG00000101158			15934	protein-coding gene	gene with protein product	"""trihydrophobin 1"""	605297	"""TH1-like (Drosophila homolog)"", ""TH1-like (Drosophila)"""	TH1L		11030415, 11042152	Standard	NM_198976		Approved	HSPC130, TH1, NELF-C, NELF-D	uc002yag.4	Q8IXH7	OTTHUMG00000032861	ENST00000344018.3:c.490G>A	20.37:g.57564035G>A	ENSP00000342300:p.Glu164Lys		B4DE06|Q9BYL2|Q9H405|Q9H888|Q9H8T3|Q9NVX5|Q9P029|Q9UGN1|Q9UGN2|Q9UGN3	Missense_Mutation	SNP	pfam_TH1	p.E164K	ENST00000344018.3	37	c.490		20	.	.	.	.	.	.	.	.	.	.	G	35	5.516859	0.96416	.	.	ENSG00000101158	ENST00000344018	.	.	.	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	D	0.84092	0.5396	M	0.86953	2.85	0.80722	D	1	D;D;D	0.76494	0.999;0.979;0.997	D;D;D	0.83275	0.996;0.982;0.992	D	0.86775	0.1975	9	0.66056	D	0.02	-26.4191	16.9062	0.86128	0.0:0.0:1.0:0.0	.	164;173;164	B4E2K1;E1P5H4;Q8IXH7	.;.;NELFD_HUMAN	K	164	.	ENSP00000342300:E164K	E	+	1	0	TH1L	56997430	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	9.234000	0.95347	2.499000	0.84300	0.561000	0.74099	GAA	TH1L	-	pfam_TH1	ENSG00000101158		0.443	NELFCD-201	KNOWN	basic|appris_principal	protein_coding	TH1L	HGNC	protein_coding		185	0.00	0	G	NM_198976		57564035	57564035	+1	no_errors	ENST00000344018	ensembl	human	known	69_37n	missense	88	27.27	33	SNP	1.000	A
USP12	219333	genome.wustl.edu	37	13	27664021	27664021	+	Splice_Site	SNP	G	G	A			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr13:27664021G>A	ENST00000282344.6	-	6	989	c.733C>T	c.(733-735)Cgg>Tgg	p.R245W		NM_182488.3	NP_872294.2	O75317	UBP12_HUMAN	ubiquitin specific peptidase 12	245	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.R245W(1)		breast(3)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Lung SC(185;0.0161)		all cancers(112;0.0508)|GBM - Glioblastoma multiforme(144;0.168)|Epithelial(112;0.244)|OV - Ovarian serous cystadenocarcinoma(117;0.246)		TAAAATTACCGTTTGTGTGCT	0.353																																					Ovarian(37;808 911 7590 44442 44991)	dbGAP											1	Substitution - Missense(1)	breast(1)											61.0	60.0	60.0					13																	27664021		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AL049221	CCDS31952.1	13q12.13	2010-05-12	2005-08-08	2003-10-08	ENSG00000152484	ENSG00000152484		"""Ubiquitin-specific peptidases"""	20485	protein-coding gene	gene with protein product			"""ubiquitin specific protease 12 like 1"", ""ubiquitin specific protease 12"""	USP12L1		12838346	Standard	NM_182488		Approved		uc001uqy.3	O75317	OTTHUMG00000016626	ENST00000282344.6:c.734+1C>T	13.37:g.27664021G>A			A8K0X0|Q5VZV3|Q8TC49	Missense_Mutation	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.R245W	ENST00000282344.6	37	c.733	CCDS31952.1	13	.	.	.	.	.	.	.	.	.	.	G	19.45	3.830023	0.71258	.	.	ENSG00000152484	ENST00000282344	T	0.33654	1.4	5.22	4.25	0.50352	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.67221	0.2870	H	0.94620	3.56	0.80722	D	1	D	0.76494	0.999	D	0.76575	0.988	T	0.74954	-0.3488	10	0.87932	D	0	-5.0269	10.9344	0.47237	0.0:0.0:0.5944:0.4056	.	245	O75317	UBP12_HUMAN	W	245	ENSP00000282344:R245W	ENSP00000282344:R245W	R	-	1	2	USP12	26562021	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.287000	0.59001	2.615000	0.88500	0.591000	0.81541	CGG	USP12	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000152484		0.353	USP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP12	HGNC	protein_coding	OTTHUMT00000044264.1	183	0.00	0	G	NM_182488	Missense_Mutation	27664021	27664021	-1	no_errors	ENST00000282344	ensembl	human	known	69_37n	missense	188	21.99	53	SNP	1.000	A
VPS13B	157680	genome.wustl.edu	37	8	100729551	100729551	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr8:100729551G>C	ENST00000358544.2	+	37	6793	c.6682G>C	c.(6682-6684)Gaa>Caa	p.E2228Q	VPS13B_ENST00000395996.1_3'UTR|VPS13B_ENST00000357162.2_Missense_Mutation_p.E2203Q	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	2228					protein transport (GO:0015031)			p.E2203*(1)|p.E2228*(1)|p.E2228Q(1)|p.E2203Q(1)		NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			TCCAGGCCCAGAACAATCCAT	0.428																																					Colon(161;2205 2542 7338 31318)	dbGAP											4	Substitution - Nonsense(2)|Substitution - Missense(2)	lung(2)|breast(2)											95.0	88.0	91.0					8																	100729551		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.6682G>C	8.37:g.100729551G>C	ENSP00000351346:p.Glu2228Gln		C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	pfam_Autophagy-rel_C	p.E2228Q	ENST00000358544.2	37	c.6682	CCDS6280.1	8	.	.	.	.	.	.	.	.	.	.	G	6.122	0.390782	0.11581	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.69175	-0.38;-0.38	5.27	4.37	0.52481	.	0.226648	0.35585	N	0.003102	T	0.50154	0.1599	N	0.14661	0.345	0.80722	D	1	B;B	0.19445	0.013;0.036	B;B	0.14023	0.007;0.01	T	0.45963	-0.9225	10	0.46703	T	0.11	.	14.3815	0.66914	0.0:0.2919:0.7081:0.0	.	2203;2228	Q7Z7G8-2;Q7Z7G8	.;VP13B_HUMAN	Q	2203;2228	ENSP00000349685:E2203Q;ENSP00000351346:E2228Q	ENSP00000349685:E2203Q	E	+	1	0	VPS13B	100798727	1.000000	0.71417	0.999000	0.59377	0.280000	0.26924	3.834000	0.55798	1.285000	0.44548	0.655000	0.94253	GAA	VPS13B	-	NULL	ENSG00000132549		0.428	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13B	HGNC	protein_coding	OTTHUMT00000277138.1	122	0.00	0	G	NM_184042		100729551	100729551	+1	no_errors	ENST00000358544	ensembl	human	known	69_37n	missense	125	20.38	32	SNP	1.000	C
VPS41	27072	genome.wustl.edu	37	7	38796567	38796567	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr7:38796567C>G	ENST00000310301.4	-	19	1620	c.1566G>C	c.(1564-1566)aaG>aaC	p.K522N	VPS41_ENST00000395969.2_Missense_Mutation_p.K497N	NM_014396.3	NP_055211.2	P49754	VPS41_HUMAN	vacuolar protein sorting 41 homolog (S. cerevisiae)	522					Golgi vesicle transport (GO:0048193)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	cytosol (GO:0005829)|early endosome (GO:0005769)|Golgi-associated vesicle (GO:0005798)|HOPS complex (GO:0030897)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)	zinc ion binding (GO:0008270)	p.K522N(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(5)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	44						TGCCATAGTTCTTGTCATAGG	0.299																																						dbGAP											1	Substitution - Missense(1)	breast(1)											104.0	107.0	106.0					7																	38796567		2202	4296	6498	-	-	-	SO:0001583	missense	0			U87309	CCDS5457.1, CCDS5458.2	7p14.1-p13	2009-05-08	2006-12-19		ENSG00000006715	ENSG00000006715			12713	protein-coding gene	gene with protein product		605485	"""vacuolar protein sorting 41 (yeast homolog)"", ""vacuolar protein sorting 41 (yeast)"""			9159129	Standard	NM_080631		Approved	HVSP41	uc003tgy.3	P49754	OTTHUMG00000023629	ENST00000310301.4:c.1566G>C	7.37:g.38796567C>G	ENSP00000309457:p.Lys522Asn		E9PF36|Q86TP8|Q99851|Q99852	Missense_Mutation	SNP	pfam_Clathrin_H-chain/VPS_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Clathrin_H-chain/VPS_repeat,pirsf_VPS41,pfscan_Znf_RING	p.K522N	ENST00000310301.4	37	c.1566	CCDS5457.1	7	.	.	.	.	.	.	.	.	.	.	C	11.13	1.547837	0.27652	.	.	ENSG00000006715	ENST00000310301;ENST00000395969	T;T	0.21734	1.99;1.99	5.85	3.2	0.36748	Tetratricopeptide-like helical (1);	0.099070	0.64402	D	0.000001	T	0.13586	0.0329	L	0.34521	1.04	0.36448	D	0.865894	B;B;B	0.27559	0.181;0.181;0.181	B;B;B	0.18561	0.022;0.022;0.022	T	0.12967	-1.0527	10	0.38643	T	0.18	-23.0578	7.7401	0.28837	0.0:0.3073:0.0:0.6927	.	522;497;522	B2RB94;E9PF36;P49754	.;.;VPS41_HUMAN	N	522;497	ENSP00000309457:K522N;ENSP00000379297:K497N	ENSP00000309457:K522N	K	-	3	2	VPS41	38763092	0.972000	0.33761	1.000000	0.80357	0.981000	0.71138	0.152000	0.16302	1.050000	0.40346	-0.302000	0.09304	AAG	VPS41	-	pirsf_VPS41	ENSG00000006715		0.299	VPS41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS41	HGNC	protein_coding	OTTHUMT00000226986.3	245	0.00	0	C			38796567	38796567	-1	no_errors	ENST00000310301	ensembl	human	known	69_37n	missense	232	36.34	133	SNP	1.000	G
ZNF610	162963	genome.wustl.edu	37	19	52856956	52856956	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0RV-01A-11D-A099-09	TCGA-B6-A0RV-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	39b0b605-29ae-4e2c-81dc-319446c807dd	00bd0921-b765-4fbd-ab79-4d85aba0d1f6	g.chr19:52856956G>A	ENST00000403906.3	+	4	541	c.85G>A	c.(85-87)Gtg>Atg	p.V29M	ZNF610_ENST00000321287.8_Missense_Mutation_p.V29M|ZNF610_ENST00000327920.8_Missense_Mutation_p.V29M|ZNF610_ENST00000601151.1_Missense_Mutation_p.V29M	NM_001161425.1	NP_001154897.1	Q8N9Z0	ZN610_HUMAN	zinc finger protein 610	29	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V29M(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(8)|liver(2)|lung(9)|ovary(2)|stomach(2)|upper_aerodigestive_tract(2)	34				OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)		ATTCATGGACGTGGCCATCGA	0.418																																						dbGAP											1	Substitution - Missense(1)	breast(1)											97.0	97.0	97.0					19																	52856956		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK093359	CCDS12851.1, CCDS54309.1	19q13.41	2013-01-08			ENSG00000167554	ENSG00000167554		"""Zinc fingers, C2H2-type"", ""-"""	26687	protein-coding gene	gene with protein product						12477932	Standard	NM_001161425		Approved	FLJ36040	uc002pyx.4	Q8N9Z0		ENST00000403906.3:c.85G>A	19.37:g.52856956G>A	ENSP00000383922:p.Val29Met		A8K4C3|Q86YH8|Q8NDS9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V29M	ENST00000403906.3	37	c.85	CCDS12851.1	19	.	.	.	.	.	.	.	.	.	.	G	12.21	1.870071	0.33069	.	.	ENSG00000167554	ENST00000403906;ENST00000321287;ENST00000327920	T;T;T	0.10382	2.88;2.88;2.88	1.47	1.47	0.22746	Krueppel-associated box (4);	.	.	.	.	T	0.35566	0.0936	M	0.90595	3.13	0.23537	N	0.997469	D;D	0.89917	0.999;1.0	D;D	0.78314	0.985;0.991	T	0.04723	-1.0931	9	0.62326	D	0.03	.	8.8849	0.35398	0.0:0.0:1.0:0.0	.	29;29	Q8N9Z0-2;Q8N9Z0	.;ZN610_HUMAN	M	29	ENSP00000383922:V29M;ENSP00000324441:V29M;ENSP00000327597:V29M	ENSP00000324441:V29M	V	+	1	0	ZNF610	57548768	0.982000	0.34865	0.830000	0.32933	0.234000	0.25298	2.190000	0.42630	1.120000	0.41904	0.563000	0.77884	GTG	ZNF610	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000167554		0.418	ZNF610-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZNF610	HGNC	protein_coding	OTTHUMT00000462880.1	237	0.00	0	G	NM_173530		52856956	52856956	+1	no_errors	ENST00000327920	ensembl	human	known	69_37n	missense	145	26.40	52	SNP	0.972	A
