#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAM21P1	145241	genome.wustl.edu	37	14	70714300	70714300	+	RNA	SNP	A	A	G	rs112607032	byFrequency	TCGA-B6-A0WY-01A-11D-A10G-09	TCGA-B6-A0WY-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c973a902-abdf-41a3-8250-57011dfef1f4	d6007264-3412-46b3-8775-f2c42146de20	g.chr14:70714300A>G	ENST00000530196.1	-	0	218					NR_003951.1				ADAM metallopeptidase domain 21 pseudogene 1																		GACAGTAGCCAGAAATAGACA	0.532																																						dbGAP											0																																										-	-	-			0					14q24.2	2014-03-25	2010-01-12	2010-01-12	ENSG00000235812	ENSG00000235812			19822	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 21 pseudogene"", ""ADAM metallopeptidase domain 21 pseudogene"""	ADAM21P			Standard	NR_003951		Approved		uc010ttg.2		OTTHUMG00000166565		14.37:g.70714300A>G				RNA	SNP	-	NULL	ENST00000530196.1	37	NULL		14																																																																																			ADAM21P1	-	-	ENSG00000235812		0.532	ADAM21P1-002	KNOWN	basic	processed_transcript	ADAM21P1	HGNC	pseudogene	OTTHUMT00000390451.1	32	0.00	0	A	NG_002467		70714300	70714300	-1	no_errors	ENST00000530196	ensembl	human	known	69_37n	rna	160	16.15	31	SNP	0.000	G
CHD1L	9557	genome.wustl.edu	37	1	146747774	146747775	+	Frame_Shift_Ins	INS	-	-	A			TCGA-B6-A0WY-01A-11D-A10G-09	TCGA-B6-A0WY-10A-01D-A10G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c973a902-abdf-41a3-8250-57011dfef1f4	d6007264-3412-46b3-8775-f2c42146de20	g.chr1:146747774_146747775insA	ENST00000369258.4	+	14	1412_1413	c.1392_1393insA	c.(1393-1395)aaafs	p.K465fs	CHD1L_ENST00000431239.1_Frame_Shift_Ins_p.K371fs|CHD1L_ENST00000369259.3_Frame_Shift_Ins_p.K261fs|CHD1L_ENST00000361293.5_Frame_Shift_Ins_p.K184fs|CHD1L_ENST00000467213.1_3'UTR	NM_001256336.1|NM_004284.4|NM_024568.2	NP_001243265.1|NP_004275.4|NP_078844.2	Q86WJ1	CHD1L_HUMAN	chromodomain helicase DNA binding protein 1-like	465	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|nucleotide binding (GO:0000166)			breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(923;0.0487)					CCAGGTCTGTTAAAGTTATTCG	0.431																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF054177	CCDS927.1, CCDS58021.1, CCDS58022.1, CCDS72882.1	1q21.1	2008-02-05			ENSG00000131778	ENSG00000131778			1916	protein-coding gene	gene with protein product		613039				9653160	Standard	NM_004284		Approved	ALC1	uc001epm.5	Q86WJ1	OTTHUMG00000150271	ENST00000369258.4:c.1395dupA	1.37:g.146747777_146747777dupA	ENSP00000358262:p.Lys465fs		A5YM64|B4DDE1|B5MDZ7|Q53EZ3|Q5VXX7|Q6DD94|Q6PK83|Q86XH3|Q96HF7|Q96SP3|Q9BVJ1|Q9NVV8	Frame_Shift_Ins	INS	pfam_SNF2_N,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_A1pp,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.V465fs	ENST00000369258.4	37	c.1392_1393	CCDS927.1	1																																																																																			CHD1L	-	pfam_HDA_complex_subunit-2/3,pfscan_Helicase_C	ENSG00000131778		0.431	CHD1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD1L	HGNC	protein_coding	OTTHUMT00000040377.1	39	0.00	0	-	NM_004284		146747774	146747775	+1	no_errors	ENST00000369258	ensembl	human	known	69_37n	frame_shift_ins	116	11.45	15	INS	0.964:0.999	A
ERP27	121506	genome.wustl.edu	37	12	15068440	15068440	+	Silent	SNP	G	G	A			TCGA-B6-A0WY-01A-11D-A10G-09	TCGA-B6-A0WY-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c973a902-abdf-41a3-8250-57011dfef1f4	d6007264-3412-46b3-8775-f2c42146de20	g.chr12:15068440G>A	ENST00000266397.2	-	6	1330	c.757C>T	c.(757-759)Cta>Tta	p.L253L	ERP27_ENST00000544881.1_5'Flank|ERP27_ENST00000540097.1_Silent_p.L152L	NM_152321.2	NP_689534.1	Q96DN0	ERP27_HUMAN	endoplasmic reticulum protein 27	253						endoplasmic reticulum (GO:0005783)		p.F252_G255del(1)		breast(2)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(4)|lung(3)|prostate(2)|skin(1)	19						TTTCCACTTAGGAATCCATCA	0.413																																						dbGAP											1	Deletion - In frame(1)	breast(1)											107.0	107.0	107.0					12																	15068440		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK056677	CCDS8670.1, CCDS73450.1	12p12.3	2011-10-19	2009-02-23	2007-03-26	ENSG00000139055	ENSG00000139055		"""Protein disulfide isomerases"""	26495	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 8"""	610642	"""chromosome 12 open reading frame 46"", ""endoplasmic reticulum protein 27 kDa"""	C12orf46		12975309, 16940051	Standard	XM_005253303		Approved	FLJ32115, ERp27, PDIA8	uc001rco.3	Q96DN0	OTTHUMG00000168741	ENST00000266397.2:c.757C>T	12.37:g.15068440G>A				Silent	SNP	superfamily_Thioredoxin-like_fold	p.L253	ENST00000266397.2	37	c.757	CCDS8670.1	12																																																																																			ERP27	-	superfamily_Thioredoxin-like_fold	ENSG00000139055		0.413	ERP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERP27	HGNC	protein_coding	OTTHUMT00000400868.1	69	0.00	0	G	NM_152321		15068440	15068440	-1	no_errors	ENST00000266397	ensembl	human	known	69_37n	silent	171	16.59	34	SNP	0.972	A
ENDOU	8909	genome.wustl.edu	37	12	48110712	48110712	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0WY-01A-11D-A10G-09	TCGA-B6-A0WY-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c973a902-abdf-41a3-8250-57011dfef1f4	d6007264-3412-46b3-8775-f2c42146de20	g.chr12:48110712G>A	ENST00000422538.3	-	5	634	c.512C>T	c.(511-513)cCg>cTg	p.P171L	ENDOU_ENST00000229003.3_Missense_Mutation_p.P130L|ENDOU_ENST00000542202.1_5'UTR|ENDOU_ENST00000545824.2_Missense_Mutation_p.P108L|RP1-197B17.3_ENST00000547799.1_lincRNA	NM_001172439.1	NP_001165910.1	P21128	ENDOU_HUMAN	endonuclease, polyU-specific	171					female pregnancy (GO:0007565)|immune response (GO:0006955)|proteolysis (GO:0006508)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	endoribonuclease activity (GO:0004521)|growth factor activity (GO:0008083)|manganese ion binding (GO:0030145)|polysaccharide binding (GO:0030247)|RNA binding (GO:0003723)|scavenger receptor activity (GO:0005044)|serine-type peptidase activity (GO:0008236)	p.P130Q(1)		autonomic_ganglia(1)|endometrium(2)|large_intestine(4)|lung(2)|ovary(3)|pancreas(1)|stomach(1)	14						GGTCTCTGACGGGGAGATGCA	0.493											OREG0021752	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Substitution - Missense(1)	lung(1)											285.0	245.0	259.0					12																	48110712		2203	4300	6503	-	-	-	SO:0001583	missense	0			M32402	CCDS8754.1, CCDS53784.1, CCDS53785.1	12q13.1	2011-08-31			ENSG00000111405	ENSG00000111405		"""Serine peptidases / Serine peptidases"""	14369	protein-coding gene	gene with protein product		606720				2350438, 1710108, 15755742, 18936097	Standard	NM_006025		Approved	PP11, P11, PRSS26	uc001rpu.2	P21128	OTTHUMG00000169670	ENST00000422538.3:c.512C>T	12.37:g.48110712G>A	ENSP00000397679:p.Pro171Leu	952	B2RBJ3|B3KQS7|B7Z6E1|Q2NKJ4	Missense_Mutation	SNP	pfam_Endoribonuclease_XendoU,pfam_Somatomedin_B_dom,smart_Somatomedin_B_dom,pfscan_Somatomedin_B_dom,prints_Somatomedin_B_chordata	p.P130L	ENST00000422538.3	37	c.389	CCDS53785.1	12	.	.	.	.	.	.	.	.	.	.	G	8.060	0.768009	0.15983	.	.	ENSG00000111405	ENST00000229003;ENST00000422538;ENST00000545824	T;T	0.30448	1.53;1.54	5.91	4.09	0.47781	.	0.368855	0.32687	N	0.005773	T	0.19805	0.0476	L	0.48642	1.525	0.25943	N	0.982843	P;B;P	0.46020	0.549;0.026;0.871	B;B;B	0.30495	0.057;0.011;0.116	T	0.12708	-1.0537	10	0.28530	T	0.3	-14.7892	9.6438	0.39855	0.0749:0.1402:0.7849:0.0	.	108;171;130	P21128-3;P21128;P21128-2	.;ENDOU_HUMAN;.	L	130;171;108	ENSP00000229003:P130L;ENSP00000397679:P171L	ENSP00000229003:P130L	P	-	2	0	ENDOU	46396979	0.438000	0.25602	0.445000	0.26908	0.302000	0.27658	3.466000	0.53071	0.857000	0.35407	-0.122000	0.15005	CCG	ENDOU	-	pfam_Endoribonuclease_XendoU	ENSG00000111405		0.493	ENDOU-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ENDOU	HGNC	protein_coding	OTTHUMT00000405352.1	77	0.00	0	G	NM_006025.2		48110712	48110712	-1	no_errors	ENST00000229003	ensembl	human	known	69_37n	missense	288	11.11	36	SNP	0.222	A
HERC2	8924	genome.wustl.edu	37	15	28389261	28389261	+	Missense_Mutation	SNP	G	G	A	rs575646071		TCGA-B6-A0WY-01A-11D-A10G-09	TCGA-B6-A0WY-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c973a902-abdf-41a3-8250-57011dfef1f4	d6007264-3412-46b3-8775-f2c42146de20	g.chr15:28389261G>A	ENST00000261609.7	-	73	11369	c.11261C>T	c.(11260-11262)gCg>gTg	p.A3754V		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CAGCGAGGCCGCAAGGCGAGG	0.537													G|||	1	0.000199681	0.0	0.0	5008	,	,		21338	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													112.0	100.0	104.0					15																	28389261		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.11261C>T	15.37:g.28389261G>A	ENSP00000261609:p.Ala3754Val			Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_CPH_domain,pfam_Mib_Herc2,pfam_Cyt_B5,pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_HECT,superfamily_Galactose-bd-like,superfamily_Cyt_B5,superfamily_UBA-like,superfamily_CUB,smart_Beta-propeller_rpt_TECPR,smart_Znf_ZZ,smart_HECT,pfscan_HECT,pfscan_Znf_ZZ,pfscan_Reg_chr_condens,pfscan_Cyt_B5,prints_Reg_chr_condens	p.A3754V	ENST00000261609.7	37	c.11261	CCDS10021.1	15	.	.	.	.	.	.	.	.	.	.	G	24.2	4.506069	0.85282	.	.	ENSG00000128731	ENST00000261609	T	0.43688	0.94	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.44371	0.1290	L	0.45137	1.4	0.80722	D	1	D	0.57899	0.981	P	0.45377	0.478	T	0.36138	-0.9760	10	0.49607	T	0.09	.	19.961	0.97250	0.0:0.0:1.0:0.0	.	3754	O95714	HERC2_HUMAN	V	3754	ENSP00000261609:A3754V	ENSP00000261609:A3754V	A	-	2	0	HERC2	26062856	1.000000	0.71417	0.298000	0.25002	0.539000	0.34962	9.420000	0.97426	2.783000	0.95769	0.655000	0.94253	GCG	HERC2	-	NULL	ENSG00000128731		0.537	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC2	HGNC	protein_coding	OTTHUMT00000251358.2	16	0.00	0	G	NM_004667		28389261	28389261	-1	no_errors	ENST00000261609	ensembl	human	known	69_37n	missense	60	19.74	15	SNP	1.000	A
FBN1	2200	genome.wustl.edu	37	15	48766481	48766481	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A0WY-01A-11D-A10G-09	TCGA-B6-A0WY-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c973a902-abdf-41a3-8250-57011dfef1f4	d6007264-3412-46b3-8775-f2c42146de20	g.chr15:48766481C>A	ENST00000316623.5	-	34	4636	c.4181G>T	c.(4180-4182)gGa>gTa	p.G1394V		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	1394	EGF-like 23; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.		Missing (in MFS). {ECO:0000269|PubMed:14695540}.		extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		ACCTGTGTATCCTTCCTTGCA	0.473																																						dbGAP											0													145.0	117.0	126.0					15																	48766481		2198	4296	6494	-	-	-	SO:0001583	missense	0			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.4181G>T	15.37:g.48766481C>A	ENSP00000325527:p.Gly1394Val		B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_EGF-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt,smart_EGF-like,smart_EGF-like_Ca-bd,pirsf_Fibrillin,pfscan_EG-like_dom	p.G1394V	ENST00000316623.5	37	c.4181	CCDS32232.1	15	.	.	.	.	.	.	.	.	.	.	C	15.98	2.991472	0.54041	.	.	ENSG00000166147	ENST00000316623;ENST00000544030	D	0.92752	-3.1	5.29	5.29	0.74685	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.097281	0.64402	D	0.000001	D	0.98147	0.9388	H	0.99391	4.545	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99457	1.0942	10	0.87932	D	0	.	18.7133	0.91666	0.0:1.0:0.0:0.0	.	1394	P35555	FBN1_HUMAN	V	1394;284	ENSP00000325527:G1394V	ENSP00000325527:G1394V	G	-	2	0	FBN1	46553773	1.000000	0.71417	0.972000	0.41901	0.983000	0.72400	7.597000	0.82733	2.753000	0.94483	0.650000	0.86243	GGA	FBN1	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pirsf_Fibrillin,pfscan_EG-like_dom	ENSG00000166147		0.473	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN1	HGNC	protein_coding	OTTHUMT00000417355.1	36	0.00	0	C			48766481	48766481	-1	no_errors	ENST00000316623	ensembl	human	known	69_37n	missense	162	15.18	29	SNP	1.000	A
KIAA2026	158358	genome.wustl.edu	37	9	5922013	5922013	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A0WY-01A-11D-A10G-09	TCGA-B6-A0WY-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c973a902-abdf-41a3-8250-57011dfef1f4	d6007264-3412-46b3-8775-f2c42146de20	g.chr9:5922013G>A	ENST00000399933.3	-	8	3982	c.3983C>T	c.(3982-3984)aCt>aTt	p.T1328I	KIAA2026_ENST00000381461.2_Missense_Mutation_p.T1298I	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	1328	Ser-rich.									breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		AGAGGAAGAAGTTGTTGATTT	0.418																																						dbGAP											0													208.0	202.0	204.0					9																	5922013		1894	4134	6028	-	-	-	SO:0001583	missense	0			AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.3983C>T	9.37:g.5922013G>A	ENSP00000382815:p.Thr1328Ile		A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Missense_Mutation	SNP	superfamily_Bromodomain	p.T1328I	ENST00000399933.3	37	c.3983		9	.	.	.	.	.	.	.	.	.	.	G	11.55	1.673480	0.29693	.	.	ENSG00000183354	ENST00000399933;ENST00000381461	.	.	.	3.66	3.66	0.41972	.	0.477858	0.17930	N	0.157200	T	0.28995	0.0720	L	0.27053	0.805	0.28321	N	0.92223	B	0.30281	0.275	B	0.29524	0.103	T	0.14448	-1.0472	9	0.30854	T	0.27	-1.1558	11.6548	0.51311	0.0:0.0:0.8219:0.1781	.	1328	Q5HYC2	K2026_HUMAN	I	1328;1298	.	ENSP00000370870:T1298I	T	-	2	0	KIAA2026	5912013	0.967000	0.33354	0.999000	0.59377	0.850000	0.48378	4.272000	0.58908	1.876000	0.54355	0.555000	0.69702	ACT	KIAA2026	-	NULL	ENSG00000183354		0.418	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	KIAA2026	HGNC	protein_coding	OTTHUMT00000051652.2	118	0.00	0	G	NM_001017969		5922013	5922013	-1	no_errors	ENST00000399933	ensembl	human	novel	69_37n	missense	152	25.73	53	SNP	1.000	A
KMT2B	9757	genome.wustl.edu	37	19	36220093	36220093	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B6-A0WY-01A-11D-A10G-09	TCGA-B6-A0WY-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c973a902-abdf-41a3-8250-57011dfef1f4	d6007264-3412-46b3-8775-f2c42146de20	g.chr19:36220093G>T	ENST00000222270.7	+	22	4813	c.4813G>T	c.(4813-4815)Gag>Tag	p.E1605*	KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000420124.1_Nonsense_Mutation_p.E1605*	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	1605					chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										CGGGCAGAACGAGTGGACACA	0.627																																						dbGAP											0													49.0	49.0	49.0					19																	36220093		2112	4222	6334	-	-	-	SO:0001587	stop_gained	0			AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.4813G>T	19.37:g.36220093G>T	ENSP00000222270:p.Glu1605*		O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Nonsense_Mutation	SNP	pirsf_MeTrfase_trithorax,pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.E1605*	ENST00000222270.7	37	c.4813	CCDS46055.1	19	.	.	.	.	.	.	.	.	.	.	G	44	11.272754	0.99539	.	.	ENSG00000105663	ENST00000222270;ENST00000420124	.	.	.	5.13	5.13	0.70059	.	0.000000	0.45126	D	0.000381	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	.	15.6068	0.76679	0.0:0.0:1.0:0.0	.	.	.	.	X	1605	.	ENSP00000222270:E1605X	E	+	1	0	AD000671.1	40911933	1.000000	0.71417	0.999000	0.59377	0.978000	0.69477	9.547000	0.98100	2.669000	0.90835	0.655000	0.94253	GAG	MLL4	-	pirsf_MeTrfase_trithorax	ENSG00000105663		0.627	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MLL4	Clone_based_vega_gene	protein_coding		12	0.00	0	G	NM_014727		36220093	36220093	+1	no_errors	ENST00000222270	ensembl	human	known	69_37n	nonsense	98	22.05	28	SNP	1.000	T
RNF123	63891	genome.wustl.edu	37	3	49726070	49726070	+	5'Flank	SNP	G	G	A	rs587776366|rs62262686		TCGA-B6-A0WY-01A-11D-A10G-09	TCGA-B6-A0WY-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c973a902-abdf-41a3-8250-57011dfef1f4	d6007264-3412-46b3-8775-f2c42146de20	g.chr3:49726070G>A	ENST00000327697.6	+	0	0				MST1_ENST00000449682.2_Missense_Mutation_p.P19S|RNF123_ENST00000432042.1_5'Flank|MST1_ENST00000383728.3_5'UTR|MST1_ENST00000545762.1_Missense_Mutation_p.P5S|MST1_ENST00000494828.2_5'UTR	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123						protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		AGCAGGAGTGGGAGCCACCCC	0.612																																						dbGAP											0													25.0	25.0	25.0					3																	49726070		2201	4296	6497	-	-	-	SO:0001631	upstream_gene_variant	0			AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891		3.37:g.49726070G>A	Exception_encountered		A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Missense_Mutation	SNP	pfam_Kringle,pfam_Peptidase_S1_S6,pfam_PAN-1_domain,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_Pan_app,smart_Kringle,smart_Peptidase_S1_S6,pfscan_Pan_app,pfscan_Kringle,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.P19S	ENST00000327697.6	37	c.55	CCDS33758.1	3	.	.	.	.	.	.	.	.	.	.	G	9.725	1.160641	0.21454	.	.	ENSG00000173531	ENST00000449682;ENST00000545762	D;T	0.86769	-2.17;0.86	3.75	-0.229	0.13094	.	0.413025	0.17820	N	0.160900	D	0.84215	0.5423	L	0.54323	1.7	0.22266	N	0.99924	D;P	0.58268	0.982;0.911	P;P	0.52554	0.702;0.555	T	0.73688	-0.3904	10	0.33940	T	0.23	.	3.5806	0.07950	0.3392:0.1931:0.4677:0.0	rs62262686	5;19	B7Z538;G3XAK1	.;.	S	19;5	ENSP00000414287:P19S;ENSP00000437535:P5S	ENSP00000411117:P19S	P	-	1	0	MST1	49701074	0.838000	0.29461	0.907000	0.35723	0.425000	0.31504	1.045000	0.30341	-0.051000	0.13334	-0.258000	0.10820	CCA	MST1	-	NULL	ENSG00000173531		0.612	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MST1	HGNC	protein_coding	OTTHUMT00000346475.2	14	0.00	0	G	NM_022064		49726070	49726070	-1	no_errors	ENST00000449682	ensembl	human	known	69_37n	missense	45	23.73	14	SNP	0.908	A
NCOR1	9611	genome.wustl.edu	37	17	16049835	16049835	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B6-A0WY-01A-11D-A10G-09	TCGA-B6-A0WY-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c973a902-abdf-41a3-8250-57011dfef1f4	d6007264-3412-46b3-8775-f2c42146de20	g.chr17:16049835G>A	ENST00000268712.3	-	10	1194	c.937C>T	c.(937-939)Cag>Tag	p.Q313*	NCOR1_ENST00000395851.1_Nonsense_Mutation_p.Q313*|NCOR1_ENST00000395848.1_Nonsense_Mutation_p.Q204*	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	313	Interaction with ZBTB33 and HEXIM1.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)	p.Q313*(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		TCCATGAGCTGATCATAACGC	0.328																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											96.0	89.0	92.0					17																	16049835		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0			AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.937C>T	17.37:g.16049835G>A	ENSP00000268712:p.Gln313*		B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Nonsense_Mutation	SNP	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.Q313*	ENST00000268712.3	37	c.937	CCDS11175.1	17	.	.	.	.	.	.	.	.	.	.	G	37	6.567240	0.97671	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849;ENST00000458113;ENST00000395848;ENST00000411510;ENST00000436828	.	.	.	5.62	5.62	0.85841	.	0.048740	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-8.9391	19.0118	0.92875	0.0:0.0:1.0:0.0	.	.	.	.	X	313;313;204;322;204;313;322	.	ENSP00000268712:Q313X	Q	-	1	0	NCOR1	15990560	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.472000	0.73567	2.813000	0.96785	0.561000	0.74099	CAG	NCOR1	-	NULL	ENSG00000141027		0.328	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOR1	HGNC	protein_coding	OTTHUMT00000131751.5	219	0.45	1	G	NM_006311		16049835	16049835	-1	no_errors	ENST00000268712	ensembl	human	known	69_37n	nonsense	179	28.40	71	SNP	1.000	A
NRAP	4892	genome.wustl.edu	37	10	115370292	115370292	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B6-A0WY-01A-11D-A10G-09	TCGA-B6-A0WY-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c973a902-abdf-41a3-8250-57011dfef1f4	d6007264-3412-46b3-8775-f2c42146de20	g.chr10:115370292G>A	ENST00000359988.3	-	31	3773	c.3529C>T	c.(3529-3531)Cga>Tga	p.R1177*	NRAP_ENST00000369360.3_Nonsense_Mutation_p.R1150*|NRAP_ENST00000369358.4_Nonsense_Mutation_p.R1185*|NRAP_ENST00000360478.3_Nonsense_Mutation_p.R1142*	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2			nebulin-related anchoring protein											autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(18)|lung(39)|ovary(6)|prostate(3)|skin(1)|stomach(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		GCAACACCTCGCATAAAGTTC	0.428																																						dbGAP											0													140.0	122.0	128.0					10																	115370292		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS7578.1, CCDS7579.1, CCDS73199.1	10q24-q26	2008-08-01			ENSG00000197893	ENSG00000197893			7988	protein-coding gene	gene with protein product		602873				12789664, 10320340	Standard	NM_006175		Approved		uc001lal.4	Q86VF7	OTTHUMG00000019072	ENST00000359988.3:c.3529C>T	10.37:g.115370292G>A	ENSP00000353078:p.Arg1177*			Nonsense_Mutation	SNP	pfam_Nebulin_35r-motif,pfam_Znf_LIM,smart_Znf_LIM,smart_Nebulin_35r-motif,pfscan_Znf_LIM,pfscan_Nebulin_35r-motif,prints_Nebulin	p.R1185*	ENST00000359988.3	37	c.3553	CCDS7579.1	10	.	.	.	.	.	.	.	.	.	.	G	42	9.559607	0.99205	.	.	ENSG00000197893	ENST00000369358;ENST00000369360;ENST00000359988;ENST00000360478	.	.	.	5.85	4.88	0.63580	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07482	T	0.82	.	13.9075	0.63845	0.0:0.0:0.7842:0.2158	.	.	.	.	X	1185;1150;1177;1142	.	ENSP00000353078:R1177X	R	-	1	2	NRAP	115360282	1.000000	0.71417	0.998000	0.56505	0.701000	0.40568	1.892000	0.39748	2.770000	0.95276	0.650000	0.86243	CGA	NRAP	-	pfscan_Nebulin_35r-motif	ENSG00000197893		0.428	NRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRAP	HGNC	protein_coding	OTTHUMT00000050425.2	75	0.00	0	G	NM_006175		115370292	115370292	-1	no_errors	ENST00000369358	ensembl	human	known	69_37n	nonsense	192	11.11	24	SNP	1.000	A
OR2T33	391195	genome.wustl.edu	37	1	248436504	248436504	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A0WY-01A-11D-A10G-09	TCGA-B6-A0WY-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c973a902-abdf-41a3-8250-57011dfef1f4	d6007264-3412-46b3-8775-f2c42146de20	g.chr1:248436504G>C	ENST00000318021.2	-	1	634	c.613C>G	c.(613-615)Ctc>Gtc	p.L205V		NM_001004695.1	NP_001004695.1	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T, member 33	205						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(41)|ovary(1)|prostate(1)|skin(4)	67	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			GGGACCAGGAGCATTAACACA	0.542																																						dbGAP											0													22.0	24.0	23.0					1																	248436504		2176	4263	6439	-	-	-	SO:0001583	missense	0				CCDS31109.1	1q44	2012-08-09			ENSG00000177212	ENSG00000177212		"""GPCR / Class A : Olfactory receptors"""	31255	protein-coding gene	gene with protein product							Standard	NM_001004695		Approved		uc010pzi.2	Q8NG76	OTTHUMG00000040458	ENST00000318021.2:c.613C>G	1.37:g.248436504G>C	ENSP00000324687:p.Leu205Val		B2RNN0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L205V	ENST00000318021.2	37	c.613	CCDS31109.1	1	.	.	.	.	.	.	.	.	.	.	-	11.42	1.634543	0.29068	.	.	ENSG00000177212	ENST00000318021	T	0.37584	1.19	1.86	1.86	0.25419	GPCR, rhodopsin-like superfamily (1);	0.000000	0.31772	U	0.007081	T	0.48277	0.1491	L	0.48877	1.53	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.19745	-1.0296	10	0.87932	D	0	.	9.985	0.41837	0.0:0.2099:0.7901:0.0	.	205	Q8NG76	O2T33_HUMAN	V	205	ENSP00000324687:L205V	ENSP00000324687:L205V	L	-	1	0	OR2T33	246503127	0.000000	0.05858	0.954000	0.39281	0.783000	0.44284	-1.367000	0.02583	1.338000	0.45544	0.494000	0.49563	CTC	OR2T33	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000177212		0.542	OR2T33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T33	HGNC	protein_coding	OTTHUMT00000097354.1	52	0.00	0	G	NM_001004695		248436504	248436504	-1	no_errors	ENST00000318021	ensembl	human	known	69_37n	missense	128	12.93	19	SNP	0.020	C
SLC6A10P	386757	genome.wustl.edu	37	16	32893876	32893876	+	RNA	SNP	T	T	C	rs375167306	byFrequency	TCGA-B6-A0WY-01A-11D-A10G-09	TCGA-B6-A0WY-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c973a902-abdf-41a3-8250-57011dfef1f4	d6007264-3412-46b3-8775-f2c42146de20	g.chr16:32893876T>C	ENST00000330048.5	-	0	1381					NR_003083.2				solute carrier family 6 (neurotransmitter transporter), member 10, pseudogene																		GACAGGGGACTGGCGGTCAGC	0.612													.|||	1546	0.308706	0.4402	0.1988	5008	,	,		27697	0.2063		0.2624	False		,,,				2504	0.362					dbGAP											0																																										-	-	-			0			U41163		16p11.2	2013-07-19	2013-07-19	2013-07-19	ENSG00000214617	ENSG00000214617		"""Solute carriers"""	11043	pseudogene	pseudogene	"""creatine transporter-2"""		"""solute carrier family 6 (neurotransmitter transporter, creatine), member 10"""	SLC6A10		9154116	Standard	NR_003083		Approved	CT-2	uc002edh.1		OTTHUMG00000132481		16.37:g.32893876T>C				RNA	SNP	-	NULL	ENST00000330048.5	37	NULL		16																																																																																			SLC6A10P	-	-	ENSG00000214617		0.612	SLC6A10P-002	KNOWN	basic	processed_transcript	SLC6A10P	HGNC	pseudogene	OTTHUMT00000432081.2	9	0.00	0	T			32893876	32893876	-1	no_errors	ENST00000330048	ensembl	human	known	69_37n	rna	40	39.39	26	SNP	0.959	C
TERF2IP	54386	genome.wustl.edu	37	16	75690148	75690148	+	Missense_Mutation	SNP	G	G	A	rs527404806		TCGA-B6-A0WY-01A-11D-A10G-09	TCGA-B6-A0WY-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c973a902-abdf-41a3-8250-57011dfef1f4	d6007264-3412-46b3-8775-f2c42146de20	g.chr16:75690148G>A	ENST00000300086.4	+	3	936	c.839G>A	c.(838-840)tGt>tAt	p.C280Y		NM_018975.3	NP_061848.2	Q9NYB0	TE2IP_HUMAN	telomeric repeat binding factor 2, interacting protein	280	Asp/Glu-rich (acidic).				negative regulation of DNA recombination at telomere (GO:0048239)|negative regulation of telomere maintenance (GO:0032205)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protection from non-homologous end joining at telomere (GO:0031848)|protein localization to chromosome, telomeric region (GO:0070198)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of transcription, DNA-templated (GO:0006355)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)|telomere maintenance via telomere lengthening (GO:0010833)|transcription, DNA-templated (GO:0006351)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear chromosome (GO:0000228)|nuclear chromosome, telomeric region (GO:0000784)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(1)	5						ATAACTATGTGTGATGATGAT	0.423																																						dbGAP											0													91.0	93.0	92.0					16																	75690148		2198	4300	6498	-	-	-	SO:0001583	missense	0			AK000669	CCDS32491.1	16q23.1	2012-10-03			ENSG00000166848	ENSG00000166848			19246	protein-coding gene	gene with protein product		605061				10850490	Standard	NM_018975		Approved	RAP1	uc002fet.2	Q9NYB0	OTTHUMG00000177136	ENST00000300086.4:c.839G>A	16.37:g.75690148G>A	ENSP00000300086:p.Cys280Tyr		B4DQN4|Q4W4Y2|Q8WYZ3|Q9NWR2	Missense_Mutation	SNP	pfam_Rap1_Myb_dom,superfamily_Homeodomain-like,superfamily_BRCT_dom	p.C280Y	ENST00000300086.4	37	c.839	CCDS32491.1	16	.	.	.	.	.	.	.	.	.	.	G	15.20	2.761495	0.49468	.	.	ENSG00000166848	ENST00000300086	T	0.44482	0.92	4.46	4.46	0.54185	.	0.693442	0.15011	N	0.285572	T	0.37892	0.1020	N	0.14661	0.345	0.35839	D	0.825885	D	0.65815	0.995	P	0.59221	0.854	T	0.04427	-1.0952	10	0.02654	T	1	-7.4665	14.9297	0.70906	0.0:0.0:1.0:0.0	.	280	Q9NYB0	TE2IP_HUMAN	Y	280	ENSP00000300086:C280Y	ENSP00000300086:C280Y	C	+	2	0	TERF2IP	74247649	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.292000	0.59031	2.760000	0.94817	0.591000	0.81541	TGT	TERF2IP	-	NULL	ENSG00000166848		0.423	TERF2IP-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	TERF2IP	HGNC	protein_coding	OTTHUMT00000435519.1	35	0.00	0	G	NM_018975		75690148	75690148	+1	no_errors	ENST00000300086	ensembl	human	putative	69_37n	missense	89	21.24	24	SNP	1.000	A
UGGT2	55757	genome.wustl.edu	37	13	96555290	96555290	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A0WY-01A-11D-A10G-09	TCGA-B6-A0WY-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c973a902-abdf-41a3-8250-57011dfef1f4	d6007264-3412-46b3-8775-f2c42146de20	g.chr13:96555290C>A	ENST00000376747.3	-	21	2390	c.2320G>T	c.(2320-2322)Ggg>Tgg	p.G774W		NM_020121.3	NP_064506.3	Q9NYU1	UGGG2_HUMAN	UDP-glucose glycoprotein glucosyltransferase 2	774					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-glucosylation (GO:0097359)	endoplasmic reticulum lumen (GO:0005788)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(17)|lung(20)|ovary(3)|pancreas(1)|prostate(4)|urinary_tract(2)	60						TAAATAATCCCCAACCGACTA	0.303																																						dbGAP											0													56.0	58.0	57.0					13																	96555290		2202	4296	6498	-	-	-	SO:0001583	missense	0			AF227906	CCDS9480.1	13q32.1	2009-07-23	2009-07-23	2009-07-23	ENSG00000102595	ENSG00000102595			15664	protein-coding gene	gene with protein product	"""UDP-glucose:glycoprotein glucosyltransferase 2"""	605898	"""UDP-glucose ceramide glucosyltransferase-like 2"""	UGCGL2		10694380	Standard	NM_020121		Approved	FLJ11485, HUGT2, FLJ10873, MGC150689, MGC87276, MGC117360	uc001vmt.3	Q9NYU1	OTTHUMG00000017230	ENST00000376747.3:c.2320G>T	13.37:g.96555290C>A	ENSP00000365938:p.Gly774Trp		A6NKL4|Q08AD0|Q5JQR8|Q8N5K0|Q9UFC4	Missense_Mutation	SNP	pfam_UDP-g_GGtrans,pfam_Glyco_trans_8	p.G774W	ENST00000376747.3	37	c.2320	CCDS9480.1	13	.	.	.	.	.	.	.	.	.	.	C	17.15	3.314915	0.60524	.	.	ENSG00000102595	ENST00000376747	T	0.09163	3.01	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.41003	0.1140	M	0.85710	2.77	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.33929	-0.9849	10	0.66056	D	0.02	-12.3422	19.7355	0.96200	0.0:1.0:0.0:0.0	.	774	Q9NYU1	UGGG2_HUMAN	W	774	ENSP00000365938:G774W	ENSP00000365938:G774W	G	-	1	0	UGGT2	95353291	1.000000	0.71417	0.892000	0.35008	0.389000	0.30415	6.523000	0.73787	2.669000	0.90835	0.650000	0.86243	GGG	UGGT2	-	NULL	ENSG00000102595		0.303	UGGT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGGT2	HGNC	protein_coding	OTTHUMT00000045507.1	117	0.00	0	C	NM_020121		96555290	96555290	-1	no_errors	ENST00000376747	ensembl	human	known	69_37n	missense	82	27.43	31	SNP	1.000	A
