#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
A2ML1	144568	genome.wustl.edu	37	12	8995942	8995942	+	Silent	SNP	C	C	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr12:8995942C>T	ENST00000299698.7	+	12	1641	c.1461C>T	c.(1459-1461)atC>atT	p.I487I	A2ML1_ENST00000539547.1_5'Flank	NM_001282424.1|NM_144670.4	NP_001269353.1|NP_653271			alpha-2-macroglobulin-like 1											NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						ACCAAGAGATCAGCTTCTCCT	0.562																																						dbGAP											0													49.0	48.0	49.0					12																	8995942		1942	4135	6077	-	-	-	SO:0001819	synonymous_variant	0			AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000299698.7:c.1461C>T	12.37:g.8995942C>T				Silent	SNP	pfam_A2M_comp,pfam_Macroglobln_a2,pfam_A2M_N_2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_SV_autoAg,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd	p.I487	ENST00000299698.7	37	c.1461	CCDS8596.2	12																																																																																			A2ML1	-	pfam_A2M_N_2	ENSG00000166535		0.562	A2ML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	A2ML1	HGNC	protein_coding	OTTHUMT00000250304.3	73	0.00	0	C	NM_144670		8995942	8995942	+1	no_errors	ENST00000299698	ensembl	human	known	69_37n	silent	48	22.58	14	SNP	0.040	T
ABCB5	340273	genome.wustl.edu	37	7	20793123	20793123	+	Silent	SNP	T	T	C			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr7:20793123T>C	ENST00000404938.2	+	27	4222	c.3570T>C	c.(3568-3570)agT>agC	p.S1190S	ABCB5_ENST00000258738.6_Silent_p.S745S	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	1190	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						ATAATGACAGTGAGAAGGTAA	0.393																																						dbGAP											0													87.0	87.0	87.0					7																	20793123		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.3570T>C	7.37:g.20793123T>C			A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Silent	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,pfam_ABC_ATPase_put,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.S745	ENST00000404938.2	37	c.2235	CCDS55090.1	7																																																																																			ABCB5	-	smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000004846		0.393	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	ABCB5	HGNC	protein_coding	OTTHUMT00000326736.2	106	0.00	0	T	NM_178559		20793123	20793123	+1	no_errors	ENST00000258738	ensembl	human	known	69_37n	silent	49	39.51	32	SNP	0.995	C
ABCB8	11194	genome.wustl.edu	37	7	150731848	150731848	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr7:150731848C>A	ENST00000297504.6	+	6	814	c.748C>A	c.(748-750)Cag>Aag	p.Q250K	ABCB8_ENST00000498578.1_Missense_Mutation_p.Q233K|ABCB8_ENST00000358849.4_Missense_Mutation_p.Q233K|ABCB8_ENST00000477719.1_Missense_Mutation_p.Q233K|ABCB8_ENST00000477092.1_Missense_Mutation_p.Q233K|ABCB8_ENST00000542328.1_Missense_Mutation_p.Q145K|ABCB8_ENST00000356058.4_Missense_Mutation_p.Q270K			Q9NUT2	ABCB8_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 8	250	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	26			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Doxorubicin(DB00997)	TAAGACAGGGCAGCTGGTGAG	0.532																																						dbGAP											0													139.0	116.0	123.0					7																	150731848		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF047690	CCDS5913.1, CCDS64798.1, CCDS64799.1, CCDS64800.1	7q36.1	2012-05-16			ENSG00000197150	ENSG00000197150		"""ATP binding cassette transporters / subfamily B"""	49	protein-coding gene	gene with protein product	"""mitochondrial ABC protein"""	605464				8894702	Standard	NM_001282291		Approved	EST328128, M-ABC1, MABC1	uc003wik.4	Q9NUT2	OTTHUMG00000158686	ENST00000297504.6:c.748C>A	7.37:g.150731848C>A	ENSP00000297504:p.Gln250Lys		A5D8W3|B2RBL8|B3KND2|B4DG02|G3XAP3|O95787|Q53GM0	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.Q250K	ENST00000297504.6	37	c.748		7	.	.	.	.	.	.	.	.	.	.	C	20.8	4.043107	0.75732	.	.	ENSG00000197150	ENST00000358849;ENST00000360651;ENST00000297504;ENST00000542328;ENST00000498578;ENST00000356058;ENST00000477719;ENST00000477092	D;D;D;D;T;T;T	0.94376	-3.41;-3.41;-3.41;-3.41;-1.33;-1.33;-1.33	5.06	5.06	0.68205	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.063060	0.64402	D	0.000004	D	0.90878	0.7134	L	0.28740	0.885	0.58432	D	0.999999	B;B;B;B;P;B;B	0.37352	0.12;0.256;0.157;0.392;0.591;0.213;0.213	B;B;B;B;B;B;B	0.42555	0.039;0.065;0.038;0.115;0.391;0.262;0.262	D	0.91905	0.5535	10	0.72032	D	0.01	-0.0019	15.9619	0.79936	0.0:1.0:0.0:0.0	.	145;233;63;250;233;233;270	G3XAP3;A5D8W3;B3KND2;Q9NUT2;Q9NUT2-2;C9JTY4;E7ENE8	.;.;.;ABCB8_HUMAN;.;.;.	K	233;216;250;145;233;270;233;233	ENSP00000351717:Q233K;ENSP00000297504:Q250K;ENSP00000438776:Q145K;ENSP00000418271:Q233K;ENSP00000348353:Q270K;ENSP00000419891:Q233K;ENSP00000419558:Q233K	ENSP00000297504:Q250K	Q	+	1	0	ABCB8	150362781	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	5.789000	0.69029	2.366000	0.80165	0.655000	0.94253	CAG	ABCB8	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1	ENSG00000197150		0.532	ABCB8-003	KNOWN	basic	protein_coding	ABCB8	HGNC	protein_coding	OTTHUMT00000351733.2	205	0.00	0	C	NM_007188		150731848	150731848	+1	no_errors	ENST00000297504	ensembl	human	known	69_37n	missense	55	32.10	26	SNP	1.000	A
ACADSB	36	genome.wustl.edu	37	10	124802613	124802613	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr10:124802613C>T	ENST00000358776.4	+	6	747	c.733C>T	c.(733-735)Cat>Tat	p.H245Y	ACADSB_ENST00000496730.2_3'UTR|ACADSB_ENST00000368869.4_Missense_Mutation_p.H143Y	NM_001609.3	NP_001600.1	P45954	ACDSB_HUMAN	acyl-CoA dehydrogenase, short/branched chain	245					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|fatty acid metabolic process (GO:0006631)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)		Colorectal(40;0.0811)|COAD - Colon adenocarcinoma(40;0.0835)	L-Isoleucine(DB00167)|Valproic Acid(DB00313)	TCCGGGCCTTCATATAGGGAA	0.403																																						dbGAP											0													123.0	128.0	126.0					10																	124802613		2203	4300	6503	-	-	-	SO:0001583	missense	0			U12778	CCDS7634.1	10q25-q26	2014-09-17	2010-04-30		ENSG00000196177	ENSG00000196177	1.3.99.-		91	protein-coding gene	gene with protein product		600301	"""acyl-Coenzyme A dehydrogenase, short/branched chain"""			7698750, 7759115	Standard	NM_001609		Approved	SBCAD, ACAD7	uc001lhb.3	P45954	OTTHUMG00000019200	ENST00000358776.4:c.733C>T	10.37:g.124802613C>T	ENSP00000357873:p.His245Tyr		B4DQ51|Q5SQN6|Q96CX7	Missense_Mutation	SNP	pfam_Acyl-CoA_Oxase/DH_1,pfam_Acyl-CoA_DH_N,pfam_Acyl-CoA_DH_2_C,pfam_Acyl-CoA_Oxase/DH_cen-dom,superfamily_AcylCoA_DH/oxidase,superfamily_AcylCo_DH/oxidase_C	p.H245Y	ENST00000358776.4	37	c.733	CCDS7634.1	10	.	.	.	.	.	.	.	.	.	.	C	12.95	2.091432	0.36952	.	.	ENSG00000196177	ENST00000368869;ENST00000358776	D;D	0.98926	-5.24;-5.24	5.63	5.63	0.86233	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA oxidase/dehydrogenase, central domain (1);	0.233361	0.44285	D	0.000475	D	0.96197	0.8760	N	0.20766	0.605	0.54753	D	0.999988	B	0.33694	0.421	B	0.31751	0.135	D	0.95176	0.8295	10	0.48119	T	0.1	.	19.6816	0.95965	0.0:1.0:0.0:0.0	.	245	P45954	ACDSB_HUMAN	Y	143;245	ENSP00000357862:H143Y;ENSP00000357873:H245Y	ENSP00000357873:H245Y	H	+	1	0	ACADSB	124792603	0.993000	0.37304	0.254000	0.24359	0.196000	0.23810	4.823000	0.62694	2.632000	0.89209	0.557000	0.71058	CAT	ACADSB	-	superfamily_AcylCoA_DH/oxidase	ENSG00000196177		0.403	ACADSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACADSB	HGNC	protein_coding	OTTHUMT00000050843.1	170	0.00	0	C	NM_001609		124802613	124802613	+1	no_errors	ENST00000358776	ensembl	human	known	69_37n	missense	159	15.43	29	SNP	0.998	T
AHNAK2	113146	genome.wustl.edu	37	14	105409722	105409722	+	Silent	SNP	G	G	A	rs372712364	byFrequency	TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr14:105409722G>A	ENST00000333244.5	-	7	12185	c.12066C>T	c.(12064-12066)tcC>tcT	p.S4022S	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4022						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CCAGGTCAGCGGAAGGGGGCT	0.657													.|||	2	0.000399361	0.0008	0.0014	5008	,	,		17513	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													109.0	115.0	113.0					14																	105409722		1954	4133	6087	-	-	-	SO:0001819	synonymous_variant	0			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.12066C>T	14.37:g.105409722G>A			Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.S4022	ENST00000333244.5	37	c.12066	CCDS45177.1	14																																																																																			AHNAK2	-	NULL	ENSG00000185567		0.657	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	174	0.00	0	G	NM_138420		105409722	105409722	-1	no_errors	ENST00000333244	ensembl	human	known	69_37n	silent	46	47.73	42	SNP	0.000	A
AHNAK2	113146	genome.wustl.edu	37	14	105420515	105420515	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr14:105420515C>T	ENST00000333244.5	-	7	1392	c.1273G>A	c.(1273-1275)Gag>Aag	p.E425K	AHNAK2_ENST00000557457.1_5'Flank	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	425						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GCCTGCCCCTCCAGGGTCTTT	0.647																																						dbGAP											0													54.0	58.0	57.0					14																	105420515		2016	4172	6188	-	-	-	SO:0001583	missense	0			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.1273G>A	14.37:g.105420515C>T	ENSP00000353114:p.Glu425Lys		Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.E425K	ENST00000333244.5	37	c.1273	CCDS45177.1	14	.	.	.	.	.	.	.	.	.	.	c	15.68	2.906302	0.52333	.	.	ENSG00000185567	ENST00000333244	T	0.02944	4.1	5.15	-8.16	0.01061	.	.	.	.	.	T	0.01320	0.0043	N	0.14661	0.345	0.09310	N	1	B	0.19817	0.039	B	0.18871	0.023	T	0.47849	-0.9085	9	0.13470	T	0.59	.	3.622	0.08099	0.0984:0.122:0.2923:0.4873	.	425	Q8IVF2	AHNK2_HUMAN	K	425	ENSP00000353114:E425K	ENSP00000353114:E425K	E	-	1	0	AHNAK2	104491560	0.000000	0.05858	0.000000	0.03702	0.051000	0.14879	-0.329000	0.07935	-1.627000	0.01550	0.650000	0.86243	GAG	AHNAK2	-	NULL	ENSG00000185567		0.647	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	69	0.00	0	C	NM_138420		105420515	105420515	-1	no_errors	ENST00000333244	ensembl	human	known	69_37n	missense	30	28.57	12	SNP	0.000	T
AKNA	80709	genome.wustl.edu	37	9	117099531	117099531	+	Missense_Mutation	SNP	T	T	G			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr9:117099531T>G	ENST00000307564.4	-	22	4284	c.4123A>C	c.(4123-4125)Aca>Cca	p.T1375P	AKNA_ENST00000374088.3_Missense_Mutation_p.T1375P|AKNA_ENST00000374079.4_Missense_Mutation_p.T320P|AKNA_ENST00000374075.5_Missense_Mutation_p.T1294P|AKNA_ENST00000223791.3_Missense_Mutation_p.T835P|AKNA_ENST00000492875.1_5'UTR	NM_030767.4	NP_110394.3	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	1375					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(7)|liver(2)|lung(22)|ovary(4)|stomach(2)	51						GGAGAGGCTGTGGGCGGCCAC	0.662																																						dbGAP											0													43.0	46.0	45.0					9																	117099531		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK024431	CCDS6805.1	9q32	2008-02-05			ENSG00000106948	ENSG00000106948			24108	protein-coding gene	gene with protein product		605729				11268217, 11853319	Standard	NM_030767		Approved	KIAA1968	uc004bis.3	Q7Z591	OTTHUMG00000020538	ENST00000307564.4:c.4123A>C	9.37:g.117099531T>G	ENSP00000303769:p.Thr1375Pro		Q05BK5|Q5T535|Q5T536|Q5T537|Q64FX6|Q64FX7|Q64FX8|Q64FY2|Q6ZMK0|Q6ZNL2|Q6ZTX0|Q8TET1|Q8TF33|Q96RR9|Q9H7P7	Missense_Mutation	SNP	pfam_TF_AT-hook	p.T1375P	ENST00000307564.4	37	c.4123	CCDS6805.1	9	.	.	.	.	.	.	.	.	.	.	T	9.319	1.057602	0.19907	.	.	ENSG00000106948	ENST00000307564;ENST00000374079;ENST00000374088;ENST00000223791;ENST00000374075	T;T;T;T;T	0.20881	2.57;2.04;2.57;2.34;2.56	5.0	-9.99	0.00435	.	.	.	.	.	T	0.07773	0.0195	N	0.12182	0.205	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.09377	0.003;0.004	T	0.31779	-0.9931	9	0.48119	T	0.1	3.3487	2.9241	0.05778	0.1989:0.4536:0.2083:0.1392	.	1375;1294	Q7Z591;Q7Z591-2	AKNA_HUMAN;.	P	1375;320;1375;835;1294	ENSP00000303769:T1375P;ENSP00000363192:T320P;ENSP00000363201:T1375P;ENSP00000223791:T835P;ENSP00000363188:T1294P	ENSP00000223791:T835P	T	-	1	0	AKNA	116139352	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-1.609000	0.02066	-2.912000	0.00307	-0.464000	0.05259	ACA	AKNA	-	NULL	ENSG00000106948		0.662	AKNA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	AKNA	HGNC	protein_coding	OTTHUMT00000053767.2	124	0.00	0	T	NM_030767		117099531	117099531	-1	no_errors	ENST00000307564	ensembl	human	known	69_37n	missense	33	14.29	6	SNP	0.000	G
AMD1	262	genome.wustl.edu	37	6	111214197	111214197	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr6:111214197G>A	ENST00000368885.3	+	8	1129	c.793G>A	c.(793-795)Gat>Aat	p.D265N	AMD1_ENST00000451850.2_Missense_Mutation_p.D145N|AMD1_ENST00000368877.5_Missense_Mutation_p.D236N|AMD1_ENST00000368882.3_Missense_Mutation_p.D117N|AMD1_ENST00000368876.1_Missense_Mutation_p.D196N	NM_001634.4	NP_001625.2	P17707	DCAM_HUMAN	adenosylmethionine decarboxylase 1	265					cellular nitrogen compound metabolic process (GO:0034641)|polyamine metabolic process (GO:0006595)|S-adenosylmethioninamine biosynthetic process (GO:0006557)|small molecule metabolic process (GO:0044281)|spermidine biosynthetic process (GO:0008295)|spermine biosynthetic process (GO:0006597)	cytosol (GO:0005829)	adenosylmethionine decarboxylase activity (GO:0004014)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(2)	8		all_cancers(87;3.83e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0209)		OV - Ovarian serous cystadenocarcinoma(136;0.0522)|Epithelial(106;0.111)|all cancers(137;0.143)	S-Adenosylmethionine(DB00118)	GACCTCCTATGATGACCTGAT	0.343																																						dbGAP											0													95.0	100.0	98.0					6																	111214197		2203	4300	6503	-	-	-	SO:0001583	missense	0			M88006	CCDS5086.1, CCDS75504.1, CCDS75505.1	6q21	2014-05-13			ENSG00000123505	ENSG00000123505	4.1.1.50		457	protein-coding gene	gene with protein product		180980	"""S-adenosylmethionine decarboxylase 1"""				Standard	NM_001634		Approved	SAMDC	uc003puk.1	P17707	OTTHUMG00000015369	ENST00000368885.3:c.793G>A	6.37:g.111214197G>A	ENSP00000357880:p.Asp265Asn		E1P5F7|Q5VXN4|Q5VXN6|Q9BWK4	Missense_Mutation	SNP	pfam_S-AdoMet_decarboxylase,superfamily_S-AdoMet_deCO2ase_core,pirsf_S-AdoMet_decarboxylase_subgr,tigrfam_S-AdoMet_decarboxylase_subgr	p.D265N	ENST00000368885.3	37	c.793	CCDS5086.1	6	.	.	.	.	.	.	.	.	.	.	G	17.41	3.382976	0.61845	.	.	ENSG00000123505	ENST00000368885;ENST00000368882;ENST00000451850;ENST00000368877;ENST00000368876	.	.	.	5.25	5.25	0.73442	S-adenosylmethionine decarboxylase, core (2);	0.000000	0.85682	D	0.000000	T	0.49321	0.1550	N	0.25825	0.765	0.80722	D	1	B;B;B	0.30763	0.294;0.014;0.143	P;B;B	0.45119	0.47;0.01;0.065	T	0.49283	-0.8956	9	0.17369	T	0.5	.	19.2117	0.93758	0.0:0.0:1.0:0.0	.	145;236;265	B4DZ60;A6NNH3;P17707	.;.;DCAM_HUMAN	N	265;117;145;236;196	.	ENSP00000357870:D196N	D	+	1	0	AMD1	111320890	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.307000	0.96226	2.611000	0.88343	0.591000	0.81541	GAT	AMD1	-	pfam_S-AdoMet_decarboxylase,superfamily_S-AdoMet_deCO2ase_core,pirsf_S-AdoMet_decarboxylase_subgr,tigrfam_S-AdoMet_decarboxylase_subgr	ENSG00000123505		0.343	AMD1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	AMD1	HGNC	protein_coding	OTTHUMT00000041816.1	97	0.00	0	G			111214197	111214197	+1	no_errors	ENST00000368885	ensembl	human	known	69_37n	missense	75	24.24	24	SNP	1.000	A
ANKRD18A	253650	genome.wustl.edu	37	9	38575638	38575638	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr9:38575638C>T	ENST00000399703.5	-	15	3173	c.2799G>A	c.(2797-2799)atG>atA	p.M933I	ANKRD18A_ENST00000313339.3_Missense_Mutation_p.M54I|ANKRD18A_ENST00000566717.2_Missense_Mutation_p.M71I|ANKRD18A_ENST00000607974.1_Missense_Mutation_p.M54I|ANKRD18A_ENST00000357072.5_5'UTR	NM_147195.2	NP_671728.2	Q8IVF6	AN18A_HUMAN	ankyrin repeat domain 18A	933										NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|prostate(1)|skin(2)|stomach(1)	16						GAAAATATTTCATCCGCTGTT	0.363																																						dbGAP											0													79.0	76.0	77.0					9																	38575638		692	1591	2283	-	-	-	SO:0001583	missense	0			AB095935	CCDS55311.1	9p13.1	2013-01-10			ENSG00000180071	ENSG00000180071		"""Ankyrin repeat domain containing"""	23643	protein-coding gene	gene with protein product							Standard	NM_147195		Approved	KIAA2015, FLJ35740	uc004abg.4	Q8IVF6	OTTHUMG00000019950	ENST00000399703.5:c.2799G>A	9.37:g.38575638C>T	ENSP00000382610:p.Met933Ile		A7MD11|A8MVU5|Q5SY86|Q7Z468|Q8NA88	Missense_Mutation	SNP	pfam_DUF3496,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.M933I	ENST00000399703.5	37	c.2799	CCDS55311.1	9	.	.	.	.	.	.	.	.	.	.	C	6.420	0.445607	0.12164	.	.	ENSG00000180071	ENST00000313339;ENST00000357072;ENST00000399703	T;T	0.29655	1.56;1.56	1.4	-1.07	0.09968	.	.	.	.	.	T	0.28732	0.0712	M	0.63428	1.95	0.09310	N	1	P;B	0.39535	0.677;0.267	B;B	0.40199	0.322;0.24	T	0.16247	-1.0409	9	0.42905	T	0.14	.	6.8	0.23746	0.0:0.5532:0.4468:0.0	.	54;933	Q6QA70;Q8IVF6	.;AN18A_HUMAN	I	54;54;933	ENSP00000326555:M54I;ENSP00000382610:M933I	ENSP00000326555:M54I	M	-	3	0	ANKRD18A	38565638	0.000000	0.05858	0.002000	0.10522	0.068000	0.16541	-0.207000	0.09384	-0.300000	0.08895	0.194000	0.17425	ATG	ANKRD18A	-	pfam_DUF3496	ENSG00000180071		0.363	ANKRD18A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD18A	HGNC	protein_coding	OTTHUMT00000052506.3	151	0.00	0	C			38575638	38575638	-1	no_errors	ENST00000399703	ensembl	human	known	69_37n	missense	73	32.73	36	SNP	0.004	T
AP4E1	23431	genome.wustl.edu	37	15	51291329	51291329	+	Nonsense_Mutation	SNP	C	C	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr15:51291329C>T	ENST00000261842.5	+	19	3071	c.2965C>T	c.(2965-2967)Caa>Taa	p.Q989*	AP4E1_ENST00000560508.1_Nonsense_Mutation_p.Q914*|AP4E1_ENST00000561397.1_Intron	NM_001252127.1|NM_007347.4	NP_001239056.1|NP_031373.2	Q9UPM8	AP4E1_HUMAN	adaptor-related protein complex 4, epsilon 1 subunit	989					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	coated pit (GO:0005905)|Golgi apparatus (GO:0005794)|membrane coat (GO:0030117)				breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(5)|skin(2)	27				all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)		CAAAAGCTTTCAATATAGTGT	0.373																																						dbGAP											0													95.0	91.0	92.0					15																	51291329		2196	4294	6490	-	-	-	SO:0001587	stop_gained	0			AB030653	CCDS32240.1, CCDS58362.1	15q21.2	2014-09-17			ENSG00000081014	ENSG00000081014			573	protein-coding gene	gene with protein product		607244				10436028, 21620353	Standard	NM_007347		Approved	AP-4-EPSILON, SPG51	uc001zyx.2	Q9UPM8	OTTHUMG00000172458	ENST00000261842.5:c.2965C>T	15.37:g.51291329C>T	ENSP00000261842:p.Gln989*		A0AVD6|A1L4A9|A6NNX7|H0YKX4|Q68D31|Q9Y588	Nonsense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_Coatomer_bsu_C,superfamily_ARM-type_fold,pirsf_AP4_complex_esu	p.Q989*	ENST00000261842.5	37	c.2965	CCDS32240.1	15	.	.	.	.	.	.	.	.	.	.	C	40	8.201017	0.98704	.	.	ENSG00000081014	ENST00000261842	.	.	.	5.04	5.04	0.67666	.	0.183667	0.48767	D	0.000174	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	-4.3434	15.707	0.77592	0.0:1.0:0.0:0.0	.	.	.	.	X	989	.	ENSP00000261842:Q989X	Q	+	1	0	AP4E1	49078621	1.000000	0.71417	0.969000	0.41365	0.818000	0.46254	3.556000	0.53734	2.621000	0.88768	0.655000	0.94253	CAA	AP4E1	-	pfam_Coatomer_bsu_C,pirsf_AP4_complex_esu	ENSG00000081014		0.373	AP4E1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	AP4E1	HGNC	protein_coding	OTTHUMT00000418656.1	161	0.00	0	C			51291329	51291329	+1	no_errors	ENST00000261842	ensembl	human	known	69_37n	nonsense	126	21.12	34	SNP	0.819	T
ARHGAP1	392	genome.wustl.edu	37	11	46702881	46702881	+	Silent	SNP	G	G	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr11:46702881G>A	ENST00000311956.4	-	6	595	c.498C>T	c.(496-498)ttC>ttT	p.F166F		NM_004308.3	NP_004299.1	Q07960	RHG01_HUMAN	Rho GTPase activating protein 1	166	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	Rac GTPase activator activity (GO:0030675)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			endometrium(1)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	11		Lung NSC(402;1.76e-12)|all_lung(304;1.3e-11)		GBM - Glioblastoma multiforme(35;5.17e-06)|BRCA - Breast invasive adenocarcinoma(625;0.00112)|Lung(87;0.153)		GAGTTTTGATGAACATGGTTG	0.557																																						dbGAP											0													294.0	211.0	239.0					11																	46702881		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0			BC018118	CCDS7922.1	11p11.2	2006-04-11			ENSG00000175220	ENSG00000175220		"""Rho GTPase activating proteins"""	673	protein-coding gene	gene with protein product		602732				8288572	Standard	NM_004308		Approved	RhoGAP, p50rhoGAP, CDC42GAP, Cdc42GAP	uc001ndd.4	Q07960	OTTHUMG00000166567	ENST00000311956.4:c.498C>T	11.37:g.46702881G>A			D3DQQ6	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_CRAL-TRIO_dom,superfamily_Rho_GTPase_activation_prot,superfamily_CRAL-TRIO_dom,smart_RhoGAP_dom,pfscan_CRAL-TRIO_dom,pfscan_RhoGAP_dom	p.H120Y	ENST00000311956.4	37	c.358	CCDS7922.1	11	.	.	.	.	.	.	.	.	.	.	G	9.951	1.220108	0.22373	.	.	ENSG00000175220	ENST00000528837	.	.	.	5.28	5.28	0.74379	.	.	.	.	.	T	0.74951	0.3784	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.73849	-0.3853	4	.	.	.	.	18.9148	0.92501	0.0:0.0:1.0:0.0	.	.	.	.	Y	120	.	.	H	-	1	0	ARHGAP1	46659457	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	4.557000	0.60782	2.470000	0.83445	0.561000	0.74099	CAT	ARHGAP1	-	pfam_CRAL-TRIO_dom,superfamily_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	ENSG00000175220		0.557	ARHGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP1	HGNC	protein_coding	OTTHUMT00000390472.1	182	0.00	0	G	NM_004308		46702881	46702881	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000528837	ensembl	human	novel	69_37n	missense	53	35.37	29	SNP	1.000	A
ARHGEF15	22899	genome.wustl.edu	37	17	8215677	8215677	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr17:8215677C>T	ENST00000361926.3	+	2	430	c.320C>T	c.(319-321)tCc>tTc	p.S107F	ARHGEF15_ENST00000421050.1_Missense_Mutation_p.S107F	NM_173728.3	NP_776089.2	O94989	ARHGF_HUMAN	Rho guanine nucleotide exchange factor (GEF) 15	107	Pro-rich.				negative regulation of synapse maturation (GO:2000297)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|regulation of catalytic activity (GO:0050790)|retina vasculature morphogenesis in camera-type eye (GO:0061299)	cytoplasm (GO:0005737)|dendrite (GO:0030425)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(9)|large_intestine(5)|lung(11)|ovary(5)|prostate(3)|skin(2)|urinary_tract(1)	37						TCCCGGCGCTCCGCCTCCCCA	0.667																																						dbGAP											0													103.0	110.0	108.0					17																	8215677		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020722	CCDS11139.1	17p13.1	2011-11-16			ENSG00000198844	ENSG00000198844		"""Rho guanine nucleotide exchange factors"""	15590	protein-coding gene	gene with protein product	"""Rho guanine exchange factor (GEF) 15"""	608504				10048485	Standard	NM_173728		Approved	KIAA0915, Vsm-RhoGEF, ARGEF15, FLJ13791, MGC44868	uc002glc.3	O94989	OTTHUMG00000108187	ENST00000361926.3:c.320C>T	17.37:g.8215677C>T	ENSP00000355026:p.Ser107Phe		A8K6G1|Q8N449|Q9H8B4	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	p.S107F	ENST00000361926.3	37	c.320	CCDS11139.1	17	.	.	.	.	.	.	.	.	.	.	C	7.724	0.697880	0.15106	.	.	ENSG00000198844	ENST00000361926;ENST00000421050	T;T	0.72394	-0.65;-0.65	4.85	3.86	0.44501	.	0.309004	0.24467	N	0.038280	T	0.52597	0.1744	L	0.27053	0.805	0.09310	N	1	P;P	0.46512	0.879;0.879	B;B	0.41202	0.235;0.35	T	0.42999	-0.9418	10	0.15499	T	0.54	-24.3026	9.2253	0.37402	0.0:0.8988:0.0:0.1012	.	107;107	D3DTR7;O94989	.;ARHGF_HUMAN	F	107	ENSP00000355026:S107F;ENSP00000412505:S107F	ENSP00000355026:S107F	S	+	2	0	ARHGEF15	8156402	0.952000	0.32445	0.939000	0.37840	0.511000	0.34104	3.576000	0.53878	2.549000	0.85964	0.555000	0.69702	TCC	ARHGEF15	-	NULL	ENSG00000198844		0.667	ARHGEF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF15	HGNC	protein_coding	OTTHUMT00000226993.2	91	0.00	0	C	NM_173728		8215677	8215677	+1	no_errors	ENST00000361926	ensembl	human	known	69_37n	missense	51	20.31	13	SNP	0.262	T
ARHGAP44	9912	genome.wustl.edu	37	17	12799747	12799747	+	Silent	SNP	G	G	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr17:12799747G>A	ENST00000379672.5	+	3	417	c.117G>A	c.(115-117)gtG>gtA	p.V39V	ARHGAP44_ENST00000262444.9_Silent_p.V39V|ARHGAP44_ENST00000340825.3_Silent_p.V39V	NM_014859.4	NP_055674.4	Q17R89	RHG44_HUMAN	Rho GTPase activating protein 44	39	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				exocytosis (GO:0006887)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endosome (GO:0005768)|leading edge membrane (GO:0031256)|synapse (GO:0045202)	GTPase activator activity (GO:0005096)|phospholipid binding (GO:0005543)			NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(7)|skin(1)|urinary_tract(1)	31						TGGAGCTGGTGAAACAGGTGT	0.617																																						dbGAP											0													40.0	45.0	43.0					17																	12799747		2101	4246	6347	-	-	-	SO:0001819	synonymous_variant	0				CCDS45616.1	17p12	2011-06-29			ENSG00000006740	ENSG00000006740		"""Rho GTPase activating proteins"""	29096	protein-coding gene	gene with protein product						19273615	Standard	NM_014859		Approved	KIAA0672, RICH-2, RICH2	uc002gnr.4	Q17R89	OTTHUMG00000058765	ENST00000379672.5:c.117G>A	17.37:g.12799747G>A			A6NCP5|A8MQB2|O75160|Q7Z5Z7|Q9Y4Q4	Silent	SNP	pfam_BAR_dom,pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_BAR_dom,smart_RhoGAP_dom,pfscan_BAR_dom,pfscan_RhoGAP_dom	p.V39	ENST00000379672.5	37	c.117	CCDS45616.1	17																																																																																			ARHGAP44	-	pfam_BAR_dom,smart_BAR_dom,pfscan_BAR_dom	ENSG00000006740		0.617	ARHGAP44-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP44	HGNC	protein_coding	OTTHUMT00000441566.1	114	0.00	0	G	NM_014859		12799747	12799747	+1	no_errors	ENST00000379672	ensembl	human	known	69_37n	silent	26	18.75	6	SNP	1.000	A
ARID1A	8289	genome.wustl.edu	37	1	27057874	27057874	+	Nonsense_Mutation	SNP	C	C	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr1:27057874C>T	ENST00000324856.7	+	3	1953	c.1582C>T	c.(1582-1584)Cag>Tag	p.Q528*	ARID1A_ENST00000457599.2_Nonsense_Mutation_p.Q528*|ARID1A_ENST00000374152.2_Nonsense_Mutation_p.Q145*	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	528					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GCCTCCACATCAGCAGTCCCC	0.617			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																	dbGAP		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	0													244.0	237.0	239.0					1																	27057874		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.1582C>T	1.37:g.27057874C>T	ENSP00000320485:p.Gln528*		D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.Q528*	ENST00000324856.7	37	c.1582	CCDS285.1	1	.	.	.	.	.	.	.	.	.	.	C	35	5.432722	0.96150	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152	.	.	.	5.44	5.44	0.79542	.	0.231855	0.38326	N	0.001734	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	-6.1739	19.4471	0.94852	0.0:1.0:0.0:0.0	rs35170002	.	.	.	X	528;528;145	.	ENSP00000320485:Q528X	Q	+	1	0	ARID1A	26930461	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	3.531000	0.53546	2.824000	0.97209	0.655000	0.94253	CAG	ARID1A	-	NULL	ENSG00000117713		0.617	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARID1A	HGNC	protein_coding	OTTHUMT00000011437.2	592	0.00	0	C	NM_139135		27057874	27057874	+1	no_errors	ENST00000324856	ensembl	human	known	69_37n	nonsense	265	22.61	78	SNP	1.000	T
ASCC2	84164	genome.wustl.edu	37	22	30189366	30189366	+	Silent	SNP	G	G	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr22:30189366G>A	ENST00000397771.2	-	18	2079	c.1902C>T	c.(1900-1902)gaC>gaT	p.D634D	ASCC2_ENST00000307790.3_Silent_p.D634D|ASCC2_ENST00000542393.1_Silent_p.D558D			Q9H1I8	ASCC2_HUMAN	activating signal cointegrator 1 complex subunit 2	634					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					endometrium(3)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(5;0.000103)|Epithelial(10;0.0169)|all cancers(5;0.0259)			TGATGAGCTCGTCATCAGAGT	0.587																																						dbGAP											0													77.0	57.0	64.0					22																	30189366		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY013289	CCDS13869.1, CCDS56226.1	22q12.1	2004-07-27			ENSG00000100325	ENSG00000100325			24103	protein-coding gene	gene with protein product	"""ASC 1 complex subunit P100"""	614216				12077347, 9847074	Standard	NM_032204		Approved	ASC1p100, FLJ21588, DKFZp586O0223	uc003agr.3	Q9H1I8	OTTHUMG00000067658	ENST00000397771.2:c.1902C>T	22.37:g.30189366G>A			B7Z8E0|F5H6J9|Q4TT54|Q8TAZ0|Q9H711|Q9H9D6	Silent	SNP	pfam_CUE,superfamily_UBA-like,smart_CUE,pfscan_CUE	p.D634	ENST00000397771.2	37	c.1902	CCDS13869.1	22																																																																																			ASCC2	-	NULL	ENSG00000100325		0.587	ASCC2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ASCC2	HGNC	protein_coding	OTTHUMT00000322127.1	81	0.00	0	G	NM_032204		30189366	30189366	-1	no_errors	ENST00000307790	ensembl	human	known	69_37n	silent	30	11.76	4	SNP	0.900	A
ASH1L	55870	genome.wustl.edu	37	1	155450397	155450397	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr1:155450397G>C	ENST00000368346.3	-	3	2903	c.2264C>G	c.(2263-2265)tCt>tGt	p.S755C	ASH1L_ENST00000392403.3_Missense_Mutation_p.S755C			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	755					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			GGCTGGCTCAGAATTACTATT	0.418																																						dbGAP											0													97.0	101.0	100.0					1																	155450397		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.2264C>G	1.37:g.155450397G>C	ENSP00000357330:p.Ser755Cys		Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	pfam_SET_dom,pfam_BAH_dom,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_AT_hook_DNA-bd_motif,smart_AWS,smart_SET_dom,smart_Bromodomain,smart_Znf_PHD,smart_BAH_dom,pfscan_AWS,pfscan_BAH_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Bromodomain	p.S755C	ENST00000368346.3	37	c.2264		1	.	.	.	.	.	.	.	.	.	.	G	13.30	2.195153	0.38806	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	D;D	0.89485	-2.52;-2.52	5.38	5.38	0.77491	.	0.109140	0.42821	D	0.000648	T	0.76926	0.4056	N	0.14661	0.345	0.80722	D	1	D;D	0.58268	0.97;0.982	B;P	0.47162	0.339;0.54	T	0.81618	-0.0851	10	0.59425	D	0.04	.	10.523	0.44931	0.1186:0.0:0.8814:0.0	.	755;755	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	C	755	ENSP00000357330:S755C;ENSP00000376204:S755C	ENSP00000357330:S755C	S	-	2	0	ASH1L	153717021	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.020000	0.57189	2.791000	0.96007	0.650000	0.86243	TCT	ASH1L	-	NULL	ENSG00000116539		0.418	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	ASH1L	HGNC	protein_coding	OTTHUMT00000039400.1	73	0.00	0	G	NM_018489		155450397	155450397	-1	no_errors	ENST00000368346	ensembl	human	known	69_37n	missense	54	28.95	22	SNP	1.000	C
ASPM	259266	genome.wustl.edu	37	1	197061060	197061060	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr1:197061060C>T	ENST00000367409.4	-	22	9677	c.9421G>A	c.(9421-9423)Gtt>Att	p.V3141I	ASPM_ENST00000294732.7_Missense_Mutation_p.V1556I|ASPM_ENST00000367408.1_Missense_Mutation_p.V806I	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	3141					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						ACTGAATTAACCTGCTTGTTA	0.323																																						dbGAP											0													78.0	79.0	79.0					1																	197061060		2203	4299	6502	-	-	-	SO:0001583	missense	0			AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.9421G>A	1.37:g.197061060C>T	ENSP00000356379:p.Val3141Ile		Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_CH-domain,superfamily_ARM-type_fold,smart_CH-domain,smart_IQ_motif_EF-hand-BS,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS	p.V3141I	ENST00000367409.4	37	c.9421	CCDS1389.1	1	.	.	.	.	.	.	.	.	.	.	C	9.560	1.118099	0.20877	.	.	ENSG00000066279	ENST00000367409;ENST00000294732;ENST00000367408;ENST00000367406	T;T;T	0.71579	-0.58;-0.58;1.54	5.28	-7.25	0.01470	.	0.875443	0.09807	N	0.753270	T	0.55000	0.1893	L	0.48642	1.525	0.09310	N	1	B;B;B	0.09022	0.002;0.001;0.0	B;B;B	0.12156	0.007;0.001;0.0	T	0.37686	-0.9695	10	0.21014	T	0.42	.	9.3635	0.38210	0.0:0.1101:0.2976:0.5923	.	1127;1556;3141	E7EQ84;Q4G1H1;Q8IZT6	.;.;ASPM_HUMAN	I	3141;1556;806;1127	ENSP00000356379:V3141I;ENSP00000294732:V1556I;ENSP00000356378:V806I	ENSP00000294732:V1556I	V	-	1	0	ASPM	195327683	0.001000	0.12720	0.000000	0.03702	0.037000	0.13140	-0.313000	0.08103	-1.495000	0.01831	-0.142000	0.14014	GTT	ASPM	-	superfamily_ARM-type_fold,smart_IQ_motif_EF-hand-BS	ENSG00000066279		0.323	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASPM	HGNC	protein_coding	OTTHUMT00000088256.1	95	0.00	0	C	NM_018136		197061060	197061060	-1	no_errors	ENST00000367409	ensembl	human	known	69_37n	missense	97	10.19	11	SNP	0.000	T
ATP8B5P	158381	genome.wustl.edu	37	9	35450104	35450104	+	RNA	SNP	G	G	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr9:35450104G>A	ENST00000430846.1	+	0	2954									ATPase, class I, type 8B, member 5, pseudogene																		TTCAGTATCAGACATGGCACA	0.413																																						dbGAP											0																																										-	-	-			0					9p13.3	2010-09-22			ENSG00000179766	ENSG00000179766		"""ATPases / P-type"""	27245	pseudogene	pseudogene	"""flippase expressed in testis splicing form A pseudogene"""					20210903, 19657017	Standard	NR_003582		Approved	FetA	uc010mkn.2		OTTHUMG00000019862		9.37:g.35450104G>A				RNA	SNP	-	NULL	ENST00000430846.1	37	NULL		9																																																																																			ATP8B5P	-	-	ENSG00000179766		0.413	ATP8B5P-002	KNOWN	basic	processed_transcript	ATP8B5P	HGNC	pseudogene	OTTHUMT00000052312.1	246	0.00	0	G	NR_003581.1		35450104	35450104	+1	no_errors	ENST00000430846	ensembl	human	known	69_37n	rna	91	26.02	32	SNP	0.993	A
B3GNT4	79369	genome.wustl.edu	37	12	122691843	122691843	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr12:122691843C>T	ENST00000324189.4	+	3	1401	c.1045C>T	c.(1045-1047)Cac>Tac	p.H349Y	B3GNT4_ENST00000545141.1_Intron|B3GNT4_ENST00000546192.1_Missense_Mutation_p.H324Y|B3GNT4_ENST00000535274.1_Missense_Mutation_p.H324Y	NM_030765.2	NP_110392.1	Q9C0J1	B3GN4_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4	349					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	13	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000297)|Epithelial(86;0.000497)|BRCA - Breast invasive adenocarcinoma(302;0.222)		CCTGCTGGTTCACCGCCTCAG	0.637																																						dbGAP											0													35.0	37.0	37.0					12																	122691843		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB049586	CCDS9227.1	12q24	2013-02-19						"""Beta 3-glycosyltransferases"""	15683	protein-coding gene	gene with protein product		605864				11042166	Standard	NM_030765		Approved	B3GN-T4, beta3Gn-T4	uc001ubx.3	Q9C0J1		ENST00000324189.4:c.1045C>T	12.37:g.122691843C>T	ENSP00000319636:p.His349Tyr		Q8N5W4|Q8N934|Q8ND21|Q8WWR5|Q8WY02|Q96QH5	Missense_Mutation	SNP	pfam_Glyco_trans_31,pfam_Fringe-like	p.H349Y	ENST00000324189.4	37	c.1045	CCDS9227.1	12	.	.	.	.	.	.	.	.	.	.	C	25.6	4.656765	0.88154	.	.	ENSG00000176383	ENST00000324189;ENST00000546192;ENST00000535274	T;T;T	0.52754	0.65;0.65;0.65	4.91	4.91	0.64330	.	0.000000	0.64402	D	0.000019	T	0.75910	0.3914	M	0.91459	3.21	0.53688	D	0.999971	D	0.89917	1.0	D	0.83275	0.996	T	0.82770	-0.0293	10	0.87932	D	0	.	17.7292	0.88373	0.0:1.0:0.0:0.0	.	349	Q9C0J1	B3GN4_HUMAN	Y	349;324;324	ENSP00000319636:H349Y;ENSP00000438840:H324Y;ENSP00000444534:H324Y	ENSP00000319636:H349Y	H	+	1	0	B3GNT4	121257796	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	7.448000	0.80631	2.280000	0.76307	0.491000	0.48974	CAC	B3GNT4	-	NULL	ENSG00000176383		0.637	B3GNT4-001	KNOWN	basic|CCDS	protein_coding	B3GNT4	HGNC	protein_coding	OTTHUMT00000401595.1	100	0.00	0	C	NM_030765		122691843	122691843	+1	no_errors	ENST00000324189	ensembl	human	known	69_37n	missense	35	25.53	12	SNP	1.000	T
BRCA1	672	genome.wustl.edu	37	17	41243518	41243518	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr17:41243518C>G	ENST00000357654.3	-	10	4148	c.4030G>C	c.(4030-4032)Gat>Cat	p.D1344H	BRCA1_ENST00000493795.1_Missense_Mutation_p.D1297H|BRCA1_ENST00000471181.2_Missense_Mutation_p.D1344H|BRCA1_ENST00000354071.3_Missense_Mutation_p.D1344H|BRCA1_ENST00000491747.2_Intron|BRCA1_ENST00000351666.3_Intron|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000346315.3_Missense_Mutation_p.D1344H|BRCA1_ENST00000309486.4_Missense_Mutation_p.D1048H|BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000468300.1_Intron|BRCA1_ENST00000352993.3_Intron|BRCA1_ENST00000586385.1_Intron	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	1344					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.D1344N(1)		NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		CTTTCTTCATCATCTGAAACC	0.428			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																												dbGAP	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	1	Substitution - Missense(1)	lung(1)											133.0	131.0	131.0					17																	41243518		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database		U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.4030G>C	17.37:g.41243518C>G	ENSP00000350283:p.Asp1344His		O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Missense_Mutation	SNP	pirsf_BRCA1,pfam_BRCT_dom,pfam_Znf_C3HC4_RING-type,superfamily_BRCT_dom,smart_Znf_RING,smart_BRCT_dom,pfscan_BRCT_dom,pfscan_Znf_RING	p.D1344H	ENST00000357654.3	37	c.4030	CCDS11453.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.24|15.24	2.775053|2.775053	0.49786|0.49786	.|.	.|.	ENSG00000012048|ENSG00000012048	ENST00000357654;ENST00000412061;ENST00000354071;ENST00000346315;ENST00000309486;ENST00000471181;ENST00000493795|ENST00000461574	D;D;D;D;D;D|.	0.88741|.	-2.3;-2.41;-2.39;-2.19;-2.3;-2.42|.	5.31|5.31	2.18|2.18	0.27775|0.27775	.|.	0.216400|.	0.32655|.	N|.	0.005815|.	T|T	0.38268|0.38268	0.1034|0.1034	L|L	0.46157|0.46157	1.445|1.445	0.28002|0.28002	N|N	0.935237|0.935237	B;B;B;B;P;B|.	0.49961|.	0.062;0.221;0.062;0.062;0.93;0.102|.	B;B;B;B;P;B|.	0.46975|.	0.039;0.039;0.039;0.039;0.533;0.085|.	T|T	0.26950|0.26950	-1.0088|-1.0088	10|5	0.38643|.	T|.	0.18|.	.|.	6.7399|6.7399	0.23431|0.23431	0.0:0.6966:0.1451:0.1583|0.0:0.6966:0.1451:0.1583	.|.	1344;1303;1344;1344;1344;1344|.	E7EMP0;E7ERL4;Q5YLB2;E9PFC7;P38398;P38398-2|.	.;.;.;.;BRCA1_HUMAN;.|.	H|I	1344;1344;1344;1344;1048;1344;1297|108	ENSP00000350283:D1344H;ENSP00000326002:D1344H;ENSP00000246907:D1344H;ENSP00000310938:D1048H;ENSP00000418960:D1344H;ENSP00000418775:D1297H|.	ENSP00000310938:D1048H|.	D|M	-|-	1|3	0|0	BRCA1|BRCA1	38497044|38497044	0.985000|0.985000	0.35326|0.35326	0.987000|0.987000	0.45799|0.45799	0.854000|0.854000	0.48673|0.48673	0.940000|0.940000	0.28992|0.28992	0.801000|0.801000	0.34066|0.34066	0.655000|0.655000	0.94253|0.94253	GAT|ATG	BRCA1	-	pirsf_BRCA1	ENSG00000012048		0.428	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA1	HGNC	protein_coding	OTTHUMT00000348798.2	238	0.00	0	C	NM_007294		41243518	41243518	-1	no_errors	ENST00000471181	ensembl	human	known	69_37n	missense	94	29.32	39	SNP	0.918	G
BRCA2	675	genome.wustl.edu	37	13	32971062	32971062	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr13:32971062G>C	ENST00000380152.3	+	26	9762	c.9529G>C	c.(9529-9531)Gaa>Caa	p.E3177Q	BRCA2_ENST00000544455.1_Missense_Mutation_p.E3177Q			P51587	BRCA2_HUMAN	breast cancer 2, early onset	3177					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		CAATGAAGCAGAAAACAAGCT	0.373			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	dbGAP	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	0													179.0	178.0	178.0					13																	32971062		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.9529G>C	13.37:g.32971062G>C	ENSP00000369497:p.Glu3177Gln		O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	pfam_DNA_recomb/repair_BRCA2_hlx,pfam_BRCA2_repeat,pfam_BRCA2_OB_3,pfam_BRCA2_OB_1,pfam_Tower,superfamily_DNA_recomb/repair_BRCA2_hlx,superfamily_NA-bd_OB-fold-like,pirsf_DNA_recomb/repair_BRCA2,pfscan_BRCA2_repeat	p.E3177Q	ENST00000380152.3	37	c.9529	CCDS9344.1	13	.	.	.	.	.	.	.	.	.	.	G	13.76	2.332667	0.41297	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	D;D	0.83163	-1.69;-1.69	5.94	3.31	0.37934	Nucleic acid-binding, OB-fold-like (1);BRCA2, oligonucleotide/oligosaccharide-binding 3 (1);	0.209847	0.49305	D	0.000158	D	0.85965	0.5820	L	0.58101	1.795	0.32335	N	0.560507	D	0.67145	0.996	P	0.61592	0.891	D	0.86071	0.1538	10	0.51188	T	0.08	.	8.9462	0.35760	0.2262:0.0:0.7738:0.0	.	3177	P51587	BRCA2_HUMAN	Q	3177	ENSP00000369497:E3177Q;ENSP00000439902:E3177Q	ENSP00000369497:E3177Q	E	+	1	0	BRCA2	31869062	1.000000	0.71417	0.800000	0.32199	0.737000	0.42083	3.077000	0.50089	0.426000	0.26116	0.563000	0.77884	GAA	BRCA2	-	pfam_BRCA2_OB_3,superfamily_NA-bd_OB-fold-like,pirsf_DNA_recomb/repair_BRCA2	ENSG00000139618		0.373	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA2	HGNC	protein_coding	OTTHUMT00000046000.2	119	0.00	0	G	NM_000059		32971062	32971062	+1	no_errors	ENST00000380152	ensembl	human	known	69_37n	missense	45	31.82	21	SNP	0.998	C
BTBD11	121551	genome.wustl.edu	37	12	108008853	108008853	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr12:108008853C>T	ENST00000280758.5	+	7	2443	c.1915C>T	c.(1915-1917)Cat>Tat	p.H639Y	BTBD11_ENST00000420571.2_Missense_Mutation_p.H639Y|BTBD11_ENST00000490090.2_Missense_Mutation_p.H639Y|RP11-128P10.1_ENST00000548473.1_RNA|BTBD11_ENST00000357167.4_Missense_Mutation_p.H176Y	NM_001018072.1	NP_001018082.1	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11	639						integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(18)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						CAGTACTCCTCATAAATATCC	0.418																																						dbGAP											0													139.0	129.0	133.0					12																	108008853		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091276	CCDS31893.1, CCDS41827.1	12q24.11	2013-10-02			ENSG00000151136	ENSG00000151136		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23844	protein-coding gene	gene with protein product							Standard	XM_005268645		Approved	FLJ33957, ABTB2B	uc001tmk.1	A6QL63	OTTHUMG00000150413	ENST00000280758.5:c.1915C>T	12.37:g.108008853C>T	ENSP00000280758:p.His639Tyr		A4FU41|B3KXG3|C9J019|C9JK80|E9PHS4|Q3ZTQ4|Q52M89|Q6ZV99|Q8N245	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_BTB_POZ,superfamily_BTB/POZ_fold,superfamily_Ankyrin_rpt-contain_dom,superfamily_Histone-fold,smart_Ankyrin_rpt,smart_BTB/POZ-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BTB/POZ-like	p.H639Y	ENST00000280758.5	37	c.1915	CCDS31893.1	12	.	.	.	.	.	.	.	.	.	.	C	13.30	2.197201	0.38806	.	.	ENSG00000151136	ENST00000280758;ENST00000420571;ENST00000490090;ENST00000357167	T;T;T;T	0.44083	1.13;1.22;1.2;0.93	5.76	5.76	0.90799	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.45955	0.1368	N	0.20574	0.59	0.80722	D	1	D;D;D;D	0.63880	0.991;0.986;0.993;0.988	P;P;P;P	0.62885	0.851;0.715;0.908;0.705	T	0.15752	-1.0426	10	0.07175	T	0.84	.	19.9857	0.97347	0.0:1.0:0.0:0.0	.	639;176;639;639	A6QL63-2;E9PHS4;A6QL63;A6QL63-3	.;.;BTBDB_HUMAN;.	Y	639;639;639;176	ENSP00000280758:H639Y;ENSP00000413889:H639Y;ENSP00000447319:H639Y;ENSP00000349690:H176Y	ENSP00000280758:H639Y	H	+	1	0	BTBD11	106532983	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.726000	0.68515	2.706000	0.92434	0.655000	0.94253	CAT	BTBD11	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000151136		0.418	BTBD11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BTBD11	HGNC	protein_coding	OTTHUMT00000318003.1	290	0.00	0	C	NM_152322		108008853	108008853	+1	no_errors	ENST00000280758	ensembl	human	known	69_37n	missense	147	25.38	50	SNP	1.000	T
CCDC181	57821	genome.wustl.edu	37	1	169390881	169390881	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr1:169390881G>T	ENST00000367806.3	-	3	940	c.788C>A	c.(787-789)tCt>tAt	p.S263Y	CCDC181_ENST00000367805.3_Missense_Mutation_p.S263Y|CCDC181_ENST00000491570.1_5'UTR|CCDC181_ENST00000545005.1_Missense_Mutation_p.S263Y	NM_021179.1	NP_067002.1	Q5TID7	CC181_HUMAN	coiled-coil domain containing 181	263						nucleus (GO:0005634)											GCCACTGACAGAGGAGTTGGA	0.458																																						dbGAP											0													151.0	145.0	147.0					1																	169390881		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL049687	CCDS1279.1, CCDS72979.1	1q24	2013-03-14	2013-03-14	2013-03-14	ENSG00000117477	ENSG00000117477			28051	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 114"""	C1orf114			Standard	XM_005245381		Approved	FLJ25846	uc001gfz.1	Q5TID7	OTTHUMG00000035448	ENST00000367806.3:c.788C>A	1.37:g.169390881G>T	ENSP00000356780:p.Ser263Tyr		O60780|Q53FD5|Q5TID9|Q8TC48	Missense_Mutation	SNP	NULL	p.S263Y	ENST00000367806.3	37	c.788		1	.	.	.	.	.	.	.	.	.	.	G	9.757	1.168981	0.21621	.	.	ENSG00000117477	ENST00000367805;ENST00000367806;ENST00000545005;ENST00000456107	T;T;T;T	0.25749	1.83;1.84;1.83;1.78	4.99	4.06	0.47325	.	1.283200	0.05071	N	0.481703	T	0.26159	0.0638	M	0.61703	1.905	0.38466	D	0.947348	P;P;P	0.52692	0.891;0.955;0.955	P;P;P	0.54312	0.568;0.748;0.748	T	0.04294	-1.0962	9	0.66056	D	0.02	0.0026	7.6367	0.28270	0.1276:0.0:0.7199:0.1525	.	263;263;263	Q5TID7-2;Q5TID7;Q5TID7-3	.;CA114_HUMAN;.	Y	263	ENSP00000356779:S263Y;ENSP00000356780:S263Y;ENSP00000442297:S263Y;ENSP00000411000:S263Y	ENSP00000356779:S263Y	S	-	2	0	C1orf114	167657505	0.001000	0.12720	0.072000	0.20136	0.092000	0.18411	0.286000	0.18902	1.042000	0.40150	0.455000	0.32223	TCT	C1orf114	-	NULL	ENSG00000117477		0.458	CCDC181-002	KNOWN	basic|appris_candidate_longest	protein_coding	C1orf114	HGNC	protein_coding	OTTHUMT00000086099.1	188	0.00	0	G	NM_021179		169390881	169390881	-1	no_errors	ENST00000367806	ensembl	human	known	69_37n	missense	111	26.49	40	SNP	0.008	T
CACNA1E	777	genome.wustl.edu	37	1	181680184	181680184	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr1:181680184C>T	ENST00000367573.2	+	8	1150	c.1150C>T	c.(1150-1152)Cgt>Tgt	p.R384C	CACNA1E_ENST00000367570.1_Missense_Mutation_p.R384C|CACNA1E_ENST00000358338.5_Missense_Mutation_p.R335C|CACNA1E_ENST00000357570.5_Missense_Mutation_p.R335C|CACNA1E_ENST00000367567.4_5'UTR|CACNA1E_ENST00000526775.1_Missense_Mutation_p.R384C|CACNA1E_ENST00000360108.3_Missense_Mutation_p.R384C	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	384	Binding to the beta subunit. {ECO:0000250}.				calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						GAATGGCTACCGTGCCTGGAT	0.602																																						dbGAP											0													57.0	63.0	61.0					1																	181680184		1993	4168	6161	-	-	-	SO:0001583	missense	0			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.1150C>T	1.37:g.181680184C>T	ENSP00000356545:p.Arg384Cys		B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_HAND_2,prints_VDCCAlpha1,prints_VDCC_R_a1su	p.R384C	ENST00000367573.2	37	c.1150	CCDS55664.1	1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.303521	0.81136	.	.	ENSG00000198216	ENST00000524607;ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.93247	-3.19;-3.19;-3.19;-3.19;-3.19;-3.19;-3.19	5.15	4.21	0.49690	.	0.301172	0.37530	N	0.002042	D	0.94561	0.8248	L	0.44542	1.39	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.67231	0.95;0.95	D	0.94751	0.7927	10	0.72032	D	0.01	.	14.3736	0.66857	0.1493:0.8507:0.0:0.0	.	384;384	Q15878-2;Q15878-3	.;.	C	384;384;384;335;335;384;384	ENSP00000432038:R384C;ENSP00000356542:R384C;ENSP00000434814:R384C;ENSP00000350183:R335C;ENSP00000351101:R335C;ENSP00000353222:R384C;ENSP00000356545:R384C	ENSP00000350183:R335C	R	+	1	0	CACNA1E	179946807	1.000000	0.71417	0.978000	0.43139	0.951000	0.60555	3.093000	0.50217	1.103000	0.41568	0.655000	0.94253	CGT	CACNA1E	-	NULL	ENSG00000198216		0.602	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	HGNC	protein_coding	OTTHUMT00000090793.2	60	0.00	0	C	NM_000721		181680184	181680184	+1	no_errors	ENST00000367573	ensembl	human	known	69_37n	missense	22	34.29	12	SNP	1.000	T
CASK	8573	genome.wustl.edu	37	X	41646461	41646461	+	Nonsense_Mutation	SNP	G	G	C			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chrX:41646461G>C	ENST00000378163.1	-	3	722	c.248C>G	c.(247-249)tCa>tGa	p.S83*	CASK_ENST00000378158.1_Nonsense_Mutation_p.S83*|CASK_ENST00000421587.2_Nonsense_Mutation_p.S83*|CASK_ENST00000378166.4_Nonsense_Mutation_p.S83*|CASK_ENST00000378154.1_Nonsense_Mutation_p.S83*|CASK_ENST00000361962.4_Nonsense_Mutation_p.S83*|CASK_ENST00000318588.9_Nonsense_Mutation_p.S83*|CASK_ENST00000442742.2_Nonsense_Mutation_p.S83*			O14936	CSKP_HUMAN	calcium/calmodulin-dependent serine protein kinase (MAGUK family)	83	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				calcium ion import (GO:0070509)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of wound healing (GO:0061045)|nucleotide phosphorylation (GO:0046939)|positive regulation of calcium ion import (GO:0090280)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	actin cytoskeleton (GO:0015629)|basement membrane (GO:0005604)|basolateral plasma membrane (GO:0016323)|cell-cell junction (GO:0005911)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nuclear lamina (GO:0005652)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(5)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|ovary(3)|prostate(1)|stomach(1)	32						CATTCCATCTGAGCTATATGT	0.358																																					NSCLC(42;104 1086 3090 27189 35040)	dbGAP											0													198.0	165.0	176.0					X																	41646461		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF035582	CCDS14257.1, CCDS48094.1, CCDS48095.1	Xp11.4	2010-02-09			ENSG00000147044	ENSG00000147044			1497	protein-coding gene	gene with protein product		300172	"""trinucleotide repeat containing 8"""	TNRC8		9722958	Standard	NM_003688		Approved	LIN2, CAGH39, FGS4	uc004dfl.4	O14936	OTTHUMG00000021378	ENST00000378163.1:c.248C>G	X.37:g.41646461G>C	ENSP00000367405:p.Ser83*		A6NES1|B7ZKY0|O43215|Q17RI4|Q59HA0|Q5VT16|Q5VT17|Q5VT18|Q5VT19|Q66T42|Q9BYH6|Q9NYB2|Q9NYB3	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Guanylate_kin,pfam_L27_C,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,pfam_SH3_2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_SH3_domain,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_L27,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,pfscan_Guanylate_kin	p.S83*	ENST00000378163.1	37	c.248		X	.	.	.	.	.	.	.	.	.	.	G	25.4	4.630334	0.87660	.	.	ENSG00000147044	ENST00000421587;ENST00000318588;ENST00000361962;ENST00000378163;ENST00000378158;ENST00000378166;ENST00000442742;ENST00000378154	.	.	.	5.51	5.51	0.81932	.	0.000000	0.37053	N	0.002270	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.1408	0.89638	0.0:0.0:1.0:0.0	.	.	.	.	X	83	.	ENSP00000322727:S83X	S	-	2	0	CASK	41531405	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.091000	0.94151	2.321000	0.78463	0.468000	0.43344	TCA	CASK	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000147044		0.358	CASK-007	KNOWN	basic|appris_candidate_longest	protein_coding	CASK	HGNC	protein_coding	OTTHUMT00000056285.1	283	0.00	0	G	NM_003688		41646461	41646461	-1	no_errors	ENST00000378163	ensembl	human	known	69_37n	nonsense	169	30.89	76	SNP	1.000	C
CACNA1F	778	genome.wustl.edu	37	X	49083480	49083480	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chrX:49083480G>C	ENST00000376265.2	-	9	1289	c.1228C>G	c.(1228-1230)Caa>Gaa	p.Q410E	CACNA1F_ENST00000323022.5_Missense_Mutation_p.Q410E|CACNA1F_ENST00000376251.1_Missense_Mutation_p.Q345E	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	410	Binding to the beta subunit. {ECO:0000250}.				axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	TCTTCGGCTTGAGTGATCCAG	0.602																																						dbGAP											0													68.0	47.0	54.0					X																	49083480		2203	4300	6503	-	-	-	SO:0001583	missense	0			AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.1228C>G	X.37:g.49083480G>C	ENSP00000365441:p.Gln410Glu		A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.Q410E	ENST00000376265.2	37	c.1228	CCDS35253.1	X	.	.	.	.	.	.	.	.	.	.	G	11.28	1.590765	0.28357	.	.	ENSG00000102001	ENST00000376251;ENST00000323022;ENST00000376265	D;D;D	0.94138	-3.36;-3.36;-3.36	4.96	4.07	0.47477	.	2.363510	0.01227	N	0.008241	D	0.93067	0.7793	L	0.58354	1.805	0.38291	D	0.942691	B;B	0.13145	0.007;0.004	B;B	0.10450	0.005;0.003	T	0.74948	-0.3490	10	0.62326	D	0.03	.	12.2399	0.54536	0.0:0.0:0.8122:0.1877	.	410;410	F5CIQ9;O60840	.;CAC1F_HUMAN	E	345;410;410	ENSP00000365427:Q345E;ENSP00000321618:Q410E;ENSP00000365441:Q410E	ENSP00000321618:Q410E	Q	-	1	0	CACNA1F	48970424	1.000000	0.71417	0.186000	0.23195	0.491000	0.33493	3.769000	0.55303	0.819000	0.34492	0.425000	0.28330	CAA	CACNA1F	-	NULL	ENSG00000102001		0.602	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1F	HGNC	protein_coding	OTTHUMT00000358157.1	125	0.00	0	G	NM_005183		49083480	49083480	-1	no_errors	ENST00000376265	ensembl	human	known	69_37n	missense	39	30.36	17	SNP	0.985	C
CDC123	8872	genome.wustl.edu	37	10	12291674	12291674	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr10:12291674C>T	ENST00000281141.4	+	12	1221	c.941C>T	c.(940-942)tCt>tTt	p.S314F	CDC123_ENST00000455773.3_3'UTR|CDC123_ENST00000378900.2_Missense_Mutation_p.S273F|RP11-186N15.3_ENST00000421657.1_RNA	NM_006023.2	NP_006014.2	O75794	CD123_HUMAN	cell division cycle 123	314					cell cycle arrest (GO:0007050)|cell division (GO:0051301)|positive regulation of cell proliferation (GO:0008284)|regulation of mitotic cell cycle (GO:0007346)	cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	12						GTAGACCTCTCTACTGGGGAG	0.468																																						dbGAP											0													91.0	84.0	86.0					10																	12291674		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC001600	CCDS7090.1	10p13	2013-01-17	2013-01-17	2006-11-06	ENSG00000151465	ENSG00000151465			16827	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 7"", ""cell division cycle 123 homolog (S. cerevisiae)"""	C10orf7		15319434	Standard	NM_006023		Approved	D123	uc001ill.3	O75794	OTTHUMG00000017680	ENST00000281141.4:c.941C>T	10.37:g.12291674C>T	ENSP00000281141:p.Ser314Phe		A8JZZ7|Q14107|Q5T0L4|Q5T0L5|Q5T0L7|Q5T0L8|Q5T0L9	Missense_Mutation	SNP	pfam_D123,pirsf_Cell_div_Cdc123	p.S314F	ENST00000281141.4	37	c.941	CCDS7090.1	10	.	.	.	.	.	.	.	.	.	.	C	16.45	3.126768	0.56721	.	.	ENSG00000151465	ENST00000281141;ENST00000378900;ENST00000455773	.	.	.	5.71	5.71	0.89125	.	0.052302	0.85682	D	0.000000	T	0.77205	0.4096	M	0.67517	2.055	0.58432	D	0.999999	D	0.64830	0.994	D	0.67900	0.954	T	0.72640	-0.4232	9	0.29301	T	0.29	-21.2046	19.4877	0.95037	0.0:1.0:0.0:0.0	.	314	O75794	CD123_HUMAN	F	314;273;229	.	ENSP00000281141:S314F	S	+	2	0	CDC123	12331680	1.000000	0.71417	0.846000	0.33378	0.032000	0.12392	7.202000	0.77856	2.686000	0.91538	0.650000	0.86243	TCT	CDC123	-	pfam_D123,pirsf_Cell_div_Cdc123	ENSG00000151465		0.468	CDC123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC123	HGNC	protein_coding	OTTHUMT00000046801.1	145	0.00	0	C	NM_006023		12291674	12291674	+1	no_errors	ENST00000281141	ensembl	human	known	69_37n	missense	87	30.40	38	SNP	1.000	T
CHD7	55636	genome.wustl.edu	37	8	61693766	61693766	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr8:61693766G>C	ENST00000423902.2	+	3	2352	c.1873G>C	c.(1873-1875)Gat>Cat	p.D625H	CHD7_ENST00000524602.1_Intron|CHD7_ENST00000525508.1_Missense_Mutation_p.D625H	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	625	Lys-rich.				adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.556_871dup(1)		NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			TGGTGGGGTAGATAACCAAGA	0.403																																						dbGAP											1	Insertion - In frame(1)	lung(1)											49.0	48.0	48.0					8																	61693766		1832	4072	5904	-	-	-	SO:0001583	missense	0			AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.1873G>C	8.37:g.61693766G>C	ENSP00000392028:p.Asp625His		D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.D625H	ENST00000423902.2	37	c.1873	CCDS47865.1	8	.	.	.	.	.	.	.	.	.	.	G	15.78	2.933450	0.52866	.	.	ENSG00000171316	ENST00000307121;ENST00000423902;ENST00000525508	D;T	0.82433	-1.61;-1.19	4.81	3.01	0.34805	.	0.520555	0.16154	N	0.227119	T	0.71668	0.3367	N	0.19112	0.55	0.25704	N	0.985554	P	0.44309	0.832	B	0.41466	0.358	T	0.62756	-0.6787	10	0.56958	D	0.05	-8.3391	9.7093	0.40236	0.1633:0.0:0.8367:0.0	.	625	Q9P2D1	CHD7_HUMAN	H	625	ENSP00000392028:D625H;ENSP00000436027:D625H	ENSP00000307304:D625H	D	+	1	0	CHD7	61856320	1.000000	0.71417	0.997000	0.53966	0.989000	0.77384	3.712000	0.54875	0.561000	0.29186	-0.143000	0.13931	GAT	CHD7	-	NULL	ENSG00000171316		0.403	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD7	HGNC	protein_coding	OTTHUMT00000383468.2	66	0.00	0	G	XM_098762		61693766	61693766	+1	no_errors	ENST00000307121	ensembl	human	known	69_37n	missense	93	15.45	17	SNP	1.000	C
CLK1	1195	genome.wustl.edu	37	2	201722462	201722462	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr2:201722462G>C	ENST00000321356.4	-	7	946	c.811C>G	c.(811-813)Cag>Gag	p.Q271E	CLK1_ENST00000434813.2_Missense_Mutation_p.Q313E|CLK1_ENST00000409769.2_Missense_Mutation_p.Q94E	NM_004071.3	NP_004062.2	P49759	CLK1_HUMAN	CDC-like kinase 1	271	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			NS(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(12)|ovary(1)|pancreas(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						TTGCATATCTGATATGCCATC	0.338																																						dbGAP											0													57.0	54.0	55.0					2																	201722462		2203	4300	6503	-	-	-	SO:0001583	missense	0			L29219	CCDS2331.1, CCDS54427.1	2q33	2008-05-02			ENSG00000013441	ENSG00000013441		"""CDC-like kinases"""	2068	protein-coding gene	gene with protein product		601951				9856501	Standard	NM_004071		Approved		uc002uwe.2	P49759	OTTHUMG00000132784	ENST00000321356.4:c.811C>G	2.37:g.201722462G>C	ENSP00000326830:p.Gln271Glu		B4DFW7|Q0P694|Q8N5V8	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Q271E	ENST00000321356.4	37	c.811	CCDS2331.1	2	.	.	.	.	.	.	.	.	.	.	G	20.3	3.967617	0.74131	.	.	ENSG00000013441	ENST00000321356;ENST00000357369;ENST00000409769;ENST00000434813	T;T;T	0.27104	1.69;1.69;1.69	5.2	5.2	0.72013	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.053691	0.85682	D	0.000000	T	0.51227	0.1662	M	0.74881	2.28	0.58432	D	0.999999	D;D;D;B	0.71674	0.998;0.994;0.994;0.408	P;P;D;B	0.64776	0.906;0.906;0.929;0.146	T	0.54925	-0.8220	10	0.87932	D	0	.	17.8663	0.88796	0.0:0.0:1.0:0.0	.	313;241;271;94	B4DFW7;E9PH13;P49759;B8ZZR0	.;.;CLK1_HUMAN;.	E	271;241;94;313	ENSP00000326830:Q271E;ENSP00000386358:Q94E;ENSP00000394734:Q313E	ENSP00000326830:Q271E	Q	-	1	0	CLK1	201430707	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.908000	0.87438	2.587000	0.87381	0.563000	0.77884	CAG	CLK1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000013441		0.338	CLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLK1	HGNC	protein_coding	OTTHUMT00000256192.2	69	0.00	0	G			201722462	201722462	-1	no_errors	ENST00000321356	ensembl	human	known	69_37n	missense	56	25.97	20	SNP	1.000	C
CMIP	80790	genome.wustl.edu	37	16	81739122	81739122	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr16:81739122C>T	ENST00000537098.3	+	19	2182	c.2110C>T	c.(2110-2112)Cgg>Tgg	p.R704W	CMIP_ENST00000539778.2_Missense_Mutation_p.R610W|CMIP_ENST00000566513.1_3'UTR|CMIP_ENST00000398040.4_Missense_Mutation_p.R551W	NM_198390.2	NP_938204.2	Q8IY22	CMIP_HUMAN	c-Maf inducing protein	704						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(5)|kidney(1)|lung(7)	13						CGCTGGCCTTCGGCTCCTGTC	0.632																																						dbGAP											0													52.0	57.0	55.0					16																	81739122		2038	4181	6219	-	-	-	SO:0001583	missense	0			AB051481	CCDS54044.1, CCDS54045.1	16q23	2011-08-04			ENSG00000153815	ENSG00000153815			24319	protein-coding gene	gene with protein product		610112				11214970, 12939343	Standard	NM_030629		Approved		uc002fgp.3	Q8IY22		ENST00000537098.3:c.2110C>T	16.37:g.81739122C>T	ENSP00000446100:p.Arg704Trp		Q9C0G9	Missense_Mutation	SNP	NULL	p.R704W	ENST00000537098.3	37	c.2110	CCDS54044.1	16	.	.	.	.	.	.	.	.	.	.	C	19.21	3.782736	0.70222	.	.	ENSG00000153815	ENST00000537098;ENST00000539778;ENST00000398040;ENST00000542097	T;T	0.53857	0.6;0.6	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.70736	0.3258	M	0.63843	1.955	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;P	0.76575	0.988;0.988;0.841	T	0.74500	-0.3645	10	0.72032	D	0.01	.	17.9786	0.89133	0.0:1.0:0.0:0.0	.	551;610;704	Q8IY22-3;Q8IY22-2;Q8IY22	.;.;CMIP_HUMAN	W	704;610;610;517	ENSP00000446100:R704W;ENSP00000440401:R610W	ENSP00000381120:R610W	R	+	1	2	CMIP	80296623	1.000000	0.71417	1.000000	0.80357	0.817000	0.46193	3.652000	0.54439	2.249000	0.74217	0.457000	0.33378	CGG	CMIP	-	NULL	ENSG00000153815		0.632	CMIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMIP	HGNC	protein_coding	OTTHUMT00000432399.2	158	0.00	0	C	NM_030629		81739122	81739122	+1	no_errors	ENST00000537098	ensembl	human	known	69_37n	missense	57	24.00	18	SNP	1.000	T
COL20A1	57642	genome.wustl.edu	37	20	61936827	61936827	+	Silent	SNP	C	C	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr20:61936827C>T	ENST00000358894.6	+	4	352	c.252C>T	c.(250-252)ggC>ggT	p.G84G	COL20A1_ENST00000422202.1_Silent_p.G84G|COL20A1_ENST00000326996.6_Silent_p.G84G|COL20A1_ENST00000435874.1_Silent_p.G84G	NM_020882.2	NP_065933.2	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	84	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)				NS(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(21)|ovary(1)|prostate(3)|urinary_tract(2)	36	all_cancers(38;1.39e-10)					CAGTGGGGGGCCTGAGCCCCT	0.607																																						dbGAP											0													35.0	39.0	38.0					20																	61936827		1932	4118	6050	-	-	-	SO:0001819	synonymous_variant	0			BC043183	CCDS46628.1	20q13.33	2014-02-12			ENSG00000101203	ENSG00000101203		"""Collagens"", ""Fibronectin type III domain containing"""	14670	protein-coding gene	gene with protein product						10819331	Standard	NM_020882		Approved	KIAA1510	uc011aau.2	Q9P218	OTTHUMG00000032964	ENST00000358894.6:c.252C>T	20.37:g.61936827C>T			Q4VXQ4|Q6PI59|Q8WUT2|Q96CY9|Q9BQU6|Q9BQU7	Silent	SNP	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.G84	ENST00000358894.6	37	c.252	CCDS46628.1	20																																																																																			COL20A1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000101203		0.607	COL20A1-006	KNOWN	basic|CCDS	protein_coding	COL20A1	HGNC	protein_coding	OTTHUMT00000144595.2	78	0.00	0	C	NM_020882		61936827	61936827	+1	no_errors	ENST00000326996	ensembl	human	known	69_37n	silent	24	65.33	49	SNP	1.000	T
CSDE1	7812	genome.wustl.edu	37	1	115276687	115276687	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr1:115276687G>A	ENST00000358528.4	-	8	1060	c.634C>T	c.(634-636)Cac>Tac	p.H212Y	CSDE1_ENST00000261443.5_Missense_Mutation_p.H181Y|CSDE1_ENST00000530886.1_Missense_Mutation_p.H82Y|CSDE1_ENST00000534699.1_Missense_Mutation_p.H212Y|CSDE1_ENST00000438362.2_Missense_Mutation_p.H258Y|CSDE1_ENST00000339438.6_Missense_Mutation_p.H181Y|CSDE1_ENST00000369530.1_Missense_Mutation_p.H227Y	NM_001007553.2	NP_001007554.1	O75534	CSDE1_HUMAN	cold shock domain containing E1, RNA-binding	212	CSD 3.				male gonad development (GO:0008584)|nuclear-transcribed mRNA catabolic process, no-go decay (GO:0070966)|regulation of transcription, DNA-templated (GO:0006355)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|endometrium(11)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	51	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;2.21e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCACTATAGTGAAAGAATATC	0.348																																						dbGAP											0													63.0	61.0	62.0					1																	115276687		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS30811.1, CCDS30812.1, CCDS44197.1, CCDS55626.1	1p13.2	2011-11-02			ENSG00000009307	ENSG00000009307			29905	protein-coding gene	gene with protein product	"""upstream of NRAS"""	191510				2204029, 10048485	Standard	NM_007158		Approved	D1S155E, UNR	uc001efi.3	O75534	OTTHUMG00000012060	ENST00000358528.4:c.634C>T	1.37:g.115276687G>A	ENSP00000351329:p.His212Tyr		A8K281|E9PGZ0|G5E9Q2|O94961|Q5TF04|Q5TF05|Q68DF1|Q68DI9|Q9Y2S4	Missense_Mutation	SNP	pfam_CSP_DNA-bd,superfamily_NA-bd_OB-fold-like,smart_Cold_shock_prot	p.H227Y	ENST00000358528.4	37	c.679	CCDS30812.1	1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.639970	0.87760	.	.	ENSG00000009307	ENST00000339438;ENST00000438362;ENST00000358528;ENST00000261443;ENST00000530886;ENST00000369530;ENST00000534699;ENST00000529046	.	.	.	6.07	5.15	0.70609	Cold shock protein (1);Nucleic acid-binding, OB-fold-like (1);Cold-shock protein, DNA-binding (1);Nucleic acid-binding, OB-fold (1);Cold-shock conserved site (1);	0.000000	0.85682	D	0.000000	D	0.88100	0.6346	H	0.96970	3.915	0.80722	D	1	D;P;P	0.76494	0.999;0.535;0.908	D;B;D	0.83275	0.996;0.438;0.922	D	0.92404	0.5932	9	0.66056	D	0.02	-13.2056	17.2984	0.87175	0.0:0.1254:0.8746:0.0	.	227;212;258	E9PGZ0;O75534;G5E9Q2	.;CSDE1_HUMAN;.	Y	181;258;212;181;82;227;212;82	.	ENSP00000261443:H181Y	H	-	1	0	CSDE1	115078210	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	1.538000	0.49270	0.655000	0.94253	CAC	CSDE1	-	pfam_CSP_DNA-bd,superfamily_NA-bd_OB-fold-like,smart_Cold_shock_prot	ENSG00000009307		0.348	CSDE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CSDE1	HGNC	protein_coding	OTTHUMT00000033397.1	97	0.00	0	G	NM_007158		115276687	115276687	-1	no_errors	ENST00000369530	ensembl	human	known	69_37n	missense	67	21.18	18	SNP	1.000	A
CSTL1	128817	genome.wustl.edu	37	20	23424675	23424675	+	Silent	SNP	G	G	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr20:23424675G>A	ENST00000246020.2	+	2	344	c.324G>A	c.(322-324)ctG>ctA	p.L108L	CSTL1_ENST00000347397.1_Silent_p.L108L			Q9H114	CST1L_HUMAN	cystatin-like 1	108						extracellular region (GO:0005576)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(2)|endometrium(2)|large_intestine(3)|lung(4)|skin(2)|stomach(1)	14	Colorectal(13;0.0993)|Lung NSC(19;0.235)					GCAAGAAGCTGAGAAAGGTGT	0.458																																						dbGAP											0													104.0	90.0	94.0					20																	23424675		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL096677	CCDS13153.1	20p11.21	2012-08-14			ENSG00000125823	ENSG00000125823			15958	protein-coding gene	gene with protein product						20565543	Standard	NM_138283		Approved	dJ322G13.4, CTES1	uc002wte.3	Q9H114	OTTHUMG00000032068	ENST00000246020.2:c.324G>A	20.37:g.23424675G>A			Q17RA8|Q64FF7	Silent	SNP	pfam_Prot_inh_cystat,smart_Prot_inh_cystat	p.L108	ENST00000246020.2	37	c.324	CCDS13153.1	20																																																																																			CSTL1	-	pfam_Prot_inh_cystat,smart_Prot_inh_cystat	ENSG00000125823		0.458	CSTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSTL1	HGNC	protein_coding	OTTHUMT00000078328.1	136	0.00	0	G			23424675	23424675	+1	no_errors	ENST00000246020	ensembl	human	known	69_37n	silent	79	24.04	25	SNP	0.101	A
CTCF	10664	genome.wustl.edu	37	16	67655431	67655431	+	Nonsense_Mutation	SNP	G	G	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr16:67655431G>T	ENST00000264010.4	+	7	1738	c.1294G>T	c.(1294-1296)Gaa>Taa	p.E432*	CTCF_ENST00000401394.1_Nonsense_Mutation_p.E104*	NM_006565.3	NP_006556.1	P49711	CTCF_HUMAN	CCCTC-binding factor (zinc finger protein)	432					chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|DNA methylation (GO:0006306)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome positioning (GO:0016584)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone acetylation (GO:0035065)|regulation of histone methylation (GO:0031060)|regulation of molecular function, epigenetic (GO:0040030)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin insulator sequence binding (GO:0043035)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(6)|central_nervous_system(2)|cervix(1)|endometrium(34)|haematopoietic_and_lymphoid_tissue(7)|kidney(3)|large_intestine(9)|liver(1)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	79		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)		GAAGCACACAGAAAATGTGGC	0.368																																					Colon(175;1200 1966 6945 23069 27405)	dbGAP											0													103.0	92.0	96.0					16																	67655431		2198	4300	6498	-	-	-	SO:0001587	stop_gained	0			U25435	CCDS10841.1, CCDS54029.1	16q21-q22.3	2013-01-08			ENSG00000102974	ENSG00000102974		"""Zinc fingers, C2H2-type"""	13723	protein-coding gene	gene with protein product	"""11 zinc finger transcriptional repressor"""	604167				8649389, 18550811	Standard	NM_006565		Approved		uc002etl.3	P49711	OTTHUMG00000137539	ENST00000264010.4:c.1294G>T	16.37:g.67655431G>T	ENSP00000264010:p.Glu432*		B5MC38|Q53XI7|Q59EL8	Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E432*	ENST00000264010.4	37	c.1294	CCDS10841.1	16	.	.	.	.	.	.	.	.	.	.	G	40	8.292649	0.98745	.	.	ENSG00000102974	ENST00000264010;ENST00000401394	.	.	.	5.84	5.84	0.93424	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-4.0223	20.1346	0.98019	0.0:0.0:1.0:0.0	.	.	.	.	X	432;104	.	ENSP00000264010:E432X	E	+	1	0	CTCF	66212932	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.765000	0.95021	0.655000	0.94253	GAA	CTCF	-	pfscan_Znf_C2H2	ENSG00000102974		0.368	CTCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTCF	HGNC	protein_coding	OTTHUMT00000268870.2	203	0.00	0	G	NM_006565		67655431	67655431	+1	no_errors	ENST00000264010	ensembl	human	known	69_37n	nonsense	104	31.13	47	SNP	1.000	T
DBH	1621	genome.wustl.edu	37	9	136516800	136516800	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr9:136516800C>G	ENST00000393056.2	+	7	1248	c.1236C>G	c.(1234-1236)caC>caG	p.H412Q	DBH-AS1_ENST00000425189.1_RNA	NM_000787.3	NP_000778.3	P09172	DOPO_HUMAN	dopamine beta-hydroxylase (dopamine beta-monooxygenase)	412					behavioral response to ethanol (GO:0048149)|blood vessel remodeling (GO:0001974)|catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|cytokine production (GO:0001816)|dopamine catabolic process (GO:0042420)|fear response (GO:0042596)|glucose homeostasis (GO:0042593)|homoiothermy (GO:0042309)|leukocyte mediated immunity (GO:0002443)|leukocyte migration (GO:0050900)|locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|memory (GO:0007613)|norepinephrine biosynthetic process (GO:0042421)|positive regulation of vasoconstriction (GO:0045907)|regulation of cell proliferation (GO:0042127)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|response to amphetamine (GO:0001975)|response to pain (GO:0048265)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|secretory granule lumen (GO:0034774)	catalytic activity (GO:0003824)|copper ion binding (GO:0005507)|dopamine beta-monooxygenase activity (GO:0004500)|L-ascorbic acid binding (GO:0031418)			central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	36				OV - Ovarian serous cystadenocarcinoma(145;2.33e-07)|Epithelial(140;1.5e-06)|all cancers(34;1.66e-05)	Disulfiram(DB00822)|Dopamine(DB00988)|Propylthiouracil(DB00550)|Vitamin C(DB00126)	CTCAGCTCCACACACACCTGA	0.652																																						dbGAP											0													124.0	96.0	106.0					9																	136516800		2203	4300	6503	-	-	-	SO:0001583	missense	0			X13256	CCDS6977.2	9q34	2013-06-03			ENSG00000123454	ENSG00000123454	1.14.17.1		2689	protein-coding gene	gene with protein product		609312					Standard	NM_000787		Approved	DBM	uc004cel.3	P09172	OTTHUMG00000020878	ENST00000393056.2:c.1236C>G	9.37:g.136516800C>G	ENSP00000376776:p.His412Gln		Q5T381|Q96AG2	Missense_Mutation	SNP	pfam_Cu2_ascorb_mOase_N,pfam_DOMON_domain,superfamily_PHM/PNGase_F_dom,smart_DOMON_domain,pfscan_DOMON_domain,prints_Dopamine_b_mOase	p.H412Q	ENST00000393056.2	37	c.1236	CCDS6977.2	9	.	.	.	.	.	.	.	.	.	.	C	17.81	3.481636	0.63849	.	.	ENSG00000123454	ENST00000393056	D	0.86562	-2.14	4.81	-0.453	0.12201	Copper type II, ascorbate-dependent monooxygenase, histidine-cluster-2 conserved site (1);PHM/PNGase F domain (1);Copper type II, ascorbate-dependent monooxygenase-like, C-terminal (1);	0.046782	0.85682	D	0.000000	D	0.93190	0.7831	M	0.91249	3.19	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91797	0.5448	10	0.56958	D	0.05	-25.7875	10.3675	0.44033	0.0:0.5815:0.0:0.4185	.	412	P09172	DOPO_HUMAN	Q	412	ENSP00000376776:H412Q	ENSP00000376776:H412Q	H	+	3	2	DBH	135506621	1.000000	0.71417	0.991000	0.47740	0.865000	0.49528	0.804000	0.27098	0.083000	0.17047	0.561000	0.74099	CAC	DBH	-	superfamily_PHM/PNGase_F_dom	ENSG00000123454		0.652	DBH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBH	HGNC	protein_coding	OTTHUMT00000054929.2	106	0.00	0	C	NM_000787		136516800	136516800	+1	no_errors	ENST00000393056	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	1.000	G
DDI1	414301	genome.wustl.edu	37	11	103908037	103908037	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr11:103908037C>T	ENST00000302259.3	+	1	730	c.487C>T	c.(487-489)Cgc>Tgc	p.R163C	PDGFD_ENST00000393158.2_Intron|PDGFD_ENST00000302251.5_Intron	NM_001001711.2	NP_001001711.1	Q8WTU0	DDI1_HUMAN	DNA-damage inducible 1 homolog 1 (S. cerevisiae)	163							aspartic-type endopeptidase activity (GO:0004190)			central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(12)|liver(2)|lung(21)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)		GCTCAAGGAACGCAACCCTCC	0.612																																						dbGAP											0													63.0	62.0	62.0					11																	103908037		2202	4299	6501	-	-	-	SO:0001583	missense	0				CCDS31660.1	11q22.3	2010-05-04	2010-05-04			ENSG00000170967			18961	protein-coding gene	gene with protein product			"""DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae)"""				Standard	NM_001001711		Approved	FLJ36017	uc001phr.2	Q8WTU0		ENST00000302259.3:c.487C>T	11.37:g.103908037C>T	ENSP00000302805:p.Arg163Cys		Q7Z4U6|Q8WTS3	Missense_Mutation	SNP	pfam_Peptidase_aspartic_euk-pred,pfam_Ubiquitin,pfam_RVP_2,pfam_Pept_A2A_retrovirus_sg,superfamily_Peptidase_aspartic,smart_Ubiquitin,pfscan_Ubiquitin_supergroup	p.R163C	ENST00000302259.3	37	c.487	CCDS31660.1	11	.	.	.	.	.	.	.	.	.	.	C	17.58	3.426199	0.62733	.	.	ENSG00000170967	ENST00000302259	T	0.25414	1.8	5.02	4.1	0.47936	.	0.000000	0.85682	D	0.000000	T	0.51975	0.1706	M	0.83603	2.65	0.50313	D	0.999869	D	0.89917	1.0	D	0.91635	0.999	T	0.57562	-0.7790	10	0.59425	D	0.04	-25.855	11.9064	0.52715	0.0:0.9143:0.0:0.0857	.	163	Q8WTU0	DDI1_HUMAN	C	163	ENSP00000302805:R163C	ENSP00000302805:R163C	R	+	1	0	DDI1	103413247	1.000000	0.71417	0.996000	0.52242	0.766000	0.43426	3.389000	0.52516	1.480000	0.48289	0.655000	0.94253	CGC	DDI1	-	NULL	ENSG00000170967		0.612	DDI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDI1	HGNC	protein_coding	OTTHUMT00000387326.1	39	0.00	0	C	NM_001001711		103908037	103908037	+1	no_errors	ENST00000302259	ensembl	human	known	69_37n	missense	9	50.00	9	SNP	1.000	T
DEPDC5	9681	genome.wustl.edu	37	22	32272223	32272223	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr22:32272223G>T	ENST00000382112.3	+	36	3820	c.3750G>T	c.(3748-3750)aaG>aaT	p.K1250N	DEPDC5_ENST00000535622.1_Missense_Mutation_p.K1159N|DEPDC5_ENST00000382111.2_Missense_Mutation_p.K1259N|DEPDC5_ENST00000400246.1_Missense_Mutation_p.K1259N|DEPDC5_ENST00000539165.1_Missense_Mutation_p.K76N|DEPDC5_ENST00000400248.2_Missense_Mutation_p.K1228N|DEPDC5_ENST00000382105.2_Intron|DEPDC5_ENST00000266091.3_Missense_Mutation_p.K1237N|DEPDC5_ENST00000400249.2_Missense_Mutation_p.K1228N	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	1259	DEP. {ECO:0000255|PROSITE- ProRule:PRU00066}.				intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						ATTTCTACAAGATAGTAACGG	0.502																																						dbGAP											0													119.0	115.0	116.0					22																	32272223		1875	4112	5987	-	-	-	SO:0001583	missense	0			AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.3750G>T	22.37:g.32272223G>T	ENSP00000371546:p.Lys1250Asn		A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Missense_Mutation	SNP	pfam_DUF3608,pfam_DEP_dom,smart_DEP_dom,pfscan_DEP_dom	p.K1237N	ENST00000382112.3	37	c.3711	CCDS46692.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	21.4|21.4	4.143426|4.143426	0.77888|0.77888	.|.	.|.	ENSG00000100150|ENSG00000100150	ENST00000433147|ENST00000535622;ENST00000266091;ENST00000400249;ENST00000382109;ENST00000400246;ENST00000382112;ENST00000382111;ENST00000400248;ENST00000539165	.|T;T;T;T;T;T;T;T	.|0.22336	.|1.96;1.96;1.96;1.96;1.96;1.96;1.96;1.96	5.27|5.27	5.27|5.27	0.74061|0.74061	.|DEP domain (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	.|0.054992	.|0.64402	.|D	.|0.000001	T|T	0.33235|0.33235	0.0856|0.0856	L|L	0.36672|0.36672	1.1|1.1	0.51767|0.51767	D|D	0.999936|0.999936	.|P;D;P;P;P;P	.|0.53462	.|0.916;0.96;0.95;0.873;0.896;0.896	.|P;P;P;P;P;P	.|0.57244	.|0.672;0.816;0.648;0.461;0.596;0.596	T|T	0.01574|0.01574	-1.1321|-1.1321	5|10	.|0.45353	.|T	.|0.12	.|.	17.9135|17.9135	0.88942|0.88942	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1259;1159;645;1237;1250;1228	.|B9EGN9;B4DH93;O75140-7;O75140-4;A8MPX9;O75140	.|.;.;.;.;.;DEPD5_HUMAN	Y|N	635|1159;1237;1228;1159;1259;1250;1259;1228;76	.|ENSP00000440210:K1159N;ENSP00000266091:K1237N;ENSP00000383108:K1228N;ENSP00000383105:K1259N;ENSP00000371546:K1250N;ENSP00000371545:K1259N;ENSP00000383107:K1228N;ENSP00000446286:K76N	.|ENSP00000266091:K1237N	D|K	+|+	1|3	0|2	DEPDC5|DEPDC5	30602223|30602223	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	5.780000|5.780000	0.68956|0.68956	2.470000|2.470000	0.83445|0.83445	0.645000|0.645000	0.84053|0.84053	GAT|AAG	DEPDC5	-	pfam_DEP_dom,smart_DEP_dom,pfscan_DEP_dom	ENSG00000100150		0.502	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DEPDC5	HGNC	protein_coding	OTTHUMT00000129087.1	77	0.00	0	G	NM_014662		32272223	32272223	+1	no_errors	ENST00000266091	ensembl	human	known	69_37n	missense	39	22.00	11	SNP	1.000	T
DET1	55070	genome.wustl.edu	37	15	89056368	89056368	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr15:89056368G>C	ENST00000268148.8	-	5	1612	c.1467C>G	c.(1465-1467)ttC>ttG	p.F489L	DET1_ENST00000444300.1_Missense_Mutation_p.F500L|RP11-97O12.7_ENST00000606219.1_RNA|DET1_ENST00000564406.1_Missense_Mutation_p.F500L	NM_001144074.1	NP_001137546.1	Q7L5Y6	DET1_HUMAN	de-etiolated homolog 1 (Arabidopsis)	489						nucleus (GO:0005634)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(10)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	Lung NSC(78;0.105)|all_lung(78;0.182)		BRCA - Breast invasive adenocarcinoma(143;0.188)			CCCGGGCATAGAACCTAAAAA	0.517																																						dbGAP											0													21.0	22.0	22.0					15																	89056368		1890	4119	6009	-	-	-	SO:0001583	missense	0			BC001242	CCDS45343.1, CCDS45344.1	15q25.3	2004-12-13				ENSG00000140543			25477	protein-coding gene	gene with protein product		608727				14739464	Standard	NM_001144074		Approved	FLJ10103	uc002bmq.2	Q7L5Y6		ENST00000268148.8:c.1467C>G	15.37:g.89056368G>C	ENSP00000268148:p.Phe489Leu		B3KNN6|Q2VPC0|Q9NWD5	Missense_Mutation	SNP	pfam_De-etiolated_protein_1_Det1	p.F500L	ENST00000268148.8	37	c.1500	CCDS45344.1	15	.	.	.	.	.	.	.	.	.	.	G	22.0	4.224145	0.79576	.	.	ENSG00000140543	ENST00000444300;ENST00000268148	.	.	.	5.84	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.77377	0.4121	M	0.85462	2.755	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.79376	-0.1829	9	0.87932	D	0	-31.502	6.2354	0.20760	0.1496:0.1672:0.6832:0.0	.	489;500	Q7L5Y6;B3KNN6	DET1_HUMAN;.	L	500;489	.	ENSP00000268148:F489L	F	-	3	2	DET1	86857372	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.540000	0.45727	2.758000	0.94735	0.655000	0.94253	TTC	DET1	-	pfam_De-etiolated_protein_1_Det1	ENSG00000140543		0.517	DET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DET1	HGNC	protein_coding	OTTHUMT00000415442.2	45	0.00	0	G	NM_017996		89056368	89056368	-1	no_errors	ENST00000444300	ensembl	human	known	69_37n	missense	23	30.30	10	SNP	1.000	C
DNAJC13	23317	genome.wustl.edu	37	3	132231857	132231857	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr3:132231857G>C	ENST00000260818.6	+	45	5547	c.5299G>C	c.(5299-5301)Gag>Cag	p.E1767Q		NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	1767					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						TCTAGGTTCTGAGAGTGAATG	0.363																																						dbGAP											0													177.0	172.0	173.0					3																	132231857		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.5299G>C	3.37:g.132231857G>C	ENSP00000260818:p.Glu1767Gln		Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Missense_Mutation	SNP	pfam_DnaJ_N,superfamily_ARM-type_fold,superfamily_GYF,smart_DnaJ_N,pfscan_DnaJ_N	p.E1767Q	ENST00000260818.6	37	c.5299	CCDS33857.1	3	.	.	.	.	.	.	.	.	.	.	G	27.5	4.841323	0.91197	.	.	ENSG00000138246	ENST00000260818;ENST00000538066	T	0.47177	0.85	5.58	5.58	0.84498	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.67804	0.2932	M	0.83223	2.63	0.80722	D	1	D	0.61697	0.99	P	0.55785	0.784	T	0.71504	-0.4573	10	0.54805	T	0.06	.	19.5565	0.95351	0.0:0.0:1.0:0.0	.	1767	O75165	DJC13_HUMAN	Q	1767;414	ENSP00000260818:E1767Q	ENSP00000260818:E1767Q	E	+	1	0	DNAJC13	133714547	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	9.517000	0.98020	2.626000	0.88956	0.467000	0.42956	GAG	DNAJC13	-	superfamily_ARM-type_fold	ENSG00000138246		0.363	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC13	HGNC	protein_coding	OTTHUMT00000356807.2	338	0.00	0	G	NM_015268		132231857	132231857	+1	no_errors	ENST00000260818	ensembl	human	known	69_37n	missense	259	17.98	57	SNP	1.000	C
DNAJC2	27000	genome.wustl.edu	37	7	102982252	102982252	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr7:102982252C>G	ENST00000379263.3	-	2	464	c.214G>C	c.(214-216)Gag>Cag	p.E72Q	DNAJC2_ENST00000249270.7_Missense_Mutation_p.E72Q|DNAJC2_ENST00000412522.1_Missense_Mutation_p.E72Q	NM_014377.1	NP_055192.1	Q99543	DNJC2_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 2	72					'de novo' cotranslational protein folding (GO:0051083)|chromatin modification (GO:0016568)|DNA replication (GO:0006260)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA biosynthetic process (GO:2000279)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone binding (GO:0042393)|Hsp70 protein binding (GO:0030544)|poly(A) RNA binding (GO:0044822)|ubiquitin binding (GO:0043130)			endometrium(1)|kidney(9)|large_intestine(6)|lung(4)|ovary(1)	21						ATGGGAAACTCTTCCAACTGC	0.373																																						dbGAP											0													138.0	127.0	130.0					7																	102982252		1833	4095	5928	-	-	-	SO:0001583	missense	0			X98260	CCDS43628.1, CCDS47679.1	7q22-q32	2011-09-02	2008-07-01	2008-07-01	ENSG00000105821	ENSG00000105821		"""Heat shock proteins / DNAJ (HSP40)"""	13192	protein-coding gene	gene with protein product		605502	"""zuotin related factor 1"""	ZRF1		8885239	Standard	NM_001129887		Approved	MPP11, MPHOSPH11, ZUO1, zuotin	uc003vbo.3	Q99543	OTTHUMG00000157202	ENST00000379263.3:c.214G>C	7.37:g.102982252C>G	ENSP00000368565:p.Glu72Gln		A4VCI0|Q9BVX1	Missense_Mutation	SNP	pfam_SANT/Myb,pfam_DnaJ_N,superfamily_DnaJ_N,superfamily_Homeodomain-like,smart_DnaJ_N,smart_SANT/Myb,pfscan_Myb-like_dom,pfscan_DnaJ_N	p.E72Q	ENST00000379263.3	37	c.214	CCDS43628.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.4|24.4	4.524403|4.524403	0.85600|0.85600	.|.	.|.	ENSG00000105821|ENSG00000105821	ENST00000249270;ENST00000379263;ENST00000537811;ENST00000412522|ENST00000426036	T;T;T|.	0.22743|.	1.94;1.94;1.94|.	5.25|5.25	4.35|4.35	0.52113|0.52113	Heat shock protein DnaJ, N-terminal (2);|.	0.106429|.	0.64402|.	D|.	0.000006|.	T|T	0.67306|0.67306	0.2879|0.2879	L|L	0.49778|0.49778	1.585|1.585	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	0.991;1.0;0.993|.	P;D;D|.	0.74348|.	0.852;0.983;0.979|.	T|T	0.65134|0.65134	-0.6242|-0.6242	10|5	0.45353|.	T|.	0.12|.	-9.1543|-9.1543	15.6102|15.6102	0.76710|0.76710	0.0:0.8619:0.1381:0.0|0.0:0.8619:0.1381:0.0	.|.	72;72;72|.	Q99543-2;F2Z3H0;Q99543|.	.;.;DNJC2_HUMAN|.	Q|N	72|60	ENSP00000249270:E72Q;ENSP00000368565:E72Q;ENSP00000406275:E72Q|.	ENSP00000249270:E72Q|.	E|K	-|-	1|3	0|2	DNAJC2|DNAJC2	102769488|102769488	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.977000|0.977000	0.68977|0.68977	7.144000|7.144000	0.77357|0.77357	1.177000|1.177000	0.42855|0.42855	0.460000|0.460000	0.39030|0.39030	GAG|AAG	DNAJC2	-	superfamily_DnaJ_N	ENSG00000105821		0.373	DNAJC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC2	HGNC	protein_coding	OTTHUMT00000347891.1	133	0.00	0	C			102982252	102982252	-1	no_errors	ENST00000379263	ensembl	human	known	69_37n	missense	73	29.52	31	SNP	1.000	G
DNTTIP1	116092	genome.wustl.edu	37	20	44429770	44429770	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr20:44429770C>A	ENST00000372622.3	+	5	498	c.430C>A	c.(430-432)Cca>Aca	p.P144T		NM_052951.2	NP_443183.1	Q9H147	TDIF1_HUMAN	deoxynucleotidyltransferase, terminal, interacting protein 1	144						nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)	9		Myeloproliferative disorder(115;0.0122)				CCATGAGCTTCCAGGAATAAA	0.483																																						dbGAP											0													135.0	127.0	130.0					20																	44429770		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB035676	CCDS13369.1	20q13.12	2003-09-10	2003-09-10	2003-09-12	ENSG00000101457	ENSG00000101457			16160	protein-coding gene	gene with protein product	"""novel protein similar to synaptotagmin 1 (SYT1, P65) (isoform 1)"", ""TdT binding protein"""	611388	"""chromosome 20 open reading frame 167"""	C20orf167		11473582	Standard	NM_052951		Approved	dJ447F3.4, Tdif1	uc002xpk.3	Q9H147	OTTHUMG00000032610	ENST00000372622.3:c.430C>A	20.37:g.44429770C>A	ENSP00000361705:p.Pro144Thr		B2RA18|Q96DE3|Q9BQP2|Q9H148	Missense_Mutation	SNP	NULL	p.P144T	ENST00000372622.3	37	c.430	CCDS13369.1	20	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	17.40|17.40|17.40	3.378880|3.378880|3.378880	0.61735|0.61735|0.61735	.|.|.	.|.|.	ENSG00000101457|ENSG00000101457|ENSG00000101457	ENST00000435014|ENST00000372622;ENST00000415790|ENST00000456939	.|T;T|.	.|0.45276|.	.|0.96;0.9|.	5.77|5.77|5.77	5.77|5.77|5.77	0.91146|0.91146|0.91146	.|.|.	.|0.497755|.	.|0.22204|.	.|N|.	.|0.063195|.	T|T|T	0.50446|0.50446|0.50446	0.1616|0.1616|0.1616	L|L|L	0.48642|0.48642|0.48642	1.525|1.525|1.525	0.28824|0.28824|0.28824	N|N|N	0.897514|0.897514|0.897514	.|P|.	.|0.48294|.	.|0.908|.	.|B|.	.|0.43916|.	.|0.436|.	T|T|T	0.48670|0.48670|0.48670	-0.9015|-0.9015|-0.9015	5|10|5	.|0.38643|.	.|T|.	.|0.18|.	-11.9098|-11.9098|-11.9098	12.4861|12.4861|12.4861	0.55874|0.55874|0.55874	0.1668:0.8332:0.0:0.0|0.1668:0.8332:0.0:0.0|0.1668:0.8332:0.0:0.0	.|.|.	.|144|.	.|Q9H147|.	.|TDIF1_HUMAN|.	L|T|Y	70|144;104|94	.|ENSP00000361705:P144T;ENSP00000392509:P104T|.	.|ENSP00000361705:P144T|.	F|P|S	+|+|+	3|1|2	2|0|0	DNTTIP1|DNTTIP1|DNTTIP1	43863177|43863177|43863177	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.988000|0.988000|0.988000	0.76386|0.76386|0.76386	1.410000|1.410000|1.410000	0.34691|0.34691|0.34691	2.729000|2.729000|2.729000	0.93468|0.93468|0.93468	0.585000|0.585000|0.585000	0.79938|0.79938|0.79938	TTC|CCA|TCC	DNTTIP1	-	NULL	ENSG00000101457		0.483	DNTTIP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DNTTIP1	HGNC	protein_coding	OTTHUMT00000079502.1	138	0.00	0	C	NM_052951		44429770	44429770	+1	no_errors	ENST00000372622	ensembl	human	known	69_37n	missense	158	12.71	23	SNP	1.000	A
DYDC1	143241	genome.wustl.edu	37	10	82111696	82111696	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr10:82111696C>T	ENST00000372204.3	-	4	374	c.210G>A	c.(208-210)atG>atA	p.M70I	DYDC2_ENST00000372199.1_Intron|DYDC1_ENST00000372202.1_Missense_Mutation_p.M70I|DYDC1_ENST00000421924.2_Missense_Mutation_p.M70I|DYDC2_ENST00000372198.1_Intron|DYDC2_ENST00000372197.1_Intron	NM_138812.3	NP_620167.1	Q8WWB3	DYDC1_HUMAN	DPY30 domain containing 1	70										kidney(1)|large_intestine(3)|skin(1)	5			Colorectal(32;0.229)			GCCTCTCCATCATTTCCTGCT	0.473																																						dbGAP											0													212.0	186.0	194.0					10																	82111696		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC019250	CCDS7366.1	10q22.3	2006-02-01			ENSG00000170788	ENSG00000170788			23460	protein-coding gene	gene with protein product		615154					Standard	NM_138812		Approved	bA36D19.5, DPY30D1	uc031pwj.1	Q8WWB3	OTTHUMG00000018609	ENST00000372204.3:c.210G>A	10.37:g.82111696C>T	ENSP00000361278:p.Met70Ile		A8K927|Q5QP03|Q5QP04|Q6WNP4|Q6ZU87	Missense_Mutation	SNP	pfam_Dpy-30_motif	p.M70I	ENST00000372204.3	37	c.210	CCDS7366.1	10	.	.	.	.	.	.	.	.	.	.	C	12.87	2.067390	0.36470	.	.	ENSG00000170788	ENST00000372204;ENST00000372202;ENST00000421924;ENST00000454362;ENST00000453477	.	.	.	5.12	2.15	0.27550	.	0.482750	0.22351	N	0.061217	T	0.46054	0.1373	M	0.62723	1.935	0.43598	D	0.99595	B;B	0.30406	0.278;0.172	B;B	0.24974	0.057;0.039	T	0.40194	-0.9576	9	0.49607	T	0.09	-3.201	3.1383	0.06447	0.1847:0.5408:0.1785:0.096	.	70;70	A8K927;Q8WWB3	.;DYDC1_HUMAN	I	70	.	ENSP00000361276:M70I	M	-	3	0	DYDC1	82101676	0.002000	0.14202	0.688000	0.30117	0.996000	0.88848	0.263000	0.18478	0.487000	0.27698	0.655000	0.94253	ATG	DYDC1	-	NULL	ENSG00000170788		0.473	DYDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYDC1	HGNC	protein_coding	OTTHUMT00000049059.1	264	0.00	0	C	NM_138812		82111696	82111696	-1	no_errors	ENST00000421924	ensembl	human	known	69_37n	missense	195	25.48	67	SNP	0.729	T
DYNC1H1	1778	genome.wustl.edu	37	14	102496269	102496269	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr14:102496269G>C	ENST00000360184.4	+	50	9920	c.9756G>C	c.(9754-9756)aaG>aaC	p.K3252N		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	3252	Stalk. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						AGGCTGAAAAGAAGAAGGTAT	0.463																																						dbGAP											0													88.0	94.0	92.0					14																	102496269		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.9756G>C	14.37:g.102496269G>C	ENSP00000348965:p.Lys3252Asn		B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like,smart_AAA+_ATPase	p.K3252N	ENST00000360184.4	37	c.9756	CCDS9966.1	14	.	.	.	.	.	.	.	.	.	.	G	15.98	2.992527	0.54041	.	.	ENSG00000197102	ENST00000360184	T	0.78246	-1.16	5.63	4.74	0.60224	Dynein heavy chain, coiled coil stalk (1);	0.000000	0.85682	D	0.000000	T	0.70824	0.3268	L	0.37561	1.115	0.80722	D	1	B	0.14012	0.009	B	0.19391	0.025	T	0.67734	-0.5594	10	0.59425	D	0.04	.	14.6852	0.69044	0.0698:0.0:0.9302:0.0	.	3252	Q14204	DYHC1_HUMAN	N	3252	ENSP00000348965:K3252N	ENSP00000348965:K3252N	K	+	3	2	DYNC1H1	101566022	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.537000	0.60643	1.380000	0.46344	0.650000	0.86243	AAG	DYNC1H1	-	NULL	ENSG00000197102		0.463	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	HGNC	protein_coding	OTTHUMT00000414574.1	163	0.00	0	G	NM_001376		102496269	102496269	+1	no_errors	ENST00000360184	ensembl	human	known	69_37n	missense	112	19.42	27	SNP	1.000	C
EGFLAM	133584	genome.wustl.edu	37	5	38407978	38407978	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr5:38407978C>G	ENST00000354891.3	+	9	1565	c.1219C>G	c.(1219-1221)Cag>Gag	p.Q407E	EGFLAM_ENST00000397202.2_Intron|EGFLAM_ENST00000336740.6_Missense_Mutation_p.Q173E|EGFLAM_ENST00000322350.5_Missense_Mutation_p.Q407E	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	407	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					GAATTCTTATCAGGCATTTCA	0.368																																					Colon(62;485 1295 3347 17454)	dbGAP											0													139.0	132.0	135.0					5																	38407978		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.1219C>G	5.37:g.38407978C>G	ENSP00000346964:p.Gln407Glu		A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Fibronectin_type3,pfam_EGF-like_dom,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_EGF-like,smart_Laminin_G,smart_EGF-like_Ca-bd,pfscan_EG-like_dom,pfscan_Fibronectin_type3,pfscan_Laminin_G	p.Q407E	ENST00000354891.3	37	c.1219	CCDS56363.1	5	.	.	.	.	.	.	.	.	.	.	C	21.3	4.127589	0.77549	.	.	ENSG00000164318	ENST00000354891;ENST00000322350;ENST00000336740;ENST00000339580	T;T;T	0.78481	-1.18;-1.18;-1.18	5.53	4.63	0.57726	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);	0.053594	0.85682	D	0.000000	D	0.83298	0.5224	L	0.51422	1.61	0.80722	D	1	D;D;P	0.64830	0.994;0.989;0.917	D;P;P	0.63033	0.91;0.868;0.771	D	0.83394	0.0019	10	0.45353	T	0.12	-12.5843	15.3446	0.74327	0.1408:0.8592:0.0:0.0	.	173;407;407	Q63HQ2-4;Q63HQ2;Q63HQ2-2	.;EGFLA_HUMAN;.	E	407;407;173;173	ENSP00000346964:Q407E;ENSP00000313084:Q407E;ENSP00000337607:Q173E	ENSP00000313084:Q407E	Q	+	1	0	EGFLAM	38443735	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.745000	0.47459	1.272000	0.44329	0.650000	0.86243	CAG	EGFLAM	-	superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000164318		0.368	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	EGFLAM	HGNC	protein_coding	OTTHUMT00000367323.1	336	0.00	0	C	NM_152403		38407978	38407978	+1	no_errors	ENST00000354891	ensembl	human	known	69_37n	missense	273	19.88	68	SNP	1.000	G
ELL	8178	genome.wustl.edu	37	19	18561569	18561569	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr19:18561569C>A	ENST00000262809.4	-	8	1254	c.1183G>T	c.(1183-1185)Gac>Tac	p.D395Y	ELL_ENST00000596124.3_Missense_Mutation_p.D262Y	NM_006532.3	NP_006523.1	P55199	ELL_HUMAN	elongation factor RNA polymerase II	395					gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of viral transcription (GO:0050434)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	phosphatase binding (GO:0019902)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(5)|prostate(1)	19				GBM - Glioblastoma multiforme(1328;7.81e-07)		GCCAGGGGGTCGTGGGCCCTC	0.741			T	MLL	AL																																	dbGAP		Dom	yes		19	19p13.1	8178	ELL gene (11-19 lysine-rich leukemia gene)		L	0													6.0	8.0	7.0					19																	18561569		2138	4193	6331	-	-	-	SO:0001583	missense	0			U16282	CCDS12380.1	19p13.1	2012-04-17	2005-05-23			ENSG00000105656		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	23114	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 68"""	600284	"""chromosome 19 open reading frame 17"""	C19orf17		7991593, 8596958	Standard	NM_006532		Approved	Men, ELL1, PPP1R68	uc002njh.3	P55199		ENST00000262809.4:c.1183G>T	19.37:g.18561569C>A	ENSP00000262809:p.Asp395Tyr			Missense_Mutation	SNP	pfam_RNA_pol_II_elong_fac_ELL,pfam_Occludin_RNApol2_elong_fac_ELL	p.D395Y	ENST00000262809.4	37	c.1183	CCDS12380.1	19	.	.	.	.	.	.	.	.	.	.	C	15.73	2.920106	0.52653	.	.	ENSG00000105656	ENST00000262809	T	0.25579	1.79	4.77	3.71	0.42584	.	0.219155	0.45867	D	0.000337	T	0.44912	0.1316	L	0.55481	1.735	0.54753	D	0.999987	D;D	0.89917	0.999;1.0	D;D	0.72075	0.964;0.976	T	0.45991	-0.9223	10	0.87932	D	0	-13.6055	14.0333	0.64629	0.0:0.8477:0.1523:0.0	.	339;395	Q59HG4;P55199	.;ELL_HUMAN	Y	395	ENSP00000262809:D395Y	ENSP00000262809:D395Y	D	-	1	0	ELL	18422569	1.000000	0.71417	0.202000	0.23494	0.054000	0.15201	7.198000	0.77823	1.195000	0.43115	0.643000	0.83706	GAC	ELL	-	NULL	ENSG00000105656		0.741	ELL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELL	HGNC	protein_coding	OTTHUMT00000466362.1	14	0.00	0	C	NM_006532		18561569	18561569	-1	no_errors	ENST00000262809	ensembl	human	known	69_37n	missense	4	50.00	4	SNP	0.998	A
ERBB3	2065	genome.wustl.edu	37	12	56478826	56478826	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr12:56478826C>G	ENST00000267101.3	+	3	722	c.282C>G	c.(280-282)ttC>ttG	p.F94L	ERBB3_ENST00000411731.2_Missense_Mutation_p.F94L|ERBB3_ENST00000450146.2_Intron|ERBB3_ENST00000415288.2_Missense_Mutation_p.F35L	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	94					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			TGAATGAATTCTCTACTCTAC	0.478																																						dbGAP											0													181.0	152.0	162.0					12																	56478826		2203	4300	6503	-	-	-	SO:0001583	missense	0			M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.282C>G	12.37:g.56478826C>G	ENSP00000267101:p.Phe94Leu		A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Missense_Mutation	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Furin-like_Cys-rich_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.F94L	ENST00000267101.3	37	c.282	CCDS31833.1	12	.	.	.	.	.	.	.	.	.	.	C	13.89	2.372299	0.42003	.	.	ENSG00000065361	ENST00000549282;ENST00000549061;ENST00000267101;ENST00000394099;ENST00000411731;ENST00000549672;ENST00000415288	T;T;T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24;-1.24;-1.24	5.82	1.95	0.26073	EGF receptor, L domain (1);	0.000000	0.64402	D	0.000001	T	0.72843	0.3511	N	0.05050	-0.12	0.80722	D	1	P;D	0.89917	0.891;1.0	P;D	0.97110	0.618;1.0	T	0.73990	-0.3808	10	0.59425	D	0.04	.	10.4166	0.44325	0.0:0.7228:0.0:0.2772	.	94;94	P21860;P21860-2	ERBB3_HUMAN;.	L	94;35;94;94;94;35;35	ENSP00000448636:F94L;ENSP00000449138:F35L;ENSP00000267101:F94L;ENSP00000415753:F94L;ENSP00000449713:F35L;ENSP00000408340:F35L	ENSP00000267101:F94L	F	+	3	2	ERBB3	54765093	0.753000	0.28349	0.497000	0.27552	0.111000	0.19643	0.481000	0.22260	0.379000	0.24794	-0.150000	0.13652	TTC	ERBB3	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_EGF_rcpt_L	ENSG00000065361		0.478	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERBB3	HGNC	protein_coding	OTTHUMT00000407619.3	122	0.00	0	C			56478826	56478826	+1	no_errors	ENST00000267101	ensembl	human	known	69_37n	missense	53	36.14	30	SNP	0.771	G
EYS	346007	genome.wustl.edu	37	6	65300723	65300723	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr6:65300723C>T	ENST00000370621.3	-	26	5563	c.5037G>A	c.(5035-5037)atG>atA	p.M1679I	EYS_ENST00000503581.1_Missense_Mutation_p.M1679I|EYS_ENST00000370616.2_Missense_Mutation_p.M1679I			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	1679					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						AATCAGAATTCATCAAGTCTG	0.308																																						dbGAP											0													78.0	72.0	74.0					6																	65300723		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.5037G>A	6.37:g.65300723C>T	ENSP00000359655:p.Met1679Ile		A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF-like_dom,superfamily_ConA-like_lec_gl,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.M1679I	ENST00000370621.3	37	c.5037		6	.	.	.	.	.	.	.	.	.	.	C	9.368	1.069670	0.20147	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	D;D;D	0.82255	-1.59;-1.57;-1.57	5.56	-1.42	0.08913	.	.	.	.	.	T	0.43055	0.1230	N	0.08118	0	0.09310	N	1	B;B	0.10296	0.003;0.001	B;B	0.08055	0.003;0.001	T	0.37526	-0.9702	9	0.45353	T	0.12	.	6.5747	0.22560	0.0:0.3827:0.1252:0.492	.	1679;1679	Q5T1H1-1;Q5T1H1	.;EYS_HUMAN	I	1679	ENSP00000424243:M1679I;ENSP00000359655:M1679I;ENSP00000359650:M1679I	ENSP00000359650:M1679I	M	-	3	0	EYS	65357444	0.000000	0.05858	0.173000	0.22940	0.865000	0.49528	-0.118000	0.10692	-0.047000	0.13423	0.591000	0.81541	ATG	EYS	-	NULL	ENSG00000188107		0.308	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3	91	0.00	0	C	XM_294050		65300723	65300723	-1	no_errors	ENST00000370616	ensembl	human	known	69_37n	missense	64	22.89	19	SNP	0.000	T
FAM118B	79607	genome.wustl.edu	37	11	126120562	126120562	+	Silent	SNP	C	C	G			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr11:126120562C>G	ENST00000533050.1	+	5	994	c.501C>G	c.(499-501)ctC>ctG	p.L167L	FAM118B_ENST00000529731.1_Intron|FAM118B_ENST00000360194.4_Silent_p.L167L|FAM118B_ENST00000525728.1_3'UTR	NM_024556.3	NP_078832.1	Q9BPY3	F118B_HUMAN	family with sequence similarity 118, member B	167										breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|skin(1)	13	all_hematologic(175;0.145)	Breast(109;0.00156)|Lung NSC(97;0.00948)|all_lung(97;0.0101)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0784)		TTGATAATCTCTTGGAACTGT	0.413																																						dbGAP											0													90.0	87.0	88.0					11																	126120562		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0			BC001340	CCDS8470.1	11q24.2	2014-03-13				ENSG00000197798			26110	protein-coding gene	gene with protein product						24569877	Standard	NM_024556		Approved	FLJ21103	uc001qdf.3	Q9BPY3		ENST00000533050.1:c.501C>G	11.37:g.126120562C>G			Q9H7B0	Silent	SNP	NULL	p.L167	ENST00000533050.1	37	c.501	CCDS8470.1	11																																																																																			FAM118B	-	NULL	ENSG00000197798		0.413	FAM118B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM118B	HGNC	protein_coding	OTTHUMT00000386346.1	153	0.00	0	C	NM_024556		126120562	126120562	+1	no_errors	ENST00000533050	ensembl	human	known	69_37n	silent	141	17.54	30	SNP	1.000	G
FAM160A1	729830	genome.wustl.edu	37	4	152499180	152499180	+	Silent	SNP	G	G	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr4:152499180G>A	ENST00000505231.1	+	3	843	c.684G>A	c.(682-684)gaG>gaA	p.E228E	FAM160A1_ENST00000435205.1_Silent_p.E228E|RN7SKP35_ENST00000517210.1_RNA			Q05DH4	F16A1_HUMAN	family with sequence similarity 160, member A1	228										endometrium(2)|kidney(1)	3						TTTCTGCTGAGAACACCATGG	0.488																																						dbGAP											0													168.0	152.0	157.0					4																	152499180		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS47146.1	4q31.3	2012-11-30			ENSG00000164142	ENSG00000164142			34237	protein-coding gene	gene with protein product							Standard	NM_001109977		Approved	FLJ43373	uc003imj.2	Q05DH4	OTTHUMG00000161675	ENST00000505231.1:c.684G>A	4.37:g.152499180G>A			Q6ZUS2	Silent	SNP	pfam_RetinoicA-induced_16-like	p.E228	ENST00000505231.1	37	c.684	CCDS47146.1	4																																																																																			FAM160A1	-	pfam_RetinoicA-induced_16-like	ENSG00000164142		0.488	FAM160A1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM160A1	HGNC	protein_coding	OTTHUMT00000365691.1	230	0.00	0	G	NM_001109977		152499180	152499180	+1	no_errors	ENST00000435205	ensembl	human	known	69_37n	silent	93	21.19	25	SNP	1.000	A
FAM49A	81553	genome.wustl.edu	37	2	16740779	16740779	+	Silent	SNP	G	G	C			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr2:16740779G>C	ENST00000381323.3	-	10	1006	c.786C>G	c.(784-786)ctC>ctG	p.L262L	FAM49A_ENST00000406434.1_Silent_p.L262L|FAM49A_ENST00000355549.2_Silent_p.L262L	NM_030797.3	NP_110424.1	Q9H0Q0	FA49A_HUMAN	family with sequence similarity 49, member A	262						intracellular (GO:0005622)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|skin(3)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(172;0.0734)|all_hematologic(175;0.088)		GBM - Glioblastoma multiforme(3;0.00969)			CATGGTCATAGAGGATGATGA	0.468																																						dbGAP											0													163.0	148.0	153.0					2																	16740779		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001942	CCDS1688.1	2p24.3	2008-02-05			ENSG00000197872	ENSG00000197872			25373	protein-coding gene	gene with protein product							Standard	NM_030797		Approved	DKFZP566A1524, FLJ11080	uc002rck.2	Q9H0Q0	OTTHUMG00000090615	ENST00000381323.3:c.786C>G	2.37:g.16740779G>C			B3KNZ1|Q53QW2	Silent	SNP	pfam_DUF1394	p.L262	ENST00000381323.3	37	c.786	CCDS1688.1	2																																																																																			FAM49A	-	pfam_DUF1394	ENSG00000197872		0.468	FAM49A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM49A	HGNC	protein_coding	OTTHUMT00000207203.2	150	0.00	0	G	NM_030797		16740779	16740779	-1	no_errors	ENST00000355549	ensembl	human	known	69_37n	silent	69	27.37	26	SNP	1.000	C
FAS	355	genome.wustl.edu	37	10	90773881	90773881	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr10:90773881G>A	ENST00000355740.2	+	9	902	c.682G>A	c.(682-684)Gac>Aac	p.D228N	FAS_ENST00000355279.2_Silent_p.L219L|FAS_ENST00000313771.5_3'UTR|FAS_ENST00000352159.4_Silent_p.*234*|RP11-399O19.9_ENST00000562983.1_RNA|FAS_ENST00000357339.2_Missense_Mutation_p.D207N	NM_000043.4|NM_152871.2|NM_152872.2	NP_000034.1|NP_690610.1|NP_690611.1	P49327	FAS_HUMAN	Fas cell surface death receptor	0	Beta-ketoacyl synthase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(2)	18		Colorectal(252;0.0161)		Colorectal(12;0.000136)|COAD - Colon adenocarcinoma(12;0.000193)	Cerulenin(DB01034)|Orlistat(DB01083)	TTCAGATGTTGACTTGAGTAA	0.303																																						dbGAP											0													60.0	61.0	61.0					10																	90773881		2203	4300	6503	-	-	-	SO:0001583	missense	0			M67454	CCDS7393.1, CCDS7394.1, CCDS7395.1	10q24.1	2014-09-17	2013-05-22	2005-01-07	ENSG00000026103	ENSG00000026103		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11920	protein-coding gene	gene with protein product	"""TNF receptor superfamily member 6"""	134637	"""tumor necrosis factor receptor superfamily, member 6"", ""Fas (TNF receptor superfamily, member 6)"""	FAS1, APT1, TNFRSF6		1385299, 1385309	Standard	NM_000043		Approved	CD95, APO-1	uc001kfr.3	P25445	OTTHUMG00000018701	ENST00000355740.2:c.682G>A	10.37:g.90773881G>A	ENSP00000347979:p.Asp228Asn		Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	pfam_Death,pfam_TNFR/NGFR_Cys_rich_reg,superfamily_DEATH-like,smart_TNFR/NGFR_Cys_rich_reg,smart_Death,prints_Fas_rcpt,pfscan_Death,pfscan_TNFR/NGFR_Cys_rich_reg	p.D228N	ENST00000355740.2	37	c.682	CCDS7393.1	10	.	.	.	.	.	.	.	.	.	.	G	16.72	3.202207	0.58234	.	.	ENSG00000026103	ENST00000540197;ENST00000355740;ENST00000357339;ENST00000371875	D;D	0.93953	-3.32;-3.32	4.75	3.83	0.44106	Death (1);DEATH-like (2);	0.580848	0.17093	N	0.187320	D	0.91358	0.7274	.	.	.	0.80722	D	1	P;P	0.48350	0.909;0.853	P;B	0.46253	0.509;0.383	D	0.88810	0.3291	9	0.39692	T	0.17	-27.4255	8.7148	0.34405	0.1098:0.0:0.8902:0.0	.	207;228	P25445-6;P25445	.;TNR6_HUMAN	N	255;228;207;228	ENSP00000347979:D228N;ENSP00000349896:D207N	ENSP00000347979:D228N	D	+	1	0	FAS	90763861	1.000000	0.71417	0.266000	0.24541	0.837000	0.47467	3.180000	0.50895	1.284000	0.44531	0.650000	0.86243	GAC	FAS	-	superfamily_DEATH-like,smart_Death,prints_Fas_rcpt	ENSG00000026103		0.303	FAS-005	KNOWN	basic|appris_principal|CCDS	protein_coding	FAS	HGNC	protein_coding	OTTHUMT00000049274.3	59	0.00	0	G			90773881	90773881	+1	no_errors	ENST00000355740	ensembl	human	known	69_37n	missense	39	48.00	36	SNP	0.950	A
FGR	2268	genome.wustl.edu	37	1	27939603	27939603	+	Missense_Mutation	SNP	A	A	C			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr1:27939603A>C	ENST00000374005.3	-	13	1700	c.1412T>G	c.(1411-1413)gTg>gGg	p.V471G	FGR_ENST00000374004.1_Missense_Mutation_p.V471G|FGR_ENST00000399173.1_Missense_Mutation_p.V471G|FGR_ENST00000545953.1_Missense_Mutation_p.V405G	NM_005248.2	NP_005239.1	P09769	FGR_HUMAN	FGR proto-oncogene, Src family tyrosine kinase	471	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|defense response to Gram-positive bacterium (GO:0050830)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of innate immune response (GO:0045088)|regulation of phagocytosis (GO:0050764)|regulation of protein kinase activity (GO:0045859)|response to virus (GO:0009615)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|Fc-gamma receptor I complex binding (GO:0034988)|immunoglobulin receptor binding (GO:0034987)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphotyrosine binding (GO:0001784)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(4)	16		all_lung(284;2.05e-05)|Colorectal(325;3.46e-05)|Lung NSC(340;3.67e-05)|Renal(390;0.00121)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00244)|KIRC - Kidney renal clear cell carcinoma(1967;0.0027)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		GCCCTGCTCCACCTGTTCCAA	0.617																																						dbGAP											0													87.0	73.0	78.0					1																	27939603		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC064382	CCDS305.1	1p36.2-p36.1	2014-06-25	2014-06-25		ENSG00000000938	ENSG00000000938		"""SH2 domain containing"""	3697	protein-coding gene	gene with protein product		164940	"""Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog"", ""v-fgr feline Gardner-Rasheed sarcoma viral oncogene homolog"", ""feline Gardner-Rasheed sarcoma viral oncogene homolog"""	SRC2		3922831	Standard	NM_001042729		Approved	c-fgr, p55c-fgr	uc001bom.3	P09769	OTTHUMG00000003516	ENST00000374005.3:c.1412T>G	1.37:g.27939603A>C	ENSP00000363117:p.Val471Gly		D3DPL7|Q9UIQ3	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_SH3_domain	p.V471G	ENST00000374005.3	37	c.1412	CCDS305.1	1	.	.	.	.	.	.	.	.	.	.	a	18.79	3.699681	0.68501	.	.	ENSG00000000938	ENST00000374005;ENST00000545953;ENST00000399173;ENST00000374004;ENST00000374003	D;D;D;D;D	0.84730	-1.89;-1.89;-1.89;-1.89;-1.89	4.77	4.77	0.60923	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.46145	D	0.000308	D	0.92782	0.7705	M	0.91872	3.25	0.58432	D	0.999995	D	0.89917	1.0	D	0.91635	0.999	D	0.93331	0.6701	10	0.87932	D	0	.	8.9349	0.35693	0.9099:0.0:0.0901:0.0	.	471	P09769	FGR_HUMAN	G	471;405;471;471;471	ENSP00000363117:V471G;ENSP00000445302:V405G;ENSP00000382126:V471G;ENSP00000363116:V471G;ENSP00000363115:V471G	ENSP00000363115:V471G	V	-	2	0	FGR	27812190	1.000000	0.71417	0.998000	0.56505	0.811000	0.45836	7.459000	0.80802	1.910000	0.55303	0.478000	0.44815	GTG	FGR	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000000938		0.617	FGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGR	HGNC	protein_coding	OTTHUMT00000009772.1	86	0.00	0	A	NM_005248		27939603	27939603	-1	no_errors	ENST00000374003	ensembl	human	known	69_37n	missense	38	11.11	5	SNP	1.000	C
FOXO4	4303	genome.wustl.edu	37	X	70321046	70321046	+	Missense_Mutation	SNP	T	T	G			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chrX:70321046T>G	ENST00000374259.3	+	2	1298	c.966T>G	c.(964-966)agT>agG	p.S322R	FOXO4_ENST00000341558.3_Missense_Mutation_p.S267R	NM_001170931.1|NM_005938.3	NP_001164402.1|NP_005929.2	P98177	FOXO4_HUMAN	forkhead box O4	322					cell cycle arrest (GO:0007050)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|mitotic G2 DNA damage checkpoint (GO:0007095)|muscle organ development (GO:0007517)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of smooth muscle cell differentiation (GO:0051151)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|stem cell differentiation (GO:0048863)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(1)	18	Renal(35;0.156)					TATCTCGGAGTGGTCTCTCTG	0.572											OREG0019856	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													40.0	43.0	42.0					X																	70321046		2074	4174	6248	-	-	-	SO:0001583	missense	0				CCDS43969.1, CCDS55440.1	Xq13.1	2008-02-05	2007-05-02	2007-05-02	ENSG00000184481	ENSG00000184481		"""Forkhead boxes"""	7139	protein-coding gene	gene with protein product		300033	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 7"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 7"""	MLLT7		7529552	Standard	NM_005938		Approved	AFX1	uc004dys.2	P98177	OTTHUMG00000021789	ENST00000374259.3:c.966T>G	X.37:g.70321046T>G	ENSP00000363377:p.Ser322Arg	1121	B7WPJ7|O43821|Q13720|Q3KPF1|Q8TDK9	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.S322R	ENST00000374259.3	37	c.966	CCDS43969.1	X	.	.	.	.	.	.	.	.	.	.	T	5.477	0.273114	0.10349	.	.	ENSG00000184481	ENST00000374259;ENST00000341558	D;D	0.95853	-3.59;-3.83	4.94	-4.85	0.03142	.	0.789176	0.11771	N	0.531123	D	0.89931	0.6858	L	0.36672	1.1	0.18873	N	0.999985	B;B	0.21905	0.062;0.037	B;B	0.26969	0.075;0.034	T	0.79514	-0.1772	10	0.40728	T	0.16	-18.7789	7.8234	0.29300	0.1168:0.629:0.1155:0.1388	.	267;322	P98177-2;P98177	.;FOXO4_HUMAN	R	322;267	ENSP00000363377:S322R;ENSP00000342209:S267R	ENSP00000342209:S267R	S	+	3	2	FOXO4	70237771	0.994000	0.37717	0.047000	0.18901	0.086000	0.17979	0.152000	0.16302	-0.723000	0.04915	-0.619000	0.04042	AGT	FOXO4	-	NULL	ENSG00000184481		0.572	FOXO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXO4	HGNC	protein_coding	OTTHUMT00000057115.1	42	0.00	0	T	NM_005938		70321046	70321046	+1	no_errors	ENST00000374259	ensembl	human	known	69_37n	missense	12	36.84	7	SNP	0.402	G
GABRR3	200959	genome.wustl.edu	37	3	97731406	97731406	+	RNA	SNP	A	A	G			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr3:97731406A>G	ENST00000472788.1	-	0	313					NM_001105580.2	NP_001099050.1	A8MPY1	GBRR3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, rho 3 (gene/pseudogene)						gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			large_intestine(2)|lung(1)	3					Adinazolam(DB00546)|Bromazepam(DB01558)|Cinolazepam(DB01594)|Clotiazepam(DB01559)|Diazepam(DB00829)|Estazolam(DB01215)|Fludiazepam(DB01567)|Flurazepam(DB00690)|Halazepam(DB00801)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Prazepam(DB01588)|Quazepam(DB01589)|Temazepam(DB00231)|Triazolam(DB00897)	AAGTCATTGTAAAGTCCTAGA	0.413																																						dbGAP											0													89.0	82.0	85.0					3																	97731406		1837	4092	5929	-	-	-			0			Y18994	CCDS54617.1	3q11.2	2014-03-25	2014-03-25		ENSG00000183185	ENSG00000183185		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	17969	protein-coding gene	gene with protein product	"""GABA(A) receptor, rho 3"""		"""gamma-aminobutyric acid (GABA) receptor, rho 3"", ""gamma-aminobutyric acid (GABA) A receptor, rho 3"""			10542332	Standard	NM_001105580		Approved		uc021xbp.1	A8MPY1	OTTHUMG00000159135		3.37:g.97731406A>G			Q9UIV9	Silent	SNP	NULL	p.F104	ENST00000472788.1	37	c.312		3																																																																																			GABRR3	-	NULL	ENSG00000183185		0.413	GABRR3-002	KNOWN	not_organism_supported|basic	polymorphic_pseudogene	GABRR3	HGNC	polymorphic_pseudogene	OTTHUMT00000353445.2	118	0.00	0	A			97731406	97731406	-1	pseudogene	ENST00000472788	ensembl	human	known	69_37n	silent	70	33.96	36	SNP	1.000	G
GCN1L1	10985	genome.wustl.edu	37	12	120582590	120582590	+	Silent	SNP	C	C	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr12:120582590C>T	ENST00000300648.6	-	41	5217	c.5205G>A	c.(5203-5205)ttG>ttA	p.L1735L		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	1735					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TTTCTGGCATCAACTTCTCCA	0.522																																						dbGAP											0													180.0	184.0	182.0					12																	120582590		2050	4209	6259	-	-	-	SO:0001819	synonymous_variant	0			U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.5205G>A	12.37:g.120582590C>T			A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Silent	SNP	pfam_DUF3554,pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.L1735	ENST00000300648.6	37	c.5205	CCDS41847.1	12																																																																																			GCN1L1	-	superfamily_ARM-type_fold	ENSG00000089154		0.522	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCN1L1	HGNC	protein_coding	OTTHUMT00000403592.1	216	0.00	0	C			120582590	120582590	-1	no_errors	ENST00000300648	ensembl	human	known	69_37n	silent	94	15.93	18	SNP	1.000	T
GGT3P	2679	genome.wustl.edu	37	22	18769678	18769678	+	RNA	SNP	G	G	A	rs3894040	byFrequency	TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr22:18769678G>A	ENST00000412448.1	-	0	1000							A6NGU5	GGT3_HUMAN	gamma-glutamyltransferase 3 pseudogene						glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)										GCTCGATGACGGTCCGCTTGT	0.672																																						dbGAP											0																																										-	-	-			0					22q11.21	2008-08-05	2008-03-10	2008-03-10	ENSG00000197421	ENSG00000197421		"""Gamma-glutamyltransferases"""	4252	pseudogene	pseudogene			"""gamma-glutamyltransferase 3"""	GGT3		8104871, 18357469	Standard	NR_003267		Approved		uc002zob.1	A6NGU5	OTTHUMG00000150161		22.37:g.18769678G>A				RNA	SNP	-	NULL	ENST00000412448.1	37	NULL		22																																																																																			GGT3P	-	-	ENSG00000197421		0.672	GGT3P-002	KNOWN	basic	processed_transcript	GGT3P	HGNC	pseudogene	OTTHUMT00000341281.1	92	0.00	0	G	NR_003267		18769678	18769678	-1	no_errors	ENST00000412448	ensembl	human	known	69_37n	rna	26	10.34	3	SNP	0.000	A
GK2	2712	genome.wustl.edu	37	4	80329028	80329028	+	Nonsense_Mutation	SNP	G	G	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr4:80329028G>T	ENST00000358842.3	-	1	344	c.327C>A	c.(325-327)taC>taA	p.Y109*		NM_033214.2	NP_149991.2	Q01415	GALK2_HUMAN	glycerol kinase 2	295					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|N-acetylgalactosamine kinase activity (GO:0033858)			autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	39						CCACAGCATTGTAGAGAGGCT	0.413																																						dbGAP											0													165.0	158.0	160.0					4																	80329028		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC029820	CCDS3585.1	4q13	2008-02-05	2002-10-03	2002-10-04	ENSG00000196475	ENSG00000196475		"""Glycerol kinases"""	4291	protein-coding gene	gene with protein product		600148	"""glycerol kinase pseudogene 2"""	GKP2		7987308	Standard	NM_033214		Approved	GKTA	uc003hlu.3	Q14410	OTTHUMG00000130199	ENST00000358842.3:c.327C>A	4.37:g.80329028G>T	ENSP00000351706:p.Tyr109*		Q7Z4Q4	Nonsense_Mutation	SNP	pfam_Carb_kinase_FGGY_N,pfam_Carb_kinase_FGGY_C,tigrfam_Glycerol_kin	p.Y109*	ENST00000358842.3	37	c.327	CCDS3585.1	4	.	.	.	.	.	.	.	.	.	.	G	10.88	1.476620	0.26511	.	.	ENSG00000196475	ENST00000358842	.	.	.	3.76	-0.162	0.13367	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.8679	7.8994	0.29725	0.416:0.0:0.584:0.0	.	.	.	.	X	109	.	ENSP00000351706:Y109X	Y	-	3	2	GK2	80548052	0.985000	0.35326	0.923000	0.36655	0.082000	0.17680	0.183000	0.16919	-0.066000	0.12998	-0.225000	0.12378	TAC	GK2	-	pfam_Carb_kinase_FGGY_N,tigrfam_Glycerol_kin	ENSG00000196475		0.413	GK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GK2	HGNC	protein_coding	OTTHUMT00000252517.2	218	0.00	0	G	NM_033214		80329028	80329028	-1	no_errors	ENST00000358842	ensembl	human	known	69_37n	nonsense	102	25.00	34	SNP	1.000	T
GLT8D2	83468	genome.wustl.edu	37	12	104388153	104388153	+	Missense_Mutation	SNP	T	T	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr12:104388153T>A	ENST00000360814.4	-	9	1132	c.727A>T	c.(727-729)Atc>Ttc	p.I243F	GLT8D2_ENST00000548660.1_Missense_Mutation_p.I243F|GLT8D2_ENST00000546436.1_Missense_Mutation_p.I243F	NM_031302.3	NP_112592.1	Q9H1C3	GL8D2_HUMAN	glycosyltransferase 8 domain containing 2	243						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			kidney(3)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)	16						TGCTTGGTGATGCGCTGGTGC	0.453																																						dbGAP											0													135.0	109.0	118.0					12																	104388153		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC022343	CCDS9096.1	12q23.3	2013-02-22			ENSG00000120820	ENSG00000120820		"""Glycosyltransferase family 8 domain containing"""	24890	protein-coding gene	gene with protein product							Standard	NM_031302		Approved	FLJ31494	uc001tkh.1	Q9H1C3	OTTHUMG00000170120	ENST00000360814.4:c.727A>T	12.37:g.104388153T>A	ENSP00000354053:p.Ile243Phe		Q96KA2	Missense_Mutation	SNP	pfam_Glyco_trans_8	p.I243F	ENST00000360814.4	37	c.727	CCDS9096.1	12	.	.	.	.	.	.	.	.	.	.	T	25.1	4.602599	0.87157	.	.	ENSG00000120820	ENST00000360814;ENST00000546436;ENST00000548660	T;T;T	0.50277	0.75;0.75;0.75	5.83	5.83	0.93111	.	0.045545	0.85682	D	0.000000	T	0.56277	0.1974	M	0.69823	2.125	0.80722	D	1	P	0.51147	0.942	P	0.49047	0.599	T	0.60944	-0.7162	10	0.56958	D	0.05	.	13.2461	0.60024	0.0:0.0:0.1319:0.8681	.	243	Q9H1C3	GL8D2_HUMAN	F	243	ENSP00000354053:I243F;ENSP00000449750:I243F;ENSP00000447450:I243F	ENSP00000354053:I243F	I	-	1	0	GLT8D2	102912283	1.000000	0.71417	0.950000	0.38849	0.972000	0.66771	4.130000	0.57964	2.235000	0.73313	0.533000	0.62120	ATC	GLT8D2	-	pfam_Glyco_trans_8	ENSG00000120820		0.453	GLT8D2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GLT8D2	HGNC	protein_coding	OTTHUMT00000407371.1	191	0.00	0	T	NM_031302		104388153	104388153	-1	no_errors	ENST00000360814	ensembl	human	known	69_37n	missense	76	34.48	40	SNP	0.996	A
GLYR1	84656	genome.wustl.edu	37	16	4861729	4861729	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr16:4861729C>T	ENST00000321919.9	-	14	1433	c.1357G>A	c.(1357-1359)Gag>Aag	p.E453K	GLYR1_ENST00000591451.1_Missense_Mutation_p.E447K|GLYR1_ENST00000381983.3_Missense_Mutation_p.E436K|GLYR1_ENST00000436648.5_Missense_Mutation_p.E372K	NM_032569.3	NP_115958	Q49A26	GLYR1_HUMAN	glyoxylate reductase 1 homolog (Arabidopsis)	453					pentose-phosphate shunt (GO:0006098)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|NAD binding (GO:0051287)|phosphogluconate dehydrogenase (decarboxylating) activity (GO:0004616)			endometrium(1)|kidney(1)|large_intestine(7)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	19						GTCAGCCCCTCGGCAATAGTG	0.572																																						dbGAP											0													79.0	70.0	73.0					16																	4861729		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF244907	CCDS10524.1	16p13.3	2010-02-17			ENSG00000140632	ENSG00000140632			24434	protein-coding gene	gene with protein product	"""nuclear protein 60kDa"""	610660				16352664	Standard	NM_032569		Approved	BM045, HIBDL, NP60, N-PAC	uc002cxx.4	Q49A26	OTTHUMG00000129530	ENST00000321919.9:c.1357G>A	16.37:g.4861729C>T	ENSP00000322716:p.Glu453Lys		B4DL47|C9JJ40|C9JJ60|Q5U632|Q6P1Q2|Q6V3W7|Q9BTI1|Q9BXK2	Missense_Mutation	SNP	pfam_6PGDH_NADP-bd,pfam_PWWP,pfam_NADP_OxRdtase_F420,superfamily_6-PGluconate_DH_C-like,smart_PWWP,pfscan_PWWP	p.E453K	ENST00000321919.9	37	c.1357	CCDS10524.1	16	.	.	.	.	.	.	.	.	.	.	C	35	5.505272	0.96371	.	.	ENSG00000140632	ENST00000321919;ENST00000381983;ENST00000436648	T;T;T	0.69175	-0.38;-0.38;-0.38	5.85	5.85	0.93711	Dehydrogenase, multihelical (1);6-phosphogluconate dehydrogenase, C-terminal-like (1);	0.000000	0.85682	D	0.000000	D	0.85448	0.5699	M	0.88979	2.995	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.999;0.998;0.983	D	0.87336	0.2328	10	0.87932	D	0	-29.6187	18.9368	0.92589	0.0:1.0:0.0:0.0	.	372;447;436;453	Q49A26-5;Q49A26-3;Q49A26-2;Q49A26	.;.;.;GLYR1_HUMAN	K	453;436;372	ENSP00000322716:E453K;ENSP00000371413:E436K;ENSP00000390276:E372K	ENSP00000322716:E453K	E	-	1	0	GLYR1	4801730	1.000000	0.71417	0.973000	0.42090	0.963000	0.63663	7.428000	0.80296	2.768000	0.95171	0.655000	0.94253	GAG	GLYR1	-	superfamily_6-PGluconate_DH_C-like	ENSG00000140632		0.572	GLYR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GLYR1	HGNC	protein_coding	OTTHUMT00000251717.2	146	0.00	0	C	NM_032569		4861729	4861729	-1	no_errors	ENST00000321919	ensembl	human	known	69_37n	missense	44	12.00	6	SNP	1.000	T
GPC2	221914	genome.wustl.edu	37	7	99773245	99773245	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr7:99773245C>T	ENST00000292377.2	-	3	765	c.598G>A	c.(598-600)Gat>Aat	p.D200N	STAG3_ENST00000317296.5_5'Flank|STAG3_ENST00000394018.2_5'Flank|GPC2_ENST00000471050.1_5'Flank|STAG3_ENST00000426455.1_5'Flank	NM_152742.1	NP_689955.1	Q8N158	GPC2_HUMAN	glypican 2	200			D -> N (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuron differentiation (GO:0030182)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	anchored component of membrane (GO:0031225)|endoplasmic reticulum (GO:0005783)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.D200N(1)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|pancreas(1)|skin(3)	18	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					AGAGAGCCATCGGTAGATGAG	0.632																																						dbGAP											1	Substitution - Missense(1)	breast(1)											38.0	34.0	36.0					7																	99773245		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX375153	CCDS5689.1	7q22.1	2007-02-16	2007-02-15		ENSG00000213420	ENSG00000213420		"""Proteoglycans / Cell Surface : Glypicans"""	4450	protein-coding gene	gene with protein product	"""glypican proteoglycan 2, cerebroglycan proteoglycan"""		"""glypican 2 (cerebroglycan)"""			8294498	Standard	NM_152742		Approved	cerebroglycan, FLJ38962, DKFZp547M109	uc003utv.3	Q8N158	OTTHUMG00000154894	ENST00000292377.2:c.598G>A	7.37:g.99773245C>T	ENSP00000292377:p.Asp200Asn		A4D2A7	Missense_Mutation	SNP	pfam_Glypican	p.D200N	ENST00000292377.2	37	c.598	CCDS5689.1	7	.	.	.	.	.	.	.	.	.	.	C	20.6	4.016969	0.75161	.	.	ENSG00000213420	ENST00000292377	T	0.37915	1.17	5.06	4.17	0.49024	.	0.000000	0.45126	D	0.000400	T	0.30572	0.0769	L	0.57536	1.79	0.23425	N	0.997703	B	0.30482	0.281	B	0.24974	0.057	T	0.13495	-1.0507	10	0.28530	T	0.3	-20.6913	9.9373	0.41559	0.0:0.9013:0.0:0.0987	.	200	Q8N158	GPC2_HUMAN	N	200	ENSP00000292377:D200N	ENSP00000292377:D200N	D	-	1	0	GPC2	99611181	0.709000	0.27886	1.000000	0.80357	0.978000	0.69477	1.907000	0.39897	2.362000	0.80069	0.306000	0.20318	GAT	GPC2	-	pfam_Glypican	ENSG00000213420		0.632	GPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC2	HGNC	protein_coding	OTTHUMT00000337556.1	71	0.00	0	C	NM_152742		99773245	99773245	-1	no_errors	ENST00000292377	ensembl	human	known	69_37n	missense	15	31.82	7	SNP	0.998	T
HTATSF1	27336	genome.wustl.edu	37	X	135593306	135593306	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chrX:135593306G>A	ENST00000218364.4	+	9	1576	c.1402G>A	c.(1402-1404)Gaa>Aaa	p.E468K	HTATSF1_ENST00000535601.1_Missense_Mutation_p.E468K	NM_014500.4	NP_055315.2	O43719	HTSF1_HUMAN	HIV-1 Tat specific factor 1	468	Asp/Glu-rich (acidic).|Mediates interaction with the P-TEFb complex.				regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(14)|ovary(3)|prostate(1)	30	Acute lymphoblastic leukemia(192;0.000127)					AAAAGAATCTGAAGAGGGCTG	0.463																																						dbGAP											0													47.0	52.0	51.0					X																	135593306		2182	4285	6467	-	-	-	SO:0001583	missense	0			U76992	CCDS14657.1	Xq26.3	2013-02-12	2006-01-09		ENSG00000102241	ENSG00000102241		"""RNA binding motif (RRM) containing"""	5276	protein-coding gene	gene with protein product		300346	"""HIV TAT specific factor 1"""			8849451	Standard	NM_014500		Approved	TAT-SF1	uc004ezx.3	O43719	OTTHUMG00000022510	ENST00000218364.4:c.1402G>A	X.37:g.135593306G>A	ENSP00000218364:p.Glu468Lys		D3DWG9|Q59G06|Q99730	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.E468K	ENST00000218364.4	37	c.1402	CCDS14657.1	X	.	.	.	.	.	.	.	.	.	.	G	13.80	2.344484	0.41498	.	.	ENSG00000102241	ENST00000535601;ENST00000218364;ENST00000415377	T;T	0.28666	1.6;1.6	3.73	3.73	0.42828	.	0.705821	0.15587	N	0.254567	T	0.20981	0.0505	N	0.12182	0.205	0.25749	N	0.985077	P	0.51057	0.941	B	0.43809	0.432	T	0.08764	-1.0706	10	0.87932	D	0	-6.7262	12.5821	0.56394	0.0:0.0:1.0:0.0	.	468	O43719	HTSF1_HUMAN	K	468	ENSP00000442699:E468K;ENSP00000218364:E468K	ENSP00000218364:E468K	E	+	1	0	HTATSF1	135420972	0.972000	0.33761	0.439000	0.26833	0.505000	0.33919	3.427000	0.52785	2.122000	0.65172	0.476000	0.43555	GAA	HTATSF1	-	NULL	ENSG00000102241		0.463	HTATSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTATSF1	HGNC	protein_coding	OTTHUMT00000058497.1	24	0.00	0	G	NM_014500		135593306	135593306	+1	no_errors	ENST00000218364	ensembl	human	known	69_37n	missense	23	20.69	6	SNP	0.767	A
IQGAP3	128239	genome.wustl.edu	37	1	156530801	156530801	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr1:156530801C>T	ENST00000361170.2	-	11	1064	c.1054G>A	c.(1054-1056)Gtg>Atg	p.V352M		NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	352					activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					AGAAGCTCCACCAGGCCCAGC	0.552																																						dbGAP											0													104.0	98.0	100.0					1																	156530801		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.1054G>A	1.37:g.156530801C>T	ENSP00000354451:p.Val352Met		Q5T3H8	Missense_Mutation	SNP	pfam_RasGAP,pfam_RasGAP_C,pfam_IQ_motif_EF-hand-BS,pfam_CH-domain,superfamily_Rho_GTPase_activation_prot,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_IQ_motif_EF-hand-BS,smart_RasGAP,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS,pfscan_RasGAP	p.V352M	ENST00000361170.2	37	c.1054	CCDS1144.1	1	.	.	.	.	.	.	.	.	.	.	C	12.03	1.815674	0.32145	.	.	ENSG00000183856	ENST00000361170	T	0.45276	0.9	5.69	0.642	0.17765	.	0.468148	0.22166	N	0.063711	T	0.10252	0.0251	L	0.29908	0.895	0.29297	N	0.86894	B	0.06786	0.001	B	0.06405	0.002	T	0.19647	-1.0299	10	0.40728	T	0.16	-2.6923	4.7209	0.12917	0.0:0.4497:0.15:0.4003	.	352	Q86VI3	IQGA3_HUMAN	M	352	ENSP00000354451:V352M	ENSP00000354451:V352M	V	-	1	0	IQGAP3	154797425	0.000000	0.05858	0.988000	0.46212	0.878000	0.50629	-0.269000	0.08596	0.069000	0.16605	-0.254000	0.11334	GTG	IQGAP3	-	NULL	ENSG00000183856		0.552	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP3	HGNC	protein_coding	OTTHUMT00000080657.1	147	0.00	0	C	NM_178229		156530801	156530801	-1	no_errors	ENST00000361170	ensembl	human	known	69_37n	missense	41	26.79	15	SNP	0.892	T
KL	9365	genome.wustl.edu	37	13	33635518	33635518	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr13:33635518G>A	ENST00000380099.3	+	4	2310	c.2302G>A	c.(2302-2304)Gga>Aga	p.G768R	KL_ENST00000426690.2_3'UTR|KL_ENST00000487852.1_3'UTR	NM_004795.3	NP_004786.2	Q9UEF7	KLOT_HUMAN	klotho	768	Glycosyl hydrolase-1 2.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|calcium ion homeostasis (GO:0055074)|carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of bone mineralization (GO:0030501)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-glucosidase activity (GO:0008422)|beta-glucuronidase activity (GO:0004566)|fibroblast growth factor binding (GO:0017134)|signal transducer activity (GO:0004871)|vitamin D binding (GO:0005499)			breast(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|skin(5)	41	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)		TTTCGGCTCTGGAGATTATCC	0.453																																						dbGAP											0													57.0	61.0	60.0					13																	33635518		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB005142	CCDS9347.1	13q12	2008-02-05			ENSG00000133116	ENSG00000133116			6344	protein-coding gene	gene with protein product		604824				9464267	Standard	NM_004795		Approved		uc001uus.3	Q9UEF7	OTTHUMG00000017408	ENST00000380099.3:c.2302G>A	13.37:g.33635518G>A	ENSP00000369442:p.Gly768Arg		Q5VZ95|Q96KV5|Q96KW5|Q9UEI9|Q9Y4F0	Missense_Mutation	SNP	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.G768R	ENST00000380099.3	37	c.2302	CCDS9347.1	13	.	.	.	.	.	.	.	.	.	.	G	28.5	4.928292	0.92389	.	.	ENSG00000133116	ENST00000380099	T	0.75938	-0.98	5.91	5.91	0.95273	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.90229	0.6945	M	0.92604	3.325	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91547	0.5254	10	0.87932	D	0	-21.9922	20.2963	0.98556	0.0:0.0:1.0:0.0	.	768	Q9UEF7	KLOT_HUMAN	R	768	ENSP00000369442:G768R	ENSP00000369442:G768R	G	+	1	0	KL	32533518	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	9.697000	0.98697	2.813000	0.96785	0.655000	0.94253	GGA	KL	-	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF	ENSG00000133116		0.453	KL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KL	HGNC	protein_coding	OTTHUMT00000045987.1	166	0.00	0	G			33635518	33635518	+1	no_errors	ENST00000380099	ensembl	human	known	69_37n	missense	70	29.00	29	SNP	1.000	A
KRT1	3848	genome.wustl.edu	37	12	53071193	53071193	+	Silent	SNP	G	G	A	rs192365492	byFrequency	TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr12:53071193G>A	ENST00000252244.3	-	5	1093	c.1035C>T	c.(1033-1035)ctC>ctT	p.L345L		NM_006121.3	NP_006112.3	P04264	K2C1_HUMAN	keratin 1	345	Linker 12.|Rod.			SL -> QF (in Ref. 9; AAA36153). {ECO:0000305}.	complement activation, lectin pathway (GO:0001867)|establishment of skin barrier (GO:0061436)|fibrinolysis (GO:0042730)|negative regulation of inflammatory response (GO:0050728)|regulation of angiogenesis (GO:0045765)|response to oxidative stress (GO:0006979)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(7)|skin(3)	39						TGTCCAGGTCGAGACTGCGGT	0.488													g|||	4	0.000798722	0.0	0.0	5008	,	,		21325	0.004		0.0	False		,,,				2504	0.0					dbGAP											0													130.0	122.0	125.0					12																	53071193		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X69725	CCDS8836.1	12q13.13	2014-06-05	2008-08-01		ENSG00000167768	ENSG00000167768		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6412	protein-coding gene	gene with protein product		139350	"""epidermolytic hyperkeratosis 1"""	EHK1		2461420, 2470667, 16831889	Standard	NM_006121		Approved	KRT1A	uc001sau.1	P04264	OTTHUMG00000169749	ENST00000252244.3:c.1035C>T	12.37:g.53071193G>A			B2RA01|P85925|P86104|Q14720|Q6GSJ0|Q9H298	Silent	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.L345	ENST00000252244.3	37	c.1035	CCDS8836.1	12																																																																																			KRT1	-	pfam_F	ENSG00000167768		0.488	KRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT1	HGNC	protein_coding	OTTHUMT00000405706.1	234	0.00	0	G	NM_006121		53071193	53071193	-1	no_errors	ENST00000252244	ensembl	human	known	69_37n	silent	98	32.88	48	SNP	1.000	A
LGI1	9211	genome.wustl.edu	37	10	95518519	95518519	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr10:95518519C>G	ENST00000371418.4	+	2	478	c.218C>G	c.(217-219)tCc>tGc	p.S73C	LGI1_ENST00000371413.3_Missense_Mutation_p.S73C|LGI1_ENST00000542308.1_Missense_Mutation_p.S73C|LGI1_ENST00000478763.1_3'UTR	NM_005097.2	NP_005088.1	O95970	LGI1_HUMAN	leucine-rich, glioma inactivated 1	73					axon guidance (GO:0007411)|cell proliferation (GO:0008283)|nervous system development (GO:0007399)|neuron projection development (GO:0031175)|positive regulation of cell growth (GO:0030307)|positive regulation of synaptic transmission (GO:0050806)|protein homooligomerization (GO:0051260)	cell junction (GO:0030054)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|synapse (GO:0045202)	receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(18)|ovary(2)|skin(1)	29		Colorectal(252;0.124)				TCTTTCAGATCCTTTGTGAGA	0.348																																						dbGAP											0													52.0	54.0	53.0					10																	95518519		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF055636	CCDS7431.1	10q24	2008-08-01	2002-06-05		ENSG00000108231	ENSG00000108231			6572	protein-coding gene	gene with protein product		604619	"""epilepsy, partial"""	EPT		9879993, 11978770, 15079011	Standard	NM_005097		Approved	IB1099, ETL1, EPITEMPIN	uc001kjc.4	O95970	OTTHUMG00000018777	ENST00000371418.4:c.218C>G	10.37:g.95518519C>G	ENSP00000360472:p.Ser73Cys		A8K0Z1|B4E1S0|Q5W001|Q5W002|Q8NI23|Q96LF5	Missense_Mutation	SNP	pfam_EPTP,pfam_Leu-rich_rpt,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,pfscan_EAR	p.S73C	ENST00000371418.4	37	c.218	CCDS7431.1	10	.	.	.	.	.	.	.	.	.	.	C	17.39	3.377878	0.61735	.	.	ENSG00000108231	ENST00000542308;ENST00000371418;ENST00000371413	D;D;D	0.90563	-2.68;-2.69;-2.69	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	D	0.96002	0.8698	M	0.89414	3.03	0.80722	D	1	D;D;P	0.89917	1.0;1.0;0.917	D;D;P	0.87578	0.998;0.987;0.897	D	0.95401	0.8490	10	0.40728	T	0.16	-8.208	18.5304	0.90990	0.0:1.0:0.0:0.0	.	73;73;73	O95970-3;O95970-2;O95970	.;.;LGI1_HUMAN	C	73	ENSP00000440763:S73C;ENSP00000360472:S73C;ENSP00000360467:S73C	ENSP00000360467:S73C	S	+	2	0	LGI1	95508509	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.854000	0.75440	2.626000	0.88956	0.555000	0.69702	TCC	LGI1	-	NULL	ENSG00000108231		0.348	LGI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGI1	HGNC	protein_coding	OTTHUMT00000049445.1	87	0.00	0	C	NM_005097		95518519	95518519	+1	no_errors	ENST00000371418	ensembl	human	known	69_37n	missense	133	18.29	30	SNP	1.000	G
LRGUK	136332	genome.wustl.edu	37	7	133886232	133886232	+	Splice_Site	SNP	G	G	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr7:133886232G>A	ENST00000285928.2	+	15	1816		c.e15-1			NM_144648.1	NP_653249.1	Q96M69	LRGUK_HUMAN	leucine-rich repeats and guanylate kinase domain containing							cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)			breast(1)|endometrium(2)|kidney(2)|large_intestine(12)|lung(23)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	49						CTTTGCTGCAGATGATCTGGA	0.393																																						dbGAP											0													124.0	108.0	113.0					7																	133886232		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK057348	CCDS5830.1	7q33	2006-10-27			ENSG00000155530	ENSG00000155530			21964	protein-coding gene	gene with protein product							Standard	NM_144648		Approved	FLJ32786	uc003vrm.1	Q96M69	OTTHUMG00000155320	ENST00000285928.2:c.1748-1G>A	7.37:g.133886232G>A			Q2M3I1	Splice_Site	SNP	-	e15-1	ENST00000285928.2	37	c.1748-1	CCDS5830.1	7	.	.	.	.	.	.	.	.	.	.	G	16.50	3.139388	0.56936	.	.	ENSG00000155530	ENST00000285928	.	.	.	4.89	4.89	0.63831	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.0069	0.89212	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LRGUK	133536772	1.000000	0.71417	0.997000	0.53966	0.606000	0.37113	6.252000	0.72447	2.415000	0.81967	0.561000	0.74099	.	LRGUK	-	-	ENSG00000155530		0.393	LRGUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRGUK	HGNC	protein_coding	OTTHUMT00000339442.1	145	0.00	0	G	NM_144648	Intron	133886232	133886232	+1	no_errors	ENST00000285928	ensembl	human	known	69_37n	splice_site	69	35.51	38	SNP	1.000	A
MACF1	23499	genome.wustl.edu	37	1	39751334	39751334	+	Missense_Mutation	SNP	A	A	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr1:39751334A>T	ENST00000372915.3	+	13	1514	c.1427A>T	c.(1426-1428)tAc>tTc	p.Y476F	MACF1_ENST00000317713.7_Missense_Mutation_p.Y476F|MACF1_ENST00000567887.1_Missense_Mutation_p.Y508F|MACF1_ENST00000545844.1_Missense_Mutation_p.Y476F|MACF1_ENST00000361689.2_Missense_Mutation_p.Y476F|MACF1_ENST00000564288.1_Missense_Mutation_p.Y471F|MACF1_ENST00000539005.1_Missense_Mutation_p.Y476F			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	476					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GTCATTATGTACATTCAGGAG	0.478																																						dbGAP											0													108.0	97.0	101.0					1																	39751334		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.1427A>T	1.37:g.39751334A>T	ENSP00000362006:p.Tyr476Phe		B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_Ca-bd,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_HAND_2	p.Y476F	ENST00000372915.3	37	c.1427		1	.	.	.	.	.	.	.	.	.	.	A	16.61	3.171511	0.57584	.	.	ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000524432;ENST00000530262;ENST00000372900	D;D;D;D;D;D;D	0.92545	-3.06;-3.06;-3.06;-3.06;-3.06;-3.06;-3.06	5.93	5.93	0.95920	.	.	.	.	.	D	0.93015	0.7777	L	0.46885	1.475	0.80722	D	1	B;D	0.67145	0.183;0.996	B;D	0.68192	0.04;0.956	D	0.90342	0.4360	9	0.17369	T	0.5	.	11.4717	0.50272	0.8659:0.0:0.0:0.1341	.	476;441	F8W8Q1;Q9UPN3-3	.;.	F	476;476;476;476;476;434;625;636	ENSP00000439537:Y476F;ENSP00000362006:Y476F;ENSP00000354573:Y476F;ENSP00000313438:Y476F;ENSP00000444364:Y476F;ENSP00000435070:Y434F;ENSP00000437059:Y625F	ENSP00000313438:Y476F	Y	+	2	0	MACF1	39523921	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	4.868000	0.63021	2.281000	0.76405	0.533000	0.62120	TAC	MACF1	-	NULL	ENSG00000127603		0.478	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	141	0.00	0	A	NM_033044		39751334	39751334	+1	no_errors	ENST00000317713	ensembl	human	known	69_37n	missense	54	35.71	30	SNP	1.000	T
MAGI2	9863	genome.wustl.edu	37	7	77789588	77789588	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr7:77789588C>T	ENST00000354212.4	-	16	2852	c.2599G>A	c.(2599-2601)Gag>Aag	p.E867K	MAGI2_ENST00000419488.1_Missense_Mutation_p.E853K|MAGI2_ENST00000522391.1_Missense_Mutation_p.E867K	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	867					cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				GGGCAGGGCTCCCCTGCAAAA	0.502																																						dbGAP											0													91.0	90.0	90.0					7																	77789588		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.2599G>A	7.37:g.77789588C>T	ENSP00000346151:p.Glu867Lys		A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	pfam_PDZ,pfam_WW_Rsp5_WWP,pfam_Guanylate_kin,superfamily_PDZ,superfamily_WW_Rsp5_WWP,smart_PDZ,smart_Guanylate_kin/L-typ_Ca_channel,smart_WW_Rsp5_WWP,pfscan_PDZ,pfscan_WW_Rsp5_WWP,pfscan_Guanylate_kin	p.E867K	ENST00000354212.4	37	c.2599	CCDS5594.1	7	.	.	.	.	.	.	.	.	.	.	C	16.94	3.260099	0.59321	.	.	ENSG00000187391	ENST00000419488;ENST00000354212;ENST00000536298;ENST00000522391	T;T;T	0.11169	2.91;2.92;2.8	5.51	5.51	0.81932	.	0.000000	0.36854	U	0.002372	T	0.08980	0.0222	N	0.24115	0.695	0.80722	D	1	B;B;B	0.14438	0.004;0.01;0.006	B;B;B	0.09377	0.004;0.004;0.003	T	0.24799	-1.0150	10	0.10636	T	0.68	.	19.4065	0.94649	0.0:1.0:0.0:0.0	.	867;853;867	E7EWI0;Q86UL8-2;Q86UL8	.;.;MAGI2_HUMAN	K	853;867;867;867	ENSP00000405766:E853K;ENSP00000346151:E867K;ENSP00000428389:E867K	ENSP00000346151:E867K	E	-	1	0	MAGI2	77627524	1.000000	0.71417	1.000000	0.80357	0.838000	0.47535	7.456000	0.80751	2.595000	0.87683	0.591000	0.81541	GAG	MAGI2	-	NULL	ENSG00000187391		0.502	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGI2	HGNC	protein_coding	OTTHUMT00000253197.3	116	0.00	0	C	NM_012301		77789588	77789588	-1	no_errors	ENST00000354212	ensembl	human	known	69_37n	missense	43	25.86	15	SNP	1.000	T
MAST2	23139	genome.wustl.edu	37	1	46488611	46488611	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr1:46488611C>G	ENST00000361297.2	+	13	1736	c.1453C>G	c.(1453-1455)Cct>Gct	p.P485A	MAST2_ENST00000372009.2_Missense_Mutation_p.P415A	NM_015112.2	NP_055927.2			microtubule associated serine/threonine kinase 2											breast(1)|lung(3)|ovary(5)|stomach(2)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					CTGTGACAGTCCTGACACTCC	0.473																																						dbGAP											0													143.0	138.0	140.0					1																	46488611		1996	4175	6171	-	-	-	SO:0001583	missense	0			AB047005	CCDS41326.1	1p34.1	2008-02-05			ENSG00000086015	ENSG00000086015			19035	protein-coding gene	gene with protein product		612257					Standard	NM_015112		Approved	MAST205, KIAA0807	uc001cov.3	Q6P0Q8	OTTHUMG00000008007	ENST00000361297.2:c.1453C>G	1.37:g.46488611C>G	ENSP00000354671:p.Pro485Ala			Missense_Mutation	SNP	pfam_MA_Ser/Thr_Kinase_dom,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,superfamily_Kinase-like_dom,superfamily_MAST_pre-PK_dom,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PDZ,pfscan_PDZ,pfscan_Prot_kinase_cat_dom	p.P485A	ENST00000361297.2	37	c.1453	CCDS41326.1	1	.	.	.	.	.	.	.	.	.	.	C	14.46	2.540903	0.45280	.	.	ENSG00000086015	ENST00000361297;ENST00000372009;ENST00000432341;ENST00000372008	T;T;T	0.63580	0.0;0.03;-0.05	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.46405	0.1391	N	0.19112	0.55	0.49483	D	0.99979	B;B;B;B;B	0.21606	0.0;0.003;0.0;0.058;0.02	B;B;B;B;B	0.23716	0.001;0.007;0.001;0.048;0.027	T	0.39292	-0.9621	10	0.07325	T	0.83	-18.1795	16.2608	0.82541	0.0:0.8683:0.1316:0.0	.	159;415;159;415;485	B3KU51;Q6P0Q8-2;E7EWL1;E7ERL6;Q6P0Q8	.;.;.;.;MAST2_HUMAN	A	485;415;159;370	ENSP00000354671:P485A;ENSP00000361079:P415A;ENSP00000361078:P370A	ENSP00000354671:P485A	P	+	1	0	MAST2	46261198	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.791000	0.55469	2.941000	0.99782	0.655000	0.94253	CCT	MAST2	-	NULL	ENSG00000086015		0.473	MAST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAST2	HGNC	protein_coding	OTTHUMT00000021977.1	221	0.00	0	C	NM_015112		46488611	46488611	+1	no_errors	ENST00000361297	ensembl	human	known	69_37n	missense	104	26.76	38	SNP	1.000	G
METTL10	399818	genome.wustl.edu	37	10	126450881	126450881	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr10:126450881G>A	ENST00000368836.2	-	6	899	c.863C>T	c.(862-864)tCg>tTg	p.S288L	RP11-12J10.3_ENST00000494792.1_Intron	NM_212554.2	NP_997719.2	Q5JPI9	MET10_HUMAN	methyltransferase like 10	288							methyltransferase activity (GO:0008168)			endometrium(1)|large_intestine(2)|lung(1)|urinary_tract(1)	5		all_lung(145;0.0186)|Lung NSC(174;0.0295)|all_neural(114;0.116)|Colorectal(57;0.172)		Colorectal(40;0.101)|COAD - Colon adenocarcinoma(40;0.111)		AAATGCCAACGAGGGCCTGGC	0.408																																						dbGAP											0													38.0	41.0	40.0					10																	126450881		1327	2309	3636	-	-	-	SO:0001583	missense	0				CCDS31307.1	10q26.13	2010-01-15			ENSG00000203791	ENSG00000203791			33787	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 138"""	C10orf138			Standard	NM_212554		Approved	Em:AC068896.3	uc001lhy.1	Q5JPI9	OTTHUMG00000019217	ENST00000368836.2:c.863C>T	10.37:g.126450881G>A	ENSP00000357829:p.Ser288Leu		A8MPY7	Missense_Mutation	SNP	pfam_Methyltransf_11,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_Small_mtfrase_dom,pfam_tRNA_(Gua-N-7)_MeTrfase	p.S288L	ENST00000368836.2	37	c.863	CCDS31307.1	10	.	.	.	.	.	.	.	.	.	.	G	0.009	-1.855477	0.00558	.	.	ENSG00000203791	ENST00000368836	T	0.25085	1.82	0.593	-1.19	0.09585	.	.	.	.	.	T	0.11665	0.0284	N	0.11131	0.1	0.18873	N	0.999985	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.15578	-1.0432	8	0.87932	D	0	.	3.7813	0.08682	0.0:0.1953:0.4296:0.3751	.	289;288	B5MDU2;Q5JPI9	.;MTL10_HUMAN	L	288	ENSP00000357829:S288L	ENSP00000357829:S288L	S	-	2	0	METTL10	126440871	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	-1.448000	0.02394	-2.447000	0.00545	-2.039000	0.00418	TCG	METTL10	-	NULL	ENSG00000203791		0.408	METTL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL10	HGNC	protein_coding	OTTHUMT00000050884.1	32	0.00	0	G	NM_212554		126450881	126450881	-1	no_errors	ENST00000368836	ensembl	human	known	69_37n	missense	37	35.09	20	SNP	0.000	A
MICAL2	9645	genome.wustl.edu	37	11	12241781	12241781	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr11:12241781G>C	ENST00000256194.4	+	9	1270	c.982G>C	c.(982-984)Gag>Cag	p.E328Q	MICAL2_ENST00000379612.3_Missense_Mutation_p.E328Q|MICAL2_ENST00000537344.1_Missense_Mutation_p.E328Q|MICAL2_ENST00000527546.1_Missense_Mutation_p.E328Q|MICAL2_ENST00000342902.5_Missense_Mutation_p.E328Q	NM_001282663.1|NM_014632.2	NP_001269592.1|NP_055447.1	O94851	MICA2_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 2	328	Monooxygenase domain. {ECO:0000250}.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|heart development (GO:0007507)|heart looping (GO:0001947)|oxidation-reduction process (GO:0055114)|positive regulation of transcription via serum response element binding (GO:0010735)|sulfur oxidation (GO:0019417)	nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|NADPH:sulfur oxidoreductase activity (GO:0043914)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	47				Epithelial(150;0.00552)		GCTGTGTGCGGAGAACGTGAA	0.527																																						dbGAP											0													161.0	138.0	146.0					11																	12241781		2201	4294	6495	-	-	-	SO:0001583	missense	0			AB018293	CCDS7809.1, CCDS60726.1, CCDS60727.1, CCDS60728.1	11p15.3	2014-08-12	2013-03-26		ENSG00000133816	ENSG00000133816			24693	protein-coding gene	gene with protein product		608881				12110185	Standard	XM_005253249		Approved	KIAA0750	uc001mjz.3	O94851	OTTHUMG00000165744	ENST00000256194.4:c.982G>C	11.37:g.12241781G>C	ENSP00000256194:p.Glu328Gln		B4DGZ0|B7Z849|D3DQW5|G3XAC8|Q5KTR3|Q5KTR4|Q7Z3A8	Missense_Mutation	SNP	pfam_CH-domain,pfam_CAMSAP_CH,pfam_Znf_LIM,pfam_mOase_FAD-bd,pfam_FAD_bind_dom,superfamily_CH-domain,smart_CH-domain,smart_Znf_LIM,prints_Rng_hydrolase-like,pfscan_CH-domain,pfscan_Znf_LIM	p.E328Q	ENST00000256194.4	37	c.982	CCDS7809.1	11	.	.	.	.	.	.	.	.	.	.	G	18.69	3.677419	0.68042	.	.	ENSG00000133816	ENST00000537344;ENST00000256194;ENST00000527546;ENST00000342902;ENST00000379612	T;T;T;T;T	0.13089	2.62;2.62;2.62;2.62;2.62	5.65	5.65	0.86999	.	0.195357	0.45361	D	0.000361	T	0.40094	0.1103	M	0.73598	2.24	0.53688	D	0.999977	D;D;P;D;D	0.76494	0.999;0.987;0.819;0.987;0.963	D;P;B;P;P	0.71414	0.973;0.827;0.434;0.827;0.84	T	0.04281	-1.0963	10	0.56958	D	0.05	.	19.5069	0.95121	0.0:0.0:1.0:0.0	.	328;328;328;328;328	G3XAC8;B7Z849;Q5KTR3;Q5KTR4;O94851	.;.;.;.;MICA2_HUMAN	Q	328	ENSP00000441689:E328Q;ENSP00000256194:E328Q;ENSP00000433965:E328Q;ENSP00000344894:E328Q;ENSP00000368932:E328Q	ENSP00000256194:E328Q	E	+	1	0	MICAL2	12198357	1.000000	0.71417	0.972000	0.41901	0.921000	0.55340	5.468000	0.66743	2.941000	0.99782	0.655000	0.94253	GAG	MICAL2	-	NULL	ENSG00000133816		0.527	MICAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MICAL2	HGNC	protein_coding	OTTHUMT00000385993.1	219	0.00	0	G	NM_014632		12241781	12241781	+1	no_errors	ENST00000256194	ensembl	human	known	69_37n	missense	92	17.86	20	SNP	0.999	C
MSL2	55167	genome.wustl.edu	37	3	135871199	135871199	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr3:135871199G>A	ENST00000309993.2	-	2	1256	c.524C>T	c.(523-525)tCt>tTt	p.S175F	MSL2_ENST00000434835.2_Missense_Mutation_p.S101F	NM_018133.3	NP_060603.2	Q9HCI7	MSL2_HUMAN	male-specific lethal 2 homolog (Drosophila)	175					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)	MSL complex (GO:0072487)|nucleoplasm (GO:0005654)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	18						AGACATTGGAGATAAACTAGC	0.393																																						dbGAP											0													74.0	69.0	71.0					3																	135871199		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001408	CCDS33861.1, CCDS46922.1	3q22.2	2008-10-29	2008-10-29	2008-10-29	ENSG00000174579	ENSG00000174579		"""RING-type (C3HC4) zinc fingers"""	25544	protein-coding gene	gene with protein product	"""male-specific lethal-2 homolog (Drosophila)"""	614802	"""ring finger protein 184"", ""male-specific lethal 2-like 1 (Drosophila)"""	RNF184, MSL2L1		16227571, 16543150	Standard	NM_018133		Approved	FLJ10546, KIAA1585, msl-2	uc003eqx.1	Q9HCI7	OTTHUMG00000159793	ENST00000309993.2:c.524C>T	3.37:g.135871199G>A	ENSP00000311827:p.Ser175Phe		B4DYL4|G5E9I1|Q0D2P1|Q8NDB4|Q9NVS4	Missense_Mutation	SNP	pfscan_Znf_RING	p.S175F	ENST00000309993.2	37	c.524	CCDS33861.1	3	.	.	.	.	.	.	.	.	.	.	G	12.04	1.819360	0.32145	.	.	ENSG00000174579	ENST00000309993;ENST00000434835;ENST00000481989;ENST00000491050	.	.	.	6.03	6.03	0.97812	.	0.402604	0.24818	N	0.035346	T	0.45875	0.1364	N	0.14661	0.345	0.43313	D	0.995328	P	0.45176	0.852	P	0.47705	0.555	T	0.47649	-0.9101	9	0.56958	D	0.05	-9.8688	15.0797	0.72106	0.0:0.1411:0.8589:0.0	.	175	Q9HCI7	MSL2_HUMAN	F	175;101;101;101	.	ENSP00000311827:S175F	S	-	2	0	MSL2	137353889	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.953000	0.63624	2.854000	0.98071	0.655000	0.94253	TCT	MSL2	-	NULL	ENSG00000174579		0.393	MSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSL2	HGNC	protein_coding	OTTHUMT00000357347.1	132	0.00	0	G	NM_018133		135871199	135871199	-1	no_errors	ENST00000309993	ensembl	human	known	69_37n	missense	78	17.02	16	SNP	1.000	A
MUC17	140453	genome.wustl.edu	37	7	100679922	100679922	+	Nonsense_Mutation	SNP	C	C	G			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr7:100679922C>G	ENST00000306151.4	+	3	5289	c.5225C>G	c.(5224-5226)tCa>tGa	p.S1742*		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1742	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					ATGCCAAACTCAACTCCTAGT	0.493																																						dbGAP											0													263.0	271.0	268.0					7																	100679922		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.5225C>G	7.37:g.100679922C>G	ENSP00000302716:p.Ser1742*		O14761|Q685J2|Q8TDH7	Nonsense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.S1742*	ENST00000306151.4	37	c.5225	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	C	41	8.705106	0.98922	.	.	ENSG00000169876	ENST00000306151	.	.	.	1.08	0.0659	0.14359	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	.	3.7517	0.08569	0.0:0.723:0.0:0.277	.	.	.	.	X	1742	.	ENSP00000302716:S1742X	S	+	2	0	MUC17	100466642	0.014000	0.17966	0.000000	0.03702	0.003000	0.03518	0.958000	0.29227	0.037000	0.15575	0.134000	0.15878	TCA	MUC17	-	NULL	ENSG00000169876		0.493	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	396	0.00	0	C	NM_001040105		100679922	100679922	+1	no_errors	ENST00000306151	ensembl	human	known	69_37n	nonsense	126	14.86	22	SNP	0.038	G
MUC17	140453	genome.wustl.edu	37	7	100681224	100681224	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr7:100681224C>G	ENST00000306151.4	+	3	6591	c.6527C>G	c.(6526-6528)tCt>tGt	p.S2176C		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2176	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GTGGCCAGTTCTGCAATCAGC	0.478																																						dbGAP											0													254.0	249.0	251.0					7																	100681224		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.6527C>G	7.37:g.100681224C>G	ENSP00000302716:p.Ser2176Cys		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.S2176C	ENST00000306151.4	37	c.6527	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	C	0.496	-0.873215	0.02570	.	.	ENSG00000169876	ENST00000306151	T	0.02682	4.2	0.683	0.683	0.17998	.	.	.	.	.	T	0.01287	0.0042	N	0.14661	0.345	0.09310	N	1	P	0.46064	0.872	B	0.26770	0.073	T	0.49698	-0.8912	9	0.59425	D	0.04	.	3.1072	0.06346	0.0:0.6672:0.0:0.3328	.	2176	Q685J3	MUC17_HUMAN	C	2176	ENSP00000302716:S2176C	ENSP00000302716:S2176C	S	+	2	0	MUC17	100467944	0.003000	0.15002	0.004000	0.12327	0.008000	0.06430	0.465000	0.22004	0.681000	0.31386	0.134000	0.15878	TCT	MUC17	-	NULL	ENSG00000169876		0.478	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	289	0.00	0	C	NM_001040105		100681224	100681224	+1	no_errors	ENST00000306151	ensembl	human	known	69_37n	missense	102	26.09	36	SNP	0.002	G
MUC5B	727897	genome.wustl.edu	37	11	1269972	1269972	+	Silent	SNP	C	C	T	rs370947976		TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr11:1269972C>T	ENST00000529681.1	+	31	11920	c.11862C>T	c.(11860-11862)atC>atT	p.I3954I	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Silent_p.I3957I	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	3954	11 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ccactacgatcacggccaccg	0.617																																						dbGAP											0													90.0	119.0	110.0					11																	1269972		1952	3933	5885	-	-	-	SO:0001819	synonymous_variant	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.11862C>T	11.37:g.1269972C>T			O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.I3957	ENST00000529681.1	37	c.11871	CCDS44515.2	11																																																																																			MUC5B	-	NULL	ENSG00000117983		0.617	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	645	0.00	0	C	XM_001126093		1269972	1269972	+1	no_errors	ENST00000447027	ensembl	human	known	69_37n	silent	234	22.52	68	SNP	0.000	T
MXRA5	25878	genome.wustl.edu	37	X	3239762	3239762	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chrX:3239762C>T	ENST00000217939.6	-	5	4118	c.3964G>A	c.(3964-3966)Gat>Aat	p.D1322N		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	1322						extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				TCTTTTCCATCTGATGTGGGT	0.353																																						dbGAP											0													148.0	132.0	137.0					X																	3239762		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.3964G>A	X.37:g.3239762C>T	ENSP00000217939:p.Asp1322Asn		Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.D1322N	ENST00000217939.6	37	c.3964	CCDS14124.1	X	.	.	.	.	.	.	.	.	.	.	c	6.009	0.370056	0.11352	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.63255	-0.03	3.41	1.56	0.23342	.	1.108720	0.07129	U	0.845273	T	0.43523	0.1251	N	0.24115	0.695	0.09310	N	1	B	0.33694	0.421	B	0.26864	0.074	T	0.26538	-1.0100	10	0.46703	T	0.11	.	5.5448	0.17057	0.0:0.6847:0.1976:0.1177	.	1322	Q9NR99	MXRA5_HUMAN	N	1322	ENSP00000217939:D1322N	ENSP00000217939:D1322N	D	-	1	0	MXRA5	3249762	0.001000	0.12720	0.000000	0.03702	0.364000	0.29643	0.946000	0.29069	-0.050000	0.13356	0.436000	0.28706	GAT	MXRA5	-	NULL	ENSG00000101825		0.353	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXRA5	HGNC	protein_coding	OTTHUMT00000055655.2	316	0.00	0	C	NM_015419		3239762	3239762	-1	no_errors	ENST00000217939	ensembl	human	known	69_37n	missense	168	40.07	113	SNP	0.000	T
MYH3	4621	genome.wustl.edu	37	17	10558307	10558307	+	Silent	SNP	G	G	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr17:10558307G>A	ENST00000583535.1	-	3	162	c.75C>T	c.(73-75)atC>atT	p.I25I	MYH3_ENST00000226209.7_Silent_p.I25I	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	25					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						TCTGAGCCTCGATCCTCTCCT	0.502																																						dbGAP											0													171.0	158.0	162.0					17																	10558307		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.75C>T	17.37:g.10558307G>A			Q15492	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.I25	ENST00000583535.1	37	c.75	CCDS11157.1	17																																																																																			MYH3	-	NULL	ENSG00000109063		0.502	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH3	HGNC	protein_coding	OTTHUMT00000252734.2	220	0.00	0	G	NM_002470		10558307	10558307	-1	no_errors	ENST00000226209	ensembl	human	known	69_37n	silent	95	22.13	27	SNP	0.995	A
NDRG2	57447	genome.wustl.edu	37	14	21486365	21486365	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr14:21486365G>C	ENST00000556147.1	-	14	1835	c.895C>G	c.(895-897)Cag>Gag	p.Q299E	NDRG2_ENST00000360463.3_Missense_Mutation_p.Q285E|NDRG2_ENST00000397855.3_Missense_Mutation_p.Q256E|NDRG2_ENST00000298687.5_Missense_Mutation_p.Q299E|NDRG2_ENST00000298684.5_Missense_Mutation_p.Q256E|NDRG2_ENST00000553503.1_Missense_Mutation_p.Q285E|NDRG2_ENST00000350792.3_Missense_Mutation_p.Q285E|NDRG2_ENST00000397844.2_Missense_Mutation_p.Q269E|NDRG2_ENST00000554104.1_Missense_Mutation_p.Q212E|NDRG2_ENST00000397851.2_Missense_Mutation_p.Q299E|NDRG2_ENST00000397853.3_Missense_Mutation_p.Q299E|NDRG2_ENST00000554277.1_5'Flank|NDRG2_ENST00000554143.1_Missense_Mutation_p.Q285E|NDRG2_ENST00000403829.3_Missense_Mutation_p.Q295E|NDRG2_ENST00000397847.2_Missense_Mutation_p.Q288E|NDRG2_ENST00000397858.1_Missense_Mutation_p.Q299E|NDRG2_ENST00000555158.1_Missense_Mutation_p.Q285E|NDRG2_ENST00000397856.3_Missense_Mutation_p.Q269E			Q9UN36	NDRG2_HUMAN	NDRG family member 2	299					cell differentiation (GO:0030154)|negative regulation of cytokine production (GO:0001818)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of smooth muscle cell proliferation (GO:0048662)|regulation of platelet-derived growth factor production (GO:0090361)|regulation of vascular endothelial growth factor production (GO:0010574)|substantia nigra development (GO:0021762)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)				breast(2)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	23	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;6.85e-11)|Epithelial(56;9.49e-09)|all cancers(55;3.84e-08)	GBM - Glioblastoma multiforme(265;0.0191)		GCACTCACCTGAGTCAGCTGG	0.592																																						dbGAP											0													44.0	41.0	42.0					14																	21486365		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033074	CCDS9564.1, CCDS9565.1, CCDS61384.1, CCDS61386.1, CCDS73613.1	14q11.2	2008-07-09			ENSG00000165795	ENSG00000165795			14460	protein-coding gene	gene with protein product		605272				10831399	Standard	NM_201535		Approved	KIAA1248, SYLD	uc001vyx.3	Q9UN36	OTTHUMG00000029619	ENST00000556147.1:c.895C>G	14.37:g.21486365G>C	ENSP00000451712:p.Gln299Glu		B3KUE3|B4DE86|B7WP11|B7WPD5|D3DS07|D3DS10|Q567T1|Q68DW2|Q86U08|Q86U46|Q96FD3|Q96FT0|Q96JU0|Q96PN0|Q9BQH5|Q9ULH2	Missense_Mutation	SNP	pfam_Ndr	p.Q299E	ENST00000556147.1	37	c.895	CCDS9565.1	14	.	.	.	.	.	.	.	.	.	.	G	19.98	3.927169	0.73327	.	.	ENSG00000165795	ENST00000298687;ENST00000350792;ENST00000554770;ENST00000397858;ENST00000554104;ENST00000555158;ENST00000553503;ENST00000397853;ENST00000360463;ENST00000556612;ENST00000556147;ENST00000554143;ENST00000397851;ENST00000397847;ENST00000397856;ENST00000397855;ENST00000298684;ENST00000397844;ENST00000403829;ENST00000556008;ENST00000556366	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.19806	2.12;2.12;2.12;2.12;2.12;2.12;2.12;2.12;2.12;2.12;2.12;2.12;2.12;2.12;2.12;2.12;2.12;2.12;2.12	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.32645	0.0836	M	0.89095	3.005	0.80722	D	1	P;P;B;B;P;B	0.42203	0.551;0.732;0.162;0.162;0.773;0.177	B;B;B;B;B;B	0.34824	0.062;0.119;0.037;0.037;0.19;0.172	T	0.47195	-0.9136	10	0.87932	D	0	-11.9368	17.017	0.86422	0.0:0.0:1.0:0.0	.	295;288;269;280;299;256	B4DE86;Q9UN36-3;Q9UN36-5;G3V3N4;Q9UN36;Q9UN36-4	.;.;.;.;NDRG2_HUMAN;.	E	299;285;280;299;212;285;285;299;285;33;299;285;299;288;269;256;256;269;295;285;212	ENSP00000298687:Q299E;ENSP00000344620:Q285E;ENSP00000380956:Q299E;ENSP00000452216:Q212E;ENSP00000452038:Q285E;ENSP00000452306:Q285E;ENSP00000380951:Q299E;ENSP00000353649:Q285E;ENSP00000451712:Q299E;ENSP00000452006:Q285E;ENSP00000380949:Q299E;ENSP00000380945:Q288E;ENSP00000380954:Q269E;ENSP00000380953:Q256E;ENSP00000298684:Q256E;ENSP00000380943:Q269E;ENSP00000385889:Q295E;ENSP00000451966:Q285E;ENSP00000452413:Q212E	ENSP00000298684:Q256E	Q	-	1	0	NDRG2	20556205	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.100000	0.94213	2.627000	0.88993	0.655000	0.94253	CAG	NDRG2	-	pfam_Ndr	ENSG00000165795		0.592	NDRG2-013	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	NDRG2	HGNC	protein_coding	OTTHUMT00000411717.1	80	0.00	0	G			21486365	21486365	-1	no_errors	ENST00000298687	ensembl	human	known	69_37n	missense	41	30.51	18	SNP	1.000	C
MYH7	4625	genome.wustl.edu	37	14	23884421	23884421	+	Missense_Mutation	SNP	C	C	T	rs397516246		TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr14:23884421C>T	ENST00000355349.3	-	37	5504	c.5342G>A	c.(5341-5343)cGc>cAc	p.R1781H	CTD-2201G16.1_ENST00000557368.1_RNA|MIR208B_ENST00000401172.1_RNA	NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1781					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		CTTCTTCATGCGCTCCAGGTG	0.597																																						dbGAP											0													101.0	99.0	100.0					14																	23884421		2203	4300	6503	-	-	-	SO:0001583	missense	0			M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.5342G>A	14.37:g.23884421C>T	ENSP00000347507:p.Arg1781His		A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R1781H	ENST00000355349.3	37	c.5342	CCDS9601.1	14	.	.	.	.	.	.	.	.	.	.	C	28.8	4.955605	0.92726	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	T	0.79454	-1.27	5.12	5.12	0.69794	Myosin tail (1);	.	.	.	.	D	0.91399	0.7286	M	0.93939	3.475	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93325	0.6696	9	0.87932	D	0	.	18.7524	0.91820	0.0:1.0:0.0:0.0	.	1781	P12883	MYH7_HUMAN	H	1781;1786	ENSP00000347507:R1781H	ENSP00000347507:R1781H	R	-	2	0	MYH7	22954261	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.624000	0.67764	2.670000	0.90874	0.563000	0.77884	CGC	MYH7	-	pfam_Myosin_tail	ENSG00000092054		0.597	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH7	HGNC	protein_coding	OTTHUMT00000071798.3	192	0.00	0	C	NM_000257		23884421	23884421	-1	no_errors	ENST00000355349	ensembl	human	known	69_37n	missense	99	16.81	20	SNP	1.000	T
NEB	4703	genome.wustl.edu	37	2	152350381	152350381	+	Splice_Site	SNP	C	C	G			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr2:152350381C>G	ENST00000172853.10	-	142	19159	c.19012G>C	c.(19012-19014)Gtg>Ctg	p.V6338L	NEB_ENST00000509223.2_Intron|NEB_ENST00000427231.2_Splice_Site_p.V8194L|NEB_ENST00000603639.1_Splice_Site_p.V8194L|NEB_ENST00000397345.3_Splice_Site_p.V8194L|NEB_ENST00000498015.2_Intron|RIF1_ENST00000457745.1_Intron|NEB_ENST00000604864.1_Splice_Site_p.V8194L|NEB_ENST00000409198.1_Splice_Site_p.V6338L|NEB_ENST00000397336.2_Splice_Site_p.V169L			P20929	NEBU_HUMAN	nebulin	6338					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TTGTATAACACCTGTGAGATA	0.383																																						dbGAP											0													58.0	54.0	55.0					2																	152350381		1822	4077	5899	-	-	-	SO:0001630	splice_region_variant	0			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.19012-1G>C	2.37:g.152350381C>G			F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom_bac,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,prints_Nebulin,pfscan_Nebulin_35r-motif,pfscan_SH3_domain	p.V8194L	ENST00000172853.10	37	c.24580		2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.38|17.38	3.375322|3.375322	0.61735|0.61735	.|.	.|.	ENSG00000183091|ENSG00000183091	ENST00000421461|ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853;ENST00000397336	.|T;T;T;T;T	.|0.51574	.|0.7;0.7;0.7;0.7;0.7	5.69|5.69	4.82|4.82	0.62117|0.62117	.|.	.|0.115291	.|0.64402	.|D	.|0.000018	T|T	0.71126|0.71126	0.3303|0.3303	M|M	0.85373|0.85373	2.75|2.75	0.44162|0.44162	D|D	0.996968|0.996968	.|B;D;D	.|0.71674	.|0.277;0.998;0.997	.|B;D;D	.|0.83275	.|0.206;0.996;0.983	T|T	0.75181|0.75181	-0.3408|-0.3408	5|10	.|0.49607	.|T	.|0.09	.|.	14.4893|14.4893	0.67639|0.67639	0.0:0.9287:0.0:0.0713|0.0:0.9287:0.0:0.0713	.|.	.|169;6338;8194	.|B7Z6P9;P20929;F8WCL5	.|.;NEBU_HUMAN;.	A|L	339|6338;8194;8194;6338;169	.|ENSP00000386259:V6338L;ENSP00000380505:V8194L;ENSP00000416578:V8194L;ENSP00000172853:V6338L;ENSP00000380497:V169L	.|ENSP00000172853:V6338L	G|V	-|-	2|1	0|0	NEB|NEB	152058627|152058627	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.886000|0.886000	0.51366|0.51366	4.598000|4.598000	0.61069|0.61069	1.407000|1.407000	0.46875|0.46875	-0.150000|-0.150000	0.13652|0.13652	GGT|GTG	NEB	-	pfam_Nebulin_35r-motif,smart_Nebulin_35r-motif,pfscan_Nebulin_35r-motif	ENSG00000183091		0.383	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding		158	0.00	0	C	NM_004543	Missense_Mutation	152350381	152350381	-1	no_errors	ENST00000397345	ensembl	human	known	69_37n	missense	84	35.38	46	SNP	1.000	G
NLRP3	114548	genome.wustl.edu	37	1	247587541	247587541	+	Missense_Mutation	SNP	C	C	G	rs180177476		TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr1:247587541C>G	ENST00000336119.3	+	3	1542	c.796C>G	c.(796-798)Ctt>Gtt	p.L266V	NLRP3_ENST00000348069.2_Missense_Mutation_p.L266V|NLRP3_ENST00000391828.3_Missense_Mutation_p.L266V|NLRP3_ENST00000474792.1_3'UTR|NLRP3_ENST00000366496.2_Missense_Mutation_p.L266V|NLRP3_ENST00000391827.2_Missense_Mutation_p.L266V|NLRP3_ENST00000366497.2_Missense_Mutation_p.L266V	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	266	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.		L -> H (in CINCA). {ECO:0000269|PubMed:12483741}.		activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)			NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			AGAGGTGAGCCTTGTGACACA	0.537																																						dbGAP											0			GRCh37	CM071600|CM077613	NLRP3	M	rs180177476						69.0	70.0	69.0					1																	247587541		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.796C>G	1.37:g.247587541C>G	ENSP00000337383:p.Leu266Val		B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.L266V	ENST00000336119.3	37	c.796	CCDS1632.1	1	.	.	.	.	.	.	.	.	.	.	C	3.782	-0.045375	0.07452	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000348069;ENST00000366496;ENST00000391827	T;T;T;T;T;T	0.78481	-1.18;-1.18;-1.18;-1.18;-1.18;-1.18	4.04	4.04	0.47022	NACHT nucleoside triphosphatase (1);	0.000000	0.44483	D	0.000458	D	0.82674	0.5088	M	0.64080	1.96	0.30741	N	0.746183	D;B;P;B;P	0.61697	0.99;0.452;0.729;0.109;0.786	D;B;B;B;P	0.66979	0.948;0.299;0.343;0.061;0.833	T	0.76868	-0.2800	10	0.16420	T	0.52	.	11.9927	0.53184	0.0:1.0:0.0:0.0	.	266;266;266;266;266	B7ZKS9;Q96P20-4;Q96P20-2;Q96P20-5;Q96P20	.;.;.;.;NALP3_HUMAN	V	266	ENSP00000375704:L266V;ENSP00000355453:L266V;ENSP00000337383:L266V;ENSP00000294752:L266V;ENSP00000355452:L266V;ENSP00000375703:L266V	ENSP00000337383:L266V	L	+	1	0	NLRP3	245654164	0.000000	0.05858	0.983000	0.44433	0.028000	0.11728	-0.720000	0.04969	2.543000	0.85770	0.563000	0.77884	CTT	NLRP3	-	pfscan_NACHT_NTPase	ENSG00000162711		0.537	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP3	HGNC	protein_coding	OTTHUMT00000097740.1	50	0.00	0	C	NM_004895		247587541	247587541	+1	no_errors	ENST00000336119	ensembl	human	known	69_37n	missense	32	20.00	8	SNP	0.913	G
NOP9	161424	genome.wustl.edu	37	14	24772295	24772295	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr14:24772295G>C	ENST00000267425.3	+	6	1252	c.1159G>C	c.(1159-1161)Gag>Cag	p.E387Q	NOP9_ENST00000396802.3_Missense_Mutation_p.E387Q	NM_174913.1	NP_777573.1	Q86U38	NOP9_HUMAN	NOP9 nucleolar protein	387							poly(A) RNA binding (GO:0044822)										CCCTGTGTTTGAGGAGCTGAG	0.542																																						dbGAP											0													91.0	83.0	85.0					14																	24772295		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9624.1, CCDS66616.1	14q12	2012-12-10	2012-12-10	2012-06-06	ENSG00000196943	ENSG00000196943			19826	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 21"", ""NOP9 nucleolar protein homolog (yeast)"""	C14orf21		21653694	Standard	XM_005267385		Approved		uc001wol.1	Q86U38	OTTHUMG00000029342	ENST00000267425.3:c.1159G>C	14.37:g.24772295G>C	ENSP00000267425:p.Glu387Gln		A8MY76|Q8IVF0|Q8TBS6	Missense_Mutation	SNP	superfamily_ARM-type_fold,smart_Pumilio_RNA-bd_rpt	p.E387Q	ENST00000267425.3	37	c.1159	CCDS9624.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.29|12.29	1.893906|1.893906	0.33442|0.33442	.|.	.|.	ENSG00000196943|ENSG00000196943	ENST00000267425;ENST00000396802|ENST00000557362	T;T|.	0.15256|.	2.44;2.5|.	5.16|5.16	4.27|4.27	0.50696|0.50696	Armadillo-like helical (1);Armadillo-type fold (1);|.	0.114793|.	0.64402|.	D|.	0.000019|.	T|T	0.60715|0.60715	0.2290|0.2290	L|L	0.50333|0.50333	1.59|1.59	0.37259|0.37259	D|D	0.906905|0.906905	P|.	0.51351|.	0.944|.	P|.	0.46758|.	0.526|.	T|T	0.64136|0.64136	-0.6478|-0.6478	10|5	0.23891|.	T|.	0.37|.	-13.0734|-13.0734	12.7453|12.7453	0.57278|0.57278	0.0806:0.0:0.9194:0.0|0.0806:0.0:0.9194:0.0	.|.	387|.	Q86U38|.	CN021_HUMAN|.	Q|F	387|12	ENSP00000267425:E387Q;ENSP00000380020:E387Q|.	ENSP00000267425:E387Q|.	E|L	+|+	1|3	0|2	C14orf21|C14orf21	23842135|23842135	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.361000|0.361000	0.29550|0.29550	3.784000|3.784000	0.55416|0.55416	1.418000|1.418000	0.47098|0.47098	0.563000|0.563000	0.77884|0.77884	GAG|TTG	NOP9	-	superfamily_ARM-type_fold,smart_Pumilio_RNA-bd_rpt	ENSG00000196943		0.542	NOP9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	NOP9	HGNC	protein_coding	OTTHUMT00000073186.2	98	0.00	0	G			24772295	24772295	+1	no_errors	ENST00000267425	ensembl	human	known	69_37n	missense	42	35.38	23	SNP	1.000	C
NSMCE4A	54780	genome.wustl.edu	37	10	123720991	123720991	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr10:123720991G>T	ENST00000369023.3	-	7	937	c.886C>A	c.(886-888)Cat>Aat	p.H296N	NSMCE4A_ENST00000538652.1_Missense_Mutation_p.H137N|NSMCE4A_ENST00000489266.1_5'UTR	NM_001167865.1|NM_017615.2	NP_001161337.1|NP_060085.2	Q9NXX6	NSE4A_HUMAN	non-SMC element 4 homolog A (S. cerevisiae)	296					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|positive regulation of response to DNA damage stimulus (GO:2001022)	chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)|Smc5-Smc6 complex (GO:0030915)				breast(2)|endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	6		all_neural(114;0.138)|Glioma(114;0.222)				GGGAAAGAATGAGGATCAACC	0.313																																						dbGAP											0													52.0	54.0	53.0					10																	123720991		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF258584	CCDS7624.1	10q26.13	2007-05-17	2006-11-24	2006-11-24	ENSG00000107672	ENSG00000107672			25935	protein-coding gene	gene with protein product		612987	"""chromosome 10 open reading frame 86"""	C10orf86		15752197	Standard	NM_017615		Approved	FLJ20003, bA500G22.3, NSE4A	uc001lfs.3	Q9NXX6	OTTHUMG00000019180	ENST00000369023.3:c.886C>A	10.37:g.123720991G>T	ENSP00000358019:p.His296Asn		Q5SQQ5|Q6P673|Q8WY66|Q9BS90	Missense_Mutation	SNP	pfam_Nse4	p.H296N	ENST00000369023.3	37	c.886	CCDS7624.1	10	.	.	.	.	.	.	.	.	.	.	G	3.954	-0.011672	0.07727	.	.	ENSG00000107672	ENST00000369023;ENST00000538652	T	0.39592	1.07	5.62	4.66	0.58398	.	0.132555	0.64402	D	0.000002	T	0.15392	0.0371	N	0.03917	-0.325	0.32307	N	0.564311	B;B	0.14438	0.003;0.01	B;B	0.13407	0.005;0.009	T	0.25916	-1.0118	10	0.02654	T	1	-15.5392	7.7678	0.28991	0.0:0.197:0.543:0.26	.	137;296	B4DWS2;Q9NXX6	.;NSE4A_HUMAN	N	296;137	ENSP00000358019:H296N	ENSP00000358019:H296N	H	-	1	0	NSMCE4A	123710981	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.576000	0.46033	2.822000	0.97130	0.650000	0.86243	CAT	NSMCE4A	-	pfam_Nse4	ENSG00000107672		0.313	NSMCE4A-005	KNOWN	basic|appris_principal|CCDS	protein_coding	NSMCE4A	HGNC	protein_coding	OTTHUMT00000050749.1	49	0.00	0	G	NM_017615		123720991	123720991	-1	no_errors	ENST00000369023	ensembl	human	known	69_37n	missense	56	15.15	10	SNP	1.000	T
OR13C2	392376	genome.wustl.edu	37	9	107367609	107367609	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr9:107367609C>G	ENST00000542196.1	-	1	342	c.300G>C	c.(298-300)caG>caC	p.Q100H		NM_001004481.1	NP_001004481.1	Q8NGS9	O13C2_HUMAN	olfactory receptor, family 13, subfamily C, member 2	100						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22						CGAGGAACATCTGCACTGCAC	0.522																																						dbGAP											0													149.0	135.0	140.0					9																	107367609		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35092.1	9q31.1	2012-10-03			ENSG00000257019	ENSG00000276119		"""GPCR / Class A : Olfactory receptors"""	14701	protein-coding gene	gene with protein product							Standard	NM_001004481		Approved		uc011lvq.2	Q8NGS9	OTTHUMG00000020415	ENST00000542196.1:c.300G>C	9.37:g.107367609C>G	ENSP00000438815:p.Gln100His		B9EGV8|Q6IF54	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.Q100H	ENST00000542196.1	37	c.300	CCDS35092.1	9	.	.	.	.	.	.	.	.	.	.	C	15.61	2.883843	0.51908	.	.	ENSG00000257019	ENST00000542196	T	0.02121	4.44	3.53	1.56	0.23342	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35151	U	0.003413	T	0.16171	0.0389	H	0.97158	3.95	0.27663	N	0.947001	D	0.89917	1.0	D	0.76575	0.988	T	0.04467	-1.0949	10	0.72032	D	0.01	.	6.9476	0.24528	0.0:0.7466:0.0:0.2534	.	100	Q8NGS9	O13C2_HUMAN	H	100	ENSP00000438815:Q100H	ENSP00000438815:Q100H	Q	-	3	2	OR13C2	106407430	0.000000	0.05858	0.712000	0.30502	0.956000	0.61745	-1.310000	0.02725	0.664000	0.31047	0.462000	0.41574	CAG	OR13C2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000257019		0.522	OR13C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C2	HGNC	protein_coding	OTTHUMT00000053489.2	364	0.00	0	C	NM_001004481		107367609	107367609	-1	no_errors	ENST00000542196	ensembl	human	known	69_37n	missense	123	25.45	42	SNP	1.000	G
OR7G3	390883	genome.wustl.edu	37	19	9237482	9237482	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr19:9237482C>T	ENST00000305444.2	-	1	144	c.145G>A	c.(145-147)Gtc>Atc	p.V49I		NM_001001958.1	NP_001001958.1	Q8NG95	OR7G3_HUMAN	olfactory receptor, family 7, subfamily G, member 3	49						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V49I(1)		NS(2)|endometrium(1)|large_intestine(3)|liver(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15						TCAGAGTTGACGGCCAGGATG	0.567																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											114.0	94.0	101.0					19																	9237482		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32899.1	19p13.2	2013-09-24			ENSG00000170920	ENSG00000170920		"""GPCR / Class A : Olfactory receptors"""	8467	protein-coding gene	gene with protein product							Standard	NM_001001958		Approved	OST085	uc010xkl.2	Q8NG95	OTTHUMG00000165520	ENST00000305444.2:c.145G>A	19.37:g.9237482C>T	ENSP00000302867:p.Val49Ile		Q6IFJ6|Q96R99	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.V49I	ENST00000305444.2	37	c.145	CCDS32899.1	19	.	.	.	.	.	.	.	.	.	.	C	0.014	-1.603681	0.00849	.	.	ENSG00000170920	ENST00000305444	T	0.01422	4.91	4.02	-7.89	0.01174	GPCR, rhodopsin-like superfamily (1);	0.347275	0.20185	N	0.097434	T	0.00637	0.0021	N	0.02842	-0.48	0.09310	N	1	B	0.22146	0.065	B	0.15870	0.014	T	0.35301	-0.9794	10	0.07325	T	0.83	.	16.9025	0.86117	0.0:0.7938:0.0:0.2062	.	49	Q8NG95	OR7G3_HUMAN	I	49	ENSP00000302867:V49I	ENSP00000302867:V49I	V	-	1	0	OR7G3	9098482	0.000000	0.05858	0.000000	0.03702	0.072000	0.16883	-3.040000	0.00633	-1.924000	0.01064	-1.396000	0.01147	GTC	OR7G3	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000170920		0.567	OR7G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7G3	HGNC	protein_coding	OTTHUMT00000384611.1	137	0.00	0	C			9237482	9237482	-1	no_errors	ENST00000305444	ensembl	human	known	69_37n	missense	53	30.26	23	SNP	0.000	T
OR7E24	26648	genome.wustl.edu	37	19	9362661	9362661	+	Silent	SNP	C	C	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr19:9362661C>T	ENST00000456448.1	+	1	1056	c.942C>T	c.(940-942)gaC>gaT	p.D314D		NM_001079935.1	NP_001073404.1	Q6IFN5	O7E24_HUMAN	olfactory receptor, family 7, subfamily E, member 24	314						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)	16						GGAACAAGGACATTCAAAGTG	0.468																																						dbGAP											0													72.0	73.0	72.0					19																	9362661		2202	4298	6500	-	-	-	SO:0001819	synonymous_variant	0			Y10529	CCDS45955.1	19p13.2	2012-08-09	2004-03-04	2004-03-05		ENSG00000237521		"""GPCR / Class A : Olfactory receptors"""	8396	protein-coding gene	gene with protein product			"""olfactory receptor, family 7, subfamily E, member 24 pseudogene"""	OR7E24P		9268701	Standard	NM_001079935		Approved	OR19-8, HSHT2, OR7E24Q	uc002mlb.1	Q6IFN5		ENST00000456448.1:c.942C>T	19.37:g.9362661C>T			B9EJD9|Q9UPJ1	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.D314	ENST00000456448.1	37	c.942	CCDS45955.1	19																																																																																			OR7E24	-	prints_7TM_GPCR_Rhodpsn	ENSG00000237521		0.468	OR7E24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7E24	HGNC	protein_coding	OTTHUMT00000449006.1	151	0.00	0	C			9362661	9362661	+1	no_errors	ENST00000456448	ensembl	human	known	69_37n	silent	51	25.00	17	SNP	0.890	T
OR8S1	341568	genome.wustl.edu	37	12	48920158	48920158	+	Silent	SNP	G	G	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr12:48920158G>A	ENST00000310194.1	+	1	744	c.744G>A	c.(742-744)gtG>gtA	p.V248V	OR8S1_ENST00000551654.1_Intron	NM_001005203.2	NP_001005203.2	Q8NH09	OR8S1_HUMAN	olfactory receptor, family 8, subfamily S, member 1	248						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|skin(4)	22						TCACTGCAGTGACACTTTACT	0.507																																						dbGAP											0													117.0	109.0	111.0					12																	48920158		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS31789.1	12q13.2	2012-08-09				ENSG00000197376		"""GPCR / Class A : Olfactory receptors"""	19628	protein-coding gene	gene with protein product							Standard	NM_001005203		Approved		uc010slu.2	Q8NH09		ENST00000310194.1:c.744G>A	12.37:g.48920158G>A				Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.V248	ENST00000310194.1	37	c.744	CCDS31789.1	12																																																																																			OR8S1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000197376		0.507	OR8S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8S1	HGNC	protein_coding	OTTHUMT00000406881.1	189	0.00	0	G			48920158	48920158	+1	no_errors	ENST00000310194	ensembl	human	known	69_37n	silent	75	27.62	29	SNP	0.937	A
ORC1	4998	genome.wustl.edu	37	1	52861727	52861727	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr1:52861727C>G	ENST00000371568.3	-	5	930	c.712G>C	c.(712-714)Gag>Cag	p.E238Q	ORC1_ENST00000371566.1_Missense_Mutation_p.E238Q	NM_001190818.1|NM_001190819.1|NM_004153.3	NP_001177747.1|NP_001177748.1|NP_004144.2	Q13415	ORC1_HUMAN	origin recognition complex, subunit 1	238					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear origin of replication recognition complex (GO:0005664)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						CTGCCAAGCTCCAGCCTCTTT	0.463																																						dbGAP											0													88.0	89.0	89.0					1																	52861727		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS566.1	1p32	2010-10-12	2010-10-12	2010-10-12	ENSG00000085840	ENSG00000085840		"""ATPases / AAA-type"""	8487	protein-coding gene	gene with protein product	"""origin recognition complex, subunit 1, S. cerevisiae, homolog-like"", ""origin recognition complex 1"", ""replication control protein 1"""	601902	"""origin recognition complex, subunit 1 (yeast homolog)-like"", ""origin recognition complex, subunit 1-like (yeast)"", ""origin recognition complex, subunit 1 homolog (S. cerevisiae)"""	ORC1L		8884289	Standard	NM_004153		Approved	HSORC1, PARC1	uc001ctu.3	Q13415	OTTHUMG00000008104	ENST00000371568.3:c.712G>C	1.37:g.52861727C>G	ENSP00000360623:p.Glu238Gln		D3DQ34|Q13471|Q5T0F5	Missense_Mutation	SNP	pfam_BAH_dom,pfam_ATPase_AAA_core,pfam_Cdc6_C_dom,pfam_DUF2075,smart_BAH_dom,smart_AAA+_ATPase,pfscan_BAH_dom	p.E238Q	ENST00000371568.3	37	c.712	CCDS566.1	1	.	.	.	.	.	.	.	.	.	.	C	12.48	1.951932	0.34471	.	.	ENSG00000085840	ENST00000371568;ENST00000371566	T;T	0.43294	0.95;0.95	4.37	4.37	0.52481	.	0.369511	0.32901	N	0.005509	T	0.38692	0.1050	M	0.71581	2.175	0.45318	D	0.998317	P;P	0.41188	0.616;0.741	B;B	0.34242	0.178;0.147	T	0.35176	-0.9799	10	0.31617	T	0.26	-13.2539	12.9212	0.58232	0.0:0.705:0.295:0.0	.	238;238	B7Z8H0;Q13415	.;ORC1_HUMAN	Q	238	ENSP00000360623:E238Q;ENSP00000360621:E238Q	ENSP00000360621:E238Q	E	-	1	0	ORC1	52634315	1.000000	0.71417	0.993000	0.49108	0.894000	0.52154	1.244000	0.32778	2.418000	0.82041	0.591000	0.81541	GAG	ORC1	-	NULL	ENSG00000085840		0.463	ORC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ORC1	HGNC	protein_coding	OTTHUMT00000022202.1	205	0.00	0	C	NM_004153		52861727	52861727	-1	no_errors	ENST00000371566	ensembl	human	known	69_37n	missense	139	26.46	50	SNP	1.000	G
OSBPL10	114884	genome.wustl.edu	37	3	31712404	31712404	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr3:31712404G>C	ENST00000396556.2	-	9	1920	c.1798C>G	c.(1798-1800)Ctc>Gtc	p.L600V	OSBPL10_ENST00000438237.2_Missense_Mutation_p.L536V	NM_017784.4	NP_060254.2	Q9BXB5	OSB10_HUMAN	oxysterol binding protein-like 10	600					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	34				STAD - Stomach adenocarcinoma(1;0.00406)		GGGATGGTGAGAATGGACCGG	0.567																																						dbGAP											0													134.0	118.0	124.0					3																	31712404		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF392451	CCDS2651.1, CCDS54559.1	3p23	2013-01-10			ENSG00000144645	ENSG00000144645		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16395	protein-coding gene	gene with protein product		606738					Standard	NM_001174060		Approved		uc021wuu.1	Q9BXB5	OTTHUMG00000130672	ENST00000396556.2:c.1798C>G	3.37:g.31712404G>C	ENSP00000379804:p.Leu600Val		B4E212|Q9BTU5	Missense_Mutation	SNP	pfam_Oxysterol-bd,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.L600V	ENST00000396556.2	37	c.1798	CCDS2651.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.89|14.89	2.670680|2.670680	0.47781|0.47781	.|.	.|.	ENSG00000144645|ENSG00000144645	ENST00000429492|ENST00000396556;ENST00000438237	.|T;T	.|0.37915	.|1.17;1.17	5.47|5.47	4.6|4.6	0.57074|0.57074	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.63873|0.63873	0.2548|0.2548	M|M	0.84585|0.84585	2.705|2.705	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.91635	.|0.999;0.998;0.999	T|T	0.70876|0.70876	-0.4753|-0.4753	5|10	.|0.87932	.|D	.|0	-22.6272|-22.6272	14.2079|14.2079	0.65746|0.65746	0.0721:0.0:0.9279:0.0|0.0721:0.0:0.9279:0.0	.|.	.|536;600;368	.|B4E212;Q9BXB5;Q59ED9	.|.;OSB10_HUMAN;.	L|V	368|600;536	.|ENSP00000379804:L600V;ENSP00000406124:L536V	.|ENSP00000379804:L600V	F|L	-|-	3|1	2|0	OSBPL10|OSBPL10	31687408|31687408	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.007000|0.007000	0.05969|0.05969	8.018000|8.018000	0.88722|0.88722	1.301000|1.301000	0.44836|0.44836	-0.259000|-0.259000	0.10710|0.10710	TTC|CTC	OSBPL10	-	pfam_Oxysterol-bd	ENSG00000144645		0.567	OSBPL10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OSBPL10	HGNC	protein_coding	OTTHUMT00000253165.2	206	0.00	0	G			31712404	31712404	-1	no_errors	ENST00000396556	ensembl	human	known	69_37n	missense	80	11.11	10	SNP	1.000	C
PCDH18	54510	genome.wustl.edu	37	4	138442365	138442365	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr4:138442365G>A	ENST00000344876.4	-	4	3612	c.3226C>T	c.(3226-3228)Cac>Tac	p.H1076Y	PCDH18_ENST00000507846.1_Missense_Mutation_p.H855Y|PCDH18_ENST00000511115.1_Missense_Mutation_p.H256Y|PCDH18_ENST00000510305.1_Missense_Mutation_p.H287Y|PCDH18_ENST00000412923.2_Missense_Mutation_p.H1075Y	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	1076	Interaction with DAB1. {ECO:0000250}.				brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					ACACTGGAGTGAGTTCCAAGT	0.522																																						dbGAP											0													43.0	41.0	42.0					4																	138442365		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.3226C>T	4.37:g.138442365G>A	ENSP00000355082:p.His1076Tyr		A8K7K3|B7ZKT1|Q52LS2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.H1076Y	ENST00000344876.4	37	c.3226	CCDS34064.1	4	.	.	.	.	.	.	.	.	.	.	G	12.55	1.972417	0.34848	.	.	ENSG00000189184	ENST00000344876;ENST00000412923;ENST00000507846;ENST00000510305;ENST00000511115	T;T;T;T;T	0.54479	0.67;0.67;0.57;1.49;1.48	5.05	5.05	0.67936	.	0.000000	0.45361	D	0.000371	T	0.62282	0.2415	M	0.62723	1.935	0.44048	D	0.996785	D;P;P;P	0.52996	0.957;0.666;0.775;0.666	P;B;B;B	0.51701	0.677;0.091;0.359;0.196	T	0.61163	-0.7118	10	0.33141	T	0.24	.	18.5017	0.90884	0.0:0.0:1.0:0.0	.	256;855;1075;1076	B4DLR6;D6RIG4;Q9HCL0-2;Q9HCL0	.;.;.;PCD18_HUMAN	Y	1076;1075;855;287;256	ENSP00000355082:H1076Y;ENSP00000390688:H1075Y;ENSP00000425903:H855Y;ENSP00000424269:H287Y;ENSP00000425647:H256Y	ENSP00000355082:H1076Y	H	-	1	0	PCDH18	138661815	1.000000	0.71417	0.940000	0.37924	0.985000	0.73830	7.770000	0.85390	2.370000	0.80446	0.586000	0.80456	CAC	PCDH18	-	NULL	ENSG00000189184		0.522	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH18	HGNC	protein_coding	OTTHUMT00000364614.1	68	0.00	0	G	NM_019035		138442365	138442365	-1	no_errors	ENST00000344876	ensembl	human	known	69_37n	missense	29	21.62	8	SNP	0.984	A
PCDH18	54510	genome.wustl.edu	37	4	138452906	138452906	+	Silent	SNP	G	G	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr4:138452906G>A	ENST00000344876.4	-	1	723	c.337C>T	c.(337-339)Cta>Tta	p.L113L	PCDH18_ENST00000507846.1_Intron|PCDH18_ENST00000511115.1_Intron|PCDH18_ENST00000510305.1_Intron|PCDH18_ENST00000412923.2_Silent_p.L113L	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	113	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					TCTGTGGGTAGAGTGATCACA	0.408																																						dbGAP											0													133.0	131.0	132.0					4																	138452906		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.337C>T	4.37:g.138452906G>A			A8K7K3|B7ZKT1|Q52LS2	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.L113	ENST00000344876.4	37	c.337	CCDS34064.1	4																																																																																			PCDH18	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000189184		0.408	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH18	HGNC	protein_coding	OTTHUMT00000364614.1	107	0.00	0	G	NM_019035		138452906	138452906	-1	no_errors	ENST00000344876	ensembl	human	known	69_37n	silent	71	15.48	13	SNP	0.981	A
PCDHB8	56128	genome.wustl.edu	37	5	140559532	140559532	+	Missense_Mutation	SNP	G	G	C	rs2740582	byFrequency	TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr5:140559532G>C	ENST00000239444.2	+	1	2162	c.1917G>C	c.(1915-1917)caG>caC	p.Q639H	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	639	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.		Q -> H (in dbSNP:rs2740582). {ECO:0000269|PubMed:11322959}.		homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGGCCAAGCAGAGGCTGGTGG	0.692													g|||	2318	0.462859	0.4607	0.5058	5008	,	,		16518	0.5655		0.3877	False		,,,				2504	0.407					dbGAP											0													21.0	24.0	23.0					5																	140559532		2085	4128	6213	-	-	-	SO:0001583	missense	0			AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.1917G>C	5.37:g.140559532G>C	ENSP00000239444:p.Gln639His		B9EGV1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Q639H	ENST00000239444.2	37	c.1917	CCDS4250.1	5	968	0.4432234432234432	220	0.44715447154471544	162	0.44751381215469616	317	0.5541958041958042	269	0.3548812664907652	C	0.013	-1.627332	0.00813	.	.	ENSG00000120322	ENST00000239444	T	0.49720	0.77	4.22	-2.07	0.07276	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.00012	0.0000	N	0.16708	0.43	0.40763	P	0.016979999999999995	B	0.02656	0.0	B	0.08055	0.003	T	0.43686	-0.9376	8	0.05833	T	0.94	.	14.4643	0.67472	0.0:0.1647:0.7471:0.0882	rs2740582;rs17844503	639	Q9UN66	PCDB8_HUMAN	H	639	ENSP00000239444:Q639H	ENSP00000239444:Q639H	Q	+	3	2	PCDHB8	140539716	0.000000	0.05858	0.859000	0.33776	0.399000	0.30720	-2.963000	0.00671	-0.360000	0.08138	-0.748000	0.03510	CAG	PCDHB8	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000120322		0.692	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB8	HGNC	protein_coding	OTTHUMT00000251816.2	11	0.00	0	G	NM_019120		140559532	140559532	+1	no_errors	ENST00000239444	ensembl	human	known	69_37n	missense	4	50.00	4	SNP	0.980	C
PDE4A	5141	genome.wustl.edu	37	19	10568682	10568682	+	Silent	SNP	C	C	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr19:10568682C>T	ENST00000352831.6	+	8	1115	c.1005C>T	c.(1003-1005)atC>atT	p.I335I	PDE4A_ENST00000592685.1_Silent_p.I313I|PDE4A_ENST00000344979.3_Silent_p.I96I|PDE4A_ENST00000380702.2_Silent_p.I313I|PDE4A_ENST00000440014.2_Silent_p.I274I|PDE4A_ENST00000293683.5_Silent_p.I309I	NM_001111307.1	NP_001104777.1	P27815	PDE4A_HUMAN	phosphodiesterase 4A, cAMP-specific	335	Catalytic.				cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Caffeine(DB00201)|Dipyridamole(DB00975)|Drotaverine(DB06751)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theophylline(DB00277)|Tofisopam(DB08811)	TGTCCCAAATCACAGGGTTGA	0.547																																						dbGAP											0													84.0	87.0	86.0					19																	10568682		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS12238.1, CCDS45961.1, CCDS45962.1, CCDS45963.1, CCDS58649.1	19p13.2	2010-06-24	2010-06-24			ENSG00000065989	3.1.4.17	"""Phosphodiesterases"""	8780	protein-coding gene	gene with protein product	"""phosphodiesterase E2 dunce homolog (Drosophila)"""	600126	"""phosphodiesterase 4A, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E2)"""	DPDE2		8009369	Standard	NM_006202		Approved		uc002moj.2	P27815		ENST00000352831.6:c.1005C>T	19.37:g.10568682C>T			O75522|O76092|Q16255|Q16691|Q5DM53|Q6PMT2|Q8IVA7|Q8WUQ3|Q9H3H2	Silent	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	p.I335	ENST00000352831.6	37	c.1005	CCDS45961.1	19																																																																																			PDE4A	-	NULL	ENSG00000065989		0.547	PDE4A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDE4A	HGNC	protein_coding	OTTHUMT00000451244.1	93	0.00	0	C			10568682	10568682	+1	no_errors	ENST00000352831	ensembl	human	known	69_37n	silent	41	28.07	16	SNP	1.000	T
PHIP	55023	genome.wustl.edu	37	6	79688311	79688311	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr6:79688311C>T	ENST00000275034.4	-	24	3054	c.2887G>A	c.(2887-2889)Gag>Aag	p.E963K	PHIP_ENST00000479165.1_5'UTR	NM_017934.5	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	963	Mediates interaction with IRS1. {ECO:0000250}.				cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(10)|kidney(4)|large_intestine(20)|lung(20)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	68		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		TAAAGTACCTCATCACCCATC	0.338																																						dbGAP											0													90.0	86.0	88.0					6																	79688311		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF310250	CCDS4987.1	6q14	2013-01-09			ENSG00000146247	ENSG00000146247		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	15673	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 14"""	612870		WDR11		11018022	Standard	NM_017934		Approved	ndrp, FLJ20705, DCAF14, BRWD2	uc003pir.3	Q8WWQ0	OTTHUMG00000015071	ENST00000275034.4:c.2887G>A	6.37:g.79688311C>T	ENSP00000275034:p.Glu963Lys		A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_Quinonprotein_ADH-like,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Bromodomain	p.E963K	ENST00000275034.4	37	c.2887	CCDS4987.1	6	.	.	.	.	.	.	.	.	.	.	C	20.7	4.031863	0.75504	.	.	ENSG00000146247	ENST00000275034	T	0.52057	0.68	5.16	5.16	0.70880	.	0.073956	0.56097	N	0.000034	T	0.38134	0.1029	M	0.81614	2.55	0.80722	D	1	B;B	0.32781	0.384;0.384	B;B	0.26517	0.07;0.07	T	0.41610	-0.9499	9	.	.	.	-4.5859	17.612	0.88056	0.0:1.0:0.0:0.0	.	963;963	A7J992;Q8WWQ0	.;PHIP_HUMAN	K	963	ENSP00000275034:E963K	.	E	-	1	0	PHIP	79745030	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	7.397000	0.79903	2.384000	0.81235	0.655000	0.94253	GAG	PHIP	-	NULL	ENSG00000146247		0.338	PHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHIP	HGNC	protein_coding	OTTHUMT00000041297.2	104	0.00	0	C			79688311	79688311	-1	no_errors	ENST00000275034	ensembl	human	known	69_37n	missense	79	17.71	17	SNP	1.000	T
PERP	64065	genome.wustl.edu	37	6	138417551	138417551	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr6:138417551G>C	ENST00000421351.3	-	2	465	c.295C>G	c.(295-297)Ctc>Gtc	p.L99V		NM_022121.4	NP_071404.2	Q96FX8	PERP_HUMAN	PERP, TP53 apoptosis effector	99					activation of cysteine-type endopeptidase activity (GO:0097202)|amelogenesis (GO:0097186)|desmosome organization (GO:0002934)|heterotypic cell-cell adhesion (GO:0034113)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of proteolysis (GO:0045862)	cell junction (GO:0030054)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)				breast(1)|cervix(1)|endometrium(1)|lung(1)|prostate(1)	5	Breast(32;0.0799)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000878)|OV - Ovarian serous cystadenocarcinoma(155;0.000997)		GGTCCACAGAGGGCGAAGAAG	0.502																																						dbGAP											0													75.0	70.0	72.0					6																	138417551		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF317550	CCDS5188.1	6q24	2014-04-29			ENSG00000112378	ENSG00000112378			17637	protein-coding gene	gene with protein product	"""keratinocyte associated protein 1"""	609301				11062687	Standard	NM_022121		Approved	PIGPC1, dJ496H19.1, KCP1, THW, KRTCAP1	uc003qht.2	Q96FX8	OTTHUMG00000015668	ENST00000421351.3:c.295C>G	6.37:g.138417551G>C	ENSP00000397157:p.Leu99Val		B2RB73|E1P590|Q8IWS3|Q8N1J6|Q8NC16|Q9H1C5|Q9H230	Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin	p.L99V	ENST00000421351.3	37	c.295	CCDS5188.1	6	.	.	.	.	.	.	.	.	.	.	G	21.4	4.145093	0.77888	.	.	ENSG00000112378	ENST00000421351;ENST00000265603	D	0.90069	-2.61	5.5	5.5	0.81552	.	0.191405	0.47093	D	0.000259	D	0.89389	0.6701	L	0.47016	1.485	0.58432	D	0.999996	D	0.67145	0.996	D	0.65573	0.936	D	0.88682	0.3203	10	0.44086	T	0.13	-48.1711	12.2937	0.54833	0.0778:0.0:0.9222:0.0	.	99	Q96FX8	PERP_HUMAN	V	99;81	ENSP00000397157:L99V	ENSP00000265603:L81V	L	-	1	0	PERP	138459244	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.676000	0.61627	2.758000	0.94735	0.561000	0.74099	CTC	PERP	-	pfam_PMP22/EMP/MP20/Claudin	ENSG00000112378		0.502	PERP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PERP	HGNC	protein_coding	OTTHUMT00000042423.2	105	0.00	0	G	NM_022121		138417551	138417551	-1	no_errors	ENST00000421351	ensembl	human	known	69_37n	missense	62	17.33	13	SNP	1.000	C
PIGQ	9091	genome.wustl.edu	37	16	633504	633504	+	Nonsense_Mutation	SNP	C	C	G			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr16:633504C>G	ENST00000026218.5	+	10	2241	c.2153C>G	c.(2152-2154)tCa>tGa	p.S718*	PIGQ_ENST00000321878.5_3'UTR	NM_148920.2	NP_683721.1	Q9BRB3	PIGQ_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class Q	718					C-terminal protein lipidation (GO:0006501)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex (GO:0000506)|integral component of membrane (GO:0016021)	phosphatidylinositol N-acetylglucosaminyltransferase activity (GO:0017176)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13		Hepatocellular(780;0.00335)				CTAGCTCCCTCAGCCGAACAG	0.672																																						dbGAP											0													41.0	39.0	40.0					16																	633504		2200	4299	6499	-	-	-	SO:0001587	stop_gained	0			AB003723	CCDS10411.1, CCDS10412.1	16p13.3	2013-03-28	2006-06-28		ENSG00000007541	ENSG00000007541		"""Phosphatidylinositol glycan anchor biosynthesis"""	14135	protein-coding gene	gene with protein product		605754	"""phosphatidylinositol glycan, class Q"""			9463366, 9729469	Standard	NM_004204		Approved	hGPI1, GPI1	uc002cho.3	Q9BRB3	OTTHUMG00000168047	ENST00000026218.5:c.2153C>G	16.37:g.633504C>G	ENSP00000026218:p.Ser718*		A2IDE1|D3DU52|O14927|Q96G00|Q96S22|Q9UJH4	Nonsense_Mutation	SNP	pfam_GlcNAc_Gpi1	p.S718*	ENST00000026218.5	37	c.2153	CCDS10411.1	16	.	.	.	.	.	.	.	.	.	.	C	25.5	4.643380	0.87859	.	.	ENSG00000007541	ENST00000026218	.	.	.	3.55	0.272	0.15645	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	2.5486	0.04743	0.191:0.5116:0.1857:0.1116	.	.	.	.	X	718	.	.	S	+	2	0	PIGQ	573505	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	0.138000	0.16016	-0.001000	0.14495	0.449000	0.29647	TCA	PIGQ	-	NULL	ENSG00000007541		0.672	PIGQ-002	KNOWN	basic|CCDS	protein_coding	PIGQ	HGNC	protein_coding	OTTHUMT00000239270.2	26	0.00	0	C	NM_004204		633504	633504	+1	no_errors	ENST00000026218	ensembl	human	known	69_37n	nonsense	13	23.53	4	SNP	0.000	G
PIK3CA	5290	genome.wustl.edu	37	3	178936082	178936082	+	Missense_Mutation	SNP	G	G	A	rs121913273		TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr3:178936082G>A	ENST00000263967.3	+	10	1781	c.1624G>A	c.(1624-1626)Gaa>Aaa	p.E542K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	542	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> K (in CLOVE, KERSEB, CRC and BC; also found in glioblastoma multiforme and endometrial carcinoma; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N- terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|E -> Q (found in an endometrial carcinoma sample; unknown pathological significance). {ECO:0000269|PubMed:16322209}.|E -> V (in BC; unknown pathological significance). {ECO:0000269|PubMed:16353168}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E542K(545)|p.E542Q(10)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TCCTCTCTCTGAAATCACTGA	0.333	E542K(BT483_BREAST)|E542K(CAL51_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(VMCUB1_URINARY_TRACT)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	555	Substitution - Missense(555)	breast(176)|large_intestine(166)|urinary_tract(45)|endometrium(37)|skin(19)|lung(18)|stomach(16)|ovary(16)|thyroid(14)|upper_aerodigestive_tract(9)|central_nervous_system(7)|cervix(6)|liver(6)|oesophagus(5)|penis(4)|kidney(3)|soft_tissue(2)|haematopoietic_and_lymphoid_tissue(2)|prostate(2)|biliary_tract(1)|pituitary(1)											56.0	56.0	56.0					3																	178936082		1809	4069	5878	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1624G>A	3.37:g.178936082G>A	ENSP00000263967:p.Glu542Lys		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E542K	ENST00000263967.3	37	c.1624	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	34	5.360420	0.95877	.	.	ENSG00000121879	ENST00000263967	T	0.62105	0.05	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69287	0.3094	L	0.41356	1.27	0.80722	D	1	D	0.65815	0.995	D	0.63192	0.912	T	0.60296	-0.7291	10	0.09843	T	0.71	-23.9623	20.0024	0.97423	0.0:0.0:1.0:0.0	.	542	P42336	PK3CA_HUMAN	K	542	ENSP00000263967:E542K	ENSP00000263967:E542K	E	+	1	0	PIK3CA	180418776	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAA	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.333	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	81	0.00	0	G			178936082	178936082	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	73	37.07	43	SNP	1.000	A
PLA2G15	23659	genome.wustl.edu	37	16	68283257	68283257	+	Silent	SNP	C	C	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr16:68283257C>A	ENST00000219345.5	+	2	275	c.192C>A	c.(190-192)ctC>ctA	p.L64L	PLA2G15_ENST00000568599.1_3'UTR|PLA2G15_ENST00000566188.1_Silent_p.L64L|PLA2G15_ENST00000444212.2_Intron|PLA2G15_ENST00000413021.2_Intron	NM_012320.3	NP_036452.1	Q8NCC3	PAG15_HUMAN	phospholipase A2, group XV	64					ceramide metabolic process (GO:0006672)|fatty acid catabolic process (GO:0009062)|phosphatidylcholine metabolic process (GO:0046470)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)	calcium-independent phospholipase A2 activity (GO:0047499)|lysophospholipase activity (GO:0004622)|O-acyltransferase activity (GO:0008374)|phospholipid binding (GO:0005543)			kidney(2)|large_intestine(2)|lung(2)|ovary(2)|prostate(3)|skin(1)	12						TGCACTACCTCTGCTCCAAGA	0.552																																						dbGAP											0													115.0	86.0	96.0					16																	68283257		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			AB017494	CCDS10864.1	16q22.1	2008-09-19	2008-09-19	2008-09-19	ENSG00000103066	ENSG00000103066			17163	protein-coding gene	gene with protein product		609362	"""lysophospholipase 3 (lysosomal phospholipase A2)"""	LYPLA3		10092508, 16973413	Standard	XM_005255886		Approved	LLPL, GXVPLA2	uc002evr.3	Q8NCC3	OTTHUMG00000137554	ENST00000219345.5:c.192C>A	16.37:g.68283257C>A			B3KMF3|B4DUD1|Q53GZ1|Q9NPQ6|Q9UG04|Q9Y2B3	Silent	SNP	pfam_LACT/PDAT_acylTrfase	p.L64	ENST00000219345.5	37	c.192	CCDS10864.1	16																																																																																			PLA2G15	-	NULL	ENSG00000103066		0.552	PLA2G15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G15	HGNC	protein_coding	OTTHUMT00000268888.2	185	0.00	0	C	NM_012320		68283257	68283257	+1	no_errors	ENST00000219345	ensembl	human	known	69_37n	silent	71	21.98	20	SNP	0.970	A
TMEM256-PLSCR3	100529211	genome.wustl.edu	37	17	7296197	7296197	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr17:7296197G>C	ENST00000576362.1	-	5	667	c.510C>G	c.(508-510)ttC>ttG	p.F170L	TMEM256-PLSCR3_ENST00000324822.11_Missense_Mutation_p.F194L|TMEM256-PLSCR3_ENST00000535512.1_Missense_Mutation_p.F194L|TMEM256-PLSCR3_ENST00000574401.1_Missense_Mutation_p.F194L|TMEM256-PLSCR3_ENST00000576201.1_Missense_Mutation_p.F194L|C17orf61-PLSCR3_ENST00000573331.1_3'UTR					TMEM256-PLSCR3 readthrough (NMD candidate)																		CCTGGATGGAGAACTTGGGGA	0.587																																						dbGAP											0													233.0	256.0	249.0					17																	7296197		2091	4219	6310	-	-	-	SO:0001583	missense	0					17p13.1	2013-09-25			ENSG00000187838	ENSG00000187838			49186	other	readthrough							Standard	NR_037719		Approved				OTTHUMG00000178150	ENST00000576362.1:c.510C>G	17.37:g.7296197G>C	ENSP00000460800:p.Phe170Leu			Missense_Mutation	SNP	pfam_Scramblase,superfamily_Tubby_C-like	p.F194L	ENST00000576362.1	37	c.582		17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.4|22.4	4.279998|4.279998	0.80692|0.80692	.|.	.|.	ENSG00000187838|ENSG00000187838	ENST00000535512;ENST00000324822|ENST00000380658	T;T|.	0.33654|.	1.4;1.4|.	5.69|5.69	3.67|3.67	0.42095|0.42095	.|.	0.054374|.	0.85682|.	N|.	0.000000|.	T|T	0.54743|0.54743	0.1877|0.1877	L|L	0.45422|0.45422	1.42|1.42	0.48288|0.48288	D|D	0.999627|0.999627	D;D|.	0.67145|.	0.996;0.994|.	D;P|.	0.65573|.	0.936;0.856|.	T|T	0.54944|0.54944	-0.8217|-0.8217	10|6	0.59425|0.87932	D|D	0.04|0	-12.8118|-12.8118	5.623|5.623	0.17467|0.17467	0.1755:0.1639:0.6607:0.0|0.1755:0.1639:0.6607:0.0	.|.	194;249|.	Q9NRY6;D3DTP7|.	PLS3_HUMAN;.|.	L|C	194|194	ENSP00000438547:F194L;ENSP00000316021:F194L|.	ENSP00000316021:F194L|ENSP00000370033:S194C	F|S	-|-	3|2	2|0	PLSCR3|PLSCR3	7236921|7236921	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.315000|1.315000	0.33608|0.33608	0.729000|0.729000	0.32403|0.32403	0.591000|0.591000	0.81541|0.81541	TTC|TCT	PLSCR3	-	pfam_Scramblase	ENSG00000187838		0.587	TMEM256-PLSCR3-008	NOVEL	basic|exp_conf	protein_coding	PLSCR3	HGNC	protein_coding	OTTHUMT00000440808.1	301	0.00	0	G			7296197	7296197	-1	no_errors	ENST00000324822	ensembl	human	known	69_37n	missense	44	45.00	36	SNP	1.000	C
POLR1D	51082	genome.wustl.edu	37	13	28197278	28197278	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr13:28197278G>C	ENST00000302979.3	+	3	1315	c.293G>C	c.(292-294)aGa>aCa	p.R98T	POLR1D_ENST00000399697.3_Intron|POLR1D_ENST00000465887.1_Intron|LNX2_ENST00000316334.3_5'Flank|POLR1D_ENST00000399696.1_Missense_Mutation_p.R98T	NM_015972.3	NP_057056.1	Q9Y2S0	RPAC2_HUMAN	polymerase (RNA) I polypeptide D, 16kDa	98					gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase I transcription (GO:0006363)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytosol (GO:0005829)|DNA-directed RNA polymerase I complex (GO:0005736)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			endometrium(1)|large_intestine(1)|lung(4)|stomach(2)	8		Lung SC(185;0.0161)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	all cancers(112;0.0758)|OV - Ovarian serous cystadenocarcinoma(117;0.1)|Epithelial(112;0.213)		CCATTTCAGAGAGGCCTGAAT	0.438																																						dbGAP											0													100.0	101.0	100.0					13																	28197278		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF077044, BC018528	CCDS9324.1, CCDS9325.1, CCDS73555.1	13q12.2	2013-01-21			ENSG00000186184	ENSG00000186184		"""RNA polymerase subunits"""	20422	protein-coding gene	gene with protein product		613715				11042152, 12391170	Standard	NM_015972		Approved	RPAC2, RPA16, RPO1-3, RPA9, MGC9850	uc001urp.3	Q9Y2S0	OTTHUMG00000016635	ENST00000302979.3:c.293G>C	13.37:g.28197278G>C	ENSP00000302478:p.Arg98Thr		Q5TBX2|Q96BR3	Missense_Mutation	SNP	pfam_DNA-dir_RNA_pol_dimersation,superfamily_DNA-dir_RNA_pol_RBP11-like	p.R98T	ENST00000302979.3	37	c.293	CCDS9325.1	13	.	.	.	.	.	.	.	.	.	.	G	14.08	2.428302	0.43122	.	.	ENSG00000186184	ENST00000302979;ENST00000399696	D;D	0.92595	-3.07;-3.07	4.87	2.76	0.32466	DNA-directed RNA polymerase, dimerisation (1);DNA-directed RNA polymerase, RBP11-like (1);	.	.	.	.	D	0.83876	0.5349	N	0.21282	0.65	0.27651	N	0.947406	B	0.13594	0.008	B	0.16289	0.015	T	0.73557	-0.3945	9	0.39692	T	0.17	-5.6433	5.4614	0.16619	0.3:0.0:0.7:0.0	.	98	Q9Y2S0	RPAC2_HUMAN	T	98	ENSP00000302478:R98T;ENSP00000382603:R98T	ENSP00000302478:R98T	R	+	2	0	POLR1D	27095278	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.376000	0.34306	1.091000	0.41335	0.650000	0.86243	AGA	POLR1D	-	pfam_DNA-dir_RNA_pol_dimersation,superfamily_DNA-dir_RNA_pol_RBP11-like	ENSG00000186184		0.438	POLR1D-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	POLR1D	HGNC	protein_coding	OTTHUMT00000044305.1	96	0.00	0	G	NM_015972, NM_152705		28197278	28197278	+1	no_errors	ENST00000302979	ensembl	human	known	69_37n	missense	47	20.34	12	SNP	1.000	C
POM121L2	94026	genome.wustl.edu	37	6	27278941	27278941	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr6:27278941G>T	ENST00000444565.1	-	1	1008	c.1009C>A	c.(1009-1011)Cct>Act	p.P337T	POM121L2_ENST00000377451.2_Missense_Mutation_p.P337T	NM_033482.3	NP_258443.2	Q96KW2	P12L2_HUMAN	POM121 transmembrane nucleoporin-like 2	337										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	7						AGCTGGGGAGGTGGGATCTCT	0.498																																						dbGAP											0													146.0	123.0	130.0					6																	27278941		692	1591	2283	-	-	-	SO:0001583	missense	0			AL021808	CCDS59497.1	6p21.3	2012-03-13	2012-03-13		ENSG00000158553	ENSG00000158553			13973	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 2 (rat)"", ""POM121 membrane glycoprotein-like 2"""				Standard	NM_033482		Approved	POM121-L	uc011dku.1	Q96KW2	OTTHUMG00000014475	ENST00000444565.1:c.1009C>A	6.37:g.27278941G>T	ENSP00000392726:p.Pro337Thr		C9J1I7	Missense_Mutation	SNP	NULL	p.P337T	ENST00000444565.1	37	c.1009	CCDS59497.1	6	.	.	.	.	.	.	.	.	.	.	G	6.886	0.532923	0.13127	.	.	ENSG00000158553	ENST00000429945;ENST00000377451;ENST00000444565	T;T;T	0.22134	1.97;1.97;1.97	3.64	0.767	0.18482	.	0.705821	0.11684	N	0.539504	T	0.06872	0.0175	L	0.47016	1.485	0.09310	N	1	P	0.39250	0.665	B	0.39805	0.31	T	0.28681	-1.0036	10	0.33141	T	0.24	.	5.8616	0.18752	0.1096:0.378:0.5124:0.0	.	337	C9J1I7	.	T	51;337;337	ENSP00000415181:P51T;ENSP00000366671:P337T;ENSP00000392726:P337T	ENSP00000366671:P337T	P	-	1	0	POM121L2	27386920	0.003000	0.15002	0.000000	0.03702	0.000000	0.00434	0.436000	0.21526	0.130000	0.18549	-0.258000	0.10820	CCT	POM121L2	-	NULL	ENSG00000158553		0.498	POM121L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POM121L2	HGNC	protein_coding	OTTHUMT00000040143.2	182	0.00	0	G	NM_033482		27278941	27278941	-1	no_errors	ENST00000444565	ensembl	human	known	69_37n	missense	89	17.43	19	SNP	0.000	T
PRDM10	56980	genome.wustl.edu	37	11	129775573	129775573	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr11:129775573G>A	ENST00000360871.3	-	20	3458	c.3227C>T	c.(3226-3228)gCa>gTa	p.A1076V	PRDM10_ENST00000423662.2_Missense_Mutation_p.A981V|PRDM10_ENST00000358825.5_Missense_Mutation_p.A1080V|PRDM10_ENST00000304538.6_Missense_Mutation_p.A943V|PRDM10_ENST00000528746.1_Missense_Mutation_p.A1037V|PRDM10_ENST00000526082.1_Missense_Mutation_p.A994V	NM_199437.1	NP_955469.1	Q9NQV6	PRD10_HUMAN	PR domain containing 10	1067					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(2)|endometrium(6)|kidney(3)|large_intestine(14)|lung(15)|pancreas(2)|skin(1)|stomach(3)|urinary_tract(2)	48	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		AACTGGAGTTGCCACACCACT	0.468																																						dbGAP											0													143.0	120.0	128.0					11																	129775573		2201	4297	6498	-	-	-	SO:0001583	missense	0			AF275817	CCDS8484.1, CCDS8485.1, CCDS44771.1, CCDS44772.1	11q24.3	2013-01-08			ENSG00000170325	ENSG00000170325		"""Zinc fingers, C2H2-type"""	13995	protein-coding gene	gene with protein product	"""PRDM zinc finger transcription factor"", ""PR-domain family member 7"", ""tristanin"""					12175877	Standard	NM_020228		Approved	KIAA1231, PFM7, MGC131802	uc001qfm.3	Q9NQV6	OTTHUMG00000165762	ENST00000360871.3:c.3227C>T	11.37:g.129775573G>A	ENSP00000354118:p.Ala1076Val		B7ZL71|G3XAE5|J3KP23|Q17R90|Q2KHR4|Q863Z2|Q9NXI4|Q9ULI9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A1080V	ENST00000360871.3	37	c.3239	CCDS8484.1	11	.	.	.	.	.	.	.	.	.	.	G	16.16	3.045885	0.55110	.	.	ENSG00000170325	ENST00000358825;ENST00000304538;ENST00000360871;ENST00000423662;ENST00000528746;ENST00000526082;ENST00000533431	T;T;T;T;T;T;T	0.11495	2.82;2.77;2.82;2.81;2.87;2.8;2.9	5.99	5.99	0.97316	.	0.304390	0.35436	N	0.003212	T	0.08313	0.0207	N	0.14661	0.345	0.28999	N	0.887579	B;B;B;B;B;B	0.09022	0.0;0.0;0.0;0.0;0.002;0.0	B;B;B;B;B;B	0.12156	0.001;0.003;0.007;0.003;0.003;0.001	T	0.12734	-1.0536	10	0.51188	T	0.08	-11.3762	14.8042	0.69938	0.0:0.2521:0.7479:0.0	.	990;1076;1067;994;943;981	B7ZL72;G3XAE5;Q9NQV6;Q9NQV6-5;Q9NQV6-2;Q9NQV6-1	.;.;PRD10_HUMAN;.;.;.	V	1080;943;1076;981;1037;994;793	ENSP00000351686:A1080V;ENSP00000302669:A943V;ENSP00000354118:A1076V;ENSP00000398431:A981V;ENSP00000431262:A1037V;ENSP00000432237:A994V;ENSP00000435940:A793V	ENSP00000302669:A943V	A	-	2	0	PRDM10	129280783	0.988000	0.35896	1.000000	0.80357	0.992000	0.81027	4.559000	0.60796	2.840000	0.97914	0.655000	0.94253	GCA	PRDM10	-	NULL	ENSG00000170325		0.468	PRDM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM10	HGNC	protein_coding	OTTHUMT00000386076.1	169	0.00	0	G	NM_199437		129775573	129775573	-1	no_errors	ENST00000358825	ensembl	human	known	69_37n	missense	102	15.70	19	SNP	0.992	A
PRPF8	10594	genome.wustl.edu	37	17	1578489	1578489	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr17:1578489G>A	ENST00000572621.1	-	19	3282	c.3017C>T	c.(3016-3018)gCc>gTc	p.A1006V	PRPF8_ENST00000304992.6_Missense_Mutation_p.A1006V			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	1006	Reverse transcriptase homology domain.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		CATGTAGTCGGCTATGTTGTG	0.512																																						dbGAP											0													226.0	150.0	176.0					17																	1578489		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.3017C>T	17.37:g.1578489G>A	ENSP00000460348:p.Ala1006Val		O14547|O75965	Missense_Mutation	SNP	pfam_PROCN,pfam_PRP8_domainIV,pfam_Prp8_U6-snRNA-bd,pfam_Pre-mRNA-splicing_factor-8,pfam_Prp8_U5-snRNA-bd,pfam_PRO_C,pfam_RRM_spliceosomal_PrP8,pfam_JAB1_Mov34_MPN_PAD1,superfamily_Cupredoxin,superfamily_Histone-fold,smart_JAB1_Mov34_MPN_PAD1	p.A1006V	ENST00000572621.1	37	c.3017	CCDS11010.1	17	.	.	.	.	.	.	.	.	.	.	G	35	5.477365	0.96291	.	.	ENSG00000174231	ENST00000304992	D	0.83755	-1.76	5.89	5.89	0.94794	RNA recognition motif, spliceosomal PrP8 (1);	0.000000	0.85682	D	0.000000	D	0.92573	0.7641	M	0.86805	2.84	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91349	0.5103	10	0.40728	T	0.16	.	20.2561	0.98419	0.0:0.0:1.0:0.0	.	1006	Q6P2Q9	PRP8_HUMAN	V	1006	ENSP00000304350:A1006V	ENSP00000304350:A1006V	A	-	2	0	PRPF8	1525239	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.869000	0.99810	2.797000	0.96272	0.563000	0.77884	GCC	PRPF8	-	pfam_RRM_spliceosomal_PrP8	ENSG00000174231		0.512	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	PRPF8	HGNC	protein_coding	OTTHUMT00000438412.2	243	0.00	0	G			1578489	1578489	-1	no_errors	ENST00000304992	ensembl	human	known	69_37n	missense	37	54.76	46	SNP	1.000	A
PTK2B	2185	genome.wustl.edu	37	8	27296585	27296585	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr8:27296585G>C	ENST00000397501.1	+	24	2489	c.1681G>C	c.(1681-1683)Gag>Cag	p.E561Q	PTK2B_ENST00000338238.4_Missense_Mutation_p.E561Q|PTK2B_ENST00000517339.1_Missense_Mutation_p.E561Q|PTK2B_ENST00000397497.4_Missense_Mutation_p.E307Q|PTK2B_ENST00000346049.5_Missense_Mutation_p.E561Q|PTK2B_ENST00000420218.2_Missense_Mutation_p.E561Q|PTK2B_ENST00000544172.1_Missense_Mutation_p.E561Q	NM_173174.2	NP_775266.1	Q14289	FAK2_HUMAN	protein tyrosine kinase 2 beta	561	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of Janus kinase activity (GO:0042976)|activation of Rac GTPase activity (GO:0032863)|apoptotic process (GO:0006915)|blood vessel endothelial cell migration (GO:0043534)|bone resorption (GO:0045453)|cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|cellular response to retinoic acid (GO:0071300)|chemokine-mediated signaling pathway (GO:0070098)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|glial cell proliferation (GO:0014009)|integrin-mediated signaling pathway (GO:0007229)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term synaptic potentiation (GO:0060291)|MAPK cascade (GO:0000165)|marginal zone B cell differentiation (GO:0002315)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cell proliferation (GO:0008285)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of potassium ion transport (GO:0043267)|neuron projection development (GO:0031175)|oocyte maturation (GO:0001556)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell chemotaxis (GO:2000538)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell adhesion (GO:0030155)|regulation of cell shape (GO:0008360)|regulation of establishment of cell polarity (GO:2000114)|regulation of inositol trisphosphate biosynthetic process (GO:0032960)|regulation of macrophage chemotaxis (GO:0010758)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000058)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to hormone (GO:0009725)|response to hydrogen peroxide (GO:0042542)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to osmotic stress (GO:0006970)|response to stress (GO:0006950)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|stress fiber assembly (GO:0043149)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	apical dendrite (GO:0097440)|axon (GO:0030424)|cell body (GO:0044297)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)	p.E561*(2)|p.E307*(1)		breast(2)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(17)|ovary(4)|skin(12)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Ovarian(32;2.72e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)	Leflunomide(DB01097)	GGCCTCCCCTGAGTGTGTGAA	0.582																																						dbGAP											3	Substitution - Nonsense(3)	large_intestine(3)											114.0	98.0	104.0					8																	27296585		2203	4300	6503	-	-	-	SO:0001583	missense	0			U33284	CCDS6057.1, CCDS6058.1	8p21.1	2013-02-18	2013-02-18		ENSG00000120899	ENSG00000120899			9612	protein-coding gene	gene with protein product		601212	"""protein tyrosine kinase 2 beta"", ""PTK2B protein tyrosine kinase 2 beta"""	FAK2		7544443, 7499242	Standard	NM_173174		Approved	CAKB, PYK2, RAFTK, PTK, CADTK	uc003xfp.2	Q14289	OTTHUMG00000102082	ENST00000397501.1:c.1681G>C	8.37:g.27296585G>C	ENSP00000380638:p.Glu561Gln		D3DST0|Q13475|Q14290|Q16709|Q6PID4	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Focal_adhesion_kin_target_dom,pfam_Prot_kinase_cat_dom,pfam_FERM_central,superfamily_Kinase-like_dom,superfamily_Focal_adhesion_kin_target_dom,superfamily_FERM_central,smart_Band_41_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_FERM_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E561Q	ENST00000397501.1	37	c.1681	CCDS6057.1	8	.	.	.	.	.	.	.	.	.	.	G	18.73	3.687271	0.68157	.	.	ENSG00000120899	ENST00000397501;ENST00000539100;ENST00000338238;ENST00000544172;ENST00000346049;ENST00000420218;ENST00000517339;ENST00000397497	T;T;T;T;T;T;T	0.61980	0.06;0.06;0.06;0.06;0.06;0.06;0.06	5.59	4.72	0.59763	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.228496	0.52532	D	0.000080	T	0.39733	0.1089	N	0.04320	-0.23	0.58432	D	0.999995	B;B;B	0.21381	0.007;0.055;0.015	B;B;B	0.22601	0.009;0.04;0.008	T	0.24083	-1.0170	10	0.34782	T	0.22	.	12.3021	0.54880	0.0821:0.0:0.9179:0.0	.	307;561;561	E9PBI4;Q14289-2;Q14289	.;.;FAK2_HUMAN	Q	561;566;561;561;561;561;561;307	ENSP00000380638:E561Q;ENSP00000342242:E561Q;ENSP00000440926:E561Q;ENSP00000332816:E561Q;ENSP00000391995:E561Q;ENSP00000427931:E561Q;ENSP00000380634:E307Q	ENSP00000342242:E561Q	E	+	1	0	PTK2B	27352502	1.000000	0.71417	0.969000	0.41365	0.976000	0.68499	7.989000	0.88205	1.371000	0.46172	0.561000	0.74099	GAG	PTK2B	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000120899		0.582	PTK2B-009	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PTK2B	HGNC	protein_coding	OTTHUMT00000219916.1	204	0.00	0	G	NM_004103		27296585	27296585	+1	no_errors	ENST00000346049	ensembl	human	known	69_37n	missense	136	12.26	19	SNP	1.000	C
PTPN22	26191	genome.wustl.edu	37	1	114397122	114397122	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr1:114397122C>A	ENST00000359785.5	-	9	856	c.721G>T	c.(721-723)Gat>Tat	p.D241Y	AP4B1-AS1_ENST00000419536.1_RNA|PTPN22_ENST00000528414.1_Missense_Mutation_p.D241Y|PTPN22_ENST00000534519.1_5'Flank|PTPN22_ENST00000525799.1_Intron|PTPN22_ENST00000460620.1_Intron|PTPN22_ENST00000538253.1_5'UTR|PTPN22_ENST00000420377.2_Missense_Mutation_p.D241Y	NM_001193431.1|NM_015967.5	NP_001180360.1|NP_057051	Q9Y2R2	PTN22_HUMAN	protein tyrosine phosphatase, non-receptor type 22 (lymphoid)	241	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				negative regulation of T cell activation (GO:0050868)|negative regulation of T cell receptor signaling pathway (GO:0050860)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphoanandamide dephosphorylation (GO:0035644)|protein dephosphorylation (GO:0006470)|regulation of B cell receptor signaling pathway (GO:0050855)|regulation of innate immune response (GO:0045088)|regulation of natural killer cell proliferation (GO:0032817)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	kinase binding (GO:0019900)|protein tyrosine phosphatase activity (GO:0004725)|SH3 domain binding (GO:0017124)			NS(1)|breast(1)|kidney(3)|large_intestine(4)|lung(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Lung SC(450;0.184)	all_cancers(81;1.93e-08)|all_epithelial(167;4.37e-08)|all_lung(203;5.22e-06)|Lung NSC(69;8.94e-06)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CATGTATAATCAATAGCACAA	0.403																																						dbGAP											0													123.0	99.0	107.0					1																	114397122		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF001846	CCDS863.1, CCDS864.1, CCDS864.2	1p13.2	2011-06-09	2005-02-02		ENSG00000134242	ENSG00000134242		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9652	protein-coding gene	gene with protein product		600716	"""protein tyrosine phosphatase, non-receptor type 8"""	PTPN8		10068674, 1373816	Standard	NM_015967		Approved	Lyp, Lyp1, Lyp2	uc001eds.3	Q9Y2R2	OTTHUMG00000011936	ENST00000359785.5:c.721G>T	1.37:g.114397122C>A	ENSP00000352833:p.Asp241Tyr		A0N0K6|B1ALC8|D4NZ71|E9PLD8|E9PPI1|O95063|O95064|Q6IPX8|Q8WVM1	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Non-rcpt_Tyr_Pase_8/22,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.D241Y	ENST00000359785.5	37	c.721	CCDS863.1	1	.	.	.	.	.	.	.	.	.	.	C	14.51	2.558251	0.45590	.	.	ENSG00000134242	ENST00000359785;ENST00000528414;ENST00000420377;ENST00000354605	D;T;D	0.85013	-1.93;2.74;-1.93	5.97	5.97	0.96955	Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.85682	D	0.000000	D	0.94145	0.8122	M	0.92219	3.285	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.94596	0.7792	10	0.87932	D	0	.	19.185	0.93639	0.0:1.0:0.0:0.0	.	241;241;241;241	E9PMT0;E9PLD8;G5E984;Q9Y2R2	.;.;.;PTN22_HUMAN	Y	241	ENSP00000352833:D241Y;ENSP00000435176:D241Y;ENSP00000388229:D241Y	ENSP00000346621:D241Y	D	-	1	0	PTPN22	114198645	1.000000	0.71417	1.000000	0.80357	0.690000	0.40134	7.102000	0.77005	2.835000	0.97688	0.591000	0.81541	GAT	PTPN22	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Non-rcpt_Tyr_Pase_8/22,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000134242		0.403	PTPN22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN22	HGNC	protein_coding	OTTHUMT00000033015.1	165	0.00	0	C	NM_015967		114397122	114397122	-1	no_errors	ENST00000359785	ensembl	human	known	69_37n	missense	94	14.41	16	SNP	1.000	A
PXDNL	137902	genome.wustl.edu	37	8	52321106	52321106	+	Silent	SNP	G	G	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr8:52321106G>T	ENST00000356297.4	-	17	3178	c.3078C>A	c.(3076-3078)ggC>ggA	p.G1026G	PXDNL_ENST00000543296.1_Silent_p.G1026G	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	1026					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GCATCCTAGTGCCAGGGTCCC	0.547																																						dbGAP											0													27.0	33.0	31.0					8																	52321106		2069	4220	6289	-	-	-	SO:0001819	synonymous_variant	0				CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.3078C>A	8.37:g.52321106G>T			B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_VWF_C,superfamily_Haem_peroxidase,smart_VWF_C,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.A145E	ENST00000356297.4	37	c.434	CCDS47855.1	8	.	.	.	.	.	.	.	.	.	.	G	0.131	-1.113446	0.01799	.	.	ENSG00000147485	ENST00000522933	.	.	.	4.2	1.91	0.25777	.	.	.	.	.	T	0.56558	0.1993	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51020	-0.8758	4	.	.	.	.	8.9181	0.35594	0.2383:0.0:0.7617:0.0	.	.	.	.	E	145	.	.	A	-	2	0	PXDNL	52483659	1.000000	0.71417	0.035000	0.18076	0.016000	0.09150	0.633000	0.24598	0.734000	0.32515	0.655000	0.94253	GCA	PXDNL	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal	ENSG00000147485		0.547	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDNL	HGNC	protein_coding	OTTHUMT00000377905.1	55	0.00	0	G	NM_144651		52321106	52321106	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000522933	ensembl	human	novel	69_37n	missense	25	35.90	14	SNP	1.000	T
RFX4	5992	genome.wustl.edu	37	12	107083069	107083069	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr12:107083069C>G	ENST00000392842.1	+	7	1010	c.596C>G	c.(595-597)tCt>tGt	p.S199C	RFX4_ENST00000229387.5_Missense_Mutation_p.S105C|RP11-144F15.1_ENST00000551505.1_Intron|RFX4_ENST00000357881.4_Missense_Mutation_p.S208C	NM_213594.2	NP_998759.1	Q33E94	RFX4_HUMAN	regulatory factor X, 4 (influences HLA class II expression)	199					cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|dorsal spinal cord development (GO:0021516)|midbrain development (GO:0030901)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein processing (GO:0070613)|telencephalon development (GO:0021537)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(20)|pancreas(1)|upper_aerodigestive_tract(1)	35						CCACAGGTTTCTACCTTTATT	0.408																																						dbGAP											0													155.0	144.0	148.0					12																	107083069		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB044245	CCDS9106.1, CCDS9108.1, CCDS55880.1	12q24	2008-08-05			ENSG00000111783	ENSG00000111783			9985	protein-coding gene	gene with protein product		603958				8600444, 11682486	Standard	NM_213594		Approved		uc001tlt.3	Q33E94	OTTHUMG00000169173	ENST00000392842.1:c.596C>G	12.37:g.107083069C>G	ENSP00000376585:p.Ser199Cys		A8K5Y0|B2RDW4|Q33DW6|Q33DW7|Q33E95|Q6YM53|Q8MHQ1|Q8NC78|Q8NDF9|Q8SNA1|Q96S80|Q9BXI0	Missense_Mutation	SNP	pfam_DNA-bd_RFX	p.S208C	ENST00000392842.1	37	c.623	CCDS9106.1	12	.	.	.	.	.	.	.	.	.	.	C	24.7	4.562420	0.86335	.	.	ENSG00000111783	ENST00000392842;ENST00000357881;ENST00000266774;ENST00000551640;ENST00000552866;ENST00000229387	T;T;D;T;T	0.86865	-0.25;-0.25;-2.18;-1.18;0.76	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.90861	0.7129	L	0.36672	1.1	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.999;0.997	D;D;D;D	0.79108	0.98;0.992;0.992;0.971	D	0.91823	0.5469	10	0.87932	D	0	-19.6183	19.2521	0.93929	0.0:1.0:0.0:0.0	.	105;208;208;199	B2RDW4;Q33E94-2;Q33E94-4;Q33E94	.;.;.;RFX4_HUMAN	C	199;208;208;144;105;105	ENSP00000376585:S199C;ENSP00000350552:S208C;ENSP00000448694:S144C;ENSP00000447904:S105C;ENSP00000229387:S105C	ENSP00000229387:S105C	S	+	2	0	RFX4	105607199	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	5.762000	0.68809	2.542000	0.85734	0.655000	0.94253	TCT	RFX4	-	NULL	ENSG00000111783		0.408	RFX4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX4	HGNC	protein_coding	OTTHUMT00000402707.1	196	0.00	0	C	NM_032491		107083069	107083069	+1	no_errors	ENST00000357881	ensembl	human	known	69_37n	missense	124	24.39	40	SNP	1.000	G
ROBO4	54538	genome.wustl.edu	37	11	124761564	124761564	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr11:124761564G>A	ENST00000306534.3	-	11	2167	c.1682C>T	c.(1681-1683)tCc>tTc	p.S561F	ROBO4_ENST00000533054.1_Missense_Mutation_p.S416F|RP11-664I21.6_ENST00000524433.1_Intron	NM_019055.5	NP_061928.4	Q8WZ75	ROBO4_HUMAN	roundabout, axon guidance receptor, homolog 4 (Drosophila)	561					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of cell migration (GO:0030336)|regulation of cell migration (GO:0030334)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(2)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(42)|ovary(1)|prostate(4)|skin(5)|urinary_tract(3)	76	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		ATGCTCACAGGAGCGACGACA	0.607																																						dbGAP											0													55.0	61.0	59.0					11																	124761564		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF361473	CCDS8455.1, CCDS73409.1	11q24.2	2013-02-11	2011-12-09		ENSG00000154133	ENSG00000154133		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17985	protein-coding gene	gene with protein product	"""magic roundabout"""	607528	"""roundabout homolog 4 (Drosophila)"""			11076864	Standard	NM_019055		Approved	FLJ20798, MRB, ECSM4	uc001qbg.3	Q8WZ75	OTTHUMG00000165936	ENST00000306534.3:c.1682C>T	11.37:g.124761564G>A	ENSP00000304945:p.Ser561Phe		A8K154|Q14DU7|Q8TEG1|Q96JV6|Q9H718|Q9NWJ8	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.S561F	ENST00000306534.3	37	c.1682	CCDS8455.1	11	.	.	.	.	.	.	.	.	.	.	G	24.0	4.486885	0.84854	.	.	ENSG00000154133	ENST00000306534;ENST00000374963;ENST00000533054	T;T	0.70164	-0.46;-0.1	5.99	5.99	0.97316	.	0.000000	0.38605	N	0.001639	T	0.81235	0.4780	M	0.69823	2.125	0.43766	D	0.996282	D;D;D	0.89917	1.0;0.999;0.998	D;D;D	0.87578	0.998;0.996;0.991	T	0.82159	-0.0595	10	0.87932	D	0	.	15.9757	0.80063	0.0:0.0:1.0:0.0	.	561;451;561	Q8WZ75-2;Q8WZ75-3;Q8WZ75	.;.;ROBO4_HUMAN	F	561;451;416	ENSP00000304945:S561F;ENSP00000437129:S416F	ENSP00000304945:S561F	S	-	2	0	ROBO4	124266774	1.000000	0.71417	0.932000	0.37286	0.923000	0.55619	4.862000	0.62976	2.847000	0.97988	0.655000	0.94253	TCC	ROBO4	-	NULL	ENSG00000154133		0.607	ROBO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO4	HGNC	protein_coding	OTTHUMT00000387111.1	56	0.00	0	G	NM_019055		124761564	124761564	-1	no_errors	ENST00000306534	ensembl	human	known	69_37n	missense	26	18.75	6	SNP	0.991	A
ROPN1B	152015	genome.wustl.edu	37	3	125701143	125701143	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr3:125701143G>A	ENST00000514116.1	+	6	742	c.427G>A	c.(427-429)Gag>Aag	p.E143K	ROPN1B_ENST00000251776.4_Missense_Mutation_p.E143K|ROPN1B_ENST00000505382.1_Missense_Mutation_p.E51K|ROPN1B_ENST00000511082.1_Missense_Mutation_p.E51K			Q9BZX4	ROP1B_HUMAN	rhophilin associated tail protein 1B	143					acrosome reaction (GO:0007340)|cytokinesis (GO:0000910)|fusion of sperm to egg plasma membrane (GO:0007342)|Rho protein signal transduction (GO:0007266)|single organismal cell-cell adhesion (GO:0016337)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor signaling complex scaffold activity (GO:0030159)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|stomach(1)	8				GBM - Glioblastoma multiforme(114;0.151)		GATAGTGTGTGAGGTCTTATC	0.418																																						dbGAP											0													143.0	123.0	130.0					3																	125701143		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF231410	CCDS33841.1	3q21.2	2011-01-20	2011-01-20		ENSG00000114547	ENSG00000114547			31927	protein-coding gene	gene with protein product			"""ropporin, rhophilin associated protein 1B"""				Standard	XM_005247137		Approved		uc003eih.3	Q9BZX4	OTTHUMG00000162651	ENST00000514116.1:c.427G>A	3.37:g.125701143G>A	ENSP00000426271:p.Glu143Lys		D3DNA6|Q96BM7	Missense_Mutation	SNP	superfamily_cAMP_dep_PK_reg_su_I/II_a/b	p.E143K	ENST00000514116.1	37	c.427	CCDS33841.1	3	.	.	.	.	.	.	.	.	.	.	G	9.656	1.142910	0.21205	.	.	ENSG00000114547	ENST00000514116;ENST00000251776;ENST00000505382;ENST00000511082	T;T;T;T	0.22945	1.98;1.98;1.93;1.93	2.27	2.27	0.28462	.	0.179769	0.38217	N	0.001770	T	0.24736	0.0600	M	0.71871	2.18	0.26674	N	0.971675	B	0.28636	0.218	B	0.25291	0.059	T	0.17137	-1.0379	10	0.48119	T	0.1	-7.3721	8.1893	0.31359	0.0:0.0:1.0:0.0	.	143	Q9BZX4	ROP1B_HUMAN	K	143;143;51;51	ENSP00000426271:E143K;ENSP00000251776:E143K;ENSP00000421662:E51K;ENSP00000424447:E51K	ENSP00000251776:E143K	E	+	1	0	ROPN1B	127183833	1.000000	0.71417	1.000000	0.80357	0.175000	0.22909	4.935000	0.63498	1.573000	0.49748	0.298000	0.19748	GAG	ROPN1B	-	NULL	ENSG00000114547		0.418	ROPN1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ROPN1B	HGNC	protein_coding	OTTHUMT00000369931.1	209	0.00	0	G	NM_001012337		125701143	125701143	+1	no_errors	ENST00000251776	ensembl	human	known	69_37n	missense	115	18.44	26	SNP	1.000	A
RYR3	6263	genome.wustl.edu	37	15	33988430	33988430	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr15:33988430G>A	ENST00000389232.4	+	39	5942	c.5872G>A	c.(5872-5874)Gaa>Aaa	p.E1958K	RYR3_ENST00000415757.3_Missense_Mutation_p.E1958K	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	1958	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AACATTGAAGGAACTCATCTC	0.532																																						dbGAP											0													60.0	59.0	59.0					15																	33988430		2058	4203	6261	-	-	-	SO:0001583	missense	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.5872G>A	15.37:g.33988430G>A	ENSP00000373884:p.Glu1958Lys		O15175|Q15412	Missense_Mutation	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.E1958K	ENST00000389232.4	37	c.5872	CCDS45210.1	15	.	.	.	.	.	.	.	.	.	.	G	14.22	2.469133	0.43839	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;T	0.96685	-4.09;-0.53	4.23	4.23	0.50019	.	0.000000	0.85682	D	0.000000	D	0.93324	0.7872	L	0.43598	1.365	0.52501	D	0.999953	P;B	0.36438	0.553;0.093	B;B	0.39562	0.303;0.074	D	0.90983	0.4829	10	0.21014	T	0.42	.	11.742	0.51799	0.0861:0.0:0.9139:0.0	.	1958;1958	Q15413-2;Q15413	.;RYR3_HUMAN	K	1958	ENSP00000373884:E1958K;ENSP00000399610:E1958K	ENSP00000354735:E1958K	E	+	1	0	RYR3	31775722	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	3.863000	0.56016	2.366000	0.80165	0.650000	0.86243	GAA	RYR3	-	NULL	ENSG00000198838		0.532	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	88	0.00	0	G			33988430	33988430	+1	no_errors	ENST00000389232	ensembl	human	known	69_37n	missense	17	37.04	10	SNP	1.000	A
SARS	6301	genome.wustl.edu	37	1	109779045	109779045	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr1:109779045G>T	ENST00000234677.2	+	9	1207	c.1132G>T	c.(1132-1134)Gac>Tac	p.D378Y	SARS_ENST00000468588.1_3'UTR|SARS_ENST00000369923.4_Missense_Mutation_p.D378Y	NM_006513.3	NP_006504.2	P49591	SYSC_HUMAN	seryl-tRNA synthetase	378					gene expression (GO:0010467)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)|seryl-tRNA aminoacylation (GO:0006434)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)|tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|RNA binding (GO:0003723)|serine-tRNA ligase activity (GO:0004828)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	17		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0301)|Lung(183;0.0677)|COAD - Colon adenocarcinoma(174;0.116)|Epithelial(280;0.233)	L-Serine(DB00133)	TAAGAAGCTTGACCTGGAGGC	0.502																																						dbGAP											0													86.0	93.0	91.0					1																	109779045		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC009390	CCDS795.1	1p13.3	2011-07-01			ENSG00000031698	ENSG00000031698	6.1.1.11	"""Aminoacyl tRNA synthetases / Class II"""	10537	protein-coding gene	gene with protein product	"""serine tRNA ligase 1, cytoplasmic"""	607529				9431993	Standard	NM_006513		Approved	SERS	uc001dwu.2	P49591	OTTHUMG00000011726	ENST00000234677.2:c.1132G>T	1.37:g.109779045G>T	ENSP00000234677:p.Asp378Tyr		B2R6Y9|Q5T5C8|Q9NSE3	Missense_Mutation	SNP	pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Ser-tRNA-synth_IIa_N,superfamily_tRNA-bd_arm,pirsf_Ser-tRNA-synth_IIa,pfscan_aa-tRNA-synth_II,prints_Ser-tRNA-synth_IIa,tigrfam_Ser-tRNA-synth_IIa	p.D378Y	ENST00000234677.2	37	c.1132	CCDS795.1	1	.	.	.	.	.	.	.	.	.	.	g	27.2	4.808051	0.90707	.	.	ENSG00000031698	ENST00000234677;ENST00000369923	T;T	0.73258	-0.73;-0.73	6.08	6.08	0.98989	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (G/ H/ P/ S), conserved domain (1);	0.084762	0.85682	D	0.000000	D	0.91620	0.7352	H	0.99732	4.735	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.996;1.0	D	0.94636	0.7826	10	0.87932	D	0	-34.4651	18.4517	0.90705	0.0:0.0:1.0:0.0	.	378;378;378	Q53HA4;Q5T5C7;P49591	.;.;SYSC_HUMAN	Y	378	ENSP00000234677:D378Y;ENSP00000358939:D378Y	ENSP00000234677:D378Y	D	+	1	0	SARS	109580568	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	9.547000	0.98100	2.894000	0.99253	0.655000	0.94253	GAC	SARS	-	pfam_aa-tRNA-synt_IIb_cons-dom,pirsf_Ser-tRNA-synth_IIa,pfscan_aa-tRNA-synth_II,prints_Ser-tRNA-synth_IIa,tigrfam_Ser-tRNA-synth_IIa	ENSG00000031698		0.502	SARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SARS	HGNC	protein_coding	OTTHUMT00000032394.2	76	0.00	0	G	NM_006513		109779045	109779045	+1	no_errors	ENST00000369923	ensembl	human	known	69_37n	missense	65	21.69	18	SNP	1.000	T
SDCCAG8	10806	genome.wustl.edu	37	1	243579083	243579083	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr1:243579083G>A	ENST00000366541.3	+	14	1814	c.1696G>A	c.(1696-1698)Gag>Aag	p.E566K	SDCCAG8_ENST00000343783.6_Missense_Mutation_p.E421K|SDCCAG8_ENST00000355875.4_Missense_Mutation_p.E523K	NM_006642.3	NP_006633.1	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8	566	Gln-rich.|Mediates interaction with OFD1.|Sufficient for homodimerization. {ECO:0000250}.				establishment of cell polarity (GO:0030010)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|tube formation (GO:0035148)	cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		AAGAGAGCAGGAGCTGACACA	0.512																																						dbGAP											0													85.0	78.0	81.0					1																	243579083		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF039690	CCDS31075.1	1q43	2011-08-02			ENSG00000054282	ENSG00000054282			10671	protein-coding gene	gene with protein product		613524				9610721, 20835237	Standard	NM_006642		Approved	NY-CO-8, CCCAP, SLSN7, NPHP10, BBS16	uc001hzw.3	Q86SQ7	OTTHUMG00000039996	ENST00000366541.3:c.1696G>A	1.37:g.243579083G>A	ENSP00000355499:p.Glu566Lys		O60527|Q3ZCR6|Q8N5F2|Q9P0F1	Missense_Mutation	SNP	NULL	p.E566K	ENST00000366541.3	37	c.1696	CCDS31075.1	1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.252729	0.80135	.	.	ENSG00000054282	ENST00000355875;ENST00000366541;ENST00000343783	T;T;T	0.52983	0.72;0.64;0.67	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.58864	0.2152	L	0.27053	0.805	0.58432	D	0.999997	D	0.89917	1.0	D	0.85130	0.997	T	0.56347	-0.7994	10	0.40728	T	0.16	-15.4003	19.9854	0.97342	0.0:0.0:1.0:0.0	.	566	Q86SQ7	SDCG8_HUMAN	K	523;566;421	ENSP00000348137:E523K;ENSP00000355499:E566K;ENSP00000341260:E421K	ENSP00000341260:E421K	E	+	1	0	SDCCAG8	241645706	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.786000	0.85741	2.786000	0.95864	0.563000	0.77884	GAG	SDCCAG8	-	NULL	ENSG00000054282		0.512	SDCCAG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDCCAG8	HGNC	protein_coding	OTTHUMT00000096485.1	112	0.00	0	G	NM_006642		243579083	243579083	+1	no_errors	ENST00000366541	ensembl	human	known	69_37n	missense	91	18.58	21	SNP	1.000	A
SEC23A	10484	genome.wustl.edu	37	14	39545233	39545233	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr14:39545233G>A	ENST00000307712.6	-	8	1410	c.893C>T	c.(892-894)cCt>cTt	p.P298L	SEC23A_ENST00000536508.1_Missense_Mutation_p.P172L|SEC23A_ENST00000537403.1_Missense_Mutation_p.P96L|SEC23A_ENST00000545328.2_Missense_Mutation_p.P269L	NM_006364.2	NP_006355.2	Q15436	SC23A_HUMAN	Sec23 homolog A (S. cerevisiae)	298					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(1)	23	Hepatocellular(127;0.213)		Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0151)		CACCATTCCAGGCCCCTGAGT	0.388																																						dbGAP											0													79.0	71.0	74.0					14																	39545233		2203	4300	6503	-	-	-	SO:0001583	missense	0			X97064	CCDS9668.1	14q21.1	2008-05-14	2001-11-28		ENSG00000100934	ENSG00000100934			10701	protein-coding gene	gene with protein product		610511	"""Sec23 (S. cerevisiae) homolog A"""			8898360, 10329445	Standard	NM_006364		Approved		uc001wup.1	Q15436	OTTHUMG00000028812	ENST00000307712.6:c.893C>T	14.37:g.39545233G>A	ENSP00000306881:p.Pro298Leu		B2R5P4|B3KXI2|Q8NE16	Missense_Mutation	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom,superfamily_Znf_Sec23_Sec24	p.P298L	ENST00000307712.6	37	c.893	CCDS9668.1	14	.	.	.	.	.	.	.	.	.	.	G	35	5.523745	0.96431	.	.	ENSG00000100934	ENST00000537403;ENST00000307712;ENST00000536508;ENST00000545328;ENST00000554645	T;T;T;T	0.81247	-1.47;-1.47;-1.47;-1.47	5.53	5.53	0.82687	Sec23/Sec24, trunk domain (1);	0.054780	0.85682	D	0.000000	D	0.90167	0.6927	M	0.90252	3.1	0.80722	D	1	D;P;D;P	0.58970	0.984;0.834;0.979;0.863	P;P;P;P	0.55713	0.727;0.53;0.659;0.782	D	0.91533	0.5244	10	0.66056	D	0.02	-16.5927	19.8195	0.96586	0.0:0.0:1.0:0.0	.	186;269;172;298	G3V531;F5H365;F5H6C4;Q15436	.;.;.;SC23A_HUMAN	L	96;298;172;269;186	ENSP00000444193:P96L;ENSP00000306881:P298L;ENSP00000437715:P172L;ENSP00000445393:P269L	ENSP00000306881:P298L	P	-	2	0	SEC23A	38614984	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.680000	0.98651	2.756000	0.94617	0.655000	0.94253	CCT	SEC23A	-	pfam_Sec23/24_trunk_dom	ENSG00000100934		0.388	SEC23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC23A	HGNC	protein_coding	OTTHUMT00000276728.2	169	0.00	0	G			39545233	39545233	-1	no_errors	ENST00000307712	ensembl	human	known	69_37n	missense	95	22.76	28	SNP	1.000	A
SEC24C	9632	genome.wustl.edu	37	10	75525340	75525340	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr10:75525340C>G	ENST00000339365.2	+	10	1521	c.1359C>G	c.(1357-1359)atC>atG	p.I453M	SEC24C_ENST00000535742.1_Intron|SEC24C_ENST00000411652.2_Missense_Mutation_p.I334M|SEC24C_ENST00000546025.1_Missense_Mutation_p.I231M|SEC24C_ENST00000345254.4_Missense_Mutation_p.I453M|SEC24C_ENST00000540668.1_Intron	NM_004922.3	NP_004913.2	P53992	SC24C_HUMAN	SEC24 family member C	453					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(12)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	Prostate(51;0.0112)					GCAGCTGTATCAATGATGGTA	0.463																																						dbGAP											0													159.0	123.0	135.0					10																	75525340		2203	4300	6503	-	-	-	SO:0001583	missense	0			D38555	CCDS7332.1	10q22	2013-10-21	2013-10-21		ENSG00000176986	ENSG00000176986			10705	protein-coding gene	gene with protein product		607185	"""SEC24 (S. cerevisiae) related gene family, member C"", ""SEC24 family, member C (S. cerevisiae)"""			10214955, 7584044	Standard	NM_004922		Approved	KIAA0079	uc001jux.3	P53992	OTTHUMG00000018476	ENST00000339365.2:c.1359C>G	10.37:g.75525340C>G	ENSP00000343405:p.Ile453Met		B4DZT4|Q8WV25	Missense_Mutation	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom,superfamily_Znf_Sec23_Sec24	p.I453M	ENST00000339365.2	37	c.1359	CCDS7332.1	10	.	.	.	.	.	.	.	.	.	.	C	16.47	3.133205	0.56828	.	.	ENSG00000176986	ENST00000546025;ENST00000345254;ENST00000339365;ENST00000411652	T;T;T;T	0.76316	-1.01;-1.01;-1.01;-1.01	5.86	3.92	0.45320	Zinc finger, Sec23/Sec24-type (2);	0.152010	0.64402	D	0.000017	T	0.71904	0.3395	L	0.43598	1.365	0.80722	D	1	B;B;B	0.30851	0.088;0.297;0.172	B;B;B	0.39027	0.057;0.19;0.288	T	0.72154	-0.4376	10	0.59425	D	0.04	-3.7822	8.2562	0.31758	0.133:0.7351:0.0:0.1319	.	334;453;453	E7EP00;G5EA31;P53992	.;.;SC24C_HUMAN	M	231;453;453;334	ENSP00000446333:I231M;ENSP00000321845:I453M;ENSP00000343405:I453M;ENSP00000402913:I334M	ENSP00000343405:I453M	I	+	3	3	SEC24C	75195346	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.694000	0.37752	2.777000	0.95525	0.591000	0.81541	ATC	SEC24C	-	pfam_Znf_Sec23_Sec24,superfamily_Znf_Sec23_Sec24	ENSG00000176986		0.463	SEC24C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC24C	HGNC	protein_coding	OTTHUMT00000048679.1	437	0.00	0	C			75525340	75525340	+1	no_errors	ENST00000339365	ensembl	human	known	69_37n	missense	397	17.29	83	SNP	1.000	G
SH3PXD2A	9644	genome.wustl.edu	37	10	105377012	105377012	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr10:105377012C>G	ENST00000369774.4	-	11	1138	c.862G>C	c.(862-864)Gag>Cag	p.E288Q	SH3PXD2A_ENST00000427662.2_Missense_Mutation_p.E150Q|SH3PXD2A_ENST00000355946.2_Missense_Mutation_p.E260Q|SH3PXD2A_ENST00000538130.1_Missense_Mutation_p.E123Q|SH3PXD2A_ENST00000315994.6_5'UTR|SH3PXD2A_ENST00000540321.1_Missense_Mutation_p.E155Q			Q5TCZ1	SPD2A_HUMAN	SH3 and PX domains 2A	288	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.				superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(18)|ovary(1)|skin(1)|urinary_tract(1)	38		Colorectal(252;0.0815)|Breast(234;0.131)		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)		ACGCCCTTCTCAAAGCCAATC	0.532																																						dbGAP											0													241.0	180.0	200.0					10																	105377012		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007878	CCDS31278.1	10q25.1	2006-02-13	2006-02-13	2006-02-13	ENSG00000107957	ENSG00000107957			23664	protein-coding gene	gene with protein product	"""five SH3 domains"""		"""SH3 multiple domains 1"""	SH3MD1		9687503	Standard	XM_005270297		Approved	FISH, KIAA0418	uc001kxj.1	Q5TCZ1	OTTHUMG00000018997	ENST00000369774.4:c.862G>C	10.37:g.105377012C>G	ENSP00000358789:p.Glu288Gln		D3DR98|O43302|Q5TCZ2|Q5TDQ8	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Phox,superfamily_Phox,superfamily_SH3_domain,smart_Phox,smart_SH3_domain,pfscan_Phox,pfscan_SH3_domain	p.E288Q	ENST00000369774.4	37	c.862		10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.3|28.3	4.905727|4.905727	0.92107|0.92107	.|.	.|.	ENSG00000107957|ENSG00000107957	ENST00000427662;ENST00000369774;ENST00000355946;ENST00000315994;ENST00000536035;ENST00000540321;ENST00000538130|ENST00000420222	T;T;T;T;T|.	0.50001|.	0.76;0.76;0.76;0.76;0.76|.	5.6|5.6	4.68|4.68	0.58851|0.58851	Src homology-3 domain (4);|.	0.096030|.	0.64402|.	D|.	0.000001|.	T|.	0.56920|.	0.2018|.	L|L	0.45422|0.45422	1.42|1.42	0.58432|0.58432	D|D	0.999998|0.999998	D;D;P;B;D|.	0.57257|.	0.976;0.979;0.887;0.096;0.97|.	P;P;P;B;P|.	0.62560|.	0.904;0.85;0.674;0.133;0.844|.	T|.	0.53627|.	-0.8412|.	10|.	0.21014|.	T|.	0.42|.	-37.7129|-37.7129	10.7641|10.7641	0.46283|0.46283	0.1317:0.799:0.0:0.0694|0.1317:0.799:0.0:0.0694	.|.	288;137;150;133;260|.	Q5TCZ1;B7Z9L8;F8WCK5;B7Z3B0;Q5TCZ1-3|.	SPD2A_HUMAN;.;.;.;.|.	Q|S	150;288;260;95;203;155;123|214	ENSP00000392664:E150Q;ENSP00000358789:E288Q;ENSP00000348215:E260Q;ENSP00000443663:E155Q;ENSP00000441514:E123Q|.	ENSP00000318135:E95Q|.	E|X	-|-	1|2	0|2	SH3PXD2A|SH3PXD2A	105367002|105367002	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.998000|0.998000	0.95712|0.95712	6.094000|6.094000	0.71431|0.71431	1.318000|1.318000	0.45170|0.45170	0.561000|0.561000	0.74099|0.74099	GAG|TGA	SH3PXD2A	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000107957		0.532	SH3PXD2A-001	KNOWN	basic	protein_coding	SH3PXD2A	HGNC	protein_coding	OTTHUMT00000050178.1	447	0.00	0	C	NM_014631		105377012	105377012	-1	no_errors	ENST00000369774	ensembl	human	known	69_37n	missense	243	14.44	41	SNP	1.000	G
SLC16A8	23539	genome.wustl.edu	37	22	38474563	38474563	+	Silent	SNP	G	G	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr22:38474563G>A	ENST00000320521.5	-	5	1455	c.1347C>T	c.(1345-1347)ggC>ggT	p.G449G	SLC16A8_ENST00000469516.1_5'UTR	NM_013356.2	NP_037488.2	O95907	MOT3_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 8	449					blood coagulation (GO:0007596)|cellular metabolic process (GO:0044237)|lactate transmembrane transport (GO:0035873)|lactate transport (GO:0015727)|leukocyte migration (GO:0050900)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lactate transmembrane transporter activity (GO:0015129)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			kidney(1)|large_intestine(1)|prostate(1)	3	Melanoma(58;0.045)				Pyruvic acid(DB00119)	CACTGGCTCCGCCCTCAGTGC	0.657																																						dbGAP											0													72.0	66.0	68.0					22																	38474563		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF132610	CCDS13966.1	22q12.3-q13.2	2013-07-18	2013-07-18		ENSG00000100156	ENSG00000100156		"""Solute carriers"""	16270	protein-coding gene	gene with protein product	"""monocarboxylate transporter 3"""	610409	"""solute carrier 16 (monocarboxylic acid transporters), member 8"""			10493836	Standard	NM_013356		Approved	MCT3, REMP	uc003auu.3	O95907	OTTHUMG00000151196	ENST00000320521.5:c.1347C>T	22.37:g.38474563G>A			Q9UBE2	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Monocarb_transpt	p.G449	ENST00000320521.5	37	c.1347	CCDS13966.1	22																																																																																			SLC16A8	-	tigrfam_Monocarb_transpt	ENSG00000100156		0.657	SLC16A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC16A8	HGNC	protein_coding	OTTHUMT00000321724.1	71	0.00	0	G	NM_013356		38474563	38474563	-1	no_errors	ENST00000320521	ensembl	human	known	69_37n	silent	12	53.85	14	SNP	0.000	A
SLC45A1	50651	genome.wustl.edu	37	1	8395594	8395594	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr1:8395594C>A	ENST00000471889.1	+	6	1926	c.1541C>A	c.(1540-1542)tCc>tAc	p.S514Y	SLC45A1_ENST00000481265.1_3'UTR|SLC45A1_ENST00000377479.2_Missense_Mutation_p.S548Y|SLC45A1_ENST00000289877.8_Missense_Mutation_p.S514Y			Q9Y2W3	S45A1_HUMAN	solute carrier family 45, member 1	514					carbohydrate transport (GO:0008643)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(2)	33	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;1.22e-15)|all_lung(118;0.000147)|Lung NSC(185;0.000251)|Renal(390;0.000469)|Colorectal(325;0.00578)|Breast(348;0.00686)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;3.95e-66)|GBM - Glioblastoma multiforme(8;5.93e-33)|Colorectal(212;2.86e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		CGCCTCTGCTCCACCATCTGC	0.652																																						dbGAP											0													75.0	76.0	75.0					1																	8395594		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF118274	CCDS30577.1	1p36.23	2014-01-28	2005-10-04	2005-10-04	ENSG00000162426	ENSG00000162426		"""Solute carriers"""	17939	protein-coding gene	gene with protein product	"""H+/sugar symporter"""	605763	"""deleted in neuroblastoma 5"""	DNB5		10729226	Standard	XM_005263467		Approved		uc001apb.3	Q9Y2W3	OTTHUMG00000000503	ENST00000471889.1:c.1541C>A	1.37:g.8395594C>A	ENSP00000418096:p.Ser514Tyr		Q5VY46|Q5VY49	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.S548Y	ENST00000471889.1	37	c.1643	CCDS30577.1	1	.	.	.	.	.	.	.	.	.	.	C	1.001	-0.690835	0.03303	.	.	ENSG00000162426	ENST00000471889;ENST00000377479;ENST00000289877	D;D;D	0.92249	-3.0;-3.0;-3.0	5.09	1.87	0.25490	.	0.923250	0.09507	N	0.792882	D	0.86489	0.5945	L	0.55743	1.74	0.34663	D	0.722847	B	0.31485	0.325	B	0.26310	0.068	T	0.75725	-0.3217	10	0.02654	T	1	-7.1985	9.661	0.39954	0.0:0.7749:0.1348:0.0903	.	514	Q9Y2W3	S45A1_HUMAN	Y	514;548;514	ENSP00000418096:S514Y;ENSP00000366699:S548Y;ENSP00000289877:S514Y	ENSP00000289877:S514Y	S	+	2	0	SLC45A1	8318181	0.005000	0.15991	0.214000	0.23707	0.777000	0.43975	1.274000	0.33132	0.065000	0.16485	0.561000	0.74099	TCC	SLC45A1	-	NULL	ENSG00000162426		0.652	SLC45A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC45A1	HGNC	protein_coding	OTTHUMT00000001245.5	76	0.00	0	C			8395594	8395594	+1	no_errors	ENST00000377479	ensembl	human	known	69_37n	missense	33	28.26	13	SNP	0.675	A
SLIT2	9353	genome.wustl.edu	37	4	20487849	20487849	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr4:20487849G>T	ENST00000504154.1	+	7	818	c.566G>T	c.(565-567)aGa>aTa	p.R189I	SLIT2_ENST00000503837.1_Missense_Mutation_p.R189I|SLIT2_ENST00000503823.1_Missense_Mutation_p.R189I|SLIT2_ENST00000273739.5_Missense_Mutation_p.R189I	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	189					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						AACATTACTAGACTTTCTGTG	0.274																																						dbGAP											0													74.0	75.0	75.0					4																	20487849		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.566G>T	4.37:g.20487849G>T	ENSP00000422591:p.Arg189Ile		B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation	SNP	pfam_EGF-like_dom,pfam_Laminin_G,pfam_Leu-rich_rpt,pfam_LRR-contain_N,pfam_Cys-rich_flank_reg_C,superfamily_ConA-like_lec_gl,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_EGF-like_Ca-bd,smart_EGF-like,smart_Fol_N,smart_Laminin_G,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom,pfscan_Laminin_G	p.R189I	ENST00000504154.1	37	c.566	CCDS3426.1	4	.	.	.	.	.	.	.	.	.	.	G	24.0	4.482501	0.84747	.	.	ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837	T;T;T;T	0.57907	0.37;0.37;0.37;0.37	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.42017	0.1184	N	0.16567	0.415	0.80722	D	1	P;B	0.36048	0.534;0.156	B;B	0.38842	0.283;0.216	T	0.23119	-1.0197	10	0.22706	T	0.39	.	19.309	0.94177	0.0:0.0:1.0:0.0	.	189;189	O94813-3;O94813	.;SLIT2_HUMAN	I	189	ENSP00000427548:R189I;ENSP00000422591:R189I;ENSP00000273739:R189I;ENSP00000422261:R189I	ENSP00000273739:R189I	R	+	2	0	SLIT2	20096947	1.000000	0.71417	0.962000	0.40283	0.993000	0.82548	7.823000	0.86660	2.624000	0.88883	0.561000	0.74099	AGA	SLIT2	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000145147		0.274	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT2	HGNC	protein_coding	OTTHUMT00000250396.2	120	0.00	0	G			20487849	20487849	+1	no_errors	ENST00000504154	ensembl	human	known	69_37n	missense	122	21.15	33	SNP	0.995	T
SNX13	23161	genome.wustl.edu	37	7	17980008	17980008	+	5'UTR	SNP	C	C	T	rs565462507		TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr7:17980008C>T	ENST00000409389.1	-	0	83				SNX13_ENST00000428135.3_5'UTR|SNX13_ENST00000409604.1_5'UTR			Q9Y5W8	SNX13_HUMAN	sorting nexin 13						intracellular protein transport (GO:0006886)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	early endosome (GO:0005769)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(13)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38	Lung NSC(10;0.0261)|all_lung(11;0.0521)					CCGCCGCCAACGGCGGCAACT	0.652																																						dbGAP											0													7.0	10.0	9.0					7																	17980008		689	1582	2271	-	-	-	SO:0001623	5_prime_UTR_variant	0			AF420470	CCDS47551.1	7p21.1	2008-03-11			ENSG00000071189	ENSG00000071189		"""Sorting nexins"""	21335	protein-coding gene	gene with protein product		606589				11485546, 11729322	Standard	NM_015132		Approved	RGS-PX1, KIAA0713	uc003stv.3	Q9Y5W8	OTTHUMG00000152730	ENST00000409389.1:c.-90G>A	7.37:g.17980008C>T			B2RCI9|O94821|Q8WVZ2|Q8WXH8	RNA	SNP	-	NULL	ENST00000409389.1	37	NULL		7																																																																																			SNX13	-	-	ENSG00000071189		0.652	SNX13-002	NOVEL	basic|exp_conf	protein_coding	SNX13	HGNC	protein_coding	OTTHUMT00000327608.1	35	0.00	0	C	NM_015132		17980008	17980008	-1	no_errors	ENST00000471744	ensembl	human	known	69_37n	rna	18	30.77	8	SNP	0.997	T
SPECC1L	23384	genome.wustl.edu	37	22	24698308	24698308	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr22:24698308G>A	ENST00000314328.9	+	3	394	c.109G>A	c.(109-111)Gga>Aga	p.G37R	SPECC1L_ENST00000541492.1_Missense_Mutation_p.G37R|SPECC1L_ENST00000416735.1_3'UTR|SPECC1L-ADORA2A_ENST00000358654.2_Missense_Mutation_p.G37R|SPECC1L_ENST00000437398.1_Missense_Mutation_p.G37R	NM_001254733.1|NM_015330.3	NP_001241662.1|NP_056145	Q69YQ0	CYTSA_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1-like	37					actin cytoskeleton organization (GO:0030036)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|negative regulation of actin filament depolymerization (GO:0030835)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|gap junction (GO:0005921)|microtubule organizing center (GO:0005815)				breast(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(6)|ovary(1)|prostate(1)|skin(3)|stomach(2)|urinary_tract(1)	27						AGCATCTACGGGAGGCAAACT	0.393																																						dbGAP											0													137.0	130.0	132.0					22																	24698308		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK025531	CCDS33619.1, CCDS58797.1	22q11.23	2012-12-20	2010-09-17	2010-09-17	ENSG00000100014	ENSG00000100014			29022	protein-coding gene	gene with protein product	"""cytokinesis and spindle organization A"", ""cytospin A"""	614140	"""SPECC1-like"""			9205841	Standard	NM_001254733		Approved	KIAA0376, CYTSA	uc002zzv.4	Q69YQ0	OTTHUMG00000171450	ENST00000314328.9:c.109G>A	22.37:g.24698308G>A	ENSP00000325785:p.Gly37Arg		B7Z758|F5H1H6|O15081	Missense_Mutation	SNP	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_HLH_DNA-bd,smart_CH-domain,pfscan_CH-domain	p.G37R	ENST00000314328.9	37	c.109	CCDS33619.1	22	.	.	.	.	.	.	.	.	.	.	.	13.48	2.250974	0.39797	.	.	ENSG00000100014	ENST00000398280;ENST00000437398;ENST00000421374;ENST00000314328;ENST00000541492	T;T;T;T	0.64803	-0.12;2.37;-0.12;2.88	5.3	5.3	0.74995	.	0.124811	0.52532	D	0.000071	T	0.65606	0.2707	L	0.47716	1.5	0.39192	D	0.962988	P;P	0.39883	0.693;0.567	P;B	0.45610	0.487;0.293	T	0.70619	-0.4822	10	0.72032	D	0.01	-32.7721	18.3166	0.90223	0.0:0.0:1.0:0.0	.	37;37	F5H1H6;Q69YQ0	.;CYTSA_HUMAN	R	65;37;37;37;37	ENSP00000393363:G37R;ENSP00000405671:G37R;ENSP00000325785:G37R;ENSP00000439633:G37R	ENSP00000325785:G37R	G	+	1	0	SPECC1L	23028308	1.000000	0.71417	0.351000	0.25721	0.239000	0.25481	5.667000	0.68067	2.643000	0.89663	0.655000	0.94253	GGA	SPECC1L	-	NULL	ENSG00000100014		0.393	SPECC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPECC1L	HGNC	protein_coding	OTTHUMT00000319986.2	135	0.00	0	G	NM_015330		24698308	24698308	+1	no_errors	ENST00000314328	ensembl	human	known	69_37n	missense	86	28.46	35	SNP	0.799	A
SRPR	6734	genome.wustl.edu	37	11	126133864	126133864	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr11:126133864C>T	ENST00000332118.6	-	14	2018	c.1864G>A	c.(1864-1866)Gac>Aac	p.D622N	SRPR_ENST00000532259.1_Missense_Mutation_p.D594N	NM_003139.3	NP_003130.2	P08240	SRPR_HUMAN	signal recognition particle receptor (docking protein)	622					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|endoplasmic reticulum unfolded protein response (GO:0030968)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|signal recognition particle receptor complex (GO:0005785)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|signal recognition particle binding (GO:0005047)			endometrium(7)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)	21	all_hematologic(175;0.145)			BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0736)		CTGCGTAGGTCACAGTAGGTC	0.547																																						dbGAP											0													149.0	138.0	142.0					11																	126133864		2201	4299	6500	-	-	-	SO:0001583	missense	0			BC001162	CCDS31717.1, CCDS53722.1	11q24-q25	2012-10-02	2008-10-29		ENSG00000182934	ENSG00000182934			11307	protein-coding gene	gene with protein product		182180	"""signal recognition particle receptor ('docking protein')"""			3340536, 1312991	Standard	NM_001177842		Approved	SRP-alpha, Sralpha	uc001qdh.3	P08240	OTTHUMG00000165826	ENST00000332118.6:c.1864G>A	11.37:g.126133864C>T	ENSP00000328023:p.Asp622Asn		A6NIB3|B2R5Z8|B4E0H3|E9PJS4|Q9BVJ4	Missense_Mutation	SNP	pfam_Sig_recog_particle_rcpt_asu_N,pfam_Signal_recog_part_SRP54_GTPase,pfam_ArgK,pfam_CobQ/CobB/MinD/ParA_Nub-bd_dom,pfam_Signal_recog_particl_SRP54_hlx,superfamily_Longin-like_dom,superfamily_Signal_recog_particl_SRP54_hlx,smart_Signal_recog_particl_SRP54_hlx,smart_AAA+_ATPase,smart_Signal_recog_part_SRP54_GTPase	p.D622N	ENST00000332118.6	37	c.1864	CCDS31717.1	11	.	.	.	.	.	.	.	.	.	.	C	27.4	4.827724	0.90955	.	.	ENSG00000182934	ENST00000332118;ENST00000532259	.	.	.	4.89	4.89	0.63831	Signal recognition particle, SRP54 subunit, GTPase (3);	0.000000	0.85682	D	0.000000	D	0.84410	0.5466	M	0.89214	3.015	0.80722	D	1	D;D	0.71674	0.998;0.995	D;D	0.70935	0.951;0.971	D	0.87080	0.2165	9	0.59425	D	0.04	-19.824	18.2376	0.89954	0.0:1.0:0.0:0.0	.	594;622	E9PJS4;P08240	.;SRPR_HUMAN	N	622;594	.	ENSP00000328023:D622N	D	-	1	0	SRPR	125639074	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.631000	0.83237	2.535000	0.85469	0.591000	0.81541	GAC	SRPR	-	pfam_Signal_recog_part_SRP54_GTPase,smart_Signal_recog_part_SRP54_GTPase	ENSG00000182934		0.547	SRPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRPR	HGNC	protein_coding	OTTHUMT00000386425.2	159	0.00	0	C	NM_003139		126133864	126133864	-1	no_errors	ENST00000332118	ensembl	human	known	69_37n	missense	85	11.34	11	SNP	1.000	T
SSX3	10214	genome.wustl.edu	37	X	48214153	48214153	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chrX:48214153G>C	ENST00000298396.2	-	3	150	c.98C>G	c.(97-99)tCt>tGt	p.S33C	SSX3_ENST00000376895.1_5'Flank|SSX3_ENST00000376893.3_Missense_Mutation_p.S33C	NM_021014.2	NP_066294.1	Q99909	SSX3_HUMAN	synovial sarcoma, X breakpoint 3	33	KRAB-related. {ECO:0000255|PROSITE- ProRule:PRU00120}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			endometrium(3)|large_intestine(1)|lung(9)	13						CTCTTCCTTAGAGAAGTATTT	0.403																																					Colon(37;227 826 19399 40970 48007)	dbGAP											0													102.0	89.0	93.0					X																	48214153		2203	4298	6501	-	-	-	SO:0001583	missense	0			U90840	CCDS14291.1	Xp11.23	2009-06-17			ENSG00000165584	ENSG00000165584			11337	protein-coding gene	gene with protein product		300325				8697803, 9378559	Standard	NM_021014		Approved	CT5.3	uc004djd.1	Q99909	OTTHUMG00000021489	ENST00000298396.2:c.98C>G	X.37:g.48214153G>C	ENSP00000298396:p.Ser33Cys		O60223|Q5JQZ3|Q9BRW7	Missense_Mutation	SNP	pfam_SSXRD_motif,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.S33C	ENST00000298396.2	37	c.98	CCDS14291.1	X	.	.	.	.	.	.	.	.	.	.	g	9.832	1.188763	0.21954	.	.	ENSG00000165584	ENST00000298396;ENST00000376893	T;T	0.01234	5.13;5.13	1.73	0.801	0.18679	Krueppel-associated box (2);Krueppel-associated box-related (1);	0.451849	0.19138	N	0.121763	T	0.08223	0.0205	M	0.92649	3.33	0.09310	N	1	D;D	0.76494	0.999;0.998	D;D	0.70935	0.971;0.945	T	0.06752	-1.0809	10	0.59425	D	0.04	.	5.5137	0.16894	0.0:0.3473:0.6527:0.0	.	33;33	Q9BRW7;Q99909	.;SSX3_HUMAN	C	33	ENSP00000298396:S33C;ENSP00000366090:S33C	ENSP00000298396:S33C	S	-	2	0	SSX3	48099097	0.793000	0.28825	0.025000	0.17156	0.042000	0.13812	2.004000	0.40854	0.188000	0.20168	0.181000	0.17075	TCT	SSX3	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	ENSG00000165584		0.403	SSX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSX3	HGNC	protein_coding	OTTHUMT00000056486.1	419	0.24	1	G	NM_021014		48214153	48214153	-1	no_errors	ENST00000298396	ensembl	human	known	69_37n	missense	311	22.83	92	SNP	0.025	C
ST18	9705	genome.wustl.edu	37	8	53071507	53071507	+	Missense_Mutation	SNP	C	C	A	rs537037958		TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr8:53071507C>A	ENST00000276480.7	-	15	2440	c.1757G>T	c.(1756-1758)aGg>aTg	p.R586M		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	586					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				TGTGGCTTCCCTGCAGCGGGT	0.582																																						dbGAP											0													106.0	113.0	111.0					8																	53071507		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.1757G>T	8.37:g.53071507C>A	ENSP00000276480:p.Arg586Met		Q17RY1	Missense_Mutation	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.R586M	ENST00000276480.7	37	c.1757	CCDS6149.1	8	.	.	.	.	.	.	.	.	.	.	C	21.3	4.125889	0.77436	.	.	ENSG00000147488	ENST00000276480;ENST00000517580	T;T	0.52295	0.67;0.67	6.08	6.08	0.98989	Myelin transcription factor 1 (1);	0.045277	0.85682	D	0.000000	T	0.72653	0.3487	M	0.80746	2.51	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.992	T	0.69982	-0.4997	10	0.42905	T	0.14	-24.3882	20.6634	0.99662	0.0:1.0:0.0:0.0	.	586;586	E5RHS3;O60284	.;ST18_HUMAN	M	586	ENSP00000276480:R586M;ENSP00000428521:R586M	ENSP00000276480:R586M	R	-	2	0	ST18	53234060	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.607000	0.61133	2.894000	0.99253	0.655000	0.94253	AGG	ST18	-	pfam_Myelin_TF	ENSG00000147488		0.582	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST18	HGNC	protein_coding	OTTHUMT00000377867.1	209	0.00	0	C			53071507	53071507	-1	no_errors	ENST00000276480	ensembl	human	known	69_37n	missense	118	16.20	23	SNP	1.000	A
STARD9	57519	genome.wustl.edu	37	15	42977168	42977168	+	Frame_Shift_Del	DEL	G	G	-			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr15:42977168delG	ENST00000290607.7	+	23	3449	c.3392delG	c.(3391-3393)tggfs	p.W1131fs		NM_020759.2	NP_065810.2	Q9P2P6	STAR9_HUMAN	StAR-related lipid transfer (START) domain containing 9	1131					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spindle assembly (GO:0051225)	centriole (GO:0005814)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|lipid binding (GO:0008289)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						GAGAGGAAATGGGATTTCCCA	0.473																																						dbGAP											0													27.0	26.0	26.0					15																	42977168		692	1590	2282	-	-	-	SO:0001589	frameshift_variant	0			AB037721	CCDS53935.1	15q15.2	2013-10-16	2007-08-16		ENSG00000159433	ENSG00000159433		"""StAR-related lipid transfer (START) domain containing"""	19162	protein-coding gene	gene with protein product		614642	"""START domain containing 9"""			10718198	Standard	NM_020759		Approved	KIAA1300	uc010udj.2	Q9P2P6	OTTHUMG00000175799	ENST00000290607.7:c.3392delG	15.37:g.42977168delG	ENSP00000290607:p.Trp1131fs		Q68DG2|Q6AI01|Q6ZWK0|Q9UF70	Frame_Shift_Del	DEL	pfam_Kinesin_motor_dom,pfam_START_lipid-bd,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,pfscan_START_lipid-bd,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.D1132fs	ENST00000290607.7	37	c.3392	CCDS53935.1	15																																																																																			STARD9	-	NULL	ENSG00000159433		0.473	STARD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD9	HGNC	protein_coding	OTTHUMT00000431094.1	36	0.00	0	G			42977168	42977168	+1	no_errors	ENST00000290607	ensembl	human	known	69_37n	frame_shift_del	10	15.38	2	DEL	0.000	-
STAT5B	6777	genome.wustl.edu	37	17	40376887	40376887	+	Splice_Site	SNP	C	C	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr17:40376887C>T	ENST00000293328.3	-	4	454		c.e4-1			NM_012448.3	NP_036580.2	P51692	STA5B_HUMAN	signal transducer and activator of transcription 5B						2-oxoglutarate metabolic process (GO:0006103)|acute-phase response (GO:0006953)|allantoin metabolic process (GO:0000255)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hormone stimulus (GO:0032870)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|development of secondary female sexual characteristics (GO:0046543)|development of secondary male sexual characteristics (GO:0046544)|fatty acid metabolic process (GO:0006631)|female pregnancy (GO:0007565)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|lipid storage (GO:0019915)|liver development (GO:0001889)|luteinization (GO:0001553)|natural killer cell differentiation (GO:0001779)|negative regulation of apoptotic process (GO:0043066)|negative regulation of erythrocyte differentiation (GO:0045647)|oxaloacetate metabolic process (GO:0006107)|Peyer's patch development (GO:0048541)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of cellular component movement (GO:0051272)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone metabolic process (GO:0042448)|prolactin signaling pathway (GO:0038161)|regulation of cell adhesion (GO:0030155)|regulation of epithelial cell differentiation (GO:0030856)|regulation of multicellular organism growth (GO:0040014)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to lipopolysaccharide (GO:0032496)|succinate metabolic process (GO:0006105)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|taurine metabolic process (GO:0019530)|transcription from RNA polymerase II promoter (GO:0006366)|valine metabolic process (GO:0006573)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|glucocorticoid receptor binding (GO:0035259)|protein dimerization activity (GO:0046983)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_cancers(22;4.15e-07)|all_epithelial(22;2.83e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.135)	Dasatinib(DB01254)	CATACGTGTTCTGAAAGAATC	0.537																																						dbGAP											0													104.0	81.0	88.0					17																	40376887		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC065227	CCDS11423.1	17q11.2	2014-09-17			ENSG00000173757	ENSG00000173757		"""SH2 domain containing"""	11367	protein-coding gene	gene with protein product		604260				8631883	Standard	NM_012448		Approved		uc002hzh.3	P51692	OTTHUMG00000150724	ENST00000293328.3:c.286-1G>A	17.37:g.40376887C>T			Q8WWS8	Splice_Site	SNP	-	e3-1	ENST00000293328.3	37	c.286-1	CCDS11423.1	17	.	.	.	.	.	.	.	.	.	.	c	17.57	3.422015	0.62622	.	.	ENSG00000173757	ENST00000293328;ENST00000415845	.	.	.	4.93	4.93	0.64822	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.9511	0.89053	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	STAT5B	37630413	1.000000	0.71417	1.000000	0.80357	0.456000	0.32438	7.320000	0.79064	2.555000	0.86185	0.585000	0.79938	.	STAT5B	-	-	ENSG00000173757		0.537	STAT5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAT5B	HGNC	protein_coding	OTTHUMT00000319797.1	190	0.00	0	C	NM_012448	Intron	40376887	40376887	-1	no_errors	ENST00000293328	ensembl	human	known	69_37n	splice_site	45	31.82	21	SNP	1.000	T
TBC1D24	57465	genome.wustl.edu	37	16	2549400	2549400	+	Silent	SNP	C	C	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr16:2549400C>T	ENST00000293970.5	+	5	1318	c.1185C>T	c.(1183-1185)ctC>ctT	p.L395L	TBC1D24_ENST00000434757.2_Silent_p.L395L|TBC1D24_ENST00000567020.1_Silent_p.L389L|RP11-20I23.1_ENST00000564543.1_Intron	NM_001199107.1	NP_001186036.1	Q9ULP9	TBC24_HUMAN	TBC1 domain family, member 24	395	TLD.				neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|terminal bouton (GO:0043195)	Rab GTPase activator activity (GO:0005097)			endometrium(2)|kidney(4)|large_intestine(3)|lung(4)	13						CCCTCTTGCTCATCAAGACCA	0.632																																						dbGAP											0													54.0	58.0	57.0					16																	2549400		2097	4227	6324	-	-	-	SO:0001819	synonymous_variant	0			AB032997	CCDS42107.1, CCDS55980.1	16p13.3	2014-05-07				ENSG00000162065			29203	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 6"""	613577	"""deafness, autosomal recessive 86"""	DFNB86		10574461, 24387994, 24729539	Standard	NM_001199107		Approved	KIAA1171, TLDC6, DFNA65	uc002cql.3	Q9ULP9		ENST00000293970.5:c.1185C>T	16.37:g.2549400C>T			A0JNW3|B9A6M6|Q2KJ08	Silent	SNP	pfam_TLDc,pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,smart_TLDc	p.L395	ENST00000293970.5	37	c.1185	CCDS55980.1	16																																																																																			TBC1D24	-	pfam_TLDc,smart_TLDc	ENSG00000162065		0.632	TBC1D24-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBC1D24	HGNC	protein_coding	OTTHUMT00000435637.1	104	0.00	0	C	NM_020705		2549400	2549400	+1	no_errors	ENST00000293970	ensembl	human	known	69_37n	silent	24	36.84	14	SNP	1.000	T
TBC1D5	9779	genome.wustl.edu	37	3	17208372	17208372	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr3:17208372C>G	ENST00000253692.7	-	21	3645	c.1981G>C	c.(1981-1983)Gag>Cag	p.E661Q	TBC1D5_ENST00000414318.2_5'UTR|TBC1D5_ENST00000429383.4_Missense_Mutation_p.E661Q|TBC1D5_ENST00000446818.2_Missense_Mutation_p.E683Q	NM_014744.2	NP_055559.1	Q92609	TBCD5_HUMAN	TBC1 domain family, member 5	661						retromer complex (GO:0030904)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	36						TCTTCGGCCTCTAGCTGGCTC	0.468																																						dbGAP											0													77.0	70.0	73.0					3																	17208372		2203	4300	6503	-	-	-	SO:0001583	missense	0			D86965	CCDS33714.1, CCDS46770.1	3p24.3	2013-07-09			ENSG00000131374	ENSG00000131374			19166	protein-coding gene	gene with protein product		615740				19531583	Standard	NM_014744		Approved	KIAA0210	uc003cbe.3	Q92609	OTTHUMG00000155488	ENST00000253692.7:c.1981G>C	3.37:g.17208372C>G	ENSP00000253692:p.Glu661Gln		A6NP25|C9JP52	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.E661Q	ENST00000253692.7	37	c.1981	CCDS33714.1	3	.	.	.	.	.	.	.	.	.	.	C	28.2	4.897996	0.91962	.	.	ENSG00000131374	ENST00000253692;ENST00000429383;ENST00000446818	T;T;T	0.31247	1.5;1.5;1.5	5.09	5.09	0.68999	.	0.102843	0.64402	D	0.000004	T	0.44829	0.1312	L	0.27053	0.805	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.73708	0.981;0.973;0.973	T	0.45977	-0.9224	10	0.66056	D	0.02	-21.0127	18.8634	0.92281	0.0:1.0:0.0:0.0	.	683;661;661	C9JP52;B9A6K1;Q92609	.;.;TBCD5_HUMAN	Q	661;661;683	ENSP00000253692:E661Q;ENSP00000398127:E661Q;ENSP00000402935:E683Q	ENSP00000253692:E661Q	E	-	1	0	TBC1D5	17183376	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	7.256000	0.78350	2.521000	0.84997	0.561000	0.74099	GAG	TBC1D5	-	NULL	ENSG00000131374		0.468	TBC1D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D5	HGNC	protein_coding	OTTHUMT00000340301.3	136	0.00	0	C	NM_014744		17208372	17208372	-1	no_errors	ENST00000253692	ensembl	human	known	69_37n	missense	104	26.24	37	SNP	1.000	G
TEKT5	146279	genome.wustl.edu	37	16	10783850	10783850	+	Silent	SNP	C	C	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr16:10783850C>T	ENST00000283025.2	-	2	668	c.597G>A	c.(595-597)aaG>aaA	p.K199K	RP11-109M19.1_ENST00000576710.1_RNA	NM_144674.1	NP_653275.1	Q96M29	TEKT5_HUMAN	tektin 5	199						cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)				breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)	34						TCCCAATCCTCTTCTCTCGAT	0.532																																						dbGAP											0													108.0	93.0	98.0					16																	10783850		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0				CCDS10542.1	16p13.13	2014-01-21			ENSG00000153060	ENSG00000153060			26554	protein-coding gene	gene with protein product							Standard	NM_144674		Approved	FLJ32871, CT149	uc002czz.1	Q96M29	OTTHUMG00000129750	ENST00000283025.2:c.597G>A	16.37:g.10783850C>T			A1L3Z3	Silent	SNP	pfam_Tektin,prints_Tektin	p.K199	ENST00000283025.2	37	c.597	CCDS10542.1	16																																																																																			TEKT5	-	pfam_Tektin	ENSG00000153060		0.532	TEKT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEKT5	HGNC	protein_coding	OTTHUMT00000251963.1	199	0.00	0	C	NM_144674		10783850	10783850	-1	no_errors	ENST00000283025	ensembl	human	known	69_37n	silent	75	28.57	30	SNP	1.000	T
THAP5	168451	genome.wustl.edu	37	7	108205254	108205254	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr7:108205254C>G	ENST00000415914.3	-	3	722	c.569G>C	c.(568-570)aGa>aCa	p.R190T	THAP5_ENST00000438865.1_3'UTR|THAP5_ENST00000493722.1_5'UTR|THAP5_ENST00000313516.5_Missense_Mutation_p.R148T	NM_001130475.1	NP_001123947.1	Q7Z6K1	THAP5_HUMAN	THAP domain containing 5	190					cell cycle (GO:0007049)|negative regulation of cell cycle (GO:0045786)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protease binding (GO:0002020)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)	8						AAAACCACCTCTACCTGTATC	0.318																																						dbGAP											0													62.0	59.0	60.0					7																	108205254		2201	4300	6501	-	-	-	SO:0001583	missense	0			AL833137	CCDS34734.2, CCDS47687.1	7q22.3	2013-01-25			ENSG00000177683	ENSG00000177683		"""THAP (C2CH-type zinc finger) domain containing"""	23188	protein-coding gene	gene with protein product		612534				12575992	Standard	NM_001287598		Approved	DKFZp313O1132	uc003vfm.3	Q7Z6K1	OTTHUMG00000154951	ENST00000415914.3:c.569G>C	7.37:g.108205254C>G	ENSP00000400500:p.Arg190Thr			Missense_Mutation	SNP	pfam_Znf_C2CH,smart_Znf_C2CH,pfscan_Znf_C2CH	p.R190T	ENST00000415914.3	37	c.569	CCDS47687.1	7	.	.	.	.	.	.	.	.	.	.	C	0.015	-1.566101	0.00903	.	.	ENSG00000177683	ENST00000415914;ENST00000313516	D;D	0.96265	-3.96;-2.47	4.46	-1.61	0.08399	.	3.479120	0.01412	N	0.014036	D	0.88153	0.6360	N	0.08118	0	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.80641	-0.1292	9	.	.	.	.	0.1964	0.00140	0.322:0.1476:0.2437:0.2867	.	190	Q7Z6K1	THAP5_HUMAN	T	190;148	ENSP00000400500:R190T;ENSP00000322440:R148T	.	R	-	2	0	THAP5	107992490	0.000000	0.05858	0.000000	0.03702	0.059000	0.15707	-0.309000	0.08145	-0.495000	0.06659	-0.272000	0.10252	AGA	THAP5	-	NULL	ENSG00000177683		0.318	THAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THAP5	HGNC	protein_coding	OTTHUMT00000337777.2	113	0.00	0	C	NM_182529		108205254	108205254	-1	no_errors	ENST00000415914	ensembl	human	known	69_37n	missense	108	10.66	13	SNP	0.000	G
TMCO3	55002	genome.wustl.edu	37	13	114188508	114188508	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr13:114188508G>C	ENST00000434316.2	+	9	1851	c.1492G>C	c.(1492-1494)Gaa>Caa	p.E498Q	TMCO3_ENST00000375391.1_Intron|TMCO3_ENST00000474393.1_3'UTR	NM_017905.4	NP_060375.4	Q6UWJ1	TMCO3_HUMAN	transmembrane and coiled-coil domains 3	498						integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)			NS(1)|endometrium(4)|large_intestine(9)|liver(1)|lung(8)|prostate(1)|stomach(1)	25	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0145)|all_epithelial(44;0.00286)|all_lung(25;0.0273)|Breast(118;0.0411)|Lung NSC(25;0.0983)	all cancers(43;0.0317)			GGGGAACAAAGAAATCCTGAT	0.348																																						dbGAP											0													156.0	153.0	154.0					13																	114188508		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC012564	CCDS9537.1	13q34	2008-02-05	2005-07-22	2005-07-22	ENSG00000150403	ENSG00000150403			20329	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 11"""	C13orf11			Standard	NM_017905		Approved	FLJ20623	uc001vtu.4	Q6UWJ1	OTTHUMG00000017389	ENST00000434316.2:c.1492G>C	13.37:g.114188508G>C	ENSP00000389399:p.Glu498Gln		Q5JSB1|Q6NUN1|Q8NG29|Q8TCI6|Q96EA6|Q9NWT2	Missense_Mutation	SNP	pfam_Cation/H_exchanger	p.E498Q	ENST00000434316.2	37	c.1492	CCDS9537.1	13	.	.	.	.	.	.	.	.	.	.	G	24.0	4.484146	0.84854	.	.	ENSG00000150403	ENST00000434316	T	0.18502	2.21	4.75	4.75	0.60458	Cation/H+ exchanger (1);	0.000000	0.85682	D	0.000000	T	0.50154	0.1599	M	0.89095	3.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	T	0.61903	-0.6967	10	0.72032	D	0.01	-22.0807	17.8175	0.88639	0.0:0.0:1.0:0.0	.	498;498	Q6UWJ1;Q6UWJ1-2	TMCO3_HUMAN;.	Q	498	ENSP00000389399:E498Q	ENSP00000389399:E498Q	E	+	1	0	TMCO3	113236509	1.000000	0.71417	0.982000	0.44146	0.849000	0.48306	8.623000	0.90957	2.195000	0.70347	0.555000	0.69702	GAA	TMCO3	-	pfam_Cation/H_exchanger	ENSG00000150403		0.348	TMCO3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCO3	HGNC	protein_coding	OTTHUMT00000045931.3	129	0.00	0	G	NM_017905		114188508	114188508	+1	no_errors	ENST00000434316	ensembl	human	known	69_37n	missense	128	25.86	45	SNP	1.000	C
TMED10	10972	genome.wustl.edu	37	14	75601659	75601659	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr14:75601659G>C	ENST00000303575.4	-	5	640	c.589C>G	c.(589-591)Ctc>Gtc	p.L197V	TMED10_ENST00000557670.1_5'UTR|RP11-950C14.7_ENST00000556236.1_RNA	NM_006827.5	NP_006818.3	P49755	TMEDA_HUMAN	transmembrane emp24-like trafficking protein 10 (yeast)	197					beta-amyloid formation (GO:0034205)|cargo loading into vesicle (GO:0035459)|COPI coating of Golgi vesicle (GO:0048205)|COPI-coated vesicle budding (GO:0035964)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|kidney development (GO:0001822)|protein oligomerization (GO:0051259)|regulated secretory pathway (GO:0045055)|response to acid chemical (GO:0001101)|response to alkaloid (GO:0043279)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle targeting, to, from or within Golgi (GO:0048199)	cis-Golgi network (GO:0005801)|COPI-coated vesicle (GO:0030137)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|gamma-secretase complex (GO:0070765)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network transport vesicle (GO:0030140)|zymogen granule membrane (GO:0042589)	syntaxin binding (GO:0019905)			endometrium(1)|large_intestine(5)|lung(3)	9				BRCA - Breast invasive adenocarcinoma(234;0.0126)		AGTCCAATGAGACAGAACATT	0.423																																						dbGAP											0													100.0	100.0	100.0					14																	75601659		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL832012, X97442	CCDS9840.1	14q24.3	2008-08-11			ENSG00000170348	ENSG00000170348			16998	protein-coding gene	gene with protein product		605406				7596406, 8663407	Standard	NM_006827		Approved	TMP21, P24(DELTA)	uc001xrm.1	P49755		ENST00000303575.4:c.589C>G	14.37:g.75601659G>C	ENSP00000303145:p.Leu197Val		B2R605|Q15602|Q16536|Q86TC2|Q86TS5	Missense_Mutation	SNP	pfam_GOLD,pfscan_GOLD	p.L197V	ENST00000303575.4	37	c.589	CCDS9840.1	14	.	.	.	.	.	.	.	.	.	.	G	22.7	4.318334	0.81469	.	.	ENSG00000170348	ENST00000303575	T	0.20598	2.06	6.04	6.04	0.98038	GOLD (1);	0.000000	0.85682	D	0.000000	T	0.53367	0.1792	M	0.83852	2.665	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	T	0.51395	-0.8711	10	0.52906	T	0.07	-32.8491	20.5948	0.99439	0.0:0.0:1.0:0.0	.	197	P49755	TMEDA_HUMAN	V	197	ENSP00000303145:L197V	ENSP00000303145:L197V	L	-	1	0	TMED10	74671412	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.756000	0.74919	2.873000	0.98535	0.563000	0.77884	CTC	TMED10	-	pfam_GOLD	ENSG00000170348		0.423	TMED10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMED10	HGNC	protein_coding	OTTHUMT00000415034.1	119	0.00	0	G	NM_006827		75601659	75601659	-1	no_errors	ENST00000303575	ensembl	human	known	69_37n	missense	53	11.67	7	SNP	1.000	C
TMEM131	23505	genome.wustl.edu	37	2	98543924	98543924	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr2:98543924C>G	ENST00000186436.5	-	2	442	c.214G>C	c.(214-216)Gaa>Caa	p.E72Q	TMEM131_ENST00000425805.2_Missense_Mutation_p.E23Q	NM_015348.1	NP_056163.1	Q92545	TM131_HUMAN	transmembrane protein 131	72						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(4)|prostate(1)|skin(1)|stomach(1)	57						CGCAGTACTTCTATTATGCTC	0.308																																						dbGAP											0													71.0	66.0	67.0					2																	98543924		1863	4096	5959	-	-	-	SO:0001583	missense	0			AK025852	CCDS46368.1	2q11.2	2006-04-12			ENSG00000075568	ENSG00000075568			30366	protein-coding gene	gene with protein product		615659				9039502, 10996388	Standard	NM_015348		Approved	CC28, YR-23, RW1, KIAA0257, PRO1048	uc002syh.4	Q92545	OTTHUMG00000153061	ENST00000186436.5:c.214G>C	2.37:g.98543924C>G	ENSP00000186436:p.Glu72Gln			Missense_Mutation	SNP	pfam_DUF3651_TMEM131	p.E72Q	ENST00000186436.5	37	c.214	CCDS46368.1	2	.	.	.	.	.	.	.	.	.	.	C	20.9	4.069894	0.76301	.	.	ENSG00000075568	ENST00000186436;ENST00000425805	T	0.38722	1.12	5.16	5.16	0.70880	.	.	.	.	.	T	0.53094	0.1775	L	0.27053	0.805	0.38659	D	0.952035	D;D	0.71674	0.998;0.97	D;P	0.78314	0.991;0.749	T	0.59236	-0.7492	9	0.72032	D	0.01	.	17.5711	0.87934	0.0:1.0:0.0:0.0	.	23;72	B4DMG2;Q92545	.;TM131_HUMAN	Q	72;23	ENSP00000186436:E72Q	ENSP00000186436:E72Q	E	-	1	0	TMEM131	97910356	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.871000	0.56077	2.687000	0.91594	0.557000	0.71058	GAA	TMEM131	-	NULL	ENSG00000075568		0.308	TMEM131-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM131	HGNC	protein_coding	OTTHUMT00000329285.2	71	0.00	0	C	XM_371542		98543924	98543924	-1	no_errors	ENST00000186436	ensembl	human	known	69_37n	missense	90	23.08	27	SNP	1.000	G
TNPO2	30000	genome.wustl.edu	37	19	12830080	12830080	+	Nonsense_Mutation	SNP	G	G	C			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr19:12830080G>C	ENST00000592287.1	-	3	278	c.170C>G	c.(169-171)tCa>tGa	p.S57*	TNPO2_ENST00000441499.1_Nonsense_Mutation_p.S57*|TNPO2_ENST00000589956.1_5'UTR|TNPO2_ENST00000450764.2_Nonsense_Mutation_p.S57*|TNPO2_ENST00000588216.1_Nonsense_Mutation_p.S57*|TNPO2_ENST00000356861.5_Nonsense_Mutation_p.S57*|TNPO2_ENST00000425528.1_Nonsense_Mutation_p.S57*	NM_001136196.1	NP_001129668.1	O14787	TNPO2_HUMAN	transportin 2	57	Importin N-terminal.				intracellular protein transport (GO:0006886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						CGTACCTTCTGACTTGAGTCT	0.542																																						dbGAP											0													166.0	180.0	175.0					19																	12830080		1984	4160	6144	-	-	-	SO:0001587	stop_gained	0			AF019039	CCDS45991.1, CCDS45992.1	19p13.13	2009-01-12	2009-01-12			ENSG00000105576		"""Importins"""	19998	protein-coding gene	gene with protein product	"""importin 3"", ""karyopherin beta 2b"""	603002				9298975, 12384575	Standard	NM_013433		Approved	IPO3, KPNB2B, FLJ12155, TRN2	uc002muo.3	O14787		ENST00000592287.1:c.170C>G	19.37:g.12830080G>C	ENSP00000468434:p.Ser57*		O14655|Q6IN77	Nonsense_Mutation	SNP	pfam_HEAT,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N	p.S57*	ENST00000592287.1	37	c.170	CCDS45991.1	19	.	.	.	.	.	.	.	.	.	.	G	38	7.105949	0.98066	.	.	ENSG00000105576	ENST00000536114;ENST00000425528;ENST00000441499;ENST00000450764;ENST00000356861;ENST00000420511;ENST00000546320	.	.	.	5.15	5.15	0.70609	.	0.126084	0.56097	D	0.000038	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-21.6946	17.7517	0.88436	0.0:0.0:1.0:0.0	.	.	.	.	X	221;57;57;57;57;57;57	.	ENSP00000349321:S57X	S	-	2	0	TNPO2	12691080	1.000000	0.71417	0.985000	0.45067	0.995000	0.86356	8.964000	0.93389	2.564000	0.86499	0.650000	0.86243	TCA	TNPO2	-	pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N	ENSG00000105576		0.542	TNPO2-002	KNOWN	basic|CCDS	protein_coding	TNPO2	HGNC	protein_coding	OTTHUMT00000450785.1	346	0.00	0	G	NM_013433		12830080	12830080	-1	no_errors	ENST00000425528	ensembl	human	known	69_37n	nonsense	131	26.26	47	SNP	1.000	C
TP53	7157	genome.wustl.edu	37	17	7579383	7579383	+	Frame_Shift_Del	DEL	T	T	-			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr17:7579383delT	ENST00000269305.4	-	4	493	c.304delA	c.(304-306)accfs	p.T102fs	TP53_ENST00000455263.2_Frame_Shift_Del_p.T102fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.T102fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.T102fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.T102fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.T102fs|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	102	Interaction with HIPK1. {ECO:0000250}.|Interaction with WWOX.|Required for interaction with ZNF385A.		T -> I (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.Y103fs*19(3)|p.K101_Y103>N(3)|p.Q100fs*37(3)|p.G59fs*23(3)|p.V73fs*9(1)|p.T102fs*21(1)|p.W91fs*13(1)|p.P13fs*18(1)|p.S33fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCCTGGTAGGTTTTCTGGGAA	0.642		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	25	Deletion - Frameshift(14)|Whole gene deletion(8)|Complex - deletion inframe(3)	central_nervous_system(5)|bone(4)|upper_aerodigestive_tract(3)|ovary(3)|prostate(3)|lung(2)|breast(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|liver(1)											52.0	53.0	52.0					17																	7579383		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.304delA	17.37:g.7579383delT	ENSP00000269305:p.Thr102fs		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.T102fs	ENST00000269305.4	37	c.304	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.642	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	57	0.00	0	T	NM_000546		7579383	7579383	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	frame_shift_del	12	25.00	4	DEL	0.262	-
TPP2	7174	genome.wustl.edu	37	13	103287966	103287966	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr13:103287966G>T	ENST00000376065.4	+	12	1459	c.1423G>T	c.(1423-1425)Gtt>Ttt	p.V475F	TPP2_ENST00000376052.3_Missense_Mutation_p.V475F	NM_003291.2	NP_003282.2	P29144	TPP2_HUMAN	tripeptidyl peptidase II	475	Peptidase S8.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|tripeptidyl-peptidase activity (GO:0008240)			breast(2)|endometrium(5)|kidney(2)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	52	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TGACTACACAGTTCATTCAGT	0.378																																						dbGAP											0													117.0	115.0	116.0					13																	103287966		2203	4300	6503	-	-	-	SO:0001583	missense	0			M55169	CCDS9502.1	13q32-q33	2008-02-05			ENSG00000134900	ENSG00000134900	3.4.14.10		12016	protein-coding gene	gene with protein product		190470				1670990	Standard	NM_003291		Approved		uc001vpi.4	P29144	OTTHUMG00000017305	ENST00000376065.4:c.1423G>T	13.37:g.103287966G>T	ENSP00000365233:p.Val475Phe		Q5VZU8	Missense_Mutation	SNP	pfam_Peptidase_S8/S53,pfam_Peptidase_S8A_TPPII,superfamily_Peptidase_S8/S53,prints_Peptidase_S8_subtilisin-rel	p.V475F	ENST00000376065.4	37	c.1423	CCDS9502.1	13	.	.	.	.	.	.	.	.	.	.	G	28.3	4.904298	0.92035	.	.	ENSG00000134900	ENST00000376065;ENST00000376052	T;T	0.43294	0.95;0.95	5.83	5.83	0.93111	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.000000	0.85682	D	0.000000	T	0.59998	0.2235	M	0.67569	2.06	0.80722	D	1	D	0.54397	0.966	P	0.55161	0.77	T	0.61637	-0.7022	10	0.87932	D	0	.	20.1374	0.98035	0.0:0.0:1.0:0.0	.	475	P29144	TPP2_HUMAN	F	475	ENSP00000365233:V475F;ENSP00000365220:V475F	ENSP00000365220:V475F	V	+	1	0	TPP2	102085967	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	6.878000	0.75567	2.763000	0.94921	0.563000	0.77884	GTT	TPP2	-	pfam_Peptidase_S8/S53,superfamily_Peptidase_S8/S53	ENSG00000134900		0.378	TPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPP2	HGNC	protein_coding	OTTHUMT00000045683.2	179	0.00	0	G			103287966	103287966	+1	no_errors	ENST00000376065	ensembl	human	known	69_37n	missense	108	19.40	26	SNP	1.000	T
TRA2B	6434	genome.wustl.edu	37	3	185639893	185639893	+	Missense_Mutation	SNP	T	T	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr3:185639893T>A	ENST00000453386.2	-	5	819	c.544A>T	c.(544-546)Atg>Ttg	p.M182L	TRA2B_ENST00000382191.4_Missense_Mutation_p.M82L	NM_004593.2	NP_004584.1	P62995	TRA2B_HUMAN	transformer 2 beta homolog (Drosophila)	182	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA splicing, via spliceosome (GO:0000398)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing, via transesterification reactions (GO:0000375)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|kidney(1)|large_intestine(6)|lung(4)|ovary(3)|prostate(1)|urinary_tract(1)	18						TCAAGCTCCATTCCATTGGCA	0.408																																						dbGAP											0													133.0	125.0	128.0					3																	185639893		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF057159	CCDS33905.1, CCDS58872.1	3q26.2-q27	2014-06-13	2009-02-27	2009-02-27	ENSG00000136527	ENSG00000136527		"""RNA binding motif (RRM) containing"""	10781	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 156"""	602719	"""splicing factor, arginine/serine-rich 10 (transformer 2 homolog, Drosophila)"""	SFRS10		9790768	Standard	NM_004593		Approved	Htra2-beta, PPP1R156	uc003fpv.3	P62995	OTTHUMG00000156641	ENST00000453386.2:c.544A>T	3.37:g.185639893T>A	ENSP00000416959:p.Met182Leu		B4DVK2|D3DNU3|O15449|Q15815|Q64283	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.M182L	ENST00000453386.2	37	c.544	CCDS33905.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.62|17.62	3.434131|3.434131	0.62955|0.62955	.|.	.|.	ENSG00000136527|ENSG00000136527	ENST00000259043;ENST00000414862|ENST00000453386;ENST00000382191	.|D;D	.|0.85339	.|-1.97;-1.97	6.17|6.17	5.01|5.01	0.66863|0.66863	.|Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.73923|0.73923	0.3649|0.3649	N|N	0.16098|0.16098	0.37|0.37	0.80722|0.80722	D|D	1|1	.|B;B	.|0.18013	.|0.025;0.025	.|B;B	.|0.27380	.|0.079;0.079	T|T	0.68522|0.68522	-0.5386|-0.5386	5|10	.|0.26408	.|T	.|0.33	-4.208|-4.208	11.8602|11.8602	0.52461|0.52461	0.0:0.0704:0.0:0.9296|0.0:0.0704:0.0:0.9296	.|.	.|182;182	.|B2RDQ3;P62995	.|.;TRA2B_HUMAN	D|L	40;1|182;82	.|ENSP00000416959:M182L;ENSP00000371626:M82L	.|ENSP00000371626:M82L	E|M	-|-	3|1	2|0	TRA2B|TRA2B	187122587|187122587	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	7.997000|7.997000	0.88414|0.88414	2.371000|2.371000	0.80710|0.80710	0.533000|0.533000	0.62120|0.62120	GAA|ATG	TRA2B	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000136527		0.408	TRA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRA2B	HGNC	protein_coding	OTTHUMT00000344984.1	259	0.00	0	T	NM_004593		185639893	185639893	-1	no_errors	ENST00000453386	ensembl	human	known	69_37n	missense	121	36.13	69	SNP	1.000	A
TRPM2	7226	genome.wustl.edu	37	21	45811190	45811190	+	Silent	SNP	C	C	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr21:45811190C>T	ENST00000397928.1	+	11	1921	c.1476C>T	c.(1474-1476)ctC>ctT	p.L492L	TRPM2_ENST00000300481.9_Silent_p.L492L|TRPM2_ENST00000397932.2_Silent_p.L492L|TRPM2_ENST00000300482.5_Silent_p.L492L|TRPM2_ENST00000498430.1_3'UTR	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	492					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)			breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						CAGCTGCACTCATCTCCAACA	0.527																																						dbGAP											0													131.0	94.0	107.0					21																	45811190		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.1476C>T	21.37:g.45811190C>T			D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Silent	SNP	pfam_Ion_trans_dom,superfamily_NUDIX_hydrolase_dom-like	p.L492	ENST00000397928.1	37	c.1476	CCDS13710.1	21																																																																																			TRPM2	-	NULL	ENSG00000142185		0.527	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPM2	HGNC	protein_coding	OTTHUMT00000098086.1	65	0.00	0	C	NM_003307		45811190	45811190	+1	no_errors	ENST00000300482	ensembl	human	known	69_37n	silent	21	19.23	5	SNP	1.000	T
TSEN34	79042	genome.wustl.edu	37	19	54695795	54695795	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr19:54695795C>T	ENST00000396383.1	+	3	778	c.467C>T	c.(466-468)tCg>tTg	p.S156L	TSEN34_ENST00000429671.2_Missense_Mutation_p.S156L|TSEN34_ENST00000396388.2_Missense_Mutation_p.S156L|MBOAT7_ENST00000474910.1_5'Flank|MBOAT7_ENST00000431666.2_5'Flank|MBOAT7_ENST00000338624.6_5'Flank|TSEN34_ENST00000302937.4_Missense_Mutation_p.S156L|MBOAT7_ENST00000391754.1_5'Flank|MBOAT7_ENST00000245615.1_5'Flank|CTD-3093M3.1_ENST00000594382.1_lincRNA			Q9BSV6	SEN34_HUMAN	TSEN34 tRNA splicing endonuclease subunit	156					mRNA processing (GO:0006397)|tRNA-type intron splice site recognition and cleavage (GO:0000379)	tRNA-intron endonuclease complex (GO:0000214)	lyase activity (GO:0016829)|nucleic acid binding (GO:0003676)|tRNA-intron endonuclease activity (GO:0000213)			endometrium(1)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	10	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GGCCAGGCTTCGGGAGAGCAG	0.577																																					Esophageal Squamous(37;841 964 4869 42824)	dbGAP											0													48.0	54.0	52.0					19																	54695795		2074	4197	6271	-	-	-	SO:0001583	missense	0			AF211970	CCDS42609.1, CCDS74446.1	19q13.4	2013-08-06	2013-08-06	2005-03-12	ENSG00000170892	ENSG00000170892		"""tRNA splicing endonuclease subunits"""	15506	protein-coding gene	gene with protein product		608754	"""leukocyte receptor cluster (LRC) member 5"", ""tRNA splicing endonuclease 34 homolog (SEN34, S. cerevisiae)"", ""tRNA splicing endonuclease 34 homolog (S. cerevisiae)"""	LENG5		10941842, 15109492	Standard	NM_024075		Approved	SEN34, SEN34L	uc002qdw.3	Q9BSV6	OTTHUMG00000066515	ENST00000396383.1:c.467C>T	19.37:g.54695795C>T	ENSP00000379667:p.Ser156Leu		A6NNB1|B0V3J1|Q9BVT1|Q9H6H5	Missense_Mutation	SNP	pfam_tRNA_intron_Endonuc_cat-like,superfamily_tRNA_intron_Endonuc_cat-like,pirsf_tRNA_splic_SEN34,tigrfam_tRNA_splic	p.S156L	ENST00000396383.1	37	c.467	CCDS42609.1	19	.	.	.	.	.	.	.	.	.	.	C	7.862	0.726200	0.15439	.	.	ENSG00000170892	ENST00000455798;ENST00000456872;ENST00000302937;ENST00000429671;ENST00000396383;ENST00000396388	T;T;T;T;T;T	0.66995	-0.19;-0.24;-0.19;-0.22;-0.19;-0.19	3.14	3.14	0.36123	.	1.749220	0.02459	N	0.086410	T	0.52386	0.1731	L	0.34521	1.04	0.09310	N	1	P;B	0.37997	0.614;0.217	B;B	0.22152	0.038;0.016	T	0.47459	-0.9116	10	0.25106	T	0.35	.	10.0197	0.42035	0.0:1.0:0.0:0.0	.	156;156	E7EQB3;Q9BSV6	.;SEN34_HUMAN	L	156;159;156;156;156;156	ENSP00000400743:S156L;ENSP00000408689:S159L;ENSP00000305524:S156L;ENSP00000397402:S156L;ENSP00000379667:S156L;ENSP00000379671:S156L	ENSP00000305524:S156L	S	+	2	0	TSEN34	59387607	0.001000	0.12720	0.013000	0.15412	0.799000	0.45148	0.366000	0.20365	2.081000	0.62600	0.561000	0.74099	TCG	TSEN34	-	pirsf_tRNA_splic_SEN34	ENSG00000170892		0.577	TSEN34-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TSEN34	HGNC	protein_coding	OTTHUMT00000142200.1	49	0.00	0	C	NM_024075		54695795	54695795	+1	no_errors	ENST00000429671	ensembl	human	known	69_37n	missense	67	25.81	24	SNP	0.002	T
TSTA3	7264	genome.wustl.edu	37	8	144696346	144696346	+	Silent	SNP	G	G	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr8:144696346G>A	ENST00000425753.2	-	7	754	c.651C>T	c.(649-651)ttC>ttT	p.F217F	TSTA3_ENST00000529064.1_Silent_p.F217F	NM_003313.3	NP_003304.1	Q13630	FCL_HUMAN	tissue specific transplantation antigen P35B	217					'de novo' GDP-L-fucose biosynthetic process (GO:0042351)|cytolysis (GO:0019835)|GDP-mannose metabolic process (GO:0019673)|leukocyte cell-cell adhesion (GO:0007159)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	coenzyme binding (GO:0050662)|electron carrier activity (GO:0009055)|GDP-4-dehydro-D-rhamnose reductase activity (GO:0042356)|GDP-L-fucose synthase activity (GO:0050577)|isomerase activity (GO:0016853)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|skin(1)	9	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.17e-38)|Epithelial(56;7.17e-37)|all cancers(56;2.46e-32)|Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			GCGAGTATATGAACTGCCTCC	0.642																																						dbGAP											0													62.0	59.0	60.0					8																	144696346		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U58766	CCDS6408.1	8q24.3	2012-02-22			ENSG00000104522	ENSG00000104522	1.1.1.271	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	12390	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 4E, member 1"", ""GDP-L-fucose synthase"""	137020				7803801, 1348494, 19027726	Standard	NM_003313		Approved	FX, P35B, SDR4E1	uc003yzb.2	Q13630	OTTHUMG00000165159	ENST00000425753.2:c.651C>T	8.37:g.144696346G>A			B2R8Y7|D3DWK5|Q567Q9|Q9UDG7	Silent	SNP	pfam_Epimerase_deHydtase,pfam_dTDP_dehydrorham_reduct	p.F217	ENST00000425753.2	37	c.651	CCDS6408.1	8																																																																																			TSTA3	-	pfam_Epimerase_deHydtase	ENSG00000104522		0.642	TSTA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSTA3	HGNC	protein_coding	OTTHUMT00000382263.1	72	0.00	0	G	NM_003313		144696346	144696346	-1	no_errors	ENST00000425753	ensembl	human	known	69_37n	silent	24	25.00	8	SNP	1.000	A
TTC28	23331	genome.wustl.edu	37	22	28503882	28503882	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr22:28503882G>C	ENST00000397906.2	-	7	2092	c.1951C>G	c.(1951-1953)Cag>Gag	p.Q651E		NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28	651					mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						ACTGCCTCCTGATAGTTTCCA	0.507																																						dbGAP											0													80.0	68.0	71.0					22																	28503882		692	1591	2283	-	-	-	SO:0001583	missense	0			AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.1951C>G	22.37:g.28503882G>C	ENSP00000381003:p.Gln651Glu		K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	Missense_Mutation	SNP	pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.Q651E	ENST00000397906.2	37	c.1951	CCDS46678.1	22	.	.	.	.	.	.	.	.	.	.	G	4.091	0.014882	0.07959	.	.	ENSG00000100154	ENST00000397906	D	0.86297	-2.1	6.02	3.71	0.42584	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.294399	0.32970	N	0.005427	T	0.76364	0.3977	N	0.16903	0.455	0.36901	D	0.890425	B	0.02656	0.0	B	0.06405	0.002	T	0.71705	-0.4512	10	0.08179	T	0.78	-20.1576	17.168	0.86821	0.0:0.2985:0.7015:0.0	.	651	Q96AY4	TTC28_HUMAN	E	651	ENSP00000381003:Q651E	ENSP00000381003:Q651E	Q	-	1	0	TTC28	26833882	1.000000	0.71417	0.990000	0.47175	0.978000	0.69477	5.740000	0.68629	1.495000	0.48549	0.591000	0.81541	CAG	TTC28	-	pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000100154		0.507	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	TTC28	HGNC	protein_coding	OTTHUMT00000320930.2	89	0.00	0	G	XM_929318		28503882	28503882	-1	no_errors	ENST00000397906	ensembl	human	novel	69_37n	missense	52	23.53	16	SNP	0.997	C
UBR3	130507	genome.wustl.edu	37	2	170732316	170732316	+	Nonsense_Mutation	SNP	C	C	G			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr2:170732316C>G	ENST00000272793.5	+	3	751	c.701C>G	c.(700-702)tCa>tGa	p.S234*	UBR3_ENST00000418381.1_Nonsense_Mutation_p.S234*			Q6ZT12	UBR3_HUMAN	ubiquitin protein ligase E3 component n-recognin 3 (putative)	234					embryo development (GO:0009790)|in utero embryonic development (GO:0001701)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)|suckling behavior (GO:0001967)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(3)|stomach(1)	33						GATGGACCATCAGAAAAGGAC	0.308																																						dbGAP											0													89.0	75.0	79.0					2																	170732316		692	1591	2283	-	-	-	SO:0001587	stop_gained	0			AL834144	CCDS2238.2	2q31.1	2008-06-23	2008-06-23	2007-11-29	ENSG00000144357	ENSG00000144357		"""Ubiquitin protein ligase E3 component n-recognins"""	30467	protein-coding gene	gene with protein product		613831	"""zinc finger protein 650"""	ZNF650		17462990	Standard	NM_172070		Approved	KIAA2024, DKFZp434P117, FLJ37422	uc010zdi.2	Q6ZT12	OTTHUMG00000132229	ENST00000272793.5:c.701C>G	2.37:g.170732316C>G	ENSP00000272793:p.Ser234*		B4DZR7|Q2KHN5|Q6ZR55|Q6ZSC2|Q8IVE7|Q8ND96	Nonsense_Mutation	SNP	pfam_Znf_N-recognin,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.S234*	ENST00000272793.5	37	c.701		2	.	.	.	.	.	.	.	.	.	.	C	35	5.500192	0.96355	.	.	ENSG00000144357	ENST00000272793;ENST00000442603;ENST00000418381	.	.	.	5.01	3.53	0.40419	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	.	11.4295	0.50032	0.0:0.8772:0.0:0.1228	.	.	.	.	X	234	.	ENSP00000272793:S234X	S	+	2	0	UBR3	170440562	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	3.712000	0.54875	0.799000	0.34018	0.460000	0.39030	TCA	UBR3	-	NULL	ENSG00000144357		0.308	UBR3-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	UBR3	HGNC	protein_coding	OTTHUMT00000255290.2	82	0.00	0	C	NM_172070		170732316	170732316	+1	no_errors	ENST00000272793	ensembl	human	known	69_37n	nonsense	44	10.20	5	SNP	1.000	G
UNC13A	23025	genome.wustl.edu	37	19	17756583	17756583	+	Silent	SNP	G	G	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr19:17756583G>A	ENST00000519716.2	-	19	2255	c.2256C>T	c.(2254-2256)cgC>cgT	p.R752R	UNC13A_ENST00000551649.1_Silent_p.R752R|UNC13A_ENST00000252773.7_Silent_p.R752R|UNC13A_ENST00000552293.1_Silent_p.R752R|UNC13A_ENST00000428389.2_Silent_p.R840R|UNC13A_ENST00000550896.1_Silent_p.R750R	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	752	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						TCTGTTTCACGCGGGATTTGA	0.587																																						dbGAP											0													75.0	78.0	77.0					19																	17756583		2127	4251	6378	-	-	-	SO:0001819	synonymous_variant	0			AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.2256C>T	19.37:g.17756583G>A			E5RHY9	Silent	SNP	pfam_Munc13_subgr_dom-2,pfam_C2_Ca-dep,pfam_Ca-dep_secretion_activator,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.R840	ENST00000519716.2	37	c.2520	CCDS46013.2	19																																																																																			UNC13A	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	ENSG00000130477		0.587	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC13A	HGNC	protein_coding	OTTHUMT00000376169.2	202	0.00	0	G	XM_038604		17756583	17756583	-1	no_errors	ENST00000428389	ensembl	human	known	69_37n	silent	49	37.50	30	SNP	0.019	A
VIM	7431	genome.wustl.edu	37	10	17278368	17278368	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr10:17278368G>C	ENST00000224237.5	+	8	1494	c.1349G>C	c.(1348-1350)aGa>aCa	p.R450T	RP11-124N14.3_ENST00000456355.1_RNA|VIM_ENST00000544301.1_Missense_Mutation_p.R450T			P08670	VIME_HUMAN	vimentin	450	Tail.				apoptotic process (GO:0006915)|astrocyte development (GO:0014002)|Bergmann glial cell differentiation (GO:0060020)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular component movement (GO:0006928)|intermediate filament organization (GO:0045109)|lens fiber cell development (GO:0070307)|muscle filament sliding (GO:0030049)|negative regulation of neuron projection development (GO:0010977)|positive regulation of gene expression (GO:0010628)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|neuron projection (GO:0043005)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	double-stranded RNA binding (GO:0003725)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of eye lens (GO:0005212)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(18)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GTTGAAACTAGAGATGGACAG	0.363																																						dbGAP											0													131.0	143.0	139.0					10																	17278368		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14144	CCDS7120.1	10p13	2013-01-16			ENSG00000026025	ENSG00000026025		"""Intermediate filaments type III"""	12692	protein-coding gene	gene with protein product		193060					Standard	NM_003380		Approved		uc001iou.2	P08670	OTTHUMG00000017744	ENST00000224237.5:c.1349G>C	10.37:g.17278368G>C	ENSP00000224237:p.Arg450Thr		B0YJC2|D3DRU4|Q15867|Q15868|Q15869|Q548L2|Q6LER9|Q8N850|Q96ML2|Q9NTM3	Missense_Mutation	SNP	pfam_F,pfam_Intermed_filament_DNA-bd,superfamily_Prefoldin	p.R450T	ENST00000224237.5	37	c.1349	CCDS7120.1	10	.	.	.	.	.	.	.	.	.	.	G	29.4	5.003014	0.93287	.	.	ENSG00000026025	ENST00000544301;ENST00000224237	D;D	0.99704	-6.46;-6.46	6.03	6.03	0.97812	.	0.000000	0.51477	D	0.000100	D	0.99674	0.9878	M	0.84773	2.715	0.80722	D	1	D;P	0.57899	0.981;0.95	P;P	0.59115	0.852;0.703	D	0.98278	1.0507	10	0.87932	D	0	.	20.5666	0.99351	0.0:0.0:1.0:0.0	.	450;450	Q53HU8;P08670	.;VIME_HUMAN	T	450	ENSP00000446007:R450T;ENSP00000224237:R450T	ENSP00000224237:R450T	R	+	2	0	VIM	17318374	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	6.026000	0.70873	2.854000	0.98071	0.655000	0.94253	AGA	VIM	-	NULL	ENSG00000026025		0.363	VIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VIM	HGNC	protein_coding	OTTHUMT00000047015.1	129	0.00	0	G	NM_003380		17278368	17278368	+1	no_errors	ENST00000224237	ensembl	human	known	69_37n	missense	73	27.45	28	SNP	1.000	C
VRK2	7444	genome.wustl.edu	37	2	58350248	58350248	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr2:58350248G>C	ENST00000435505.2	+	11	1301	c.556G>C	c.(556-558)Gat>Cat	p.D186H	VRK2_ENST00000412104.2_Missense_Mutation_p.D186H|VRK2_ENST00000417641.2_Missense_Mutation_p.D186H|VRK2_ENST00000440705.2_Missense_Mutation_p.D163H|VRK2_ENST00000340157.4_Missense_Mutation_p.D186H			Q86Y07	VRK2_HUMAN	vaccinia related kinase 2	186	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to oxidative stress (GO:0034599)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interleukin-1-mediated signaling pathway (GO:2000659)|regulation of MAPK cascade (GO:0043408)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)	24						TTATCTTGCAGATTATGGACT	0.363																																						dbGAP											0													126.0	121.0	123.0					2																	58350248		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK058199	CCDS1859.1, CCDS46291.1, CCDS46292.1	2p16.1	2008-05-15			ENSG00000028116	ENSG00000028116			12719	protein-coding gene	gene with protein product		602169					Standard	NM_001130480		Approved		uc002rzv.3	Q86Y07	OTTHUMG00000129348	ENST00000435505.2:c.556G>C	2.37:g.58350248G>C	ENSP00000408002:p.Asp186His		B4DKL0|D6W5D4|D6W5D6|Q49AK9|Q53EU9|Q53S39|Q53S77|Q53TU1|Q86Y08|Q86Y09|Q86Y10|Q86Y11|Q86Y12|Q8IXI5|Q99987	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	p.D186H	ENST00000435505.2	37	c.556	CCDS1859.1	2	.	.	.	.	.	.	.	.	.	.	G	26.3	4.727712	0.89390	.	.	ENSG00000028116	ENST00000435505;ENST00000417641;ENST00000423109;ENST00000412104;ENST00000340157;ENST00000394539;ENST00000440705	D;D;D;D;D	0.93076	-3.16;-3.16;-3.16;-3.16;-3.16	5.83	5.83	0.93111	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.98601	0.9532	H	0.99697	4.71	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;1.0	D	0.99232	1.0882	10	0.87932	D	0	-26.1948	20.1197	0.97955	0.0:0.0:1.0:0.0	.	190;186;186;186	B7Z2X1;Q86Y07-2;Q86Y07-5;Q86Y07	.;.;.;VRK2_HUMAN	H	186;186;190;186;186;186;163	ENSP00000408002:D186H;ENSP00000402375:D186H;ENSP00000404156:D186H;ENSP00000342381:D186H;ENSP00000398323:D163H	ENSP00000342381:D186H	D	+	1	0	VRK2	58203752	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.747000	0.94245	0.585000	0.79938	GAT	VRK2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	ENSG00000028116		0.363	VRK2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VRK2	HGNC	protein_coding	OTTHUMT00000325304.2	157	0.00	0	G	NM_006296		58350248	58350248	+1	no_errors	ENST00000340157	ensembl	human	known	69_37n	missense	89	24.58	29	SNP	1.000	C
WSCD2	9671	genome.wustl.edu	37	12	108620839	108620839	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr12:108620839G>A	ENST00000332082.4	+	7	1695	c.877G>A	c.(877-879)Gac>Aac	p.D293N	WSCD2_ENST00000261400.3_Missense_Mutation_p.D293N|WSCD2_ENST00000549903.1_Missense_Mutation_p.D293N|WSCD2_ENST00000547525.1_Missense_Mutation_p.D293N			Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	293	WSC 2. {ECO:0000255|PROSITE- ProRule:PRU00558}.					integral component of membrane (GO:0016021)				breast(4)|endometrium(3)|kidney(1)|large_intestine(16)|liver(2)|lung(23)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	57						CCCGCTCCATGACAGAGAGGA	0.587																																						dbGAP											0													68.0	70.0	69.0					12																	108620839		1973	4147	6120	-	-	-	SO:0001583	missense	0				CCDS41828.1	12q23.3	2008-02-05				ENSG00000075035			29117	protein-coding gene	gene with protein product							Standard	NM_014653		Approved	KIAA0789	uc001tms.3	Q2TBF2		ENST00000332082.4:c.877G>A	12.37:g.108620839G>A	ENSP00000331933:p.Asp293Asn		B2RN48|B4DES1|Q8IY35|Q9Y4B7	Missense_Mutation	SNP	pfam_WSC_carb-bd,smart_WSC_carb-bd_subgr,pfscan_WSC_carb-bd	p.D293N	ENST00000332082.4	37	c.877	CCDS41828.1	12	.	.	.	.	.	.	.	.	.	.	G	20.4	3.978256	0.74360	.	.	ENSG00000075035	ENST00000547525;ENST00000261400;ENST00000332082;ENST00000549903	T;T;T;T	0.55234	0.53;0.53;0.53;0.53	5.4	5.4	0.78164	Carbohydrate-binding WSC (2);Carbohydrate-binding WSC, subgroup (1);	0.253184	0.45361	D	0.000377	T	0.49372	0.1553	L	0.42245	1.32	0.42012	D	0.990943	B;B	0.24186	0.096;0.099	B;B	0.30179	0.049;0.112	T	0.37820	-0.9689	10	0.25106	T	0.35	-21.4904	18.3441	0.90315	0.0:0.0:1.0:0.0	.	293;293	Q2TBF2-2;Q2TBF2	.;WSCD2_HUMAN	N	293	ENSP00000448047:D293N;ENSP00000261400:D293N;ENSP00000331933:D293N;ENSP00000447272:D293N	ENSP00000261400:D293N	D	+	1	0	WSCD2	107144969	1.000000	0.71417	0.998000	0.56505	0.972000	0.66771	7.244000	0.78228	2.805000	0.96524	0.655000	0.94253	GAC	WSCD2	-	pfam_WSC_carb-bd,smart_WSC_carb-bd_subgr,pfscan_WSC_carb-bd	ENSG00000075035		0.587	WSCD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	WSCD2	HGNC	protein_coding	OTTHUMT00000405554.1	90	0.00	0	G	NM_014653		108620839	108620839	+1	no_errors	ENST00000261400	ensembl	human	known	69_37n	missense	27	22.86	8	SNP	1.000	A
XPO7	23039	genome.wustl.edu	37	8	21861537	21861537	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr8:21861537G>C	ENST00000252512.9	+	27	3266	c.3166G>C	c.(3166-3168)Gac>Cac	p.D1056H	XPO7_ENST00000434536.1_Missense_Mutation_p.D1065H|XPO7_ENST00000433566.4_Missense_Mutation_p.D1057H	NM_015024.4	NP_055839.3	Q9UIA9	XPO7_HUMAN	exportin 7	1056					mRNA transport (GO:0051028)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	nuclear export signal receptor activity (GO:0005049)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				Colorectal(74;0.0187)|COAD - Colon adenocarcinoma(73;0.0724)		GAAAAACAGAGACAGGTGAGT	0.438																																						dbGAP											0													69.0	66.0	66.0					8																	21861537		1912	4137	6049	-	-	-	SO:0001583	missense	0			AF064729	CCDS47818.1	8p21	2011-04-13	2003-03-11	2003-03-14	ENSG00000130227	ENSG00000130227		"""Exportins"""	14108	protein-coding gene	gene with protein product		606140	"""RAN binding protein 16"""	RANBP16		11024021, 9872452	Standard	NM_015024		Approved	KIAA0745	uc003xaa.4	Q9UIA9	OTTHUMG00000163789	ENST00000252512.9:c.3166G>C	8.37:g.21861537G>C	ENSP00000252512:p.Asp1056His		O94846|Q6PJK9|Q8NEK7	Missense_Mutation	SNP	pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.D1065H	ENST00000252512.9	37	c.3193	CCDS47818.1	8	.	.	.	.	.	.	.	.	.	.	G	27.4	4.831176	0.91036	.	.	ENSG00000130227	ENST00000434536;ENST00000252512;ENST00000433566	T;T;T	0.29397	1.57;1.57;1.57	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.63768	0.2539	M	0.88105	2.93	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.76575	0.988;0.98;0.966	T	0.70684	-0.4804	10	0.66056	D	0.02	-18.4118	18.7228	0.91702	0.0:0.0:1.0:0.0	.	1057;1065;1056	E7ESC6;E9PEN8;Q9UIA9	.;.;XPO7_HUMAN	H	1065;1056;1057	ENSP00000404853:D1065H;ENSP00000252512:D1056H;ENSP00000410249:D1057H	ENSP00000252512:D1056H	D	+	1	0	XPO7	21917483	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.431000	0.97494	2.601000	0.87937	0.650000	0.86243	GAC	XPO7	-	NULL	ENSG00000130227		0.438	XPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO7	HGNC	protein_coding	OTTHUMT00000375494.1	110	0.00	0	G	NM_015024		21861537	21861537	+1	no_errors	ENST00000434536	ensembl	human	known	69_37n	missense	92	24.59	30	SNP	1.000	C
YLPM1	56252	genome.wustl.edu	37	14	75265199	75265199	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr14:75265199G>A	ENST00000325680.7	+	5	3323	c.3199G>A	c.(3199-3201)Gat>Aat	p.D1067N	YLPM1_ENST00000552421.1_Intron|YLPM1_ENST00000238571.3_Missense_Mutation_p.D872N	NM_019589.2	NP_062535.2	P49750	YLPM1_HUMAN	YLP motif containing 1	872	Arg-rich.				regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		TAGAAGAGAAGATAGTCGAGA	0.527																																						dbGAP											0													102.0	110.0	107.0					14																	75265199		1974	4160	6134	-	-	-	SO:0001583	missense	0			AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000325680.7:c.3199G>A	14.37:g.75265199G>A	ENSP00000324463:p.Asp1067Asn		P49752|Q96I64|Q9P1V7	Missense_Mutation	SNP	superfamily_FH2_actin-bd	p.D1067N	ENST00000325680.7	37	c.3199	CCDS45135.1	14	.	.	.	.	.	.	.	.	.	.	G	15.84	2.952978	0.53293	.	.	ENSG00000119596	ENST00000325680;ENST00000238571;ENST00000423680	.	.	.	5.69	5.69	0.88448	.	0.192676	0.38837	N	0.001547	T	0.34279	0.0892	L	0.50333	1.59	0.27265	N	0.958534	B	0.33238	0.403	B	0.27715	0.082	T	0.25537	-1.0129	9	0.24483	T	0.36	-9.4891	12.3234	0.54997	0.0777:0.0:0.9223:0.0	.	1067	P49750-4	.	N	1067;872;780	.	ENSP00000238571:D872N	D	+	1	0	YLPM1	74334952	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	4.808000	0.62583	2.690000	0.91761	0.643000	0.83706	GAT	YLPM1	-	NULL	ENSG00000119596		0.527	YLPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YLPM1	HGNC	protein_coding	OTTHUMT00000404451.1	133	0.00	0	G	NM_019589		75265199	75265199	+1	no_errors	ENST00000325680	ensembl	human	known	69_37n	missense	96	29.93	41	SNP	1.000	A
ZBTB16	7704	genome.wustl.edu	37	11	113934294	113934294	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr11:113934294C>T	ENST00000335953.4	+	2	652	c.272C>T	c.(271-273)aCg>aTg	p.T91M	ZBTB16_ENST00000392996.2_Missense_Mutation_p.T91M	NM_006006.4	NP_005997.2	Q05516	ZBT16_HUMAN	zinc finger and BTB domain containing 16	91	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|cartilage development (GO:0051216)|central nervous system development (GO:0007417)|embryonic digit morphogenesis (GO:0042733)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic pattern specification (GO:0009880)|forelimb morphogenesis (GO:0035136)|hemopoiesis (GO:0030097)|male germ-line stem cell asymmetric division (GO:0048133)|mesonephros development (GO:0001823)|myeloid cell differentiation (GO:0030099)|negative regulation of cell proliferation (GO:0008285)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of ossification (GO:0045778)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nuclear body (GO:0016604)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(2)	6		all_cancers(61;3.79e-18)|all_epithelial(67;2.32e-10)|all_hematologic(158;2.96e-05)|Melanoma(852;0.000362)|Acute lymphoblastic leukemia(157;0.00108)|Breast(348;0.0104)|all_neural(223;0.0294)|Prostate(24;0.0318)|Medulloblastoma(222;0.0438)		BRCA - Breast invasive adenocarcinoma(274;6.75e-06)|Epithelial(105;0.000181)|all cancers(92;0.0018)		TATACAGCCACGCTGCAAGCC	0.527																																						dbGAP											0													73.0	63.0	66.0					11																	113934294		2201	4296	6497	-	-	-	SO:0001583	missense	0			Z19002	CCDS8367.1	11q23	2013-10-17	2004-07-16	2004-07-16	ENSG00000109906	ENSG00000109906		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12930	protein-coding gene	gene with protein product	"""promyelocytic leukaemia zinc finger"""	176797	"""zinc finger protein 145 (Kruppel-like, expressed in promyelocytic leukemia)"""	ZNF145			Standard	XM_006718899		Approved	PLZF	uc001poq.3	Q05516	OTTHUMG00000168243	ENST00000335953.4:c.272C>T	11.37:g.113934294C>T	ENSP00000338157:p.Thr91Met		Q8TAL4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.T91M	ENST00000335953.4	37	c.272	CCDS8367.1	11	.	.	.	.	.	.	.	.	.	.	C	21.3	4.133322	0.77662	.	.	ENSG00000109906	ENST00000335953;ENST00000544220;ENST00000535700;ENST00000392996;ENST00000310883	T;T;T;T	0.69435	-0.4;-0.4;-0.4;-0.4	5.53	5.53	0.82687	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.047683	0.85682	D	0.000000	T	0.80555	0.4645	L	0.59912	1.85	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.948;0.991	T	0.81059	-0.1104	10	0.72032	D	0.01	-12.9052	19.827	0.96621	0.0:1.0:0.0:0.0	.	91;96	Q05516;Q59H43	ZBT16_HUMAN;.	M	91	ENSP00000338157:T91M;ENSP00000437716:T91M;ENSP00000443013:T91M;ENSP00000376721:T91M	ENSP00000309507:T91M	T	+	2	0	ZBTB16	113439504	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.755000	0.85180	2.759000	0.94783	0.561000	0.74099	ACG	ZBTB16	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	ENSG00000109906		0.527	ZBTB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB16	HGNC	protein_coding	OTTHUMT00000398940.1	62	0.00	0	C	NM_006006		113934294	113934294	+1	no_errors	ENST00000335953	ensembl	human	known	69_37n	missense	18	30.77	8	SNP	1.000	T
ZDHHC2	51201	genome.wustl.edu	37	8	17067946	17067946	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr8:17067946G>A	ENST00000262096.8	+	10	1602	c.907G>A	c.(907-909)Gaa>Aaa	p.E303K		NM_016353.4	NP_057437.1	Q9UIJ5	ZDHC2_HUMAN	zinc finger, DHHC-type containing 2	303					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|recycling endosome membrane (GO:0055038)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(3)|lung(1)|pancreas(1)|stomach(1)	8				Colorectal(111;0.0697)|COAD - Colon adenocarcinoma(73;0.244)		CCAGGATCCTGAACAAGCATC	0.343																																						dbGAP											0													76.0	71.0	73.0					8																	17067946		1838	4094	5932	-	-	-	SO:0001583	missense	0			AB023584	CCDS47810.1	8p22	2008-05-15			ENSG00000104219	ENSG00000104219		"""Zinc fingers, DHHC-type"""	18469	protein-coding gene	gene with protein product						10918388	Standard	NM_016353		Approved	ZNF372	uc003wxe.3	Q9UIJ5	OTTHUMG00000163860	ENST00000262096.8:c.907G>A	8.37:g.17067946G>A	ENSP00000262096:p.Glu303Lys		D3DSP5	Missense_Mutation	SNP	pfam_Znf_DHHC_palmitoyltrfase,superfamily_Plexin-like_fold,pfscan_Znf_DHHC_palmitoyltrfase	p.E303K	ENST00000262096.8	37	c.907	CCDS47810.1	8	.	.	.	.	.	.	.	.	.	.	G	35	5.539491	0.96474	.	.	ENSG00000104219	ENST00000262096	T	0.46819	0.86	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.71771	0.3379	M	0.80982	2.52	0.80722	D	1	D	0.69078	0.997	D	0.73380	0.98	T	0.72469	-0.4284	10	0.51188	T	0.08	-3.684	19.8416	0.96692	0.0:0.0:1.0:0.0	.	303	Q9UIJ5	ZDHC2_HUMAN	K	303	ENSP00000262096:E303K	ENSP00000262096:E303K	E	+	1	0	ZDHHC2	17112317	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	7.442000	0.80503	2.774000	0.95407	0.585000	0.79938	GAA	ZDHHC2	-	NULL	ENSG00000104219		0.343	ZDHHC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC2	HGNC	protein_coding	OTTHUMT00000376014.2	107	0.00	0	G	NM_016353		17067946	17067946	+1	no_errors	ENST00000262096	ensembl	human	known	69_37n	missense	116	20.55	30	SNP	1.000	A
ZFHX3	463	genome.wustl.edu	37	16	72827828	72827828	+	Nonsense_Mutation	SNP	G	G	C			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr16:72827828G>C	ENST00000268489.5	-	9	9425	c.8753C>G	c.(8752-8754)tCa>tGa	p.S2918*	ZFHX3_ENST00000397992.5_Nonsense_Mutation_p.S2004*|RP5-991G20.4_ENST00000569195.1_RNA	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	2918					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				TGCAAGGCTTGAGGTTTCACT	0.537																																						dbGAP											0													48.0	49.0	48.0					16																	72827828		2198	4300	6498	-	-	-	SO:0001587	stop_gained	0			D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.8753C>G	16.37:g.72827828G>C	ENSP00000268489:p.Ser2918*		D3DWS8|O15101|Q13719	Nonsense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.S2918*	ENST00000268489.5	37	c.8753	CCDS10908.1	16	.	.	.	.	.	.	.	.	.	.	G	52	19.751321	0.99923	.	.	ENSG00000140836	ENST00000268489;ENST00000397992	.	.	.	6.17	6.17	0.99709	.	0.000000	0.45126	D	0.000397	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	.	.	.	X	2918;2004	.	ENSP00000268489:S2918X	S	-	2	0	ZFHX3	71385329	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.941000	0.99782	0.655000	0.94253	TCA	ZFHX3	-	NULL	ENSG00000140836		0.537	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFHX3	HGNC	protein_coding	OTTHUMT00000269008.1	87	0.00	0	G	NM_006885		72827828	72827828	-1	no_errors	ENST00000268489	ensembl	human	known	69_37n	nonsense	38	33.33	19	SNP	1.000	C
ZFHX3	463	genome.wustl.edu	37	16	72832052	72832052	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr16:72832052G>A	ENST00000268489.5	-	9	5201	c.4529C>T	c.(4528-4530)tCt>tTt	p.S1510F	ZFHX3_ENST00000397992.5_Missense_Mutation_p.S596F	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	1510					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				TACTGACCCAGAGTCACTGCC	0.498																																						dbGAP											0													91.0	97.0	95.0					16																	72832052		2198	4300	6498	-	-	-	SO:0001583	missense	0			D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.4529C>T	16.37:g.72832052G>A	ENSP00000268489:p.Ser1510Phe		D3DWS8|O15101|Q13719	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.S1510F	ENST00000268489.5	37	c.4529	CCDS10908.1	16	.	.	.	.	.	.	.	.	.	.	G	14.69	2.611935	0.46631	.	.	ENSG00000140836	ENST00000268489;ENST00000397992	T;T	0.76060	-0.99;-0.99	5.78	5.78	0.91487	.	0.000000	0.48286	D	0.000198	T	0.80633	0.4660	M	0.64404	1.975	0.58432	D	0.999999	P	0.37061	0.58	P	0.45856	0.495	T	0.80719	-0.1257	10	0.87932	D	0	.	20.3668	0.98882	0.0:0.0:1.0:0.0	.	1510	Q15911	ZFHX3_HUMAN	F	1510;596	ENSP00000268489:S1510F;ENSP00000438926:S596F	ENSP00000268489:S1510F	S	-	2	0	ZFHX3	71389553	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.602000	0.67612	2.894000	0.99253	0.655000	0.94253	TCT	ZFHX3	-	NULL	ENSG00000140836		0.498	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFHX3	HGNC	protein_coding	OTTHUMT00000269008.1	49	0.00	0	G	NM_006885		72832052	72832052	-1	no_errors	ENST00000268489	ensembl	human	known	69_37n	missense	49	16.95	10	SNP	1.000	A
ZNF560	147741	genome.wustl.edu	37	19	9584909	9584909	+	Silent	SNP	C	C	G			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr19:9584909C>G	ENST00000301480.4	-	4	336	c.123G>C	c.(121-123)gtG>gtC	p.V41V		NM_152476.2	NP_689689.2	Q96MR9	ZN560_HUMAN	zinc finger protein 560	41	KRAB 1. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(16)|liver(2)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	65						TCTCCAGCATCACATCTCTGT	0.443																																						dbGAP											0													155.0	146.0	149.0					19																	9584909		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK056548	CCDS12214.1	19p13.2	2013-09-20			ENSG00000198028	ENSG00000198028		"""Zinc fingers, C2H2-type"", ""-"""	26484	protein-coding gene	gene with protein product							Standard	NM_152476		Approved	FLJ31986	uc002mlp.1	Q96MR9	OTTHUMG00000180130	ENST00000301480.4:c.123G>C	19.37:g.9584909C>G			Q495S9|Q495T1	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V41	ENST00000301480.4	37	c.123	CCDS12214.1	19																																																																																			ZNF560	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000198028		0.443	ZNF560-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF560	HGNC	protein_coding	OTTHUMT00000449901.1	302	0.00	0	C	NM_152476		9584909	9584909	-1	no_errors	ENST00000301480	ensembl	human	known	69_37n	silent	104	13.93	17	SNP	0.411	G
ZNF609	23060	genome.wustl.edu	37	15	64966802	64966802	+	Silent	SNP	C	C	T			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr15:64966802C>T	ENST00000326648.3	+	4	1877	c.1749C>T	c.(1747-1749)ttC>ttT	p.F583F	ZNF609_ENST00000559364.1_3'UTR	NM_015042.1	NP_055857.1	O15014	ZN609_HUMAN	zinc finger protein 609	583						nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CAAGCAAATTCAGCACAAAAG	0.517																																						dbGAP											0													68.0	69.0	69.0					15																	64966802		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			BC014251	CCDS32270.1	15q22.1	2008-05-02				ENSG00000180357		"""Zinc fingers, C2H2-type"""	29003	protein-coding gene	gene with protein product						9205841	Standard	NM_015042		Approved	KIAA0295	uc002ann.3	O15014		ENST00000326648.3:c.1749C>T	15.37:g.64966802C>T			Q0D2I2	Silent	SNP	pfscan_Znf_C2H2	p.F583	ENST00000326648.3	37	c.1749	CCDS32270.1	15																																																																																			ZNF609	-	NULL	ENSG00000180357		0.517	ZNF609-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF609	HGNC	protein_coding	OTTHUMT00000418130.1	64	0.00	0	C	XM_042833		64966802	64966802	+1	no_errors	ENST00000326648	ensembl	human	known	69_37n	silent	38	29.09	16	SNP	1.000	T
ZNF841	284371	genome.wustl.edu	37	19	52580298	52580298	+	Intron	SNP	G	G	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr19:52580298G>A	ENST00000426391.2	-	4	475				ZNF432_ENST00000598446.1_Intron|ZNF841_ENST00000389534.4_Nonsense_Mutation_p.Q19*|ZNF841_ENST00000594295.1_Nonsense_Mutation_p.Q19*			Q6ZN19	ZN841_HUMAN	zinc finger protein 841						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(3)|lung(3)	11						CACTCCTCCTGAGAGAATTCT	0.443																																						dbGAP											0													50.0	45.0	46.0					19																	52580298		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AK131409	CCDS46161.1	19q13.41	2013-01-08			ENSG00000197608	ENSG00000197608		"""Zinc fingers, C2H2-type"", ""-"""	27611	protein-coding gene	gene with protein product							Standard	NM_001136499		Approved	LOC284371	uc010ydh.1	Q6ZN19		ENST00000426391.2:c.76+7741C>T	19.37:g.52580298G>A			B9EG58|Q6ZN82|Q6ZP71|Q8N9U7	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q19*	ENST00000426391.2	37	c.55		19	.	.	.	.	.	.	.	.	.	.	G	28.8	4.951637	0.92660	.	.	ENSG00000197608	ENST00000389534	.	.	.	2.66	1.59	0.23543	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	.	4.088	0.09957	0.1468:0.2442:0.609:0.0	.	.	.	.	X	19	.	ENSP00000374185:Q19X	Q	-	1	0	ZNF841	57272110	0.000000	0.05858	0.897000	0.35233	0.232000	0.25224	-0.695000	0.05109	0.450000	0.26774	0.449000	0.29647	CAG	ZNF841	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000197608		0.443	ZNF841-001	PUTATIVE	basic	protein_coding	ZNF841	HGNC	protein_coding	OTTHUMT00000462435.1	233	0.00	0	G	XM_209155		52580298	52580298	-1	no_errors	ENST00000389534	ensembl	human	known	69_37n	nonsense	326	11.14	41	SNP	0.961	A
ZRSR1	7310	genome.wustl.edu	37	5	112228531	112228531	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12T-01A-11D-A10Y-09	TCGA-C8-A12T-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	961fae8a-d944-4866-b198-ea6f1e59a979	7ccbb62c-9382-43ef-ba5f-3f81d0074e07	g.chr5:112228531G>A	ENST00000391338.1	+	1	1219	c.1195G>A	c.(1195-1197)Gaa>Aaa	p.E399K	REEP5_ENST00000504247.1_Intron|CTC-487M23.5_ENST00000602872.1_RNA|CTC-487M23.8_ENST00000512790.1_3'UTR|REEP5_ENST00000474542.2_Intron|REEP5_ENST00000379638.4_Intron|REEP5_ENST00000513339.1_Intron|REEP5_ENST00000545426.1_Intron|CTC-487M23.8_ENST00000506997.1_3'UTR	NM_001204199.1	NP_001191128.1	Q15695	U2AFL_HUMAN	zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 1	399						nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|skin(1)|stomach(2)	4						AAGAAATGGGGAATCCGAGAG	0.507																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			D49676		5q22.2	2013-02-12	2006-09-26	2006-09-26	ENSG00000212643	ENSG00000212643		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	12456	protein-coding gene	gene with protein product	"""U2(RNU2) small nuclear RNA auxiliary factor pseudogene 1"""	601079	"""U2(RNU2) small nuclear RNA auxiliary factor binding protein-like"", ""U2(RNU2) small nuclear RNA auxillary factor 1-like 1"", ""U2 small nuclear RNA auxillary factor 1-like 1"""	U2AFBPL, U2AF1P, U2AF1L1		7956352	Standard	NG_005419		Approved	U2AF1-RS1, U2AF1RS1	uc021ycm.1	Q15695	OTTHUMG00000163143	ENST00000391338.1:c.1195G>A	5.37:g.112228531G>A	ENSP00000375133:p.Glu399Lys		B2R901|Q13570|Q2M3R8	Missense_Mutation	SNP	pfam_Znf_CCCH,pfam_RRM_dom,smart_Znf_CCCH,smart_RRM_dom_euk,pfscan_RRM_dom,prints_U2_small	p.E399K	ENST00000391338.1	37	c.1195		5	.	.	.	.	.	.	.	.	.	.	G	9.743	1.165297	0.21538	.	.	ENSG00000212643	ENST00000391338	T	0.02446	4.29	1.16	1.16	0.20824	.	0.280783	0.41294	D	0.000908	T	0.02230	0.0069	.	.	.	0.09310	N	1	B	0.22414	0.069	B	0.21360	0.034	T	0.45381	-0.9265	9	0.33940	T	0.23	.	8.1803	0.31307	0.0:0.0:1.0:0.0	.	399	Q15695	U2AFL_HUMAN	K	399	ENSP00000375133:E399K	ENSP00000375133:E399K	E	+	1	0	ZRSR1	112256430	1.000000	0.71417	0.005000	0.12908	0.030000	0.12068	3.887000	0.56197	0.916000	0.36871	0.467000	0.42956	GAA	ZRSR1	-	NULL	ENSG00000212643		0.507	ZRSR1-001	KNOWN	basic|appris_principal	protein_coding	ZRSR1	HGNC	protein_coding	OTTHUMT00000371801.1	72	0.00	0	G	NM_005083		112228531	112228531	+1	no_errors	ENST00000391338	ensembl	human	known	69_37n	missense	51	21.21	14	SNP	0.009	A
