#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACTR2	10097	genome.wustl.edu	37	2	65467062	65467062	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr2:65467062G>C	ENST00000260641.5	+	2	282	c.125G>C	c.(124-126)aGa>aCa	p.R42T	ACTR2_ENST00000542850.1_5'UTR|ACTR2_ENST00000476840.1_3'UTR|ACTR2_ENST00000377982.4_Missense_Mutation_p.R42T	NM_005722.3	NP_005713.1	P61160	ARP2_HUMAN	ARP2 actin-related protein 2 homolog (yeast)	42					Arp2/3 complex-mediated actin nucleation (GO:0034314)|asymmetric cell division (GO:0008356)|cellular component movement (GO:0006928)|cilium assembly (GO:0042384)|cytoplasmic transport (GO:0016482)|establishment or maintenance of cell polarity (GO:0007163)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|meiotic chromosome movement towards spindle pole (GO:0016344)|meiotic cytokinesis (GO:0033206)|spindle localization (GO:0051653)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ATP binding (GO:0005524)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(1)|prostate(1)	12						CCTATTATCAGATCAACCACC	0.328																																						dbGAP											0													84.0	80.0	81.0					2																	65467062		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF006082	CCDS1881.1, CCDS46307.1	2p14	2008-05-20	2001-11-28		ENSG00000138071	ENSG00000138071			169	protein-coding gene	gene with protein product		604221	"""ARP2 (actin-related protein 2, yeast) homolog"""			9230079	Standard	NM_001005386		Approved	ARP2	uc002sdp.3	P61160	OTTHUMG00000129540	ENST00000260641.5:c.125G>C	2.37:g.65467062G>C	ENSP00000260641:p.Arg42Thr		B2RCP5|D6W5F4|E9PF41|O15142|Q96C82	Missense_Mutation	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.R42T	ENST00000260641.5	37	c.125	CCDS1881.1	2	.	.	.	.	.	.	.	.	.	.	G	33	5.220067	0.95139	.	.	ENSG00000138071	ENST00000260641;ENST00000377982	D;D	0.97279	-4.32;-4.32	5.87	5.87	0.94306	.	0.065557	0.64402	D	0.000007	D	0.98223	0.9412	M	0.70787	2.145	0.80722	D	1	D;D	0.67145	0.996;0.992	D;D	0.66196	0.942;0.942	D	0.98563	1.0642	10	0.87932	D	0	-18.7885	20.5827	0.99408	0.0:0.0:1.0:0.0	.	42;42	P61160;E9PF41	ARP2_HUMAN;.	T	42	ENSP00000260641:R42T;ENSP00000367220:R42T	ENSP00000260641:R42T	R	+	2	0	ACTR2	65320566	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.813000	0.99286	2.941000	0.99782	0.655000	0.94253	AGA	ACTR2	-	pfam_Actin-like,smart_Actin-like	ENSG00000138071		0.328	ACTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTR2	HGNC	protein_coding	OTTHUMT00000251730.1	628	0.00	0	G	NM_001005386		65467062	65467062	+1	no_errors	ENST00000377982	ensembl	human	known	69_37n	missense	56	22.22	16	SNP	1.000	C
ADAM2	2515	genome.wustl.edu	37	8	39624678	39624678	+	Silent	SNP	G	G	A			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr8:39624678G>A	ENST00000265708.4	-	13	1408	c.1305C>T	c.(1303-1305)aaC>aaT	p.N435N	ADAM2_ENST00000379853.2_Silent_p.N309N|ADAM2_ENST00000521880.1_Silent_p.N435N|ADAM2_ENST00000347580.4_Silent_p.N416N	NM_001464.3	NP_001455.3	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2	435	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				adult behavior (GO:0030534)|binding of sperm to zona pellucida (GO:0007339)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|visual learning (GO:0008542)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(29)|ovary(3)|prostate(1)|skin(5)|urinary_tract(1)	53		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		TTACTAGACAGTTTTCGCAGC	0.343																																						dbGAP											0													152.0	147.0	149.0					8																	39624678		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U52370	CCDS34884.1, CCDS64882.1, CCDS64883.1	8p11.2	2009-03-25	2008-07-31		ENSG00000104755	ENSG00000104755		"""ADAM metallopeptidase domain containing"""	198	protein-coding gene	gene with protein product	"""cancer/testis antigen 15"""	601533	"""fertilin beta"""	FTNB		8702389, 9070941	Standard	NM_001278113		Approved	PH-30b, PH30, CT15	uc003xnj.4	Q99965	OTTHUMG00000164041	ENST00000265708.4:c.1305C>T	8.37:g.39624678G>A			P78326|Q9UQQ8	Silent	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.N435	ENST00000265708.4	37	c.1305	CCDS34884.1	8																																																																																			ADAM2	-	pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,pfscan_Blood-coag_inhib_Disintegrin,prints_Blood-coag_inhib_Disintegrin	ENSG00000104755		0.343	ADAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM2	HGNC	protein_coding	OTTHUMT00000376926.1	361	0.00	0	G	NM_001464		39624678	39624678	-1	no_errors	ENST00000265708	ensembl	human	known	69_37n	silent	42	26.32	15	SNP	0.000	A
ANKRD13D	338692	genome.wustl.edu	37	11	67059113	67059113	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr11:67059113G>A	ENST00000447274.2	+	5	1351	c.176G>A	c.(175-177)cGc>cAc	p.R59H	ANKRD13D_ENST00000308440.6_Missense_Mutation_p.R59H|ANKRD13D_ENST00000514166.1_Missense_Mutation_p.R59H|ANKRD13D_ENST00000511455.2_Missense_Mutation_p.R146H			Q6ZTN6	AN13D_HUMAN	ankyrin repeat domain 13 family, member D	59						endosome (GO:0005768)|plasma membrane (GO:0005886)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			GATGTGTACCGCGTGTGGAAG	0.622																																						dbGAP											0													73.0	76.0	75.0					11																	67059113		2200	4295	6495	-	-	-	SO:0001583	missense	0			AK027313	CCDS31616.1, CCDS31616.2	11q13.2	2013-01-11		2005-08-09	ENSG00000172932	ENSG00000172932		"""Ankyrin repeat domain containing"""	27880	protein-coding gene	gene with protein product		615126					Standard	NM_207354		Approved		uc001okd.2	Q6ZTN6	OTTHUMG00000162929	ENST00000447274.2:c.176G>A	11.37:g.67059113G>A	ENSP00000402616:p.Arg59His		D6RCN6|Q0VAK0|Q0VGC3|Q6ZVD0|Q86SU1	Missense_Mutation	SNP	pfam_ANKRD13,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Ubiquitin-int_motif,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Ubiquitin-int_motif	p.R146H	ENST00000447274.2	37	c.437		11	.	.	.	.	.	.	.	.	.	.	G	21.0	4.089083	0.76756	.	.	ENSG00000172932	ENST00000447274;ENST00000511455;ENST00000308440;ENST00000514166	T;T;T;T	0.34859	1.34;1.53;1.34;1.34	3.95	3.04	0.35103	.	0.081744	0.48767	D	0.000177	T	0.47451	0.1446	L	0.49571	1.57	0.48087	D	0.999583	D;P	0.76494	0.999;0.815	D;B	0.67900	0.954;0.241	T	0.44847	-0.9301	10	0.87932	D	0	-8.8452	7.6297	0.28232	0.1997:0.0:0.8003:0.0	.	146;59	Q6ZTN6-3;Q6ZTN6	.;AN13D_HUMAN	H	59;146;59;59	ENSP00000402616:R59H;ENSP00000427130:R146H;ENSP00000310874:R59H;ENSP00000444404:R59H	ENSP00000310874:R59H	R	+	2	0	ANKRD13D	66815689	0.998000	0.40836	0.797000	0.32132	0.949000	0.60115	2.896000	0.48656	1.034000	0.39945	0.561000	0.74099	CGC	ANKRD13D	-	NULL	ENSG00000172932		0.622	ANKRD13D-001	KNOWN	basic	protein_coding	ANKRD13D	HGNC	protein_coding	OTTHUMT00000371067.2	112	0.00	0	G	NM_207354		67059113	67059113	+1	no_errors	ENST00000511455	ensembl	human	known	69_37n	missense	65	25.29	22	SNP	0.966	A
ANKK1	255239	genome.wustl.edu	37	11	113266103	113266103	+	Silent	SNP	C	C	T			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr11:113266103C>T	ENST00000303941.3	+	4	749	c.655C>T	c.(655-657)Cta>Tta	p.L219L		NM_178510.1	NP_848605.1	Q8NFD2	ANKK1_HUMAN	ankyrin repeat and kinase domain containing 1	219	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|stomach(1)	29		all_cancers(61;1.53e-11)|all_epithelial(67;3e-06)|Melanoma(852;4.04e-05)|all_hematologic(158;0.000315)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0461)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Prostate(24;0.194)		BRCA - Breast invasive adenocarcinoma(274;4.82e-06)|Epithelial(105;5.41e-05)|all cancers(92;0.000442)|OV - Ovarian serous cystadenocarcinoma(223;0.238)		CATCTGGGAGCTACTCACTCA	0.577																																						dbGAP											0													63.0	66.0	65.0					11																	113266103		1953	4137	6090	-	-	-	SO:0001819	synonymous_variant	0			AJ541797	CCDS44734.1	11q23.2	2013-01-10			ENSG00000170209	ENSG00000170209		"""Ankyrin repeat domain containing"""	21027	protein-coding gene	gene with protein product		608774				15146457	Standard	NM_178510		Approved	X-kinase	uc001pny.3	Q8NFD2	OTTHUMG00000167715	ENST00000303941.3:c.655C>T	11.37:g.113266103C>T				Silent	SNP	pfam_Ankyrin_rpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_cat_dom,prints_Ankyrin_rpt,prints_Ser-Thr/Tyr_kinase_cat_dom	p.L219	ENST00000303941.3	37	c.655	CCDS44734.1	11																																																																																			ANKK1	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000170209		0.577	ANKK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKK1	HGNC	protein_coding	OTTHUMT00000395830.1	82	0.00	0	C	NM_178510		113266103	113266103	+1	no_errors	ENST00000303941	ensembl	human	known	69_37n	silent	22	37.84	14	SNP	0.977	T
AQR	9716	genome.wustl.edu	37	15	35149085	35149085	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr15:35149085C>G	ENST00000156471.5	-	35	4591	c.4366G>C	c.(4366-4368)Gag>Cag	p.E1456Q		NM_014691.2	NP_055506.1	O60306	AQR_HUMAN	aquarius intron-binding spliceosomal factor	1456					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(10)|lung(18)|ovary(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	57		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		GGGGTGGTCTCAGATAAAGCA	0.552																																						dbGAP											0													138.0	146.0	143.0					15																	35149085		2024	4196	6220	-	-	-	SO:0001583	missense	0			AB011132	CCDS42013.1	15q13	2013-09-12	2013-09-12			ENSG00000021776			29513	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 164"""	610548	"""aquarius homolog (mouse)"""			9626505, 16949364	Standard	NM_014691		Approved	KIAA0560, fSAP164, IBP160	uc001ziv.3	O60306		ENST00000156471.5:c.4366G>C	15.37:g.35149085C>G	ENSP00000156471:p.Glu1456Gln		A0JP17|A5YKK3|Q2YDX9|Q6IRU8|Q6PIC8	Missense_Mutation	SNP	NULL	p.E1456Q	ENST00000156471.5	37	c.4366	CCDS42013.1	15	.	.	.	.	.	.	.	.	.	.	C	14.05	2.420904	0.42918	.	.	ENSG00000021776	ENST00000543879	.	.	.	5.26	4.33	0.51752	.	1.010630	0.07938	N	0.978660	T	0.25791	0.0628	N	0.08118	0	0.09310	N	1	B	0.12013	0.005	B	0.06405	0.002	T	0.15867	-1.0422	9	0.24483	T	0.36	-4.3144	11.5803	0.50887	0.0:0.8205:0.1794:0.0	.	1456	O60306	AQR_HUMAN	Q	1456	.	ENSP00000445700:E1456Q	E	-	1	0	AQR	32936377	0.005000	0.15991	0.004000	0.12327	0.017000	0.09413	0.406000	0.21032	1.407000	0.46875	0.557000	0.71058	GAG	AQR	-	NULL	ENSG00000021776		0.552	AQR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AQR	HGNC	protein_coding	OTTHUMT00000417526.2	490	0.20	1	C	NM_014691		35149085	35149085	-1	no_errors	ENST00000156471	ensembl	human	known	69_37n	missense	132	27.47	50	SNP	0.010	G
ASPA	443	genome.wustl.edu	37	17	3402293	3402293	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr17:3402293G>A	ENST00000263080.2	+	6	1011	c.853G>A	c.(853-855)Gag>Aag	p.E285K	SPATA22_ENST00000541913.1_Intron|ASPA_ENST00000456349.2_Missense_Mutation_p.E285K	NM_000049.2	NP_000040.1	P45381	ACY2_HUMAN	aspartoacylase	285			E -> A (in CAND; predominant mutation in Ashkenazi Jewish population; 99% loss of activity; dbSNP:rs28940279). {ECO:0000269|PubMed:8023850, ECO:0000269|PubMed:8252036, ECO:0000269|PubMed:8659549}.		aspartate catabolic process (GO:0006533)|central nervous system myelination (GO:0022010)|positive regulation of oligodendrocyte differentiation (GO:0048714)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminoacylase activity (GO:0004046)|aspartoacylase activity (GO:0019807)|hydrolase activity, acting on ester bonds (GO:0016788)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(6)|lung(5)|stomach(1)|urinary_tract(1)	17					L-Aspartic Acid(DB00128)	GTTTGTGAATGAGGCCGCATA	0.448																																						dbGAP											0													93.0	78.0	83.0					17																	3402293		2203	4300	6503	-	-	-	SO:0001583	missense	0			S67156	CCDS11028.1	17p13.3	2010-06-24	2010-06-24		ENSG00000108381	ENSG00000108381	3.5.1.15		756	protein-coding gene	gene with protein product	"""aminoacylase 2"", ""Canavan disease"""	608034	"""aspartoacylase (aminoacylase 2, Canavan disease)"""			8252036	Standard	NM_001128085		Approved	ASP, ACY2	uc002fvq.3	P45381	OTTHUMG00000090655	ENST00000263080.2:c.853G>A	17.37:g.3402293G>A	ENSP00000263080:p.Glu285Lys			Missense_Mutation	SNP	pfam_Aste_AspA,pirsf_Aspartoacylase	p.E285K	ENST00000263080.2	37	c.853	CCDS11028.1	17	.	.	.	.	.	.	.	.	.	.	g	23.8	4.461029	0.84317	.	.	ENSG00000108381	ENST00000456349;ENST00000263080	D;D	0.98164	-4.76;-4.76	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	D	0.99211	0.9726	M	0.91140	3.18	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99368	1.0919	10	0.87932	D	0	-20.7277	19.3276	0.94268	0.0:0.0:1.0:0.0	.	285	P45381	ACY2_HUMAN	K	285	ENSP00000409976:E285K;ENSP00000263080:E285K	ENSP00000263080:E285K	E	+	1	0	ASPA	3349043	1.000000	0.71417	0.945000	0.38365	0.067000	0.16453	9.423000	0.97461	2.894000	0.99253	0.591000	0.81541	GAG	ASPA	-	pfam_Aste_AspA,pirsf_Aspartoacylase	ENSG00000108381		0.448	ASPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASPA	HGNC	protein_coding	OTTHUMT00000207315.1	217	0.00	0	G	NM_000049		3402293	3402293	+1	no_errors	ENST00000263080	ensembl	human	known	69_37n	missense	33	31.25	15	SNP	1.000	A
ARHGEF15	22899	genome.wustl.edu	37	17	8222090	8222090	+	Nonsense_Mutation	SNP	C	C	G			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr17:8222090C>G	ENST00000361926.3	+	12	2005	c.1895C>G	c.(1894-1896)tCa>tGa	p.S632*	ARHGEF15_ENST00000582060.1_3'UTR|AC135178.7_ENST00000458568.1_RNA|ARHGEF15_ENST00000421050.1_Nonsense_Mutation_p.S632*	NM_173728.3	NP_776089.2	O94989	ARHGF_HUMAN	Rho guanine nucleotide exchange factor (GEF) 15	632					negative regulation of synapse maturation (GO:2000297)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|regulation of catalytic activity (GO:0050790)|retina vasculature morphogenesis in camera-type eye (GO:0061299)	cytoplasm (GO:0005737)|dendrite (GO:0030425)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(9)|large_intestine(5)|lung(11)|ovary(5)|prostate(3)|skin(2)|urinary_tract(1)	37						GTCTCCTGGTCACGGCGCCTG	0.672																																						dbGAP											0													77.0	91.0	86.0					17																	8222090		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB020722	CCDS11139.1	17p13.1	2011-11-16			ENSG00000198844	ENSG00000198844		"""Rho guanine nucleotide exchange factors"""	15590	protein-coding gene	gene with protein product	"""Rho guanine exchange factor (GEF) 15"""	608504				10048485	Standard	NM_173728		Approved	KIAA0915, Vsm-RhoGEF, ARGEF15, FLJ13791, MGC44868	uc002glc.3	O94989	OTTHUMG00000108187	ENST00000361926.3:c.1895C>G	17.37:g.8222090C>G	ENSP00000355026:p.Ser632*		A8K6G1|Q8N449|Q9H8B4	Nonsense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	p.S632*	ENST00000361926.3	37	c.1895	CCDS11139.1	17	.	.	.	.	.	.	.	.	.	.	c	39	7.823437	0.98510	.	.	ENSG00000198844	ENST00000361926;ENST00000455564;ENST00000421050	.	.	.	4.93	4.93	0.64822	.	0.184416	0.45867	D	0.000332	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-13.809	10.675	0.45781	0.1908:0.8092:0.0:0.0	.	.	.	.	X	632;422;632	.	ENSP00000355026:S632X	S	+	2	0	ARHGEF15	8162815	0.972000	0.33761	0.954000	0.39281	0.997000	0.91878	2.333000	0.43912	2.562000	0.86427	0.555000	0.69702	TCA	ARHGEF15	-	NULL	ENSG00000198844		0.672	ARHGEF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF15	HGNC	protein_coding	OTTHUMT00000226993.2	20	0.00	0	C	NM_173728		8222090	8222090	+1	no_errors	ENST00000361926	ensembl	human	known	69_37n	nonsense	21	36.36	12	SNP	0.969	G
ATN1	1822	genome.wustl.edu	37	12	7045891	7045892	+	In_Frame_Ins	INS	-	-	CAG	rs199920334|rs377147612|rs150855426|rs60216939	byFrequency	TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr12:7045891_7045892insCAG	ENST00000356654.4	+	5	1698_1699	c.1461_1462insCAG	c.(1462-1464)cag>CAGcag	p.488_488Q>QQ	ATN1_ENST00000396684.2_In_Frame_Ins_p.488_488Q>QQ	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	488	Poly-Gln.		Missing. {ECO:0000269|PubMed:7485154, ECO:0000269|PubMed:7842016, ECO:0000269|PubMed:8965642}.		cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)	p.Q487_Q488insQ(1)|p.Q488delQ(1)		breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						agcaacagcaacagcagcagca	0.634																																						dbGAP											2	Insertion - In frame(1)|Deletion - In frame(1)	breast(2)																																								-	-	-	SO:0001652	inframe_insertion	0			U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.1504_1506dupCAG	12.37:g.7045898_7045900dupCAG	ENSP00000349076:p.Gln502dup		Q99495|Q99621|Q9UEK7	In_Frame_Ins	INS	pfam_Atrophin-like,prints_Atrophin-1	p.491in_frame_insQ	ENST00000356654.4	37	c.1461_1462	CCDS31734.1	12																																																																																			ATN1	-	pfam_Atrophin-like	ENSG00000111676		0.634	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATN1	HGNC	protein_coding	OTTHUMT00000401948.2	57	0.00	0	-	NM_001940		7045891	7045892	+1	no_errors	ENST00000356654	ensembl	human	known	69_37n	in_frame_ins	67	14.10	11	INS	0.002:0.834	CAG
ATP8B2	57198	genome.wustl.edu	37	1	154318775	154318775	+	Silent	SNP	C	C	T			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr1:154318775C>T	ENST00000368489.3	+	25	2946	c.2946C>T	c.(2944-2946)ttC>ttT	p.F982F		NM_020452.3	NP_065185.1	P98198	AT8B2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 2	968					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)		IL6R/ATP8B2(2)	breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			ACCTTCTCTTCAACAAGCGGG	0.577																																						dbGAP											0													97.0	92.0	94.0					1																	154318775		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB032963	CCDS1066.1, CCDS41405.1	1q21.3	2012-03-09	2012-03-09		ENSG00000143515	ENSG00000143515		"""ATPases / P-type"""	13534	protein-coding gene	gene with protein product		605867	"""ATPase, class I, type 8B, member 2"""			10574461, 11015572	Standard	NM_020452		Approved	ATPID, KIAA1137	uc001fex.3	P98198	OTTHUMG00000035979	ENST00000368489.3:c.2946C>T	1.37:g.154318775C>T			B4E3P4|Q6NT69|Q7Z486|Q96I43|Q96NQ7	Silent	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.F982	ENST00000368489.3	37	c.2946	CCDS1066.1	1																																																																																			ATP8B2	-	tigrfam_ATPase_P-typ_Plipid-transl	ENSG00000143515		0.577	ATP8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP8B2	HGNC	protein_coding	OTTHUMT00000087658.2	227	0.00	0	C	NM_020452		154318775	154318775	+1	no_errors	ENST00000368489	ensembl	human	known	69_37n	silent	80	24.53	26	SNP	1.000	T
BIRC6	57448	genome.wustl.edu	37	2	32738180	32738180	+	Silent	SNP	A	A	G			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr2:32738180A>G	ENST00000421745.2	+	54	10661	c.10527A>G	c.(10525-10527)gtA>gtG	p.V3509V		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	3509					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					AGCTGCTTGTAGAATATGACT	0.423																																					Pancreas(94;175 1509 16028 18060 45422)	dbGAP											0													129.0	111.0	117.0					2																	32738180		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.10527A>G	2.37:g.32738180A>G			Q9ULD1	Silent	SNP	pfam_DUF3643,pfam_UBQ-conjugat_E2,pfam_BIR,pfam_UEV_N,superfamily_UBQ-conjugating_enzyme/RWD,superfamily_Galactose-bd-like,superfamily_WD40_repeat_dom,smart_BIR,pfscan_BIR,pfscan_UBQ-conjugat_E2	p.V3509	ENST00000421745.2	37	c.10527	CCDS33175.2	2																																																																																			BIRC6	-	pfam_DUF3643	ENSG00000115760		0.423	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIRC6	HGNC	protein_coding	OTTHUMT00000318769.3	343	0.00	0	A	NM_016252		32738180	32738180	+1	no_errors	ENST00000421745	ensembl	human	known	69_37n	silent	71	22.83	21	SNP	0.750	G
BRPF3	27154	genome.wustl.edu	37	6	36175197	36175197	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr6:36175197G>C	ENST00000357641.6	+	4	1966	c.1713G>C	c.(1711-1713)aaG>aaC	p.K571N	BRPF3_ENST00000534694.1_Missense_Mutation_p.K571N|BRPF3_ENST00000534400.1_Missense_Mutation_p.K571N|BRPF3_ENST00000339717.7_Missense_Mutation_p.K571N|BRPF3_ENST00000443324.2_Missense_Mutation_p.K571N|BRPF3_ENST00000543502.1_Missense_Mutation_p.K571N	NM_015695.2	NP_056510.2	Q9ULD4	BRPF3_HUMAN	bromodomain and PHD finger containing, 3	571					blood coagulation (GO:0007596)|histone H3 acetylation (GO:0043966)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	cytosol (GO:0005829)|extracellular region (GO:0005576)|MOZ/MORF histone acetyltransferase complex (GO:0070776)	zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	40						TGATTCGGAAGAGAGAGAAGC	0.537																																						dbGAP											0													49.0	47.0	48.0					6																	36175197		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033112	CCDS34437.1	6p21.31	2008-02-05			ENSG00000096070	ENSG00000096070			14256	protein-coding gene	gene with protein product						10574462	Standard	NM_015695		Approved	KIAA1286	uc003olv.4	Q9ULD4	OTTHUMG00000014589	ENST00000357641.6:c.1713G>C	6.37:g.36175197G>C	ENSP00000350267:p.Lys571Asn		A6ND56|A6NJE2|B7ZLN5|E7EX85|Q17RB6|Q5R3K8	Missense_Mutation	SNP	pfam_Enhancer_polycomb-like_N,pfam_Bromodomain,pfam_PWWP,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_Bromodomain,smart_PWWP,pfscan_PWWP,pfscan_Znf_PHD-finger,pfscan_Bromodomain,prints_Bromodomain	p.K571N	ENST00000357641.6	37	c.1713	CCDS34437.1	6	.	.	.	.	.	.	.	.	.	.	G	15.36	2.811430	0.50527	.	.	ENSG00000096070	ENST00000357641;ENST00000339717;ENST00000534694;ENST00000543502;ENST00000443324;ENST00000534400	T;T;T;T;T;T	0.24538	2.1;2.15;2.13;2.15;2.13;1.85	4.86	2.17	0.27698	Bromodomain (1);	0.000000	0.85682	D	0.000000	T	0.33556	0.0867	M	0.76328	2.33	0.54753	D	0.999989	D;D;D	0.89917	0.998;0.998;1.0	D;D;D	0.85130	0.991;0.991;0.997	T	0.15521	-1.0434	10	0.87932	D	0	.	7.5014	0.27520	0.4957:0.0:0.5043:0.0	.	571;571;571	B7ZLN5;Q17RB6;Q9ULD4	.;.;BRPF3_HUMAN	N	571	ENSP00000350267:K571N;ENSP00000345419:K571N;ENSP00000434501:K571N;ENSP00000445352:K571N;ENSP00000387368:K571N;ENSP00000436504:K571N	ENSP00000345419:K571N	K	+	3	2	BRPF3	36283175	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.426000	0.44731	0.181000	0.19994	0.655000	0.94253	AAG	BRPF3	-	superfamily_Bromodomain	ENSG00000096070		0.537	BRPF3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	BRPF3	HGNC	protein_coding	OTTHUMT00000040335.3	136	0.00	0	G	NM_015695		36175197	36175197	+1	no_errors	ENST00000357641	ensembl	human	known	69_37n	missense	49	23.44	15	SNP	1.000	C
C5AR1	728	genome.wustl.edu	37	19	47823195	47823195	+	Missense_Mutation	SNP	G	G	A	rs143680994		TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr19:47823195G>A	ENST00000355085.3	+	2	183	c.161G>A	c.(160-162)gGc>gAc	p.G54D		NM_001736.3	NP_001727.1	P21730	C5AR1_HUMAN	complement component 5a receptor 1	54					activation of MAPK activity (GO:0000187)|activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|cell proliferation in hindbrain (GO:0021534)|cellular defense response (GO:0006968)|chemotaxis (GO:0006935)|complement component C5a signaling pathway (GO:0038178)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|inflammatory response (GO:0006954)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of neuron apoptotic process (GO:0043524)|neutrophil chemotaxis (GO:0030593)|organ regeneration (GO:0031100)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|response to lipopolysaccharide (GO:0032496)|response to peptidoglycan (GO:0032494)|sensory perception of chemical stimulus (GO:0007606)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C5a anaphylatoxin receptor activity (GO:0004944)|complement component C5a receptor activity (GO:0004878)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(11)|ovary(2)|prostate(1)|skin(1)	20		all_cancers(25;2e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;0.000267)|OV - Ovarian serous cystadenocarcinoma(262;0.000618)|Epithelial(262;0.0142)|GBM - Glioblastoma multiforme(486;0.0242)		GGAGTGCTGGGCAATGCCCTG	0.572																																						dbGAP											0													183.0	148.0	160.0					19																	47823195		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33063.1	19q13.3-q13.4	2012-08-10	2006-02-09	2006-02-09		ENSG00000197405		"""CD molecules"", ""Complement system"", ""GPCR / Class A : Complement component receptors"""	1338	protein-coding gene	gene with protein product		113995	"""complement component 5 receptor 1 (C5a ligand)"""	C5R1		1612600	Standard	NM_001736		Approved	C5A, C5AR, CD88	uc002pgj.1	P21730		ENST00000355085.3:c.161G>A	19.37:g.47823195G>A	ENSP00000347197:p.Gly54Asp			Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_C5A_anaphtx_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Anphylx_rcpt,prints_Brdyknn_rcpt,prints_Frt_met_rcpt	p.G54D	ENST00000355085.3	37	c.161	CCDS33063.1	19	.	.	.	.	.	.	.	.	.	.	G	19.46	3.832096	0.71258	.	.	ENSG00000197405	ENST00000355085	T	0.57107	0.42	4.67	4.67	0.58626	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	U	0.000000	T	0.79610	0.4475	M	0.93507	3.425	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	D	0.85948	0.1462	10	0.87932	D	0	.	16.347	0.83138	0.0:0.0:1.0:0.0	.	54	P21730	C5AR_HUMAN	D	54	ENSP00000347197:G54D	ENSP00000347197:G54D	G	+	2	0	C5AR1	52515035	1.000000	0.71417	0.963000	0.40424	0.598000	0.36846	7.912000	0.87465	2.128000	0.65567	0.478000	0.44815	GGC	C5AR1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000197405		0.572	C5AR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C5AR1	HGNC	protein_coding	OTTHUMT00000466925.1	200	0.00	0	G	NM_001736		47823195	47823195	+1	no_errors	ENST00000355085	ensembl	human	known	69_37n	missense	81	35.20	44	SNP	1.000	A
C8A	731	genome.wustl.edu	37	1	57341812	57341812	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr1:57341812G>C	ENST00000361249.3	+	4	490	c.394G>C	c.(394-396)Gat>Cat	p.D132H		NM_000562.2	NP_000553.1	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide	132	LDL-receptor class A. {ECO:0000255|PROSITE-ProRule:PRU00124}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	43						CGACTGTGAAGATGTCAGGGC	0.542																																						dbGAP											0													139.0	119.0	126.0					1																	57341812		2203	4300	6503	-	-	-	SO:0001583	missense	0			M16974	CCDS606.1	1p32.2	2014-09-17			ENSG00000157131	ENSG00000157131		"""Complement system"""	1352	protein-coding gene	gene with protein product		120950					Standard	NM_000562		Approved		uc001cyo.2	P07357	OTTHUMG00000008306	ENST00000361249.3:c.394G>C	1.37:g.57341812G>C	ENSP00000354458:p.Asp132His		A2RUI4|A2RUI5|Q13668|Q9H130	Missense_Mutation	SNP	pfam_MACPF,pfam_LDrepeatLR_classA_rpt,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,pfscan_LDrepeatLR_classA_rpt,pfscan_Thrombospondin_1_rpt,prints_MAC_perforin	p.D132H	ENST00000361249.3	37	c.394	CCDS606.1	1	.	.	.	.	.	.	.	.	.	.	G	11.86	1.763967	0.31228	.	.	ENSG00000157131	ENST00000361249	D	0.87809	-2.3	5.84	4.9	0.64082	.	0.434403	0.27673	N	0.018326	T	0.72503	0.3468	N	0.02802	-0.49	0.45097	D	0.998116	P	0.36249	0.545	B	0.33846	0.171	T	0.76790	-0.2829	10	0.54805	T	0.06	-20.4921	14.9892	0.71374	0.0:0.2684:0.7316:0.0	.	132	P07357	CO8A_HUMAN	H	132	ENSP00000354458:D132H	ENSP00000354458:D132H	D	+	1	0	C8A	57114400	1.000000	0.71417	0.965000	0.40720	0.401000	0.30781	2.199000	0.42715	1.434000	0.47414	0.655000	0.94253	GAT	C8A	-	superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt	ENSG00000157131		0.542	C8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C8A	HGNC	protein_coding	OTTHUMT00000022890.1	156	0.00	0	G	NM_000562		57341812	57341812	+1	no_errors	ENST00000361249	ensembl	human	known	69_37n	missense	71	27.55	27	SNP	0.991	C
CALR	811	genome.wustl.edu	37	19	13050042	13050042	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr19:13050042A>C	ENST00000316448.5	+	2	259	c.186A>C	c.(184-186)aaA>aaC	p.K62N		NM_004343.3	NP_004334.1	P27797	CALR_HUMAN	calreticulin	62	N-domain.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cellular calcium ion homeostasis (GO:0006874)|cellular protein metabolic process (GO:0044267)|cellular response to lithium ion (GO:0071285)|cellular senescence (GO:0090398)|chaperone-mediated protein folding (GO:0061077)|cortical actin cytoskeleton organization (GO:0030866)|endoplasmic reticulum unfolded protein response (GO:0030968)|glucocorticoid receptor signaling pathway (GO:0042921)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|peptide antigen assembly with MHC class I protein complex (GO:0002502)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of DNA replication (GO:0045740)|positive regulation of gene expression (GO:0010628)|positive regulation of phagocytosis (GO:0050766)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|post-translational protein modification (GO:0043687)|protein export from nucleus (GO:0006611)|protein folding (GO:0006457)|protein localization to nucleus (GO:0034504)|protein maturation by protein folding (GO:0022417)|protein N-linked glycosylation via asparagine (GO:0018279)|protein stabilization (GO:0050821)|regulation of apoptotic process (GO:0042981)|regulation of meiosis (GO:0040020)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to testosterone (GO:0033574)|sequestering of calcium ion (GO:0051208)|spermatogenesis (GO:0007283)	acrosomal vesicle (GO:0001669)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|intracellular (GO:0005622)|membrane (GO:0016020)|MHC class I peptide loading complex (GO:0042824)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|proteinaceous extracellular matrix (GO:0005578)|sarcoplasmic reticulum (GO:0016529)	androgen receptor binding (GO:0050681)|calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|chaperone binding (GO:0051087)|complement component C1q binding (GO:0001849)|DNA binding (GO:0003677)|glycoprotein binding (GO:0001948)|hormone binding (GO:0042562)|integrin binding (GO:0005178)|iron ion binding (GO:0005506)|mRNA binding (GO:0003729)|peptide binding (GO:0042277)|poly(A) RNA binding (GO:0044822)|protein binding involved in protein folding (GO:0044183)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(3)|lung(5)|ovary(1)	10					Antihemophilic Factor(DB00025)|Melatonin(DB01065)|Tenecteplase(DB00031)	ACGAGGAGAAAGATAAAGGTA	0.527											OREG0025278	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													37.0	35.0	36.0					19																	13050042		2202	4298	6500	-	-	-	SO:0001583	missense	0			M84739	CCDS12288.1	19p13.3-p13.2	2014-09-17				ENSG00000179218			1455	protein-coding gene	gene with protein product	"""Sicca syndrome antigen A (autoantigen Ro; calreticulin)"", ""autoantigen Ro"""	109091				2365822	Standard	NM_004343		Approved	RO, SSA, cC1qR, CRT, FLJ26680	uc002mvu.2	P27797		ENST00000316448.5:c.186A>C	19.37:g.13050042A>C	ENSP00000320866:p.Lys62Asn	684	Q6IAT4|Q9UDG2	Missense_Mutation	SNP	pirsf_Calreticulin,pfam_Calret/calnex,superfamily_ConA-like_lec_gl,prints_Calret/calnex	p.K62N	ENST00000316448.5	37	c.186	CCDS12288.1	19	.	.	.	.	.	.	.	.	.	.	A	14.53	2.564150	0.45694	.	.	ENSG00000179218	ENST00000316448	T	0.40225	1.04	5.6	-1.66	0.08265	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.090234	0.85682	D	0.000000	T	0.36303	0.0962	L	0.59436	1.845	0.80722	D	1	B	0.21225	0.053	B	0.25140	0.058	T	0.22452	-1.0216	10	0.39692	T	0.17	-26.2146	12.1434	0.54010	0.381:0.0:0.619:0.0	.	62	P27797	CALR_HUMAN	N	62	ENSP00000320866:K62N	ENSP00000320866:K62N	K	+	3	2	CALR	12911042	0.586000	0.26782	0.995000	0.50966	0.980000	0.70556	-0.122000	0.10627	-0.205000	0.10219	0.459000	0.35465	AAA	CALR	-	pirsf_Calreticulin,pfam_Calret/calnex,superfamily_ConA-like_lec_gl	ENSG00000179218		0.527	CALR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALR	HGNC	protein_coding	OTTHUMT00000451952.1	145	0.00	0	A	NM_004343		13050042	13050042	+1	no_errors	ENST00000316448	ensembl	human	known	69_37n	missense	41	29.31	17	SNP	0.968	C
CASR	846	genome.wustl.edu	37	3	122003748	122003748	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr3:122003748C>G	ENST00000490131.1	+	7	3319	c.2947C>G	c.(2947-2949)Cag>Gag	p.Q983E	CASR_ENST00000498619.1_Missense_Mutation_p.Q993E|AC068754.1_ENST00000408547.1_RNA|CASR_ENST00000296154.5_Missense_Mutation_p.Q983E	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	983					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	TGATGAGCCTCAGAAGAACGC	0.577																																						dbGAP											0													71.0	66.0	68.0					3																	122003748		2203	4300	6503	-	-	-	SO:0001583	missense	0			U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.2947C>G	3.37:g.122003748C>G	ENSP00000418685:p.Gln983Glu		Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Growth_fac_rcpt,pfscan_GPCR_3_C,prints_GPCR_3	p.Q993E	ENST00000490131.1	37	c.2977	CCDS3010.1	3	.	.	.	.	.	.	.	.	.	.	C	12.31	1.899903	0.33535	.	.	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.88975	-2.45;-2.44;-2.45	5.79	5.79	0.91817	.	0.123680	0.56097	D	0.000030	T	0.82222	0.4990	N	0.14661	0.345	0.40830	D	0.983586	B;B	0.26002	0.139;0.139	B;B	0.22601	0.04;0.04	T	0.79140	-0.1926	10	0.56958	D	0.05	.	19.0289	0.92946	0.0:1.0:0.0:0.0	.	993;983	E7ENE0;P41180	.;CASR_HUMAN	E	983;993;983	ENSP00000418685:Q983E;ENSP00000420194:Q993E;ENSP00000296154:Q983E	ENSP00000296154:Q983E	Q	+	1	0	CASR	123486438	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	5.443000	0.66581	2.746000	0.94184	0.561000	0.74099	CAG	CASR	-	NULL	ENSG00000036828		0.577	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASR	HGNC	protein_coding	OTTHUMT00000355761.1	144	0.00	0	C	NM_000388		122003748	122003748	+1	no_errors	ENST00000498619	ensembl	human	known	69_37n	missense	69	22.47	20	SNP	0.998	G
CD101	9398	genome.wustl.edu	37	1	117564350	117564350	+	Silent	SNP	C	C	T			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr1:117564350C>T	ENST00000256652.4	+	7	2231	c.2173C>T	c.(2173-2175)Cta>Tta	p.L725L	CD101_ENST00000369470.1_Silent_p.L725L	NM_001256106.1|NM_001256109.1|NM_001256111.1|NM_004258.4	NP_001243035.1|NP_001243038.1|NP_001243040.1|NP_004249.2	Q93033	IGSF2_HUMAN	CD101 molecule	725	Ig-like C2-type 6.				cell surface receptor signaling pathway (GO:0007166)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(14)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						TGCCTCTTGGCTAAAGATCCT	0.403																																						dbGAP											0													73.0	66.0	68.0					1																	117564350		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z33642	CCDS891.1	1p13	2013-01-29	2009-10-27	2009-10-27	ENSG00000134256	ENSG00000134256		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5949	protein-coding gene	gene with protein product		604516	"""immunoglobulin superfamily, member 2"""	IGSF2		7722300	Standard	NM_004258		Approved	V7	uc010oxb.2	Q93033	OTTHUMG00000012029	ENST00000256652.4:c.2173C>T	1.37:g.117564350C>T			Q15856	Silent	SNP	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.L725	ENST00000256652.4	37	c.2173	CCDS891.1	1																																																																																			CD101	-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000134256		0.403	CD101-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CD101	HGNC	protein_coding	OTTHUMT00000033274.1	264	0.00	0	C	NM_004258		117564350	117564350	+1	no_errors	ENST00000256652	ensembl	human	known	69_37n	silent	35	25.53	12	SNP	0.093	T
CDH8	1006	genome.wustl.edu	37	16	62055140	62055140	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr16:62055140C>A	ENST00000577390.1	-	2	1122	c.168G>T	c.(166-168)ttG>ttT	p.L56F	CDH8_ENST00000299345.6_Missense_Mutation_p.L56F|CDH8_ENST00000577730.1_Missense_Mutation_p.L56F|CDH8_ENST00000584337.1_Missense_Mutation_p.L56F	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	56					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		TGGAGCGGTTCAAAATTCGCT	0.443																																						dbGAP											0													74.0	74.0	74.0					16																	62055140		2203	4300	6503	-	-	-	SO:0001583	missense	0			L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.168G>T	16.37:g.62055140C>A	ENSP00000462701:p.Leu56Phe		B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.L56F	ENST00000577390.1	37	c.168	CCDS10802.1	16	.	.	.	.	.	.	.	.	.	.	C	18.06	3.540417	0.65085	.	.	ENSG00000150394	ENST00000299345	T	0.00509	6.91	6.17	5.11	0.69529	.	0.000000	0.64402	D	0.000001	T	0.01156	0.0038	M	0.61703	1.905	0.39894	D	0.973819	D	0.67145	0.996	D	0.64321	0.924	T	0.74090	-0.3777	10	0.39692	T	0.17	.	9.8308	0.40941	0.0:0.8246:0.0:0.1754	.	56	P55286	CADH8_HUMAN	F	56	ENSP00000299345:L56F	ENSP00000299345:L56F	L	-	3	2	CDH8	60612641	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.668000	0.37481	1.368000	0.46115	0.655000	0.94253	TTG	CDH8	-	NULL	ENSG00000150394		0.443	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH8	HGNC	protein_coding	OTTHUMT00000268754.3	357	0.00	0	C	NM_001796		62055140	62055140	-1	no_errors	ENST00000577390	ensembl	human	known	69_37n	missense	64	20.99	17	SNP	1.000	A
CHAMP1	283489	genome.wustl.edu	37	13	115091437	115091437	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr13:115091437G>C	ENST00000361283.1	+	3	2429	c.2120G>C	c.(2119-2121)gGa>gCa	p.G707A		NM_001164144.1|NM_001164145.1|NM_032436.2	NP_001157616.1|NP_001157617.1|NP_115812.1	Q96JM3	CHAP1_HUMAN	chromosome alignment maintaining phosphoprotein 1	707	Mediates localization to the chromosome and the spindle and negatively regulates chromosome alignment.				attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation (GO:0051315)|protein localization to kinetochore (GO:0034501)|protein localization to microtubule (GO:0035372)|sister chromatid biorientation (GO:0031134)	condensed chromosome (GO:0000793)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)										CGTGGAAAAGGAAAGTATTAT	0.358																																						dbGAP											0													106.0	105.0	105.0					13																	115091437		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074894	CCDS9545.1	13q34	2013-01-07	2011-10-07	2011-10-07	ENSG00000198824	ENSG00000198824		"""Zinc fingers, C2H2-type"""	20311	protein-coding gene	gene with protein product	"""chromosome alignment-maintaining phosphoprotein"""		"""chromosome 13 open reading frame 8"", ""zinc finger protein 828"""	C13orf8, ZNF828		21063390	Standard	NM_032436		Approved	CAMP, CHAMP	uc010ahb.3	Q96JM3	OTTHUMG00000017404	ENST00000361283.1:c.2120G>C	13.37:g.115091437G>C	ENSP00000354730:p.Gly707Ala		B3KU06|Q6P181|Q8NC88|Q9BST0	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G707A	ENST00000361283.1	37	c.2120	CCDS9545.1	13	.	.	.	.	.	.	.	.	.	.	g	18.11	3.550901	0.65311	.	.	ENSG00000198824	ENST00000361283	T	0.01258	5.09	5.81	5.81	0.92471	.	0.000000	0.64402	D	0.000018	T	0.07773	0.0195	L	0.58925	1.835	0.45427	D	0.998404	D	0.89917	1.0	D	0.91635	0.999	T	0.20174	-1.0283	9	.	.	.	-12.8426	20.074	0.97736	0.0:0.0:1.0:0.0	.	707	Q96JM3	ZN828_HUMAN	A	707	ENSP00000354730:G707A	.	G	+	2	0	ZNF828	114109539	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.139000	0.71728	2.746000	0.94184	0.655000	0.94253	GGA	CHAMP1	-	NULL	ENSG00000198824		0.358	CHAMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHAMP1	HGNC	protein_coding	OTTHUMT00000045977.2	640	0.00	0	G	NM_032436		115091437	115091437	+1	no_errors	ENST00000361283	ensembl	human	known	69_37n	missense	97	25.19	33	SNP	1.000	C
CHRM4	1132	genome.wustl.edu	37	11	46407541	46407541	+	Silent	SNP	G	G	A			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr11:46407541G>A	ENST00000433765.2	-	1	566	c.567C>T	c.(565-567)ttC>ttT	p.F189F		NM_000741.2	NP_000732.2	P08173	ACM4_HUMAN	cholinergic receptor, muscarinic 4	189					adenylate cyclase-inhibiting G-protein coupled acetylcholine receptor signaling pathway (GO:0007197)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|regulation of locomotion (GO:0040012)|signal transduction (GO:0007165)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)			breast(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(6)|prostate(3)|skin(1)	20				GBM - Glioblastoma multiforme(35;0.0254)|Lung(87;0.14)	Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Darifenacin(DB00496)|Desipramine(DB01151)|Doxepin(DB01142)|Fesoterodine(DB06702)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Isopropamide(DB01625)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paroxetine(DB00715)|Pethidine(DB00454)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Tolterodine(DB01036)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	GGTTGGACAGGAACTGGATGA	0.582																																					Esophageal Squamous(171;1020 1936 4566 30205 42542)	dbGAP											0													36.0	41.0	39.0					11																	46407541		2184	4288	6472	-	-	-	SO:0001819	synonymous_variant	0			M16405	CCDS44581.1	11p12-p11.2	2012-08-08			ENSG00000180720	ENSG00000180720		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1953	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 4"""	118495				1577490	Standard	NM_000741		Approved		uc001nct.1	P08173	OTTHUMG00000154371	ENST00000433765.2:c.567C>T	11.37:g.46407541G>A			B2RPP4|Q0VD60|Q4VBK7	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Musac_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Musac_M4_rcpt	p.F189	ENST00000433765.2	37	c.567	CCDS44581.1	11																																																																																			CHRM4	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Musac_rcpt	ENSG00000180720		0.582	CHRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRM4	HGNC	protein_coding	OTTHUMT00000334985.1	68	0.00	0	G	NM_000741		46407541	46407541	-1	no_errors	ENST00000433765	ensembl	human	known	69_37n	silent	56	31.71	26	SNP	1.000	A
CLDN4	1364	genome.wustl.edu	37	7	73245839	73245839	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr7:73245839A>C	ENST00000435050.1	+	2	2988	c.308A>C	c.(307-309)aAg>aCg	p.K103T	CLDN4_ENST00000431918.1_Missense_Mutation_p.K103T|CLDN4_ENST00000340958.2_Missense_Mutation_p.K103T			O14493	CLD4_HUMAN	claudin 4	103	Interaction with EPHA2.				calcium-independent cell-cell adhesion (GO:0016338)|establishment of skin barrier (GO:0061436)|female pregnancy (GO:0007565)|response to progesterone (GO:0032570)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basal plasma membrane (GO:0009925)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)|transmembrane signaling receptor activity (GO:0004888)			kidney(2)|lung(4)|urinary_tract(1)	7		Lung NSC(55;0.159)				GTGGGGGGCAAGTGTACCAAC	0.647																																						dbGAP											0													88.0	80.0	83.0					7																	73245839		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB000712	CCDS5560.1	7q11.23	2008-07-18			ENSG00000189143	ENSG00000189143		"""Claudins"""	2046	protein-coding gene	gene with protein product	"""Clostridium perfringens enterotoxin receptor 1"", ""Williams-Beuren syndrome chromosomal region 8 protein"""	602909		CPETR, CPETR1		9334247, 9892664	Standard	NM_001305		Approved	CPE-R, WBSCR8, hCPE-R	uc003tzi.4	O14493	OTTHUMG00000023425	ENST00000435050.1:c.308A>C	7.37:g.73245839A>C	ENSP00000409544:p.Lys103Thr			Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin,prints_Claudin4	p.K103T	ENST00000435050.1	37	c.308	CCDS5560.1	7	.	.	.	.	.	.	.	.	.	.	A	31	5.099137	0.94197	.	.	ENSG00000189143	ENST00000435050;ENST00000431918;ENST00000340958;ENST00000543176	D;D;D	0.89485	-2.52;-2.52;-2.52	5.37	5.37	0.77165	.	0.096988	0.64402	D	0.000002	D	0.95401	0.8507	H	0.97291	3.975	0.54753	D	0.999989	D	0.52996	0.957	P	0.55161	0.77	D	0.96640	0.9473	10	0.87932	D	0	.	13.3146	0.60399	1.0:0.0:0.0:0.0	.	103	O14493	CLD4_HUMAN	T	103;103;103;90	ENSP00000409544:K103T;ENSP00000388639:K103T;ENSP00000342445:K103T	ENSP00000342445:K103T	K	+	2	0	CLDN4	72883775	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	4.384000	0.59607	2.045000	0.60652	0.459000	0.35465	AAG	CLDN4	-	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin	ENSG00000189143		0.647	CLDN4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CLDN4	HGNC	protein_coding	OTTHUMT00000348030.1	76	0.00	0	A	NM_001305		73245839	73245839	+1	no_errors	ENST00000340958	ensembl	human	known	69_37n	missense	111	25.50	38	SNP	1.000	C
CNGA2	1260	genome.wustl.edu	37	X	150911888	150911888	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chrX:150911888G>C	ENST00000329903.4	+	6	946	c.913G>C	c.(913-915)Gac>Cac	p.D305H		NM_005140.1	NP_005131.1	Q16280	CNGA2_HUMAN	cyclic nucleotide gated channel alpha 2	305					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|endometrium(4)|large_intestine(5)|lung(34)|prostate(2)	49	Acute lymphoblastic leukemia(192;6.56e-05)					CTTTGGGGTCGACACCTGGGT	0.483																																						dbGAP											0													179.0	160.0	167.0					X																	150911888		2203	4300	6503	-	-	-	SO:0001583	missense	0			S76067	CCDS14701.1	Xq27	2011-07-05			ENSG00000183862	ENSG00000183862		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2149	protein-coding gene	gene with protein product		300338		CNCA1, CNCA		7532814, 16382102	Standard	NM_005140		Approved	CNG2, OCNC1, OCNCa, OCNCALPHA, OCNCalpha, FLJ46312	uc004fey.1	Q16280	OTTHUMG00000024173	ENST00000329903.4:c.913G>C	X.37:g.150911888G>C	ENSP00000328478:p.Asp305His		A0AVD0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.D305H	ENST00000329903.4	37	c.913	CCDS14701.1	X	.	.	.	.	.	.	.	.	.	.	G	16.10	3.026809	0.54683	.	.	ENSG00000183862	ENST00000329903	D	0.97665	-4.48	4.96	4.96	0.65561	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98667	0.9553	M	0.91196	3.185	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99748	1.1017	10	0.87932	D	0	.	14.8649	0.70406	0.0:0.0:1.0:0.0	.	305	Q16280	CNGA2_HUMAN	H	305	ENSP00000328478:D305H	ENSP00000328478:D305H	D	+	1	0	CNGA2	150662544	1.000000	0.71417	0.890000	0.34922	0.694000	0.40290	7.590000	0.82653	2.183000	0.69458	0.529000	0.55759	GAC	CNGA2	-	pfam_Ion_trans_dom	ENSG00000183862		0.483	CNGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNGA2	HGNC	protein_coding	OTTHUMT00000060888.1	176	0.00	0	G	NM_005140		150911888	150911888	+1	no_errors	ENST00000329903	ensembl	human	known	69_37n	missense	89	40.27	60	SNP	0.999	C
CRHR2	1395	genome.wustl.edu	37	7	30695226	30695226	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr7:30695226G>C	ENST00000471646.1	-	10	1440	c.1023C>G	c.(1021-1023)atC>atG	p.I341M	CRHR2_ENST00000341843.4_Missense_Mutation_p.I327M|CRHR2_ENST00000506074.2_Missense_Mutation_p.I341M|CRHR2_ENST00000348438.4_Missense_Mutation_p.I368M	NM_001202482.1|NM_001202483.1|NM_001883.4	NP_001189411.1|NP_001189412.1|NP_001874.2	Q13324	CRFR2_HUMAN	corticotropin releasing hormone receptor 2	341					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|positive regulation of cAMP-mediated signaling (GO:0043950)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	corticotrophin-releasing factor receptor activity (GO:0015056)			breast(2)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						AGTTGAAATAGATGAACATGA	0.592																																						dbGAP											0													128.0	120.0	123.0					7																	30695226		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5429.1, CCDS56477.1, CCDS56478.1, CCDS75576.1	7p21-p15	2012-08-10			ENSG00000106113	ENSG00000106113		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2358	protein-coding gene	gene with protein product		602034				8536644	Standard	NM_001883		Approved	CRF2, CRF-RB, HM-CRF	uc003tbp.3	Q13324	OTTHUMG00000023218	ENST00000471646.1:c.1023C>G	7.37:g.30695226G>C	ENSP00000418722:p.Ile341Met		B2R967|B3SXS6|B3SXS7|B3SXS8|B3SXT0|F8WA81|O43461|Q4QRJ4|Q99431	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_CRF_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_CRF2_rcpt,prints_GPCR_2_diuretic_rcpt	p.I368M	ENST00000471646.1	37	c.1104	CCDS5429.1	7	.	.	.	.	.	.	.	.	.	.	G	16.08	3.022546	0.54683	.	.	ENSG00000106113	ENST00000471646;ENST00000348438;ENST00000341843;ENST00000506074	T;T;T;T	0.38077	1.16;1.16;1.16;1.16	5.11	4.21	0.49690	GPCR, family 2-like (1);	0.047860	0.85682	D	0.000000	T	0.41236	0.1150	L	0.29908	0.895	0.53688	D	0.999974	D;D;D;D;D	0.76494	0.998;0.998;0.999;0.999;0.998	D;D;D;D;D	0.77557	0.985;0.985;0.99;0.986;0.985	T	0.07635	-1.0762	10	0.23302	T	0.38	.	8.4376	0.32797	0.1776:0.0:0.8224:0.0	.	340;341;368;327;341	B3SXT0;B3SXS6;Q13324-2;Q13324-3;Q13324	.;.;.;.;CRFR2_HUMAN	M	341;368;327;341	ENSP00000418722:I341M;ENSP00000340943:I368M;ENSP00000344304:I327M;ENSP00000426498:I341M	ENSP00000344304:I327M	I	-	3	3	CRHR2	30661751	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	2.570000	0.45981	2.533000	0.85409	0.561000	0.74099	ATC	CRHR2	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_CRF_rcpt,prints_GPCR_2_secretin-like	ENSG00000106113		0.592	CRHR2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CRHR2	HGNC	protein_coding	OTTHUMT00000250448.3	175	0.00	0	G			30695226	30695226	-1	no_errors	ENST00000348438	ensembl	human	known	69_37n	missense	114	14.93	20	SNP	1.000	C
COPS6	10980	genome.wustl.edu	37	7	99688954	99688954	+	Splice_Site	SNP	G	G	A			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr7:99688954G>A	ENST00000303904.3	+	8	779		c.e8+1		MIR106B_ENST00000385301.1_RNA|MIR93_ENST00000385024.1_RNA|MIR25_ENST00000384816.1_RNA|COPS6_ENST00000418625.1_Splice_Site	NM_006833.4	NP_006824.2	Q7L5N1	CSN6_HUMAN	COP9 signalosome subunit 6						cullin deneddylation (GO:0010388)|viral process (GO:0016032)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				breast(1)|endometrium(3)|large_intestine(4)|lung(2)|prostate(1)|stomach(1)	12	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			TCTGAAGCGGGTAGGACAGGG	0.547																																						dbGAP											0													130.0	130.0	130.0					7																	99688954		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC002520	CCDS5682.1	7q22.1	2013-03-14	2013-03-14		ENSG00000168090	ENSG00000168090			21749	protein-coding gene	gene with protein product	"""COP9 subunit 6 (MOV34 homolog, 34 kD)"""	614729	"""COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis)"""			12477932	Standard	NM_006833		Approved	MOV34-34KD, CSN6	uc003usu.3	Q7L5N1	OTTHUMG00000154632	ENST00000303904.3:c.742+1G>A	7.37:g.99688954G>A			A4D2A3|O15387	Splice_Site	SNP	-	e8+1	ENST00000303904.3	37	c.742+1	CCDS5682.1	7	.	.	.	.	.	.	.	.	.	.	G	16.40	3.111333	0.56398	.	.	ENSG00000168090	ENST00000303904;ENST00000418625	.	.	.	4.39	4.39	0.52855	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8418	0.70230	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	COPS6	99526890	1.000000	0.71417	1.000000	0.80357	0.702000	0.40608	8.476000	0.90421	2.440000	0.82611	0.561000	0.74099	.	COPS6	-	-	ENSG00000168090		0.547	COPS6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COPS6	HGNC	protein_coding	OTTHUMT00000336412.3	280	0.00	0	G	NM_006833	Intron	99688954	99688954	+1	no_errors	ENST00000303904	ensembl	human	known	69_37n	splice_site	169	19.14	40	SNP	1.000	A
CROCCP2	84809	genome.wustl.edu	37	1	16950449	16950449	+	lincRNA	SNP	A	A	G	rs11260846	byFrequency	TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr1:16950449A>G	ENST00000412962.1	-	0	1000							Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											GCCAGCTGCCATTGCACCTCA	0.667																																						dbGAP											0																																										-	-	-			0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16950449A>G			Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.667	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	46	0.00	0	A	NR_026752.1		16950449	16950449	-1	no_errors	ENST00000421700	ensembl	human	known	69_37n	rna	66	13.16	10	SNP	0.983	G
DCT	1638	genome.wustl.edu	37	13	95112432	95112432	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr13:95112432T>A	ENST00000377028.5	-	6	1505	c.1092A>T	c.(1090-1092)caA>caT	p.Q364H	DCT_ENST00000490854.1_5'Flank|DCT_ENST00000446125.1_Missense_Mutation_p.Q364H	NM_001922.3	NP_001913.2	P40126	TYRP2_HUMAN	dopachrome tautomerase	364					cell development (GO:0048468)|developmental pigmentation (GO:0048066)|epidermis development (GO:0008544)|melanin biosynthetic process from tyrosine (GO:0006583)|positive regulation of neuroblast proliferation (GO:0002052)|ventricular zone neuroblast division (GO:0021847)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)	copper ion binding (GO:0005507)|dopachrome isomerase activity (GO:0004167)|oxidoreductase activity (GO:0016491)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	50	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)		GGCTCATCACTTGAGAATCCA	0.423																																						dbGAP											0													94.0	87.0	90.0					13																	95112432		2203	4300	6503	-	-	-	SO:0001583	missense	0			D17547	CCDS9470.1, CCDS45060.1	13q32	2012-09-28	2012-09-28		ENSG00000080166	ENSG00000080166	5.3.3.12		2709	protein-coding gene	gene with protein product	"""dopachrome delta-isomerase"""	191275	"""tyrosine-related protein 2"""	TYRP2		8306979	Standard	NM_001922		Approved		uc010afh.3	P40126	OTTHUMG00000017206	ENST00000377028.5:c.1092A>T	13.37:g.95112432T>A	ENSP00000366227:p.Gln364His		Q09GT4	Missense_Mutation	SNP	pfam_Tyrosinase,superfamily_Unchr_di-copper_centre,prints_Tyrosinase	p.Q364H	ENST00000377028.5	37	c.1092	CCDS9470.1	13	.	.	.	.	.	.	.	.	.	.	T	16.01	3.000631	0.54254	.	.	ENSG00000080166	ENST00000377028;ENST00000446125	D;D	0.98968	-5.28;-5.28	5.52	3.02	0.34903	Tyrosinase (1);Uncharacterised domain, di-copper centre (2);	0.417296	0.28778	N	0.014170	D	0.96975	0.9012	N	0.25647	0.755	0.09310	N	1	P;P	0.52316	0.952;0.905	P;P	0.54270	0.747;0.656	D	0.92779	0.6239	10	0.38643	T	0.18	-3.4903	8.9461	0.35760	0.0:0.2335:0.0:0.7665	.	364;364	Q09GT4;P40126	.;TYRP2_HUMAN	H	364	ENSP00000366227:Q364H;ENSP00000392762:Q364H	ENSP00000366227:Q364H	Q	-	3	2	DCT	93910433	0.001000	0.12720	0.531000	0.27976	0.985000	0.73830	0.327000	0.19663	0.377000	0.24735	0.533000	0.62120	CAA	DCT	-	pfam_Tyrosinase,superfamily_Unchr_di-copper_centre	ENSG00000080166		0.423	DCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCT	HGNC	protein_coding	OTTHUMT00000045461.3	397	0.00	0	T			95112432	95112432	-1	no_errors	ENST00000446125	ensembl	human	known	69_37n	missense	68	17.07	14	SNP	0.031	A
DIDO1	11083	genome.wustl.edu	37	20	61528246	61528246	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr20:61528246C>G	ENST00000266070.4	-	7	2016	c.1691G>C	c.(1690-1692)aGa>aCa	p.R564T	DIDO1_ENST00000395335.2_Missense_Mutation_p.R564T|DIDO1_ENST00000395340.1_Missense_Mutation_p.R564T|DIDO1_ENST00000395343.1_Missense_Mutation_p.R564T	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	564					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					CACGAGGTTTCTAGGTGCAGG	0.567																																					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	dbGAP											0													44.0	44.0	44.0					20																	61528246		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.1691G>C	20.37:g.61528246C>G	ENSP00000266070:p.Arg564Thr		A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	pfam_TFIIS_cen_dom,pfam_SPOC_C,pfam_Znf_PHD-finger,superfamily_TFIIS_cen_dom,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_TFS2M,pfscan_Znf_PHD-finger	p.R564T	ENST00000266070.4	37	c.1691	CCDS33506.1	20	.	.	.	.	.	.	.	.	.	.	C	13.87	2.365905	0.41902	.	.	ENSG00000101191	ENST00000266070;ENST00000395343;ENST00000395340;ENST00000395335	T;T;T;T	0.11930	3.07;3.07;2.73;2.73	5.71	5.71	0.89125	.	0.000000	0.46442	D	0.000285	T	0.26629	0.0651	M	0.71581	2.175	0.37505	D	0.916913	D;P	0.56746	0.977;0.791	P;B	0.52957	0.714;0.15	T	0.04360	-1.0957	10	0.46703	T	0.11	-16.947	11.7715	0.51962	0.0:0.9126:0.0:0.0874	.	564;564	Q9BTC0-1;Q9BTC0	.;DIDO1_HUMAN	T	564	ENSP00000266070:R564T;ENSP00000378752:R564T;ENSP00000378749:R564T;ENSP00000378744:R564T	ENSP00000266070:R564T	R	-	2	0	DIDO1	60998691	0.062000	0.20869	0.007000	0.13788	0.020000	0.10135	1.866000	0.39489	2.685000	0.91497	0.563000	0.77884	AGA	DIDO1	-	NULL	ENSG00000101191		0.567	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIDO1	HGNC	protein_coding	OTTHUMT00000080091.2	38	0.00	0	C	NM_080796		61528246	61528246	-1	no_errors	ENST00000266070	ensembl	human	known	69_37n	missense	31	27.91	12	SNP	0.033	G
DLG5	9231	genome.wustl.edu	37	10	79572041	79572041	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr10:79572041C>T	ENST00000372391.2	-	21	4125	c.4120G>A	c.(4120-4122)Gtc>Atc	p.V1374I	DLG5_ENST00000459739.1_5'UTR|DLG5_ENST00000372388.2_Missense_Mutation_p.V1034I	NM_004747.3	NP_004738.3	Q8TDM6	DLG5_HUMAN	discs, large homolog 5 (Drosophila)	1374	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				apical protein localization (GO:0045176)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|intracellular signal transduction (GO:0035556)|metanephric collecting duct development (GO:0072205)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|polarized epithelial cell differentiation (GO:0030859)|protein complex assembly (GO:0006461)|protein localization to adherens junction (GO:0071896)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|zonula adherens assembly (GO:0045186)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cytoskeletal protein binding (GO:0008092)|receptor signaling complex scaffold activity (GO:0030159)			breast(9)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(17)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	60	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			ACCTTGGAGACGTAGATGCCG	0.627																																						dbGAP											0													105.0	90.0	95.0					10																	79572041		2203	4300	6503	-	-	-	SO:0001583	missense	0			U61843	CCDS7353.2	10q23	2008-07-09	2001-11-28		ENSG00000151208	ENSG00000151208			2904	protein-coding gene	gene with protein product		604090	"""discs, large (Drosophila) homolog 5"""			9738934	Standard	XM_005270276		Approved	P-dlg, KIAA0583	uc001jzk.3	Q8TDM6	OTTHUMG00000018548	ENST00000372391.2:c.4120G>A	10.37:g.79572041C>T	ENSP00000361467:p.Val1374Ile		A6H8Y3|Q149N1|Q5T1H7|Q5T1H8|Q6DKG3|Q86WC0|Q8TDM7|Q9UE73|Q9Y4E3	Missense_Mutation	SNP	pfam_PDZ,pfam_DUF622,pfam_Guanylate_kin,superfamily_PDZ,superfamily_SH3_domain,superfamily_DEATH-like,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_CARD,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin	p.V1374I	ENST00000372391.2	37	c.4120	CCDS7353.2	10	.	.	.	.	.	.	.	.	.	.	C	25.9	4.682520	0.88542	.	.	ENSG00000151208	ENST00000372391;ENST00000424842;ENST00000372388	T;T;T	0.51574	0.7;0.7;0.7	5.8	4.9	0.64082	PDZ/DHR/GLGF (4);	0.000000	0.35378	N	0.003246	T	0.59729	0.2215	L	0.46670	1.46	0.40148	D	0.97691	P;P	0.52061	0.95;0.732	D;P	0.63113	0.911;0.574	T	0.60586	-0.7234	10	0.42905	T	0.14	.	15.0675	0.72008	0.0:0.932:0.0:0.068	.	1374;1034	Q8TDM6;Q8TDM6-2	DLG5_HUMAN;.	I	1374;335;1034	ENSP00000361467:V1374I;ENSP00000394797:V335I;ENSP00000361464:V1034I	ENSP00000361464:V1034I	V	-	1	0	DLG5	79242047	1.000000	0.71417	0.998000	0.56505	0.644000	0.38419	7.339000	0.79282	1.451000	0.47736	0.655000	0.94253	GTC	DLG5	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000151208		0.627	DLG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLG5	HGNC	protein_coding	OTTHUMT00000048900.2	64	0.00	0	C			79572041	79572041	-1	no_errors	ENST00000372391	ensembl	human	known	69_37n	missense	45	36.62	26	SNP	1.000	T
DYNC1H1	1778	genome.wustl.edu	37	14	102449535	102449535	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr14:102449535G>C	ENST00000360184.4	+	6	1305	c.1141G>C	c.(1141-1143)Gtg>Ctg	p.V381L		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	381	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						ACTGCGTTTGGTGGAGGCAAT	0.393																																						dbGAP											0													79.0	75.0	76.0					14																	102449535		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.1141G>C	14.37:g.102449535G>C	ENSP00000348965:p.Val381Leu		B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like,smart_AAA+_ATPase	p.V381L	ENST00000360184.4	37	c.1141	CCDS9966.1	14	.	.	.	.	.	.	.	.	.	.	G	20.3	3.972091	0.74246	.	.	ENSG00000197102	ENST00000360184	T	0.54279	0.58	5.88	5.88	0.94601	Dynein heavy chain, domain-1 (1);	0.000000	0.85682	D	0.000000	T	0.56411	0.1983	M	0.74546	2.27	0.80722	D	1	B	0.19935	0.04	B	0.28849	0.095	T	0.56517	-0.7966	10	0.07325	T	0.83	.	20.1989	0.98252	0.0:0.0:1.0:0.0	.	381	Q14204	DYHC1_HUMAN	L	381	ENSP00000348965:V381L	ENSP00000348965:V381L	V	+	1	0	DYNC1H1	101519288	1.000000	0.71417	0.997000	0.53966	0.930000	0.56654	9.476000	0.97823	2.784000	0.95788	0.591000	0.81541	GTG	DYNC1H1	-	pfam_Dynein_heavy_dom-1	ENSG00000197102		0.393	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	HGNC	protein_coding	OTTHUMT00000414574.1	395	0.00	0	G	NM_001376		102449535	102449535	+1	no_errors	ENST00000360184	ensembl	human	known	69_37n	missense	60	29.41	25	SNP	1.000	C
EXT1	2131	genome.wustl.edu	37	8	118842589	118842589	+	Splice_Site	SNP	C	C	G			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr8:118842589C>G	ENST00000378204.2	-	4	1971		c.e4-1			NM_000127.2	NP_000118.2	Q16394	EXT1_HUMAN	exostosin glycosyltransferase 1						axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular polysaccharide biosynthetic process (GO:0033692)|embryonic skeletal joint development (GO:0072498)|endoderm development (GO:0007492)|gastrulation (GO:0007369)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|mesoderm development (GO:0007498)|olfactory bulb development (GO:0021772)|ossification (GO:0001503)|protein glycosylation (GO:0006486)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)|glucuronosyltransferase activity (GO:0015020)|heparan sulfate N-acetylglucosaminyltransferase activity (GO:0042328)|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity (GO:0050509)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|endometrium(7)|kidney(1)|large_intestine(12)|lung(10)|ovary(3)|prostate(1)|stomach(1)|urinary_tract(2)	38	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)			TAGAAGGAATCTGTAACACAA	0.363			"""Mis, N, F, S"""			"""exostoses, osteosarcoma"""			Langer-Giedion syndrome;Hereditary Multiple Exostoses																													dbGAP	yes	Rec		Multiple Exostoses Type 1	8	8q24.11-q24.13	2131	multiple exostoses type 1 gene		M	0													79.0	78.0	78.0					8																	118842589		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II;HME, Hereditary Exostoses, Multiple Osteochondromatosis, Multiple Cartilaginous Exostoses	S79639	CCDS6324.1	8q24.11	2014-09-17	2013-03-01		ENSG00000182197	ENSG00000182197	2.4.1.224, 2.4.1.225	"""Exostosin glycosyltransferase family"""	3512	protein-coding gene	gene with protein product	"""Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase"""	608177	"""Langer-Giedion syndrome chromosome region"", ""exostoses (multiple) 1"", ""exostosin 1"""	LGCR, LGS			Standard	NM_000127		Approved	ttv	uc003yok.1	Q16394	OTTHUMG00000059718	ENST00000378204.2:c.1165-1G>C	8.37:g.118842589C>G			B2R7V2|Q9BVI9	Splice_Site	SNP	-	e4-1	ENST00000378204.2	37	c.1165-1	CCDS6324.1	8	.	.	.	.	.	.	.	.	.	.	c	29.6	5.023499	0.93462	.	.	ENSG00000182197	ENST00000378204;ENST00000436216	.	.	.	6.16	6.16	0.99307	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	EXT1	118911770	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.814000	0.86154	2.937000	0.99478	0.650000	0.86243	.	EXT1	-	-	ENSG00000182197		0.363	EXT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXT1	HGNC	protein_coding	OTTHUMT00000132768.3	749	0.00	0	C	NM_000127	Intron	118842589	118842589	-1	no_errors	ENST00000378204	ensembl	human	known	69_37n	splice_site	47	20.34	12	SNP	1.000	G
DENND6B	414918	genome.wustl.edu	37	22	50752890	50752890	+	Silent	SNP	G	G	A			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr22:50752890G>A	ENST00000413817.3	-	12	1082	c.1011C>T	c.(1009-1011)ttC>ttT	p.F337F	XX-C283C717.1_ENST00000453835.1_RNA	NM_001001794.3	NP_001001794.3	Q8NEG7	DEN6B_HUMAN	DENN/MADD domain containing 6B	337					positive regulation of Rab GTPase activity (GO:0032851)	endosome (GO:0005768)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)										TTTTGATAAAGAAAGGGTTTG	0.587																																						dbGAP											0													47.0	46.0	46.0					22																	50752890		1936	4130	6066	-	-	-	SO:0001819	synonymous_variant	0			AK054743	CCDS46732.1	22q13.33	2012-10-03	2012-10-03	2012-10-03	ENSG00000205593	ENSG00000205593		"""DENN/MADD domain containing"""	32690	protein-coding gene	gene with protein product			"""family with sequence similarity 116, member B"""	FAM116B		21330364	Standard	NM_001001794		Approved	MGC33692, AFI1B	uc011arv.1	Q8NEG7	OTTHUMG00000150210	ENST00000413817.3:c.1011C>T	22.37:g.50752890G>A			A6X8I5	Silent	SNP	pfam_Afi1_N,pfam_DENN_dom,pfam_Secretory_pathway_prot_Avl9	p.F337	ENST00000413817.3	37	c.1011	CCDS46732.1	22																																																																																			FAM116B	-	pfam_Afi1_N	ENSG00000205593		0.587	DENND6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM116B	HGNC	protein_coding	OTTHUMT00000316845.3	246	0.00	0	G	NM_001001794		50752890	50752890	-1	no_errors	ENST00000413817	ensembl	human	known	69_37n	silent	130	26.14	46	SNP	1.000	A
FAM178B	51252	genome.wustl.edu	37	2	97568366	97568366	+	Silent	SNP	C	C	T			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr2:97568366C>T	ENST00000417561.3	-	17	2084	c.2085G>A	c.(2083-2085)gaG>gaA	p.E695E	FAM178B_ENST00000490605.2_Silent_p.E547E|FAM178B_ENST00000327896.3_Silent_p.E515E			Q8IXR5	F178B_HUMAN	family with sequence similarity 178, member B	695										large_intestine(1)|ovary(1)	2						CCTGGGTCTTCTCTTGCCAGA	0.622																																						dbGAP											0													54.0	51.0	52.0					2																	97568366		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AF151068, BC039488	CCDS33252.1, CCDS46366.1, CCDS46366.2	2q11.2	2008-08-08			ENSG00000168754	ENSG00000168754			28036	protein-coding gene	gene with protein product						11042152	Standard	NM_001122646		Approved	LOC51252	uc002sxl.4	Q8IXR5	OTTHUMG00000155257	ENST00000417561.3:c.2085G>A	2.37:g.97568366C>T			A8MXN2|E9PD86|Q8IUY0|Q9P0P4	Silent	SNP	NULL	p.E695	ENST00000417561.3	37	c.2085		2																																																																																			FAM178B	-	NULL	ENSG00000168754		0.622	FAM178B-202	KNOWN	basic	protein_coding	FAM178B	HGNC	protein_coding		85	0.00	0	C	NM_016490		97568366	97568366	-1	no_errors	ENST00000417561	ensembl	human	known	69_37n	silent	36	32.08	17	SNP	1.000	T
FANCD2	2177	genome.wustl.edu	37	3	10130185	10130185	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr3:10130185G>C	ENST00000419585.1	+	35	3680	c.3519G>C	c.(3517-3519)gaG>gaC	p.E1173D	FANCD2_ENST00000287647.3_Missense_Mutation_p.E1173D|FANCD2_ENST00000383806.1_Missense_Mutation_p.E1173D|FANCD2_ENST00000383807.1_Missense_Mutation_p.E1173D|FANCD2OS_ENST00000436517.1_Intron|FANCD2OS_ENST00000524279.1_Intron			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	1173					DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		GGGATAAAGAGAAGAGCAACA	0.438			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													dbGAP	yes	Rec		Fanconi anaemia D2	3	3p26	2177	"""Fanconi anemia, complementation group D2"""		L	0													159.0	142.0	148.0					3																	10130185		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.3519G>C	3.37:g.10130185G>C	ENSP00000398754:p.Glu1173Asp		Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.E1173D	ENST00000419585.1	37	c.3519	CCDS33696.1	3	.	.	.	.	.	.	.	.	.	.	G	23.7	4.452555	0.84209	.	.	ENSG00000144554	ENST00000287647;ENST00000383807;ENST00000383806;ENST00000419585	T;T;T;T	0.58940	0.3;0.3;0.3;0.3	5.7	4.83	0.62350	.	0.046648	0.85682	D	0.000000	T	0.67496	0.2899	M	0.68952	2.095	0.80722	D	1	D;P	0.57899	0.981;0.948	P;P	0.56042	0.79;0.7	T	0.68815	-0.5309	10	0.45353	T	0.12	.	12.7392	0.57241	0.0794:0.0:0.9206:0.0	.	1173;1173	Q9BXW9-2;Q9BXW9	.;FACD2_HUMAN	D	1173	ENSP00000287647:E1173D;ENSP00000373318:E1173D;ENSP00000373317:E1173D;ENSP00000398754:E1173D	ENSP00000287647:E1173D	E	+	3	2	FANCD2	10105185	1.000000	0.71417	0.996000	0.52242	0.913000	0.54294	4.163000	0.58183	1.441000	0.47550	-0.143000	0.13931	GAG	FANCD2	-	NULL	ENSG00000144554		0.438	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCD2	HGNC	protein_coding	OTTHUMT00000339873.1	590	0.17	1	G			10130185	10130185	+1	no_errors	ENST00000287647	ensembl	human	known	69_37n	missense	83	25.89	29	SNP	1.000	C
FAS	355	genome.wustl.edu	37	10	90773992	90773992	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr10:90773992G>C	ENST00000355740.2	+	9	1013	c.793G>C	c.(793-795)Gac>Cac	p.D265H	RP11-399O19.9_ENST00000562983.1_RNA|FAS_ENST00000355279.2_3'UTR|FAS_ENST00000357339.2_Missense_Mutation_p.D244H|FAS_ENST00000352159.4_3'UTR	NM_000043.4|NM_152871.2|NM_152872.2	NP_000034.1|NP_690610.1|NP_690611.1	P49327	FAS_HUMAN	Fas cell surface death receptor	0	Beta-ketoacyl synthase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(2)	18		Colorectal(252;0.0161)		Colorectal(12;0.000136)|COAD - Colon adenocarcinoma(12;0.000193)	Cerulenin(DB01034)|Orlistat(DB01083)	GATCAAGAATGACAATGTCCA	0.373																																						dbGAP											0													128.0	119.0	122.0					10																	90773992		2203	4300	6503	-	-	-	SO:0001583	missense	0			M67454	CCDS7393.1, CCDS7394.1, CCDS7395.1	10q24.1	2014-09-17	2013-05-22	2005-01-07	ENSG00000026103	ENSG00000026103		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11920	protein-coding gene	gene with protein product	"""TNF receptor superfamily member 6"""	134637	"""tumor necrosis factor receptor superfamily, member 6"", ""Fas (TNF receptor superfamily, member 6)"""	FAS1, APT1, TNFRSF6		1385299, 1385309	Standard	NM_000043		Approved	CD95, APO-1	uc001kfr.3	P25445	OTTHUMG00000018701	ENST00000355740.2:c.793G>C	10.37:g.90773992G>C	ENSP00000347979:p.Asp265His		Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	pfam_Death,pfam_TNFR/NGFR_Cys_rich_reg,superfamily_DEATH-like,smart_TNFR/NGFR_Cys_rich_reg,smart_Death,prints_Fas_rcpt,pfscan_Death,pfscan_TNFR/NGFR_Cys_rich_reg	p.D265H	ENST00000355740.2	37	c.793	CCDS7393.1	10	.	.	.	.	.	.	.	.	.	.	G	11.73	1.726394	0.30593	.	.	ENSG00000026103	ENST00000540197;ENST00000355740;ENST00000357339	D;D	0.94497	-3.44;-3.44	4.65	1.6	0.23607	Death (3);DEATH-like (2);	2.843700	0.01218	N	0.008038	D	0.93530	0.7935	M	0.79258	2.445	0.34795	D	0.736082	P;P	0.39250	0.613;0.665	B;B	0.33799	0.104;0.17	D	0.84347	0.0530	10	0.72032	D	0.01	-26.9019	7.2215	0.25990	0.3103:0.0:0.6897:0.0	.	244;265	P25445-6;P25445	.;TNR6_HUMAN	H	292;265;244	ENSP00000347979:D265H;ENSP00000349896:D244H	ENSP00000347979:D265H	D	+	1	0	FAS	90763972	0.288000	0.24324	0.817000	0.32601	0.833000	0.47200	1.089000	0.30890	0.211000	0.20683	0.650000	0.86243	GAC	FAS	-	pfam_Death,superfamily_DEATH-like,smart_Death,pfscan_Death	ENSG00000026103		0.373	FAS-005	KNOWN	basic|appris_principal|CCDS	protein_coding	FAS	HGNC	protein_coding	OTTHUMT00000049274.3	325	0.00	0	G			90773992	90773992	+1	no_errors	ENST00000355740	ensembl	human	known	69_37n	missense	30	30.23	13	SNP	0.491	C
FLNA	2316	genome.wustl.edu	37	X	153587753	153587753	+	Silent	SNP	C	C	G			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chrX:153587753C>G	ENST00000369850.3	-	25	4400	c.4164G>C	c.(4162-4164)ctG>ctC	p.L1388L	FLNA_ENST00000422373.1_Silent_p.L1388L|FLNA_ENST00000369856.3_5'Flank|FLNA_ENST00000344736.4_Silent_p.L1388L|FLNA_ENST00000360319.4_Silent_p.L1388L	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	1388					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CAGCCAGGCCCAGGCCGCCCG	0.652																																						dbGAP											0													75.0	85.0	82.0					X																	153587753		1984	4146	6130	-	-	-	SO:0001819	synonymous_variant	0			X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.4164G>C	X.37:g.153587753C>G			E9KL45|Q5HY53|Q5HY55|Q8NF52	Silent	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.L1388	ENST00000369850.3	37	c.4164	CCDS48194.1	X																																																																																			FLNA	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000196924		0.652	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNA	HGNC	protein_coding	OTTHUMT00000058942.3	40	0.00	0	C			153587753	153587753	-1	no_errors	ENST00000369850	ensembl	human	known	69_37n	silent	84	16.83	17	SNP	1.000	G
GJA4	2701	genome.wustl.edu	37	1	35260735	35260735	+	Silent	SNP	C	C	A			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr1:35260735C>A	ENST00000342280.4	+	2	1009	c.921C>A	c.(919-921)ctC>ctA	p.L307L		NM_002060.2	NP_002051.2	P35212	CXA4_HUMAN	gap junction protein, alpha 4, 37kDa	307					blood vessel development (GO:0001568)|calcium ion transport (GO:0006816)|cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|endothelium development (GO:0003158)|response to pain (GO:0048265)|transport (GO:0006810)	connexon complex (GO:0005922)|gap junction (GO:0005921)|integral component of plasma membrane (GO:0005887)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(3)|prostate(4)|stomach(1)	14		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)				GGCCCCCTCTCTTCCTGGACC	0.577																																						dbGAP											0													42.0	40.0	41.0					1																	35260735		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M96789	CCDS30669.1	1p35.1	2008-02-05	2007-01-16		ENSG00000187513	ENSG00000187513		"""Ion channels / Gap junction proteins (connexins)"""	4278	protein-coding gene	gene with protein product	"""connexin 37"""	121012	"""gap junction protein, alpha 4, 37kD (connexin 37)"", ""gap junction protein, alpha 4, 37kDa (connexin 37)"""			9843209, 7680674	Standard	XM_005270750		Approved	CX37	uc001bya.3	P35212	OTTHUMG00000004050	ENST00000342280.4:c.921C>A	1.37:g.35260735C>A			A8K698|D3DPR4|Q9P106|Q9UBL1|Q9UNA9|Q9UNB0|Q9UNB1|Q9Y5N7	Silent	SNP	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin,prints_Connexin37	p.L307	ENST00000342280.4	37	c.921	CCDS30669.1	1																																																																																			GJA4	-	NULL	ENSG00000187513		0.577	GJA4-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GJA4	HGNC	protein_coding	OTTHUMT00000011556.1	30	0.00	0	C	NM_002060		35260735	35260735	+1	no_errors	ENST00000342280	ensembl	human	known	69_37n	silent	22	31.25	10	SNP	0.625	A
GNS	2799	genome.wustl.edu	37	12	65141517	65141517	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr12:65141517A>G	ENST00000258145.3	-	3	604	c.434T>C	c.(433-435)tTt>tCt	p.F145S	GNS_ENST00000542058.1_Missense_Mutation_p.F125S|GNS_ENST00000418919.2_Missense_Mutation_p.F89S|GNS_ENST00000543646.1_Missense_Mutation_p.F177S	NM_002076.3	NP_002067.1	P15586	GNS_HUMAN	glucosamine (N-acetyl)-6-sulfatase	145					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	metal ion binding (GO:0046872)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)|sulfuric ester hydrolase activity (GO:0008484)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(4)	15	Lung NSC(1;7.25e-14)|all_lung(1;1.25e-12)		LUAD - Lung adenocarcinoma(6;0.115)	GBM - Glioblastoma multiforme(28;0.0435)		CCCTGCAAAAAAGGTCTGATA	0.328																																						dbGAP											0													125.0	119.0	121.0					12																	65141517		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8970.1	12q14	2010-05-04	2008-08-01		ENSG00000135677	ENSG00000135677	3.1.6.14		4422	protein-coding gene	gene with protein product	"""Sanfilippo disease IIID"", ""N-acetylglucosamine-6-sulfatase"""	607664					Standard	NM_002076		Approved		uc001ssg.4	P15586	OTTHUMG00000168819	ENST00000258145.3:c.434T>C	12.37:g.65141517A>G	ENSP00000258145:p.Phe145Ser		B4DYH8|Q53F05	Missense_Mutation	SNP	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core,pirsf_GlcNAc_6-SO4ase	p.F145S	ENST00000258145.3	37	c.434	CCDS8970.1	12	.	.	.	.	.	.	.	.	.	.	A	16.70	3.197212	0.58126	.	.	ENSG00000135677	ENST00000418919;ENST00000258145;ENST00000543646;ENST00000542058;ENST00000539825;ENST00000545471;ENST00000545273	D;D;D;D;D	0.99888	-3.96;-3.96;-3.96;-3.96;-7.54	5.74	5.74	0.90152	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase, conserved site (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	L	0.58583	1.82	0.80722	D	1	D;D;B;D	0.89917	0.974;1.0;0.389;0.999	P;D;P;D	0.80764	0.869;0.994;0.688;0.971	D	0.96940	0.9687	9	.	.	.	-21.1209	16.3501	0.83202	1.0:0.0:0.0:0.0	.	125;177;145;89	B4DYH8;F6S8M0;P15586;Q7Z3X3	.;.;GNS_HUMAN;.	S	89;145;177;125;62;82;69	ENSP00000413130:F89S;ENSP00000258145:F145S;ENSP00000438497:F177S;ENSP00000444819:F125S;ENSP00000445055:F69S	.	F	-	2	0	GNS	63427784	1.000000	0.71417	1.000000	0.80357	0.208000	0.24298	9.197000	0.94985	2.323000	0.78572	0.528000	0.53228	TTT	GNS	-	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core,pirsf_GlcNAc_6-SO4ase	ENSG00000135677		0.328	GNS-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GNS	HGNC	protein_coding	OTTHUMT00000401195.2	342	0.29	1	A			65141517	65141517	-1	no_errors	ENST00000258145	ensembl	human	known	69_37n	missense	44	26.67	16	SNP	1.000	G
GPC6	10082	genome.wustl.edu	37	13	94482413	94482413	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr13:94482413T>C	ENST00000377047.4	+	3	941	c.326T>C	c.(325-327)tTc>tCc	p.F109S	GPC6-AS2_ENST00000445540.1_RNA	NM_005708.3	NP_005699.1	Q9Y625	GPC6_HUMAN	glypican 6	109					carbohydrate metabolic process (GO:0005975)|cell migration (GO:0016477)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	38	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				GCAGAATTTTTCCGAGAGCTC	0.388																																						dbGAP											0													32.0	33.0	33.0					13																	94482413		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF111178	CCDS9469.1	13q32	2008-02-05			ENSG00000183098	ENSG00000183098		"""Proteoglycans / Cell Surface : Glypicans"""	4454	protein-coding gene	gene with protein product	"""glypican proteoglycan 6"""	604404				10329016	Standard	NM_005708		Approved		uc001vlt.3	Q9Y625	OTTHUMG00000017205	ENST00000377047.4:c.326T>C	13.37:g.94482413T>C	ENSP00000366246:p.Phe109Ser		A8K279|Q96SG5|Q96SG8|Q9H1P4	Missense_Mutation	SNP	pfam_Glypican	p.F109S	ENST00000377047.4	37	c.326	CCDS9469.1	13	.	.	.	.	.	.	.	.	.	.	T	25.5	4.647365	0.87958	.	.	ENSG00000183098	ENST00000377047	T	0.59906	0.23	5.53	5.53	0.82687	.	0.059667	0.64402	D	0.000001	T	0.81702	0.4878	M	0.92923	3.36	0.50632	D	0.999887	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.86428	0.1759	10	0.87932	D	0	.	15.9539	0.79865	0.0:0.0:0.0:1.0	.	109;109	B4E2M1;Q9Y625	.;GPC6_HUMAN	S	109	ENSP00000366246:F109S	ENSP00000366246:F109S	F	+	2	0	GPC6	93280414	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.655000	0.83696	2.240000	0.73641	0.528000	0.53228	TTC	GPC6	-	pfam_Glypican	ENSG00000183098		0.388	GPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC6	HGNC	protein_coding	OTTHUMT00000045460.4	99	0.00	0	T	NM_005708		94482413	94482413	+1	no_errors	ENST00000377047	ensembl	human	known	69_37n	missense	22	26.67	8	SNP	1.000	C
GPR111	222611	genome.wustl.edu	37	6	47650367	47650367	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr6:47650367G>T	ENST00000296862.1	+	6	2072	c.2072G>T	c.(2071-2073)aGt>aTt	p.S691I	GPR111_ENST00000507065.1_Missense_Mutation_p.S623I|GPR111_ENST00000398742.2_Intron			Q8IZF7	GP111_HUMAN	G protein-coupled receptor 111	691					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(2)|lung(15)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29						TTCCAGGTAAGTCCAGATGCT	0.448																																						dbGAP											0													53.0	51.0	52.0					6																	47650367		2036	4212	6248	-	-	-	SO:0001583	missense	0			AB065684		6p12.3	2014-08-08			ENSG00000164393	ENSG00000164393		"""-"", ""GPCR / Class B : Orphans"""	18991	protein-coding gene	gene with protein product						12435584	Standard	NM_153839		Approved	hGPCR35, PGR20	uc003oyy.3	Q8IZF7	OTTHUMG00000046168	ENST00000296862.1:c.2072G>T	6.37:g.47650367G>T	ENSP00000296862:p.Ser691Ile		Q2PNZ1|Q86SL6|Q8NGU5|Q8TDT5	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_GPCR_2-like	p.S691I	ENST00000296862.1	37	c.2072		6	.	.	.	.	.	.	.	.	.	.	G	13.73	2.323775	0.41096	.	.	ENSG00000164393	ENST00000507065;ENST00000296862	T;T	0.22134	2.01;1.97	5.64	5.64	0.86602	.	0.810371	0.11320	N	0.576139	T	0.30759	0.0775	.	.	.	0.80722	D	1	D	0.76494	0.999	D	0.68765	0.96	T	0.00878	-1.1530	9	0.20519	T	0.43	.	16.842	0.85971	0.0:0.0:1.0:0.0	.	691	Q8IZF7	GP111_HUMAN	I	623;691	ENSP00000422934:S623I;ENSP00000296862:S691I	ENSP00000296862:S691I	S	+	2	0	GPR111	47758326	0.996000	0.38824	0.993000	0.49108	0.973000	0.67179	2.446000	0.44908	2.651000	0.90000	0.655000	0.94253	AGT	GPR111	-	NULL	ENSG00000164393		0.448	GPR111-001	KNOWN	basic	protein_coding	GPR111	HGNC	protein_coding	OTTHUMT00000106423.2	144	0.00	0	G	NM_153839		47650367	47650367	+1	no_errors	ENST00000296862	ensembl	human	known	69_37n	missense	32	23.81	10	SNP	0.993	T
GPR161	23432	genome.wustl.edu	37	1	168066104	168066104	+	Silent	SNP	G	G	A			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr1:168066104G>A	ENST00000367838.1	-	5	1054	c.741C>T	c.(739-741)tcC>tcT	p.S247S	GPR161_ENST00000361697.2_Silent_p.S247S|GPR161_ENST00000546300.1_Silent_p.S133S|GPR161_ENST00000537209.1_Silent_p.S267S|GPR161_ENST00000367836.1_Silent_p.S115S|GPR161_ENST00000539777.1_Silent_p.S169S|GPR161_ENST00000271357.5_Silent_p.S247S|GPR161_ENST00000367835.1_Silent_p.S247S	NM_001267611.1|NM_153832.2	NP_001254540.1|NP_722561.1	Q8N6U8	GP161_HUMAN	G protein-coupled receptor 161	247					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)|recycling endosome (GO:0055037)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|skin(1)	26	all_hematologic(923;0.215)					TGCCTGAAGAGGAGGTGGAGG	0.602																																						dbGAP											0													107.0	112.0	111.0					1																	168066104		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF091890	CCDS1268.1, CCDS58042.1, CCDS58043.1, CCDS58044.1, CCDS58045.1, CCDS72978.1	1q23.3	2012-08-21			ENSG00000143147	ENSG00000143147		"""GPCR / Class A : Orphans"""	23694	protein-coding gene	gene with protein product		612250				11959142	Standard	NM_153832		Approved	RE2	uc009wvo.4	Q8N6U8	OTTHUMG00000034651	ENST00000367838.1:c.741C>T	1.37:g.168066104G>A			B3KV34|B7Z5D7|B7Z5E8|B7Z5Z6|F5GXD6|F5H6J7|O75963|Q5TGK0|Q5TGK1|Q5TGK2	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.S267	ENST00000367838.1	37	c.801	CCDS1268.1	1																																																																																			GPR161	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000143147		0.602	GPR161-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR161	HGNC	protein_coding	OTTHUMT00000083829.1	86	0.00	0	G	NM_007369		168066104	168066104	-1	no_errors	ENST00000537209	ensembl	human	known	69_37n	silent	34	38.18	21	SNP	1.000	A
GPRIN1	114787	genome.wustl.edu	37	5	176026311	176026311	+	Silent	SNP	C	C	A			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr5:176026311C>A	ENST00000303991.4	-	2	702	c.525G>T	c.(523-525)cgG>cgT	p.R175R		NM_052899.2	NP_443131.2	Q7Z2K8	GRIN1_HUMAN	G protein regulated inducer of neurite outgrowth 1	175					neuron projection development (GO:0031175)	cell projection (GO:0042995)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(89;0.00263)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GATCTGCCTTCCGTGAGGACC	0.498																																						dbGAP											0													68.0	71.0	70.0					5																	176026311		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB067480	CCDS4405.1	5q35.2	2008-02-05			ENSG00000169258	ENSG00000169258			24835	protein-coding gene	gene with protein product		611239				11572484	Standard	NM_052899		Approved	GRIN1, KIAA1893	uc003meo.1	Q7Z2K8	OTTHUMG00000130659	ENST00000303991.4:c.525G>T	5.37:g.176026311C>A			C9JM70|Q8ND74|Q96PZ4	Silent	SNP	NULL	p.R175	ENST00000303991.4	37	c.525	CCDS4405.1	5																																																																																			GPRIN1	-	NULL	ENSG00000169258		0.498	GPRIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRIN1	HGNC	protein_coding	OTTHUMT00000253149.1	82	0.00	0	C	NM_052899		176026311	176026311	-1	no_errors	ENST00000303991	ensembl	human	known	69_37n	silent	36	29.41	15	SNP	0.000	A
GRB7	2886	genome.wustl.edu	37	17	37898524	37898524	+	5'UTR	SNP	T	T	A			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr17:37898524T>A	ENST00000309156.4	+	0	227				GRB7_ENST00000394204.1_5'UTR|GRB7_ENST00000309185.3_5'UTR|GRB7_ENST00000445327.2_Silent_p.G13G|GRB7_ENST00000578702.1_3'UTR|GRB7_ENST00000394209.2_5'UTR|GRB7_ENST00000394211.3_5'UTR	NM_005310.3	NP_005301.2	Q14451	GRB7_HUMAN	growth factor receptor-bound protein 7						blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|leukocyte migration (GO:0050900)|negative regulation of translation (GO:0017148)|positive regulation of cell migration (GO:0030335)|positive regulation of signal transduction (GO:0009967)|stress granule assembly (GO:0034063)	cell projection (GO:0042995)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)|protein kinase binding (GO:0019901)|RNA binding (GO:0003723)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;6.86e-60)|all cancers(3;1.65e-53)|BRCA - Breast invasive adenocarcinoma(8;2.03e-43)|STAD - Stomach adenocarcinoma(3;1.43e-12)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			ACACAACTGGTTCCGTTAAGC	0.587																																						dbGAP											0													170.0	165.0	167.0					17																	37898524		2203	4300	6503	-	-	-	SO:0001623	5_prime_UTR_variant	0			D43772	CCDS11345.1, CCDS56028.1	17q12	2013-02-14			ENSG00000141738	ENSG00000141738		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4567	protein-coding gene	gene with protein product		601522					Standard	NM_005310		Approved		uc021twu.1	Q14451	OTTHUMG00000133253	ENST00000309156.4:c.-31T>A	17.37:g.37898524T>A			B2RAV1|B3KNL0|B3KWP9|B7WP75|J3KQM4|Q53YD3|Q92568|Q96DF9|Q9Y220	Silent	SNP	pfam_BPS-dom,pfam_SH2,pfam_Ras-assoc,pfam_Pleckstrin_homology,smart_Ras-assoc,smart_Pleckstrin_homology,smart_SH2,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SH2,prints_SH2	p.G13	ENST00000309156.4	37	c.39	CCDS11345.1	17																																																																																			GRB7	-	NULL	ENSG00000141738		0.587	GRB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRB7	HGNC	protein_coding	OTTHUMT00000257024.2	117	0.00	0	T	NM_005310		37898524	37898524	+1	no_errors	ENST00000445327	ensembl	human	known	69_37n	silent	37	28.85	15	SNP	0.000	A
GRIK2	2898	genome.wustl.edu	37	6	102134229	102134229	+	Splice_Site	SNP	G	G	A			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr6:102134229G>A	ENST00000421544.1	+	6	1441		c.e6+1		GRIK2_ENST00000369137.3_Splice_Site|GRIK2_ENST00000369138.1_Splice_Site|GRIK2_ENST00000369134.4_Splice_Site|GRIK2_ENST00000318991.6_Splice_Site|GRIK2_ENST00000358361.3_Splice_Site|GRIK2_ENST00000413795.1_Splice_Site	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2						behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	ATTTATGACGGTATGAATACC	0.378																																						dbGAP											0													78.0	79.0	79.0					6																	102134229		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.951+1G>A	6.37:g.102134229G>A			A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Splice_Site	SNP	-	e6+1	ENST00000421544.1	37	c.951+1	CCDS5048.1	6	.	.	.	.	.	.	.	.	.	.	G	26.9	4.785092	0.90282	.	.	ENSG00000164418	ENST00000421544;ENST00000413795;ENST00000369138;ENST00000358361;ENST00000369137;ENST00000318991;ENST00000403289;ENST00000369134;ENST00000540076	.	.	.	5.74	5.74	0.90152	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9351	0.97137	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GRIK2	102240922	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.474000	0.97718	2.703000	0.92315	0.655000	0.94253	.	GRIK2	-	-	ENSG00000164418		0.378	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK2	HGNC	protein_coding	OTTHUMT00000043718.1	233	0.00	0	G		Intron	102134229	102134229	+1	no_errors	ENST00000421544	ensembl	human	known	69_37n	splice_site	15	46.43	13	SNP	1.000	A
GRIK4	2900	genome.wustl.edu	37	11	120686110	120686110	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr11:120686110G>T	ENST00000527524.2	+	5	558	c.271G>T	c.(271-273)Gtg>Ttg	p.V91L	GRIK4_ENST00000438375.2_Missense_Mutation_p.V91L	NM_001282470.1	NP_001269399.1	Q16099	GRIK4_HUMAN	glutamate receptor, ionotropic, kainate 4	91					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|response to corticosteroid (GO:0031960)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|nucleus (GO:0005634)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(20)|liver(1)|lung(29)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	69		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)		CCCCAAGGGGGTGGTCGCTGT	0.617																																						dbGAP											0													57.0	39.0	45.0					11																	120686110		2175	4237	6412	-	-	-	SO:0001583	missense	0			S67803	CCDS8433.1	11q23.3	2012-08-29			ENSG00000149403	ENSG00000149403		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4582	protein-coding gene	gene with protein product		600282		GRIK			Standard	NM_001282470		Approved	GluK4, KA1	uc009zax.1	Q16099	OTTHUMG00000048255	ENST00000527524.2:c.271G>T	11.37:g.120686110G>T	ENSP00000435648:p.Val91Leu		A8K9L1	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.V91L	ENST00000527524.2	37	c.271	CCDS8433.1	11	.	.	.	.	.	.	.	.	.	.	G	34	5.354094	0.95830	.	.	ENSG00000149403	ENST00000527524;ENST00000438375	D;D	0.89050	-2.46;-2.46	5.01	5.01	0.66863	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.91375	0.7279	M	0.76002	2.32	0.80722	D	1	D;D	0.59357	0.958;0.985	P;P	0.48815	0.451;0.591	D	0.92835	0.6283	10	0.87932	D	0	.	18.3385	0.90297	0.0:0.0:1.0:0.0	.	91;91	A6H8K8;Q16099	.;GRIK4_HUMAN	L	91	ENSP00000435648:V91L;ENSP00000404063:V91L	ENSP00000404063:V91L	V	+	1	0	GRIK4	120191320	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	9.421000	0.97455	2.313000	0.78055	0.467000	0.42956	GTG	GRIK4	-	pfam_ANF_lig-bd_rcpt	ENSG00000149403		0.617	GRIK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK4	HGNC	protein_coding	OTTHUMT00000109760.4	27	0.00	0	G	NM_014619		120686110	120686110	+1	no_errors	ENST00000527524	ensembl	human	known	69_37n	missense	43	30.65	19	SNP	1.000	T
GYS2	2998	genome.wustl.edu	37	12	21693414	21693414	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr12:21693414C>T	ENST00000261195.2	-	14	1993	c.1739G>A	c.(1738-1740)cGc>cAc	p.R580H		NM_021957.3	NP_068776.2	P54840	GYS2_HUMAN	glycogen synthase 2 (liver)	580					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|ectoplasm (GO:0043265)	glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein homodimerization activity (GO:0042803)	p.R580H(1)		NS(1)|breast(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(14)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						AATCCTTTGGCGGCGTGACTG	0.443																																					Colon(149;9 1820 3690 10544 50424)	dbGAP											1	Substitution - Missense(1)	endometrium(1)											154.0	158.0	157.0					12																	21693414		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8690.1	12p12.2-p11.2	2013-02-22			ENSG00000111713	ENSG00000111713	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4707	protein-coding gene	gene with protein product		138571					Standard	NM_021957		Approved		uc001rfb.3	P54840	OTTHUMG00000169135	ENST00000261195.2:c.1739G>A	12.37:g.21693414C>T	ENSP00000261195:p.Arg580His		A0AVD8	Missense_Mutation	SNP	pfam_Glycogen_synth,pfam_Glyco_trans_1	p.R580H	ENST00000261195.2	37	c.1739	CCDS8690.1	12	.	.	.	.	.	.	.	.	.	.	C	34	5.348564	0.95807	.	.	ENSG00000111713	ENST00000261195	T	0.73152	-0.72	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	D	0.87466	0.6184	M	0.90309	3.105	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89839	0.4001	10	0.87932	D	0	-16.9227	18.6922	0.91588	0.0:1.0:0.0:0.0	.	580	P54840	GYS2_HUMAN	H	580	ENSP00000261195:R580H	ENSP00000261195:R580H	R	-	2	0	GYS2	21584681	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.638000	0.83328	2.641000	0.89580	0.650000	0.86243	CGC	GYS2	-	pfam_Glycogen_synth,pfam_Glyco_trans_1	ENSG00000111713		0.443	GYS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GYS2	HGNC	protein_coding	OTTHUMT00000402396.1	543	0.00	0	C	NM_021957		21693414	21693414	-1	no_errors	ENST00000261195	ensembl	human	known	69_37n	missense	101	16.53	20	SNP	1.000	T
IER5L	389792	genome.wustl.edu	37	9	131940287	131940287	+	Silent	SNP	C	C	T	rs187062328	byFrequency	TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr9:131940287C>T	ENST00000372491.2	-	1	253	c.45G>A	c.(43-45)ctG>ctA	p.L15L	RP11-247A12.8_ENST00000599172.2_RNA|RP11-247A12.2_ENST00000372490.3_RNA	NM_203434.2	NP_982258.2	Q5T953	IER5L_HUMAN	immediate early response 5-like	15													Ovarian(14;0.0448)|Medulloblastoma(224;0.235)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)		GGATCTTGCGCAGGGAGATGC	0.667													c|||	2	0.000399361	0.0015	0.0	5008	,	,		11159	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													19.0	24.0	22.0					9																	131940287		2178	4287	6465	-	-	-	SO:0001819	synonymous_variant	0			BC013070	CCDS43888.1	9q34.11	2013-09-20			ENSG00000188483	ENSG00000188483			23679	protein-coding gene	gene with protein product							Standard	NM_203434		Approved	bA247A12.2	uc010myt.1	Q5T953	OTTHUMG00000020773	ENST00000372491.2:c.45G>A	9.37:g.131940287C>T			Q6P3E2	Silent	SNP	pfam_IER	p.L15	ENST00000372491.2	37	c.45	CCDS43888.1	9																																																																																			IER5L	-	pfam_IER	ENSG00000188483		0.667	IER5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IER5L	HGNC	protein_coding	OTTHUMT00000054556.2	22	0.00	0	C			131940287	131940287	-1	no_errors	ENST00000372491	ensembl	human	known	69_37n	silent	40	28.57	16	SNP	1.000	T
IGHD	3495	genome.wustl.edu	37	14	106307259	106307259	+	RNA	SNP	C	C	G			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr14:106307259C>G	ENST00000390556.2	-	0	778							P01880	IGHD_HUMAN	immunoglobulin heavy constant delta						immune response (GO:0006955)	blood microparticle (GO:0072562)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)										GCGCCATCAACCTCTGGGGTG	0.682																																						dbGAP											0													16.0	20.0	18.0					14																	106307259		2097	4189	6286	-	-	-			0			K02875		14q32.33	2012-03-09			ENSG00000211898	ENSG00000211898		"""Immunoglobulins / IGH locus"""	5480	other	immunoglobulin gene	"""immunoglobulin delta"", ""constant region of heavy chain of IgD"""	147170				3922054	Standard	NG_001019		Approved	FLJ00382, FLJ46727, MGC29633	uc001ysj.3	P01880	OTTHUMG00000152538		14.37:g.106307259C>G			Q6P4I8|Q8WU38	Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_Immunoglobulin,smart_Ig_C1-set,pfscan_Ig-like	p.G260A	ENST00000390556.2	37	c.779		14																																																																																			IGHD	-	pfscan_Ig-like	ENSG00000211898		0.682	IGHD-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	IG_C_gene	IGHD	HGNC	IG_C_gene	OTTHUMT00000326652.1	32	0.00	0	C	NG_001019		106307259	106307259	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000390556	ensembl	human	known	69_37n	missense	34	39.29	22	SNP	0.000	G
ITGA10	8515	genome.wustl.edu	37	1	145527615	145527615	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr1:145527615C>G	ENST00000369304.3	+	2	230	c.55C>G	c.(55-57)Ctc>Gtc	p.L19V	ITGA10_ENST00000539363.1_Intron|ITGA10_ENST00000538811.1_5'UTR	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	19					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CCCCACAGGTCTCTGCTCCCC	0.512																																						dbGAP											0													116.0	110.0	112.0					1																	145527615		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.55C>G	1.37:g.145527615C>G	ENSP00000358310:p.Leu19Val		B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.L19V	ENST00000369304.3	37	c.55	CCDS918.1	1	.	.	.	.	.	.	.	.	.	.	C	14.30	2.493174	0.44352	.	.	ENSG00000143127	ENST00000369304	T	0.58940	0.3	5.12	5.12	0.69794	.	0.087556	0.45606	D	0.000360	T	0.58850	0.2151	L	0.41356	1.27	0.80722	D	1	P;D	0.67145	0.647;0.996	B;D	0.80764	0.297;0.994	T	0.56141	-0.8028	10	0.36615	T	0.2	.	13.9281	0.63975	0.0:1.0:0.0:0.0	.	19;19	O75578;O75578-2	ITA10_HUMAN;.	V	19	ENSP00000358310:L19V	ENSP00000358310:L19V	L	+	1	0	ITGA10	144238972	0.998000	0.40836	1.000000	0.80357	0.983000	0.72400	1.020000	0.30027	2.659000	0.90383	0.655000	0.94253	CTC	ITGA10	-	NULL	ENSG00000143127		0.512	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA10	HGNC	protein_coding	OTTHUMT00000038537.2	365	0.27	1	C	NM_003637		145527615	145527615	+1	no_errors	ENST00000369304	ensembl	human	known	69_37n	missense	75	21.05	20	SNP	1.000	G
KANK2	25959	genome.wustl.edu	37	19	11303747	11303747	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr19:11303747G>C	ENST00000586659.1	-	4	1323	c.1009C>G	c.(1009-1011)Cgg>Ggg	p.R337G	KANK2_ENST00000355150.5_Missense_Mutation_p.R337G|KANK2_ENST00000589359.1_Missense_Mutation_p.R337G|KANK2_ENST00000589894.1_Missense_Mutation_p.R337G|KANK2_ENST00000432929.2_Missense_Mutation_p.R337G			Q63ZY3	KANK2_HUMAN	KN motif and ankyrin repeat domains 2	337					apoptotic process (GO:0006915)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of programmed cell death (GO:0043069)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)				endometrium(2)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						TCCACCTCCCGTGGCCCTTCT	0.741																																						dbGAP											0													11.0	13.0	13.0					19																	11303747		2191	4289	6480	-	-	-	SO:0001583	missense	0			AK000011	CCDS12255.1, CCDS54219.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000197256		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	29300	protein-coding gene	gene with protein product		614610	"""matrix-remodelling associated 3"", ""ankyrin repeat domain 25"""	MXRA3, ANKRD25		10819331, 17996375, 19554261	Standard	NM_015493		Approved	KIAA1518	uc002mqm.3	Q63ZY3		ENST00000586659.1:c.1009C>G	19.37:g.11303747G>C	ENSP00000465650:p.Arg337Gly		B0I1P4|Q3KQZ3|Q6GUF5|Q9H8S4|Q9NUP0|Q9P210	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_KN_motif,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.R337G	ENST00000586659.1	37	c.1009	CCDS12255.1	19	.	.	.	.	.	.	.	.	.	.	G	5.465	0.270841	0.10349	.	.	ENSG00000197256	ENST00000432929;ENST00000355150	T;T	0.29397	1.57;1.57	4.11	-0.0259	0.13933	.	0.178891	0.37809	N	0.001931	T	0.21468	0.0517	L	0.49350	1.555	0.22034	N	0.999409	B;B;B	0.28636	0.03;0.005;0.218	B;B;B	0.26864	0.03;0.003;0.074	T	0.15378	-1.0439	10	0.24483	T	0.36	-21.0918	7.0157	0.24887	0.0:0.2231:0.4033:0.3736	.	337;337;337	Q63ZY3-3;Q63ZY3;Q63ZY3-2	.;KANK2_HUMAN;.	G	337	ENSP00000395650:R337G;ENSP00000347276:R337G	ENSP00000347276:R337G	R	-	1	2	KANK2	11164747	0.000000	0.05858	0.237000	0.24090	0.076000	0.17211	-0.142000	0.10311	0.204000	0.20548	-0.372000	0.07161	CGG	KANK2	-	NULL	ENSG00000197256		0.741	KANK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KANK2	HGNC	protein_coding	OTTHUMT00000453066.2	10	0.00	0	G	NM_015493		11303747	11303747	-1	no_errors	ENST00000432929	ensembl	human	known	69_37n	missense	22	21.43	6	SNP	0.006	C
KCNE3	10008	genome.wustl.edu	37	11	74168592	74168592	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr11:74168592C>G	ENST00000310128.4	-	3	436	c.17G>C	c.(16-18)gGa>gCa	p.G6A	KCNE3_ENST00000525550.1_Missense_Mutation_p.G6A|RP11-702H23.4_ENST00000533008.1_RNA|RP11-702H23.6_ENST00000530510.1_RNA	NM_005472.4	NP_005463.1	Q9Y6H6	KCNE3_HUMAN	potassium voltage-gated channel, Isk-related family, member 3	6					regulation of potassium ion transport (GO:0043266)	integral component of membrane (GO:0016021)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			cervix(1)|large_intestine(1)|lung(1)|ovary(1)	4	Breast(11;2.86e-06)					GGTCTCCGTTCCATTGGTAGT	0.567																																						dbGAP											0													70.0	67.0	68.0					11																	74168592		2200	4293	6493	-	-	-	SO:0001583	missense	0			AF076531	CCDS8232.1	11q13.4	2014-09-17				ENSG00000175538		"""Potassium channels"""	6243	protein-coding gene	gene with protein product		604433				10219239	Standard	NM_005472		Approved	MiRP2, HOKPP	uc001ovc.3	Q9Y6H6		ENST00000310128.4:c.17G>C	11.37:g.74168592C>G	ENSP00000310557:p.Gly6Ala			Missense_Mutation	SNP	pfam_K_chnl_volt-dep_bsu_KCNE,prints_K_chnl_volt-dep_bsu_KCNE3,prints_K_chnl_volt-dep_bsu_KCNE	p.G6A	ENST00000310128.4	37	c.17	CCDS8232.1	11	.	.	.	.	.	.	.	.	.	.	C	11.09	1.535814	0.27475	.	.	ENSG00000175538	ENST00000310128;ENST00000525550;ENST00000532569;ENST00000531854;ENST00000529425;ENST00000526855	D;D;D;D;T	0.86030	-2.06;-2.06;-2.06;-1.65;-1.28	4.94	4.94	0.65067	.	0.318129	0.28042	N	0.016826	T	0.68007	0.2954	N	0.14661	0.345	0.29075	N	0.883034	P	0.34522	0.455	B	0.32211	0.142	T	0.61168	-0.7117	10	0.02654	T	1	-0.0324	11.6819	0.51463	0.0:0.8214:0.1786:0.0	.	6	Q9Y6H6	KCNE3_HUMAN	A	6	ENSP00000310557:G6A;ENSP00000433633:G6A;ENSP00000431739:G6A;ENSP00000433697:G6A;ENSP00000434890:G6A	ENSP00000310557:G6A	G	-	2	0	KCNE3	73846240	0.796000	0.28864	0.989000	0.46669	0.318000	0.28184	2.887000	0.48586	2.717000	0.92951	0.462000	0.41574	GGA	KCNE3	-	prints_K_chnl_volt-dep_bsu_KCNE3	ENSG00000175538		0.567	KCNE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNE3	HGNC	protein_coding	OTTHUMT00000385531.1	64	0.00	0	C	NM_005472		74168592	74168592	-1	no_errors	ENST00000310128	ensembl	human	known	69_37n	missense	31	34.04	16	SNP	0.964	G
KCNH4	23415	genome.wustl.edu	37	17	40315285	40315285	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr17:40315285G>T	ENST00000264661.3	-	14	2877	c.2545C>A	c.(2545-2547)Cct>Act	p.P849T	KCNH4_ENST00000607371.1_Missense_Mutation_p.P849T	NM_012285.2	NP_036417.1	Q9UQ05	KCNH4_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 4	849					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(15)|skin(2)|urinary_tract(1)	32		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		GGCAGTTCAGGCCTCCTGCTG	0.602																																					NSCLC(117;707 1703 2300 21308 31858)	dbGAP											0													58.0	55.0	56.0					17																	40315285		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB022698	CCDS11420.1	17q21	2012-07-05				ENSG00000089558		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6253	protein-coding gene	gene with protein product		604528				10455180, 16382104	Standard	NM_012285		Approved	Kv12.3, elk1	uc002hzb.2	Q9UQ05		ENST00000264661.3:c.2545C>A	17.37:g.40315285G>T	ENSP00000264661:p.Pro849Thr			Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Ion_trans_2,pfam_PAS_fold_3,pfam_PAS_fold,pfam_PAS_4,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_PAC,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,pfscan_PAS,pfscan_PAS-assoc_C,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ELK,prints_K_chnl_volt-dep_ERG,tigrfam_PAS	p.P849T	ENST00000264661.3	37	c.2545	CCDS11420.1	17	.	.	.	.	.	.	.	.	.	.	G	6.480	0.456737	0.12283	.	.	ENSG00000089558	ENST00000264661	D	0.98701	-5.08	4.15	2.09	0.27110	.	0.208512	0.24078	N	0.041759	D	0.94591	0.8257	L	0.43152	1.355	0.26053	N	0.981457	P	0.40144	0.704	B	0.30716	0.119	D	0.89051	0.3455	10	0.14252	T	0.57	.	6.7986	0.23738	0.0:0.1968:0.5994:0.2038	.	849	Q9UQ05	KCNH4_HUMAN	T	849	ENSP00000264661:P849T	ENSP00000264661:P849T	P	-	1	0	KCNH4	37568811	0.255000	0.24002	0.834000	0.33040	0.110000	0.19582	0.196000	0.17176	0.389000	0.25086	-0.311000	0.09066	CCT	KCNH4	-	NULL	ENSG00000089558		0.602	KCNH4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	KCNH4	HGNC	protein_coding	OTTHUMT00000449791.2	75	0.00	0	G	NM_012285		40315285	40315285	-1	no_errors	ENST00000264661	ensembl	human	known	69_37n	missense	54	21.74	15	SNP	0.800	T
KCNN3	3782	genome.wustl.edu	37	1	154842243	154842244	+	Missense_Mutation	DNP	AA	AA	CT			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr1:154842243_154842244AA>CT	ENST00000271915.4	-	1	512_513	c.197_198TT>AG	c.(196-198)cTT>cAG	p.L66Q	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	66	Gln-rich.				potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	gctgctgctgaagctgcggagg	0.703																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.197_198delinsCT	1.37:g.154842243_154842244delinsCT	ENSP00000271915:p.Leu66Gln		B1ANX0|O43517|Q86VF9|Q8WXG7	Silent|Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_SK,pfam_CaM-bd_dom,pfam_Ion_trans_2,superfamily_CaM-bd_dom,prints_K_chnl_Ca-activ_SK	p.L66|p.L66H	ENST00000271915.4	37	c.198|c.197	CCDS30880.1	1																																																																																			KCNN3	-	NULL	ENSG00000143603		0.703	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	KCNN3	HGNC	protein_coding	OTTHUMT00000090688.3	21	0.00	0	A	NM_002249		154842243|154842244	154842243|154842244	-1	no_errors	ENST00000271915	ensembl	human	known	69_37n	silent|missense	123|124	25.00|23.17	41|38	SNP	0.000|0.166	C|T
KIF24	347240	genome.wustl.edu	37	9	34311171	34311171	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr9:34311171G>C	ENST00000402558.2	-	1	198	c.174C>G	c.(172-174)atC>atG	p.I58M	KIF24_ENST00000345050.2_Missense_Mutation_p.I58M|KIF24_ENST00000379166.2_Missense_Mutation_p.I58M|KIF24_ENST00000379174.3_Missense_Mutation_p.I58M			Q5T7B8	KIF24_HUMAN	kinesin family member 24	58	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)	centriole (GO:0005814)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(13)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	32			LUSC - Lung squamous cell carcinoma(29;0.0107)			TAATAATTTTGATAAGTTGGA	0.393																																						dbGAP											0													105.0	94.0	97.0					9																	34311171		1875	4111	5986	-	-	-	SO:0001583	missense	0			AK001795	CCDS6551.2	9p13.3	2013-01-10			ENSG00000186638	ENSG00000186638		"""Kinesins"", ""Sterile alpha motif (SAM) domain containing"""	19916	protein-coding gene	gene with protein product		613747	"""chromosome 9 open reading frame 48"""	C9orf48		12477932	Standard	NM_194313		Approved	bA571F15.4, FLJ10933, FLJ43884	uc003zua.4	Q5T7B8	OTTHUMG00000019810	ENST00000402558.2:c.174C>G	9.37:g.34311171G>C	ENSP00000384433:p.Ile58Met		Q2TB93|Q5T7B5|Q5T7B7|Q6ZU97|Q6ZUZ2|Q86XZ0|Q9NV43	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_SAM_type1,superfamily_SAM/pointed,smart_Kinesin_motor_dom,pfscan_SAM,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.I58M	ENST00000402558.2	37	c.174	CCDS6551.2	9	.	.	.	.	.	.	.	.	.	.	G	15.99	2.996031	0.54147	.	.	ENSG00000186638	ENST00000402558;ENST00000379174;ENST00000379166;ENST00000345050;ENST00000420188	T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21	5.48	2.26	0.28386	Sterile alpha motif domain (1);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.000000	0.40908	D	0.000981	T	0.67420	0.2891	L	0.29908	0.895	0.30176	N	0.800873	D;D	0.89917	1.0;1.0	D;D	0.81914	0.992;0.995	T	0.63730	-0.6571	10	0.87932	D	0	.	6.6418	0.22913	0.4377:0.0:0.5623:0.0	.	58;58	Q5T7B8-4;Q5T7B8	.;KIF24_HUMAN	M	58	ENSP00000384433:I58M;ENSP00000368472:I58M;ENSP00000368464:I58M;ENSP00000340179:I58M	ENSP00000340179:I58M	I	-	3	3	KIF24	34301171	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	0.704000	0.25661	0.702000	0.31825	-0.145000	0.13849	ATC	KIF24	-	pfam_SAM_type1,superfamily_SAM/pointed,pfscan_SAM	ENSG00000186638		0.393	KIF24-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF24	HGNC	protein_coding	OTTHUMT00000052150.5	658	0.00	0	G			34311171	34311171	-1	no_errors	ENST00000379166	ensembl	human	known	69_37n	missense	92	28.12	36	SNP	1.000	C
KIF7	374654	genome.wustl.edu	37	15	90196008	90196008	+	Missense_Mutation	SNP	C	C	T	rs8179065	byFrequency	TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr15:90196008C>T	ENST00000394412.3	-	2	230	c.154G>A	c.(154-156)Gac>Aac	p.D52N		NM_198525.2	NP_940927.2	Q2M1P5	KIF7_HUMAN	kinesin family member 7	52	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.		D -> N (in dbSNP:rs8179065).		ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|kinesin complex (GO:0005871)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	25	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			AAGTGTCGGTCACGGCCCAGA	0.672													C|||	1214	0.242412	0.0507	0.2651	5008	,	,		17437	0.4117		0.2614	False		,,,				2504	0.2914					dbGAP											0													46.0	53.0	51.0					15																	90196008		689	1590	2279	-	-	-	SO:0001583	missense	0			AY358384	CCDS32325.2	15q26.1	2011-06-02			ENSG00000166813	ENSG00000166813		"""Kinesins"""	30497	protein-coding gene	gene with protein product		611254				11416179, 15547730	Standard	NM_198525		Approved	JBTS12	uc002bof.2	Q2M1P5	OTTHUMG00000157177	ENST00000394412.3:c.154G>A	15.37:g.90196008C>T	ENSP00000377934:p.Asp52Asn		Q3SXY0|Q6UXE9|Q8IW72	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.D52N	ENST00000394412.3	37	c.154	CCDS32325.2	15	516	0.23626373626373626	30	0.06097560975609756	85	0.23480662983425415	205	0.3583916083916084	196	0.25857519788918204	C	13.49	2.253446	0.39797	.	.	ENSG00000166813	ENST00000394412	T	0.74947	-0.89	4.66	2.35	0.29111	Kinesin, motor domain (4);	.	.	.	.	T	0.00012	0.0000	L	0.28344	0.845	0.29058	P	0.884112	B	0.15719	0.014	B	0.16289	0.015	T	0.14643	-1.0465	8	0.62326	D	0.03	.	4.3016	0.10927	0.0:0.4722:0.1771:0.3507	rs8179065	52	Q2M1P5	KIF7_HUMAN	N	52	ENSP00000377934:D52N	ENSP00000377934:D52N	D	-	1	0	KIF7	87997012	0.117000	0.22190	0.763000	0.31416	0.798000	0.45092	0.710000	0.25748	0.942000	0.37525	0.655000	0.94253	GAC	KIF7	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000166813		0.672	KIF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF7	HGNC	protein_coding	OTTHUMT00000347782.1	34	0.00	0	C	NM_198525		90196008	90196008	-1	no_errors	ENST00000394412	ensembl	human	known	69_37n	missense	33	29.79	14	SNP	0.559	T
LRIG2	9860	genome.wustl.edu	37	1	113650273	113650273	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr1:113650273G>A	ENST00000361127.5	+	12	1569	c.1371G>A	c.(1369-1371)tgG>tgA	p.W457*	LRIG2_ENST00000492207.1_3'UTR	NM_014813.1	NP_055628.1	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like domains 2	457	LRRCT.				innervation (GO:0060384)|regulation of platelet-derived growth factor receptor signaling pathway (GO:0010640)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(10)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	31	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		TACTTCAATGGTTGGTTGATA	0.408																																						dbGAP											0													124.0	114.0	117.0					1																	113650273		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB018349	CCDS30808.1	1p13.1	2013-01-11			ENSG00000198799	ENSG00000198799		"""Immunoglobulin superfamily / I-set domain containing"""	20889	protein-coding gene	gene with protein product		608869					Standard	XM_005271369		Approved	KIAA0806	uc001edf.1	O94898	OTTHUMG00000012133	ENST00000361127.5:c.1371G>A	1.37:g.113650273G>A	ENSP00000355396:p.Trp457*		Q9NSN2	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Immunoglobulin,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.W457*	ENST00000361127.5	37	c.1371	CCDS30808.1	1	.	.	.	.	.	.	.	.	.	.	g	38	7.056703	0.98032	.	.	ENSG00000198799	ENST00000361127	.	.	.	5.27	5.27	0.74061	.	0.118170	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.3021	0.94148	0.0:0.0:1.0:0.0	.	.	.	.	X	457	.	ENSP00000355396:W457X	W	+	3	0	LRIG2	113451796	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	9.686000	0.98664	2.640000	0.89533	0.650000	0.86243	TGG	LRIG2	-	smart_Cys-rich_flank_reg_C	ENSG00000198799		0.408	LRIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIG2	HGNC	protein_coding	OTTHUMT00000033549.2	141	0.00	0	G	NM_014813		113650273	113650273	+1	no_errors	ENST00000361127	ensembl	human	known	69_37n	nonsense	36	23.40	11	SNP	1.000	A
LRRTM3	347731	genome.wustl.edu	37	10	68687935	68687935	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr10:68687935A>G	ENST00000361320.4	+	2	1839	c.1261A>G	c.(1261-1263)Atc>Gtc	p.I421V	CTNNA3_ENST00000433211.2_Intron|CTNNA3_ENST00000373744.4_Intron	NM_178011.3	NP_821079.3	Q86VH5	LRRT3_HUMAN	leucine rich repeat transmembrane neuronal 3	421					positive regulation of beta-amyloid formation (GO:1902004)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	41						CCATAAAATCATCGCGGGCAG	0.597																																						dbGAP											0													67.0	66.0	66.0					10																	68687935		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX640611	CCDS7270.1	10q22.1	2007-01-22				ENSG00000198739			19410	protein-coding gene	gene with protein product		610869				12676565	Standard	XR_247527		Approved		uc001jmz.1	Q86VH5		ENST00000361320.4:c.1261A>G	10.37:g.68687935A>G	ENSP00000355187:p.Ile421Val		A8K2A3|Q2NKX7|Q6N0A3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	p.I421V	ENST00000361320.4	37	c.1261	CCDS7270.1	10	.	.	.	.	.	.	.	.	.	.	A	4.154	0.026982	0.08054	.	.	ENSG00000198739	ENST00000361320;ENST00000373722	T	0.73258	-0.73	5.94	5.94	0.96194	.	0.000000	0.64402	D	0.000001	T	0.52191	0.1719	N	0.11651	0.15	0.46774	D	0.999197	B;B	0.18610	0.017;0.029	B;B	0.25759	0.052;0.063	T	0.50866	-0.8777	10	0.10377	T	0.69	.	15.3823	0.74669	1.0:0.0:0.0:0.0	.	421;421	Q86VH5;Q86VH5-2	LRRT3_HUMAN;.	V	421	ENSP00000355187:I421V	ENSP00000355187:I421V	I	+	1	0	LRRTM3	68357941	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.268000	0.65536	2.275000	0.75901	0.528000	0.53228	ATC	LRRTM3	-	NULL	ENSG00000198739		0.597	LRRTM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRTM3	HGNC	protein_coding	OTTHUMT00000048277.2	38	0.00	0	A	NM_178011		68687935	68687935	+1	no_errors	ENST00000361320	ensembl	human	known	69_37n	missense	25	39.02	16	SNP	1.000	G
MAGED1	9500	genome.wustl.edu	37	X	51641714	51641714	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chrX:51641714C>G	ENST00000375722.1	+	10	2071	c.1819C>G	c.(1819-1821)Ctc>Gtc	p.L607V	MAGED1_ENST00000375772.3_Missense_Mutation_p.L607V|MAGED1_ENST00000494718.1_3'UTR|MAGED1_ENST00000375695.2_Missense_Mutation_p.L663V|MAGED1_ENST00000326587.7_Missense_Mutation_p.L607V			Q9Y5V3	MAGD1_HUMAN	melanoma antigen family D, 1	607	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|circadian regulation of gene expression (GO:0032922)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of circadian rhythm (GO:0042752)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(4)|large_intestine(10)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	32	Ovarian(276;0.236)					AAGGAAACTTCTCACCTATGA	0.453										Multiple Myeloma(10;0.10)																												dbGAP											0													154.0	141.0	145.0					X																	51641714		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF124440	CCDS14337.1, CCDS35279.1	Xp11.23	2008-08-01			ENSG00000179222	ENSG00000179222			6813	protein-coding gene	gene with protein product		300224				10409427	Standard	NM_006986		Approved	NRAGE, DLXIN-1	uc004dpn.3	Q9Y5V3	OTTHUMG00000021540	ENST00000375722.1:c.1819C>G	X.37:g.51641714C>G	ENSP00000364874:p.Leu607Val		Q5VSH6|Q8IZ84|Q8WY92|Q9H352|Q9HBT4|Q9UF36	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.L663V	ENST00000375722.1	37	c.1987	CCDS14337.1	X	.	.	.	.	.	.	.	.	.	.	C	11.39	1.625102	0.28889	.	.	ENSG00000179222	ENST00000375772;ENST00000375722;ENST00000326587;ENST00000375695	T;T;T;T	0.06294	3.32;3.32;3.32;3.32	4.26	4.26	0.50523	.	0.000000	0.35585	N	0.003112	T	0.09598	0.0236	N	0.20530	0.585	0.33428	D	0.580708	D;D	0.56287	0.969;0.975	P;P	0.59889	0.787;0.865	T	0.05649	-1.0872	10	0.87932	D	0	.	8.6343	0.33939	0.2273:0.7727:0.0:0.0	.	663;607	Q9Y5V3-2;Q9Y5V3	.;MAGD1_HUMAN	V	607;607;607;663	ENSP00000364927:L607V;ENSP00000364874:L607V;ENSP00000325333:L607V;ENSP00000364847:L663V	ENSP00000325333:L607V	L	+	1	0	MAGED1	51658454	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	2.687000	0.46976	2.384000	0.81235	0.429000	0.28392	CTC	MAGED1	-	pfam_MAGE,pfscan_MAGE	ENSG00000179222		0.453	MAGED1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MAGED1	HGNC	protein_coding	OTTHUMT00000056593.1	589	0.00	0	C	NM_001005332		51641714	51641714	+1	no_errors	ENST00000375695	ensembl	human	known	69_37n	missense	113	28.93	46	SNP	1.000	G
MAP1A	4130	genome.wustl.edu	37	15	43814593	43814593	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr15:43814593C>T	ENST00000300231.5	+	4	1372	c.922C>T	c.(922-924)Ctc>Ttc	p.L308F	MAP1A_ENST00000399453.1_Missense_Mutation_p.L308F|MAP1A_ENST00000382031.1_Missense_Mutation_p.L546F			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	308					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	GCCTACCAACCTCAAGCCCAG	0.572																																						dbGAP											0													41.0	44.0	43.0					15																	43814593		1979	4167	6146	-	-	-	SO:0001583	missense	0			U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.922C>T	15.37:g.43814593C>T	ENSP00000300231:p.Leu308Phe		O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	NULL	p.L308F	ENST00000300231.5	37	c.922	CCDS42031.1	15	.	.	.	.	.	.	.	.	.	.	C	11.23	1.576546	0.28092	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231;ENST00000442025	T;T;T	0.03441	3.93;3.93;3.93	5.07	3.18	0.36537	.	0.000000	0.29280	N	0.012603	T	0.13157	0.0319	M	0.76574	2.34	0.41927	D	0.990548	D	0.76494	0.999	D	0.71656	0.974	T	0.00575	-1.1663	10	0.72032	D	0.01	-10.1051	6.0251	0.19650	0.1532:0.6986:0.0:0.1482	.	308	P78559	MAP1A_HUMAN	F	546;308;308;308	ENSP00000371462:L546F;ENSP00000382380:L308F;ENSP00000300231:L308F	ENSP00000300231:L308F	L	+	1	0	MAP1A	41601885	0.999000	0.42202	1.000000	0.80357	0.990000	0.78478	1.674000	0.37544	0.719000	0.32188	0.561000	0.74099	CTC	MAP1A	-	NULL	ENSG00000166963		0.572	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP1A	HGNC	protein_coding	OTTHUMT00000132894.5	98	0.00	0	C	NM_002373		43814593	43814593	+1	no_errors	ENST00000399453	ensembl	human	known	69_37n	missense	71	21.98	20	SNP	0.998	T
MCOLN2	255231	genome.wustl.edu	37	1	85412716	85412716	+	Splice_Site	SNP	T	T	C	rs147803870	byFrequency	TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr1:85412716T>C	ENST00000370608.3	-	7	914	c.847A>G	c.(847-849)Act>Gct	p.T283A	MCOLN2_ENST00000531325.1_5'UTR|MCOLN2_ENST00000284027.5_Splice_Site_p.T255A	NM_153259.2	NP_694991.2	Q8IZK6	MCLN2_HUMAN	mucolipin 2	283					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	18				all cancers(265;0.0111)|Epithelial(280;0.0263)|OV - Ovarian serous cystadenocarcinoma(397;0.217)		GCATACTTACTAGATCCAAAT	0.313																																						dbGAP											0													141.0	146.0	144.0					1																	85412716		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0			AK094010	CCDS30762.1	1p22	2011-12-16			ENSG00000153898	ENSG00000153898		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13357	protein-coding gene	gene with protein product		607399				16382100	Standard	XM_005270719		Approved	TRPML2, FLJ36691, TRP-ML2	uc001dkm.3	Q8IZK6	OTTHUMG00000009954	ENST00000370608.3:c.847+1A>G	1.37:g.85412716T>C			A6NI99|Q2M3I6|Q5TAG5|Q8N9R3	Missense_Mutation	SNP	pfam_PKD1_2_channel	p.T283A	ENST00000370608.3	37	c.847	CCDS30762.1	1	.	.	.	.	.	.	.	.	.	.	T	5.359	0.251535	0.10130	.	.	ENSG00000153898	ENST00000370608;ENST00000284027	T;T	0.76060	-0.99;-0.99	5.85	3.4	0.38934	.	0.827348	0.11072	N	0.602846	T	0.19886	0.0478	N	0.01048	-1.04	0.34804	D	0.737034	B	0.02656	0.0	B	0.01281	0.0	T	0.05370	-1.0889	9	.	.	.	-37.95	6.8809	0.24173	0.0:0.1461:0.1246:0.7293	.	283	Q8IZK6	MCLN2_HUMAN	A	283;255	ENSP00000359640:T283A;ENSP00000284027:T255A	.	T	-	1	0	MCOLN2	85185304	0.724000	0.28038	0.998000	0.56505	0.917000	0.54804	1.122000	0.31295	0.405000	0.25532	0.472000	0.43445	ACT	MCOLN2	-	NULL	ENSG00000153898		0.313	MCOLN2-001	KNOWN	basic|CCDS	protein_coding	MCOLN2	HGNC	protein_coding	OTTHUMT00000027567.2	492	0.00	0	T	NM_153259	Missense_Mutation	85412716	85412716	-1	no_errors	ENST00000370608	ensembl	human	known	69_37n	missense	67	27.17	25	SNP	0.962	C
MFSD1	64747	genome.wustl.edu	37	3	158531782	158531782	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr3:158531782G>A	ENST00000264266.8	+	7	640	c.578G>A	c.(577-579)gGa>gAa	p.G193E	MFSD1_ENST00000392813.4_Missense_Mutation_p.G203E|MFSD1_ENST00000415822.2_Missense_Mutation_p.G242E			Q9H3U5	MFSD1_HUMAN	major facilitator superfamily domain containing 1	193					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(15)|skin(1)	26			Lung(72;0.00372)|LUSC - Lung squamous cell carcinoma(72;0.00523)			AACCTCATGGGATGGCTGTAT	0.388																																					Pancreas(62;1186 1654 36636 37908)	dbGAP											0													171.0	143.0	153.0					3																	158531782		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC017661	CCDS3185.1, CCDS3185.2, CCDS54666.1	3q25.32	2005-11-17			ENSG00000118855	ENSG00000118855			25874	protein-coding gene	gene with protein product							Standard	NM_022736		Approved	FLJ14153, UG0581B09	uc003fcl.2	Q9H3U5	OTTHUMG00000158835	ENST00000264266.8:c.578G>A	3.37:g.158531782G>A	ENSP00000264266:p.Gly193Glu		B4DGJ8|B4DMR8|B4DU49|B4DWU1|C9JS94|J3KQL7|Q05C07|Q5XKJ1|Q8IVS1|Q8IXG4|Q9H7X1	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.G242E	ENST00000264266.8	37	c.725		3	.	.	.	.	.	.	.	.	.	.	g	12.87	2.068686	0.36470	.	.	ENSG00000118855	ENST00000415822;ENST00000392813;ENST00000264266;ENST00000361159;ENST00000477743	T;T;T;D	0.84370	-0.24;-0.24;-0.24;-1.84	4.9	4.9	0.64082	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.80454	0.4626	L	0.48362	1.52	0.80722	D	1	B;B	0.24258	0.1;0.011	B;B	0.25405	0.06;0.014	T	0.75510	-0.3292	10	0.07325	T	0.83	.	18.4761	0.90793	0.0:0.0:1.0:0.0	.	203;193	C9JS94;Q9H3U5	.;MFSD1_HUMAN	E	242;203;193;117;27	ENSP00000403117:G242E;ENSP00000376560:G203E;ENSP00000264266:G193E;ENSP00000417163:G27E	ENSP00000264266:G193E	G	+	2	0	MFSD1	160014476	1.000000	0.71417	0.998000	0.56505	0.833000	0.47200	9.597000	0.98273	2.424000	0.82194	0.650000	0.86243	GGA	MFSD1	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000118855		0.388	MFSD1-018	KNOWN	basic|appris_principal	protein_coding	MFSD1	HGNC	protein_coding	OTTHUMT00000470730.1	946	0.00	0	G	NM_022736		158531782	158531782	+1	no_errors	ENST00000415822	ensembl	human	known	69_37n	missense	139	15.24	25	SNP	1.000	A
MMP12	4321	genome.wustl.edu	37	11	102737137	102737137	+	RNA	SNP	A	A	C			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr11:102737137A>C	ENST00000532855.1	-	0	1049							P39900	MMP12_HUMAN	matrix metallopeptidase 12 (macrophage elastase)						collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|proteolysis (GO:0006508)|wound healing, spreading of epidermal cells (GO:0035313)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	26		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.014)	Acetohydroxamic Acid(DB00551)|Marimastat(DB00786)	AAATTAAATTAACACTGGTCT	0.373																																						dbGAP											0													69.0	72.0	71.0					11																	102737137		1831	4086	5917	-	-	-			0			L23808	CCDS73375.1	11q22.3	2009-02-26	2005-08-08			ENSG00000262406			7158	protein-coding gene	gene with protein product		601046	"""matrix metalloproteinase 12 (macrophage elastase)"""				Standard	NM_002426		Approved	HME	uc001phk.3	P39900			11.37:g.102737137A>C			B2R9X8|B7ZLF6|Q2M1L9	RNA	SNP	-	NULL	ENST00000532855.1	37	NULL		11																																																																																			MMP12	-	-	ENSG00000110347		0.373	MMP12-001	KNOWN	basic	processed_transcript	MMP12	HGNC	processed_transcript	OTTHUMT00000386646.1	449	0.00	0	A	NM_002426		102737137	102737137	-1	no_errors	ENST00000326227	ensembl	human	known	69_37n	rna	60	25.93	21	SNP	0.000	C
MYO1E	4643	genome.wustl.edu	37	15	59516993	59516993	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr15:59516993T>G	ENST00000288235.4	-	8	1071	c.672A>C	c.(670-672)aaA>aaC	p.K224N	MYO1E_ENST00000558814.1_5'UTR	NM_004998.3	NP_004989.2	Q12965	MYO1E_HUMAN	myosin IE	224	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(6)|lung(10)|pancreas(2)|prostate(1)|urinary_tract(1)	33				all cancers(107;0.207)		CAAGGCTGTGTTTCTGCTCTG	0.537																																						dbGAP											0													105.0	81.0	90.0					15																	59516993		2190	4290	6480	-	-	-	SO:0001583	missense	0			U14391	CCDS32254.1	15q21-q22	2011-09-27				ENSG00000157483		"""Myosins / Myosin superfamily : Class I"""	7599	protein-coding gene	gene with protein product	"""myosin-IC"""	601479				8884266	Standard	NM_004998		Approved	MYO1C, HuncM-IC, MGC104638	uc002aga.4	Q12965		ENST00000288235.4:c.672A>C	15.37:g.59516993T>G	ENSP00000288235:p.Lys224Asn		Q14778	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_SH3_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_SH3_domain,prints_Myosin_head_motor_dom,prints_SH3_domain	p.K224N	ENST00000288235.4	37	c.672	CCDS32254.1	15	.	.	.	.	.	.	.	.	.	.	T	18.49	3.635255	0.67130	.	.	ENSG00000157483	ENST00000288235	D	0.88741	-2.42	5.22	0.567	0.17325	Myosin head, motor domain (2);	0.044144	0.85682	D	0.000000	D	0.91068	0.7189	M	0.80422	2.495	0.48511	D	0.999663	P	0.45126	0.851	P	0.54174	0.744	D	0.89155	0.3526	10	0.72032	D	0.01	.	8.0693	0.30680	0.0:0.5183:0.0:0.4817	.	224	Q12965	MYO1E_HUMAN	N	224	ENSP00000288235:K224N	ENSP00000288235:K224N	K	-	3	2	MYO1E	57304285	1.000000	0.71417	0.986000	0.45419	0.935000	0.57460	0.988000	0.29616	0.295000	0.22570	-0.146000	0.13790	AAA	MYO1E	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000157483		0.537	MYO1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO1E	HGNC	protein_coding	OTTHUMT00000416024.1	125	0.00	0	T	NM_004998		59516993	59516993	-1	no_errors	ENST00000288235	ensembl	human	known	69_37n	missense	36	24.49	12	SNP	0.928	G
MZF1	7593	genome.wustl.edu	37	19	59073966	59073966	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr19:59073966G>A	ENST00000215057.2	-	6	2238	c.1678C>T	c.(1678-1680)Cgg>Tgg	p.R560W	AC016629.8_ENST00000593642.1_RNA|AC016629.8_ENST00000600726.1_RNA|MZF1_ENST00000599369.1_Missense_Mutation_p.R560W|AC016629.8_ENST00000600534.1_RNA|MZF1_ENST00000594234.1_3'UTR	NM_001267033.1|NM_198055.1	NP_001253962.1|NP_932172.1	P28698	MZF1_HUMAN	myeloid zinc finger 1	560					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0443)|all cancers(4;7.92e-14)|Epithelial(4;5.57e-11)|OV - Ovarian serous cystadenocarcinoma(4;1.13e-09)|GBM - Glioblastoma multiforme(193;0.0108)|Lung(386;0.182)		TGGATGCGCCGGTGCTGCGTC	0.716																																						dbGAP											0													10.0	10.0	10.0					19																	59073966		2191	4275	6466	-	-	-	SO:0001583	missense	0			M58297	CCDS12988.1, CCDS59427.1	19q13.43	2014-08-22	2006-06-15	2006-06-15	ENSG00000099326	ENSG00000099326		"""-"", ""Zinc fingers, C2H2-type"""	13108	protein-coding gene	gene with protein product		194550	"""zinc finger protein 42 (myeloid-specific retinoic acid-responsive)"""	ZNF42		1860835	Standard	NM_198055		Approved	ZSCAN6, MZF1B, MZF-1, Zfp98	uc002qtn.3	P28698	OTTHUMG00000183550	ENST00000215057.2:c.1678C>T	19.37:g.59073966G>A	ENSP00000215057:p.Arg560Trp		M0QXU0|Q7Z729|Q96I71|Q9NRY0|Q9UBW2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.R560W	ENST00000215057.2	37	c.1678	CCDS12988.1	19	.	.	.	.	.	.	.	.	.	.	G	14.65	2.598724	0.46318	.	.	ENSG00000099326	ENST00000215057	T	0.07688	3.17	3.45	0.0615	0.14341	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.494425	0.15217	N	0.274144	T	0.09992	0.0245	M	0.69248	2.105	0.20074	N	0.999931	B	0.14012	0.009	B	0.13407	0.009	T	0.21655	-1.0239	10	0.87932	D	0	-17.8185	7.6519	0.28352	0.0914:0.0:0.6222:0.2865	.	560	P28698	MZF1_HUMAN	W	560	ENSP00000215057:R560W	ENSP00000215057:R560W	R	-	1	2	MZF1	63765778	0.840000	0.29493	0.984000	0.44739	0.911000	0.54048	1.116000	0.31221	-0.120000	0.11809	-2.048000	0.00412	CGG	MZF1	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000099326		0.716	MZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MZF1	HGNC	protein_coding	OTTHUMT00000467112.1	8	0.00	0	G	NM_198055		59073966	59073966	-1	no_errors	ENST00000215057	ensembl	human	known	69_37n	missense	11	45.00	9	SNP	0.012	A
NLRP10	338322	genome.wustl.edu	37	11	7981802	7981802	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr11:7981802G>C	ENST00000328600.2	-	2	1518	c.1357C>G	c.(1357-1359)Caa>Gaa	p.Q453E		NM_176821.3	NP_789791.1	Q86W26	NAL10_HUMAN	NLR family, pyrin domain containing 10	453	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				defense response to fungus (GO:0050832)|defense response to Gram-negative bacterium (GO:0050829)|dendritic cell migration (GO:0036336)|helper T cell enhancement of adaptive immune response (GO:0035397)|innate immune response (GO:0045087)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 type immune response (GO:2000318)	cytoplasm (GO:0005737)|extrinsic component of plasma membrane (GO:0019897)	ATP binding (GO:0005524)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		AGTCCCAATTGGTAGTCGTTA	0.483																																						dbGAP											0													105.0	116.0	112.0					11																	7981802		2201	4296	6497	-	-	-	SO:0001583	missense	0			AY154465	CCDS7784.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000182261		"""Nucleotide-binding domain and leucine rich repeat containing"""	21464	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 10"""	609662	"""NACHT, leucine rich repeat and PYD containing 10"""	NALP10		12563287	Standard	NM_176821		Approved	NOD8, PAN5, Pynod, CLR11.1	uc001mfv.1	Q86W26		ENST00000328600.2:c.1357C>G	11.37:g.7981802G>C	ENSP00000327763:p.Gln453Glu		Q2M3C4|Q6JGT0	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,pfscan_NACHT_NTPase,pfscan_DAPIN	p.Q453E	ENST00000328600.2	37	c.1357	CCDS7784.1	11	.	.	.	.	.	.	.	.	.	.	G	8.597	0.886035	0.17540	.	.	ENSG00000182261	ENST00000328600	D	0.87334	-2.24	4.86	2.94	0.34122	.	1.102330	0.07078	N	0.836489	D	0.82976	0.5154	L	0.46885	1.475	0.09310	N	1	P	0.41313	0.745	B	0.40329	0.326	T	0.69292	-0.5183	10	0.38643	T	0.18	.	5.9851	0.19430	0.0986:0.0:0.7131:0.1883	.	453	Q86W26	NAL10_HUMAN	E	453	ENSP00000327763:Q453E	ENSP00000327763:Q453E	Q	-	1	0	NLRP10	7938378	0.002000	0.14202	0.001000	0.08648	0.001000	0.01503	0.700000	0.25601	0.554000	0.29061	0.655000	0.94253	CAA	NLRP10	-	NULL	ENSG00000182261		0.483	NLRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP10	HGNC	protein_coding	OTTHUMT00000385705.1	336	0.00	0	G	NM_176821		7981802	7981802	-1	no_errors	ENST00000328600	ensembl	human	known	69_37n	missense	61	26.19	22	SNP	0.001	C
NPIPA1	9284	genome.wustl.edu	37	16	15023409	15023409	+	3'UTR	SNP	C	C	T			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr16:15023409C>T	ENST00000472413.1	+	0	2188							Q9UND3	NPIA1_HUMAN	nuclear pore complex interacting protein family, member A1						mRNA transport (GO:0051028)|protein transport (GO:0015031)	nuclear pore (GO:0005643)											ACCTCAGTGACGTGGTGCAGC	0.622																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AC002045	CCDS10557.1	16p13.11	2013-06-11	2013-06-11	2013-06-11	ENSG00000183426	ENSG00000183426			7909	protein-coding gene	gene with protein product		606406	"""nuclear pore complex interacting protein"""	NPIP		11586358, 18055785	Standard	NM_006985		Approved	morpheus	uc002dcy.4	Q9UND3	OTTHUMG00000090663	ENST00000472413.1:c.*2185C>T	16.37:g.15023409C>T			O15102	RNA	SNP	-	NULL	ENST00000472413.1	37	NULL		16																																																																																			NPIP	-	-	ENSG00000183426		0.622	NPIPA1-002	KNOWN	basic|readthrough_transcript	processed_transcript	NPIP	HGNC	protein_coding	OTTHUMT00000207327.1	17	0.00	0	C	NM_006985		15023409	15023409	+1	no_errors	ENST00000472413	ensembl	human	known	69_37n	rna	26	21.21	7	SNP	0.696	T
OR1L1	26737	genome.wustl.edu	37	9	125424329	125424329	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr9:125424329G>C	ENST00000373686.1	+	1	485	c.485G>C	c.(484-486)aGt>aCt	p.S162T	OR1L1_ENST00000309623.1_Missense_Mutation_p.S112T			Q8NH94	OR1L1_HUMAN	olfactory receptor, family 1, subfamily L, member 1	162						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)	17						AACACAGACAGTTACCTGCTA	0.458																																						dbGAP											0													230.0	217.0	221.0					9																	125424329		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35127.1, CCDS35127.2	9q33.2	2013-09-20			ENSG00000173679	ENSG00000173679		"""GPCR / Class A : Olfactory receptors"""	8213	protein-coding gene	gene with protein product				OR1L2			Standard	NM_001005236		Approved	OR9-C	uc022bmz.1	Q8NH94	OTTHUMG00000020618	ENST00000373686.1:c.485G>C	9.37:g.125424329G>C	ENSP00000362790:p.Ser162Thr		Q5T7Z3|Q6IFN2	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S162T	ENST00000373686.1	37	c.485		9	.	.	.	.	.	.	.	.	.	.	G	17.76	3.467789	0.63625	.	.	ENSG00000173679	ENST00000373686;ENST00000309623	T;T	0.00402	7.56;7.56	3.11	3.11	0.35812	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00440	0.0014	L	0.33485	1.01	0.09310	N	1	D	0.57571	0.98	P	0.55508	0.777	T	0.59584	-0.7427	9	0.51188	T	0.08	.	5.1171	0.14840	0.2576:0.0:0.7424:0.0	.	162	Q8NH94	OR1L1_HUMAN	T	162;112	ENSP00000362790:S162T;ENSP00000310773:S112T	ENSP00000310773:S112T	S	+	2	0	OR1L1	124464150	0.000000	0.05858	0.409000	0.26459	0.786000	0.44442	-0.096000	0.11059	1.721000	0.51461	0.313000	0.20887	AGT	OR1L1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000173679		0.458	OR1L1-201	KNOWN	basic	protein_coding	OR1L1	HGNC	protein_coding		382	0.00	0	G			125424329	125424329	+1	no_errors	ENST00000373686	ensembl	human	known	69_37n	missense	86	23.21	26	SNP	0.004	C
OR4M2	390538	genome.wustl.edu	37	15	22369434	22369434	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr15:22369434A>C	ENST00000332663.2	+	1	957	c.859A>C	c.(859-861)Att>Ctt	p.I287L	RP11-69H14.6_ENST00000558896.1_RNA	NM_001004719.2	NP_001004719.2	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M, member 2	287						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(38)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	63		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		ACGTAATCCCATTATTTACAC	0.358																																						dbGAP											0													134.0	106.0	115.0					15																	22369434		2203	4300	6503	-	-	-	SO:0001583	missense	0			AC060768	CCDS32172.1	15q11.2	2013-09-23			ENSG00000182974	ENSG00000182974		"""GPCR / Class A : Olfactory receptors"""	15373	protein-coding gene	gene with protein product							Standard	NM_001004719		Approved		uc010tzu.2	Q8NGB6	OTTHUMG00000171738	ENST00000332663.2:c.859A>C	15.37:g.22369434A>C	ENSP00000329467:p.Ile287Leu		B9EH16|Q6IEY2	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.I287L	ENST00000332663.2	37	c.859	CCDS32172.1	15	.	.	.	.	.	.	.	.	.	.	.	0.093	-1.164395	0.01673	.	.	ENSG00000182974	ENST00000332663	T	0.37752	1.18	2.28	2.28	0.28536	GPCR, rhodopsin-like superfamily (1);	0.000000	0.50627	D	0.000117	T	0.13628	0.0330	N	0.11698	0.16	0.31784	N	0.630544	B	0.25563	0.129	B	0.20184	0.028	T	0.28364	-1.0046	10	0.02654	T	1	-15.654	5.3763	0.16166	0.7045:0.2955:0.0:0.0	.	287	Q8NGB6	OR4M2_HUMAN	L	287	ENSP00000329467:I287L	ENSP00000329467:I287L	I	+	1	0	OR4M2	19870798	0.000000	0.05858	0.998000	0.56505	0.853000	0.48598	-0.161000	0.10026	1.068000	0.40764	0.368000	0.22195	ATT	OR4M2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	ENSG00000182974		0.358	OR4M2-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	OR4M2	HGNC	protein_coding	OTTHUMT00000414921.1	644	0.16	1	A			22369434	22369434	+1	no_errors	ENST00000332663	ensembl	human	known	69_37n	missense	133	20.83	35	SNP	1.000	C
OR5M9	390162	genome.wustl.edu	37	11	56230828	56230828	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr11:56230828C>G	ENST00000279791.1	-	1	49	c.50G>C	c.(49-51)tGt>tCt	p.C17S		NM_001004743.1	NP_001004743.1	Q8NGP3	OR5M9_HUMAN	olfactory receptor, family 5, subfamily M, member 9	17						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	36	Esophageal squamous(21;0.00448)					CTCCTGACGACAGGTCAGCCC	0.418																																						dbGAP											0													34.0	35.0	34.0					11																	56230828		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB065747	CCDS31531.1	11q11	2012-08-09			ENSG00000150269	ENSG00000150269		"""GPCR / Class A : Olfactory receptors"""	15294	protein-coding gene	gene with protein product							Standard	NM_001004743		Approved		uc010rjj.2	Q8NGP3	OTTHUMG00000166874	ENST00000279791.1:c.50G>C	11.37:g.56230828C>G	ENSP00000279791:p.Cys17Ser		Q6IEW5|Q96RB9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.C17S	ENST00000279791.1	37	c.50	CCDS31531.1	11	.	.	.	.	.	.	.	.	.	.	C	2.194	-0.384699	0.04966	.	.	ENSG00000150269	ENST00000279791	T	0.00421	7.46	4.79	1.84	0.25277	.	0.268745	0.26496	N	0.024060	T	0.00109	0.0003	N	0.00223	-1.815	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.38134	-0.9675	10	0.44086	T	0.13	-4.2653	4.9769	0.14146	0.0:0.5625:0.1585:0.279	.	17	Q8NGP3	OR5M9_HUMAN	S	17	ENSP00000279791:C17S	ENSP00000279791:C17S	C	-	2	0	OR5M9	55987404	0.000000	0.05858	0.001000	0.08648	0.443000	0.32047	-1.072000	0.03434	0.543000	0.28864	0.549000	0.68633	TGT	OR5M9	-	NULL	ENSG00000150269		0.418	OR5M9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5M9	HGNC	protein_coding	OTTHUMT00000391638.1	77	0.00	0	C	NM_001004743		56230828	56230828	-1	no_errors	ENST00000279791	ensembl	human	known	69_37n	missense	15	37.50	9	SNP	0.000	G
OR6C70	390327	genome.wustl.edu	37	12	55863464	55863464	+	Silent	SNP	G	G	A			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr12:55863464G>A	ENST00000327335.4	-	1	458	c.459C>T	c.(457-459)atC>atT	p.I153I	RP11-110A12.2_ENST00000556750.1_RNA|RP11-110A12.2_ENST00000554049.1_RNA|RP11-110A12.2_ENST00000555138.1_RNA|RP11-110A12.2_ENST00000555146.1_RNA	NM_001005499.1	NP_001005499.1	A6NIJ9	O6C70_HUMAN	olfactory receptor, family 6, subfamily C, member 70	153						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(5)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	18						GAGTGAAAATGATCAGGAATC	0.363																																						dbGAP											0													72.0	74.0	73.0					12																	55863464		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS31825.1	12q13.2	2013-09-23			ENSG00000184954	ENSG00000184954		"""GPCR / Class A : Olfactory receptors"""	31299	protein-coding gene	gene with protein product							Standard	NM_001005499		Approved		uc010spn.2	A6NIJ9	OTTHUMG00000171127	ENST00000327335.4:c.459C>T	12.37:g.55863464G>A				Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.I153	ENST00000327335.4	37	c.459	CCDS31825.1	12																																																																																			OR6C70	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000184954		0.363	OR6C70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6C70	HGNC	protein_coding	OTTHUMT00000411820.1	172	0.00	0	G			55863464	55863464	-1	no_errors	ENST00000327335	ensembl	human	known	69_37n	silent	19	36.67	11	SNP	0.000	A
OR8I2	120586	genome.wustl.edu	37	11	55861191	55861191	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr11:55861191G>A	ENST00000302124.2	+	1	439	c.408G>A	c.(406-408)atG>atA	p.M136I		NM_001003750.1	NP_001003750.1	Q8N0Y5	OR8I2_HUMAN	olfactory receptor, family 8, subfamily I, member 2	136						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(24)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	53	Esophageal squamous(21;0.00693)					CAGTAGTCATGTCCCAAAAAG	0.448																																						dbGAP											0													153.0	138.0	143.0					11																	55861191		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB065656	CCDS31517.1	11q11	2012-08-09			ENSG00000172154	ENSG00000172154		"""GPCR / Class A : Olfactory receptors"""	15310	protein-coding gene	gene with protein product							Standard	NM_001003750		Approved		uc010rix.2	Q8N0Y5	OTTHUMG00000166831	ENST00000302124.2:c.408G>A	11.37:g.55861191G>A	ENSP00000303864:p.Met136Ile		B2RNN4|Q6IFC0|Q96RC5	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.M136I	ENST00000302124.2	37	c.408	CCDS31517.1	11	.	.	.	.	.	.	.	.	.	.	G	14.70	2.614906	0.46631	.	.	ENSG00000172154	ENST00000302124	T	0.00388	7.59	4.5	4.5	0.54988	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	U	0.000160	T	0.00524	0.0017	M	0.84773	2.715	0.33508	D	0.590824	B	0.30068	0.267	B	0.28139	0.086	T	0.36915	-0.9728	10	0.66056	D	0.02	-23.4866	16.5902	0.84763	0.0:0.0:1.0:0.0	.	136	Q8N0Y5	OR8I2_HUMAN	I	136	ENSP00000303864:M136I	ENSP00000303864:M136I	M	+	3	0	OR8I2	55617767	0.996000	0.38824	0.763000	0.31416	0.145000	0.21501	2.392000	0.44433	2.225000	0.72522	0.440000	0.28878	ATG	OR8I2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000172154		0.448	OR8I2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8I2	HGNC	protein_coding		322	0.00	0	G	NM_001003750		55861191	55861191	+1	no_errors	ENST00000302124	ensembl	human	known	69_37n	missense	65	22.62	19	SNP	0.966	A
OTUD7A	161725	genome.wustl.edu	37	15	31779732	31779732	+	Silent	SNP	C	C	A			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr15:31779732C>A	ENST00000307050.4	-	9	1280	c.1188G>T	c.(1186-1188)ctG>ctT	p.L396L	OTUD7A_ENST00000382902.1_Silent_p.L403L	NM_130901.1	NP_570971.1	Q8TE49	OTU7A_HUMAN	OTU deubiquitinase 7A	396	Catalytic. {ECO:0000250}.|TRAF-binding. {ECO:0000250}.				protein K11-linked deubiquitination (GO:0035871)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			endometrium(7)|large_intestine(4)|lung(11)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	30		all_lung(180;1.6e-09)		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)		AGTGCAGAGGCAGCAGCTTGT	0.602																																						dbGAP											0													80.0	69.0	73.0					15																	31779732		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AJ430383	CCDS10026.1	15q13.1	2014-02-24	2014-02-24	2006-07-07	ENSG00000169918	ENSG00000169918		"""OTU domain containing"""	20718	protein-coding gene	gene with protein product		612024	"""chromosome 15 open reading frame 16"", ""OTU domain containing 7"", ""OTU domain containing 7A"""	C15orf16, OTUD7		23827681	Standard	NM_130901		Approved	CEZANNE2	uc001zfq.3	Q8TE49	OTTHUMG00000129275	ENST00000307050.4:c.1188G>T	15.37:g.31779732C>A			Q8IWK5	Silent	SNP	pfam_OTU,superfamily_UBA-like,smart_Znf_A20,pfscan_OTU,pfscan_Znf_A20	p.L403	ENST00000307050.4	37	c.1209	CCDS10026.1	15																																																																																			OTUD7A	-	NULL	ENSG00000169918		0.602	OTUD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTUD7A	HGNC	protein_coding	OTTHUMT00000251393.2	102	0.97	1	C	NM_130901		31779732	31779732	-1	no_errors	ENST00000382902	ensembl	human	known	69_37n	silent	64	24.42	21	SNP	1.000	A
PARPBP	55010	genome.wustl.edu	37	12	102542086	102542086	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr12:102542086C>G	ENST00000358383.5	+	3	277	c.232C>G	c.(232-234)Cca>Gca	p.P78A	PARPBP_ENST00000535811.1_Intron|PARPBP_ENST00000537257.1_Missense_Mutation_p.P78A|PARPBP_ENST00000541394.1_Missense_Mutation_p.P78A|PARPBP_ENST00000392911.2_5'UTR|PARPBP_ENST00000543784.1_Intron|PARPBP_ENST00000378128.3_Missense_Mutation_p.P78A|PARPBP_ENST00000327680.2_5'UTR			Q9NWS1	PARI_HUMAN	PARP1 binding protein	78					DNA repair (GO:0006281)|negative regulation of double-strand break repair via homologous recombination (GO:2000042)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|lung(8)|urinary_tract(2)	11						ATTGAACTTACCAGTTGAAAA	0.343																																						dbGAP											0													95.0	94.0	95.0					12																	102542086		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000648	CCDS9090.1, CCDS9090.2	12q23.2	2013-03-14	2012-01-24	2012-01-24		ENSG00000185480			26074	protein-coding gene	gene with protein product	"""PARP-1 binding protein"""	613687	"""chromosome 12 open reading frame 48"""	C12orf48		20931645	Standard	NM_017915		Approved	FLJ20641, PARI	uc001tjf.3	Q9NWS1		ENST00000358383.5:c.232C>G	12.37:g.102542086C>G	ENSP00000351153:p.Pro78Ala		B4E0Y0|Q05C00|Q499L8|Q4FZA0|Q4KMW7|Q6NSC6|Q6PJA1|Q86W36	Missense_Mutation	SNP	NULL	p.P78A	ENST00000358383.5	37	c.232	CCDS9090.2	12	.	.	.	.	.	.	.	.	.	.	C	4.046	0.006141	0.07866	.	.	ENSG00000185480	ENST00000378128;ENST00000541394;ENST00000537257;ENST00000358383;ENST00000417507;ENST00000412715	T;T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02;1.02	5.25	3.41	0.39046	.	.	.	.	.	T	0.39784	0.1091	L	0.46157	1.445	0.80722	D	1	B;B;B;P;B;B	0.51351	0.213;0.011;0.052;0.944;0.053;0.141	B;B;B;P;B;B	0.50617	0.102;0.019;0.072;0.646;0.039;0.073	T	0.15607	-1.0431	9	0.31617	T	0.26	-0.4759	4.7762	0.13180	0.0:0.552:0.154:0.2939	.	78;78;78;78;78;78	B4DZ31;Q9NWS1-6;Q9NWS1-7;Q9NWS1-3;Q9NWS1;Q9NWS1-4	.;.;.;.;PR1BP_HUMAN;.	A	78;78;78;78;45;45	ENSP00000367368:P78A;ENSP00000440850:P78A;ENSP00000442549:P78A;ENSP00000351153:P78A;ENSP00000411313:P45A;ENSP00000393867:P45A	ENSP00000351153:P78A	P	+	1	0	C12orf48	101066216	0.673000	0.27539	0.961000	0.40146	0.408000	0.30992	0.634000	0.24614	0.703000	0.31848	0.563000	0.77884	CCA	PARPBP	-	NULL	ENSG00000185480		0.343	PARPBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARPBP	HGNC	protein_coding	OTTHUMT00000397030.2	242	0.00	0	C	NM_017915		102542086	102542086	+1	no_errors	ENST00000358383	ensembl	human	known	69_37n	missense	12	42.86	9	SNP	0.830	G
PCDH11X	27328	genome.wustl.edu	37	X	91132735	91132735	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chrX:91132735C>T	ENST00000373094.1	+	2	2341	c.1496C>T	c.(1495-1497)gCt>gTt	p.A499V	PCDH11X_ENST00000406881.1_Missense_Mutation_p.A499V|PCDH11X_ENST00000361724.1_Missense_Mutation_p.A499V|PCDH11X_ENST00000395337.2_Missense_Mutation_p.A499V|PCDH11X_ENST00000298274.8_Missense_Mutation_p.A499V|PCDH11X_ENST00000373088.1_Missense_Mutation_p.A499V|PCDH11X_ENST00000504220.2_Missense_Mutation_p.A499V|PCDH11X_ENST00000373097.1_Missense_Mutation_p.A499V|PCDH11X_ENST00000361655.2_Missense_Mutation_p.A499V	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	499	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						GGGCCTAATGCTAAGATCAAT	0.448																																					NSCLC(38;925 1092 2571 38200 45895)	dbGAP											0													84.0	67.0	73.0					X																	91132735		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.1496C>T	X.37:g.91132735C>T	ENSP00000362186:p.Ala499Val		A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A499V	ENST00000373094.1	37	c.1496	CCDS14461.1	X	.	.	.	.	.	.	.	.	.	.	C	10.58	1.391024	0.25118	.	.	ENSG00000102290	ENST00000395337;ENST00000373094;ENST00000373097;ENST00000361724;ENST00000373088;ENST00000504220;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T;T;T;T	0.53857	0.6;0.6;0.6;0.6;0.6;0.6;0.6;0.6;0.6	5.38	3.49	0.39957	Cadherin (4);Cadherin-like (1);	0.053369	0.64402	D	0.000001	T	0.75079	0.3801	M	0.88031	2.925	0.51482	D	0.999923	P;P;D;D;D;D;P;P	0.63880	0.955;0.914;0.975;0.991;0.991;0.993;0.923;0.923	P;P;P;P;P;D;P;P	0.65773	0.856;0.824;0.898;0.898;0.898;0.938;0.784;0.724	T	0.81931	-0.0707	10	0.87932	D	0	.	15.6841	0.77396	0.0:0.7279:0.2721:0.0	.	499;499;499;499;499;499;499;499	Q9BZA7-6;Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7;Q9BZA7-7;Q9BZA7-2	.;.;.;.;.;PC11X_HUMAN;.;.	V	499	ENSP00000378746:A499V;ENSP00000362186:A499V;ENSP00000362189:A499V;ENSP00000355040:A499V;ENSP00000362180:A499V;ENSP00000423762:A499V;ENSP00000355105:A499V;ENSP00000384758:A499V;ENSP00000298274:A499V	ENSP00000298274:A499V	A	+	2	0	PCDH11X	91019391	1.000000	0.71417	0.992000	0.48379	0.014000	0.08584	4.719000	0.61937	1.029000	0.39812	-0.279000	0.10071	GCT	PCDH11X	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000102290		0.448	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH11X	HGNC	protein_coding	OTTHUMT00000057436.1	290	0.34	1	C	NM_032969		91132735	91132735	+1	no_errors	ENST00000373094	ensembl	human	known	69_37n	missense	58	25.64	20	SNP	0.999	T
PCDH15	65217	genome.wustl.edu	37	10	55591215	55591215	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr10:55591215G>C	ENST00000320301.6	-	30	4456	c.4062C>G	c.(4060-4062)atC>atG	p.I1354M	PCDH15_ENST00000395445.1_Missense_Mutation_p.I1361M|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000409834.1_Missense_Mutation_p.I965M|PCDH15_ENST00000414778.1_Missense_Mutation_p.I1359M|PCDH15_ENST00000463095.1_5'UTR|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000437009.1_Missense_Mutation_p.I1283M|PCDH15_ENST00000395432.2_Missense_Mutation_p.I1317M|PCDH15_ENST00000373965.2_Missense_Mutation_p.I1361M|PCDH15_ENST00000361849.3_Missense_Mutation_p.I1354M|PCDH15_ENST00000395433.1_Missense_Mutation_p.I1332M|PCDH15_ENST00000395430.1_Missense_Mutation_p.I1354M|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000395438.1_Missense_Mutation_p.I1354M	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	1354					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				CTGGAGTCCGGATCTCCAGAA	0.433										HNSCC(58;0.16)																												dbGAP											0													195.0	171.0	179.0					10																	55591215		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.4062C>G	10.37:g.55591215G>C	ENSP00000322604:p.Ile1354Met		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.I1354M	ENST00000320301.6	37	c.4062	CCDS7248.1	10	.	.	.	.	.	.	.	.	.	.	G	19.54	3.846074	0.71603	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000409834;ENST00000395445;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009	T;T;T;T;T;T;T;T;T;T;T	0.61510	0.3;0.33;0.26;0.28;0.24;0.14;0.11;0.16;0.12;0.1;0.11	5.75	4.84	0.62591	.	.	.	.	.	T	0.66954	0.2842	L	0.36672	1.1	0.58432	D	0.999996	D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	0.998;1.0;1.0;0.997;0.999;1.0;0.998;0.992;0.996;0.996;0.992;0.998;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D	0.85130	0.997;0.985;0.985;0.923;0.99;0.985;0.997;0.944;0.969;0.969;0.944;0.969;0.985	T	0.70189	-0.4940	9	0.87932	D	0	.	13.4705	0.61279	0.0768:0.0:0.9232:0.0	.	1332;1354;1354;1359;1283;1317;1354;1354;1361;1361;1354;1359;1354	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	M	1361;1359;1354;1354;965;1361;1317;1354;1332;1354;1354;1359;1283	ENSP00000363076:I1361M;ENSP00000410304:I1359M;ENSP00000378826:I1354M;ENSP00000386693:I965M;ENSP00000378832:I1361M;ENSP00000378820:I1317M;ENSP00000354950:I1354M;ENSP00000378821:I1332M;ENSP00000322604:I1354M;ENSP00000378818:I1354M;ENSP00000412628:I1283M	ENSP00000322604:I1354M	I	-	3	3	PCDH15	55261221	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.002000	0.57053	1.402000	0.46780	0.585000	0.79938	ATC	PCDH15	-	NULL	ENSG00000150275		0.433	PCDH15-001	KNOWN	basic|CCDS	protein_coding	PCDH15	HGNC	protein_coding	OTTHUMT00000048121.2	443	0.00	0	G	NM_033056		55591215	55591215	-1	no_errors	ENST00000320301	ensembl	human	known	69_37n	missense	111	18.98	26	SNP	1.000	C
PCNXL3	399909	genome.wustl.edu	37	11	65401651	65401651	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr11:65401651G>A	ENST00000355703.3	+	28	5064	c.4525G>A	c.(4525-4527)Gag>Aag	p.E1509K	MIR4690_ENST00000578459.1_RNA|PCNXL3_ENST00000531280.1_3'UTR	NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)	1509						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						GCTCAGCCATGAGGGCATCAC	0.662																																						dbGAP											0													30.0	35.0	33.0					11																	65401651		2072	4194	6266	-	-	-	SO:0001583	missense	0			BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539	ENST00000355703.3:c.4525G>A	11.37:g.65401651G>A	ENSP00000347931:p.Glu1509Lys		Q6MZN8	Missense_Mutation	SNP	pfam_Pecanex	p.E1509K	ENST00000355703.3	37	c.4525	CCDS44650.1	11	.	.	.	.	.	.	.	.	.	.	G	15.72	2.917076	0.52546	.	.	ENSG00000197136	ENST00000355703	T	0.08720	3.06	4.5	4.5	0.54988	.	0.144331	0.45126	D	0.000392	T	0.26484	0.0647	M	0.71036	2.16	0.47862	D	0.999538	P;D	0.63880	0.887;0.993	P;D	0.68192	0.596;0.956	T	0.00923	-1.1513	10	0.46703	T	0.11	.	15.0671	0.72005	0.0:0.0:1.0:0.0	.	396;1509	Q9H6A9-3;Q9H6A9	.;PCX3_HUMAN	K	1509	ENSP00000347931:E1509K	ENSP00000347931:E1509K	E	+	1	0	PCNXL3	65158227	1.000000	0.71417	0.902000	0.35471	0.023000	0.10783	6.371000	0.73119	2.239000	0.73571	0.561000	0.74099	GAG	PCNXL3	-	NULL	ENSG00000197136		0.662	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNXL3	HGNC	protein_coding	OTTHUMT00000390321.1	42	0.00	0	G	NM_032223		65401651	65401651	+1	no_errors	ENST00000355703	ensembl	human	known	69_37n	missense	45	21.05	12	SNP	0.999	A
PLD1	5337	genome.wustl.edu	37	3	171379903	171379903	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr3:171379903G>A	ENST00000351298.4	-	20	2413	c.2287C>T	c.(2287-2289)Cac>Tac	p.H763Y	PLD1_ENST00000340989.4_Missense_Mutation_p.H763Y|PLD1_ENST00000356327.5_Missense_Mutation_p.H725Y|PLD1_ENST00000342215.6_3'UTR	NM_002662.4	NP_002653.1	Q13393	PLD1_HUMAN	phospholipase D1, phosphatidylcholine-specific	763	Catalytic.				chemotaxis (GO:0006935)|defense response to Gram-positive bacterium (GO:0050830)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|lung(27)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	63	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	TAAGCGGCGTGGATGGACTCT	0.443																																					NSCLC(149;2174 3517 34058)	dbGAP											0													118.0	113.0	115.0					3																	171379903		2203	4300	6503	-	-	-	SO:0001583	missense	0			U38545	CCDS3216.1, CCDS46957.1	3q26	2013-01-10	2006-02-17		ENSG00000075651	ENSG00000075651	3.1.4.4	"""Pleckstrin homology (PH) domain containing"""	9067	protein-coding gene	gene with protein product	"""choline phosphatase 1"""	602382				9858822, 8530346	Standard	NM_002662		Approved		uc003fhs.3	Q13393	OTTHUMG00000156947	ENST00000351298.4:c.2287C>T	3.37:g.171379903G>A	ENSP00000342793:p.His763Tyr			Missense_Mutation	SNP	pfam_Phox,pfam_PLipase_D/transphosphatidylase,pfam_Pleckstrin_homology,superfamily_Phox,smart_Phox,smart_Pleckstrin_homology,smart_PLipase_D/transphosphatidylase,pirsf_PLipase_D_euk,pfscan_Phox,pfscan_PLipase_D/transphosphatidylase	p.H763Y	ENST00000351298.4	37	c.2287	CCDS3216.1	3	.	.	.	.	.	.	.	.	.	.	G	16.81	3.226534	0.58668	.	.	ENSG00000075651	ENST00000356327;ENST00000351298;ENST00000340989	T;T;T	0.29142	1.58;1.58;1.58	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.51109	0.1655	M	0.62088	1.915	0.80722	D	1	D;P;D;D	0.76494	0.998;0.863;0.997;0.999	D;P;D;D	0.74023	0.982;0.614;0.96;0.978	T	0.35500	-0.9786	10	0.13470	T	0.59	-20.738	18.193	0.89813	0.0:0.0:1.0:0.0	.	725;763;748;763	Q13393-2;Q13393-4;Q59EA4;Q13393	.;.;.;PLD1_HUMAN	Y	725;763;763	ENSP00000348681:H725Y;ENSP00000342793:H763Y;ENSP00000340326:H763Y	ENSP00000340326:H763Y	H	-	1	0	PLD1	172862597	1.000000	0.71417	0.996000	0.52242	0.318000	0.28184	9.011000	0.93618	2.573000	0.86826	0.467000	0.42956	CAC	PLD1	-	pirsf_PLipase_D_euk	ENSG00000075651		0.443	PLD1-001	KNOWN	basic|CCDS	protein_coding	PLD1	HGNC	protein_coding	OTTHUMT00000346730.2	470	0.21	1	G	NM_002662		171379903	171379903	-1	no_errors	ENST00000351298	ensembl	human	known	69_37n	missense	99	13.91	16	SNP	1.000	A
PRDM16	63976	genome.wustl.edu	37	1	3334490	3334490	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr1:3334490C>G	ENST00000270722.5	+	11	2839	c.2790C>G	c.(2788-2790)ttC>ttG	p.F930L	PRDM16_ENST00000442529.2_Missense_Mutation_p.F929L|PRDM16_ENST00000511072.1_Missense_Mutation_p.F931L|PRDM16_ENST00000378398.3_Missense_Mutation_p.F930L|PRDM16_ENST00000514189.1_Missense_Mutation_p.F930L|PRDM16_ENST00000441472.2_Missense_Mutation_p.F929L|PRDM16_ENST00000512462.1_3'UTR|PRDM16_ENST00000378391.2_Missense_Mutation_p.F930L			Q9HAZ2	PRD16_HUMAN	PR domain containing 16	930	Interaction with CTBP1 and CTBP2. {ECO:0000250}.|Mediates interaction with SKI and regulation of TGF-beta signaling.				brown fat cell differentiation (GO:0050873)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurogenesis (GO:0022008)|palate development (GO:0060021)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular respiration (GO:0043457)|somatic stem cell maintenance (GO:0035019)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(3)	59	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		ACCACCCCTTCAACTTCCGGT	0.627			T	EVI1	"""MDS, AML"""																																	dbGAP		Dom	yes		1	1p36.23-p33	63976	PR domain containing 16		L	0													54.0	59.0	57.0					1																	3334490		1906	4112	6018	-	-	-	SO:0001583	missense	0			AF294278	CCDS41236.1, CCDS44048.1, CCDS41236.2, CCDS44048.2	1p36.23-p33	2013-01-08			ENSG00000142611	ENSG00000142611		"""Zinc fingers, C2H2-type"""	14000	protein-coding gene	gene with protein product	"""MDS1/EVI1-like"", ""PR-domain zinc finger protein 16"", ""transcription factor MEL1"""	605557				11050005	Standard	NM_199454		Approved	MEL1, PFM13, KIAA1675, MGC166915	uc001akf.3	Q9HAZ2	OTTHUMG00000000581	ENST00000270722.5:c.2790C>G	1.37:g.3334490C>G	ENSP00000270722:p.Phe930Leu		A6NHQ8|B1AJP7|B1AJP8|B1AJP9|B1WB48|Q8WYJ9|Q9C0I8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_BED_prd,smart_SET_dom,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.F930L	ENST00000270722.5	37	c.2790	CCDS41236.2	1	.	.	.	.	.	.	.	.	.	.	C	18.41	3.618258	0.66787	.	.	ENSG00000142611	ENST00000511072;ENST00000378398;ENST00000441472;ENST00000442529;ENST00000378391;ENST00000514189;ENST00000270722;ENST00000512462;ENST00000408992;ENST00000509860	T;T;T;T;T;T;T;T;T	0.06528	3.33;3.36;3.38;3.38;3.33;3.37;3.34;3.29;3.33	4.49	4.49	0.54785	.	0.000000	0.53938	D	0.000053	T	0.19005	0.0456	M	0.65498	2.005	0.53688	D	0.999973	D;B;P;B	0.69078	0.997;0.02;0.734;0.011	D;B;B;B	0.70716	0.97;0.009;0.311;0.007	T	0.00824	-1.1551	10	0.30078	T	0.28	.	11.135	0.48368	0.0:0.9136:0.0:0.0864	.	930;930;929;929	Q9HAZ2;Q9HAZ2-2;F8WEV3;D3YTA5	PRD16_HUMAN;.;.;.	L	931;930;929;929;930;930;930;746;746;738	ENSP00000426975:F931L;ENSP00000367651:F930L;ENSP00000407968:F929L;ENSP00000405253:F929L;ENSP00000367643:F930L;ENSP00000421400:F930L;ENSP00000270722:F930L;ENSP00000422504:F746L;ENSP00000425796:F738L	ENSP00000270722:F930L	F	+	3	2	PRDM16	3324350	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.521000	0.53472	2.228000	0.72767	0.563000	0.77884	TTC	PRDM16	-	NULL	ENSG00000142611		0.627	PRDM16-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRDM16	HGNC	protein_coding	OTTHUMT00000001382.3	79	0.00	0	C	NM_022114		3334490	3334490	+1	no_errors	ENST00000270722	ensembl	human	known	69_37n	missense	19	29.63	8	SNP	1.000	G
PTCH2	8643	genome.wustl.edu	37	1	45297909	45297909	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr1:45297909C>G	ENST00000372192.3	-	3	500	c.370G>C	c.(370-372)Gag>Cag	p.E124Q	PTCH2_ENST00000447098.2_Missense_Mutation_p.E124Q	NM_003738.4	NP_003729.3	Q9Y6C5	PTC2_HUMAN	patched 2	124					epidermis development (GO:0008544)|hair cycle (GO:0042633)|negative regulation of smoothened signaling pathway (GO:0045879)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|smoothened binding (GO:0005119)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	50	Acute lymphoblastic leukemia(166;0.155)					AGGATGTTCTCTCCCTCCTGG	0.582									Basal Cell Nevus syndrome																													dbGAP											0													244.0	209.0	221.0					1																	45297909		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Gorlin syndrome, Gorlin-Golz syndrome, Naevoid Basal Cell Carcinoma syndrome, NBCCS	AF091501	CCDS516.1, CCDS53312.1	1p34.1	2010-06-24	2010-06-24		ENSG00000117425	ENSG00000117425			9586	protein-coding gene	gene with protein product		603673	"""patched (Drosophila) homolog 2"", ""patched homolog 2 (Drosophila)"""			9811851, 9931336	Standard	NM_003738		Approved		uc010olf.2	Q9Y6C5	OTTHUMG00000008490	ENST00000372192.3:c.370G>C	1.37:g.45297909C>G	ENSP00000361266:p.Glu124Gln		O95341|O95856|Q53Z57|Q5QP87|Q6UX14	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD,tigrfam_TM_rcpt_patched	p.E124Q	ENST00000372192.3	37	c.370	CCDS516.1	1	.	.	.	.	.	.	.	.	.	.	C	8.058	0.767558	0.15983	.	.	ENSG00000117425	ENST00000447098;ENST00000372192	D;D	0.92249	-2.99;-3.0	4.67	3.76	0.43208	.	0.281921	0.25352	N	0.031284	D	0.86439	0.5933	N	0.25647	0.755	0.25827	N	0.984214	B	0.19935	0.04	B	0.26094	0.066	T	0.78102	-0.2335	10	0.45353	T	0.12	-1.4518	11.6128	0.51072	0.0:0.9126:0.0:0.0874	.	124	Q9Y6C5	PTC2_HUMAN	Q	124	ENSP00000389703:E124Q;ENSP00000361266:E124Q	ENSP00000361266:E124Q	E	-	1	0	PTCH2	45070496	0.059000	0.20769	0.985000	0.45067	0.306000	0.27790	2.205000	0.42770	1.193000	0.43086	0.561000	0.74099	GAG	PTCH2	-	tigrfam_TM_rcpt_patched	ENSG00000117425		0.582	PTCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTCH2	HGNC	protein_coding	OTTHUMT00000023428.4	122	0.00	0	C	NM_003738		45297909	45297909	-1	no_errors	ENST00000372192	ensembl	human	known	69_37n	missense	80	24.53	26	SNP	0.965	G
PTCHD4	442213	genome.wustl.edu	37	6	47846828	47846828	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr6:47846828T>A	ENST00000339488.4	-	3	1785	c.1752A>T	c.(1750-1752)gaA>gaT	p.E584D		NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	584						integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)										AATGCTGGAATTCTGGCTTTT	0.433																																						dbGAP											0													54.0	54.0	54.0					6																	47846828		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.1752A>T	6.37:g.47846828T>A	ENSP00000341914:p.Glu584Asp		B0QZ29|B4DRK3|Q5T884	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD	p.E584D	ENST00000339488.4	37	c.1752	CCDS34473.2	6	.	.	.	.	.	.	.	.	.	.	T	15.95	2.985319	0.53934	.	.	ENSG00000244694	ENST00000339488	D	0.86230	-2.09	5.48	0.816	0.18768	.	0.000000	0.85682	D	0.000000	T	0.82167	0.4978	L	0.45581	1.43	0.80722	D	1	D	0.62365	0.991	D	0.67548	0.952	T	0.78219	-0.2289	10	0.13470	T	0.59	.	9.4229	0.38561	0.0:0.4012:0.0:0.5988	.	584	Q6ZW05	CF138_HUMAN	D	584	ENSP00000341914:E584D	ENSP00000341914:E584D	E	-	3	2	C6orf138	47954787	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.887000	0.28254	0.165000	0.19558	0.528000	0.53228	GAA	PTCHD4	-	pfam_Patched	ENSG00000244694		0.433	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD4	HGNC	protein_coding	OTTHUMT00000317987.2	256	0.00	0	T	NM_001013732		47846828	47846828	-1	no_errors	ENST00000339488	ensembl	human	known	69_37n	missense	40	35.48	22	SNP	1.000	A
PTPRJ	5795	genome.wustl.edu	37	11	48134343	48134343	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr11:48134343G>C	ENST00000418331.2	+	3	512	c.160G>C	c.(160-162)Ggg>Cgg	p.G54R	PTPRJ_ENST00000526550.1_3'UTR|PTPRJ_ENST00000440289.2_Missense_Mutation_p.G54R	NM_002843.3	NP_002834.3	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	54					contact inhibition (GO:0060242)|heart development (GO:0007507)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of vascular permeability (GO:0043116)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of cell adhesion (GO:0045785)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion (GO:0030155)|vasculogenesis (GO:0001570)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|mitogen-activated protein kinase binding (GO:0051019)|phosphatase activity (GO:0016791)|platelet-derived growth factor receptor binding (GO:0005161)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|endometrium(7)|kidney(7)|large_intestine(5)|lung(15)|ovary(1)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						TGTTGCCACAGGGGAAAATGG	0.433																																						dbGAP											0													92.0	88.0	90.0					11																	48134343		2201	4298	6499	-	-	-	SO:0001583	missense	0			U10886	CCDS7945.1, CCDS44596.1	11p11.2	2013-02-11			ENSG00000149177	ENSG00000149177		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9673	protein-coding gene	gene with protein product		600925				7937872, 7994032	Standard	NM_001098503		Approved	DEP1, HPTPeta, CD148	uc001ngp.4	Q12913	OTTHUMG00000166573	ENST00000418331.2:c.160G>C	11.37:g.48134343G>C	ENSP00000400010:p.Gly54Arg		Q15255|Q6P4H4|Q8NHM2|Q9UDA9	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.G54R	ENST00000418331.2	37	c.160	CCDS7945.1	11	.	.	.	.	.	.	.	.	.	.	G	0.998	-0.691945	0.03303	.	.	ENSG00000149177	ENST00000278456;ENST00000418331;ENST00000440289;ENST00000527952	T;T	0.45276	2.38;0.9	1.28	0.0875	0.14451	.	.	.	.	.	T	0.16981	0.0408	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.25363	-1.0134	9	0.14656	T	0.56	.	3.0277	0.06096	0.7037:0.0:0.2963:0.0	.	54;54	Q12913;Q6P4H4	PTPRJ_HUMAN;.	R	54	ENSP00000400010:G54R;ENSP00000409733:G54R	ENSP00000278456:G54R	G	+	1	0	PTPRJ	48090919	0.000000	0.05858	0.002000	0.10522	0.037000	0.13140	0.229000	0.17833	0.004000	0.14682	0.205000	0.17691	GGG	PTPRJ	-	NULL	ENSG00000149177		0.433	PTPRJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRJ	HGNC	protein_coding	OTTHUMT00000390525.1	145	0.00	0	G			48134343	48134343	+1	no_errors	ENST00000418331	ensembl	human	known	69_37n	missense	37	27.45	14	SNP	0.002	C
RASA2	5922	genome.wustl.edu	37	3	141328869	141328869	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr3:141328869A>G	ENST00000452898.1	+	23	2518	c.2483A>G	c.(2482-2484)tAt>tGt	p.Y828C	RASA2_ENST00000286364.3_Missense_Mutation_p.Y827C	NM_006506.2	NP_006497.2	Q15283	RASA2_HUMAN	RAS p21 protein activator 2	828					intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	34						CATGAAAAATATAGGAAGAAA	0.323																																						dbGAP											0													59.0	63.0	61.0					3																	141328869		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF115573	CCDS3117.1	3q22-q23	2013-01-10			ENSG00000155903	ENSG00000155903		"""Pleckstrin homology (PH) domain containing"""	9872	protein-coding gene	gene with protein product		601589				8699317	Standard	NM_006506		Approved	GAP1M	uc003etz.1	Q15283	OTTHUMG00000160221	ENST00000452898.1:c.2483A>G	3.37:g.141328869A>G	ENSP00000391677:p.Tyr828Cys		A8K7K1|G3V0F9|O00695|Q15284|Q92594|Q99577|Q9UEQ2	Missense_Mutation	SNP	pfam_RasGAP,pfam_C2_Ca-dep,pfam_Pleckstrin_homology,pfam_Znf_Btk_motif,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_RasGAP,smart_Pleckstrin_homology,smart_Znf_Btk_motif,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_Znf_Btk_motif,pfscan_RasGAP,prints_Znf_Btk_motif	p.Y828C	ENST00000452898.1	37	c.2483		3	.	.	.	.	.	.	.	.	.	.	A	19.27	3.795398	0.70452	.	.	ENSG00000155903	ENST00000286364;ENST00000452898	T;D	0.81659	-1.49;-1.52	4.96	4.96	0.65561	.	0.096623	0.45361	D	0.000365	D	0.86883	0.6040	L	0.57536	1.79	0.49389	D	0.999788	D;D;D	0.76494	0.998;0.999;0.998	P;D;P	0.66716	0.885;0.946;0.885	D	0.88397	0.3012	10	0.87932	D	0	.	14.8013	0.69919	1.0:0.0:0.0:0.0	.	828;828;827	A8K7K1;G3V0F9;Q15283	.;.;RASA2_HUMAN	C	827;828	ENSP00000286364:Y827C;ENSP00000391677:Y828C	ENSP00000286364:Y827C	Y	+	2	0	RASA2	142811559	1.000000	0.71417	0.999000	0.59377	0.976000	0.68499	5.849000	0.69465	2.096000	0.63516	0.460000	0.39030	TAT	RASA2	-	NULL	ENSG00000155903		0.323	RASA2-201	KNOWN	basic	protein_coding	RASA2	HGNC	protein_coding		375	0.00	0	A	NM_006506		141328869	141328869	+1	no_errors	ENST00000452898	ensembl	human	known	69_37n	missense	34	24.44	11	SNP	1.000	G
RBP3	5949	genome.wustl.edu	37	10	48390375	48390375	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr10:48390375T>C	ENST00000224600.4	-	1	616	c.503A>G	c.(502-504)gAt>gGt	p.D168G	AL731561.2_ENST00000581861.1_RNA	NM_002900.2	NP_002891.1	P10745	RET3_HUMAN	retinol binding protein 3, interstitial	168	4 X approximate tandem repeats.				lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transport (GO:0006810)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interphotoreceptor matrix (GO:0033165)|vesicle (GO:0031982)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(30)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59					Vitamin A(DB00162)	GTGCCGGAGATCCAGCACTAA	0.612																																						dbGAP											0													75.0	78.0	77.0					10																	48390375		2203	4300	6503	-	-	-	SO:0001583	missense	0			M22453	CCDS73119.1	10q11.2	2014-05-06	2001-11-28		ENSG00000107618	ENSG00000265203			9921	protein-coding gene	gene with protein product		180290	"""retinol-binding protein 3, interstitial"""				Standard	NM_002900		Approved	D10S64, D10S65, D10S66, RP66	uc001jez.3	P10745	OTTHUMG00000188321	ENST00000224600.4:c.503A>G	10.37:g.48390375T>C	ENSP00000224600:p.Asp168Gly		Q0QD34|Q5VSR0|Q8IXN0	Missense_Mutation	SNP	pfam_Interphotoreceptor_retinol-bd,pfam_Interphotorcpt_retinol-bd_N,smart_Interphotoreceptor_retinol-bd	p.D168G	ENST00000224600.4	37	c.503	CCDS7218.1	10	.	.	.	.	.	.	.	.	.	.	T	21.3	4.135097	0.77662	.	.	ENSG00000107618	ENST00000224600	D	0.97328	-4.34	5.56	5.56	0.83823	Interphotoreceptor retinol-binding (2);	0.042848	0.85682	D	0.000000	D	0.99036	0.9670	H	0.97240	3.965	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.99297	1.0900	10	0.87932	D	0	-32.7516	14.8963	0.70646	0.0:0.0:0.0:1.0	.	168	P10745	RET3_HUMAN	G	168	ENSP00000224600:D168G	ENSP00000224600:D168G	D	-	2	0	RBP3	48010381	1.000000	0.71417	1.000000	0.80357	0.826000	0.46750	7.551000	0.82182	2.116000	0.64780	0.528000	0.53228	GAT	RBP3	-	pfam_Interphotoreceptor_retinol-bd,smart_Interphotoreceptor_retinol-bd	ENSG00000107618		0.612	RBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBP3	HGNC	protein_coding	OTTHUMT00000047888.1	80	0.00	0	T	NM_002900		48390375	48390375	-1	no_errors	ENST00000224600	ensembl	human	known	69_37n	missense	73	22.34	21	SNP	1.000	C
RP1L1	94137	genome.wustl.edu	37	8	10465970	10465970	+	Nonsense_Mutation	SNP	C	C	A	rs368791833	byFrequency	TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr8:10465970C>A	ENST00000382483.3	-	4	5861	c.5638G>T	c.(5638-5640)Gaa>Taa	p.E1880*		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1960					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		GCCTCTCCTTCTGCCTCTGGG	0.602																																						dbGAP											0													159.0	174.0	169.0					8																	10465970		1931	4145	6076	-	-	-	SO:0001587	stop_gained	0			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.5638G>T	8.37:g.10465970C>A	ENSP00000371923:p.Glu1880*		Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Nonsense_Mutation	SNP	pfam_Doublecortin_dom,superfamily_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.E1880*	ENST00000382483.3	37	c.5638	CCDS43708.1	8	.	.	.	.	.	.	.	.	.	.	C	43	10.309070	0.99380	.	.	ENSG00000183638	ENST00000382483	.	.	.	1.4	1.4	0.22301	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	9.8447	0.41019	0.0:1.0:0.0:0.0	.	.	.	.	X	1880	.	ENSP00000371923:E1880X	E	-	1	0	RP1L1	10503380	0.000000	0.05858	0.245000	0.24217	0.139000	0.21198	0.267000	0.18552	0.652000	0.30806	0.484000	0.47621	GAA	RP1L1	-	NULL	ENSG00000183638		0.602	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1L1	HGNC	protein_coding	OTTHUMT00000375673.1	387	0.00	0	C			10465970	10465970	-1	no_errors	ENST00000382483	ensembl	human	known	69_37n	nonsense	143	52.96	161	SNP	0.286	A
SH3PXD2B	285590	genome.wustl.edu	37	5	171765522	171765522	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr5:171765522C>T	ENST00000311601.5	-	13	2757	c.2587G>A	c.(2587-2589)Gga>Aga	p.G863R	SH3PXD2B_ENST00000519643.1_Intron	NM_001017995.2	NP_001017995.1	A1X283	SPD2B_HUMAN	SH3 and PX domains 2B	863	SH3 4. {ECO:0000255|PROSITE- ProRule:PRU00192}.				adipose tissue development (GO:0060612)|bone development (GO:0060348)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|eye development (GO:0001654)|heart development (GO:0007507)|podosome assembly (GO:0071800)|positive regulation of fat cell differentiation (GO:0045600)|protein localization to membrane (GO:0072657)|skeletal system development (GO:0001501)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|SH2 domain binding (GO:0042169)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TCTTTGTCTCCTTCAAAGTCG	0.577																																						dbGAP											0													70.0	65.0	67.0					5																	171765522		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095834	CCDS34291.1	5q35.2	2008-02-05	2006-02-13	2006-02-13	ENSG00000174705	ENSG00000174705			29242	protein-coding gene	gene with protein product		613293	"""KIAA1295"""	KIAA1295		10718198	Standard	NM_001017995		Approved	FLJ20831	uc003mbr.3	A1X283	OTTHUMG00000163280	ENST00000311601.5:c.2587G>A	5.37:g.171765522C>T	ENSP00000309714:p.Gly863Arg		B6F0V2|Q9P2Q1	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Phox,pfam_SH3-like_bac,pfam_DUF1058,superfamily_Phox,superfamily_SH3_domain,smart_Phox,smart_SH3_domain,pfscan_Phox,pfscan_SH3_domain	p.G863R	ENST00000311601.5	37	c.2587	CCDS34291.1	5	.	.	.	.	.	.	.	.	.	.	C	22.2	4.254926	0.80135	.	.	ENSG00000174705	ENST00000311601	T	0.09350	2.99	4.96	4.96	0.65561	Src homology-3 domain (2);Variant SH3 (1);	0.000000	0.85682	D	0.000000	T	0.35451	0.0932	M	0.80332	2.49	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.11446	-1.0587	9	.	.	.	-15.5346	15.6932	0.77473	0.0:1.0:0.0:0.0	.	863	A1X283	SPD2B_HUMAN	R	863	ENSP00000309714:G863R	.	G	-	1	0	SH3PXD2B	171698127	1.000000	0.71417	0.997000	0.53966	0.949000	0.60115	7.818000	0.86416	2.289000	0.77006	0.462000	0.41574	GGA	SH3PXD2B	-	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain	ENSG00000174705		0.577	SH3PXD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3PXD2B	HGNC	protein_coding	OTTHUMT00000372449.1	119	0.00	0	C	NM_017963		171765522	171765522	-1	no_errors	ENST00000311601	ensembl	human	known	69_37n	missense	80	28.57	32	SNP	1.000	T
SHC4	399694	genome.wustl.edu	37	15	49148213	49148213	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr15:49148213G>C	ENST00000332408.4	-	8	1607	c.1179C>G	c.(1177-1179)atC>atG	p.I393M	SHC4_ENST00000396535.3_Missense_Mutation_p.I150M|SHC4_ENST00000537958.1_Missense_Mutation_p.I107M	NM_203349.3	NP_976224.3	Q6S5L8	SHC4_HUMAN	SHC (Src homology 2 domain containing) family, member 4	393	CH1.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of cell proliferation (GO:0008284)|regulation of gene expression (GO:0010468)|stem cell differentiation (GO:0048863)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(2)|large_intestine(8)|lung(11)|ovary(3)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	29		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)		CTTGAACTTTGATCCGCATAT	0.423																																						dbGAP											0													165.0	151.0	156.0					15																	49148213		2197	4294	6491	-	-	-	SO:0001583	missense	0			AY358250	CCDS10130.1	15q21.1-q21.2	2013-02-14			ENSG00000185634	ENSG00000185634		"""SH2 domain containing"""	16743	protein-coding gene	gene with protein product	"""rai-like protein"""						Standard	NM_203349		Approved	RaLP	uc001zxb.1	Q6S5L8	OTTHUMG00000131513	ENST00000332408.4:c.1179C>G	15.37:g.49148213G>C	ENSP00000329668:p.Ile393Met		Q6UXQ3|Q8IYW3	Missense_Mutation	SNP	pfam_PTyr_interaction_dom,pfam_SH2,smart_PTyr_interaction_dom,smart_SH2,prints_PID_domain,prints_SH2,pfscan_PTyr_interaction_dom,pfscan_SH2	p.I393M	ENST00000332408.4	37	c.1179	CCDS10130.1	15	.	.	.	.	.	.	.	.	.	.	G	8.919	0.960596	0.18583	.	.	ENSG00000185634	ENST00000332408;ENST00000396535;ENST00000537958	T;T;T	0.32272	3.5;1.46;1.48	5.03	2.16	0.27623	.	0.391146	0.25517	N	0.030134	T	0.16727	0.0402	N	0.19112	0.55	0.09310	N	1	B;B	0.12630	0.006;0.001	B;B	0.16289	0.015;0.004	T	0.15407	-1.0438	10	0.45353	T	0.12	-15.8717	5.3046	0.15797	0.3036:0.331:0.3654:0.0	.	150;393	Q6S5L8-2;Q6S5L8	.;SHC4_HUMAN	M	393;150;107	ENSP00000329668:I393M;ENSP00000379786:I150M;ENSP00000443300:I107M	ENSP00000329668:I393M	I	-	3	3	SHC4	46935505	1.000000	0.71417	0.018000	0.16275	0.977000	0.68977	1.257000	0.32932	0.301000	0.22738	0.655000	0.94253	ATC	SHC4	-	NULL	ENSG00000185634		0.423	SHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHC4	HGNC	protein_coding	OTTHUMT00000254371.1	362	0.00	0	G	NM_203349		49148213	49148213	-1	no_errors	ENST00000332408	ensembl	human	known	69_37n	missense	56	28.21	22	SNP	0.016	C
SPINK5	11005	genome.wustl.edu	37	5	147494010	147494010	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr5:147494010G>T	ENST00000256084.7	+	21	2015	c.1973G>T	c.(1972-1974)gGc>gTc	p.G658V	SPINK5_ENST00000398454.1_Missense_Mutation_p.G658V|SPINK5_ENST00000359874.3_Missense_Mutation_p.G658V	NM_006846.3	NP_006837.2	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5	658	Kazal-like 10. {ECO:0000255|PROSITE- ProRule:PRU00798}.				anagen (GO:0042640)|epidermal cell differentiation (GO:0009913)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|hair cell differentiation (GO:0035315)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of immune response (GO:0050777)|negative regulation of proteolysis (GO:0045861)|negative regulation of serine-type peptidase activity (GO:1902572)|regulation of cell adhesion (GO:0030155)|regulation of T cell differentiation (GO:0045580)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(8)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCCCAGATGGCAAGACCCAT	0.458																																						dbGAP											0													84.0	81.0	82.0					5																	147494010		1923	4146	6069	-	-	-	SO:0001583	missense	0			AJ228139	CCDS43382.1, CCDS47300.1, CCDS47301.1	5q31-q32	2014-09-17	2005-08-17		ENSG00000133710	ENSG00000133710		"""Serine peptidase inhibitors, Kazal type"""	15464	protein-coding gene	gene with protein product	"""lymphoepithelial Kazal-type-related inhibitor"""	605010	"""serine protease inhibitor, Kazal type 5"""			10419450	Standard	NM_001127698		Approved	VAKTI, LEKTI, LETKI, NETS, NS, FLJ21544, FLJ97536, FLJ97596, FLJ99794, DKFZp686K19184	uc003loy.2	Q9NQ38	OTTHUMG00000134305	ENST00000256084.7:c.1973G>T	5.37:g.147494010G>T	ENSP00000256084:p.Gly658Val		A8MYE8|B7WPB7|D6REN5|O75770|Q3LX95|Q3LX96|Q3LX97|Q96PP2|Q96PP3	Missense_Mutation	SNP	pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,smart_Prot_inh_Kazal	p.G658V	ENST00000256084.7	37	c.1973	CCDS43382.1	5	.	.	.	.	.	.	.	.	.	.	G	21.0	4.075722	0.76415	.	.	ENSG00000133710	ENST00000398454;ENST00000359874;ENST00000508733;ENST00000256084	T;T;T;T	0.12569	2.67;2.67;2.67;2.67	5.42	5.42	0.78866	Proteinase inhibitor I1, Kazal (1);Protease inhibitor, Kazal-type (1);	0.090324	0.44688	D	0.000434	T	0.47488	0.1448	M	0.92738	3.34	0.58432	D	0.999992	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.57883	-0.7734	10	0.87932	D	0	-15.6787	15.0935	0.72215	0.0:0.0:1.0:0.0	.	639;658;658;658	B4DWS3;Q9NQ38-3;Q9NQ38;Q9NQ38-2	.;.;ISK5_HUMAN;.	V	658;658;639;658	ENSP00000381472:G658V;ENSP00000352936:G658V;ENSP00000421519:G639V;ENSP00000256084:G658V	ENSP00000256084:G658V	G	+	2	0	SPINK5	147474203	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.858000	0.55979	2.703000	0.92315	0.655000	0.94253	GGC	SPINK5	-	pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,smart_Prot_inh_Kazal	ENSG00000133710		0.458	SPINK5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SPINK5	HGNC	protein_coding	OTTHUMT00000259215.2	172	0.00	0	G	NM_001127698		147494010	147494010	+1	no_errors	ENST00000359874	ensembl	human	known	69_37n	missense	21	22.22	6	SNP	1.000	T
SPTBN2	6712	genome.wustl.edu	37	11	66475011	66475011	+	Silent	SNP	G	G	C			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr11:66475011G>C	ENST00000533211.1	-	13	1960	c.1629C>G	c.(1627-1629)ctC>ctG	p.L543L	SPTBN2_ENST00000309996.2_Silent_p.L543L|SPTBN2_ENST00000529997.1_Silent_p.L543L			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	543			Missing (in SCA5). {ECO:0000269|PubMed:16429157}.		actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						TCCAGTCCATGAGGTAGAGCA	0.637																																						dbGAP											0													26.0	24.0	24.0					11																	66475011		2198	4290	6488	-	-	-	SO:0001819	synonymous_variant	0			AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.1629C>G	11.37:g.66475011G>C			O14872|O14873	Silent	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,pfscan_CH-domain,pfscan_Pleckstrin_homology,prints_PH_dom-spectrin-type	p.L543	ENST00000533211.1	37	c.1629	CCDS8150.1	11																																																																																			SPTBN2	-	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000173898		0.637	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN2	HGNC	protein_coding	OTTHUMT00000393892.2	17	0.00	0	G	NM_006946		66475011	66475011	-1	no_errors	ENST00000309996	ensembl	human	known	69_37n	silent	14	22.22	4	SNP	1.000	C
SULF1	23213	genome.wustl.edu	37	8	70476282	70476282	+	Silent	SNP	T	T	C			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr8:70476282T>C	ENST00000260128.4	+	5	789	c.72T>C	c.(70-72)acT>acC	p.T24T	SULF1_ENST00000402687.4_Silent_p.T24T|SULF1_ENST00000458141.2_Silent_p.T24T|SULF1_ENST00000419716.3_Silent_p.T24T	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	24					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			TCTGTTCGACTGTCAGATCCC	0.478																																						dbGAP											0													153.0	140.0	144.0					8																	70476282		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.72T>C	8.37:g.70476282T>C			Q86YV8|Q8NCA2|Q9UPS5	Silent	SNP	pfam_Sulfatase,pfam_Extracellular_sulfatase_C,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core,pirsf_Extracellular_sulfatase	p.T24	ENST00000260128.4	37	c.72	CCDS6204.1	8																																																																																			SULF1	-	pirsf_Extracellular_sulfatase	ENSG00000137573		0.478	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SULF1	HGNC	protein_coding	OTTHUMT00000378885.2	463	0.00	0	T	NM_015170		70476282	70476282	+1	no_errors	ENST00000260128	ensembl	human	known	69_37n	silent	67	30.93	30	SNP	0.000	C
SYNE2	23224	genome.wustl.edu	37	14	64450476	64450477	+	Frame_Shift_Ins	INS	-	-	C	rs368463904|rs199854951		TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr14:64450476_64450477insC	ENST00000344113.4	+	18	2235_2236	c.2023_2024insC	c.(2023-2025)atafs	p.I675fs	SYNE2_ENST00000358025.3_Frame_Shift_Ins_p.I675fs|SYNE2_ENST00000554584.1_Frame_Shift_Ins_p.I675fs|SYNE2_ENST00000357395.3_5'UTR	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	675					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		GCCACTGATGATAAAAAAACAG	0.297																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	Exception_encountered	14.37:g.64450476_64450477insC	ENSP00000341781:p.Ile675fs		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Frame_Shift_Ins	INS	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.I675fs	ENST00000344113.4	37	c.2023_2024	CCDS41963.1	14																																																																																			SYNE2	-	NULL	ENSG00000054654		0.297	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	100	0.00	0	-	NM_182914		64450476	64450477	+1	no_errors	ENST00000358025	ensembl	human	known	69_37n	frame_shift_ins	9	18.18	2	INS	0.000:0.000	C
SYNJ2	8871	genome.wustl.edu	37	6	158484821	158484821	+	Splice_Site	SNP	A	A	G			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr6:158484821A>G	ENST00000355585.4	+	9	1202		c.e9-1		SYNJ2_ENST00000367121.3_Splice_Site|SYNJ2_ENST00000367122.2_Splice_Site|SYNJ2_ENST00000449859.2_Splice_Site	NM_001178088.1|NM_003898.3	NP_001171559.1|NP_003889.1	O15056	SYNJ2_HUMAN	synaptojanin 2						phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			biliary_tract(1)|endometrium(9)|kidney(3)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)		TCTTGTCCTAAGTTTTCAGAA	0.488																																						dbGAP											0													149.0	142.0	145.0					6																	158484821		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB002346	CCDS5254.1	6q25.3	2008-05-15			ENSG00000078269	ENSG00000078269			11504	protein-coding gene	gene with protein product		609410					Standard	NM_003898		Approved	INPP5H	uc003qqx.2	O15056	OTTHUMG00000015904	ENST00000355585.4:c.1128-1A>G	6.37:g.158484821A>G			Q5TA13|Q5TA16|Q5TA19|Q86XK0|Q8IZA8|Q9H226	Splice_Site	SNP	-	e9-2	ENST00000355585.4	37	c.1128-2	CCDS5254.1	6	.	.	.	.	.	.	.	.	.	.	A	19.88	3.909497	0.72868	.	.	ENSG00000078269	ENST00000367122;ENST00000367121;ENST00000355585;ENST00000449859	.	.	.	4.98	4.98	0.66077	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.7246	0.69336	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SYNJ2	158404809	1.000000	0.71417	0.898000	0.35279	0.848000	0.48234	8.022000	0.88759	2.327000	0.79052	0.456000	0.33151	.	SYNJ2	-	-	ENSG00000078269		0.488	SYNJ2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNJ2	HGNC	protein_coding	OTTHUMT00000042858.2	340	0	0	A		Intron	158484821	158484821	+1	no_errors	ENST00000355585	ensembl	human	known	69_37n	splice_site	43	29.51	18	SNP	1.000	G
TEKT5	146279	genome.wustl.edu	37	16	10769857	10769857	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr16:10769857C>A	ENST00000283025.2	-	5	1116	c.1045G>T	c.(1045-1047)Gtg>Ttg	p.V349L		NM_144674.1	NP_653275.1	Q96M29	TEKT5_HUMAN	tektin 5	349						cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)				breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)	34						ACATCCGTCACCTCAGAGATG	0.602																																						dbGAP											0													132.0	111.0	118.0					16																	10769857		2197	4300	6497	-	-	-	SO:0001583	missense	0				CCDS10542.1	16p13.13	2014-01-21			ENSG00000153060	ENSG00000153060			26554	protein-coding gene	gene with protein product							Standard	NM_144674		Approved	FLJ32871, CT149	uc002czz.1	Q96M29	OTTHUMG00000129750	ENST00000283025.2:c.1045G>T	16.37:g.10769857C>A	ENSP00000283025:p.Val349Leu		A1L3Z3	Missense_Mutation	SNP	pfam_Tektin,prints_Tektin	p.V349L	ENST00000283025.2	37	c.1045	CCDS10542.1	16	.	.	.	.	.	.	.	.	.	.	C	6.671	0.492390	0.12702	.	.	ENSG00000153060	ENST00000283025	T	0.02236	4.38	4.68	3.71	0.42584	.	0.407498	0.20451	N	0.092085	T	0.01558	0.0050	N	0.11789	0.175	0.26505	N	0.974696	B	0.06786	0.001	B	0.12156	0.007	T	0.45116	-0.9283	10	0.33141	T	0.24	-19.8691	7.0386	0.25006	0.1736:0.7378:0.0:0.0886	.	349	Q96M29	TEKT5_HUMAN	L	349	ENSP00000283025:V349L	ENSP00000283025:V349L	V	-	1	0	TEKT5	10677358	1.000000	0.71417	0.972000	0.41901	0.244000	0.25665	3.516000	0.53436	1.066000	0.40716	0.563000	0.77884	GTG	TEKT5	-	pfam_Tektin	ENSG00000153060		0.602	TEKT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEKT5	HGNC	protein_coding	OTTHUMT00000251963.1	168	0.00	0	C	NM_144674		10769857	10769857	-1	no_errors	ENST00000283025	ensembl	human	known	69_37n	missense	107	21.32	29	SNP	0.996	A
THOC3	84321	genome.wustl.edu	37	5	175387009	175387009	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr5:175387009C>T	ENST00000265097.4	-	6	1109	c.1019G>A	c.(1018-1020)gGa>gAa	p.G340E	THOC3_ENST00000510300.1_5'Flank|THOC3_ENST00000514861.1_Missense_Mutation_p.G155E|RP11-91H12.4_ENST00000502813.1_RNA	NM_032361.2	NP_115737.1	Q96J01	THOC3_HUMAN	THO complex 3	340					mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			endometrium(1)|kidney(1)|large_intestine(2)	4	all_cancers(89;0.00406)|Renal(175;0.000269)|Lung NSC(126;0.0103)|all_lung(126;0.0164)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Kidney(146;0.0965)		CTTCACAGTTCCGGCTTCCCG	0.547																																						dbGAP											0													5.0	6.0	6.0					5																	175387009		1808	3584	5392	-	-	-	SO:0001583	missense	0			BC006849	CCDS4397.1	5q35.3	2013-02-11			ENSG00000051596	ENSG00000051596		"""WD repeat domain containing"", ""THO complex subunits"""	19072	protein-coding gene	gene with protein product		606929				11979277	Standard	NM_032361		Approved	TEX1, MGC5469	uc003mdg.5	Q96J01	OTTHUMG00000130658	ENST00000265097.4:c.1019G>A	5.37:g.175387009C>T	ENSP00000265097:p.Gly340Glu		Q6NZ53	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_TIF2A_beta_prop-like,pfam_PD40,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G340E	ENST00000265097.4	37	c.1019	CCDS4397.1	5	.	.	.	.	.	.	.	.	.	.	C	22.8	4.333632	0.81801	.	.	ENSG00000051596	ENST00000265097;ENST00000514861	T;T	0.75367	0.2;-0.93	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	D	0.84588	0.5505	M	0.80422	2.495	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81645	-0.0839	10	0.06099	T	0.92	-9.5446	17.5687	0.87928	0.0:1.0:0.0:0.0	.	340	Q96J01	THOC3_HUMAN	E	340;155	ENSP00000265097:G340E;ENSP00000425039:G155E	ENSP00000265097:G340E	G	-	2	0	THOC3	175319615	1.000000	0.71417	0.996000	0.52242	0.672000	0.39443	7.689000	0.84165	2.380000	0.81148	0.609000	0.83330	GGA	THOC3	-	smart_WD40_repeat	ENSG00000051596		0.547	THOC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THOC3	HGNC	protein_coding	OTTHUMT00000253148.1	39	0.00	0	C			175387009	175387009	-1	no_errors	ENST00000265097	ensembl	human	known	69_37n	missense	20	20.00	5	SNP	1.000	T
THSD4	79875	genome.wustl.edu	37	15	71952960	71952960	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr15:71952960C>G	ENST00000355327.3	+	8	1378	c.1244C>G	c.(1243-1245)tCg>tGg	p.S415W	THSD4_ENST00000261862.6_Missense_Mutation_p.S415W|THSD4_ENST00000567838.1_3'UTR|THSD4_ENST00000357769.4_Missense_Mutation_p.S55W			Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4	415					elastic fiber assembly (GO:0048251)	extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)			breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(20)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						CAGGTTGTGTCGGGCGTGTTT	0.547																																						dbGAP											0													137.0	144.0	142.0					15																	71952960		1982	4168	6150	-	-	-	SO:0001583	missense	0			AK023772	CCDS10238.2, CCDS66817.1	15q23	2009-11-09			ENSG00000187720	ENSG00000187720			25835	protein-coding gene	gene with protein product		614476				19734141	Standard	NM_001286429		Approved	FVSY9334, PRO34005, FLJ13710, ADAMTSL6	uc002atb.1	Q6ZMP0	OTTHUMG00000133389	ENST00000355327.3:c.1244C>G	15.37:g.71952960C>G	ENSP00000347484:p.Ser415Trp		B2RTY3|B4DR13|Q6MZI3|Q6UXZ8|Q9H8E4	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt	p.S415W	ENST00000355327.3	37	c.1244	CCDS10238.2	15	.	.	.	.	.	.	.	.	.	.	C	24.4	4.523684	0.85600	.	.	ENSG00000187720	ENST00000355327;ENST00000261862;ENST00000357769;ENST00000345002	T;T;T	0.69561	-0.41;-0.41;0.58	4.77	4.77	0.60923	ADAM-TS Spacer 1 (1);	1.255030	0.05404	N	0.541184	D	0.85860	0.5795	M	0.85777	2.775	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.989;0.997;0.996	T	0.76908	-0.2785	10	0.87932	D	0	.	15.6624	0.77197	0.0:1.0:0.0:0.0	.	55;55;415;415	B4E1J6;B4DR13;Q6ZMP0-2;Q6ZMP0	.;.;.;THSD4_HUMAN	W	415;415;55;55	ENSP00000347484:S415W;ENSP00000261862:S415W;ENSP00000350413:S55W	ENSP00000261862:S415W	S	+	2	0	THSD4	69740014	1.000000	0.71417	0.914000	0.36105	0.960000	0.62799	5.795000	0.69074	2.362000	0.80069	0.655000	0.94253	TCG	THSD4	-	pfam_ADAM_spacer1	ENSG00000187720		0.547	THSD4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	THSD4	HGNC	protein_coding	OTTHUMT00000257253.2	178	0.00	0	C	NM_024817		71952960	71952960	+1	no_errors	ENST00000261862	ensembl	human	known	69_37n	missense	32	42.86	24	SNP	0.999	G
TMEM129	92305	genome.wustl.edu	37	4	1719273	1719273	+	Silent	SNP	G	G	A			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr4:1719273G>A	ENST00000382936.3	-	3	1303	c.810C>T	c.(808-810)gtC>gtT	p.V270V	TMEM129_ENST00000303277.2_Intron|TMEM129_ENST00000536901.1_Silent_p.V270V	NM_001127266.1	NP_001120738.1	A0AVI4	TM129_HUMAN	transmembrane protein 129, E3 ubiquitin protein ligase	270					protein ubiquitination (GO:0016567)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)			lung(2)	2			OV - Ovarian serous cystadenocarcinoma(23;0.00765)			AGGCCGGGTTGACCTCTACCA	0.687																																						dbGAP											0													46.0	54.0	52.0					4																	1719273		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			BC009331	CCDS3351.1, CCDS46998.1	4p16.3	2014-07-25	2014-07-25		ENSG00000168936	ENSG00000168936			25137	protein-coding gene	gene with protein product		615975	"""transmembrane protein 129"""			24807418, 25030448	Standard	NM_138385		Approved	D4S2561E	uc003gdn.3	A0AVI4	OTTHUMG00000121150	ENST00000382936.3:c.810C>T	4.37:g.1719273G>A			A6NH49|A6NI98|D3DVP8	Silent	SNP	pfam_Tmpp129	p.V270	ENST00000382936.3	37	c.810	CCDS46998.1	4																																																																																			TMEM129	-	pfam_Tmpp129	ENSG00000168936		0.687	TMEM129-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM129	HGNC	protein_coding	OTTHUMT00000350724.1	16	0.00	0	G	NM_138385		1719273	1719273	-1	no_errors	ENST00000382936	ensembl	human	known	69_37n	silent	29	35.56	16	SNP	0.974	A
TLL1	7092	genome.wustl.edu	37	4	166981198	166981198	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr4:166981198T>C	ENST00000061240.2	+	15	2512	c.1865T>C	c.(1864-1866)cTt>cCt	p.L622P	TLL1_ENST00000507499.1_Missense_Mutation_p.L645P	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	622	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		GGTGGACTTCTTACCAAACTT	0.458																																						dbGAP											0													70.0	69.0	69.0					4																	166981198		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.1865T>C	4.37:g.166981198T>C	ENSP00000061240:p.Leu622Pro		B2RMU2|Q96AN3|Q9NQS4	Missense_Mutation	SNP	pfam_CUB,pfam_Peptidase_M12A,pfam_EGF-like_Ca-bd,superfamily_CUB,smart_Peptidase_Metallo,smart_CUB,smart_EGF-like_Ca-bd,smart_EGF-like,pirsf_BMP_1/tolloid-like,pfscan_CUB,pfscan_EG-like_dom,prints_Peptidase_M12A	p.L622P	ENST00000061240.2	37	c.1865	CCDS3811.1	4	.	.	.	.	.	.	.	.	.	.	T	16.15	3.042541	0.55003	.	.	ENSG00000038295	ENST00000061240;ENST00000507499	T;T	0.35421	1.31;1.31	6.17	6.17	0.99709	CUB (5);	0.000000	0.64402	U	0.000006	T	0.64271	0.2583	M	0.81682	2.555	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.989;1.0	T	0.68326	-0.5438	10	0.87932	D	0	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	645;622	E9PD25;O43897	.;TLL1_HUMAN	P	622;645	ENSP00000061240:L622P;ENSP00000426082:L645P	ENSP00000061240:L622P	L	+	2	0	TLL1	167200648	0.992000	0.36948	0.905000	0.35620	0.025000	0.11179	7.921000	0.87530	2.371000	0.80710	0.533000	0.62120	CTT	TLL1	-	pfam_CUB,superfamily_CUB,smart_CUB,pirsf_BMP_1/tolloid-like,pfscan_CUB	ENSG00000038295		0.458	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLL1	HGNC	protein_coding	OTTHUMT00000363821.1	312	0.00	0	T			166981198	166981198	+1	no_errors	ENST00000061240	ensembl	human	known	69_37n	missense	50	21.88	14	SNP	0.997	C
TNNT1	7138	genome.wustl.edu	37	19	55645295	55645295	+	Splice_Site	SNP	T	T	A			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr19:55645295T>A	ENST00000588981.1	-	13	955	c.751A>T	c.(751-753)Atc>Ttc	p.I251F	TNNT1_ENST00000587465.2_Splice_Site_p.I165F|TNNT1_ENST00000587758.1_Splice_Site_p.I224F|TNNT1_ENST00000588426.1_Splice_Site_p.I132F|TNNT1_ENST00000291901.8_Splice_Site_p.I235F|TNNT1_ENST00000536926.1_Splice_Site_p.I224F|TNNT1_ENST00000356783.5_Splice_Site_p.I224F|TNNT1_ENST00000585321.2_Splice_Site_p.I165F	NM_003283.4	NP_003274.3	P13805	TNNT1_HUMAN	troponin T type 1 (skeletal, slow)	251					muscle filament sliding (GO:0030049)|negative regulation of muscle contraction (GO:0045932)|skeletal muscle contraction (GO:0003009)|slow-twitch skeletal muscle fiber contraction (GO:0031444)	cytosol (GO:0005829)|troponin complex (GO:0005861)	tropomyosin binding (GO:0005523)			endometrium(2)|kidney(3)|lung(4)|ovary(1)	10			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.047)		AGCACGTTGATCTGCGGAGGC	0.642																																						dbGAP											0													125.0	81.0	96.0					19																	55645295		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS12917.1, CCDS46185.1, CCDS59421.1	19q13.4	2014-09-17	2005-09-12			ENSG00000105048			11948	protein-coding gene	gene with protein product	"""slow skeletal muscle troponin T"", ""troponin T1, skeletal, slow"", ""nemaline myopathy type 5"""	191041	"""troponin T1, skeletal, slow"""			1505979	Standard	XM_006723343		Approved	ANM, STNT, TNT, TNTS, FLJ98147, MGC104241, NEM5	uc002qjb.4	P13805		ENST00000588981.1:c.751-1A>T	19.37:g.55645295T>A			O95472|Q16061|Q5U0E1	Missense_Mutation	SNP	pfam_Troponin	p.I251F	ENST00000588981.1	37	c.751	CCDS12917.1	19	.	.	.	.	.	.	.	.	.	.	t	16.16	3.043184	0.55003	.	.	ENSG00000105048	ENST00000291901;ENST00000356783;ENST00000536926;ENST00000537693	D;D	0.89875	-2.58;-2.58	4.24	4.24	0.50183	.	0.060281	0.64402	U	0.000005	D	0.90400	0.6995	M	0.83774	2.66	0.80722	D	1	P;P;P;P	0.49090	0.919;0.919;0.893;0.919	P;P;B;P	0.46275	0.51;0.51;0.409;0.51	D	0.91520	0.5234	10	0.87932	D	0	-17.4669	11.6047	0.51024	0.0:0.0:0.0:1.0	.	224;235;251;224	P13805-2;P13805-3;P13805;F5H1H4	.;.;TNNT1_HUMAN;.	F	251;224;224;165	ENSP00000349233:I224F;ENSP00000439640:I224F	ENSP00000291901:I251F	I	-	1	0	TNNT1	60337107	1.000000	0.71417	1.000000	0.80357	0.175000	0.22909	4.962000	0.63687	1.721000	0.51461	0.166000	0.16787	ATC	TNNT1	-	NULL	ENSG00000105048		0.642	TNNT1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNNT1	HGNC	protein_coding	OTTHUMT00000451825.2	63	0.00	0	T	NM_003283	Missense_Mutation	55645295	55645295	-1	no_errors	ENST00000588981	ensembl	human	known	69_37n	missense	22	45.00	18	SNP	1.000	A
TXNDC11	51061	genome.wustl.edu	37	16	11773272	11773272	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr16:11773272T>C	ENST00000356957.3	-	13	2844	c.2737A>G	c.(2737-2739)Aac>Gac	p.N913D	TXNDC11_ENST00000283033.5_Missense_Mutation_p.N886D|TXNDC11_ENST00000570917.1_5'UTR			Q6PKC3	TXD11_HUMAN	thioredoxin domain containing 11	913					cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)			endometrium(3)|large_intestine(5)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	21						GTAAGGAGGTTTTCTGAGGCA	0.612																																						dbGAP											0													61.0	60.0	61.0					16																	11773272		2197	4300	6497	-	-	-	SO:0001583	missense	0			BC013727	CCDS32387.1	16p13.13	2008-09-29				ENSG00000153066			28030	protein-coding gene	gene with protein product	"""EF-hand binding protein 1"""					8619474, 9110174	Standard	XM_005255346		Approved	EFP1	uc002dbg.1	Q6PKC3		ENST00000356957.3:c.2737A>G	16.37:g.11773272T>C	ENSP00000349439:p.Asn913Asp		O95887|Q6PJA6|Q8N2Q4|Q96K45|Q96K53	Missense_Mutation	SNP	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	p.N913D	ENST00000356957.3	37	c.2737		16	.	.	.	.	.	.	.	.	.	.	T	8.940	0.965493	0.18583	.	.	ENSG00000153066	ENST00000356957;ENST00000283033	T;T	0.15256	2.66;2.44	5.63	4.53	0.55603	.	0.497944	0.24294	N	0.039795	T	0.14830	0.0358	L	0.54323	1.7	0.09310	N	0.999999	B;P	0.38504	0.346;0.634	B;B	0.30495	0.074;0.116	T	0.11641	-1.0579	10	0.32370	T	0.25	-2.1445	10.9134	0.47122	0.0:0.0731:0.0:0.9269	.	913;886	Q6PKC3;Q6PKC3-2	TXD11_HUMAN;.	D	913;886	ENSP00000349439:N913D;ENSP00000283033:N886D	ENSP00000283033:N886D	N	-	1	0	TXNDC11	11680773	0.885000	0.30320	0.001000	0.08648	0.036000	0.12997	1.679000	0.37597	0.961000	0.38030	0.533000	0.62120	AAC	TXNDC11	-	NULL	ENSG00000153066		0.612	TXNDC11-002	KNOWN	basic|appris_candidate_longest	protein_coding	TXNDC11	HGNC	protein_coding	OTTHUMT00000437057.1	53	0.00	0	T	NM_015914		11773272	11773272	-1	no_errors	ENST00000356957	ensembl	human	known	69_37n	missense	48	21.31	13	SNP	0.437	C
UXS1	80146	genome.wustl.edu	37	2	106761823	106761823	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr2:106761823T>C	ENST00000409501.3	-	6	337	c.280A>G	c.(280-282)Aca>Gca	p.T94A	UXS1_ENST00000428048.2_Intron|UXS1_ENST00000479621.1_5'UTR|UXS1_ENST00000540130.1_Missense_Mutation_p.T37A|UXS1_ENST00000283148.7_Missense_Mutation_p.T99A			Q8NBZ7	UXS1_HUMAN	UDP-glucuronate decarboxylase 1	94					protein tetramerization (GO:0051262)|UDP-D-xylose biosynthetic process (GO:0033320)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	NAD+ binding (GO:0070403)|protein homodimerization activity (GO:0042803)|UDP-glucuronate decarboxylase activity (GO:0048040)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)	17						GCGCCTCCTGTTATCTGCATC	0.562																																						dbGAP											0													64.0	64.0	64.0					2																	106761823		2112	4234	6346	-	-	-	SO:0001583	missense	0			AK027244	CCDS46378.1, CCDS58720.1, CCDS58721.1	2q12.2	2012-02-22			ENSG00000115652	ENSG00000115652	4.1.1.35	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	17729	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 6E, member 12"""	609749				19027726	Standard	NM_001253875		Approved	FLJ23591, UGD, SDR6E1	uc002tdn.3	Q8NBZ7	OTTHUMG00000153150	ENST00000409501.3:c.280A>G	2.37:g.106761823T>C	ENSP00000387019:p.Thr94Ala		Q8NBX3|Q9H5C2	Missense_Mutation	SNP	pfam_Epimerase_deHydtase,pfam_UXS1_N,pfam_dTDP_dehydrorham_reduct,pfam_Male_sterile_NAD-bd,pfam_3Beta_OHSteriod_DH/Estase	p.T99A	ENST00000409501.3	37	c.295	CCDS46378.1	2	.	.	.	.	.	.	.	.	.	.	T	16.50	3.142054	0.57044	.	.	ENSG00000115652	ENST00000283148;ENST00000540130;ENST00000409501;ENST00000457835	D;D;D;D	0.95171	-3.63;-3.63;-3.63;-3.63	5.84	5.84	0.93424	NAD-dependent epimerase/dehydratase (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.94509	0.8232	M	0.68317	2.08	0.80722	D	1	B;P	0.35328	0.44;0.495	B;B	0.40901	0.232;0.343	D	0.94423	0.7642	10	0.66056	D	0.02	-8.8177	16.2141	0.82191	0.0:0.0:0.0:1.0	.	99;94	Q8NBZ7-2;Q8NBZ7	.;UXS1_HUMAN	A	99;37;94;37	ENSP00000283148:T99A;ENSP00000438265:T37A;ENSP00000387019:T94A;ENSP00000399316:T37A	ENSP00000283148:T99A	T	-	1	0	UXS1	106128255	1.000000	0.71417	0.977000	0.42913	0.251000	0.25915	7.665000	0.83852	2.230000	0.72887	0.528000	0.53228	ACA	UXS1	-	pfam_Epimerase_deHydtase,pfam_dTDP_dehydrorham_reduct,pfam_3Beta_OHSteriod_DH/Estase	ENSG00000115652		0.562	UXS1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	UXS1	HGNC	protein_coding	OTTHUMT00000329778.1	150	0.00	0	T	NM_025076.3		106761823	106761823	-1	no_errors	ENST00000283148	ensembl	human	known	69_37n	missense	90	23.73	28	SNP	1.000	C
VEZF1	7716	genome.wustl.edu	37	17	56056604	56056605	+	In_Frame_Ins	INS	-	-	TGC	rs61731354|rs57786397|rs138088904|rs369163670	byFrequency	TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr17:56056604_56056605insTGC	ENST00000581208.1	-	5	1086_1087	c.1046_1047insGCA	c.(1045-1047)caa>caGCAa	p.349_349Q>QQ	VEZF1_ENST00000584396.1_In_Frame_Ins_p.340_340Q>QQ	NM_007146.2	NP_009077.2	Q14119	VEZF1_HUMAN	vascular endothelial zinc finger 1	349	Poly-Gln.				angiogenesis (GO:0001525)|cellular defense response (GO:0006968)|endothelial cell development (GO:0001885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(2)|lung(5)|ovary(1)	10						gttgttgttgttgctgctgctg	0.465																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			D28118	CCDS32687.1	17q22	2012-10-05	2006-08-16	2006-08-16	ENSG00000136451	ENSG00000136451		"""Zinc fingers, C2H2-type"""	12949	protein-coding gene	gene with protein product		606747	"""zinc finger protein 161"""	ZNF161		8035792	Standard	XM_005257643		Approved	DB1	uc002ivf.1	Q14119	OTTHUMG00000178777	ENST00000581208.1:c.1044_1046dupGCA	17.37:g.56056611_56056613dupTGC	ENSP00000462337:p.Gln354dup			In_Frame_Ins	INS	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.353in_frame_insQ	ENST00000581208.1	37	c.1047_1046	CCDS32687.1	17																																																																																			VEZF1	-	NULL	ENSG00000136451		0.465	VEZF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VEZF1	HGNC	protein_coding	OTTHUMT00000443321.1	144	0.00	0	-			56056604	56056605	-1	no_errors	ENST00000581208	ensembl	human	known	69_37n	in_frame_ins	123	13.38	19	INS	0.934:0.940	TGC
TBC1D31	93594	genome.wustl.edu	37	8	124121778	124121778	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr8:124121778G>C	ENST00000287380.1	+	10	1444	c.1354G>C	c.(1354-1356)Gat>Cat	p.D452H	TBC1D31_ENST00000378080.2_Missense_Mutation_p.D347H|TBC1D31_ENST00000522420.1_Missense_Mutation_p.D347H|TBC1D31_ENST00000309336.3_Missense_Mutation_p.D452H|TBC1D31_ENST00000521676.1_Missense_Mutation_p.D329H|TBC1D31_ENST00000327098.5_Missense_Mutation_p.D452H|TBC1D31_ENST00000518805.1_Missense_Mutation_p.D85H	NM_145647.3	NP_663622.2	Q96DN5	TBC31_HUMAN	TBC1 domain family, member 31	452	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.					centrosome (GO:0005813)	Rab GTPase activator activity (GO:0005097)										TACCCTCATAGATAAGGGGAC	0.373																																						dbGAP											0													126.0	130.0	129.0					8																	124121778		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK094612	CCDS6338.1, CCDS47916.1	8q24.13	2013-07-10	2013-07-10	2013-07-10	ENSG00000156787	ENSG00000156787		"""WD repeat domain containing"""	30888	protein-coding gene	gene with protein product			"""WD repeat domain 67"""	WDR67		12477932	Standard	NM_001145088		Approved	MGC21654, Gm85	uc003ypp.2	Q96DN5	OTTHUMG00000165081	ENST00000287380.1:c.1354G>C	8.37:g.124121778G>C	ENSP00000287380:p.Asp452His		B7ZL19|Q2M2J9|Q3MIR6|Q8TBP9	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_Rab-GTPase-TBC_dom,smart_WD40_repeat,pfscan_Rab-GTPase-TBC_dom,pfscan_WD40_repeat_dom	p.D452H	ENST00000287380.1	37	c.1354	CCDS6338.1	8	.	.	.	.	.	.	.	.	.	.	G	21.9	4.216426	0.79352	.	.	ENSG00000156787	ENST00000287380;ENST00000309336;ENST00000519418;ENST00000327098;ENST00000522420;ENST00000521676;ENST00000378080;ENST00000518805	T;T;T;T;T;T;T;T	0.36520	1.25;1.25;1.25;1.25;1.25;1.25;1.25;1.25	5.29	5.29	0.74685	Rab-GAP/TBC domain (1);	0.047185	0.85682	D	0.000000	T	0.61726	0.2370	M	0.72118	2.19	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.99;0.979;0.995	T	0.65372	-0.6184	10	0.87932	D	0	-24.0969	18.9236	0.92536	0.0:0.0:1.0:0.0	.	452;347;452	B7ZL19;E7ERK7;Q96DN5	.;.;WDR67_HUMAN	H	452;452;120;452;347;329;347;85	ENSP00000287380:D452H;ENSP00000308358:D452H;ENSP00000430927:D120H;ENSP00000312701:D452H;ENSP00000429334:D347H;ENSP00000430628:D329H;ENSP00000367320:D347H;ENSP00000429494:D85H	ENSP00000287380:D452H	D	+	1	0	WDR67	124190959	1.000000	0.71417	0.901000	0.35422	0.724000	0.41520	8.959000	0.93110	2.465000	0.83290	0.491000	0.48974	GAT	WDR67	-	pfscan_Rab-GTPase-TBC_dom	ENSG00000156787		0.373	TBC1D31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR67	HGNC	protein_coding	OTTHUMT00000381721.1	960	0.00	0	G	NM_145647		124121778	124121778	+1	no_errors	ENST00000287380	ensembl	human	known	69_37n	missense	71	10.13	8	SNP	1.000	C
ZC3H13	23091	genome.wustl.edu	37	13	46616315	46616315	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr13:46616315G>A	ENST00000242848.4	-	4	671	c.323C>T	c.(322-324)tCa>tTa	p.S108L	ZC3H13_ENST00000282007.3_Missense_Mutation_p.S108L			Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	108							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|lung(25)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	79		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		AGGTGAGGATGACTCCTCTGT	0.398																																					Esophageal Squamous(187;747 2077 11056 31291 44172)	dbGAP											0													185.0	167.0	173.0					13																	46616315		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020660	CCDS9400.1	13q14.11	2012-07-05	2006-05-15	2006-05-15	ENSG00000123200	ENSG00000123200		"""Zinc fingers, CCCH-type domain containing"""	20368	protein-coding gene	gene with protein product			"""KIAA0853"""	KIAA0853		10048485	Standard	XM_005266301		Approved	DKFZp434D1812	uc001vas.1	Q5T200	OTTHUMG00000016863	ENST00000242848.4:c.323C>T	13.37:g.46616315G>A	ENSP00000242848:p.Ser108Leu		A2A323|O94936|Q5T1Z9|Q7Z7J3|Q8NDT6|Q9H0L6	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.S108L	ENST00000242848.4	37	c.323		13	.	.	.	.	.	.	.	.	.	.	G	15.36	2.809536	0.50421	.	.	ENSG00000123200	ENST00000242848;ENST00000282007;ENST00000428921	T;T	0.32753	2.37;1.44	5.43	5.43	0.79202	.	0.137984	0.33419	N	0.004936	T	0.24122	0.0584	N	0.24115	0.695	0.80722	D	1	B;P	0.35272	0.361;0.493	B;B	0.35971	0.081;0.215	T	0.04900	-1.0919	10	0.49607	T	0.09	.	14.9163	0.70801	0.0:0.0:0.8563:0.1437	.	108;108	Q5T200;Q5T200-2	ZC3HD_HUMAN;.	L	108	ENSP00000242848:S108L;ENSP00000282007:S108L	ENSP00000242848:S108L	S	-	2	0	ZC3H13	45514316	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.055000	0.76656	2.557000	0.86248	0.467000	0.42956	TCA	ZC3H13	-	NULL	ENSG00000123200		0.398	ZC3H13-001	KNOWN	basic|appris_candidate_longest	protein_coding	ZC3H13	HGNC	protein_coding	OTTHUMT00000044789.1	613	0.00	0	G	NM_015070		46616315	46616315	-1	no_errors	ENST00000242848	ensembl	human	known	69_37n	missense	82	29.31	34	SNP	1.000	A
ZC3H3	23144	genome.wustl.edu	37	8	144550824	144550824	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr8:144550824G>C	ENST00000262577.5	-	6	1940	c.1909C>G	c.(1909-1911)Ctg>Gtg	p.L637V		NM_015117.2	NP_055932.2	Q8IXZ2	ZC3H3_HUMAN	zinc finger CCCH-type containing 3	637					mRNA polyadenylation (GO:0006378)|poly(A)+ mRNA export from nucleus (GO:0016973)|regulation of mRNA export from nucleus (GO:0010793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)			GCAGGATCCAGCCGGCCTGTG	0.687																																						dbGAP											0													27.0	32.0	30.0					8																	144550824		2114	4158	6272	-	-	-	SO:0001583	missense	0			D63484	CCDS6402.1	8q24.3	2012-07-05	2005-06-02	2005-06-02	ENSG00000014164	ENSG00000014164		"""Zinc fingers, CCCH-type domain containing"""	28972	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 3"""	ZC3HDC3		8590280	Standard	NM_015117		Approved	KIAA0150	uc003yyd.2	Q8IXZ2	OTTHUMG00000165127	ENST00000262577.5:c.1909C>G	8.37:g.144550824G>C	ENSP00000262577:p.Leu637Val		Q14163|Q8N4E2|Q9BUS4	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.L637V	ENST00000262577.5	37	c.1909	CCDS6402.1	8	.	.	.	.	.	.	.	.	.	.	G	12.19	1.864112	0.32884	.	.	ENSG00000014164	ENST00000262577	T	0.03152	4.03	4.5	-1.68	0.08212	.	0.733423	0.11771	N	0.531159	T	0.03608	0.0103	M	0.64997	1.995	0.09310	N	1	B	0.25772	0.134	B	0.20577	0.03	T	0.43956	-0.9359	10	0.23891	T	0.37	.	2.1967	0.03913	0.2194:0.145:0.489:0.1465	.	637	Q8IXZ2	ZC3H3_HUMAN	V	637	ENSP00000262577:L637V	ENSP00000262577:L637V	L	-	1	2	ZC3H3	144621967	0.000000	0.05858	0.151000	0.22473	0.865000	0.49528	-2.226000	0.01211	-0.648000	0.05437	0.467000	0.42956	CTG	ZC3H3	-	NULL	ENSG00000014164		0.687	ZC3H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H3	HGNC	protein_coding	OTTHUMT00000382011.2	37	0.00	0	G	NM_015117		144550824	144550824	-1	no_errors	ENST00000262577	ensembl	human	known	69_37n	missense	65	15.58	12	SNP	0.070	C
ZNF200	7752	genome.wustl.edu	37	16	3282891	3282891	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr16:3282891G>A	ENST00000431561.3	-	3	893	c.281C>T	c.(280-282)cCc>cTc	p.P94L	ZNF200_ENST00000396868.3_Missense_Mutation_p.P94L|ZNF200_ENST00000575948.1_Missense_Mutation_p.P94L|ZNF200_ENST00000414144.2_Missense_Mutation_p.P94L|ZNF200_ENST00000396871.4_Missense_Mutation_p.P94L|ZNF200_ENST00000396870.4_Missense_Mutation_p.P94L	NM_001145447.1|NM_003454.3	NP_001138919.1|NP_003445.2	P98182	ZN200_HUMAN	zinc finger protein 200	94					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(2)|kidney(2)|large_intestine(4)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	17						GACTCCTTTGGGCAGAAGCTT	0.473																																						dbGAP											0													103.0	91.0	95.0					16																	3282891		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF060866	CCDS10497.1, CCDS42112.1, CCDS45395.1	16p13.3	2013-01-08			ENSG00000010539	ENSG00000010539		"""Zinc fingers, C2H2-type"""	12993	protein-coding gene	gene with protein product		603231				9288094, 9787081	Standard	NM_003454		Approved		uc002cuk.2	P98182	OTTHUMG00000129317	ENST00000431561.3:c.281C>T	16.37:g.3282891G>A	ENSP00000395723:p.Pro94Leu		D3DUB7|D3DUB8|O15361|Q5XKM5|Q7Z5V1	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P94L	ENST00000431561.3	37	c.281	CCDS10497.1	16	.	.	.	.	.	.	.	.	.	.	G	15.19	2.758961	0.49468	.	.	ENSG00000010539	ENST00000396870;ENST00000396868;ENST00000396871;ENST00000414144;ENST00000431561	T;T;T;T;T	0.08193	3.15;3.12;3.15;3.25;3.25	5.1	4.13	0.48395	.	0.415062	0.17922	N	0.157470	T	0.13756	0.0333	L	0.54323	1.7	0.36503	D	0.869101	P;P;P	0.40431	0.594;0.594;0.717	B;B;P	0.44990	0.276;0.276;0.466	T	0.08046	-1.0741	10	0.66056	D	0.02	-13.9793	11.864	0.52482	0.0:0.1764:0.8236:0.0	.	94;94;94	D3DUB7;P98182;P98182-2	.;ZN200_HUMAN;.	L	94	ENSP00000380079:P94L;ENSP00000380077:P94L;ENSP00000380080:P94L;ENSP00000405786:P94L;ENSP00000395723:P94L	ENSP00000380077:P94L	P	-	2	0	ZNF200	3222892	0.990000	0.36364	0.992000	0.48379	0.760000	0.43138	2.617000	0.46385	1.263000	0.44181	0.650000	0.86243	CCC	ZNF200	-	NULL	ENSG00000010539		0.473	ZNF200-005	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZNF200	HGNC	protein_coding	OTTHUMT00000437545.1	321	0.00	0	G			3282891	3282891	-1	no_errors	ENST00000414144	ensembl	human	known	69_37n	missense	52	32.05	25	SNP	0.992	A
ZNF300P1	134466	genome.wustl.edu	37	5	150322220	150322220	+	RNA	SNP	C	C	T			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr5:150322220C>T	ENST00000520773.1	-	0	1264									zinc finger protein 300 pseudogene 1 (functional)																		ACAGCCACATCCTCAAATGAC	0.463																																						dbGAP											0																																										-	-	-			0			AK096536		5q33.1	2014-09-11	2014-01-16		ENSG00000197083	ENSG00000197083		"""-"""	27032	pseudogene	pseudogene			"""zinc finger protein 300 pseudogene 1"""			24393131	Standard	NR_026867		Approved		uc003lsz.1		OTTHUMG00000154830		5.37:g.150322220C>T				RNA	SNP	-	NULL	ENST00000520773.1	37	NULL		5																																																																																			ZNF300P1	-	-	ENSG00000197083		0.463	ZNF300P1-002	KNOWN	basic	processed_transcript	ZNF300P1	HGNC	pseudogene	OTTHUMT00000374771.1	304	0.00	0	C	NR_026867		150322220	150322220	-1	no_errors	ENST00000520773	ensembl	human	known	69_37n	rna	34	26.09	12	SNP	0.975	T
ZNF626	199777	genome.wustl.edu	37	19	20808343	20808344	+	Nonsense_Mutation	DNP	TT	TT	AA			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr19:20808343_20808344TT>AA	ENST00000601440.1	-	4	485_486	c.339_340AA>TT	c.(337-342)ttAAaa>ttTTaa	p.113_114LK>F*	CTC-513N18.7_ENST00000595094.1_lincRNA	NM_001076675.2	NP_001070143.1	Q68DY1	ZN626_HUMAN	zinc finger protein 626	113					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|lung(3)|skin(1)	6						CATCCTTTTTTTAACTGTAAAT	0.351																																						dbGAP											0																																										-	-	-	SO:0001587	stop_gained	0			BC007116	CCDS32976.1, CCDS42535.1	19p13.11	2013-01-08				ENSG00000188171		"""Zinc fingers, C2H2-type"", ""-"""	30461	protein-coding gene	gene with protein product						12477932	Standard	NM_145297		Approved		uc002npb.1	Q68DY1		ENST00000601440.1:c.339_340delinsAA	19.37:g.20808343_20808344delinsAA	ENSP00000469958:p.L113_K114delinsF*		Q8N8T4|Q96QM1	Nonsense_Mutation|Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K114*|p.L113F	ENST00000601440.1	37	c.340|c.339	CCDS42535.1	19																																																																																			ZNF626	-	NULL	ENSG00000188171		0.351	ZNF626-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF626	HGNC	protein_coding	OTTHUMT00000447845.2	602|598	0.00	0	T	NM_145297		20808343|20808344	20808343|20808344	-1	no_errors	ENST00000305570	ensembl	human	known	69_37n	nonsense|missense	60|59	25.93|26.25	21	SNP	0.001	A
ZNF710	374655	genome.wustl.edu	37	15	90617463	90617463	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr15:90617463A>G	ENST00000268154.4	+	4	2017	c.1766A>G	c.(1765-1767)aAc>aGc	p.N589S	RP11-617F23.1_ENST00000558334.1_RNA	NM_198526.2	NP_940928.2	Q8N1W2	ZN710_HUMAN	zinc finger protein 710	589					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(1)|ovary(2)|prostate(1)|stomach(1)|urinary_tract(3)	19	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.00769)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.129)			CTCAAGGGCAACCTGAGCCGG	0.582																																						dbGAP											0													60.0	52.0	55.0					15																	90617463		2200	4298	6498	-	-	-	SO:0001583	missense	0			AK094712	CCDS10358.1	15q26.1	2013-01-08			ENSG00000140548	ENSG00000140548		"""Zinc fingers, C2H2-type"""	25352	protein-coding gene	gene with protein product							Standard	XM_005254905		Approved	DKFZp547K1113, FLJ37393, FLJ00306	uc002bov.2	Q8N1W2	OTTHUMG00000149812	ENST00000268154.4:c.1766A>G	15.37:g.90617463A>G	ENSP00000268154:p.Asn589Ser		A0AVS3|Q6ZMK9|Q8NDU0	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.N589S	ENST00000268154.4	37	c.1766	CCDS10358.1	15	.	.	.	.	.	.	.	.	.	.	A	21.0	4.075639	0.76415	.	.	ENSG00000140548	ENST00000268154	T	0.03272	3.99	5.2	5.2	0.72013	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.072713	0.49916	N	0.000131	T	0.03783	0.0107	N	0.11724	0.165	0.48452	D	0.999658	P	0.42735	0.788	P	0.44772	0.46	T	0.62784	-0.6781	10	0.33940	T	0.23	-68.888	14.044	0.64693	1.0:0.0:0.0:0.0	.	589	Q8N1W2	ZN710_HUMAN	S	589	ENSP00000268154:N589S	ENSP00000268154:N589S	N	+	2	0	ZNF710	88418467	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.139000	0.94554	2.183000	0.69458	0.528000	0.53228	AAC	ZNF710	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000140548		0.582	ZNF710-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF710	HGNC	protein_coding	OTTHUMT00000313423.1	67	0.00	0	A	NM_198526		90617463	90617463	+1	no_errors	ENST00000268154	ensembl	human	known	69_37n	missense	34	29.17	14	SNP	1.000	G
ZNF804B	219578	genome.wustl.edu	37	7	88963479	88963479	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr7:88963479C>A	ENST00000333190.4	+	4	1792	c.1183C>A	c.(1183-1185)Caa>Aaa	p.Q395K		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	395							metal ion binding (GO:0046872)	p.Q395K(1)		NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			GCCAAGTGAACAAAAGAGTAC	0.383										HNSCC(36;0.09)																												dbGAP											1	Substitution - Missense(1)	large_intestine(1)											46.0	52.0	50.0					7																	88963479		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.1183C>A	7.37:g.88963479C>A	ENSP00000329638:p.Gln395Lys		B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz	p.Q395K	ENST00000333190.4	37	c.1183	CCDS5613.1	7	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.339630	0.00224	.	.	ENSG00000182348	ENST00000333190	T	0.04706	3.57	5.19	-0.447	0.12234	.	0.499250	0.18623	N	0.135813	T	0.02767	0.0083	L	0.33485	1.01	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.48210	-0.9055	10	0.05436	T	0.98	-2.3582	5.8442	0.18657	0.4895:0.3349:0.1111:0.0645	.	395	A4D1E1	Z804B_HUMAN	K	395	ENSP00000329638:Q395K	ENSP00000329638:Q395K	Q	+	1	0	ZNF804B	88801415	0.017000	0.18338	0.072000	0.20136	0.138000	0.21146	0.203000	0.17315	0.021000	0.15133	-0.182000	0.12963	CAA	ZNF804B	-	NULL	ENSG00000182348		0.383	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804B	HGNC	protein_coding	OTTHUMT00000253683.2	182	0.00	0	C	NM_181646		88963479	88963479	+1	no_errors	ENST00000333190	ensembl	human	known	69_37n	missense	34	22.73	10	SNP	0.008	A
ZSCAN23	222696	genome.wustl.edu	37	6	28403872	28403872	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18V-06A-11D-A20S-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb47d473-a728-45a4-ac9c-606c08e97cbc	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr6:28403872C>G	ENST00000289788.4	-	2	317	c.172G>C	c.(172-174)Gag>Cag	p.E58Q	ZSCAN23_ENST00000486481.1_Intron	NM_001012455.1	NP_001012458.1	Q3MJ62	ZSC23_HUMAN	zinc finger and SCAN domain containing 23	58	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|prostate(1)|stomach(2)	4						CCAGGGGACTCCTGATAGCAG	0.547																																						dbGAP											0													27.0	28.0	28.0					6																	28403872		692	1591	2283	-	-	-	SO:0001583	missense	0			AK092117	CCDS47393.1	6p21.33	2013-01-08	2007-02-20	2007-02-20	ENSG00000187987	ENSG00000187987		"""-"", ""Zinc fingers, C2H2-type"""	21193	protein-coding gene	gene with protein product			"""zinc finger protein 453"", ""zinc finger protein 390"""	ZNF453, ZNF390			Standard	NM_001012455		Approved	dJ29K1.3.1	uc003nli.4	Q3MJ62	OTTHUMG00000016346	ENST00000289788.4:c.172G>C	6.37:g.28403872C>G	ENSP00000289788:p.Glu58Gln		Q96KV9	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.E58Q	ENST00000289788.4	37	c.172	CCDS47393.1	6	.	.	.	.	.	.	.	.	.	.	C	20.3	3.973462	0.74246	.	.	ENSG00000187987	ENST00000289788	T	0.08008	3.14	3.6	3.6	0.41247	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.000000	0.43260	D	0.000592	T	0.27063	0.0663	H	0.94582	3.555	0.27780	N	0.943173	D;D	0.89917	0.996;1.0	D;D	0.70487	0.944;0.969	T	0.12319	-1.0552	10	0.87932	D	0	.	13.5359	0.61646	0.0:1.0:0.0:0.0	.	58;58	G3V1D5;Q3MJ62	.;ZSC23_HUMAN	Q	58	ENSP00000289788:E58Q	ENSP00000289788:E58Q	E	-	1	0	ZSCAN23	28511851	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	3.431000	0.52814	2.272000	0.75746	0.557000	0.71058	GAG	ZSCAN23	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN	ENSG00000187987		0.547	ZSCAN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN23	HGNC	protein_coding	OTTHUMT00000043751.2	124	0.00	0	C	XM_167147		28403872	28403872	-1	no_errors	ENST00000289788	ensembl	human	known	69_37n	missense	50	25.37	17	SNP	1.000	G
