#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AKT3	10000	genome.wustl.edu	37	1	243828162	243828162	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A1EO-01A-11D-A135-09	TCGA-BH-A1EO-11A-31D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20131381-8a11-425d-8954-980e6ec7c427	cb2284f3-6d08-40ec-bf36-dfa349354c59	g.chr1:243828162G>A	ENST00000366539.1	-	4	396	c.196C>T	c.(196-198)Cga>Tga	p.R66*	AKT3_ENST00000263826.5_Nonsense_Mutation_p.R66*|AKT3_ENST00000336199.5_Nonsense_Mutation_p.R66*|AKT3_ENST00000366540.1_Nonsense_Mutation_p.R66*			Q9Y243	AKT3_HUMAN	v-akt murine thymoma viral oncogene homolog 3	66	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				mitochondrial genome maintenance (GO:0000002)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|skin(3)|stomach(1)	26	all_cancers(71;0.000307)|all_epithelial(71;0.000374)|all_lung(81;0.0323)|Ovarian(71;0.0619)|all_neural(11;0.101)|Lung NSC(105;0.168)	all_cancers(173;0.0274)	all cancers(7;4.3e-08)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00196)			GGCTTTGGTCGTTCTGTTTTC	0.299																																						dbGAP											0													154.0	151.0	152.0					1																	243828162		2202	4300	6502	-	-	-	SO:0001587	stop_gained	0			AF124141	CCDS31076.1, CCDS31077.1	1q44	2013-07-09	2013-07-09		ENSG00000117020	ENSG00000117020	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	393	protein-coding gene	gene with protein product	"""protein kinase B, gamma"""	611223				10092583, 10208883	Standard	NM_005465		Approved	PKBG, RAC-gamma, PRKBG	uc001iab.2	Q9Y243	OTTHUMG00000039994	ENST00000366539.1:c.196C>T	1.37:g.243828162G>A	ENSP00000355497:p.Arg66*		Q0VAA6|Q5VTI1|Q5VTI2|Q96QV3|Q9UFP5	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pleckstrin_homology,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom	p.R66*	ENST00000366539.1	37	c.196	CCDS31077.1	1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.480297	0.84747	.	.	ENSG00000117020	ENST00000336199;ENST00000366540;ENST00000366539;ENST00000263826;ENST00000552631	.	.	.	6.08	5.15	0.70609	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.652	0.85219	0.0:0.0:0.8691:0.1309	.	.	.	.	X	66	.	ENSP00000263826:R66X	R	-	1	2	AKT3	241894785	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.191000	0.58372	1.538000	0.49270	0.655000	0.94253	CGA	AKT3	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000117020		0.299	AKT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKT3	HGNC	protein_coding	OTTHUMT00000096479.1	311	0.00	0	G	NM_181690		243828162	243828162	-1	no_errors	ENST00000263826	ensembl	human	known	69_37n	nonsense	232	43.41	178	SNP	1.000	A
AP2A1	160	genome.wustl.edu	37	19	50302640	50302640	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A1EO-01A-11D-A135-09	TCGA-BH-A1EO-11A-31D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20131381-8a11-425d-8954-980e6ec7c427	cb2284f3-6d08-40ec-bf36-dfa349354c59	g.chr19:50302640G>C	ENST00000359032.5	+	9	1022	c.1022G>C	c.(1021-1023)cGg>cCg	p.R341P	AP2A1_ENST00000354293.5_Missense_Mutation_p.R341P	NM_014203.2	NP_055018.2	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1 subunit	341					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Golgi to endosome transport (GO:0006895)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	AP-2 adaptor complex (GO:0030122)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)	19		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		CTGCAGCACCGGGAGACCAAC	0.622																																						dbGAP											0													24.0	28.0	26.0					19																	50302640		2092	4208	6300	-	-	-	SO:0001583	missense	0			AA993745	CCDS46148.1, CCDS46149.1	19q13.3	2008-05-23				ENSG00000196961			561	protein-coding gene	gene with protein product		601026		CLAPA1, ADTAA		2564002	Standard	NM_014203		Approved		uc002ppn.3	O95782		ENST00000359032.5:c.1022G>C	19.37:g.50302640G>C	ENSP00000351926:p.Arg341Pro		Q96CI7|Q96PP6|Q96PP7|Q9H070	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_Clathrin_a-adaptin_app_sub_C,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/calthrin_app_sub_C,superfamily_Coatomer/clathrin_app_Ig-like,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP2_complex_asu	p.R341P	ENST00000359032.5	37	c.1022	CCDS46148.1	19	.	.	.	.	.	.	.	.	.	.	G	25.9	4.688693	0.88639	.	.	ENSG00000196961	ENST00000354293;ENST00000359032	T;T	0.24908	1.83;1.83	4.25	4.25	0.50352	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.51907	0.1702	M	0.77103	2.36	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.989;0.991	T	0.58679	-0.7594	10	0.66056	D	0.02	.	15.5794	0.76422	0.0:0.0:1.0:0.0	.	341;341	O95782-2;O95782	.;AP2A1_HUMAN	P	341	ENSP00000346246:R341P;ENSP00000351926:R341P	ENSP00000346246:R341P	R	+	2	0	AP2A1	54994452	1.000000	0.71417	0.997000	0.53966	0.978000	0.69477	9.575000	0.98187	2.211000	0.71520	0.561000	0.74099	CGG	AP2A1	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP2_complex_asu	ENSG00000196961		0.622	AP2A1-008	NOVEL	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	AP2A1	HGNC	protein_coding	OTTHUMT00000465809.1	15	0.00	0	G			50302640	50302640	+1	no_errors	ENST00000359032	ensembl	human	known	69_37n	missense	10	41.18	7	SNP	1.000	C
ARHGEF7	8874	genome.wustl.edu	37	13	111927898	111927898	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1EO-01A-11D-A135-09	TCGA-BH-A1EO-11A-31D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20131381-8a11-425d-8954-980e6ec7c427	cb2284f3-6d08-40ec-bf36-dfa349354c59	g.chr13:111927898G>A	ENST00000375741.2	+	13	1605	c.1355G>A	c.(1354-1356)cGg>cAg	p.R452Q	ARHGEF7_ENST00000218789.5_Missense_Mutation_p.R274Q|ARHGEF7_ENST00000375736.4_Missense_Mutation_p.R274Q|ARHGEF7_ENST00000375739.2_Missense_Mutation_p.R402Q|ARHGEF7_ENST00000483189.1_3'UTR|ARHGEF7_ENST00000375737.5_Missense_Mutation_p.R349Q|ARHGEF7_ENST00000375723.1_Missense_Mutation_p.R274Q|ARHGEF7_ENST00000370623.3_Missense_Mutation_p.R359Q|ARHGEF7_ENST00000426073.2_Missense_Mutation_p.R274Q|ARHGEF7_ENST00000317133.5_Missense_Mutation_p.R431Q|ARHGEF7_ENST00000478679.1_Missense_Mutation_p.R196Q|ARHGEF7_ENST00000544132.1_Missense_Mutation_p.R108Q	NM_001113511.1|NM_145735.2	NP_001106983.1|NP_663788.1	Q14155	ARHG7_HUMAN	Rho guanine nucleotide exchange factor (GEF) 7	452					apoptotic signaling pathway (GO:0097190)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|hematopoietic progenitor cell differentiation (GO:0002244)|lamellipodium assembly (GO:0030032)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of GTPase activity (GO:0043547)|positive regulation of lamellipodium morphogenesis (GO:2000394)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase binding (GO:0019901)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	41	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.188)			CAAGAAGTCCGGAAGAGGAAA	0.478																																						dbGAP											0													132.0	120.0	124.0					13																	111927898		2203	4300	6503	-	-	-	SO:0001583	missense	0			D63476	CCDS9521.1, CCDS32009.1, CCDS45068.1, CCDS45069.1	13q33.3	2013-01-10			ENSG00000102606	ENSG00000102606		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15607	protein-coding gene	gene with protein product	"""SH3 domain-containing proline-rich protein"", ""PAK-interacting exchange factor beta"", ""rho"", ""guanine nucleotide exchange factor 7"""	605477				9207241, 9726964	Standard	NM_003899		Approved	KIAA0142, PIXB, DKFZp761K1021, Nbla10314, DKFZp686C12170, BETA-PIX, COOL1, P85SPR, P85, P85COOL1, P50BP, PAK3, P50	uc001vrs.2	Q14155	OTTHUMG00000017357	ENST00000375741.2:c.1355G>A	13.37:g.111927898G>A	ENSP00000364893:p.Arg452Gln		B1ALK6|B1ALK8|Q3LIA4|Q5W9H0|Q6P9G3|Q6PII2|Q86W63|Q8N3M1	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_2,pfam_SH3_domain,pfam_Pleckstrin_homology,pfam_CH-domain,superfamily_DH-domain,superfamily_CH-domain,superfamily_SH3_domain,smart_CH-domain,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,prints_SH3_domain,pfscan_CH-domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.R452Q	ENST00000375741.2	37	c.1355	CCDS45068.1	13	.	.	.	.	.	.	.	.	.	.	G	35	5.531078	0.96446	.	.	ENSG00000102606	ENST00000317133;ENST00000375741;ENST00000375739;ENST00000370623;ENST00000545635;ENST00000466143;ENST00000544132;ENST00000218789;ENST00000375736;ENST00000426073;ENST00000375737;ENST00000375723;ENST00000478679	T;T;T;T;T;T;T;T;T;T;T	0.17054	2.3;2.3;2.3;2.3;2.3;2.3;2.3;2.3;2.3;2.3;2.3	5.25	5.25	0.73442	Dbl homology (DH) domain (2);	0.128071	0.53938	D	0.000047	T	0.48223	0.1488	M	0.90252	3.1	0.80722	D	1	P;D;D;P;D;P	0.65815	0.924;0.995;0.969;0.795;0.972;0.951	P;P;P;P;P;P	0.59643	0.648;0.861;0.648;0.461;0.48;0.679	T	0.59037	-0.7529	10	0.72032	D	0.01	.	19.2523	0.93930	0.0:0.0:1.0:0.0	.	196;349;196;402;452;431	E9PDQ5;B7Z6G2;B7Z344;Q14155-2;Q14155;Q14155-3	.;.;.;.;ARHG7_HUMAN;.	Q	431;452;402;359;429;274;108;274;274;274;349;274;196	ENSP00000325994:R431Q;ENSP00000364893:R452Q;ENSP00000364891:R402Q;ENSP00000359657:R359Q;ENSP00000418067:R274Q;ENSP00000218789:R274Q;ENSP00000364888:R274Q;ENSP00000397068:R274Q;ENSP00000364889:R349Q;ENSP00000364875:R274Q;ENSP00000417596:R196Q	ENSP00000218789:R274Q	R	+	2	0	ARHGEF7	110725899	1.000000	0.71417	0.506000	0.27664	0.965000	0.64279	9.249000	0.95470	2.617000	0.88574	0.650000	0.86243	CGG	ARHGEF7	-	superfamily_DH-domain	ENSG00000102606		0.478	ARHGEF7-204	KNOWN	basic|CCDS	protein_coding	ARHGEF7	HGNC	protein_coding		150	0.00	0	G	NM_001113511		111927898	111927898	+1	no_errors	ENST00000375741	ensembl	human	known	69_37n	missense	146	15.12	26	SNP	1.000	A
ARID1A	8289	genome.wustl.edu	37	1	27057934	27057934	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A1EO-01A-11D-A135-09	TCGA-BH-A1EO-11A-31D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20131381-8a11-425d-8954-980e6ec7c427	cb2284f3-6d08-40ec-bf36-dfa349354c59	g.chr1:27057934C>T	ENST00000324856.7	+	3	2013	c.1642C>T	c.(1642-1644)Cag>Tag	p.Q548*	ARID1A_ENST00000374152.2_Nonsense_Mutation_p.Q165*|ARID1A_ENST00000457599.2_Nonsense_Mutation_p.Q548*	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	548					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.Q548*(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		CCCCCAGAGCCAGCCCCCCTA	0.642			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																	dbGAP		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	1	Substitution - Nonsense(1)	ovary(1)											173.0	182.0	179.0					1																	27057934		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.1642C>T	1.37:g.27057934C>T	ENSP00000320485:p.Gln548*		D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.Q548*	ENST00000324856.7	37	c.1642	CCDS285.1	1	.	.	.	.	.	.	.	.	.	.	C	19.13	3.767717	0.69878	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152	.	.	.	5.44	5.44	0.79542	.	0.145657	0.47093	D	0.000260	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	-6.7819	14.9862	0.71351	0.0:0.858:0.142:0.0	.	.	.	.	X	548;548;165	.	ENSP00000320485:Q548X	Q	+	1	0	ARID1A	26930521	1.000000	0.71417	1.000000	0.80357	0.249000	0.25844	5.518000	0.67068	2.824000	0.97209	0.655000	0.94253	CAG	ARID1A	-	NULL	ENSG00000117713		0.642	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARID1A	HGNC	protein_coding	OTTHUMT00000011437.2	234	0.00	0	C	NM_139135		27057934	27057934	+1	no_errors	ENST00000324856	ensembl	human	known	69_37n	nonsense	140	43.32	107	SNP	1.000	T
ASB5	140458	genome.wustl.edu	37	4	177138077	177138077	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BH-A1EO-01A-11D-A135-09	TCGA-BH-A1EO-11A-31D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20131381-8a11-425d-8954-980e6ec7c427	cb2284f3-6d08-40ec-bf36-dfa349354c59	g.chr4:177138077delG	ENST00000296525.3	-	6	867	c.754delC	c.(754-756)ctgfs	p.L253fs	ASB5_ENST00000512254.1_Frame_Shift_Del_p.L200fs	NM_080874.3	NP_543150.1	Q8WWX0	ASB5_HUMAN	ankyrin repeat and SOCS box containing 5	253					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					endometrium(2)|kidney(1)|large_intestine(9)|lung(18)|prostate(2)|skin(2)	34		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.13e-20)|Epithelial(43;9.94e-18)|OV - Ovarian serous cystadenocarcinoma(60;2e-09)|GBM - Glioblastoma multiforme(59;0.000254)|STAD - Stomach adenocarcinoma(60;0.000653)|LUSC - Lung squamous cell carcinoma(193;0.0393)		AATTCTAGCAGTAAGTTTACA	0.413																																						dbGAP											0													198.0	188.0	191.0					4																	177138077		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AY057053	CCDS3827.1	4q34.1	2013-01-10	2011-01-25		ENSG00000164122	ENSG00000164122		"""Ankyrin repeat domain containing"""	17180	protein-coding gene	gene with protein product		615050	"""ankyrin repeat and SOCS box-containing 5"""				Standard	NM_080874		Approved		uc003iuq.2	Q8WWX0	OTTHUMG00000160793	ENST00000296525.3:c.754delC	4.37:g.177138077delG	ENSP00000296525:p.Leu253fs		Q8N7B5	Frame_Shift_Del	DEL	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C,prints_Ankyrin_rpt	p.L252fs	ENST00000296525.3	37	c.754	CCDS3827.1	4																																																																																			ASB5	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	ENSG00000164122		0.413	ASB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB5	HGNC	protein_coding	OTTHUMT00000362344.1	327	0.00	0	G			177138077	177138077	-1	no_errors	ENST00000296525	ensembl	human	known	69_37n	frame_shift_del	248	19.16	59	DEL	1.000	-
CDH7	1005	genome.wustl.edu	37	18	63547856	63547856	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1EO-01A-11D-A135-09	TCGA-BH-A1EO-11A-31D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20131381-8a11-425d-8954-980e6ec7c427	cb2284f3-6d08-40ec-bf36-dfa349354c59	g.chr18:63547856G>A	ENST00000397968.2	+	12	2510	c.2084G>A	c.(2083-2085)cGa>cAa	p.R695Q	CDH7_ENST00000323011.3_Missense_Mutation_p.R695Q	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	695					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				TTCCTGAGTCGACCAGCTTTT	0.458																																						dbGAP											0													91.0	97.0	95.0					18																	63547856		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.2084G>A	18.37:g.63547856G>A	ENSP00000381058:p.Arg695Gln		Q9H157	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R695Q	ENST00000397968.2	37	c.2084	CCDS11993.1	18	.	.	.	.	.	.	.	.	.	.	G	17.77	3.470720	0.63625	.	.	ENSG00000081138	ENST00000323011;ENST00000397966;ENST00000397968	T;T	0.76060	-0.99;-0.99	5.37	5.37	0.77165	Cadherin, cytoplasmic domain (1);	0.072966	0.52532	D	0.000061	T	0.72542	0.3473	L	0.31578	0.945	0.58432	D	0.999993	P	0.51653	0.947	P	0.49012	0.598	T	0.73408	-0.3992	10	0.42905	T	0.14	.	19.1123	0.93321	0.0:0.0:1.0:0.0	.	695	Q9ULB5	CADH7_HUMAN	Q	695	ENSP00000319166:R695Q;ENSP00000381058:R695Q	ENSP00000319166:R695Q	R	+	2	0	CDH7	61698836	1.000000	0.71417	0.853000	0.33588	0.545000	0.35147	8.897000	0.92532	2.515000	0.84797	0.655000	0.94253	CGA	CDH7	-	pfam_Cadherin_cytoplasmic-dom	ENSG00000081138		0.458	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH7	HGNC	protein_coding	OTTHUMT00000256217.2	194	0.00	0	G	NM_033646		63547856	63547856	+1	no_errors	ENST00000323011	ensembl	human	known	69_37n	missense	80	40.74	55	SNP	1.000	A
CDK5	1020	genome.wustl.edu	37	7	150752460	150752460	+	Splice_Site	SNP	C	C	A			TCGA-BH-A1EO-01A-11D-A135-09	TCGA-BH-A1EO-11A-31D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20131381-8a11-425d-8954-980e6ec7c427	cb2284f3-6d08-40ec-bf36-dfa349354c59	g.chr7:150752460C>A	ENST00000485972.1	-	8	1165	c.484G>T	c.(484-486)Gtg>Ttg	p.V162L	SLC4A2_ENST00000485713.1_5'Flank|CDK5_ENST00000297518.4_Splice_Site_p.V130L	NM_004935.3	NP_004926.1	Q00535	CDK5_HUMAN	cyclin-dependent kinase 5	162	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon extension (GO:0048675)|axon guidance (GO:0007411)|behavioral response to cocaine (GO:0048148)|blood coagulation (GO:0007596)|calcium ion import (GO:0070509)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|central nervous system neuron development (GO:0021954)|cerebellar cortex formation (GO:0021697)|corpus callosum development (GO:0022038)|cortical actin cytoskeleton organization (GO:0030866)|dendrite morphogenesis (GO:0048813)|embryo development (GO:0009790)|hippocampus development (GO:0021766)|intracellular protein transport (GO:0006886)|layer formation in cerebral cortex (GO:0021819)|motor neuron axon guidance (GO:0008045)|negative regulation of axon extension (GO:0030517)|negative regulation of cell cycle (GO:0045786)|negative regulation of neuron death (GO:1901215)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of proteolysis (GO:0045861)|negative regulation of synaptic plasticity (GO:0031914)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|nucleocytoplasmic transport (GO:0006913)|oligodendrocyte differentiation (GO:0048709)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphorylation (GO:0016310)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein targeting to membrane (GO:0090314)|protein autophosphorylation (GO:0046777)|protein localization to synapse (GO:0035418)|receptor catabolic process (GO:0032801)|receptor clustering (GO:0043113)|regulated secretory pathway (GO:0045055)|regulation of apoptotic process (GO:0042981)|regulation of cell cycle arrest (GO:0071156)|regulation of cell migration (GO:0030334)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|rhythmic process (GO:0048511)|Schwann cell development (GO:0014044)|sensory perception of pain (GO:0019233)|serine phosphorylation of STAT3 protein (GO:0033136)|skeletal muscle tissue development (GO:0007519)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle exocytosis (GO:0016079)|visual learning (GO:0008542)	axon (GO:0030424)|cell junction (GO:0030054)|cyclin-dependent protein kinase 5 holoenzyme complex (GO:0016533)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|filopodium (GO:0030175)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activator activity (GO:0030549)|ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|ErbB-2 class receptor binding (GO:0005176)|ErbB-3 class receptor binding (GO:0043125)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			central_nervous_system(1)|endometrium(2)|lung(5)|urinary_tract(1)	9		Breast(660;0.159)|Ovarian(593;0.182)	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)|LUSC - Lung squamous cell carcinoma(290;0.008)|Lung(243;0.00942)|BRCA - Breast invasive adenocarcinoma(188;0.242)		AGTGTGACCACCTGGAGGAGA	0.582																																						dbGAP											0													53.0	58.0	56.0					7																	150752460		1964	4147	6111	-	-	-	SO:0001630	splice_region_variant	0			X66364	CCDS47748.1, CCDS55184.1	7q36	2011-11-08			ENSG00000164885	ENSG00000164885		"""Cyclin-dependent kinases"""	1774	protein-coding gene	gene with protein product		123831				8275715, 1639063	Standard	NM_001164410		Approved	PSSALRE	uc003wir.2	Q00535	OTTHUMG00000158414	ENST00000485972.1:c.484-1G>T	7.37:g.150752460C>A			A1XKG3	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.V162L	ENST00000485972.1	37	c.484	CCDS47748.1	7	.	.	.	.	.	.	.	.	.	.	C	28.4	4.918731	0.92249	.	.	ENSG00000164885	ENST00000485972;ENST00000297518	T;T	0.51071	0.72;0.72	4.63	4.63	0.57726	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.68284	0.2984	M	0.74647	2.275	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.976	T	0.72462	-0.4286	10	0.87932	D	0	-18.8917	15.346	0.74337	0.0:1.0:0.0:0.0	.	130;162	Q00535-2;Q00535	.;CDK5_HUMAN	L	162;130	ENSP00000419782:V162L;ENSP00000297518:V130L	ENSP00000297518:V130L	V	-	1	0	CDK5	150383393	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	6.923000	0.75817	2.550000	0.86006	0.561000	0.74099	GTG	CDK5	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000164885		0.582	CDK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK5	HGNC	protein_coding	OTTHUMT00000350965.3	77	0.00	0	C		Missense_Mutation	150752460	150752460	-1	no_errors	ENST00000485972	ensembl	human	known	69_37n	missense	57	40.62	39	SNP	1.000	A
COL6A6	131873	genome.wustl.edu	37	3	130285633	130285633	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1EO-01A-11D-A135-09	TCGA-BH-A1EO-11A-31D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20131381-8a11-425d-8954-980e6ec7c427	cb2284f3-6d08-40ec-bf36-dfa349354c59	g.chr3:130285633C>T	ENST00000358511.6	+	4	1401	c.1370C>T	c.(1369-1371)aCg>aTg	p.T457M	COL6A6_ENST00000453409.2_Missense_Mutation_p.T457M	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	457	Nonhelical region.|VWFA 3. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						GAAATGAAGACGTTCCTGTCA	0.502																																						dbGAP											0													93.0	93.0	93.0					3																	130285633		1953	4131	6084	-	-	-	SO:0001583	missense	0			AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.1370C>T	3.37:g.130285633C>T	ENSP00000351310:p.Thr457Met		A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.T457M	ENST00000358511.6	37	c.1370	CCDS46911.1	3	.	.	.	.	.	.	.	.	.	.	C	10.47	1.359757	0.24598	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	D;D	0.83837	-1.77;-1.77	5.24	-0.335	0.12662	von Willebrand factor, type A (3);	0.440714	0.21699	N	0.070441	T	0.69088	0.3072	L	0.39085	1.19	0.24118	N	0.995811	B	0.25743	0.133	B	0.25140	0.058	T	0.57505	-0.7800	10	0.49607	T	0.09	.	3.2314	0.06750	0.2004:0.5073:0.0983:0.194	.	457	A6NMZ7	CO6A6_HUMAN	M	457	ENSP00000351310:T457M;ENSP00000399236:T457M	ENSP00000351310:T457M	T	+	2	0	COL6A6	131768323	0.002000	0.14202	0.981000	0.43875	0.664000	0.39144	0.020000	0.13466	-0.039000	0.13602	-1.134000	0.01955	ACG	COL6A6	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000206384		0.502	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL6A6	HGNC	protein_coding	OTTHUMT00000356705.5	132	0.00	0	C	NM_001102608		130285633	130285633	+1	no_errors	ENST00000358511	ensembl	human	known	69_37n	missense	77	45.07	64	SNP	0.686	T
DET1	55070	genome.wustl.edu	37	15	89074906	89074906	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A1EO-01A-11D-A135-09	TCGA-BH-A1EO-11A-31D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20131381-8a11-425d-8954-980e6ec7c427	cb2284f3-6d08-40ec-bf36-dfa349354c59	g.chr15:89074906G>A	ENST00000268148.8	-	2	176	c.31C>T	c.(31-33)Cga>Tga	p.R11*	DET1_ENST00000559656.1_5'Flank|DET1_ENST00000444300.1_Nonsense_Mutation_p.R22*|DET1_ENST00000558413.1_Nonsense_Mutation_p.R11*|DET1_ENST00000564406.1_Nonsense_Mutation_p.R22*	NM_001144074.1	NP_001137546.1	Q7L5Y6	DET1_HUMAN	de-etiolated homolog 1 (Arabidopsis)	11						nucleus (GO:0005634)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(10)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	Lung NSC(78;0.105)|all_lung(78;0.182)		BRCA - Breast invasive adenocarcinoma(143;0.188)			TGGATTCTTCGAGGCTTGATG	0.423																																						dbGAP											0													86.0	83.0	84.0					15																	89074906		1939	4156	6095	-	-	-	SO:0001587	stop_gained	0			BC001242	CCDS45343.1, CCDS45344.1	15q25.3	2004-12-13				ENSG00000140543			25477	protein-coding gene	gene with protein product		608727				14739464	Standard	NM_001144074		Approved	FLJ10103	uc002bmq.2	Q7L5Y6		ENST00000268148.8:c.31C>T	15.37:g.89074906G>A	ENSP00000268148:p.Arg11*		B3KNN6|Q2VPC0|Q9NWD5	Nonsense_Mutation	SNP	pfam_De-etiolated_protein_1_Det1	p.R22*	ENST00000268148.8	37	c.64	CCDS45344.1	15	.	.	.	.	.	.	.	.	.	.	G	24.9	4.577734	0.86645	.	.	ENSG00000140543	ENST00000444300;ENST00000268148	.	.	.	5.91	4.98	0.66077	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.0299	15.5324	0.75974	0.0:0.0:0.8608:0.1391	.	.	.	.	X	22;11	.	ENSP00000268148:R11X	R	-	1	2	DET1	86875910	1.000000	0.71417	0.999000	0.59377	0.753000	0.42808	5.146000	0.64845	1.480000	0.48289	-0.181000	0.13052	CGA	DET1	-	NULL	ENSG00000140543		0.423	DET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DET1	HGNC	protein_coding	OTTHUMT00000415442.2	185	0.00	0	G	NM_017996		89074906	89074906	-1	no_errors	ENST00000444300	ensembl	human	known	69_37n	nonsense	104	24.64	34	SNP	1.000	A
DIP2A	23181	genome.wustl.edu	37	21	47974150	47974150	+	Silent	SNP	G	G	A			TCGA-BH-A1EO-01A-11D-A135-09	TCGA-BH-A1EO-11A-31D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20131381-8a11-425d-8954-980e6ec7c427	cb2284f3-6d08-40ec-bf36-dfa349354c59	g.chr21:47974150G>A	ENST00000417564.2	+	26	3120	c.3099G>A	c.(3097-3099)ctG>ctA	p.L1033L	DIP2A_ENST00000318711.7_Silent_p.L1034L|DIP2A_ENST00000427143.2_Silent_p.L969L|DIP2A_ENST00000400274.1_Silent_p.L1029L			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	1033					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		CCGCGGCTCTGATGGAGAAGG	0.572																																						dbGAP											0													98.0	113.0	108.0					21																	47974150		2121	4250	6371	-	-	-	SO:0001819	synonymous_variant	0			AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.3099G>A	21.37:g.47974150G>A			A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Silent	SNP	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.L1034	ENST00000417564.2	37	c.3102	CCDS46655.1	21																																																																																			DIP2A	-	pfam_AMP-dep_Synth/Lig	ENSG00000160305		0.572	DIP2A-012	KNOWN	basic|CCDS	protein_coding	DIP2A	HGNC	protein_coding	OTTHUMT00000376736.1	97	0.00	0	G	NM_015151		47974150	47974150	+1	no_errors	ENST00000318711	ensembl	human	known	69_37n	silent	81	22.12	23	SNP	1.000	A
DMRTA1	63951	genome.wustl.edu	37	9	22451851	22451851	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A1EO-01A-11D-A135-09	TCGA-BH-A1EO-11A-31D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20131381-8a11-425d-8954-980e6ec7c427	cb2284f3-6d08-40ec-bf36-dfa349354c59	g.chr9:22451851A>T	ENST00000325870.2	+	2	1681	c.1456A>T	c.(1456-1458)Agt>Tgt	p.S486C		NM_022160.2	NP_071443.2	Q5VZB9	DMRTA_HUMAN	DMRT-like family A1	486					male mating behavior (GO:0060179)|ovarian follicle development (GO:0001541)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(1)|large_intestine(3)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15		all_cancers(5;4.09e-243)|Acute lymphoblastic leukemia(3;8.25e-150)|all_hematologic(3;4.25e-147)|Esophageal squamous(3;2.32e-09)|Renal(3;1.71e-07)|Breast(3;2.07e-06)|Hepatocellular(5;0.00563)		GBM - Glioblastoma multiforme(1;5.12e-278)|Lung(24;8.2e-52)|LUSC - Lung squamous cell carcinoma(38;1.46e-37)|OV - Ovarian serous cystadenocarcinoma(39;0.0517)		CTACCTTTCCAGTAAAGACTC	0.428																																						dbGAP											0													85.0	82.0	83.0					9																	22451851		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ290954	CCDS6514.1	9p21.3	2008-05-15			ENSG00000176399	ENSG00000176399			13826	protein-coding gene	gene with protein product		614803					Standard	NM_022160		Approved		uc003zpp.1	Q5VZB9	OTTHUMG00000019693	ENST00000325870.2:c.1456A>T	9.37:g.22451851A>T	ENSP00000319651:p.Ser486Cys		A1L481|Q8N8Y9|Q9H4B9	Missense_Mutation	SNP	pfam_DM_DNA-bd,pfam_DMA,superfamily_DM_DNA-bd,superfamily_UBA-like,smart_DM_DNA-bd,pfscan_DM_DNA-bd	p.S486C	ENST00000325870.2	37	c.1456	CCDS6514.1	9	.	.	.	.	.	.	.	.	.	.	A	15.66	2.899764	0.52227	.	.	ENSG00000176399	ENST00000325870	T	0.34859	1.34	5.68	1.93	0.25924	.	0.604553	0.18731	N	0.132736	T	0.35682	0.0940	M	0.75264	2.295	0.33813	D	0.628157	B	0.15930	0.015	B	0.14023	0.01	T	0.37174	-0.9717	10	0.66056	D	0.02	-0.5522	7.0426	0.25029	0.6107:0.1336:0.0:0.2558	.	486	Q5VZB9	DMRTA_HUMAN	C	486	ENSP00000319651:S486C	ENSP00000319651:S486C	S	+	1	0	DMRTA1	22441851	0.944000	0.32072	0.970000	0.41538	0.984000	0.73092	1.580000	0.36547	0.074000	0.16767	0.528000	0.53228	AGT	DMRTA1	-	NULL	ENSG00000176399		0.428	DMRTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMRTA1	HGNC	protein_coding	OTTHUMT00000051935.2	125	0.00	0	A			22451851	22451851	+1	no_errors	ENST00000325870	ensembl	human	known	69_37n	missense	101	19.69	25	SNP	1.000	T
PTRH1	138428	genome.wustl.edu	37	9	130477768	130477768	+	Intron	SNP	G	G	A	rs504434	byFrequency	TCGA-BH-A1EO-01A-11D-A135-09	TCGA-BH-A1EO-11A-31D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20131381-8a11-425d-8954-980e6ec7c427	cb2284f3-6d08-40ec-bf36-dfa349354c59	g.chr9:130477768G>A	ENST00000419060.1	-	2	1553				PTRH1_ENST00000543175.1_Intron|TTC16_ENST00000373289.3_5'Flank|C9orf117_ENST00000464092.1_3'UTR|PTRH1_ENST00000423807.1_Intron|TTC16_ENST00000393748.4_5'Flank|C9orf117_ENST00000373293.5_3'UTR|PTRH1_ENST00000429848.1_5'Flank			Q86Y79	PTH_HUMAN	peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae)							mitochondrion (GO:0005739)	aminoacyl-tRNA hydrolase activity (GO:0004045)|poly(A) RNA binding (GO:0044822)			NS(1)	1						GGACATAATGGCCGAACTGAA	0.612													G|||	2650	0.529153	0.6422	0.5447	5008	,	,		14317	0.2927		0.5557	False		,,,				2504	0.5818					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK090922	CCDS35147.1	9q34.11	2006-02-13	2006-02-13	2006-02-13	ENSG00000187024	ENSG00000187024			27039	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 115"""	C9orf115			Standard	NM_001002913		Approved	PTH1	uc004bro.3	Q86Y79	OTTHUMG00000020710	ENST00000419060.1:c.96+54C>T	9.37:g.130477768G>A				RNA	SNP	-	NULL	ENST00000419060.1	37	NULL	CCDS35147.1	9																																																																																			RP11-56D16.2	-	-	ENSG00000248666		0.612	PTRH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000248666	Clone_based_vega_gene	protein_coding	OTTHUMT00000054219.4	10	0.00	0	G	NM_001002913		130477768	130477768	-1	no_errors	ENST00000335223	ensembl	human	known	69_37n	rna	5	66.67	10	SNP	0.041	A
FANCA	2175	genome.wustl.edu	37	16	89818569	89818569	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1EO-01A-11D-A135-09	TCGA-BH-A1EO-11A-31D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20131381-8a11-425d-8954-980e6ec7c427	cb2284f3-6d08-40ec-bf36-dfa349354c59	g.chr16:89818569C>T	ENST00000389301.3	-	31	3073	c.3043G>A	c.(3043-3045)Gag>Aag	p.E1015K	FANCA_ENST00000568369.1_Missense_Mutation_p.E1015K	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	1015					DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		ATAATATCCTCATTTCCTGTG	0.423			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													dbGAP	yes	Rec		Fanconi anaemia A	16	16q24.3	2175	"""Fanconi anemia, complementation group A"""		L	0													194.0	193.0	193.0					16																	89818569		2198	4300	6498	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.3043G>A	16.37:g.89818569C>T	ENSP00000373952:p.Glu1015Lys		A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Missense_Mutation	SNP	pfam_Fanconia,prints_Fanconia	p.E1015K	ENST00000389301.3	37	c.3043	CCDS32515.1	16	.	.	.	.	.	.	.	.	.	.	C	3.915	-0.019325	0.07634	.	.	ENSG00000187741	ENST00000389301	D	0.83914	-1.78	5.21	-0.765	0.11023	.	1.806010	0.03220	N	0.177349	T	0.68128	0.2967	N	0.16478	0.41	0.09310	N	1	B;B	0.12013	0.005;0.005	B;B	0.08055	0.003;0.003	T	0.56402	-0.7985	10	0.05959	T	0.93	-1.9188	9.3881	0.38356	0.0:0.5105:0.2696:0.2199	.	1015;1015	B4DRI7;O15360	.;FANCA_HUMAN	K	1015	ENSP00000373952:E1015K	ENSP00000373952:E1015K	E	-	1	0	FANCA	88346070	0.006000	0.16342	0.000000	0.03702	0.012000	0.07955	0.915000	0.28638	-0.249000	0.09569	-0.171000	0.13296	GAG	FANCA	-	NULL	ENSG00000187741		0.423	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FANCA	HGNC	protein_coding	OTTHUMT00000421927.1	126	0.00	0	C			89818569	89818569	-1	no_errors	ENST00000389301	ensembl	human	known	69_37n	missense	58	44.76	47	SNP	0.000	T
FLNC	2318	genome.wustl.edu	37	7	128494721	128494721	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A1EO-01A-11D-A135-09	TCGA-BH-A1EO-11A-31D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20131381-8a11-425d-8954-980e6ec7c427	cb2284f3-6d08-40ec-bf36-dfa349354c59	g.chr7:128494721G>T	ENST00000325888.8	+	41	7243	c.6982G>T	c.(6982-6984)Gtg>Ttg	p.V2328L	RP11-309L24.2_ENST00000469965.1_RNA|FLNC_ENST00000346177.6_Missense_Mutation_p.V2295L	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	2328					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						GGAGCGAGGTGTGGCCGGCGT	0.672																																						dbGAP											0													16.0	20.0	18.0					7																	128494721		2173	4261	6434	-	-	-	SO:0001583	missense	0			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.6982G>T	7.37:g.128494721G>T	ENSP00000327145:p.Val2328Leu		B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.V2328L	ENST00000325888.8	37	c.6982	CCDS43644.1	7	.	.	.	.	.	.	.	.	.	.	G	11.72	1.722034	0.30503	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.85339	-1.97;-1.97	4.86	4.86	0.63082	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.83376	0.5241	N	0.11651	0.15	0.53688	D	0.999973	P;B	0.52463	0.953;0.007	D;B	0.65874	0.939;0.011	T	0.80113	-0.1518	10	0.12103	T	0.63	.	18.0	0.89196	0.0:0.0:1.0:0.0	.	2295;2328	Q14315-2;Q14315	.;FLNC_HUMAN	L	2328;2295	ENSP00000327145:V2328L;ENSP00000344002:V2295L	ENSP00000327145:V2328L	V	+	1	0	FLNC	128281957	1.000000	0.71417	0.994000	0.49952	0.979000	0.70002	5.593000	0.67550	2.231000	0.72958	0.563000	0.77884	GTG	FLNC	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000128591		0.672	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	HGNC	protein_coding	OTTHUMT00000059948.3	25	0.00	0	G			128494721	128494721	+1	no_errors	ENST00000325888	ensembl	human	known	69_37n	missense	18	33.33	9	SNP	1.000	T
HERC2P2	400322	genome.wustl.edu	37	15	23300098	23300098	+	RNA	SNP	C	C	T			TCGA-BH-A1EO-01A-11D-A135-09	TCGA-BH-A1EO-11A-31D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20131381-8a11-425d-8954-980e6ec7c427	cb2284f3-6d08-40ec-bf36-dfa349354c59	g.chr15:23300098C>T	ENST00000560464.1	-	0	4189									hect domain and RLD 2 pseudogene 2																		GTGGTGGCCTCACTGGAGCTG	0.617																																						dbGAP											0																																										-	-	-			0			AF041080		15q11.2	2014-03-18			ENSG00000140181				4870	pseudogene	pseudogene						9730612	Standard	NR_002824		Approved	D15F37S3	uc001yvq.2		OTTHUMG00000171926		15.37:g.23300098C>T				RNA	SNP	-	NULL	ENST00000560464.1	37	NULL		15																																																																																			HERC2P2	-	-	ENSG00000140181		0.617	HERC2P2-001	KNOWN	basic	processed_transcript	HERC2P2	HGNC	pseudogene	OTTHUMT00000415936.1	32	0.00	0	C			23300098	23300098	-1	no_errors	ENST00000560464	ensembl	human	known	69_37n	rna	24	20.00	6	SNP	1.000	T
ITPR1	3708	genome.wustl.edu	37	3	4854831	4854831	+	Missense_Mutation	SNP	G	G	T	rs187571979		TCGA-BH-A1EO-01A-11D-A135-09	TCGA-BH-A1EO-11A-31D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20131381-8a11-425d-8954-980e6ec7c427	cb2284f3-6d08-40ec-bf36-dfa349354c59	g.chr3:4854831G>T	ENST00000443694.2	+	54	7429	c.7429G>T	c.(7429-7431)Ggc>Tgc	p.G2477C	ITPR1_ENST00000544951.1_Missense_Mutation_p.G455C|ITPR1_ENST00000354582.6_Missense_Mutation_p.G2477C|AC018816.3_ENST00000489771.1_5'Flank|ITPR1_ENST00000302640.8_Missense_Mutation_p.G2477C|ITPR1_ENST00000357086.4_Missense_Mutation_p.G2444C|ITPR1_ENST00000456211.2_Missense_Mutation_p.G2429C|ITPR1_ENST00000463980.1_3'UTR|ITPR1_ENST00000423119.2_Missense_Mutation_p.G2444C			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	2492	Interaction with ERP44. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	CCCAGAAACCGGCGAGAGTTT	0.473																																						dbGAP											0													109.0	106.0	107.0					3																	4854831		1850	4100	5950	-	-	-	SO:0001583	missense	0			D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.7429G>T	3.37:g.4854831G>T	ENSP00000401671:p.Gly2477Cys		E7EPX7|E9PDE9|Q14660|Q99897	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.G2477C	ENST00000443694.2	37	c.7429	CCDS54551.1	3	.	.	.	.	.	.	.	.	.	.	G	10.37	1.330512	0.24167	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000426160;ENST00000357086;ENST00000456211;ENST00000544951;ENST00000443694	D;D;D;D;D;D;D	0.97553	-2.82;-2.83;-2.82;-2.82;-2.82;-4.43;-2.82	5.02	-0.577	0.11727	Ion transport (1);	1.308940	0.05111	N	0.488904	D	0.98012	0.9345	M	0.77820	2.39	0.32258	N	0.570559	D;D;B	0.89917	1.0;0.976;0.011	D;P;B	0.72982	0.979;0.882;0.035	D	0.92962	0.6390	10	0.39692	T	0.17	.	9.4689	0.38831	0.4429:0.0:0.5571:0.0	.	455;2492;2444	B7ZMI3;Q14643;G5E9P1	.;ITPR1_HUMAN;.	C	2492;2477;2477;2444;938;2444;2429;455;2477	ENSP00000306253:G2477C;ENSP00000346595:G2477C;ENSP00000405934:G2444C;ENSP00000349597:G2444C;ENSP00000397885:G2429C;ENSP00000440564:G455C;ENSP00000401671:G2477C	ENSP00000306253:G2477C	G	+	1	0	ITPR1	4829831	0.988000	0.35896	0.960000	0.40013	0.729000	0.41735	2.025000	0.41059	-0.052000	0.13311	0.557000	0.71058	GGC	ITPR1	-	pfam_Ion_trans_dom	ENSG00000150995		0.473	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	ITPR1	HGNC	protein_coding	OTTHUMT00000337982.3	209	0.00	0	G	NM_002222		4854831	4854831	+1	no_errors	ENST00000302640	ensembl	human	known	69_37n	missense	187	14.61	32	SNP	0.110	T
LRRC37A4P	55073	genome.wustl.edu	37	17	43592301	43592301	+	RNA	SNP	G	G	A			TCGA-BH-A1EO-01A-11D-A135-09	TCGA-BH-A1EO-11A-31D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20131381-8a11-425d-8954-980e6ec7c427	cb2284f3-6d08-40ec-bf36-dfa349354c59	g.chr17:43592301G>A	ENST00000579913.1	-	0	221				RP11-798G7.5_ENST00000253803.2_RNA	NR_002940.2				leucine rich repeat containing 37, member A4, pseudogene																		CTGGACTCCCGAGCCTTTTTT	0.577																																						dbGAP											0																																										-	-	-			0			AK000982		17q21.31	2014-04-01	2012-03-07	2012-03-07	ENSG00000214425	ENSG00000214425			25479	pseudogene	pseudogene			"""leucine rich repeat containing 37, member A4 (pseudogene)"""	LRRC37A4			Standard	NR_002940		Approved	FLJ10120	uc031rhd.1		OTTHUMG00000179212		17.37:g.43592301G>A				RNA	SNP	-	NULL	ENST00000579913.1	37	NULL		17																																																																																			LRRC37A4P	-	-	ENSG00000214425		0.577	LRRC37A4P-002	KNOWN	basic	processed_transcript	LRRC37A4P	HGNC	pseudogene	OTTHUMT00000445300.1	30	0.00	0	G	NR_002940		43592301	43592301	-1	no_errors	ENST00000579913	ensembl	human	known	69_37n	rna	14	26.32	5	SNP	0.000	A
NFE2	4778	genome.wustl.edu	37	12	54686775	54686775	+	Missense_Mutation	SNP	G	G	A	rs544424590	byFrequency	TCGA-BH-A1EO-01A-11D-A135-09	TCGA-BH-A1EO-11A-31D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20131381-8a11-425d-8954-980e6ec7c427	cb2284f3-6d08-40ec-bf36-dfa349354c59	g.chr12:54686775G>A	ENST00000540264.2	-	2	1014	c.505C>T	c.(505-507)Cgc>Tgc	p.R169C	NFE2_ENST00000435572.2_Missense_Mutation_p.R169C|NFE2_ENST00000312156.4_Missense_Mutation_p.R169C|RP11-968A15.8_ENST00000553061.1_RNA|NFE2_ENST00000553070.1_Missense_Mutation_p.R169C			Q16621	NFE2_HUMAN	nuclear factor, erythroid 2	169	Transactivation domain.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|hemostasis (GO:0007599)|labyrinthine layer blood vessel development (GO:0060716)|multicellular organismal development (GO:0007275)|negative regulation of bone mineralization (GO:0030502)|negative regulation of syncytium formation by plasma membrane fusion (GO:0034242)|nucleosome disassembly (GO:0006337)|positive regulation of peptidyl-lysine acetylation (GO:2000758)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|WW domain binding (GO:0050699)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(7)|upper_aerodigestive_tract(2)	16						TATTCGCTGCGCCGCCGACCA	0.552													G|||	3	0.000599042	0.0	0.0	5008	,	,		18674	0.003		0.0	False		,,,				2504	0.0					dbGAP											0													94.0	91.0	92.0					12																	54686775		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC005044	CCDS8876.1	12q13	2013-08-23	2013-08-23			ENSG00000123405		"""basic leucine zipper proteins"""	7780	protein-coding gene	gene with protein product		601490	"""nuclear factor (erythroid-derived 2), 45kD"", ""nuclear factor (erythroid-derived 2), 45kDa"""			8355703	Standard	NM_001136023		Approved	NF-E2	uc001sfr.5	Q16621		ENST00000540264.2:c.505C>T	12.37:g.54686775G>A	ENSP00000439120:p.Arg169Cys		Q07720|Q6ICV9	Missense_Mutation	SNP	pfam_bZIP_1,pfam_bZIP_2,pfam_bZIP_Maf,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.R169C	ENST00000540264.2	37	c.505	CCDS8876.1	12	.	.	.	.	.	.	.	.	.	.	G	15.60	2.880779	0.51801	.	.	ENSG00000123405	ENST00000312156;ENST00000435572;ENST00000540264;ENST00000553070;ENST00000553198	.	.	.	5.1	1.89	0.25635	.	0.274240	0.36854	N	0.002372	T	0.44603	0.1301	L	0.44542	1.39	0.35056	D	0.761071	B	0.11235	0.004	B	0.04013	0.001	T	0.51196	-0.8736	9	0.72032	D	0.01	-2.8668	6.6599	0.23009	0.0939:0.0:0.5916:0.3145	.	169	Q16621	NFE2_HUMAN	C	169	.	ENSP00000312436:R169C	R	-	1	0	NFE2	52973042	0.058000	0.20735	0.655000	0.29622	0.990000	0.78478	1.278000	0.33179	0.755000	0.32990	0.655000	0.94253	CGC	NFE2	-	NULL	ENSG00000123405		0.552	NFE2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NFE2	HGNC	protein_coding	OTTHUMT00000405747.1	93	0.00	0	G	NM_006163		54686775	54686775	-1	no_errors	ENST00000312156	ensembl	human	known	69_37n	missense	53	41.24	40	SNP	0.731	A
NAV3	89795	genome.wustl.edu	37	12	78225321	78225321	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A1EO-01A-11D-A135-09	TCGA-BH-A1EO-11A-31D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20131381-8a11-425d-8954-980e6ec7c427	cb2284f3-6d08-40ec-bf36-dfa349354c59	g.chr12:78225321C>G	ENST00000397909.2	+	1	253	c.80C>G	c.(79-81)cCa>cGa	p.P27R	NAV3_ENST00000228327.6_Missense_Mutation_p.P27R|NAV3_ENST00000266692.7_Missense_Mutation_p.P27R|NAV3_ENST00000536525.2_Missense_Mutation_p.P27R			Q8IVL0	NAV3_HUMAN	neuron navigator 3	27						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						CTTCCGATACCAAATCTTGGC	0.458										HNSCC(70;0.22)																												dbGAP											0													142.0	138.0	139.0					12																	78225321		1916	4130	6046	-	-	-	SO:0001583	missense	0			AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.80C>G	12.37:g.78225321C>G	ENSP00000381007:p.Pro27Arg		Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	pfam_CH-domain,pfam_ATPase_AAA_core,superfamily_CH-domain,smart_CH-domain,smart_AAA+_ATPase,pfscan_CH-domain	p.P27R	ENST00000397909.2	37	c.80		12	.	.	.	.	.	.	.	.	.	.	C	19.06	3.753140	0.69648	.	.	ENSG00000067798	ENST00000549464;ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692	T;T;T;T;T	0.60424	0.19;1.73;1.72;1.73;1.62	5.54	5.54	0.83059	Calponin homology domain (1);	.	.	.	.	T	0.66655	0.2811	N	0.24115	0.695	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.69917	-0.5015	9	0.62326	D	0.03	-11.2884	19.4875	0.95035	0.0:1.0:0.0:0.0	.	27;27	Q8IVL0;Q8IVL0-2	NAV3_HUMAN;.	R	27	ENSP00000446628:P27R;ENSP00000446132:P27R;ENSP00000381007:P27R;ENSP00000228327:P27R;ENSP00000266692:P27R	ENSP00000228327:P27R	P	+	2	0	NAV3	76749452	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.341000	0.72977	2.615000	0.88500	0.655000	0.94253	CCA	NAV3	-	superfamily_CH-domain	ENSG00000067798		0.458	NAV3-001	KNOWN	basic	protein_coding	NAV3	HGNC	protein_coding	OTTHUMT00000406812.1	172	0.00	0	C	NM_001024383		78225321	78225321	+1	no_errors	ENST00000397909	ensembl	human	known	69_37n	missense	68	43.33	52	SNP	1.000	G
TENM1	10178	genome.wustl.edu	37	X	123554340	123554340	+	Silent	SNP	G	G	A			TCGA-BH-A1EO-01A-11D-A135-09	TCGA-BH-A1EO-11A-31D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20131381-8a11-425d-8954-980e6ec7c427	cb2284f3-6d08-40ec-bf36-dfa349354c59	g.chrX:123554340G>A	ENST00000371130.3	-	24	4845	c.4782C>T	c.(4780-4782)ggC>ggT	p.G1594G	STAG2_ENST00000469481.1_Intron|TENM1_ENST00000422452.2_Silent_p.G1601G	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	1594					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										GCGGCATTCCGCCTGCATCAC	0.498																																						dbGAP											0													87.0	63.0	71.0					X																	123554340		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.4782C>T	X.37:g.123554340G>A			B2RTR5|Q5JZ17	Silent	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EGF-like,pfscan_EG-like_dom,tigrfam_YD	p.G1601	ENST00000371130.3	37	c.4803	CCDS14609.1	X																																																																																			ODZ1	-	NULL	ENSG00000009694		0.498	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ1	HGNC	protein_coding	OTTHUMT00000058985.1	132	0.00	0	G	NM_014253		123554340	123554340	-1	no_errors	ENST00000422452	ensembl	human	known	69_37n	silent	132	15.82	25	SNP	0.000	A
OTOGL	283310	genome.wustl.edu	37	12	80647295	80647295	+	Silent	SNP	C	C	T			TCGA-BH-A1EO-01A-11D-A135-09	TCGA-BH-A1EO-11A-31D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20131381-8a11-425d-8954-980e6ec7c427	cb2284f3-6d08-40ec-bf36-dfa349354c59	g.chr12:80647295C>T	ENST00000547103.1	+	13	1314	c.1308C>T	c.(1306-1308)tgC>tgT	p.C436C	OTOGL_ENST00000458043.2_Silent_p.C436C			Q3ZCN5	OTOGL_HUMAN	otogelin-like	436					L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						ATTGCCCATGCGGTTTTCATG	0.363																																						dbGAP											0													152.0	148.0	149.0					12																	80647295		1845	4100	5945	-	-	-	SO:0001819	synonymous_variant	0			AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.1308C>T	12.37:g.80647295C>T			F8W0C3|Q495U8|Q8N8G5|Q8NC28	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_AbfB,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.C436	ENST00000547103.1	37	c.1308		12																																																																																			OTOGL	-	smart_VWC_out	ENSG00000165899		0.363	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	OTOGL	HGNC	protein_coding	OTTHUMT00000407438.1	493	0.40	2	C	NM_173591		80647295	80647295	+1	no_errors	ENST00000458043	ensembl	human	known	69_37n	silent	230	23.59	71	SNP	0.986	T
PLEKHM1	9842	genome.wustl.edu	37	17	43531287	43531287	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1EO-01A-11D-A135-09	TCGA-BH-A1EO-11A-31D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20131381-8a11-425d-8954-980e6ec7c427	cb2284f3-6d08-40ec-bf36-dfa349354c59	g.chr17:43531287G>A	ENST00000430334.3	-	7	2064	c.1931C>T	c.(1930-1932)cCt>cTt	p.P644L	PLEKHM1_ENST00000421073.2_Missense_Mutation_p.P555L|AC091132.1_ENST00000433601.1_RNA	NM_014798.2	NP_055613.1	Q9Y4G2	PKHM1_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 1	644					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(6)|large_intestine(1)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26	Renal(3;0.0405)					GGGTTCCTCAGGCTGGTCTGG	0.687																																						dbGAP											0													31.0	37.0	35.0					17																	43531287		2202	4298	6500	-	-	-	SO:0001583	missense	0			X85792	CCDS32671.1	17q21.31	2013-01-11				ENSG00000225190		"""Pleckstrin homology (PH) domain containing"""	29017	protein-coding gene	gene with protein product		611466				9205841, 12820725	Standard	NM_014798		Approved	KIAA0356	uc002ija.3	Q9Y4G2		ENST00000430334.3:c.1931C>T	17.37:g.43531287G>A	ENSP00000389913:p.Pro644Leu		Q6P2R5|Q8TEL9|Q9NPP5|Q9NYA0	Missense_Mutation	SNP	pfam_Run,superfamily_Znf_FYVE_PHD,smart_Run,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Pleckstrin_homology,pfscan_Run,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.P644L	ENST00000430334.3	37	c.1931	CCDS32671.1	17	.	.	.	.	.	.	.	.	.	.	G	0.082	-1.181108	0.01633	.	.	ENSG00000225190	ENST00000430334;ENST00000446609;ENST00000421073	T;T	0.63913	-0.07;-0.07	4.8	2.76	0.32466	.	0.970008	0.08486	N	0.938685	T	0.49406	0.1555	L	0.54323	1.7	0.09310	N	1	B;B;B	0.29862	0.007;0.001;0.259	B;B;B	0.21151	0.006;0.002;0.033	T	0.35226	-0.9797	10	0.12430	T	0.62	.	5.3362	0.15959	0.1867:0.1676:0.6457:0.0	.	555;593;644	F8W648;B4DRX1;Q9Y4G2	.;.;PKHM1_HUMAN	L	644;593;555	ENSP00000389913:P644L;ENSP00000414352:P555L	ENSP00000414352:P555L	P	-	2	0	PLEKHM1	40887070	0.001000	0.12720	0.004000	0.12327	0.019000	0.09904	1.084000	0.30828	1.267000	0.44247	0.586000	0.80456	CCT	PLEKHM1	-	NULL	ENSG00000225190		0.687	PLEKHM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHM1	HGNC	protein_coding	OTTHUMT00000444659.1	19	0.00	0	G	NM_014798		43531287	43531287	-1	no_errors	ENST00000430334	ensembl	human	known	69_37n	missense	22	26.67	8	SNP	0.000	A
PNMA1	9240	genome.wustl.edu	37	14	74179741	74179741	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1EO-01A-11D-A135-09	TCGA-BH-A1EO-11A-31D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20131381-8a11-425d-8954-980e6ec7c427	cb2284f3-6d08-40ec-bf36-dfa349354c59	g.chr14:74179741C>T	ENST00000316836.3	-	1	1387	c.602G>A	c.(601-603)cGg>cAg	p.R201Q		NM_006029.4	NP_006020.4	Q8ND90	PNMA1_HUMAN	paraneoplastic Ma antigen 1	201					inflammatory response to antigenic stimulus (GO:0002437)|positive regulation of apoptotic process (GO:0043065)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleolus (GO:0005730)				breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|prostate(1)|urinary_tract(2)	13				BRCA - Breast invasive adenocarcinoma(234;0.00331)|KIRC - Kidney renal clear cell carcinoma(182;0.0797)		ctccatcaaccgccgcctctt	0.562																																						dbGAP											0													37.0	41.0	40.0					14																	74179741		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF037364	CCDS9818.1	14q24.3	2012-02-09	2012-02-09		ENSG00000176903	ENSG00000176903		"""Paraneoplastic Ma antigens"""	9158	protein-coding gene	gene with protein product		604010	"""paraneoplastic antigen MA1"""			10050892	Standard	NM_006029		Approved	MA1	uc001xor.1	Q8ND90	OTTHUMG00000169183	ENST00000316836.3:c.602G>A	14.37:g.74179741C>T	ENSP00000318914:p.Arg201Gln		A8K4L5|O95144|Q8NG07	Missense_Mutation	SNP	superfamily_Globin-like	p.R201Q	ENST00000316836.3	37	c.602	CCDS9818.1	14	.	.	.	.	.	.	.	.	.	.	C	17.75	3.465472	0.63513	.	.	ENSG00000176903	ENST00000316836	T	0.10860	2.83	4.27	4.27	0.50696	.	0.340228	0.21729	N	0.069988	T	0.27629	0.0679	M	0.64080	1.96	0.35085	D	0.763775	D	0.89917	1.0	D	0.70716	0.97	T	0.15178	-1.0446	10	0.54805	T	0.06	-0.0507	12.5148	0.56026	0.0:1.0:0.0:0.0	.	201	Q8ND90	PNMA1_HUMAN	Q	201	ENSP00000318914:R201Q	ENSP00000318914:R201Q	R	-	2	0	PNMA1	73249494	1.000000	0.71417	0.998000	0.56505	0.958000	0.62258	2.984000	0.49353	2.669000	0.90835	0.655000	0.94253	CGG	PNMA1	-	superfamily_Globin-like	ENSG00000176903		0.562	PNMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNMA1	HGNC	protein_coding	OTTHUMT00000402774.1	13	0.00	0	C	NM_006029		74179741	74179741	-1	no_errors	ENST00000316836	ensembl	human	known	69_37n	missense	10	54.55	12	SNP	0.998	T
POLR3B	55703	genome.wustl.edu	37	12	106850925	106850925	+	Missense_Mutation	SNP	G	G	A	rs267608687		TCGA-BH-A1EO-01A-11D-A135-09	TCGA-BH-A1EO-11A-31D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20131381-8a11-425d-8954-980e6ec7c427	cb2284f3-6d08-40ec-bf36-dfa349354c59	g.chr12:106850925G>A	ENST00000228347.4	+	21	2525	c.2303G>A	c.(2302-2304)cGt>cAt	p.R768H	POLR3B_ENST00000539066.1_Missense_Mutation_p.R710H	NM_018082.5	NP_060552.4	Q9NW08	RPC2_HUMAN	polymerase (RNA) III (DNA directed) polypeptide B	768			R -> H (in HLD8). {ECO:0000269|PubMed:22036171}.		defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(22)|ovary(1)|prostate(3)|skin(3)|urinary_tract(2)	57						GGCTTTGGGCGTTGCCTTGTA	0.408													G|||	1	0.000199681	0.0	0.0	5008	,	,		16437	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													179.0	165.0	170.0					12																	106850925		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY092084	CCDS9105.1, CCDS53824.1	12q23.3	2014-08-12			ENSG00000013503	ENSG00000013503		"""RNA polymerase subunits"""	30348	protein-coding gene	gene with protein product		614366				12391170	Standard	NM_018082		Approved	RPC2, FLJ10388	uc001tlp.3	Q9NW08	OTTHUMG00000170077	ENST00000228347.4:c.2303G>A	12.37:g.106850925G>A	ENSP00000228347:p.Arg768His		A8K6H0|B3KV73|F5H1E6|Q9NW59	Missense_Mutation	SNP	pfam_DNA-dir_RNA_pol_su2_6,pfam_RNA_pol_bsu_protrusion,pfam_RNA_pol_Rpb2_7,pfam_RNA_pol_Rpb2_2,pfam_RNA_pol_Rpb2_3,pfam_RNA_pol_Rpb2_4,pfam_RNA_pol_Rpb2_5	p.R768H	ENST00000228347.4	37	c.2303	CCDS9105.1	12	.	.	.	.	.	.	.	.	.	.	G	35	5.511962	0.96402	.	.	ENSG00000013503	ENST00000228347;ENST00000539066	T;T	0.72942	-0.7;-0.7	6.01	6.01	0.97437	DNA-directed RNA polymerase, subunit 2, domain 6 (1);	0.000000	0.85682	D	0.000000	D	0.84492	0.5484	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.72625	0.978	D	0.84621	0.0684	10	0.87932	D	0	-17.3304	20.5211	0.99222	0.0:0.0:1.0:0.0	.	768	Q9NW08	RPC2_HUMAN	H	768;710	ENSP00000228347:R768H;ENSP00000445721:R710H	ENSP00000228347:R768H	R	+	2	0	POLR3B	105375055	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	9.827000	0.99397	2.861000	0.98227	0.650000	0.86243	CGT	POLR3B	-	pfam_DNA-dir_RNA_pol_su2_6	ENSG00000013503		0.408	POLR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR3B	HGNC	protein_coding	OTTHUMT00000407166.1	436	0.00	0	G	NM_018082		106850925	106850925	+1	no_errors	ENST00000228347	ensembl	human	known	69_37n	missense	239	21.64	66	SNP	1.000	A
RUFY1	80230	genome.wustl.edu	37	5	178994480	178994481	+	Frame_Shift_Ins	INS	-	-	CGAG	rs367832710		TCGA-BH-A1EO-01A-11D-A135-09	TCGA-BH-A1EO-11A-31D-A135-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20131381-8a11-425d-8954-980e6ec7c427	cb2284f3-6d08-40ec-bf36-dfa349354c59	g.chr5:178994480_178994481insCGAG	ENST00000319449.4	+	4	633_634	c.621_622insCGAG	c.(622-624)cgafs	p.-209fs	RUFY1_ENST00000393438.2_Frame_Shift_Ins_p.-101fs|RUFY1_ENST00000377001.2_Frame_Shift_Ins_p.-209fs|RUFY1_ENST00000437570.2_Frame_Shift_Ins_p.-101fs	NM_025158.4	NP_079434.3	Q96T51	RUFY1_HUMAN	RUN and FYVE domain containing 1						endocytosis (GO:0006897)|regulation of endocytosis (GO:0030100)	cytoplasm (GO:0005737)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	lipid binding (GO:0008289)|protein transporter activity (GO:0008565)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	26	all_cancers(89;0.00018)|all_epithelial(37;8.37e-05)|Renal(175;0.000159)|Lung NSC(126;0.00108)|all_lung(126;0.00195)	all_cancers(40;0.0322)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGGGAAGAGGCCGAGCGTGGCT	0.406										HNSCC(44;0.11)																												dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF361055	CCDS4445.2, CCDS34312.1	5q35.3	2008-02-05			ENSG00000176783	ENSG00000176783		"""Zinc fingers, FYVE domain containing"""	19760	protein-coding gene	gene with protein product		610327				11877430	Standard	NM_001040451		Approved	FLJ22251, ZFYVE12, RABIP4	uc003mka.2	Q96T51	OTTHUMG00000130913	ENST00000319449.4:c.622_625dupCGAG	5.37:g.178994481_178994484dupCGAG	ENSP00000325594:p.Ala209fs		Q59FF3|Q71S93|Q9H6I3	Frame_Shift_Ins	INS	pfam_Run,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,superfamily_Prefoldin,smart_Run,smart_Znf_FYVE,pfscan_Run,pfscan_Znf_FYVE-rel,pfscan_Znf_RING	p.W209fs	ENST00000319449.4	37	c.621_622	CCDS4445.2	5																																																																																			RUFY1	-	pfam_Run,smart_Run,pfscan_Run	ENSG00000176783		0.406	RUFY1-001	KNOWN	basic|CCDS	protein_coding	RUFY1	HGNC	protein_coding	OTTHUMT00000253505.2	237	0.00	0	-	NM_001040451		178994480	178994481	+1	no_errors	ENST00000319449	ensembl	human	known	69_37n	frame_shift_ins	214	26.46	77	INS	0.998:0.998	CGAG
SLC6A7	6534	genome.wustl.edu	37	5	149588999	149588999	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1EO-01A-11D-A135-09	TCGA-BH-A1EO-11A-31D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20131381-8a11-425d-8954-980e6ec7c427	cb2284f3-6d08-40ec-bf36-dfa349354c59	g.chr5:149588999G>A	ENST00000230671.2	+	14	2103	c.1732G>A	c.(1732-1734)Gac>Aac	p.D578N	SLC6A7_ENST00000524041.1_Missense_Mutation_p.D578N	NM_014228.3	NP_055043.2	Q99884	SC6A7_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 7	578					proline transport (GO:0015824)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|skin(1)|stomach(1)	16		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		L-Proline(DB00172)	GCCGGCCATGGACTGGGGACC	0.622																																						dbGAP											0													45.0	50.0	49.0					5																	149588999		2203	4300	6503	-	-	-	SO:0001583	missense	0			S80071	CCDS4305.1	5q32	2013-07-19	2013-07-19		ENSG00000011083	ENSG00000011083		"""Solute carriers"""	11054	protein-coding gene	gene with protein product	"""brain-specific L-proline transporter"", ""sodium-dependent proline transporter"""	606205	"""solute carrier family 6 (neurotransmitter transporter, L-proline), member 7"""			7651355	Standard	NM_014228		Approved	PROT	uc003lrr.3	Q99884	OTTHUMG00000130046	ENST00000230671.2:c.1732G>A	5.37:g.149588999G>A	ENSP00000230671:p.Asp578Asn		Q0VG81|Q52LU6	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport	p.D578N	ENST00000230671.2	37	c.1732	CCDS4305.1	5	.	.	.	.	.	.	.	.	.	.	G	18.12	3.552575	0.65425	.	.	ENSG00000011083	ENST00000230671;ENST00000524041	T;T	0.74002	-0.79;-0.8	5.15	4.28	0.50868	.	0.139525	0.47455	D	0.000235	T	0.64659	0.2618	L	0.34521	1.04	0.44012	D	0.996725	B	0.31879	0.344	B	0.31547	0.132	T	0.64854	-0.6309	10	0.52906	T	0.07	.	13.4778	0.61318	0.0751:0.0:0.9249:0.0	.	578	Q99884	SC6A7_HUMAN	N	578	ENSP00000230671:D578N;ENSP00000428200:D578N	ENSP00000230671:D578N	D	+	1	0	SLC6A7	149569192	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.717000	0.61923	1.177000	0.42855	0.561000	0.74099	GAC	SLC6A7	-	NULL	ENSG00000011083		0.622	SLC6A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A7	HGNC	protein_coding	OTTHUMT00000252325.1	22	0.00	0	G	NM_014228		149588999	149588999	+1	no_errors	ENST00000230671	ensembl	human	known	69_37n	missense	14	33.33	7	SNP	1.000	A
TEX13A	56157	genome.wustl.edu	37	X	104464131	104464131	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1EO-01A-11D-A135-09	TCGA-BH-A1EO-11A-31D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20131381-8a11-425d-8954-980e6ec7c427	cb2284f3-6d08-40ec-bf36-dfa349354c59	g.chrX:104464131G>A	ENST00000413579.1	-	5	856	c.745C>T	c.(745-747)Ctt>Ttt	p.L249F	TEX13A_ENST00000372575.1_Silent_p.S249S|IL1RAPL2_ENST00000372582.1_Intron|TEX13A_ENST00000372578.3_Silent_p.S249S|IL1RAPL2_ENST00000344799.4_Intron			Q9BXU3	TX13A_HUMAN	testis expressed 13A	249							zinc ion binding (GO:0008270)			large_intestine(5)|ovary(2)|upper_aerodigestive_tract(1)	8						GCATCTCCAAGGAGCTGCAGG	0.582																																						dbGAP											0													40.0	40.0	40.0					X																	104464131		1940	4117	6057	-	-	-	SO:0001583	missense	0			AF285597	CCDS76005.1	Xq28	2012-04-20	2007-03-13		ENSG00000133149	ENSG00000268629			11735	protein-coding gene	gene with protein product		300312	"""testis expressed sequence 13A"""			11279525	Standard	NM_031274		Approved		uc004ema.3	Q9BXU3	OTTHUMG00000022133	ENST00000413579.1:c.745C>T	X.37:g.104464131G>A	ENSP00000399753:p.Leu249Phe		B1B1G8|Q32NB6	Missense_Mutation	SNP	pfam_Znf_RanBP2,pfscan_Znf_RanBP2	p.L249F	ENST00000413579.1	37	c.745		X	.	.	.	.	.	.	.	.	.	.	G	11.72	1.723683	0.30593	.	.	ENSG00000133149	ENST00000413579	.	.	.	3.45	0.636	0.17729	.	0.607423	0.12581	N	0.456441	T	0.30634	0.0771	L	0.47716	1.5	0.09310	N	1	B	0.22414	0.069	B	0.18871	0.023	T	0.29579	-1.0007	9	0.62326	D	0.03	.	3.2485	0.06806	0.2694:0.2204:0.5102:0.0	.	249	Q9BXU3	TX13A_HUMAN	F	249	.	ENSP00000399753:L249F	L	-	1	0	TEX13A	104350787	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.125000	0.15749	0.008000	0.14787	-0.322000	0.08575	CTT	TEX13A	-	NULL	ENSG00000133149		0.582	TEX13A-201	KNOWN	basic|appris_principal	protein_coding	TEX13A	HGNC	protein_coding		150	0.00	0	G	NM_031274		104464131	104464131	-1	no_errors	ENST00000413579	ensembl	human	known	69_37n	missense	133	30.00	57	SNP	0.000	A
TRMT44	152992	genome.wustl.edu	37	4	8469962	8469962	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A1EO-01A-11D-A135-09	TCGA-BH-A1EO-11A-31D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20131381-8a11-425d-8954-980e6ec7c427	cb2284f3-6d08-40ec-bf36-dfa349354c59	g.chr4:8469962C>T	ENST00000389737.4	+	9	1816	c.1816C>T	c.(1816-1818)Cga>Tga	p.R606*	TRMT44_ENST00000513449.2_Nonsense_Mutation_p.R365*	NM_152544.2	NP_689757.2	Q8IYL2	TRM44_HUMAN	tRNA methyltransferase 44 homolog (S. cerevisiae)	606					tRNA processing (GO:0008033)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)										CGCCCTGCCACGAGATTTTAT	0.502																																						dbGAP											0													57.0	60.0	59.0					4																	8469962		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK093044	CCDS3402.1, CCDS3402.2	4p16.1	2012-06-12	2012-06-12	2012-06-12	ENSG00000155275	ENSG00000155275			26653	protein-coding gene	gene with protein product	"""tRNA methyltransferase 44 homolog (S. cerevisiae)"""	614309	"""chromosome 4 open reading frame 23"", ""methyltransferase like 19"""	C4orf23, METTL19		21658913	Standard	NM_152544		Approved	FLJ35725, TRM44	uc003glg.2	Q8IYL2	OTTHUMG00000160935	ENST00000389737.4:c.1816C>T	4.37:g.8469962C>T	ENSP00000374387:p.Arg606*		Q8NA95	Nonsense_Mutation	SNP	pfam_tRNA_uracil_MeTrfase	p.R606*	ENST00000389737.4	37	c.1816	CCDS3402.2	4	.	.	.	.	.	.	.	.	.	.	C	31	5.103552	0.94245	.	.	ENSG00000155275	ENST00000513449;ENST00000389737;ENST00000285635	.	.	.	4.83	3.07	0.35406	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.6602	12.7131	0.57100	0.4325:0.5675:0.0:0.0	.	.	.	.	X	365;606;214	.	ENSP00000285635:R214X	R	+	1	2	METTL19	8520862	1.000000	0.71417	0.002000	0.10522	0.000000	0.00434	2.110000	0.41873	0.611000	0.30052	-0.310000	0.09108	CGA	TRMT44	-	NULL	ENSG00000155275		0.502	TRMT44-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	TRMT44	HGNC	protein_coding	OTTHUMT00000359197.2	106	0.00	0	C	NM_152544		8469962	8469962	+1	no_errors	ENST00000389737	ensembl	human	known	69_37n	nonsense	72	12.20	10	SNP	0.723	T
TSPAN17	26262	genome.wustl.edu	37	5	176078754	176078754	+	Splice_Site	SNP	G	G	A			TCGA-BH-A1EO-01A-11D-A135-09	TCGA-BH-A1EO-11A-31D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20131381-8a11-425d-8954-980e6ec7c427	cb2284f3-6d08-40ec-bf36-dfa349354c59	g.chr5:176078754G>A	ENST00000503045.1	+	3	193		c.e3-1		TSPAN17_ENST00000310032.8_Splice_Site|TSPAN17_ENST00000298564.10_Intron|TSPAN17_ENST00000515708.1_Splice_Site|TSPAN17_ENST00000508164.1_Splice_Site|TSPAN17_ENST00000405525.2_Splice_Site			Q96FV3	TSN17_HUMAN	tetraspanin 17						establishment of protein localization to organelle (GO:0072594)|protein ubiquitination (GO:0016567)	integral component of membrane (GO:0016021)|ubiquitin ligase complex (GO:0000151)	enzyme binding (GO:0019899)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(4)|kidney(1)|large_intestine(2)|lung(5)|urinary_tract(1)	13	all_cancers(89;0.00141)|Renal(175;0.000269)|Lung NSC(126;0.00814)|all_lung(126;0.0133)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCCCGGCACAGGGCGTTCTCT	0.637																																						dbGAP											0													127.0	115.0	119.0					5																	176078754		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF174603	CCDS34298.1, CCDS47346.1, CCDS47346.2, CCDS54952.1	5q35.3	2013-02-14	2005-03-21	2005-03-21	ENSG00000048140	ENSG00000048140		"""Tetraspanins"""	13594	protein-coding gene	gene with protein product			"""F-box only protein 23, transmembrane 4 superfamily member 17"""	FBXO23, TM4SF17		10531035, 10531037	Standard	NM_012171		Approved	FBX23	uc003met.3	Q96FV3	OTTHUMG00000163230	ENST00000503045.1:c.139-1G>A	5.37:g.176078754G>A			Q6NXF7|Q96S98|Q9UKB9	Splice_Site	SNP	-	e3-1	ENST00000503045.1	37	c.139-1		5	.	.	.	.	.	.	.	.	.	.	G	14.37	2.513900	0.44763	.	.	ENSG00000048140	ENST00000310032;ENST00000405525;ENST00000508164;ENST00000504168;ENST00000503045;ENST00000515708	.	.	.	4.32	4.32	0.51571	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7159	0.77667	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TSPAN17	176011360	1.000000	0.71417	0.995000	0.50966	0.298000	0.27526	9.545000	0.98095	2.231000	0.72958	0.491000	0.48974	.	TSPAN17	-	-	ENSG00000048140		0.637	TSPAN17-008	NOVEL	basic|exp_conf	protein_coding	TSPAN17	HGNC	protein_coding	OTTHUMT00000372215.1	179	0.56	1	G		Intron	176078754	176078754	+1	no_errors	ENST00000310032	ensembl	human	known	69_37n	splice_site	195	12.11	27	SNP	1.000	A
TTI1	9675	genome.wustl.edu	37	20	36641436	36641436	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A1EO-01A-11D-A135-09	TCGA-BH-A1EO-11A-31D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20131381-8a11-425d-8954-980e6ec7c427	cb2284f3-6d08-40ec-bf36-dfa349354c59	g.chr20:36641436T>A	ENST00000373448.2	-	3	1021	c.783A>T	c.(781-783)aaA>aaT	p.K261N	TTI1_ENST00000449821.1_Missense_Mutation_p.K261N|TTI1_ENST00000487362.1_Intron|TTI1_ENST00000373447.3_Missense_Mutation_p.K261N	NM_014657.1	NP_055472.1	O43156	TTI1_HUMAN	TELO2 interacting protein 1	261					regulation of TOR signaling (GO:0032006)	cytoplasm (GO:0005737)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)				breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	47						CAACTGCAGGTTTTGCTTGGA	0.408																																						dbGAP											0													196.0	197.0	197.0					20																	36641436		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC013121	CCDS13300.1	20q11.23	2011-11-10	2011-11-10	2010-06-22	ENSG00000101407	ENSG00000101407			29029	protein-coding gene	gene with protein product	"""smg-10 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	614425	"""KIAA0406"", ""Tel2 interacting protein 1 homolog (S. pombe)"""	KIAA0406		9455477, 20427287, 20371770	Standard	NM_014657		Approved	smg-10	uc002xhl.3	O43156	OTTHUMG00000032433	ENST00000373448.2:c.783A>T	20.37:g.36641436T>A	ENSP00000362547:p.Lys261Asn		D6W4K3|Q5JX67|Q96A38|Q9BR47|Q9H4K0	Missense_Mutation	SNP	superfamily_ARM-type_fold,pirsf_UCP005250	p.K261N	ENST00000373448.2	37	c.783	CCDS13300.1	20	.	.	.	.	.	.	.	.	.	.	T	2.635	-0.285524	0.05605	.	.	ENSG00000101407	ENST00000373448;ENST00000373447;ENST00000449821	T;T;T	0.16457	2.34;2.34;2.34	5.45	0.062	0.14343	Armadillo-like helical (1);Armadillo-type fold (1);	0.707965	0.15356	N	0.266689	T	0.14657	0.0354	M	0.68317	2.08	0.20074	N	0.999931	B	0.30361	0.277	B	0.29785	0.107	T	0.30504	-0.9976	10	0.16896	T	0.51	-15.9562	5.7537	0.18160	0.1228:0.6091:0.0:0.2681	.	261	O43156	TTI1_HUMAN	N	261	ENSP00000362547:K261N;ENSP00000362546:K261N;ENSP00000407270:K261N	ENSP00000362546:K261N	K	-	3	2	TTI1	36074850	0.027000	0.19231	0.017000	0.16124	0.436000	0.31835	-0.608000	0.05641	-0.099000	0.12263	-0.248000	0.11899	AAA	TTI1	-	superfamily_ARM-type_fold,pirsf_UCP005250	ENSG00000101407		0.408	TTI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTI1	HGNC	protein_coding	OTTHUMT00000079138.2	316	0.31	1	T	NM_014657		36641436	36641436	-1	no_errors	ENST00000373447	ensembl	human	known	69_37n	missense	258	33.51	130	SNP	0.155	A
TYK2	7297	genome.wustl.edu	37	19	10475348	10475348	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1EO-01A-11D-A135-09	TCGA-BH-A1EO-11A-31D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20131381-8a11-425d-8954-980e6ec7c427	cb2284f3-6d08-40ec-bf36-dfa349354c59	g.chr19:10475348C>T	ENST00000525621.1	-	9	1790	c.1309G>A	c.(1309-1311)Gag>Aag	p.E437K	TYK2_ENST00000529370.1_Missense_Mutation_p.E437K|TYK2_ENST00000264818.6_Missense_Mutation_p.E437K|TYK2_ENST00000524462.1_Missense_Mutation_p.E252K	NM_003331.4	NP_003322.3	P29597	TYK2_HUMAN	tyrosine kinase 2	437					cytokine-mediated signaling pathway (GO:0019221)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(11)|kidney(6)|large_intestine(3)|lung(19)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			GGAGCCACCTCGTGGCACAGG	0.692																																						dbGAP											0													38.0	47.0	44.0					19																	10475348		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS12236.1	19p13.2	2014-09-17			ENSG00000105397	ENSG00000105397	2.7.10.1		12440	protein-coding gene	gene with protein product		176941				2156206	Standard	NM_003331		Approved	JTK1	uc002moc.4	P29597	OTTHUMG00000166373	ENST00000525621.1:c.1309G>A	19.37:g.10475348C>T	ENSP00000431885:p.Glu437Lys		Q6QB10|Q96CH0	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_FERM_central,smart_Band_41_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_FERM_domain,pfscan_Prot_kinase_cat_dom,prints_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_Tyr_kinase_non-rcpt_TYK2_N	p.E437K	ENST00000525621.1	37	c.1309	CCDS12236.1	19	.	.	.	.	.	.	.	.	.	.	C	28.9	4.959119	0.92726	.	.	ENSG00000105397	ENST00000524462;ENST00000525621;ENST00000264818;ENST00000543792;ENST00000529370	T;T;T;T	0.62788	0.0;0.0;0.0;0.0	5.24	2.95	0.34219	.	0.111853	0.36932	N	0.002332	T	0.70150	0.3191	M	0.78049	2.395	0.48341	D	0.999635	D;D	0.64830	0.994;0.981	P;P	0.51453	0.67;0.641	T	0.76580	-0.2907	10	0.87932	D	0	-28.6488	13.0694	0.59053	0.0:0.6911:0.3089:0.0	.	437;437	E9PPF2;P29597	.;TYK2_HUMAN	K	252;437;437;184;437	ENSP00000433203:E252K;ENSP00000431885:E437K;ENSP00000264818:E437K;ENSP00000432728:E437K	ENSP00000264818:E437K	E	-	1	0	TYK2	10336348	0.987000	0.35691	0.913000	0.36048	0.989000	0.77384	2.752000	0.47516	1.198000	0.43158	0.471000	0.43371	GAG	TYK2	-	pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Tyr_kinase_non-rcpt_Jak/Tyk2	ENSG00000105397		0.692	TYK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYK2	HGNC	protein_coding	OTTHUMT00000389443.1	20	0.00	0	C			10475348	10475348	-1	no_errors	ENST00000264818	ensembl	human	known	69_37n	missense	16	30.43	7	SNP	0.986	T
ZNF577	84765	genome.wustl.edu	37	19	52381767	52381767	+	Splice_Site	SNP	C	C	A			TCGA-BH-A1EO-01A-11D-A135-09	TCGA-BH-A1EO-11A-31D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20131381-8a11-425d-8954-980e6ec7c427	cb2284f3-6d08-40ec-bf36-dfa349354c59	g.chr19:52381767C>A	ENST00000301399.5	-	5	427	c.62G>T	c.(61-63)gGg>gTg	p.G21V	ZNF577_ENST00000485702.1_5'UTR|ZNF577_ENST00000420592.1_Splice_Site_p.G21V|ZNF577_ENST00000451628.2_Splice_Site_p.G21V|ZNF577_ENST00000412216.1_Splice_Site_p.G21V	NM_032679.2	NP_116068.2	Q9BSK1	ZN577_HUMAN	zinc finger protein 577	21					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		TGACAATGACCCCTATAATAA	0.463																																						dbGAP											0													109.0	96.0	101.0					19																	52381767		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AL832871	CCDS12842.2, CCDS46160.1	19q13.41	2013-09-20			ENSG00000161551	ENSG00000161551		"""Zinc fingers, C2H2-type"", ""-"""	28673	protein-coding gene	gene with protein product						12477932	Standard	NM_032679		Approved	MGC4400	uc010yde.2	Q9BSK1	OTTHUMG00000157045	ENST00000301399.5:c.61-1G>T	19.37:g.52381767C>A			A8K0B4|A8K6Z7|C9JFB9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G21V	ENST00000301399.5	37	c.62	CCDS12842.2	19	.	.	.	.	.	.	.	.	.	.	.	12.09	1.832781	0.32421	.	.	ENSG00000161551	ENST00000412216;ENST00000301399;ENST00000420592;ENST00000451628;ENST00000458390;ENST00000453272;ENST00000446514;ENST00000419138	T;T;T;T;T;T;T;T	0.00873	5.59;5.59;5.59;5.59;5.59;5.59;5.59;5.59	3.49	-6.97	0.01616	Krueppel-associated box (1);	.	.	.	.	T	0.00666	0.0022	L	0.36672	1.1	0.09310	N	1	B;B	0.24368	0.062;0.102	B;B	0.16289	0.01;0.015	T	0.46978	-0.9152	9	0.37606	T	0.19	.	0.2194	0.00166	0.2562:0.1699:0.273:0.3009	.	21;21	Q9BSK1;Q9BSK1-2	ZN577_HUMAN;.	V	21	ENSP00000394828:G21V;ENSP00000301399:G21V;ENSP00000413476:G21V;ENSP00000389652:G21V;ENSP00000404509:G21V;ENSP00000413560:G21V;ENSP00000415307:G21V;ENSP00000407476:G21V	ENSP00000301399:G21V	G	-	2	0	ZNF577	57073579	0.000000	0.05858	0.000000	0.03702	0.372000	0.29890	-2.973000	0.00666	-1.363000	0.02164	0.591000	0.81541	GGG	ZNF577	-	superfamily_Krueppel-associated_box	ENSG00000161551		0.463	ZNF577-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF577	HGNC	protein_coding	OTTHUMT00000347243.1	173	0.00	0	C	NM_032679	Missense_Mutation	52381767	52381767	-1	no_errors	ENST00000301399	ensembl	human	known	69_37n	missense	136	30.26	59	SNP	0.000	A
ZNF831	128611	genome.wustl.edu	37	20	57782030	57782030	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A1EO-01A-11D-A135-09	TCGA-BH-A1EO-11A-31D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20131381-8a11-425d-8954-980e6ec7c427	cb2284f3-6d08-40ec-bf36-dfa349354c59	g.chr20:57782030C>T	ENST00000371030.2	+	3	3946	c.3946C>T	c.(3946-3948)Cga>Tga	p.R1316*		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1316							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.R1316*(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					AACCTGGGTGCGAAGAAGAAG	0.532																																						dbGAP											1	Substitution - Nonsense(1)	ovary(1)											78.0	84.0	82.0					20																	57782030		1937	4137	6074	-	-	-	SO:0001587	stop_gained	0			AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.3946C>T	20.37:g.57782030C>T	ENSP00000360069:p.Arg1316*		Q5TDR4|Q8TCP0	Nonsense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R1316*	ENST00000371030.2	37	c.3946	CCDS42894.1	20	.	.	.	.	.	.	.	.	.	.	C	41	8.812320	0.98962	.	.	ENSG00000124203	ENST00000371030	.	.	.	5.44	4.49	0.54785	.	1.434950	0.04290	N	0.345272	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	-1.112	11.6326	0.51185	0.1777:0.8223:0.0:0.0	.	.	.	.	X	1316	.	ENSP00000360069:R1316X	R	+	1	2	ZNF831	57215425	0.021000	0.18746	0.014000	0.15608	0.011000	0.07611	1.946000	0.40283	1.267000	0.44247	0.655000	0.94253	CGA	ZNF831	-	NULL	ENSG00000124203		0.532	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF831	HGNC	protein_coding	OTTHUMT00000079916.2	66	0.00	0	C	NM_178457		57782030	57782030	+1	no_errors	ENST00000371030	ensembl	human	novel	69_37n	nonsense	56	32.14	27	SNP	0.005	T
