#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAMDEC1	27299	genome.wustl.edu	37	8	24259508	24259508	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr8:24259508T>A	ENST00000256412.4	+	12	1443	c.1223T>A	c.(1222-1224)cTg>cAg	p.L408Q	ADAMDEC1_ENST00000522298.1_Missense_Mutation_p.L329Q|ADAMDEC1_ENST00000538205.1_Missense_Mutation_p.L329Q|RP11-624C23.1_ENST00000519689.1_RNA|RP11-624C23.1_ENST00000523578.1_RNA	NM_014479.3	NP_055294.1	O15204	ADEC1_HUMAN	ADAM-like, decysin 1	408	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				immune response (GO:0006955)|negative regulation of cell adhesion (GO:0007162)	extracellular region (GO:0005576)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|large_intestine(4)|skin(2)|stomach(1)	9		Prostate(55;0.0181)		Colorectal(74;0.016)|COAD - Colon adenocarcinoma(73;0.0646)|BRCA - Breast invasive adenocarcinoma(99;0.168)		CCAAAGTGCCTGCTGCAAGCA	0.413																																					Ovarian(147;687 1849 3699 25981 31337)	dbGAP											0													106.0	106.0	106.0					8																	24259508		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y13323	CCDS6044.1, CCDS55212.1	8p12	2008-08-07			ENSG00000134028	ENSG00000134028			16299	protein-coding gene	gene with protein product		606393				9271581, 12037602	Standard	NM_001145271		Approved	M12.219	uc003xdz.2	O15204	OTTHUMG00000097858	ENST00000256412.4:c.1223T>A	8.37:g.24259508T>A	ENSP00000256412:p.Leu408Gln		B7ZAK5	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B	p.L408Q	ENST00000256412.4	37	c.1223	CCDS6044.1	8	.	.	.	.	.	.	.	.	.	.	T	15.43	2.831970	0.50845	.	.	ENSG00000134028	ENST00000256412;ENST00000538205;ENST00000522298	T;T;T	0.73789	-0.78;-0.78;-0.78	6.16	6.16	0.99307	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.268007	0.27340	N	0.019803	D	0.89269	0.6667	M	0.93241	3.395	0.31507	N	0.664046	D	0.89917	1.0	D	0.87578	0.998	D	0.91579	0.5277	10	0.87932	D	0	0.0044	13.1979	0.59749	0.0:0.0:0.0:1.0	.	408	O15204	ADEC1_HUMAN	Q	408;329;329	ENSP00000256412:L408Q;ENSP00000442592:L329Q;ENSP00000428993:L329Q	ENSP00000256412:L408Q	L	+	2	0	ADAMDEC1	24315453	0.198000	0.23374	0.412000	0.26496	0.209000	0.24338	4.531000	0.60602	2.367000	0.80283	0.528000	0.53228	CTG	ADAMDEC1	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000134028		0.413	ADAMDEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMDEC1	HGNC	protein_coding	OTTHUMT00000215149.2	102	0.00	0	T	NM_014479		24259508	24259508	+1	no_errors	ENST00000256412	ensembl	human	known	69_37n	missense	133	16.88	27	SNP	0.771	A
ADAMTS20	80070	genome.wustl.edu	37	12	43837653	43837653	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr12:43837653G>A	ENST00000389420.3	-	16	2230	c.2231C>T	c.(2230-2232)gCa>gTa	p.A744V	ADAMTS20_ENST00000553158.1_Missense_Mutation_p.A744V	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	744	Spacer.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		AACGTTTGTTGCTCCTGCGGG	0.383																																						dbGAP											0													184.0	180.0	181.0					12																	43837653		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.2231C>T	12.37:g.43837653G>A	ENSP00000374071:p.Ala744Val		A6NNC9|J3QT00	Missense_Mutation	SNP	pfam_Pept_M12B_GON-ADAMTSs,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS,pfscan_Pept_M12B_GON-ADAMTSs,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B	p.A744V	ENST00000389420.3	37	c.2231	CCDS31778.2	12	.	.	.	.	.	.	.	.	.	.	G	32	5.135771	0.94517	.	.	ENSG00000173157	ENST00000389420;ENST00000553158;ENST00000389417	T;T	0.69926	-0.44;-0.44	4.92	4.92	0.64577	ADAM-TS Spacer 1 (1);	0.000000	0.50627	D	0.000117	D	0.87458	0.6182	H	0.95224	3.64	0.80722	D	1	D	0.71674	0.998	D	0.72338	0.977	D	0.91130	0.4937	10	0.87932	D	0	.	19.0131	0.92882	0.0:0.0:1.0:0.0	.	744	P59510	ATS20_HUMAN	V	744	ENSP00000374071:A744V;ENSP00000448341:A744V	ENSP00000374068:A744V	A	-	2	0	ADAMTS20	42123920	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.274000	0.95731	2.664000	0.90586	0.655000	0.94253	GCA	ADAMTS20	-	pfam_ADAM_spacer1	ENSG00000173157		0.383	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS20	HGNC	protein_coding	OTTHUMT00000403643.1	220	0.00	0	G	NM_025003		43837653	43837653	-1	no_errors	ENST00000389420	ensembl	human	known	69_37n	missense	154	21.03	41	SNP	1.000	A
AFG3L2	10939	genome.wustl.edu	37	18	12337422	12337422	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr18:12337422T>C	ENST00000269143.3	-	16	2324	c.2093A>G	c.(2092-2094)gAt>gGt	p.D698G		NM_006796.2	NP_006787.2	Q9Y4W6	AFG32_HUMAN	AFG3-like AAA ATPase 2	698					axonogenesis (GO:0007409)|cell death (GO:0008219)|cristae formation (GO:0042407)|mitochondrial fusion (GO:0008053)|mitochondrial protein processing (GO:0034982)|muscle fiber development (GO:0048747)|myelination (GO:0042552)|nerve development (GO:0021675)|neuromuscular junction development (GO:0007528)|regulation of multicellular organism growth (GO:0040014)|righting reflex (GO:0060013)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(12)|prostate(3)|skin(1)|stomach(3)|urinary_tract(1)	27					Adenosine triphosphate(DB00171)	TACTTCATCATCTATCAATCT	0.438																																						dbGAP											0													125.0	118.0	120.0					18																	12337422		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y18314	CCDS11859.1	18p11.21	2014-09-17	2013-10-17		ENSG00000141385	ENSG00000141385		"""ATPases / AAA-type"""	315	protein-coding gene	gene with protein product		604581	"""AFG3 (ATPase family gene 3, yeast)-like 2"", ""spinocerebellar ataxia 28"", ""AFG3 ATPase family gene 3-like 2 (yeast)"", ""AFG3 ATPase family gene 3-like 2 (S. cerevisiae)"", ""AFG3 ATPase family member 3-like 2 (S. cerevisiae)"""	SCA28		10395799, 18769991	Standard	NM_006796		Approved	SPAX5	uc002kqz.2	Q9Y4W6	OTTHUMG00000131695	ENST00000269143.3:c.2093A>G	18.37:g.12337422T>C	ENSP00000269143:p.Asp698Gly		Q6P1L0	Missense_Mutation	SNP	pfam_Peptidase_M41,pfam_ATPase_AAA_core,pfam_Pept_M41_FtsH_extracell,smart_AAA+_ATPase,tigrfam_FtsH	p.D698G	ENST00000269143.3	37	c.2093	CCDS11859.1	18	.	.	.	.	.	.	.	.	.	.	T	26.2	4.716990	0.89205	.	.	ENSG00000141385	ENST00000269143;ENST00000537174	D	0.89681	-2.55	5.62	5.62	0.85841	Peptidase M41 (1);Peptidase M41, FtsH (2);	0.044993	0.85682	D	0.000000	D	0.97315	0.9122	H	0.99689	4.705	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.99264	1.0891	10	0.87932	D	0	-2.587	15.8226	0.78667	0.0:0.0:0.0:1.0	.	698	Q9Y4W6	AFG32_HUMAN	G	698;713	ENSP00000269143:D698G	ENSP00000269143:D698G	D	-	2	0	AFG3L2	12327422	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.623000	0.83113	2.146000	0.66826	0.533000	0.62120	GAT	AFG3L2	-	pfam_Peptidase_M41,tigrfam_FtsH	ENSG00000141385		0.438	AFG3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFG3L2	HGNC	protein_coding	OTTHUMT00000254603.2	158	0.00	0	T	NM_006796		12337422	12337422	-1	no_errors	ENST00000269143	ensembl	human	known	69_37n	missense	78	28.44	31	SNP	1.000	C
AKNA	80709	genome.wustl.edu	37	9	117120245	117120245	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr9:117120245G>A	ENST00000307564.4	-	12	2856	c.2695C>T	c.(2695-2697)Ctt>Ttt	p.L899F	AKNA_ENST00000374075.5_Missense_Mutation_p.L818F|AKNA_ENST00000374088.3_Missense_Mutation_p.L899F|AKNA_ENST00000223791.3_Missense_Mutation_p.L359F	NM_030767.4	NP_110394.3	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	899					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(7)|liver(2)|lung(22)|ovary(4)|stomach(2)	51						TTCTGTGGAAGGCGCTCAGAG	0.632																																						dbGAP											0													55.0	55.0	55.0					9																	117120245		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK024431	CCDS6805.1	9q32	2008-02-05			ENSG00000106948	ENSG00000106948			24108	protein-coding gene	gene with protein product		605729				11268217, 11853319	Standard	NM_030767		Approved	KIAA1968	uc004bis.3	Q7Z591	OTTHUMG00000020538	ENST00000307564.4:c.2695C>T	9.37:g.117120245G>A	ENSP00000303769:p.Leu899Phe		Q05BK5|Q5T535|Q5T536|Q5T537|Q64FX6|Q64FX7|Q64FX8|Q64FY2|Q6ZMK0|Q6ZNL2|Q6ZTX0|Q8TET1|Q8TF33|Q96RR9|Q9H7P7	Missense_Mutation	SNP	pfam_TF_AT-hook	p.L899F	ENST00000307564.4	37	c.2695	CCDS6805.1	9	.	.	.	.	.	.	.	.	.	.	G	16.53	3.149818	0.57151	.	.	ENSG00000106948	ENST00000307564;ENST00000374088;ENST00000223791;ENST00000374075	T;T;T;T	0.22539	2.19;2.19;1.95;2.19	3.79	2.89	0.33648	.	0.165632	0.26923	N	0.021802	T	0.32102	0.0818	L	0.50333	1.59	0.25600	N	0.986607	D;D	0.71674	0.998;0.99	P;P	0.62649	0.905;0.885	T	0.03157	-1.1066	10	0.66056	D	0.02	-3.7544	7.225	0.26010	0.1202:0.0:0.8798:0.0	.	899;818	Q7Z591;Q7Z591-2	AKNA_HUMAN;.	F	899;899;359;818	ENSP00000303769:L899F;ENSP00000363201:L899F;ENSP00000223791:L359F;ENSP00000363188:L818F	ENSP00000223791:L359F	L	-	1	0	AKNA	116160066	0.988000	0.35896	0.135000	0.22099	0.253000	0.25986	2.878000	0.48515	1.185000	0.42971	0.442000	0.29010	CTT	AKNA	-	NULL	ENSG00000106948		0.632	AKNA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	AKNA	HGNC	protein_coding	OTTHUMT00000053767.2	86	0.00	0	G	NM_030767		117120245	117120245	-1	no_errors	ENST00000307564	ensembl	human	known	69_37n	missense	65	20.73	17	SNP	0.145	A
ANKRD36C	400986	genome.wustl.edu	37	2	96521508	96521508	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr2:96521508G>A	ENST00000456556.1	-	63	4585	c.4501C>T	c.(4501-4503)Cat>Tat	p.H1501Y	ANKRD36C_ENST00000419039.2_Missense_Mutation_p.H528Y|ANKRD36C_ENST00000420871.2_Missense_Mutation_p.H752Y			Q5JPF3	AN36C_HUMAN	ankyrin repeat domain 36C	1501							ion channel inhibitor activity (GO:0008200)			breast(1)|endometrium(8)|kidney(5)|lung(4)	18						TCCTGTAAATGACAACATTTA	0.398																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AL832836		2q11.1	2013-01-10			ENSG00000174501	ENSG00000174501		"""Ankyrin repeat domain containing"""	32946	protein-coding gene	gene with protein product	"""protein immuno-reactive with anti-PTH polyclonal antibodies"""						Standard	XR_251121		Approved	DKFZp667P0924	uc002suz.1	Q5JPF3	OTTHUMG00000155211	ENST00000456556.1:c.4501C>T	2.37:g.96521508G>A	ENSP00000403302:p.His1501Tyr		C9JZ08|Q15694|Q53S06|Q658V2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.H1501Y	ENST00000456556.1	37	c.4501		2	.	.	.	.	.	.	.	.	.	.	g	9.976	1.226756	0.22542	.	.	ENSG00000174501	ENST00000420871;ENST00000456556;ENST00000419039	T;T;T	0.14640	2.49;2.49;2.49	1.87	-0.0412	0.13869	.	.	.	.	.	T	0.18551	0.0445	M	0.64404	1.975	0.20638	N	0.999878	.	.	.	.	.	.	T	0.21415	-1.0246	7	0.66056	D	0.02	.	5.6893	0.17821	0.329:0.0:0.671:0.0	.	.	.	.	Y	752;1501;528	ENSP00000415231:H752Y;ENSP00000403302:H1501Y;ENSP00000407838:H528Y	ENSP00000407838:H528Y	H	-	1	0	AC073995.2	95885235	0.862000	0.29867	0.589000	0.28718	0.680000	0.39746	1.597000	0.36729	-0.026000	0.13895	0.313000	0.20887	CAT	ANKRD36C	-	NULL	ENSG00000174501		0.398	ANKRD36C-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	ANKRD36C	HGNC	protein_coding	OTTHUMT00000338799.2	144	0.00	0	G	NM_001010914		96521508	96521508	-1	no_errors	ENST00000456556	ensembl	human	known	69_37n	missense	101	25.19	34	SNP	0.926	A
AOC2	314	genome.wustl.edu	37	17	41002222	41002222	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr17:41002222G>T	ENST00000253799.3	+	4	2155	c.2128G>T	c.(2128-2130)Gac>Tac	p.D710Y	AOC2_ENST00000452774.2_Missense_Mutation_p.D683Y|AOC3_ENST00000308423.2_5'Flank	NM_009590.2	NP_033720.2	O75106	AOC2_HUMAN	amine oxidase, copper containing 2 (retina-specific)	710					amine metabolic process (GO:0009308)|catecholamine metabolic process (GO:0006584)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	aliphatic-amine oxidase activity (GO:0052595)|aminoacetone:oxygen oxidoreductase(deaminating) activity (GO:0052594)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|phenethylamine:oxygen oxidoreductase (deaminating) activity (GO:0052596)|primary amine oxidase activity (GO:0008131)|quinone binding (GO:0048038)|tryptamine:oxygen oxidoreductase (deaminating) activity (GO:0052593)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(14)|ovary(4)|skin(2)	30		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)		CTTTGATGAGGACCCCTCCAT	0.572																																						dbGAP											0													206.0	208.0	207.0					17																	41002222		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF081363	CCDS11443.1, CCDS45690.1	17q21	2012-07-13				ENSG00000131480	1.4.3.21		549	protein-coding gene	gene with protein product		602268				9119395, 9722954	Standard	NM_001158		Approved	RAO, DAO2	uc002ibu.3	O75106		ENST00000253799.3:c.2128G>T	17.37:g.41002222G>T	ENSP00000253799:p.Asp710Tyr		A5PKW2|O00120|O75105|Q4TTW5|Q9UNY0	Missense_Mutation	SNP	pfam_Cu_amine_oxidase_C,pfam_Cu_amine_oxidase_N3,pfam_Cu_amine_oxidase_N2,superfamily_Cu_amine_oxidase_C,superfamily_Cu_amine_oxidase_N-reg,prints_Cu_amine_oxidase	p.D710Y	ENST00000253799.3	37	c.2128	CCDS11443.1	17	.	.	.	.	.	.	.	.	.	.	G	23.5	4.421491	0.83559	.	.	ENSG00000131480	ENST00000253799;ENST00000452774	T;T	0.04862	3.54;3.54	5.19	5.19	0.71726	Copper amine oxidase, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.34048	0.0884	M	0.90705	3.14	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.997	T	0.39057	-0.9632	10	0.87932	D	0	-2.813	18.7224	0.91700	0.0:0.0:1.0:0.0	.	710;683	O75106;O75106-2	AOC2_HUMAN;.	Y	710;683	ENSP00000253799:D710Y;ENSP00000406134:D683Y	ENSP00000253799:D710Y	D	+	1	0	AOC2	38255748	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.841000	0.86834	2.426000	0.82243	0.561000	0.74099	GAC	AOC2	-	pfam_Cu_amine_oxidase_C,superfamily_Cu_amine_oxidase_C	ENSG00000131480		0.572	AOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AOC2	HGNC	protein_coding	OTTHUMT00000452442.1	550	0.00	0	G	NM_009590, NM_001158		41002222	41002222	+1	no_errors	ENST00000253799	ensembl	human	known	69_37n	missense	380	24.30	122	SNP	1.000	T
ARAP3	64411	genome.wustl.edu	37	5	141052414	141052415	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr5:141052414_141052415insG	ENST00000239440.4	-	8	1236_1237	c.1171_1172insC	c.(1171-1173)caafs	p.Q391fs	ARAP3_ENST00000513878.1_Frame_Shift_Ins_p.Q53fs|ARAP3_ENST00000508305.1_Frame_Shift_Ins_p.Q313fs	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	391					cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						TCGGGGTGGTTGGGGGGGCCGG	0.658																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.1172dupC	5.37:g.141052421_141052421dupG	ENSP00000239440:p.Gln391fs		B4DIT1|D3DQE3	Frame_Shift_Ins	INS	pfam_RhoGAP_dom,pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ras-assoc,pfam_SAM_2,pfam_SAM_type1,superfamily_Rho_GTPase_activation_prot,superfamily_ArfGAP,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.Q391fs	ENST00000239440.4	37	c.1172_1171	CCDS4266.1	5																																																																																			ARAP3	-	NULL	ENSG00000120318		0.658	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARAP3	HGNC	protein_coding	OTTHUMT00000251805.1	28	0.00	0	-	NM_022481		141052414	141052415	-1	no_errors	ENST00000239440	ensembl	human	known	69_37n	frame_shift_ins	27	10.00	3	INS	0.039:0.035	G
ARHGEF4	50649	genome.wustl.edu	37	2	131688585	131688585	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr2:131688585G>T	ENST00000326016.5	+	3	574	c.55G>T	c.(55-57)Gcg>Tcg	p.A19S	SCARNA4_ENST00000517020.2_RNA|ARHGEF4_ENST00000409303.1_Missense_Mutation_p.A19S|ARHGEF4_ENST00000392953.3_Missense_Mutation_p.A19S|ARHGEF4_ENST00000525839.1_Missense_Mutation_p.A19S|ARHGEF4_ENST00000428230.2_Missense_Mutation_p.A19S|ARHGEF4_ENST00000409359.1_Missense_Mutation_p.A875S	NM_015320.2	NP_056135.2	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor (GEF) 4	19					apoptotic signaling pathway (GO:0097190)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein domain specific binding (GO:0019904)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(4)	29		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		CAGTCAGAAGGCGTTCCACAT	0.592																																						dbGAP											0													71.0	65.0	67.0					2																	131688585		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL137289	CCDS2165.1, CCDS42754.1	2q22	2013-01-10			ENSG00000136002	ENSG00000136002		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	684	protein-coding gene	gene with protein product	"""APC-stimulated guanine nucleotide exchange factor"""	605216				10873612	Standard	NM_015320		Approved	STM6, KIAA1112, ASEF	uc002tsa.1	Q9NR80	OTTHUMG00000131657	ENST00000326016.5:c.55G>T	2.37:g.131688585G>T	ENSP00000316845:p.Ala19Ser		Q9HDC6|Q9UPP0	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_SH3_domain,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.A19S	ENST00000326016.5	37	c.55	CCDS2165.1	2	.	.	.	.	.	.	.	.	.	.	G	11.80	1.745584	0.30955	.	.	ENSG00000136002	ENST00000409359;ENST00000326016;ENST00000392953;ENST00000438985;ENST00000428230;ENST00000525839;ENST00000409303	T;T;T;T;T;T;T	0.70986	0.96;-0.24;-0.36;0.99;0.91;-0.36;-0.53	4.72	1.67	0.24075	.	.	.	.	.	T	0.58075	0.2097	L	0.29908	0.895	0.09310	N	1	B;P;B;B	0.40332	0.003;0.713;0.009;0.003	B;B;B;B	0.43575	0.004;0.424;0.009;0.004	T	0.51949	-0.8640	9	0.72032	D	0.01	.	3.161	0.06520	0.2318:0.0:0.559:0.2092	.	19;875;19;19	E9PEM0;E7EV07;Q9NR80-4;Q9NR80	.;.;.;ARHG4_HUMAN	S	875;19;19;199;19;19;19	ENSP00000386794:A875S;ENSP00000316845:A19S;ENSP00000376680:A19S;ENSP00000389661:A199S;ENSP00000398455:A19S;ENSP00000432267:A19S;ENSP00000387285:A19S	ENSP00000316845:A19S	A	+	1	0	ARHGEF4	131405055	0.004000	0.15560	0.002000	0.10522	0.008000	0.06430	0.277000	0.18734	0.391000	0.25143	0.467000	0.42956	GCG	ARHGEF4	-	NULL	ENSG00000136002		0.592	ARHGEF4-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	ARHGEF4	HGNC	protein_coding	OTTHUMT00000254554.4	142	0.00	0	G			131688585	131688585	+1	no_errors	ENST00000326016	ensembl	human	known	69_37n	missense	102	19.05	24	SNP	0.003	T
ASB8	140461	genome.wustl.edu	37	12	48543359	48543359	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr12:48543359T>G	ENST00000317697.3	-	4	826	c.657A>C	c.(655-657)gaA>gaC	p.E219D	ASB8_ENST00000536549.1_Missense_Mutation_p.E219D|ASB8_ENST00000537754.1_5'UTR|ASB8_ENST00000536953.1_3'UTR	NM_024095.3	NP_077000.1	Q9H765	ASB8_HUMAN	ankyrin repeat and SOCS box containing 8	219					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				breast(1)|kidney(2)|large_intestine(2)|lung(5)|soft_tissue(1)	11						TTTTCCTCAATTCAAAGTGTC	0.522																																						dbGAP											0													77.0	79.0	78.0					12																	48543359		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK024908	CCDS8761.1	12q13.12	2013-01-10	2011-01-25			ENSG00000177981		"""Ankyrin repeat domain containing"""	17183	protein-coding gene	gene with protein product		615053	"""ankyrin repeat and SOCS box-containing 8"""			12076535	Standard	NM_024095		Approved	MGC5540, FLJ21255	uc001rrh.3	Q9H765		ENST00000317697.3:c.657A>C	12.37:g.48543359T>G	ENSP00000320893:p.Glu219Asp		A8K1P2|Q547Q2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C	p.E219D	ENST00000317697.3	37	c.657	CCDS8761.1	12	.	.	.	.	.	.	.	.	.	.	T	20.7	4.036013	0.75617	.	.	ENSG00000177981	ENST00000317697;ENST00000536549;ENST00000446549	T;T	0.41758	0.99;0.99	5.19	4.04	0.47022	Ankyrin repeat-containing domain (1);	0.096479	0.64402	D	0.000001	T	0.27967	0.0689	L	0.27053	0.805	0.80722	D	1	B	0.19200	0.034	B	0.14023	0.01	T	0.09058	-1.0692	10	0.41790	T	0.15	-18.621	8.9349	0.35693	0.0:0.1402:0.0:0.8598	.	219	Q9H765	ASB8_HUMAN	D	219;219;186	ENSP00000320893:E219D;ENSP00000445622:E219D	ENSP00000320893:E219D	E	-	3	2	ASB8	46829626	0.991000	0.36638	1.000000	0.80357	0.979000	0.70002	0.241000	0.18065	2.103000	0.63969	0.533000	0.62120	GAA	ASB8	-	superfamily_Ankyrin_rpt-contain_dom	ENSG00000177981		0.522	ASB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB8	HGNC	protein_coding	OTTHUMT00000396497.1	77	0.00	0	T			48543359	48543359	-1	no_errors	ENST00000317697	ensembl	human	known	69_37n	missense	126	11.27	16	SNP	1.000	G
BAZ1A	11177	genome.wustl.edu	37	14	35231037	35231037	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr14:35231037G>A	ENST00000382422.2	-	23	4496	c.4169C>T	c.(4168-4170)tCt>tTt	p.S1390F	BAZ1A_ENST00000358716.4_Missense_Mutation_p.S1358F|BAZ1A_ENST00000360310.1_Missense_Mutation_p.S1390F			Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	1390					chromatin remodeling (GO:0006338)|DNA-dependent DNA replication (GO:0006261)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	ACF complex (GO:0016590)|CHRAC (GO:0008623)|nuclear chromosome (GO:0000228)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(2)|large_intestine(7)|lung(19)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		AATATTTACAGATCTTGACTG	0.378																																						dbGAP											0													169.0	167.0	168.0					14																	35231037		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB032252	CCDS9651.1, CCDS41943.1	14q13.2	2013-01-28			ENSG00000198604	ENSG00000198604		"""Zinc fingers, PHD-type"""	960	protein-coding gene	gene with protein product		605680				10662543	Standard	NM_013448		Approved	hACF1, ACF1, WALp1, WCRF180	uc001wsk.3	Q9NRL2	OTTHUMG00000140216	ENST00000382422.2:c.4169C>T	14.37:g.35231037G>A	ENSP00000371859:p.Ser1390Phe		Q9NZ15|Q9P065|Q9UIG1|Q9Y3V3	Missense_Mutation	SNP	pfam_WSTF_Acf1_Cbp146,pfam_Bromodomain,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_WSTF_Acf1_Cbp146,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.S1390F	ENST00000382422.2	37	c.4169	CCDS9651.1	14	.	.	.	.	.	.	.	.	.	.	.	12.96	2.094802	0.36952	.	.	ENSG00000198604	ENST00000358716;ENST00000382422;ENST00000360310;ENST00000543083	T;T;T	0.59364	0.27;0.27;0.27	5.95	4.88	0.63580	.	1.038400	0.07528	N	0.911740	T	0.45316	0.1336	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.18272	-1.0342	10	0.59425	D	0.04	.	10.3239	0.43781	0.1103:0.0:0.7578:0.132	.	1358;1390	Q9NRL2-2;Q9NRL2	.;BAZ1A_HUMAN	F	1358;1390;1390;1042	ENSP00000351555:S1358F;ENSP00000371859:S1390F;ENSP00000353458:S1390F	ENSP00000351555:S1358F	S	-	2	0	BAZ1A	34300788	0.998000	0.40836	0.763000	0.31416	0.967000	0.64934	2.290000	0.43531	2.817000	0.96982	0.563000	0.77884	TCT	BAZ1A	-	NULL	ENSG00000198604		0.378	BAZ1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAZ1A	HGNC	protein_coding	OTTHUMT00000276646.1	253	0.00	0	G			35231037	35231037	-1	no_errors	ENST00000360310	ensembl	human	known	69_37n	missense	398	17.39	84	SNP	0.002	A
C12orf57	113246	genome.wustl.edu	37	12	7053758	7053761	+	Frame_Shift_Del	DEL	GCCA	GCCA	-	rs11553333		TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	GCCA	GCCA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr12:7053758_7053761delGCCA	ENST00000229281.5	+	2	271_274	c.172_175delGCCA	c.(172-177)gccacgfs	p.AT58fs	C12orf57_ENST00000542222.1_3'UTR|PTPN6_ENST00000447931.2_5'Flank|C12orf57_ENST00000537087.1_Intron|U47924.31_ENST00000607421.1_RNA|C12orf57_ENST00000544681.1_Frame_Shift_Del_p.AT58fs|PTPN6_ENST00000399448.1_5'Flank|RNU7-1_ENST00000458811.1_RNA|C12orf57_ENST00000540506.2_Frame_Shift_Del_p.AT23fs	NM_138425.2	NP_612434.1	Q99622	C10_HUMAN	chromosome 12 open reading frame 57	58						cytoplasm (GO:0005737)				kidney(1)|large_intestine(1)	2						GCTGCCCGTGGCCACGCAGATCCA	0.632											OREG0021642	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U47924	CCDS8571.1	12p13.31	2012-05-30			ENSG00000111678	ENSG00000111678			29521	protein-coding gene	gene with protein product		615140				9445485	Standard	NM_138425		Approved	GRCC10, C10	uc009zfj.2	Q99622	OTTHUMG00000169017	ENST00000229281.5:c.172_175delGCCA	12.37:g.7053758_7053761delGCCA	ENSP00000229281:p.Ala58fs	638	B2R4Q6	Frame_Shift_Del	DEL	NULL	p.A58fs	ENST00000229281.5	37	c.172_175	CCDS8571.1	12																																																																																			C12orf57	-	NULL	ENSG00000111678		0.632	C12orf57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf57	HGNC	protein_coding	OTTHUMT00000401959.1	26	0.00	0	GCCA	NM_138425		7053758	7053761	+1	no_errors	ENST00000229281	ensembl	human	known	69_37n	frame_shift_del	21	16.00	4	DEL	1.000:1.000:1.000:1.000	-
C12orf57	113246	genome.wustl.edu	37	12	7053762	7053763	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr12:7053762_7053763insT	ENST00000229281.5	+	2	275_276	c.176_177insT	c.(175-180)acgcagfs	p.Q60fs	C12orf57_ENST00000542222.1_3'UTR|PTPN6_ENST00000447931.2_5'Flank|C12orf57_ENST00000537087.1_Intron|U47924.31_ENST00000607421.1_RNA|C12orf57_ENST00000544681.1_Frame_Shift_Ins_p.Q60fs|PTPN6_ENST00000399448.1_5'Flank|RNU7-1_ENST00000458811.1_RNA|C12orf57_ENST00000540506.2_Frame_Shift_Ins_p.Q25fs	NM_138425.2	NP_612434.1	Q99622	C10_HUMAN	chromosome 12 open reading frame 57	60						cytoplasm (GO:0005737)				kidney(1)|large_intestine(1)	2						CCCGTGGCCACGCAGATCCAGC	0.629											OREG0021642	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U47924	CCDS8571.1	12p13.31	2012-05-30			ENSG00000111678	ENSG00000111678			29521	protein-coding gene	gene with protein product		615140				9445485	Standard	NM_138425		Approved	GRCC10, C10	uc009zfj.2	Q99622	OTTHUMG00000169017	Exception_encountered	12.37:g.7053762_7053763insT	ENSP00000229281:p.Gln60fs	638	B2R4Q6	Frame_Shift_Ins	INS	NULL	p.Q60fs	ENST00000229281.5	37	c.176_177	CCDS8571.1	12																																																																																			C12orf57	-	NULL	ENSG00000111678		0.629	C12orf57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf57	HGNC	protein_coding	OTTHUMT00000401959.1	26	0.00	0	-	NM_138425		7053762	7053763	+1	no_errors	ENST00000229281	ensembl	human	known	69_37n	frame_shift_ins	21	16.00	4	INS	1.000:1.000	T
C5orf42	65250	genome.wustl.edu	37	5	37157925	37157925	+	Intron	SNP	G	G	C			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr5:37157925G>C	ENST00000508244.1	-	39	7906				C5orf42_ENST00000425232.2_Intron|C5orf42_ENST00000274258.7_Missense_Mutation_p.L1500V			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42							integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			TCCTGTAGAAGATCATTAGCT	0.363																																						dbGAP											0													76.0	69.0	71.0					5																	37157925		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0				CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.7813-9C>G	5.37:g.37157925G>C			A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	NULL	p.L1500V	ENST00000508244.1	37	c.4498	CCDS34146.2	5	.	.	.	.	.	.	.	.	.	.	G	17.10	3.302581	0.60195	.	.	ENSG00000197603	ENST00000274258;ENST00000514429;ENST00000388739	T;T	0.28069	1.63;1.65	5.43	4.56	0.56223	.	0.000000	0.37906	N	0.001900	T	0.15782	0.0380	.	.	.	0.23162	N	0.99819	P	0.35780	0.52	B	0.27170	0.077	T	0.12837	-1.0532	8	.	.	.	.	7.9814	0.30185	0.0833:0.0:0.7456:0.1712	.	1500	Q9H799	CE042_HUMAN	V	1500;1668;1500	ENSP00000274258:L1500V;ENSP00000424223:L1668V	.	L	-	1	0	C5orf42	37193682	0.996000	0.38824	0.980000	0.43619	0.967000	0.64934	2.641000	0.46587	2.534000	0.85438	0.561000	0.74099	CTT	C5orf42	-	NULL	ENSG00000197603		0.363	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C5orf42	HGNC	protein_coding	OTTHUMT00000360806.1	65	0.00	0	G	NM_023073		37157925	37157925	-1	no_errors	ENST00000274258	ensembl	human	known	69_37n	missense	54	29.87	23	SNP	0.939	C
C9orf3	84909	genome.wustl.edu	37	9	97522520	97522520	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr9:97522520C>T	ENST00000375315.2	+	1	455	c.455C>T	c.(454-456)tCt>tTt	p.S152F	C9orf3_ENST00000277198.2_Missense_Mutation_p.S152F|C9orf3_ENST00000297979.5_Missense_Mutation_p.S152F	NM_001193329.1	NP_001180258.1	Q8N6M6	AMPO_HUMAN	chromosome 9 open reading frame 3	152					leukotriene biosynthetic process (GO:0019370)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(323;0.000275)		TGTGATTTATCTGTGTTAAAA	0.458																																						dbGAP											0													188.0	188.0	188.0					9																	97522520		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF043896	CCDS6713.1, CCDS55327.1, CCDS55328.1	9q22	2013-06-27			ENSG00000148120	ENSG00000148120			1361	protein-coding gene	gene with protein product	aminopeptidase O					15687497	Standard	NM_001193329		Approved	C90RF3, FLJ14675, APO, AOPEP, AP-O	uc004ava.3	Q8N6M6	OTTHUMG00000020276	ENST00000375315.2:c.455C>T	9.37:g.97522520C>T	ENSP00000364464:p.Ser152Phe		Q5T9B1|Q5T9B3|Q5T9B4|Q8WUL6|Q96M23|Q96SS1	Missense_Mutation	SNP	pfam_Peptidase_M1_N,pfam_Peptidase_M1_C,superfamily_ARM-type_fold	p.S152F	ENST00000375315.2	37	c.455	CCDS55328.1	9	.	.	.	.	.	.	.	.	.	.	C	14.36	2.512620	0.44660	.	.	ENSG00000148120	ENST00000277198;ENST00000297979;ENST00000375315;ENST00000427193	T;T;T;T	0.04603	3.59;3.59;3.59;3.59	4.82	3.91	0.45181	.	0.149202	0.46758	D	0.000275	T	0.18841	0.0452	M	0.66939	2.045	0.80722	D	1	D;D;D;D	0.76494	0.992;0.999;0.998;0.997	P;D;D;D	0.70227	0.901;0.968;0.935;0.954	T	0.01078	-1.1459	10	0.87932	D	0	-8.9705	15.4264	0.75055	0.0:0.8604:0.1396:0.0	.	152;152;152;152	Q8N6M6;Q8N6M6-4;Q8N6M6-2;Q8N6M6-3	AMPO_HUMAN;.;.;.	F	152;152;152;26	ENSP00000277198:S152F;ENSP00000297979:S152F;ENSP00000364464:S152F;ENSP00000387736:S26F	ENSP00000277198:S152F	S	+	2	0	C9orf3	96562341	0.997000	0.39634	0.999000	0.59377	0.997000	0.91878	3.384000	0.52478	1.360000	0.45960	0.563000	0.77884	TCT	C9orf3	-	NULL	ENSG00000148120		0.458	C9orf3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf3	HGNC	protein_coding		503	0.00	0	C	NM_032823		97522520	97522520	+1	no_errors	ENST00000375315	ensembl	human	known	69_37n	missense	509	17.48	108	SNP	0.998	T
CCDC155	147872	genome.wustl.edu	37	19	49898468	49898468	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr19:49898468G>T	ENST00000447857.3	+	4	459	c.254G>T	c.(253-255)gGg>gTg	p.G85V		NM_144688.4	NP_653289.3	Q8N6L0	KASH5_HUMAN	coiled-coil domain containing 155	85						chromosome, telomeric region (GO:0000781)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(10)|ovary(1)|stomach(1)	22						GACCCCAATGGGGAGGGCCCT	0.607																																						dbGAP											0													88.0	91.0	90.0					19																	49898468		2056	4204	6260	-	-	-	SO:0001583	missense	0				CCDS46140.1	19q13.33	2014-01-21			ENSG00000161609	ENSG00000161609			26520	protein-coding gene	gene with protein product							Standard	NM_144688		Approved	FLJ32658, KASH5	uc002pnm.2	Q8N6L0	OTTHUMG00000183170	ENST00000447857.3:c.254G>T	19.37:g.49898468G>T	ENSP00000404220:p.Gly85Val		Q96MC3	Missense_Mutation	SNP	NULL	p.G85V	ENST00000447857.3	37	c.254	CCDS46140.1	19	.	.	.	.	.	.	.	.	.	.	G	14.29	2.491503	0.44249	.	.	ENSG00000161609	ENST00000447857	T	0.67865	-0.29	4.35	3.3	0.37823	EF-hand-like domain (1);	0.254594	0.36234	N	0.002717	T	0.77452	0.4132	M	0.73962	2.25	0.22975	N	0.998487	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.65487	-0.6156	10	0.72032	D	0.01	0.0	7.5262	0.27656	0.1194:0.0:0.8806:0.0	.	85;85;165	C9JGW3;Q8N6L0;Q6ZRK4	.;CC155_HUMAN;.	V	85	ENSP00000404220:G85V	ENSP00000404220:G85V	G	+	2	0	CCDC155	54590280	0.400000	0.25295	0.518000	0.27811	0.631000	0.37964	1.359000	0.34113	2.156000	0.67533	0.462000	0.41574	GGG	CCDC155	-	NULL	ENSG00000161609		0.607	CCDC155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC155	HGNC	protein_coding	OTTHUMT00000465436.2	142	0.00	0	G	NM_144688		49898468	49898468	+1	no_errors	ENST00000447857	ensembl	human	known	69_37n	missense	99	30.77	44	SNP	0.114	T
CCT6B	10693	genome.wustl.edu	37	17	33266704	33266704	+	Missense_Mutation	SNP	C	C	G	rs113790777		TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr17:33266704C>G	ENST00000314144.5	-	9	1112	c.997G>C	c.(997-999)Gtg>Ctg	p.V333L	CCT6B_ENST00000421975.3_Missense_Mutation_p.V296L|CCT6B_ENST00000436961.3_Missense_Mutation_p.V288L	NM_006584.3	NP_006575.2	Q92526	TCPW_HUMAN	chaperonin containing TCP1, subunit 6B (zeta 2)	333					chaperone-mediated protein complex assembly (GO:0051131)|protein folding (GO:0006457)|protein transport (GO:0015031)|spermatogenesis (GO:0007283)	chaperonin-containing T-complex (GO:0005832)	ATP binding (GO:0005524)|protein transporter activity (GO:0008565)|unfolded protein binding (GO:0051082)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)	20		Ovarian(249;0.17)				AAAGAATTCACGGCCATTCCA	0.358																																						dbGAP											0													111.0	95.0	100.0					17																	33266704		2203	4300	6503	-	-	-	SO:0001583	missense	0			D78333	CCDS32617.1, CCDS54105.1, CCDS54106.1	17q	2011-09-02			ENSG00000132141	ENSG00000132141		"""Heat Shock Proteins / Chaperonins"""	1621	protein-coding gene	gene with protein product		610730				8812458, 9013858	Standard	NM_006584		Approved	Cctz2, TSA303	uc002hig.3	Q92526		ENST00000314144.5:c.997G>C	17.37:g.33266704C>G	ENSP00000327191:p.Val333Leu		B4DX20|B4DYB0|Q8TC34	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,prints_Chaperone_TCP-1,prints_Chaprnin_Cpn60,tigrfam_Chap_CCT_zeta	p.V333L	ENST00000314144.5	37	c.997	CCDS32617.1	17	.	.	.	.	.	.	.	.	.	.	c	0.050	-1.252298	0.01469	.	.	ENSG00000132141	ENST00000421975;ENST00000314144;ENST00000436961	T;T;T	0.79749	-1.3;-1.3;-1.3	4.7	-2.13	0.07144	.	0.161492	0.64402	N	0.000003	T	0.61451	0.2348	L	0.31420	0.93	0.25121	N	0.990643	B;B;B	0.12630	0.006;0.003;0.003	B;B;B	0.20184	0.028;0.023;0.014	T	0.42882	-0.9425	10	0.30078	T	0.28	-1.5555	3.3168	0.07036	0.2957:0.3:0.0:0.4044	.	288;296;333	B4DYB0;B4DX20;Q92526	.;.;TCPW_HUMAN	L	296;333;288	ENSP00000398044:V296L;ENSP00000327191:V333L;ENSP00000400917:V288L	ENSP00000327191:V333L	V	-	1	0	CCT6B	30290817	1.000000	0.71417	0.955000	0.39395	0.576000	0.36127	1.726000	0.38085	-0.167000	0.10871	-2.202000	0.00303	GTG	CCT6B	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,tigrfam_Chap_CCT_zeta	ENSG00000132141		0.358	CCT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT6B	HGNC	protein_coding	OTTHUMT00000448014.1	188	0.00	0	C	NM_006584		33266704	33266704	-1	no_errors	ENST00000314144	ensembl	human	known	69_37n	missense	203	15.06	36	SNP	0.995	G
CD19	930	genome.wustl.edu	37	16	28944363	28944363	+	Missense_Mutation	SNP	C	C	T	rs561660848		TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr16:28944363C>T	ENST00000324662.3	+	3	531	c.487C>T	c.(487-489)Cgc>Tgc	p.R163C	CD19_ENST00000567541.1_Missense_Mutation_p.R163C|CD19_ENST00000538922.1_Missense_Mutation_p.R163C			P15391	CD19_HUMAN	CD19 molecule	163					B cell receptor signaling pathway (GO:0050853)|cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor signaling protein activity (GO:0005057)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(4)|urinary_tract(1)	29						GGCCAAAGACCGCCCTGAGAT	0.642																																						dbGAP											0													43.0	37.0	39.0					16																	28944363		2197	4300	6497	-	-	-	SO:0001583	missense	0				CCDS10644.1, CCDS53998.1	16p11.2	2014-09-17	2006-03-28		ENSG00000177455	ENSG00000177455		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1633	protein-coding gene	gene with protein product		107265	"""CD19 antigen"""				Standard	NM_001770		Approved		uc010byo.2	P15391	OTTHUMG00000097049	ENST00000324662.3:c.487C>T	16.37:g.28944363C>T	ENSP00000313419:p.Arg163Cys		A0N0P9|F5H635|Q96S68|Q9BRD6	Missense_Mutation	SNP	smart_Ig_sub,pfscan_Ig-like	p.R163C	ENST00000324662.3	37	c.487	CCDS10644.1	16	.	.	.	.	.	.	.	.	.	.	C	16.38	3.106995	0.56291	.	.	ENSG00000177455	ENST00000538922;ENST00000324662;ENST00000537306	T;T	0.37752	1.18;1.19	5.3	-8.78	0.00824	.	3.609210	0.00659	N	0.000596	T	0.29588	0.0738	L	0.40543	1.245	0.09310	N	1	D;D	0.56521	0.976;0.958	P;B	0.46975	0.533;0.332	T	0.53837	-0.8382	10	0.72032	D	0.01	1.2609	4.8247	0.13410	0.457:0.2238:0.2523:0.0669	.	163;163	F5H635;P15391	.;CD19_HUMAN	C	163;163;12	ENSP00000437940:R163C;ENSP00000313419:R163C	ENSP00000313419:R163C	R	+	1	0	CD19	28851864	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.090000	0.03372	-1.549000	0.01710	-3.225000	0.00052	CGC	CD19	-	NULL	ENSG00000177455		0.642	CD19-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD19	HGNC	protein_coding	OTTHUMT00000214152.2	77	0.00	0	C			28944363	28944363	+1	no_errors	ENST00000538922	ensembl	human	known	69_37n	missense	83	13.54	13	SNP	0.000	T
COL15A1	1306	genome.wustl.edu	37	9	101765816	101765816	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr9:101765816G>T	ENST00000375001.3	+	8	1570	c.1147G>T	c.(1147-1149)Ggg>Tgg	p.G383W		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	383	4 X tandem repeats.|Nonhelical region 1 (NC1).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				TGTGCCCACCGGGGGACCAAC	0.592																																						dbGAP											0													66.0	71.0	69.0					9																	101765816		2203	4300	6503	-	-	-	SO:0001583	missense	0			L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.1147G>T	9.37:g.101765816G>T	ENSP00000364140:p.Gly383Trp		Q5T6J4|Q9UDC5|Q9Y4W4	Missense_Mutation	SNP	pfam_Collagenase_NC10/endostatin,pfam_Collagen,superfamily_C-type_lectin_fold,superfamily_ConA-like_lec_gl,smart_Laminin_G	p.G383W	ENST00000375001.3	37	c.1147	CCDS35081.1	9	.	.	.	.	.	.	.	.	.	.	G	10.49	1.365654	0.24684	.	.	ENSG00000204291	ENST00000375001;ENST00000536083	D	0.90563	-2.69	3.77	-1.16	0.09678	.	1.181720	0.06413	N	0.721050	D	0.89047	0.6604	L	0.32530	0.975	0.09310	N	1	D	0.60575	0.988	P	0.54706	0.759	T	0.79217	-0.1894	10	0.62326	D	0.03	0.7557	7.1516	0.25614	0.5549:0.0:0.4451:0.0	.	383	P39059	COFA1_HUMAN	W	383;353	ENSP00000364140:G383W	ENSP00000364140:G383W	G	+	1	0	COL15A1	100805637	0.000000	0.05858	0.000000	0.03702	0.112000	0.19704	-0.020000	0.12525	-0.248000	0.09583	-0.219000	0.12488	GGG	COL15A1	-	NULL	ENSG00000204291		0.592	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL15A1	HGNC	protein_coding	OTTHUMT00000053386.3	60	0.00	0	G	NM_001855		101765816	101765816	+1	no_errors	ENST00000375001	ensembl	human	known	69_37n	missense	61	12.86	9	SNP	0.000	T
CX3CR1	1524	genome.wustl.edu	37	3	39323136	39323136	+	5'Flank	SNP	C	C	A			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr3:39323136C>A	ENST00000541347.1	-	0	0				CX3CR1_ENST00000399220.2_5'Flank|CX3CR1_ENST00000542107.1_5'Flank|CX3CR1_ENST00000358309.3_Missense_Mutation_p.K17N	NM_001171171.1	NP_001164642.1	P49238	CX3C1_HUMAN	chemokine (C-X3-C motif) receptor 1						cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cerebral cortex cell migration (GO:0021795)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|macrophage chemotaxis (GO:0048246)|microglial cell activation involved in immune response (GO:0002282)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|positive regulation of angiogenesis (GO:0045766)|response to wounding (GO:0009611)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|neuronal cell body membrane (GO:0032809)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	C-X3-C chemokine receptor activity (GO:0016495)|chemokine receptor activity (GO:0004950)			endometrium(3)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|urinary_tract(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.0557)|Kidney(284;0.0699)		ccagagagctcttcctgaaat	0.542																																						dbGAP											0													92.0	88.0	89.0					3																	39323136		1568	3582	5150	-	-	-	SO:0001631	upstream_gene_variant	0			BC028078	CCDS43069.1, CCDS54571.1	3p21.3	2012-08-08	2002-08-22		ENSG00000168329	ENSG00000168329		"""GPCR / Class A : Chemokine receptors : C-X-3-C motif"""	2558	protein-coding gene	gene with protein product		601470	"""chemokine (C-X3-C) receptor 1"""	GPR13, CMKBRL1		9726990, 7646814	Standard	NM_001171171		Approved	CMKDR1, V28, CCRL1	uc021wwc.1	P49238	OTTHUMG00000156249		3.37:g.39323136C>A	Exception_encountered		A0N0N6|B2R5Z4|J3KP17	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Chemokine_fractalkine_CX3CR1,prints_7TM_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Duffy_chemokine_rcpt,prints_Chemokine_CXCR4	p.K17N	ENST00000541347.1	37	c.51	CCDS43069.1	3	.	.	.	.	.	.	.	.	.	.	C	10.99	1.506675	0.26949	.	.	ENSG00000168329	ENST00000358309	T	0.67345	-0.26	2.03	2.03	0.26663	.	.	.	.	.	T	0.64811	0.2632	.	.	.	0.26125	N	0.980493	.	.	.	.	.	.	T	0.59026	-0.7531	6	0.72032	D	0.01	.	7.5927	0.28029	0.0:1.0:0.0:0.0	.	.	.	.	N	17	ENSP00000351059:K17N	ENSP00000351059:K17N	K	-	3	2	CX3CR1	39298140	0.012000	0.17670	0.225000	0.23894	0.097000	0.18754	0.685000	0.25378	1.476000	0.48215	0.655000	0.94253	AAG	CX3CR1	-	NULL	ENSG00000168329		0.542	CX3CR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CX3CR1	HGNC	protein_coding	OTTHUMT00000343613.1	53	0.00	0	C	NM_001337		39323136	39323136	-1	no_errors	ENST00000358309	ensembl	human	known	69_37n	missense	37	13.95	6	SNP	0.245	A
CYP2S1	29785	genome.wustl.edu	37	19	41709354	41709354	+	Splice_Site	SNP	G	G	C			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr19:41709354G>C	ENST00000310054.4	+	7	1192		c.e7-1		CYP2S1_ENST00000542619.1_Splice_Site	NM_030622.6	NP_085125.1	Q96SQ9	CP2S1_HUMAN	cytochrome P450, family 2, subfamily S, polypeptide 1						small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(1)|endometrium(3)|large_intestine(3)|lung(5)|skin(2)	14						CTTGCTTGCAGAGTGGGTACG	0.627																																						dbGAP											0													27.0	27.0	27.0					19																	41709354		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AA301039	CCDS12573.1	19q13.2	2013-11-11	2003-01-14		ENSG00000167600	ENSG00000167600		"""Cytochrome P450s"""	15654	protein-coding gene	gene with protein product		611529	"""cytochrome P450, subfamily IIS, polypeptide 1"""			11181079	Standard	NM_030622		Approved		uc002opw.3	Q96SQ9	OTTHUMG00000182721	ENST00000310054.4:c.977-1G>C	19.37:g.41709354G>C			Q9BZ66	Splice_Site	SNP	-	e7-1	ENST00000310054.4	37	c.977-1	CCDS12573.1	19	.	.	.	.	.	.	.	.	.	.	g	16.14	3.039096	0.55003	.	.	ENSG00000167600	ENST00000301173;ENST00000310054;ENST00000542619	.	.	.	4.95	4.95	0.65309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.734	0.77827	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CYP2S1	46401194	1.000000	0.71417	0.640000	0.29408	0.118000	0.20060	8.092000	0.89530	2.305000	0.77605	0.499000	0.49734	.	CYP2S1	-	-	ENSG00000167600		0.627	CYP2S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2S1	HGNC	protein_coding	OTTHUMT00000463287.1	46	0.00	0	G		Intron	41709354	41709354	+1	no_errors	ENST00000310054	ensembl	human	known	69_37n	splice_site	26	21.21	7	SNP	0.999	C
DCAF12L1	139170	genome.wustl.edu	37	X	125685704	125685704	+	Silent	SNP	G	G	T			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chrX:125685704G>T	ENST00000371126.1	-	1	1130	c.888C>A	c.(886-888)tcC>tcA	p.S296S		NM_178470.4	NP_848565.2	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	296										breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(39)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68						ACAGCAGCCTGGATAGTGCGC	0.612																																						dbGAP											0													62.0	58.0	60.0					X																	125685704		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC035674	CCDS14610.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198889	ENSG00000198889		"""WD repeat domain containing"""	29395	protein-coding gene	gene with protein product			"""WD repeat domain 40B"""	WDR40B		12477932	Standard	NM_178470		Approved	KIAA1892L	uc004eul.3	Q5VU92	OTTHUMG00000022353	ENST00000371126.1:c.888C>A	X.37:g.125685704G>T			Q8IYK3	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S296	ENST00000371126.1	37	c.888	CCDS14610.1	X																																																																																			DCAF12L1	-	superfamily_WD40_repeat_dom	ENSG00000198889		0.612	DCAF12L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF12L1	HGNC	protein_coding	OTTHUMT00000058186.1	23	0.00	0	G	NM_178470		125685704	125685704	-1	no_errors	ENST00000371126	ensembl	human	known	69_37n	silent	9	44.44	8	SNP	0.998	T
DENND5B	160518	genome.wustl.edu	37	12	31542280	31542280	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr12:31542280T>A	ENST00000389082.5	-	20	3883	c.3619A>T	c.(3619-3621)Att>Ttt	p.I1207F	DENND5B_ENST00000306833.6_Missense_Mutation_p.I1242F|DENND5B_ENST00000536562.1_Missense_Mutation_p.I1242F	NM_144973.3	NP_659410.3	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	1207	RUN 2. {ECO:0000255|PROSITE- ProRule:PRU00178}.				positive regulation of Rab GTPase activity (GO:0032851)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						CAAACTAAAATCTGGAATTTG	0.378																																						dbGAP											0													98.0	91.0	93.0					12																	31542280		1865	4111	5976	-	-	-	SO:0001583	missense	0			AF086301	CCDS44857.1	12p11.21	2012-10-03			ENSG00000170456	ENSG00000170456		"""DENN/MADD domain containing"""	28338	protein-coding gene	gene with protein product						12477932	Standard	NM_144973		Approved	MGC24039	uc001rki.1	Q6ZUT9	OTTHUMG00000169034	ENST00000389082.5:c.3619A>T	12.37:g.31542280T>A	ENSP00000373734:p.Ile1207Phe		B5ME75|Q59FW8|Q68CZ7|Q6NUJ0|Q7Z3F9|Q8N973|Q8WUC8	Missense_Mutation	SNP	pfam_DENN_dom,pfam_Run,pfam_uDENN_dom,pfam_dDENN_dom,pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,smart_Run,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom,pfscan_LipOase_LH2,pfscan_Run	p.I1242F	ENST00000389082.5	37	c.3724	CCDS44857.1	12	.	.	.	.	.	.	.	.	.	.	T	14.36	2.511176	0.44660	.	.	ENSG00000170456	ENST00000389082;ENST00000306833;ENST00000536562	T;T;T	0.31247	1.5;1.5;1.5	4.34	4.34	0.51931	RUN (3);	0.081689	0.50627	D	0.000102	T	0.23766	0.0575	N	0.22421	0.69	0.48762	D	0.999706	B;B	0.30021	0.202;0.265	B;B	0.36335	0.222;0.142	T	0.10730	-1.0617	10	0.66056	D	0.02	-26.0056	9.9518	0.41642	0.0:0.0:0.1706:0.8294	.	1207;1242	Q6ZUT9;G3V1S3	DEN5B_HUMAN;.	F	1207;1242;1242	ENSP00000373734:I1207F;ENSP00000306482:I1242F;ENSP00000444889:I1242F	ENSP00000306482:I1242F	I	-	1	0	DENND5B	31433547	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.002000	0.29796	1.816000	0.52996	0.477000	0.44152	ATT	DENND5B	-	pfam_Run,smart_Run,pfscan_Run	ENSG00000170456		0.378	DENND5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND5B	HGNC	protein_coding	OTTHUMT00000402040.1	35	0.00	0	T	NM_144973		31542280	31542280	-1	no_errors	ENST00000306833	ensembl	human	known	69_37n	missense	43	17.31	9	SNP	1.000	A
ELF1	1997	genome.wustl.edu	37	13	41533074	41533074	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr13:41533074G>C	ENST00000239882.3	-	3	465	c.151C>G	c.(151-153)Cta>Gta	p.L51V	ELF1_ENST00000498824.1_5'UTR|ELF1_ENST00000442101.1_Missense_Mutation_p.L51V	NM_172373.3	NP_758961.1	P32519	ELF1_HUMAN	E74-like factor 1 (ets domain transcription factor)	51					cell differentiation (GO:0030154)|negative regulation of T cell receptor signaling pathway (GO:0050860)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine production (GO:0001817)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L51V(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37		Lung NSC(96;8.3e-05)|Prostate(109;0.0233)|Breast(139;0.0296)|Lung SC(185;0.0367)		all cancers(112;1.87e-08)|Epithelial(112;8.45e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000202)|GBM - Glioblastoma multiforme(144;0.00266)|BRCA - Breast invasive adenocarcinoma(63;0.072)		ACACAGGCTAGACCGGCATAA	0.453																																						dbGAP											1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											195.0	149.0	165.0					13																	41533074		2203	4300	6503	-	-	-	SO:0001583	missense	0			M82882	CCDS9374.1	13q13	2008-07-18			ENSG00000120690	ENSG00000120690			3316	protein-coding gene	gene with protein product		189973				1545787	Standard	NM_001145353		Approved		uc001uxs.3	P32519	OTTHUMG00000016783	ENST00000239882.3:c.151C>G	13.37:g.41533074G>C	ENSP00000239882:p.Leu51Val		B4E2I5|E9PDQ9|Q8N6F6|Q9UDE1	Missense_Mutation	SNP	pfam_TF_Elf_N,pfam_Ets,smart_Ets,prints_Ets,pfscan_Ets	p.L51V	ENST00000239882.3	37	c.151	CCDS9374.1	13	.	.	.	.	.	.	.	.	.	.	G	13.68	2.309952	0.40895	.	.	ENSG00000120690	ENST00000442101;ENST00000239882	T;T	0.60548	0.18;0.18	5.87	2.2	0.27929	.	0.000000	0.56097	D	0.000026	T	0.69269	0.3092	M	0.68593	2.085	0.28658	N	0.906275	D;D	0.76494	0.999;0.999	D;D	0.87578	0.994;0.998	T	0.61554	-0.7039	10	0.56958	D	0.05	.	8.7215	0.34443	0.3591:0.0:0.6409:0.0	.	51;51	E9PDQ9;P32519	.;ELF1_HUMAN	V	51	ENSP00000405580:L51V;ENSP00000239882:L51V	ENSP00000239882:L51V	L	-	1	2	ELF1	40431074	0.888000	0.30383	0.097000	0.21041	0.393000	0.30537	1.515000	0.35845	0.824000	0.34613	0.655000	0.94253	CTA	ELF1	-	pfam_TF_Elf_N	ENSG00000120690		0.453	ELF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ELF1	HGNC	protein_coding	OTTHUMT00000044654.3	102	0.00	0	G	NM_172373		41533074	41533074	-1	no_errors	ENST00000239882	ensembl	human	known	69_37n	missense	47	31.43	22	SNP	0.542	C
EMR3	84658	genome.wustl.edu	37	19	14774246	14774246	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr19:14774246delG	ENST00000253673.5	-	3	283	c.183delC	c.(181-183)cccfs	p.P61fs	EMR3_ENST00000599900.1_5'UTR|EMR3_ENST00000344373.4_Frame_Shift_Del_p.P61fs|EMR3_ENST00000443157.2_Frame_Shift_Del_p.P61fs	NM_032571.3	NP_115960.2	Q9BY15	EMR3_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 3	61	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(14)|ovary(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	50						ATGTCTCCAAGGGGAATGTGA	0.393																																						dbGAP											0													84.0	72.0	76.0					19																	14774246		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF239764	CCDS12315.1, CCDS74296.1, CCDS74297.1	19p13.1	2014-08-08				ENSG00000131355		"""-"", ""GPCR / Class B : Orphans"""	23647	protein-coding gene	gene with protein product		606101				11279179, 12975309	Standard	XM_005260118		Approved		uc002mzi.4	Q9BY15		ENST00000253673.5:c.183delC	19.37:g.14774246delG	ENSP00000253673:p.Pro61fs			Frame_Shift_Del	DEL	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EGF-like_Ca-bd,smart_EGF-like,smart_EGF-like_Ca-bd,smart_GPS_dom,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_EMR1_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_CD97	p.L62fs	ENST00000253673.5	37	c.183	CCDS12315.1	19																																																																																			EMR3	-	smart_EGF-like	ENSG00000131355		0.393	EMR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMR3	HGNC	protein_coding	OTTHUMT00000466488.1	61	0.00	0	G	NM_032571		14774246	14774246	-1	no_errors	ENST00000253673	ensembl	human	known	69_37n	frame_shift_del	89	15.89	17	DEL	0.000	-
FAM153C	653316	genome.wustl.edu	37	5	177457620	177457620	+	Intron	SNP	C	C	T	rs200476067		TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr5:177457620C>T	ENST00000507848.1	+	3	145				FAM153C_ENST00000511189.1_Silent_p.L9L|FAM153C_ENST00000398106.2_Intron			Q494X1	F153C_HUMAN	family with sequence similarity 153, member C											kidney(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	4	all_cancers(89;0.00176)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTTGTTGCCTCGAAGGTATGT	0.393																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC101338		5q35.3	2008-01-09				ENSG00000204677			33936	protein-coding gene	gene with protein product							Standard	NR_038353		Approved	NY-REN-7-like	uc011dge.2	Q494X1		ENST00000507848.1:c.-56-4477C>T	5.37:g.177457620C>T			A4IF33|B2RUV5|B7ZW12	Silent	SNP	prints_FAM153	p.L9	ENST00000507848.1	37	c.27		5																																																																																			FAM153C	-	NULL	ENSG00000204677		0.393	FAM153C-002	KNOWN	basic|appris_candidate	protein_coding	FAM153C	HGNC	protein_coding	OTTHUMT00000373556.1	75	0.00	0	C	NM_001079527		177457620	177457620	+1	no_errors	ENST00000511189	ensembl	human	novel	69_37n	silent	85	10.53	10	SNP	0.000	T
NUTM2F	54754	genome.wustl.edu	37	9	97087707	97087707	+	Missense_Mutation	SNP	T	T	C	rs190275133	byFrequency	TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr9:97087707T>C	ENST00000253262.4	-	2	546	c.526A>G	c.(526-528)Agg>Ggg	p.R176G	NUTM2F_ENST00000341207.4_Missense_Mutation_p.R176G|NUTM2F_ENST00000335456.7_Missense_Mutation_p.R176G	NM_017561.1	NP_060031.1	A1L443	NTM2F_HUMAN	NUT family member 2F	176			R -> G (in dbSNP:rs2479282). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:17974005}.														GGCCATGGCCTAGCGTTCCCT	0.667													.|||	4069	0.8125	0.9319	0.6988	5008	,	,		6301	0.9901		0.5676	False		,,,				2504	0.8006					dbGAP											0													11.0	25.0	23.0					9																	97087707		441	2300	2741	-	-	-	SO:0001583	missense	0				CCDS47994.1	9q22.32	2013-05-02	2013-03-14	2013-05-02	ENSG00000130950	ENSG00000130950			23450	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member F"""	FAM22F			Standard	NM_017561		Approved	DKFZp434I1117		A1L443	OTTHUMG00000020260	ENST00000253262.4:c.526A>G	9.37:g.97087707T>C	ENSP00000253262:p.Arg176Gly		B6ZDF0|Q5SR58|Q5SR59|Q9UFB1	Missense_Mutation	SNP	NULL	p.R176G	ENST00000253262.4	37	c.526	CCDS47994.1	9	1447	0.6625457875457875	315	0.6402439024390244	234	0.6464088397790055	521	0.9108391608391608	377	0.4973614775725594	.	0.015	-1.548782	0.00926	.	.	ENSG00000130950	ENST00000335456;ENST00000253262;ENST00000341207;ENST00000375347	T;T;T	0.20598	2.06;2.06;2.06	1.52	-0.72	0.11195	Nuclear Testis  protein, N-terminal (1);	1.228550	0.05698	N	0.593604	T	0.00012	0.0000	N	0.00268	-1.735	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.40459	-0.9562	9	0.02654	T	1	.	0.7153	0.00931	0.2373:0.3577:0.234:0.171	.	176	A1L443	FA22F_HUMAN	G	176	ENSP00000335067:R176G;ENSP00000253262:R176G;ENSP00000343865:R176G	ENSP00000253262:R176G	R	-	1	2	FAM22F	96127528	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.634000	0.05477	-0.630000	0.05567	-2.735000	0.00129	AGG	FAM22F	-	NULL	ENSG00000130950		0.667	NUTM2F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM22F	HGNC	protein_coding	OTTHUMT00000053173.2	33	0.00	0	T	NM_017561		97087707	97087707	-1	no_errors	ENST00000253262	ensembl	human	known	69_37n	missense	22	12.00	3	SNP	0.000	C
MIR7162	102466227	genome.wustl.edu	37	15	62538839	62538839	+	RNA	SNP	G	G	A	rs189062597		TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr15:62538839G>A	ENST00000570077.1	-	0	377																											TGGAGGCTCCGGGGGCAGGGG	0.577													.|||	1	0.000199681	0.0	0.0	5008	,	,		17479	0.0		0.001	False		,,,				2504	0.0					dbGAP											0																																										-	-	-			0																															15.37:g.62538839G>A				RNA	SNP	-	NULL	ENST00000570077.1	37	NULL		15	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	1.669	-0.509430	0.04231	.	.	ENSG00000166104	ENST00000429274	.	.	.	2.11	-2.21	0.06973	.	.	.	.	.	T	0.35158	0.0922	.	.	.	.	.	.	P	0.45044	0.849	P	0.46208	0.507	T	0.37709	-0.9694	6	0.66056	D	0.02	.	3.4954	0.07653	0.1685:0.0:0.5011:0.3304	.	154	Q8N8X6-2	.	W	154	.	ENSP00000396161:R154W	R	-	1	2	AC126323.1	60326131	0.000000	0.05858	0.004000	0.12327	0.008000	0.06430	-0.790000	0.04604	-0.514000	0.06488	0.313000	0.20887	CGG	RP11-299H22.3	-	-	ENSG00000166104		0.577	hsa-mir-7162.1-004	KNOWN	basic	processed_transcript	FLJ38723	Clone_based_vega_gene	pseudogene	OTTHUMT00000422143.1	31	0.00	0	G			62538839	62538839	-1	no_errors	ENST00000570077	ensembl	human	known	69_37n	rna	12	29.41	5	SNP	0.019	A
GEMIN5	25929	genome.wustl.edu	37	5	154284974	154284974	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr5:154284974T>C	ENST00000285873.7	-	17	2533	c.2458A>G	c.(2458-2460)Att>Gtt	p.I820V		NM_001252156.1|NM_015465.4	NP_001239085.1|NP_056280.2	Q8TEQ6	GEMI5_HUMAN	gem (nuclear organelle) associated protein 5	820					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|protein complex assembly (GO:0006461)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)	poly(A) RNA binding (GO:0044822)|snRNA binding (GO:0017069)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TTGTTATTAATGGTGACTTTT	0.348																																						dbGAP											0													109.0	110.0	110.0					5																	154284974		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK022748	CCDS4330.1	5q34	2013-01-10			ENSG00000082516	ENSG00000082516		"""WD repeat domain containing"""	20043	protein-coding gene	gene with protein product		607005				11714716	Standard	NM_015465		Approved		uc003lvx.3	Q8TEQ6	OTTHUMG00000130189	ENST00000285873.7:c.2458A>G	5.37:g.154284974T>C	ENSP00000285873:p.Ile820Val		Q14CV0|Q8WWV4|Q969W4|Q9H9K3|Q9UFI5	Missense_Mutation	SNP	pfam_WD40_repeat,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.I820V	ENST00000285873.7	37	c.2458	CCDS4330.1	5	.	.	.	.	.	.	.	.	.	.	T	0.982	-0.696610	0.03279	.	.	ENSG00000082516	ENST00000285873	T	0.68331	-0.32	5.35	-1.2	0.09554	.	0.818326	0.11219	N	0.586888	T	0.32041	0.0816	N	0.02539	-0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.29971	-0.9994	10	0.02654	T	1	-1.1096	8.927	0.35646	0.0:0.4322:0.0:0.5678	.	819;820	B7ZLC9;Q8TEQ6	.;GEMI5_HUMAN	V	820	ENSP00000285873:I820V	ENSP00000285873:I820V	I	-	1	0	GEMIN5	154265167	0.005000	0.15991	0.264000	0.24511	0.991000	0.79684	-0.310000	0.08135	-0.454000	0.07066	0.528000	0.53228	ATT	GEMIN5	-	NULL	ENSG00000082516		0.348	GEMIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GEMIN5	HGNC	protein_coding	OTTHUMT00000252507.1	132	0.00	0	T			154284974	154284974	-1	no_errors	ENST00000285873	ensembl	human	known	69_37n	missense	80	34.43	42	SNP	0.052	C
HIST1H2BJ	8970	genome.wustl.edu	37	6	27100194	27100194	+	Silent	SNP	C	C	A			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr6:27100194C>A	ENST00000607124.1	-	1	335	c.336G>T	c.(334-336)gtG>gtT	p.V112V	HIST1H2BJ_ENST00000339812.2_Silent_p.V112V|HIST1H2AG_ENST00000359193.2_5'Flank|HIST1H2BJ_ENST00000541790.1_Silent_p.V112V			P06899	H2B1J_HUMAN	histone cluster 1, H2bj	112					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|kidney(2)|lung(5)|ovary(1)|prostate(1)	10						TACCCTCGGACACGGCGTGCT	0.587																																						dbGAP											0													82.0	82.0	82.0					6																	27100194		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X00088	CCDS4618.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000124635	ENSG00000124635		"""Histones / Replication-dependent"""	4761	protein-coding gene	gene with protein product		615044	"""H2B histone family, member R"", ""histone 1, H2bj"""	H2BFR		6647026, 12408966	Standard	NM_021058		Approved	H2B/r	uc003niv.3	P06899	OTTHUMG00000014470	ENST00000607124.1:c.336G>T	6.37:g.27100194C>A			B2R4J4|O60816	Silent	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.V112	ENST00000607124.1	37	c.336	CCDS4618.1	6																																																																																			HIST1H2BJ	-	superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	ENSG00000124635		0.587	HIST1H2BJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BJ	HGNC	protein_coding	OTTHUMT00000040138.2	128	0.00	0	C	NM_021058		27100194	27100194	-1	no_errors	ENST00000339812	ensembl	human	known	69_37n	silent	93	16.22	18	SNP	1.000	A
ICA1L	130026	genome.wustl.edu	37	2	203653586	203653586	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr2:203653586C>G	ENST00000392237.2	-	12	1367	c.1210G>C	c.(1210-1212)Gac>Cac	p.D404H	ICA1L_ENST00000358299.2_Missense_Mutation_p.D404H	NM_138468.4	NP_612477.3	Q8NDH6	ICA1L_HUMAN	islet cell autoantigen 1,69kDa-like	404										breast(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						AAGCCAAGGTCAAAGAGTTGT	0.483																																						dbGAP											0													71.0	69.0	70.0					2																	203653586		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB053317	CCDS2354.1, CCDS74632.1	2q33	2008-02-05	2006-05-26	2006-05-26	ENSG00000163596	ENSG00000163596			14442	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 15"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 14"""	ALS2CR15, ALS2CR14		11586298	Standard	NM_138468		Approved		uc002uzh.1	Q8NDH6	OTTHUMG00000132856	ENST00000392237.2:c.1210G>C	2.37:g.203653586C>G	ENSP00000376070:p.Asp404His		B3KRW6|Q53P45|Q53QZ4|Q53T97|Q96N47|Q96Q32|Q9BVQ2	Missense_Mutation	SNP	pfam_Islet_autoAg_Ica1_C,pfam_Arfaptin_homology_dom,pfscan_Arfaptin_homology_dom	p.D404H	ENST00000392237.2	37	c.1210	CCDS2354.1	2	.	.	.	.	.	.	.	.	.	.	C	20.8	4.046889	0.75846	.	.	ENSG00000163596	ENST00000392237;ENST00000358299	.	.	.	6.07	5.18	0.71444	Islet cell autoantigen Ica1, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.78547	0.4300	M	0.77103	2.36	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80439	-0.1382	9	0.54805	T	0.06	.	13.3255	0.60457	0.0:0.8419:0.1581:0.0	.	404	Q8NDH6	ICA1L_HUMAN	H	404	.	ENSP00000351047:D404H	D	-	1	0	ICA1L	203361831	1.000000	0.71417	0.997000	0.53966	0.793000	0.44817	5.150000	0.64869	1.537000	0.49254	0.655000	0.94253	GAC	ICA1L	-	pfam_Islet_autoAg_Ica1_C	ENSG00000163596		0.483	ICA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ICA1L	HGNC	protein_coding	OTTHUMT00000256330.1	150	0.66	1	C	NM_138468		203653586	203653586	-1	no_errors	ENST00000358299	ensembl	human	known	69_37n	missense	162	18.18	36	SNP	1.000	G
KIAA1109	84162	genome.wustl.edu	37	4	123159399	123159399	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr4:123159399C>T	ENST00000264501.4	+	28	4100	c.3727C>T	c.(3727-3729)Cag>Tag	p.Q1243*	KIAA1109_ENST00000388738.3_Nonsense_Mutation_p.Q1243*|KIAA1109_ENST00000455637.1_Nonsense_Mutation_p.Q1243*|KIAA1109_ENST00000495260.1_3'UTR			Q2LD37	K1109_HUMAN	KIAA1109	1243					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						TAGTGCTGCACAGCCTTTGTT	0.423																																						dbGAP											0													134.0	128.0	130.0					4																	123159399		1908	4119	6027	-	-	-	SO:0001587	stop_gained	0			AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.3727C>T	4.37:g.123159399C>T	ENSP00000264501:p.Gln1243*		Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Nonsense_Mutation	SNP	pfam_Fragile_site-assoc_C	p.Q1243*	ENST00000264501.4	37	c.3727	CCDS43267.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	39|39	7.599187|7.599187	0.98381|0.98381	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000455637|ENST00000424425	.|.	.|.	.|.	5.68|5.68	5.68|5.68	0.88126|0.88126	.|.	0.226562|.	0.19400|.	U|.	0.115198|.	.|T	.|0.79770	.|0.4503	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.77755	.|-0.2469	.|3	0.20046|.	T|.	0.44|.	.|.	19.7855|19.7855	0.96434|0.96434	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|I	1243|1074	.|.	ENSP00000264501:Q1243X|.	Q|T	+|+	1|2	0|0	KIAA1109|KIAA1109	123378849|123378849	0.998000|0.998000	0.40836|0.40836	0.983000|0.983000	0.44433|0.44433	0.987000|0.987000	0.75469|0.75469	4.120000|4.120000	0.57897|0.57897	2.698000|2.698000	0.92095|0.92095	0.585000|0.585000	0.79938|0.79938	CAG|ACA	KIAA1109	-	NULL	ENSG00000138688		0.423	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1109	HGNC	protein_coding	OTTHUMT00000316415.1	151	0.00	0	C	NM_020797		123159399	123159399	+1	no_errors	ENST00000264501	ensembl	human	known	69_37n	nonsense	178	28.23	70	SNP	0.997	T
KLHL18	23276	genome.wustl.edu	37	3	47382093	47382093	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr3:47382093A>T	ENST00000232766.5	+	8	1173	c.1153A>T	c.(1153-1155)Atc>Ttc	p.I385F	KLHL18_ENST00000455924.2_Missense_Mutation_p.I273F	NM_025010.4	NP_079286.2	O94889	KLH18_HUMAN	kelch-like family member 18	385										endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	21		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00645)|Kidney(197;0.00741)		GGATGGGCAGATCTACGTCTG	0.587																																						dbGAP											0													208.0	178.0	188.0					3																	47382093		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018338	CCDS33749.1	3p21	2013-01-30	2013-01-30		ENSG00000114648	ENSG00000114648		"""Kelch-like"", ""BTB/POZ domain containing"""	29120	protein-coding gene	gene with protein product			"""kelch-like 18 (Drosophila)"""			9872452	Standard	NM_025010		Approved	KIAA0795, FLJ13703	uc003crd.3	O94889	OTTHUMG00000156522	ENST00000232766.5:c.1153A>T	3.37:g.47382093A>T	ENSP00000232766:p.Ile385Phe		A8K612|Q7Z3E8|Q8N125	Missense_Mutation	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_BACK,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.I385F	ENST00000232766.5	37	c.1153	CCDS33749.1	3	.	.	.	.	.	.	.	.	.	.	A	33	5.232797	0.95207	.	.	ENSG00000114648	ENST00000232766;ENST00000455924	D;D	0.85484	-1.99;-1.99	5.59	5.59	0.84812	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	D	0.94801	0.8321	H	0.98256	4.185	0.80722	D	1	P	0.50272	0.933	P	0.62885	0.908	D	0.95994	0.8988	10	0.59425	D	0.04	.	13.5024	0.61465	1.0:0.0:0.0:0.0	.	385	O94889	KLH18_HUMAN	F	385;273	ENSP00000232766:I385F;ENSP00000405585:I273F	ENSP00000232766:I385F	I	+	1	0	KLHL18	47357097	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.215000	0.95146	2.125000	0.65367	0.528000	0.53228	ATC	KLHL18	-	pfam_Kelch_1,pfam_Kelch_2,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000114648		0.587	KLHL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL18	HGNC	protein_coding	OTTHUMT00000344493.1	151	0.00	0	A	NM_025010		47382093	47382093	+1	no_errors	ENST00000232766	ensembl	human	known	69_37n	missense	55	23.61	17	SNP	1.000	T
LRRC23	10233	genome.wustl.edu	37	12	7019120	7019120	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr12:7019120C>T	ENST00000007969.8	+	6	908	c.688C>T	c.(688-690)Cga>Tga	p.R230*	LRRC23_ENST00000436789.1_Intron|LRRC23_ENST00000443597.2_Nonsense_Mutation_p.R230*|LRRC23_ENST00000429740.1_Intron|LRRC23_ENST00000323702.5_Nonsense_Mutation_p.R230*	NM_001135217.1|NM_201650.2	NP_001128689.1|NP_964013.1	Q53EV4	LRC23_HUMAN	leucine rich repeat containing 23	230										NS(1)|breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|stomach(1)	13						CTTGCATCTTCGAGACAACCA	0.522																																						dbGAP											0													167.0	142.0	150.0					12																	7019120		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC014450	CCDS8568.1, CCDS8569.1	12p13	2006-02-02			ENSG00000010626	ENSG00000010626			19138	protein-coding gene	gene with protein product						11830501, 11826754	Standard	NM_201650		Approved	B7, LRPB7	uc001qrp.3	Q53EV4	OTTHUMG00000156668	ENST00000007969.8:c.688C>T	12.37:g.7019120C>T	ENSP00000007969:p.Arg230*		A8K8C6|D3DUT1|Q8N6K6|Q92977|Q99620	Nonsense_Mutation	SNP	pfam_Leu-rich_rpt	p.R230*	ENST00000007969.8	37	c.688	CCDS8569.1	12	.	.	.	.	.	.	.	.	.	.	C	38	6.733544	0.97796	.	.	ENSG00000010626	ENST00000007969;ENST00000323702;ENST00000443597	.	.	.	5.65	4.75	0.60458	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	-5.2131	13.6435	0.62267	0.2818:0.7182:0.0:0.0	.	.	.	.	X	230	.	ENSP00000007969:R230X	R	+	1	2	LRRC23	6889381	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.870000	0.39529	1.360000	0.45960	0.561000	0.74099	CGA	LRRC23	-	NULL	ENSG00000010626		0.522	LRRC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC23	HGNC	protein_coding	OTTHUMT00000345214.1	134	0.74	1	C	NM_006992		7019120	7019120	+1	no_errors	ENST00000007969	ensembl	human	known	69_37n	nonsense	106	28.38	42	SNP	0.999	T
LRRIQ4	344657	genome.wustl.edu	37	3	169540420	169540420	+	Silent	SNP	G	G	A			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr3:169540420G>A	ENST00000340806.6	+	1	711	c.711G>A	c.(709-711)tcG>tcA	p.S237S		NM_001080460.1	NP_001073929.1	A6NIV6	LRIQ4_HUMAN	leucine-rich repeats and IQ motif containing 4	237								p.S237S(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	30						GCCAACTGTCGGTGCTCGATT	0.572																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											50.0	54.0	53.0					3																	169540420		1986	4156	6142	-	-	-	SO:0001819	synonymous_variant	0				CCDS46951.1	3q26.2	2008-08-08	2008-06-12	2008-06-12	ENSG00000188306	ENSG00000188306			34298	protein-coding gene	gene with protein product	"""leucine rich repeat containing 64"""						Standard	NM_001080460		Approved	LRRC64	uc003fgb.3	A6NIV6	OTTHUMG00000164420	ENST00000340806.6:c.711G>A	3.37:g.169540420G>A				Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,pfscan_IQ_motif_EF-hand-BS	p.S237	ENST00000340806.6	37	c.711	CCDS46951.1	3																																																																																			LRRIQ4	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000188306		0.572	LRRIQ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRIQ4	HGNC	protein_coding	OTTHUMT00000378698.1	106	0.00	0	G	NM_001080460		169540420	169540420	+1	no_errors	ENST00000340806	ensembl	human	known	69_37n	silent	180	12.14	25	SNP	0.000	A
MRPL52	122704	genome.wustl.edu	37	14	23299300	23299300	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr14:23299300G>A	ENST00000355151.5	+	2	100	c.70G>A	c.(70-72)Ggc>Agc	p.G24S	MRPL52_ENST00000397496.3_Missense_Mutation_p.G23S|MRPL52_ENST00000555536.1_5'UTR|MRPL52_ENST00000555345.1_5'UTR|MRPL52_ENST00000553711.1_5'UTR|MRPL52_ENST00000556840.1_5'UTR|MRPL52_ENST00000397505.2_Missense_Mutation_p.G24S|MRPL52_ENST00000432849.3_Missense_Mutation_p.G23S|MRPL52_ENST00000311892.6_5'UTR|MRPL52_ENST00000557221.1_5'UTR|MRPL52_ENST00000461594.1_3'UTR	NM_178336.2|NM_180982.2|NM_181306.2	NP_848026.1|NP_851313.1|NP_851823.1	Q86TS9	RM52_HUMAN	mitochondrial ribosomal protein L52	24					translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)	structural constituent of ribosome (GO:0003735)					all_cancers(95;9.47e-05)			GBM - Glioblastoma multiforme(265;0.00551)		CGCTTGGGCGGGCGGCCAGTG	0.652																																						dbGAP											0													25.0	31.0	29.0					14																	23299300		2202	4300	6502	-	-	-	SO:0001583	missense	0			AK000450	CCDS9575.1, CCDS9576.1, CCDS41917.1, CCDS41918.1	14q11.2	2012-09-13			ENSG00000172590	ENSG00000172590		"""Mitochondrial ribosomal proteins / large subunits"""	16655	protein-coding gene	gene with protein product		611856				11551941, 11943462	Standard	NM_178336		Approved		uc001wgw.4	Q86TS9	OTTHUMG00000028703	ENST00000355151.5:c.70G>A	14.37:g.23299300G>A	ENSP00000347277:p.Gly24Ser		A6NMQ8|A8MXK5|A8MYI6|G3XCN9|Q6NVH8	Missense_Mutation	SNP	NULL	p.G24S	ENST00000355151.5	37	c.70	CCDS41917.1	14	.	.	.	.	.	.	.	.	.	.	G	18.85	3.711744	0.68730	.	.	ENSG00000172590	ENST00000355151;ENST00000397496;ENST00000432849;ENST00000556465;ENST00000397505	T;T;T;T;T	0.23552	1.9;1.9;1.9;1.9;1.9	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.49609	0.1567	M	0.73217	2.22	0.80722	D	1	D;D;D	0.64830	0.992;0.994;0.973	P;D;P	0.69142	0.876;0.962;0.747	T	0.44682	-0.9312	10	0.56958	D	0.05	-14.0859	15.3376	0.74269	0.0:0.0:1.0:0.0	.	24;23;24	A8MXK5;G3XCN9;Q86TS9	.;.;RM52_HUMAN	S	24;23;23;23;24	ENSP00000347277:G24S;ENSP00000380633:G23S;ENSP00000406655:G23S;ENSP00000451832:G23S;ENSP00000380642:G24S	ENSP00000310762:G24S	G	+	1	0	MRPL52	22369140	1.000000	0.71417	0.460000	0.27093	0.210000	0.24377	4.138000	0.58017	2.768000	0.95171	0.650000	0.86243	GGC	MRPL52	-	NULL	ENSG00000172590		0.652	MRPL52-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MRPL52	HGNC	protein_coding	OTTHUMT00000071657.4	21	0.00	0	G	NM_180982		23299300	23299300	+1	no_errors	ENST00000355151	ensembl	human	known	69_37n	missense	33	28.26	13	SNP	0.565	A
MUC16	94025	genome.wustl.edu	37	19	9008211	9008211	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr19:9008211C>T	ENST00000397910.4	-	41	39544	c.39341G>A	c.(39340-39342)gGc>gAc	p.G13114D		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13116	SEA 7. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGTGTAGGGGCCCAGCTCTTT	0.557																																						dbGAP											0													207.0	189.0	195.0					19																	9008211		2016	4184	6200	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.39341G>A	19.37:g.9008211C>T	ENSP00000381008:p.Gly13114Asp		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.G13114D	ENST00000397910.4	37	c.39341	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	.	9.754	1.168237	0.21621	.	.	ENSG00000181143	ENST00000397910;ENST00000441155	T	0.24350	1.86	2.04	0.984	0.19773	.	.	.	.	.	T	0.25644	0.0624	M	0.89287	3.02	.	.	.	P	0.43094	0.799	B	0.29598	0.104	T	0.40683	-0.9550	8	0.87932	D	0	.	4.4675	0.11696	0.0:0.7997:0.0:0.2003	.	13114	B5ME49	.	D	13114;267	ENSP00000381008:G13114D	ENSP00000381008:G13114D	G	-	2	0	MUC16	8869211	0.477000	0.25909	0.015000	0.15790	0.034000	0.12701	0.679000	0.25291	0.409000	0.25649	0.195000	0.17529	GGC	MUC16	-	smart_SEA	ENSG00000181143		0.557	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	974	0.00	0	C	NM_024690		9008211	9008211	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	813	21.10	218	SNP	0.019	T
NFE2L3	9603	genome.wustl.edu	37	7	26224166	26224167	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	GA	GA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr7:26224166_26224167delGA	ENST00000056233.3	+	4	1107_1108	c.848_849delGA	c.(847-849)ggafs	p.G283fs		NM_004289.6	NP_004280.5	Q9Y4A8	NF2L3_HUMAN	nuclear factor, erythroid 2-like 3	283					transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(5)|urinary_tract(7)	29						ATCTCATTGGGAGATATTCCTC	0.401																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB010812	CCDS5396.1	7p15.2	2013-08-23	2013-08-23		ENSG00000050344	ENSG00000050344		"""basic leucine zipper proteins"""	7783	protein-coding gene	gene with protein product		604135	"""nuclear factor (erythroid-derived 2)-like 3"""			10037736	Standard	NM_004289		Approved	Nrf3	uc003sxq.3	Q9Y4A8	OTTHUMG00000023882	ENST00000056233.3:c.848_849delGA	7.37:g.26224168_26224169delGA	ENSP00000056233:p.Gly283fs		Q6NUS0|Q7Z498|Q86UJ4|Q86VR5|Q9UQA4	Frame_Shift_Del	DEL	pfam_bZIP_1,pfam_bZIP_Maf,pfam_bZIP_2,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.D284fs	ENST00000056233.3	37	c.848_849	CCDS5396.1	7																																																																																			NFE2L3	-	NULL	ENSG00000050344		0.401	NFE2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFE2L3	HGNC	protein_coding	OTTHUMT00000214088.1	385	0.00	0	GA			26224166	26224167	+1	no_errors	ENST00000056233	ensembl	human	known	69_37n	frame_shift_del	317	23.98	100	DEL	0.960:0.971	-
Unknown	0	genome.wustl.edu	37	19	14975331	14975331	+	IGR	SNP	A	A	C			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr19:14975331A>C								OR7A10 (22642 upstream) : OR7A17 (15806 downstream)																							TACGAAGGACAGGTTGGAGAG	0.512																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															19.37:g.14975331A>C				Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.L66R		37	c.197		19	.	.	.	.	.	.	.	.	.	.	a	12.31	1.898613	0.33535	.	.	ENSG00000172148	ENST00000304105	.	.	.	2.29	2.29	0.28610	.	0.000000	0.30704	U	0.009041	T	0.55305	0.1912	.	.	.	0.26094	N	0.980903	.	.	.	.	.	.	T	0.67665	-0.5612	5	0.87932	D	0	.	8.1016	0.30861	1.0:0.0:0.0:0.0	.	.	.	.	R	66	.	ENSP00000307397:L66R	L	-	2	0	OR7A2P	14836331	0.898000	0.30612	0.966000	0.40874	0.071000	0.16799	5.845000	0.69437	1.076000	0.40961	0.172000	0.16884	CTG	OR7A2P	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000172148	0	0.512					OR7A2P	HGNC			221	0.45	1	A			14975331	14975331	-1	no_start_codon	ENST00000304105	ensembl	human	known	69_37n	missense	261	23.46	80	SNP	0.762	C
OTOA	146183	genome.wustl.edu	37	16	21742179	21742179	+	Silent	SNP	C	C	T	rs139312489		TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr16:21742179C>T	ENST00000286149.4	+	20	2272	c.2271C>T	c.(2269-2271)gcC>gcT	p.A757A	OTOA_ENST00000388957.3_Silent_p.A419A|OTOA_ENST00000388956.4_Silent_p.A664A|OTOA_ENST00000388958.3_Silent_p.A743A			Q7RTW8	OTOAN_HUMAN	otoancorin	757					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)	46				GBM - Glioblastoma multiforme(48;0.0414)		ACTGGACAGCCGAGACCACGA	0.448																																						dbGAP											0													103.0	82.0	89.0					16																	21742179		2195	4268	6463	-	-	-	SO:0001819	synonymous_variant	0			AK057335	CCDS10600.2, CCDS32403.1, CCDS53994.1	16p12.2	2009-08-18	2002-07-05		ENSG00000155719	ENSG00000155719			16378	protein-coding gene	gene with protein product	"""cancer/testis antigen 108"""	607038	"""deafness, autosomal recessive 22"""	DFNB22		11972037, 19088187	Standard	NM_170664		Approved	CT108	uc002djh.3	Q7RTW8	OTTHUMG00000090721	ENST00000286149.4:c.2271C>T	16.37:g.21742179C>T			A1L3A8|A2VDI0|B3KWU3|E9PF51|Q8NA86|Q96M76	Silent	SNP	NULL	p.A757	ENST00000286149.4	37	c.2271		16																																																																																			OTOA	-	NULL	ENSG00000155719		0.448	OTOA-003	KNOWN	basic	protein_coding	OTOA	HGNC	protein_coding	OTTHUMT00000430021.1	43	0.00	0	C			21742179	21742179	+1	no_errors	ENST00000286149	ensembl	human	known	69_37n	silent	60	11.76	8	SNP	0.282	T
OVCA2	124641	genome.wustl.edu	37	17	1946346	1946346	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr17:1946346C>G	ENST00000572195.1	+	2	647	c.632C>G	c.(631-633)gCt>gGt	p.A211G	RP11-667K14.4_ENST00000572404.1_RNA|DPH1_ENST00000263083.6_3'UTR|RP11-667K14.3_ENST00000572790.1_lincRNA	NM_080822.2	NP_543012.1	Q8WZ82	OVCA2_HUMAN	ovarian tumor suppressor candidate 2	211					metabolic process (GO:0008152)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)										ATTCCAGCAGCTGCACCCCAG	0.552											OREG0024078	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													71.0	78.0	76.0					17																	1946346		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF321875	CCDS11015.1	17p13.3	2012-10-08			ENSG00000262664	ENSG00000262664			24203	protein-coding gene	gene with protein product	"""candidate tumor suppressor in ovarian cancer 2"""	607896				11979432, 8616839, 16368187	Standard	NM_080822		Approved		uc002ftx.3	Q8WZ82	OTTHUMG00000132471	ENST00000572195.1:c.632C>G	17.37:g.1946346C>G	ENSP00000461388:p.Ala211Gly	599	Q86XN3|Q8IW87|Q9UCX9	Missense_Mutation	SNP	pfam_Serine_hydrolase_FSH,pfam_PLipase/COase/thioEstase	p.A211G	ENST00000572195.1	37	c.632	CCDS11015.1	17	.	.	.	.	.	.	.	.	.	.	C	21.2	4.117510	0.77323	.	.	ENSG00000214014	ENST00000263084	.	.	.	5.38	4.39	0.52855	.	0.287283	0.27340	U	0.019810	T	0.41373	0.1156	L	0.50333	1.59	0.09310	N	0.999992	B	0.13594	0.008	B	0.16289	0.015	T	0.23084	-1.0198	9	0.22109	T	0.4	.	13.289	0.60260	0.0:0.6957:0.3043:0.0	.	211	Q8WZ82	OVCA2_HUMAN	G	211	.	ENSP00000263084:A211G	A	+	2	0	OVCA2	1893096	0.900000	0.30661	0.010000	0.14722	0.944000	0.59088	2.841000	0.48223	1.223000	0.43536	0.655000	0.94253	GCT	OVCA2	-	pfam_Serine_hydrolase_FSH	ENSG00000214014		0.552	OVCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OVCA2	HGNC	protein_coding	OTTHUMT00000255636.5	39	0.00	0	C	NM_080822		1946346	1946346	+1	no_errors	ENST00000263084	ensembl	human	known	69_37n	missense	19	50.00	19	SNP	0.170	G
PEAR1	375033	genome.wustl.edu	37	1	156874586	156874586	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr1:156874586C>G	ENST00000338302.3	+	4	373	c.148C>G	c.(148-150)Ctc>Gtc	p.L50V	PEAR1_ENST00000292357.7_Missense_Mutation_p.L50V			Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	50	EMI. {ECO:0000255|PROSITE- ProRule:PRU00384}.				recognition of apoptotic cell (GO:0043654)	integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(6)|lung(22)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)	43	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CTTCAGCCTGCTCCCCTCAGA	0.677																																						dbGAP											0													59.0	63.0	62.0					1																	156874586		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK098809	CCDS30892.1	1q23.1	2008-02-05	2007-10-25	2007-10-25	ENSG00000187800	ENSG00000187800			33631	protein-coding gene	gene with protein product		610278	"""multiple EGF-like-domains 12"""	MEGF12		15851471	Standard	NM_001080471		Approved	JEDI, FLJ00193	uc001fqj.1	Q5VY43	OTTHUMG00000041293	ENST00000338302.3:c.148C>G	1.37:g.156874586C>G	ENSP00000344465:p.Leu50Val		Q8TEK2	Missense_Mutation	SNP	pfam_EGF_laminin,superfamily_Growth_fac_rcpt,smart_EGF-like,smart_EGF_laminin,pfscan_EG-like_dom,pfscan_EMI_domain	p.L50V	ENST00000338302.3	37	c.148	CCDS30892.1	1	.	.	.	.	.	.	.	.	.	.	C	3.558	-0.090316	0.07053	.	.	ENSG00000187800	ENST00000338302;ENST00000455314;ENST00000292357	D;T;D	0.88354	-2.37;1.02;-2.37	3.56	1.5	0.22942	EMI domain (1);	0.673502	0.12230	N	0.487581	T	0.55593	0.1930	N	0.17082	0.46	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.47837	-0.9086	10	0.10111	T	0.7	.	5.3567	0.16065	0.0:0.6996:0.0:0.3004	.	50	Q5VY43	PEAR1_HUMAN	V	50	ENSP00000344465:L50V;ENSP00000389742:L50V;ENSP00000292357:L50V	ENSP00000292357:L50V	L	+	1	0	PEAR1	155141210	0.002000	0.14202	0.553000	0.28255	0.951000	0.60555	-0.252000	0.08806	0.236000	0.21180	-0.367000	0.07326	CTC	PEAR1	-	superfamily_Growth_fac_rcpt,pfscan_EMI_domain	ENSG00000187800		0.677	PEAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEAR1	HGNC	protein_coding	OTTHUMT00000098937.2	125	0.00	0	C	NM_001080471		156874586	156874586	+1	no_errors	ENST00000292357	ensembl	human	known	69_37n	missense	96	20.66	25	SNP	0.147	G
PLCH1	23007	genome.wustl.edu	37	3	155199904	155199904	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr3:155199904C>T	ENST00000340059.7	-	23	3934	c.3935G>A	c.(3934-3936)cGt>cAt	p.R1312H	PLCH1_ENST00000334686.6_Missense_Mutation_p.R1274H|PLCH1_ENST00000447496.2_3'UTR|PLCH1_ENST00000494598.1_Intron|PLCH1_ENST00000460012.1_Missense_Mutation_p.R1274H|PLCH1_ENST00000414191.1_Missense_Mutation_p.R1274H	NM_001130960.1	NP_001124432.1	Q4KWH8	PLCH1_HUMAN	phospholipase C, eta 1	1312					inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phosphatidylinositol-mediated signaling (GO:0048015)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase C activity (GO:0050429)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			NS(3)|breast(3)|endometrium(9)|kidney(4)|large_intestine(20)|lung(45)|ovary(2)|prostate(5)|skin(8)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	107			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			TAACCAGCCACGAGAAGTATT	0.498																																						dbGAP											0													104.0	107.0	106.0					3																	155199904		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB028992	CCDS33881.1, CCDS46939.1, CCDS46940.1	3q25	2013-01-10	2006-03-16	2006-03-16	ENSG00000114805	ENSG00000114805	3.1.4.11	"""EF-hand domain containing"""	29185	protein-coding gene	gene with protein product		612835	"""phospholipase C-like 3"""	PLCL3		15702972	Standard	NM_014996		Approved	KIAA1069, MGC117152, DKFZp434C1372, PLCeta1	uc021xge.1	Q4KWH8	OTTHUMG00000158477	ENST00000340059.7:c.3935G>A	3.37:g.155199904C>T	ENSP00000345988:p.Arg1312His		Q29RV9|Q4KWH9|Q68CN0|Q86XK4|Q9H9U2|Q9UPT3	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,smart_EF_hand_Ca-bd,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,pfscan_EF_HAND_2,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.R1312H	ENST00000340059.7	37	c.3935	CCDS46939.1	3	.	.	.	.	.	.	.	.	.	.	T	12.95	2.091509	0.36952	.	.	ENSG00000114805	ENST00000460012;ENST00000340059;ENST00000334686;ENST00000414191	T;T;T;T	0.75938	-0.98;-0.98;-0.98;-0.98	5.19	-9.07	0.00724	.	2.887850	0.01490	N	0.017025	T	0.40322	0.1112	N	0.01874	-0.695	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.42632	-0.9440	10	0.13853	T	0.58	.	5.1664	0.15088	0.1119:0.4168:0.3219:0.1493	.	1274;1312	Q4KWH8-2;Q4KWH8	.;PLCH1_HUMAN	H	1274;1312;1274;1274	ENSP00000417502:R1274H;ENSP00000345988:R1312H;ENSP00000335469:R1274H;ENSP00000412977:R1274H	ENSP00000335469:R1274H	R	-	2	0	PLCH1	156682598	0.000000	0.05858	0.000000	0.03702	0.555000	0.35460	-0.230000	0.09083	-2.239000	0.00711	-0.550000	0.04213	CGT	PLCH1	-	NULL	ENSG00000114805		0.498	PLCH1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCH1	HGNC	protein_coding	OTTHUMT00000351125.1	166	0.00	0	C	NM_014996		155199904	155199904	-1	no_errors	ENST00000340059	ensembl	human	known	69_37n	missense	119	19.05	28	SNP	0.000	T
PRPS2	5634	genome.wustl.edu	37	X	12837706	12837706	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chrX:12837706G>A	ENST00000380668.5	+	5	739	c.611G>A	c.(610-612)cGg>cAg	p.R204Q	PRPS2_ENST00000398491.2_Missense_Mutation_p.R207Q	NM_001039091.2|NM_002765.4	NP_001034180.1|NP_002756.1	P11908	PRPS2_HUMAN	phosphoribosyl pyrophosphate synthetase 2	204					5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|AMP biosynthetic process (GO:0006167)|nucleobase-containing compound metabolic process (GO:0006139)|organ regeneration (GO:0031100)	extracellular vesicular exosome (GO:0070062)|ribose phosphate diphosphokinase complex (GO:0002189)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|ATP binding (GO:0005524)|carbohydrate binding (GO:0030246)|GDP binding (GO:0019003)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)|ribose phosphate diphosphokinase activity (GO:0004749)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|urinary_tract(1)	16						GAAGTGGACCGGATGGTCCTG	0.527																																						dbGAP											0													258.0	227.0	237.0					X																	12837706		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y00971	CCDS14150.1, CCDS43918.1	Xp22.2	2012-10-02			ENSG00000101911	ENSG00000101911	2.7.6.1		9465	protein-coding gene	gene with protein product	"""PRS II"", ""ribose-phosphate diphosphokinase 2"""	311860				1962753	Standard	NM_002765		Approved		uc004cva.3	P11908	OTTHUMG00000021139	ENST00000380668.5:c.611G>A	X.37:g.12837706G>A	ENSP00000370043:p.Arg204Gln		Q0VDH9|Q0VDI0|Q15245|Q2TAK7	Missense_Mutation	SNP	pfam_PRibTrfase,tigrfam_Rib-P_diPkinase	p.R207Q	ENST00000380668.5	37	c.620	CCDS14150.1	X	.	.	.	.	.	.	.	.	.	.	G	20.3	3.962002	0.74016	.	.	ENSG00000101911	ENST00000380668;ENST00000398491	T;T	0.71698	-0.59;-0.59	4.86	4.86	0.63082	Phosphoribosyltransferase (1);	0.000000	0.85682	D	0.000000	T	0.66848	0.2831	L	0.55743	1.74	0.80722	D	1	B;B	0.12630	0.006;0.004	B;B	0.08055	0.003;0.002	T	0.62932	-0.6749	10	0.28530	T	0.3	-11.9925	17.4192	0.87510	0.0:0.0:1.0:0.0	.	204;207	P11908;P11908-2	PRPS2_HUMAN;.	Q	204;207	ENSP00000370043:R204Q;ENSP00000381504:R207Q	ENSP00000370043:R204Q	R	+	2	0	PRPS2	12747627	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	9.273000	0.95719	2.125000	0.65367	0.513000	0.50165	CGG	PRPS2	-	pfam_PRibTrfase,tigrfam_Rib-P_diPkinase	ENSG00000101911		0.527	PRPS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRPS2	HGNC	protein_coding	OTTHUMT00000055772.2	132	0.00	0	G	NM_002765		12837706	12837706	+1	no_errors	ENST00000398491	ensembl	human	known	69_37n	missense	60	44.95	49	SNP	1.000	A
PTPN22	26191	genome.wustl.edu	37	1	114372309	114372309	+	Missense_Mutation	SNP	C	C	G	rs370982954		TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr1:114372309C>G	ENST00000359785.5	-	18	2290	c.2155G>C	c.(2155-2157)Gaa>Caa	p.E719Q	PTPN22_ENST00000420377.2_Missense_Mutation_p.E719Q|PTPN22_ENST00000528414.1_Missense_Mutation_p.E664Q|PTPN22_ENST00000525799.1_Missense_Mutation_p.E592Q|PTPN22_ENST00000538253.1_Missense_Mutation_p.E475Q|PTPN22_ENST00000460620.1_Intron|RP5-1073O3.2_ENST00000448199.1_RNA	NM_001193431.1|NM_015967.5	NP_001180360.1|NP_057051	Q9Y2R2	PTN22_HUMAN	protein tyrosine phosphatase, non-receptor type 22 (lymphoid)	719					negative regulation of T cell activation (GO:0050868)|negative regulation of T cell receptor signaling pathway (GO:0050860)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphoanandamide dephosphorylation (GO:0035644)|protein dephosphorylation (GO:0006470)|regulation of B cell receptor signaling pathway (GO:0050855)|regulation of innate immune response (GO:0045088)|regulation of natural killer cell proliferation (GO:0032817)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	kinase binding (GO:0019900)|protein tyrosine phosphatase activity (GO:0004725)|SH3 domain binding (GO:0017124)			NS(1)|breast(1)|kidney(3)|large_intestine(4)|lung(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Lung SC(450;0.184)	all_cancers(81;1.93e-08)|all_epithelial(167;4.37e-08)|all_lung(203;5.22e-06)|Lung NSC(69;8.94e-06)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GAATATGTTTCTATAGATTGG	0.338																																						dbGAP											0													105.0	106.0	106.0					1																	114372309		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF001846	CCDS863.1, CCDS864.1, CCDS864.2	1p13.2	2011-06-09	2005-02-02		ENSG00000134242	ENSG00000134242		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9652	protein-coding gene	gene with protein product		600716	"""protein tyrosine phosphatase, non-receptor type 8"""	PTPN8		10068674, 1373816	Standard	NM_015967		Approved	Lyp, Lyp1, Lyp2	uc001eds.3	Q9Y2R2	OTTHUMG00000011936	ENST00000359785.5:c.2155G>C	1.37:g.114372309C>G	ENSP00000352833:p.Glu719Gln		A0N0K6|B1ALC8|D4NZ71|E9PLD8|E9PPI1|O95063|O95064|Q6IPX8|Q8WVM1	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Non-rcpt_Tyr_Pase_8/22,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.E719Q	ENST00000359785.5	37	c.2155	CCDS863.1	1	.	.	.	.	.	.	.	.	.	.	C	14.51	2.557484	0.45590	.	.	ENSG00000134242	ENST00000359785;ENST00000528414;ENST00000538253;ENST00000420377;ENST00000525799	T;T;T;T;T	0.34275	3.62;3.26;1.37;3.56;3.01	5.48	0.289	0.15723	.	0.956265	0.08733	N	0.901776	T	0.10594	0.0259	L	0.39514	1.22	0.09310	N	1	P;D;B;B;B	0.53312	0.75;0.959;0.139;0.046;0.139	B;B;B;B;B	0.43623	0.357;0.425;0.037;0.03;0.051	T	0.09684	-1.0663	10	0.28530	T	0.3	.	2.3038	0.04169	0.1455:0.4122:0.282:0.1604	.	475;592;719;664;719	F5H2S8;E9PPI1;E9PMT0;E9PLD8;Q9Y2R2	.;.;.;.;PTN22_HUMAN	Q	719;664;475;719;592	ENSP00000352833:E719Q;ENSP00000435176:E664Q;ENSP00000439372:E475Q;ENSP00000388229:E719Q;ENSP00000432674:E592Q	ENSP00000352833:E719Q	E	-	1	0	PTPN22	114173832	0.002000	0.14202	0.000000	0.03702	0.855000	0.48748	0.210000	0.17455	-0.193000	0.10415	0.591000	0.81541	GAA	PTPN22	-	pirsf_Non-rcpt_Tyr_Pase_8/22	ENSG00000134242		0.338	PTPN22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN22	HGNC	protein_coding	OTTHUMT00000033015.1	187	0.00	0	C	NM_015967		114372309	114372309	-1	no_errors	ENST00000359785	ensembl	human	known	69_37n	missense	264	12.25	37	SNP	0.042	G
SCN5A	6331	genome.wustl.edu	37	3	38655318	38655318	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr3:38655318T>C	ENST00000333535.4	-	6	768	c.619A>G	c.(619-621)Act>Gct	p.T207A	SCN5A_ENST00000450102.2_Intron|SCN5A_ENST00000425664.1_Intron|SCN5A_ENST00000423572.2_Missense_Mutation_p.T207A|SCN5A_ENST00000413689.1_Intron|SCN5A_ENST00000451551.2_Intron|SCN5A_ENST00000455624.2_Intron|SCN5A_ENST00000443581.1_Missense_Mutation_p.T207A|SCN5A_ENST00000449557.2_Missense_Mutation_p.T207A|SCN5A_ENST00000414099.2_Intron			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	207					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	ACAAATTCAGTTGTGTATCTG	0.478																																						dbGAP											0													42.0	46.0	45.0					3																	38655318		2061	4215	6276	-	-	-	SO:0001583	missense	0			AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.619A>G	3.37:g.38655318T>C	ENSP00000328968:p.Thr207Ala		A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,prints_Na_channel_a5su,prints_Na_channel_asu	p.T207A	ENST00000333535.4	37	c.619	CCDS46796.1	3	.	.	.	.	.	.	.	.	.	.	T	15.70	2.911787	0.52439	.	.	ENSG00000183873	ENST00000423572;ENST00000443581;ENST00000333535;ENST00000449557	D;D;D;D	0.98550	-4.99;-4.99;-4.99;-4.99	4.3	4.3	0.51218	Ion transport (1);	0.180634	0.48286	D	0.000183	D	0.96200	0.8761	L	0.43554	1.36	0.80722	D	1	B;B	0.15141	0.012;0.002	B;B	0.20767	0.031;0.01	D	0.94729	0.7908	10	0.72032	D	0.01	.	13.6958	0.62578	0.0:0.0:0.0:1.0	.	207;207	Q14524;Q14524-2	SCN5A_HUMAN;.	A	207	ENSP00000398266:T207A;ENSP00000397915:T207A;ENSP00000328968:T207A;ENSP00000413996:T207A	ENSP00000328968:T207A	T	-	1	0	SCN5A	38630322	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.117000	0.71577	1.826000	0.53198	0.454000	0.30748	ACT	SCN5A	-	pfam_Ion_trans_dom	ENSG00000183873		0.478	SCN5A-014	KNOWN	basic|CCDS	protein_coding	SCN5A	HGNC	protein_coding	OTTHUMT00000377958.1	23	0.00	0	T	NM_198056		38655318	38655318	-1	no_errors	ENST00000333535	ensembl	human	known	69_37n	missense	12	29.41	5	SNP	1.000	C
SEC31A	22872	genome.wustl.edu	37	4	83793139	83793139	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr4:83793139C>A	ENST00000395310.2	-	7	922	c.740G>T	c.(739-741)cGa>cTa	p.R247L	SEC31A_ENST00000508479.1_Missense_Mutation_p.R247L|SEC31A_ENST00000264405.5_5'Flank|SEC31A_ENST00000348405.4_Missense_Mutation_p.R247L|SEC31A_ENST00000432794.1_Missense_Mutation_p.R247L|SEC31A_ENST00000355196.2_Missense_Mutation_p.R247L|SEC31A_ENST00000448323.1_Missense_Mutation_p.R247L|SEC31A_ENST00000311785.7_Missense_Mutation_p.R247L|SEC31A_ENST00000513858.1_Missense_Mutation_p.R247L|SEC31A_ENST00000443462.2_Missense_Mutation_p.R242L|SEC31A_ENST00000436790.2_5'UTR|SEC31A_ENST00000326950.5_Missense_Mutation_p.R247L|SEC31A_ENST00000509142.1_Missense_Mutation_p.R247L|SEC31A_ENST00000505472.1_Missense_Mutation_p.R247L|SEC31A_ENST00000505984.1_Missense_Mutation_p.R247L|SEC31A_ENST00000500777.2_Missense_Mutation_p.R247L|SEC31A_ENST00000508502.1_Missense_Mutation_p.R247L	NM_001077207.2|NM_001077208.2|NM_014933.3	NP_001070675.1|NP_001070676.1|NP_055748.2	O94979	SC31A_HUMAN	SEC31 homolog A (S. cerevisiae)	247	Interaction with SEC13.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)|response to calcium ion (GO:0051592)	COPII vesicle coat (GO:0030127)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle (GO:0030134)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|vesicle coat (GO:0030120)	calcium-dependent protein binding (GO:0048306)		SEC31A/ALK(3)|SEC31A/JAK2(4)	breast(1)	1		Hepatocellular(203;0.114)				GGAAGCAAATCGAAGATCCCA	0.473																																						dbGAP											0													126.0	98.0	107.0					4																	83793139		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018358	CCDS3596.1, CCDS3597.1, CCDS43244.1, CCDS47088.1, CCDS54773.1, CCDS75155.1, CCDS75156.1	4q21.3	2013-01-10	2006-10-05	2006-09-07	ENSG00000138674	ENSG00000138674		"""WD repeat domain containing"""	17052	protein-coding gene	gene with protein product		610257	"""SEC31-like 1 (S. cerevisiae)"", ""Sec31 homolog A (S. cerevisiae)"""	SEC31L1		10048485, 10788476	Standard	NM_001077206		Approved	KIAA0905, ABP125, ABP130	uc003hnh.3	O94979	OTTHUMG00000130297	ENST00000395310.2:c.740G>T	4.37:g.83793139C>A	ENSP00000378721:p.Arg247Leu		B4DIW6|B7ZKZ7|B7ZL00|H7C2W3|Q17RR5|Q5H9P6|Q5XG74|Q659G7|Q6ZU90|Q7LCX9|Q86TJ0|Q8IZH4|Q9P048|Q9P0A6|Q9UM05|Q9UM06	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R247L	ENST00000395310.2	37	c.740	CCDS3596.1	4	.	.	.	.	.	.	.	.	.	.	C	36	5.640253	0.96693	.	.	ENSG00000138674	ENST00000348405;ENST00000513858;ENST00000395310;ENST00000443462;ENST00000509142;ENST00000432794;ENST00000448323;ENST00000326950;ENST00000311785;ENST00000505472;ENST00000500777;ENST00000508502;ENST00000355196;ENST00000505984;ENST00000508479;ENST00000503058	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.67171	1.64;1.64;1.64;1.38;1.64;1.64;1.64;1.64;1.64;1.64;1.64;1.64;1.64;1.64;1.64;-0.25	5.65	5.65	0.86999	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.058713	0.64402	D	0.000002	D	0.87063	0.6084	M	0.94021	3.485	0.80722	D	1	P;P;D;P;D;D;D;P;D	0.76494	0.947;0.954;0.973;0.895;0.998;0.965;0.999;0.852;0.971	P;P;P;P;D;D;D;P;P	0.75020	0.85;0.726;0.69;0.617;0.985;0.979;0.984;0.663;0.895	D	0.89888	0.4035	10	0.87932	D	0	-4.6315	19.718	0.96131	0.0:1.0:0.0:0.0	.	242;247;247;247;247;247;247;247;247	B4DIW6;B7ZL00;O94979-5;D6RHZ5;O94979-6;O94979-4;O94979-3;O94979-2;O94979	.;.;.;.;.;.;.;.;SC31A_HUMAN	L	247;247;247;242;247;247;247;247;247;247;247;247;247;247;247;218	ENSP00000337602:R247L;ENSP00000426886:R247L;ENSP00000378721:R247L;ENSP00000408027:R242L;ENSP00000426569:R247L;ENSP00000407944:R247L;ENSP00000400926:R247L;ENSP00000325087:R247L;ENSP00000309070:R247L;ENSP00000421633:R247L;ENSP00000421464:R247L;ENSP00000424635:R247L;ENSP00000347329:R247L;ENSP00000424451:R247L;ENSP00000425999:R247L;ENSP00000425056:R218L	ENSP00000309070:R247L	R	-	2	0	SEC31A	84012163	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.814000	0.86154	2.645000	0.89757	0.585000	0.79938	CGA	SEC31A	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom	ENSG00000138674		0.473	SEC31A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEC31A	HGNC	protein_coding	OTTHUMT00000252640.1	96	0.00	0	C	NM_016211		83793139	83793139	-1	no_errors	ENST00000432794	ensembl	human	known	69_37n	missense	85	43.33	65	SNP	1.000	A
SI	6476	genome.wustl.edu	37	3	164764723	164764723	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr3:164764723G>A	ENST00000264382.3	-	16	1855	c.1793C>T	c.(1792-1794)gCt>gTt	p.A598V		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	598	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	CCAATGCGCAGCATGTCTTCC	0.378										HNSCC(35;0.089)																												dbGAP											0													91.0	87.0	89.0					3																	164764723		2203	4300	6503	-	-	-	SO:0001583	missense	0			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.1793C>T	3.37:g.164764723G>A	ENSP00000264382:p.Ala598Val		A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd,smart_P_trefoil	p.A598V	ENST00000264382.3	37	c.1793	CCDS3196.1	3	.	.	.	.	.	.	.	.	.	.	G	22.8	4.333457	0.81801	.	.	ENSG00000090402	ENST00000264382	D	0.92099	-2.97	5.36	5.36	0.76844	Glycoside hydrolase, superfamily (1);	0.196808	0.45606	D	0.000342	D	0.94095	0.8107	M	0.73753	2.245	0.32469	N	0.543075	D	0.76494	0.999	P	0.60682	0.878	D	0.94511	0.7718	10	0.48119	T	0.1	.	8.9175	0.35590	0.08:0.1506:0.7694:0.0	.	598	P14410	SUIS_HUMAN	V	598	ENSP00000264382:A598V	ENSP00000264382:A598V	A	-	2	0	SI	166247417	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.061000	0.71148	2.519000	0.84933	0.467000	0.42956	GCT	SI	-	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF	ENSG00000090402		0.378	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SI	HGNC	protein_coding	OTTHUMT00000350116.1	164	0.00	0	G	NM_001041		164764723	164764723	-1	no_errors	ENST00000264382	ensembl	human	known	69_37n	missense	126	19.23	30	SNP	1.000	A
SLC12A5	57468	genome.wustl.edu	37	20	44665392	44665392	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr20:44665392G>A	ENST00000454036.2	+	5	557	c.508G>A	c.(508-510)Gcc>Acc	p.A170T	SLC12A5_ENST00000372315.1_Missense_Mutation_p.A147T|SLC12A5_ENST00000243964.3_Missense_Mutation_p.A147T|SLC12A5_ENST00000608944.1_Missense_Mutation_p.A96T	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	170					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	GATGCTCACGGCCATCTCCAT	0.592																																						dbGAP											0													153.0	116.0	128.0					20																	44665392		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.508G>A	20.37:g.44665392G>A	ENSP00000387694:p.Ala170Thr		A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Missense_Mutation	SNP	pfam_AA-permease_dom,prints_KCL_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.A170T	ENST00000454036.2	37	c.508	CCDS46610.1	20	.	.	.	.	.	.	.	.	.	.	G	19.74	3.883129	0.72410	.	.	ENSG00000124140	ENST00000454036;ENST00000372315;ENST00000539566;ENST00000243964	D;D;D;D	0.98822	-5.16;-5.16;-5.16;-5.16	4.65	4.65	0.58169	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.97514	0.9186	L	0.39245	1.2	0.80722	D	1	P;B;P	0.38440	0.631;0.251;0.538	P;B;B	0.44811	0.461;0.169;0.219	D	0.98472	1.0601	10	0.59425	D	0.04	.	16.6989	0.85343	0.0:0.0:1.0:0.0	.	170;147;147	Q9H2X9;Q9H2X9-2;A8K143	S12A5_HUMAN;.;.	T	170;147;147;147	ENSP00000387694:A170T;ENSP00000361389:A147T;ENSP00000446091:A147T;ENSP00000243964:A147T	ENSP00000243964:A147T	A	+	1	0	SLC12A5	44098799	1.000000	0.71417	0.998000	0.56505	0.316000	0.28119	7.683000	0.84093	2.411000	0.81874	0.563000	0.77884	GCC	SLC12A5	-	pfam_AA-permease_dom,tigrfam_Na/K/Cl_cotransptS	ENSG00000124140		0.592	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	SLC12A5	HGNC	protein_coding	OTTHUMT00000471538.1	34	0.00	0	G			44665392	44665392	+1	no_errors	ENST00000454036	ensembl	human	known	69_37n	missense	51	12.07	7	SNP	1.000	A
SLC39A5	283375	genome.wustl.edu	37	12	56625119	56625119	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr12:56625119T>C	ENST00000266980.4	+	2	354	c.61T>C	c.(61-63)Tgg>Cgg	p.W21R	SLC39A5_ENST00000454355.2_Missense_Mutation_p.W21R	NM_001135195.1	NP_001128667.1	Q6ZMH5	S39A5_HUMAN	solute carrier family 39 (zinc transporter), member 5	21					cellular response to zinc ion starvation (GO:0034224)|G1 to G0 transition involved in cell differentiation (GO:0070315)|neural precursor cell proliferation (GO:0061351)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)			NS(1)|cervix(6)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						CGTCTTGGGCTGGGTAGGGGG	0.617																																						dbGAP											0													84.0	82.0	83.0					12																	56625119		2203	4298	6501	-	-	-	SO:0001583	missense	0				CCDS8912.2	12q13.3	2013-07-17	2013-07-17		ENSG00000139540	ENSG00000139540		"""Solute carriers"""	20502	protein-coding gene	gene with protein product		608730	"""solute carrier family 39 (metal ion transporter), member 5"""				Standard	NM_173596		Approved		uc010sqj.2	Q6ZMH5	OTTHUMG00000156962	ENST00000266980.4:c.61T>C	12.37:g.56625119T>C	ENSP00000266980:p.Trp21Arg		B2R808|Q8N6Y3	Missense_Mutation	SNP	pfam_ZIP	p.W21R	ENST00000266980.4	37	c.61	CCDS8912.2	12	.	.	.	.	.	.	.	.	.	.	T	12.05	1.821632	0.32237	.	.	ENSG00000139540	ENST00000424625;ENST00000419753;ENST00000454355;ENST00000417965;ENST00000266980;ENST00000437277	T;T;T;T;T;T	0.22539	1.95;1.95;1.95;1.95;1.95;1.95	4.67	2.1	0.27182	.	0.440966	0.19557	N	0.111422	T	0.14098	0.0341	L	0.44542	1.39	0.25133	N	0.990557	B	0.06786	0.001	B	0.08055	0.003	T	0.20306	-1.0279	10	0.51188	T	0.08	-12.7427	1.5746	0.02622	0.1695:0.0975:0.1755:0.5574	.	21	Q6ZMH5	S39A5_HUMAN	R	21	ENSP00000404155:W21R;ENSP00000402891:W21R;ENSP00000405360:W21R;ENSP00000414868:W21R;ENSP00000266980:W21R;ENSP00000407399:W21R	ENSP00000266980:W21R	W	+	1	0	SLC39A5	54911386	0.845000	0.29573	0.992000	0.48379	0.870000	0.49936	-0.042000	0.12063	0.752000	0.32923	0.459000	0.35465	TGG	SLC39A5	-	NULL	ENSG00000139540		0.617	SLC39A5-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC39A5	HGNC	protein_coding	OTTHUMT00000346834.1	81	0.00	0	T	NM_173596		56625119	56625119	+1	no_errors	ENST00000266980	ensembl	human	known	69_37n	missense	80	22.33	23	SNP	0.899	C
SLITRK6	84189	genome.wustl.edu	37	13	86370546	86370547	+	Missense_Mutation	DNP	GA	GA	AG			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	G|A	G|A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr13:86370546_86370547GA>AG	ENST00000400286.2	-	2	695_696	c.97_98TC>CT	c.(97-99)TCt>CTt	p.S33L		NM_032229.2	NP_115605.2	Q9H5Y7	SLIK6_HUMAN	SLIT and NTRK-like family, member 6	33	LRRNT 1.				adult locomotory behavior (GO:0008344)|auditory behavior (GO:0031223)|auditory receptor cell morphogenesis (GO:0002093)|axonogenesis (GO:0007409)|cochlea development (GO:0090102)|innervation (GO:0060384)|lens development in camera-type eye (GO:0002088)|linear vestibuloocular reflex (GO:0060007)|multicellular organism growth (GO:0035264)|sensory perception of sound (GO:0007605)|startle response (GO:0001964)|synapse assembly (GO:0007416)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)				breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(18)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		ATTGCAAAGAGAATCACAAGAG	0.406																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK026427	CCDS41903.1	13q31.1	2006-04-12			ENSG00000184564	ENSG00000184564			23503	protein-coding gene	gene with protein product		609681				14557068	Standard	NM_032229		Approved	FLJ22774	uc001vll.1	Q9H5Y7	OTTHUMG00000017157	ENST00000400286.2:c.97_98delinsAG	13.37:g.86370546_86370547delinsAG	ENSP00000383143:p.Ser33Leu		A8K9S8|Q495Q0|Q6AW93|Q9HAA8|Q9NT60	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.S33F|p.S33P	ENST00000400286.2	37	c.98|c.97	CCDS41903.1	13																																																																																			SLITRK6	-	NULL	ENSG00000184564		0.406	SLITRK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK6	HGNC	protein_coding	OTTHUMT00000045404.2	235|233	0.42|0.00	1|0	G|A	NM_032229		86370546|86370547	86370546|86370547	-1	no_errors	ENST00000400286	ensembl	human	known	69_37n	missense	191|193	24.80|24.02	63|61	SNP	1.000|0.997	A|G
SORBS1	10580	genome.wustl.edu	37	10	97141537	97141537	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr10:97141537C>T	ENST00000361941.3	-	16	1584	c.1558G>A	c.(1558-1560)Gat>Aat	p.D520N	SORBS1_ENST00000371245.3_Missense_Mutation_p.D405N|SORBS1_ENST00000607232.1_Missense_Mutation_p.D309N|SORBS1_ENST00000371241.1_Missense_Mutation_p.D310N|SORBS1_ENST00000354106.3_Missense_Mutation_p.D490N|SORBS1_ENST00000347291.4_Missense_Mutation_p.D388N|SORBS1_ENST00000371247.2_Missense_Mutation_p.D520N|SORBS1_ENST00000371227.4_Missense_Mutation_p.D474N|SORBS1_ENST00000371239.1_Missense_Mutation_p.D319N|SORBS1_ENST00000353505.5_Missense_Mutation_p.D405N|SORBS1_ENST00000277982.5_Missense_Mutation_p.D542N|SORBS1_ENST00000371249.2_Missense_Mutation_p.D442N|SORBS1_ENST00000393949.1_Missense_Mutation_p.D490N|SORBS1_ENST00000371246.2_Missense_Mutation_p.D542N|SORBS1_ENST00000306402.6_Missense_Mutation_p.D351N|SORBS1_ENST00000474353.2_5'UTR	NM_001034954.1	NP_001030126			sorbin and SH3 domain containing 1											NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(19)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		ACTTTCTTATCTGGGGGTTCC	0.428																																						dbGAP											0													143.0	144.0	144.0					10																	97141537		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF136381	CCDS7442.1, CCDS31252.1, CCDS31253.1, CCDS31254.1, CCDS31255.1, CCDS31256.1, CCDS73169.1	10q23.33	2011-07-25	2002-05-08		ENSG00000095637	ENSG00000095637			14565	protein-coding gene	gene with protein product	"""c-Cbl-associated protein"""	605264	"""SH3-domain protein 5 (ponsin)"""	SH3D5		10085297, 11001060	Standard	XM_005269405		Approved	FLJ12406, CAP, sh3p12, ponsin, KIAA1296	uc001kkp.3	Q9BX66	OTTHUMG00000018812	ENST00000361941.3:c.1558G>A	10.37:g.97141537C>T	ENSP00000355136:p.Asp520Asn			Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Sorb,superfamily_SH3_domain,smart_Sorb,smart_SH3_domain,pfscan_Sorb,pfscan_SH3_domain	p.D520N	ENST00000361941.3	37	c.1558	CCDS31255.1	10	.	.	.	.	.	.	.	.	.	.	C	34	5.398538	0.96030	.	.	ENSG00000095637	ENST00000371245;ENST00000306402;ENST00000371249;ENST00000371247;ENST00000371227;ENST00000371246;ENST00000393949;ENST00000353505;ENST00000347291;ENST00000361941;ENST00000277982;ENST00000371241;ENST00000354106;ENST00000371239	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.36157	1.27;1.27;1.27;1.27;1.27;1.27;1.27;1.27;1.27;1.27;1.27;1.27;1.27;1.27	5.98	5.98	0.97165	.	0.000000	0.42682	D	0.000661	T	0.57373	0.2049	L	0.46819	1.47	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;0.993;1.0;0.997;1.0;0.995;0.998;1.0;1.0;0.992;1.0;1.0;0.997	D;P;D;D;D;D;D;D;D;D;D;D;P	0.91635	0.998;0.88;0.999;0.976;0.999;0.971;0.998;0.999;0.999;0.96;0.999;0.999;0.889	T	0.54990	-0.8210	10	0.72032	D	0.01	-15.1323	20.4366	0.99092	0.0:1.0:0.0:0.0	.	672;319;474;442;351;310;319;405;520;542;388;490;98	B7Z9B7;B4DTX5;Q9BX66-11;Q9BX66-10;Q9BX66-9;Q9BX66-4;Q9BX66-8;Q9BX66-3;Q9BX66;Q9BX66-2;Q9BX66-6;Q9BX66-5;Q6MZY5	.;.;.;.;.;.;.;.;SRBS1_HUMAN;.;.;.;.	N	405;351;442;520;474;542;490;405;388;520;542;310;490;319	ENSP00000360291:D405N;ENSP00000302556:D351N;ENSP00000360295:D442N;ENSP00000360293:D520N;ENSP00000360271:D474N;ENSP00000360292:D542N;ENSP00000377521:D490N;ENSP00000343998:D405N;ENSP00000277985:D388N;ENSP00000355136:D520N;ENSP00000277982:D542N;ENSP00000360285:D310N;ENSP00000277984:D490N;ENSP00000360283:D319N	ENSP00000277982:D542N	D	-	1	0	SORBS1	97131527	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.625000	0.83145	2.843000	0.97960	0.585000	0.79938	GAT	SORBS1	-	NULL	ENSG00000095637		0.428	SORBS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SORBS1	HGNC	protein_coding	OTTHUMT00000049517.1	138	0.00	0	C			97141537	97141537	-1	no_errors	ENST00000361941	ensembl	human	known	69_37n	missense	158	25.82	55	SNP	1.000	T
SP7	121340	genome.wustl.edu	37	12	53722555	53722555	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr12:53722555A>G	ENST00000536324.2	-	3	954	c.671T>C	c.(670-672)tTg>tCg	p.L224S	SP7_ENST00000537210.2_Missense_Mutation_p.L206S|SP7_ENST00000303846.3_Missense_Mutation_p.L224S	NM_001173467.1	NP_001166938.1	Q8TDD2	SP7_HUMAN	Sp7 transcription factor	224					hematopoietic stem cell differentiation (GO:0060218)|osteoblast differentiation (GO:0001649)|positive regulation of stem cell differentiation (GO:2000738)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DEAD/H-box RNA helicase binding (GO:0017151)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(2)|large_intestine(3)|lung(7)|skin(1)|urinary_tract(1)	14						ATCTTGGGGCAAGACATGCTG	0.597																																						dbGAP											0													47.0	51.0	50.0					12																	53722555		1911	4118	6029	-	-	-	SO:0001583	missense	0			AF477981	CCDS44897.1, CCDS73475.1	12q13.13	2013-01-08				ENSG00000170374		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	17321	protein-coding gene	gene with protein product		606633				11792318	Standard	NM_152860		Approved	osterix, OSX	uc001sct.3	Q8TDD2		ENST00000536324.2:c.671T>C	12.37:g.53722555A>G	ENSP00000443827:p.Leu224Ser		B3KY26|Q3MJ72|Q7Z718	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L224S	ENST00000536324.2	37	c.671	CCDS44897.1	12	.	.	.	.	.	.	.	.	.	.	A	13.55	2.271249	0.40194	.	.	ENSG00000170374	ENST00000536324;ENST00000303846;ENST00000537210;ENST00000547755	T;T;T;T	0.59224	2.92;2.92;2.88;0.28	4.13	4.13	0.48395	.	0.000000	0.64402	D	0.000008	T	0.70579	0.3240	M	0.66297	2.02	0.51012	D	0.999906	D	0.76494	0.999	D	0.64410	0.925	T	0.73623	-0.3924	10	0.56958	D	0.05	.	12.827	0.57725	1.0:0.0:0.0:0.0	.	224	Q8TDD2	SP7_HUMAN	S	224;224;206;206	ENSP00000443827:L224S;ENSP00000302812:L224S;ENSP00000441367:L206S;ENSP00000449355:L206S	ENSP00000302812:L224S	L	-	2	0	SP7	52008822	1.000000	0.71417	0.983000	0.44433	0.943000	0.58893	5.812000	0.69194	1.819000	0.53055	0.260000	0.18958	TTG	SP7	-	NULL	ENSG00000170374		0.597	SP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SP7	HGNC	protein_coding	OTTHUMT00000406917.1	37	0.00	0	A			53722555	53722555	-1	no_errors	ENST00000303846	ensembl	human	known	69_37n	missense	34	20.93	9	SNP	1.000	G
SPOCD1	90853	genome.wustl.edu	37	1	32279706	32279706	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr1:32279706G>A	ENST00000360482.2	-	2	1358	c.1229C>T	c.(1228-1230)tCa>tTa	p.S410L	SPOCD1_ENST00000533231.1_Missense_Mutation_p.S410L|SPOCD1_ENST00000373648.2_Missense_Mutation_p.S410L|SPOCD1_ENST00000257100.3_Intron	NM_144569.4	NP_653170.3	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1	410					negative regulation of phosphatase activity (GO:0010923)|transcription, DNA-templated (GO:0006351)					NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(1)|lung(7)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	37		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		GAATGGGCCTGAGCAGGCCCT	0.627																																						dbGAP											0													31.0	33.0	32.0					1																	32279706		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK058077	CCDS347.1, CCDS60066.1, CCDS72748.1	1p35.1	2014-06-13			ENSG00000134668	ENSG00000134668			26338	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 146"""					12477932	Standard	NM_144569		Approved	FLJ25348, PPP1R146	uc001bts.1	Q6ZMY3	OTTHUMG00000003879	ENST00000360482.2:c.1229C>T	1.37:g.32279706G>A	ENSP00000353670:p.Ser410Leu		Q24JU3|Q6PI90|Q8N869|Q8N8U0|Q8NBC6|Q96LN6	Missense_Mutation	SNP	pfam_TFIIS_cen_dom,pfam_SPOC_C,superfamily_TFIIS_cen_dom,smart_TFS2M	p.S410L	ENST00000360482.2	37	c.1229	CCDS347.1	1	.	.	.	.	.	.	.	.	.	.	G	15.57	2.871335	0.51695	.	.	ENSG00000134668	ENST00000360482;ENST00000373648;ENST00000533231	T;T;T	0.35789	1.71;1.29;1.72	3.53	1.65	0.23941	.	.	.	.	.	T	0.19287	0.0463	N	0.19112	0.55	0.09310	N	0.999998	P;P	0.38677	0.642;0.51	B;B	0.32211	0.142;0.067	T	0.11665	-1.0578	9	0.72032	D	0.01	-0.0273	5.7503	0.18142	0.2483:0.0:0.7517:0.0	.	410;410	Q6ZMY3-2;Q6ZMY3	.;SPOC1_HUMAN	L	410	ENSP00000353670:S410L;ENSP00000362752:S410L;ENSP00000435851:S410L	ENSP00000353670:S410L	S	-	2	0	SPOCD1	32052293	0.001000	0.12720	0.257000	0.24404	0.227000	0.25037	0.524000	0.22940	0.479000	0.27511	0.462000	0.41574	TCA	SPOCD1	-	NULL	ENSG00000134668		0.627	SPOCD1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPOCD1	HGNC	protein_coding	OTTHUMT00000381912.1	27	0.00	0	G	NM_144569		32279706	32279706	-1	no_errors	ENST00000360482	ensembl	human	known	69_37n	missense	27	32.50	13	SNP	0.314	A
SYNE1	23345	genome.wustl.edu	37	6	152763222	152763222	+	Silent	SNP	T	T	C			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr6:152763222T>C	ENST00000367255.5	-	31	4597	c.3996A>G	c.(3994-3996)gaA>gaG	p.E1332E	SYNE1_ENST00000413186.2_Silent_p.E1332E|SYNE1_ENST00000423061.1_Silent_p.E1339E|SYNE1_ENST00000448038.1_Silent_p.E1339E|SYNE1_ENST00000341594.5_Silent_p.E1398E|SYNE1_ENST00000367253.4_Silent_p.E1332E|SYNE1_ENST00000265368.4_Silent_p.E1332E|SYNE1_ENST00000367248.3_Silent_p.E1322E	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1332					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GGATGCGGCGTTCCTGCCTCT	0.627										HNSCC(10;0.0054)																												dbGAP											0													60.0	61.0	61.0					6																	152763222		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.3996A>G	6.37:g.152763222T>C			E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.E1332	ENST00000367255.5	37	c.3996	CCDS5236.2	6																																																																																			SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1	ENSG00000131018		0.627	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	89	0.00	0	T	NM_182961		152763222	152763222	-1	no_errors	ENST00000265368	ensembl	human	known	69_37n	silent	63	26.74	23	SNP	0.933	C
TAS2R60	338398	genome.wustl.edu	37	7	143141397	143141397	+	Silent	SNP	G	G	A			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr7:143141397G>A	ENST00000332690.1	+	1	852	c.852G>A	c.(850-852)gtG>gtA	p.V284V	EPHA1-AS1_ENST00000429289.1_RNA	NM_177437.1	NP_803186.1	P59551	T2R60_HUMAN	taste receptor, type 2, member 60	284					sensory perception of bitter taste (GO:0050913)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|kidney(1)|large_intestine(2)|lung(17)|prostate(1)|skin(7)|urinary_tract(2)	31	Melanoma(164;0.172)					GGGAGTCAGTGATTTATCTGT	0.488																																						dbGAP											0													151.0	151.0	151.0					7																	143141397		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY114094	CCDS5885.1	7q35	2014-07-10			ENSG00000185899	ENSG00000185899		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	20639	protein-coding gene	gene with protein product		613968				12584440	Standard	NM_177437		Approved	T2R60	uc011ktg.2	P59551	OTTHUMG00000154891	ENST00000332690.1:c.852G>A	7.37:g.143141397G>A			A4D2G8|Q645W8|Q7RTR7	Silent	SNP	pfam_TAS2_rcpt	p.V284	ENST00000332690.1	37	c.852	CCDS5885.1	7																																																																																			TAS2R60	-	pfam_TAS2_rcpt	ENSG00000185899		0.488	TAS2R60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R60	HGNC	protein_coding	OTTHUMT00000337541.1	427	0.00	0	G			143141397	143141397	+1	no_errors	ENST00000332690	ensembl	human	known	69_37n	silent	365	36.94	215	SNP	0.023	A
TCHHL1	126637	genome.wustl.edu	37	1	152058657	152058657	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr1:152058657C>A	ENST00000368806.1	-	3	1565	c.1501G>T	c.(1501-1503)Gat>Tat	p.D501Y		NM_001008536.1	NP_001008536.1	Q5QJ38	TCHL1_HUMAN	trichohyalin-like 1	501							calcium ion binding (GO:0005509)			breast(4)|endometrium(1)|kidney(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(1)|skin(7)|stomach(1)	60	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.246)			GGTGCTAAATCTTGTGTTCTT	0.493																																						dbGAP											0													238.0	202.0	214.0					1																	152058657		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS30857.1	1q21.3	2011-10-11	2004-10-05	2006-01-27	ENSG00000182898	ENSG00000182898		"""S100 calcium binding proteins"""	31796	protein-coding gene	gene with protein product			"""S100 calcium binding protein A17"""	S100A17, THHL1			Standard	NM_001008536		Approved		uc001ezo.1	Q5QJ38	OTTHUMG00000013058	ENST00000368806.1:c.1501G>T	1.37:g.152058657C>A	ENSP00000357796:p.Asp501Tyr		B2RPK8|Q5VTJ9	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub	p.D501Y	ENST00000368806.1	37	c.1501	CCDS30857.1	1	.	.	.	.	.	.	.	.	.	.	.	15.38	2.815966	0.50527	.	.	ENSG00000182898	ENST00000368806	T	0.24538	1.85	5.59	4.69	0.59074	.	0.775342	0.10940	N	0.617306	T	0.13670	0.0331	L	0.40543	1.245	0.09310	N	1	P	0.52316	0.952	P	0.45881	0.496	T	0.10245	-1.0638	10	0.59425	D	0.04	-2.8745	10.3037	0.43667	0.0:0.9096:0.0:0.0904	.	501	Q5QJ38	TCHL1_HUMAN	Y	501	ENSP00000357796:D501Y	ENSP00000357796:D501Y	D	-	1	0	TCHHL1	150325281	0.000000	0.05858	0.021000	0.16686	0.012000	0.07955	0.587000	0.23909	1.375000	0.46248	0.650000	0.86243	GAT	TCHHL1	-	NULL	ENSG00000182898		0.493	TCHHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHHL1	HGNC	protein_coding	OTTHUMT00000036638.2	657	0.15	1	C	XM_060104		152058657	152058657	-1	no_errors	ENST00000368806	ensembl	human	known	69_37n	missense	550	23.47	169	SNP	0.010	A
TRABD2A	129293	genome.wustl.edu	37	2	85051165	85051165	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr2:85051165C>T	ENST00000409520.2	-	6	1288	c.1246G>A	c.(1246-1248)Gaa>Aaa	p.E416K	TRABD2A_ENST00000479944.1_5'UTR|TRABD2A_ENST00000335459.5_Missense_Mutation_p.E367K	NM_001277053.1	NP_001263982.1	Q86V40	TIKI1_HUMAN	TraB domain containing 2A	416					head development (GO:0060322)|metabolic process (GO:0008152)|negative regulation of Wnt signaling pathway (GO:0030178)|protein oxidation (GO:0018158)|Wnt signaling pathway (GO:0016055)	integral component of organelle membrane (GO:0031301)|integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|Wnt-protein binding (GO:0017147)										AACCTCTGTTCGGCCTCACTG	0.647																																						dbGAP											0													39.0	44.0	42.0					2																	85051165		2197	4300	6497	-	-	-	SO:0001583	missense	0			BC049209	CCDS46349.1, CCDS62946.1	2p11.2	2012-07-04	2012-07-04	2012-07-04	ENSG00000186854	ENSG00000186854			27013	protein-coding gene	gene with protein product		614912	"""chromosome 2 open reading frame 89"""	C2orf89		12477932	Standard	NM_001080824		Approved		uc010ysl.3	Q86V40	OTTHUMG00000152922	ENST00000409520.2:c.1246G>A	2.37:g.85051165C>T	ENSP00000387075:p.Glu416Lys		B4DKK8|I6UMB9	Missense_Mutation	SNP	NULL	p.E416K	ENST00000409520.2	37	c.1246		2	.	.	.	.	.	.	.	.	.	.	c	11.53	1.667077	0.29604	.	.	ENSG00000186854	ENST00000335459;ENST00000409520	T;T	0.26810	1.71;1.8	3.65	1.74	0.24563	.	0.288290	0.26450	N	0.024315	T	0.15089	0.0364	.	.	.	0.09310	N	1	P;P	0.36438	0.553;0.456	B;B	0.25405	0.06;0.05	T	0.10613	-1.0622	9	0.52906	T	0.07	.	9.8456	0.41026	0.0:0.5653:0.4347:0.0	.	416;367	Q86V40;Q86V40-2	CB089_HUMAN;.	K	367;416	ENSP00000335004:E367K;ENSP00000387075:E416K	ENSP00000335004:E367K	E	-	1	0	C2orf89	84904676	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.645000	0.24782	0.316000	0.23135	0.444000	0.29173	GAA	TRABD2A	-	NULL	ENSG00000186854		0.647	TRABD2A-201	KNOWN	basic|appris_principal	protein_coding	TRABD2A	HGNC	protein_coding		35	0.00	0	C	NM_001080824		85051165	85051165	-1	no_errors	ENST00000409520	ensembl	human	known	69_37n	missense	16	27.27	6	SNP	0.000	T
TRAFD1	10906	genome.wustl.edu	37	12	112580087	112580087	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr12:112580087A>T	ENST00000257604.5	+	6	1455	c.838A>T	c.(838-840)Agt>Tgt	p.S280C	TRAFD1_ENST00000412615.2_Missense_Mutation_p.S280C	NM_001143906.1	NP_001137378.1	O14545	TRAD1_HUMAN	TRAF-type zinc finger domain containing 1	280					negative regulation of innate immune response (GO:0045824)|response to cytokine (GO:0034097)		metal ion binding (GO:0046872)			kidney(5)|large_intestine(3)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	17						CAGGTCTCTCAGTGACATAAA	0.458																																						dbGAP											0													77.0	76.0	77.0					12																	112580087		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007447	CCDS9160.1	12q24.13	2013-01-25			ENSG00000135148	ENSG00000135148			24808	protein-coding gene	gene with protein product		613197				12477932	Standard	NM_006700		Approved	FLN29	uc001ttp.3	O14545	OTTHUMG00000169640	ENST00000257604.5:c.838A>T	12.37:g.112580087A>T	ENSP00000257604:p.Ser280Cys		A8K5L6|B4DI89	Missense_Mutation	SNP	superfamily_TRAF-like	p.S280C	ENST00000257604.5	37	c.838	CCDS9160.1	12	.	.	.	.	.	.	.	.	.	.	A	22.9	4.347867	0.82022	.	.	ENSG00000135148	ENST00000412615;ENST00000257604;ENST00000552896;ENST00000548277	T;T;T	0.32988	1.43;1.43;2.12	4.89	0.12	0.14691	.	1.270390	0.04945	N	0.459327	T	0.19967	0.0480	N	0.14661	0.345	0.09310	N	1	B	0.23249	0.082	B	0.21546	0.035	T	0.34179	-0.9839	10	0.62326	D	0.03	-0.5578	7.6542	0.28365	0.6134:0.0:0.3866:0.0	.	280	O14545	TRAD1_HUMAN	C	280;280;280;74	ENSP00000396526:S280C;ENSP00000257604:S280C;ENSP00000450357:S280C	ENSP00000257604:S280C	S	+	1	0	TRAFD1	111064470	0.000000	0.05858	0.001000	0.08648	0.939000	0.58152	0.435000	0.21510	0.115000	0.18071	0.460000	0.39030	AGT	TRAFD1	-	NULL	ENSG00000135148		0.458	TRAFD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAFD1	HGNC	protein_coding	OTTHUMT00000405214.1	90	0.00	0	A	NM_006700		112580087	112580087	+1	no_errors	ENST00000257604	ensembl	human	known	69_37n	missense	108	22.86	32	SNP	0.000	T
TXLNG	55787	genome.wustl.edu	37	X	16859739	16859739	+	Silent	SNP	C	C	T			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chrX:16859739C>T	ENST00000380122.5	+	10	1498	c.1437C>T	c.(1435-1437)ccC>ccT	p.P479P	TXLNG_ENST00000485153.1_3'UTR|TXLNG_ENST00000398155.4_Silent_p.P347P	NM_018360.2	NP_060830.2	Q9NUQ3	TXLNG_HUMAN	taxilin gamma	479					cell cycle (GO:0007049)|regulation of bone mineralization (GO:0030500)|regulation of cell cycle (GO:0051726)|regulation of cell cycle process (GO:0010564)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)	protein heterodimerization activity (GO:0046982)			breast(2)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	15						TGATGCAGCCCTGTACTGCCC	0.547																																						dbGAP											0													84.0	70.0	75.0					X																	16859739		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK002071	CCDS14178.1, CCDS55373.1	Xp22.2	2014-05-07	2010-04-20	2010-04-20	ENSG00000086712	ENSG00000086712			18578	protein-coding gene	gene with protein product	"""lipopolysaccharide specific response-5 protein"", ""factor inhibiting activating transcription factor 4 (ATF4)-mediated transcription"""	300677	"""chromosome X open reading frame 15"""	CXorf15		15911876, 15184072, 16831913	Standard	NM_018360		Approved	FLJ11209, LSR5, FIAT, MGC126621, MGC126625, TXLNGX	uc004cxq.2	Q9NUQ3	OTTHUMG00000021196	ENST00000380122.5:c.1437C>T	X.37:g.16859739C>T			Q2KQ75|Q5JNZ7|Q9P0X1	Silent	SNP	pfam_Taxilin	p.P479	ENST00000380122.5	37	c.1437	CCDS14178.1	X																																																																																			TXLNG	-	NULL	ENSG00000086712		0.547	TXLNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TXLNG	HGNC	protein_coding	OTTHUMT00000055912.1	131	0.00	0	C	NM_018360		16859739	16859739	+1	no_errors	ENST00000380122	ensembl	human	known	69_37n	silent	60	45.45	50	SNP	0.000	T
UACA	55075	genome.wustl.edu	37	15	70971994	70971994	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr15:70971994C>A	ENST00000322954.6	-	10	1029	c.844G>T	c.(844-846)Gat>Tat	p.D282Y	UACA_ENST00000560441.1_Missense_Mutation_p.D269Y|UACA_ENST00000559183.1_5'Flank|UACA_ENST00000539319.1_Missense_Mutation_p.D173Y|UACA_ENST00000379983.2_Missense_Mutation_p.D269Y	NM_018003.2	NP_060473.2	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and ankyrin repeats	282					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of protein import into nucleus (GO:0042307)|response to UV (GO:0009411)	apoptosome (GO:0043293)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(7)|kidney(4)|large_intestine(13)|lung(17)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	50						TTTACTTCATCTTGCATGTGT	0.328																																						dbGAP											0													126.0	111.0	116.0					15																	70971994		2199	4296	6495	-	-	-	SO:0001583	missense	0			AF322916	CCDS10235.1, CCDS32280.1	15q22-q24	2013-01-10			ENSG00000137831	ENSG00000137831		"""Ankyrin repeat domain containing"""	15947	protein-coding gene	gene with protein product		612516				11162650, 10997877	Standard	NM_001008224		Approved	FLJ10128, KIAA1561	uc002asr.3	Q9BZF9	OTTHUMG00000133363	ENST00000322954.6:c.844G>T	15.37:g.70971994C>A	ENSP00000314556:p.Asp282Tyr		G3XAG2|Q14DD3|Q8N3B8|Q96NH6|Q9HCL1|Q9NWC6	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_Prefoldin,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_T_SNARE_dom,prints_Ankyrin_rpt	p.D282Y	ENST00000322954.6	37	c.844	CCDS10235.1	15	.	.	.	.	.	.	.	.	.	.	C	20.7	4.026002	0.75390	.	.	ENSG00000137831	ENST00000322954;ENST00000379983;ENST00000395362;ENST00000539319	T;T;T	0.35973	1.28;1.3;1.76	5.85	5.85	0.93711	.	0.264923	0.32785	N	0.005644	T	0.52075	0.1712	L	0.57536	1.79	0.41216	D	0.986479	P;P;P;D	0.58620	0.884;0.95;0.93;0.983	P;P;P;P	0.56278	0.69;0.526;0.526;0.795	T	0.51228	-0.8732	10	0.62326	D	0.03	-9.8809	16.8855	0.86075	0.0:1.0:0.0:0.0	.	173;282;282;269	F5H2B9;B7ZKM6;Q9BZF9;G3XAG2	.;.;UACA_HUMAN;.	Y	282;269;269;173	ENSP00000314556:D282Y;ENSP00000369319:D269Y;ENSP00000438667:D173Y	ENSP00000314556:D282Y	D	-	1	0	UACA	68759048	1.000000	0.71417	0.887000	0.34795	0.696000	0.40369	3.838000	0.55828	2.773000	0.95371	0.585000	0.79938	GAT	UACA	-	NULL	ENSG00000137831		0.328	UACA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UACA	HGNC	protein_coding	OTTHUMT00000257199.2	79	0.00	0	C			70971994	70971994	-1	no_errors	ENST00000322954	ensembl	human	known	69_37n	missense	54	23.94	17	SNP	0.997	A
UNC13B	10497	genome.wustl.edu	37	9	35403592	35403592	+	Missense_Mutation	SNP	C	C	T	rs576351913		TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr9:35403592C>T	ENST00000378495.3	+	38	4708	c.4486C>T	c.(4486-4488)Cac>Tac	p.H1496Y	UNC13B_ENST00000378496.4_Missense_Mutation_p.H1515Y|UNC13B_ENST00000396787.1_Missense_Mutation_p.H1527Y	NM_006377.3	NP_006368.3	O14795	UN13B_HUMAN	unc-13 homolog B (C. elegans)	1496	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				apoptotic process (GO:0006915)|excretion (GO:0007588)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synaptic vesicle priming (GO:0010808)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|terminal bouton (GO:0043195)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(16)|liver(2)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			TGAGACATTCCACTTGTAAGT	0.552													C|||	1	0.000199681	0.0008	0.0	5008	,	,		9988	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													32.0	27.0	29.0					9																	35403592		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF020202	CCDS6579.1	9p13.3	2008-05-15	2003-10-17	2003-10-17	ENSG00000198722	ENSG00000198722			12566	protein-coding gene	gene with protein product		605836	"""unc-13-like (C. elegans)"""	UNC13		9607201	Standard	NM_006377		Approved	hmunc13, Unc13h2	uc003zwq.3	O14795	OTTHUMG00000019856	ENST00000378495.3:c.4486C>T	9.37:g.35403592C>T	ENSP00000367756:p.His1496Tyr		Q5VYM8	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_Ca-dep,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.H1527Y	ENST00000378495.3	37	c.4579	CCDS6579.1	9	.	.	.	.	.	.	.	.	.	.	C	15.96	2.987865	0.53934	.	.	ENSG00000198722	ENST00000396787;ENST00000378495;ENST00000378496;ENST00000535471	T;T;T	0.68765	-0.35;-0.35;-0.35	5.55	5.55	0.83447	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.105869	0.64402	D	0.000003	T	0.70842	0.3270	L	0.37697	1.125	0.58432	D	0.999998	D;D	0.57571	0.962;0.98	P;P	0.58721	0.616;0.844	T	0.62305	-0.6882	10	0.14656	T	0.56	-20.0547	19.6941	0.96016	0.0:1.0:0.0:0.0	.	1515;1496	F8W8M9;O14795	.;UN13B_HUMAN	Y	1527;1496;1515;1102	ENSP00000380006:H1527Y;ENSP00000367756:H1496Y;ENSP00000367757:H1515Y	ENSP00000367756:H1496Y	H	+	1	0	UNC13B	35393592	0.973000	0.33851	1.000000	0.80357	0.992000	0.81027	2.100000	0.41777	2.885000	0.99019	0.655000	0.94253	CAC	UNC13B	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	ENSG00000198722		0.552	UNC13B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC13B	HGNC	protein_coding	OTTHUMT00000052296.1	87	0.00	0	C	NM_006377		35403592	35403592	+1	no_errors	ENST00000396787	ensembl	human	known	69_37n	missense	27	25.00	9	SNP	1.000	T
USP5	8078	genome.wustl.edu	37	12	6971685	6971685	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr12:6971685G>T	ENST00000229268.8	+	14	1777	c.1725G>T	c.(1723-1725)aaG>aaT	p.K575N	USP5_ENST00000389231.5_Missense_Mutation_p.K575N|USP5_ENST00000541969.1_3'UTR	NM_001098536.1	NP_001092006.1	P45974	UBP5_HUMAN	ubiquitin specific peptidase 5 (isopeptidase T)	575	USP.				positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)	lysosome (GO:0005764)	cysteine-type endopeptidase activity (GO:0004197)|omega peptidase activity (GO:0008242)|ubiquitin thiolesterase activity (GO:0004221)|zinc ion binding (GO:0008270)			breast(6)|endometrium(4)|kidney(2)|large_intestine(6)|lung(14)|skin(2)|urinary_tract(2)	36						AGATCAAGAAGTTCACCTTCG	0.502																																						dbGAP											0													183.0	164.0	170.0					12																	6971685		2203	4300	6503	-	-	-	SO:0001583	missense	0			U35116	CCDS31733.1, CCDS41743.1	12p13	2007-03-02	2005-08-08		ENSG00000111667	ENSG00000111667		"""Ubiquitin-specific peptidases"""	12628	protein-coding gene	gene with protein product		601447	"""ubiquitin specific protease 5 (isopeptidase T)"""			12838346, 8723724	Standard	NM_003481		Approved	IsoT	uc001qri.4	P45974	OTTHUMG00000169233	ENST00000229268.8:c.1725G>T	12.37:g.6971685G>T	ENSP00000229268:p.Lys575Asn		D3DUS7|D3DUS8|Q96J22	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_UBA/transl_elong_EF1B_N,pfam_Znf_UBP,superfamily_UBA-like,smart_Znf_UBP,smart_UBA/transl_elong_EF1B_N_euk,pirsf_Ubiquitinyl_hydrolase,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_UBP,pfscan_Peptidase_C19	p.K575N	ENST00000229268.8	37	c.1725	CCDS41743.1	12	.	.	.	.	.	.	.	.	.	.	G	19.19	3.780197	0.70222	.	.	ENSG00000111667	ENST00000229268;ENST00000389231	T;T	0.75050	-0.9;-0.9	5.39	2.63	0.31362	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	D	0.86847	0.6031	M	0.91561	3.22	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.80764	0.988;0.994	D	0.86556	0.1838	10	0.87932	D	0	-8.3203	9.6424	0.39846	0.2705:0.0:0.7295:0.0	.	575;575	P45974;P45974-2	UBP5_HUMAN;.	N	575	ENSP00000229268:K575N;ENSP00000373883:K575N	ENSP00000229268:K575N	K	+	3	2	USP5	6841946	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.764000	0.26532	0.422000	0.26005	0.655000	0.94253	AAG	USP5	-	pfam_Peptidase_C19,pirsf_Ubiquitinyl_hydrolase,pfscan_Peptidase_C19	ENSG00000111667		0.502	USP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP5	HGNC	protein_coding	OTTHUMT00000402982.1	123	0.00	0	G			6971685	6971685	+1	no_errors	ENST00000229268	ensembl	human	known	69_37n	missense	84	20.75	22	SNP	1.000	T
VPS13A	23230	genome.wustl.edu	37	9	79955428	79955428	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr9:79955428G>A	ENST00000360280.3	+	50	7248	c.6988G>A	c.(6988-6990)Gaa>Aaa	p.E2330K	VPS13A_ENST00000357409.5_Missense_Mutation_p.E2330K|VPS13A_ENST00000376634.4_Missense_Mutation_p.E2330K|VPS13A_ENST00000376636.3_Missense_Mutation_p.E2291K	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	2330					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						AGTGGCTGAAGAAGGAAATGA	0.328																																						dbGAP											0													90.0	94.0	92.0					9																	79955428		2203	4295	6498	-	-	-	SO:0001583	missense	0			AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.6988G>A	9.37:g.79955428G>A	ENSP00000353422:p.Glu2330Lys		Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Missense_Mutation	SNP	pfam_VPSAP,pfam_Autophagy-rel_C	p.E2330K	ENST00000360280.3	37	c.6988	CCDS6655.1	9	.	.	.	.	.	.	.	.	.	.	G	14.09	2.431126	0.43122	.	.	ENSG00000197969	ENST00000376634;ENST00000376636;ENST00000360280;ENST00000357409	T;T;T;T	0.28666	1.6;1.6;1.6;1.6	5.61	4.71	0.59529	Vacuolar protein sorting-associated protein (1);	0.187954	0.45606	D	0.000342	T	0.33440	0.0863	M	0.64404	1.975	0.80722	D	1	B;B;P;B	0.38129	0.061;0.273;0.619;0.39	B;B;B;B	0.40410	0.091;0.328;0.281;0.281	T	0.12553	-1.0543	10	0.07813	T	0.8	.	16.9378	0.86207	0.0:0.1279:0.8721:0.0	.	2291;2330;2330;2330	Q96RL7-3;Q96RL7;Q96RL7-2;Q96RL7-4	.;VP13A_HUMAN;.;.	K	2330;2291;2330;2330	ENSP00000365821:E2330K;ENSP00000365823:E2291K;ENSP00000353422:E2330K;ENSP00000349985:E2330K	ENSP00000349985:E2330K	E	+	1	0	VPS13A	79145248	1.000000	0.71417	1.000000	0.80357	0.407000	0.30961	6.767000	0.74975	1.500000	0.48636	0.655000	0.94253	GAA	VPS13A	-	pfam_VPSAP	ENSG00000197969		0.328	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13A	HGNC	protein_coding	OTTHUMT00000052753.2	291	0.00	0	G	NM_015186		79955428	79955428	+1	no_errors	ENST00000360280	ensembl	human	known	69_37n	missense	225	12.74	33	SNP	1.000	A
ZNF25	219749	genome.wustl.edu	37	10	38241444	38241444	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr10:38241444C>G	ENST00000302609.7	-	6	1194	c.982G>C	c.(982-984)Gcc>Ccc	p.A328P	AL117337.1_ENST00000582458.1_RNA|ZNF25_ENST00000374633.1_5'UTR	NM_145011.2	NP_659448.1	P17030	ZNF25_HUMAN	zinc finger protein 25	328					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_neural(218;0.0218)|Breast(68;0.0389)|Ovarian(717;0.0443)|Renal(717;0.157)				ACTGTGAGGGCTGACTTCTGG	0.403																																						dbGAP											0													71.0	71.0	71.0					10																	38241444		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056452	CCDS7195.1	10p11.2	2013-01-08	2006-05-10		ENSG00000175395	ENSG00000175395		"""Zinc fingers, C2H2-type"", ""-"""	13043	protein-coding gene	gene with protein product		194528	"""zinc finger protein 25 (KOX 19)"""			1639412, 8464732	Standard	NM_145011		Approved	KOX19, FLJ31890, Zfp9	uc001ize.1	P17030	OTTHUMG00000019344	ENST00000302609.7:c.982G>C	10.37:g.38241444C>G	ENSP00000302222:p.Ala328Pro		A9Z1X5|Q8IYE3|Q8NDD6|Q96MU2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A328P	ENST00000302609.7	37	c.982	CCDS7195.1	10	.	.	.	.	.	.	.	.	.	.	C	16.65	3.181164	0.57800	.	.	ENSG00000175395	ENST00000302609;ENST00000374633	T	0.08458	3.09	4.66	3.73	0.42828	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.42682	D	0.000667	T	0.19485	0.0468	L	0.50847	1.595	0.33574	D	0.599019	D	0.76494	0.999	D	0.68039	0.955	T	0.16188	-1.0411	10	0.36615	T	0.2	0.0012	11.9863	0.53149	0.1747:0.8253:0.0:0.0	.	328	P17030	ZNF25_HUMAN	P	328;292	ENSP00000302222:A328P	ENSP00000302222:A328P	A	-	1	0	ZNF25	38281450	0.000000	0.05858	1.000000	0.80357	0.983000	0.72400	-0.675000	0.05227	1.279000	0.44446	0.556000	0.70494	GCC	ZNF25	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000175395		0.403	ZNF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF25	HGNC	protein_coding	OTTHUMT00000051214.1	131	0.00	0	C	NM_145011, NM_006966		38241444	38241444	-1	no_errors	ENST00000302609	ensembl	human	known	69_37n	missense	199	33.33	100	SNP	1.000	G
ZNF554	115196	genome.wustl.edu	37	19	2834359	2834359	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0B4-01A-11W-A019-09	TCGA-BH-A0B4-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	83bee702-eb97-4216-a47e-d4e4eece279a	cf1209cc-b0f9-40d1-9f55-f04a74981a96	g.chr19:2834359G>A	ENST00000317243.5	+	5	1324	c.1126G>A	c.(1126-1128)Gga>Aga	p.G376R		NM_001102651.1	NP_001096121.1	Q86TJ5	ZN554_HUMAN	zinc finger protein 554	376					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|liver(3)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AACTCATACTGGAGAGAAGCC	0.552																																						dbGAP											0													42.0	47.0	46.0					19																	2834359		2179	4290	6469	-	-	-	SO:0001583	missense	0			AK027860	CCDS42462.1	19p13.3	2013-09-20			ENSG00000172006	ENSG00000172006		"""Zinc fingers, C2H2-type"", ""-"""	26629	protein-coding gene	gene with protein product						12477932	Standard	NM_001102651		Approved	FLJ34817	uc002lwm.2	Q86TJ5	OTTHUMG00000180493	ENST00000317243.5:c.1126G>A	19.37:g.2834359G>A	ENSP00000321132:p.Gly376Arg		Q8NAT3|Q9BWN3	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G376R	ENST00000317243.5	37	c.1126	CCDS42462.1	19	.	.	.	.	.	.	.	.	.	.	G	19.59	3.855971	0.71834	.	.	ENSG00000172006	ENST00000317243	T	0.26223	1.75	2.76	2.76	0.32466	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.43233	0.1238	L	0.53780	1.695	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.41233	-0.9520	9	0.87932	D	0	.	11.2941	0.49267	0.0:0.0:1.0:0.0	.	376	Q86TJ5	ZN554_HUMAN	R	376	ENSP00000321132:G376R	ENSP00000321132:G376R	G	+	1	0	ZNF554	2785359	1.000000	0.71417	0.996000	0.52242	0.862000	0.49288	7.987000	0.88182	1.560000	0.49568	0.573000	0.79308	GGA	ZNF554	-	pfscan_Znf_C2H2	ENSG00000172006		0.552	ZNF554-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF554	HGNC	protein_coding	OTTHUMT00000451598.3	50	0.00	0	G	NM_152303		2834359	2834359	+1	no_errors	ENST00000317243	ensembl	human	known	69_37n	missense	63	12.50	9	SNP	1.000	A
