#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACTR1A	10121	genome.wustl.edu	37	10	104241877	104241877	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr10:104241877C>T	ENST00000369905.4	-	8	869	c.806G>A	c.(805-807)gGa>gAa	p.G269E	ACTR1A_ENST00000470322.1_5'UTR|ACTR1A_ENST00000545684.1_Missense_Mutation_p.G195E|RP11-18I14.11_ENST00000608017.1_RNA|ACTR1A_ENST00000487599.1_Missense_Mutation_p.G269E|ACTR1A_ENST00000446605.2_Missense_Mutation_p.G222E	NM_005736.3	NP_005727.1	P61163	ACTZ_HUMAN	ARP1 actin-related protein 1 homolog A, centractin alpha (yeast)	269					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|vesicle-mediated transport (GO:0016192)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|extracellular vesicular exosome (GO:0070062)|microtubule associated complex (GO:0005875)	ATP binding (GO:0005524)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	13		Colorectal(252;0.122)		Epithelial(162;5.34e-09)|all cancers(201;1.43e-07)|BRCA - Breast invasive adenocarcinoma(275;0.222)		ACTCTCCTCTCCAATCAAATC	0.567																																						dbGAP											0													112.0	120.0	117.0					10																	104241877		2203	4300	6503	-	-	-	SO:0001583	missense	0			X82206	CCDS7536.1	10q24	2008-07-08	2001-11-28		ENSG00000138107	ENSG00000138107			167	protein-coding gene	gene with protein product		605143	"""ARP1 (actin-related protein 1, yeast) homolog A (centractin alpha)"""			1528266	Standard	NM_005736		Approved	ARP1	uc001kvv.3	P61163	OTTHUMG00000018956	ENST00000369905.4:c.806G>A	10.37:g.104241877C>T	ENSP00000358921:p.Gly269Glu		B2R6B0|P42024	Missense_Mutation	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.G269E	ENST00000369905.4	37	c.806	CCDS7536.1	10	.	.	.	.	.	.	.	.	.	.	C	20.3	3.965431	0.74131	.	.	ENSG00000138107	ENST00000369905;ENST00000545684;ENST00000446605	T;T;T	0.10573	2.86;2.86;2.86	5.93	5.93	0.95920	.	0.069052	0.64402	D	0.000011	T	0.47451	0.1446	M	0.93283	3.4	0.80722	D	1	D	0.65815	0.995	D	0.78314	0.991	T	0.58194	-0.7679	10	0.87932	D	0	.	20.3437	0.98782	0.0:1.0:0.0:0.0	.	269	P61163	ACTZ_HUMAN	E	269;195;222	ENSP00000358921:G269E;ENSP00000438890:G195E;ENSP00000406028:G222E	ENSP00000358921:G269E	G	-	2	0	ACTR1A	104231867	1.000000	0.71417	0.331000	0.25455	0.100000	0.18952	7.792000	0.85828	2.815000	0.96918	0.561000	0.74099	GGA	ACTR1A	-	pfam_Actin-like,smart_Actin-like	ENSG00000138107		0.567	ACTR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTR1A	HGNC	protein_coding	OTTHUMT00000050053.1	78	0.00	0	C			104241877	104241877	-1	no_errors	ENST00000369905	ensembl	human	known	69_37n	missense	72	16.28	14	SNP	1.000	T
ADPRHL2	54936	genome.wustl.edu	37	1	36557241	36557241	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr1:36557241G>A	ENST00000373178.4	+	3	361	c.331G>A	c.(331-333)Gac>Aac	p.D111N		NM_017825.2	NP_060295.1	Q9NX46	ARHL2_HUMAN	ADP-ribosylhydrolase like 2	111						mitochondrion (GO:0005739)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(ADP-ribose) glycohydrolase activity (GO:0004649)			cervix(1)|endometrium(2)|large_intestine(1)|lung(3)|pancreas(1)	8		Myeloproliferative disorder(586;0.0393)				GTACAAGAAAGACCCTGACAG	0.498																																						dbGAP											0													73.0	80.0	78.0					1																	36557241		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ427295	CCDS402.1	1p34.3	2008-02-05			ENSG00000116863	ENSG00000116863			21304	protein-coding gene	gene with protein product		610624				12070318, 16278211	Standard	NM_017825		Approved	ARH3, FLJ20446	uc001bzt.3	Q9NX46	OTTHUMG00000007628	ENST00000373178.4:c.331G>A	1.37:g.36557241G>A	ENSP00000362273:p.Asp111Asn		Q53G94|Q6IAB8|Q9BY47	Missense_Mutation	SNP	pfam_Ribosyl_crysJ1,superfamily_Ribosyl_crysJ1	p.D111N	ENST00000373178.4	37	c.331	CCDS402.1	1	.	.	.	.	.	.	.	.	.	.	G	18.38	3.610991	0.66558	.	.	ENSG00000116863	ENST00000373178;ENST00000540867	T	0.29917	1.55	5.15	5.15	0.70609	.	0.332530	0.35407	N	0.003224	T	0.29976	0.0750	L	0.43646	1.37	0.42012	D	0.990943	B	0.14805	0.011	B	0.20184	0.028	T	0.06752	-1.0809	10	0.22109	T	0.4	-3.4349	18.6234	0.91328	0.0:0.0:1.0:0.0	.	111	Q9NX46	ARHL2_HUMAN	N	111;31	ENSP00000362273:D111N	ENSP00000362273:D111N	D	+	1	0	ADPRHL2	36329828	1.000000	0.71417	0.994000	0.49952	0.993000	0.82548	6.215000	0.72206	2.370000	0.80446	0.563000	0.77884	GAC	ADPRHL2	-	pfam_Ribosyl_crysJ1,superfamily_Ribosyl_crysJ1	ENSG00000116863		0.498	ADPRHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADPRHL2	HGNC	protein_coding	OTTHUMT00000020199.1	121	0.00	0	G	NM_017825		36557241	36557241	+1	no_errors	ENST00000373178	ensembl	human	known	69_37n	missense	82	23.36	25	SNP	0.998	A
ADRBK1	156	genome.wustl.edu	37	11	67050618	67050618	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr11:67050618C>G	ENST00000308595.5	+	15	1537	c.1247C>G	c.(1246-1248)tCc>tGc	p.S416C	ADRBK1_ENST00000526285.1_Intron|ADRBK1_ENST00000527176.1_3'UTR	NM_001619.3	NP_001610.2	P25098	ARBK1_HUMAN	adrenergic, beta, receptor kinase 1	416	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|cardiac muscle contraction (GO:0060048)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of striated muscle contraction (GO:0045988)|negative regulation of the force of heart contraction by chemical signal (GO:0003108)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of catecholamine secretion (GO:0033605)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|tachykinin receptor signaling pathway (GO:0007217)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|ATP binding (GO:0005524)|beta-adrenergic receptor kinase activity (GO:0047696)|Edg-2 lysophosphatidic acid receptor binding (GO:0031755)|G-protein coupled receptor kinase activity (GO:0004703)|protein kinase activity (GO:0004672)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|liver(2)|lung(8)|prostate(2)	22			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)		Adenosine triphosphate(DB00171)	CTGCCCGACTCCTTCTCCCCT	0.632																																						dbGAP											0													117.0	120.0	119.0					11																	67050618		2200	4295	6495	-	-	-	SO:0001583	missense	0			X61157	CCDS8156.1	11q13	2013-01-10			ENSG00000173020	ENSG00000173020		"""Pleckstrin homology (PH) domain containing"""	289	protein-coding gene	gene with protein product		109635				2037065	Standard	NM_001619		Approved	GRK2, BARK1	uc009yrn.1	P25098	OTTHUMG00000167104	ENST00000308595.5:c.1247C>G	11.37:g.67050618C>G	ENSP00000312262:p.Ser416Cys		B0ZBE1|Q13837|Q6GTT3	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Regulat_G_prot_signal,pfam_Pleckstrin_homology,superfamily_Kinase-like_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Regulat_G_prot_signal,pfscan_Prot_kinase_cat_dom,prints_GPCR_kinase	p.S416C	ENST00000308595.5	37	c.1247	CCDS8156.1	11	.	.	.	.	.	.	.	.	.	.	C	17.39	3.376326	0.61735	.	.	ENSG00000173020	ENST00000308595	T	0.49139	0.79	4.89	4.89	0.63831	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.56097	D	0.000031	T	0.40791	0.1131	L	0.31207	0.915	0.80722	D	1	B	0.10296	0.003	B	0.13407	0.009	T	0.27971	-1.0058	10	0.59425	D	0.04	-5.0583	18.607	0.91270	0.0:1.0:0.0:0.0	.	416	P25098	ARBK1_HUMAN	C	416	ENSP00000312262:S416C	ENSP00000312262:S416C	S	+	2	0	ADRBK1	66807194	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.902000	0.75699	2.712000	0.92718	0.561000	0.74099	TCC	ADRBK1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000173020		0.632	ADRBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADRBK1	HGNC	protein_coding	OTTHUMT00000393153.1	76	0.00	0	C	NM_001619		67050618	67050618	+1	no_errors	ENST00000308595	ensembl	human	known	69_37n	missense	387	10.60	46	SNP	1.000	G
AFF2	2334	genome.wustl.edu	37	X	147743846	147743846	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chrX:147743846C>A	ENST00000370460.2	+	3	1077	c.598C>A	c.(598-600)Cca>Aca	p.P200T	AFF2_ENST00000370458.1_Missense_Mutation_p.P196T|AFF2_ENST00000342251.3_Missense_Mutation_p.P196T|AFF2_ENST00000370457.5_Missense_Mutation_p.P196T	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	200					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					CTTTGTCTACCCAGCTGAACA	0.468																																						dbGAP											0													144.0	142.0	142.0					X																	147743846		2203	4300	6503	-	-	-	SO:0001583	missense	0			U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.598C>A	X.37:g.147743846C>A	ENSP00000359489:p.Pro200Thr		A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	pfam_TF_AF4/FMR2	p.P200T	ENST00000370460.2	37	c.598	CCDS14684.1	X	.	.	.	.	.	.	.	.	.	.	C	15.32	2.799052	0.50208	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000370458	T;T;T;T	0.63255	-0.03;-0.03;-0.03;-0.03	5.82	5.82	0.92795	.	0.196989	0.43579	D	0.000546	T	0.66934	0.2840	N	0.24115	0.695	0.80722	D	1	B;B;B;B;P;D	0.64830	0.433;0.433;0.433;0.433;0.489;0.994	B;B;B;B;B;P	0.59424	0.11;0.11;0.11;0.11;0.175;0.857	T	0.70385	-0.4886	10	0.62326	D	0.03	.	19.0492	0.93036	0.0:1.0:0.0:0.0	.	200;196;196;196;200;196	P51816-6;P51816-3;P51816-2;P51816-5;P51816;P51816-4	.;.;.;.;AFF2_HUMAN;.	T	200;196;196;196	ENSP00000359489:P200T;ENSP00000359486:P196T;ENSP00000345459:P196T;ENSP00000359487:P196T	ENSP00000345459:P196T	P	+	1	0	AFF2	147551538	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.467000	0.73547	2.448000	0.82819	0.600000	0.82982	CCA	AFF2	-	pfam_TF_AF4/FMR2	ENSG00000155966		0.468	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AFF2	HGNC	protein_coding	OTTHUMT00000058673.2	114	0.00	0	C	NM_002025		147743846	147743846	+1	no_errors	ENST00000370460	ensembl	human	known	69_37n	missense	56	32.53	27	SNP	1.000	A
ALDH1A3	220	genome.wustl.edu	37	15	101438383	101438383	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr15:101438383C>G	ENST00000329841.5	+	8	1408	c.876C>G	c.(874-876)gaC>gaG	p.D292E	ALDH1A3_ENST00000346623.6_Missense_Mutation_p.D185E|RP11-66B24.4_ENST00000560351.1_RNA	NM_000693.2	NP_000684.2	P47895	AL1A3_HUMAN	aldehyde dehydrogenase 1 family, member A3	292					embryonic eye morphogenesis (GO:0048048)|face development (GO:0060324)|inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|nucleus accumbens development (GO:0021768)|olfactory pit development (GO:0060166)|optic cup morphogenesis involved in camera-type eye development (GO:0002072)|positive regulation of apoptotic process (GO:0043065)|retinal metabolic process (GO:0042574)|retinoic acid biosynthetic process (GO:0002138)|retinoic acid metabolic process (GO:0042573)|retinol metabolic process (GO:0042572)|righting reflex (GO:0060013)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)|NAD+ binding (GO:0070403)|protein homodimerization activity (GO:0042803)|thyroid hormone binding (GO:0070324)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(7)|lung(9)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	27	Lung NSC(78;0.00144)|all_lung(78;0.0018)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)		Vitamin A(DB00162)	TGTGTGCGGACGCTGACTGTG	0.577																																						dbGAP											0													58.0	56.0	57.0					15																	101438383		2203	4300	6503	-	-	-	SO:0001583	missense	0			U07919	CCDS10389.1	15q26	2010-05-07			ENSG00000184254	ENSG00000184254	1.2.1.5	"""Aldehyde dehydrogenases"""	409	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 3"""	600463		ALDH6		7698756	Standard	XR_111558		Approved	RALDH3	uc002bwn.4	P47895	OTTHUMG00000149870	ENST00000329841.5:c.876C>G	15.37:g.101438383C>G	ENSP00000332256:p.Asp292Glu		Q6NT64	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	p.D292E	ENST00000329841.5	37	c.876	CCDS10389.1	15	.	.	.	.	.	.	.	.	.	.	c	12.75	2.032234	0.35893	.	.	ENSG00000184254	ENST00000329841;ENST00000346623	T	0.23147	1.92	5.76	-11.5	0.00074	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.85682	D	0.000000	T	0.62829	0.2460	H	0.98466	4.24	0.32406	N	0.551348	D;D	0.76494	0.999;0.998	D;D	0.81914	0.995;0.99	D	0.87077	0.2163	10	0.87932	D	0	.	23.2449	0.99981	0.0:0.2311:0.0:0.7689	.	196;292	Q7Z3A2;P47895	.;AL1A3_HUMAN	E	292;196	ENSP00000332256:D292E	ENSP00000332256:D292E	D	+	3	2	ALDH1A3	99255906	0.050000	0.20438	0.000000	0.03702	0.001000	0.01503	-0.692000	0.05127	-3.896000	0.00094	-3.359000	0.00041	GAC	ALDH1A3	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	ENSG00000184254		0.577	ALDH1A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1A3	HGNC	protein_coding	OTTHUMT00000313620.2	61	0.00	0	C			101438383	101438383	+1	no_errors	ENST00000329841	ensembl	human	known	69_37n	missense	28	33.33	14	SNP	0.009	G
ANKRD30BL	554226	genome.wustl.edu	37	2	133015505	133015505	+	5'UTR	SNP	G	G	A			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr2:133015505G>A	ENST00000470729.1	-	0	37				MIR663B_ENST00000408361.1_RNA	NR_027020.2		A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						GAGGCAGAACGGTAGCCCCTC	0.687																																						dbGAP											0													36.0	41.0	39.0					2																	133015505		692	1591	2283	-	-	-	SO:0001623	5_prime_UTR_variant	0					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000470729.1:c.-1388C>T	2.37:g.133015505G>A			B8ZZL7	RNA	SNP	-	NULL	ENST00000470729.1	37	NULL		2																																																																																			ANKRD30BL	-	-	ENSG00000163046		0.687	ANKRD30BL-002	KNOWN	basic	processed_transcript	ANKRD30BL	HGNC	protein_coding	OTTHUMT00000331354.1	40	0.00	0	G	NR_027019		133015505	133015505	-1	no_errors	ENST00000470729	ensembl	human	known	69_37n	rna	62	16.22	12	SNP	0.040	A
ATP5A1	498	genome.wustl.edu	37	18	43668162	43668162	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr18:43668162C>G	ENST00000398752.6	-	6	833	c.712G>C	c.(712-714)Gaa>Caa	p.E238Q	ATP5A1_ENST00000282050.2_Missense_Mutation_p.E238Q|ATP5A1_ENST00000593152.2_Missense_Mutation_p.E188Q|ATP5A1_ENST00000590665.1_Missense_Mutation_p.E216Q	NM_001001935.2|NM_004046.5	NP_001001935.1|NP_004037.1	P25705	ATPA_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle	238					ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular metabolic process (GO:0044237)|embryo development (GO:0009790)|lipid metabolic process (GO:0006629)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|negative regulation of endothelial cell proliferation (GO:0001937)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|proton-transporting ATP synthase complex, catalytic core F(1) (GO:0045261)	ATP binding (GO:0005524)|MHC class I protein binding (GO:0042288)|poly(A) RNA binding (GO:0044822)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)			breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(8)|skin(1)|urinary_tract(1)	22						TTCTTCTTTTCATCAGATCCA	0.333																																						dbGAP											0													113.0	107.0	109.0					18																	43668162		2203	4300	6503	-	-	-	SO:0001583	missense	0			D14710	CCDS11927.1, CCDS58620.1, CCDS59315.1	18q21	2012-10-12	2006-01-13		ENSG00000152234	ENSG00000152234	3.6.1.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	823	protein-coding gene	gene with protein product		164360	"""ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform 2, non-cardiac muscle-like 2"", ""ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform 1, cardiac muscle"""	ATP5AL2, ATPM		1830491	Standard	NM_001257334		Approved	ATP5A, hATP1, OMR, ORM	uc002lbr.2	P25705	OTTHUMG00000132637	ENST00000398752.6:c.712G>C	18.37:g.43668162C>G	ENSP00000381736:p.Glu238Gln		A8K092|B4DY56|K7ENP3|Q53XX6|Q8IXV2|Q96FB4|Q96HW2|Q96IR6|Q9BTV8	Missense_Mutation	SNP	pfam_ATPase_F1/V1/A1_a/bsu_nucl-bd,pfam_ATPase_F1/V1/A1-cplx_a/bsu_C,pfam_ATPase_F1/V1/A1-cplx_a/bsu_N,superfamily_ATPase_F1/V1/A1-cplx_a/bsu_C,superfamily_ATPase_F1/A1-cplx_a/bsu_N,tigrfam_ATPase_F1-cplx_asu	p.E238Q	ENST00000398752.6	37	c.712	CCDS11927.1	18	.	.	.	.	.	.	.	.	.	.	C	21.7	4.188505	0.78789	.	.	ENSG00000152234	ENST00000282050;ENST00000398752;ENST00000542290	D;D	0.81739	-1.53;-1.53	5.06	5.06	0.68205	ATPase, F1/V1/A1 complex, alpha/beta subunit, nucleotide-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.82176	0.4980	M	0.61703	1.905	0.80722	D	1	P	0.50066	0.931	P	0.45310	0.476	D	0.85408	0.1135	10	0.87932	D	0	-22.1932	18.4439	0.90677	0.0:1.0:0.0:0.0	.	238	P25705	ATPA_HUMAN	Q	238;238;188	ENSP00000282050:E238Q;ENSP00000381736:E238Q	ENSP00000282050:E238Q	E	-	1	0	ATP5A1	41922160	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.760000	0.85248	2.344000	0.79699	0.591000	0.81541	GAA	ATP5A1	-	pfam_ATPase_F1/V1/A1_a/bsu_nucl-bd,tigrfam_ATPase_F1-cplx_asu	ENSG00000152234		0.333	ATP5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP5A1	HGNC	protein_coding	OTTHUMT00000255884.1	306	0.00	0	C	NM_004046		43668162	43668162	-1	no_errors	ENST00000282050	ensembl	human	known	69_37n	missense	134	25.14	45	SNP	1.000	G
ATP8B3	148229	genome.wustl.edu	37	19	1796813	1796813	+	Silent	SNP	C	C	A			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr19:1796813C>A	ENST00000310127.6	-	16	1888	c.1650G>T	c.(1648-1650)ctG>ctT	p.L550L	ATP8B3_ENST00000539485.1_Silent_p.L550L|ATP8B3_ENST00000525591.1_Silent_p.L503L	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3	550					binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCACGAGGTGCAGCAGGGCCG	0.701																																						dbGAP											0													30.0	36.0	34.0					19																	1796813		2076	4183	6259	-	-	-	SO:0001819	synonymous_variant	0			AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.1650G>T	19.37:g.1796813C>A			Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Silent	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.L550	ENST00000310127.6	37	c.1650	CCDS45901.1	19																																																																																			ATP8B3	-	pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,tigrfam_ATPase_P-typ_Plipid-transl	ENSG00000130270		0.701	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	ATP8B3	HGNC	protein_coding	OTTHUMT00000388279.1	11	0.00	0	C	NM_138813		1796813	1796813	-1	no_errors	ENST00000539485	ensembl	human	known	69_37n	silent	12	29.41	5	SNP	0.010	A
BAHD1	22893	genome.wustl.edu	37	15	40750766	40750766	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr15:40750766G>A	ENST00000416165.1	+	2	174	c.103G>A	c.(103-105)Gag>Aag	p.E35K	BAHD1_ENST00000560846.1_Missense_Mutation_p.E35K|BAHD1_ENST00000561234.1_Missense_Mutation_p.E35K	NM_014952.3	NP_055767.3	Q8TBE0	BAHD1_HUMAN	bromo adjacent homology domain containing 1	35					heterochromatin assembly (GO:0031507)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|chromosome (GO:0005694)	chromatin binding (GO:0003682)			NS(1)|endometrium(6)|kidney(3)|large_intestine(3)|lung(10)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	28		all_cancers(109;8.28e-19)|all_epithelial(112;2.64e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.46e-06)|BRCA - Breast invasive adenocarcinoma(123;0.08)		GCAGGGGGTTGAGGGTGTGGA	0.612																																						dbGAP											0													92.0	88.0	89.0					15																	40750766		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL833923	CCDS10058.1, CCDS73705.1	15q14	2005-11-10			ENSG00000140320	ENSG00000140320			29153	protein-coding gene	gene with protein product		613880				10231032	Standard	XM_005254229		Approved	KIAA0945	uc001zlu.2	Q8TBE0	OTTHUMG00000129982	ENST00000416165.1:c.103G>A	15.37:g.40750766G>A	ENSP00000396976:p.Glu35Lys		Q8NDF7|Q9Y2F4	Missense_Mutation	SNP	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	p.E35K	ENST00000416165.1	37	c.103	CCDS10058.1	15	.	.	.	.	.	.	.	.	.	.	G	22.5	4.302055	0.81136	.	.	ENSG00000140320	ENST00000416165	T	0.21031	2.03	5.14	5.14	0.70334	.	0.155443	0.41194	D	0.000928	T	0.13286	0.0322	N	0.08118	0	0.39275	D	0.964456	B;B;B	0.34290	0.447;0.319;0.447	B;B;B	0.33690	0.168;0.081;0.168	T	0.16689	-1.0394	10	0.54805	T	0.06	-15.7332	16.5393	0.84381	0.0:0.0:1.0:0.0	.	35;35;35	Q8TBE0-3;Q8TBE0;Q8TBE0-2	.;BAHD1_HUMAN;.	K	35	ENSP00000396976:E35K	ENSP00000396976:E35K	E	+	1	0	BAHD1	38538058	0.976000	0.34144	0.513000	0.27749	0.974000	0.67602	3.903000	0.56318	2.668000	0.90789	0.655000	0.94253	GAG	BAHD1	-	NULL	ENSG00000140320		0.612	BAHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BAHD1	HGNC	protein_coding	OTTHUMT00000252248.1	30	0.00	0	G	NM_014952		40750766	40750766	+1	no_errors	ENST00000416165	ensembl	human	known	69_37n	missense	19	32.14	9	SNP	0.914	A
BAZ2B	29994	genome.wustl.edu	37	2	160295653	160295653	+	Nonsense_Mutation	SNP	G	G	C			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr2:160295653G>C	ENST00000392783.2	-	7	1262	c.767C>G	c.(766-768)tCa>tGa	p.S256*	BAZ2B_ENST00000392782.1_Nonsense_Mutation_p.S254*|BAZ2B_ENST00000355831.2_Nonsense_Mutation_p.S256*|BAZ2B_ENST00000343439.5_Nonsense_Mutation_p.S254*	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	256	Ser-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						GCCTTCACTTGAGGTGTCTGA	0.388																																						dbGAP											0													329.0	292.0	304.0					2																	160295653		1949	4152	6101	-	-	-	SO:0001587	stop_gained	0			AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.767C>G	2.37:g.160295653G>C	ENSP00000376534:p.Ser256*		D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Nonsense_Mutation	SNP	pfam_Bromodomain,pfam_Methyl_CpG_DNA-bd,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_DNA-bd_integrase-typ,superfamily_Znf_FYVE_PHD,superfamily_ARM-type_fold,smart_Methyl_CpG_DNA-bd,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Methyl_CpG_DNA-bd,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.S256*	ENST00000392783.2	37	c.767	CCDS2209.2	2	.	.	.	.	.	.	.	.	.	.	G	38	7.088000	0.98055	.	.	ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439;ENST00000546335	.	.	.	5.33	5.33	0.75918	.	0.000000	0.31210	U	0.008052	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-5.565	19.0185	0.92903	0.0:0.0:1.0:0.0	.	.	.	.	X	254;256;256;254;193	.	ENSP00000339670:S254X	S	-	2	0	BAZ2B	160003899	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.999000	0.76283	2.455000	0.83008	0.563000	0.77884	TCA	BAZ2B	-	NULL	ENSG00000123636		0.388	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAZ2B	HGNC	protein_coding	OTTHUMT00000255037.2	683	0.00	0	G			160295653	160295653	-1	no_errors	ENST00000392783	ensembl	human	known	69_37n	nonsense	353	24.41	114	SNP	1.000	C
BOD1L1	259282	genome.wustl.edu	37	4	13605023	13605023	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr4:13605023C>G	ENST00000040738.5	-	10	3636	c.3501G>C	c.(3499-3501)ttG>ttC	p.L1167F		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	1167						nucleus (GO:0005634)	DNA binding (GO:0003677)										TGCAAGTTCTCAATTCATCCT	0.383																																						dbGAP											0													104.0	112.0	109.0					4																	13605023		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.3501G>C	4.37:g.13605023C>G	ENSP00000040738:p.Leu1167Phe		Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	NULL	p.L1167F	ENST00000040738.5	37	c.3501	CCDS3411.2	4	.	.	.	.	.	.	.	.	.	.	C	0.960	-0.703518	0.03255	.	.	ENSG00000038219	ENST00000040738	T	0.08720	3.06	5.54	0.0108	0.14084	.	0.654401	0.12588	N	0.455848	T	0.05868	0.0153	L	0.38531	1.155	0.09310	N	1	B	0.20368	0.044	B	0.20384	0.029	T	0.43782	-0.9370	10	0.20046	T	0.44	-3.6196	5.1592	0.15053	0.0:0.3098:0.1482:0.542	.	1167	Q8NFC6	BOD1L_HUMAN	F	1167	ENSP00000040738:L1167F	ENSP00000040738:L1167F	L	-	3	2	BOD1L	13214121	0.001000	0.12720	0.003000	0.11579	0.009000	0.06853	-0.050000	0.11904	0.054000	0.16065	-0.290000	0.09829	TTG	BOD1L1	-	NULL	ENSG00000038219		0.383	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1L1	HGNC	protein_coding	OTTHUMT00000207321.1	185	0.00	0	C	NM_148894		13605023	13605023	-1	no_errors	ENST00000040738	ensembl	human	known	69_37n	missense	80	23.08	24	SNP	0.005	G
BOD1L1	259282	genome.wustl.edu	37	4	13605203	13605203	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr4:13605203C>G	ENST00000040738.5	-	10	3456	c.3321G>C	c.(3319-3321)aaG>aaC	p.K1107N		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	1107						nucleus (GO:0005634)	DNA binding (GO:0003677)										TATCACCACTCTTTTTTGGTC	0.433																																						dbGAP											0													118.0	118.0	118.0					4																	13605203		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.3321G>C	4.37:g.13605203C>G	ENSP00000040738:p.Lys1107Asn		Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	NULL	p.K1107N	ENST00000040738.5	37	c.3321	CCDS3411.2	4	.	.	.	.	.	.	.	.	.	.	C	12.77	2.037196	0.35893	.	.	ENSG00000038219	ENST00000040738	T	0.09163	3.01	5.35	-3.21	0.05140	.	0.397494	0.21423	N	0.074787	T	0.12135	0.0295	M	0.61703	1.905	0.09310	N	1	P	0.48162	0.906	P	0.46585	0.521	T	0.26643	-1.0097	10	0.19147	T	0.46	-1.6094	10.61	0.45417	0.1372:0.6869:0.0:0.1758	.	1107	Q8NFC6	BOD1L_HUMAN	N	1107	ENSP00000040738:K1107N	ENSP00000040738:K1107N	K	-	3	2	BOD1L	13214301	0.000000	0.05858	0.004000	0.12327	0.911000	0.54048	0.130000	0.15850	-0.498000	0.06632	-0.302000	0.09304	AAG	BOD1L1	-	NULL	ENSG00000038219		0.433	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1L1	HGNC	protein_coding	OTTHUMT00000207321.1	397	0.00	0	C	NM_148894		13605203	13605203	-1	no_errors	ENST00000040738	ensembl	human	known	69_37n	missense	154	27.70	59	SNP	0.021	G
C10orf53	282966	genome.wustl.edu	37	10	50916467	50916467	+	Missense_Mutation	SNP	A	A	G			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr10:50916467A>G	ENST00000374112.3	+	3	290	c.278A>G	c.(277-279)cAg>cGg	p.Q93R	C10orf53_ENST00000535836.1_Missense_Mutation_p.Q93R	NM_182554.2	NP_872360.2	Q8N6V4	CJ053_HUMAN	chromosome 10 open reading frame 53	0										endometrium(1)|lung(6)	7		all_neural(218;0.107)				acatttcaccagcttagcagc	0.493																																						dbGAP											0													129.0	117.0	121.0					10																	50916467		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC028127	CCDS31202.1, CCDS41521.1	10q11.23	2012-05-24			ENSG00000178645	ENSG00000178645			27421	protein-coding gene	gene with protein product						12477932	Standard	NM_182554		Approved	Em:AC069546.1	uc001jid.1	Q8N6V4	OTTHUMG00000018199	ENST00000374112.3:c.278A>G	10.37:g.50916467A>G	ENSP00000363226:p.Gln93Arg		A6NI81|A6NLE0|B9ZVK6	Missense_Mutation	SNP	NULL	p.Q93R	ENST00000374112.3	37	c.278	CCDS31202.1	10	.	.	.	.	.	.	.	.	.	.	A	5.985	0.365740	0.11352	.	.	ENSG00000178645	ENST00000374112;ENST00000535836	.	.	.	1.48	-0.184	0.13280	.	.	.	.	.	T	0.11239	0.0274	N	0.08118	0	0.09310	N	1	P	0.36144	0.539	B	0.26310	0.068	T	0.15549	-1.0433	8	0.59425	D	0.04	.	3.3729	0.07227	0.5644:0.0:0.4356:0.0	.	93	B9ZVK6	.	R	93	.	ENSP00000363226:Q93R	Q	+	2	0	C10orf53	50586473	0.000000	0.05858	0.002000	0.10522	0.020000	0.10135	-0.429000	0.06982	-0.061000	0.13110	0.402000	0.26972	CAG	C10orf53	-	NULL	ENSG00000178645		0.493	C10orf53-003	KNOWN	basic|CCDS	protein_coding	C10orf53	HGNC	protein_coding	OTTHUMT00000048006.1	135	0.00	0	A	NM_182554		50916467	50916467	+1	no_errors	ENST00000374112	ensembl	human	known	69_37n	missense	101	22.31	29	SNP	0.002	G
C10orf12	26148	genome.wustl.edu	37	10	98742331	98742331	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr10:98742331C>T	ENST00000286067.2	+	1	1291	c.1184C>T	c.(1183-1185)tCa>tTa	p.S395L		NM_015652.2	NP_056467.2	Q8N655	CJ012_HUMAN	chromosome 10 open reading frame 12	395										NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(3)|prostate(2)|skin(2)|stomach(4)	45		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		CCTCAGTGCTCAGAAAATCAG	0.512																																						dbGAP											0													75.0	84.0	81.0					10																	98742331		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC024315	CCDS7452.1	10q24.2	2014-03-11			ENSG00000155640	ENSG00000155640			23420	protein-coding gene	gene with protein product						24550272	Standard	NM_015652		Approved	DKFZP564P1916, FLJ13022	uc001kmv.3	Q8N655	OTTHUMG00000018840	ENST00000286067.2:c.1184C>T	10.37:g.98742331C>T	ENSP00000286067:p.Ser395Leu		Q9H945|Q9Y457	Missense_Mutation	SNP	NULL	p.S395L	ENST00000286067.2	37	c.1184	CCDS7452.1	10	.	.	.	.	.	.	.	.	.	.	C	14.57	2.574219	0.45902	.	.	ENSG00000155640	ENST00000286067;ENST00000539886	T	0.08634	3.07	6.05	6.05	0.98169	.	0.000000	0.30085	N	0.010448	T	0.07324	0.0185	L	0.27053	0.805	0.09310	N	1	B;B	0.27351	0.041;0.176	B;B	0.28849	0.027;0.095	T	0.26087	-1.0113	10	0.52906	T	0.07	0.0132	9.8469	0.41032	0.0:0.8816:0.0:0.1184	.	229;395	A0PJI9;Q8N655	.;CJ012_HUMAN	L	395;229	ENSP00000286067:S395L	ENSP00000286067:S395L	S	+	2	0	C10orf12	98732321	0.029000	0.19370	0.071000	0.20095	0.865000	0.49528	0.440000	0.21592	2.880000	0.98712	0.655000	0.94253	TCA	C10orf12	-	NULL	ENSG00000155640		0.512	C10orf12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf12	HGNC	protein_coding	OTTHUMT00000049627.1	51	0.00	0	C	NM_015652		98742331	98742331	+1	no_errors	ENST00000286067	ensembl	human	known	69_37n	missense	33	23.26	10	SNP	0.047	T
C11orf86	254439	genome.wustl.edu	37	11	66743094	66743094	+	Silent	SNP	G	G	C			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr11:66743094G>C	ENST00000308963.4	+	1	347	c.261G>C	c.(259-261)ctG>ctC	p.L87L		NM_001136485.1	NP_001129957.1	A6NJI1	CK086_HUMAN	chromosome 11 open reading frame 86	87										NS(1)|skin(1)	2						GGTGGTGGCTGAGGCGGTACC	0.647																																						dbGAP											0													19.0	30.0	26.0					11																	66743094		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AK026328, AP003176	CCDS44656.1	11q13.1	2012-08-10			ENSG00000173237	ENSG00000173237			34442	protein-coding gene	gene with protein product							Standard	NM_001136485		Approved	FLJ22675	uc010rpm.2	A6NJI1	OTTHUMG00000153671	ENST00000308963.4:c.261G>C	11.37:g.66743094G>C				Silent	SNP	NULL	p.L87	ENST00000308963.4	37	c.261	CCDS44656.1	11																																																																																			C11orf86	-	NULL	ENSG00000173237		0.647	C11orf86-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf86	HGNC	protein_coding	OTTHUMT00000332022.2	12	0.00	0	G	NM_001136485		66743094	66743094	+1	no_errors	ENST00000308963	ensembl	human	known	69_37n	silent	11	31.25	5	SNP	0.765	C
C4orf29	80167	genome.wustl.edu	37	4	128938554	128938554	+	Silent	SNP	G	G	C			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr4:128938554G>C	ENST00000444616.1	+	8	754	c.507G>C	c.(505-507)gtG>gtC	p.V169V	C4orf29_ENST00000398965.1_Silent_p.V169V|C4orf29_ENST00000388795.5_Silent_p.V87V			Q0P651	CD029_HUMAN	chromosome 4 open reading frame 29	169						extracellular region (GO:0005576)				breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	8						ACCTTTTTGTGATGGGAGGAG	0.398																																						dbGAP											0													81.0	71.0	74.0					4																	128938554		1819	4086	5905	-	-	-	SO:0001819	synonymous_variant	0			AK024759	CCDS47131.1	4q28.2	2008-02-05			ENSG00000164074	ENSG00000164074			26111	protein-coding gene	gene with protein product						12477932	Standard	XM_006714318		Approved	FLJ21106	uc021xrt.1	Q0P651	OTTHUMG00000133304	ENST00000444616.1:c.507G>C	4.37:g.128938554G>C			A1A4W8|A1A4W9|Q9H7A7	Silent	SNP	pfam_DUF2048	p.V169	ENST00000444616.1	37	c.507		4																																																																																			C4orf29	-	pfam_DUF2048	ENSG00000164074		0.398	C4orf29-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	C4orf29	HGNC	protein_coding	OTTHUMT00000257098.1	324	0.00	0	G	NM_001039717		128938554	128938554	+1	no_errors	ENST00000398965	ensembl	human	known	69_37n	silent	113	26.62	41	SNP	1.000	C
C5orf42	65250	genome.wustl.edu	37	5	37213766	37213766	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr5:37213766C>T	ENST00000508244.1	-	15	2908	c.2815G>A	c.(2815-2817)Gtc>Atc	p.V939I	C5orf42_ENST00000274258.7_5'UTR|C5orf42_ENST00000425232.2_Missense_Mutation_p.V939I			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	939						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			ATGGACTGGACGACTCTCACT	0.473																																						dbGAP											0													111.0	92.0	98.0					5																	37213766		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.2815G>A	5.37:g.37213766C>T	ENSP00000421690:p.Val939Ile		A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	superfamily_Quino_amine_DH_bsu	p.V939I	ENST00000508244.1	37	c.2815	CCDS34146.2	5	.	.	.	.	.	.	.	.	.	.	C	10.41	1.342180	0.24339	.	.	ENSG00000197603	ENST00000508244;ENST00000425232	T;T	0.36878	1.23;1.23	5.44	-0.785	0.10950	.	0.300724	0.26784	N	0.022509	T	0.20129	0.0484	N	0.19112	0.55	0.80722	D	1	B	0.16802	0.019	B	0.14023	0.01	T	0.07770	-1.0755	10	0.24483	T	0.36	-0.0055	11.3423	0.49539	0.0:0.3554:0.0:0.6446	.	939	E9PH94	.	I	939	ENSP00000421690:V939I;ENSP00000389014:V939I	ENSP00000389014:V939I	V	-	1	0	C5orf42	37249523	0.040000	0.19996	0.393000	0.26258	0.561000	0.35649	0.045000	0.14013	-0.235000	0.09767	-0.327000	0.08410	GTC	C5orf42	-	NULL	ENSG00000197603		0.473	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C5orf42	HGNC	protein_coding	OTTHUMT00000360806.1	81	0.00	0	C	NM_023073		37213766	37213766	-1	no_errors	ENST00000425232	ensembl	human	known	69_37n	missense	87	15.53	16	SNP	0.989	T
C5orf42	65250	genome.wustl.edu	37	5	37224748	37224748	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr5:37224748C>T	ENST00000508244.1	-	12	2479	c.2386G>A	c.(2386-2388)Gaa>Aaa	p.E796K	C5orf42_ENST00000274258.7_5'UTR|C5orf42_ENST00000425232.2_Missense_Mutation_p.E796K			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	796						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			GTCATCTTTTCAGTTAACTGA	0.378																																						dbGAP											0													311.0	258.0	274.0					5																	37224748		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.2386G>A	5.37:g.37224748C>T	ENSP00000421690:p.Glu796Lys		A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	superfamily_Quino_amine_DH_bsu	p.E796K	ENST00000508244.1	37	c.2386	CCDS34146.2	5	.	.	.	.	.	.	.	.	.	.	C	14.32	2.500040	0.44455	.	.	ENSG00000197603	ENST00000508244;ENST00000425232	T;T	0.30981	1.51;1.51	5.28	5.28	0.74379	.	0.394116	0.21867	U	0.067954	T	0.46249	0.1383	L	0.42245	1.32	0.80722	D	1	D	0.71674	0.998	D	0.63597	0.916	T	0.30650	-0.9971	10	0.52906	T	0.07	-6.2817	16.011	0.80404	0.0:1.0:0.0:0.0	.	796	E9PH94	.	K	796	ENSP00000421690:E796K;ENSP00000389014:E796K	ENSP00000389014:E796K	E	-	1	0	C5orf42	37260505	0.973000	0.33851	0.288000	0.24862	0.598000	0.36846	2.360000	0.44151	2.622000	0.88805	0.650000	0.86243	GAA	C5orf42	-	NULL	ENSG00000197603		0.378	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C5orf42	HGNC	protein_coding	OTTHUMT00000360806.1	465	0.00	0	C	NM_023073		37224748	37224748	-1	no_errors	ENST00000425232	ensembl	human	known	69_37n	missense	276	21.59	76	SNP	0.849	T
CALR3	125972	genome.wustl.edu	37	19	16593522	16593522	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr19:16593522C>A	ENST00000269881.3	-	6	815	c.753G>T	c.(751-753)tgG>tgT	p.W251C	CTD-3222D19.2_ENST00000409035.1_3'UTR|CALR3_ENST00000602234.1_5'UTR	NM_145046.4	NP_659483.2	Q96L12	CALR3_HUMAN	calreticulin 3	251	3 X approximate repeats.|P-domain.				cell differentiation (GO:0030154)|protein folding (GO:0006457)|spermatogenesis (GO:0007283)	endoplasmic reticulum (GO:0005783)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|prostate(1)|skin(1)	15						TCGGCGCTGGCCAGTCCCCAT	0.582																																						dbGAP											0													49.0	47.0	48.0					19																	16593522		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK058084	CCDS12344.1	19p13.11	2014-09-17				ENSG00000269058			20407	protein-coding gene	gene with protein product	"""cancer/testis antigen 93"", ""calsperin"""	611414				12384296	Standard	NM_145046		Approved	CRT2, FLJ25355, MGC26577, CT93	uc002ned.3	Q96L12		ENST00000269881.3:c.753G>T	19.37:g.16593522C>A	ENSP00000269881:p.Trp251Cys		D9N574|Q96LN3	Missense_Mutation	SNP	pfam_Calret/calnex,superfamily_ConA-like_lec_gl,superfamily_Calreticulin/calnexin_P,pirsf_Calreticulin,prints_Calret/calnex	p.W251C	ENST00000269881.3	37	c.753	CCDS12344.1	19	.	.	.	.	.	.	.	.	.	.	C	13.53	2.264769	0.40095	.	.	ENSG00000141979	ENST00000269881;ENST00000409035	T	0.58940	0.3	4.39	3.33	0.38152	Concanavalin A-like lectin/glucanase (1);Calreticulin/calnexin, P (1);	0.273852	0.39210	N	0.001426	T	0.81465	0.4828	H	0.95539	3.685	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85946	0.1461	10	0.87932	D	0	-12.3267	12.3502	0.55144	0.1701:0.8299:0.0:0.0	.	251	Q96L12	CALR3_HUMAN	C	251;48	ENSP00000269881:W251C	ENSP00000269881:W251C	W	-	3	0	CALR3	16454522	1.000000	0.71417	0.989000	0.46669	0.148000	0.21650	5.070000	0.64376	1.036000	0.39998	0.579000	0.79373	TGG	CALR3	-	pfam_Calret/calnex,superfamily_ConA-like_lec_gl,superfamily_Calreticulin/calnexin_P,pirsf_Calreticulin,prints_Calret/calnex	ENSG00000141979		0.582	CALR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALR3	HGNC	protein_coding	OTTHUMT00000461089.1	51	0.00	0	C	NM_145046		16593522	16593522	-1	no_errors	ENST00000269881	ensembl	human	known	69_37n	missense	79	20.20	20	SNP	1.000	A
CDHR3	222256	genome.wustl.edu	37	7	105660837	105660837	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr7:105660837G>C	ENST00000317716.9	+	13	1752	c.1672G>C	c.(1672-1674)Gaa>Caa	p.E558Q	CDHR3_ENST00000470188.1_Intron|CDHR3_ENST00000542731.1_Missense_Mutation_p.E558Q|CDHR3_ENST00000478080.1_Missense_Mutation_p.E470Q|CDHR3_ENST00000343407.5_Intron	NM_152750.4	NP_689963.2	Q6ZTQ4	CDHR3_HUMAN	cadherin-related family member 3	558	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(1)	23						GAACATCCTTGAAGAAAATGA	0.408																																						dbGAP											0													66.0	58.0	61.0					7																	105660837		1864	4110	5974	-	-	-	SO:0001583	missense	0			AK126338	CCDS47684.1, CCDS75651.1	7q22.2	2011-07-01			ENSG00000128536	ENSG00000128536		"""Cadherins / Cadherin-related"""	26308	protein-coding gene	gene with protein product		615610					Standard	NM_152750		Approved	FLJ44366, FLJ23834, CDH28	uc003vdl.4	Q6ZTQ4	OTTHUMG00000157520	ENST00000317716.9:c.1672G>C	7.37:g.105660837G>C	ENSP00000325954:p.Glu558Gln		Q8TCI7	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.E558Q	ENST00000317716.9	37	c.1672	CCDS47684.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.10|19.10	3.761377|3.761377	0.69763|0.69763	.|.	.|.	ENSG00000128536|ENSG00000128536	ENST00000542731;ENST00000317716;ENST00000478080|ENST00000468477	T;T;T|T	0.55930|0.73258	0.56;0.56;0.49|-0.73	5.42|5.42	5.42|5.42	0.78866|0.78866	Cadherin (4);Cadherin-like (1);|.	0.318227|.	0.30060|.	N|.	0.010512|.	T|T	0.82102|0.82102	0.4964|0.4964	M|M	0.72118|0.72118	2.19|2.19	0.80722|0.80722	D|D	1|1	P;P|.	0.50710|.	0.93;0.938|.	B;B|.	0.44315|.	0.446;0.446|.	T|T	0.82333|0.82333	-0.0509|-0.0509	10|7	0.87932|0.51188	D|T	0|0.08	-4.5262|-4.5262	19.2175|19.2175	0.93783|0.93783	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	545;558|.	B3KYA0;Q6ZTQ4|.	.;CDHR3_HUMAN|.	Q|F	558;558;470|26	ENSP00000439766:E558Q;ENSP00000325954:E558Q;ENSP00000417771:E470Q|ENSP00000418958:L26F	ENSP00000325954:E558Q|ENSP00000418958:L26F	E|L	+|+	1|3	0|2	CDHR3|CDHR3	105448073|105448073	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.740000|0.740000	0.42216|0.42216	4.024000|4.024000	0.57218|0.57218	2.547000|2.547000	0.85894|0.85894	0.563000|0.563000	0.77884|0.77884	GAA|TTG	CDHR3	-	superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	ENSG00000128536		0.408	CDHR3-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDHR3	HGNC	protein_coding	OTTHUMT00000349025.2	190	0.00	0	G	NM_152750		105660837	105660837	+1	no_errors	ENST00000317716	ensembl	human	known	69_37n	missense	133	22.99	40	SNP	1.000	C
CEP350	9857	genome.wustl.edu	37	1	180053301	180053301	+	Silent	SNP	C	C	T			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr1:180053301C>T	ENST00000367607.3	+	31	6691	c.6273C>T	c.(6271-6273)atC>atT	p.I2091I		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	2091					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						CCAGTCTGATCAAGCAGTTAG	0.383																																						dbGAP											0													59.0	57.0	57.0					1																	180053301		2201	4300	6501	-	-	-	SO:0001819	synonymous_variant	0			AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.6273C>T	1.37:g.180053301C>T			O75068|Q8TDK3|Q8WY20	Nonsense_Mutation	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,pfscan_CAP-Gly_domain	p.Q266*	ENST00000367607.3	37	c.796	CCDS1336.1	1	.	.	.	.	.	.	.	.	.	.	C	8.958	0.969917	0.18659	.	.	ENSG00000135837	ENST00000429851	.	.	.	5.28	2.36	0.29203	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.1005	0.14756	0.1477:0.6293:0.0:0.223	.	.	.	.	X	266	.	.	Q	+	1	0	CEP350	178319924	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	1.590000	0.36654	0.589000	0.29677	-0.320000	0.08662	CAA	CEP350	-	NULL	ENSG00000135837		0.383	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP350	HGNC	protein_coding	OTTHUMT00000085315.2	195	0.00	0	C	NM_014810		180053301	180053301	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000429851	ensembl	human	novel	69_37n	nonsense	228	11.97	31	SNP	1.000	T
CEP95	90799	genome.wustl.edu	37	17	62533819	62533819	+	Silent	SNP	C	C	T			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr17:62533819C>T	ENST00000556440.2	+	20	2898	c.2388C>T	c.(2386-2388)ttC>ttT	p.F796F	CEP95_ENST00000553412.1_Silent_p.F632F	NM_138363.1	NP_612372.1	Q96GE4	CEP95_HUMAN	centrosomal protein 95kDa	796						centrosome (GO:0005813)|cytoplasm (GO:0005737)|spindle pole (GO:0000922)				endometrium(1)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)	13						ATGTTTTCTTCCGGGAACTGG	0.458																																						dbGAP											0													62.0	62.0	62.0					17																	62533819		1941	4141	6082	-	-	-	SO:0001819	synonymous_variant	0			AL832822	CCDS45763.1	17q24.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000258890	ENSG00000258890			25141	protein-coding gene	gene with protein product			"""coiled-coil domain containing 45"""	CCDC45		21399614	Standard	NM_138363		Approved	DKFZp667E1824	uc002jem.3	Q96GE4	OTTHUMG00000179174	ENST00000556440.2:c.2388C>T	17.37:g.62533819C>T			B4DMD2|Q96M81	Silent	SNP	superfamily_CH-domain	p.F796	ENST00000556440.2	37	c.2388	CCDS45763.1	17																																																																																			CEP95	-	NULL	ENSG00000258890		0.458	CEP95-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP95	HGNC	protein_coding	OTTHUMT00000445100.2	138	0.00	0	C	NM_138363		62533819	62533819	+1	no_errors	ENST00000556440	ensembl	human	known	69_37n	silent	62	17.33	13	SNP	1.000	T
CHCHD2	51142	genome.wustl.edu	37	7	56171926	56171926	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr7:56171926G>A	ENST00000395422.3	-	2	455	c.293C>T	c.(292-294)aCt>aTt	p.T98I		NM_016139.2	NP_057223.1	Q9Y6H1	CHCH2_HUMAN	coiled-coil-helix-coiled-coil-helix domain containing 2	98						mitochondrion (GO:0005739)				endometrium(1)|large_intestine(1)|lung(3)	5	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			CACCTGGTAAGTGATGTCAGG	0.512																																						dbGAP											0													90.0	87.0	88.0					7																	56171926		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF078845	CCDS5526.1	7p11.2	2014-07-14	2004-01-19	2004-01-21	ENSG00000106153	ENSG00000106153		"""Coiled-coil-helix-coiled-coil-helix domain containing"""	21645	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 17"""	C7orf17		23303788	Standard	NM_016139		Approved		uc003tsa.3	Q9Y6H1	OTTHUMG00000129429	ENST00000395422.3:c.293C>T	7.37:g.56171926G>A	ENSP00000378812:p.Thr98Ile		Q498C3|Q6NZ50	Missense_Mutation	SNP	pfam_CHCH	p.T98I	ENST00000395422.3	37	c.293	CCDS5526.1	7	.	.	.	.	.	.	.	.	.	.	G	23.1	4.380444	0.82792	.	.	ENSG00000106153	ENST00000395422	T	0.45668	0.89	5.62	5.62	0.85841	.	0.048425	0.85682	D	0.000000	T	0.56499	0.1989	L	0.54323	1.7	0.58432	D	0.999999	D	0.54772	0.968	P	0.56788	0.806	T	0.53244	-0.8466	10	0.46703	T	0.11	.	18.6292	0.91354	0.0:0.0:1.0:0.0	.	98	Q9Y6H1	CHCH2_HUMAN	I	98	ENSP00000378812:T98I	ENSP00000378812:T98I	T	-	2	0	CHCHD2	56139420	1.000000	0.71417	1.000000	0.80357	0.513000	0.34164	9.445000	0.97587	2.655000	0.90218	0.655000	0.94253	ACT	CHCHD2	-	NULL	ENSG00000106153		0.512	CHCHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHCHD2	HGNC	protein_coding	OTTHUMT00000251589.1	14	0.00	0	G	NM_016139		56171926	56171926	-1	no_errors	ENST00000395422	ensembl	human	known	69_37n	missense	33	21.43	9	SNP	1.000	A
COL12A1	1303	genome.wustl.edu	37	6	75893674	75893674	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr6:75893674G>A	ENST00000322507.8	-	9	1493	c.1184C>T	c.(1183-1185)tCa>tTa	p.S395L	COL12A1_ENST00000483888.2_Missense_Mutation_p.S395L|COL12A1_ENST00000416123.2_Missense_Mutation_p.S395L|COL12A1_ENST00000345356.6_Intron	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	395	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						TGTGTCTGCTGAGAGGTCGCG	0.502																																						dbGAP											0													168.0	163.0	165.0					6																	75893674		2024	4192	6216	-	-	-	SO:0001583	missense	0			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.1184C>T	6.37:g.75893674G>A	ENSP00000325146:p.Ser395Leu		O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.S395L	ENST00000322507.8	37	c.1184	CCDS43482.1	6	.	.	.	.	.	.	.	.	.	.	G	25.5	4.644627	0.87859	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000416123;ENST00000483888	T;T;T	0.56611	0.45;0.45;0.45	5.31	4.43	0.53597	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.215065	0.32068	N	0.006626	T	0.42585	0.1209	L	0.48986	1.54	0.40053	D	0.975807	B;P	0.36110	0.394;0.537	B;B	0.43018	0.19;0.405	T	0.45600	-0.9250	10	0.45353	T	0.12	.	14.3199	0.66479	0.0729:0.0:0.9271:0.0	.	395;395	D6RGG3;Q99715	.;COCA1_HUMAN	L	395	ENSP00000325146:S395L;ENSP00000412864:S395L;ENSP00000421216:S395L	ENSP00000325146:S395L	S	-	2	0	COL12A1	75950394	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	4.646000	0.61411	2.481000	0.83766	0.655000	0.94253	TCA	COL12A1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000111799		0.502	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL12A1	HGNC	protein_coding	OTTHUMT00000041249.3	150	0.00	0	G	NM_004370		75893674	75893674	-1	no_errors	ENST00000322507	ensembl	human	known	69_37n	missense	118	18.62	27	SNP	0.999	A
DCTN2	10540	genome.wustl.edu	37	12	57925870	57925870	+	Silent	SNP	G	G	A			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr12:57925870G>A	ENST00000548249.1	-	13	1314	c.1047C>T	c.(1045-1047)ctC>ctT	p.L349L	DCTN2_ENST00000551400.1_5'Flank|DCTN2_ENST00000543672.1_Silent_p.L354L|DCTN2_ENST00000537439.1_Silent_p.L326L|DCTN2_ENST00000434715.3_Silent_p.L354L	NM_001261412.1|NM_001261413.1	NP_001248341.1|NP_001248342.1	Q13561	DCTN2_HUMAN	dynactin 2 (p50)	349					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|vesicle (GO:0031982)	motor activity (GO:0003774)|spectrin binding (GO:0030507)			endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|upper_aerodigestive_tract(2)	11						AGTGTGTCAGGAGCTGACCAA	0.458																																						dbGAP											0													93.0	97.0	95.0					12																	57925870		1967	4143	6110	-	-	-	SO:0001819	synonymous_variant	0			U50733	CCDS44930.1, CCDS58245.1, CCDS73489.1	12q13.3	2008-05-14				ENSG00000175203			2712	protein-coding gene	gene with protein product		607376				8647893	Standard	NM_001261412		Approved	RBP50, DCTN-50	uc001som.2	Q13561	OTTHUMG00000170124	ENST00000548249.1:c.1047C>T	12.37:g.57925870G>A			B2RBK5|Q86YN2|Q9BW17	Missense_Mutation	SNP	pfam_Dynamitin_2su	p.S315F	ENST00000548249.1	37	c.944	CCDS58245.1	12																																																																																			DCTN2	-	NULL	ENSG00000175203		0.458	DCTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCTN2	HGNC	protein_coding	OTTHUMT00000407393.2	183	0.00	0	G	NM_006400		57925870	57925870	-1	no_errors	ENST00000550201	ensembl	human	known	69_37n	missense	140	21.35	38	SNP	0.956	A
DEFB114	245928	genome.wustl.edu	37	6	49928136	49928136	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr6:49928136C>A	ENST00000322066.3	-	2	78	c.79G>T	c.(79-81)Gat>Tat	p.D27Y		NM_001037499.1	NP_001032588.1	Q30KQ6	DB114_HUMAN	defensin, beta 114	27					defense response to bacterium (GO:0042742)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)	extracellular region (GO:0005576)	lipopolysaccharide binding (GO:0001530)			kidney(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	8	Lung NSC(77;0.042)					GTGCAACGATCAGCATTCACC	0.353																																						dbGAP											0													98.0	88.0	92.0					6																	49928136		2203	4299	6502	-	-	-	SO:0001583	missense	0			DQ012018	CCDS34474.1	6p12.3	2010-03-30			ENSG00000177684	ENSG00000177684		"""Defensins, beta"""	18095	protein-coding gene	gene with protein product		615243				11854508, 16033865	Standard	NM_001037499		Approved	DEFB-14	uc011dwp.2	Q30KQ6	OTTHUMG00000160209	ENST00000322066.3:c.79G>T	6.37:g.49928136C>A	ENSP00000312702:p.Asp27Tyr		Q8NES9	Missense_Mutation	SNP	NULL	p.D27Y	ENST00000322066.3	37	c.79	CCDS34474.1	6	.	.	.	.	.	.	.	.	.	.	C	5.464	0.270632	0.10349	.	.	ENSG00000177684	ENST00000322066	T	0.16196	2.36	3.55	1.76	0.24704	.	0.791814	0.10713	N	0.642693	T	0.13329	0.0323	.	.	.	0.09310	N	1	D	0.67145	0.996	P	0.57371	0.819	T	0.09185	-1.0686	8	.	.	.	-3.5665	5.8533	0.18707	0.0:0.7565:0.0:0.2435	.	27	Q30KQ6	DB114_HUMAN	Y	27	ENSP00000312702:D27Y	.	D	-	1	0	DEFB114	50036095	0.751000	0.28327	0.005000	0.12908	0.418000	0.31294	0.091000	0.15046	0.501000	0.28013	0.650000	0.86243	GAT	DEFB114	-	NULL	ENSG00000177684		0.353	DEFB114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB114	HGNC	protein_coding	OTTHUMT00000359665.1	228	0.00	0	C	NM_001037499		49928136	49928136	-1	no_errors	ENST00000322066	ensembl	human	known	69_37n	missense	119	20.13	30	SNP	0.014	A
DHX37	57647	genome.wustl.edu	37	12	125461919	125461919	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr12:125461919G>A	ENST00000308736.2	-	5	954	c.856C>T	c.(856-858)Cct>Tct	p.P286S	DHX37_ENST00000544745.1_Missense_Mutation_p.P73S	NM_032656.3	NP_116045.2	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	286	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.						ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(5)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|liver(1)|lung(27)|ovary(1)|prostate(2)|skin(3)	65	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		AGAAACTGAGGCACCTGTGTG	0.562																																						dbGAP											0													139.0	130.0	133.0					12																	125461919		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB040950	CCDS9261.1	12q24.31	2004-03-25	2003-06-13	2003-06-20		ENSG00000150990		"""DEAH-boxes"""	17210	protein-coding gene	gene with protein product			"""DEAD/DEAH box helicase DDX37"""	DDX37		10819331	Standard	NM_032656		Approved	KIAA1517, MGC4322, MGC2695	uc001ugy.3	Q8IY37		ENST00000308736.2:c.856C>T	12.37:g.125461919G>A	ENSP00000311135:p.Pro286Ser		Q9BUI7|Q9P211	Missense_Mutation	SNP	pfam_DUF1605,pfam_Helicase-assoc_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_T2SS_protein-E,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.P286S	ENST00000308736.2	37	c.856	CCDS9261.1	12	.	.	.	.	.	.	.	.	.	.	G	25.1	4.607773	0.87258	.	.	ENSG00000150990	ENST00000308736;ENST00000544745	T;T	0.25912	1.77;1.77	5.06	5.06	0.68205	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.049370	0.85682	N	0.000000	T	0.67655	0.2916	H	0.97340	3.985	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.81267	-0.1010	10	0.87932	D	0	-7.2904	18.0298	0.89279	0.0:0.0:1.0:0.0	.	286	Q8IY37	DHX37_HUMAN	S	286;73	ENSP00000311135:P286S;ENSP00000439009:P73S	ENSP00000311135:P286S	P	-	1	0	DHX37	124027872	1.000000	0.71417	0.999000	0.59377	0.760000	0.43138	8.864000	0.92294	2.358000	0.79984	0.467000	0.42956	CCT	DHX37	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_T2SS_protein-E,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000150990		0.562	DHX37-201	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX37	HGNC	protein_coding		53	0.00	0	G	NM_032656		125461919	125461919	-1	no_errors	ENST00000308736	ensembl	human	known	69_37n	missense	37	21.28	10	SNP	1.000	A
DNAH1	25981	genome.wustl.edu	37	3	52360796	52360796	+	Silent	SNP	C	C	T			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr3:52360796C>T	ENST00000420323.2	+	5	888	c.627C>T	c.(625-627)ttC>ttT	p.F209F		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	209	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		AGTTGCTGTTCAGCCAGGGCA	0.597																																						dbGAP											0													100.0	117.0	111.0					3																	52360796		2145	4244	6389	-	-	-	SO:0001819	synonymous_variant	0			U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.627C>T	3.37:g.52360796C>T			B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Silent	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA	p.F209	ENST00000420323.2	37	c.627	CCDS46842.1	3																																																																																			DNAH1	-	NULL	ENSG00000114841		0.597	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH1	HGNC	protein_coding	OTTHUMT00000350816.1	55	0.00	0	C	NM_015512		52360796	52360796	+1	no_errors	ENST00000420323	ensembl	human	known	69_37n	silent	52	41.57	37	SNP	0.000	T
DTD1	92675	genome.wustl.edu	37	20	18724832	18724832	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr20:18724832G>A	ENST00000377452.3	+	5	746	c.566G>A	c.(565-567)cGa>cAa	p.R189Q		NM_080820.4	NP_543010.3	Q8TEA8	DTD1_HUMAN	D-tyrosyl-tRNA deacylase 1	189					D-amino acid catabolic process (GO:0019478)|DNA replication (GO:0006260)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|hydrolase activity, acting on ester bonds (GO:0016788)|metal ion binding (GO:0046872)			large_intestine(4)|lung(1)|ovary(2)	7						AACACTCCCCGAAAAGAAGAC	0.517																																						dbGAP											0													62.0	59.0	60.0					20																	18724832		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF332356	CCDS13138.1	20p11.23	2012-09-25	2012-09-25	2007-02-23	ENSG00000125821	ENSG00000125821			16219	protein-coding gene	gene with protein product		610996	"""chromosome 20 open reading frame 88"", ""D-tyrosyl-tRNA deacylase 1 homolog (S. cerevisiae)"""	C20orf88, HARS2			Standard	NM_080820		Approved	DUEB, MGC119131, MGC41905, bA379J5.3, bA555E18.1, pqn-68	uc002wrf.4	Q8TEA8	OTTHUMG00000031980	ENST00000377452.3:c.566G>A	20.37:g.18724832G>A	ENSP00000366672:p.Arg189Gln		A8K5X5|D3DW37|Q496D1|Q5W184|Q8WXU8|Q9BW67|Q9H464|Q9H474	Missense_Mutation	SNP	pfam_DTyrtRNA_deacyls,superfamily_DTD-like_dom,tigrfam_DTyrtRNA_deacyls	p.R189Q	ENST00000377452.3	37	c.566	CCDS13138.1	20	.	.	.	.	.	.	.	.	.	.	G	17.29	3.352010	0.61183	.	.	ENSG00000125821	ENST00000377452	.	.	.	5.69	4.75	0.60458	.	0.058008	0.64402	D	0.000003	T	0.26195	0.0639	N	0.24115	0.695	0.32714	N	0.511264	P	0.43352	0.804	B	0.32762	0.152	T	0.43782	-0.9370	9	0.66056	D	0.02	-9.5112	12.4448	0.55645	0.0813:0.0:0.9187:0.0	.	189	Q8TEA8	DTD1_HUMAN	Q	189	.	ENSP00000366672:R189Q	R	+	2	0	DTD1	18672832	1.000000	0.71417	0.192000	0.23308	0.944000	0.59088	7.196000	0.77805	1.419000	0.47118	-0.251000	0.11542	CGA	DTD1	-	NULL	ENSG00000125821		0.517	DTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTD1	HGNC	protein_coding	OTTHUMT00000078189.3	108	0.00	0	G	NM_080820		18724832	18724832	+1	no_errors	ENST00000377452	ensembl	human	known	69_37n	missense	35	66.02	68	SNP	0.904	A
DYNC1H1	1778	genome.wustl.edu	37	14	102516407	102516407	+	Splice_Site	SNP	G	G	A			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr14:102516407G>A	ENST00000360184.4	+	77	13848		c.e77-1		RP11-1017G21.4_ENST00000557242.1_RNA|RP11-1017G21.4_ENST00000553701.1_RNA	NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						CCGCCTCACAGGTTTGAAACT	0.587																																						dbGAP											0													72.0	68.0	69.0					14																	102516407		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.13685-1G>A	14.37:g.102516407G>A			B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Splice_Site	SNP	-	e77-1	ENST00000360184.4	37	c.13685-1	CCDS9966.1	14	.	.	.	.	.	.	.	.	.	.	G	21.4	4.147547	0.77888	.	.	ENSG00000197102	ENST00000360184	.	.	.	5.42	5.42	0.78866	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2092	0.93747	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DYNC1H1	101586160	1.000000	0.71417	0.962000	0.40283	0.746000	0.42486	9.593000	0.98250	2.551000	0.86045	0.491000	0.48974	.	DYNC1H1	-	-	ENSG00000197102		0.587	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	HGNC	protein_coding	OTTHUMT00000414574.1	32	0.00	0	G	NM_001376	Intron	102516407	102516407	+1	no_errors	ENST00000360184	ensembl	human	known	69_37n	splice_site	74	17.78	16	SNP	1.000	A
EFNA3	1944	genome.wustl.edu	37	1	155058975	155058975	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr1:155058975G>T	ENST00000368408.3	+	5	743	c.673G>T	c.(673-675)Gcc>Tcc	p.A225S	EFNA3_ENST00000498667.1_3'UTR|EFNA3_ENST00000505139.1_Missense_Mutation_p.A220S|EFNA3_ENST00000556931.1_Missense_Mutation_p.A220S|EFNA3_ENST00000418360.2_Missense_Mutation_p.A199S	NM_004952.4	NP_004943.1	P52797	EFNA3_HUMAN	ephrin-A3	225					axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)|ephrin receptor signaling pathway (GO:0048013)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)|transmembrane-ephrin receptor activity (GO:0005005)			breast(1)|central_nervous_system(1)|large_intestine(1)|lung(2)	5	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		all cancers(21;5.67e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000284)|LUSC - Lung squamous cell carcinoma(543;0.193)			CCTGCCCCTGGCCGTGGGCAT	0.632											OREG0013850	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													100.0	100.0	100.0					1																	155058975		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC017722	CCDS1090.1	1q21-q22	2011-03-09			ENSG00000143590	ENSG00000143590		"""Ephrins"""	3223	protein-coding gene	gene with protein product		601381		EPLG3		8660976	Standard	NM_004952		Approved	LERK3, Ehk1-L	uc001fhf.3	P52797	OTTHUMG00000035313	ENST00000368408.3:c.673G>T	1.37:g.155058975G>T	ENSP00000357393:p.Ala225Ser	220	B7ZAD3|D3DV85|Q0VGC9|Q5SR70	Missense_Mutation	SNP	pfam_Ephrin,superfamily_Cupredoxin,prints_Ephrin	p.A225S	ENST00000368408.3	37	c.673	CCDS1090.1	1	.	.	.	.	.	.	.	.	.	.	G	11.14	1.551382	0.27739	.	.	ENSG00000143590;ENSG00000143590;ENSG00000143590;ENSG00000251246	ENST00000556931;ENST00000368408;ENST00000418360;ENST00000505139	D;D;D;D	0.95980	-3.37;-3.34;-3.87;-3.37	3.91	2.99	0.34606	.	0.298995	0.30620	N	0.009236	T	0.75860	0.3907	N	0.03608	-0.345	0.32332	N	0.560897	B;B;B	0.19073	0.02;0.033;0.02	B;B;B	0.17433	0.011;0.01;0.018	T	0.66081	-0.6012	10	0.33141	T	0.24	-8.3705	6.2264	0.20710	0.2282:0.0:0.7718:0.0	.	199;220;225	B7ZAD3;B4DXG7;P52797	.;.;EFNA3_HUMAN	S	220;225;199;220	ENSP00000450814:A220S;ENSP00000357393:A225S;ENSP00000391370:A199S;ENSP00000426741:A220S	ENSP00000357393:A225S	A	+	1	0	RP11-540D14.8;EFNA3	153325599	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	3.556000	0.53734	0.990000	0.38787	0.462000	0.41574	GCC	EFNA3	-	NULL	ENSG00000143590		0.632	EFNA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EFNA3	HGNC	protein_coding	OTTHUMT00000085429.1	27	0.00	0	G	NM_004952		155058975	155058975	+1	no_errors	ENST00000368408	ensembl	human	known	69_37n	missense	46	20.69	12	SNP	1.000	T
EIF3L	51386	genome.wustl.edu	37	22	38266249	38266249	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr22:38266249C>T	ENST00000412331.2	+	8	1228	c.646C>T	c.(646-648)Cgt>Tgt	p.R216C	EIF3L_ENST00000476955.1_3'UTR|EIF3L_ENST00000406934.1_Missense_Mutation_p.R118C|EIF3L_ENST00000381683.6_Missense_Mutation_p.R168C	NM_016091.3	NP_057175.1			eukaryotic translation initiation factor 3, subunit L											kidney(2)|large_intestine(3)|lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						TGACTTTCTTCGTTCCAATCC	0.433																																						dbGAP											0													165.0	131.0	143.0					22																	38266249		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF083243	CCDS13960.1, CCDS56230.1	22q	2012-12-20	2009-01-07	2009-01-07	ENSG00000100129	ENSG00000100129			18138	protein-coding gene	gene with protein product			"""eukaryotic translation initiation factor 3, subunit 6 interacting protein"", ""eukaryotic translation initiation factor 3, subunit E interacting protein"""	EIF3S6IP, EIF3EIP		11042152, 11590142	Standard	NM_016091		Approved	HSPC021, HSPC025, EIF3S11	uc003auf.3	Q9Y262	OTTHUMG00000150671	ENST00000412331.2:c.646C>T	22.37:g.38266249C>T	ENSP00000416892:p.Arg216Cys			Missense_Mutation	SNP	pfam_TIF3_suL	p.R259C	ENST00000412331.2	37	c.775	CCDS13960.1	22	.	.	.	.	.	.	.	.	.	.	C	12.14	1.847928	0.32699	.	.	ENSG00000100129	ENST00000412331;ENST00000425539;ENST00000381683;ENST00000262832;ENST00000406934	T;T;T	0.45276	0.9;0.9;0.9	4.93	2.77	0.32553	.	0.045908	0.85682	D	0.000000	T	0.29850	0.0746	L	0.37750	1.13	0.80722	D	1	B;B;B;B	0.33120	0.246;0.063;0.246;0.398	B;B;B;B	0.30572	0.042;0.017;0.067;0.117	T	0.05435	-1.0885	10	0.39692	T	0.17	-3.292	9.6656	0.39983	0.1447:0.7808:0.0:0.0745	.	168;118;216;259	B4DYB2;B0QY90;Q9Y262;B0QY89	.;.;EIF3L_HUMAN;.	C	216;259;168;183;118	ENSP00000416892:R216C;ENSP00000371099:R168C;ENSP00000384634:R118C	ENSP00000262832:R183C	R	+	1	0	EIF3L	36596195	1.000000	0.71417	0.652000	0.29579	0.708000	0.40852	4.802000	0.62539	0.550000	0.28991	-0.355000	0.07637	CGT	EIF3L	-	pfam_TIF3_suL	ENSG00000100129		0.433	EIF3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF3L	HGNC	protein_coding	OTTHUMT00000319551.2	331	0.00	0	C	NM_016091		38266249	38266249	+1	no_errors	ENST00000425539	ensembl	human	known	69_37n	missense	193	26.34	69	SNP	1.000	T
IFT80	57560	genome.wustl.edu	37	3	159976355	159976355	+	Silent	SNP	T	T	A	rs376683399		TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr3:159976355T>A	ENST00000326448.7	-	20	2724	c.2292A>T	c.(2290-2292)tcA>tcT	p.S764S	IFT80_ENST00000483465.1_Silent_p.S627S|IFT80_ENST00000496589.1_Silent_p.S627S|RP11-432B6.3_ENST00000483754.1_Silent_p.S935S	NM_020800.2	NP_065851.1	Q9P2H3	IFT80_HUMAN	intraflagellar transport 80	764					bone morphogenesis (GO:0060349)|chondrocyte differentiation (GO:0002062)|cilium assembly (GO:0042384)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of non-canonical Wnt signaling pathway (GO:2000051)|osteoblast differentiation (GO:0001649)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)				NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(12)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	36			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			GGCTGCTTGATGATTGCTCTC	0.338																																						dbGAP											0													243.0	227.0	232.0					3																	159976355		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AB037795	CCDS3188.1, CCDS54668.1	3q25.33	2014-07-03	2014-07-03	2005-11-02	ENSG00000068885	ENSG00000068885		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29262	protein-coding gene	gene with protein product		611177	"""WD repeat domain 56"", ""intraflagellar transport 80 homolog (Chlamydomonas)"""	WDR56		10718198	Standard	NM_020800		Approved	KIAA1374	uc021xgq.1	Q9P2H3	OTTHUMG00000158953	ENST00000326448.7:c.2292A>T	3.37:g.159976355T>A			B4E0K1|C9J8I0|Q3MJC4|Q86YF4|Q9UIX1	Silent	SNP	pfam_WD40_repeat,pfam_Znf_C3HC4_RING-type,pfam_Znf_B-box,superfamily_WD40_repeat_dom,smart_Znf_RING,smart_WD40_repeat,pfscan_Znf_B-box,pfscan_Znf_RING,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S935	ENST00000326448.7	37	c.2805	CCDS3188.1	3																																																																																			RP11-432B6.3	-	NULL	ENSG00000248710		0.338	IFT80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000248710	Clone_based_vega_gene	protein_coding	OTTHUMT00000352651.2	610	0.00	0	T	NM_020800		159976355	159976355	-1	no_errors	ENST00000483754	ensembl	human	known	69_37n	silent	515	18.10	114	SNP	0.575	A
EPPK1	83481	genome.wustl.edu	37	8	144944180	144944180	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr8:144944180G>C	ENST00000525985.1	-	2	3313	c.3242C>G	c.(3241-3243)tCc>tGc	p.S1081C				P58107	EPIPL_HUMAN	epiplakin 1	1081						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GAAGGTTTCGGAGGAGCTGGA	0.637																																						dbGAP											0													38.0	41.0	40.0					8																	144944180		2095	4227	6322	-	-	-	SO:0001583	missense	0			AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.3242C>G	8.37:g.144944180G>C	ENSP00000436337:p.Ser1081Cys		Q76E58|Q9NSU9	Missense_Mutation	SNP	pfam_Plectin_repeat,smart_Plectin_repeat	p.S1081C	ENST00000525985.1	37	c.3242		8	.	.	.	.	.	.	.	.	.	.	G	10.29	1.309190	0.23821	.	.	ENSG00000227184	ENST00000525985	T	0.69926	-0.44	4.35	3.47	0.39725	.	.	.	.	.	T	0.59569	0.2203	L	0.43923	1.385	0.09310	N	1	B	0.14805	0.011	B	0.17722	0.019	T	0.54450	-0.8292	9	0.54805	T	0.06	.	12.0708	0.53616	0.0:0.1752:0.8248:0.0	.	1081	E9PPU0	.	C	1081	ENSP00000436337:S1081C	ENSP00000436337:S1081C	S	-	2	0	EPPK1	145016168	0.004000	0.15560	0.001000	0.08648	0.008000	0.06430	1.386000	0.34419	1.031000	0.39867	-0.257000	0.10917	TCC	EPPK1	-	NULL	ENSG00000227184		0.637	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	EPPK1	HGNC	protein_coding	OTTHUMT00000382675.1	26	0.00	0	G	NM_031308		144944180	144944180	-1	no_errors	ENST00000525985	ensembl	human	known	69_37n	missense	37	22.92	11	SNP	0.003	C
GNPAT	8443	genome.wustl.edu	37	1	231396288	231396288	+	Silent	SNP	C	C	T			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr1:231396288C>T	ENST00000366647.4	+	3	466	c.297C>T	c.(295-297)ctC>ctT	p.L99L	GNPAT_ENST00000366646.3_Silent_p.L38L	NM_014236.3	NP_055051.1	O15228	GNPAT_HUMAN	glyceronephosphate O-acyltransferase	99					cellular lipid metabolic process (GO:0044255)|cerebellum morphogenesis (GO:0021587)|ether lipid biosynthetic process (GO:0008611)|glycerophospholipid biosynthetic process (GO:0046474)|membrane organization (GO:0061024)|paranodal junction assembly (GO:0030913)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to fatty acid (GO:0070542)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)|synapse assembly (GO:0007416)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	glycerone-phosphate O-acyltransferase activity (GO:0016287)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	23	Breast(184;0.0871)	all_cancers(173;0.2)|Prostate(94;0.183)				TGGATGTCCTCCGAGAGGAAG	0.398																																						dbGAP											0													191.0	198.0	196.0					1																	231396288		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF043937	CCDS1592.1	1q42	2008-02-05			ENSG00000116906	ENSG00000116906	2.3.1.42		4416	protein-coding gene	gene with protein product		602744				9459311, 9536089	Standard	NM_014236		Approved	DHAPAT, DAPAT, DAP-AT	uc001hup.4	O15228	OTTHUMG00000038024	ENST00000366647.4:c.297C>T	1.37:g.231396288C>T			B4DNM9|Q5TBH7|Q9BWC2	Silent	SNP	pfam_Acyltransferase,smart_Acyltransferase	p.L99	ENST00000366647.4	37	c.297	CCDS1592.1	1																																																																																			GNPAT	-	NULL	ENSG00000116906		0.398	GNPAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GNPAT	HGNC	protein_coding	OTTHUMT00000092871.1	187	0.00	0	C			231396288	231396288	+1	no_errors	ENST00000366647	ensembl	human	known	69_37n	silent	91	21.37	25	SNP	1.000	T
GOLGA1	2800	genome.wustl.edu	37	9	127660909	127660909	+	Silent	SNP	T	T	C			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr9:127660909T>C	ENST00000373555.4	-	15	1659	c.1326A>G	c.(1324-1326)caA>caG	p.Q442Q	AL354928.1_ENST00000580940.1_RNA	NM_002077.3	NP_002068	Q92805	GOGA1_HUMAN	golgin A1	442	Gln-rich.				protein targeting to Golgi (GO:0000042)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)				NS(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	20						CTGCATTTTCTTGCTCCAGTT	0.388																																						dbGAP											0													142.0	140.0	140.0					9																	127660909		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			U51587	CCDS6860.1	9q34.11	2010-02-12	2010-02-12		ENSG00000136935	ENSG00000136935			4424	protein-coding gene	gene with protein product		602502	"""golgi autoantigen, golgin subfamily a, 1"""			9324025	Standard	NM_002077		Approved	golgin-97, MGC33154	uc004bpc.3	Q92805	OTTHUMG00000020665	ENST00000373555.4:c.1326A>G	9.37:g.127660909T>C			Q5T164|Q8IYZ9	Silent	SNP	pfam_GRIP,superfamily_Prefoldin,superfamily_GRIP,smart_GRIP,pfscan_GRIP	p.Q442	ENST00000373555.4	37	c.1326	CCDS6860.1	9																																																																																			GOLGA1	-	NULL	ENSG00000136935		0.388	GOLGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA1	HGNC	protein_coding	OTTHUMT00000054049.1	355	0.00	0	T	NM_002077		127660909	127660909	-1	no_errors	ENST00000373555	ensembl	human	known	69_37n	silent	161	22.22	46	SNP	1.000	C
GP6	51206	genome.wustl.edu	37	19	55526128	55526128	+	3'UTR	SNP	G	G	A			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr19:55526128G>A	ENST00000417454.1	-	0	1208				CTC-550B14.7_ENST00000586845.1_RNA|GP6_ENST00000310373.3_Silent_p.F395F|CTC-550B14.7_ENST00000593060.1_RNA|GP6_ENST00000333884.2_3'UTR	NM_016363.4	NP_057447	Q9HCN6	GPVI_HUMAN	glycoprotein VI (platelet)						blood coagulation (GO:0007596)|enzyme linked receptor protein signaling pathway (GO:0007167)|leukocyte migration (GO:0050900)|platelet activation (GO:0030168)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	collagen binding (GO:0005518)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.F395F(1)		NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19			BRCA - Breast invasive adenocarcinoma(297;0.156)	GBM - Glioblastoma multiforme(193;0.0515)		gacaCTGGCCGAACGGCTCCC	0.597																																						dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											51.0	60.0	57.0					19																	55526128		2161	4266	6427	-	-	-	SO:0001624	3_prime_UTR_variant	0			AB035073	CCDS42626.1, CCDS46184.1, CCDS58678.1	19q13.4	2013-01-29			ENSG00000088053	ENSG00000088053		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14388	protein-coding gene	gene with protein product		605546				11027634	Standard	NM_001083899		Approved	GPVI	uc002qil.3	Q9HCN6	OTTHUMG00000159709	ENST00000417454.1:c.*161C>T	19.37:g.55526128G>A			Q9HCN7|Q9UIF2	Silent	SNP	smart_Ig_sub,smart_Ig_sub2	p.F395	ENST00000417454.1	37	c.1185	CCDS46184.1	19																																																																																			GP6	-	NULL	ENSG00000088053		0.597	GP6-001	KNOWN	basic|CCDS	protein_coding	GP6	HGNC	protein_coding	OTTHUMT00000357006.1	41	0.00	0	G			55526128	55526128	-1	no_errors	ENST00000310373	ensembl	human	known	69_37n	silent	45	22.41	13	SNP	0.001	A
GPR98	84059	genome.wustl.edu	37	5	90077371	90077371	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr5:90077371G>C	ENST00000405460.2	+	65	13303	c.13207G>C	c.(13207-13209)Gac>Cac	p.D4403H	GPR98_ENST00000425867.2_Missense_Mutation_p.D64H	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	4403	Calx-beta 30. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		CATTGAATTTGACCCAAAGTA	0.363																																						dbGAP											0													60.0	56.0	57.0					5																	90077371		1872	4102	5974	-	-	-	SO:0001583	missense	0			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.13207G>C	5.37:g.90077371G>C	ENSP00000384582:p.Asp4403His		O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.D4403H	ENST00000405460.2	37	c.13207	CCDS47246.1	5	.	.	.	.	.	.	.	.	.	.	G	18.46	3.628446	0.67015	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000425867	T;T	0.32515	1.45;1.45	5.8	5.8	0.92144	Na-Ca exchanger/integrin-beta4 (2);	0.249082	0.43110	D	0.000602	T	0.62085	0.2399	M	0.84846	2.72	0.32131	N	0.586817	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79784	0.993;0.979;0.988	T	0.67757	-0.5588	10	0.42905	T	0.14	.	19.649	0.95793	0.0:0.0:1.0:0.0	.	64;4403;64	E7EML1;Q8WXG9;Q8WXG9-2	.;GPR98_HUMAN;.	H	4403;4403;64	ENSP00000384582:D4403H;ENSP00000392618:D64H	ENSP00000296619:D4403H	D	+	1	0	GPR98	90113127	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	3.453000	0.52978	2.740000	0.93945	0.650000	0.86243	GAC	GPR98	-	pfam_Calx_beta,smart_Calx_beta	ENSG00000164199		0.363	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	HGNC	protein_coding	OTTHUMT00000369993.2	127	0.00	0	G	NM_032119		90077371	90077371	+1	no_errors	ENST00000405460	ensembl	human	known	69_37n	missense	43	25.86	15	SNP	1.000	C
GPSM3	63940	genome.wustl.edu	37	6	32159275	32159275	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr6:32159275C>A	ENST00000375040.3	-	4	743	c.351G>T	c.(349-351)caG>caT	p.Q117H	GPSM3_ENST00000487761.1_Missense_Mutation_p.Q114H|PBX2_ENST00000375050.4_5'Flank|GPSM3_ENST00000375043.3_Missense_Mutation_p.Q117H	NM_001276501.1	NP_001263430.1	Q9Y4H4	GPSM3_HUMAN	G-protein signaling modulator 3	117	GoLoco 2. {ECO:0000255|PROSITE- ProRule:PRU00097}.				regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cytoplasm (GO:0005737)	GDP-dissociation inhibitor activity (GO:0005092)			large_intestine(1)	1						CTTCCATCCGCTGGCACTGGA	0.612																																						dbGAP											0													36.0	40.0	39.0					6																	32159275		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF155657	CCDS34419.1	6p21.3	2010-06-24	2010-06-24	2004-02-04	ENSG00000213654	ENSG00000213654			13945	protein-coding gene	gene with protein product	"""activator of G-protein signaling 4"""		"""chromosome 6 open reading frame 9"", ""G-protein signalling modulator 3 (AGS3-like, C. elegans)"""	C6orf9		2259622, 15096500	Standard	NM_022107		Approved	NG1, G18, G18.1a, G18.1b, G18.2, AGS4	uc003oaz.3	Q9Y4H4	OTTHUMG00000031244	ENST00000375040.3:c.351G>T	6.37:g.32159275C>A	ENSP00000364180:p.Gln117His		A2BFJ3	Missense_Mutation	SNP	pfam_GoLoco_motif,smart_GoLoco_motif,pfscan_GoLoco_motif	p.Q117H	ENST00000375040.3	37	c.351	CCDS34419.1	6	.	.	.	.	.	.	.	.	.	.	C	16.73	3.203013	0.58234	.	.	ENSG00000213654	ENST00000487761;ENST00000375040;ENST00000375043	.	.	.	4.51	4.51	0.55191	GoLoco motif (2);	0.000000	0.52532	U	0.000074	T	0.46151	0.1378	L	0.34521	1.04	0.34161	D	0.668679	D;D	0.61697	0.99;0.99	P;P	0.59288	0.855;0.855	T	0.52578	-0.8557	9	0.59425	D	0.04	-17.8843	12.603	0.56506	0.0:1.0:0.0:0.0	.	117;117	Q9Y4H4;A2BFJ3	GPSM3_HUMAN;.	H	114;117;117	.	ENSP00000364180:Q117H	Q	-	3	2	GPSM3	32267253	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.588000	0.36633	2.342000	0.79632	0.563000	0.77884	CAG	GPSM3	-	pfam_GoLoco_motif,smart_GoLoco_motif	ENSG00000213654		0.612	GPSM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPSM3	HGNC	protein_coding	OTTHUMT00000076509.1	21	0.00	0	C	NM_022107		32159275	32159275	-1	no_errors	ENST00000375040	ensembl	human	known	69_37n	missense	36	16.28	7	SNP	1.000	A
GZMK	3003	genome.wustl.edu	37	5	54329596	54329597	+	Frame_Shift_Ins	INS	-	-	AT	rs143967846	byFrequency	TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr5:54329596_54329597insAT	ENST00000231009.2	+	5	707_708	c.637_638insAT	c.(637-639)gacfs	p.D213fs	CTD-2313F11.1_ENST00000596137.1_RNA|CTD-2313F11.1_ENST00000609792.1_RNA|CTD-2313F11.1_ENST00000595218.1_RNA|CTD-2313F11.1_ENST00000609699.1_RNA	NM_002104.2	NP_002095.1	P49863	GRAK_HUMAN	granzyme K (granzyme 3; tryptase II)	213	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)	15		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.183)				CTTCCAGGGTGACTCAGGGGGC	0.455																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC035802	CCDS3964.1	5q11.2	2008-05-15	2005-08-17		ENSG00000113088	ENSG00000113088			4711	protein-coding gene	gene with protein product		600784	"""granzyme K (serine protease, granzyme 3; tryptase II)"""			7758581	Standard	NM_002104		Approved	TRYP2, PRSS	uc003jpl.1	P49863	OTTHUMG00000097009	Exception_encountered	5.37:g.54329596_54329597insAT	ENSP00000231009:p.Asp213fs		B2R563	Frame_Shift_Ins	INS	pfam_Peptidase_S1_S6,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.S214fs	ENST00000231009.2	37	c.637_638	CCDS3964.1	5																																																																																			GZMK	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	ENSG00000113088		0.455	GZMK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GZMK	HGNC	protein_coding	OTTHUMT00000214098.1	179	0.00	0	-	NM_002104		54329596	54329597	+1	no_errors	ENST00000231009	ensembl	human	known	69_37n	frame_shift_ins	49	55.05	60	INS	1.000:1.000	AT
HOOK2	29911	genome.wustl.edu	37	19	12885536	12885536	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr19:12885536C>T	ENST00000397668.3	-	3	224	c.151G>A	c.(151-153)Gag>Aag	p.E51K	HOOK2_ENST00000264827.5_Missense_Mutation_p.E51K|HOOK2_ENST00000589965.1_5'UTR	NM_013312.2	NP_037444.2	Q96ED9	HOOK2_HUMAN	hook microtubule-tethering protein 2	51	Required for localization to the centrosome and induction of aggresome formation.|Sufficient for interaction with microtubules.				early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	centrosome (GO:0005813)|FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(5)|skin(1)	20						AGCCATGCCTCGTTGAACCAG	0.567																																						dbGAP											0													71.0	73.0	72.0					19																	12885536		1977	4150	6127	-	-	-	SO:0001583	missense	0			AF044924	CCDS42507.1, CCDS42508.1	19p13.2	2013-08-21	2013-08-21						19885	protein-coding gene	gene with protein product		607824	"""hook homolog 2 (Drosophila)"""			9927460	Standard	NM_013312		Approved	HK2	uc002muy.2	Q96ED9		ENST00000397668.3:c.151G>A	19.37:g.12885536C>T	ENSP00000380785:p.Glu51Lys		O60562	Missense_Mutation	SNP	pfam_HOOK,superfamily_UBA-like	p.E51K	ENST00000397668.3	37	c.151	CCDS42508.1	19	.	.	.	.	.	.	.	.	.	.	C	26.4	4.731892	0.89390	.	.	ENSG00000095066	ENST00000397668;ENST00000264827	T;T	0.22539	1.95;1.95	5.22	2.95	0.34219	.	0.177166	0.47455	D	0.000226	T	0.26048	0.0635	L	0.58583	1.82	0.35341	D	0.786466	P;P	0.39094	0.607;0.659	B;B	0.43950	0.214;0.437	T	0.31392	-0.9945	10	0.54805	T	0.06	-8.1407	10.1738	0.42927	0.0:0.7853:0.1371:0.0776	.	51;51	Q96ED9-2;Q96ED9	.;HOOK2_HUMAN	K	51	ENSP00000380785:E51K;ENSP00000264827:E51K	ENSP00000264827:E51K	E	-	1	0	HOOK2	12746536	1.000000	0.71417	0.712000	0.30502	0.976000	0.68499	4.376000	0.59556	0.626000	0.30322	0.561000	0.74099	GAG	HOOK2	-	pfam_HOOK	ENSG00000095066		0.567	HOOK2-002	KNOWN	basic|CCDS	protein_coding	HOOK2	HGNC	protein_coding	OTTHUMT00000451008.1	100	0.99	1	C	NM_013312		12885536	12885536	-1	no_errors	ENST00000397668	ensembl	human	known	69_37n	missense	177	18.26	40	SNP	0.999	T
INSRR	3645	genome.wustl.edu	37	1	156823931	156823931	+	Silent	SNP	G	G	A			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr1:156823931G>A	ENST00000368195.3	-	2	646	c.250C>T	c.(250-252)Ctg>Ttg	p.L84L	NTRK1_ENST00000392302.2_Intron	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	84					actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CGGAAGAGCAGCAGGTAGTCG	0.642																																						dbGAP											0													78.0	76.0	77.0					1																	156823931		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.250C>T	1.37:g.156823931G>A			O60724|Q5VZS3	Silent	SNP	pirsf_Tyr_kinase_insulin-like_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.L84	ENST00000368195.3	37	c.250	CCDS1160.1	1																																																																																			INSRR	-	pirsf_Tyr_kinase_insulin-like_rcpt,pfam_EGF_rcpt_L	ENSG00000027644		0.642	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INSRR	HGNC	protein_coding	OTTHUMT00000098929.1	25	0.00	0	G	NM_014215		156823931	156823931	-1	no_errors	ENST00000368195	ensembl	human	known	69_37n	silent	49	30.99	22	SNP	1.000	A
ITGB5	3693	genome.wustl.edu	37	3	124578168	124578168	+	Silent	SNP	G	G	T			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr3:124578168G>T	ENST00000296181.4	-	3	578	c.282C>A	c.(280-282)ctC>ctA	p.L94L		NM_002213.3	NP_002204.2	P18084	ITB5_HUMAN	integrin, beta 5	94					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|epithelial cell-cell adhesion (GO:0090136)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|stress fiber assembly (GO:0043149)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alphav-beta5 complex (GO:0034684)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	30				GBM - Glioblastoma multiforme(114;0.163)		CCTTGCTGCTGAGGGGCAGGC	0.592																																						dbGAP											0													68.0	69.0	68.0					3																	124578168		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			J05633	CCDS3030.1	3q21.2	2010-03-23			ENSG00000082781	ENSG00000082781		"""Integrins"""	6160	protein-coding gene	gene with protein product		147561				2211615	Standard	NM_002213		Approved		uc003eho.3	P18084	OTTHUMG00000159432	ENST00000296181.4:c.282C>A	3.37:g.124578168G>T			B0LPF8|B2RD70	Silent	SNP	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,pfam_Integrin_bsu_cyt,pfam_Integrin_bsu_tail,pfam_EGF_extracell,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like,smart_Integrin_bsu_N,smart_VWF_A,prints_Integrin_bsu	p.L94	ENST00000296181.4	37	c.282	CCDS3030.1	3																																																																																			ITGB5	-	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,smart_Integrin_bsu_N	ENSG00000082781		0.592	ITGB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB5	HGNC	protein_coding	OTTHUMT00000355286.3	51	0.00	0	G	NM_002213		124578168	124578168	-1	no_errors	ENST00000296181	ensembl	human	known	69_37n	silent	28	54.84	34	SNP	1.000	T
ITK	3702	genome.wustl.edu	37	5	156675970	156675970	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr5:156675970C>A	ENST00000422843.3	+	16	1896	c.1744C>A	c.(1744-1746)Ctg>Atg	p.L582M	ITK_ENST00000519749.1_3'UTR	NM_005546.3	NP_005537.3	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	582	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cellular defense response (GO:0006968)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|intracellular signal transduction (GO:0035556)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.L582V(1)		breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(25)|ovary(8)|prostate(2)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	70	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Pazopanib(DB06589)	CAAGCCCCGGCTGGCCTCCAC	0.498			T	SYK	peripheral T-cell lymphoma																																Esophageal Squamous(70;1378 1469 8785 19883)	dbGAP		Dom	yes		5	5q31-q32	3702	IL2-inducible T-cell kinase		L	1	Substitution - Missense(1)	ovary(1)											114.0	96.0	102.0					5																	156675970		2203	4300	6503	-	-	-	SO:0001583	missense	0			D13720	CCDS4336.1	5q31-q32	2014-09-17			ENSG00000113263	ENSG00000113263		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	6171	protein-coding gene	gene with protein product		186973				8364206	Standard	NM_005546		Approved	EMT, PSCTK2, LYK	uc003lwo.1	Q08881	OTTHUMG00000130245	ENST00000422843.3:c.1744C>A	5.37:g.156675970C>A	ENSP00000398655:p.Leu582Met		B2R752|Q32ML7	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_Znf_Btk_motif,pfam_SH3_domain,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_Znf_Btk_motif,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Znf_Btk_motif,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.L582M	ENST00000422843.3	37	c.1744	CCDS4336.1	5	.	.	.	.	.	.	.	.	.	.	C	12.98	2.099567	0.37048	.	.	ENSG00000113263	ENST00000422843	D	0.82893	-1.66	5.71	3.01	0.34805	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	T	0.80964	0.4725	L	0.49350	1.555	0.39974	D	0.974829	P	0.45672	0.864	P	0.50314	0.637	T	0.78661	-0.2117	10	0.49607	T	0.09	.	5.5737	0.17210	0.1295:0.5987:0.0:0.2718	.	582	Q08881	ITK_HUMAN	M	582	ENSP00000398655:L582M	ENSP00000398655:L582M	L	+	1	2	ITK	156608548	0.002000	0.14202	0.663000	0.29738	0.855000	0.48748	0.017000	0.13399	0.796000	0.33947	0.650000	0.86243	CTG	ITK	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000113263		0.498	ITK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITK	HGNC	protein_coding	OTTHUMT00000252569.2	98	0.00	0	C			156675970	156675970	+1	no_errors	ENST00000422843	ensembl	human	known	69_37n	missense	68	34.62	36	SNP	0.275	A
ITSN2	50618	genome.wustl.edu	37	2	24484451	24484451	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr2:24484451G>C	ENST00000355123.4	-	21	2959	c.2516C>G	c.(2515-2517)tCt>tGt	p.S839C	ITSN2_ENST00000361999.3_Missense_Mutation_p.S812C|ITSN2_ENST00000406921.3_Missense_Mutation_p.S839C	NM_006277.2	NP_006268.2	Q9NZM3	ITSN2_HUMAN	intersectin 2	839					endocytosis (GO:0006897)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(8)|large_intestine(11)|liver(3)|lung(28)|ovary(2)|stomach(1)	61	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGAGGTAGCAGATAAAGAAAC	0.353																																						dbGAP											0													119.0	124.0	122.0					2																	24484451		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033082	CCDS1710.2, CCDS1711.2, CCDS46230.1	2p23.3	2013-09-19	2002-10-30		ENSG00000198399	ENSG00000198399		"""Rho guanine nucleotide exchange factors"", ""EF-hand domain containing"""	6184	protein-coding gene	gene with protein product	"""SH3 domain protein 1B"", ""SH3P18-like WASP associated protein"""	604464	"""SH3 domain protein 1B"""	SH3D1B		10922467, 11748279	Standard	NM_006277		Approved	KIAA1256, SWAP, SH3P18, SWA, PRO2015	uc002rfe.2	Q9NZM3	OTTHUMG00000090818	ENST00000355123.4:c.2516C>G	2.37:g.24484451G>C	ENSP00000347244:p.Ser839Cys		O95062|Q15812|Q9HAK4|Q9NXE6|Q9NYG0|Q9NZM2|Q9ULG4	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_DH-domain,pfam_C2_Ca-dep,superfamily_DH-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_SH3_domain,smart_EPS15_homology,smart_EF_hand_Ca-bd,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_C2_Ca-dep,pfscan_EF_HAND_2,pfscan_EPS15_homology,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain,prints_SH3_domain,prints_p67phox	p.S839C	ENST00000355123.4	37	c.2516	CCDS1710.2	2	.	.	.	.	.	.	.	.	.	.	G	14.95	2.689684	0.48097	.	.	ENSG00000198399	ENST00000361999;ENST00000355123;ENST00000380868;ENST00000406921	T;T;T;T	0.33438	1.41;1.41;1.41;1.41	5.12	5.12	0.69794	Src homology-3 domain (1);	0.438000	0.16316	U	0.219781	T	0.35158	0.0922	L	0.34521	1.04	0.51767	D	0.99993	P;P;B	0.43169	0.8;0.525;0.39	P;P;B	0.46885	0.526;0.53;0.286	T	0.05632	-1.0873	10	0.38643	T	0.18	.	18.9438	0.92613	0.0:0.0:1.0:0.0	.	839;812;839	Q9NZM3-3;Q9NZM3-2;Q9NZM3	.;.;ITSN2_HUMAN	C	812;839;812;839	ENSP00000354561:S812C;ENSP00000347244:S839C;ENSP00000370250:S812C;ENSP00000384499:S839C	ENSP00000347244:S839C	S	-	2	0	ITSN2	24337955	1.000000	0.71417	0.994000	0.49952	0.967000	0.64934	5.074000	0.64401	2.577000	0.86979	0.561000	0.74099	TCT	ITSN2	-	superfamily_SH3_domain	ENSG00000198399		0.353	ITSN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ITSN2	HGNC	protein_coding	OTTHUMT00000207620.2	428	0.00	0	G	NM_006277		24484451	24484451	-1	no_errors	ENST00000355123	ensembl	human	known	69_37n	missense	127	28.65	51	SNP	1.000	C
LGR6	59352	genome.wustl.edu	37	1	202266674	202266674	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr1:202266674C>T	ENST00000367278.3	+	7	844	c.755C>T	c.(754-756)gCc>gTc	p.A252V	LGR6_ENST00000255432.7_Missense_Mutation_p.A200V|LGR6_ENST00000308543.3_3'UTR|LGR6_ENST00000439764.2_Missense_Mutation_p.A113V	NM_001017403.1	NP_001017403.1	Q9HBX8	LGR6_HUMAN	leucine-rich repeat containing G protein-coupled receptor 6	252					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of Wnt signaling pathway (GO:0030177)|Wnt signaling pathway (GO:0016055)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	36						TTCCCTGTGGCCATCCGGACC	0.557																																						dbGAP											0													120.0	117.0	118.0					1																	202266674		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF190501	CCDS1424.1, CCDS30971.1, CCDS30972.1	1q32.1	2012-08-21	2011-01-25		ENSG00000133067	ENSG00000133067		"""GPCR / Class A : Orphans"""	19719	protein-coding gene	gene with protein product		606653	"""leucine-rich repeat-containing G protein-coupled receptor 6"""			10935549	Standard	XM_005245404		Approved	FLJ14471	uc001gxu.3	Q9HBX8	OTTHUMG00000041383	ENST00000367278.3:c.755C>T	1.37:g.202266674C>T	ENSP00000356247:p.Ala252Val		Q5T509|Q5T512|Q6UY15|Q86VU0|Q96K69|Q9BYD7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_7TM_GPCR_Rhodpsn,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,prints_Gphrmn_rcpt,prints_7TM_GPCR_Rhodpsn	p.A252V	ENST00000367278.3	37	c.755	CCDS30971.1	1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.426957	0.83667	.	.	ENSG00000133067	ENST00000367278;ENST00000255432;ENST00000367277;ENST00000423542;ENST00000439764	T;T;T;T	0.60040	5.48;3.53;0.22;0.46	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.73401	0.3582	L	0.59967	1.855	0.47778	D	0.999516	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.999;0.994;0.995	T	0.75133	-0.3425	10	0.87932	D	0	.	16.6028	0.84820	0.0:1.0:0.0:0.0	.	113;200;252	Q9HBX8-1;Q9HBX8-2;Q9HBX8	.;.;LGR6_HUMAN	V	252;200;154;154;113	ENSP00000356247:A252V;ENSP00000255432:A200V;ENSP00000402284:A154V;ENSP00000387869:A113V	ENSP00000255432:A200V	A	+	2	0	LGR6	200533297	1.000000	0.71417	0.994000	0.49952	0.619000	0.37552	6.362000	0.73077	2.659000	0.90383	0.563000	0.77884	GCC	LGR6	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000133067		0.557	LGR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGR6	HGNC	protein_coding	OTTHUMT00000099143.1	94	0.00	0	C	NM_021636		202266674	202266674	+1	no_errors	ENST00000367278	ensembl	human	known	69_37n	missense	134	14.10	22	SNP	1.000	T
LRRC73	221424	genome.wustl.edu	37	6	43476523	43476523	+	Silent	SNP	G	G	A			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr6:43476523G>A	ENST00000372441.1	-	2	1308	c.408C>T	c.(406-408)ctC>ctT	p.L136L		NM_001012974.1	NP_001012992.1	Q5JTD7	LRC73_HUMAN	leucine rich repeat containing 73	136																	CTGGGGGCAGGAGGCCACAGA	0.612																																						dbGAP											0													75.0	79.0	78.0					6																	43476523		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS34456.1	6p21.1	2011-11-25	2011-11-25	2011-11-25	ENSG00000204052	ENSG00000204052			21375	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 154"""	C6orf154			Standard	NM_001012974		Approved	dJ337H4.2	uc003ovk.2	Q5JTD7	OTTHUMG00000014737	ENST00000372441.1:c.408C>T	6.37:g.43476523G>A				Silent	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.L136	ENST00000372441.1	37	c.408	CCDS34456.1	6																																																																																			LRRC73	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000204052		0.612	LRRC73-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LRRC73	HGNC	protein_coding	OTTHUMT00000040635.1	18	0.00	0	G	NM_001012974		43476523	43476523	-1	no_errors	ENST00000372441	ensembl	human	novel	69_37n	silent	15	25.00	5	SNP	1.000	A
MATK	4145	genome.wustl.edu	37	19	3784877	3784877	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr19:3784877G>C	ENST00000310132.6	-	3	476	c.78C>G	c.(76-78)agC>agG	p.S26R	MATK_ENST00000590821.1_5'Flank|MATK_ENST00000395045.2_Missense_Mutation_p.S27R|MATK_ENST00000585778.1_Missense_Mutation_p.S26R|MATK_ENST00000395040.2_5'UTR	NM_139355.2	NP_647612.1	P42679	MATK_HUMAN	megakaryocyte-associated tyrosine kinase	26					cell proliferation (GO:0008283)|mesoderm development (GO:0007498)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(2)|stomach(2)|urinary_tract(1)	26		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		GGAAGCGGGGGCTCACCTGGG	0.672																																						dbGAP											0													17.0	18.0	18.0					19																	3784877		2160	4205	6365	-	-	-	SO:0001583	missense	0			L18974	CCDS12113.1, CCDS12114.1, CCDS42468.1	19p13.3	2013-02-14						"""SH2 domain containing"""	6906	protein-coding gene	gene with protein product	"""Csk-homologous kinase"", ""tyrosine-protein kinase CTK"", ""protein kinase HYL"", ""hematopoietic consensus tyrosine-lacking kinase"", ""tyrosylprotein kinase"", ""hydroxyaryl-protein kinase"", ""Csk-type protein tyrosine kinase"", ""HYL tyrosine kinase"", ""tyrosine kinase MATK"", ""leukocyte carboxyl-terminal src kinase related"""	600038				8288563, 7530249	Standard	NM_139355		Approved	HYLTK, CTK, HYL, Lsk, CHK, HHYLTK, DKFZp434N1212, MGC1708, MGC2101	uc002lyt.3	P42679		ENST00000310132.6:c.78C>G	19.37:g.3784877G>C	ENSP00000308734:p.Ser26Arg		B3KNZ9|Q9NST8	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.S27R	ENST00000310132.6	37	c.81	CCDS12114.1	19	.	.	.	.	.	.	.	.	.	.	G	8.294	0.818425	0.16607	.	.	ENSG00000007264	ENST00000395045;ENST00000310132	T;T	0.74209	-0.8;-0.82	4.43	2.15	0.27550	.	0.677816	0.13055	U	0.417334	T	0.56321	0.1977	L	0.27053	0.805	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.40308	-0.9570	10	0.31617	T	0.26	-5.1971	4.3933	0.11351	0.1319:0.0:0.6489:0.2191	.	26;27;26	F1T0G6;B3KNZ9;P42679	.;.;MATK_HUMAN	R	27;26	ENSP00000378485:S27R;ENSP00000308734:S26R	ENSP00000308734:S26R	S	-	3	2	MATK	3735877	0.491000	0.26019	0.218000	0.23776	0.400000	0.30750	1.997000	0.40786	0.364000	0.24374	0.455000	0.32223	AGC	MATK	-	NULL	ENSG00000007264		0.672	MATK-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	MATK	HGNC	protein_coding	OTTHUMT00000453639.1	20	0.00	0	G	NM_139355		3784877	3784877	-1	no_errors	ENST00000395045	ensembl	human	known	69_37n	missense	10	37.50	6	SNP	0.229	C
ME3	10873	genome.wustl.edu	37	11	86160981	86160981	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr11:86160981C>T	ENST00000393324.3	-	9	1334	c.1081G>A	c.(1081-1083)Gag>Aag	p.E361K	ME3_ENST00000359636.2_Missense_Mutation_p.E361K|RP11-317J19.1_ENST00000524610.1_RNA|ME3_ENST00000543262.1_Missense_Mutation_p.E361K	NM_001014811.1	NP_001014811.1	Q16798	MAON_HUMAN	malic enzyme 3, NADP(+)-dependent, mitochondrial	361					aerobic respiration (GO:0009060)|malate metabolic process (GO:0006108)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|pyruvate metabolic process (GO:0006090)	mitochondrion (GO:0005739)	cofactor binding (GO:0048037)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|oxaloacetate decarboxylase activity (GO:0008948)			endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|skin(3)|stomach(2)|urinary_tract(1)	27		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)				CTTGTGGCCTCTGCCTTCGGT	0.522																																						dbGAP											0													172.0	160.0	164.0					11																	86160981		2202	4299	6501	-	-	-	SO:0001583	missense	0			X79440	CCDS8277.1	11q14.2	2012-09-20			ENSG00000151376	ENSG00000151376	1.1.1.40		6985	protein-coding gene	gene with protein product		604626				7818469	Standard	NM_001161586		Approved		uc001pbz.3	Q16798	OTTHUMG00000167217	ENST00000393324.3:c.1081G>A	11.37:g.86160981C>T	ENSP00000376998:p.Glu361Lys		B7Z6V0|Q8TBJ0	Missense_Mutation	SNP	pfam_Malic_NAD-bd,pfam_Malic_N,smart_Malic_NAD-bd,prints_Malic_OxRdtase	p.E361K	ENST00000393324.3	37	c.1081	CCDS8277.1	11	.	.	.	.	.	.	.	.	.	.	C	16.45	3.128036	0.56721	.	.	ENSG00000151376	ENST00000359636;ENST00000543262;ENST00000393324;ENST00000524826	T;T;T;T	0.34072	1.38;1.38;1.38;1.38	5.7	4.73	0.59995	Malic enzyme, NAD-binding (2);NAD(P)-binding domain (1);	0.187591	0.56097	D	0.000029	T	0.39200	0.1069	M	0.68593	2.085	0.80722	D	1	B	0.22146	0.065	B	0.25884	0.064	T	0.18272	-1.0342	9	.	.	.	.	16.1541	0.81644	0.0:0.8667:0.1333:0.0	.	361	Q16798	MAON_HUMAN	K	361	ENSP00000352657:E361K;ENSP00000440246:E361K;ENSP00000376998:E361K;ENSP00000431182:E361K	.	E	-	1	0	ME3	85838629	1.000000	0.71417	0.997000	0.53966	0.507000	0.33981	4.827000	0.62723	2.703000	0.92315	0.650000	0.86243	GAG	ME3	-	pfam_Malic_NAD-bd,smart_Malic_NAD-bd	ENSG00000151376		0.522	ME3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ME3	HGNC	protein_coding	OTTHUMT00000393767.2	173	0.00	0	C			86160981	86160981	-1	no_errors	ENST00000359636	ensembl	human	known	69_37n	missense	233	15.52	43	SNP	1.000	T
MEFV	4210	genome.wustl.edu	37	16	3298943	3298943	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr16:3298943C>A	ENST00000219596.1	-	4	1361	c.1322G>T	c.(1321-1323)cGa>cTa	p.R441L	MEFV_ENST00000541159.1_Missense_Mutation_p.R230L|MEFV_ENST00000339854.4_Missense_Mutation_p.R261L|MEFV_ENST00000536379.1_Missense_Mutation_p.R230L	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	441	Required for homotrimerization and induction of pyroptosomes.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						CCCATAGGATCGCTGCTCCTC	0.517																																						dbGAP											0													201.0	172.0	182.0					16																	3298943		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.1322G>T	16.37:g.3298943C>A	ENSP00000219596:p.Arg441Leu		D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Missense_Mutation	SNP	pfam_DAPIN,pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl,superfamily_DEATH-like,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_DAPIN,pfscan_Znf_B-box,prints_Butyrophylin	p.R441L	ENST00000219596.1	37	c.1322	CCDS10498.1	16	.	.	.	.	.	.	.	.	.	.	C	12.21	1.870893	0.33069	.	.	ENSG00000103313	ENST00000545159;ENST00000219596;ENST00000339854;ENST00000541159;ENST00000536379;ENST00000534868	T;T;T;T	0.66280	-0.2;0.22;0.21;0.24	5.5	2.22	0.28083	.	0.481200	0.18825	N	0.130152	T	0.61887	0.2383	M	0.75447	2.3	0.24944	N	0.991831	D	0.58268	0.982	P	0.49012	0.598	T	0.57751	-0.7757	10	0.62326	D	0.03	-15.3933	2.3967	0.04392	0.2259:0.4386:0.0:0.3355	.	441	O15553	MEFV_HUMAN	L	441;441;261;230;230;230	ENSP00000219596:R441L;ENSP00000339639:R261L;ENSP00000438711:R230L;ENSP00000445079:R230L	ENSP00000219596:R441L	R	-	2	0	MEFV	3238944	0.327000	0.24678	0.243000	0.24186	0.013000	0.08279	0.639000	0.24690	0.296000	0.22592	-0.311000	0.09066	CGA	MEFV	-	NULL	ENSG00000103313		0.517	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEFV	HGNC	protein_coding	OTTHUMT00000251464.1	192	0.00	0	C	NM_000243		3298943	3298943	-1	no_errors	ENST00000219596	ensembl	human	known	69_37n	missense	142	24.87	47	SNP	0.394	A
MLLT4	4301	genome.wustl.edu	37	6	168319551	168319551	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr6:168319551G>T	ENST00000447894.2	+	20	2825	c.2825G>T	c.(2824-2826)tGt>tTt	p.C942F	MLLT4_ENST00000344191.4_Missense_Mutation_p.C942F|MLLT4_ENST00000392108.3_Missense_Mutation_p.C942F|MLLT4_ENST00000366806.2_Missense_Mutation_p.C942F|MLLT4_ENST00000392112.1_Missense_Mutation_p.C926F|MLLT4_ENST00000351017.4_Missense_Mutation_p.C949F|MLLT4_ENST00000400822.3_Missense_Mutation_p.C941F			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	942					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		GGTTATTCTTGTGATGTTGTC	0.478			T	MLL	AL																																	dbGAP		Dom	yes		6	6q27	4301	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""		L	0													96.0	84.0	88.0					6																	168319551		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.2825G>T	6.37:g.168319551G>T	ENSP00000404595:p.Cys942Phe		O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	Missense_Mutation	SNP	pfam_Ras-assoc,pfam_Dil_domain,pfam_PDZ,pfam_FHA_dom,superfamily_PDZ,superfamily_SMAD_FHA_domain,smart_Ras-assoc,smart_FHA_dom,smart_PDZ,pfscan_Dilute,pfscan_PDZ,pfscan_Ras-assoc	p.C942F	ENST00000447894.2	37	c.2825		6	.	.	.	.	.	.	.	.	.	.	G	26.1	4.702354	0.88924	.	.	ENSG00000130396	ENST00000344191;ENST00000351017;ENST00000392108;ENST00000366806;ENST00000392112;ENST00000341575;ENST00000400822;ENST00000447894;ENST00000497596	T;T;T;T;T;T;T	0.05319	3.67;3.56;3.67;3.65;3.46;3.55;3.55	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.19805	0.0476	M	0.70595	2.14	0.80722	D	1	D;D;D;D	0.89917	0.992;1.0;0.99;0.995	D;D;D;D	0.85130	0.961;0.997;0.92;0.941	T	0.00507	-1.1699	10	0.72032	D	0.01	-23.3278	19.7664	0.96346	0.0:0.0:1.0:0.0	.	942;941;942;926	P55196;P55196-5;P55196-6;P55196-2	AFAD_HUMAN;.;.;.	F	942;949;942;942;926;942;941;942;105	ENSP00000341118:C942F;ENSP00000252692:C949F;ENSP00000375956:C942F;ENSP00000355771:C942F;ENSP00000375960:C926F;ENSP00000383623:C941F;ENSP00000404595:C942F	ENSP00000345834:C942F	C	+	2	0	MLLT4	168062400	1.000000	0.71417	0.950000	0.38849	0.995000	0.86356	9.211000	0.95120	2.735000	0.93741	0.655000	0.94253	TGT	MLLT4	-	NULL	ENSG00000130396		0.478	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	MLLT4	HGNC	protein_coding	OTTHUMT00000372077.1	175	0.00	0	G	NM_005936		168319551	168319551	+1	no_errors	ENST00000366806	ensembl	human	known	69_37n	missense	67	28.72	27	SNP	1.000	T
MOAP1	64112	genome.wustl.edu	37	14	93650053	93650053	+	Nonsense_Mutation	SNP	C	C	A			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr14:93650053C>A	ENST00000556883.1	-	2	1019	c.535G>T	c.(535-537)Gaa>Taa	p.E179*	TMEM251_ENST00000283534.4_5'Flank|RP11-371E8.4_ENST00000557574.1_5'Flank|TMEM251_ENST00000415050.2_5'Flank|MOAP1_ENST00000298894.4_Nonsense_Mutation_p.E179*			Q96BY2	MOAP1_HUMAN	modulator of apoptosis 1	179					apoptotic signaling pathway (GO:0097190)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of apoptotic process (GO:0043065)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:0001844)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(1)|skin(2)	13		all_cancers(154;0.00528)|Acute lymphoblastic leukemia(33;0.0497)|all_epithelial(191;0.125)|all_neural(303;0.13)		Epithelial(152;0.178)|all cancers(159;0.2)|COAD - Colon adenocarcinoma(157;0.204)		ccaaattcttcttctcctggt	0.502																																						dbGAP											0													69.0	72.0	71.0					14																	93650053		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC015044	CCDS9908.1	14q32.12	2012-02-09			ENSG00000165943	ENSG00000165943		"""Paraneoplastic Ma antigens"""	16658	protein-coding gene	gene with protein product	"""paraneoplastic Ma antigen family member 4"""	609485				11060313	Standard	NM_022151		Approved	MAP-1, PNMA4	uc001ybj.3	Q96BY2	OTTHUMG00000169184	ENST00000556883.1:c.535G>T	14.37:g.93650053C>A	ENSP00000451594:p.Glu179*		B2RDF6|Q9H833|Q9HAS1	Nonsense_Mutation	SNP	NULL	p.E179*	ENST00000556883.1	37	c.535	CCDS9908.1	14	.	.	.	.	.	.	.	.	.	.	C	38	7.164168	0.98107	.	.	ENSG00000165943	ENST00000298894;ENST00000556883	.	.	.	3.78	3.78	0.43462	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-0.0917	11.5084	0.50481	0.0:1.0:0.0:0.0	.	.	.	.	X	179	.	ENSP00000298894:E179X	E	-	1	0	MOAP1	92719806	0.941000	0.31946	0.916000	0.36221	0.614000	0.37383	1.147000	0.31602	2.411000	0.81874	0.650000	0.86243	GAA	MOAP1	-	NULL	ENSG00000165943		0.502	MOAP1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MOAP1	HGNC	protein_coding	OTTHUMT00000412685.1	80	0.00	0	C			93650053	93650053	-1	no_errors	ENST00000298894	ensembl	human	known	69_37n	nonsense	55	36.05	31	SNP	0.960	A
MSH6	2956	genome.wustl.edu	37	2	48027214	48027214	+	Missense_Mutation	SNP	C	C	G	rs63750832		TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr2:48027214C>G	ENST00000234420.5	+	4	2244	c.2092C>G	c.(2092-2094)Cag>Gag	p.Q698E	FBXO11_ENST00000405808.1_Intron|MSH6_ENST00000540021.1_Missense_Mutation_p.Q568E|MSH6_ENST00000538136.1_Missense_Mutation_p.Q396E	NM_000179.2	NP_000170.1	P52701	MSH6_HUMAN	mutS homolog 6	698			Q -> E (in HNPCC; unknown pathological significance). {ECO:0000269|PubMed:10480359}.		ATP catabolic process (GO:0006200)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|response to UV (GO:0009411)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|MutSalpha complex (GO:0032301)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|guanine/thymine mispair binding (GO:0032137)|methylated histone binding (GO:0035064)|mismatched DNA binding (GO:0030983)	p.0?(2)		breast(8)|central_nervous_system(29)|cervix(1)|endometrium(32)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(75)|lung(25)|ovary(3)|prostate(3)|skin(10)|stomach(22)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	229		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			CCTTATTGATCAGGAGCTTTT	0.418			"""Mis, N, F, S"""		colorectal	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																													dbGAP	yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p16	2956	mutS homolog 6 (E. coli)		E	2	Whole gene deletion(2)	haematopoietic_and_lymphoid_tissue(2)	GRCh37	CM990715	MSH6	M	rs63750832						155.0	151.0	152.0					2																	48027214		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	U54777	CCDS1836.1, CCDS62906.1, CCDS62907.1	2p16	2014-09-17	2013-09-12		ENSG00000116062	ENSG00000116062			7329	protein-coding gene	gene with protein product		600678	"""mutS (E. coli) homolog 6"", ""mutS homolog 6 (E. coli)"""	GTBP		7604266	Standard	NM_000179		Approved		uc002rwd.4	P52701	OTTHUMG00000129129	ENST00000234420.5:c.2092C>G	2.37:g.48027214C>G	ENSP00000234420:p.Gln698Glu		B4DF41|B4E3I4|F5H2F9|O43706|O43917|Q8TCX4|Q9BTB5	Missense_Mutation	SNP	pfam_DNA_mismatch_repair_MutS_C,pfam_DNA_mismatch_repair_MutS-lik_N,pfam_DNA_mismatch_repair_MutS_core,pfam_PWWP,pfam_DNA_mismatch_repair_MutS_clamp,pfam_DNA_mismatch_repair_MutS_connt,superfamily_DNA_mismatch_repair_MutS_core,superfamily_DNA_mismatch_repair_MutS_N,superfamily_DNA_mismatch_repair_MutS_connt,smart_PWWP,smart_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_C,pirsf_DNA_mismatch_repair_Msh6,pfscan_PWWP	p.Q698E	ENST00000234420.5	37	c.2092	CCDS1836.1	2	.	.	.	.	.	.	.	.	.	.	C	8.948	0.967537	0.18659	.	.	ENSG00000116062	ENST00000234420;ENST00000544857;ENST00000540021;ENST00000538136	D;D;D	0.87491	-2.26;-2.26;-2.26	5.01	4.05	0.47172	DNA mismatch repair protein MutS, connector (1);	0.167192	0.53938	D	0.000048	T	0.75547	0.3864	N	0.20807	0.61	0.80722	D	1	B;B;B	0.28258	0.082;0.205;0.06	B;B;B	0.29077	0.063;0.098;0.07	T	0.69383	-0.5160	10	0.19590	T	0.45	-11.1237	9.6512	0.39899	0.146:0.7695:0.0:0.0845	rs63750832	568;698;698	B4DF41;P52701;P52701-2	.;MSH6_HUMAN;.	E	698;696;568;396	ENSP00000234420:Q698E;ENSP00000446475:Q568E;ENSP00000438580:Q396E	ENSP00000234420:Q698E	Q	+	1	0	MSH6	47880718	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.600000	0.54052	2.609000	0.88269	0.460000	0.39030	CAG	MSH6	-	pfam_DNA_mismatch_repair_MutS_connt,superfamily_DNA_mismatch_repair_MutS_connt,pirsf_DNA_mismatch_repair_Msh6	ENSG00000116062		0.418	MSH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSH6	HGNC	protein_coding	OTTHUMT00000251180.4	196	0.00	0	C	NM_000179		48027214	48027214	+1	no_errors	ENST00000234420	ensembl	human	known	69_37n	missense	80	23.81	25	SNP	1.000	G
MYO5A	4644	genome.wustl.edu	37	15	52652227	52652227	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr15:52652227C>T	ENST00000399231.3	-	25	3604	c.3361G>A	c.(3361-3363)Gag>Aag	p.E1121K	MYO5A_ENST00000553916.1_Missense_Mutation_p.E1121K|MYO5A_ENST00000356338.6_Missense_Mutation_p.E1121K|MYO5A_ENST00000399233.2_Missense_Mutation_p.E1121K|MYO5A_ENST00000358212.6_Missense_Mutation_p.E1121K	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	1121					actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		TATTCAGACTCGTTGCTGCTG	0.413																																						dbGAP											0													100.0	98.0	99.0					15																	52652227		1972	4165	6137	-	-	-	SO:0001583	missense	0				CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.3361G>A	15.37:g.52652227C>T	ENSP00000382177:p.Glu1121Lys		A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_Skp1_comp_dimer,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E1121K	ENST00000399231.3	37	c.3361	CCDS42037.1	15	.	.	.	.	.	.	.	.	.	.	C	24.3	4.519743	0.85495	.	.	ENSG00000197535	ENST00000399231;ENST00000399229;ENST00000399233;ENST00000356338;ENST00000358212;ENST00000546028;ENST00000553916	T;T;T;T;T	0.22134	1.97;1.97;1.97;1.97;1.97	5.78	5.78	0.91487	.	0.048995	0.85682	D	0.000000	T	0.11495	0.0280	N	0.08118	0	0.80722	D	1	P;P	0.42757	0.789;0.625	B;B	0.31337	0.107;0.128	T	0.11941	-1.0567	10	0.35671	T	0.21	.	20.0203	0.97492	0.0:1.0:0.0:0.0	.	1121;1121	Q9Y4I1;Q9Y4I1-2	MYO5A_HUMAN;.	K	1121;655;1121;1121;1121;751;1121	ENSP00000382177:E1121K;ENSP00000382179:E1121K;ENSP00000348693:E1121K;ENSP00000350945:E1121K;ENSP00000451109:E1121K	ENSP00000348693:E1121K	E	-	1	0	MYO5A	50439519	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	3.642000	0.54367	2.730000	0.93505	0.655000	0.94253	GAG	MYO5A	-	NULL	ENSG00000197535		0.413	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYO5A	HGNC	protein_coding	OTTHUMT00000268102.1	186	0.00	0	C	NM_000259		52652227	52652227	-1	no_errors	ENST00000358212	ensembl	human	known	69_37n	missense	146	28.78	59	SNP	1.000	T
N4BP1	9683	genome.wustl.edu	37	16	48585301	48585301	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr16:48585301C>T	ENST00000262384.3	-	4	2349	c.2113G>A	c.(2113-2115)Gac>Aac	p.D705N	N4BP1_ENST00000565423.1_5'UTR	NM_153029.3	NP_694574.3	O75113	N4BP1_HUMAN	NEDD4 binding protein 1	705					cellular response to UV (GO:0034644)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein ubiquitination (GO:0031397)	nucleolus (GO:0005730)|PML body (GO:0016605)				breast(3)|kidney(2)|lung(11)|urinary_tract(1)	17		all_cancers(37;0.179)|all_lung(18;0.11)				TCATACCTGTCATCATGAGAA	0.502																																						dbGAP											0													128.0	124.0	125.0					16																	48585301		1910	4136	6046	-	-	-	SO:0001583	missense	0			AK026937	CCDS45479.1	16q12.1	2008-01-18				ENSG00000102921			29850	protein-coding gene	gene with protein product						9734811, 11717310	Standard	NM_153029		Approved		uc002efp.3	O75113		ENST00000262384.3:c.2113G>A	16.37:g.48585301C>T	ENSP00000262384:p.Asp705Asn		A7MD49|Q2YDX1	Missense_Mutation	SNP	pfam_RNase_Zc3h12	p.D705N	ENST00000262384.3	37	c.2113	CCDS45479.1	16	.	.	.	.	.	.	.	.	.	.	C	36	5.783809	0.96937	.	.	ENSG00000102921	ENST00000262384	T	0.64438	-0.1	5.67	5.67	0.87782	Ribonuclease Zc3h12a-like (1);	0.000000	0.85682	D	0.000000	T	0.82135	0.4971	M	0.85710	2.77	0.80722	D	1	D	0.60575	0.988	D	0.69824	0.966	D	0.83973	0.0328	10	0.66056	D	0.02	.	19.7863	0.96440	0.0:1.0:0.0:0.0	.	705	O75113	N4BP1_HUMAN	N	705	ENSP00000262384:D705N	ENSP00000262384:D705N	D	-	1	0	N4BP1	47142802	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.252000	0.78309	2.665000	0.90641	0.655000	0.94253	GAC	N4BP1	-	pfam_RNase_Zc3h12	ENSG00000102921		0.502	N4BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	N4BP1	HGNC	protein_coding	OTTHUMT00000429920.1	156	0.64	1	C	NM_014664		48585301	48585301	-1	no_errors	ENST00000262384	ensembl	human	known	69_37n	missense	56	26.32	20	SNP	1.000	T
NBPF10	100132406	genome.wustl.edu	37	1	145366857	145366857	+	Missense_Mutation	SNP	G	G	T	rs111300665		TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr1:145366857G>T	ENST00000342960.5	+	82	10202	c.10167G>T	c.(10165-10167)gaG>gaT	p.E3389D	NBPF10_ENST00000369338.1_Intron|NBPF10_ENST00000369339.3_Intron	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	703						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		ATGAGAAAGAGCCTGAAGTCT	0.483																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.10167G>T	1.37:g.145366857G>T	ENSP00000345684:p.Glu3389Asp		Q5RHC0|Q9NWN6	Missense_Mutation	SNP	pfam_NBPF_dom	p.E3389D	ENST00000342960.5	37	c.10167	CCDS53355.1	1	.	.	.	.	.	.	.	.	.	.	.	7.213	0.595737	0.13875	.	.	ENSG00000163386	ENST00000342960	T	0.15372	2.43	1.13	-0.0539	0.13816	.	.	.	.	.	T	0.06371	0.0164	L	0.42245	1.32	0.80722	P	0.0	.	.	.	.	.	.	T	0.32375	-0.9909	6	0.59425	D	0.04	.	3.5822	0.07958	0.3063:0.0:0.6937:0.0	.	.	.	.	D	3389	ENSP00000345684:E3389D	ENSP00000345684:E3389D	E	+	3	2	NBPF10	144078214	0.010000	0.17322	0.002000	0.10522	0.054000	0.15201	1.548000	0.36201	-0.275000	0.09219	0.152000	0.16155	GAG	NBPF10	-	pfam_NBPF_dom	ENSG00000163386		0.483	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	NBPF10	HGNC	protein_coding		12	0.00	0	G	NM_001039703		145366857	145366857	+1	no_errors	ENST00000342960	ensembl	human	known	69_37n	missense	3	57.14	4	SNP	0.002	T
NFE2L1	4779	genome.wustl.edu	37	17	46128581	46128581	+	Nonsense_Mutation	SNP	C	C	G			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr17:46128581C>G	ENST00000362042.3	+	2	717	c.101C>G	c.(100-102)tCa>tGa	p.S34*	NFE2L1_ENST00000585291.1_Nonsense_Mutation_p.S34*|NFE2L1_ENST00000357480.5_Nonsense_Mutation_p.S34*|NFE2L1_ENST00000361665.3_Nonsense_Mutation_p.S34*	NM_003204.2	NP_003195.1	Q14494	NF2L1_HUMAN	nuclear factor, erythroid 2-like 1	34					anatomical structure morphogenesis (GO:0009653)|erythrocyte differentiation (GO:0030218)|heme biosynthetic process (GO:0006783)|inflammatory response (GO:0006954)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)			cervix(1)|endometrium(3)|kidney(9)|large_intestine(7)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TACCTGACCTCACAGCTTCCC	0.507																																						dbGAP											0													108.0	101.0	104.0					17																	46128581		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK090459	CCDS11524.1	17q21.3	2013-08-23	2013-08-23			ENSG00000082641		"""basic leucine zipper proteins"""	7781	protein-coding gene	gene with protein product		163260	"""nuclear factor (erythroid-derived 2)-like 1"""	TCF11		8248256, 9501099	Standard	NM_003204		Approved	NRF1, LCR-F1, FLJ00380	uc002imz.4	Q14494		ENST00000362042.3:c.101C>G	17.37:g.46128581C>G	ENSP00000354855:p.Ser34*		D3DTU3|D3DTU5|Q12877|Q96FN6	Nonsense_Mutation	SNP	pfam_bZIP_1,pfam_bZIP_2,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.S34*	ENST00000362042.3	37	c.101	CCDS11524.1	17	.	.	.	.	.	.	.	.	.	.	C	23.6	4.434577	0.83885	.	.	ENSG00000082641	ENST00000362042;ENST00000361665;ENST00000357480	.	.	.	4.98	4.98	0.66077	.	0.148489	0.46758	D	0.000267	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	-12.5435	17.0233	0.86439	0.0:1.0:0.0:0.0	.	.	.	.	X	53;34;34	.	ENSP00000350072:S34X	S	+	2	0	NFE2L1	43483580	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.968000	0.63728	2.323000	0.78572	0.462000	0.41574	TCA	NFE2L1	-	NULL	ENSG00000082641		0.507	NFE2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFE2L1	HGNC	protein_coding	OTTHUMT00000443019.1	80	0.00	0	C	NM_003204		46128581	46128581	+1	no_errors	ENST00000362042	ensembl	human	known	69_37n	nonsense	79	19.39	19	SNP	1.000	G
OR5M3	219482	genome.wustl.edu	37	11	56237827	56237827	+	Silent	SNP	G	G	A			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr11:56237827G>A	ENST00000312240.2	-	1	187	c.147C>T	c.(145-147)gtC>gtT	p.V49V		NM_001004742.2	NP_001004742.2	Q8NGP4	OR5M3_HUMAN	olfactory receptor, family 5, subfamily M, member 3	49						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(15)|ovary(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	37	Esophageal squamous(21;0.00448)					GCTGAGGACTGACCTTGATTA	0.438																																						dbGAP											0													136.0	117.0	124.0					11																	56237827		2201	4295	6496	-	-	-	SO:0001819	synonymous_variant	0			AB065746	CCDS31532.1	11q11	2012-08-09			ENSG00000174937	ENSG00000174937		"""GPCR / Class A : Olfactory receptors"""	14806	protein-coding gene	gene with protein product							Standard	NM_001004742		Approved		uc010rjk.2	Q8NGP4	OTTHUMG00000166875	ENST00000312240.2:c.147C>T	11.37:g.56237827G>A			B2RNM7|Q6IEW4|Q96RC0	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.V49	ENST00000312240.2	37	c.147	CCDS31532.1	11																																																																																			OR5M3	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000174937		0.438	OR5M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5M3	HGNC	protein_coding	OTTHUMT00000391639.1	155	0.64	1	G	NM_001004742		56237827	56237827	-1	no_errors	ENST00000312240	ensembl	human	known	69_37n	silent	76	26.21	27	SNP	0.001	A
PAPD5	64282	genome.wustl.edu	37	16	50258849	50258849	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr16:50258849G>A	ENST00000561678.1	+	8	1255	c.1181G>A	c.(1180-1182)aGa>aAa	p.R394K	PAPD5_ENST00000436909.3_Missense_Mutation_p.R504K|PAPD5_ENST00000357464.3_Missense_Mutation_p.R425K|PAPD5_ENST00000573002.1_3'UTR			Q8NDF8	PAPD5_HUMAN	PAP associated domain containing 5	425					histone mRNA catabolic process (GO:0071044)|mitotic nuclear division (GO:0007067)|mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)			endometrium(1)|kidney(1)|lung(2)	4		all_cancers(37;0.0452)		BRCA - Breast invasive adenocarcinoma(181;0.0843)|GBM - Glioblastoma multiforme(240;0.231)		GCCACATATAGAGATTGGATA	0.378																																						dbGAP											0													180.0	171.0	174.0					16																	50258849		1860	4104	5964	-	-	-	SO:0001583	missense	0			AF089897	CCDS54006.1	16q12.1	2010-11-18				ENSG00000121274			30758	protein-coding gene	gene with protein product	"""TUTase3"""	605540				10066793	Standard	NM_001040284		Approved	TRF4-2	uc010vgo.2	Q8NDF8		ENST00000561678.1:c.1181G>A	16.37:g.50258849G>A	ENSP00000455837:p.Arg394Lys		B4DV38|Q9NW67|Q9Y6C0	Missense_Mutation	SNP	pfam_PAP_assoc,pfam_Nucleotidyltransferase	p.R504K	ENST00000561678.1	37	c.1511		16	.	.	.	.	.	.	.	.	.	.	G	21.0	4.082194	0.76528	.	.	ENSG00000121274	ENST00000436909;ENST00000357464	T;T	0.64085	-0.08;-0.02	6.07	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.78071	0.4226	M	0.68317	2.08	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.80246	-0.1462	10	0.59425	D	0.04	.	16.898	0.86106	0.0:0.0:0.8709:0.1291	.	504;425	B4DV38;Q8NDF8	.;PAPD5_HUMAN	K	504;425	ENSP00000396995:R504K;ENSP00000350054:R425K	ENSP00000350054:R425K	R	+	2	0	PAPD5	48816350	1.000000	0.71417	0.675000	0.29917	0.564000	0.35744	9.444000	0.97578	1.570000	0.49709	0.585000	0.79938	AGA	PAPD5	-	NULL	ENSG00000121274		0.378	PAPD5-002	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	PAPD5	HGNC	protein_coding	OTTHUMT00000423150.1	434	0.00	0	G	NM_022447		50258849	50258849	+1	no_errors	ENST00000436909	ensembl	human	known	69_37n	missense	203	23.88	64	SNP	1.000	A
PEG3	5178	genome.wustl.edu	37	19	57326917	57326917	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr19:57326917G>A	ENST00000326441.9	-	10	3256	c.2893C>T	c.(2893-2895)Cga>Tga	p.R965*	PEG3_ENST00000598410.1_Nonsense_Mutation_p.R841*|ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000423103.2_Nonsense_Mutation_p.R965*|ZIM2_ENST00000601070.1_Intron|PEG3_ENST00000593695.1_Nonsense_Mutation_p.R839*	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	965					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		AGCATCCCTCGAGGGCGAAAT	0.473																																						dbGAP											0													122.0	116.0	118.0					19																	57326917		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.2893C>T	19.37:g.57326917G>A	ENSP00000326581:p.Arg965*		A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.R965*	ENST00000326441.9	37	c.2893	CCDS12948.1	19	.	.	.	.	.	.	.	.	.	.	G	38	7.031542	0.98013	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	.	.	.	3.99	1.9	0.25705	.	0.269759	0.26731	N	0.022787	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	-17.5433	3.5155	0.07723	0.0:0.2159:0.2184:0.5657	.	.	.	.	X	965	.	ENSP00000326581:R965X	R	-	1	2	ZIM2	62018729	0.000000	0.05858	0.343000	0.25615	0.089000	0.18198	-0.525000	0.06214	0.379000	0.24794	-0.262000	0.10625	CGA	PEG3	-	NULL	ENSG00000198300		0.473	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG3	HGNC	protein_coding	OTTHUMT00000416099.2	158	0.00	0	G			57326917	57326917	-1	no_errors	ENST00000326441	ensembl	human	known	69_37n	nonsense	101	26.62	37	SNP	0.983	A
PHF14	9678	genome.wustl.edu	37	7	11030350	11030350	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr7:11030350G>C	ENST00000403050.3	+	4	1373	c.921G>C	c.(919-921)aaG>aaC	p.K307N	PHF14_ENST00000445996.2_Missense_Mutation_p.K22N	NM_014660.3	NP_055475.2	O94880	PHF14_HUMAN	PHD finger protein 14	307					lung alveolus development (GO:0048286)|negative regulation of mesenchymal cell proliferation involved in lung development (GO:2000791)|negative regulation of platelet-derived growth factor receptor-alpha signaling pathway (GO:2000584)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	35				UCEC - Uterine corpus endometrioid carcinoma (126;0.205)		TTCTTGAGAAGAGTCAAAACT	0.303																																						dbGAP											0													84.0	73.0	77.0					7																	11030350		1813	4076	5889	-	-	-	SO:0001583	missense	0			AB018326	CCDS47542.1	7p21.3	2013-01-28			ENSG00000106443	ENSG00000106443		"""Zinc fingers, PHD-type"""	22203	protein-coding gene	gene with protein product						9872452	Standard	NM_014660		Approved	KIAA0783	uc003sry.2	O94880	OTTHUMG00000150463	ENST00000403050.3:c.921G>C	7.37:g.11030350G>C	ENSP00000385795:p.Lys307Asn		A7MCZ3|B4DI82	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.K307N	ENST00000403050.3	37	c.921	CCDS47542.1	7	.	.	.	.	.	.	.	.	.	.	G	15.18	2.756195	0.49362	.	.	ENSG00000106443	ENST00000403050;ENST00000445996	T;T	0.71222	1.51;-0.55	5.24	5.24	0.73138	Zinc finger, FYVE/PHD-type (1);	0.066718	0.64402	D	0.000016	T	0.51261	0.1664	N	0.19112	0.55	0.50171	D	0.999859	P;B;P;P	0.37466	0.557;0.148;0.596;0.596	B;B;B;B	0.32533	0.147;0.051;0.143;0.143	T	0.53725	-0.8398	10	0.37606	T	0.19	.	9.8582	0.41098	0.1529:0.0:0.8471:0.0	.	22;22;307;307	O94880-2;B4DG57;A8MSQ1;O94880	.;.;.;PHF14_HUMAN	N	307;22	ENSP00000385795:K307N;ENSP00000403907:K22N	ENSP00000385795:K307N	K	+	3	2	PHF14	10996875	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.863000	0.56016	2.605000	0.88082	0.585000	0.79938	AAG	PHF14	-	superfamily_Znf_FYVE_PHD	ENSG00000106443		0.303	PHF14-001	KNOWN	basic|CCDS	protein_coding	PHF14	HGNC	protein_coding	OTTHUMT00000318212.1	364	0.00	0	G	NM_014660		11030350	11030350	+1	no_errors	ENST00000403050	ensembl	human	known	69_37n	missense	171	34.73	91	SNP	1.000	C
PHTF2	57157	genome.wustl.edu	37	7	77531171	77531171	+	Missense_Mutation	SNP	C	C	T	rs534841738		TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr7:77531171C>T	ENST00000248550.7	+	6	455	c.379C>T	c.(379-381)Cgg>Tgg	p.R127W	PHTF2_ENST00000416283.2_Missense_Mutation_p.R93W|PHTF2_ENST00000450574.1_Missense_Mutation_p.R93W|PHTF2_ENST00000422959.2_Missense_Mutation_p.R93W|PHTF2_ENST00000424760.1_Missense_Mutation_p.R89W|PHTF2_ENST00000307305.8_Missense_Mutation_p.R89W|PHTF2_ENST00000275575.7_Missense_Mutation_p.R89W|PHTF2_ENST00000415251.2_Missense_Mutation_p.R89W			Q8N3S3	PHTF2_HUMAN	putative homeodomain transcription factor 2	127					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	19						CTTTTTCTTCCGGTGGTGGTT	0.383													C|||	1	0.000199681	0.0	0.0014	5008	,	,		13741	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													105.0	96.0	99.0					7																	77531171		1818	4082	5900	-	-	-	SO:0001583	missense	0			AL136883	CCDS47621.1, CCDS47622.1, CCDS47623.1, CCDS47624.1	7q11.23-q21	2008-02-01			ENSG00000006576	ENSG00000006576			13411	protein-coding gene	gene with protein product						10729229	Standard	NM_020432		Approved	DKFZp434D166	uc003ugq.4	Q8N3S3	OTTHUMG00000155557	ENST00000248550.7:c.379C>T	7.37:g.77531171C>T	ENSP00000248550:p.Arg127Trp		A0JP04|A0JP05|A4D1C2|E9PEE3|G5E9H7|Q6NW35|Q8TBW4|Q9H099	Missense_Mutation	SNP	pfam_TF_homeodomain_male	p.R127W	ENST00000248550.7	37	c.379		7	.	.	.	.	.	.	.	.	.	.	C	20.4	3.982633	0.74474	.	.	ENSG00000006576	ENST00000427986;ENST00000422959;ENST00000307305;ENST00000424760;ENST00000415251;ENST00000275575;ENST00000450574;ENST00000416283;ENST00000248550	.	.	.	5.43	4.43	0.53597	Transcription factor homeodomain, male germ-cell (1);	0.059063	0.64402	D	0.000005	T	0.68686	0.3028	L	0.53249	1.67	0.47621	D	0.999472	D;D;D;D;D;D;D	0.89917	0.999;0.997;1.0;1.0;0.999;1.0;1.0	D;D;D;D;P;D;D	0.73708	0.932;0.913;0.971;0.976;0.9;0.981;0.981	T	0.70103	-0.4964	9	0.72032	D	0.01	-11.9903	11.2373	0.48949	0.3896:0.6104:0.0:0.0	.	89;93;127;93;89;89;89	Q8N3S3-4;Q8N3S3-2;Q8N3S3;G5E9H7;Q8N3S3-3;B3KQZ2;E9PEE3	.;.;PHTF2_HUMAN;.;.;.;.	W	93;93;89;89;89;89;93;93;127	.	ENSP00000248550:R127W	R	+	1	2	PHTF2	77369107	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.401000	0.44513	2.692000	0.91855	0.591000	0.81541	CGG	PHTF2	-	pfam_TF_homeodomain_male	ENSG00000006576		0.383	PHTF2-006	KNOWN	basic	protein_coding	PHTF2	HGNC	protein_coding	OTTHUMT00000340638.2	574	0.00	0	C	NM_020432		77531171	77531171	+1	no_errors	ENST00000248550	ensembl	human	known	69_37n	missense	250	19.55	61	SNP	1.000	T
PLA2G4F	255189	genome.wustl.edu	37	15	42446363	42446363	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr15:42446363G>C	ENST00000382396.4	-	4	463	c.377C>G	c.(376-378)tCt>tGt	p.S126C	PLA2G4F_ENST00000397272.3_Missense_Mutation_p.S126C			Q68DD2	PA24F_HUMAN	phospholipase A2, group IVF	126	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				arachidonic acid secretion (GO:0050482)|cellular response to antibiotic (GO:0071236)|cellular response to organic cyclic compound (GO:0071407)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	calcium-dependent phospholipase A2 activity (GO:0047498)|lysophospholipase activity (GO:0004622)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(109;4.82e-12)|all_epithelial(112;5.64e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.97e-07)		CAGGAGCAGAGAGAGCTGGTC	0.597																																						dbGAP											0													91.0	83.0	86.0					15																	42446363		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS32204.1	15q15.1	2008-09-19				ENSG00000168907	3.1.1.4		27396	protein-coding gene	gene with protein product						14702039, 15866882	Standard	NM_213600		Approved	PLA2G4F/Z	uc001zoz.3	Q68DD2		ENST00000382396.4:c.377C>G	15.37:g.42446363G>C	ENSP00000371833:p.Ser126Cys		Q6ZMC8	Missense_Mutation	SNP	pfam_LysoPLipase_cat_dom,pfam_C2_Ca-dep,superfamily_Acyl_Trfase/lysoPLipase,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_LysoPLipase_cat_dom,pfscan_C2_membr_targeting,pfscan_LysoPLipase_cat_dom	p.S126C	ENST00000382396.4	37	c.377	CCDS32204.1	15	.	.	.	.	.	.	.	.	.	.	G	5.751	0.322945	0.10900	.	.	ENSG00000168907	ENST00000290497;ENST00000397272;ENST00000382396;ENST00000357924;ENST00000443825	T;T	0.63255	-0.03;-0.03	5.4	2.45	0.29901	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.403315	0.23110	N	0.051802	T	0.40067	0.1102	N	0.14661	0.345	0.09310	N	1	B	0.14012	0.009	B	0.17433	0.018	T	0.21381	-1.0247	10	0.36615	T	0.2	-21.9758	6.5855	0.22618	0.1699:0.1495:0.6806:0.0	.	126	Q68DD2	PA24F_HUMAN	C	122;126;126;126;126	ENSP00000380442:S126C;ENSP00000371833:S126C	ENSP00000290497:S122C	S	-	2	0	PLA2G4F	40233655	0.439000	0.25610	0.011000	0.14972	0.122000	0.20287	1.672000	0.37523	0.338000	0.23692	0.650000	0.86243	TCT	PLA2G4F	-	superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	ENSG00000168907		0.597	PLA2G4F-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLA2G4F	HGNC	protein_coding	OTTHUMT00000420463.1	88	0.00	0	G	NM_213600		42446363	42446363	-1	no_errors	ENST00000397272	ensembl	human	known	69_37n	missense	108	22.86	32	SNP	0.038	C
PLCD1	5333	genome.wustl.edu	37	3	38051649	38051649	+	Silent	SNP	G	G	A			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr3:38051649G>A	ENST00000334661.4	-	7	1332	c.1110C>T	c.(1108-1110)ctC>ctT	p.L370L	PLCD1_ENST00000479619.1_5'Flank|PLCD1_ENST00000463876.1_Silent_p.L391L	NM_006225.3	NP_006216.2	P51178	PLCD1_HUMAN	phospholipase C, delta 1	370	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				angiogenesis (GO:0001525)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|labyrinthine layer blood vessel development (GO:0060716)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTPase activating protein binding (GO:0032794)|phosphatidic acid binding (GO:0070300)|phosphatidylinositol phosphate binding (GO:1901981)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylserine binding (GO:0001786)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(6)|prostate(1)|skin(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		GGATGGCCCTGAGCACATCGC	0.597																																						dbGAP											0													119.0	115.0	116.0					3																	38051649		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2671.1, CCDS46793.1	3p22-p21.3	2013-01-10			ENSG00000187091	ENSG00000187091	3.1.4.11	"""EF-hand domain containing"""	9060	protein-coding gene	gene with protein product		602142				9345909	Standard	NM_001130964		Approved		uc003chm.3	P51178	OTTHUMG00000130813	ENST00000334661.4:c.1110C>T	3.37:g.38051649G>A			B3KR14|Q86VN8	Silent	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,smart_EF_hand_Ca-bd,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,pfscan_EF_HAND_2,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.L391	ENST00000334661.4	37	c.1173	CCDS2671.1	3																																																																																			PLCD1	-	pfam_PLipase_C_PInositol-sp_X_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_PInositol-sp_X_dom	ENSG00000187091		0.597	PLCD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLCD1	HGNC	protein_coding	OTTHUMT00000253359.2	48	0.00	0	G			38051649	38051649	-1	no_errors	ENST00000463876	ensembl	human	known	69_37n	silent	91	19.47	22	SNP	1.000	A
PMPCA	23203	genome.wustl.edu	37	9	139309033	139309033	+	Missense_Mutation	SNP	G	G	A	rs543713243	byFrequency	TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr9:139309033G>A	ENST00000371717.3	+	5	475	c.466G>A	c.(466-468)Gat>Aat	p.D156N	PMPCA_ENST00000371720.1_Intron|PMPCA_ENST00000399219.3_Intron	NM_001282946.1|NM_015160.1	NP_001269875.1|NP_055975.1	Q10713	MPPA_HUMAN	peptidase (mitochondrial processing) alpha	156					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)|proteolysis (GO:0006508)	extracellular space (GO:0005615)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			endometrium(3)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|urinary_tract(1)	14		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;9.3e-06)|Epithelial(140;1.15e-05)		TGTGTCTGCTGATAGCAAAGG	0.572													G|||	3	0.000599042	0.0	0.0	5008	,	,		20233	0.003		0.0	False		,,,				2504	0.0					dbGAP											0													169.0	152.0	158.0					9																	139309033		2203	4300	6503	-	-	-	SO:0001583	missense	0			D21064	CCDS35180.1, CCDS65192.1	9q34.3	2008-02-05	2003-06-13	2003-06-20	ENSG00000165688	ENSG00000165688			18667	protein-coding gene	gene with protein product		613036	"""inositol polyphosphate-5-phosphatase, 72 kD"""	INPP5E		8590280, 7788527	Standard	NM_015160		Approved	KIAA0123, Alpha-MPP	uc004chl.3	Q10713	OTTHUMG00000020926	ENST00000371717.3:c.466G>A	9.37:g.139309033G>A	ENSP00000360782:p.Asp156Asn		B4DKL3|E7ET61|Q16639|Q5SXM9|Q8N513	Missense_Mutation	SNP	pfam_Pept_M16_N,pfam_Peptidase_M16_C,superfamily_Metalloenz_metal-bd	p.D156N	ENST00000371717.3	37	c.466	CCDS35180.1	9	.	.	.	.	.	.	.	.	.	.	G	20.8	4.052606	0.75960	.	.	ENSG00000165688	ENST00000371717	T	0.41400	1.0	5.53	5.53	0.82687	Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);Peptidase M16, N-terminal (1);	0.097405	0.64402	D	0.000001	T	0.49813	0.1579	M	0.75447	2.3	0.80722	D	1	B;B;B	0.24092	0.014;0.097;0.097	B;B;B	0.32211	0.02;0.142;0.142	T	0.44375	-0.9332	10	0.27785	T	0.31	.	18.4525	0.90709	0.0:0.0:1.0:0.0	.	156;156;156	B4DRK5;Q5SXM9;Q10713	.;.;MPPA_HUMAN	N	156	ENSP00000360782:D156N	ENSP00000360782:D156N	D	+	1	0	PMPCA	138428854	1.000000	0.71417	0.952000	0.39060	0.992000	0.81027	9.425000	0.97467	2.578000	0.87016	0.650000	0.86243	GAT	PMPCA	-	pfam_Pept_M16_N,superfamily_Metalloenz_metal-bd	ENSG00000165688		0.572	PMPCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMPCA	HGNC	protein_coding	OTTHUMT00000055054.1	103	0.00	0	G	NM_015160		139309033	139309033	+1	no_errors	ENST00000371717	ensembl	human	known	69_37n	missense	118	27.16	44	SNP	1.000	A
PRAME	23532	genome.wustl.edu	37	22	22892625	22892625	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr22:22892625C>T	ENST00000398741.1	-	5	782	c.476G>A	c.(475-477)cGa>cAa	p.R159Q	PRAME_ENST00000539862.1_Missense_Mutation_p.R143Q|PRAME_ENST00000402697.1_Missense_Mutation_p.R159Q|PRAME_ENST00000543184.1_Missense_Mutation_p.R159Q|PRAME_ENST00000405655.3_Missense_Mutation_p.R159Q|PRAME_ENST00000398743.2_Missense_Mutation_p.R159Q|PRAME_ENST00000485532.1_5'Flank|PRAME_ENST00000424204.2_Missense_Mutation_p.R143Q	NM_206955.1	NP_996838.1	P78395	PRAME_HUMAN	preferentially expressed antigen in melanoma	159					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	retinoic acid receptor binding (GO:0042974)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)|all_lung(157;4.03e-05)		READ - Rectum adenocarcinoma(21;0.0649)		ATCTACTTTTCGCTTCTTTGT	0.498																																					Melanoma(73;1707 1838 15168 27201)	dbGAP											0													99.0	87.0	91.0					22																	22892625		2203	4300	6503	-	-	-	SO:0001583	missense	0			U65011	CCDS13801.1	22q11.22	2013-01-17			ENSG00000185686	ENSG00000185686		"""-"""	9336	protein-coding gene	gene with protein product	"""cancer/testis antigen 130"""	606021		MAPE		9047241, 10591208	Standard	XM_006725402		Approved	CT130	uc002zwj.3	P78395	OTTHUMG00000151172	ENST00000398741.1:c.476G>A	22.37:g.22892625C>T	ENSP00000381726:p.Arg159Gln		B2R6Y7|O43481|Q8IXN8	Missense_Mutation	SNP	NULL	p.R159Q	ENST00000398741.1	37	c.476	CCDS13801.1	22	.	.	.	.	.	.	.	.	.	.	.	3.806	-0.040792	0.07452	.	.	ENSG00000185686	ENST00000398743;ENST00000543184;ENST00000398741;ENST00000405655;ENST00000539862;ENST00000402697;ENST00000424204;ENST00000439106	T;T;T;T;T;T;T;T	0.50548	0.74;0.74;0.74;0.74;0.74;0.74;0.74;2.49	3.16	-6.31	0.02001	.	3.974840	0.00567	N	0.000283	T	0.22898	0.0553	N	0.16567	0.415	0.09310	N	1	B	0.22541	0.071	B	0.12156	0.007	T	0.33752	-0.9856	10	0.02654	T	1	.	4.9763	0.14142	0.0:0.2919:0.28:0.4281	.	159	P78395	PRAME_HUMAN	Q	159;159;159;159;143;159;143;159	ENSP00000381728:R159Q;ENSP00000445675:R159Q;ENSP00000381726:R159Q;ENSP00000384343:R159Q;ENSP00000445097:R143Q;ENSP00000385198:R159Q;ENSP00000407342:R143Q;ENSP00000407320:R159Q	ENSP00000381726:R159Q	R	-	2	0	PRAME	21222625	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.437000	0.01018	-1.480000	0.01865	-0.302000	0.09304	CGA	PRAME	-	NULL	ENSG00000185686		0.498	PRAME-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRAME	HGNC	protein_coding	OTTHUMT00000321644.1	117	0.00	0	C	NM_206953		22892625	22892625	-1	no_errors	ENST00000398741	ensembl	human	known	69_37n	missense	217	35.61	120	SNP	0.000	T
PROS1	5627	genome.wustl.edu	37	3	93629501	93629501	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr3:93629501G>A	ENST00000394236.3	-	4	624	c.308C>T	c.(307-309)tCa>tTa	p.S103L	PROS1_ENST00000407433.1_5'UTR	NM_000313.3	NP_000304.2	P07225	PROS_HUMAN	protein S (alpha)	103	Thrombin-sensitive.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|negative regulation of endopeptidase activity (GO:0010951)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|endopeptidase inhibitor activity (GO:0004866)			endometrium(3)|kidney(5)|large_intestine(8)|lung(26)|ovary(1)|skin(2)|urinary_tract(1)	46					Drotrecogin alfa(DB00055)|Menadione(DB00170)|Sodium Tetradecyl Sulfate(DB00464)	AGCATTAGTTGACTGACGTGC	0.363																																						dbGAP											0			GRCh37	CM961170	PROS1	M							92.0	80.0	84.0					3																	93629501		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2923.1	3q11.1	2013-06-03			ENSG00000184500	ENSG00000184500			9456	protein-coding gene	gene with protein product		176880		PROS		214811, 1833851	Standard	NM_000313		Approved		uc003drb.4	P07225	OTTHUMG00000150354	ENST00000394236.3:c.308C>T	3.37:g.93629501G>A	ENSP00000377783:p.Ser103Leu		A8KAC9|D3DN28|Q15518|Q7Z715|Q9UCZ8	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF-like_Ca-bd,pfam_GLA_domain,pfam_EGF-like_dom,superfamily_ConA-like_lec_gl,superfamily_GLA_domain,smart_GLA_domain,smart_EGF-like_Ca-bd,smart_EGF-like,smart_Laminin_G,pfscan_EG-like_dom,pfscan_GLA_domain,pfscan_Laminin_G,prints_GLA_domain	p.S103L	ENST00000394236.3	37	c.308	CCDS2923.1	3	.	.	.	.	.	.	.	.	.	.	G	11.76	1.733640	0.30684	.	.	ENSG00000184500	ENST00000394236;ENST00000348974	D;D	0.92348	-2.67;-3.02	4.3	3.38	0.38709	Gamma-carboxyglutamic acid-rich (GLA) domain (1);	0.947671	0.08890	N	0.878708	D	0.94860	0.8339	M	0.63428	1.95	0.24957	N	0.99176	D	0.71674	0.998	D	0.76071	0.987	D	0.85677	0.1298	10	0.44086	T	0.13	.	10.8834	0.46953	0.0:0.0:0.8115:0.1885	.	103	P07225	PROS_HUMAN	L	103;135	ENSP00000377783:S103L;ENSP00000330021:S135L	ENSP00000330021:S135L	S	-	2	0	PROS1	95112191	0.986000	0.35501	0.002000	0.10522	0.076000	0.17211	3.820000	0.55693	1.085000	0.41206	0.491000	0.48974	TCA	PROS1	-	superfamily_GLA_domain	ENSG00000184500		0.363	PROS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROS1	HGNC	protein_coding	OTTHUMT00000317762.1	228	0.00	0	G	NM_000313		93629501	93629501	-1	no_errors	ENST00000394236	ensembl	human	known	69_37n	missense	144	17.51	31	SNP	0.010	A
PSG6	5675	genome.wustl.edu	37	19	43414651	43414651	+	Intron	SNP	G	G	C	rs528407578		TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr19:43414651G>C	ENST00000292125.2	-	3	751				PSG6_ENST00000402603.4_Intron|PSG6_ENST00000187910.2_Intron	NM_002782.4	NP_002773.1	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6						female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(19)|ovary(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44		Prostate(69;0.00899)				ACTTGGACCTGAGAGGGACTG	0.517																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS12613.1, CCDS33038.1	19q13.2	2013-01-29			ENSG00000170848	ENSG00000170848		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9523	protein-coding gene	gene with protein product		176395				1690992	Standard	NM_002782		Approved			Q00889	OTTHUMG00000151127	ENST00000292125.2:c.706+80C>G	19.37:g.43414651G>C			O75244|Q15224|Q15235|Q549K1	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	p.Q263E	ENST00000292125.2	37	c.787	CCDS12613.1	19	.	.	.	.	.	.	.	.	.	.	N	2.507	-0.313856	0.05422	.	.	ENSG00000170848	ENST00000402456	.	.	.	1.64	-1.03	0.10102	.	.	.	.	.	T	0.26557	0.0649	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.30238	-0.9985	5	0.48119	T	0.1	.	2.5437	0.04732	0.2308:0.3227:0.4465:0.0	.	.	.	.	E	263	.	ENSP00000385856:Q263E	Q	-	1	0	PSG6	48106491	0.000000	0.05858	0.003000	0.11579	0.006000	0.05464	-0.220000	0.09215	-0.001000	0.14495	0.194000	0.17425	CAG	PSG6	-	NULL	ENSG00000170848		0.517	PSG6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSG6	HGNC	protein_coding	OTTHUMT00000321436.1	28	0.00	0	G	NM_002782		43414651	43414651	-1	no_errors	ENST00000402456	ensembl	human	putative	69_37n	missense	21	48.78	20	SNP	0.001	C
REC8	9985	genome.wustl.edu	37	14	24644763	24644763	+	Silent	SNP	C	C	T			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr14:24644763C>T	ENST00000311457.3	+	7	1073	c.474C>T	c.(472-474)ctC>ctT	p.L158L	REC8_ENST00000559919.1_Silent_p.L158L			O95072	REC8_HUMAN	REC8 meiotic recombination protein	158					double-strand break repair via homologous recombination (GO:0000724)|fertilization (GO:0009566)|linear element assembly (GO:0030999)|male meiosis I (GO:0007141)|meiotic nuclear division (GO:0007126)|oocyte maturation (GO:0001556)|reciprocal meiotic recombination (GO:0007131)|seminiferous tubule development (GO:0072520)|sister chromatid cohesion (GO:0007062)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)	condensed nuclear chromosome kinetochore (GO:0000778)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nuclear meiotic cohesin complex (GO:0034991)|nucleus (GO:0005634)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	15				GBM - Glioblastoma multiforme(265;0.00839)		TTCGACACCTCTTAGAGGCTG	0.507																																					NSCLC(139;1764 2537 12868 49041)	dbGAP											0													65.0	65.0	65.0					14																	24644763		1855	4102	5957	-	-	-	SO:0001819	synonymous_variant	0			AF006264	CCDS41932.1	14q11.2-q12	2013-08-06	2013-08-06	2007-04-03		ENSG00000100918			16879	protein-coding gene	gene with protein product		608193	"""REC8-like 1 (yeast)"", ""REC8 homolog (yeast)"""	REC8L1		10207075, 15935783, 12759374	Standard	NM_005132		Approved	Rec8p, kleisin-alpha	uc001wms.3	O95072		ENST00000311457.3:c.474C>T	14.37:g.24644763C>T			A8K576|D3DS62|Q658V5|Q6IA92|Q8WUV8|Q9BTF2|Q9NVQ9	Silent	SNP	pfam_Rad21_Rec8_N,pfam_Rad21/Rec8_C_eu	p.L158	ENST00000311457.3	37	c.474	CCDS41932.1	14																																																																																			REC8	-	NULL	ENSG00000100918		0.507	REC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REC8	HGNC	protein_coding	OTTHUMT00000415889.3	92	0.00	0	C	NM_005132		24644763	24644763	+1	no_errors	ENST00000311457	ensembl	human	known	69_37n	silent	71	26.04	25	SNP	0.981	T
RIMBP2	23504	genome.wustl.edu	37	12	130926616	130926616	+	Silent	SNP	G	G	T			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr12:130926616G>T	ENST00000261655.4	-	8	1393	c.1230C>A	c.(1228-1230)tcC>tcA	p.S410S	RIMBP2_ENST00000536002.1_Silent_p.S318S|RIMBP2_ENST00000535703.1_Silent_p.S318S	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	410	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		TGGGTAGCCAGGAGAGCTGGG	0.602																																						dbGAP											0													105.0	75.0	85.0					12																	130926616		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.1230C>A	12.37:g.130926616G>T			Q96ID2	Silent	SNP	pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_Fibronectin_type3,smart_SH3_domain,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_SH3_domain,prints_SH3_domain	p.S410	ENST00000261655.4	37	c.1230	CCDS31925.1	12																																																																																			RIMBP2	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000060709		0.602	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMBP2	HGNC	protein_coding	OTTHUMT00000399520.1	31	0.00	0	G	NM_015347		130926616	130926616	-1	no_errors	ENST00000261655	ensembl	human	known	69_37n	silent	71	15.48	13	SNP	1.000	T
RNF20	56254	genome.wustl.edu	37	9	104323426	104323426	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr9:104323426C>G	ENST00000389120.3	+	18	2653	c.2563C>G	c.(2563-2565)Cag>Gag	p.Q855E		NM_019592.5	NP_062538.5	Q5VTR2	BRE1A_HUMAN	ring finger protein 20, E3 ubiquitin protein ligase	855					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|negative regulation of cell migration (GO:0030336)|positive regulation of histone methylation (GO:0031062)|positive regulation of transcription, DNA-templated (GO:0045893)|protein polyubiquitination (GO:0000209)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|ligase activity (GO:0016874)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|kidney(6)|large_intestine(7)|lung(23)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)		GGAGTTGGCTCAGAAGAAGCT	0.428																																						dbGAP											0													100.0	94.0	96.0					9																	104323426		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF265230	CCDS35084.1	9q22	2012-02-23	2012-02-23	2008-12-12	ENSG00000155827	ENSG00000155827		"""RING-type (C3HC4) zinc fingers"""	10062	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog (S. cerevisiae)"""	607699	"""ring finger protein 20"""			16337599, 12876294, 18832071, 19037095	Standard	NM_019592		Approved	FLJ20382, FLJ11189, KAIA2779, BRE1A, hBRE1, BRE1	uc004bbn.3	Q5VTR2	OTTHUMG00000020385	ENST00000389120.3:c.2563C>G	9.37:g.104323426C>G	ENSP00000373772:p.Gln855Glu		A7MCT5|Q2TB34|Q69YL5|Q6P527|Q8N3J4|Q96JD3|Q9H9Y7|Q9HA51|Q9NUR4|Q9NWQ3|Q9NX83	Missense_Mutation	SNP	superfamily_STAT_TF_coiled-coil,superfamily_Prefoldin,smart_Znf_RING,pfscan_Znf_RING	p.Q855E	ENST00000389120.3	37	c.2563	CCDS35084.1	9	.	.	.	.	.	.	.	.	.	.	C	19.71	3.878503	0.72294	.	.	ENSG00000155827	ENST00000389120	T	0.31247	1.5	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.35595	0.0937	M	0.69823	2.125	0.80722	D	1	B	0.28128	0.201	B	0.21546	0.035	T	0.13764	-1.0497	10	0.19590	T	0.45	-26.4461	19.7565	0.96296	0.0:1.0:0.0:0.0	.	855	Q5VTR2	BRE1A_HUMAN	E	855	ENSP00000373772:Q855E	ENSP00000373772:Q855E	Q	+	1	0	RNF20	103363247	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.298000	0.78815	2.835000	0.97688	0.650000	0.86243	CAG	RNF20	-	NULL	ENSG00000155827		0.428	RNF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF20	HGNC	protein_coding	OTTHUMT00000356402.1	133	0.00	0	C	NM_019592		104323426	104323426	+1	no_errors	ENST00000389120	ensembl	human	known	69_37n	missense	68	29.17	28	SNP	1.000	G
RTN2	6253	genome.wustl.edu	37	19	45992785	45992785	+	Missense_Mutation	SNP	T	T	C			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr19:45992785T>C	ENST00000245923.4	-	6	1295	c.1060A>G	c.(1060-1062)Acg>Gcg	p.T354A	PPM1N_ENST00000401705.1_Intron|RTN2_ENST00000344680.4_Missense_Mutation_p.T281A|RTN2_ENST00000590526.1_Missense_Mutation_p.T80A|RTN2_ENST00000430715.2_Missense_Mutation_p.T14A	NM_005619.4	NP_005610.1	O75298	RTN2_HUMAN	reticulon 2	354	Reticulon. {ECO:0000255|PROSITE- ProRule:PRU00170}.				cell death (GO:0008219)|intracellular protein transmembrane transport (GO:0065002)|regulation of glucose import (GO:0046324)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)				cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(4)|skin(1)|urinary_tract(1)	20		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00829)|Epithelial(262;0.184)|GBM - Glioblastoma multiforme(486;0.246)		GACGTCCTCGTGTCCTTCCAG	0.617																																						dbGAP											0													83.0	46.0	58.0					19																	45992785		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF038540	CCDS12665.1, CCDS12666.1, CCDS46114.1	19q13.2-q13.3	2012-03-30				ENSG00000125744			10468	protein-coding gene	gene with protein product	"""NSP-like protein 1"", ""Neuroendocrine-specific protein-like 1"""	603183	"""spastic paraplegia 12 (autosomal dominant)"""	SPG12		8812484, 9530622, 22232211	Standard	NM_005619		Approved	NSP2, NSPL1	uc002pcb.4	O75298		ENST00000245923.4:c.1060A>G	19.37:g.45992785T>C	ENSP00000245923:p.Thr354Ala		O60509|Q7RTM6|Q7RTN1|Q7RTN2	Missense_Mutation	SNP	pfam_Reticulon,pfscan_Reticulon	p.T354A	ENST00000245923.4	37	c.1060	CCDS12665.1	19	.	.	.	.	.	.	.	.	.	.	T	16.64	3.180242	0.57800	.	.	ENSG00000125744	ENST00000344680;ENST00000245923;ENST00000430715	T;T;T	0.41400	1.0;1.0;1.0	4.4	0.966	0.19667	.	0.429572	0.25948	N	0.027276	T	0.27629	0.0679	L	0.39898	1.24	0.47737	D	0.999501	B;B	0.16802	0.001;0.019	B;B	0.18561	0.004;0.022	T	0.07028	-1.0794	10	0.51188	T	0.08	-1.3279	2.9073	0.05725	0.1841:0.2097:0.0:0.6063	.	281;354	O75298-2;O75298	.;RTN2_HUMAN	A	281;354;14	ENSP00000345127:T281A;ENSP00000245923:T354A;ENSP00000398178:T14A	ENSP00000245923:T354A	T	-	1	0	RTN2	50684625	0.051000	0.20477	0.945000	0.38365	0.998000	0.95712	0.173000	0.16724	-0.070000	0.12908	0.529000	0.55759	ACG	RTN2	-	pfam_Reticulon,pfscan_Reticulon	ENSG00000125744		0.617	RTN2-001	KNOWN	basic|CCDS	protein_coding	RTN2	HGNC	protein_coding	OTTHUMT00000459574.1	26	0.00	0	T	NM_005619		45992785	45992785	-1	no_errors	ENST00000245923	ensembl	human	known	69_37n	missense	10	33.33	5	SNP	0.597	C
SETDB1	9869	genome.wustl.edu	37	1	150923915	150923915	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr1:150923915C>T	ENST00000271640.5	+	14	2478	c.2288C>T	c.(2287-2289)tCt>tTt	p.S763F	SETDB1_ENST00000368969.4_Missense_Mutation_p.S763F|SETDB1_ENST00000459773.1_Intron	NM_001145415.1|NM_012432.3	NP_001138887.1|NP_036564.3	Q15047	SETB1_HUMAN	SET domain, bifurcated 1	763	Pre-SET. {ECO:0000255|PROSITE- ProRule:PRU00157}.				bone development (GO:0060348)|histone H3-K9 trimethylation (GO:0036124)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			AACCCTAACTCTGGCTACCAG	0.483																																						dbGAP											0													92.0	81.0	85.0					1																	150923915		2203	4300	6503	-	-	-	SO:0001583	missense	0			D31891	CCDS972.1, CCDS44217.1, CCDS58026.1	1q21	2013-01-23			ENSG00000143379	ENSG00000143379		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Tudor domain containing"""	10761	protein-coding gene	gene with protein product	"""tudor domain containing 21"""	604396				10343109	Standard	NM_001145415		Approved	KG1T, KIAA0067, ESET, KMT1E, TDRD21	uc001evu.2	Q15047	OTTHUMG00000035003	ENST00000271640.5:c.2288C>T	1.37:g.150923915C>T	ENSP00000271640:p.Ser763Phe		A6NEW2|Q5SZD8|Q5SZD9|Q5SZE0|Q5SZE7|Q96GM9	Missense_Mutation	SNP	pfam_SET_dom,pfam_Pre-SET_dom,pfam_Methyl_CpG_DNA-bd,superfamily_DNA-bd_integrase-typ,smart_Tudor,smart_Methyl_CpG_DNA-bd,smart_Pre-SET_Zn-bd_sub,smart_SET_dom,pfscan_Methyl_CpG_DNA-bd,pfscan_SET_dom,pfscan_Pre-SET_dom,pfscan_Post-SET_dom	p.S763F	ENST00000271640.5	37	c.2288	CCDS44217.1	1	.	.	.	.	.	.	.	.	.	.	C	32	5.138500	0.94560	.	.	ENSG00000143379	ENST00000271640;ENST00000368969;ENST00000498193	D;D;D	0.89050	-2.46;-2.46;-2.46	5.81	5.81	0.92471	Pre-SET zinc-binding sub-group (1);Pre-SET domain (2);	0.053607	0.64402	D	0.000001	D	0.87071	0.6086	N	0.14661	0.345	0.80722	D	1	D;D;D	0.71674	0.998;0.983;0.986	D;P;P	0.63283	0.913;0.804;0.876	D	0.88097	0.2817	10	0.45353	T	0.12	.	19.6888	0.95989	0.0:1.0:0.0:0.0	.	763;763;763	E9PRF4;Q15047-3;Q15047	.;.;SETB1_HUMAN	F	763	ENSP00000271640:S763F;ENSP00000357965:S763F;ENSP00000432348:S763F	ENSP00000271640:S763F	S	+	2	0	SETDB1	149190539	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.582000	0.82546	2.736000	0.93811	0.655000	0.94253	TCT	SETDB1	-	pfam_Pre-SET_dom,smart_Pre-SET_Zn-bd_sub,pfscan_Pre-SET_dom	ENSG00000143379		0.483	SETDB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SETDB1	HGNC	protein_coding	OTTHUMT00000084717.2	81	0.00	0	C			150923915	150923915	+1	no_errors	ENST00000271640	ensembl	human	known	69_37n	missense	289	10.25	33	SNP	1.000	T
SCAMP3	10067	genome.wustl.edu	37	1	155231906	155231906	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr1:155231906C>T	ENST00000302631.3	-	1	144	c.37G>A	c.(37-39)Gag>Aag	p.E13K	SCAMP3_ENST00000355379.3_Missense_Mutation_p.E13K|SCAMP3_ENST00000472397.1_5'Flank|CLK2_ENST00000497188.1_5'Flank	NM_005698.3	NP_005689.2	O14828	SCAM3_HUMAN	secretory carrier membrane protein 3	13					post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|response to retinoic acid (GO:0032526)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|large_intestine(3)|lung(7)|ovary(4)|urinary_tract(1)	19	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			TCGCTGGGCTCGGCGAACGGG	0.647																																						dbGAP											0													76.0	76.0	76.0					1																	155231906		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF005039	CCDS1105.1, CCDS1106.1	1q21	2013-02-21			ENSG00000116521	ENSG00000116521		"""Secretory carrier membrane proteins"""	10565	protein-coding gene	gene with protein product	"""Propin 1"""	606913		C1orf3		9331372, 9658162	Standard	NM_005698		Approved		uc001fjs.3	O14828	OTTHUMG00000035874	ENST00000302631.3:c.37G>A	1.37:g.155231906C>T	ENSP00000307275:p.Glu13Lys		A9Z1W6|B1AVS6|O15128|Q96FR8|Q9BPY0	Missense_Mutation	SNP	pfam_SCAMP	p.E13K	ENST00000302631.3	37	c.37	CCDS1105.1	1	.	.	.	.	.	.	.	.	.	.	.	22.0	4.229971	0.79688	.	.	ENSG00000116521	ENST00000302631;ENST00000355379	T;T	0.18810	2.29;2.19	5.23	4.3	0.51218	.	0.241113	0.32068	N	0.006626	T	0.07593	0.0191	L	0.49778	1.585	0.28909	N	0.892836	P;B;B	0.40476	0.718;0.001;0.396	B;B;B	0.28709	0.093;0.004;0.015	T	0.11966	-1.0566	10	0.66056	D	0.02	-4.4964	9.9753	0.41779	0.0:0.906:0.0:0.094	.	13;13;13	Q6FHJ5;O14828-2;O14828	.;.;SCAM3_HUMAN	K	13	ENSP00000307275:E13K;ENSP00000347540:E13K	ENSP00000307275:E13K	E	-	1	0	SCAMP3	153498530	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	2.316000	0.43761	2.719000	0.93026	0.650000	0.86243	GAG	SCAMP3	-	NULL	ENSG00000116521		0.647	SCAMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAMP3	HGNC	protein_coding	OTTHUMT00000087399.1	12	0.00	0	C	NM_005698		155231906	155231906	-1	no_errors	ENST00000302631	ensembl	human	known	69_37n	missense	57	18.57	13	SNP	0.999	T
SHCBP1	79801	genome.wustl.edu	37	16	46633858	46633858	+	Missense_Mutation	SNP	A	A	C			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr16:46633858A>C	ENST00000303383.3	-	9	1496	c.1230T>G	c.(1228-1230)gaT>gaG	p.D410E		NM_024745.4	NP_079021	Q8NEM2	SHCBP_HUMAN	SHC SH2-domain binding protein 1	410					fibroblast growth factor receptor signaling pathway (GO:0008543)|regulation of neural precursor cell proliferation (GO:2000177)					breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_cancers(37;0.00404)|all_epithelial(9;0.00527)|all_lung(18;0.0413)|Lung NSC(13;0.213)				TCACAATGTCATCTGGTAGGC	0.413																																						dbGAP											0													78.0	72.0	74.0					16																	46633858		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055931	CCDS10720.1	16q11	2008-02-05			ENSG00000171241	ENSG00000171241			29547	protein-coding gene	gene with protein product		611027				10086341	Standard	NM_024745		Approved	FLJ22009	uc002eec.4	Q8NEM2	OTTHUMG00000132540	ENST00000303383.3:c.1230T>G	16.37:g.46633858A>C	ENSP00000306473:p.Asp410Glu		Q96N60|Q9BVS0|Q9H6P6	Missense_Mutation	SNP	superfamily_Pectin_lyase_fold/virulence,smart_PbH1	p.D410E	ENST00000303383.3	37	c.1230	CCDS10720.1	16	.	.	.	.	.	.	.	.	.	.	A	11.10	1.540590	0.27563	.	.	ENSG00000171241	ENST00000303383	T	0.42900	0.96	3.92	2.82	0.32997	Pectin lyase fold/virulence factor (1);Pectin lyase fold (1);	0.000000	0.85682	D	0.000000	T	0.43233	0.1238	N	0.24115	0.695	0.58432	D	0.999994	D	0.76494	0.999	D	0.85130	0.997	T	0.16129	-1.0413	10	0.15952	T	0.53	-20.7722	9.1411	0.36903	0.9119:0.0:0.0881:0.0	.	410	Q8NEM2	SHCBP_HUMAN	E	410	ENSP00000306473:D410E	ENSP00000306473:D410E	D	-	3	2	SHCBP1	45191359	1.000000	0.71417	0.999000	0.59377	0.404000	0.30871	2.759000	0.47573	0.571000	0.29365	0.455000	0.32223	GAT	SHCBP1	-	superfamily_Pectin_lyase_fold/virulence	ENSG00000171241		0.413	SHCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHCBP1	HGNC	protein_coding	OTTHUMT00000255740.1	150	0.00	0	A	NM_024745		46633858	46633858	-1	no_errors	ENST00000303383	ensembl	human	known	69_37n	missense	109	15.50	20	SNP	1.000	C
SLC2A11	66035	genome.wustl.edu	37	22	24210689	24210689	+	Nonsense_Mutation	SNP	G	G	T			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr22:24210689G>T	ENST00000345044.6	+	3	410	c.142G>T	c.(142-144)Gag>Tag	p.E48*	SLC2A11_ENST00000467660.1_3'UTR|AP000350.10_ENST00000433835.3_Nonsense_Mutation_p.E13*|SLC2A11_ENST00000403208.3_Nonsense_Mutation_p.E48*|SLC2A11_ENST00000405847.1_Nonsense_Mutation_p.E48*|SLC2A11_ENST00000398356.2_Nonsense_Mutation_p.E55*|SLC2A11_ENST00000316185.8_Nonsense_Mutation_p.E51*			Q9BYW1	GTR11_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 11	48					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|skin(2)	12						ATTCACCAATGAGACATGGCA	0.562																																						dbGAP											0													175.0	140.0	152.0					22																	24210689		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AJ271290	CCDS13818.1, CCDS33616.1, CCDS46673.1, CCDS74828.1	22q11.23	2013-05-22			ENSG00000133460	ENSG00000133460		"""Solute carriers"""	14239	protein-coding gene	gene with protein product		610367					Standard	NM_001024938		Approved	GLUT11, GLUT10	uc002zyp.4	Q9BYW1	OTTHUMG00000166469	ENST00000345044.6:c.142G>T	22.37:g.24210689G>T	ENSP00000342542:p.Glu48*		E9PH55|Q542Y4|Q6ICJ5|Q8WXF9|Q8WYM4	Nonsense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,prints_Sugar/inositol_transpt,tigrfam_Sugar/inositol_transpt	p.E55*	ENST00000345044.6	37	c.163	CCDS46673.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.34|18.34	3.602321|3.602321	0.66445|0.66445	.|.	.|.	ENSG00000133460;ENSG00000133460;ENSG00000133460;ENSG00000133460;ENSG00000133460;ENSG00000133460;ENSG00000133460;ENSG00000133460;ENSG00000251357|ENSG00000251357	ENST00000345044;ENST00000403208;ENST00000398356;ENST00000398363;ENST00000398359;ENST00000405847;ENST00000407566;ENST00000316185;ENST00000433835|ENST00000421180	.|.	.|.	.|.	3.24|3.24	2.19|2.19	0.27852|0.27852	.|.	0.328576|.	0.31061|.	N|.	0.008335|.	.|T	.|0.51500	.|0.1678	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.60682	.|-0.7215	.|3	0.40728|.	T|.	0.16|.	.|.	10.5643|10.5643	0.45163|0.45163	0.0:0.199:0.8009:0.0|0.0:0.199:0.8009:0.0	.|.	.|.	.|.	.|.	X|I	48;48;55;48;55;48;55;51;13|23	.|.	ENSP00000400325:E13X|.	E|M	+|+	1|3	0|0	AP000350.10;SLC2A11|AP000350.10	22540689|22540689	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.335000|0.335000	0.28730|0.28730	2.013000|2.013000	0.40942|0.40942	0.937000|0.937000	0.37394|0.37394	0.400000|0.400000	0.26472|0.26472	GAG|ATG	SLC2A11	-	pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	ENSG00000133460		0.562	SLC2A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A11	HGNC	protein_coding	OTTHUMT00000319889.3	83	0.00	0	G	NM_030807		24210689	24210689	+1	no_errors	ENST00000398356	ensembl	human	known	69_37n	nonsense	241	14.49	41	SNP	1.000	T
SRRM1	10250	genome.wustl.edu	37	1	24978962	24978962	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr1:24978962G>A	ENST00000323848.9	+	7	1078	c.763G>A	c.(763-765)Gag>Aag	p.E255K	SRRM1_ENST00000479034.1_3'UTR|SRRM1_ENST00000374389.4_Missense_Mutation_p.E255K|SRRM1_ENST00000537199.1_Missense_Mutation_p.E124K|SRRM1_ENST00000447431.2_Missense_Mutation_p.E255K	NM_005839.3	NP_005830.2	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1	255	Arg-rich.|Pro-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	36		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		ACCTATACCAGAGCCTAAAGA	0.408																																					Ovarian(68;897 1494 3282 17478)	dbGAP											0													28.0	31.0	30.0					1																	24978962		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF048977	CCDS255.1	1p36	2010-04-22			ENSG00000133226	ENSG00000133226			16638	protein-coding gene	gene with protein product	"""Ser/Arg-related nuclear matrix protein"", ""plenty of prolines 101-like"""	605975				9531537	Standard	NM_005839		Approved	SRM160, POP101, MGC39488	uc001bjm.3	Q8IYB3	OTTHUMG00000003320	ENST00000323848.9:c.763G>A	1.37:g.24978962G>A	ENSP00000326261:p.Glu255Lys		O60585|Q5VVN4	Missense_Mutation	SNP	pfam_PWI,superfamily_PWI,smart_PWI	p.E255K	ENST00000323848.9	37	c.763	CCDS255.1	1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.168833	0.78339	.	.	ENSG00000133226	ENST00000323848;ENST00000447431;ENST00000374389;ENST00000537199	T;T;T;T	0.50548	0.92;0.92;0.91;0.74	6.05	6.05	0.98169	.	0.000000	0.64402	D	0.000006	T	0.35422	0.0931	L	0.27053	0.805	0.80722	D	1	P;P	0.40731	0.728;0.608	B;B	0.30105	0.111;0.052	T	0.17684	-1.0361	10	0.42905	T	0.14	-3.3109	20.2117	0.98287	0.0:0.0:1.0:0.0	.	255;255	E9PCT1;Q8IYB3	.;SRRM1_HUMAN	K	255;255;255;124	ENSP00000326261:E255K;ENSP00000391430:E255K;ENSP00000363510:E255K;ENSP00000441776:E124K	ENSP00000326261:E255K	E	+	1	0	SRRM1	24851549	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	8.548000	0.90669	2.878000	0.98634	0.650000	0.86243	GAG	SRRM1	-	NULL	ENSG00000133226		0.408	SRRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM1	HGNC	protein_coding	OTTHUMT00000009292.2	68	0.00	0	G	NM_005839		24978962	24978962	+1	no_errors	ENST00000447431	ensembl	human	known	69_37n	missense	23	20.69	6	SNP	1.000	A
SPTA1	6708	genome.wustl.edu	37	1	158644181	158644181	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr1:158644181C>T	ENST00000368147.4	-	10	1468	c.1288G>A	c.(1288-1290)Gat>Aat	p.D430N		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	430					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CCAGTCTCATCAGCAGATTGA	0.413																																						dbGAP											0													207.0	197.0	200.0					1																	158644181		1929	4133	6062	-	-	-	SO:0001583	missense	0			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.1288G>A	1.37:g.158644181C>T	ENSP00000357129:p.Asp430Asn		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_HAND_2,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.D430N	ENST00000368147.4	37	c.1288	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	c	1.809	-0.475041	0.04414	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.44881	0.91;0.91	5.28	-0.1	0.13621	.	21.564400	0.00738	N	0.000987	T	0.08044	0.0201	N	0.12961	0.28	0.09310	N	1	B	0.02656	0.0	B	0.10450	0.005	T	0.08391	-1.0724	10	0.17369	T	0.5	.	4.3361	0.11087	0.1097:0.569:0.1071:0.2142	.	430	P02549	SPTA1_HUMAN	N	430	ENSP00000357130:D430N;ENSP00000357129:D430N	ENSP00000357129:D430N	D	-	1	0	SPTA1	156910805	0.992000	0.36948	0.008000	0.14137	0.023000	0.10783	1.460000	0.35244	-0.401000	0.07644	-1.739000	0.00688	GAT	SPTA1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000163554		0.413	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3	176	0.00	0	C	NM_003126		158644181	158644181	-1	no_errors	ENST00000368148	ensembl	human	known	69_37n	missense	137	18.93	32	SNP	0.217	T
SULF2	55959	genome.wustl.edu	37	20	46385992	46385992	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr20:46385992C>T	ENST00000359930.4	-	2	967	c.116G>A	c.(115-117)cGc>cAc	p.R39H	SULF2_ENST00000467815.1_Missense_Mutation_p.R39H|SULF2_ENST00000361612.4_Missense_Mutation_p.R39H|SULF2_ENST00000484875.1_Missense_Mutation_p.R39H	NM_018837.3	NP_061325.1	Q8IWU5	SULF2_HUMAN	sulfatase 2	39					bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	54						GATGTTCCTGCGGTCCCTCTG	0.647																																						dbGAP											0													65.0	46.0	52.0					20																	46385992		2200	4293	6493	-	-	-	SO:0001583	missense	0			AY101176	CCDS13408.1, CCDS13409.1, CCDS13409.2	20q13.12-q13.13	2008-05-14			ENSG00000196562	ENSG00000196562			20392	protein-coding gene	gene with protein product		610013				12368295	Standard	NM_018837		Approved	KIAA1247, HSULF-2, SULF-2	uc002xto.3	Q8IWU5	OTTHUMG00000032675	ENST00000359930.4:c.116G>A	20.37:g.46385992C>T	ENSP00000353007:p.Arg39His		E1P5U6|Q5JYE1|Q6UX86|Q96SG2|Q9H1H0|Q9UJR3|Q9ULH3	Missense_Mutation	SNP	pfam_Sulfatase,pfam_Extracellular_sulfatase_C,superfamily_Alkaline_phosphatase_core,pirsf_Extracellular_sulfatase	p.R39H	ENST00000359930.4	37	c.116	CCDS13408.1	20	.	.	.	.	.	.	.	.	.	.	C	32	5.121985	0.94429	.	.	ENSG00000196562	ENST00000359930;ENST00000484875;ENST00000361612;ENST00000467815;ENST00000437955	D;D;D;D;D	0.99158	-5.5;-5.5;-5.5;-5.5;-4.54	4.76	4.76	0.60689	.	0.000000	0.85682	D	0.000000	D	0.99251	0.9739	M	0.81497	2.545	0.52501	D	0.999951	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.998	D	0.99376	1.0921	10	0.72032	D	0.01	-18.4615	17.3933	0.87439	0.0:1.0:0.0:0.0	.	39;39;39	G3XAE6;Q8IWU5-2;Q8IWU5	.;.;SULF2_HUMAN	H	39	ENSP00000353007:R39H;ENSP00000418290:R39H;ENSP00000354662:R39H;ENSP00000418442:R39H;ENSP00000410026:R39H	ENSP00000353007:R39H	R	-	2	0	SULF2	45819399	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.056000	0.76662	2.178000	0.69098	0.561000	0.74099	CGC	SULF2	-	pirsf_Extracellular_sulfatase	ENSG00000196562		0.647	SULF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SULF2	HGNC	protein_coding	OTTHUMT00000079606.1	24	0.00	0	C	NM_018837		46385992	46385992	-1	no_errors	ENST00000359930	ensembl	human	known	69_37n	missense	45	22.03	13	SNP	1.000	T
SYAP1	94056	genome.wustl.edu	37	X	16774820	16774820	+	Silent	SNP	C	C	A			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chrX:16774820C>A	ENST00000380155.3	+	7	852	c.759C>A	c.(757-759)atC>atA	p.I253I		NM_032796.3	NP_116185.2	Q96A49	SYAP1_HUMAN	synapse associated protein 1	253						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				endometrium(3)|lung(4)|pancreas(1)|prostate(1)|skin(1)	10	Hepatocellular(33;0.0997)					CCGTTGTAATCAAATCTCAGC	0.358																																						dbGAP											0													83.0	76.0	78.0					X																	16774820		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF338728	CCDS14177.1	Xp22.31	2010-06-25	2010-06-25		ENSG00000169895	ENSG00000169895			16273	protein-coding gene	gene with protein product	"""SAP47 homolog (Drosophila)"""					11483580	Standard	NM_032796		Approved	FLJ14495, PRO3113	uc004cxp.3	Q96A49	OTTHUMG00000021192	ENST00000380155.3:c.759C>A	X.37:g.16774820C>A			Q68CP1|Q96C60|Q96JQ6|Q96T20	Silent	SNP	pfam_BSD,smart_BSD,pfscan_BSD	p.I253	ENST00000380155.3	37	c.759	CCDS14177.1	X																																																																																			SYAP1	-	NULL	ENSG00000169895		0.358	SYAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYAP1	HGNC	protein_coding	OTTHUMT00000055904.1	215	0.00	0	C	NM_032796		16774820	16774820	+1	no_errors	ENST00000380155	ensembl	human	known	69_37n	silent	76	31.25	35	SNP	1.000	A
TLN2	83660	genome.wustl.edu	37	15	63031644	63031644	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr15:63031644C>T	ENST00000561311.1	+	30	4015	c.3785C>T	c.(3784-3786)aCc>aTc	p.T1262I	TLN2_ENST00000559908.1_3'UTR|TLN2_ENST00000306829.6_Missense_Mutation_p.T1262I			Q9Y4G6	TLN2_HUMAN	talin 2	1262					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						GTCCATGCCACCCGGGGCCAG	0.557																																						dbGAP											0													95.0	88.0	90.0					15																	63031644		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.3785C>T	15.37:g.63031644C>T	ENSP00000453508:p.Thr1262Ile		A6NLB8	Missense_Mutation	SNP	pfam_Talin_cent,pfam_ILWEQ,pfam_Vinculin-bd_dom,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ,pfscan_FERM_domain,pfscan_ILWEQ	p.T1262I	ENST00000561311.1	37	c.3785	CCDS32261.1	15	.	.	.	.	.	.	.	.	.	.	C	20.3	3.972663	0.74246	.	.	ENSG00000171914	ENST00000306829	T	0.14266	2.52	5.29	5.29	0.74685	.	0.100134	0.64402	D	0.000001	T	0.10723	0.0262	N	0.08118	0	0.80722	D	1	B	0.25850	0.136	B	0.30029	0.11	T	0.26467	-1.0102	10	0.66056	D	0.02	-30.4788	19.2955	0.94119	0.0:1.0:0.0:0.0	.	1262	Q9Y4G6	TLN2_HUMAN	I	1262	ENSP00000303476:T1262I	ENSP00000303476:T1262I	T	+	2	0	TLN2	60818936	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.776000	0.85560	2.639000	0.89480	0.585000	0.79938	ACC	TLN2	-	superfamily_Vinculin/catenin	ENSG00000171914		0.557	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN2	HGNC	protein_coding	OTTHUMT00000257878.2	106	0.00	0	C			63031644	63031644	+1	no_errors	ENST00000306829	ensembl	human	known	69_37n	missense	104	29.73	44	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7578236	7578236	+	Missense_Mutation	SNP	A	A	T			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr17:7578236A>T	ENST00000269305.4	-	6	802	c.613T>A	c.(613-615)Tat>Aat	p.Y205N	TP53_ENST00000574684.1_Intron|TP53_ENST00000413465.2_Missense_Mutation_p.Y205N|TP53_ENST00000445888.2_Missense_Mutation_p.Y205N|TP53_ENST00000455263.2_Missense_Mutation_p.Y205N|TP53_ENST00000359597.4_Missense_Mutation_p.Y205N|TP53_ENST00000420246.2_Missense_Mutation_p.Y205N	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	205	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1459726}.|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in sporadic cancers; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y205D(13)|p.0?(8)|p.Y205N(8)|p.?(5)|p.Y205H(5)|p.Y112N(2)|p.Y73N(2)|p.Y205fs*43(1)|p.Y205fs*42(1)|p.E204fs*39(1)|p.G199fs*42(1)|p.E204_N210delEYLDDRN(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCATCCAAATACTCCACACGC	0.542		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	48	Substitution - Missense(30)|Whole gene deletion(8)|Unknown(5)|Deletion - Frameshift(3)|Deletion - In frame(1)|Insertion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(6)|biliary_tract(5)|large_intestine(5)|endometrium(5)|upper_aerodigestive_tract(4)|central_nervous_system(4)|bone(4)|breast(3)|pancreas(3)|stomach(2)|lung(2)|skin(2)|urinary_tract(1)|oesophagus(1)|ovary(1)											136.0	121.0	126.0					17																	7578236		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.613T>A	17.37:g.7578236A>T	ENSP00000269305:p.Tyr205Asn		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.Y205N	ENST00000269305.4	37	c.613	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	22.9	4.346482	0.82022	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99869	-7.33;-7.33;-7.33;-7.33;-7.33;-7.33;-7.33;-7.33	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99859	0.9934	M	0.88906	2.99	0.80722	D	1	D;D;D;D;D;D;D	0.76494	0.997;0.999;0.998;0.999;0.999;0.997;0.999	D;D;D;D;D;D;D	0.79108	0.96;0.991;0.972;0.983;0.992;0.983;0.978	D	0.96416	0.9308	10	0.87932	D	0	-5.8058	13.709	0.62656	1.0:0.0:0.0:0.0	.	166;205;205;112;205;205;205	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	N	205;205;205;205;205;205;194;112;73;112;73	ENSP00000410739:Y205N;ENSP00000352610:Y205N;ENSP00000269305:Y205N;ENSP00000398846:Y205N;ENSP00000391127:Y205N;ENSP00000391478:Y205N;ENSP00000425104:Y73N;ENSP00000423862:Y112N	ENSP00000269305:Y205N	Y	-	1	0	TP53	7518961	1.000000	0.71417	0.163000	0.22734	0.042000	0.13812	7.465000	0.80898	2.183000	0.69458	0.533000	0.62120	TAT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	221	0.88	2	A	NM_000546		7578236	7578236	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	72	31.48	34	SNP	0.994	T
TRBV6-8	28599	genome.wustl.edu	37	7	142124196	142124196	+	RNA	SNP	G	G	C			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr7:142124196G>C	ENST00000390376.2	-	0	281									T cell receptor beta variable 6-8																		ACACCAGCCTGAGTGGGAAAT	0.507																																						dbGAP											0													203.0	211.0	209.0					7																	142124196		1958	4139	6097	-	-	-			0			L36092		7q34	2012-02-07			ENSG00000253534	ENSG00000253534		"""T cell receptors / TRB locus"""	12233	other	T cell receptor gene						8650574	Standard	NG_001333		Approved	TRBV68, TCRBV13S7P, TCRBV6S8			OTTHUMG00000158916		7.37:g.142124196G>C				Silent	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.L94	ENST00000390376.2	37	c.282		7																																																																																			TRBV6-8	-	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000253534		0.507	TRBV6-8-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TRBV6-8	HGNC	TR_V_gene	OTTHUMT00000352531.2	110	0.00	0	G	NG_001333		142124196	142124196	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390376	ensembl	human	known	69_37n	silent	129	40.83	89	SNP	0.183	C
TRIM21	6737	genome.wustl.edu	37	11	4411328	4411328	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr11:4411328C>A	ENST00000254436.7	-	2	424	c.312G>T	c.(310-312)gaG>gaT	p.E104D	TRIM21_ENST00000543625.1_Missense_Mutation_p.E104D	NM_003141.3	NP_003132.2	P19474	RO52_HUMAN	tripartite motif containing 21	104					cell cycle (GO:0007049)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein deubiquitination (GO:0090086)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell cycle (GO:0045787)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of type I interferon production (GO:0032481)|positive regulation of viral entry into host cell (GO:0046598)|protein autoubiquitination (GO:0051865)|protein destabilization (GO:0031648)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein trimerization (GO:0070206)|protein ubiquitination (GO:0016567)|regulation of type I interferon production (GO:0032479)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)	16		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;2.08e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0851)|LUSC - Lung squamous cell carcinoma(625;0.194)		TCCCATCTTTCTCACAGAACA	0.557																																						dbGAP											0													82.0	87.0	85.0					11																	4411328		2059	4200	6259	-	-	-	SO:0001583	missense	0			AF391283	CCDS44525.1	11p15.5-p15.3	2014-02-14	2011-01-25	2004-11-26		ENSG00000132109		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	11312	protein-coding gene	gene with protein product		109092	"""Sjogren syndrome antigen A1 (52kDa, ribonucleoprotein autoantigen SS-A/Ro)"", ""tripartite motif-containing 21"""	SSA1		8094596	Standard	NM_003141		Approved	RNF81, RO52, Ro/SSA	uc001lyy.1	P19474		ENST00000254436.7:c.312G>T	11.37:g.4411328C>A	ENSP00000254436:p.Glu104Asp		Q5XPV5|Q96RF8	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl,smart_Ubox_domain,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin,prints_Znf_B-box_chordata	p.E104D	ENST00000254436.7	37	c.312	CCDS44525.1	11	.	.	.	.	.	.	.	.	.	.	C	21.3	4.126306	0.77549	.	.	ENSG00000132109	ENST00000254436;ENST00000543625	T;T	0.46451	0.87;0.87	4.32	4.32	0.51571	Zinc finger, B-box, chordata (1);Zinc finger, B-box (3);	0.126252	0.36374	N	0.002623	T	0.52821	0.1758	M	0.76002	2.32	0.29742	N	0.836997	P	0.50819	0.939	P	0.53988	0.739	T	0.57112	-0.7867	10	0.87932	D	0	.	8.3663	0.32389	0.0:0.8971:0.0:0.1029	.	104	P19474	RO52_HUMAN	D	104	ENSP00000254436:E104D;ENSP00000444045:E104D	ENSP00000254436:E104D	E	-	3	2	TRIM21	4367904	0.654000	0.27367	0.998000	0.56505	0.955000	0.61496	1.278000	0.33179	2.691000	0.91804	0.561000	0.74099	GAG	TRIM21	-	pfam_Znf_B-box,smart_Znf_B-box,pfscan_Znf_B-box,prints_Znf_B-box_chordata	ENSG00000132109		0.557	TRIM21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIM21	HGNC	protein_coding	OTTHUMT00000385842.1	83	0.00	0	C	NM_003141		4411328	4411328	-1	no_errors	ENST00000254436	ensembl	human	known	69_37n	missense	49	30.99	22	SNP	1.000	A
UBAP1	51271	genome.wustl.edu	37	9	34241364	34241364	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr9:34241364C>T	ENST00000297661.4	+	4	576	c.341C>T	c.(340-342)cCa>cTa	p.P114L	UBAP1_ENST00000379186.4_Missense_Mutation_p.P114L|UBAP1_ENST00000545103.1_Missense_Mutation_p.P178L|UBAP1_ENST00000536252.1_Missense_Mutation_p.P114L|UBAP1_ENST00000543944.1_Missense_Mutation_p.P150L|UBAP1_ENST00000359544.2_Missense_Mutation_p.P114L|UBAP1_ENST00000540348.1_Missense_Mutation_p.P114L	NM_016525.4	NP_057609.2	Q9NZ09	UBAP1_HUMAN	ubiquitin associated protein 1	114					protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|ESCRT I complex (GO:0000813)	ubiquitin binding (GO:0043130)			endometrium(4)|kidney(2)|lung(6)|upper_aerodigestive_tract(1)	13			LUSC - Lung squamous cell carcinoma(29;0.00272)			GCCACAATGCCACCTCCTATT	0.507																																					NSCLC(109;1074 1634 14978 20375 39620)	dbGAP											0													151.0	140.0	143.0					9																	34241364		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF222043	CCDS6550.1	9p13.3	2008-05-15	2002-08-27	2002-08-30	ENSG00000165006	ENSG00000165006			12461	protein-coding gene	gene with protein product		609787	"""ubiquitin associated protein"""	UBAP			Standard	NM_001171201		Approved		uc011loj.2	Q9NZ09	OTTHUMG00000000430	ENST00000297661.4:c.341C>T	9.37:g.34241364C>T	ENSP00000297661:p.Pro114Leu		B7Z348|B7Z8N9|D3DRL7|F5GXE2|F5H0J8|Q4V759|Q53FP7|Q5T7B3|Q6FI75|Q8NC52|Q8NCG6|Q8NCH9	Missense_Mutation	SNP	superfamily_UBA-like,pfscan_UBA/transl_elong_EF1B_N_euk	p.P178L	ENST00000297661.4	37	c.533	CCDS6550.1	9	.	.	.	.	.	.	.	.	.	.	C	26.5	4.744492	0.89663	.	.	ENSG00000165006	ENST00000545103;ENST00000543944;ENST00000536252;ENST00000540348;ENST00000297661;ENST00000379186;ENST00000359544	T;T;T;T;T;T;T	0.59224	0.58;0.28;0.69;0.69;0.69;0.68;0.69	6.03	6.03	0.97812	.	0.046170	0.85682	D	0.000000	T	0.76392	0.3981	M	0.75264	2.295	0.80722	D	1	D;D;D;D	0.71674	0.992;0.992;0.998;0.992	P;P;D;P	0.63597	0.864;0.864;0.916;0.864	T	0.76135	-0.3070	10	0.59425	D	0.04	-24.0154	20.5568	0.99304	0.0:1.0:0.0:0.0	.	178;150;178;114	F5GXE2;F5H0J8;B7Z8N9;Q9NZ09	.;.;.;UBAP1_HUMAN	L	178;150;114;114;114;114;114	ENSP00000441024:P178L;ENSP00000439806:P150L;ENSP00000440456:P114L;ENSP00000439976:P114L;ENSP00000297661:P114L;ENSP00000368484:P114L;ENSP00000352541:P114L	ENSP00000297661:P114L	P	+	2	0	UBAP1	34231364	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.487000	0.81328	2.861000	0.98227	0.655000	0.94253	CCA	UBAP1	-	NULL	ENSG00000165006		0.507	UBAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBAP1	HGNC	protein_coding	OTTHUMT00000001084.1	201	0.00	0	C			34241364	34241364	+1	no_errors	ENST00000545103	ensembl	human	known	69_37n	missense	135	34.15	70	SNP	1.000	T
UXS1	80146	genome.wustl.edu	37	2	106780148	106780148	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr2:106780148C>T	ENST00000409501.3	-	4	247	c.190G>A	c.(190-192)Gag>Aag	p.E64K	UXS1_ENST00000540130.1_Missense_Mutation_p.E7K|UXS1_ENST00000283148.7_Missense_Mutation_p.E69K|UXS1_ENST00000428048.2_Intron			Q8NBZ7	UXS1_HUMAN	UDP-glucuronate decarboxylase 1	64					protein tetramerization (GO:0051262)|UDP-D-xylose biosynthetic process (GO:0033320)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	NAD+ binding (GO:0070403)|protein homodimerization activity (GO:0042803)|UDP-glucuronate decarboxylase activity (GO:0048040)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)	17						CTGATTTTCTCTCTTAGTGGT	0.294																																						dbGAP											0													38.0	36.0	37.0					2																	106780148		1654	3736	5390	-	-	-	SO:0001583	missense	0			AK027244	CCDS46378.1, CCDS58720.1, CCDS58721.1	2q12.2	2012-02-22			ENSG00000115652	ENSG00000115652	4.1.1.35	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	17729	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 6E, member 12"""	609749				19027726	Standard	NM_001253875		Approved	FLJ23591, UGD, SDR6E1	uc002tdn.3	Q8NBZ7	OTTHUMG00000153150	ENST00000409501.3:c.190G>A	2.37:g.106780148C>T	ENSP00000387019:p.Glu64Lys		Q8NBX3|Q9H5C2	Missense_Mutation	SNP	pfam_Epimerase_deHydtase,pfam_UXS1_N,pfam_dTDP_dehydrorham_reduct,pfam_Male_sterile_NAD-bd,pfam_3Beta_OHSteriod_DH/Estase	p.E69K	ENST00000409501.3	37	c.205	CCDS46378.1	2	.	.	.	.	.	.	.	.	.	.	C	17.34	3.365008	0.61513	.	.	ENSG00000115652	ENST00000283148;ENST00000540130;ENST00000409501;ENST00000457835	D;D;D;D	0.96168	-3.87;-3.84;-3.92;-3.93	5.72	5.72	0.89469	.	0.229019	0.43747	D	0.000539	D	0.91586	0.7342	L	0.27053	0.805	0.80722	D	1	B;B	0.21753	0.06;0.027	B;B	0.19666	0.026;0.026	D	0.87526	0.2449	10	0.30854	T	0.27	-12.3776	16.7956	0.85601	0.0:1.0:0.0:0.0	.	69;64	Q8NBZ7-2;Q8NBZ7	.;UXS1_HUMAN	K	69;7;64;7	ENSP00000283148:E69K;ENSP00000438265:E7K;ENSP00000387019:E64K;ENSP00000399316:E7K	ENSP00000283148:E69K	E	-	1	0	UXS1	106146580	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.415000	0.66411	2.708000	0.92522	0.650000	0.86243	GAG	UXS1	-	pfam_UXS1_N	ENSG00000115652		0.294	UXS1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	UXS1	HGNC	protein_coding	OTTHUMT00000329778.1	217	0.00	0	C	NM_025076.3		106780148	106780148	-1	no_errors	ENST00000283148	ensembl	human	known	69_37n	missense	65	25.29	22	SNP	1.000	T
VEGFB	7423	genome.wustl.edu	37	11	64004663	64004663	+	Frame_Shift_Del	DEL	A	A	-			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr11:64004663delA	ENST00000309422.2	+	5	675	c.379delA	c.(379-381)aaafs	p.K129fs	RP11-783K16.14_ENST00000539963.1_RNA|RP11-783K16.14_ENST00000534988.1_RNA|VEGFB_ENST00000426086.2_Frame_Shift_Del_p.K129fs	NM_001243733.1|NM_003377.4	NP_001230662.1|NP_003368.1	P49765	VEGFB_HUMAN	vascular endothelial growth factor B	129					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|coronary vasculature development (GO:0060976)|induction of positive chemotaxis (GO:0050930)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of cell division (GO:0051781)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of mast cell chemotaxis (GO:0060754)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of vascular wound healing (GO:0035470)|protein O-linked glycosylation (GO:0006493)|response to drug (GO:0042493)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	chemoattractant activity (GO:0042056)|heparin binding (GO:0008201)|vascular endothelial growth factor receptor 1 binding (GO:0043183)	p.K129fs*5(2)		endometrium(2)|large_intestine(2)|prostate(1)|stomach(1)	6					Aflibercept(DB08885)	TTTCAGACCTAAAAAAAAGGA	0.473																																						dbGAP											2	Deletion - Frameshift(2)	large_intestine(2)											137.0	121.0	126.0					11																	64004663		2201	4297	6498	-	-	-	SO:0001589	frameshift_variant	0			BC008818	CCDS8062.1, CCDS58144.1	11q13	2005-09-29				ENSG00000173511			12681	protein-coding gene	gene with protein product		601398		VRF		8637916, 8919691	Standard	NM_001243733		Approved	VEGFL	uc001nyw.3	P49765		ENST00000309422.2:c.379delA	11.37:g.64004663delA	ENSP00000311127:p.Lys129fs		Q16528	Frame_Shift_Del	DEL	pfam_PD_growth_factor,smart_PD_growth_factor,pfscan_PD_growth_factor	p.K129fs	ENST00000309422.2	37	c.379	CCDS8062.1	11																																																																																			VEGFB	-	pfscan_PD_growth_factor	ENSG00000173511		0.473	VEGFB-001	KNOWN	basic|CCDS	protein_coding	VEGFB	HGNC	protein_coding	OTTHUMT00000396393.2	148	0.00	0	A	NM_003377		64004663	64004663	+1	no_errors	ENST00000309422	ensembl	human	known	69_37n	frame_shift_del	101	12.07	14	DEL	1.000	-
VPS13C	54832	genome.wustl.edu	37	15	62239428	62239428	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr15:62239428C>A	ENST00000261517.5	-	43	4913	c.4840G>T	c.(4840-4842)Gat>Tat	p.D1614Y	VPS13C_ENST00000249837.3_Missense_Mutation_p.D1571Y|VPS13C_ENST00000395896.4_Missense_Mutation_p.D1614Y|VPS13C_ENST00000395898.3_Missense_Mutation_p.D1571Y	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						CACTTCTGATCACAGACAAAG	0.303																																						dbGAP											0													108.0	109.0	109.0					15																	62239428		2203	4293	6496	-	-	-	SO:0001583	missense	0			AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.4840G>T	15.37:g.62239428C>A	ENSP00000261517:p.Asp1614Tyr			Missense_Mutation	SNP	pfam_VPSAP,pfam_Autophagy-rel_C	p.D1614Y	ENST00000261517.5	37	c.4840	CCDS32257.1	15	.	.	.	.	.	.	.	.	.	.	C	19.07	3.755361	0.69648	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.48836	0.8;0.8;0.8	5.4	5.4	0.78164	.	0.173055	0.48767	D	0.000169	T	0.69531	0.3121	M	0.81942	2.565	0.54753	D	0.999986	D;D;D;D	0.69078	0.997;0.997;0.997;0.994	D;D;D;D	0.74023	0.973;0.982;0.973;0.94	T	0.73563	-0.3943	10	0.72032	D	0.01	.	14.7035	0.69171	0.1452:0.8548:0.0:0.0	.	1571;1614;1571;1614	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	Y	1571;1614;1614;1614	ENSP00000249837:D1571Y;ENSP00000261517:D1614Y;ENSP00000379233:D1614Y	ENSP00000249837:D1571Y	D	-	1	0	VPS13C	60026720	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.142000	0.50601	2.538000	0.85594	0.561000	0.74099	GAT	VPS13C	-	NULL	ENSG00000129003		0.303	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13C	HGNC	protein_coding	OTTHUMT00000415997.1	265	0.38	1	C	NM_017684		62239428	62239428	-1	no_errors	ENST00000261517	ensembl	human	known	69_37n	missense	107	23.57	33	SNP	1.000	A
XAB2	56949	genome.wustl.edu	37	19	7687717	7687717	+	Silent	SNP	G	G	A			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr19:7687717G>A	ENST00000358368.4	-	10	1339	c.1302C>T	c.(1300-1302)agC>agT	p.S434S	XAB2_ENST00000534844.1_Silent_p.S431S	NM_020196.2	NP_064581.2	Q9HCS7	SYF1_HUMAN	XPA binding protein 2	434					blastocyst development (GO:0001824)|DNA repair (GO:0006281)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|transcription, DNA-templated (GO:0006351)|transcription-coupled nucleotide-excision repair (GO:0006283)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	26						GACACCACACGCTTGCCAGGT	0.657								Direct reversal of damage;Nucleotide excision repair (NER)																														dbGAP											0													79.0	62.0	68.0					19																	7687717		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB026111	CCDS32892.1	19p13.3	2013-08-21				ENSG00000076924			14089	protein-coding gene	gene with protein product	"""SYF1 homolog, RNA splicing factor (S. cerevisiae)"", ""SYF1 pre-mRNA-splicing factor"""	610850				10944529	Standard	NM_020196		Approved	HCNP, HCRN, SYF1, NTC90	uc002mgx.3	Q9HCS7		ENST00000358368.4:c.1302C>T	19.37:g.7687717G>A			Q8TET6|Q96HB0|Q96IW0|Q9NRG6|Q9ULP3	Silent	SNP	smart_HAT,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S434	ENST00000358368.4	37	c.1302	CCDS32892.1	19																																																																																			XAB2	-	smart_HAT,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000076924		0.657	XAB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	XAB2	HGNC	protein_coding	OTTHUMT00000461021.1	26	0.00	0	G	NM_020196		7687717	7687717	-1	no_errors	ENST00000358368	ensembl	human	known	69_37n	silent	24	33.33	12	SNP	0.980	A
XBP1	7494	genome.wustl.edu	37	22	29191398	29191399	+	3'UTR	DEL	AC	AC	-			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	AC	AC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr22:29191398_29191399delAC	ENST00000216037.6	-	0	993_994				XBP1_ENST00000405219.3_3'UTR|XBP1_ENST00000344347.5_Frame_Shift_Del_p.V299fs|XBP1_ENST00000403532.3_3'UTR	NM_001079539.1|NM_005080.3	NP_001073007.1|NP_005071.2	P17861	XBP1_HUMAN	X-box binding protein 1						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cellular response to antibiotic (GO:0071236)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial cell maturation involved in salivary gland development (GO:0060691)|exocrine pancreas development (GO:0031017)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|positive regulation of endoplasmic reticulum unfolded protein response (GO:1900103)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|serotonin secretion, neurotransmission (GO:0060096)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|large_intestine(1)|lung(1)	5						CTTCACTGAGACAATGAATTCA	0.49																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			M31627	CCDS13847.1	22q12.1	2013-01-10			ENSG00000100219	ENSG00000100219		"""basic leucine zipper proteins"""	12801	protein-coding gene	gene with protein product		194355		XBP2		1718857, 2196176	Standard	NM_001079539		Approved		uc003aec.3	P17861	OTTHUMG00000151094	ENST00000216037.6:c.*136GT>-	22.37:g.29191398_29191399delAC			Q8WYK6|Q969P1|Q96BD7	Frame_Shift_Del	DEL	pfam_bZIP_2,pfam_bZIP_1,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.V299fs	ENST00000216037.6	37	c.896_895	CCDS13847.1	22																																																																																			XBP1	-	NULL	ENSG00000100219		0.490	XBP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	XBP1	HGNC	protein_coding	OTTHUMT00000321274.1	156	0.00	0	AC	NM_005080		29191398	29191399	-1	no_errors	ENST00000344347	ensembl	human	known	69_37n	frame_shift_del	113	16.30	22	DEL	1.000:1.000	-
XRCC6	2547	genome.wustl.edu	37	22	42018039	42018039	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr22:42018039G>C	ENST00000359308.4	+	1	686	c.31G>C	c.(31-33)Gag>Cag	p.E11Q	XRCC6_ENST00000402580.3_Missense_Mutation_p.E11Q|XRCC6_ENST00000428575.2_5'UTR|XRCC6_ENST00000360079.3_Missense_Mutation_p.E11Q|XRCC6_ENST00000405506.1_5'UTR|XRCC6_ENST00000405878.1_Missense_Mutation_p.E11Q|DESI1_ENST00000263256.6_5'Flank			P12956	XRCC6_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 6	11	Asp/Glu-rich (acidic).|Ser-rich (potentially targets for phosphorylation).				brain development (GO:0007420)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA ligation (GO:0006266)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear telomere cap complex (GO:0000783)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	5'-deoxyribose-5-phosphate lyase activity (GO:0051575)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	31						TTACAAAACCGAGGGCGATGA	0.448								Non-homologous end-joining																														dbGAP											0													206.0	179.0	188.0					22																	42018039		2203	4300	6503	-	-	-	SO:0001583	missense	0			J04607	CCDS14021.1, CCDS74870.1, CCDS74871.1	22q13.2	2011-09-12	2008-07-31	2005-05-06	ENSG00000196419	ENSG00000196419			4055	protein-coding gene	gene with protein product	"""Ku autoantigen, 70kDa"""	152690	"""thyroid autoantigen 70kD (Ku antigen)"", ""thyroid autoantigen 70kDa (Ku antigen)"""	G22P1		9200330, 9223317	Standard	NM_001469		Approved	D22S731, D22S671, KU70, ML8	uc003bao.1	P12956	OTTHUMG00000151190	ENST00000359308.4:c.31G>C	22.37:g.42018039G>C	ENSP00000352257:p.Glu11Gln		B1AHC8|Q6FG89|Q9UCQ2|Q9UCQ3	Missense_Mutation	SNP	pirsf_DNA_helicase_ATP-dep_Ku70,pfam_Ku_N,pfam_DNA_helicase_ATP-dep_Ku,pfam_Ku_C,pfam_SAP_DNA-bd,superfamily_SPOC-like,smart_DNA_helicase_ATP-dep_Ku,smart_SAP_DNA-bd,pfscan_SAP_DNA-bd,tigrfam_DNA_helicase_ATP-dep_Ku70	p.E11Q	ENST00000359308.4	37	c.31	CCDS14021.1	22	.	.	.	.	.	.	.	.	.	.	G	14.74	2.625999	0.46840	.	.	ENSG00000196419	ENST00000360079;ENST00000402580;ENST00000359308;ENST00000405878;ENST00000402409	.	.	.	5.36	3.25	0.37280	.	0.114950	0.56097	D	0.000026	T	0.46619	0.1402	L	0.31926	0.97	0.80722	D	1	B;B;B	0.24368	0.051;0.102;0.102	B;B;B	0.24394	0.019;0.053;0.043	T	0.31138	-0.9954	9	0.33141	T	0.24	-18.7917	14.5911	0.68365	0.0:0.1824:0.8176:0.0	.	11;11;11	B1AHC7;B1AHC8;P12956	.;.;XRCC6_HUMAN	Q	11	.	ENSP00000352257:E11Q	E	+	1	0	XRCC6	40347985	1.000000	0.71417	0.989000	0.46669	0.680000	0.39746	2.480000	0.45206	0.630000	0.30394	0.655000	0.94253	GAG	XRCC6	-	pirsf_DNA_helicase_ATP-dep_Ku70	ENSG00000196419		0.448	XRCC6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	XRCC6	HGNC	protein_coding	OTTHUMT00000321688.1	307	0.00	0	G	NM_001469		42018039	42018039	+1	no_errors	ENST00000359308	ensembl	human	known	69_37n	missense	255	24.26	82	SNP	0.972	C
XRCC6	2547	genome.wustl.edu	37	22	42024199	42024199	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr22:42024199G>A	ENST00000359308.4	+	2	815	c.160G>A	c.(160-162)Gaa>Aaa	p.E54K	XRCC6_ENST00000402580.3_Missense_Mutation_p.E54K|XRCC6_ENST00000428575.2_Intron|XRCC6_ENST00000360079.3_Missense_Mutation_p.E54K|XRCC6_ENST00000405506.1_Intron|XRCC6_ENST00000405878.1_Missense_Mutation_p.E54K			P12956	XRCC6_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 6	54	Ser-rich (potentially targets for phosphorylation).				brain development (GO:0007420)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA ligation (GO:0006266)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear telomere cap complex (GO:0000783)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	5'-deoxyribose-5-phosphate lyase activity (GO:0051575)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	31						ATCTCAGAGTGAAGATGAGTT	0.378								Non-homologous end-joining																														dbGAP											0													115.0	109.0	111.0					22																	42024199		2203	4300	6503	-	-	-	SO:0001583	missense	0			J04607	CCDS14021.1, CCDS74870.1, CCDS74871.1	22q13.2	2011-09-12	2008-07-31	2005-05-06	ENSG00000196419	ENSG00000196419			4055	protein-coding gene	gene with protein product	"""Ku autoantigen, 70kDa"""	152690	"""thyroid autoantigen 70kD (Ku antigen)"", ""thyroid autoantigen 70kDa (Ku antigen)"""	G22P1		9200330, 9223317	Standard	NM_001469		Approved	D22S731, D22S671, KU70, ML8	uc003bao.1	P12956	OTTHUMG00000151190	ENST00000359308.4:c.160G>A	22.37:g.42024199G>A	ENSP00000352257:p.Glu54Lys		B1AHC8|Q6FG89|Q9UCQ2|Q9UCQ3	Missense_Mutation	SNP	pirsf_DNA_helicase_ATP-dep_Ku70,pfam_Ku_N,pfam_DNA_helicase_ATP-dep_Ku,pfam_Ku_C,pfam_SAP_DNA-bd,superfamily_SPOC-like,smart_DNA_helicase_ATP-dep_Ku,smart_SAP_DNA-bd,pfscan_SAP_DNA-bd,tigrfam_DNA_helicase_ATP-dep_Ku70	p.E54K	ENST00000359308.4	37	c.160	CCDS14021.1	22	.	.	.	.	.	.	.	.	.	.	G	20.7	4.040937	0.75732	.	.	ENSG00000196419	ENST00000360079;ENST00000402580;ENST00000359308;ENST00000405878;ENST00000402409	.	.	.	5.19	5.19	0.71726	Ku70/Ku80, N-terminal alpha/beta (1);	0.255702	0.39020	N	0.001483	T	0.59088	0.2168	L	0.58101	1.795	0.80722	D	1	B;B;B	0.26672	0.156;0.154;0.049	B;B;B	0.28638	0.056;0.092;0.049	T	0.56866	-0.7908	9	0.09843	T	0.71	-8.07	18.7736	0.91901	0.0:0.0:1.0:0.0	.	54;54;54	B1AHC7;B1AHC8;P12956	.;.;XRCC6_HUMAN	K	54	.	ENSP00000352257:E54K	E	+	1	0	XRCC6	40354145	1.000000	0.71417	0.998000	0.56505	0.852000	0.48524	7.022000	0.76431	2.452000	0.82932	0.460000	0.39030	GAA	XRCC6	-	pirsf_DNA_helicase_ATP-dep_Ku70,pfam_Ku_N,tigrfam_DNA_helicase_ATP-dep_Ku70	ENSG00000196419		0.378	XRCC6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	XRCC6	HGNC	protein_coding	OTTHUMT00000321688.1	464	0.00	0	G	NM_001469		42024199	42024199	+1	no_errors	ENST00000359308	ensembl	human	known	69_37n	missense	191	20.75	50	SNP	1.000	A
ZDHHC13	54503	genome.wustl.edu	37	11	19169220	19169220	+	Splice_Site	SNP	G	G	A			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr11:19169220G>A	ENST00000446113.2	+	4	495	c.374G>A	c.(373-375)cGa>cAa	p.R125Q	ZDHHC13_ENST00000399351.3_5'UTR	NM_019028.2	NP_061901.2	Q8IUH4	ZDH13_HUMAN	zinc finger, DHHC-type containing 13	125					metabolic process (GO:0008152)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	magnesium ion transmembrane transporter activity (GO:0015095)|palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	6						TGGGCCATCCGGTAAGGTTTC	0.363																																						dbGAP											0													65.0	60.0	61.0					11																	19169220		1816	4082	5898	-	-	-	SO:0001630	splice_region_variant	0			AB024495	CCDS44550.1, CCDS44551.1	11p15.1	2013-01-10			ENSG00000177054	ENSG00000177054		"""Zinc fingers, DHHC-type"", ""Ankyrin repeat domain containing"""	18413	protein-coding gene	gene with protein product		612815				18794299	Standard	NM_001001483		Approved	FLJ10852, FLJ10941, HIP14L	uc001mpi.3	Q8IUH4	OTTHUMG00000166099	ENST00000446113.2:c.374+1G>A	11.37:g.19169220G>A			Q7Z2D3|Q86VK2|Q9NV30|Q9NV99	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Znf_DHHC_palmitoyltrfase,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Znf_DHHC_palmitoyltrfase	p.R125Q	ENST00000446113.2	37	c.374	CCDS44550.1	11	.	.	.	.	.	.	.	.	.	.	G	35	5.574080	0.96553	.	.	ENSG00000177054	ENST00000446113	T	0.64991	-0.13	5.27	5.27	0.74061	Ankyrin repeat-containing domain (4);	0.750914	0.13168	N	0.408510	T	0.71213	0.3313	L	0.31420	0.93	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.66221	-0.5978	10	0.28530	T	0.3	-7.2361	18.4726	0.90779	0.0:0.0:1.0:0.0	.	125	Q8IUH4	ZDH13_HUMAN	Q	125	ENSP00000400113:R125Q	ENSP00000400113:R125Q	R	+	2	0	ZDHHC13	19125796	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.869000	0.99810	2.440000	0.82611	0.585000	0.79938	CGA	ZDHHC13	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000177054		0.363	ZDHHC13-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	ZDHHC13	HGNC	protein_coding	OTTHUMT00000387821.1	397	0.25	1	G	NM_019028	Missense_Mutation	19169220	19169220	+1	no_errors	ENST00000446113	ensembl	human	known	69_37n	missense	99	30.77	44	SNP	1.000	A
ZNF106	64397	genome.wustl.edu	37	15	42749157	42749157	+	Splice_Site	SNP	G	G	A			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr15:42749157G>A	ENST00000263805.4	-	1	573	c.247C>T	c.(247-249)Cga>Tga	p.R83*	ZNF106_ENST00000565611.1_Intron|ZNF106_ENST00000565380.1_Intron	NM_001284306.1|NM_001284307.1|NM_022473.1	NP_001271235.1|NP_001271236.1|NP_071918.1	Q9H2Y7	ZN106_HUMAN	zinc finger protein 106	83					insulin receptor signaling pathway (GO:0008286)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										ATTACTTACCGACTTTGTTCT	0.333																																						dbGAP											0													26.0	30.0	28.0					15																	42749157		2186	4282	6468	-	-	-	SO:0001630	splice_region_variant	0			AF205632	CCDS32208.1, CCDS61602.1, CCDS61603.1	15q15.1	2012-11-27	2012-11-27		ENSG00000103994	ENSG00000103994		"""Zinc fingers, C2H2-type"""	12886	protein-coding gene	gene with protein product	"""SH3-domain binding protein 3"""		"""zinc finger protein 106 homolog (mouse)"""	ZFP106			Standard	XM_005254591		Approved	ZNF474, SH3BP3	uc001zpw.3	Q9H2Y7	OTTHUMG00000173244	ENST00000263805.4:c.248+1C>T	15.37:g.42749157G>A			B4DZ40|E9PE29|Q6NSD9|Q6PEK1|Q86T43|Q86T45|Q86T50|Q86T58|Q86TA9|Q96M37|Q9H7B8	Nonsense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_Znf_C2H2-like,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R83*	ENST00000263805.4	37	c.247	CCDS32208.1	15	.	.	.	.	.	.	.	.	.	.	G	32	5.155053	0.94686	.	.	ENSG00000103994	ENST00000263805	.	.	.	5.52	5.52	0.82312	.	0.092888	0.42172	D	0.000760	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.6259	14.294	0.66300	0.0:0.0:0.8513:0.1487	.	.	.	.	X	83	.	ENSP00000263805:R83X	R	-	1	2	ZFP106	40536449	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.864000	0.56024	2.593000	0.87608	0.549000	0.68633	CGA	ZFP106	-	NULL	ENSG00000103994		0.333	ZNF106-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP106	HGNC	protein_coding	OTTHUMT00000422587.1	40	0.00	0	G	NM_022473	Nonsense_Mutation	42749157	42749157	-1	no_errors	ENST00000263805	ensembl	human	known	69_37n	nonsense	25	24.24	8	SNP	1.000	A
ZNF208	7757	genome.wustl.edu	37	19	22155448	22155448	+	Silent	SNP	C	C	T			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr19:22155448C>T	ENST00000397126.4	-	4	2536	c.2388G>A	c.(2386-2388)aaG>aaA	p.K796K	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	796					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				TATGAATTCTCTTATGTTTAA	0.363																																						dbGAP											0													57.0	65.0	63.0					19																	22155448		2096	4241	6337	-	-	-	SO:0001819	synonymous_variant	0			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.2388G>A	19.37:g.22155448C>T				Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K796	ENST00000397126.4	37	c.2388	CCDS54240.1	19																																																																																			ZNF208	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000160321		0.363	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	HGNC	protein_coding	OTTHUMT00000464302.1	147	0.00	0	C	NM_007153		22155448	22155448	-1	no_errors	ENST00000397126	ensembl	human	known	69_37n	silent	60	21.05	16	SNP	0.000	T
ZNF267	10308	genome.wustl.edu	37	16	31927082	31927082	+	Silent	SNP	T	T	C			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr16:31927082T>C	ENST00000300870.10	+	4	1721	c.1512T>C	c.(1510-1512)agT>agC	p.S504S		NM_001265588.1|NM_003414.5	NP_001252517.1|NP_003405	Q14586	ZN267_HUMAN	zinc finger protein 267	504					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(5)|kidney(1)|large_intestine(14)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	41						TTAGCCGTAGTTCTTGCCTTA	0.343																																						dbGAP											0													44.0	47.0	46.0					16																	31927082		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			X78925	CCDS32440.1	16p11.2	2013-01-08			ENSG00000185947	ENSG00000185947		"""Zinc fingers, C2H2-type"", ""-"""	13060	protein-coding gene	gene with protein product		604752				7865130	Standard	NM_003414		Approved	HZF2	uc002ecs.5	Q14586		ENST00000300870.10:c.1512T>C	16.37:g.31927082T>C			A0JNZ9|Q8NE41|Q9NRJ0	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S504	ENST00000300870.10	37	c.1512	CCDS32440.1	16																																																																																			ZNF267	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000185947		0.343	ZNF267-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF267	HGNC	protein_coding	OTTHUMT00000432446.2	97	0.00	0	T	NM_003414		31927082	31927082	+1	no_errors	ENST00000300870	ensembl	human	known	69_37n	silent	37	26.00	13	SNP	0.000	C
ZNF280B	140883	genome.wustl.edu	37	22	22842274	22842274	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr22:22842274G>A	ENST00000406426.1	-	4	2192	c.1450C>T	c.(1450-1452)Caa>Taa	p.Q484*	ZNF280B_ENST00000360412.2_Nonsense_Mutation_p.Q484*			Q86YH2	Z280B_HUMAN	zinc finger protein 280B	484					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(2)	22	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		TTAAACATTTGATGACACTGG	0.443																																						dbGAP											0													139.0	131.0	134.0					22																	22842274		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK097608	CCDS13799.1	22q11.2	2007-09-20	2007-09-20	2007-09-20	ENSG00000198477	ENSG00000275004			23022	protein-coding gene	gene with protein product			"""zinc finger protein 279"", ""suppressor of hairy wing homolog 2 (Drosophila)"""	ZNF279, SUHW2		9074928	Standard	NM_080764		Approved	5'OY11.1, ZNF632	uc002zwc.1	Q86YH2	OTTHUMG00000151066	ENST00000406426.1:c.1450C>T	22.37:g.22842274G>A	ENSP00000385998:p.Gln484*			Nonsense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q484*	ENST00000406426.1	37	c.1450	CCDS13799.1	22	.	.	.	.	.	.	.	.	.	.	G	44	10.880133	0.99483	.	.	ENSG00000198477	ENST00000406426;ENST00000360412	.	.	.	4.85	3.81	0.43845	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.17832	T	0.49	-14.2909	8.2449	0.31682	0.0:0.1729:0.6481:0.179	.	.	.	.	X	484	.	ENSP00000353586:Q484X	Q	-	1	0	ZNF280B	21172274	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	2.723000	0.47277	1.377000	0.46286	0.655000	0.94253	CAA	ZNF280B	-	NULL	ENSG00000198477		0.443	ZNF280B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF280B	HGNC	protein_coding	OTTHUMT00000321170.2	224	0.00	0	G	NM_080764		22842274	22842274	-1	no_errors	ENST00000360412	ensembl	human	known	69_37n	nonsense	339	32.74	165	SNP	1.000	A
ZNF280B	140883	genome.wustl.edu	37	22	22843589	22843589	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr22:22843589G>C	ENST00000406426.1	-	4	877	c.135C>G	c.(133-135)atC>atG	p.I45M	ZNF280B_ENST00000360412.2_Missense_Mutation_p.I45M			Q86YH2	Z280B_HUMAN	zinc finger protein 280B	45					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(2)	22	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		CCCCAACAAAGATTAGCTCAG	0.398																																						dbGAP											0													152.0	134.0	140.0					22																	22843589		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK097608	CCDS13799.1	22q11.2	2007-09-20	2007-09-20	2007-09-20	ENSG00000198477	ENSG00000275004			23022	protein-coding gene	gene with protein product			"""zinc finger protein 279"", ""suppressor of hairy wing homolog 2 (Drosophila)"""	ZNF279, SUHW2		9074928	Standard	NM_080764		Approved	5'OY11.1, ZNF632	uc002zwc.1	Q86YH2	OTTHUMG00000151066	ENST00000406426.1:c.135C>G	22.37:g.22843589G>C	ENSP00000385998:p.Ile45Met			Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.I45M	ENST00000406426.1	37	c.135	CCDS13799.1	22	.	.	.	.	.	.	.	.	.	.	G	15.15	2.747129	0.49257	.	.	ENSG00000198477	ENST00000406426;ENST00000360412	T;T	0.35789	1.29;1.29	4.43	2.33	0.28932	.	.	.	.	.	T	0.53465	0.1798	M	0.78049	2.395	0.26903	N	0.96706	D	0.61080	0.989	P	0.62298	0.9	T	0.41484	-0.9506	9	0.87932	D	0	.	6.9486	0.24532	0.2099:0.0:0.7901:0.0	.	45	Q86YH2	Z280B_HUMAN	M	45	ENSP00000385998:I45M;ENSP00000353586:I45M	ENSP00000353586:I45M	I	-	3	3	ZNF280B	21173589	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	0.788000	0.26872	0.617000	0.30160	0.585000	0.79938	ATC	ZNF280B	-	NULL	ENSG00000198477		0.398	ZNF280B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF280B	HGNC	protein_coding	OTTHUMT00000321170.2	261	0.00	0	G	NM_080764		22843589	22843589	-1	no_errors	ENST00000360412	ensembl	human	known	69_37n	missense	445	34.22	232	SNP	1.000	C
ZNF700	90592	genome.wustl.edu	37	19	12059454	12059454	+	Silent	SNP	C	C	T			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr19:12059454C>T	ENST00000254321.5	+	4	758	c.615C>T	c.(613-615)ttC>ttT	p.F205F	ZNF763_ENST00000538752.1_Intron|ZNF700_ENST00000482090.1_Silent_p.F187F|ZNF763_ENST00000591944.1_Intron|CTD-2006C1.12_ENST00000586394.1_RNA|ZNF763_ENST00000590798.1_Intron	NM_001271848.1|NM_144566.1	NP_001258777.1|NP_653167.1	Q9H0M5	ZN700_HUMAN	zinc finger protein 700	205					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)		ZNF700/MAST1_ENST00000251472(2)	breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(13)|pancreas(1)|prostate(1)|urinary_tract(1)	33						CCTTTATTTTCCATTCAAGCA	0.388																																						dbGAP											0													85.0	89.0	87.0					19																	12059454		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL136732	CCDS32915.1, CCDS74289.1	19p13.2	2013-01-08			ENSG00000196757	ENSG00000196757		"""Zinc fingers, C2H2-type"", ""-"""	25292	protein-coding gene	gene with protein product							Standard	NM_144566		Approved	DKFZp434I1610	uc031rjk.1	Q9H0M5	OTTHUMG00000156421	ENST00000254321.5:c.615C>T	19.37:g.12059454C>T			B9EGU4	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F205	ENST00000254321.5	37	c.615	CCDS32915.1	19																																																																																			ZNF700	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196757		0.388	ZNF700-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF700	HGNC	protein_coding	OTTHUMT00000344126.2	285	0.00	0	C	NM_144566		12059454	12059454	+1	no_errors	ENST00000254321	ensembl	human	known	69_37n	silent	152	16.85	31	SNP	0.000	T
ZNF85	7639	genome.wustl.edu	37	19	21116931	21116931	+	Silent	SNP	G	G	A			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr19:21116931G>A	ENST00000328178.8	+	2	218	c.105G>A	c.(103-105)gaG>gaA	p.E35E	ZNF85_ENST00000345030.6_Silent_p.E35E|ZNF85_ENST00000596476.1_Silent_p.E3E|ZNF85_ENST00000601023.1_5'Flank|ZNF85_ENST00000300540.3_Silent_p.E35E|ZNF85_ENST00000597314.1_Silent_p.E35E	NM_001256173.1|NM_003429.4	NP_001243102.1|NP_003420.2	Q03923	ZNF85_HUMAN	zinc finger protein 85	35	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)	20						TGATGTTAGAGAACTACAGAA	0.383																																						dbGAP											0													167.0	189.0	181.0					19																	21116931		1511	2707	4218	-	-	-	SO:0001819	synonymous_variant	0			U35376	CCDS32977.1, CCDS58657.1	19p12	2013-01-08	2006-05-12			ENSG00000105750		"""Zinc fingers, C2H2-type"", ""-"""	13160	protein-coding gene	gene with protein product		603899	"""zinc finger protein 85 (HPF4, HTF1)"""			2505992	Standard	NM_003429		Approved	HPF4, HTF1	uc031rjx.1	Q03923		ENST00000328178.8:c.105G>A	19.37:g.21116931G>A			B9ZVP4|Q6NVI0	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E35	ENST00000328178.8	37	c.105	CCDS32977.1	19																																																																																			ZNF85	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000105750		0.383	ZNF85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF85	HGNC	protein_coding	OTTHUMT00000463430.1	394	0.00	0	G	NM_003429		21116931	21116931	+1	no_errors	ENST00000328178	ensembl	human	known	69_37n	silent	186	18.06	41	SNP	0.925	A
ZNF611	81856	genome.wustl.edu	37	19	53209290	53209290	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr19:53209290C>G	ENST00000319783.1	-	7	1334	c.1018G>C	c.(1018-1020)Gaa>Caa	p.E340Q	ZNF611_ENST00000602162.1_Missense_Mutation_p.E271Q|ZNF611_ENST00000453741.2_Missense_Mutation_p.E271Q|ZNF611_ENST00000602046.1_5'Flank|ZNF611_ENST00000543227.1_Missense_Mutation_p.E340Q|ZNF611_ENST00000595798.1_Missense_Mutation_p.E271Q|ZNF611_ENST00000540744.1_Missense_Mutation_p.E340Q	NM_030972.3	NP_112234.3	Q8N823	ZN611_HUMAN	zinc finger protein 611	340			E -> G (in dbSNP:rs4087790).		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(12)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(262;0.0233)|GBM - Glioblastoma multiforme(134;0.04)		TAAGGATTTTCTCCAGTATCA	0.343																																						dbGAP											0													77.0	76.0	77.0					19																	53209290		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK091389	CCDS12855.1, CCDS54312.1	19q13.42	2013-01-08			ENSG00000213020	ENSG00000213020		"""Zinc fingers, C2H2-type"", ""-"""	28766	protein-coding gene	gene with protein product						12477932	Standard	NM_030972		Approved	MGC5384	uc010ydq.2	Q8N823	OTTHUMG00000154908	ENST00000319783.1:c.1018G>C	19.37:g.53209290C>G	ENSP00000322427:p.Glu340Gln		B3KRD5|Q69YG9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E340Q	ENST00000319783.1	37	c.1018	CCDS12855.1	19	.	.	.	.	.	.	.	.	.	.	.	13.08	2.129618	0.37630	.	.	ENSG00000213020	ENST00000543227;ENST00000540744;ENST00000453741;ENST00000319783	T;T;T;T	0.20332	2.08;2.08;2.08;2.08	1.53	0.195	0.15151	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.38295	0.1035	M	0.71296	2.17	0.21782	N	0.999542	D	0.67145	0.996	D	0.66196	0.942	T	0.14727	-1.0462	9	0.59425	D	0.04	.	7.4888	0.27449	0.2589:0.7411:0.0:0.0	.	340	Q8N823	ZN611_HUMAN	Q	340;340;271;340	ENSP00000437616:E340Q;ENSP00000439211:E340Q;ENSP00000443505:E271Q;ENSP00000322427:E340Q	ENSP00000322427:E340Q	E	-	1	0	ZNF611	57901102	0.040000	0.19996	0.071000	0.20095	0.032000	0.12392	0.935000	0.28924	-0.067000	0.12976	0.306000	0.20318	GAA	ZNF611	-	pfscan_Znf_C2H2	ENSG00000213020		0.343	ZNF611-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF611	HGNC	protein_coding	OTTHUMT00000337612.1	196	0.00	0	C	NM_030972		53209290	53209290	-1	no_errors	ENST00000319783	ensembl	human	known	69_37n	missense	110	26.67	40	SNP	0.999	G
ZPLD1	131368	genome.wustl.edu	37	3	102181129	102181129	+	Nonsense_Mutation	SNP	C	C	G			TCGA-C8-A12Q-01A-11D-A10Y-09	TCGA-C8-A12Q-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b6b4af38-7ebb-4fa8-9876-6d88d2b1e7e4	c393110b-afe2-4838-bc8f-998ca23058d9	g.chr3:102181129C>G	ENST00000491959.1	+	13	1469	c.587C>G	c.(586-588)tCa>tGa	p.S196*	ZPLD1_ENST00000466937.1_Nonsense_Mutation_p.S196*|ZPLD1_ENST00000306176.1_Nonsense_Mutation_p.S212*			Q8TCW7	ZPLD1_HUMAN	zona pellucida-like domain containing 1	196	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.					integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(18)|ovary(2)|skin(3)	35						CATTAGGATTCAACCTACAAC	0.338																																						dbGAP											0													75.0	75.0	75.0					3																	102181129		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0			AY090780	CCDS2947.1	3q12.3	2009-03-25			ENSG00000170044	ENSG00000170044			27022	protein-coding gene	gene with protein product		615915				18632209	Standard	NM_175056		Approved		uc003dvt.1	Q8TCW7	OTTHUMG00000159229	ENST00000491959.1:c.587C>G	3.37:g.102181129C>G	ENSP00000420265:p.Ser196*		Q49AS1|Q8WU36	Nonsense_Mutation	SNP	pfam_Zona_pellucida_Endoglin/CD105,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105	p.S212*	ENST00000491959.1	37	c.635		3	.	.	.	.	.	.	.	.	.	.	C	39	7.356367	0.98231	.	.	ENSG00000170044	ENST00000491959;ENST00000306176;ENST00000466937	.	.	.	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-9.5173	18.9126	0.92491	0.0:1.0:0.0:0.0	.	.	.	.	X	196;212;196	.	ENSP00000307801:S212X	S	+	2	0	ZPLD1	103663819	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.378000	0.79679	2.455000	0.83008	0.591000	0.81541	TCA	ZPLD1	-	pfam_Zona_pellucida_Endoglin/CD105,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105	ENSG00000170044		0.338	ZPLD1-001	KNOWN	basic|appris_principal	protein_coding	ZPLD1	HGNC	protein_coding	OTTHUMT00000353984.1	379	0.00	0	C	NM_175056		102181129	102181129	+1	no_errors	ENST00000306176	ensembl	human	known	69_37n	nonsense	192	19.25	46	SNP	1.000	G
