#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AASDHPPT	60496	genome.wustl.edu	37	11	105948531	105948531	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr11:105948531G>A	ENST00000278618.4	+	1	316	c.94G>A	c.(94-96)Gaa>Aaa	p.E32K	KBTBD3_ENST00000531837.1_5'Flank|KBTBD3_ENST00000526793.1_5'Flank|KBTBD3_ENST00000534815.1_5'Flank	NM_015423.2	NP_056238.2	Q9NRN7	ADPPT_HUMAN	aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase	32					macromolecule biosynthetic process (GO:0009059)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	holo-[acyl-carrier-protein] synthase activity (GO:0008897)|magnesium ion binding (GO:0000287)			endometrium(3)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)	17		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.78e-05)|Epithelial(105;0.00622)|all cancers(92;0.041)		GAGCCGAGCCGAATGGCTGCT	0.607																																						dbGAP											0													75.0	77.0	76.0					11																	105948531		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF302110	CCDS31664.1	11q22	2010-12-09			ENSG00000149313	ENSG00000149313	1.2.1.31		14235	protein-coding gene	gene with protein product		607756				12815048, 11286508	Standard	NM_015423		Approved	LYS5, CGI-80, AASD-PPT	uc001pjc.1	Q9NRN7	OTTHUMG00000166253	ENST00000278618.4:c.94G>A	11.37:g.105948531G>A	ENSP00000278618:p.Glu32Lys		B2R6D1|B4DDW7|Q9C068|Q9P0Q3|Q9UG80|Q9Y389	Missense_Mutation	SNP	pfam_4-PPantetheinyl_Trfase,superfamily_4-PPantetheinyl_Trfase	p.E32K	ENST00000278618.4	37	c.94	CCDS31664.1	11	.	.	.	.	.	.	.	.	.	.	G	23.7	4.451686	0.84209	.	.	ENSG00000149313	ENST00000278618	.	.	.	5.5	3.52	0.40303	4&apos (1);-phosphopantetheinyl transferase (1);	0.233360	0.43579	D	0.000547	T	0.56746	0.2006	M	0.79475	2.455	0.46336	D	0.998991	D	0.65815	0.995	B	0.42462	0.388	T	0.62478	-0.6846	9	0.48119	T	0.1	.	10.4012	0.44231	0.0739:0.1349:0.7912:0.0	.	32	Q9NRN7	ADPPT_HUMAN	K	32	.	ENSP00000278618:E32K	E	+	1	0	AASDHPPT	105453741	1.000000	0.71417	0.978000	0.43139	0.418000	0.31294	7.382000	0.79729	1.332000	0.45431	-0.251000	0.11542	GAA	AASDHPPT	-	superfamily_4-PPantetheinyl_Trfase	ENSG00000149313		0.607	AASDHPPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AASDHPPT	HGNC	protein_coding	OTTHUMT00000388734.1	72	0.00	0	G	NM_015423		105948531	105948531	+1	no_errors	ENST00000278618	ensembl	human	known	69_37n	missense	111	25.00	37	SNP	1.000	A
ADM2	79924	genome.wustl.edu	37	22	50921701	50921701	+	3'UTR	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr22:50921701G>A	ENST00000395738.2	+	0	1108				ADM2_ENST00000362068.2_Missense_Mutation_p.R189K	NM_001253845.1|NM_024866.5	NP_001240774.1|NP_079142.2	Q7Z4H4	ADM2_HUMAN	adrenomedullin 2						adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|angiogenesis (GO:0001525)|digestion (GO:0007586)|feeding behavior (GO:0007631)|negative regulation of blood pressure (GO:0045776)|positive regulation of angiogenesis (GO:0045766)|positive regulation of gene expression (GO:0010628)|protein phosphorylation (GO:0006468)	extracellular region (GO:0005576)	protein complex binding (GO:0032403)			breast(1)|kidney(1)	2		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GAACTGGCCAGAAGTGGCCCC	0.632																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF529213	CCDS33682.1	22q13.33	2013-02-25			ENSG00000128165	ENSG00000128165		"""Endogenous ligands"""	28898	protein-coding gene	gene with protein product		608682				14706825	Standard	NM_024866		Approved	AM2, FLJ21135	uc003blj.3	Q7Z4H4	OTTHUMG00000150202	ENST00000395738.2:c.*369G>A	22.37:g.50921701G>A			Q3LFQ0	Missense_Mutation	SNP	NULL	p.R189K	ENST00000395738.2	37	c.566	CCDS33682.1	22	.	.	.	.	.	.	.	.	.	.	G	11.36	1.614804	0.28712	.	.	ENSG00000128165	ENST00000362068	.	.	.	3.6	-6.6	0.01824	.	.	.	.	.	T	0.25158	0.0611	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.40040	-0.9584	5	0.87932	D	0	.	1.3689	0.02207	0.2984:0.3267:0.246:0.1288	.	.	.	.	K	189	.	ENSP00000354955:R189K	R	+	2	0	ADM2	49268567	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.921000	0.04008	-1.259000	0.02468	0.462000	0.41574	AGA	ADM2	-	NULL	ENSG00000128165		0.632	ADM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADM2	HGNC	protein_coding	OTTHUMT00000316816.1	11	0.00	0	G	NM_024866		50921701	50921701	+1	no_errors	ENST00000362068	ensembl	human	known	69_37n	missense	30	31.82	14	SNP	0.000	A
ADPRHL1	113622	genome.wustl.edu	37	13	114079385	114079385	+	Missense_Mutation	SNP	A	A	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr13:114079385A>T	ENST00000375418.3	-	5	842	c.756T>A	c.(754-756)gaT>gaA	p.D252E	ADPRHL1_ENST00000356501.4_Missense_Mutation_p.D170E	NM_138430.3	NP_612439.2	Q8NDY3	ARHL1_HUMAN	ADP-ribosylhydrolase like 1	252					protein de-ADP-ribosylation (GO:0051725)		ADP-ribosylarginine hydrolase activity (GO:0003875)|magnesium ion binding (GO:0000287)			endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|skin(1)	11	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0395)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.0195)|GBM - Glioblastoma multiforme(44;0.116)			TCTCTTCTGCATCATAATTGT	0.448																																						dbGAP											0													237.0	216.0	223.0					13																	114079385		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ313429	CCDS9535.1, CCDS9536.1	13q34	2003-06-19			ENSG00000153531	ENSG00000153531			21303	protein-coding gene	gene with protein product		610620				12070318	Standard	NM_138430		Approved	ARH2	uc001vtq.1	Q8NDY3	OTTHUMG00000017386	ENST00000375418.3:c.756T>A	13.37:g.114079385A>T	ENSP00000364567:p.Asp252Glu		Q5JUG2|Q96GD1	Missense_Mutation	SNP	pfam_Ribosyl_crysJ1,superfamily_Ribosyl_crysJ1,pirsf_ADP-ribosylarg_hydro	p.D252E	ENST00000375418.3	37	c.756	CCDS9535.1	13	.	.	.	.	.	.	.	.	.	.	a	13.48	2.249067	0.39797	.	.	ENSG00000153531	ENST00000356501;ENST00000375418;ENST00000413169	T	0.48522	0.81	5.22	-6.31	0.02001	.	0.051911	0.64402	D	0.000001	T	0.58221	0.2107	M	0.73753	2.245	0.41765	D	0.989735	D	0.71674	0.998	D	0.69654	0.965	T	0.69950	-0.5006	10	0.16420	T	0.52	-12.6808	15.5252	0.75898	0.8078:0.0:0.1922:0.0	.	252	Q8NDY3	ARHL1_HUMAN	E	170;252;170	ENSP00000364567:D252E	ENSP00000348894:D170E	D	-	3	2	ADPRHL1	113127386	0.198000	0.23374	0.009000	0.14445	0.015000	0.08874	-0.241000	0.08940	-1.737000	0.01350	-1.054000	0.02325	GAT	ADPRHL1	-	pfam_Ribosyl_crysJ1,superfamily_Ribosyl_crysJ1,pirsf_ADP-ribosylarg_hydro	ENSG00000153531		0.448	ADPRHL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADPRHL1	HGNC	protein_coding	OTTHUMT00000045915.2	57	0.00	0	A	NM_138430		114079385	114079385	-1	no_errors	ENST00000375418	ensembl	human	known	69_37n	missense	81	19.80	20	SNP	0.941	T
AHNAK	79026	genome.wustl.edu	37	11	62295895	62295895	+	Silent	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr11:62295895C>T	ENST00000378024.4	-	5	6268	c.5994G>A	c.(5992-5994)ctG>ctA	p.L1998L	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	1998					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TGGGGCCTTTCAGGTGTAAGT	0.478																																						dbGAP											0													329.0	333.0	332.0					11																	62295895		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.5994G>A	11.37:g.62295895C>T			A1A586	Silent	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.L1998	ENST00000378024.4	37	c.5994	CCDS31584.1	11																																																																																			AHNAK	-	NULL	ENSG00000124942		0.478	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK	HGNC	protein_coding	OTTHUMT00000395572.1	100	0.00	0	C	NM_024060		62295895	62295895	-1	no_errors	ENST00000378024	ensembl	human	known	69_37n	silent	133	18.90	31	SNP	0.557	T
ANGPT4	51378	genome.wustl.edu	37	20	858903	858903	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr20:858903G>T	ENST00000381922.3	-	7	1223	c.1121C>A	c.(1120-1122)gCa>gAa	p.A374E	ANGPT4_ENST00000546022.1_Missense_Mutation_p.A374E	NM_015985.2	NP_057069.1	Q9Y264	ANGP4_HUMAN	angiopoietin 4	374	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to hypoxia (GO:0071456)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)	27						AGAGTAGGCTGCCCTTCTGGT	0.602																																					Pancreas(181;481 2077 3259 31286 49856)	dbGAP											0													59.0	49.0	52.0					20																	858903		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF074332	CCDS13009.1	20p13	2013-02-06			ENSG00000101280	ENSG00000101280		"""Fibrinogen C domain containing"""	487	protein-coding gene	gene with protein product		603705				10051567, 10218486	Standard	NM_015985		Approved		uc002wei.3	Q9Y264	OTTHUMG00000031652	ENST00000381922.3:c.1121C>A	20.37:g.858903G>T	ENSP00000371347:p.Ala374Glu		B4E3J9|Q5TFF4|Q9H4Z4	Missense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	p.A374E	ENST00000381922.3	37	c.1121	CCDS13009.1	20	.	.	.	.	.	.	.	.	.	.	G	9.708	1.156321	0.21454	.	.	ENSG00000101280	ENST00000381922;ENST00000546022	T;T	0.28666	2.11;1.6	5.5	2.46	0.29980	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.558202	0.19126	N	0.122056	T	0.18800	0.0451	N	0.17674	0.51	0.09310	N	1	P;P	0.39535	0.677;0.606	B;B	0.41988	0.299;0.372	T	0.07712	-1.0758	10	0.33940	T	0.23	.	4.9441	0.13980	0.2357:0.2914:0.4728:0.0	.	374;374	B4E3J9;Q9Y264	.;ANGP4_HUMAN	E	374	ENSP00000371347:A374E;ENSP00000439605:A374E	ENSP00000371347:A374E	A	-	2	0	ANGPT4	806903	0.000000	0.05858	0.001000	0.08648	0.867000	0.49689	0.832000	0.27490	0.415000	0.25817	-0.136000	0.14681	GCA	ANGPT4	-	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	ENSG00000101280		0.602	ANGPT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGPT4	HGNC	protein_coding	OTTHUMT00000077493.1	13	0.00	0	G	NM_015985		858903	858903	-1	no_errors	ENST00000381922	ensembl	human	known	69_37n	missense	32	23.81	10	SNP	0.002	T
ANXA3	306	genome.wustl.edu	37	4	79516556	79516556	+	Missense_Mutation	SNP	A	A	G			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr4:79516556A>G	ENST00000264908.6	+	8	884	c.505A>G	c.(505-507)Aaa>Gaa	p.K169E	ANXA3_ENST00000512884.1_Missense_Mutation_p.K130E|ANXA3_ENST00000503570.2_Missense_Mutation_p.K130E	NM_005139.2	NP_005130.1	P12429	ANXA3_HUMAN	annexin A3	169					defense response to bacterium (GO:0042742)|neutrophil degranulation (GO:0043312)|phagocytosis (GO:0006909)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|phospholipase A2 inhibitor activity (GO:0019834)			NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15						TGAAAGTCTGAAAGTGGATGA	0.433																																					GBM(2;126 157 27790 28920 42492)	dbGAP											0													177.0	179.0	179.0					4																	79516556		2203	4300	6503	-	-	-	SO:0001583	missense	0			M63310	CCDS3584.1	4q21.21	2009-07-10			ENSG00000138772	ENSG00000138772	3.1.4.43	"""Annexins"""	541	protein-coding gene	gene with protein product		106490		ANX3		1830024	Standard	XM_005262973		Approved		uc003hld.3	P12429	OTTHUMG00000130198	ENST00000264908.6:c.505A>G	4.37:g.79516556A>G	ENSP00000264908:p.Lys169Glu		B2R9W6|Q6LET2	Missense_Mutation	SNP	pfam_Annexin_repeat,superfamily_Annexin,smart_Annexin_repeat,prints_Annexin,prints_AnnexinIII	p.K169E	ENST00000264908.6	37	c.505	CCDS3584.1	4	.	.	.	.	.	.	.	.	.	.	A	10.99	1.508138	0.27036	.	.	ENSG00000138772	ENST00000264908;ENST00000512884;ENST00000512542;ENST00000503570	T;T;T;T	0.20881	2.87;2.87;2.04;2.87	4.89	4.89	0.63831	.	0.384852	0.29348	N	0.012409	T	0.09774	0.0240	N	0.05487	-0.04	0.42438	D	0.992708	B	0.19817	0.039	B	0.18871	0.023	T	0.08371	-1.0725	10	0.02654	T	1	.	13.6252	0.62159	1.0:0.0:0.0:0.0	.	169	P12429	ANXA3_HUMAN	E	169;130;13;130	ENSP00000264908:K169E;ENSP00000423068:K130E;ENSP00000426591:K13E;ENSP00000421015:K130E	ENSP00000264908:K169E	K	+	1	0	ANXA3	79735580	0.987000	0.35691	0.996000	0.52242	0.993000	0.82548	3.036000	0.49767	2.052000	0.61016	0.402000	0.26972	AAA	ANXA3	-	superfamily_Annexin	ENSG00000138772		0.433	ANXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA3	HGNC	protein_coding	OTTHUMT00000252516.3	84	0.00	0	A	NM_005139		79516556	79516556	+1	no_errors	ENST00000264908	ensembl	human	known	69_37n	missense	101	17.21	21	SNP	0.998	G
ARHGAP10	79658	genome.wustl.edu	37	4	148787878	148787878	+	Nonsense_Mutation	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr4:148787878C>T	ENST00000336498.3	+	7	852	c.613C>T	c.(613-615)Cag>Tag	p.Q205*		NM_024605.3	NP_078881.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 10	0					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			autonomic_ganglia(2)|endometrium(5)|kidney(2)|large_intestine(4)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	33	all_hematologic(180;0.151)	Renal(17;0.0166)		GBM - Glioblastoma multiforme(119;0.0423)		GTCATTTTTTCAGGGGATGTT	0.378											OREG0016355	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													132.0	122.0	125.0					4																	148787878		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC047914	CCDS34075.1	4q31.23	2013-09-20			ENSG00000071205	ENSG00000071205		"""Rho GTPase activating proteins"""	26099	protein-coding gene	gene with protein product		609746				8288572	Standard	NM_024605		Approved	FLJ20896, FLJ41791, GRAF2	uc003ilf.3	A1A4S6	OTTHUMG00000161460	ENST00000336498.3:c.613C>T	4.37:g.148787878C>T	ENSP00000336923:p.Gln205*	1720	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Nonsense_Mutation	SNP	pfam_RhoGAP_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_RhoGAP_dom,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.Q205*	ENST00000336498.3	37	c.613	CCDS34075.1	4	.	.	.	.	.	.	.	.	.	.	C	41	8.921518	0.99004	.	.	ENSG00000071205	ENST00000336498	.	.	.	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	.	19.9643	0.97261	0.0:1.0:0.0:0.0	.	.	.	.	X	205	.	ENSP00000336923:Q205X	Q	+	1	0	ARHGAP10	149007328	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.047000	0.76599	2.826000	0.97356	0.655000	0.94253	CAG	ARHGAP10	-	NULL	ENSG00000071205		0.378	ARHGAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP10	HGNC	protein_coding	OTTHUMT00000365005.1	76	0.00	0	C	NM_024605		148787878	148787878	+1	no_errors	ENST00000336498	ensembl	human	known	69_37n	nonsense	97	20.49	25	SNP	1.000	T
ARHGAP25	9938	genome.wustl.edu	37	2	69034573	69034573	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr2:69034573G>C	ENST00000295381.3	+	5	1051	c.632G>C	c.(631-633)aGa>aCa	p.R211T	ARHGAP25_ENST00000409220.1_Missense_Mutation_p.R205T|ARHGAP25_ENST00000497079.1_Missense_Mutation_p.R205T|ARHGAP25_ENST00000409202.3_Missense_Mutation_p.R212T|ARHGAP25_ENST00000409030.3_Missense_Mutation_p.R204T|ARHGAP25_ENST00000456116.2_3'UTR|ARHGAP25_ENST00000467265.1_Missense_Mutation_p.R172T|ARHGAP25_ENST00000544262.1_Missense_Mutation_p.R186T	NM_001007231.2	NP_001007232.2	P42331	RHG25_HUMAN	Rho GTPase activating protein 25	211	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(20)|ovary(3)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	52						AAGCAGCTGAGAGACGCTTTT	0.597																																						dbGAP											0													118.0	111.0	113.0					2																	69034573		2203	4300	6503	-	-	-	SO:0001583	missense	0			D29642	CCDS33214.1, CCDS46312.1, CCDS33214.2, CCDS54363.1, CCDS54364.1	2p13.3	2013-01-10			ENSG00000163219	ENSG00000163219		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	28951	protein-coding gene	gene with protein product		610587				7584044	Standard	NM_001007231		Approved	KIAA0053	uc010fdg.3	P42331	OTTHUMG00000152621	ENST00000295381.3:c.632G>C	2.37:g.69034573G>C	ENSP00000295381:p.Arg211Thr		A8K2Y1|B7Z498|E9PFQ7|G5E9G2|Q8IXQ2	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.R212T	ENST00000295381.3	37	c.635		2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.24|18.24	3.579676|3.579676	0.65992|0.65992	.|.	.|.	ENSG00000163219|ENSG00000163219	ENST00000497259|ENST00000544262;ENST00000295381;ENST00000409202;ENST00000467265;ENST00000409030;ENST00000409220;ENST00000482106;ENST00000497079;ENST00000543533	.|T;T;T;T;T;T;T	.|0.48522	.|0.81;0.81;2.63;2.63;0.81;2.63;2.63	4.78|4.78	4.78|4.78	0.61160|0.61160	.|Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	.|0.092352	.|0.85682	.|D	.|0.000000	T|T	0.57607|0.57607	0.2065|0.2065	M|M	0.69248|0.69248	2.105|2.105	0.53688|0.53688	D|D	0.999977|0.999977	.|D;P;P;P;P;P;P	.|0.54772	.|0.968;0.797;0.873;0.873;0.873;0.952;0.755	.|P;P;B;B;B;B;P	.|0.55303	.|0.773;0.698;0.344;0.344;0.344;0.385;0.493	T|T	0.60801|0.60801	-0.7191|-0.7191	5|10	.|0.62326	.|D	.|0.03	.|.	10.546|10.546	0.45060|0.45060	0.0878:0.0:0.9122:0.0|0.0878:0.0:0.9122:0.0	.|.	.|172;186;212;205;204;205;211	.|E9PFQ7;B7Z8K7;P42331-4;G5E9G2;P42331-3;P42331-2;P42331	.|.;.;.;.;.;.;RHG25_HUMAN	Q|T	71|186;211;212;172;204;205;205;205;196	.|ENSP00000439917:R186T;ENSP00000295381:R211T;ENSP00000386911:R212T;ENSP00000420583:R172T;ENSP00000386863:R204T;ENSP00000386241:R205T;ENSP00000417139:R205T	.|ENSP00000295381:R211T	E|R	+|+	1|2	0|0	ARHGAP25|ARHGAP25	68888077|68888077	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.956000|0.956000	0.61745|0.61745	4.027000|4.027000	0.57239|0.57239	2.487000|2.487000	0.83934|0.83934	0.555000|0.555000	0.69702|0.69702	GAG|AGA	ARHGAP25	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000163219		0.597	ARHGAP25-201	KNOWN	basic|appris_candidate	protein_coding	ARHGAP25	HGNC	protein_coding		33	0.00	0	G	NM_014882		69034573	69034573	+1	no_errors	ENST00000409202	ensembl	human	known	69_37n	missense	48	15.79	9	SNP	0.979	C
ARMC5	79798	genome.wustl.edu	37	16	31473745	31473745	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr16:31473745C>G	ENST00000563544.1	+	4	1423	c.877C>G	c.(877-879)Ccc>Gcc	p.P293A	ARMC5_ENST00000408912.3_Missense_Mutation_p.P388A|ARMC5_ENST00000457010.2_Missense_Mutation_p.P293A|ARMC5_ENST00000412665.2_Intron|ARMC5_ENST00000538189.1_Missense_Mutation_p.P325A|RP11-452L6.5_ENST00000564629.1_RNA|ARMC5_ENST00000268314.4_Missense_Mutation_p.P293A			Q96C12	ARMC5_HUMAN	armadillo repeat containing 5	293										central_nervous_system(1)|endometrium(4)|large_intestine(3)|liver(2)|lung(12)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28						GGCTTCCCACCCCAAGCGGGC	0.662																																						dbGAP											0													30.0	34.0	33.0					16																	31473745		2083	4206	6289	-	-	-	SO:0001583	missense	0			AY217348	CCDS42155.1, CCDS45472.1, CCDS73874.1	16p11	2013-02-14			ENSG00000140691	ENSG00000140691		"""Armadillo repeat containing"""	25781	protein-coding gene	gene with protein product		615549					Standard	NM_024742		Approved	FLJ13063	uc002ecc.3	Q96C12	OTTHUMG00000176618	ENST00000563544.1:c.877C>G	16.37:g.31473745C>G	ENSP00000456877:p.Pro293Ala		Q86WM9|Q9H7P8|Q9H925	Missense_Mutation	SNP	superfamily_ARM-type_fold,superfamily_BTB/POZ_fold,smart_Armadillo,pfscan_Armadillo,pfscan_BTB/POZ-like	p.P388A	ENST00000563544.1	37	c.1162	CCDS45472.1	16	.	.	.	.	.	.	.	.	.	.	c	0.321	-0.961679	0.02249	.	.	ENSG00000140691	ENST00000408912;ENST00000538189;ENST00000268314;ENST00000457010	T;T;T;T	0.59224	0.28;0.28;0.28;0.28	4.51	4.51	0.55191	Armadillo-like helical (1);Armadillo-type fold (1);	0.187310	0.47852	D	0.000212	T	0.53417	0.1795	L	0.28274	0.84	0.80722	D	1	D;D;D;B	0.60160	0.987;0.987;0.965;0.42	P;P;P;B	0.56088	0.791;0.791;0.702;0.143	T	0.47328	-0.9126	10	0.06891	T	0.86	-14.3195	14.7442	0.69477	0.0:1.0:0.0:0.0	.	325;388;293;293	F5H156;B4DIU9;Q96C12;Q96C12-4	.;.;ARMC5_HUMAN;.	A	388;325;293;293	ENSP00000386125:P388A;ENSP00000443995:P325A;ENSP00000268314:P293A;ENSP00000399561:P293A	ENSP00000268314:P293A	P	+	1	0	ARMC5	31381246	0.080000	0.21391	0.984000	0.44739	0.306000	0.27790	0.381000	0.20619	2.060000	0.61445	0.450000	0.29827	CCC	ARMC5	-	superfamily_ARM-type_fold	ENSG00000140691		0.662	ARMC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMC5	HGNC	protein_coding	OTTHUMT00000432847.1	13	0.00	0	C	NM_024742		31473745	31473745	+1	no_errors	ENST00000408912	ensembl	human	known	69_37n	missense	56	17.65	12	SNP	1.000	G
ASB13	79754	genome.wustl.edu	37	10	5683789	5683789	+	Missense_Mutation	SNP	G	G	T	rs564380910		TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr10:5683789G>T	ENST00000357700.6	-	5	679	c.653C>A	c.(652-654)cCg>cAg	p.P218Q	ASB13_ENST00000479033.1_5'UTR	NM_024701.3	NP_078977.2	Q8WXK3	ASB13_HUMAN	ankyrin repeat and SOCS box containing 13	218					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					NS(1)|endometrium(3)|lung(3)|ovary(1)	8				GBM - Glioblastoma multiforme(2;9.59e-09)		GTAGTCAGACGGCTTCTTCCC	0.602																																						dbGAP											0													82.0	73.0	76.0					10																	5683789		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091935	CCDS7070.1	10p15.1	2013-01-10	2011-01-25		ENSG00000196372	ENSG00000196372		"""Ankyrin repeat domain containing"""	19765	protein-coding gene	gene with protein product		615055	"""ankyrin repeat and SOCS box-containing 13"""			12076535	Standard	NM_024701		Approved	FLJ13134, MGC19879	uc001iig.2	Q8WXK3	OTTHUMG00000017603	ENST00000357700.6:c.653C>A	10.37:g.5683789G>T	ENSP00000350331:p.Pro218Gln		A8K7Q6|D3DRR2|Q96EP7|Q9H8Z1	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C	p.P218Q	ENST00000357700.6	37	c.653	CCDS7070.1	10	.	.	.	.	.	.	.	.	.	.	G	35	5.444640	0.96187	.	.	ENSG00000196372	ENST00000357700	T	0.61274	0.12	5.76	5.76	0.90799	Ankyrin repeat-containing domain (3);	0.047596	0.85682	D	0.000000	T	0.81317	0.4797	M	0.89353	3.025	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84089	0.0389	10	0.87932	D	0	-20.8901	19.5531	0.95330	0.0:0.0:1.0:0.0	.	218	Q8WXK3	ASB13_HUMAN	Q	218	ENSP00000350331:P218Q	ENSP00000350331:P218Q	P	-	2	0	ASB13	5723795	1.000000	0.71417	0.964000	0.40570	0.967000	0.64934	9.222000	0.95196	2.721000	0.93114	0.591000	0.81541	CCG	ASB13	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000196372		0.602	ASB13-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB13	HGNC	protein_coding	OTTHUMT00000046564.1	27	0.00	0	G			5683789	5683789	-1	no_errors	ENST00000357700	ensembl	human	known	69_37n	missense	39	22.00	11	SNP	1.000	T
BAP1	8314	genome.wustl.edu	37	3	52437465	52437465	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr3:52437465C>T	ENST00000460680.1	-	13	2167	c.1696G>A	c.(1696-1698)Gag>Aag	p.E566K	BAP1_ENST00000296288.5_Missense_Mutation_p.E548K	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		ACCCCATCCTCAGCCAGGTGC	0.622			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															GBM(101;493 1458 7992 21037 25532)	dbGAP		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	0													63.0	59.0	60.0					3																	52437465		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.1696G>A	3.37:g.52437465C>T	ENSP00000417132:p.Glu566Lys		B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Missense_Mutation	SNP	pfam_Peptidase_C12,prints_Peptidase_C12	p.E566K	ENST00000460680.1	37	c.1696	CCDS2853.1	3	.	.	.	.	.	.	.	.	.	.	C	17.26	3.345553	0.61073	.	.	ENSG00000163930	ENST00000460680;ENST00000296288;ENST00000478368	T;T;T	0.59502	0.29;0.26;0.52	5.94	5.94	0.96194	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (1);	0.141504	0.64402	D	0.000005	T	0.42832	0.1220	N	0.19112	0.55	0.58432	D	0.999999	B	0.06786	0.001	B	0.06405	0.002	T	0.22836	-1.0205	10	0.33141	T	0.24	.	13.5427	0.61684	0.0:0.9291:0.0:0.0709	.	566	Q92560	BAP1_HUMAN	K	566;548;67	ENSP00000417132:E566K;ENSP00000296288:E548K;ENSP00000420647:E67K	ENSP00000296288:E548K	E	-	1	0	BAP1	52412505	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.781000	0.68964	2.809000	0.96659	0.655000	0.94253	GAG	BAP1	-	NULL	ENSG00000163930		0.622	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAP1	HGNC	protein_coding	OTTHUMT00000350895.1	16	0.00	0	C			52437465	52437465	-1	no_errors	ENST00000460680	ensembl	human	known	69_37n	missense	38	19.15	9	SNP	1.000	T
BTN3A3	10384	genome.wustl.edu	37	6	26452095	26452095	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr6:26452095G>T	ENST00000244519.2	+	11	1454	c.1211G>T	c.(1210-1212)aGa>aTa	p.R404I	BTN3A3_ENST00000339789.4_Missense_Mutation_p.R362I|BTN3A3_ENST00000361232.3_Missense_Mutation_p.R355I	NM_006994.4	NP_008925.1	O00478	BT3A3_HUMAN	butyrophilin, subfamily 3, member A3	404	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				T cell mediated immunity (GO:0002456)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	30						GTGGGGGACAGAAAAGAGTGG	0.488																																						dbGAP											0													97.0	94.0	95.0					6																	26452095		2203	4300	6503	-	-	-	SO:0001583	missense	0			U90548	CCDS4611.1, CCDS4612.1, CCDS4612.2	6p22.1	2014-01-14			ENSG00000111801	ENSG00000111801		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	1140	protein-coding gene	gene with protein product		613595				10354554, 9149941	Standard	NM_006994		Approved	BTF3, BTN3.3	uc003nhz.3	O00478	OTTHUMG00000014451	ENST00000244519.2:c.1211G>T	6.37:g.26452095G>T	ENSP00000244519:p.Arg404Ile		B4DWI7|E9PCP5	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Ig_V-set,superfamily_ConA-like_lec_gl,smart_Ig_sub,smart_Ig_V-set_subgr,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Ig-like,prints_Butyrophylin	p.R404I	ENST00000244519.2	37	c.1211	CCDS4611.1	6	.	.	.	.	.	.	.	.	.	.	G	14.65	2.597930	0.46318	.	.	ENSG00000111801	ENST00000244519;ENST00000339789;ENST00000361232;ENST00000490254	T;T;T;T	0.61158	0.13;0.13;0.13;0.13	3.15	-0.114	0.13564	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	T	0.52125	0.1715	M	0.79693	2.465	0.09310	N	1	P;D	0.76494	0.669;0.999	B;D	0.78314	0.421;0.991	T	0.35968	-0.9767	9	0.23302	T	0.38	.	1.2563	0.01992	0.1267:0.1894:0.3087:0.3752	.	355;404	E9PCP5;O00478	.;BT3A3_HUMAN	I	404;362;355;194	ENSP00000244519:R404I;ENSP00000344968:R362I;ENSP00000355238:R355I;ENSP00000419736:R194I	ENSP00000244519:R404I	R	+	2	0	BTN3A3	26560074	0.000000	0.05858	0.000000	0.03702	0.125000	0.20455	-0.075000	0.11431	0.064000	0.16427	0.455000	0.32223	AGA	BTN3A3	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000111801		0.488	BTN3A3-001	KNOWN	basic|CCDS	protein_coding	BTN3A3	HGNC	protein_coding	OTTHUMT00000040116.2	63	0.00	0	G	NM_006994		26452095	26452095	+1	no_errors	ENST00000244519	ensembl	human	known	69_37n	missense	71	15.48	13	SNP	0.000	T
KATNBL1	79768	genome.wustl.edu	37	15	34455763	34455763	+	Missense_Mutation	SNP	C	C	T	rs535651317		TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr15:34455763C>T	ENST00000256544.3	-	2	257	c.115G>A	c.(115-117)Gag>Aag	p.E39K		NM_024713.2	NP_078989.1	Q9H079	KTBL1_HUMAN	katanin p80 subunit B-like 1	39						nucleolus (GO:0005730)											AGACTTACCTCCTTCATGTTC	0.308													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15579	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													57.0	56.0	56.0					15																	34455763		2198	4286	6484	-	-	-	SO:0001583	missense	0			AL136908	CCDS10034.1	15q13.2	2012-09-27	2012-09-27	2012-09-27	ENSG00000134152	ENSG00000134152			26199	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 29"""	C15orf29		11230166	Standard	NM_024713		Approved	FLJ22557	uc001zhp.3	Q9H079	OTTHUMG00000129368	ENST00000256544.3:c.115G>A	15.37:g.34455763C>T	ENSP00000256544:p.Glu39Lys		A8KAF6|Q2TAC0|Q9H670	Missense_Mutation	SNP	NULL	p.E39K	ENST00000256544.3	37	c.115	CCDS10034.1	15	.	.	.	.	.	.	.	.	.	.	C	19.27	3.794522	0.70452	.	.	ENSG00000134152	ENST00000256544	.	.	.	4.34	4.34	0.51931	.	0.049894	0.85682	D	0.000000	T	0.46502	0.1396	L	0.34521	1.04	0.58432	D	0.999995	P	0.38473	0.633	B	0.33799	0.17	T	0.52457	-0.8573	9	0.45353	T	0.12	.	16.977	0.86316	0.0:1.0:0.0:0.0	.	39	Q9H079	CO029_HUMAN	K	39	.	ENSP00000256544:E39K	E	-	1	0	C15orf29	32243055	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.310000	0.51911	2.420000	0.82092	0.557000	0.71058	GAG	C15orf29	-	NULL	ENSG00000134152		0.308	KATNBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C15orf29	HGNC	protein_coding	OTTHUMT00000251520.1	72	0.00	0	C	NM_024713		34455763	34455763	-1	no_errors	ENST00000256544	ensembl	human	known	69_37n	missense	56	22.22	16	SNP	1.000	T
KNSTRN	90417	genome.wustl.edu	37	15	40683726	40683726	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr15:40683726G>A	ENST00000249776.8	+	7	833	c.718G>A	c.(718-720)Gaa>Aaa	p.E240K	KNSTRN_ENST00000608100.1_Missense_Mutation_p.E162K|KNSTRN_ENST00000416151.2_Missense_Mutation_p.E240K|KNSTRN_ENST00000448395.2_Intron	NM_033286.3	NP_150628.3			kinetochore-localized astrin/SPAG5 binding protein																		ATCACGACAAGAATCCACTAC	0.463																																						dbGAP											0													123.0	115.0	118.0					15																	40683726		2026	4185	6211	-	-	-	SO:0001583	missense	0			AK027408	CCDS42021.1, CCDS45226.1, CCDS45227.1	15q15.1	2013-01-17	2012-12-04	2012-12-04	ENSG00000128944	ENSG00000128944			30767	protein-coding gene	gene with protein product	"""small kinetochore-associated protein"", ""kinetochore-localized astrin-binding protein"", ""TRAF4 associated factor 1"""	614718	"""chromosome 15 open reading frame 23"""	C15orf23		12477932	Standard	NM_033286		Approved	FLJ14502, SKAP, kinastrin, TRAF4AF1	uc001zll.3	Q9Y448	OTTHUMG00000172454	ENST00000249776.8:c.718G>A	15.37:g.40683726G>A	ENSP00000249776:p.Glu240Lys			Missense_Mutation	SNP	NULL	p.E240K	ENST00000249776.8	37	c.718	CCDS42021.1	15	.	.	.	.	.	.	.	.	.	.	G	14.25	2.479805	0.44044	.	.	ENSG00000128944	ENST00000249776;ENST00000416151	T;T	0.27402	1.67;1.67	5.18	4.25	0.50352	.	0.259460	0.31976	N	0.006780	T	0.20740	0.0499	N	0.14661	0.345	0.23126	N	0.998256	P;B	0.40731	0.728;0.386	B;B	0.43623	0.425;0.124	T	0.07385	-1.0775	10	0.33940	T	0.23	-4.3865	9.8045	0.40783	0.094:0.0:0.906:0.0	.	240;240	Q9Y448-2;Q9Y448	.;T4AF1_HUMAN	K	240	ENSP00000249776:E240K;ENSP00000391233:E240K	ENSP00000249776:E240K	E	+	1	0	C15orf23	38471018	0.010000	0.17322	0.008000	0.14137	0.016000	0.09150	1.253000	0.32886	1.379000	0.46325	0.655000	0.94253	GAA	C15orf23	-	NULL	ENSG00000128944		0.463	KNSTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C15orf23	HGNC	protein_coding	OTTHUMT00000418636.1	49	0.00	0	G	NM_001142761		40683726	40683726	+1	no_errors	ENST00000249776	ensembl	human	known	69_37n	missense	57	20.83	15	SNP	0.044	A
MAATS1	89876	genome.wustl.edu	37	3	119462918	119462918	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr3:119462918G>A	ENST00000273390.5	+	14	1854	c.1777G>A	c.(1777-1779)Gag>Aag	p.E593K	RP11-169N13.4_ENST00000489428.2_RNA	NM_033364.3	NP_203528	Q7Z4T9	MAAT1_HUMAN	MYCBP-associated, testis expressed 1	429						mitochondrion (GO:0005739)											ACTGCAGGAGGAGAGGAGGAT	0.577																																						dbGAP											0													104.0	91.0	95.0					3																	119462918		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB063296	CCDS2994.1	3q12-q13.3	2014-07-31	2012-12-07	2012-09-26	ENSG00000183833	ENSG00000183833			24010	protein-coding gene	gene with protein product	"""AMY-1-associating protein expressed in testis 1"", ""MYCBP-binding protein"", ""spermatogenesis associated 26"""	609910	"""chromosome 3 open reading frame 15"", ""MYCBP/AMY-1-associated, testis expressed 1"""	C3orf15		12223483, 14551891, 17967944	Standard	NM_033364		Approved	AAT1, AAT1alpha, SPATA26, CaM-IP2	uc003ede.4	Q7Z4T9	OTTHUMG00000159422	ENST00000273390.5:c.1777G>A	3.37:g.119462918G>A	ENSP00000273390:p.Glu593Lys		A0AVK2|A8K1J9|B3KP23|B4DG52|B4DZ14|C9JUG4|Q68DX2|Q8TD41|Q96A45|Q96JE8	Missense_Mutation	SNP	superfamily_S-AdoMet_deCO2ase_core	p.E593K	ENST00000273390.5	37	c.1777	CCDS2994.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.833908	0.97003	.	.	ENSG00000183833	ENST00000273390	T	0.29397	1.57	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.63343	0.2503	M	0.85462	2.755	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.995;0.998	T	0.66118	-0.6003	10	0.62326	D	0.03	-16.1825	20.1322	0.98003	0.0:0.0:1.0:0.0	.	429;531;593	Q7Z4T9;Q7Z4T9-3;Q7Z4T9-7	AAT1_HUMAN;.;.	K	593	ENSP00000273390:E593K	ENSP00000273390:E593K	E	+	1	0	C3orf15	120945608	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.184000	0.94893	2.765000	0.95021	0.484000	0.47621	GAG	C3orf15	-	NULL	ENSG00000183833		0.577	MAATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf15	HGNC	protein_coding	OTTHUMT00000355222.1	30	0.00	0	G	NM_033364		119462918	119462918	+1	no_errors	ENST00000273390	ensembl	human	known	69_37n	missense	48	17.24	10	SNP	1.000	A
CA14	23632	genome.wustl.edu	37	1	150233919	150233919	+	Silent	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr1:150233919G>A	ENST00000369111.4	+	3	1108	c.138G>A	c.(136-138)tcG>tcA	p.S46S	snoU13_ENST00000458929.1_RNA	NM_012113.1	NP_036245.1	Q9ULX7	CAH14_HUMAN	carbonic anhydrase XIV	46					bicarbonate transport (GO:0015701)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)	18	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)		Acetazolamide(DB00819)|Zonisamide(DB00909)	ATGCCCAGTCGCCCATCGATA	0.567																																						dbGAP											0													149.0	115.0	126.0					1																	150233919		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB025904	CCDS947.1	1q21	2008-02-05			ENSG00000118298	ENSG00000118298		"""Carbonic anhydrases"""	1372	protein-coding gene	gene with protein product		604832				10512682	Standard	XM_005245059		Approved		uc001etx.3	Q9ULX7	OTTHUMG00000012549	ENST00000369111.4:c.138G>A	1.37:g.150233919G>A			Q5TB24|Q8NCF4	Silent	SNP	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	p.S46	ENST00000369111.4	37	c.138	CCDS947.1	1																																																																																			CA14	-	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	ENSG00000118298		0.567	CA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CA14	HGNC	protein_coding	OTTHUMT00000035064.2	27	0.00	0	G	NM_012113		150233919	150233919	+1	no_errors	ENST00000369111	ensembl	human	known	69_37n	silent	38	41.79	28	SNP	0.794	A
CAPN12	147968	genome.wustl.edu	37	19	39221790	39221790	+	Silent	SNP	G	G	A	rs530113729		TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr19:39221790G>A	ENST00000328867.4	-	19	2339	c.2031C>T	c.(2029-2031)ttC>ttT	p.F677F	CAPN12_ENST00000601953.1_Silent_p.F528F|ACTN4_ENST00000252699.2_3'UTR	NM_144691.3	NP_653292.2	Q6ZSI9	CAN12_HUMAN	calpain 12	677	Domain IV.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(60;2.87e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)			CGAACCGCTCGAAGTCCACAC	0.647																																						dbGAP											0													66.0	49.0	54.0					19																	39221790		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC014027	CCDS12519.1	19q13.2	2014-08-12			ENSG00000182472	ENSG00000182472		"""EF-hand domain containing"""	13249	protein-coding gene	gene with protein product		608839					Standard	NM_144691		Approved		uc002ojd.1	Q6ZSI9	OTTHUMG00000182525	ENST00000328867.4:c.2031C>T	19.37:g.39221790G>A				Silent	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,pfscan_EF_HAND_2,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.F677	ENST00000328867.4	37	c.2031	CCDS12519.1	19																																																																																			CAPN12	-	NULL	ENSG00000182472		0.647	CAPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPN12	HGNC	protein_coding	OTTHUMT00000462151.1	34	0.00	0	G			39221790	39221790	-1	no_errors	ENST00000328867	ensembl	human	known	69_37n	silent	48	26.15	17	SNP	0.509	A
CASKIN1	57524	genome.wustl.edu	37	16	2229628	2229628	+	Silent	SNP	G	G	A	rs370306374		TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr16:2229628G>A	ENST00000343516.6	-	18	3833	c.3741C>T	c.(3739-3741)tcC>tcT	p.S1247S	CASKIN1_ENST00000564289.1_5'Flank	NM_020764.3	NP_065815.1	Q8WXD9	CSKI1_HUMAN	CASK interacting protein 1	1247	Pro-rich.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|liver(1)|lung(7)|ovary(4)|prostate(5)|skin(3)	28						GCACCTTCTTGGAGGTGGGTG	0.697																																						dbGAP											0													4.0	5.0	5.0					16																	2229628		1807	3966	5773	-	-	-	SO:0001819	synonymous_variant	0			AF451977	CCDS42103.1	16p13.3	2013-01-10				ENSG00000167971		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20879	protein-coding gene	gene with protein product		612184				12040031	Standard	NM_020764		Approved	KIAA1306, ANKS5A	uc010bsg.1	Q8WXD9		ENST00000343516.6:c.3741C>T	16.37:g.2229628G>A			Q9P2P0	Silent	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_SAM_2,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SAM,pfscan_SH3_domain,prints_Ankyrin_rpt	p.S1247	ENST00000343516.6	37	c.3741	CCDS42103.1	16																																																																																			CASKIN1	-	NULL	ENSG00000167971		0.697	CASKIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASKIN1	HGNC	protein_coding	OTTHUMT00000435055.1	9	0.00	0	G	NM_020764		2229628	2229628	-1	no_errors	ENST00000343516	ensembl	human	known	69_37n	silent	5	58.33	7	SNP	1.000	A
CCT6P3	643180	genome.wustl.edu	37	7	64531401	64531401	+	RNA	SNP	C	C	T	rs184482762	byFrequency	TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr7:64531401C>T	ENST00000426828.1	+	0	1209				SNORA15_ENST00000384334.1_RNA	NR_033416.1				chaperonin containing TCP1, subunit 6 (zeta) pseudogene 3																		TTTGCTGATGCGTTGCTCGTT	0.438																																						dbGAP											0																																										-	-	-			0					7q11.21	2010-06-29			ENSG00000234585	ENSG00000234585			35137	pseudogene	pseudogene							Standard	NR_033416		Approved		uc010kzt.1		OTTHUMG00000156630		7.37:g.64531401C>T				RNA	SNP	-	NULL	ENST00000426828.1	37	NULL		7																																																																																			CCT6P3	-	-	ENSG00000234585		0.438	CCT6P3-004	KNOWN	basic	processed_transcript	CCT6P3	HGNC	pseudogene	OTTHUMT00000344862.1	49	0.00	0	C			64531401	64531401	+1	no_errors	ENST00000426828	ensembl	human	known	69_37n	rna	57	19.72	14	SNP	1.000	T
CDH1	999	genome.wustl.edu	37	16	68846048	68846049	+	Frame_Shift_Ins	INS	-	-	G	rs61747632|rs61747631	byFrequency	TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr16:68846048_68846049insG	ENST00000261769.5	+	8	1210_1211	c.1019_1020insG	c.(1018-1023)acgtatfs	p.Y341fs	RP11-354M1.2_ENST00000563916.1_RNA|CDH1_ENST00000422392.2_Frame_Shift_Ins_p.Y341fs|CDH1_ENST00000562836.1_3'UTR	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	341	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.S337_T379del(1)|p.T340M(1)|p.?(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		AGTTTCCCTACGTATACCCTGG	0.505			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	3	Substitution - Missense(1)|Unknown(1)|Deletion - In frame(1)	biliary_tract(1)|stomach(1)|breast(1)																																								-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.1020dupG	16.37:g.68846049_68846049dupG	ENSP00000261769:p.Tyr341fs		A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Frame_Shift_Ins	INS	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Y341fs	ENST00000261769.5	37	c.1019_1020	CCDS10869.1	16																																																																																			CDH1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000039068		0.505	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	81	0.00	0	-	NM_004360		68846048	68846049	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	frame_shift_ins	76	24.00	24	INS	0.000:0.000	G
CDH17	1015	genome.wustl.edu	37	8	95172318	95172318	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr8:95172318C>T	ENST00000027335.3	-	12	1556	c.1432G>A	c.(1432-1434)Gat>Aat	p.D478N	CDH17_ENST00000441892.2_Missense_Mutation_p.D264N|CDH17_ENST00000450165.2_Missense_Mutation_p.D478N	NM_004063.3	NP_004054.3	Q12864	CAD17_HUMAN	cadherin 17, LI cadherin (liver-intestine)	478	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|oligopeptide transmembrane transport (GO:0035672)|oligopeptide transport (GO:0006857)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)|transporter activity (GO:0005215)			NS(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(4)|stomach(2)	52	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			AATGGCTCATCAGCATCAGTG	0.463																																						dbGAP											0													122.0	122.0	122.0					8																	95172318		2203	4300	6503	-	-	-	SO:0001583	missense	0			X83228	CCDS6260.1	8q22.1	2010-01-26			ENSG00000079112	ENSG00000079112		"""Cadherins / Major cadherins"""	1756	protein-coding gene	gene with protein product		603017				9615235, 10191097	Standard	NM_004063		Approved	HPT-1, cadherin	uc003ygh.2	Q12864	OTTHUMG00000164391	ENST00000027335.3:c.1432G>A	8.37:g.95172318C>T	ENSP00000027335:p.Asp478Asn		Q15336|Q2M2E0	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.D478N	ENST00000027335.3	37	c.1432	CCDS6260.1	8	.	.	.	.	.	.	.	.	.	.	C	22.6	4.313699	0.81358	.	.	ENSG00000079112	ENST00000027335;ENST00000441892;ENST00000450165	T;T;T	0.74002	-0.8;-0.8;-0.8	5.27	5.27	0.74061	Cadherin (4);Cadherin-like (1);	0.000000	0.48767	D	0.000166	D	0.91081	0.7193	H	0.97516	4.02	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94004	0.7278	10	0.87932	D	0	-26.8169	15.8056	0.78506	0.0:1.0:0.0:0.0	.	264;478	E7EN24;Q12864	.;CAD17_HUMAN	N	478;264;478	ENSP00000027335:D478N;ENSP00000392811:D264N;ENSP00000401468:D478N	ENSP00000027335:D478N	D	-	1	0	CDH17	95241494	0.999000	0.42202	0.968000	0.41197	0.662000	0.39071	5.317000	0.65822	2.469000	0.83416	0.561000	0.74099	GAT	CDH17	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000079112		0.463	CDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH17	HGNC	protein_coding	OTTHUMT00000378560.1	44	0.00	0	C	NM_004063		95172318	95172318	-1	no_errors	ENST00000027335	ensembl	human	known	69_37n	missense	83	19.42	20	SNP	0.998	T
CDK11A	728642	genome.wustl.edu	37	1	1635286	1635286	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr1:1635286C>T	ENST00000378633.1	-	17	1976	c.1897G>A	c.(1897-1899)Gat>Aat	p.D633N	RP1-283E3.8_ENST00000598846.1_RNA|CDK11A_ENST00000358779.5_Missense_Mutation_p.D620N|CDK11A_ENST00000357760.2_Missense_Mutation_p.D629N|CDK11A_ENST00000356200.3_Missense_Mutation_p.D596N|CDK11A_ENST00000404249.3_Missense_Mutation_p.D630N|CDK11A_ENST00000495016.1_5'Flank|CDK11A_ENST00000378638.2_Missense_Mutation_p.D596N			Q9UQ88	CD11A_HUMAN	cyclin-dependent kinase 11A	633	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(4)|stomach(1)|urinary_tract(1)	18						TTGATCTGATCGATTTCCGAA	0.582																																					Pancreas(186;965 2119 30274 40311 50569)	dbGAP											0													79.0	83.0	82.0					1																	1635286		2011	4167	6178	-	-	-	SO:0001583	missense	0			AF067522	CCDS44042.1, CCDS44043.1	1p36.33	2011-11-08	2009-12-16	2009-12-16	ENSG00000008128	ENSG00000008128		"""Cyclin-dependent kinases"""	1730	protein-coding gene	gene with protein product		116951	"""cell division cycle 2-like 2"", ""cell division cycle 2-like 2 (PITSLRE proteins)"""	CDC2L3, CDC2L2		7920654, 9750192, 19884882	Standard	NM_033529		Approved	PITSLRE, CDK11-p110, CDK11-p58, CDK11-p46, p58GTA		Q9UQ88	OTTHUMG00000000703	ENST00000378633.1:c.1897G>A	1.37:g.1635286C>T	ENSP00000367900:p.Asp633Asn		O95227|O95228|O96012|Q12821|Q12853|Q12854|Q2TAJ0|Q5QPR0|Q5QPR1|Q5QPR2|Q9UBC4|Q9UBI3|Q9UEI1|Q9UEI2|Q9UP53|Q9UP54|Q9UP55|Q9UP56|Q9UQ86|Q9UQ87|Q9UQ89	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D630N	ENST00000378633.1	37	c.1888		1	.	.	.	.	.	.	.	.	.	.	-	13.44	2.238100	0.39598	.	.	ENSG00000008128	ENST00000356200;ENST00000404249;ENST00000357760;ENST00000358779;ENST00000378633;ENST00000378638;ENST00000378630	T;T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21;-0.21;-0.21	2.37	2.37	0.29283	.	0.043515	0.85682	D	0.000000	T	0.77260	0.4104	M	0.68952	2.095	0.80722	D	1	D;D;P	0.76494	0.999;0.999;0.646	D;D;B	0.74023	0.982;0.982;0.373	T	0.79783	-0.1658	10	0.87932	D	0	.	11.6771	0.51436	0.0:1.0:0.0:0.0	.	630;620;247	Q9UQ88-2;Q9UQ88-4;Q9UQ88-5	.;.;.	N	596;630;629;620;633;596;596	ENSP00000348529:D596N;ENSP00000384442:D630N;ENSP00000350403:D629N;ENSP00000351629:D620N;ENSP00000367900:D633N;ENSP00000367905:D596N	ENSP00000348529:D596N	D	-	1	0	CDK11A	1625146	1.000000	0.71417	0.569000	0.28460	0.008000	0.06430	5.191000	0.65110	1.345000	0.45676	0.486000	0.48141	GAT	CDK11A	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000008128		0.582	CDK11A-005	NOVEL	basic	protein_coding	CDK11A	HGNC	protein_coding	OTTHUMT00000001735.1	103	0.96	1	C	NM_024011		1635286	1635286	-1	no_errors	ENST00000404249	ensembl	human	known	69_37n	missense	146	17.51	31	SNP	1.000	T
CELSR3	1951	genome.wustl.edu	37	3	48696551	48696551	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr3:48696551G>C	ENST00000164024.4	-	1	3797	c.3517C>G	c.(3517-3519)Cag>Gag	p.Q1173E	CELSR3_ENST00000544264.1_Missense_Mutation_p.Q1173E	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	1173	Cadherin 9. {ECO:0000255|PROSITE- ProRule:PRU00043}.				axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		AAGAGGATCTGGAAGTTGTTG	0.557																																						dbGAP											0													146.0	142.0	144.0					3																	48696551		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.3517C>G	3.37:g.48696551G>C	ENSP00000164024:p.Gln1173Glu		O75092	Missense_Mutation	SNP	pfam_Cadherin,pfam_GPCR_2_secretin-like,pfam_Laminin_G,pfam_DUF3497,pfam_EGF-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.Q1173E	ENST00000164024.4	37	c.3517	CCDS2775.1	3	.	.	.	.	.	.	.	.	.	.	G	13.10	2.135403	0.37728	.	.	ENSG00000008300	ENST00000164024;ENST00000544264	T;T	0.68331	-0.32;-0.32	5.44	5.44	0.79542	Cadherin-like (1);	.	.	.	.	T	0.53094	0.1775	N	0.10629	0.01	0.80722	D	1	B;P	0.48089	0.224;0.905	B;P	0.46026	0.145;0.501	T	0.53012	-0.8498	9	0.18276	T	0.48	.	19.2719	0.94013	0.0:0.0:1.0:0.0	.	1173;1243	Q9NYQ7;Q5Y190	CELR3_HUMAN;.	E	1173	ENSP00000164024:Q1173E;ENSP00000445694:Q1173E	ENSP00000164024:Q1173E	Q	-	1	0	CELSR3	48671555	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.881000	0.87252	2.561000	0.86390	0.561000	0.74099	CAG	CELSR3	-	superfamily_Cadherin-like	ENSG00000008300		0.557	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR3	HGNC	protein_coding	OTTHUMT00000257523.1	21	0.00	0	G	NM_001407		48696551	48696551	-1	no_errors	ENST00000544264	ensembl	human	known	69_37n	missense	30	26.83	11	SNP	1.000	C
COPB2	9276	genome.wustl.edu	37	3	139092649	139092649	+	Splice_Site	SNP	T	T	C			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr3:139092649T>C	ENST00000333188.5	-	8	934	c.753A>G	c.(751-753)ggA>ggG	p.G251G	COPB2_ENST00000507777.1_Splice_Site_p.G222G	NM_004766.2	NP_004757.1	P35606	COPB2_HUMAN	coatomer protein complex, subunit beta 2 (beta prime)	251					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)	structural molecule activity (GO:0005198)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	24						TACGTACTGTTCCTAAAAAGA	0.418																																						dbGAP											0													95.0	83.0	87.0					3																	139092649		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC000326	CCDS3108.1	3q23	2013-01-10			ENSG00000184432	ENSG00000184432		"""WD repeat domain containing"""	2232	protein-coding gene	gene with protein product		606990				9858824	Standard	NM_004766		Approved	beta'-COP, betaprime-COP	uc003etf.4	P35606	OTTHUMG00000159959	ENST00000333188.5:c.752-1A>G	3.37:g.139092649T>C			B4DZI8	Silent	SNP	pirsf_Coatomer_b'su,pfam_Coatomer_WD-assoc_reg,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G251	ENST00000333188.5	37	c.753	CCDS3108.1	3																																																																																			COPB2	-	pirsf_Coatomer_b'su,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000184432		0.418	COPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPB2	HGNC	protein_coding	OTTHUMT00000358495.2	22	0.00	0	T	NM_004766	Silent	139092649	139092649	-1	no_errors	ENST00000333188	ensembl	human	known	69_37n	silent	25	19.35	6	SNP	0.938	C
CORO2B	10391	genome.wustl.edu	37	15	69004035	69004035	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr15:69004035G>A	ENST00000566799.1	+	5	667	c.638G>A	c.(637-639)cGt>cAt	p.R213H	CORO2B_ENST00000540068.1_Missense_Mutation_p.R208H|CORO2B_ENST00000261861.5_Missense_Mutation_p.R208H|CORO2B_ENST00000543950.1_Missense_Mutation_p.R208H			Q9UQ03	COR2B_HUMAN	coronin, actin binding protein, 2B	213					actin cytoskeleton organization (GO:0030036)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|membrane (GO:0016020)	actin binding (GO:0003779)|actin filament binding (GO:0051015)			kidney(3)|large_intestine(13)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36						CGCTCTGGCCGTGTTCTGCAG	0.557																																						dbGAP											0													75.0	66.0	69.0					15																	69004035		2200	4298	6498	-	-	-	SO:0001583	missense	0			AB010098	CCDS53952.1, CCDS10229.2	15q22.31	2013-01-10	2001-11-28		ENSG00000103647	ENSG00000103647		"""Coronins"", ""WD repeat domain containing"""	2256	protein-coding gene	gene with protein product	"""clipin C"", ""coronin, actin-binding, 2B"""	605002	"""coronin, actin-binding protein, 2B"""			10224093, 10231032	Standard	NM_001190456		Approved	ClipinC, KIAA0925	uc021spj.1	Q9UQ03	OTTHUMG00000133288	ENST00000566799.1:c.638G>A	15.37:g.69004035G>A	ENSP00000454783:p.Arg213His		A8K0W3|O94767|Q8TAN1	Missense_Mutation	SNP	pfam_DUF1900,pfam_DUF1899,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R213H	ENST00000566799.1	37	c.638	CCDS10229.2	15	.	.	.	.	.	.	.	.	.	.	G	15.23	2.773101	0.49680	.	.	ENSG00000103647	ENST00000261861;ENST00000540068;ENST00000543950	T;T	0.07114	3.22;3.22	5.68	4.74	0.60224	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.407010	0.27710	N	0.018180	T	0.10809	0.0264	L	0.52011	1.625	0.46849	D	0.999224	B	0.06786	0.001	B	0.06405	0.002	T	0.03268	-1.1054	10	0.48119	T	0.1	-17.5154	14.8688	0.70437	0.0:0.0:0.8554:0.1446	.	213	Q9UQ03	COR2B_HUMAN	H	213;208;208	ENSP00000446250:R208H;ENSP00000443819:R208H	ENSP00000261861:R213H	R	+	2	0	CORO2B	66791089	0.902000	0.30710	0.984000	0.44739	0.992000	0.81027	1.624000	0.37018	1.349000	0.45751	0.561000	0.74099	CGT	CORO2B	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000103647		0.557	CORO2B-203	KNOWN	basic|CCDS	protein_coding	CORO2B	HGNC	protein_coding		16	0.00	0	G	NM_006091		69004035	69004035	+1	no_errors	ENST00000566799	ensembl	human	known	69_37n	missense	43	17.31	9	SNP	0.939	A
CPN2	1370	genome.wustl.edu	37	3	194062061	194062061	+	Silent	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr3:194062061C>T	ENST00000323830.3	-	2	1460	c.1371G>A	c.(1369-1371)acG>acA	p.T457T	CPN2_ENST00000429275.1_Silent_p.T457T	NM_001080513.2	NP_001073982	P22792	CPN2_HUMAN	carboxypeptidase N, polypeptide 2	457					protein stabilization (GO:0050821)|regulation of catalytic activity (GO:0050790)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	enzyme regulator activity (GO:0030234)			breast(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|ovary(5)|prostate(1)	27	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.65e-05)		CGTCCGGCCACGTGACCTGGA	0.667																																						dbGAP											0													67.0	70.0	69.0					3																	194062061		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			J05158	CCDS33920.1	3q29	2012-02-10	2007-02-23		ENSG00000178772	ENSG00000178772	3.4.17.3		2313	protein-coding gene	gene with protein product		603104	"""carboxypeptidase N, polypeptide 2, 83kD"""	ACBP		2378615, 9628828	Standard	XM_005269280		Approved		uc003fts.3	P22792	OTTHUMG00000156047	ENST00000323830.3:c.1371G>A	3.37:g.194062061C>T			B2RPE7|Q86SU4|Q8N5V4	Silent	SNP	pfam_Leu-rich_rpt,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.T457	ENST00000323830.3	37	c.1371	CCDS33920.1	3																																																																																			CPN2	-	NULL	ENSG00000178772		0.667	CPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPN2	HGNC	protein_coding	OTTHUMT00000342856.2	27	0.00	0	C	NM_001080513		194062061	194062061	-1	no_errors	ENST00000323830	ensembl	human	known	69_37n	silent	51	17.74	11	SNP	0.000	T
CSF3	1440	genome.wustl.edu	37	17	38172018	38172018	+	Missense_Mutation	SNP	C	C	G	rs543073657		TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr17:38172018C>G	ENST00000225474.2	+	2	146	c.115C>G	c.(115-117)Ctg>Gtg	p.L39V	CSF3_ENST00000394149.3_Missense_Mutation_p.L39V|CSF3_ENST00000331769.2_Missense_Mutation_p.L35V|RP11-387H17.6_ENST00000583462.1_lincRNA|CSF3_ENST00000577675.1_Missense_Mutation_p.L35V|CSF3_ENST00000394148.3_Missense_Mutation_p.L39V			P09919	CSF3_HUMAN	colony stimulating factor 3 (granulocyte)	39					cellular response to cytokine stimulus (GO:0071345)|cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|granulocyte differentiation (GO:0030851)|immune response (GO:0006955)|multicellular organismal development (GO:0007275)|negative regulation of neuron death (GO:1901215)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell proliferation (GO:0008284)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)|enzyme binding (GO:0019899)|granulocyte colony-stimulating factor receptor binding (GO:0005130)			endometrium(1)|ovary(1)|prostate(1)	3	Colorectal(19;0.000442)	Myeloproliferative disorder(1115;0.0255)				TGCCAGCTCCCTGCCCCAGAG	0.647													C|||	1	0.000199681	0.0	0.0	5008	,	,		18425	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													26.0	25.0	25.0					17																	38172018		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS11357.1, CCDS11358.1, CCDS42314.1, CCDS11358.2	17q11.2-q12	2014-01-30			ENSG00000108342	ENSG00000108342		"""Endogenous ligands"""	2438	protein-coding gene	gene with protein product	"""granulocyte colony stimulating factor"", ""pluripoietin"", ""filgrastim"", ""lenograstim"""	138970	"""chromosome 17 open reading frame 33"""	GCSF, G-CSF, C17orf33		3499671, 3501046	Standard	NM_000759		Approved	MGC45931	uc002htp.3	P09919	OTTHUMG00000133247	ENST00000225474.2:c.115C>G	17.37:g.38172018C>G	ENSP00000225474:p.Leu39Val		A8MXR7	Missense_Mutation	SNP	pfam_IL6_MGF_GCSF,superfamily_4_helix_cytokine-like_core,smart_IL6_MGF_GCSF,pirsf_IL6_MGF_GCSF,prints_IL6_MGF_GCSF	p.L39V	ENST00000225474.2	37	c.115	CCDS11357.1	17	.	.	.	.	.	.	.	.	.	.	C	15.92	2.976674	0.53720	.	.	ENSG00000108342	ENST00000394149;ENST00000225474;ENST00000331769;ENST00000394148	T;T;T;T	0.34072	1.38;1.38;1.38;1.38	5.6	5.6	0.85130	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.603585	0.16253	N	0.222610	T	0.48447	0.1500	M	0.62723	1.935	0.25417	N	0.988307	D;B;B;B	0.56521	0.976;0.365;0.365;0.365	P;B;B;B	0.51833	0.681;0.29;0.29;0.29	T	0.43393	-0.9394	10	0.25751	T	0.34	-11.8315	17.1313	0.86727	0.0:1.0:0.0:0.0	.	35;35;39;39	B4DNY7;Q8N4W3;P09919;Q6FH65	.;.;CSF3_HUMAN;.	V	39;39;35;39	ENSP00000377705:L39V;ENSP00000225474:L39V;ENSP00000327766:L35V;ENSP00000377704:L39V	ENSP00000225474:L39V	L	+	1	2	CSF3	35425544	0.414000	0.25408	0.374000	0.26016	0.986000	0.74619	4.034000	0.57289	2.650000	0.89964	0.561000	0.74099	CTG	CSF3	-	superfamily_4_helix_cytokine-like_core,pirsf_IL6_MGF_GCSF	ENSG00000108342		0.647	CSF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CSF3	HGNC	protein_coding	OTTHUMT00000256988.2	26	0.00	0	C	NM_172220		38172018	38172018	+1	no_errors	ENST00000225474	ensembl	human	known	69_37n	missense	21	22.22	6	SNP	0.491	G
CYFIP1	23191	genome.wustl.edu	37	15	22933648	22933648	+	Silent	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr15:22933648G>A	ENST00000313077.7	+	7	782	c.657G>A	c.(655-657)aaG>aaA	p.K219K	CYFIP1_ENST00000560848.1_Silent_p.K219K	NM_014608.2	NP_055423.1			cytoplasmic FMR1 interacting protein 1											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(1)|lung(14)|ovary(4)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	40		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		ATCATAACAAGATCACACAGG	0.517																																						dbGAP											0													104.0	89.0	94.0					15																	22933648		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D38549	CCDS73695.1, CCDS73696.1	15q11	2008-07-18			ENSG00000068793	ENSG00000273749			13759	protein-coding gene	gene with protein product	"""selective hybridizing clone"", ""cytoplasmic FMRP interacting protein 1"""	606322				11438699	Standard	XM_005272543		Approved	KIAA0068, P140SRA-1, SHYC	uc001yus.3	Q7L576	OTTHUMG00000129100	ENST00000313077.7:c.657G>A	15.37:g.22933648G>A				Silent	SNP	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub,prints_Cytoplasmic_FMR1-int	p.K219	ENST00000313077.7	37	c.657	CCDS10009.1	15																																																																																			CYFIP1	-	pirsf_Cytoplasmic_FMR1-int_sub	ENSG00000068793		0.517	CYFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYFIP1	HGNC	protein_coding	OTTHUMT00000251136.2	43	0.00	0	G	NM_014608		22933648	22933648	+1	no_errors	ENST00000313077	ensembl	human	known	69_37n	silent	39	17.02	8	SNP	1.000	A
DLG2	1740	genome.wustl.edu	37	11	83984229	83984229	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr11:83984229G>A	ENST00000418306.2	-	1	94	c.70C>T	c.(70-72)Caa>Taa	p.Q24*	DLG2_ENST00000398301.2_Intron|DLG2_ENST00000398309.2_Intron|DLG2_ENST00000543673.1_Intron|DLG2_ENST00000524982.1_Intron|DLG2_ENST00000376104.2_Intron|DLG2_ENST00000280241.8_Intron|DLG2_ENST00000531015.1_Nonsense_Mutation_p.Q24*|DLG2_ENST00000537455.1_5'UTR|DLG2_ENST00000532653.1_Intron|DLG2_ENST00000376106.3_5'UTR|DLG2_ENST00000330014.6_5'UTR	NM_001142700.1	NP_001136172.1	Q14168	MPP2_HUMAN	discs, large homolog 2 (Drosophila)	0	L27 1. {ECO:0000255|PROSITE- ProRule:PRU00365}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(11)|lung(35)|ovary(3)|pancreas(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	71		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				TGTTCACATTGTTTTAAGGAA	0.378																																						dbGAP											0													48.0	46.0	47.0					11																	83984229		1567	3581	5148	-	-	-	SO:0001587	stop_gained	0			U32376	CCDS41696.1, CCDS44690.1, CCDS44691.1, CCDS44692.1, CCDS55782.1, CCDS73357.1	11q21	2012-04-17	2008-12-15		ENSG00000150672	ENSG00000150672		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	2901	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 58"""	603583	"""discs, large homolog 2, chapsyn-110 (Drosophila)"""			8755482, 9806853	Standard	NM_001142702		Approved	PSD-93, PSD93, chapsyn-110, PPP1R58	uc001pak.2	Q15700	OTTHUMG00000134309	ENST00000418306.2:c.70C>T	11.37:g.83984229G>A	ENSP00000402275:p.Gln24*		B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Nonsense_Mutation	SNP	pfam_PDZ,pfam_Guanylate_kin,pfam_PDZ_assoc,pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_PDZ,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pirsf_M-assoc_guanylate_kinase,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin	p.Q24*	ENST00000418306.2	37	c.70	CCDS44691.1	11	.	.	.	.	.	.	.	.	.	.	G	37	6.458029	0.97581	.	.	ENSG00000150672	ENST00000418306;ENST00000531015	.	.	.	5.78	3.74	0.42951	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.6197	0.28179	0.0:0.1373:0.5958:0.2669	.	.	.	.	X	24	.	.	Q	-	1	0	DLG2	83661877	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.343000	0.52167	1.413000	0.46997	0.650000	0.86243	CAA	DLG2	-	superfamily_PDZ,pirsf_M-assoc_guanylate_kinase	ENSG00000150672		0.378	DLG2-013	KNOWN	basic|CCDS	protein_coding	DLG2	HGNC	protein_coding	OTTHUMT00000393436.1	36	0.00	0	G	NM_001364		83984229	83984229	-1	no_errors	ENST00000418306	ensembl	human	known	69_37n	nonsense	44	13.73	7	SNP	1.000	A
DUSP27	92235	genome.wustl.edu	37	1	167096565	167096565	+	Missense_Mutation	SNP	G	G	A	rs552291779		TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr1:167096565G>A	ENST00000361200.2	+	6	2363	c.2197G>A	c.(2197-2199)Gag>Aag	p.E733K	DUSP27_ENST00000443333.1_Missense_Mutation_p.E733K|DUSP27_ENST00000271385.5_Missense_Mutation_p.E733K|DUSP27_ENST00000485151.1_Intron			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	733					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						TGTAGTCAGTGAGACCCTTGC	0.552																																						dbGAP											0													102.0	87.0	92.0					1																	167096565		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.2197G>A	1.37:g.167096565G>A	ENSP00000354483:p.Glu733Lys		A0AUM4|Q9C074	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP,prints_Atypical_DUSP_famA	p.E733K	ENST00000361200.2	37	c.2197	CCDS30932.1	1	.	.	.	.	.	.	.	.	.	.	G	18.83	3.707633	0.68615	.	.	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	T;T;T	0.09350	2.99;2.99;2.99	4.92	4.92	0.64577	.	0.667620	0.13759	N	0.364717	T	0.27241	0.0668	M	0.71581	2.175	0.54753	D	0.999984	D	0.76494	0.999	D	0.80764	0.994	T	0.01635	-1.1307	10	0.87932	D	0	-24.5761	18.3196	0.90232	0.0:0.0:1.0:0.0	.	733	Q5VZP5	DUS27_HUMAN	K	733	ENSP00000354483:E733K;ENSP00000271385:E733K;ENSP00000404874:E733K	ENSP00000271385:E733K	E	+	1	0	DUSP27	165363189	1.000000	0.71417	0.924000	0.36721	0.468000	0.32798	9.254000	0.95512	2.535000	0.85469	0.643000	0.83706	GAG	DUSP27	-	NULL	ENSG00000198842		0.552	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP27	HGNC	protein_coding	OTTHUMT00000083244.1	25	0.00	0	G	NM_001080426		167096565	167096565	+1	no_errors	ENST00000271385	ensembl	human	known	69_37n	missense	49	22.22	14	SNP	1.000	A
EEF2	1938	genome.wustl.edu	37	19	3982831	3982831	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr19:3982831C>T	ENST00000309311.6	-	4	674	c.586G>A	c.(586-588)Gag>Aag	p.E196K	SNORD37_ENST00000384048.1_RNA|EEF2_ENST00000600720.1_5'Flank	NM_001961.3	NP_001952.1	P13639	EF2_HUMAN	eukaryotic translation elongation factor 2	196	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|hematopoietic progenitor cell differentiation (GO:0002244)|positive regulation of gene expression (GO:0010628)|positive regulation of translation (GO:0045727)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation activator activity (GO:0008494)|translation elongation factor activity (GO:0003746)			endometrium(4)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|GBM - Glioblastoma multiforme(1328;0.0223)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGCCGCTCTCGCCCTCGCCG	0.652																																					Colon(165;1804 1908 4071 6587 18799)	dbGAP											0													56.0	41.0	46.0					19																	3982831		2202	4300	6502	-	-	-	SO:0001583	missense	0			Z11692	CCDS12117.1	19p13.3	2012-09-20			ENSG00000167658	ENSG00000167658			3214	protein-coding gene	gene with protein product	"""polypeptidyl-tRNA translocase"""	130610		EF2		2610926, 6427766	Standard	NM_001961		Approved	EEF-2	uc002lze.3	P13639		ENST00000309311.6:c.586G>A	19.37:g.3982831C>T	ENSP00000307940:p.Glu196Lys		B2RMP5|D6W618|Q58J86	Missense_Mutation	SNP	pfam_ProtSyn_GTP-bd,pfam_Transl_elong_EFG/EF2_IV,pfam_Transl_elong_EFG/EF2_C,pfam_Transl_elong_EFTu/EF1A_2,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_Transl_elong_init/rib_B-barrel,superfamily_Elongation_fac_G/III/V,smart_Transl_elong_EFG/EF2_IV,smart_Transl_elong_EFG/EF2_C,prints_ProtSyn_GTP-bd,tigrfam_Small_GTP-bd_dom	p.E196K	ENST00000309311.6	37	c.586	CCDS12117.1	19	.	.	.	.	.	.	.	.	.	.	C	22.7	4.329978	0.81690	.	.	ENSG00000167658	ENST00000543343;ENST00000309311	T	0.29917	1.55	5.25	5.25	0.73442	Protein synthesis factor, GTP-binding (1);	0.000000	0.85682	D	0.000000	T	0.29556	0.0737	L	0.42245	1.32	0.80722	D	1	B	0.28178	0.202	B	0.19946	0.027	T	0.07046	-1.0793	10	0.59425	D	0.04	-66.7525	17.8232	0.88656	0.0:1.0:0.0:0.0	.	196	P13639	EF2_HUMAN	K	196	ENSP00000307940:E196K	ENSP00000307940:E196K	E	-	1	0	EEF2	3933831	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.769000	0.85360	2.440000	0.82611	0.561000	0.74099	GAG	EEF2	-	pfam_ProtSyn_GTP-bd	ENSG00000167658		0.652	EEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEF2	HGNC	protein_coding	OTTHUMT00000457615.2	34	0.00	0	C	NM_001961		3982831	3982831	-1	no_errors	ENST00000309311	ensembl	human	known	69_37n	missense	44	22.41	13	SNP	1.000	T
EFCAB3	146779	genome.wustl.edu	37	17	60451215	60451215	+	Silent	SNP	G	G	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr17:60451215G>T	ENST00000450662.2	+	2	146	c.75G>T	c.(73-75)ctG>ctT	p.L25L		NM_001144933.1	NP_001138405.1	Q8N7B9	EFCB3_HUMAN	EF-hand calcium binding domain 3	0							calcium ion binding (GO:0005509)			cervix(1)|endometrium(2)|large_intestine(5)|lung(6)|skin(3)	17			BRCA - Breast invasive adenocarcinoma(2;2.27e-11)			TGGAGGGCCTGAAGAAGTTTA	0.264																																						dbGAP											0													38.0	33.0	35.0					17																	60451215		692	1580	2272	-	-	-	SO:0001819	synonymous_variant	0			AK098684	CCDS11632.1, CCDS45751.1	17q23.3	2013-01-10			ENSG00000172421	ENSG00000172421		"""EF-hand domain containing"""	26379	protein-coding gene	gene with protein product						12477932	Standard	NM_173503		Approved	FLJ25818	uc010wpc.2	Q8N7B9	OTTHUMG00000179175	ENST00000450662.2:c.75G>T	17.37:g.60451215G>T			J3KQM8	Silent	SNP	pfscan_EF_HAND_2	p.L25	ENST00000450662.2	37	c.75	CCDS45751.1	17																																																																																			EFCAB3	-	NULL	ENSG00000172421		0.264	EFCAB3-002	KNOWN	basic|CCDS	protein_coding	EFCAB3	HGNC	protein_coding	OTTHUMT00000379315.1	62	0.00	0	G	NM_173503		60451215	60451215	+1	no_errors	ENST00000450662	ensembl	human	known	69_37n	silent	43	12.24	6	SNP	1.000	T
EIF3A	8661	genome.wustl.edu	37	10	120801560	120801560	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr10:120801560G>C	ENST00000369144.3	-	19	3599	c.3472C>G	c.(3472-3474)Ccc>Gcc	p.P1158A	EIF3A_ENST00000541549.1_Missense_Mutation_p.P1124A	NM_003750.2	NP_003741.1	P56537	IF6_HUMAN	eukaryotic translation initiation factor 3, subunit A	0					mature ribosome assembly (GO:0042256)|ribosomal large subunit biogenesis (GO:0042273)|ribosomal subunit export from nucleus (GO:0000054)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lamin filament (GO:0005638)|nucleus (GO:0005634)	ribosomal large subunit binding (GO:0043023)|ribosome binding (GO:0043022)|translation initiation factor activity (GO:0003743)			endometrium(8)|kidney(4)|large_intestine(14)|lung(22)|prostate(1)|skin(4)|urinary_tract(3)	56		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)		CCCCGTCTGGGAAACCGATCA	0.473																																						dbGAP											0													139.0	110.0	120.0					10																	120801560		2203	4300	6503	-	-	-	SO:0001583	missense	0			U78311	CCDS7608.1	10q26.11	2007-08-03	2007-07-27	2007-07-27	ENSG00000107581	ENSG00000107581			3271	protein-coding gene	gene with protein product		602039	"""eukaryotic translation initiation factor 3, subunit 10 theta, 150/170kDa"""	EIF3, EIF3S10		9054404, 8590280	Standard	NM_003750		Approved	eIF3-theta, eIF3-p170, KIAA0139, eIF3a, TIF32	uc001ldu.3	Q14152	OTTHUMG00000019144	ENST00000369144.3:c.3472C>G	10.37:g.120801560G>C	ENSP00000358140:p.Pro1158Ala		B7ZBG9|Q6IBN8|Q96TD5	Missense_Mutation	SNP	pfam_PCI_dom,smart_PCI_dom	p.P1158A	ENST00000369144.3	37	c.3472	CCDS7608.1	10	.	.	.	.	.	.	.	.	.	.	G	8.177	0.793054	0.16327	.	.	ENSG00000107581	ENST00000369144;ENST00000541549	T;T	0.34859	1.34;1.35	5.52	1.44	0.22558	.	0.000000	0.39210	N	0.001435	T	0.26557	0.0649	L	0.57536	1.79	0.27695	N	0.945979	P;P	0.39326	0.668;0.595	B;B	0.37267	0.245;0.138	T	0.30031	-0.9992	10	0.05620	T	0.96	-1.2732	9.8851	0.41257	0.2875:0.0:0.7125:0.0	.	1124;1158	F5H335;Q14152	.;EIF3A_HUMAN	A	1158;1124	ENSP00000358140:P1158A;ENSP00000438178:P1124A	ENSP00000358140:P1158A	P	-	1	0	EIF3A	120791550	0.979000	0.34478	0.348000	0.25681	0.296000	0.27459	1.753000	0.38359	0.258000	0.21686	-0.137000	0.14449	CCC	EIF3A	-	NULL	ENSG00000107581		0.473	EIF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF3A	HGNC	protein_coding	OTTHUMT00000050634.1	30	0.00	0	G	NM_003750		120801560	120801560	-1	no_errors	ENST00000369144	ensembl	human	known	69_37n	missense	50	25.37	17	SNP	0.969	C
ERBB2	2064	genome.wustl.edu	37	17	37868193	37868193	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr17:37868193C>G	ENST00000269571.5	+	8	1073	c.914C>G	c.(913-915)tCt>tGt	p.S305C	ERBB2_ENST00000406381.2_Missense_Mutation_p.S275C|ERBB2_ENST00000540042.1_Missense_Mutation_p.S275C|ERBB2_ENST00000584601.1_Missense_Mutation_p.S275C|ERBB2_ENST00000578199.1_Missense_Mutation_p.S275C|ERBB2_ENST00000584450.1_Missense_Mutation_p.S305C|ERBB2_ENST00000541774.1_Missense_Mutation_p.S290C|ERBB2_ENST00000540147.1_Missense_Mutation_p.S275C|ERBB2_ENST00000445658.2_Missense_Mutation_p.S29C			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	305					axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	AACTACCTTTCTACGGACGTG	0.557		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																												dbGAP		Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	0													288.0	239.0	256.0					17																	37868193		2203	4300	6503	-	-	-	SO:0001583	missense	0			X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.914C>G	17.37:g.37868193C>G	ENSP00000269571:p.Ser305Cys		B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Missense_Mutation	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S305C	ENST00000269571.5	37	c.914	CCDS32642.1	17	.	.	.	.	.	.	.	.	.	.	C	12.54	1.969261	0.34754	.	.	ENSG00000141736	ENST00000406381;ENST00000541774;ENST00000445658;ENST00000269571;ENST00000540147;ENST00000540042	T;T;T;T;T;T	0.62639	0.01;0.01;0.01;0.01;0.01;0.01	5.83	5.83	0.93111	Growth factor, receptor (1);Furin-like cysteine-rich domain (1);	.	.	.	.	T	0.68540	0.3012	N	0.22421	0.69	0.49915	D	0.999833	P;D;D;P;D	0.67145	0.849;0.967;0.967;0.924;0.996	B;P;P;P;D	0.64877	0.399;0.666;0.645;0.724;0.93	T	0.71876	-0.4460	9	0.87932	D	0	.	18.8848	0.92372	0.0:1.0:0.0:0.0	.	29;275;290;305;305	B4DTR1;F5H1T4;P04626-4;P04626;Q9UK79	.;.;.;ERBB2_HUMAN;.	C	275;290;29;305;275;275	ENSP00000385185:S275C;ENSP00000446466:S290C;ENSP00000404047:S29C;ENSP00000269571:S305C;ENSP00000443562:S275C;ENSP00000446382:S275C	ENSP00000269571:S305C	S	+	2	0	ERBB2	35121719	0.999000	0.42202	0.733000	0.30861	0.461000	0.32589	4.473000	0.60196	2.766000	0.95052	0.491000	0.48974	TCT	ERBB2	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Furin-like_Cys-rich_dom,superfamily_Growth_fac_rcpt	ENSG00000141736		0.557	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	ERBB2	HGNC	protein_coding	OTTHUMT00000445621.2	43	0.00	0	C			37868193	37868193	+1	no_errors	ENST00000269571	ensembl	human	known	69_37n	missense	60	33.33	30	SNP	1.000	G
ERBB2	2064	genome.wustl.edu	37	17	37868682	37868682	+	Silent	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr17:37868682C>T	ENST00000269571.5	+	9	1288	c.1129C>T	c.(1129-1131)Ctg>Ttg	p.L377L	ERBB2_ENST00000406381.2_Silent_p.L347L|ERBB2_ENST00000540042.1_Silent_p.L347L|ERBB2_ENST00000584601.1_Silent_p.L347L|ERBB2_ENST00000578199.1_Silent_p.L347L|ERBB2_ENST00000584450.1_Silent_p.L377L|ERBB2_ENST00000541774.1_Silent_p.L362L|ERBB2_ENST00000540147.1_Silent_p.L347L|ERBB2_ENST00000445658.2_Silent_p.L101L			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	377					axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	CCTGGCATTTCTGCCGGAGAG	0.557		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																												dbGAP		Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	0													62.0	50.0	54.0					17																	37868682		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.1129C>T	17.37:g.37868682C>T			B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Silent	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L377	ENST00000269571.5	37	c.1129	CCDS32642.1	17																																																																																			ERBB2	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_EGF_rcpt_L	ENSG00000141736		0.557	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	ERBB2	HGNC	protein_coding	OTTHUMT00000445621.2	23	0.00	0	C			37868682	37868682	+1	no_errors	ENST00000269571	ensembl	human	known	69_37n	silent	27	15.62	5	SNP	1.000	T
AMER1	139285	genome.wustl.edu	37	X	63410388	63410388	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chrX:63410388C>A	ENST00000330258.3	-	2	3051	c.2779G>T	c.(2779-2781)Gat>Tat	p.D927Y	AMER1_ENST00000374869.3_Intron|AMER1_ENST00000403336.1_Intron	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	927					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)									TCATCTGAATCTTCCTGCTGG	0.577																																						dbGAP											67	Whole gene deletion(67)	kidney(65)|ovary(1)|large_intestine(1)											54.0	52.0	53.0					X																	63410388		2008	4159	6167	-	-	-	SO:0001583	missense	0			AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.2779G>T	X.37:g.63410388C>A	ENSP00000329117:p.Asp927Tyr		A2IB86|Q8N885	Missense_Mutation	SNP	pfam_Uncharacterised_FAM123	p.D927Y	ENST00000330258.3	37	c.2779	CCDS14377.2	X	.	.	.	.	.	.	.	.	.	.	C	11.25	1.582628	0.28180	.	.	ENSG00000184675	ENST00000330258	T	0.56444	0.46	4.26	3.4	0.38934	.	1.436590	0.04993	N	0.467737	T	0.39064	0.1064	L	0.27053	0.805	0.80722	D	1	B	0.29162	0.235	B	0.25405	0.06	T	0.17258	-1.0375	9	.	.	.	-11.2245	6.6556	0.22986	0.1771:0.7222:0.0:0.1007	.	927	Q5JTC6	F123B_HUMAN	Y	927	ENSP00000329117:D927Y	.	D	-	1	0	FAM123B	63327113	1.000000	0.71417	0.999000	0.59377	0.642000	0.38348	1.684000	0.37649	1.163000	0.42636	-0.297000	0.09499	GAT	FAM123B	-	NULL	ENSG00000184675		0.577	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM123B	HGNC	protein_coding	OTTHUMT00000316584.1	59	0.00	0	C	NM_152424		63410388	63410388	-1	no_errors	ENST00000330258	ensembl	human	known	69_37n	missense	74	12.94	11	SNP	1.000	A
FAM127A	8933	genome.wustl.edu	37	X	134167088	134167088	+	3'UTR	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chrX:134167088C>T	ENST00000257013.7	+	0	756				FAM127A_ENST00000464369.1_Intron	NM_001078171.1	NP_001071639.1	O15255	CXX1_HUMAN	family with sequence similarity 127, member A							plasma membrane (GO:0005886)				endometrium(3)|urinary_tract(1)	4	Acute lymphoblastic leukemia(192;0.000127)					AGACCACCCACTGCCGCCGCT	0.627																																						dbGAP											0													63.0	66.0	65.0					X																	134167088		692	1591	2283	-	-	-	SO:0001624	3_prime_UTR_variant	0			Y13374	CCDS43997.1	Xq26	2014-05-16	2006-11-16	2006-11-16	ENSG00000134590	ENSG00000134590			2569	protein-coding gene	gene with protein product		300213	"""CAAX box 1"""	CXX1		9403077, 15716091, 16093683	Standard	NM_001078171		Approved	Mart8, Mar8, MAR8C	uc004eyd.3	A6ZKI3	OTTHUMG00000022465	ENST00000257013.7:c.*333C>T	X.37:g.134167088C>T			Q6IBF1	RNA	SNP	-	NULL	ENST00000257013.7	37	NULL	CCDS43997.1	X																																																																																			FAM127A	-	-	ENSG00000134590		0.627	FAM127A-002	NOVEL	basic|appris_principal|CCDS	protein_coding	FAM127A	HGNC	protein_coding	OTTHUMT00000058391.2	37	0.00	0	C	NM_001078171		134167088	134167088	+1	no_errors	ENST00000495563	ensembl	human	known	69_37n	rna	76	10.59	9	SNP	0.000	T
GAREM	64762	genome.wustl.edu	37	18	29890260	29890260	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr18:29890260G>A	ENST00000269209.6	-	3	292	c.289C>T	c.(289-291)Cga>Tga	p.R97*	GAREM_ENST00000399218.4_Nonsense_Mutation_p.R97*|GAREM_ENST00000578619.1_5'UTR			Q9H706	GAREM_HUMAN	GRB2 associated, regulator of MAPK1	97	CABIT.				cellular response to epidermal growth factor stimulus (GO:0071364)|epidermal growth factor receptor signaling pathway (GO:0007173)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)										TTTATATCTCGGTCTTGTTCC	0.448																																						dbGAP											0													192.0	173.0	179.0					18																	29890260		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK025263	CCDS11905.1, CCDS56057.1	18q12.1	2012-11-30	2012-11-30	2012-11-30	ENSG00000141441	ENSG00000141441			26136	protein-coding gene	gene with protein product	"""Grb2-associated and regulator of Erk/MAPK"""		"""chromosome 18 open reading frame 11"", ""family with sequence similarity 59, member A"""	C18orf11, FAM59A		19509291	Standard	NM_001242409		Approved	FLJ21610	uc002kxl.3	Q9H706	OTTHUMG00000132273	ENST00000269209.6:c.289C>T	18.37:g.29890260G>A	ENSP00000269209:p.Arg97*		Q0VAG3|Q0VAG4|Q8ND03|Q9BSF5	Nonsense_Mutation	SNP	superfamily_SAM/pointed	p.R97*	ENST00000269209.6	37	c.289	CCDS56057.1	18	.	.	.	.	.	.	.	.	.	.	G	37	6.113059	0.97296	.	.	ENSG00000141441	ENST00000399218;ENST00000269209	.	.	.	5.76	3.92	0.45320	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.8375	15.0704	0.72030	0.0:0.0:0.7518:0.2482	.	.	.	.	X	97	.	ENSP00000269209:R97X	R	-	1	2	FAM59A	28144258	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.050000	0.57404	0.730000	0.32425	0.655000	0.94253	CGA	FAM59A	-	NULL	ENSG00000141441		0.448	GAREM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM59A	HGNC	protein_coding	OTTHUMT00000255365.1	46	0.00	0	G	NM_022751		29890260	29890260	-1	no_errors	ENST00000269209	ensembl	human	known	69_37n	nonsense	53	26.39	19	SNP	1.000	A
FAM65C	140876	genome.wustl.edu	37	20	49225878	49225878	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr20:49225878C>T	ENST00000327979.2	-	8	991	c.580G>A	c.(580-582)Gag>Aag	p.E194K	FAM65C_ENST00000535356.1_Missense_Mutation_p.E198K|FAM65C_ENST00000045083.2_Missense_Mutation_p.E194K			Q96MK2	FA65C_HUMAN	family with sequence similarity 65, member C	194										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(1)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						AGGGCCCCCTCGATGAGCCAC	0.647																																						dbGAP											0													44.0	48.0	47.0					20																	49225878		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL133230	CCDS13431.2	20q13.13	2011-11-24	2008-06-13	2008-06-13	ENSG00000042062	ENSG00000042062			16168	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 175"", ""chromosome 20 open reading frame 176"""	C20orf175, C20orf176			Standard	XM_005260294		Approved	dJ530I15.2, dJ530I15.3	uc002xvm.3	Q96MK2	OTTHUMG00000032724	ENST00000327979.2:c.580G>A	20.37:g.49225878C>T	ENSP00000332663:p.Glu194Lys		Q5QPB6|Q9NQQ2	Missense_Mutation	SNP	superfamily_ARM-type_fold,superfamily_Chemokine_IL8-like_dom	p.E198K	ENST00000327979.2	37	c.592	CCDS13431.2	20	.	.	.	.	.	.	.	.	.	.	C	34	5.352723	0.95830	.	.	ENSG00000042062	ENST00000327979;ENST00000045083;ENST00000535356	T;T;T	0.02345	4.33;4.33;4.33	4.78	4.78	0.61160	.	0.000000	0.85682	D	0.000000	T	0.16727	0.0402	M	0.81942	2.565	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.00557	-1.1672	10	0.87932	D	0	-27.9818	16.5839	0.84722	0.0:1.0:0.0:0.0	.	198;194	F5H0X2;Q96MK2	.;FA65C_HUMAN	K	194;194;198	ENSP00000332663:E194K;ENSP00000045083:E194K;ENSP00000439802:E198K	ENSP00000045083:E194K	E	-	1	0	FAM65C	48659285	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	4.665000	0.61547	2.174000	0.68829	0.555000	0.69702	GAG	FAM65C	-	NULL	ENSG00000042062		0.647	FAM65C-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM65C	HGNC	protein_coding	OTTHUMT00000257962.1	29	0.00	0	C			49225878	49225878	-1	no_errors	ENST00000535356	ensembl	human	known	69_37n	missense	46	16.36	9	SNP	1.000	T
FANCD2	2177	genome.wustl.edu	37	3	10089628	10089628	+	Silent	SNP	C	C	T	rs373898927		TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr3:10089628C>T	ENST00000419585.1	+	16	1467	c.1306C>T	c.(1306-1308)Ctg>Ttg	p.L436L	FANCD2_ENST00000383806.1_Silent_p.L436L|FANCD2_ENST00000287647.3_Silent_p.L436L|FANCD2_ENST00000383807.1_Silent_p.L436L			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	436					DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		TTCATCCATTCTGTCGCTGGC	0.393			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													dbGAP	yes	Rec		Fanconi anaemia D2	3	3p26	2177	"""Fanconi anemia, complementation group D2"""		L	0													174.0	178.0	176.0					3																	10089628		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.1306C>T	3.37:g.10089628C>T			Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Silent	SNP	superfamily_ARM-type_fold	p.L436	ENST00000419585.1	37	c.1306	CCDS33696.1	3																																																																																			FANCD2	-	superfamily_ARM-type_fold	ENSG00000144554		0.393	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCD2	HGNC	protein_coding	OTTHUMT00000339873.1	101	0.00	0	C			10089628	10089628	+1	no_errors	ENST00000287647	ensembl	human	known	69_37n	silent	126	10.64	15	SNP	1.000	T
FBN1	2200	genome.wustl.edu	37	15	48829850	48829850	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr15:48829850G>A	ENST00000316623.5	-	7	1149	c.694C>T	c.(694-696)Cgc>Tgc	p.R232C		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	232	TB 1.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		AAGCCACGGCGGCAGGGGTGA	0.552																																						dbGAP											0													55.0	61.0	59.0					15																	48829850		2197	4296	6493	-	-	-	SO:0001583	missense	0			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.694C>T	15.37:g.48829850G>A	ENSP00000325527:p.Arg232Cys		B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_EGF-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt,smart_EGF-like,smart_EGF-like_Ca-bd,pirsf_Fibrillin,pfscan_EG-like_dom	p.R232C	ENST00000316623.5	37	c.694	CCDS32232.1	15	.	.	.	.	.	.	.	.	.	.	G	21.5	4.157583	0.78114	.	.	ENSG00000166147	ENST00000316623	D	0.92805	-3.11	5.44	5.44	0.79542	Matrix fibril-associated (3);	0.000000	0.85682	D	0.000000	D	0.94545	0.8243	L	0.47716	1.5	0.80722	D	1	D	0.89917	1.0	D	0.66847	0.947	D	0.94538	0.7742	10	0.66056	D	0.02	.	19.4586	0.94906	0.0:0.0:1.0:0.0	.	232	P35555	FBN1_HUMAN	C	232	ENSP00000325527:R232C	ENSP00000325527:R232C	R	-	1	0	FBN1	46617142	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.095000	0.64529	2.828000	0.97474	0.655000	0.94253	CGC	FBN1	-	pfam_TB_dom,superfamily_TB_dom,pirsf_Fibrillin	ENSG00000166147		0.552	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN1	HGNC	protein_coding	OTTHUMT00000417355.1	16	0.00	0	G			48829850	48829850	-1	no_errors	ENST00000316623	ensembl	human	known	69_37n	missense	17	32.00	8	SNP	1.000	A
FBXO5	26271	genome.wustl.edu	37	6	153292185	153292185	+	3'UTR	SNP	T	T	C			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr6:153292185T>C	ENST00000229758.3	-	0	1515				FBXO5_ENST00000367241.3_3'UTR|FBXO5_ENST00000477822.1_5'UTR	NM_012177.3	NP_036309.1	Q9UKT4	FBX5_HUMAN	F-box protein 5						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|G1/S transition of mitotic cell cycle (GO:0000082)|inhibition of mitotic anaphase-promoting complex activity (GO:0060565)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|negative regulation of meiosis (GO:0045835)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|oocyte maturation (GO:0001556)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|spindle assembly involved in female meiosis I (GO:0007057)|vesicle organization (GO:0016050)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)	15		Ovarian(120;0.125)		OV - Ovarian serous cystadenocarcinoma(155;4.38e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0893)		AACCTCAGGATACTACACCGA	0.259																																					NSCLC(121;372 1757 17721 17977 29669)	dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF129535	CCDS5242.1, CCDS47501.1	6q25-q26	2008-02-05	2004-06-15		ENSG00000112029	ENSG00000112029		"""F-boxes /  ""other"""""	13584	protein-coding gene	gene with protein product		606013	"""F-box only protein 5"""			10531035, 10531037	Standard	NM_012177		Approved	FBX5, Fbxo31, EMI1	uc003qpg.3	Q9UKT4	OTTHUMG00000015854	ENST00000229758.3:c.*113A>G	6.37:g.153292185T>C			B3KNX5|Q5TF47|Q8WV29|Q9UGC8	RNA	SNP	-	NULL	ENST00000229758.3	37	NULL	CCDS5242.1	6																																																																																			FBXO5	-	-	ENSG00000112029		0.259	FBXO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO5	HGNC	protein_coding	OTTHUMT00000042757.1	14	0.00	0	T			153292185	153292185	-1	no_errors	ENST00000477822	ensembl	human	known	69_37n	rna	9	40.00	6	SNP	0.000	C
FBXO7	25793	genome.wustl.edu	37	22	32891506	32891506	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr22:32891506G>C	ENST00000266087.7	+	8	1498	c.1171G>C	c.(1171-1173)Gat>Cat	p.D391H	FBXO7_ENST00000382058.3_Missense_Mutation_p.D312H|FBXO7_ENST00000397426.1_Missense_Mutation_p.D277H	NM_012179.3	NP_036311.3	Q9Y3I1	FBX7_HUMAN	F-box protein 7	391	Important for interaction with CDK6.				cell death (GO:0008219)|mitochondrion degradation (GO:0000422)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of lymphocyte differentiation (GO:0045620)|protein targeting to mitochondrion (GO:0006626)|protein ubiquitination (GO:0016567)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TCAAGACACAGATTGGAAAGA	0.284																																						dbGAP											0													58.0	55.0	56.0					22																	32891506		2202	4293	6495	-	-	-	SO:0001583	missense	0			AF129537	CCDS13907.1, CCDS58806.1	22q12.3	2013-09-19	2004-06-15		ENSG00000100225	ENSG00000100225		"""F-boxes /  ""other"""", ""Parkinson disease"""	13586	protein-coding gene	gene with protein product		605648	"""F-box only protein 7"""			10531035, 10531037, 19038853	Standard	NM_001257990		Approved	FBX7, Fbx, PARK15	uc003amq.3	Q9Y3I1	OTTHUMG00000030674	ENST00000266087.7:c.1171G>C	22.37:g.32891506G>C	ENSP00000266087:p.Asp391His		B4DNB3|B4DWX5|Q5TGC4|Q5TI86|Q96HM6|Q9UF21|Q9UKT2	Missense_Mutation	SNP	pfam_Inhibitor_PI31,pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like	p.D391H	ENST00000266087.7	37	c.1171	CCDS13907.1	22	.	.	.	.	.	.	.	.	.	.	G	21.3	4.122829	0.77436	.	.	ENSG00000100225	ENST00000266087;ENST00000382058;ENST00000397426	T;T;T	0.57907	0.37;0.37;0.37	5.82	5.82	0.92795	F-box domain, Skp2-like (1);	0.089462	0.85682	D	0.000000	T	0.74397	0.3711	M	0.79475	2.455	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.78314	0.987;0.991;0.987	T	0.76236	-0.3033	10	0.72032	D	0.01	-23.9843	18.2948	0.90141	0.0:0.0:1.0:0.0	.	391;312;391	A8K7F7;Q9Y3I1-2;Q9Y3I1	.;.;FBX7_HUMAN	H	391;312;277	ENSP00000266087:D391H;ENSP00000371490:D312H;ENSP00000380571:D277H	ENSP00000266087:D391H	D	+	1	0	FBXO7	31221506	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.448000	0.66612	2.765000	0.95021	0.650000	0.86243	GAT	FBXO7	-	superfamily_F-box_dom_cyclin-like	ENSG00000100225		0.284	FBXO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO7	HGNC	protein_coding	OTTHUMT00000129001.1	19	0.00	0	G			32891506	32891506	+1	no_errors	ENST00000266087	ensembl	human	known	69_37n	missense	26	23.53	8	SNP	1.000	C
FGG	2266	genome.wustl.edu	37	4	155531295	155531295	+	Silent	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr4:155531295C>T	ENST00000336098.3	-	5	494	c.456G>A	c.(454-456)gaG>gaA	p.E152E	FGG_ENST00000407946.1_Silent_p.E152E|FGG_ENST00000404648.3_Silent_p.E152E|FGG_ENST00000405164.1_Silent_p.E152E	NM_021870.2	NP_068656.2	P02679	FIBG_HUMAN	fibrinogen gamma chain	152					blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(9)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	GGGCTACCTTCTCTTTCAGGT	0.348																																						dbGAP											0													162.0	148.0	152.0					4																	155531295		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS3788.1, CCDS47153.1	4q28	2014-09-17			ENSG00000171557	ENSG00000171557		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3694	protein-coding gene	gene with protein product		134850	"""fibrinogen, gamma polypeptide"""				Standard	NM_000509		Approved		uc003ioj.3	P02679	OTTHUMG00000150329	ENST00000336098.3:c.456G>A	4.37:g.155531295C>T			A8K057|P04469|P04470|Q53Y18|Q96A14|Q96KJ3|Q9UC62|Q9UC63|Q9UCF3	Silent	SNP	pfam_Fibrinogen_a/b/g_C,pfam_Fibrinogen_a/b/g_coil_dom,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	p.E152	ENST00000336098.3	37	c.456	CCDS3788.1	4																																																																																			FGG	-	pfam_Fibrinogen_a/b/g_coil_dom	ENSG00000171557		0.348	FGG-002	KNOWN	basic|CCDS	protein_coding	FGG	HGNC	protein_coding	OTTHUMT00000317581.1	56	0.00	0	C	NM_021870		155531295	155531295	-1	no_errors	ENST00000336098	ensembl	human	known	69_37n	silent	71	15.48	13	SNP	0.996	T
FH	2271	genome.wustl.edu	37	1	241675380	241675380	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr1:241675380G>C	ENST00000366560.3	-	4	480	c.442C>G	c.(442-444)Cag>Gag	p.Q148E	FH_ENST00000493477.1_5'Flank	NM_000143.3	NP_000134.2	P07954	FUMH_HUMAN	fumarate hydratase	148					cellular metabolic process (GO:0044237)|fumarate metabolic process (GO:0006106)|homeostasis of number of cells within a tissue (GO:0048873)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|tricarboxylic acid cycle enzyme complex (GO:0045239)	fumarate hydratase activity (GO:0004333)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|skin(2)	26	Ovarian(103;0.103)	all_cancers(173;2.37e-314)|all_epithelial(177;5.17e-286)|Breast(1374;1.06e-10)|Acute lymphoblastic leukemia(190;4.93e-10)|all_neural(198;0.00118)	OV - Ovarian serous cystadenocarcinoma(106;0.0214)	Colorectal(1306;2.33e-53)|COAD - Colon adenocarcinoma(196;1.05e-44)|KIRC - Kidney renal clear cell carcinoma(1967;0.000109)		ATATTTGTCTGAGTTCCTGAT	0.363			"""Mis, N, F"""			"""lieomyomatosis, renal"""			Hereditary Leiomyomatosis and Renal Cell Cancer																												Melanoma(148;1573 2486 7381 46575)	dbGAP	yes	Rec		hereditary leiomyomatosis and renal cell cancer	1	1q42.1	2271	fumarate hydratase		"""E, M"""	0													186.0	169.0	175.0					1																	241675380		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	HLRCC, Reed syndrome, Hereditary Multiple Leiomyomata of Skin and Uterus	BC003108	CCDS1617.1	1q42.1	2014-09-17			ENSG00000091483	ENSG00000091483	4.2.1.2		3700	protein-coding gene	gene with protein product		136850					Standard	NM_000143		Approved	fumarase	uc001hyx.3	P07954	OTTHUMG00000039597	ENST00000366560.3:c.442C>G	1.37:g.241675380G>C	ENSP00000355518:p.Gln148Glu		B1ANK7	Missense_Mutation	SNP	pfam_Lyase1_N,pfam_Fumarase_C_C,superfamily_L-Aspartase-like,prints_Fumarate_lyase,tigrfam_Fum_hydII	p.Q148E	ENST00000366560.3	37	c.442	CCDS1617.1	1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.664126	0.88251	.	.	ENSG00000091483	ENST00000366560	D	0.99388	-5.81	5.24	5.24	0.73138	Lyase 1, N-terminal (1);L-Aspartase-like (1);L-Aspartase-like, N-terminal (1);	0.176592	0.51477	D	0.000094	D	0.99674	0.9878	H	0.98738	4.315	0.80722	D	1	D	0.60160	0.987	D	0.65140	0.932	D	0.97377	0.9980	10	0.87932	D	0	-26.4528	16.6875	0.85312	0.0:0.0:1.0:0.0	.	148	P07954	FUMH_HUMAN	E	148	ENSP00000355518:Q148E	ENSP00000355518:Q148E	Q	-	1	0	FH	239742003	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.911000	0.92721	2.609000	0.88269	0.655000	0.94253	CAG	FH	-	pfam_Lyase1_N,superfamily_L-Aspartase-like,tigrfam_Fum_hydII	ENSG00000091483		0.363	FH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FH	HGNC	protein_coding	OTTHUMT00000095490.1	61	0.00	0	G	NM_000143		241675380	241675380	-1	no_errors	ENST00000366560	ensembl	human	known	69_37n	missense	52	13.33	8	SNP	1.000	C
FLJ33534	285150	genome.wustl.edu	37	2	11264529	11264529	+	lincRNA	SNP	C	C	G	rs2292650	byFrequency	TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr2:11264529C>G	ENST00000396164.1	-	0	646					NR_040080.1																						CCAAGACCCCCCGCACCCTGC	0.622											OREG0014436	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	1287	0.256989	0.0091	0.2767	5008	,	,		18541	0.4643		0.2376	False		,,,				2504	0.3845					dbGAP											0																																										-	-	-			0																															2.37:g.11264529C>G		670		RNA	SNP	-	NULL	ENST00000396164.1	37	NULL		2																																																																																			AC062028.1	-	-	ENSG00000145063		0.622	AC062028.1-202	KNOWN	basic	lincRNA	FLJ33534	Clone_based_vega_gene	lincRNA		9	0.00	0	C			11264529	11264529	-1	no_errors	ENST00000447433	ensembl	human	known	69_37n	rna	6	40.00	4	SNP	0.000	G
FMO3	2328	genome.wustl.edu	37	1	171083178	171083178	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr1:171083178G>A	ENST00000367755.4	+	7	970	c.859G>A	c.(859-861)Gag>Aag	p.E287K	FMO3_ENST00000542847.1_Missense_Mutation_p.E267K|FMO3_ENST00000392085.2_Missense_Mutation_p.E287K|FMO3_ENST00000538429.1_Missense_Mutation_p.E224K	NM_001002294.2	NP_001002294.1	P31513	FMO3_HUMAN	flavin containing monooxygenase 3	287					drug metabolic process (GO:0017144)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	amino acid binding (GO:0016597)|flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)|trimethylamine monooxygenase activity (GO:0034899)			endometrium(1)|kidney(1)|large_intestine(12)|lung(12)|skin(1)|stomach(2)|urinary_tract(2)	31	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Almotriptan(DB00918)|Cimetidine(DB00501)|Clozapine(DB00363)|Dapsone(DB00250)|Dasatinib(DB01254)|Olanzapine(DB00334)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	ATTTAACGATGAGCTCCCAGC	0.413																																						dbGAP											0													93.0	84.0	87.0					1																	171083178		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC032016	CCDS1292.1	1q24.3	2013-10-01			ENSG00000007933	ENSG00000007933	2.6.1.16		3771	protein-coding gene	gene with protein product		136132				8486388, 9417913	Standard	NM_001002294		Approved		uc001ghh.3	P31513	OTTHUMG00000035505	ENST00000367755.4:c.859G>A	1.37:g.171083178G>A	ENSP00000356729:p.Glu287Lys		B2R816|Q14854|Q8N5N5	Missense_Mutation	SNP	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase,prints_Flavin_mOase_3,prints_Flavin_mOase_1,prints_Flavin_mOase_2	p.E287K	ENST00000367755.4	37	c.859	CCDS1292.1	1	.	.	.	.	.	.	.	.	.	.	G	15.27	2.784891	0.49997	.	.	ENSG00000007933	ENST00000367755;ENST00000392085;ENST00000542847;ENST00000538429	T;T;T;T	0.57907	0.37;0.37;0.37;0.37	4.73	3.81	0.43845	.	0.194320	0.52532	D	0.000072	T	0.50922	0.1644	M	0.64997	1.995	0.35848	D	0.826559	P;D;P	0.54207	0.802;0.965;0.788	B;P;P	0.58013	0.304;0.831;0.788	T	0.57207	-0.7851	10	0.54805	T	0.06	-4.8862	9.9677	0.41734	0.0:0.1509:0.6925:0.1566	.	224;267;287	F5H261;F5GZZ8;P31513	.;.;FMO3_HUMAN	K	287;287;267;224	ENSP00000356729:E287K;ENSP00000375935:E287K;ENSP00000444073:E267K;ENSP00000439500:E224K	ENSP00000356729:E287K	E	+	1	0	FMO3	169349802	1.000000	0.71417	0.731000	0.30826	0.048000	0.14542	6.411000	0.73298	1.074000	0.40909	-0.181000	0.13052	GAG	FMO3	-	pfam_Flavin_mOase-like,pirsf_DiMe-aniline_mOase	ENSG00000007933		0.413	FMO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMO3	HGNC	protein_coding	OTTHUMT00000086219.1	51	0.00	0	G	NM_006894		171083178	171083178	+1	no_errors	ENST00000367755	ensembl	human	known	69_37n	missense	77	20.62	20	SNP	1.000	A
FREM2	341640	genome.wustl.edu	37	13	39264059	39264059	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr13:39264059G>A	ENST00000280481.7	+	1	2794	c.2578G>A	c.(2578-2580)Gat>Aat	p.D860N		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	860					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TGTAGACACTGATGTTGCCCA	0.512																																						dbGAP											0													114.0	101.0	106.0					13																	39264059		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.2578G>A	13.37:g.39264059G>A	ENSP00000280481:p.Asp860Asn		Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.D860N	ENST00000280481.7	37	c.2578	CCDS31960.1	13	.	.	.	.	.	.	.	.	.	.	G	13.30	2.197397	0.38806	.	.	ENSG00000150893	ENST00000280481	T	0.26373	1.74	5.8	5.8	0.92144	.	0.184367	0.52532	D	0.000079	T	0.31734	0.0806	M	0.68728	2.09	0.48395	D	0.999649	B	0.26708	0.157	B	0.22601	0.04	T	0.04961	-1.0915	10	0.27082	T	0.32	.	20.0609	0.97674	0.0:0.0:1.0:0.0	.	860	Q5SZK8	FREM2_HUMAN	N	860	ENSP00000280481:D860N	ENSP00000280481:D860N	D	+	1	0	FREM2	38162059	1.000000	0.71417	0.785000	0.31869	0.165000	0.22458	4.729000	0.62008	2.755000	0.94549	0.655000	0.94253	GAT	FREM2	-	NULL	ENSG00000150893		0.512	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FREM2	HGNC	protein_coding	OTTHUMT00000044599.2	33	0.00	0	G	NM_207361		39264059	39264059	+1	no_errors	ENST00000280481	ensembl	human	known	69_37n	missense	59	20.27	15	SNP	0.834	A
GOLGA1	2800	genome.wustl.edu	37	9	127684133	127684133	+	Missense_Mutation	SNP	T	T	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr9:127684133T>A	ENST00000373555.4	-	9	933	c.600A>T	c.(598-600)caA>caT	p.Q200H		NM_002077.3	NP_002068	Q92805	GOGA1_HUMAN	golgin A1	200					protein targeting to Golgi (GO:0000042)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)				NS(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	20						CCTCCAATTCTTGTTCCATTT	0.388																																						dbGAP											0													189.0	176.0	181.0					9																	127684133		2203	4300	6503	-	-	-	SO:0001583	missense	0			U51587	CCDS6860.1	9q34.11	2010-02-12	2010-02-12		ENSG00000136935	ENSG00000136935			4424	protein-coding gene	gene with protein product		602502	"""golgi autoantigen, golgin subfamily a, 1"""			9324025	Standard	NM_002077		Approved	golgin-97, MGC33154	uc004bpc.3	Q92805	OTTHUMG00000020665	ENST00000373555.4:c.600A>T	9.37:g.127684133T>A	ENSP00000362656:p.Gln200His		Q5T164|Q8IYZ9	Missense_Mutation	SNP	pfam_GRIP,superfamily_Prefoldin,superfamily_GRIP,smart_GRIP,pfscan_GRIP	p.Q200H	ENST00000373555.4	37	c.600	CCDS6860.1	9	.	.	.	.	.	.	.	.	.	.	T	11.60	1.686767	0.29962	.	.	ENSG00000136935	ENST00000373555	T	0.10573	2.86	5.0	1.22	0.21188	.	0.731524	0.11648	N	0.543097	T	0.05777	0.0151	N	0.12182	0.205	0.27032	N	0.964205	B;B	0.14438	0.01;0.003	B;B	0.14023	0.01;0.003	T	0.34576	-0.9823	10	0.49607	T	0.09	-1.02	5.3641	0.16103	0.0:0.2246:0.1499:0.6255	.	99;200	Q59HA1;Q92805	.;GOGA1_HUMAN	H	200	ENSP00000362656:Q200H	ENSP00000362656:Q200H	Q	-	3	2	GOLGA1	126723954	0.976000	0.34144	0.999000	0.59377	0.990000	0.78478	-0.109000	0.10840	0.309000	0.22966	0.460000	0.39030	CAA	GOLGA1	-	NULL	ENSG00000136935		0.388	GOLGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA1	HGNC	protein_coding	OTTHUMT00000054049.1	42	0.00	0	T	NM_002077		127684133	127684133	-1	no_errors	ENST00000373555	ensembl	human	known	69_37n	missense	49	27.94	19	SNP	0.998	A
GPATCH4	54865	genome.wustl.edu	37	1	156565376	156565376	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr1:156565376G>A	ENST00000438976.2	-	8	787	c.757C>T	c.(757-759)Caa>Taa	p.Q253*	GPATCH4_ENST00000368232.4_Nonsense_Mutation_p.Q248*|GPATCH4_ENST00000497287.1_5'Flank			Q5T3I0	GPTC4_HUMAN	G patch domain containing 4	248							poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(3)|stomach(1)	17	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TTTCCTTCTTGATGTCGCCTT	0.458																																						dbGAP											0													342.0	325.0	331.0					1																	156565376		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC056904	CCDS1146.1, CCDS44245.1	1q22	2013-01-28		2006-12-13	ENSG00000160818	ENSG00000160818		"""G patch domain containing"""	25982	protein-coding gene	gene with protein product				GPATC4		12477932	Standard	NM_015590		Approved	FLJ20249, DKFZP434F1735	uc001fpl.3	Q5T3I0	OTTHUMG00000033203	ENST00000438976.2:c.757C>T	1.37:g.156565376G>A	ENSP00000396441:p.Gln253*		Q5T3I1|Q6ZUE7|Q8IWG8|Q9NXH4	Nonsense_Mutation	SNP	pfam_G_patch_dom,smart_G_patch_dom,pfscan_G_patch_dom	p.Q253*	ENST00000438976.2	37	c.757	CCDS44245.1	1	.	.	.	.	.	.	.	.	.	.	G	16.23	3.063701	0.55432	.	.	ENSG00000160818	ENST00000368232;ENST00000368229;ENST00000438976;ENST00000415314	.	.	.	5.79	3.7	0.42460	.	1.847990	0.02316	N	0.072577	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	-20.1785	13.0839	0.59129	0.0:0.0:0.5389:0.4611	.	.	.	.	X	248;248;253;219	.	ENSP00000357212:Q248X	Q	-	1	0	GPATCH4	154832000	0.000000	0.05858	0.002000	0.10522	0.195000	0.23768	-0.218000	0.09240	1.291000	0.44653	0.655000	0.94253	CAA	GPATCH4	-	NULL	ENSG00000160818		0.458	GPATCH4-015	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPATCH4	HGNC	protein_coding	OTTHUMT00000386947.1	84	0.00	0	G	NM_017725		156565376	156565376	-1	no_errors	ENST00000438976	ensembl	human	known	69_37n	nonsense	125	19.23	30	SNP	0.001	A
GPR162	27239	genome.wustl.edu	37	12	6935488	6935488	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr12:6935488C>A	ENST00000311268.3	+	4	1972	c.1185C>A	c.(1183-1185)ttC>ttA	p.F395L	LEPREL2_ENST00000251761.8_RNA|LEPREL2_ENST00000396725.2_RNA|LEPREL2_ENST00000606935.1_RNA|GPR162_ENST00000428545.2_Missense_Mutation_p.F111L|GPR162_ENST00000382315.3_Missense_Mutation_p.F91L	NM_019858.1	NP_062832.1	Q16538	GP162_HUMAN	G protein-coupled receptor 162	395						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(2)|skin(1)	18						ACATGCTCTTCCCTCCTCTTG	0.562											OREG0021636	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													48.0	47.0	47.0					12																	6935488		2203	4300	6503	-	-	-	SO:0001583	missense	0			U47928, U47929, U47924, U47925	CCDS8563.1, CCDS44819.1	12p13	2012-08-21						"""GPCR / Class A : Orphans"""	16693	protein-coding gene	gene with protein product						15777626	Standard	NM_014449		Approved	A-2, GRCA	uc001qqw.1	Q16538		ENST00000311268.3:c.1185C>A	12.37:g.6935488C>A	ENSP00000311528:p.Phe395Leu	637	Q16664|Q59EH5|Q66K56	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_GPCR_162,prints_GPCR_153/162	p.F395L	ENST00000311268.3	37	c.1185	CCDS8563.1	12	.	.	.	.	.	.	.	.	.	.	C	16.69	3.194240	0.58017	.	.	ENSG00000250510	ENST00000311268;ENST00000428545;ENST00000382315	T;T;T	0.39997	3.22;1.05;1.06	4.87	-1.36	0.09085	.	.	.	.	.	T	0.16041	0.0386	N	0.03115	-0.41	0.28006	N	0.935117	B;B;B	0.14012	0.002;0.009;0.001	B;B;B	0.06405	0.001;0.002;0.001	T	0.34030	-0.9845	9	0.09338	T	0.73	.	8.8501	0.35194	0.0:0.5371:0.179:0.2839	.	179;111;395	Q13513;Q16538-2;Q16538	.;.;GP162_HUMAN	L	395;111;91	ENSP00000311528:F395L;ENSP00000399670:F111L;ENSP00000371752:F91L	ENSP00000311528:F395L	F	+	3	2	GPR162	6805749	0.265000	0.24102	0.990000	0.47175	0.976000	0.68499	-0.782000	0.04643	-0.416000	0.07473	-0.339000	0.08088	TTC	GPR162	-	prints_GPCR_162	ENSG00000250510		0.562	GPR162-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR162	HGNC	protein_coding	OTTHUMT00000399478.1	39	0.00	0	C	NM_019858		6935488	6935488	+1	no_errors	ENST00000311268	ensembl	human	known	69_37n	missense	58	12.12	8	SNP	0.983	A
GRIK1	2897	genome.wustl.edu	37	21	30934055	30934055	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr21:30934055G>A	ENST00000399907.1	-	15	2657	c.2246C>T	c.(2245-2247)gCg>gTg	p.A749V	GRIK1_ENST00000389125.3_Missense_Mutation_p.A734V|GRIK1_ENST00000327783.4_Missense_Mutation_p.A749V|GRIK1_ENST00000389124.2_Missense_Mutation_p.A749V|GRIK1_ENST00000399913.1_Missense_Mutation_p.A749V|GRIK1_ENST00000399914.1_Missense_Mutation_p.A734V|GRIK1_ENST00000309434.7_Missense_Mutation_p.A751V|GRIK1_ENST00000399909.1_Missense_Mutation_p.A734V|GRIK1_ENST00000535441.1_Missense_Mutation_p.A751V	NM_000830.3	NP_000821.1	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	749					adult behavior (GO:0030534)|behavioral response to pain (GO:0048266)|central nervous system development (GO:0007417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|nervous system development (GO:0007399)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(18)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	45					Topiramate(DB00273)	CATCAGCAGCGCGTAGTCTGT	0.542																																						dbGAP											0													147.0	119.0	129.0					21																	30934055		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33530.1, CCDS42913.1	21q22	2012-08-29			ENSG00000171189	ENSG00000171189		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4579	protein-coding gene	gene with protein product		138245		GLUR5		8468067	Standard	XM_005260942		Approved	GluK1	uc002yno.1	P39086	OTTHUMG00000078879	ENST00000399907.1:c.2246C>T	21.37:g.30934055G>A	ENSP00000382791:p.Ala749Val		Q13001|Q86SU9	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.A751V	ENST00000399907.1	37	c.2252	CCDS42913.1	21	.	.	.	.	.	.	.	.	.	.	G	34	5.324998	0.95708	.	.	ENSG00000171189	ENST00000327783;ENST00000389125;ENST00000399913;ENST00000399914;ENST00000535441;ENST00000541508;ENST00000389124;ENST00000399907;ENST00000399909;ENST00000309434	T;T;T;T;T;T;T;T;T	0.18810	2.19;2.19;2.19;2.19;2.19;2.19;2.19;2.19;2.19	4.96	4.96	0.65561	Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.53867	0.1823	M	0.87180	2.865	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;0.999	T	0.61302	-0.7090	10	0.72032	D	0.01	.	18.367	0.90394	0.0:0.0:1.0:0.0	.	734;749;749;734	E7EPY9;E9PD61;P39086;P39086-2	.;.;GRIK1_HUMAN;.	V	749;734;749;734;751;610;749;749;734;751	ENSP00000327687:A749V;ENSP00000373777:A734V;ENSP00000382797:A749V;ENSP00000382798:A734V;ENSP00000446326:A751V;ENSP00000373776:A749V;ENSP00000382791:A749V;ENSP00000382793:A734V;ENSP00000311646:A751V	ENSP00000311646:A751V	A	-	2	0	GRIK1	29855926	1.000000	0.71417	0.991000	0.47740	0.939000	0.58152	9.554000	0.98121	2.733000	0.93635	0.655000	0.94253	GCG	GRIK1	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000171189		0.542	GRIK1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIK1	HGNC	protein_coding	OTTHUMT00000171979.1	45	0.00	0	G			30934055	30934055	-1	no_errors	ENST00000535441	ensembl	human	known	69_37n	missense	81	19.00	19	SNP	1.000	A
GSPT2	23708	genome.wustl.edu	37	X	51487020	51487020	+	Nonsense_Mutation	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chrX:51487020C>T	ENST00000340438.4	+	1	540	c.298C>T	c.(298-300)Caa>Taa	p.Q100*		NM_018094.4	NP_060564.2	Q8IYD1	ERF3B_HUMAN	G1 to S phase transition 2	100					cell cycle (GO:0007049)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational termination (GO:0006415)	cytosol (GO:0005829)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Ovarian(276;0.236)					GGGATACCCTCAAGGTAAAAG	0.627																																						dbGAP											0													12.0	12.0	12.0					X																	51487020		2198	4291	6489	-	-	-	SO:0001587	stop_gained	0			AI285711	CCDS14336.1	Xp11.22	2008-05-14			ENSG00000189369	ENSG00000189369			4622	protein-coding gene	gene with protein product		300418				10575220	Standard	NM_018094		Approved	eRF3b, FLJ10441	uc004dpl.3	Q8IYD1	OTTHUMG00000021538	ENST00000340438.4:c.298C>T	X.37:g.51487020C>T	ENSP00000341247:p.Gln100*		Q9H909|Q9NVY0|Q9NY44	Nonsense_Mutation	SNP	pfam_ProtSyn_GTP-bd,pfam_Transl_elong_EFTu/EF1A_C,pfam_Transl_elong_EFTu/EF1A_2,pfam_Ataxin-2_C,superfamily_Transl_elong_EF1A/Init_IF2_C,superfamily_Transl_elong_init/rib_B-barrel,prints_ProtSyn_GTP-bd	p.Q100*	ENST00000340438.4	37	c.298	CCDS14336.1	X	.	.	.	.	.	.	.	.	.	.	C	13.50	2.254342	0.39896	.	.	ENSG00000189369	ENST00000340438;ENST00000502175	.	.	.	4.58	-2.49	0.06403	.	3.632690	0.00871	N	0.002039	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05436	T	0.98	-0.2819	3.2341	0.06758	0.276:0.2289:0.4033:0.0917	.	.	.	.	X	100;17	.	ENSP00000341247:Q100X	Q	+	1	0	GSPT2	51503760	0.200000	0.23398	0.131000	0.22000	0.027000	0.11550	-0.442000	0.06871	-0.395000	0.07715	-0.373000	0.07131	CAA	GSPT2	-	NULL	ENSG00000189369		0.627	GSPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSPT2	HGNC	protein_coding	OTTHUMT00000056587.1	29	0.00	0	C			51487020	51487020	+1	no_errors	ENST00000340438	ensembl	human	known	69_37n	nonsense	23	20.69	6	SNP	0.046	T
HDAC7	51564	genome.wustl.edu	37	12	48183079	48183079	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr12:48183079G>T	ENST00000427332.2	-	19	2239	c.2083C>A	c.(2083-2085)Cag>Aag	p.Q695K	HDAC7_ENST00000080059.7_Missense_Mutation_p.Q734K|HDAC7_ENST00000488927.1_5'UTR|HDAC7_ENST00000354334.3_Missense_Mutation_p.Q697K|HDAC7_ENST00000552960.1_Missense_Mutation_p.Q717K|HDAC7_ENST00000380610.4_Missense_Mutation_p.Q751K			Q8WUI4	HDAC7_HUMAN	histone deacetylase 7	695	Histone deacetylase.				cell-cell junction assembly (GO:0007043)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25				GBM - Glioblastoma multiforme(48;0.137)		GCCTTGCTCTGCTGTTGCAGC	0.592																																						dbGAP											0													103.0	107.0	106.0					12																	48183079		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF239243	CCDS8756.2, CCDS41776.1	12q13.1	2008-02-25	2008-02-25	2008-02-25	ENSG00000061273	ENSG00000061273			14067	protein-coding gene	gene with protein product		606542	"""histone deacetylase 7A"""	HDAC7A		10922406, 10640276	Standard	NM_015401		Approved	DKFZP586J0917	uc010slo.2	Q8WUI4	OTTHUMG00000152968	ENST00000427332.2:c.2083C>A	12.37:g.48183079G>T	ENSP00000404394:p.Gln695Lys		B3KY08|B4DWI0|B4E0Q5|Q6P1W9|Q6W9G7|Q7Z4K2|Q7Z5I1|Q96K01|Q9BR73|Q9H7L0|Q9NW41|Q9NWA9|Q9NYK9|Q9UFU7	Missense_Mutation	SNP	pfam_His_deacetylse_dom,pirsf_Histone_deAcase_II_euk,prints_His_deacetylse	p.Q751K	ENST00000427332.2	37	c.2251		12	.	.	.	.	.	.	.	.	.	.	G	1.529	-0.544786	0.04024	.	.	ENSG00000061273	ENST00000080059;ENST00000354334;ENST00000552960;ENST00000380610;ENST00000427332	T;T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31;-0.31	4.62	3.65	0.41850	.	0.205924	0.39274	N	0.001406	T	0.32224	0.0822	N	0.01686	-0.76	0.30102	N	0.807354	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.26780	-1.0093	10	0.02654	T	1	.	10.1482	0.42778	0.0:0.0:0.6439:0.3561	.	734;717;697	Q8WUI4-5;Q8WUI4-6;Q8WUI4-7	.;.;.	K	734;697;717;751;695	ENSP00000080059:Q734K;ENSP00000351326:Q697K;ENSP00000448532:Q717K;ENSP00000369984:Q751K;ENSP00000404394:Q695K	ENSP00000080059:Q734K	Q	-	1	0	HDAC7	46469346	1.000000	0.71417	0.974000	0.42286	0.479000	0.33129	5.643000	0.67895	2.316000	0.78162	0.650000	0.86243	CAG	HDAC7	-	pfam_His_deacetylse_dom,pirsf_Histone_deAcase_II_euk	ENSG00000061273		0.592	HDAC7-013	NOVEL	basic|appris_principal	protein_coding	HDAC7	HGNC	protein_coding	OTTHUMT00000328804.2	35	0.00	0	G			48183079	48183079	-1	no_errors	ENST00000380610	ensembl	human	known	69_37n	missense	24	14.29	4	SNP	0.990	T
HIGD1A	25994	genome.wustl.edu	37	3	42835709	42835709	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr3:42835709C>G	ENST00000321331.7	-	2	154	c.37G>C	c.(37-39)Gag>Cag	p.E13Q	HIGD1A_ENST00000452906.2_Missense_Mutation_p.E27Q|HIGD1A_ENST00000418900.2_Missense_Mutation_p.E13Q|HIGD1A_ENST00000430190.1_Missense_Mutation_p.E13Q|HIGD1A_ENST00000470543.1_Intron	NM_001099669.1|NM_014056.3	NP_001093139.1|NP_054775.2	Q9Y241	HIG1A_HUMAN	HIG1 hypoxia inducible domain family, member 1A	13	HIG1. {ECO:0000255|PROSITE- ProRule:PRU00836}.				cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|protein complex (GO:0043234)|respiratory chain (GO:0070469)				lung(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.217)		TGATCTTCCTCATATGAAGGA	0.388																																						dbGAP											0													95.0	85.0	88.0					3																	42835709		1860	4101	5961	-	-	-	SO:0001583	missense	0			BC009583	CCDS43073.1, CCDS46806.1	3p22.1	2014-02-12	2009-03-17		ENSG00000181061	ENSG00000181061			29527	protein-coding gene	gene with protein product	"""hypoxia inducible gene 1"""		"""HIG1 domain family, member 1A"""			11042152, 11230166	Standard	NM_001099668		Approved	HIG1, DKFZP564K247	uc010hid.3	Q9Y241	OTTHUMG00000156277	ENST00000321331.7:c.37G>C	3.37:g.42835709C>G	ENSP00000319393:p.Glu13Gln		Q9UFZ2	Missense_Mutation	SNP	pfam_Hypoxia_induced_domain	p.E27Q	ENST00000321331.7	37	c.79	CCDS43073.1	3	.	.	.	.	.	.	.	.	.	.	C	15.31	2.796972	0.50208	.	.	ENSG00000181061	ENST00000321331;ENST00000418900;ENST00000430190;ENST00000452906	T;T;T	0.32988	1.43;1.43;1.44	5.13	5.13	0.70059	Hypoxia induced protein, domain (1);	0.261628	0.41712	D	0.000833	T	0.35740	0.0942	.	.	.	0.31927	N	0.612688	P;B	0.41450	0.75;0.159	P;B	0.46585	0.521;0.147	T	0.38607	-0.9653	9	0.41790	T	0.15	-0.5877	14.2644	0.66107	0.0:1.0:0.0:0.0	.	27;13	Q9Y241-2;Q9Y241	.;HIG1A_HUMAN	Q	13;13;13;27	ENSP00000319393:E13Q;ENSP00000402160:E13Q;ENSP00000398064:E27Q	ENSP00000319393:E13Q	E	-	1	0	HIGD1A	42810713	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	4.123000	0.57917	2.824000	0.97209	0.655000	0.94253	GAG	HIGD1A	-	NULL	ENSG00000181061		0.388	HIGD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIGD1A	HGNC	protein_coding	OTTHUMT00000343686.1	46	0.00	0	C	NM_014056		42835709	42835709	-1	no_errors	ENST00000452906	ensembl	human	known	69_37n	missense	59	16.90	12	SNP	1.000	G
HMBS	3145	genome.wustl.edu	37	11	118958972	118958972	+	Missense_Mutation	SNP	A	A	G			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr11:118958972A>G	ENST00000278715.3	+	2	192	c.41A>G	c.(40-42)aAc>aGc	p.N14S	HMBS_ENST00000542729.1_5'UTR|HMBS_ENST00000544387.1_Missense_Mutation_p.N14S|HMBS_ENST00000442944.2_5'UTR|HMBS_ENST00000537841.1_5'UTR|HMBS_ENST00000543090.1_Intron|HMBS_ENST00000392841.1_5'UTR	NM_000190.3	NP_000181.2	P08397	HEM3_HUMAN	hydroxymethylbilane synthase	14					heme biosynthetic process (GO:0006783)|peptidyl-pyrromethane cofactor linkage (GO:0018160)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	hydroxymethylbilane synthase activity (GO:0004418)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	15	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.72e-05)		CAGGAAGAAAACAGCCCAAAG	0.527																																						dbGAP											0			GRCh37	CD002699	HMBS	D							112.0	122.0	119.0					11																	118958972		2200	4295	6495	-	-	-	SO:0001583	missense	0			X04808	CCDS8409.1, CCDS41726.1, CCDS58186.1, CCDS58187.1	11q23.3	2013-07-10			ENSG00000256269	ENSG00000256269	2.5.1.61		4982	protein-coding gene	gene with protein product		609806	"""uroporphyrinogen I synthase"", ""porphobilinogen deaminase"", ""porphyria, acute; Chester type"""	PBGD, UPS, PORC		8432552, 17298217	Standard	NM_001258208		Approved		uc001puz.1	P08397	OTTHUMG00000168295	ENST00000278715.3:c.41A>G	11.37:g.118958972A>G	ENSP00000278715:p.Asn14Ser		A8K2L0|G3V1P4|G5EA58|P08396|Q16012	Missense_Mutation	SNP	pfam_Porphobilin_deaminase_N,pfam_Porphobilinogen_deaminase_C,superfamily_Porphobilinogen_deaminase_C,pirsf_4pyrrol_synth_OHMeBilane_synth,prints_4pyrrol_synth_OHMeBilane_synth,tigrfam_4pyrrol_synth_OHMeBilane_synth	p.N14S	ENST00000278715.3	37	c.41	CCDS8409.1	11	.	.	.	.	.	.	.	.	.	.	A	18.08	3.543377	0.65198	.	.	ENSG00000256269	ENST00000278715;ENST00000536813;ENST00000546302;ENST00000544387	D;D;D;D	0.99818	-6.92;-5.63;-5.99;-6.61	5.52	4.37	0.52481	.	0.216015	0.49305	N	0.000160	D	0.98717	0.9569	L	0.28192	0.835	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	D	0.99780	1.1027	10	0.46703	T	0.11	-13.0037	9.6368	0.39814	0.9209:0.0:0.0791:0.0	.	14;14	G5EA58;P08397	.;HEM3_HUMAN	S	14	ENSP00000278715:N14S;ENSP00000438726:N14S;ENSP00000445599:N14S;ENSP00000438424:N14S	ENSP00000278715:N14S	N	+	2	0	HMBS	118464182	1.000000	0.71417	0.909000	0.35828	0.993000	0.82548	3.789000	0.55454	1.077000	0.40990	0.528000	0.53228	AAC	HMBS	-	NULL	ENSG00000256269		0.527	HMBS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMBS	HGNC	protein_coding	OTTHUMT00000399188.1	37	0.00	0	A	NM_000190		118958972	118958972	+1	no_errors	ENST00000278715	ensembl	human	known	69_37n	missense	52	26.76	19	SNP	0.906	G
HOXB13	10481	genome.wustl.edu	37	17	46804342	46804342	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr17:46804342G>A	ENST00000290295.7	-	2	1249	c.665C>T	c.(664-666)cCg>cTg	p.P222L	PRAC2_ENST00000432056.1_RNA|PRAC2_ENST00000422730.2_RNA|MIR3185_ENST00000583892.1_RNA	NM_006361.5	NP_006352.2	Q92826	HXB13_HUMAN	homeobox B13	222					angiogenesis (GO:0001525)|epidermis development (GO:0008544)|epithelial cell maturation involved in prostate gland development (GO:0060743)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|response to testosterone (GO:0033574)|response to wounding (GO:0009611)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(2)|lung(6)|prostate(1)	11						CTTGCTGTACGGAATGCGTTT	0.627																																						dbGAP											0													78.0	73.0	75.0					17																	46804342		2203	4300	6503	-	-	-	SO:0001583	missense	0			U57052	CCDS11536.1	17q21.32	2014-09-17	2005-12-22		ENSG00000159184	ENSG00000159184		"""Homeoboxes / ANTP class : HOXL subclass"""	5112	protein-coding gene	gene with protein product		604607	"""homeo box B13"""			8756292, 9665387	Standard	NM_006361		Approved		uc002ioa.3	Q92826	OTTHUMG00000159900	ENST00000290295.7:c.665C>T	17.37:g.46804342G>A	ENSP00000290295:p.Pro222Leu		B2R878|Q96QM4|Q99810	Missense_Mutation	SNP	pfam_HoxA13_N,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.P222L	ENST00000290295.7	37	c.665	CCDS11536.1	17	.	.	.	.	.	.	.	.	.	.	G	34	5.298669	0.95574	.	.	ENSG00000159184	ENST00000290295	D	0.96041	-3.89	5.06	5.06	0.68205	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.96645	0.8905	L	0.43923	1.385	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97288	0.9922	10	0.87932	D	0	.	18.2172	0.89890	0.0:0.0:1.0:0.0	.	222	Q92826	HXB13_HUMAN	L	222	ENSP00000290295:P222L	ENSP00000290295:P222L	P	-	2	0	HOXB13	44159341	1.000000	0.71417	0.997000	0.53966	0.857000	0.48899	9.657000	0.98554	2.635000	0.89317	0.655000	0.94253	CCG	HOXB13	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000159184		0.627	HOXB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXB13	HGNC	protein_coding	OTTHUMT00000358087.3	21	0.00	0	G	NM_006361		46804342	46804342	-1	no_errors	ENST00000290295	ensembl	human	known	69_37n	missense	31	16.22	6	SNP	1.000	A
HSP90AA4P	3323	genome.wustl.edu	37	4	190395817	190395817	+	RNA	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr4:190395817G>A	ENST00000378770.1	+	0	809							Q58FG1	HS904_HUMAN	heat shock protein 90kDa alpha (cytosolic), class A member 4, pseudogene						protein folding (GO:0006457)|response to stress (GO:0006950)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)										gaaacaggaagagggaaaaca	0.398																																						dbGAP											0																																										-	-	-			0					4q35.2	2011-04-15	2011-04-15	2006-02-24	ENSG00000205100	ENSG00000205100			5255	pseudogene	pseudogene			"""heat shock 90kD protein 1, alpha-like 2"", ""heat shock 90kDa protein 1, alpha-like 2"""	HSPCAL2		1740332, 16269234	Standard	NG_003014		Approved			Q58FG1	OTTHUMG00000160204		4.37:g.190395817G>A				RNA	SNP	-	NULL	ENST00000378770.1	37	NULL		4																																																																																			HSP90AA4P	-	-	ENSG00000205100		0.398	HSP90AA4P-002	KNOWN	basic	processed_transcript	HSP90AA4P	HGNC	pseudogene	OTTHUMT00000359634.1	38	0.00	0	G	NG_003014		190395817	190395817	+1	no_errors	ENST00000378770	ensembl	human	known	69_37n	rna	46	24.59	15	SNP	1.000	A
HTATSF1	27336	genome.wustl.edu	37	X	135594142	135594142	+	Silent	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chrX:135594142C>T	ENST00000218364.4	+	9	2412	c.2238C>T	c.(2236-2238)ctC>ctT	p.L746L	HTATSF1_ENST00000535601.1_Silent_p.L746L	NM_014500.4	NP_055315.2	O43719	HTSF1_HUMAN	HIV-1 Tat specific factor 1	746	Asp/Glu-rich (acidic).|Mediates interaction with the P-TEFb complex.				regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(14)|ovary(3)|prostate(1)	30	Acute lymphoblastic leukemia(192;0.000127)					GCTTTATTCTCAGTAGCGATG	0.448																																						dbGAP											0													175.0	167.0	170.0					X																	135594142		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U76992	CCDS14657.1	Xq26.3	2013-02-12	2006-01-09		ENSG00000102241	ENSG00000102241		"""RNA binding motif (RRM) containing"""	5276	protein-coding gene	gene with protein product		300346	"""HIV TAT specific factor 1"""			8849451	Standard	NM_014500		Approved	TAT-SF1	uc004ezx.3	O43719	OTTHUMG00000022510	ENST00000218364.4:c.2238C>T	X.37:g.135594142C>T			D3DWG9|Q59G06|Q99730	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.L746	ENST00000218364.4	37	c.2238	CCDS14657.1	X																																																																																			HTATSF1	-	NULL	ENSG00000102241		0.448	HTATSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTATSF1	HGNC	protein_coding	OTTHUMT00000058497.1	52	0.00	0	C	NM_014500		135594142	135594142	+1	no_errors	ENST00000218364	ensembl	human	known	69_37n	silent	76	23.23	23	SNP	0.993	T
IL27RA	9466	genome.wustl.edu	37	19	14142743	14142743	+	Missense_Mutation	SNP	T	T	C			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr19:14142743T>C	ENST00000263379.2	+	1	184	c.59T>C	c.(58-60)cTg>cCg	p.L20P	CTB-55O6.4_ENST00000590528.1_RNA	NM_004843.3	NP_004834.1	Q6UWB1	I27RA_HUMAN	interleukin 27 receptor, alpha	20					cell surface receptor signaling pathway (GO:0007166)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of T-helper 1 type immune response (GO:0002827)|regulation of isotype switching to IgG isotypes (GO:0048302)	integral component of plasma membrane (GO:0005887)	interleukin-27 receptor activity (GO:0045509)|transmembrane signaling receptor activity (GO:0004888)			breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	26						CTGGCGCTGCTGCCTCTGTTG	0.741																																					Colon(164;1849 1896 4443 37792 47834)	dbGAP											0													17.0	18.0	18.0					19																	14142743		2201	4294	6495	-	-	-	SO:0001583	missense	0			AF053004	CCDS12303.1	19p13.11	2013-02-11				ENSG00000104998		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	17290	protein-coding gene	gene with protein product	"""T-cell cytokine receptor type 1"""	605350				9600072, 11057672	Standard	NM_004843		Approved	WSX-1, TCCR, CRL1, WSX1, zcytor1, IL-27R	uc002mxx.4	Q6UWB1		ENST00000263379.2:c.59T>C	19.37:g.14142743T>C	ENSP00000263379:p.Leu20Pro		A0N0L1|O60624	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.L20P	ENST00000263379.2	37	c.59	CCDS12303.1	19	.	.	.	.	.	.	.	.	.	.	T	15.43	2.831877	0.50845	.	.	ENSG00000104998	ENST00000263379	T	0.41065	1.01	2.71	1.68	0.24146	.	.	.	.	.	T	0.38931	0.1059	L	0.32530	0.975	0.09310	N	0.999992	D	0.58620	0.983	P	0.53401	0.725	T	0.17776	-1.0358	9	0.72032	D	0.01	.	4.5004	0.11862	0.0:0.1585:0.0:0.8415	.	20	Q6UWB1	I27RA_HUMAN	P	20	ENSP00000263379:L20P	ENSP00000263379:L20P	L	+	2	0	IL27RA	14003743	0.849000	0.29639	0.001000	0.08648	0.084000	0.17831	2.659000	0.46741	0.472000	0.27344	0.402000	0.26972	CTG	IL27RA	-	NULL	ENSG00000104998		0.741	IL27RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL27RA	HGNC	protein_coding	OTTHUMT00000458539.1	15	0.00	0	T	NM_004843		14142743	14142743	+1	no_errors	ENST00000263379	ensembl	human	known	69_37n	missense	24	20.00	6	SNP	0.003	C
ITIH5	80760	genome.wustl.edu	37	10	7621822	7621822	+	Silent	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr10:7621822G>A	ENST00000256861.6	-	9	1392	c.1314C>T	c.(1312-1314)atC>atT	p.I438I	ITIH5_ENST00000446830.2_Silent_p.I220I|ITIH5_ENST00000298441.6_Silent_p.I224I|ITIH5_ENST00000397145.2_Silent_p.I438I|ITIH5_ENST00000397146.2_Silent_p.I438I|ITIH5_ENST00000434980.1_5'UTR	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	438	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						CGTCGTTGCCGATGCCAATGG	0.632																																						dbGAP											0													131.0	117.0	122.0					10																	7621822		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0					10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.1314C>T	10.37:g.7621822G>A			Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Silent	SNP	pfam_ITI_HC_C,pfam_VIT,pfam_VWF_A,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.I438	ENST00000256861.6	37	c.1314		10																																																																																			ITIH5	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000123243		0.632	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	ITIH5	HGNC	protein_coding	OTTHUMT00000046688.1	59	0.00	0	G	NM_030569		7621822	7621822	-1	no_errors	ENST00000256861	ensembl	human	known	69_37n	silent	103	18.25	23	SNP	0.350	A
IWS1	55677	genome.wustl.edu	37	2	128260970	128260970	+	Nonsense_Mutation	SNP	C	C	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr2:128260970C>A	ENST00000295321.4	-	4	1661	c.1402G>T	c.(1402-1404)Gaa>Taa	p.E468*	IWS1_ENST00000486662.1_5'Flank|AC010976.2_ENST00000599001.1_RNA|IWS1_ENST00000455721.2_Nonsense_Mutation_p.E475*	NM_017969.2	NP_060439.2	Q96ST2	IWS1_HUMAN	IWS1 homolog (S. cerevisiae)	468	Glu-rich.				mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of histone H3-K36 trimethylation (GO:2001253)|regulation of histone H4 acetylation (GO:0090239)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(2)|kidney(6)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)		TACTCTTCTTCATTGCCTGAC	0.408																																						dbGAP											0													190.0	184.0	186.0					2																	128260970		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK000868	CCDS2146.1	2q14.3	2006-03-17			ENSG00000163166	ENSG00000163166			25467	protein-coding gene	gene with protein product							Standard	NM_017969		Approved	DKFZp761G0123, FLJ10006, FLJ14655, FLJ32319	uc002ton.2	Q96ST2	OTTHUMG00000131527	ENST00000295321.4:c.1402G>T	2.37:g.128260970C>A	ENSP00000295321:p.Glu468*		Q2TB65|Q6P157|Q8N3E8|Q96MI7|Q9NV97|Q9NWH8	Nonsense_Mutation	SNP	pfam_TFIIS_N,superfamily_TFIIS_N	p.E468*	ENST00000295321.4	37	c.1402	CCDS2146.1	2	.	.	.	.	.	.	.	.	.	.	C	41	8.642005	0.98897	.	.	ENSG00000163166	ENST00000295321;ENST00000433551;ENST00000455721	.	.	.	5.95	5.95	0.96441	.	0.055575	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	-18.8022	20.3789	0.98926	0.0:1.0:0.0:0.0	.	.	.	.	X	468;421;475	.	ENSP00000295321:E468X	E	-	1	0	IWS1	127977440	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.548000	0.67255	2.826000	0.97356	0.563000	0.77884	GAA	IWS1	-	NULL	ENSG00000163166		0.408	IWS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IWS1	HGNC	protein_coding	OTTHUMT00000254384.2	36	0.00	0	C	NM_017969		128260970	128260970	-1	no_errors	ENST00000295321	ensembl	human	known	69_37n	nonsense	62	20.51	16	SNP	1.000	A
KIAA1210	57481	genome.wustl.edu	37	X	118227690	118227690	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chrX:118227690C>T	ENST00000402510.2	-	10	1422	c.1423G>A	c.(1423-1425)Gaa>Aaa	p.E475K		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	475										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						ATGCTCTTTTCTTCTTCAGAA	0.433																																						dbGAP											0													138.0	111.0	120.0					X																	118227690		1876	4102	5978	-	-	-	SO:0001583	missense	0			AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.1423G>A	X.37:g.118227690C>T	ENSP00000384670:p.Glu475Lys		B7ZCI8|Q5JPN4	Missense_Mutation	SNP	NULL	p.E475K	ENST00000402510.2	37	c.1423	CCDS48156.1	X	.	.	.	.	.	.	.	.	.	.	C	8.972	0.973211	0.18736	.	.	ENSG00000250423;ENSG00000241087	ENST00000402510;ENST00000420240	T	0.12361	2.69	3.59	1.53	0.23141	.	.	.	.	.	T	0.13157	0.0319	N	0.14661	0.345	0.09310	N	1	D	0.63880	0.993	P	0.59643	0.861	T	0.18429	-1.0337	9	0.31617	T	0.26	.	4.2903	0.10874	0.0:0.6131:0.2226:0.1643	.	475	Q9ULL0	K1210_HUMAN	K	475;275	ENSP00000384670:E475K	ENSP00000396164:E275K	E	-	1	0	RP13-347D8.5;RP13-347D8.6	118111718	0.484000	0.25964	0.010000	0.14722	0.033000	0.12548	0.593000	0.23999	0.089000	0.17243	-0.231000	0.12243	GAA	KIAA1210	-	NULL	ENSG00000250423		0.433	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1210	HGNC	protein_coding	OTTHUMT00000371251.2	68	0.00	0	C	NM_020721		118227690	118227690	-1	no_errors	ENST00000402510	ensembl	human	known	69_37n	missense	55	20.29	14	SNP	0.178	T
KIFC1	3833	genome.wustl.edu	37	6	33374170	33374170	+	Silent	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr6:33374170C>T	ENST00000428849.2	+	8	2184	c.1734C>T	c.(1732-1734)ctC>ctT	p.L578L		NM_002263.3	NP_002254.2	Q9BW19	KIFC1_HUMAN	kinesin family member C1	578	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|spindle assembly (GO:0051225)	endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|minus-end-directed microtubule motor activity (GO:0008569)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(3)|skin(1)	13						GCTTAGCCCTCGGCCCCGGGG	0.647																																						dbGAP											0													52.0	61.0	58.0					6																	33374170		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D14678	CCDS34430.1	6p21.32	2014-05-15	2003-01-09	2003-01-10	ENSG00000237649	ENSG00000237649		"""Kinesins"""	6389	protein-coding gene	gene with protein product		603763	"""kinesin-like 2"""	KNSL2		8276466	Standard	NM_002263		Approved	HSET	uc003oef.4	Q9BW19	OTTHUMG00000031209	ENST00000428849.2:c.1734C>T	6.37:g.33374170C>T			O60887|Q14834|Q4KMP0|Q5SU09|Q6GMS7|Q6P4A5|Q9UQP7	Silent	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.L578	ENST00000428849.2	37	c.1734	CCDS34430.1	6																																																																																			KIFC1	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	ENSG00000237649		0.647	KIFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIFC1	HGNC	protein_coding	OTTHUMT00000076417.1	40	0.00	0	C	NM_002263		33374170	33374170	+1	no_errors	ENST00000428849	ensembl	human	known	69_37n	silent	38	19.15	9	SNP	0.000	T
KLC4	89953	genome.wustl.edu	37	6	43028032	43028033	+	Intron	DEL	TC	TC	-	rs375367308		TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	TC	TC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr6:43028032_43028033delTC	ENST00000394056.2	+	1	382				KLC4_ENST00000259708.3_Intron|MRPL2_ENST00000388752.3_5'Flank|KLC4_ENST00000458460.2_Intron|KLC4_ENST00000394058.1_5'Flank|KLC4_ENST00000479388.1_Intron|MRPL2_ENST00000230413.5_5'Flank|MRPL2_ENST00000487429.1_5'Flank|MRPL2_ENST00000468957.1_5'Flank|KLC4_ENST00000347162.5_Intron|KLC4_ENST00000453940.2_Intron|MRPL2_ENST00000489623.1_5'Flank			Q9NSK0	KLC4_HUMAN	kinesin light chain 4							cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)			endometrium(2)|large_intestine(7)|lung(5)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(4)	23			all cancers(41;0.00169)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0376)|KIRC - Kidney renal clear cell carcinoma(2;0.0453)			TCTGGTTAAGTCTCTCTCTCTC	0.55																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK055293	CCDS4882.1, CCDS4883.1, CCDS47429.1, CCDS75459.1	6p21.1	2013-01-10	2005-09-13	2005-09-13	ENSG00000137171	ENSG00000137171		"""Tetratricopeptide (TTC) repeat domain containing"""	21624	protein-coding gene	gene with protein product			"""kinesin-like 8"""	KNSL8			Standard	NM_001289034		Approved	bA387M24.3	uc003otw.1	Q9NSK0	OTTHUMG00000014720	ENST00000394056.2:c.-114+18TC>-	6.37:g.43028042_43028043delTC			B3KNY4|B3KPI3|B3KSQ3|B4DME9|Q66K28|Q96EG6	Frame_Shift_Del	DEL	NULL	p.L32fs	ENST00000394056.2	37	c.85_86	CCDS4883.1	6																																																																																			KLC4	-	NULL	ENSG00000137171		0.550	KLC4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KLC4	HGNC	protein_coding	OTTHUMT00000040579.2	54	0.00	0	TC	NM_138343		43028032	43028033	+1	no_errors	ENST00000481499	ensembl	human	known	69_37n	frame_shift_del	67	18.29	15	DEL	0.000:0.000	-
KRTAP10-6	386674	genome.wustl.edu	37	21	46011676	46011676	+	Silent	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr21:46011676C>T	ENST00000400368.1	-	1	710	c.690G>A	c.(688-690)gtG>gtA	p.V230V	TSPEAR_ENST00000323084.4_Intron	NM_198688.2	NP_941961.2	P60371	KR106_HUMAN	keratin associated protein 10-6	230	29 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(6)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23						AGCAGACGGGCACGCAGCAGG	0.642																																						dbGAP											0													125.0	135.0	132.0					21																	46011676		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB076353	CCDS42959.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000188155	ENSG00000188155		"""Keratin associated proteins"""	20523	protein-coding gene	gene with protein product			"""keratin associated protein 18-6"""	KRTAP18-6			Standard	NM_198688		Approved	KRTAP18.6, KAP18.6, KAP10.6	uc002zfm.3	P60371	OTTHUMG00000057634	ENST00000400368.1:c.690G>A	21.37:g.46011676C>T				Silent	SNP	NULL	p.V230	ENST00000400368.1	37	c.690	CCDS42959.1	21																																																																																			KRTAP10-6	-	NULL	ENSG00000188155		0.642	KRTAP10-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-6	HGNC	protein_coding	OTTHUMT00000128037.1	66	0.00	0	C	NM_198688		46011676	46011676	-1	no_errors	ENST00000400368	ensembl	human	known	69_37n	silent	136	15.00	24	SNP	0.000	T
LAMB4	22798	genome.wustl.edu	37	7	107706818	107706818	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr7:107706818C>T	ENST00000388781.3	-	20	2757	c.2674G>A	c.(2674-2676)Gaa>Aaa	p.E892K	LAMB4_ENST00000205386.4_Missense_Mutation_p.E892K|LAMB4_ENST00000388780.3_Missense_Mutation_p.E892K	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	892	Laminin EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00460}.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)				NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						CCATACCTTTCACAGTTTCTG	0.393																																						dbGAP											0													53.0	50.0	51.0					7																	107706818		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.2674G>A	7.37:g.107706818C>T	ENSP00000373433:p.Glu892Lys		A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.E892K	ENST00000388781.3	37	c.2674	CCDS34732.1	7	.	.	.	.	.	.	.	.	.	.	C	34	5.345649	0.95807	.	.	ENSG00000091128	ENST00000205386;ENST00000388781;ENST00000388780	T;T;T	0.68181	-0.31;-0.31;-0.31	4.98	4.98	0.66077	EGF-like, laminin (4);	0.118668	0.37437	N	0.002096	D	0.86535	0.5956	H	0.95004	3.61	0.80722	D	1	D	0.71674	0.998	D	0.66847	0.947	D	0.90280	0.4314	10	0.72032	D	0.01	.	18.4442	0.90678	0.0:1.0:0.0:0.0	.	892	A4D0S4	LAMB4_HUMAN	K	892	ENSP00000205386:E892K;ENSP00000373433:E892K;ENSP00000373432:E892K	ENSP00000205386:E892K	E	-	1	0	LAMB4	107494054	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.117000	0.77129	2.591000	0.87537	0.563000	0.77884	GAA	LAMB4	-	pfam_EGF_laminin,smart_EGF_laminin,pfscan_EGF_laminin	ENSG00000091128		0.393	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB4	HGNC	protein_coding	OTTHUMT00000337442.1	20	0.00	0	C	XM_209857		107706818	107706818	-1	no_errors	ENST00000205386	ensembl	human	known	69_37n	missense	28	15.15	5	SNP	1.000	T
LINC00273	649159	genome.wustl.edu	37	16	33961786	33961786	+	lincRNA	SNP	C	C	T	rs200619814		TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr16:33961786C>T	ENST00000539813.1	-	0	717				AC136932.1_ENST00000385251.1_RNA	NR_038368.1				long intergenic non-protein coding RNA 273											lung(1)	1						CGCCCCTCTGCGGGCTCCCGG	0.701																																						dbGAP											0																																										-	-	-			0			AY587847		16p11.2	2013-06-03	2011-08-11	2011-08-11	ENSG00000256642	ENSG00000256642		"""Long non-coding RNAs"""	38595	other	unknown	"""non-protein coding RNA 273-1"""		"""non-protein coding RNA 273"""	NCRNA00273			Standard	NR_038368		Approved	TOP, NCRNA00273-1	uc021thl.1		OTTHUMG00000176379		16.37:g.33961786C>T				Missense_Mutation	SNP	NULL	p.A219T	ENST00000539813.1	37	c.655		16	.	.	.	.	.	.	.	.	.	.	c	2.093	-0.407846	0.04832	.	.	ENSG00000256642	ENST00000539813	.	.	.	.	.	.	.	.	.	.	.	T	0.29355	0.0731	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26467	-1.0102	2	.	.	.	.	.	.	.	.	.	.	.	T	219	.	.	A	-	1	0	AC136932.2	33869287	0.178000	0.23122	0.014000	0.15608	0.014000	0.08584	1.169000	0.31871	0.119000	0.18210	0.121000	0.15741	GCA	LINC00273	-	NULL	ENSG00000256642		0.701	LINC00273-001	KNOWN	basic	lincRNA	LINC00273	HGNC	lincRNA	OTTHUMT00000431840.1	28	0.00	0	C	NR_038368		33961786	33961786	-1	no_errors	ENST00000539813	ensembl	human	putative	69_37n	missense	39	13.33	6	SNP	0.014	T
LINC00588	26138	genome.wustl.edu	37	8	58192367	58192367	+	lincRNA	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr8:58192367G>A	ENST00000521663.1	+	0	266					NR_026772.1		Q9Y4M8	CH071_HUMAN	long intergenic non-protein coding RNA 588																		TGGCGACCTCGTTCTCTGGGC	0.642																																						dbGAP											0																																										-	-	-			0					8q12.1	2012-10-12	2012-04-17	2012-04-17	ENSG00000215117	ENSG00000215117		"""Long non-coding RNAs"""	24494	non-coding RNA	RNA, long non-coding			"""chromosome 8 open reading frame 71"""	C8orf71		11230166	Standard	NR_026772		Approved	DKFZP434F122	uc003xtg.3	Q9Y4M8	OTTHUMG00000164424		8.37:g.58192367G>A				RNA	SNP	-	NULL	ENST00000521663.1	37	NULL		8																																																																																			LINC00588	-	-	ENSG00000215117		0.642	LINC00588-001	KNOWN	basic	lincRNA	LINC00588	HGNC	lincRNA	OTTHUMT00000378704.1	58	0.00	0	G	NR_026772		58192367	58192367	+1	no_errors	ENST00000521663	ensembl	human	known	69_37n	rna	97	16.38	19	SNP	0.212	A
LRIG1	26018	genome.wustl.edu	37	3	66456365	66456365	+	Intron	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr3:66456365C>T	ENST00000273261.3	-	9	1604				LRIG1_ENST00000496559.2_5'UTR|LRIG1_ENST00000383703.3_Intron	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1						innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		TCAATGGCTTCCCAGCTTCCA	0.587																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.1080-663G>A	3.37:g.66456365C>T			Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	RNA	SNP	-	NULL	ENST00000273261.3	37	NULL	CCDS33783.1	3																																																																																			LRIG1	-	-	ENSG00000144749		0.587	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIG1	HGNC	protein_coding	OTTHUMT00000351930.1	18	0.00	0	C	NM_015541		66456365	66456365	-1	no_errors	ENST00000496559	ensembl	human	known	69_37n	rna	18	18.18	4	SNP	0.018	T
LRRK2	120892	genome.wustl.edu	37	12	40742252	40742252	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr12:40742252G>A	ENST00000298910.7	+	43	6380	c.6322G>A	c.(6322-6324)Gag>Aag	p.E2108K		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	2108	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				GCCTATGGTTGAGAAATTAAT	0.318																																						dbGAP											0													87.0	86.0	86.0					12																	40742252		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.6322G>A	12.37:g.40742252G>A	ENSP00000298910:p.Glu2108Lys		A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIRO-like,pfam_Small_GTPase,pfam_Leu-rich_rpt,pfam_Small_GTPase_ARF/SAR,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Small_GTPase_Rab_type,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,prints_Small_GTPase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,tigrfam_Small_GTP-bd_dom	p.E2108K	ENST00000298910.7	37	c.6322	CCDS31774.1	12	.	.	.	.	.	.	.	.	.	.	G	23.5	4.426758	0.83667	.	.	ENSG00000188906	ENST00000298910	T	0.62498	0.02	5.34	5.34	0.76211	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.046228	0.85682	D	0.000000	T	0.48892	0.1525	N	0.04768	-0.165	0.58432	D	0.99999	B;B	0.33883	0.046;0.43	B;B	0.38296	0.089;0.27	T	0.57670	-0.7771	10	0.66056	D	0.02	.	19.0992	0.93266	0.0:0.0:1.0:0.0	.	2108;2108	Q17RV3;Q5S007	.;LRRK2_HUMAN	K	2108	ENSP00000298910:E2108K	ENSP00000298910:E2108K	E	+	1	0	LRRK2	39028519	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.085000	0.64468	2.531000	0.85337	0.650000	0.86243	GAG	LRRK2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	ENSG00000188906		0.318	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	HGNC	protein_coding	OTTHUMT00000277179.1	65	0.00	0	G	XM_058513		40742252	40742252	+1	no_errors	ENST00000298910	ensembl	human	known	69_37n	missense	58	27.50	22	SNP	1.000	A
MAZ	4150	genome.wustl.edu	37	16	29819170	29819170	+	Intron	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr16:29819170G>A	ENST00000322945.6	+	2	1208				MAZ_ENST00000563402.1_Intron|MAZ_ENST00000569978.1_5'Flank|AC009133.20_ENST00000569039.1_RNA|MAZ_ENST00000545521.1_Intron|MAZ_ENST00000568544.1_5'Flank|MAZ_ENST00000219782.6_Intron|MAZ_ENST00000562337.1_Intron|AC009133.14_ENST00000563806.1_RNA|AC009133.15_ENST00000566537.1_RNA|MAZ_ENST00000566906.2_Intron|MAZ_ENST00000568282.1_5'Flank|AC009133.14_ENST00000569981.1_RNA	NM_002383.2	NP_002374.2	P56270	MAZ_HUMAN	MYC-associated zinc finger protein (purine-binding transcription factor)						positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|termination of RNA polymerase II transcription (GO:0006369)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			endometrium(3)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	10						GGCCTCGGCCGCCCGCTAGGC	0.706																																					Colon(72;875 1167 15364 30899 37091)	dbGAP											0													13.0	15.0	14.0					16																	29819170		1914	3965	5879	-	-	-	SO:0001627	intron_variant	0			M93339	CCDS42143.1, CCDS42144.1, CCDS61902.1, CCDS61903.1	16p11.2	2013-01-08			ENSG00000103495	ENSG00000103495		"""Zinc fingers, C2H2-type"""	6914	protein-coding gene	gene with protein product		600999				1567856, 1502157	Standard	NM_001276275		Approved	ZF87, Pur-1, Zif87, ZNF801	uc002dtx.4	P56270	OTTHUMG00000132119	ENST00000322945.6:c.1043+21G>A	16.37:g.29819170G>A			A8QJL9|C6G496|G5E927|H3BQD6|Q15703|Q8NFN7|Q99443	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R11H	ENST00000322945.6	37	c.32	CCDS42143.1	16																																																																																			MAZ	-	NULL	ENSG00000103495		0.706	MAZ-001	KNOWN	basic|CCDS	protein_coding	MAZ	HGNC	protein_coding	OTTHUMT00000435536.1	16	0.00	0	G	NM_002383		29819170	29819170	+1	no_start_codon	ENST00000563012	ensembl	human	novel	69_37n	missense	18	25.00	6	SNP	0.975	A
MBNL3	55796	genome.wustl.edu	37	X	131540295	131540295	+	Silent	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chrX:131540295C>T	ENST00000370853.3	-	2	381	c.303G>A	c.(301-303)caG>caA	p.Q101Q	RAP2C-AS1_ENST00000441399.2_RNA|MBNL3_ENST00000370857.3_Silent_p.Q101Q|MBNL3_ENST00000370844.1_Silent_p.Q5Q|MBNL3_ENST00000538204.1_Silent_p.Q51Q|MBNL3_ENST00000370849.3_Silent_p.Q51Q|MBNL3_ENST00000394311.2_Silent_p.Q5Q|MBNL3_ENST00000370839.3_Silent_p.Q101Q|RAP2C-AS1_ENST00000421483.2_RNA|MBNL3_ENST00000473364.1_5'UTR	NM_018388.3	NP_060858.2	Q9NUK0	MBNL3_HUMAN	muscleblind-like splicing regulator 3	101					mRNA processing (GO:0006397)|multicellular organismal development (GO:0007275)|negative regulation of myoblast differentiation (GO:0045662)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|prostate(2)	16	Acute lymphoblastic leukemia(192;0.000127)					TAAGCTGCATCTGCTGGGCGA	0.458																																						dbGAP											0													148.0	115.0	126.0					X																	131540295		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF491305	CCDS14633.1, CCDS14634.1, CCDS55492.1, CCDS55493.1, CCDS55494.1	Xq26.2	2013-01-18	2012-02-23		ENSG00000076770	ENSG00000076770		"""Zinc fingers, CCCH-type domain containing"""	20564	protein-coding gene	gene with protein product		300413	"""muscleblind-like 3 (Drosophila)"""			12297108, 10970838	Standard	NM_018388		Approved	CHCR, FLJ11316, MBLX39, MBXL	uc004ewv.4	Q9NUK0	OTTHUMG00000022426	ENST00000370853.3:c.303G>A	X.37:g.131540295C>T			Q5JXN8|Q5JXN9|Q5JXP4|Q6UDQ1|Q8IUR4|Q8TAD9|Q8TAF4|Q9H0Z7|Q9UF37	Silent	SNP	smart_Znf_CCCH	p.Q101	ENST00000370853.3	37	c.303	CCDS14633.1	X																																																																																			MBNL3	-	NULL	ENSG00000076770		0.458	MBNL3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MBNL3	HGNC	protein_coding	OTTHUMT00000058319.1	42	0.00	0	C	NM_018388		131540295	131540295	-1	no_errors	ENST00000370853	ensembl	human	known	69_37n	silent	51	15.00	9	SNP	0.994	T
MCM3AP	8888	genome.wustl.edu	37	21	47690281	47690281	+	Intron	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr21:47690281C>T	ENST00000397708.1	-	10	2883				MCM3AP_ENST00000291688.1_Intron			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein						DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					CACCTGCTTTCTTCCAACTCT	0.468																																						dbGAP											0													81.0	82.0	82.0					21																	47690281		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.2628+33G>A	21.37:g.47690281C>T			C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	RNA	SNP	-	NULL	ENST00000397708.1	37	NULL	CCDS13734.1	21																																																																																			MCM3AP	-	-	ENSG00000160294		0.468	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM3AP	HGNC	protein_coding	OTTHUMT00000207254.1	20	0.00	0	C	NM_003906		47690281	47690281	-1	no_errors	ENST00000479557	ensembl	human	known	69_37n	rna	20	16.67	4	SNP	0.000	T
MED1	5469	genome.wustl.edu	37	17	37564556	37564556	+	Silent	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr17:37564556G>A	ENST00000300651.6	-	17	4141	c.3918C>T	c.(3916-3918)gtC>gtT	p.V1306V	MED1_ENST00000394287.3_Intron|CTB-131K11.1_ENST00000582842.1_RNA	NM_004774.3	NP_004765.2	O95243	MBD4_HUMAN	mediator complex subunit 1	0					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)			NS(1)|breast(2)|cervix(3)|kidney(3)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(7)|urinary_tract(1)	59		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		GTTTATCTATGACAGCTGTCA	0.517										HNSCC(31;0.082)																											Pancreas(21;279 768 2492 4877 24026)	dbGAP											0													70.0	77.0	75.0					17																	37564556		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L40366	CCDS11336.1	17q12	2007-07-30	2007-07-30	2007-07-30	ENSG00000125686	ENSG00000125686			9234	protein-coding gene	gene with protein product		604311	"""PPAR binding protein"""	TRIP2, PPARGBP, PPARBP		9325263, 10485914	Standard	NM_004774		Approved	PBP, TRAP220, RB18A, DRIP230, CRSP200, CRSP1	uc002hrv.4	Q15648	OTTHUMG00000133216	ENST00000300651.6:c.3918C>T	17.37:g.37564556G>A			B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Silent	SNP	pfam_Mediator_Med1_met/fun	p.V1306	ENST00000300651.6	37	c.3918	CCDS11336.1	17																																																																																			MED1	-	NULL	ENSG00000125686		0.517	MED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED1	HGNC	protein_coding	OTTHUMT00000256943.3	20	0.00	0	G	NM_004774		37564556	37564556	-1	no_errors	ENST00000300651	ensembl	human	known	69_37n	silent	18	18.18	4	SNP	1.000	A
MED12	9968	genome.wustl.edu	37	X	70349589	70349589	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chrX:70349589G>A	ENST00000374080.3	+	27	3783	c.3751G>A	c.(3751-3753)Gag>Aag	p.E1251K	MED12_ENST00000374102.1_Missense_Mutation_p.E1251K|MED12_ENST00000333646.6_Missense_Mutation_p.E1251K			Q93074	MED12_HUMAN	mediator complex subunit 12	1251					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					AGAACTTCCAGAGGAGGAGGG	0.582			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome				OREG0019857	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP		Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	0													35.0	42.0	40.0					X																	70349589		2137	4228	6365	-	-	-	SO:0001583	missense	0			U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.3751G>A	X.37:g.70349589G>A	ENSP00000363193:p.Glu1251Lys	1121	O15410|O75557|Q9UHV6|Q9UND7	Missense_Mutation	SNP	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12_catenin-bd,pfam_Mediator_Med12	p.E1251K	ENST00000374080.3	37	c.3751	CCDS43970.1	X	.	.	.	.	.	.	.	.	.	.	.	14.45	2.538596	0.45176	.	.	ENSG00000184634	ENST00000333646;ENST00000536756;ENST00000374102;ENST00000374080;ENST00000430072	T;T;T;T	0.57107	0.43;0.42;0.42;0.42	5.38	5.38	0.77491	.	0.109105	0.64402	D	0.000008	T	0.48660	0.1512	L	0.48642	1.525	0.58432	D	0.999998	B;B;B;B	0.30326	0.27;0.255;0.214;0.276	B;B;B;B	0.35278	0.117;0.037;0.199;0.076	T	0.42068	-0.9473	10	0.07990	T	0.79	-20.9619	18.515	0.90933	0.0:0.0:1.0:0.0	.	1251;1098;1251;1251	F5H3Y1;Q7Z3Z5;Q93074-3;Q93074	.;.;.;MED12_HUMAN	K	1251;1251;1251;1251;1219	ENSP00000333125:E1251K;ENSP00000363215:E1251K;ENSP00000363193:E1251K;ENSP00000414203:E1219K	ENSP00000333125:E1251K	E	+	1	0	MED12	70266314	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.113000	0.89568	2.401000	0.81631	0.468000	0.43344	GAG	MED12	-	NULL	ENSG00000184634		0.582	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MED12	HGNC	protein_coding	OTTHUMT00000057105.1	23	0.00	0	G	NM_005120		70349589	70349589	+1	no_errors	ENST00000333646	ensembl	human	known	69_37n	missense	38	13.64	6	SNP	1.000	A
MFSD4	148808	genome.wustl.edu	37	1	205567990	205567990	+	Intron	SNP	C	C	T	rs12092624	byFrequency	TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr1:205567990C>T	ENST00000367147.4	+	9	1461				MFSD4_ENST00000539267.1_Intron|MFSD4_ENST00000478555.1_3'UTR|MFSD4_ENST00000536357.1_Intron	NM_181644.4	NP_857595.3	Q8N468	MFSD4_HUMAN	major facilitator superfamily domain containing 4						transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0908)			TGATAGAGATCGTCAGAAGGT	0.473													T|||	1844	0.368211	0.388	0.3444	5008	,	,		20179	0.3006		0.4871	False		,,,				2504	0.3057					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC036549	CCDS1455.1	1q32.1	2008-02-05			ENSG00000174514	ENSG00000174514			25433	protein-coding gene	gene with protein product							Standard	NM_181644		Approved	DKFZp761N1114, FLJ34577, UNQ3064, FLJ25004	uc001hcv.4	Q8N468	OTTHUMG00000037197	ENST00000367147.4:c.1369-269C>T	1.37:g.205567990C>T			B7Z8X3|Q6UY25|Q8NAY0|Q8TCP4	RNA	SNP	-	NULL	ENST00000367147.4	37	NULL	CCDS1455.1	1																																																																																			MFSD4	-	-	ENSG00000174514		0.473	MFSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFSD4	HGNC	protein_coding	OTTHUMT00000090391.1	8	0.00	0	C	NM_181644		205567990	205567990	+1	no_errors	ENST00000478555	ensembl	human	known	69_37n	rna	6	66.67	12	SNP	0.005	T
CCDC180	100499483	genome.wustl.edu	37	9	100125857	100125857	+	Intron	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr9:100125857C>T	ENST00000357054.1	+	41	4771				RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000375202.2_Intron|CCDC180_ENST00000395220.1_Intron|CCDC180_ENST00000529487.1_Intron|MIR1302-8_ENST00000408342.1_RNA			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180							extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											actggaatttcagatcaacac	0.383																																						dbGAP											0													110.0	102.0	105.0					9																	100125857		1568	3582	5150	-	-	-	SO:0001627	intron_variant	0			AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.3837-443C>T	9.37:g.100125857C>T			Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	RNA	SNP	-	NULL	ENST00000357054.1	37	NULL		9																																																																																			MIR1302-8	-	-	ENSG00000221269		0.383	CCDC180-201	KNOWN	basic	protein_coding	MIR1302-8	HGNC	protein_coding		24	0.00	0	C	NM_020893		100125857	100125857	-1	no_errors	ENST00000408342	ensembl	human	known	69_37n	rna	21	50.00	21	SNP	0.077	T
LIN7A	8825	genome.wustl.edu	37	12	81226349	81226349	+	Intron	SNP	C	C	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr12:81226349C>A	ENST00000552864.1	-	4	686				MIR617_ENST00000385030.1_RNA	NM_004664.2	NP_004655.1	O14910	LIN7A_HUMAN	lin-7 homolog A (C. elegans)						exocytosis (GO:0006887)|inner ear development (GO:0048839)|neurotransmitter secretion (GO:0007269)|protein complex assembly (GO:0006461)|protein transport (GO:0015031)|synaptic vesicle transport (GO:0048489)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	L27 domain binding (GO:0097016)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|skin(2)	15						CCTGGACTTACCATTTGAAGG	0.463																																						dbGAP											0													53.0	46.0	48.0					12																	81226349		1565	3573	5138	-	-	-	SO:0001627	intron_variant	0			AF028826	CCDS9021.1	12q21.31	2014-09-04			ENSG00000111052	ENSG00000111052			17787	protein-coding gene	gene with protein product	"""mammalian LIN-7 1"""	603380				10341223, 17237226	Standard	NM_004664		Approved	MALS-1, TIP-33, LIN-7A, VELI1	uc001szj.1	O14910	OTTHUMG00000170168	ENST00000552864.1:c.483+13159G>T	12.37:g.81226349C>A			A4FTY3|Q147W1|Q6LES3|Q7LDS4	RNA	SNP	-	NULL	ENST00000552864.1	37	NULL	CCDS9021.1	12																																																																																			MIR617	-	-	ENSG00000207763		0.463	LIN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR617	HGNC	protein_coding	OTTHUMT00000407760.1	15	0.00	0	C			81226349	81226349	-1	no_errors	ENST00000385030	ensembl	human	known	69_37n	rna	19	24.00	6	SNP	0.045	A
KMT2C	58508	genome.wustl.edu	37	7	151868351	151868351	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr7:151868351G>A	ENST00000262189.6	-	40	9669	c.9451C>T	c.(9451-9453)Cag>Tag	p.Q3151*	KMT2C_ENST00000355193.2_Nonsense_Mutation_p.Q3151*	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	3151	Gln-rich.				histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										AGTGTTACCTGAGGAATGGCC	0.473																																						dbGAP											0													172.0	133.0	147.0					7																	151868351		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.9451C>T	7.37:g.151868351G>A	ENSP00000262189:p.Gln3151*		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Nonsense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.Q3151*	ENST00000262189.6	37	c.9451	CCDS5931.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	51|51	17.513602|17.513602	0.99888|0.99888	.|.	.|.	ENSG00000055609|ENSG00000055609	ENST00000262189;ENST00000355193|ENST00000360104	.|.	.|.	.|.	5.86|5.86	5.86|5.86	0.93980|0.93980	.|.	0.167176|.	0.28088|.	N|.	0.016654|.	.|T	.|0.76644	.|0.4016	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.74016	.|-0.3800	.|4	0.72032|.	D|.	0.01|.	.|.	19.7876|19.7876	0.96444|0.96444	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|L	3151|656	.|.	ENSP00000262189:Q3151X|.	Q|S	-|-	1|2	0|0	MLL3|MLL3	151499284|151499284	1.000000|1.000000	0.71417|0.71417	0.982000|0.982000	0.44146|0.44146	0.057000|0.057000	0.15508|0.15508	6.752000|6.752000	0.74898|0.74898	2.778000|2.778000	0.95560|0.95560	0.655000|0.655000	0.94253|0.94253	CAG|TCA	MLL3	-	NULL	ENSG00000055609		0.473	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL3	HGNC	protein_coding	OTTHUMT00000318887.3	28	0.00	0	G			151868351	151868351	-1	no_errors	ENST00000355193	ensembl	human	known	69_37n	nonsense	71	19.32	17	SNP	0.998	A
MRPL50	54534	genome.wustl.edu	37	9	104153128	104153128	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr9:104153128C>G	ENST00000374865.4	-	2	118	c.97G>C	c.(97-99)Gag>Cag	p.E33Q	MRPL50_ENST00000539624.1_Missense_Mutation_p.E33Q	NM_019051.2	NP_061924.1	Q8N5N7	RM50_HUMAN	mitochondrial ribosomal protein L50	33						mitochondrion (GO:0005739)|ribosome (GO:0005840)				large_intestine(1)|lung(2)|prostate(2)	5		Acute lymphoblastic leukemia(62;0.0559)				GGCTCTTTCTCTTTTCTGGAA	0.408																																						dbGAP											0													105.0	106.0	105.0					9																	104153128		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK000500	CCDS6753.1	9q31.1	2012-11-14			ENSG00000136897	ENSG00000136897		"""Mitochondrial ribosomal proteins / large subunits"""	16654	protein-coding gene	gene with protein product	"""mitochondrial 39S ribosomal protein L50"""	611854					Standard	NM_019051		Approved	FLJ20493, MRP-L50	uc004bbe.2	Q8N5N7	OTTHUMG00000020384	ENST00000374865.4:c.97G>C	9.37:g.104153128C>G	ENSP00000363999:p.Glu33Gln		B7Z358|Q5T7E0|Q9NX15	Missense_Mutation	SNP	pfam_Ribosomal_L50_mt	p.E33Q	ENST00000374865.4	37	c.97	CCDS6753.1	9	.	.	.	.	.	.	.	.	.	.	C	6.802	0.516995	0.13005	.	.	ENSG00000136897	ENST00000374865;ENST00000539624	T	0.49720	0.77	5.62	2.54	0.30619	.	0.261395	0.32753	N	0.005682	T	0.32585	0.0834	N	0.20986	0.625	0.19775	N	0.999957	B;B	0.12630	0.006;0.006	B;B	0.17098	0.017;0.006	T	0.32508	-0.9904	10	0.66056	D	0.02	-1.8701	10.3222	0.43773	0.0:0.6486:0.2725:0.0788	.	33;33	B7Z358;Q8N5N7	.;RM50_HUMAN	Q	33	ENSP00000363999:E33Q	ENSP00000363999:E33Q	E	-	1	0	MRPL50	103192949	0.556000	0.26538	0.780000	0.31762	0.229000	0.25112	0.553000	0.23391	0.728000	0.32382	-0.262000	0.10625	GAG	MRPL50	-	NULL	ENSG00000136897		0.408	MRPL50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL50	HGNC	protein_coding	OTTHUMT00000053450.1	21	0.00	0	C	NM_019051		104153128	104153128	-1	no_errors	ENST00000374865	ensembl	human	known	69_37n	missense	16	30.43	7	SNP	0.421	G
MSH5	4439	genome.wustl.edu	37	6	31721124	31721124	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr6:31721124C>T	ENST00000375755.3	+	11	1145	c.859C>T	c.(859-861)Cgt>Tgt	p.R287C	MSH5_ENST00000534153.4_Missense_Mutation_p.R304C|MSH5_ENST00000431848.2_5'UTR|MSH5_ENST00000375740.3_Missense_Mutation_p.R304C|MSH5_ENST00000375703.3_Missense_Mutation_p.R287C|MSH5_ENST00000375742.3_Missense_Mutation_p.R304C|MSH5-SAPCD1_ENST00000493662.2_Missense_Mutation_p.R304C|MSH5_ENST00000375750.3_Missense_Mutation_p.R287C	NM_002441.4	NP_002432.1	O43196	MSH5_HUMAN	mutS homolog 5	287					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)			breast(1)|ovary(2)|skin(2)	5						GCTCAGTTCTCGTCTGGACGT	0.532								Direct reversal of damage;Mismatch excision repair (MMR)																														dbGAP											0													159.0	142.0	147.0					6																	31721124		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF070071	CCDS4720.1, CCDS34409.1, CCDS34410.1, CCDS34409.2	6p21.3	2013-09-12	2013-09-12		ENSG00000204410	ENSG00000204410			7328	protein-coding gene	gene with protein product		603382	"""mutS (E. coli) homolog 5"", ""mutS homolog 5 (E. coli)"""			9740671, 9787078, 17977839	Standard	NM_002441		Approved		uc011hbg.2	O43196	OTTHUMG00000167551	ENST00000375755.3:c.859C>T	6.37:g.31721124C>T	ENSP00000364908:p.Arg287Cys		B0V033|B0V034|O60586|Q5BLU9|Q5SSR1|Q8IW44|Q9BQC7	Missense_Mutation	SNP	pfam_DNA_mismatch_repair_MutS_C,pfam_DNA_mismatch_repair_MutS_core,pfam_DNA_mismatch_repair_MutS_clamp,superfamily_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_C	p.R304C	ENST00000375755.3	37	c.910	CCDS4720.1	6	.	.	.	.	.	.	.	.	.	.	C	22.0	4.236515	0.79800	.	.	ENSG00000204410	ENST00000375755;ENST00000375742;ENST00000375750;ENST00000534153;ENST00000375703;ENST00000375740;ENST00000450148	T;T;T;T;T;T;T	0.63096	-0.02;-0.02;-0.02;-0.02;-0.02;-0.02;-0.02	5.06	5.06	0.68205	DNA mismatch repair protein MutS, core (3);	0.000000	0.64402	D	0.000001	T	0.78660	0.4318	M	0.87682	2.9	0.47094	D	0.999317	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.83239	-0.0059	9	0.87932	D	0	-8.6591	15.9458	0.79792	0.0:1.0:0.0:0.0	.	304;287;287;304	O43196-4;O43196;O43196-2;O43196-3	.;MSH5_HUMAN;.;.	C	287;304;287;304;287;304;124	ENSP00000364908:R287C;ENSP00000364894:R304C;ENSP00000364903:R287C;ENSP00000431693:R304C;ENSP00000364855:R287C;ENSP00000364892:R304C;ENSP00000394971:R124C	ENSP00000364855:R287C	R	+	1	0	MSH5	31829103	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	4.354000	0.59417	2.333000	0.79357	0.563000	0.77884	CGT	MSH5	-	pfam_DNA_mismatch_repair_MutS_core,superfamily_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_core	ENSG00000204410		0.532	MSH5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MSH5	HGNC	protein_coding	OTTHUMT00000076243.4	23	0.00	0	C			31721124	31721124	+1	no_errors	ENST00000375742	ensembl	human	known	69_37n	missense	19	20.83	5	SNP	1.000	T
MYH13	8735	genome.wustl.edu	37	17	10210333	10210333	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr17:10210333G>A	ENST00000418404.3	-	35	5381	c.5218C>T	c.(5218-5220)Cag>Tag	p.Q1740*	MYH13_ENST00000252172.4_Nonsense_Mutation_p.Q1740*|RP11-401O9.4_ENST00000609088.1_RNA			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	1740					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						GCCTGGCACTGAGCTATGTCA	0.483																																						dbGAP											0													89.0	93.0	91.0					17																	10210333		2194	4299	6493	-	-	-	SO:0001587	stop_gained	0			AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.5218C>T	17.37:g.10210333G>A	ENSP00000404570:p.Gln1740*		O95252|Q9P0U8	Nonsense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.Q1740*	ENST00000418404.3	37	c.5218	CCDS45613.1	17	.	.	.	.	.	.	.	.	.	.	G	46	12.192850	0.99645	.	.	ENSG00000006788	ENST00000252172	.	.	.	4.1	3.04	0.35103	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	.	14.4307	0.67249	0.0:0.1482:0.8518:0.0	.	.	.	.	X	1740	.	ENSP00000252172:Q1740X	Q	-	1	0	MYH13	10151058	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.459000	0.73513	2.265000	0.75225	0.563000	0.77884	CAG	MYH13	-	pfam_Myosin_tail	ENSG00000006788		0.483	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYH13	HGNC	protein_coding	OTTHUMT00000442255.1	67	0.00	0	G	NM_003802		10210333	10210333	-1	no_errors	ENST00000252172	ensembl	human	known	69_37n	nonsense	43	25.86	15	SNP	1.000	A
MYH1	4619	genome.wustl.edu	37	17	10399279	10399279	+	Silent	SNP	G	G	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr17:10399279G>T	ENST00000226207.5	-	35	5251	c.5157C>A	c.(5155-5157)ctC>ctA	p.L1719L	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1719					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						GGGTGTGCAGGAGCTGAACAC	0.463																																						dbGAP											0													75.0	69.0	71.0					17																	10399279		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.5157C>A	17.37:g.10399279G>T			Q14CA4|Q9Y622	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L1719	ENST00000226207.5	37	c.5157	CCDS11155.1	17																																																																																			MYH1	-	pfam_Myosin_tail	ENSG00000109061		0.463	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH1	HGNC	protein_coding	OTTHUMT00000252725.1	70	0.00	0	G	NM_005963		10399279	10399279	-1	no_errors	ENST00000226207	ensembl	human	known	69_37n	silent	57	25.97	20	SNP	1.000	T
MYH16	84176	genome.wustl.edu	37	7	98903620	98903620	+	IGR	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr7:98903620G>A								MYH16 (47841 upstream) : ARPC1A (19900 downstream)																							AGAAGCTTCAGAACAAGCTGA	0.567																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															7.37:g.98903620G>A				RNA	SNP	-	NULL		37	NULL		7																																																																																			MYH16	-	-	ENSG00000002079	0	0.567					MYH16	HGNC			29	0.00	0	G			98903620	98903620	+1	no_errors	ENST00000453378	ensembl	human	known	69_37n	rna	26	31.58	12	SNP	1.000	A
NCKAP5L	57701	genome.wustl.edu	37	12	50190646	50190646	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr12:50190646C>T	ENST00000335999.6	-	8	1198	c.997G>A	c.(997-999)Gag>Aag	p.E333K		NM_001037806.3	NP_001032895.2	Q9HCH0	NCK5L_HUMAN	NCK-associated protein 5-like	329	Pro-rich.									central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(8)|prostate(2)	18						TCTGTGTCCTCAAGGAGCTGG	0.652																																						dbGAP											0													17.0	20.0	19.0					12																	50190646		1976	4138	6114	-	-	-	SO:0001583	missense	0			AB046822	CCDS41781.2	12q13.12	2009-08-14	2009-08-14	2009-08-14	ENSG00000167566	ENSG00000167566			29321	protein-coding gene	gene with protein product		615104	"""KIAA1602"""	KIAA1602			Standard	NM_001037806		Approved		uc009zlk.2	Q9HCH0	OTTHUMG00000156969	ENST00000335999.6:c.997G>A	12.37:g.50190646C>T	ENSP00000337998:p.Glu333Lys		Q2TB26|Q71RH1|Q8N4W1|Q96HX2	Missense_Mutation	SNP	NULL	p.E333K	ENST00000335999.6	37	c.997	CCDS41781.2	12	.	.	.	.	.	.	.	.	.	.	C	15.92	2.974974	0.53720	.	.	ENSG00000167566	ENST00000335999;ENST00000354423	T	0.43294	0.95	4.12	4.12	0.48240	.	0.170499	0.28360	N	0.015625	T	0.21145	0.0509	N	0.08118	0	0.27216	N	0.959771	B	0.30281	0.275	B	0.31812	0.136	T	0.13361	-1.0512	10	0.07990	T	0.79	-8.956	12.2668	0.54683	0.0:1.0:0.0:0.0	.	329	E2QRB5	.	K	333;329	ENSP00000337998:E333K	ENSP00000337998:E333K	E	-	1	0	NCKAP5L	48476913	0.776000	0.28616	0.995000	0.50966	0.992000	0.81027	2.472000	0.45136	2.032000	0.59987	0.462000	0.41574	GAG	NCKAP5L	-	NULL	ENSG00000167566		0.652	NCKAP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCKAP5L	HGNC	protein_coding	OTTHUMT00000346884.2	28	0.00	0	C	XM_035497		50190646	50190646	-1	no_errors	ENST00000335999	ensembl	human	known	69_37n	missense	35	16.67	7	SNP	0.991	T
NDST3	9348	genome.wustl.edu	37	4	119036068	119036068	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr4:119036068G>A	ENST00000296499.5	+	4	1580	c.1177G>A	c.(1177-1179)Gag>Aag	p.E393K	NDST3_ENST00000433996.2_Intron	NM_004784.2	NP_004775.1	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3	393	Heparan sulfate N-deacetylase 3.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	54						CTTCCACAATGAGTCATCTTT	0.438																																						dbGAP											0													136.0	126.0	129.0					4																	119036068		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF074924	CCDS3708.1	4q26	2008-08-04			ENSG00000164100	ENSG00000164100		"""Sulfotransferases, membrane-bound"""	7682	protein-coding gene	gene with protein product		603950				9915799	Standard	NM_004784		Approved	HSST3	uc003ibx.3	O95803	OTTHUMG00000132959	ENST00000296499.5:c.1177G>A	4.37:g.119036068G>A	ENSP00000296499:p.Glu393Lys		B4DI67|Q4W5C1|Q4W5D0|Q6UWC5|Q9UP21	Missense_Mutation	SNP	pfam_Heparan_SO4_deacetylase,pfam_Sulfotransferase_dom	p.E393K	ENST00000296499.5	37	c.1177	CCDS3708.1	4	.	.	.	.	.	.	.	.	.	.	G	12.77	2.038539	0.35989	.	.	ENSG00000164100	ENST00000296499	T	0.35789	1.29	5.47	5.47	0.80525	.	0.100851	0.64402	D	0.000003	T	0.42562	0.1208	L	0.57536	1.79	0.80722	D	1	B	0.28760	0.221	B	0.39771	0.309	T	0.25606	-1.0127	10	0.06757	T	0.87	.	19.6923	0.96007	0.0:0.0:1.0:0.0	.	393	O95803	NDST3_HUMAN	K	393	ENSP00000296499:E393K	ENSP00000296499:E393K	E	+	1	0	NDST3	119255516	1.000000	0.71417	0.969000	0.41365	0.907000	0.53573	4.414000	0.59802	2.712000	0.92718	0.650000	0.86243	GAG	NDST3	-	pfam_Heparan_SO4_deacetylase	ENSG00000164100		0.438	NDST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDST3	HGNC	protein_coding	OTTHUMT00000256517.4	121	0.00	0	G	NM_004784		119036068	119036068	+1	no_errors	ENST00000296499	ensembl	human	known	69_37n	missense	146	19.78	36	SNP	1.000	A
NDUFS7	374291	genome.wustl.edu	37	19	1390884	1390884	+	Silent	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr19:1390884C>T	ENST00000233627.9	+	5	539	c.243C>T	c.(241-243)ccC>ccT	p.P81P	AC005329.7_ENST00000501448.1_RNA|NDUFS7_ENST00000540530.1_3'UTR|NDUFS7_ENST00000414651.2_Silent_p.P111P|NDUFS7_ENST00000539480.1_Silent_p.P81P|AC005329.7_ENST00000585596.1_RNA|NDUFS7_ENST00000313408.7_Silent_p.P81P|NDUFS7_ENST00000546283.1_Silent_p.P81P|AC005329.7_ENST00000589734.1_RNA	NM_024407.4	NP_077718.3	O75251	NDUS7_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase)	81					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|mitochondrial respiratory chain complex I assembly (GO:0032981)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|synaptic membrane (GO:0097060)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|quinone binding (GO:0048038)			ovary(1)	1		Acute lymphoblastic leukemia(61;5.61e-13)|all_hematologic(61;2.65e-08)|Breast(49;0.00186)|Lung NSC(49;0.00292)|all_lung(49;0.00419)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Doxorubicin(DB00997)	CTCTGTGGCCCATGACCTTCG	0.701																																						dbGAP											0													32.0	32.0	32.0					19																	1390884		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			AF115969	CCDS12063.1	19p13	2011-07-04	2002-08-29		ENSG00000115286	ENSG00000115286		"""Mitochondrial respiratory chain complex / Complex I"""	7714	protein-coding gene	gene with protein product	"""complex I 20kDa subunit"", ""NADH dehydrogenase [ubiquinone] iron-sulfur protein 7, mitochondrial"""	601825	"""NADH dehydrogenase (ubiquinone) Fe-S protein 7 (20kD) (NADH-coenzyme Q reductase)"""			8938450	Standard	NM_024407		Approved	PSST, FLJ46880, FLJ45860, CI-20	uc002lse.4	O75251	OTTHUMG00000168077	ENST00000233627.9:c.243C>T	19.37:g.1390884C>T			B3KRI2|Q2T9H7|Q9BV17	Silent	SNP	pfam_NADH_UbQ_OxRdtase-like_20kDa,tigrfam_NADH_UQ_OxRdtase_20Kd_su	p.P81	ENST00000233627.9	37	c.243	CCDS12063.1	19																																																																																			NDUFS7	-	tigrfam_NADH_UQ_OxRdtase_20Kd_su	ENSG00000115286		0.701	NDUFS7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFS7	HGNC	protein_coding	OTTHUMT00000397984.1	31	0.00	0	C	NM_024407		1390884	1390884	+1	no_errors	ENST00000233627	ensembl	human	known	69_37n	silent	44	22.41	13	SNP	0.994	T
NEK11	79858	genome.wustl.edu	37	3	130947413	130947413	+	Missense_Mutation	SNP	G	G	A	rs369191214		TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr3:130947413G>A	ENST00000510769.1	+	11	1379	c.1126G>A	c.(1126-1128)Gat>Aat	p.D376N	NEK11_ENST00000510688.1_Missense_Mutation_p.D481N|NEK11_ENST00000429253.2_Missense_Mutation_p.D481N|NEK11_ENST00000383366.4_Missense_Mutation_p.D481N|NEK11_ENST00000412440.2_Missense_Mutation_p.D297N|NEK11_ENST00000508196.1_Missense_Mutation_p.D481N					NIMA-related kinase 11									p.A482_D484delAFD(1)		breast(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(14)|stomach(1)|urinary_tract(2)	33						GTACTACGCTGATGCATTTGA	0.403																																						dbGAP											1	Deletion - In frame(1)	breast(1)											141.0	136.0	138.0					3																	130947413		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027148	CCDS3069.1, CCDS46915.1, CCDS54639.1	3q22.1	2012-11-15	2012-11-15		ENSG00000114670	ENSG00000114670			18593	protein-coding gene	gene with protein product		609779	"""NIMA (never in mitosis gene a)- related kinase 11"""				Standard	NM_024800		Approved	FLJ23495	uc003eny.3	Q8NG66	OTTHUMG00000159654	ENST00000510769.1:c.1126G>A	3.37:g.130947413G>A	ENSP00000421549:p.Asp376Asn			Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.D481N	ENST00000510769.1	37	c.1441		3	.	.	.	.	.	.	.	.	.	.	G	16.91	3.252040	0.59212	.	.	ENSG00000114670	ENST00000510769;ENST00000429253;ENST00000510688;ENST00000383366;ENST00000412440;ENST00000508196	T;T;T;T;T;T	0.77489	-0.71;-0.54;-1.1;-0.54;-0.72;-0.54	5.67	5.67	0.87782	.	0.158034	0.29480	N	0.012029	D	0.82962	0.5151	L	0.48642	1.525	0.25888	N	0.983517	D;D;D;D	0.63046	0.979;0.986;0.992;0.986	P;P;P;P	0.61592	0.801;0.78;0.891;0.78	T	0.76206	-0.3044	10	0.41790	T	0.15	.	16.6756	0.85278	0.0:0.0:1.0:0.0	.	376;297;481;481	E9PHI8;B4DDN2;Q8NG66-4;Q8NG66	.;.;.;NEK11_HUMAN	N	376;481;481;481;297;481	ENSP00000421549:D376N;ENSP00000397180:D481N;ENSP00000423458:D481N;ENSP00000372857:D481N;ENSP00000411888:D297N;ENSP00000421851:D481N	ENSP00000372857:D481N	D	+	1	0	NEK11	132430103	0.994000	0.37717	0.314000	0.25224	0.015000	0.08874	5.408000	0.66368	2.654000	0.90174	0.655000	0.94253	GAT	NEK11	-	NULL	ENSG00000114670		0.403	NEK11-005	NOVEL	basic|exp_conf	protein_coding	NEK11	HGNC	protein_coding	OTTHUMT00000356757.1	46	0.00	0	G	NM_024800		130947413	130947413	+1	no_errors	ENST00000383366	ensembl	human	known	69_37n	missense	28	24.32	9	SNP	0.389	A
NEU1	4758	genome.wustl.edu	37	6	31827913	31827913	+	Silent	SNP	G	G	A	rs114639005		TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr6:31827913G>A	ENST00000375631.4	-	5	1056	c.927C>T	c.(925-927)ttC>ttT	p.F309F		NM_000434.3	NP_000425.1	Q99519	NEUR1_HUMAN	sialidase 1 (lysosomal sialidase)	309					glycosphingolipid metabolic process (GO:0006687)|lipid catabolic process (GO:0016042)|oligosaccharide catabolic process (GO:0009313)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	exo-alpha-(2->3)-sialidase activity (GO:0052794)|exo-alpha-(2->6)-sialidase activity (GO:0052795)|exo-alpha-(2->8)-sialidase activity (GO:0052796)|exo-alpha-sialidase activity (GO:0004308)			kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	10					Oseltamivir(DB00198)	GCTCAGGGTCGAAGGTCACAT	0.552																																						dbGAP											0													89.0	82.0	85.0					6																	31827913		1511	2709	4220	-	-	-	SO:0001819	synonymous_variant	0			AF040958	CCDS4723.1	6p21	2012-10-02			ENSG00000204386	ENSG00000204386	3.2.1.18		7758	protein-coding gene	gene with protein product		608272		NEU		9054950	Standard	NM_000434		Approved		uc003nxq.4	Q99519	OTTHUMG00000031284	ENST00000375631.4:c.927C>T	6.37:g.31827913G>A				Silent	SNP	superfamily_Neuraminidase	p.F309	ENST00000375631.4	37	c.927	CCDS4723.1	6																																																																																			NEU1	-	superfamily_Neuraminidase	ENSG00000204386		0.552	NEU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEU1	HGNC	protein_coding	OTTHUMT00000076616.2	18	0.00	0	G			31827913	31827913	-1	no_errors	ENST00000375631	ensembl	human	known	69_37n	silent	33	19.51	8	SNP	0.036	A
NF1	4763	genome.wustl.edu	37	17	29585447	29585447	+	Nonsense_Mutation	SNP	C	C	G			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr17:29585447C>G	ENST00000358273.4	+	32	4642	c.4259C>G	c.(4258-4260)tCa>tGa	p.S1420*	NF1_ENST00000356175.3_Nonsense_Mutation_p.S1399*	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1420	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(5)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GCCATTGTCTCACCGTATGAA	0.423			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												dbGAP	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	13	Whole gene deletion(8)|Unknown(5)	soft_tissue(7)|autonomic_ganglia(3)|central_nervous_system(2)|lung(1)											105.0	94.0	98.0					17																	29585447		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.4259C>G	17.37:g.29585447C>G	ENSP00000351015:p.Ser1420*		O00662|Q14284|Q14930|Q14931|Q9UMK3	Nonsense_Mutation	SNP	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,superfamily_CRAL-TRIO_dom,smart_RasGAP,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_RasGAP	p.S1420*	ENST00000358273.4	37	c.4259	CCDS42292.1	17	.	.	.	.	.	.	.	.	.	.	C	47	13.078295	0.99718	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	.	.	.	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.7178	0.91682	0.0:1.0:0.0:0.0	.	.	.	.	X	1420;1399;1065	.	ENSP00000348498:S1399X	S	+	2	0	NF1	26609573	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.456000	0.80751	2.857000	0.98124	0.650000	0.86243	TCA	NF1	-	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,smart_RasGAP,pfscan_RasGAP	ENSG00000196712		0.423	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	HGNC	protein_coding	OTTHUMT00000256351.2	56	0.00	0	C	NM_000267		29585447	29585447	+1	no_errors	ENST00000358273	ensembl	human	known	69_37n	nonsense	59	25.32	20	SNP	1.000	G
NF1	4763	genome.wustl.edu	37	17	29585516	29585516	+	Nonsense_Mutation	SNP	C	C	G			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr17:29585516C>G	ENST00000358273.4	+	32	4711	c.4328C>G	c.(4327-4329)tCa>tGa	p.S1443*	NF1_ENST00000356175.3_Nonsense_Mutation_p.S1422*	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1443	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(5)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		AAGTTAATGTCAAAGGTGAAT	0.343			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												dbGAP	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	13	Whole gene deletion(8)|Unknown(5)	soft_tissue(7)|autonomic_ganglia(3)|central_nervous_system(2)|lung(1)	GRCh37	CM040786	NF1	M							54.0	50.0	51.0					17																	29585516		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.4328C>G	17.37:g.29585516C>G	ENSP00000351015:p.Ser1443*		O00662|Q14284|Q14930|Q14931|Q9UMK3	Nonsense_Mutation	SNP	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,superfamily_CRAL-TRIO_dom,smart_RasGAP,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_RasGAP	p.S1443*	ENST00000358273.4	37	c.4328	CCDS42292.1	17	.	.	.	.	.	.	.	.	.	.	C	47	13.076948	0.99718	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	.	.	.	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	18.7178	0.91682	0.0:1.0:0.0:0.0	.	.	.	.	X	1443;1422;1088	.	ENSP00000348498:S1422X	S	+	2	0	NF1	26609642	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.456000	0.80751	2.857000	0.98124	0.650000	0.86243	TCA	NF1	-	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,smart_RasGAP,pfscan_RasGAP	ENSG00000196712		0.343	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	HGNC	protein_coding	OTTHUMT00000256351.2	55	0.00	0	C	NM_000267		29585516	29585516	+1	no_errors	ENST00000358273	ensembl	human	known	69_37n	nonsense	47	23.44	15	SNP	1.000	G
NPHP1	4867	genome.wustl.edu	37	2	110889333	110889333	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr2:110889333G>A	ENST00000393272.3	-	17	1827	c.1730C>T	c.(1729-1731)tCt>tTt	p.S577F	NPHP1_ENST00000445609.2_Missense_Mutation_p.S522F|NPHP1_ENST00000355301.4_Missense_Mutation_p.S459F|NPHP1_ENST00000417665.1_Missense_Mutation_p.S521F|NPHP1_ENST00000316534.4_Missense_Mutation_p.S578F	NM_000272.3|NM_207181.2	NP_000263.2|NP_997064.2	O15259	NPHP1_HUMAN	nephronophthisis 1 (juvenile)	577					actin cytoskeleton organization (GO:0030036)|cell projection organization (GO:0030030)|cellular protein localization (GO:0034613)|excretion (GO:0007588)|photoreceptor cell outer segment organization (GO:0035845)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|spermatid differentiation (GO:0048515)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|motile cilium (GO:0031514)|photoreceptor connecting cilium (GO:0032391)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(2)	24						CAAGTGAATAGAACACATATT	0.348																																						dbGAP											0													71.0	69.0	70.0					2																	110889333		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF023674	CCDS2086.1, CCDS46384.1, CCDS46385.1, CCDS46386.1	2q13	2014-01-28			ENSG00000144061	ENSG00000144061			7905	protein-coding gene	gene with protein product	"""nephrocystin-1"""	607100		NPH1			Standard	NM_000272		Approved	JBTS4, SLSN1	uc002tfm.4	O15259	OTTHUMG00000131195	ENST00000393272.3:c.1730C>T	2.37:g.110889333G>A	ENSP00000376953:p.Ser577Phe		O14837	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.S578F	ENST00000393272.3	37	c.1733	CCDS46385.1	2	.	.	.	.	.	.	.	.	.	.	G	1.548	-0.539905	0.04053	.	.	ENSG00000144061	ENST00000316534;ENST00000445609;ENST00000393272;ENST00000355301;ENST00000417665	T;T;T;T;T	0.60040	0.25;0.25;0.25;0.25;0.22	5.15	-1.2	0.09554	.	0.648080	0.15750	N	0.246477	T	0.28234	0.0697	N	0.11427	0.14	0.22253	N	0.999259	B;B;P;B;B;P	0.39282	0.17;0.394;0.666;0.276;0.261;0.529	B;B;B;B;B;B	0.32677	0.031;0.031;0.098;0.045;0.069;0.15	T	0.19877	-1.0292	10	0.30078	T	0.28	-1.36	7.6475	0.28329	0.0:0.3176:0.2335:0.4489	.	521;521;459;577;522;578	B4DQY0;C9JNM7;O15259-3;O15259;O15259-2;O15259-4	.;.;.;NPHP1_HUMAN;.;.	F	578;522;577;459;521	ENSP00000313169:S578F;ENSP00000389879:S522F;ENSP00000376953:S577F;ENSP00000347452:S459F;ENSP00000402176:S521F	ENSP00000313169:S578F	S	-	2	0	NPHP1	110246622	0.002000	0.14202	0.017000	0.16124	0.691000	0.40173	-0.168000	0.09925	-0.098000	0.12285	0.467000	0.42956	TCT	NPHP1	-	NULL	ENSG00000144061		0.348	NPHP1-001	KNOWN	basic|CCDS	protein_coding	NPHP1	HGNC	protein_coding	OTTHUMT00000253919.3	30	0.00	0	G	NM_000272		110889333	110889333	-1	no_errors	ENST00000316534	ensembl	human	known	69_37n	missense	21	16.00	4	SNP	0.120	A
OLFM3	118427	genome.wustl.edu	37	1	102462320	102462320	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr1:102462320C>G	ENST00000370103.4	-	1	266	c.53G>C	c.(52-54)gGa>gCa	p.G18A	OLFM3_ENST00000462354.1_5'UTR	NM_058170.2	NP_477518.2	Q96PB7	NOE3_HUMAN	olfactomedin 3	31					eye photoreceptor cell development (GO:0042462)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)				breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(24)|ovary(3)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	43		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)		AGGATCTAATCCGGCAAACAA	0.388																																						dbGAP											0													139.0	143.0	142.0					1																	102462320		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF397392	CCDS30781.1, CCDS72832.1	1p22	2008-05-23			ENSG00000118733	ENSG00000118733			17990	protein-coding gene	gene with protein product	"""optimedin"""	607567				12019210, 16115881	Standard	NM_001288821		Approved	NOE3	uc001dug.2	Q96PB7	OTTHUMG00000010941	ENST00000370103.4:c.53G>C	1.37:g.102462320C>G	ENSP00000359121:p.Gly18Ala		Q5T3V6|Q6IMI7|Q6IMI8|Q6IMI9|Q6IMJ1|Q8TBG1|Q96PB2|Q96PB3|Q96PB4|Q96PB5|Q96PB6	Missense_Mutation	SNP	pfam_Olfac-like,pfam_Noelin-1,superfamily_Quino_amine_DH_bsu,smart_Olfac-like,pfscan_Olfac-like	p.G18A	ENST00000370103.4	37	c.53	CCDS30781.1	1	.	.	.	.	.	.	.	.	.	.	C	0.526	-0.860218	0.02610	.	.	ENSG00000118733	ENST00000370103	D	0.87103	-2.21	5.98	2.86	0.33363	.	.	.	.	.	T	0.72930	0.3522	L	0.50333	1.59	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.67496	-0.5656	9	0.16896	T	0.51	.	15.2606	0.73617	0.0:0.5999:0.4001:0.0	.	18	Q5T3V6	.	A	18	ENSP00000359121:G18A	ENSP00000359121:G18A	G	-	2	0	OLFM3	102234908	1.000000	0.71417	0.998000	0.56505	0.016000	0.09150	2.148000	0.42235	0.809000	0.34255	0.591000	0.81541	GGA	OLFM3	-	superfamily_Quino_amine_DH_bsu	ENSG00000118733		0.388	OLFM3-003	KNOWN	basic|CCDS	protein_coding	OLFM3	HGNC	protein_coding	OTTHUMT00000030144.1	75	0.00	0	C			102462320	102462320	-1	no_errors	ENST00000370103	ensembl	human	known	69_37n	missense	91	22.22	26	SNP	0.999	G
NUP210L	91181	genome.wustl.edu	37	1	154108376	154108376	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr1:154108376G>A	ENST00000368559.3	-	7	994	c.923C>T	c.(922-924)tCt>tTt	p.S308F	NUP210L_ENST00000271854.3_Missense_Mutation_p.S308F	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	308					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			CACTTTCTCAGAATGAGACCC	0.403																																						dbGAP											0													121.0	112.0	115.0					1																	154108376		1882	4119	6001	-	-	-	SO:0001583	missense	0			AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.923C>T	1.37:g.154108376G>A	ENSP00000357547:p.Ser308Phe		E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation	SNP	pfam_Big_2,superfamily_Invasin/intimin_cell_adhesion,smart_Big_2	p.S308F	ENST00000368559.3	37	c.923	CCDS41399.1	1	.	.	.	.	.	.	.	.	.	.	G	11.06	1.526671	0.27299	.	.	ENSG00000143552	ENST00000368559;ENST00000271854	T;T	0.06294	3.32;3.32	5.0	3.08	0.35506	.	0.324184	0.26975	N	0.021543	T	0.02047	0.0064	L	0.54323	1.7	0.09310	N	1	P;P	0.34780	0.468;0.468	B;B	0.28139	0.086;0.086	T	0.38950	-0.9637	10	0.66056	D	0.02	-29.8679	4.879	0.13670	0.2459:0.1631:0.591:0.0	.	308;308	E7EP56;Q5VU65	.;P210L_HUMAN	F	308	ENSP00000357547:S308F;ENSP00000271854:S308F	ENSP00000271854:S308F	S	-	2	0	NUP210L	152375000	0.001000	0.12720	0.017000	0.16124	0.241000	0.25554	0.845000	0.27668	1.323000	0.45263	0.655000	0.94253	TCT	NUP210L	-	NULL	ENSG00000143552		0.403	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP210L	HGNC	protein_coding	OTTHUMT00000087270.3	63	0.00	0	G	NM_207308		154108376	154108376	-1	no_errors	ENST00000368559	ensembl	human	known	69_37n	missense	75	13.79	12	SNP	0.001	A
NUF2	83540	genome.wustl.edu	37	1	163298074	163298074	+	Silent	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr1:163298074C>T	ENST00000271452.3	+	4	534	c.255C>T	c.(253-255)ttC>ttT	p.F85F	NUF2_ENST00000490881.1_3'UTR|NUF2_ENST00000367900.3_Silent_p.F85F|NUF2_ENST00000524800.1_Silent_p.F85F	NM_145697.2	NP_663735.2	Q9BZD4	NUF2_HUMAN	NUF2, NDC80 kinetochore complex component	85	Interaction with the N-terminus of NDC80.				chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	all_hematologic(923;0.101)					TCTTACCATTCAGCAATTTAG	0.318																																						dbGAP											0													139.0	127.0	131.0					1																	163298074		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BG354574	CCDS1245.1	1q23.3	2013-07-03	2013-07-03	2006-11-07	ENSG00000143228	ENSG00000143228			14621	protein-coding gene	gene with protein product	"""cancer/testis antigen 106"""	611772	"""cell division cycle associated 1"", ""NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae)"""	CDCA1		11266451, 11685532	Standard	NM_031423		Approved	NUF2R, CT106	uc001gcr.1	Q9BZD4	OTTHUMG00000034275	ENST00000271452.3:c.255C>T	1.37:g.163298074C>T			Q8WU69|Q96HJ4|Q96Q78	Silent	SNP	pfam_Kinetochore_Nuf2	p.F85	ENST00000271452.3	37	c.255	CCDS1245.1	1																																																																																			NUF2	-	pfam_Kinetochore_Nuf2	ENSG00000143228		0.318	NUF2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	NUF2	HGNC	protein_coding	OTTHUMT00000082812.1	40	0.00	0	C	NM_145697		163298074	163298074	+1	no_errors	ENST00000271452	ensembl	human	known	69_37n	silent	61	19.74	15	SNP	0.986	T
OR52E6	390078	genome.wustl.edu	37	11	5862420	5862420	+	Silent	SNP	G	G	C			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr11:5862420G>C	ENST00000329322.5	-	1	707	c.708C>G	c.(706-708)ctC>ctG	p.L236L	OR52E6_ENST00000379946.2_Silent_p.L240L|TRIM5_ENST00000380027.1_Intron	NM_001005167.1	NP_001005167.1	Q96RD3	O52E6_HUMAN	olfactory receptor, family 52, subfamily E, member 6	236						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.55e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGAGAGCTTTGAGTCGAGCTT	0.443																																						dbGAP											0													62.0	64.0	63.0					11																	5862420		2196	4294	6490	-	-	-	SO:0001819	synonymous_variant	0			AB065815	CCDS53597.1	11p15.4	2012-08-09				ENSG00000205409		"""GPCR / Class A : Olfactory receptors"""	15215	protein-coding gene	gene with protein product							Standard	NM_001005167		Approved		uc010qzq.2	Q96RD3		ENST00000329322.5:c.708C>G	11.37:g.5862420G>C			Q6IFF8	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L240	ENST00000329322.5	37	c.720	CCDS53597.1	11																																																																																			OR52E6	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000205409		0.443	OR52E6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52E6	HGNC	protein_coding	OTTHUMT00000401144.1	28	0.00	0	G	NM_001005167		5862420	5862420	-1	no_errors	ENST00000379946	ensembl	human	known	69_37n	silent	29	14.71	5	SNP	0.020	C
ORM2	5005	genome.wustl.edu	37	9	117092582	117092582	+	Intron	SNP	A	A	C	rs71505503	byFrequency	TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr9:117092582A>C	ENST00000431067.2	+	2	150				ORM2_ENST00000412657.1_Missense_Mutation_p.H133P	NM_000608.2	NP_000599.1	P19652	A1AG2_HUMAN	orosomucoid 2						acute-phase response (GO:0006953)|regulation of immune system process (GO:0002682)|transport (GO:0006810)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|large_intestine(1)|lung(1)|skin(2)|urinary_tract(1)	7		Myeloproliferative disorder(63;0.163)			Chlorpromazine(DB00477)|Oxycodone(DB00497)|Thalidomide(DB01041)	GAGCTCCTGCATGCGCACTGC	0.597													-|||	879	0.175519	0.084	0.1715	5008	,	,		16819	0.1915		0.1869	False		,,,				2504	0.274				NSCLC(65;867 1308 1814 2391 12508)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS6804.1	9q32	2013-09-19			ENSG00000228278	ENSG00000228278		"""Lipocalins"""	8499	protein-coding gene	gene with protein product	"""alpha-1-acid glycoprotein, type 2"""	138610				4711474, 2970990	Standard	NM_000608		Approved	AGP-B, AGP-B', AGP2		P19652	OTTHUMG00000021014	ENST00000431067.2:c.115-132A>C	9.37:g.117092582A>C			B2R5L2|Q16571|Q5T538|Q6IB74	Missense_Mutation	SNP	NULL	p.H133P	ENST00000431067.2	37	c.398	CCDS6804.1	9	.	.	.	.	.	.	.	.	.	.	-	2.542	-0.306019	0.05458	.	.	ENSG00000228278	ENST00000412657	T	0.37058	1.22	2.46	0.105	0.14535	.	.	.	.	.	T	0.39091	0.1065	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.51787	-0.8661	5	0.87932	D	0	.	7.433	0.27139	0.3648:0.6352:0.0:0.0	.	.	.	.	P	133	ENSP00000407099:H133P	ENSP00000407099:H133P	H	+	2	0	ORM2	116132403	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-1.016000	0.03633	0.018000	0.15052	0.404000	0.27445	CAT	ORM2	-	NULL	ENSG00000228278		0.597	ORM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ORM2	HGNC	protein_coding	OTTHUMT00000055432.1	9	0.00	0	A	NM_000608		117092582	117092582	+1	no_errors	ENST00000412657	ensembl	human	known	69_37n	missense	6	45.45	5	SNP	0.000	C
PAK3	5063	genome.wustl.edu	37	X	110388139	110388139	+	Intron	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chrX:110388139G>A	ENST00000372010.1	+	7	718				PAK3_ENST00000262836.4_Intron|PAK3_ENST00000360648.4_Missense_Mutation_p.E110K|PAK3_ENST00000446737.1_Intron|PAK3_ENST00000372007.5_Intron|PAK3_ENST00000417227.1_Missense_Mutation_p.E110K|PAK3_ENST00000425146.1_Intron|PAK3_ENST00000519681.1_Missense_Mutation_p.E110K|PAK3_ENST00000518291.1_Missense_Mutation_p.E110K			O75914	PAK3_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 3						activation of MAPK activity (GO:0000187)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|dendritic spine morphogenesis (GO:0060997)|MAPK cascade (GO:0000165)|regulation of actin filament polymerization (GO:0030833)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	41						AAGTCAATCAGAGGGAAAAAT	0.403										TSP Lung(19;0.15)																												dbGAP											0													54.0	38.0	43.0					X																	110388139		1566	3571	5137	-	-	-	SO:0001627	intron_variant	0			AF068864	CCDS14554.1, CCDS48151.1, CCDS48152.1, CCDS48153.1	Xq22.3	2008-06-17	2008-06-17		ENSG00000077264	ENSG00000077264			8592	protein-coding gene	gene with protein product		300142	"""mental retardation, X-linked 47"", ""p21 (CDKN1A)-activated kinase 3"""	MRX30, MRX47		8826460, 9731525	Standard	NM_002578		Approved	hPAK3, bPAK	uc010npv.1	O75914	OTTHUMG00000022202	ENST00000372010.1:c.277-1610G>A	X.37:g.110388139G>A			A8K389|B1GX77|B1GX78|B1GX79|Q5JWX1|Q5JWX2|Q7Z2D6|Q7Z2E4|Q7Z3Z8|Q8WWK5|Q8WX23|Q9P0J8	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PAK_box_Rho-bd,superfamily_Kinase-like_dom,smart_PAK_box_Rho-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_PAK_box_Rho-bd,pfscan_Prot_kinase_cat_dom	p.E110K	ENST00000372010.1	37	c.328	CCDS48153.1	X	.	.	.	.	.	.	.	.	.	.	G	10.30	1.311249	0.23821	.	.	ENSG00000077264	ENST00000519681;ENST00000518291;ENST00000429193;ENST00000360648;ENST00000417227	T;T;T;T	0.71222	-0.52;-0.55;-0.55;-0.52	4.35	3.46	0.39613	.	1.203730	0.06184	U	0.679997	T	0.75177	0.3814	L	0.42245	1.32	0.80722	D	1	P;P	0.37398	0.593;0.593	P;P	0.57846	0.828;0.828	T	0.63386	-0.6649	10	0.06236	T	0.91	.	8.3266	0.32160	0.0:0.0:0.7659:0.2341	.	110;110	O75914-4;O75914-3	.;.	K	110	ENSP00000429113:E110K;ENSP00000428921:E110K;ENSP00000353864:E110K;ENSP00000389172:E110K	ENSP00000353864:E110K	E	+	1	0	PAK3	110274795	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.343000	0.44001	1.119000	0.41883	0.506000	0.49869	GAG	PAK3	-	NULL	ENSG00000077264		0.403	PAK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAK3	HGNC	protein_coding	OTTHUMT00000057918.1	35	0.00	0	G	NM_002578		110388139	110388139	+1	no_errors	ENST00000360648	ensembl	human	known	69_37n	missense	57	21.92	16	SNP	1.000	A
PAN2	9924	genome.wustl.edu	37	12	56713158	56713158	+	Silent	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr12:56713158G>A	ENST00000425394.2	-	23	3592	c.3216C>T	c.(3214-3216)ctC>ctT	p.L1072L	PAN2_ENST00000257931.5_Silent_p.L1071L|PAN2_ENST00000548043.1_Silent_p.L1072L|PAN2_ENST00000549090.1_5'UTR|PAN2_ENST00000440411.3_Silent_p.L1068L	NM_001127460.2	NP_001120932	Q9HBH5	RDH14_HUMAN	PAN2 poly(A) specific ribonuclease subunit	228					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	41					Vitamin A(DB00162)	CAATGTCAATGAGAAAACGAA	0.458																																						dbGAP											0													121.0	122.0	121.0					12																	56713158		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB014610	CCDS8915.1, CCDS44922.1, CCDS53802.1	12q13.2	2014-03-27	2014-03-27	2008-01-08		ENSG00000135473		"""Ubiquitin-specific peptidases"""	20074	protein-coding gene	gene with protein product	"""PAN2 homolog, PABP1 dependent poly A specific ribonuclease subunit (S. cerevisiae)"""		"""ubiquitin specific protease 52"", ""ubiquitin specific peptidase 52"", ""PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""	USP52		12838346, 14583602	Standard	NM_014871		Approved	KIAA0710, hPAN2	uc001skx.3	Q504Q3	OTTHUMG00000170412	ENST00000425394.2:c.3216C>T	12.37:g.56713158G>A				Silent	SNP	pfam_Exonuclease_RNaseT/DNA_pol3,pfam_Peptidase_C19,superfamily_RNaseH-like_dom,superfamily_WD40_repeat_dom,smart_Exonuclease,pfscan_Peptidase_C19	p.L1072	ENST00000425394.2	37	c.3216	CCDS44922.1	12																																																																																			PAN2	-	pfam_Exonuclease_RNaseT/DNA_pol3,superfamily_RNaseH-like_dom,smart_Exonuclease	ENSG00000135473		0.458	PAN2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAN2	HGNC	protein_coding	OTTHUMT00000409024.1	47	0.00	0	G	NM_014871		56713158	56713158	-1	no_errors	ENST00000425394	ensembl	human	known	69_37n	silent	70	14.63	12	SNP	0.999	A
PCDH10	57575	genome.wustl.edu	37	4	134072895	134072895	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr4:134072895G>C	ENST00000264360.5	+	1	2426	c.1600G>C	c.(1600-1602)Gag>Cag	p.E534Q	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	534	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		CTTCGACTATGAGCAGCTGAA	0.562																																						dbGAP											0													59.0	63.0	62.0					4																	134072895		2176	4249	6425	-	-	-	SO:0001583	missense	0			AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.1600G>C	4.37:g.134072895G>C	ENSP00000264360:p.Glu534Gln		Q4W5F6|Q96SF0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E534Q	ENST00000264360.5	37	c.1600	CCDS34063.1	4	.	.	.	.	.	.	.	.	.	.	G	33	5.268111	0.95429	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.72942	-0.7	4.51	4.51	0.55191	Cadherin (5);Cadherin-like (1);	0.000000	0.43747	D	0.000539	D	0.89629	0.6770	H	0.97465	4.01	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.997;1.0	D	0.93403	0.6762	10	0.87932	D	0	.	16.1677	0.81782	0.0:0.0:1.0:0.0	.	534;534	Q9P2E7;Q96SF0	PCD10_HUMAN;.	Q	534	ENSP00000264360:E534Q	ENSP00000264360:E534Q	E	+	1	0	PCDH10	134292345	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.616000	0.98359	2.329000	0.79093	0.655000	0.94253	GAG	PCDH10	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000138650		0.562	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PCDH10	HGNC	protein_coding	OTTHUMT00000364457.2	18	0.00	0	G	NM_032961		134072895	134072895	+1	no_errors	ENST00000264360	ensembl	human	known	69_37n	missense	39	26.42	14	SNP	1.000	C
PCF11	51585	genome.wustl.edu	37	11	82877653	82877653	+	Nonsense_Mutation	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr11:82877653C>T	ENST00000298281.4	+	5	2166	c.1714C>T	c.(1714-1716)Cag>Tag	p.Q572*		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	572					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						AACTACAAATCAGCATTCTAC	0.408																																						dbGAP											0													64.0	64.0	64.0					11																	82877653		1860	4087	5947	-	-	-	SO:0001587	stop_gained	0			AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.1714C>T	11.37:g.82877653C>T	ENSP00000298281:p.Gln572*		A6H8W7|O43671|Q6P0X8	Nonsense_Mutation	SNP	pfam_RNA_pol_II-bd,superfamily_ENTH_VHS,smart_RNA_polymerase_II_lsu_CTD	p.Q572*	ENST00000298281.4	37	c.1714	CCDS44689.1	11	.	.	.	.	.	.	.	.	.	.	C	41	8.730415	0.98931	.	.	ENSG00000165494	ENST00000298281;ENST00000530660;ENST00000530304	.	.	.	6.07	5.16	0.70880	.	0.000000	0.56097	D	0.000029	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.7401	0.46147	0.0:0.7998:0.1325:0.0677	.	.	.	.	X	572	.	.	Q	+	1	0	PCF11	82555301	0.998000	0.40836	0.860000	0.33809	0.963000	0.63663	3.251000	0.51453	1.549000	0.49425	0.655000	0.94253	CAG	PCF11	-	NULL	ENSG00000165494		0.408	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCF11	HGNC	protein_coding	OTTHUMT00000392548.2	25	0.00	0	C	NM_015885		82877653	82877653	+1	no_errors	ENST00000298281	ensembl	human	known	69_37n	nonsense	18	35.71	10	SNP	0.997	T
PCSK6	5046	genome.wustl.edu	37	15	101887939	101887939	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr15:101887939C>T	ENST00000344273.2	-	16	1944	c.1945G>A	c.(1945-1947)Gag>Aag	p.E649K	PCSK6_ENST00000398181.2_3'UTR|PCSK6_ENST00000561177.1_Intron|PCSK6_ENST00000348070.1_Intron|PCSK6_ENST00000358417.3_Intron	NM_138324.1	NP_612197.1	P29122	PCSK6_HUMAN	proprotein convertase subtilisin/kexin type 6	0					determination of left/right symmetry (GO:0007368)|glycoprotein metabolic process (GO:0009100)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|regulation of BMP signaling pathway (GO:0030510)|secretion by cell (GO:0032940)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|nerve growth factor binding (GO:0048406)|serine-type endopeptidase activity (GO:0004252)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TACCAAAGCTCTTGTTCAATC	0.488																																						dbGAP											0													98.0	96.0	97.0					15																	101887939		1905	4131	6036	-	-	-	SO:0001583	missense	0				CCDS73789.1, CCDS73790.1, CCDS73791.1, CCDS73792.1, CCDS73793.1	15q26	2008-07-18	2004-06-14	2004-06-16		ENSG00000140479			8569	protein-coding gene	gene with protein product	"""subtilisin-like protease"", ""subtilisin-like proprotein convertase 4"", ""subtilisin/kexin-like protease PACE4"""	167405	"""paired basic amino acid cleaving system 4"""	PACE4		1741956	Standard	NM_002570		Approved	SPC4	uc002bwy.3	P29122		ENST00000344273.2:c.1945G>A	15.37:g.101887939C>T	ENSP00000344410:p.Glu649Lys		Q15099|Q15100|Q9UEG7|Q9UEJ1|Q9UEJ2|Q9UEJ7|Q9UEJ8|Q9UEJ9|Q9Y4G9|Q9Y4H0|Q9Y4H1	Missense_Mutation	SNP	pfam_Peptidase_S8/S53,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53,superfamily_Galactose-bd-like,superfamily_Prot_inh_propept,prints_Peptidase_S8_subtilisin-rel	p.E649K	ENST00000344273.2	37	c.1945		15	.	.	.	.	.	.	.	.	.	.	C	11.81	1.751112	0.31046	.	.	ENSG00000140479	ENST00000344273	T	0.66995	-0.24	2.8	-0.351	0.12602	.	.	.	.	.	T	0.37237	0.0996	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.14643	-1.0465	9	0.27082	T	0.32	.	1.5071	0.02489	0.192:0.4209:0.2497:0.1374	.	649	E7EQ62	.	K	649	ENSP00000344410:E649K	ENSP00000344410:E649K	E	-	1	0	PCSK6	99705462	0.000000	0.05858	0.000000	0.03702	0.074000	0.17049	-0.230000	0.09083	-0.070000	0.12908	0.655000	0.94253	GAG	PCSK6	-	NULL	ENSG00000140479		0.488	PCSK6-202	KNOWN	basic	protein_coding	PCSK6	HGNC	protein_coding		42	0.00	0	C	NM_002570		101887939	101887939	-1	no_errors	ENST00000344273	ensembl	human	known	69_37n	missense	44	20.00	11	SNP	0.000	T
PGAP2	27315	genome.wustl.edu	37	11	3846131	3846131	+	Intron	SNP	A	A	G			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr11:3846131A>G	ENST00000463452.2	+	5	608				PGAP2_ENST00000465307.2_Intron|PGAP2_ENST00000493547.2_Intron|PGAP2_ENST00000396986.2_Intron|PGAP2_ENST00000532017.1_3'UTR|PGAP2_ENST00000479072.1_Intron|PGAP2_ENST00000278243.4_Intron|PGAP2_ENST00000496834.2_Intron|PGAP2_ENST00000300730.6_Intron|PGAP2_ENST00000396991.2_Intron|PGAP2_ENST00000396993.4_Intron	NM_001256240.1	NP_001243169.1	Q9UHJ9	PGAP2_HUMAN	post-GPI attachment to proteins 2						GPI anchor biosynthetic process (GO:0006506)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|signal transduction in response to DNA damage (GO:0042770)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			NS(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)|urinary_tract(1)	11						GCTCCCTTCCATGACCGCTAG	0.607											OREG0020703	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF159615	CCDS7747.1, CCDS44523.1, CCDS58112.1, CCDS58113.1, CCDS73244.1, CCDS73245.1	11p15.4	2014-01-31			ENSG00000148985	ENSG00000148985			17893	protein-coding gene	gene with protein product	"""FGF receptor activating protein 1"", ""cell wall biogenesis 43 N-terminal homolog (S. cerevisiae)"""	615187	"""mental retardation, non-syndromic, autosomal recessive, 21"""	MRT21		10585768, 16407401, 23561846	Standard	NM_014489		Approved	FRAG1, CWH43-N	uc010qxw.3	Q9UHJ9	OTTHUMG00000012238	ENST00000463452.2:c.526-119A>G	11.37:g.3846131A>G		614	E9PJG5|H7BXL9|Q6UC77|Q96G66|Q9UF01|Q9Y4N1	RNA	SNP	-	NULL	ENST00000463452.2	37	NULL	CCDS58112.1	11																																																																																			PGAP2	-	-	ENSG00000148985		0.607	PGAP2-049	KNOWN	basic|CCDS	protein_coding	PGAP2	HGNC	protein_coding	OTTHUMT00000383260.1	16	0.00	0	A			3846131	3846131	+1	no_errors	ENST00000532017	ensembl	human	known	69_37n	rna	25	19.35	6	SNP	0.000	G
PGM1	5236	genome.wustl.edu	37	1	64100532	64100532	+	Nonsense_Mutation	SNP	G	G	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr1:64100532G>T	ENST00000371084.3	+	5	928	c.715G>T	c.(715-717)Gaa>Taa	p.E239*	PGM1_ENST00000371083.4_Nonsense_Mutation_p.E257*|PGM1_ENST00000540265.1_Nonsense_Mutation_p.E42*	NM_002633.2	NP_002624.2	P36871	PGM1_HUMAN	phosphoglucomutase 1	239					carbohydrate metabolic process (GO:0005975)|galactose catabolic process (GO:0019388)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	magnesium ion binding (GO:0000287)|phosphoglucomutase activity (GO:0004614)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20						GATCCTCTGTGAAGAACTCGG	0.473																																						dbGAP											0													129.0	129.0	129.0					1																	64100532		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC019920	CCDS625.1, CCDS53323.1, CCDS53324.1	1p22.1	2012-10-02			ENSG00000079739	ENSG00000079739	5.4.2.2		8905	protein-coding gene	gene with protein product		171900				4517931, 1530890	Standard	NM_002633		Approved		uc010ooz.2	P36871	OTTHUMG00000008968	ENST00000371084.3:c.715G>T	1.37:g.64100532G>T	ENSP00000360125:p.Glu239*		B2R5N9|B4DPV0|Q16105|Q16106|Q5BKZ9|Q6NW22|Q86U74|Q96J40|Q9NTY4	Nonsense_Mutation	SNP	pfam_A-D-PHexomutase_a/b/a-I,pfam_A-D-PHexomutase_a/b/a-III,pfam_A-D-PHexomutase_a/b/a-II,pfam_A-D-PHexomutase_C,superfamily_A-D-PHexomutase_a/b/a-I/II/III,prints_Alpha-D-phosphohexomutase_SF	p.E257*	ENST00000371084.3	37	c.769	CCDS625.1	1	.	.	.	.	.	.	.	.	.	.	G	39	7.805958	0.98501	.	.	ENSG00000079739	ENST00000538673;ENST00000371084;ENST00000540265;ENST00000371083	.	.	.	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11794	T	0.64	-7.1247	18.7907	0.91973	0.0:0.0:1.0:0.0	.	.	.	.	X	215;239;42;257	.	ENSP00000360124:E257X	E	+	1	0	PGM1	63873120	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	7.674000	0.83992	2.656000	0.90262	0.655000	0.94253	GAA	PGM1	-	pfam_A-D-PHexomutase_a/b/a-II	ENSG00000079739		0.473	PGM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGM1	HGNC	protein_coding	OTTHUMT00000024868.1	33	0.00	0	G	NM_002633		64100532	64100532	+1	no_errors	ENST00000371083	ensembl	human	known	69_37n	nonsense	34	12.82	5	SNP	1.000	T
PHLDB3	653583	genome.wustl.edu	37	19	43999763	43999763	+	Silent	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr19:43999763G>A	ENST00000292140.5	-	7	1195	c.835C>T	c.(835-837)Ctg>Ttg	p.L279L		NM_198850.3	NP_942147.3	Q6NSJ2	PHLB3_HUMAN	pleckstrin homology-like domain, family B, member 3	279							enzyme binding (GO:0019899)			breast(1)|central_nervous_system(1)|lung(5)	7		Prostate(69;0.0153)				CGGTGCTGCAGAGCACCCCTC	0.647																																						dbGAP											0													22.0	28.0	26.0					19																	43999763		1965	4159	6124	-	-	-	SO:0001819	synonymous_variant	0				CCDS12621.2	19q13.31	2013-01-10			ENSG00000176531	ENSG00000176531		"""Pleckstrin homology (PH) domain containing"""	30499	protein-coding gene	gene with protein product							Standard	NM_198850		Approved	FLJ40193	uc002own.4	Q6NSJ2	OTTHUMG00000150693	ENST00000292140.5:c.835C>T	19.37:g.43999763G>A			Q8N7Z4	Silent	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.L279	ENST00000292140.5	37	c.835	CCDS12621.2	19																																																																																			PHLDB3	-	NULL	ENSG00000176531		0.647	PHLDB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB3	HGNC	protein_coding	OTTHUMT00000319643.2	32	0.00	0	G			43999763	43999763	-1	no_errors	ENST00000292140	ensembl	human	known	69_37n	silent	36	28.00	14	SNP	0.410	A
PIK3CA	5290	genome.wustl.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)											99.0	89.0	92.0					3																	178952085		1912	4130	6042	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	3.37:g.178952085A>G	ENSP00000263967:p.His1047Arg		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.H1047R	ENST00000263967.3	37	c.3140	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	18	0.00	0	A			178952085	178952085	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	24	27.27	9	SNP	1.000	G
PKD1L1	168507	genome.wustl.edu	37	7	47969108	47969108	+	Silent	SNP	C	C	T	rs574059167		TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr7:47969108C>T	ENST00000289672.2	-	7	803	c.753G>A	c.(751-753)ccG>ccA	p.P251P		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	251					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						GAATGCCAGGCGGAAGGCCGT	0.612													C|||	1	0.000199681	0.0	0.0	5008	,	,		18390	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													49.0	51.0	50.0					7																	47969108		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.753G>A	7.37:g.47969108C>T			Q6UWK1	Silent	SNP	pfam_PKD/REJ-like,pfam_PKD1_2_channel,pfam_PKD_dom,pfam_LipOase_LH2,superfamily_Lipase_LipOase,superfamily_PKD_dom,smart_PKD/Chitinase_dom,smart_LipOase_LH2,pfscan_PKD_dom,pfscan_LipOase_LH2,pfscan_REJ-like	p.P251	ENST00000289672.2	37	c.753	CCDS34633.1	7																																																																																			PKD1L1	-	NULL	ENSG00000158683		0.612	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD1L1	HGNC	protein_coding	OTTHUMT00000340974.1	9	0.00	0	C	NM_138295		47969108	47969108	-1	no_errors	ENST00000289672	ensembl	human	known	69_37n	silent	11	35.29	6	SNP	0.000	T
PMS2P4	5382	genome.wustl.edu	37	7	66762213	66762213	+	RNA	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr7:66762213C>T	ENST00000414507.1	-	0	261				Y_RNA_ENST00000364695.1_RNA					postmeiotic segregation increased 2 pseudogene 4																		CTTAAGCCTTCAAAGTTTTCT	0.338																																						dbGAP											0																																										-	-	-			0			D38438		7q11.22	2010-10-26	2010-10-26	2010-10-26	ENSG00000067601	ENSG00000067601			9129	pseudogene	pseudogene	"""PMS2 pseudogene"""		"""postmeiotic segregation increased 2-like 4"", ""postmeiotic segregation increased 2-like 4 pseudogene"""	PMS2L4		8586419	Standard	NR_046297		Approved	PMS6	uc003tvo.3		OTTHUMG00000156923		7.37:g.66762213C>T				RNA	SNP	-	NULL	ENST00000414507.1	37	NULL		7																																																																																			PMS2P4	-	-	ENSG00000067601		0.338	PMS2P4-002	KNOWN	basic	processed_transcript	PMS2P4	HGNC	pseudogene	OTTHUMT00000346632.1	84	0.00	0	C	NR_022007		66762213	66762213	-1	no_errors	ENST00000414507	ensembl	human	known	69_37n	rna	89	10.10	10	SNP	1.000	T
POMGNT1	55624	genome.wustl.edu	37	1	46654475	46654475	+	3'UTR	SNP	C	C	G			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr1:46654475C>G	ENST00000371984.3	-	0	2607				POMGNT1_ENST00000485714.1_5'Flank|POMGNT1_ENST00000535522.1_3'UTR|POMGNT1_ENST00000396420.3_3'UTR|POMGNT1_ENST00000371992.1_Silent_p.L721L|POMGNT1_ENST00000371986.3_Silent_p.L721L	NM_017739.3	NP_060209	Q8WZA1	PMGT1_HUMAN	protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-)						protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity (GO:0047223)			breast(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(166;0.155)					GAGTCTGTGTCAGCATGTGGG	0.542																																						dbGAP											0													71.0	70.0	70.0					1																	46654475		876	1991	2867	-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS531.1, CCDS57995.1	1p34.1	2014-09-17	2013-07-31		ENSG00000085998	ENSG00000085998	2.4.1.-	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	19139	protein-coding gene	gene with protein product	"""protein O-mannose beta-1,2-N-acetylglucosaminyltransferase"""	606822	"""muscle-eye-brain disease"", ""protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase"""	MEB		11742540, 12788071	Standard	NM_017739		Approved	FLJ20277, MGAT1.2, LGMD2O	uc001cpg.3	Q8WZA1	OTTHUMG00000007604	ENST00000371984.3:c.*467G>C	1.37:g.46654475C>G			D3DQ16|Q5VST2|Q5VST3|Q9BV55|Q9H9L8|Q9NXF9|Q9NYF7	Silent	SNP	pfam_Glyco_trans_13	p.L721	ENST00000371984.3	37	c.2163	CCDS531.1	1																																																																																			POMGNT1	-	NULL	ENSG00000085998		0.542	POMGNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POMGNT1	HGNC	protein_coding	OTTHUMT00000020146.1	27	0.00	0	C	NM_017739		46654475	46654475	-1	no_errors	ENST00000371986	ensembl	human	known	69_37n	silent	29	25.64	10	SNP	1.000	G
POMGNT1	55624	genome.wustl.edu	37	1	46656456	46656456	+	Splice_Site	SNP	C	C	G			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr1:46656456C>G	ENST00000371984.3	-	18	1697	c.1540G>C	c.(1540-1542)Gag>Cag	p.E514Q	POMGNT1_ENST00000485714.1_5'UTR|POMGNT1_ENST00000535522.1_Splice_Site_p.E492Q|POMGNT1_ENST00000396420.3_3'UTR|POMGNT1_ENST00000371992.1_Splice_Site_p.E514Q|POMGNT1_ENST00000371986.3_Splice_Site_p.E514Q	NM_017739.3	NP_060209	Q8WZA1	PMGT1_HUMAN	protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-)	514					protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity (GO:0047223)			breast(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(166;0.155)					AAGTAGGCCTCCTGGAGTGGG	0.522																																						dbGAP											0													119.0	108.0	112.0					1																	46656456		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS531.1, CCDS57995.1	1p34.1	2014-09-17	2013-07-31		ENSG00000085998	ENSG00000085998	2.4.1.-	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	19139	protein-coding gene	gene with protein product	"""protein O-mannose beta-1,2-N-acetylglucosaminyltransferase"""	606822	"""muscle-eye-brain disease"", ""protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase"""	MEB		11742540, 12788071	Standard	NM_017739		Approved	FLJ20277, MGAT1.2, LGMD2O	uc001cpg.3	Q8WZA1	OTTHUMG00000007604	ENST00000371984.3:c.1540-1G>C	1.37:g.46656456C>G			D3DQ16|Q5VST2|Q5VST3|Q9BV55|Q9H9L8|Q9NXF9|Q9NYF7	Missense_Mutation	SNP	pfam_Glyco_trans_13	p.E514Q	ENST00000371984.3	37	c.1540	CCDS531.1	1	.	.	.	.	.	.	.	.	.	.	C	33	5.246706	0.95305	.	.	ENSG00000085998	ENST00000371984;ENST00000371992;ENST00000535522;ENST00000371986	D;D;D;D	0.84370	-1.84;-1.84;-1.84;-1.84	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	D	0.86830	0.6027	L	0.41632	1.29	0.80722	D	1	P;D;P;P	0.54601	0.89;0.967;0.91;0.91	B;P;P;P	0.52710	0.444;0.707;0.499;0.58	D	0.84513	0.0623	10	0.35671	T	0.21	-23.6542	20.5792	0.99380	0.0:1.0:0.0:0.0	.	492;514;371;514	F5H827;Q5VST3;B7Z7F2;Q8WZA1	.;.;.;PMGT1_HUMAN	Q	514;514;492;514	ENSP00000361052:E514Q;ENSP00000361060:E514Q;ENSP00000443767:E492Q;ENSP00000361054:E514Q	ENSP00000361052:E514Q	E	-	1	0	POMGNT1	46429043	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.453000	0.80700	2.873000	0.98535	0.561000	0.74099	GAG	POMGNT1	-	pfam_Glyco_trans_13	ENSG00000085998		0.522	POMGNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POMGNT1	HGNC	protein_coding	OTTHUMT00000020146.1	36	0.00	0	C	NM_017739	Missense_Mutation	46656456	46656456	-1	no_errors	ENST00000371986	ensembl	human	known	69_37n	missense	43	25.86	15	SNP	1.000	G
POGZ	23126	genome.wustl.edu	37	1	151381003	151381003	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr1:151381003C>T	ENST00000271715.2	-	14	2430	c.2116G>A	c.(2116-2118)Gat>Aat	p.D706N	POGZ_ENST00000409503.1_Missense_Mutation_p.D697N|POGZ_ENST00000531094.1_Missense_Mutation_p.D644N|POGZ_ENST00000392723.1_Missense_Mutation_p.D653N|POGZ_ENST00000361398.3_Missense_Mutation_p.D653N|POGZ_ENST00000491586.1_Missense_Mutation_p.D662N|POGZ_ENST00000540984.1_Missense_Mutation_p.D68N|POGZ_ENST00000368863.2_Missense_Mutation_p.D611N	NM_001194937.1|NM_015100.3	NP_001181866.1|NP_055915.2	Q7Z3K3	POGZ_HUMAN	pogo transposable element with ZNF domain	706					kinetochore assembly (GO:0051382)|mitotic sister chromatid cohesion (GO:0007064)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(10)|kidney(3)|large_intestine(10)|liver(2)|lung(11)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	47	Lung SC(34;0.00471)|Ovarian(49;0.00672)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GGAGGTGTATCATTAGAGGAT	0.547																																						dbGAP											0													77.0	80.0	79.0					1																	151381003		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007930	CCDS997.1, CCDS998.1, CCDS44222.1, CCDS44222.2, CCDS53365.1, CCDS53366.1	1q21.1	2013-07-22			ENSG00000143442	ENSG00000143442			18801	protein-coding gene	gene with protein product	"""zinc finger protein 280E"", ""putative protein product of Nbla00003"""	614787				10976766	Standard	NM_015100		Approved	KIAA0461, ZNF635m, ZNF280E	uc001eyd.2	Q7Z3K3	OTTHUMG00000012499	ENST00000271715.2:c.2116G>A	1.37:g.151381003C>T	ENSP00000271715:p.Asp706Asn		B4DTP8|B4DYL9|B7ZBY5|E9PM80|O75049|Q3LIC4|Q5SZS1|Q5SZS2|Q5SZS3|Q5SZS4|Q8TDZ7|Q9Y4X7	Missense_Mutation	SNP	pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_Znf_C2H2	p.D706N	ENST00000271715.2	37	c.2116	CCDS997.1	1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.191721	0.78902	.	.	ENSG00000143442	ENST00000392723;ENST00000271715;ENST00000361398;ENST00000368863;ENST00000409503;ENST00000531094;ENST00000540984;ENST00000491586;ENST00000529669	T;T;T;T;T;T;T;T;T	0.31247	5.87;5.88;5.87;5.83;5.88;5.87;1.96;5.37;1.5	5.07	5.07	0.68467	.	0.000000	0.64402	D	0.000002	T	0.31420	0.0796	N	0.19112	0.55	0.45962	D	0.99878	D;D;D;D;D;D	0.71674	0.993;0.993;0.996;0.998;0.996;0.993	P;D;D;D;D;P	0.78314	0.823;0.971;0.914;0.991;0.987;0.823	T	0.09292	-1.0681	10	0.41790	T	0.15	-19.7226	17.1798	0.86852	0.0:1.0:0.0:0.0	.	644;697;611;662;653;706	E9PM80;B7ZBY5;Q7Z3K3-5;Q7Z3K3-3;Q7Z3K3-2;Q7Z3K3	.;.;.;.;.;POGZ_HUMAN	N	653;706;653;611;697;644;68;662;106	ENSP00000376484:D653N;ENSP00000271715:D706N;ENSP00000354467:D653N;ENSP00000357856:D611N;ENSP00000386836:D697N;ENSP00000431259:D644N;ENSP00000443547:D68N;ENSP00000418408:D662N;ENSP00000432295:D106N	ENSP00000271715:D706N	D	-	1	0	POGZ	149647627	0.873000	0.30073	0.801000	0.32222	0.828000	0.46876	3.480000	0.53172	2.645000	0.89757	0.655000	0.94253	GAT	POGZ	-	NULL	ENSG00000143442		0.547	POGZ-001	KNOWN	basic|CCDS	protein_coding	POGZ	HGNC	protein_coding	OTTHUMT00000034915.2	17	0.00	0	C	NM_207171		151381003	151381003	-1	no_errors	ENST00000271715	ensembl	human	known	69_37n	missense	20	23.08	6	SNP	0.927	T
POSTN	10631	genome.wustl.edu	37	13	38164577	38164577	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr13:38164577C>T	ENST00000379747.4	-	4	490	c.373G>A	c.(373-375)Gag>Aag	p.E125K	POSTN_ENST00000379742.4_Missense_Mutation_p.E125K|POSTN_ENST00000379743.4_Missense_Mutation_p.E125K|POSTN_ENST00000541179.1_Missense_Mutation_p.E125K|POSTN_ENST00000541481.1_Missense_Mutation_p.E125K|POSTN_ENST00000379749.4_Missense_Mutation_p.E125K	NM_006475.2	NP_006466.2	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor	125	FAS1 1. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of Notch signaling pathway (GO:0008593)|skeletal system development (GO:0001501)|tissue development (GO:0009888)	proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network (GO:0005802)	heparin binding (GO:0008201)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(16)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	59		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		CCCTCGATCTCCTCCCTCAGT	0.433																																						dbGAP											0													111.0	97.0	102.0					13																	38164577		2203	4300	6503	-	-	-	SO:0001583	missense	0			D13665	CCDS9364.1, CCDS45034.1, CCDS53864.1, CCDS66530.1, CCDS66531.1	13q13.3	2008-02-05			ENSG00000133110	ENSG00000133110			16953	protein-coding gene	gene with protein product		608777				8363580, 12235007	Standard	NM_006475		Approved	OSF-2, PN, periostin	uc001uwo.4	Q15063	OTTHUMG00000016751	ENST00000379747.4:c.373G>A	13.37:g.38164577C>T	ENSP00000369071:p.Glu125Lys		B1ALD8|C0IMJ1|C0IMJ2|C0IMJ4|D2KRH7|F5H628|Q15064|Q29XZ0|Q3KPJ5|Q5VSY5|Q8IZF9	Missense_Mutation	SNP	pfam_FAS1_domain,superfamily_FAS1_domain,smart_FAS1_domain,pirsf_TGFb-ind_bIGH3/osteoblast_fac2,pfscan_EMI_domain,pfscan_FAS1_domain	p.E125K	ENST00000379747.4	37	c.373	CCDS9364.1	13	.	.	.	.	.	.	.	.	.	.	C	32	5.188593	0.94923	.	.	ENSG00000133110	ENST00000541179;ENST00000379749;ENST00000379747;ENST00000379743;ENST00000379742;ENST00000541481;ENST00000538347	D;D;D;D;D;D	0.91351	-2.83;-2.83;-2.83;-2.83;-2.83;-2.83	5.36	5.36	0.76844	FAS1 domain (4);	0.000000	0.85682	D	0.000000	D	0.93190	0.7831	L	0.51914	1.62	0.58432	D	0.999996	D;D;P;D;D;P;P	0.89917	1.0;0.999;0.655;0.999;0.996;0.778;0.655	D;D;P;D;D;P;P	0.87578	0.998;0.996;0.585;0.996;0.99;0.646;0.585	D	0.89662	0.3877	10	0.10111	T	0.7	.	19.0894	0.93221	0.0:1.0:0.0:0.0	.	125;125;125;125;125;125;125	C0IMJ4;F5H628;B1ALD8;Q15063-3;Q15063-4;Q15063-2;Q15063	.;.;.;.;.;.;POSTN_HUMAN	K	125;125;125;125;125;125;42	ENSP00000437959:E125K;ENSP00000369073:E125K;ENSP00000369071:E125K;ENSP00000369067:E125K;ENSP00000369066:E125K;ENSP00000437953:E125K	ENSP00000369066:E125K	E	-	1	0	POSTN	37062577	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	5.741000	0.68638	2.515000	0.84797	0.650000	0.86243	GAG	POSTN	-	pfam_FAS1_domain,superfamily_FAS1_domain,pirsf_TGFb-ind_bIGH3/osteoblast_fac2,pfscan_FAS1_domain	ENSG00000133110		0.433	POSTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	POSTN	HGNC	protein_coding	OTTHUMT00000044566.2	26	0.00	0	C	NM_006475		38164577	38164577	-1	no_errors	ENST00000379747	ensembl	human	known	69_37n	missense	34	26.09	12	SNP	1.000	T
PRR23B	389151	genome.wustl.edu	37	3	138738918	138738918	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr3:138738918C>T	ENST00000329447.5	-	1	850	c.586G>A	c.(586-588)Gaa>Aaa	p.E196K	MRPS22_ENST00000495075.1_Intron	NM_001013650.2	NP_001013672.1	Q6ZRT6	PR23B_HUMAN	proline rich 23B	196	Pro-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GCACAGGGTTCTGGGATGGGG	0.632																																						dbGAP											0													36.0	44.0	41.0					3																	138738918		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC137146	CCDS33868.1	3q22.3	2014-06-03			ENSG00000184814	ENSG00000184814			33764	protein-coding gene	gene with protein product							Standard	NM_001013650		Approved	FLJ46116	uc003esy.1	Q6ZRT6	OTTHUMG00000160633	ENST00000329447.5:c.586G>A	3.37:g.138738918C>T	ENSP00000328768:p.Glu196Lys		B2RNV9	Missense_Mutation	SNP	pfam_UPF0572	p.E196K	ENST00000329447.5	37	c.586	CCDS33868.1	3	.	.	.	.	.	.	.	.	.	.	C	13.57	2.277910	0.40294	.	.	ENSG00000184814	ENST00000329447	.	.	.	2.79	0.808	0.18719	.	1.586980	0.04230	N	0.335022	T	0.35278	0.0926	L	0.44542	1.39	0.09310	N	1	P	0.46064	0.872	B	0.42827	0.399	T	0.36311	-0.9753	9	0.54805	T	0.06	.	8.6528	0.34044	0.0:0.5508:0.4492:0.0	.	196	Q6ZRT6	PR23B_HUMAN	K	196	.	ENSP00000328768:E196K	E	-	1	0	PRR23B	140221608	0.000000	0.05858	0.000000	0.03702	0.064000	0.16182	0.136000	0.15974	0.183000	0.20059	0.407000	0.27541	GAA	PRR23B	-	pfam_UPF0572	ENSG00000184814		0.632	PRR23B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRR23B	HGNC	protein_coding	OTTHUMT00000361501.1	36	0.00	0	C	NM_001013650		138738918	138738918	-1	no_errors	ENST00000329447	ensembl	human	known	69_37n	missense	30	21.05	8	SNP	0.000	T
PTPDC1	138639	genome.wustl.edu	37	9	96860128	96860128	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr9:96860128G>A	ENST00000375360.3	+	7	1458	c.1118G>A	c.(1117-1119)tGg>tAg	p.W373*	PTPDC1_ENST00000288976.3_Nonsense_Mutation_p.W425*	NM_001253830.1|NM_177995.2	NP_001240759.1|NP_818931.1	A2A3K4	PTPC1_HUMAN	protein tyrosine phosphatase domain containing 1	373					cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)		protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	32						GACCCTCTTTGGAAAAGGCGG	0.507																																						dbGAP											0													62.0	65.0	64.0					9																	96860128		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC051654	CCDS6707.1, CCDS6708.1, CCDS75860.1	9q22.32	2011-06-09			ENSG00000158079	ENSG00000158079		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	30184	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase PTP9Q22"""					14702039	Standard	NM_152422		Approved	PTP9Q22, FLJ37312	uc010mrj.2	A2A3K4	OTTHUMG00000020258	ENST00000375360.3:c.1118G>A	9.37:g.96860128G>A	ENSP00000364509:p.Trp373*		Q5T3M4|Q6NXE8|Q8IWM1|Q8N1X4|Q8N9F5	Nonsense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Dual-sp_phosphatase_subgr_cat,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase	p.W373*	ENST00000375360.3	37	c.1118	CCDS6707.1	9	.	.	.	.	.	.	.	.	.	.	.	38	6.850501	0.97885	.	.	ENSG00000158079	ENST00000375360;ENST00000288976	.	.	.	5.93	5.93	0.95920	.	0.109683	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.8178	19.3421	0.94347	0.0:0.0:1.0:0.0	.	.	.	.	X	373;425	.	ENSP00000288976:W425X	W	+	2	0	PTPDC1	95899949	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.122000	0.89584	2.826000	0.97356	0.655000	0.94253	TGG	PTPDC1	-	NULL	ENSG00000158079		0.507	PTPDC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPDC1	HGNC	protein_coding	OTTHUMT00000215007.1	34	0.00	0	G	NM_177995, NM_152422		96860128	96860128	+1	no_errors	ENST00000375360	ensembl	human	known	69_37n	nonsense	49	18.33	11	SNP	1.000	A
RAB13	5872	genome.wustl.edu	37	1	153955601	153955602	+	Intron	INS	-	-	A	rs375247680|rs370008084		TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr1:153955601_153955602insA	ENST00000368575.3	-	4	440				RAB13_ENST00000462680.1_5'UTR	NM_002870.2	NP_002861.1	P51153	RAB13_HUMAN	RAB13, member RAS oncogene family						cellular response to insulin stimulus (GO:0032869)|cortical actin cytoskeleton organization (GO:0030866)|endocytic recycling (GO:0032456)|endosomal transport (GO:0016197)|endothelial cell chemotaxis (GO:0035767)|establishment of protein localization to plasma membrane (GO:0090002)|establishment of Sertoli cell barrier (GO:0097368)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|neuron projection development (GO:0031175)|protein kinase A signaling (GO:0010737)|protein localization to cell leading edge (GO:1902463)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|tight junction assembly (GO:0070830)|trans-Golgi network to recycling endosome transport (GO:0044795)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|insulin-responsive compartment (GO:0032593)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|tight junction (GO:0005923)|trans-Golgi network (GO:0005802)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(3)|kidney(1)|lung(5)|urinary_tract(1)	11	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			aacttcatctcaaaaaaaaaaa	0.495																																					Ovarian(138;395 2427 24306 43415)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			X75593	CCDS1058.1, CCDS72921.1	1q21.2	2008-02-05			ENSG00000143545	ENSG00000143545		"""RAB, member RAS oncogene"""	9762	protein-coding gene	gene with protein product		602672				8294494	Standard	NM_002870		Approved		uc001fdt.2	P51153	OTTHUMG00000036589	ENST00000368575.3:c.324+92->T	1.37:g.153955612_153955612dupA			A8K6B5|D3DV67|Q5U0A6|Q6GPG6|Q96GU4	RNA	INS	-	NULL	ENST00000368575.3	37	NULL	CCDS1058.1	1																																																																																			RAB13	-	-	ENSG00000143545		0.495	RAB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB13	HGNC	protein_coding	OTTHUMT00000088992.1	11	0.00	0	-	NM_002870		153955601	153955602	-1	no_errors	ENST00000462680	ensembl	human	known	69_37n	rna	12	20.00	3	INS	0.027:0.029	A
RASIP1	54922	genome.wustl.edu	37	19	49228118	49228118	+	Nonsense_Mutation	SNP	C	C	A	rs201454840		TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr19:49228118C>A	ENST00000222145.4	-	9	2431	c.2227G>T	c.(2227-2229)Gga>Tga	p.G743*		NM_017805.2	NP_060275.2	Q5U651	RAIN_HUMAN	Ras interacting protein 1	743	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|negative regulation of autophagy (GO:0010507)|regulation of Rho GTPase activity (GO:0032319)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	Golgi apparatus (GO:0005794)				central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	21		all_lung(116;4.89e-06)|all_epithelial(76;7.04e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000272)|Epithelial(262;0.0155)|GBM - Glioblastoma multiforme(486;0.0222)		GGTCTCAATCCTGGAGGCATG	0.607																																						dbGAP											0													71.0	73.0	72.0					19																	49228118		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC028614	CCDS12731.1	19q13.33	2008-02-05				ENSG00000105538			24716	protein-coding gene	gene with protein product		609623				15031288	Standard	NM_017805		Approved	FLJ20401, RAIN	uc002pki.3	Q5U651		ENST00000222145.4:c.2227G>T	19.37:g.49228118C>A	ENSP00000222145:p.Gly743*		Q6U676	Nonsense_Mutation	SNP	pfam_Dil_domain,pfam_Ras-assoc,superfamily_SMAD_FHA_domain,smart_Ras-assoc,pfscan_Dilute,pfscan_Ras-assoc	p.G743*	ENST00000222145.4	37	c.2227	CCDS12731.1	19	.	.	.	.	.	.	.	.	.	.	C	41	8.930137	0.99006	.	.	ENSG00000105538	ENST00000222145	.	.	.	4.98	4.98	0.66077	.	0.291084	0.33382	N	0.004975	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-3.229	16.1914	0.81992	0.0:1.0:0.0:0.0	.	.	.	.	X	743	.	ENSP00000222145:G743X	G	-	1	0	RASIP1	53919930	0.996000	0.38824	0.150000	0.22450	0.994000	0.84299	5.452000	0.66638	2.502000	0.84385	0.650000	0.86243	GGA	RASIP1	-	pfscan_Dilute	ENSG00000105538		0.607	RASIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASIP1	HGNC	protein_coding	OTTHUMT00000466185.1	34	0.00	0	C	NM_017805		49228118	49228118	-1	no_errors	ENST00000222145	ensembl	human	known	69_37n	nonsense	60	10.45	7	SNP	0.873	A
RBBP6	5930	genome.wustl.edu	37	16	24581109	24581109	+	Missense_Mutation	SNP	A	A	G			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr16:24581109A>G	ENST00000319715.4	+	17	3530	c.3098A>G	c.(3097-3099)aAt>aGt	p.N1033S	RBBP6_ENST00000381039.3_Intron|RBBP6_ENST00000348022.2_Missense_Mutation_p.N999S	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6	1033	Interaction with RB1. {ECO:0000250}.				embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		AAAAAAGAAAATATTGTAAAA	0.393																																						dbGAP											0													70.0	75.0	73.0					16																	24581109		2197	4300	6497	-	-	-	SO:0001583	missense	0				CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.3098A>G	16.37:g.24581109A>G	ENSP00000317872:p.Asn1033Ser		Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Missense_Mutation	SNP	pfam_DWNN_domain,pfam_Ubox_domain,pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_CCHC,smart_Znf_RING,pfscan_Znf_RING,pfscan_Znf_CCHC	p.N1033S	ENST00000319715.4	37	c.3098	CCDS10621.1	16	.	.	.	.	.	.	.	.	.	.	A	4.380	0.070094	0.08436	.	.	ENSG00000122257	ENST00000319715;ENST00000348022	T;T	0.12672	2.66;2.68	5.66	0.597	0.17504	.	0.470890	0.21545	N	0.072838	T	0.03220	0.0094	N	0.01874	-0.695	0.25321	N	0.989114	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.43572	-0.9383	10	0.05351	T	0.99	-11.7804	5.4411	0.16509	0.2403:0.3627:0.3969:0.0	.	999;1033	Q7Z6E9-2;Q7Z6E9	.;RBBP6_HUMAN	S	1033;999	ENSP00000317872:N1033S;ENSP00000316291:N999S	ENSP00000317872:N1033S	N	+	2	0	RBBP6	24488610	0.001000	0.12720	0.873000	0.34254	0.838000	0.47535	-0.075000	0.11431	0.091000	0.17302	-0.290000	0.09829	AAT	RBBP6	-	NULL	ENSG00000122257		0.393	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBBP6	HGNC	protein_coding	OTTHUMT00000214067.2	14	0.00	0	A	NM_006910		24581109	24581109	+1	no_errors	ENST00000319715	ensembl	human	known	69_37n	missense	9	52.63	10	SNP	0.240	G
RBP3	5949	genome.wustl.edu	37	10	48385957	48385957	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr10:48385957C>G	ENST00000224600.4	-	2	3248	c.3135G>C	c.(3133-3135)ttG>ttC	p.L1045F	AL731561.2_ENST00000581861.1_RNA	NM_002900.2	NP_002891.1	P10745	RET3_HUMAN	retinol binding protein 3, interstitial	1045	4 X approximate tandem repeats.				lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transport (GO:0006810)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interphotoreceptor matrix (GO:0033165)|vesicle (GO:0031982)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(30)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59					Vitamin A(DB00162)	TGTCAAACCTCAAGTAGCCAA	0.502																																						dbGAP											0													138.0	128.0	131.0					10																	48385957		2203	4300	6503	-	-	-	SO:0001583	missense	0			M22453	CCDS73119.1	10q11.2	2014-05-06	2001-11-28		ENSG00000107618	ENSG00000265203			9921	protein-coding gene	gene with protein product		180290	"""retinol-binding protein 3, interstitial"""				Standard	NM_002900		Approved	D10S64, D10S65, D10S66, RP66	uc001jez.3	P10745	OTTHUMG00000188321	ENST00000224600.4:c.3135G>C	10.37:g.48385957C>G	ENSP00000224600:p.Leu1045Phe		Q0QD34|Q5VSR0|Q8IXN0	Missense_Mutation	SNP	pfam_Interphotoreceptor_retinol-bd,pfam_Interphotorcpt_retinol-bd_N,smart_Interphotoreceptor_retinol-bd	p.L1045F	ENST00000224600.4	37	c.3135	CCDS7218.1	10	.	.	.	.	.	.	.	.	.	.	C	15.44	2.833658	0.50951	.	.	ENSG00000107618	ENST00000224600	T	0.74737	-0.87	5.14	5.14	0.70334	Interphotoreceptor retinol-binding (2);	0.072940	0.64402	D	0.000020	D	0.85531	0.5718	M	0.83852	2.665	0.53688	D	0.999974	D	0.89917	1.0	D	0.75020	0.985	D	0.87094	0.2174	10	0.87932	D	0	-17.4121	11.4339	0.50058	0.0:0.9172:0.0:0.0828	.	1045	P10745	RET3_HUMAN	F	1045	ENSP00000224600:L1045F	ENSP00000224600:L1045F	L	-	3	2	RBP3	48005963	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	2.228000	0.42981	2.553000	0.86117	0.561000	0.74099	TTG	RBP3	-	pfam_Interphotoreceptor_retinol-bd,smart_Interphotoreceptor_retinol-bd	ENSG00000107618		0.502	RBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBP3	HGNC	protein_coding	OTTHUMT00000047888.1	22	0.00	0	C	NM_002900		48385957	48385957	-1	no_errors	ENST00000224600	ensembl	human	known	69_37n	missense	32	15.79	6	SNP	1.000	G
RDH16	8608	genome.wustl.edu	37	12	57345768	57345768	+	3'UTR	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr12:57345768C>T	ENST00000398138.3	-	0	1855				RDH16_ENST00000360752.4_5'UTR	NM_003708.3	NP_003699.3	O75452	RDH16_HUMAN	retinol dehydrogenase 16 (all-trans)						lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	electron carrier activity (GO:0009055)|retinol dehydrogenase activity (GO:0004745)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)	16						CACCACCCCTCATAGCACACC	0.542																																					GBM(179;741 2921 43105 45298)	dbGAP											0													27.0	29.0	28.0					12																	57345768		1992	4152	6144	-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS41797.1	12q13.3	2011-09-14	2006-05-09			ENSG00000139547		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	29674	protein-coding gene	gene with protein product	"""microsomal NAD+ dependent retinol dehydrogenase 4"", ""short chain dehydrogenase/reductase family 9C, member 8"""		"""retinol dehydrogenase 16 (all-trans and 13-cis)"""			9677409, 10329026, 19027726	Standard	NM_003708		Approved	RODH-4, SDR9C8	uc001smi.4	O75452		ENST00000398138.3:c.*45G>A	12.37:g.57345768C>T			Q9UNV2	RNA	SNP	-	NULL	ENST00000398138.3	37	NULL	CCDS41797.1	12																																																																																			RDH16	-	-	ENSG00000139547		0.542	RDH16-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RDH16	HGNC	protein_coding	OTTHUMT00000410898.1	23	0.00	0	C	NM_003708		57345768	57345768	-1	no_errors	ENST00000360752	ensembl	human	known	69_37n	rna	43	28.33	17	SNP	0.009	T
RFPL2	10739	genome.wustl.edu	37	22	32588949	32588949	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr22:32588949C>G	ENST00000400237.1	-	4	1431	c.496G>C	c.(496-498)Gaa>Caa	p.E166Q	RFPL2_ENST00000400236.3_Missense_Mutation_p.E76Q|RFPL2_ENST00000489846.1_5'UTR|RFPL2_ENST00000248980.4_Missense_Mutation_p.E105Q|RFPL2_ENST00000248983.4_Missense_Mutation_p.E76Q			O75678	RFPL2_HUMAN	ret finger protein-like 2	166							zinc ion binding (GO:0008270)			endometrium(2)|kidney(4)|large_intestine(3)|lung(9)|ovary(1)|skin(2)	21						GGCTCCAGTTCCTTGATGTGG	0.527																																						dbGAP											0													97.0	100.0	99.0					22																	32588949		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ010231	CCDS43009.1, CCDS46694.1, CCDS43009.2	22q12.3	2008-06-12				ENSG00000128253		"""RING-type (C3HC4) zinc fingers"""	9979	protein-coding gene	gene with protein product		605969				10508838	Standard	NM_001098527		Approved	RNF79	uc003amg.3	O75678		ENST00000400237.1:c.496G>C	22.37:g.32588949C>G	ENSP00000383096:p.Glu166Gln			Missense_Mutation	SNP	pfam_RDM_domain_RFPL,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_PRY,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY	p.E166Q	ENST00000400237.1	37	c.496	CCDS43009.2	22	.	.	.	.	.	.	.	.	.	.	C	9.446	1.089328	0.20390	.	.	ENSG00000128253	ENST00000248980;ENST00000248983;ENST00000400236;ENST00000400237	T;T;T;T	0.35789	1.29;1.29;1.29;1.29	0.636	0.636	0.17729	Zinc finger, RING/FYVE/PHD-type (1);RDM domain, Ret finger protein-like (1);	.	.	.	.	T	0.48589	0.1508	L	0.57536	1.79	0.09310	N	0.999999	D;D	0.76494	0.999;0.999	D;D	0.74674	0.984;0.963	T	0.37174	-0.9717	8	0.23302	T	0.38	.	.	.	.	.	166;105	O75678;O75678-3	RFPL2_HUMAN;.	Q	105;76;76;166	ENSP00000248980:E105Q;ENSP00000248983:E76Q;ENSP00000383095:E76Q;ENSP00000383096:E166Q	ENSP00000248980:E105Q	E	-	1	0	RFPL2	30918949	0.016000	0.18221	0.048000	0.18961	0.034000	0.12701	-0.003000	0.12901	0.608000	0.30000	0.460000	0.39030	GAA	RFPL2	-	pfam_RDM_domain_RFPL	ENSG00000128253		0.527	RFPL2-001	KNOWN	basic|CCDS	protein_coding	RFPL2	HGNC	protein_coding	OTTHUMT00000075262.2	59	0.00	0	C	NM_006605		32588949	32588949	-1	no_errors	ENST00000400237	ensembl	human	known	69_37n	missense	73	22.34	21	SNP	0.464	G
RIMBP2	23504	genome.wustl.edu	37	12	130926638	130926638	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr12:130926638G>A	ENST00000261655.4	-	8	1371	c.1208C>T	c.(1207-1209)aCg>aTg	p.T403M	RIMBP2_ENST00000536002.1_Missense_Mutation_p.T311M|RIMBP2_ENST00000535703.1_Missense_Mutation_p.T311M	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	403	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		GGAGATCTGCGTGATGTTGTC	0.637																																						dbGAP											0													102.0	77.0	85.0					12																	130926638		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.1208C>T	12.37:g.130926638G>A	ENSP00000261655:p.Thr403Met		Q96ID2	Missense_Mutation	SNP	pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_Fibronectin_type3,smart_SH3_domain,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_SH3_domain,prints_SH3_domain	p.T403M	ENST00000261655.4	37	c.1208	CCDS31925.1	12	.	.	.	.	.	.	.	.	.	.	g	18.61	3.661600	0.67700	.	.	ENSG00000060709	ENST00000261655;ENST00000392375;ENST00000535703;ENST00000536002	T;T;T	0.57436	0.4;0.4;0.4	4.23	4.23	0.50019	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.73218	0.3559	M	0.77486	2.375	0.54753	D	0.999981	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.959;0.982;0.996	T	0.78874	-0.2032	10	0.87932	D	0	-25.6129	16.6129	0.84899	0.0:0.0:1.0:0.0	.	311;311;403	C9JWN3;O15034-2;O15034	.;.;RIMB2_HUMAN	M	403;311;311;311	ENSP00000261655:T403M;ENSP00000440347:T311M;ENSP00000439159:T311M	ENSP00000261655:T403M	T	-	2	0	RIMBP2	129492591	1.000000	0.71417	0.971000	0.41717	0.831000	0.47069	6.756000	0.74919	1.867000	0.54127	0.537000	0.68136	ACG	RIMBP2	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000060709		0.637	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMBP2	HGNC	protein_coding	OTTHUMT00000399520.1	68	0.00	0	G	NM_015347		130926638	130926638	-1	no_errors	ENST00000261655	ensembl	human	known	69_37n	missense	73	16.09	14	SNP	0.998	A
RNA5-8SP6	100873336	genome.wustl.edu	37	Y	10037856	10037856	+	RNA	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chrY:10037856G>A	ENST00000515896.1	+	0	93									RNA, 5.8S ribosomal pseudogene 6																		ATTGATCATCGACACTTCGAA	0.537																																						dbGAP											0																																										-	-	-			0					Yp11.2	2012-08-07	2012-08-07	2012-08-07	ENSG00000251705	ENSG00000251705			41960	pseudogene	RNA, pseudogene			"""RNA, 5.8S ribosomal 6"""	RN5-8S6			Standard	NG_033474		Approved						Y.37:g.10037856G>A				RNA	SNP	-	NULL	ENST00000515896.1	37	NULL		Y																																																																																			RNA5-8SP6	-	-	ENSG00000251705		0.537	RNA5-8SP6-201	KNOWN	basic	rRNA	RNA5-8SP6	HGNC	rRNA		39	0.00	0	G			10037856	10037856	+1	no_errors	ENST00000515896	ensembl	human	known	69_37n	rna	39	17.02	8	SNP	1.000	A
RNF150	57484	genome.wustl.edu	37	4	142053860	142053860	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr4:142053860C>T	ENST00000515673.2	-	1	136	c.103G>A	c.(103-105)Gag>Aag	p.E35K	RNF150_ENST00000306799.3_Missense_Mutation_p.E35K|RNF150_ENST00000507500.1_Missense_Mutation_p.E35K|RNF150_ENST00000420921.2_Intron			Q9ULK6	RN150_HUMAN	ring finger protein 150	35						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)|large_intestine(10)|lung(7)|ovary(1)	19	all_hematologic(180;0.162)					TCCTCCTTCTCGGCCACGGTA	0.647																																						dbGAP											0													72.0	60.0	64.0					4																	142053860		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033040	CCDS34065.1	4q31.1	2013-01-09			ENSG00000170153	ENSG00000170153		"""RING-type (C3HC4) zinc fingers"""	23138	protein-coding gene	gene with protein product						10574462	Standard	XM_005263150		Approved	KIAA1214	uc003iio.1	Q9ULK6	OTTHUMG00000161380	ENST00000515673.2:c.103G>A	4.37:g.142053860C>T	ENSP00000425840:p.Glu35Lys		Q3T1D0|Q6ZNW6	Missense_Mutation	SNP	pfam_Protease-assoc_domain,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.E35K	ENST00000515673.2	37	c.103	CCDS34065.1	4	.	.	.	.	.	.	.	.	.	.	C	25.4	4.638857	0.87760	.	.	ENSG00000170153	ENST00000306799;ENST00000515673;ENST00000507500	T;T;T	0.14022	2.54;3.49;3.52	3.4	3.4	0.38934	.	0.143100	0.45867	D	0.000337	T	0.08268	0.0206	N	0.08118	0	0.80722	D	1	D;P;P	0.62365	0.991;0.846;0.918	B;B;B	0.42995	0.404;0.161;0.173	T	0.39292	-0.9621	10	0.32370	T	0.25	.	15.6897	0.77439	0.0:1.0:0.0:0.0	.	35;35;35	Q9ULK6-2;Q9ULK6-3;Q9ULK6	.;.;RN150_HUMAN	K	35	ENSP00000304321:E35K;ENSP00000425840:E35K;ENSP00000425568:E35K	ENSP00000304321:E35K	E	-	1	0	RNF150	142273310	1.000000	0.71417	1.000000	0.80357	0.760000	0.43138	7.206000	0.77891	1.858000	0.53909	0.305000	0.20034	GAG	RNF150	-	NULL	ENSG00000170153		0.647	RNF150-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF150	HGNC	protein_coding	OTTHUMT00000364739.2	15	0.00	0	C	XM_291090		142053860	142053860	-1	no_errors	ENST00000515673	ensembl	human	known	69_37n	missense	16	20.00	4	SNP	1.000	T
RNF181	51255	genome.wustl.edu	37	2	85824654	85824654	+	3'UTR	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr2:85824654C>T	ENST00000306368.4	+	0	519				RNF181_ENST00000441634.1_3'UTR	NM_016494.3	NP_057578.1	Q9P0P0	RN181_HUMAN	ring finger protein 181						protein autoubiquitination (GO:0051865)		ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			lung(1)|stomach(1)	2						TGCTGGCCCTCTGCGTCTTCC	0.527																																						dbGAP											0													75.0	71.0	73.0					2																	85824654		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			AF151072	CCDS1981.1	2p11.2	2013-01-09			ENSG00000168894	ENSG00000168894		"""RING-type (C3HC4) zinc fingers"""	28037	protein-coding gene	gene with protein product		612490				11042152	Standard	XM_005264359		Approved	HSPC238	uc002spv.1	Q9P0P0	OTTHUMG00000130182	ENST00000306368.4:c.*27C>T	2.37:g.85824654C>T			Q53H81	Silent	SNP	NULL	p.L159	ENST00000306368.4	37	c.477	CCDS1981.1	2																																																																																			RNF181	-	NULL	ENSG00000168894		0.527	RNF181-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNF181	HGNC	protein_coding	OTTHUMT00000252500.1	54	0.00	0	C	NM_016494		85824654	85824654	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000456023	ensembl	human	putative	69_37n	silent	53	22.06	15	SNP	0.016	T
RNF186	54546	genome.wustl.edu	37	1	20141288	20141288	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr1:20141288C>T	ENST00000375121.2	-	1	483	c.307G>A	c.(307-309)Gag>Aag	p.E103K	RP11-91K11.2_ENST00000454736.1_RNA	NM_019062.1	NP_061935.1	Q9NXI6	RN186_HUMAN	ring finger protein 186	103						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			kidney(1)|lung(3)|urinary_tract(1)	5		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00459)|Lung NSC(340;0.00475)|Breast(348;0.00526)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|COAD - Colon adenocarcinoma(152;1.07e-05)|BRCA - Breast invasive adenocarcinoma(304;7.77e-05)|Kidney(64;0.000162)|GBM - Glioblastoma multiforme(114;0.00036)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		ACCACCGCCTCATGGTCGCGC	0.672																																						dbGAP											0													39.0	44.0	42.0					1																	20141288		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS199.1	1p36.13	2008-02-05			ENSG00000178828	ENSG00000178828		"""RING-type (C3HC4) zinc fingers"""	25978	protein-coding gene	gene with protein product	"""hypothetical protein FLJ20225"""					12477932	Standard	NM_019062		Approved	FLJ20225	uc001bcr.3	Q9NXI6	OTTHUMG00000002709	ENST00000375121.2:c.307G>A	1.37:g.20141288C>T	ENSP00000364263:p.Glu103Lys		Q53GE0	Missense_Mutation	SNP	smart_Znf_RING,pfscan_Znf_RING	p.E103K	ENST00000375121.2	37	c.307	CCDS199.1	1	.	.	.	.	.	.	.	.	.	.	C	16.08	3.022132	0.54576	.	.	ENSG00000178828	ENST00000375121	T	0.32023	1.47	5.7	4.79	0.61399	Zinc finger, RING/FYVE/PHD-type (1);	0.332405	0.25178	N	0.032550	T	0.28234	0.0697	L	0.53249	1.67	0.25928	N	0.98303	B	0.31548	0.328	B	0.26202	0.067	T	0.11665	-1.0578	10	0.29301	T	0.29	-23.3976	13.3914	0.60827	0.0:0.9238:0.0:0.0762	.	103	Q9NXI6	RN186_HUMAN	K	103	ENSP00000364263:E103K	ENSP00000364263:E103K	E	-	1	0	RNF186	20013875	0.963000	0.33076	0.949000	0.38748	0.006000	0.05464	1.386000	0.34419	1.404000	0.46819	0.650000	0.86243	GAG	RNF186	-	NULL	ENSG00000178828		0.672	RNF186-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF186	HGNC	protein_coding	OTTHUMT00000007694.1	27	0.00	0	C	NM_019062		20141288	20141288	-1	no_errors	ENST00000375121	ensembl	human	known	69_37n	missense	47	11.32	6	SNP	0.576	T
RNF213	57674	genome.wustl.edu	37	17	78261666	78261666	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr17:78261666C>T	ENST00000582970.1	+	4	457	c.314C>T	c.(313-315)tCa>tTa	p.S105L	RNF213_ENST00000508628.2_Missense_Mutation_p.S154L|RNF213_ENST00000319921.4_Missense_Mutation_p.S105L|RNF213_ENST00000456466.1_Missense_Mutation_p.S105L	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	105					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			TCCGCTTCCTCAGAGCTGGCT	0.493																																						dbGAP											0													38.0	35.0	36.0					17																	78261666		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.314C>T	17.37:g.78261666C>T	ENSP00000464087:p.Ser105Leu		C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	smart_AAA+_ATPase,smart_Znf_RING,pfscan_Znf_RING	p.S105L	ENST00000582970.1	37	c.314	CCDS58606.1	17	.	.	.	.	.	.	.	.	.	.	C	8.597	0.885921	0.17540	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000456466;ENST00000319921	.	.	.	4.54	1.29	0.21616	.	264.331000	0.02665	N	0.107929	T	0.27489	0.0675	L	0.36672	1.1	0.09310	N	0.999992	P	0.38677	0.642	B	0.31337	0.128	T	0.22208	-1.0223	9	0.56958	D	0.05	1.2195	5.4321	0.16458	0.3527:0.5499:0.0:0.0974	.	105	Q9HCF4-2	.	L	105;154;105;105	.	ENSP00000324392:S105L	S	+	2	0	RNF213	75876261	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	0.010000	0.13242	0.095000	0.17434	0.655000	0.94253	TCA	RNF213	-	NULL	ENSG00000173821		0.493	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	HGNC	protein_coding	OTTHUMT00000443298.1	23	0.00	0	C	NM_020914		78261666	78261666	+1	no_errors	ENST00000582970	ensembl	human	known	69_37n	missense	20	20.00	5	SNP	0.001	T
RYR3	6263	genome.wustl.edu	37	15	34123205	34123205	+	Silent	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr15:34123205C>T	ENST00000389232.4	+	86	11446	c.11376C>T	c.(11374-11376)gaC>gaT	p.D3792D	RYR3_ENST00000415757.3_Silent_p.D3787D	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	3792					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CAGGGAAGGACATCATTGATG	0.383																																						dbGAP											0													110.0	100.0	103.0					15																	34123205		1867	4096	5963	-	-	-	SO:0001819	synonymous_variant	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.11376C>T	15.37:g.34123205C>T			O15175|Q15412	Silent	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.D3792	ENST00000389232.4	37	c.11376	CCDS45210.1	15																																																																																			RYR3	-	pfam_RIH_assoc-dom,superfamily_ARM-type_fold	ENSG00000198838		0.383	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	38	0.00	0	C			34123205	34123205	+1	no_errors	ENST00000389232	ensembl	human	known	69_37n	silent	46	13.21	7	SNP	1.000	T
SHROOM4	57477	genome.wustl.edu	37	X	50350778	50350778	+	Missense_Mutation	SNP	T	T	G	rs112781654		TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chrX:50350778T>G	ENST00000289292.7	-	6	3647	c.3364A>C	c.(3364-3366)Aag>Cag	p.K1122Q	SHROOM4_ENST00000460112.3_Missense_Mutation_p.K1006Q|SHROOM4_ENST00000376020.2_Missense_Mutation_p.K1122Q			Q9ULL8	SHRM4_HUMAN	shroom family member 4	1122	Gln-rich.				actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					tgttgctgcttctgctgctgG	0.582																																						dbGAP											0													22.0	20.0	21.0					X																	50350778		2201	4295	6496	-	-	-	SO:0001583	missense	0			AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.3364A>C	X.37:g.50350778T>G	ENSP00000289292:p.Lys1122Gln		A7E2X9|D6RFW0|Q96LA0	Missense_Mutation	SNP	pfam_ASD2,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.K1122Q	ENST00000289292.7	37	c.3364	CCDS35277.1	X	.	.	.	.	.	.	.	.	.	.	T	1.804	-0.476250	0.04414	.	.	ENSG00000158352	ENST00000289292;ENST00000376020;ENST00000460112	T;T;T	0.09073	3.02;3.02;3.02	4.36	1.23	0.21249	.	0.932286	0.08995	N	0.863864	T	0.02304	0.0071	N	0.01352	-0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45071	-0.9286	10	0.06099	T	0.92	.	5.8974	0.18947	0.0:0.1611:0.3673:0.4717	.	1122	Q9ULL8	SHRM4_HUMAN	Q	1122;1122;1006	ENSP00000289292:K1122Q;ENSP00000365188:K1122Q;ENSP00000421450:K1006Q	ENSP00000289292:K1122Q	K	-	1	0	SHROOM4	50367518	0.007000	0.16637	0.012000	0.15200	0.528000	0.34623	0.084000	0.14891	0.088000	0.17205	0.417000	0.27973	AAG	SHROOM4	-	NULL	ENSG00000158352		0.582	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	SHROOM4	HGNC	protein_coding	OTTHUMT00000056564.4	18	0.00	0	T	NM_020717		50350778	50350778	-1	no_errors	ENST00000289292	ensembl	human	known	69_37n	missense	16	23.81	5	SNP	0.014	G
SHROOM4	57477	genome.wustl.edu	37	X	50350782	50350782	+	Silent	SNP	C	C	T	rs113799046		TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chrX:50350782C>T	ENST00000289292.7	-	6	3643	c.3360G>A	c.(3358-3360)caG>caA	p.Q1120Q	SHROOM4_ENST00000460112.3_Silent_p.Q1004Q|SHROOM4_ENST00000376020.2_Silent_p.Q1120Q			Q9ULL8	SHRM4_HUMAN	shroom family member 4	1120	Gln-rich.				actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					gctgcttctgctgctgGGCTG	0.587																																						dbGAP											0													23.0	21.0	22.0					X																	50350782		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0			AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.3360G>A	X.37:g.50350782C>T			A7E2X9|D6RFW0|Q96LA0	Silent	SNP	pfam_ASD2,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.Q1120	ENST00000289292.7	37	c.3360	CCDS35277.1	X																																																																																			SHROOM4	-	NULL	ENSG00000158352		0.587	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	SHROOM4	HGNC	protein_coding	OTTHUMT00000056564.4	18	0.00	0	C	NM_020717		50350782	50350782	-1	no_errors	ENST00000289292	ensembl	human	known	69_37n	silent	16	23.81	5	SNP	0.943	T
SIDT2	51092	genome.wustl.edu	37	11	117063053	117063053	+	Silent	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr11:117063053C>T	ENST00000324225.4	+	20	2487	c.1956C>T	c.(1954-1956)ctC>ctT	p.L652L	SIDT2_ENST00000431081.2_Silent_p.L649L|SIDT2_ENST00000532062.1_5'Flank	NM_001040455.1	NP_001035545.1	Q8NBJ9	SIDT2_HUMAN	SID1 transmembrane family, member 2	652					cell morphogenesis (GO:0000902)|dsRNA transport (GO:0033227)|glucose homeostasis (GO:0042593)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to glucose (GO:0009749)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell proliferation (GO:0044342)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	RNA transmembrane transporter activity (GO:0051033)			NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	36	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000219)|all cancers(92;0.00144)		GCACGCAGCTCTATTACATGG	0.642																																						dbGAP											0													90.0	78.0	82.0					11																	117063053		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AF151799	CCDS31682.1	11q23.3	2008-02-05			ENSG00000149577	ENSG00000149577			24272	protein-coding gene	gene with protein product						10810093, 12975309	Standard	NM_001040455		Approved	CGI-40	uc001pqh.1	Q8NBJ9	OTTHUMG00000167065	ENST00000324225.4:c.1956C>T	11.37:g.117063053C>T			Q8NBY7|Q9Y357	Silent	SNP	NULL	p.L673	ENST00000324225.4	37	c.2019	CCDS31682.1	11																																																																																			SIDT2	-	NULL	ENSG00000149577		0.642	SIDT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIDT2	HGNC	protein_coding	OTTHUMT00000392836.1	32	0.00	0	C	NM_015996		117063053	117063053	+1	no_errors	ENST00000278951	ensembl	human	known	69_37n	silent	44	24.14	14	SNP	1.000	T
SIRPG	55423	genome.wustl.edu	37	20	1629905	1629905	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr20:1629905C>G	ENST00000303415.3	-	2	287	c.223G>C	c.(223-225)Gaa>Caa	p.E75Q	SIRPG_ENST00000344103.4_Missense_Mutation_p.E75Q|SIRPG_ENST00000381583.2_Missense_Mutation_p.E75Q|SIRPG_ENST00000381580.1_Missense_Mutation_p.E42Q|RP11-77C3.3_ENST00000456177.1_RNA|SIRPG_ENST00000216927.4_Missense_Mutation_p.E75Q	NM_018556.3	NP_061026.2	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein gamma	75	Ig-like V-type.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|stomach(1)	27						TAGATTAATTCCCGGCCTGGT	0.512																																						dbGAP											0													188.0	169.0	176.0					20																	1629905		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB042624	CCDS13020.2, CCDS13021.2, CCDS33434.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000089012	ENSG00000089012		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15757	protein-coding gene	gene with protein product		605466	"""signal-regulatory protein beta 2"""	SIRPB2		11185750, 16339511	Standard	XM_005260749		Approved	bA77C3.1, SIRP-B2, SIRPgamma, CD172g	uc002wfm.1	Q9P1W8	OTTHUMG00000031680	ENST00000303415.3:c.223G>C	20.37:g.1629905C>G	ENSP00000305529:p.Glu75Gln		B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_CD80_C2-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Ig_C1-set,pfscan_Ig-like	p.E75Q	ENST00000303415.3	37	c.223	CCDS13020.2	20	.	.	.	.	.	.	.	.	.	.	.	1.253	-0.617974	0.03663	.	.	ENSG00000089012	ENST00000381580;ENST00000344103;ENST00000303415;ENST00000381583;ENST00000216927	T;T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26;-0.26	1.93	-3.78	0.04333	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.758526	0.12324	N	0.478996	T	0.45256	0.1333	L	0.43701	1.375	0.09310	N	1	P;B;B	0.38642	0.641;0.036;0.095	B;B;B	0.35353	0.201;0.011;0.042	T	0.40590	-0.9555	10	0.16420	T	0.52	.	3.5162	0.07726	0.0:0.3392:0.206:0.4548	.	75;75;75	Q9P1W8-3;Q9P1W8-4;Q9P1W8	.;.;SIRPG_HUMAN	Q	42;75;75;75;75	ENSP00000370992:E42Q;ENSP00000342759:E75Q;ENSP00000305529:E75Q;ENSP00000370995:E75Q;ENSP00000216927:E75Q	ENSP00000216927:E75Q	E	-	1	0	SIRPG	1577905	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-2.146000	0.01294	-0.965000	0.03591	0.195000	0.17529	GAA	SIRPG	-	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000089012		0.512	SIRPG-005	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRPG	HGNC	protein_coding	OTTHUMT00000077566.2	68	0.00	0	C	NM_018556		1629905	1629905	-1	no_errors	ENST00000303415	ensembl	human	known	69_37n	missense	85	22.73	25	SNP	0.000	G
SLCO5A1	81796	genome.wustl.edu	37	8	70667681	70667681	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr8:70667681C>T	ENST00000260126.4	-	4	1942	c.1236G>A	c.(1234-1236)atG>atA	p.M412I	SLCO5A1_ENST00000530307.1_Missense_Mutation_p.M412I|SLCO5A1_ENST00000524945.1_Missense_Mutation_p.M412I	NM_030958.2	NP_112220.2	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family, member 5A1	412						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	53	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			TTCCAAATCCCATCGAAGAAA	0.393																																						dbGAP											0													132.0	111.0	118.0					8																	70667681		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF205075	CCDS6205.1, CCDS55242.1, CCDS55243.1	8q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000137571	ENSG00000137571		"""Solute carriers"""	19046	protein-coding gene	gene with protein product		613543	"""solute carrier family 21 (organic anion transporter), member 15"""	SLC21A15		12507753	Standard	NM_030958		Approved	OATPRP4, OATP-J, OATP5A1	uc003xyl.3	Q9H2Y9	OTTHUMG00000165121	ENST00000260126.4:c.1236G>A	8.37:g.70667681C>T	ENSP00000260126:p.Met412Ile		A4QPC2|B2RPF7|B3KMU7|E9PKK5|G3V1C0	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal-type_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.M412I	ENST00000260126.4	37	c.1236	CCDS6205.1	8	.	.	.	.	.	.	.	.	.	.	C	9.069	0.996393	0.19043	.	.	ENSG00000137571	ENST00000260126;ENST00000524945;ENST00000530307	T;T;T	0.58358	1.19;1.56;0.34	5.38	1.44	0.22558	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.166110	0.64402	N	0.000004	T	0.31295	0.0792	N	0.20986	0.625	0.38838	D	0.955992	B;B;B;B	0.11235	0.004;0.0;0.0;0.0	B;B;B;B	0.15870	0.014;0.001;0.006;0.002	T	0.05616	-1.0874	10	0.30854	T	0.27	.	4.5122	0.11917	0.1411:0.5377:0.0:0.3212	.	412;412;412;412	B4DR09;E9PKK5;Q9H2Y9;G3V1C0	.;.;SO5A1_HUMAN;.	I	412	ENSP00000260126:M412I;ENSP00000434422:M412I;ENSP00000431611:M412I	ENSP00000260126:M412I	M	-	3	0	SLCO5A1	70830235	1.000000	0.71417	0.996000	0.52242	0.970000	0.65996	0.932000	0.28884	0.073000	0.16731	-0.251000	0.11542	ATG	SLCO5A1	-	pfam_OA_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000137571		0.393	SLCO5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO5A1	HGNC	protein_coding	OTTHUMT00000381990.3	34	0.00	0	C	NM_030958		70667681	70667681	-1	no_errors	ENST00000260126	ensembl	human	known	69_37n	missense	38	39.68	25	SNP	0.984	T
STAB1	23166	genome.wustl.edu	37	3	52556576	52556576	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr3:52556576C>T	ENST00000321725.6	+	61	6692	c.6616C>T	c.(6616-6618)Cgg>Tgg	p.R2206W		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	2206	Link. {ECO:0000255|PROSITE- ProRule:PRU00323, ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		TGCAGAGAAACGGGCTGGCGT	0.612																																						dbGAP											0													80.0	82.0	81.0					3																	52556576		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.6616C>T	3.37:g.52556576C>T	ENSP00000312946:p.Arg2206Trp		A7E297|Q8IUH0|Q8IUH1|Q93072	Missense_Mutation	SNP	pfam_FAS1_domain,pfam_Link,superfamily_C-type_lectin_fold,superfamily_FAS1_domain,smart_EGF-like,smart_EGF_laminin,smart_FAS1_domain,smart_EGF-like_Ca-bd,smart_Link,pfscan_EG-like_dom,pfscan_FAS1_domain,pfscan_Link	p.R2206W	ENST00000321725.6	37	c.6616	CCDS33768.1	3	.	.	.	.	.	.	.	.	.	.	C	15.47	2.843104	0.51057	.	.	ENSG00000010327	ENST00000321725	D	0.85411	-1.98	5.65	2.68	0.31781	Link (1);	0.258408	0.33753	N	0.004591	T	0.75781	0.3896	L	0.36672	1.1	0.22851	N	0.998658	B;B	0.20780	0.048;0.028	B;B	0.10450	0.005;0.005	T	0.67070	-0.5763	10	0.66056	D	0.02	.	7.4256	0.27096	0.4972:0.4211:0.0:0.0818	.	93;2206	B3KSK0;Q9NY15	.;STAB1_HUMAN	W	2206	ENSP00000312946:R2206W	ENSP00000312946:R2206W	R	+	1	2	STAB1	52531616	0.041000	0.20044	0.788000	0.31933	0.958000	0.62258	1.213000	0.32407	0.717000	0.32145	0.561000	0.74099	CGG	STAB1	-	smart_Link	ENSG00000010327		0.612	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAB1	HGNC	protein_coding	OTTHUMT00000351380.2	29	0.00	0	C	NM_015136		52556576	52556576	+1	no_errors	ENST00000321725	ensembl	human	known	69_37n	missense	40	16.67	8	SNP	0.759	T
STAG3	10734	genome.wustl.edu	37	7	99802301	99802301	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr7:99802301C>A	ENST00000426455.1	+	27	3261	c.2854C>A	c.(2854-2856)Cct>Act	p.P952T	STAG3_ENST00000394018.2_Missense_Mutation_p.P894T|GATS_ENST00000543273.1_RNA|GATS_ENST00000436886.2_Intron|STAG3_ENST00000440830.1_3'UTR|STAG3_ENST00000317296.5_Missense_Mutation_p.P952T	NM_001282716.1	NP_001269645.1	Q9UJ98	STAG3_HUMAN	stromal antigen 3	952					chromosome segregation (GO:0007059)|synaptonemal complex assembly (GO:0007130)	chromosome, centromeric region (GO:0000775)|extracellular space (GO:0005615)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleolus (GO:0005730)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)|transverse filament (GO:0000802)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(11)|lung(30)|ovary(5)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	66	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GAATGAGCTTCCTGCCTTCAT	0.582																																						dbGAP											0													72.0	58.0	63.0					7																	99802301		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ007798	CCDS34703.1, CCDS64730.1, CCDS75642.1	7q22	2008-02-01			ENSG00000066923	ENSG00000066923			11356	protein-coding gene	gene with protein product		608489				10698974	Standard	XM_005250116		Approved		uc003utx.1	Q9UJ98	OTTHUMG00000155183	ENST00000426455.1:c.2854C>A	7.37:g.99802301C>A	ENSP00000400359:p.Pro952Thr		A6H8Z1|B4DZ10|D6W5U8|H7BYK9|Q8NDP3	Missense_Mutation	SNP	pfam_STAG,superfamily_ARM-type_fold	p.P952T	ENST00000426455.1	37	c.2854	CCDS34703.1	7	.	.	.	.	.	.	.	.	.	.	.	12.33	1.906332	0.33628	.	.	ENSG00000066923	ENST00000426455;ENST00000394018;ENST00000317296	T;T;T	0.21361	2.01;2.01;2.01	5.1	5.1	0.69264	.	0.000000	0.45126	D	0.000383	T	0.34745	0.0908	L	0.41710	1.295	0.80722	D	1	B;D;P	0.76494	0.146;0.999;0.882	B;D;P	0.64144	0.032;0.922;0.451	T	0.03910	-1.0993	10	0.59425	D	0.04	-10.81	14.047	0.64710	0.0:1.0:0.0:0.0	.	894;952;952	B4DZ10;D6W5U7;Q9UJ98	.;.;STAG3_HUMAN	T	952;894;952	ENSP00000400359:P952T;ENSP00000377586:P894T;ENSP00000319318:P952T	ENSP00000319318:P952T	P	+	1	0	STAG3	99640237	0.998000	0.40836	0.994000	0.49952	0.851000	0.48451	3.890000	0.56220	2.376000	0.81061	0.655000	0.94253	CCT	STAG3	-	NULL	ENSG00000066923		0.582	STAG3-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	STAG3	HGNC	protein_coding	OTTHUMT00000338734.2	21	0.00	0	C	NM_012447		99802301	99802301	+1	no_errors	ENST00000317296	ensembl	human	known	69_37n	missense	45	27.42	17	SNP	0.998	A
STK32A	202374	genome.wustl.edu	37	5	146754671	146754671	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr5:146754671G>C	ENST00000397936.3	+	11	1255	c.922G>C	c.(922-924)Gat>Cat	p.D308H	STK32A_ENST00000398523.3_Missense_Mutation_p.D308H	NM_001112724.1	NP_001106195.1	Q8WU08	ST32A_HUMAN	serine/threonine kinase 32A	308							ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|prostate(1)|skin(1)	13			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTGAATTGTGATCCTACCTT	0.398																																						dbGAP											0													63.0	57.0	59.0					5																	146754671		1568	3582	5150	-	-	-	SO:0001583	missense	0				CCDS47299.1, CCDS75351.1	5q32	2008-02-05			ENSG00000169302	ENSG00000169302			28317	protein-coding gene	gene with protein product						12477932	Standard	NM_001112724		Approved	MGC22688, YANK1	uc010jgn.1	Q8WU08	OTTHUMG00000163411	ENST00000397936.3:c.922G>C	5.37:g.146754671G>C	ENSP00000381030:p.Asp308His		B3KSY0	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D308H	ENST00000397936.3	37	c.922	CCDS47299.1	5	.	.	.	.	.	.	.	.	.	.	G	24.2	4.501247	0.85176	.	.	ENSG00000169302	ENST00000397936;ENST00000398523	T;T	0.24908	1.83;1.83	5.78	5.78	0.91487	Protein kinase-like domain (1);	0.000000	0.49916	D	0.000133	T	0.59362	0.2188	M	0.87547	2.89	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.64803	-0.6321	10	0.87932	D	0	.	18.7737	0.91901	0.0:0.0:1.0:0.0	.	308;308;308	B7Z9H7;Q8WU08;Q8WU08-3	.;ST32A_HUMAN;.	H	308	ENSP00000381030:D308H;ENSP00000381535:D308H	ENSP00000381030:D308H	D	+	1	0	STK32A	146734864	1.000000	0.71417	0.994000	0.49952	0.991000	0.79684	8.896000	0.92521	2.738000	0.93877	0.655000	0.94253	GAT	STK32A	-	superfamily_Kinase-like_dom	ENSG00000169302		0.398	STK32A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	STK32A	HGNC	protein_coding	OTTHUMT00000373306.1	34	0.00	0	G	NM_145001		146754671	146754671	+1	no_errors	ENST00000397936	ensembl	human	known	69_37n	missense	53	15.87	10	SNP	1.000	C
STMN3	50861	genome.wustl.edu	37	20	62275115	62275115	+	Silent	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr20:62275115C>T	ENST00000370053.1	-	3	366	c.285G>A	c.(283-285)cgG>cgA	p.R95R	STMN3_ENST00000540534.1_Silent_p.R84R	NM_001276310.1|NM_015894.2	NP_001263239.1|NP_056978.2	Q9NZ72	STMN3_HUMAN	stathmin-like 3	95	SLD. {ECO:0000255|PROSITE- ProRule:PRU00998}.				cytoplasmic microtubule organization (GO:0031122)|negative regulation of Rac protein signal transduction (GO:0035021)|nervous system development (GO:0007399)|neuron projection development (GO:0031175)|regulation of cytoskeleton organization (GO:0051493)|regulation of microtubule polymerization or depolymerization (GO:0031110)|regulation of Rac GTPase activity (GO:0032314)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	protein domain specific binding (GO:0019904)			kidney(1)|large_intestine(1)|lung(5)|prostate(1)	8	all_cancers(38;2.31e-11)|all_epithelial(29;7.76e-13)		Epithelial(9;1.9e-09)|all cancers(9;1.22e-08)|BRCA - Breast invasive adenocarcinoma(10;8.86e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.00559)			TTGCCTTCCTCCGCTCCTCGG	0.662																																						dbGAP											0													32.0	35.0	34.0					20																	62275115		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF069709	CCDS13529.1, CCDS63330.1	20q13.3	2007-01-22			ENSG00000197457	ENSG00000197457			15926	protein-coding gene	gene with protein product		608362				9603203, 10655513	Standard	NM_001276310		Approved	SCLIP	uc002yfr.2	Q9NZ72	OTTHUMG00000032985	ENST00000370053.1:c.285G>A	20.37:g.62275115C>T			B3KSQ5|B7WP52|B7Z5G4|O75527|Q969Y4	Silent	SNP	pfam_Stathmin,superfamily_Stathmin,pirsf_Stathmin,prints_Stathmin	p.R95	ENST00000370053.1	37	c.285	CCDS13529.1	20																																																																																			STMN3	-	pfam_Stathmin,superfamily_Stathmin,pirsf_Stathmin,prints_Stathmin	ENSG00000197457		0.662	STMN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STMN3	HGNC	protein_coding	OTTHUMT00000080163.1	17	0.00	0	C	NM_015894		62275115	62275115	-1	no_errors	ENST00000370053	ensembl	human	known	69_37n	silent	26	18.75	6	SNP	1.000	T
STX4	6810	genome.wustl.edu	37	16	31044468	31044468	+	5'Flank	SNP	C	C	G			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr16:31044468C>G	ENST00000313843.3	+	0	0				STX4_ENST00000394998.1_5'UTR|STX4_ENST00000493902.1_3'UTR	NM_004604.3	NP_004595.2	Q12846	STX4_HUMAN	syntaxin 4						blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|neurotransmitter transport (GO:0006836)|platelet activation (GO:0030168)|post-Golgi vesicle-mediated transport (GO:0006892)|SNARE complex assembly (GO:0035493)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|membrane (GO:0016020)|myelin sheath adaxonal region (GO:0035749)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|SNARE complex (GO:0031201)|specific granule (GO:0042581)|trans-Golgi network (GO:0005802)|vacuole (GO:0005773)				NS(2)|breast(1)|large_intestine(3)|lung(3)	9						CTCCCCACCTCGCGGGGGCCG	0.697																																						dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			AF026007	CCDS10700.1, CCDS61916.1	16p11.2	2008-02-05	2006-04-25	2006-04-25	ENSG00000103496	ENSG00000103496			11439	protein-coding gene	gene with protein product		186591	"""syntaxin 4A (placental)"""	STX4A		8206394, 16339081	Standard	NM_001272095		Approved	p35-2	uc002eak.4	Q12846	OTTHUMG00000132404		16.37:g.31044468C>G	Exception_encountered		A8MXY0|Q15525|Q6FHE8	RNA	SNP	-	NULL	ENST00000313843.3	37	NULL	CCDS10700.1	16																																																																																			STX4	-	-	ENSG00000103496		0.697	STX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STX4	HGNC	protein_coding	OTTHUMT00000255538.3	10	0.00	0	C	NM_004604		31044468	31044468	+1	no_errors	ENST00000493902	ensembl	human	known	69_37n	rna	24	20.00	6	SNP	0.021	G
SYNE2	23224	genome.wustl.edu	37	14	64547350	64547350	+	Silent	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr14:64547350G>A	ENST00000344113.4	+	56	11552	c.11340G>A	c.(11338-11340)ttG>ttA	p.L3780L	SYNE2_ENST00000357395.3_Silent_p.L142L|SYNE2_ENST00000554584.1_Silent_p.L3813L|SYNE2_ENST00000358025.3_Silent_p.L3780L|SYNE2_ENST00000555002.1_Silent_p.L414L|SYNE2_ENST00000394768.2_Silent_p.L142L	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	3780					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		CCTCACAGTTGAATAAGGTAT	0.408																																						dbGAP											0													103.0	91.0	95.0					14																	64547350		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.11340G>A	14.37:g.64547350G>A			Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Silent	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.L3780	ENST00000344113.4	37	c.11340	CCDS41963.1	14																																																																																			SYNE2	-	smart_Spectrin/alpha-actinin	ENSG00000054654		0.408	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	82	0.00	0	G	NM_182914		64547350	64547350	+1	no_errors	ENST00000358025	ensembl	human	known	69_37n	silent	120	20.53	31	SNP	0.677	A
SYNE3	161176	genome.wustl.edu	37	14	95934203	95934203	+	Silent	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr14:95934203C>T	ENST00000334258.5	-	2	260	c.246G>A	c.(244-246)ggG>ggA	p.G82G	SYNE3_ENST00000553340.1_Silent_p.G82G|SYNE3_ENST00000557275.1_Silent_p.G82G	NM_152592.3	NP_689805.3	Q6ZMZ3	SYNE3_HUMAN	spectrin repeat containing, nuclear envelope family member 3	82					cytoskeletal anchoring at nuclear membrane (GO:0090286)|cytoskeleton organization (GO:0007010)|establishment of protein localization to membrane (GO:0090150)|regulation of cell shape (GO:0008360)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear outer membrane (GO:0005640)|SUN-KASH complex (GO:0034993)	actin filament binding (GO:0051015)			breast(1)|endometrium(2)|lung(25)	28						GGGCCAGGATCCCGGGCTTCT	0.617																																						dbGAP											0													71.0	58.0	62.0					14																	95934203		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK098471	CCDS9935.1	14q32.13	2012-05-31	2012-05-31	2012-05-31	ENSG00000176438	ENSG00000176438			19861	protein-coding gene	gene with protein product		610861	"""chromosome 14 open reading frame 49"""	C14orf49			Standard	NM_152592		Approved	FLJ25605, NET53, Nesprin-3, Nesp3	uc001yei.4	Q6ZMZ3	OTTHUMG00000171632	ENST00000334258.5:c.246G>A	14.37:g.95934203C>T			A6H8H3|Q86SX5|Q8N7G8	Silent	SNP	pfam_KASH,pfam_Spectrin_repeat,superfamily_Retrov_capsid_C,smart_Spectrin/alpha-actinin,pfscan_KASH	p.G82	ENST00000334258.5	37	c.246	CCDS9935.1	14																																																																																			SYNE3	-	smart_Spectrin/alpha-actinin	ENSG00000176438		0.617	SYNE3-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE3	HGNC	protein_coding	OTTHUMT00000420529.2	33	0.00	0	C	NM_152592		95934203	95934203	-1	no_errors	ENST00000334258	ensembl	human	known	69_37n	silent	53	18.46	12	SNP	0.263	T
SYT6	148281	genome.wustl.edu	37	1	114682373	114682373	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr1:114682373C>T	ENST00000610222.1	-	2	522	c.376G>A	c.(376-378)Ggc>Agc	p.G126S	SYT6_ENST00000607941.1_Missense_Mutation_p.G41S|SYT6_ENST00000393296.1_Missense_Mutation_p.G126S|SYT6_ENST00000609117.1_Missense_Mutation_p.G41S|SYT6_ENST00000369547.1_Missense_Mutation_p.G41S			Q5T7P8	SYT6_HUMAN	synaptotagmin VI	126					acrosomal vesicle exocytosis (GO:0060478)	cell junction (GO:0030054)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	clathrin binding (GO:0030276)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|syntaxin binding (GO:0019905)|transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37	Lung SC(450;0.184)	all_cancers(81;4.41e-08)|all_epithelial(167;5.18e-08)|all_lung(203;1.58e-05)|Lung NSC(69;2.82e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCCAGGAAGCCCAGGGTGCTG	0.622																																						dbGAP											0													86.0	85.0	85.0					1																	114682373		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS871.1	1p13.1	2013-01-21			ENSG00000134207	ENSG00000134207		"""Synaptotagmins"""	18638	protein-coding gene	gene with protein product		607718				11543631	Standard	NM_205848		Approved		uc021orz.1	Q5T7P8	OTTHUMG00000011755	ENST00000610222.1:c.376G>A	1.37:g.114682373C>T	ENSP00000476396:p.Gly126Ser		B1AMB8|B3KPK1	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting,prints_Synaptotagmin,prints_C2_dom	p.G126S	ENST00000610222.1	37	c.376		1	.	.	.	.	.	.	.	.	.	.	C	13.80	2.344519	0.41498	.	.	ENSG00000134207	ENST00000369547;ENST00000393296;ENST00000369546;ENST00000369545;ENST00000425037;ENST00000447981	T;T;T;T;T;T	0.56941	0.43;0.43;0.43;0.43;1.57;0.98	5.76	3.91	0.45181	.	0.055189	0.64402	D	0.000001	T	0.14614	0.0353	N	0.25380	0.74	0.51767	D	0.999935	B	0.14438	0.01	B	0.09377	0.004	T	0.18178	-1.0345	10	0.02654	T	1	.	10.6042	0.45384	0.0:0.7891:0.0:0.2109	.	126	Q5T7P8	SYT6_HUMAN	S	41;126;41;126;41;41	ENSP00000358560:G41S;ENSP00000376974:G126S;ENSP00000358559:G41S;ENSP00000358558:G126S;ENSP00000412443:G41S;ENSP00000389266:G41S	ENSP00000358558:G126S	G	-	1	0	SYT6	114483896	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.967000	0.49216	0.801000	0.34066	0.655000	0.94253	GGC	SYT6	-	NULL	ENSG00000134207		0.622	SYT6-004	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	SYT6	HGNC	protein_coding	OTTHUMT00000314819.2	20	0.00	0	C	NM_205848		114682373	114682373	-1	no_errors	ENST00000369545	ensembl	human	known	69_37n	missense	23	14.81	4	SNP	1.000	T
TACR2	6865	genome.wustl.edu	37	10	71164782	71164782	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr10:71164782C>G	ENST00000373306.4	-	5	1540	c.997G>C	c.(997-999)Gaa>Caa	p.E333Q	TACR2_ENST00000373307.1_Missense_Mutation_p.E121Q	NM_001057.2	NP_001048.2	P21452	NK2R_HUMAN	tachykinin receptor 2	333					excretion (GO:0007588)|intestine smooth muscle contraction (GO:0014827)|muscle contraction (GO:0006936)|negative regulation of luteinizing hormone secretion (GO:0033685)|operant conditioning (GO:0035106)|positive regulation of acetylcholine secretion, neurotransmission (GO:0014057)|positive regulation of uterine smooth muscle contraction (GO:0070474)|positive regulation of vascular permeability (GO:0043117)|prolactin secretion (GO:0070459)|tachykinin receptor signaling pathway (GO:0007217)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	substance K receptor activity (GO:0016497)|tachykinin receptor activity (GO:0004995)			endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	11						AGCTTATCTTCCTTGGTGGGT	0.607																																						dbGAP											0													148.0	127.0	134.0					10																	71164782		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS7293.1	10q22.1	2012-09-20			ENSG00000075073	ENSG00000075073		"""GPCR / Class A : Tachykinin receptors"""	11527	protein-coding gene	gene with protein product		162321		TAC2R, NKNAR			Standard	NM_001057		Approved	SKR, NK2R	uc001jpn.2	P21452	OTTHUMG00000018377	ENST00000373306.4:c.997G>C	10.37:g.71164782C>G	ENSP00000362403:p.Glu333Gln		A8K7I1|Q4QRI5|Q8NGQ8|Q9UDE6|Q9UDE7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_NK2_rcpt,prints_Neurokn_rcpt,prints_7TM_GPCR_Rhodpsn,prints_NPY_rcpt	p.E333Q	ENST00000373306.4	37	c.997	CCDS7293.1	10	.	.	.	.	.	.	.	.	.	.	C	7.266	0.606094	0.14002	.	.	ENSG00000075073	ENST00000373307;ENST00000373306	T;T	0.72835	0.09;-0.69	5.72	4.81	0.61882	.	0.054461	0.64402	D	0.000001	T	0.57888	0.2084	L	0.54323	1.7	0.34525	D	0.70862	B	0.33345	0.409	B	0.27715	0.082	T	0.64275	-0.6446	10	0.30854	T	0.27	.	5.6536	0.17631	0.1685:0.6725:0.0:0.1589	.	333	P21452	NK2R_HUMAN	Q	121;333	ENSP00000362404:E121Q;ENSP00000362403:E333Q	ENSP00000362403:E333Q	E	-	1	0	TACR2	70834788	0.006000	0.16342	1.000000	0.80357	0.055000	0.15305	0.023000	0.13533	2.694000	0.91930	0.655000	0.94253	GAA	TACR2	-	prints_NK2_rcpt	ENSG00000075073		0.607	TACR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TACR2	HGNC	protein_coding	OTTHUMT00000048411.1	27	0.00	0	C			71164782	71164782	-1	no_errors	ENST00000373306	ensembl	human	known	69_37n	missense	71	13.41	11	SNP	0.954	G
TAF1L	138474	genome.wustl.edu	37	9	32631814	32631814	+	Missense_Mutation	SNP	C	C	T	rs553990595		TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr9:32631814C>T	ENST00000242310.4	-	1	3853	c.3764G>A	c.(3763-3765)cGg>cAg	p.R1255Q	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	1255					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TTCCTGGTTCCGCTTAAGCCG	0.468													C|||	1	0.000199681	0.0	0.0	5008	,	,		19713	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													88.0	87.0	88.0					9																	32631814		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.3764G>A	9.37:g.32631814C>T	ENSP00000418379:p.Arg1255Gln		Q0VG57	Missense_Mutation	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.R1255Q	ENST00000242310.4	37	c.3764	CCDS35003.1	9	.	.	.	.	.	.	.	.	.	.	C	18.23	3.577749	0.65878	.	.	ENSG00000122728	ENST00000242310	T	0.65364	-0.15	1.04	-0.0542	0.13815	.	0.050642	0.85682	D	0.000000	T	0.66992	0.2846	L	0.54323	1.7	0.44862	D	0.997871	D	0.89917	1.0	D	0.73380	0.98	T	0.65175	-0.6232	10	0.72032	D	0.01	.	4.9434	0.13976	0.0:0.7269:0.0:0.2731	.	1255	Q8IZX4	TAF1L_HUMAN	Q	1255	ENSP00000418379:R1255Q	ENSP00000418379:R1255Q	R	-	2	0	TAF1L	32621814	1.000000	0.71417	0.989000	0.46669	0.350000	0.29205	4.926000	0.63433	0.507000	0.28148	0.195000	0.17529	CGG	TAF1L	-	pirsf_TAF1_animal	ENSG00000122728		0.468	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1L	HGNC	protein_coding	OTTHUMT00000052012.2	47	0.00	0	C			32631814	32631814	-1	no_errors	ENST00000242310	ensembl	human	known	69_37n	missense	54	19.40	13	SNP	0.997	T
TARBP1	6894	genome.wustl.edu	37	1	234536980	234536980	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr1:234536980G>C	ENST00000040877.1	-	25	4017	c.4018C>G	c.(4018-4020)Cag>Gag	p.Q1340E	TARBP1_ENST00000483404.1_5'UTR	NM_005646.3	NP_005637.3	Q13395	TARB1_HUMAN	TAR (HIV-1) RNA binding protein 1	1340					regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA processing (GO:0006396)	nucleus (GO:0005634)	RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(7)|large_intestine(6)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	55	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			AAATGCTCCTGAATGCGTTGC	0.363																																						dbGAP											0													116.0	108.0	111.0					1																	234536980		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS1601.1	1q42.2	2012-06-12	2007-06-26		ENSG00000059588	ENSG00000059588			11568	protein-coding gene	gene with protein product	"""tRNA methyltransferase 3 homolog (S. cerevisiae)"""	605052	"""Tar (HIV-1) RNA binding protein 1"""			1936997	Standard	NM_005646		Approved	TRP-185, TRM3	uc001hwd.3	Q13395	OTTHUMG00000037947	ENST00000040877.1:c.4018C>G	1.37:g.234536980G>C	ENSP00000040877:p.Gln1340Glu		Q9H581	Missense_Mutation	SNP	pfam_SpoU_MeTrfase,superfamily_ARM-type_fold	p.Q1340E	ENST00000040877.1	37	c.4018	CCDS1601.1	1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.641484	0.87859	.	.	ENSG00000059588	ENST00000040877	T	0.06933	3.24	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	T	0.30823	0.0777	M	0.78637	2.42	0.80722	D	1	D	0.63880	0.993	D	0.64506	0.926	T	0.00192	-1.1935	10	0.34782	T	0.22	-20.7423	20.4488	0.99124	0.0:0.0:1.0:0.0	.	1340	Q13395	TARB1_HUMAN	E	1340	ENSP00000040877:Q1340E	ENSP00000040877:Q1340E	Q	-	1	0	TARBP1	232603603	1.000000	0.71417	0.996000	0.52242	0.675000	0.39556	8.815000	0.91973	2.843000	0.97960	0.655000	0.94253	CAG	TARBP1	-	NULL	ENSG00000059588		0.363	TARBP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	TARBP1	HGNC	protein_coding	OTTHUMT00000092616.1	26	0.00	0	G	NM_005646		234536980	234536980	-1	no_errors	ENST00000040877	ensembl	human	known	69_37n	missense	49	24.62	16	SNP	1.000	C
TBC1D29	26083	genome.wustl.edu	37	17	28887667	28887667	+	Silent	SNP	T	T	C	rs78888987	byFrequency	TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr17:28887667T>C	ENST00000580161.1	+	4	2608	c.111T>C	c.(109-111)gaT>gaC	p.D37D	RP11-218M11.6_ENST00000582125.1_RNA|TBC1D29_ENST00000579181.1_Silent_p.D37D|TBC1D29_ENST00000584297.1_Silent_p.D37D			Q9UFV1	TBC29_HUMAN	TBC1 domain family, member 29	37	Rab-GAP TBC; truncated. {ECO:0000255|PROSITE-ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)	p.D37D(1)		breast(1)|kidney(1)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Myeloproliferative disorder(56;0.0255)				GCCTGTGGGATATGTATTTGC	0.572																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											149.0	126.0	134.0					17																	28887667		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC096718	CCDS32606.1	17q11.2	2014-09-04			ENSG00000266733	ENSG00000266733			24509	protein-coding gene	gene with protein product						12618308	Standard	XM_006721805		Approved	DKFZP434O047	uc002hfh.3	Q9UFV1	OTTHUMG00000178857	ENST00000580161.1:c.111T>C	17.37:g.28887667T>C				Silent	SNP	superfamily_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.D37	ENST00000580161.1	37	c.111	CCDS32606.1	17																																																																																			TBC1D29	-	superfamily_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000266733		0.572	TBC1D29-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	TBC1D29	HGNC	protein_coding	OTTHUMT00000443632.1	46	0.00	0	T	NM_015594		28887667	28887667	+1	no_errors	ENST00000579181	ensembl	human	known	69_37n	silent	53	17.19	11	SNP	1.000	C
TFAP4	7023	genome.wustl.edu	37	16	4322744	4322744	+	Nonsense_Mutation	SNP	C	C	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr16:4322744C>A	ENST00000204517.6	-	1	332	c.4G>T	c.(4-6)Gag>Tag	p.E2*		NM_003223.2	NP_003214.1	Q01664	TFAP4_HUMAN	transcription factor AP-4 (activating enhancer binding protein 4)	2					cellular response to dexamethasone stimulus (GO:0071549)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001269)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|histone deacetylase binding (GO:0042826)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|endometrium(2)|lung(8)|ovary(1)|prostate(1)|skin(1)	14						ATGAAATACTCCATAGCGATC	0.552																																						dbGAP											0													93.0	86.0	88.0					16																	4322744		2197	4300	6497	-	-	-	SO:0001587	stop_gained	0			X57435	CCDS10510.1	16p13	2013-05-21	2001-11-28		ENSG00000090447	ENSG00000090447		"""Basic helix-loop-helix proteins"""	11745	protein-coding gene	gene with protein product		600743	"""transcription factor AP-4 (activating enhancer-binding protein 4)"""			2123466	Standard	NM_003223		Approved	AP-4, bHLHc41	uc010uxg.2	Q01664	OTTHUMG00000129435	ENST00000204517.6:c.4G>T	16.37:g.4322744C>A	ENSP00000204517:p.Glu2*		O60409	Nonsense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.E2*	ENST00000204517.6	37	c.4	CCDS10510.1	16	.	.	.	.	.	.	.	.	.	.	C	38	6.889248	0.97912	.	.	ENSG00000090447	ENST00000204517	.	.	.	4.49	4.49	0.54785	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.9595	0.79918	0.0:1.0:0.0:0.0	.	.	.	.	X	2	.	ENSP00000204517:E2X	E	-	1	0	TFAP4	4262745	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.462000	0.73526	2.048000	0.60808	0.462000	0.41574	GAG	TFAP4	-	NULL	ENSG00000090447		0.552	TFAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFAP4	HGNC	protein_coding	OTTHUMT00000251595.2	57	0.00	0	C	NM_003223		4322744	4322744	-1	no_errors	ENST00000204517	ensembl	human	known	69_37n	nonsense	96	14.29	16	SNP	1.000	A
TIGD3	220359	genome.wustl.edu	37	11	65123363	65123363	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr11:65123363G>T	ENST00000309880.5	+	2	291	c.84G>T	c.(82-84)aaG>aaT	p.K28N		NM_145719.2	NP_663771.1	Q6B0B8	TIGD3_HUMAN	tigger transposable element derived 3	28	HTH psq-type. {ECO:0000255|PROSITE- ProRule:PRU00320}.					nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(3)|large_intestine(1)|lung(9)|prostate(2)|skin(2)	17						ATGAGTCCAAGATGTCCCAGT	0.622																																						dbGAP											0													60.0	64.0	63.0					11																	65123363		2201	4297	6498	-	-	-	SO:0001583	missense	0				CCDS8101.1	11q13.1	2008-07-21				ENSG00000173825			18334	protein-coding gene	gene with protein product							Standard	NM_145719		Approved		uc001odo.4	Q6B0B8		ENST00000309880.5:c.84G>T	11.37:g.65123363G>T	ENSP00000308354:p.Lys28Asn			Missense_Mutation	SNP	pfam_HTH_CenpB_DNA-bd_dom,pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_Psq,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_HTH_Psq	p.K28N	ENST00000309880.5	37	c.84	CCDS8101.1	11	.	.	.	.	.	.	.	.	.	.	G	14.80	2.643785	0.47258	.	.	ENSG00000173825	ENST00000309880	T	0.44083	0.93	4.94	3.06	0.35304	Homeodomain-related (1);Homeodomain-like (1);Helix-turn-helix, Psq-like (1);Centromere protein Cenp-B, DNA-binding domain 1 (1);	0.000000	0.33753	N	0.004598	T	0.41026	0.1141	N	0.21545	0.675	0.35250	D	0.778634	D	0.76494	0.999	D	0.81914	0.995	T	0.43972	-0.9358	10	0.09590	T	0.72	-22.1679	7.7051	0.28646	0.1964:0.0:0.8036:0.0	.	28	Q6B0B8	TIGD3_HUMAN	N	28	ENSP00000308354:K28N	ENSP00000308354:K28N	K	+	3	2	TIGD3	64879939	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.078000	0.41567	0.621000	0.30232	0.456000	0.33151	AAG	TIGD3	-	pfam_HTH_Psq,superfamily_Homeodomain-like,pfscan_HTH_Psq	ENSG00000173825		0.622	TIGD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGD3	HGNC	protein_coding	OTTHUMT00000387310.1	29	0.00	0	G	NM_145719		65123363	65123363	+1	no_errors	ENST00000309880	ensembl	human	known	69_37n	missense	37	39.34	24	SNP	1.000	T
TIGD3	220359	genome.wustl.edu	37	11	65124541	65124541	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr11:65124541G>A	ENST00000309880.5	+	2	1469	c.1262G>A	c.(1261-1263)aGa>aAa	p.R421K		NM_145719.2	NP_663771.1	Q6B0B8	TIGD3_HUMAN	tigger transposable element derived 3	421						nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(3)|large_intestine(1)|lung(9)|prostate(2)|skin(2)	17						AAGGGGGACAGAGAGGGTGCC	0.582																																						dbGAP											0													104.0	98.0	100.0					11																	65124541		2201	4297	6498	-	-	-	SO:0001583	missense	0				CCDS8101.1	11q13.1	2008-07-21				ENSG00000173825			18334	protein-coding gene	gene with protein product							Standard	NM_145719		Approved		uc001odo.4	Q6B0B8		ENST00000309880.5:c.1262G>A	11.37:g.65124541G>A	ENSP00000308354:p.Arg421Lys			Missense_Mutation	SNP	pfam_HTH_CenpB_DNA-bd_dom,pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_Psq,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_HTH_Psq	p.R421K	ENST00000309880.5	37	c.1262	CCDS8101.1	11	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.753724	0.00663	.	.	ENSG00000173825	ENST00000309880	T	0.17528	2.27	3.46	1.37	0.22104	.	.	.	.	.	T	0.07548	0.0190	N	0.14661	0.345	0.09310	N	1	B	0.12013	0.005	B	0.15870	0.014	T	0.42172	-0.9467	9	0.06365	T	0.9	1.4112	6.258	0.20884	0.0:0.2064:0.5812:0.2124	.	421	Q6B0B8	TIGD3_HUMAN	K	421	ENSP00000308354:R421K	ENSP00000308354:R421K	R	+	2	0	TIGD3	64881117	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-0.550000	0.06034	0.199000	0.20427	0.456000	0.33151	AGA	TIGD3	-	NULL	ENSG00000173825		0.582	TIGD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGD3	HGNC	protein_coding	OTTHUMT00000387310.1	21	0.00	0	G	NM_145719		65124541	65124541	+1	no_errors	ENST00000309880	ensembl	human	known	69_37n	missense	15	34.78	8	SNP	0.005	A
TIGD3	220359	genome.wustl.edu	37	11	65124663	65124663	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr11:65124663G>C	ENST00000309880.5	+	2	1591	c.1384G>C	c.(1384-1386)Gag>Cag	p.E462Q		NM_145719.2	NP_663771.1	Q6B0B8	TIGD3_HUMAN	tigger transposable element derived 3	462						nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(3)|large_intestine(1)|lung(9)|prostate(2)|skin(2)	17						CTACGACTGTGAGGAGGAGGT	0.562																																						dbGAP											0													42.0	44.0	43.0					11																	65124663		2201	4297	6498	-	-	-	SO:0001583	missense	0				CCDS8101.1	11q13.1	2008-07-21				ENSG00000173825			18334	protein-coding gene	gene with protein product							Standard	NM_145719		Approved		uc001odo.4	Q6B0B8		ENST00000309880.5:c.1384G>C	11.37:g.65124663G>C	ENSP00000308354:p.Glu462Gln			Missense_Mutation	SNP	pfam_HTH_CenpB_DNA-bd_dom,pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_Psq,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_HTH_Psq	p.E462Q	ENST00000309880.5	37	c.1384	CCDS8101.1	11	.	.	.	.	.	.	.	.	.	.	G	17.92	3.506949	0.64410	.	.	ENSG00000173825	ENST00000309880	T	0.27402	1.67	4.37	4.37	0.52481	.	0.000000	0.34223	N	0.004153	T	0.40398	0.1115	L	0.27053	0.805	0.29121	N	0.880265	D	0.63880	0.993	D	0.70227	0.968	T	0.25433	-1.0132	10	0.72032	D	0.01	-10.4327	12.8254	0.57716	0.0:0.0:1.0:0.0	.	462	Q6B0B8	TIGD3_HUMAN	Q	462	ENSP00000308354:E462Q	ENSP00000308354:E462Q	E	+	1	0	TIGD3	64881239	1.000000	0.71417	0.993000	0.49108	0.807000	0.45602	5.881000	0.69706	2.187000	0.69744	0.306000	0.20318	GAG	TIGD3	-	NULL	ENSG00000173825		0.562	TIGD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGD3	HGNC	protein_coding	OTTHUMT00000387310.1	18	0.00	0	G	NM_145719		65124663	65124663	+1	no_errors	ENST00000309880	ensembl	human	known	69_37n	missense	30	21.05	8	SNP	0.999	C
TIPIN	54962	genome.wustl.edu	37	15	66671800	66671800	+	5'UTR	SNP	C	C	G			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr15:66671800C>G	ENST00000561773.1	-	0	536							Q9BVW5	TIPIN_HUMAN	TIMELESS interacting protein						cell cycle phase transition (GO:0044770)|DNA replication checkpoint (GO:0000076)|intra-S DNA damage checkpoint (GO:0031573)|mitotic nuclear division (GO:0007067)|positive regulation of cell proliferation (GO:0008284)|regulation of nuclear cell cycle DNA replication (GO:0033262)|replication fork protection (GO:0048478)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)				autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|ovary(1)|skin(1)|stomach(1)	7						GAAACAAGCTCAATGTCATTT	0.398																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			BK001386	CCDS10215.1	15q22.31	2012-03-02	2006-08-08		ENSG00000075131	ENSG00000075131			30750	protein-coding gene	gene with protein product	"""CSM3 homolog (S. cerevisiae)"""	610716				12875843, 17102137	Standard	NM_017858		Approved	FLJ20516	uc002apr.2	Q9BVW5	OTTHUMG00000133188	ENST00000561773.1:c.-193G>C	15.37:g.66671800C>G			B2CW64|Q9NWZ6	RNA	SNP	-	NULL	ENST00000561773.1	37	NULL		15																																																																																			TIPIN	-	-	ENSG00000075131		0.398	TIPIN-006	KNOWN	mRNA_end_NF|basic	processed_transcript	TIPIN	HGNC	protein_coding	OTTHUMT00000420721.1	85	0.00	0	C	NM_017858		66671800	66671800	-1	no_errors	ENST00000561773	ensembl	human	known	69_37n	rna	99	13.79	16	SNP	1.000	G
TLE6	79816	genome.wustl.edu	37	19	2989231	2989231	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr19:2989231G>A	ENST00000246112.4	+	12	1114	c.913G>A	c.(913-915)Ggc>Agc	p.G305S	TLE6_ENST00000478073.2_3'UTR|TLE6_ENST00000452088.1_Missense_Mutation_p.G182S	NM_001143986.1	NP_001137458.1	Q9H808	TLE6_HUMAN	transducin-like enhancer of split 6	305					regulation of transcription, DNA-templated (GO:0006355)	cell cortex (GO:0005938)|nucleus (GO:0005634)|protein complex (GO:0043234)				breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|urinary_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTTCACCTGTGGCAGAAGAGG	0.612																																						dbGAP											0													59.0	44.0	49.0					19																	2989231		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK024071	CCDS12100.1, CCDS45910.1	19p13.3	2014-03-07	2014-03-07		ENSG00000104953	ENSG00000104953		"""WD repeat domain containing"""	30788	protein-coding gene	gene with protein product		612399	"""transducin-like enhancer of split 6 (E(sp1) homolog, Drosophila)"""			11486032	Standard	NM_024760		Approved	FLJ14009, GRG6	uc002lwt.2	Q9H808	OTTHUMG00000156793	ENST00000246112.4:c.913G>A	19.37:g.2989231G>A	ENSP00000246112:p.Gly305Ser		J3KMZ1	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom,prints_Groucho_enhance	p.G305S	ENST00000246112.4	37	c.913	CCDS45910.1	19	.	.	.	.	.	.	.	.	.	.	G	7.703	0.693570	0.15039	.	.	ENSG00000104953	ENST00000447920;ENST00000246112;ENST00000452088;ENST00000441927	T;T	0.10099	2.91;2.91	3.53	-2.4	0.06583	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	.	.	.	.	T	0.06188	0.0160	L	0.33137	0.985	0.42321	D	0.992254	P;P;B;B	0.40970	0.518;0.734;0.154;0.347	B;B;B;B	0.35470	0.147;0.203;0.085;0.085	T	0.44452	-0.9327	9	0.29301	T	0.29	.	7.4595	0.27287	0.6297:0.0:0.3703:0.0	.	305;163;182;182	C9JGZ7;Q9Y6S1;Q9H808;Q6PJM9	.;.;TLE6_HUMAN;.	S	305;305;182;182	ENSP00000246112:G305S;ENSP00000406893:G182S	ENSP00000246112:G305S	G	+	1	0	TLE6	2940231	1.000000	0.71417	0.069000	0.20011	0.071000	0.16799	2.868000	0.48436	-0.339000	0.08401	-0.378000	0.06908	GGC	TLE6	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000104953		0.612	TLE6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TLE6	HGNC	protein_coding	OTTHUMT00000345996.3	8	0.00	0	G	NM_024760		2989231	2989231	+1	no_errors	ENST00000246112	ensembl	human	known	69_37n	missense	16	27.27	6	SNP	0.958	A
TMEM131	23505	genome.wustl.edu	37	2	98375464	98375464	+	Silent	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr2:98375464C>T	ENST00000186436.5	-	40	5487	c.5259G>A	c.(5257-5259)agG>agA	p.R1753R		NM_015348.1	NP_056163.1	Q92545	TM131_HUMAN	transmembrane protein 131	1753	Ser-rich.					integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(4)|prostate(1)|skin(1)|stomach(1)	57						CGTTCCAGCTCCTCTGTGAGG	0.507																																						dbGAP											0													87.0	93.0	91.0					2																	98375464		2001	4183	6184	-	-	-	SO:0001819	synonymous_variant	0			AK025852	CCDS46368.1	2q11.2	2006-04-12			ENSG00000075568	ENSG00000075568			30366	protein-coding gene	gene with protein product		615659				9039502, 10996388	Standard	NM_015348		Approved	CC28, YR-23, RW1, KIAA0257, PRO1048	uc002syh.4	Q92545	OTTHUMG00000153061	ENST00000186436.5:c.5259G>A	2.37:g.98375464C>T				Silent	SNP	pfam_DUF3651_TMEM131	p.R1753	ENST00000186436.5	37	c.5259	CCDS46368.1	2																																																																																			TMEM131	-	NULL	ENSG00000075568		0.507	TMEM131-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM131	HGNC	protein_coding	OTTHUMT00000329285.2	36	0.00	0	C	XM_371542		98375464	98375464	-1	no_errors	ENST00000186436	ensembl	human	known	69_37n	silent	51	25.00	17	SNP	0.995	T
TMEM74	157753	genome.wustl.edu	37	8	109796528	109796528	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr8:109796528G>A	ENST00000297459.3	-	2	978	c.800C>T	c.(799-801)tCt>tTt	p.S267F	TMEM74_ENST00000518838.1_Intron	NM_153015.1	NP_694560.1	Q96NL1	TMM74_HUMAN	transmembrane protein 74	267					autophagy (GO:0006914)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)				breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	29			OV - Ovarian serous cystadenocarcinoma(57;3.08e-10)			CTCTTTGGAAGAGGCAAATCT	0.507																																						dbGAP											0													88.0	84.0	85.0					8																	109796528		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055230	CCDS6310.1	8q23.1	2009-11-06				ENSG00000164841			26409	protein-coding gene	gene with protein product		613935				12477932	Standard	NM_153015		Approved	FLJ30668, NET36	uc003ymy.1	Q96NL1		ENST00000297459.3:c.800C>T	8.37:g.109796528G>A	ENSP00000297459:p.Ser267Phe			Missense_Mutation	SNP	NULL	p.S267F	ENST00000297459.3	37	c.800	CCDS6310.1	8	.	.	.	.	.	.	.	.	.	.	G	13.62	2.291866	0.40594	.	.	ENSG00000164841	ENST00000297459	.	.	.	5.93	5.93	0.95920	.	0.198823	0.45867	D	0.000326	T	0.58850	0.2151	L	0.44542	1.39	0.39481	D	0.967889	P	0.41524	0.753	B	0.43103	0.408	T	0.60870	-0.7177	9	0.54805	T	0.06	-13.6657	20.3404	0.98760	0.0:0.0:1.0:0.0	.	267	Q96NL1	TMM74_HUMAN	F	267	.	ENSP00000297459:S267F	S	-	2	0	TMEM74	109865704	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.166000	0.71896	2.812000	0.96745	0.637000	0.83480	TCT	TMEM74	-	NULL	ENSG00000164841		0.507	TMEM74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM74	HGNC	protein_coding	OTTHUMT00000380755.1	48	0.00	0	G	NM_153015		109796528	109796528	-1	no_errors	ENST00000297459	ensembl	human	known	69_37n	missense	43	21.82	12	SNP	1.000	A
TNIK	23043	genome.wustl.edu	37	3	170819401	170819401	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr3:170819401C>G	ENST00000436636.2	-	22	2772	c.2428G>C	c.(2428-2430)Gaa>Caa	p.E810Q	TNIK_ENST00000460047.1_Missense_Mutation_p.E747Q|TNIK_ENST00000488470.1_Missense_Mutation_p.E755Q|TNIK_ENST00000284483.8_Missense_Mutation_p.E802Q|TNIK_ENST00000470834.1_Missense_Mutation_p.E773Q|TNIK_ENST00000357327.5_Missense_Mutation_p.E781Q|TNIK_ENST00000369326.5_Missense_Mutation_p.E788Q|TNIK_ENST00000341852.6_Missense_Mutation_p.E726Q|TNIK_ENST00000538048.1_Missense_Mutation_p.E762Q|TNIK_ENST00000475336.1_Missense_Mutation_p.E718Q	NM_015028.2	NP_055843.1	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase	810	Mediates interaction with NEDD4.				actin cytoskeleton reorganization (GO:0031532)|activation of JNKK activity (GO:0007256)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite morphogenesis (GO:0048814)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(22)|ovary(5)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)	62	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			TCTCTTAGTTCTTTGGCTAAT	0.453																																						dbGAP											0													197.0	176.0	183.0					3																	170819401		1942	4154	6096	-	-	-	SO:0001583	missense	0			AF172264	CCDS46956.1, CCDS54673.1, CCDS54674.1, CCDS54675.1, CCDS54676.1, CCDS54677.1, CCDS54678.1, CCDS54679.1	3q26.31	2008-01-23			ENSG00000154310	ENSG00000154310			30765	protein-coding gene	gene with protein product		610005				9628581, 10521462	Standard	NR_027767		Approved	KIAA0551	uc003fhh.2	Q9UKE5	OTTHUMG00000159036	ENST00000436636.2:c.2428G>C	3.37:g.170819401C>G	ENSP00000399511:p.Glu810Gln		A7E2A3|A8K4U1|D3DNQ6|O60298|Q8WUY7|Q9UKD8|Q9UKD9|Q9UKE0|Q9UKE1|Q9UKE2|Q9UKE3|Q9UKE4	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_cat_dom	p.E810Q	ENST00000436636.2	37	c.2428	CCDS46956.1	3	.	.	.	.	.	.	.	.	.	.	C	23.4	4.414601	0.83449	.	.	ENSG00000154310	ENST00000436636;ENST00000369326;ENST00000538048;ENST00000341852;ENST00000284483;ENST00000475336;ENST00000357327;ENST00000460047;ENST00000488470;ENST00000470834	D;D;D;D;D;D;D;D;D;D	0.87103	-2.21;-2.21;-2.21;-2.21;-2.21;-2.21;-2.21;-2.21;-2.21;-2.21	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	D	0.93625	0.7964	M	0.75777	2.31	0.80722	D	1	D;D;D;D;D;D;D;D	0.71674	0.989;0.995;0.989;0.989;0.997;0.997;0.989;0.998	D;D;D;D;D;D;D;D	0.72982	0.979;0.962;0.979;0.979;0.979;0.979;0.979;0.979	D	0.93260	0.6642	10	0.72032	D	0.01	.	20.5373	0.99239	0.0:1.0:0.0:0.0	.	718;773;747;726;802;781;755;810	Q9UKE5-8;Q9UKE5-6;Q9UKE5-7;Q9UKE5-5;Q9UKE5-4;Q9UKE5-2;Q9UKE5-3;Q9UKE5	.;.;.;.;.;.;.;TNIK_HUMAN	Q	810;788;762;726;802;718;781;747;755;773	ENSP00000399511:E810Q;ENSP00000358332:E788Q;ENSP00000443278:E762Q;ENSP00000345352:E726Q;ENSP00000284483:E802Q;ENSP00000418156:E718Q;ENSP00000349880:E781Q;ENSP00000418916:E747Q;ENSP00000418378:E755Q;ENSP00000419990:E773Q	ENSP00000284483:E802Q	E	-	1	0	TNIK	172302095	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.291000	0.78721	2.857000	0.98124	0.650000	0.86243	GAA	TNIK	-	NULL	ENSG00000154310		0.453	TNIK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNIK	HGNC	protein_coding	OTTHUMT00000352973.2	80	0.00	0	C	XM_039796		170819401	170819401	-1	no_errors	ENST00000436636	ensembl	human	known	69_37n	missense	64	27.27	24	SNP	1.000	G
TNXB	7148	genome.wustl.edu	37	6	32065108	32065108	+	Silent	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr6:32065108C>T	ENST00000479795.1	-	3	662	c.522G>A	c.(520-522)gaG>gaA	p.E174E	TNXB_ENST00000375244.3_Silent_p.E174E|TNXB_ENST00000375247.2_Silent_p.E174E			P22105	TENX_HUMAN	tenascin XB	174					actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						AGGGAGGGATCTCAGCATCTG	0.627																																						dbGAP											0													30.0	34.0	33.0					6																	32065108		2108	4216	6324	-	-	-	SO:0001819	synonymous_variant	0			X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000479795.1:c.522G>A	6.37:g.32065108C>T			P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Silent	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C,superfamily_Fibronectin_type3,smart_EGF-like,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.E174	ENST00000479795.1	37	c.522		6																																																																																			TNXB	-	NULL	ENSG00000168477		0.627	TNXB-007	PUTATIVE	basic|exp_conf	protein_coding	TNXB	HGNC	protein_coding	OTTHUMT00000357059.1	37	0.00	0	C	NM_019105		32065108	32065108	-1	no_errors	ENST00000375247	ensembl	human	known	69_37n	silent	35	18.60	8	SNP	0.000	T
TPR	7175	genome.wustl.edu	37	1	186321198	186321198	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr1:186321198C>A	ENST00000367478.4	-	19	2675	c.2379G>T	c.(2377-2379)ttG>ttT	p.L793F	TPR_ENST00000474852.1_5'UTR	NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	793					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		GAACTTCAGACAATTTAAGCA	0.338			T	NTRK1	papillary thyroid																																	dbGAP		Dom	yes		1	1q25	7175	translocated promoter region		E	0													126.0	119.0	121.0					1																	186321198		1816	4072	5888	-	-	-	SO:0001583	missense	0			U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.2379G>T	1.37:g.186321198C>A	ENSP00000356448:p.Leu793Phe		Q15655|Q5SWY0|Q99968	Missense_Mutation	SNP	pfam_TPR_MLP1_2,superfamily_Prefoldin,superfamily_tRNA-bd_arm	p.L793F	ENST00000367478.4	37	c.2379	CCDS41446.1	1	.	.	.	.	.	.	.	.	.	.	C	13.92	2.381599	0.42207	.	.	ENSG00000047410	ENST00000367478	T	0.22945	1.93	5.75	1.86	0.25419	.	0.196970	0.43579	D	0.000545	T	0.18718	0.0449	L	0.43152	1.355	0.34078	D	0.659216	P	0.43477	0.808	B	0.36719	0.231	T	0.28106	-1.0054	10	0.54805	T	0.06	.	9.7125	0.40254	0.0:0.7257:0.0:0.2743	.	793	P12270	TPR_HUMAN	F	793	ENSP00000356448:L793F	ENSP00000356448:L793F	L	-	3	2	TPR	184587821	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.995000	0.29706	0.371000	0.24564	0.563000	0.77884	TTG	TPR	-	NULL	ENSG00000047410		0.338	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPR	HGNC	protein_coding	OTTHUMT00000086353.2	42	0.00	0	C	NM_003292		186321198	186321198	-1	no_errors	ENST00000367478	ensembl	human	known	69_37n	missense	55	11.29	7	SNP	1.000	A
TRPC4AP	26133	genome.wustl.edu	37	20	33591329	33591329	+	Missense_Mutation	SNP	G	G	A	rs11552601		TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr20:33591329G>A	ENST00000252015.2	-	18	2229	c.2140C>T	c.(2140-2142)Cgg>Tgg	p.R714W	TRPC4AP_ENST00000539834.1_Missense_Mutation_p.R316W|TRPC4AP_ENST00000432634.2_Missense_Mutation_p.R675W|TRPC4AP_ENST00000451813.2_Missense_Mutation_p.R706W			Q8TEL6	TP4AP_HUMAN	transient receptor potential cation channel, subfamily C, member 4 associated protein	714					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|protein ubiquitination (GO:0016567)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process (GO:0006511)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|skin(1)|stomach(1)|urinary_tract(1)	32			BRCA - Breast invasive adenocarcinoma(18;0.00936)			TGCTCCATCCGCTGCAGCAGC	0.612																																						dbGAP											0													41.0	39.0	40.0					20																	33591329		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055022	CCDS13246.1, CCDS46591.1	20q11.23	2014-06-13	2003-10-06	2003-10-08	ENSG00000100991	ENSG00000100991			16181	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 158"""	608430	"""chromosome 20 open reading frame 188"""	C20orf188			Standard	NM_015638		Approved	DKFZP727M231, DKFZp586C1223, dJ756N5.2, TRRP4AP, PPP1R158	uc002xbk.3	Q8TEL6	OTTHUMG00000032319	ENST00000252015.2:c.2140C>T	20.37:g.33591329G>A	ENSP00000252015:p.Arg714Trp		E1P5Q0|E1P5Q1|Q96H82|Q9BVB8|Q9H429|Q9UFS6	Missense_Mutation	SNP	pfam_DUF3689	p.R714W	ENST00000252015.2	37	c.2140	CCDS13246.1	20	.	.	.	.	.	.	.	.	.	.	G	18.09	3.547318	0.65311	.	.	ENSG00000100991	ENST00000252015;ENST00000451813;ENST00000539834;ENST00000432634;ENST00000541994	.	.	.	4.62	2.51	0.30379	.	0.348081	0.31989	N	0.006755	T	0.35364	0.0929	N	0.14661	0.345	0.36335	D	0.859102	D;D;D	0.71674	0.998;0.97;0.984	P;P;P	0.51229	0.663;0.663;0.663	T	0.45131	-0.9282	9	0.72032	D	0.01	.	6.8581	0.24052	0.08:0.1194:0.666:0.1346	rs11552601	675;706;714	B4E0Q1;E1P5Q0;Q8TEL6	.;.;TP4AP_HUMAN	W	714;706;316;675;699	.	ENSP00000252015:R714W	R	-	1	2	TRPC4AP	33054990	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.731000	0.55013	1.154000	0.42482	0.462000	0.41574	CGG	TRPC4AP	-	pfam_DUF3689	ENSG00000100991		0.612	TRPC4AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC4AP	HGNC	protein_coding	OTTHUMT00000078832.2	93	0.00	0	G	NM_015638		33591329	33591329	-1	no_errors	ENST00000252015	ensembl	human	known	69_37n	missense	175	11.17	22	SNP	1.000	A
TSHZ2	128553	genome.wustl.edu	37	20	51872433	51872433	+	Silent	SNP	C	C	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr20:51872433C>A	ENST00000371497.5	+	2	3323	c.2436C>A	c.(2434-2436)tcC>tcA	p.S812S	RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000329613.6_Silent_p.S809S|TSHZ2_ENST00000603338.2_Silent_p.S809S	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	812					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			AGCCAGCCTCCTCCTCCAGGG	0.542																																						dbGAP											0													83.0	79.0	80.0					20																	51872433		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.2436C>A	20.37:g.51872433C>A			B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Silent	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Znf_C2H2	p.S812	ENST00000371497.5	37	c.2436	CCDS33490.1	20																																																																																			TSHZ2	-	NULL	ENSG00000182463		0.542	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ2	HGNC	protein_coding	OTTHUMT00000080398.6	19	0.00	0	C	NM_173485		51872433	51872433	+1	no_errors	ENST00000371497	ensembl	human	known	69_37n	silent	33	32.65	16	SNP	0.000	A
TSPAN11	441631	genome.wustl.edu	37	12	31135536	31135536	+	Missense_Mutation	SNP	G	G	A	rs202130566		TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr12:31135536G>A	ENST00000261177.9	+	6	585	c.526G>A	c.(526-528)Gag>Aag	p.E176K	TSPAN11_ENST00000535215.1_Missense_Mutation_p.E105K|TSPAN11_ENST00000544427.1_Missense_Mutation_p.E166K|TSPAN11_ENST00000546076.1_Missense_Mutation_p.E176K	NM_001080509.2	NP_001073978.1	A1L157	TSN11_HUMAN	tetraspanin 11	176						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)	11	all_lung(12;3.11e-10)|Lung NSC(12;5.24e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					GCGGGAGGCCGAGGGCCGCCA	0.647																																						dbGAP											0													25.0	27.0	26.0					12																	31135536		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS31765.1	12p11.21	2013-02-14				ENSG00000110900		"""Tetraspanins"""	30795	protein-coding gene	gene with protein product							Standard	NM_001080509		Approved		uc001rjp.3	A1L157		ENST00000261177.9:c.526G>A	12.37:g.31135536G>A	ENSP00000261177:p.Glu176Lys		A1L158|B2RUX6	Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.E176K	ENST00000261177.9	37	c.526	CCDS31765.1	12	.	.	.	.	.	.	.	.	.	.	G	5.189	0.220371	0.09863	.	.	ENSG00000110900	ENST00000546076;ENST00000535215;ENST00000544427;ENST00000261177	T;T;T;T	0.79454	-1.27;-1.27;-1.27;-1.27	4.01	-1.76	0.08006	Tetraspanin, EC2 domain (1);	0.917586	0.09014	N	0.861055	T	0.61426	0.2346	L	0.41356	1.27	0.22479	N	0.999069	B;B	0.23442	0.085;0.037	B;B	0.13407	0.009;0.009	T	0.41645	-0.9497	10	0.08837	T	0.75	.	6.3361	0.21296	0.1827:0.4152:0.4021:0.0	.	166;176	F5H0F0;A1L157	.;TSN11_HUMAN	K	176;105;166;176	ENSP00000437403:E176K;ENSP00000445503:E105K;ENSP00000439895:E166K;ENSP00000261177:E176K	ENSP00000261177:E176K	E	+	1	0	TSPAN11	31026803	0.751000	0.28327	0.713000	0.30519	0.265000	0.26407	-0.055000	0.11807	-0.937000	0.03719	-0.671000	0.03813	GAG	TSPAN11	-	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2	ENSG00000110900		0.647	TSPAN11-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TSPAN11	HGNC	protein_coding	OTTHUMT00000399888.1	38	0.00	0	G	XM_497334		31135536	31135536	+1	no_errors	ENST00000261177	ensembl	human	known	69_37n	missense	73	20.65	19	SNP	0.980	A
UBE2Q2P1	388165	genome.wustl.edu	37	15	85070737	85070738	+	RNA	INS	-	-	A	rs202234771|rs368120520|rs148315064	byFrequency	TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr15:85070737_85070738insA	ENST00000560239.1	-	0	0				UBE2Q2P1_ENST00000339094.1_RNA																							caaaacaaaacaaacaaaaAAC	0.386																																						dbGAP											0																																										-	-	-			0																															15.37:g.85070740_85070740dupA				RNA	INS	-	NULL	ENST00000560239.1	37	NULL		15																																																																																			UBE2Q2P1	-	-	ENSG00000189136		0.386	RP11-182J1.12-001	KNOWN	mRNA_end_NF|basic|readthrough_transcript	processed_transcript	UBE2Q2P1	HGNC	processed_transcript	OTTHUMT00000418581.1	10	0.00	0	-			85070737	85070738	-1	no_errors	ENST00000339094	ensembl	human	known	69_37n	rna	6	33.33	3	INS	0.007:0.009	A
UBN2	254048	genome.wustl.edu	37	7	138946214	138946214	+	Silent	SNP	G	G	C			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr7:138946214G>C	ENST00000473989.3	+	6	1122	c.1122G>C	c.(1120-1122)ctG>ctC	p.L374L	UBN2_ENST00000288561.8_Silent_p.L291L	NM_173569.3	NP_775840.3	Q6ZU65	UBN2_HUMAN	ubinuclein 2	374						extracellular space (GO:0005615)|nucleus (GO:0005634)				NS(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	42						ACTTAAATCTGAGCAGCGGTG	0.478																																						dbGAP											0													90.0	88.0	88.0					7																	138946214		1906	4116	6022	-	-	-	SO:0001819	synonymous_variant	0			AK098644	CCDS43655.1, CCDS43655.2	7q34	2008-12-08			ENSG00000157741	ENSG00000157741			21931	protein-coding gene	gene with protein product		613841				19029251	Standard	NM_173569		Approved	FLJ25778, KIAA2030	uc011kqr.2	Q6ZU65	OTTHUMG00000157623	ENST00000473989.3:c.1122G>C	7.37:g.138946214G>C			A4D1S2|Q2YDY4|Q6P1K0|Q86XN9|Q8N7D1	Nonstop_Mutation	SNP	NULL	p.*143S	ENST00000473989.3	37	c.428	CCDS43655.2	7	.	.	.	.	.	.	.	.	.	.	g	0.023	-1.400419	0.01165	.	.	ENSG00000157741	ENST00000483726	.	.	.	5.55	0.162	0.14981	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	.	.	.	.	.	.	.	-4.1155	8.4315	0.32761	0.0:0.227:0.2856:0.4874	.	.	.	.	S	143	.	.	X	+	2	2	UBN2	138596754	0.993000	0.37304	0.064000	0.19789	0.069000	0.16628	0.621000	0.24418	0.146000	0.19002	-1.792000	0.00626	TGA	UBN2	-	NULL	ENSG00000157741		0.478	UBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBN2	HGNC	protein_coding	OTTHUMT00000349272.3	24	0.00	0	G	NM_173569		138946214	138946214	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000483726	ensembl	human	putative	69_37n	nonstop	33	10.81	4	SNP	0.757	C
UCK1	83549	genome.wustl.edu	37	9	134404460	134404460	+	Intron	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr9:134404460C>T	ENST00000372215.4	-	5	602				UCK1_ENST00000372210.3_Intron|UCK1_ENST00000372208.3_Intron|UCK1_ENST00000372211.3_Intron|UCK1_ENST00000459858.1_5'UTR	NM_001261450.1|NM_001261451.1|NM_031432.2	NP_001248379.1|NP_001248380.1|NP_113620.1	Q9HA47	UCK1_HUMAN	uridine-cytidine kinase 1						CTP salvage (GO:0044211)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)	cytosol (GO:0005829)	ATP binding (GO:0005524)|nucleoside kinase activity (GO:0019206)|uridine kinase activity (GO:0004849)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|skin(1)|upper_aerodigestive_tract(1)	6				OV - Ovarian serous cystadenocarcinoma(145;2.34e-05)|Epithelial(140;0.000219)		CTTCAGACCTCAGGACCTGCC	0.677																																					Melanoma(42;523 1129 28385 43975 48113)	dbGAP											0													40.0	31.0	35.0					9																	134404460		2203	4299	6502	-	-	-	SO:0001627	intron_variant	0			AF237290	CCDS6944.1, CCDS48046.1, CCDS59151.1, CCDS59152.1	9q34.1	2008-02-05			ENSG00000130717	ENSG00000130717	2.7.1.48		14859	protein-coding gene	gene with protein product		609328				11306702	Standard	NM_031432		Approved	URK1, FLJ12255	uc031tfj.1	Q9HA47	OTTHUMG00000020823	ENST00000372215.4:c.509-35G>A	9.37:g.134404460C>T			Q5JT09|Q5JT10|Q5JT12|Q5JT13|Q6IA74|Q96BJ0	RNA	SNP	-	NULL	ENST00000372215.4	37	NULL	CCDS6944.1	9																																																																																			UCK1	-	-	ENSG00000130717		0.677	UCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UCK1	HGNC	protein_coding	OTTHUMT00000054726.1	47	0.00	0	C	NM_031432		134404460	134404460	-1	no_errors	ENST00000459858	ensembl	human	known	69_37n	rna	64	20.00	16	SNP	0.000	T
UGT1A9	54600	genome.wustl.edu	37	2	234581019	234581019	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr2:234581019C>T	ENST00000354728.4	+	1	521	c.439C>T	c.(439-441)Ctc>Ttc	p.L147F	UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A1_ENST00000609637.1_Missense_Mutation_p.L147F			O60656	UD19_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A9	147					cellular glucuronidation (GO:0052695)|cellular lipid metabolic process (GO:0044255)|drug metabolic process (GO:0017144)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|metabolic process (GO:0008152)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of fatty acid metabolic process (GO:0045922)|retinoic acid metabolic process (GO:0042573)|small molecule metabolic process (GO:0044281)|xenobiotic glucuronidation (GO:0052697)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)			breast(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	37		Breast(86;0.000766)|all_lung(227;0.00269)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0331)|Lung NSC(271;0.0459)|Lung SC(224;0.128)		Epithelial(121;1.26e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000436)|Lung(119;0.00347)|LUSC - Lung squamous cell carcinoma(224;0.00757)	Acetaminophen(DB00316)|Buprenorphine(DB00921)|Canagliflozin(DB08907)|Dabigatran etexilate(DB06695)|Dapagliflozin(DB06292)|Entacapone(DB00494)|Etodolac(DB00749)|Ezogabine(DB04953)|Flurbiprofen(DB00712)|Haloperidol(DB00502)|Human Serum Albumin(DB00062)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ketobemidone(DB06738)|Lumiracoxib(DB01283)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Nateglinide(DB00731)|Niflumic Acid(DB04552)|Oxazepam(DB00842)|Propofol(DB00818)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sulfamethoxazole(DB01015)|Tapentadol(DB06204)|Valproic Acid(DB00313)|Zileuton(DB00744)	TGCAGTGTTTCTCGATCCTTT	0.368																																						dbGAP											0													136.0	135.0	136.0					2																	234581019		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF056188	CCDS2505.1	2q37	2010-03-05	2005-07-20		ENSG00000241119	ENSG00000241119		"""UDP glucuronosyltransferases"""	12541	other	complex locus constituent		606434	"""UDP glycosyltransferase 1 family, polypeptide A9"""			9295054, 1910331	Standard	NM_021027		Approved	HLUGP4, LUGP4, UGT1AI		O60656	OTTHUMG00000059124	ENST00000354728.4:c.439C>T	2.37:g.234581019C>T	ENSP00000346768:p.Leu147Phe		B8K285|P36509|Q9HAX0	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.L147F	ENST00000354728.4	37	c.439	CCDS2505.1	2	.	.	.	.	.	.	.	.	.	.	C	11.67	1.707449	0.30322	.	.	ENSG00000241119	ENST00000354728	T	0.62105	0.05	3.41	1.47	0.22746	.	.	.	.	.	T	0.49304	0.1549	L	0.33792	1.035	0.23107	N	0.998286	B;B	0.28783	0.222;0.222	B;B	0.33196	0.159;0.159	T	0.49051	-0.8979	9	0.87932	D	0	.	5.5072	0.16860	0.5771:0.3107:0.0:0.1122	.	147;147	Q5DSZ5;O60656	.;UD19_HUMAN	F	147	ENSP00000346768:L147F	ENSP00000346768:L147F	L	+	1	0	UGT1A9	234245758	0.000000	0.05858	0.909000	0.35828	0.166000	0.22503	0.422000	0.21296	0.719000	0.32188	0.440000	0.28878	CTC	UGT1A9	-	pfam_UDP_glucos_trans	ENSG00000241119		0.368	UGT1A9-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	UGT1A9	HGNC	protein_coding	OTTHUMT00000130995.1	46	0.00	0	C	NM_021027		234581019	234581019	+1	no_errors	ENST00000354728	ensembl	human	known	69_37n	missense	42	19.23	10	SNP	0.762	T
UNC5B	219699	genome.wustl.edu	37	10	73046505	73046505	+	Silent	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr10:73046505C>T	ENST00000335350.6	+	5	1028	c.612C>T	c.(610-612)ctC>ctT	p.L204L	UNC5B_ENST00000373192.4_Silent_p.L204L	NM_170744.4	NP_734465.2	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B (C. elegans)	204	Ig-like C2-type.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(4)|skin(4)	49						ACTTCCTGCTCACCATCGACC	0.607																																						dbGAP											0													256.0	224.0	235.0					10																	73046505		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB096256	CCDS7309.1, CCDS58083.1	10q22.2	2013-01-11	2001-11-28		ENSG00000107731	ENSG00000107731		"""Immunoglobulin superfamily / I-set domain containing"""	12568	protein-coding gene	gene with protein product		607870	"""unc5 (C.elegans homolog) b"""				Standard	NM_170744		Approved	UNC5H2, p53RDL1	uc001jro.3	Q8IZJ1	OTTHUMG00000018422	ENST00000335350.6:c.612C>T	10.37:g.73046505C>T			Q5T3R9|Q5T3S0|Q86SN3|Q8N1Y2|Q9H9F3	Silent	SNP	pfam_ZU5,pfam_Ig_I-set,pfam_Death,pfam_Thrombospondin_1_rpt,superfamily_DEATH-like,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like	p.L204	ENST00000335350.6	37	c.612	CCDS7309.1	10																																																																																			UNC5B	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000107731		0.607	UNC5B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC5B	HGNC	protein_coding	OTTHUMT00000048541.1	46	0.00	0	C	NM_170744		73046505	73046505	+1	no_errors	ENST00000335350	ensembl	human	known	69_37n	silent	70	19.54	17	SNP	1.000	T
UQCR11	10975	genome.wustl.edu	37	19	1599413	1599413	+	3'UTR	SNP	G	G	A	rs1127697		TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr19:1599413G>A	ENST00000591899.3	-	0	268				UQCR11_ENST00000585671.1_3'UTR|UQCR11_ENST00000593029.1_5'UTR|UQCR11_ENST00000585937.1_3'UTR|UQCR11_ENST00000589880.1_3'UTR	NM_006830.3	NP_006821.1	O14957	QCR10_HUMAN	ubiquinol-cytochrome c reductase, complex III subunit XI						cellular metabolic process (GO:0044237)|generation of precursor metabolites and energy (GO:0006091)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain (GO:0070469)	electron carrier activity (GO:0009055)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(1)|lung(2)|ovary(1)|prostate(1)	5						AAACTTACCAGAGCAGTCTGT	0.567																																						dbGAP											0													77.0	71.0	73.0					19																	1599413		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			D55636	CCDS12073.1	19p13.3	2011-07-04	2010-01-26	2010-01-26	ENSG00000127540	ENSG00000127540		"""Mitochondrial respiratory chain complex / Complex III"""	30862	protein-coding gene	gene with protein product	"""complex III subunit 10"""	609711	"""ubiquinol-cytochrome c reductase, 6.4kDa subunit"""	UQCR		9161705	Standard	NM_006830		Approved	QCR10	uc002ltm.3	O14957		ENST00000591899.3:c.*26C>T	19.37:g.1599413G>A			B2R542|D6W5Z4|Q9UEA3|Q9UPK4	RNA	SNP	-	NULL	ENST00000591899.3	37	NULL	CCDS12073.1	19																																																																																			UQCR11	-	-	ENSG00000127540		0.567	UQCR11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UQCR11	HGNC	protein_coding	OTTHUMT00000449668.3	58	0.00	0	G	NM_006830		1599413	1599413	-1	no_errors	ENST00000593029	ensembl	human	known	69_37n	rna	127	18.06	28	SNP	0.000	A
WDR38	401551	genome.wustl.edu	37	9	127619046	127619046	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr9:127619046G>T	ENST00000373574.1	+	7	710	c.654G>T	c.(652-654)tgG>tgT	p.W218C		NM_001045476.1|NM_001276374.1	NP_001038941.1|NP_001263303.1	Q5JTN6	WDR38_HUMAN	WD repeat domain 38	218					hematopoietic progenitor cell differentiation (GO:0002244)					breast(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	8						TCCACATCTGGAAGCCCACAA	0.617																																						dbGAP											0													68.0	75.0	73.0					9																	127619046		2054	4184	6238	-	-	-	SO:0001583	missense	0				CCDS43876.1, CCDS75898.1, CCDS75899.1	9q33.3	2013-01-09			ENSG00000136918	ENSG00000136918		"""WD repeat domain containing"""	23745	protein-coding gene	gene with protein product							Standard	NM_001276375		Approved		uc011lzo.3	Q5JTN6	OTTHUMG00000020664	ENST00000373574.1:c.654G>T	9.37:g.127619046G>T	ENSP00000362677:p.Trp218Cys		A0PK24	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.W218C	ENST00000373574.1	37	c.654	CCDS43876.1	9	.	.	.	.	.	.	.	.	.	.	G	16.27	3.075846	0.55646	.	.	ENSG00000136918	ENST00000373574	D	0.83506	-1.73	4.82	3.9	0.45041	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.105272	0.42964	N	0.000631	D	0.89100	0.6619	H	0.96943	3.91	0.58432	D	0.999991	B;B;B;B	0.34161	0.439;0.215;0.215;0.215	B;B;B;B	0.37422	0.249;0.159;0.159;0.159	D	0.90326	0.4348	10	0.87932	D	0	.	12.7284	0.57185	0.0:0.1667:0.8333:0.0	.	218;218;207;218	B9EK65;B7ZW23;B7ZW24;Q5JTN6	.;.;.;WDR38_HUMAN	C	218	ENSP00000362677:W218C	ENSP00000362677:W218C	W	+	3	0	WDR38	126658867	1.000000	0.71417	1.000000	0.80357	0.790000	0.44656	5.655000	0.67981	1.224000	0.43551	0.561000	0.74099	TGG	WDR38	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000136918		0.617	WDR38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR38	HGNC	protein_coding	OTTHUMT00000054048.1	37	0.00	0	G	NM_001045476		127619046	127619046	+1	no_errors	ENST00000373574	ensembl	human	known	69_37n	missense	53	22.06	15	SNP	1.000	T
XIRP2	129446	genome.wustl.edu	37	2	168105391	168105391	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr2:168105391G>A	ENST00000409195.1	+	9	7578	c.7489G>A	c.(7489-7491)Gca>Aca	p.A2497T	XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.A2275T|XIRP2_ENST00000295237.9_Missense_Mutation_p.A2497T	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	2322					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TATTGACTCTGCAAACTGTCT	0.398																																						dbGAP											0													82.0	79.0	80.0					2																	168105391		1892	4111	6003	-	-	-	SO:0001583	missense	0			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.7489G>A	2.37:g.168105391G>A	ENSP00000386840:p.Ala2497Thr		A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	pfam_Actin-binding_Xin_repeat,superfamily_FH2_actin-bd	p.A2497T	ENST00000409195.1	37	c.7489	CCDS42769.1	2	.	.	.	.	.	.	.	.	.	.	G	0.287	-0.982220	0.02197	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.02631	4.23;4.23;4.22	5.52	-0.297	0.12820	.	1.235530	0.05395	N	0.539612	T	0.01454	0.0047	N	0.11560	0.145	0.09310	N	1	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.09377	0.001;0.001;0.004	T	0.46775	-0.9167	10	0.09590	T	0.72	0.0896	0.6708	0.00858	0.3468:0.1746:0.3045:0.1741	.	2322;2322;2275	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	T	2497;2497;2275	ENSP00000386840:A2497T;ENSP00000295237:A2497T;ENSP00000387255:A2275T	ENSP00000295237:A2497T	A	+	1	0	XIRP2	167813637	0.000000	0.05858	0.007000	0.13788	0.299000	0.27559	-0.324000	0.07986	-0.174000	0.10743	0.643000	0.83706	GCA	XIRP2	-	NULL	ENSG00000163092		0.398	XIRP2-001	KNOWN	basic|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333547.1	20	0.00	0	G	NM_152381		168105391	168105391	+1	no_errors	ENST00000295237	ensembl	human	known	69_37n	missense	16	20.00	4	SNP	0.008	A
ZBTB37	84614	genome.wustl.edu	37	1	173840037	173840037	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr1:173840037G>A	ENST00000367701.5	+	2	865	c.674G>A	c.(673-675)gGa>gAa	p.G225E	ZBTB37_ENST00000367704.1_Missense_Mutation_p.G225E|ZBTB37_ENST00000432989.1_Missense_Mutation_p.G225E|ZBTB37_ENST00000427304.1_Missense_Mutation_p.G225E|ZBTB37_ENST00000367702.1_Missense_Mutation_p.G225E			Q5TC79	ZBT37_HUMAN	zinc finger and BTB domain containing 37	225					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(4)	13						GTGGAGACAGGAGTGGCGGAC	0.527																																						dbGAP											0													65.0	69.0	68.0					1																	173840037		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK057310	CCDS1312.1, CCDS44278.1	1q24.2	2013-01-08			ENSG00000185278	ENSG00000185278		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	28365	protein-coding gene	gene with protein product						12477932	Standard	NM_032522		Approved	MGC2629, ZNF908	uc009wwp.1	Q5TC79	OTTHUMG00000037274	ENST00000367701.5:c.674G>A	1.37:g.173840037G>A	ENSP00000356674:p.Gly225Glu		Q5TC80|Q96M87|Q9BQ88	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.G225E	ENST00000367701.5	37	c.674	CCDS44278.1	1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.376095	0.82682	.	.	ENSG00000185278	ENST00000367704;ENST00000427304;ENST00000432989;ENST00000367702;ENST00000367703;ENST00000367701	T;T;T;T;T	0.79554	-1.25;2.59;-1.28;-1.28;2.59	5.9	5.9	0.94986	.	0.094349	0.64402	D	0.000001	T	0.75910	0.3914	L	0.27053	0.805	0.58432	D	0.999999	P;D	0.76494	0.816;0.999	B;D	0.72075	0.177;0.976	T	0.70360	-0.4893	10	0.02654	T	1	.	20.2723	0.98479	0.0:0.0:1.0:0.0	.	225;225	Q5TC79;Q5TC79-2	ZBT37_HUMAN;.	E	225;225;225;225;133;225	ENSP00000356677:G225E;ENSP00000415293:G225E;ENSP00000409408:G225E;ENSP00000356675:G225E;ENSP00000356674:G225E	ENSP00000356674:G225E	G	+	2	0	ZBTB37	172106660	1.000000	0.71417	0.942000	0.38095	0.995000	0.86356	7.598000	0.82745	2.793000	0.96121	0.563000	0.77884	GGA	ZBTB37	-	NULL	ENSG00000185278		0.527	ZBTB37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB37	HGNC	protein_coding	OTTHUMT00000090729.2	16	0.00	0	G	NM_032522		173840037	173840037	+1	no_errors	ENST00000367701	ensembl	human	known	69_37n	missense	26	18.75	6	SNP	0.990	A
ZC2HC1C	79696	genome.wustl.edu	37	14	75544334	75544334	+	3'UTR	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr14:75544334G>A	ENST00000524913.1	+	0	1927				ZC2HC1C_ENST00000439583.2_3'UTR|ZC2HC1C_ENST00000238686.8_3'UTR|ZC2HC1C_ENST00000526748.1_3'UTR	NM_024643.2	NP_078919.2	Q53FD0	ZC21C_HUMAN	zinc finger, C2HC-type containing 1C								metal ion binding (GO:0046872)										TGCCAAAGGTGGAAACTGTTC	0.527																																						dbGAP											0													41.0	39.0	40.0					14																	75544334		692	1591	2283	-	-	-	SO:0001624	3_prime_UTR_variant	0			AK026746	CCDS41972.1, CCDS45138.1	14q24.3	2013-01-10	2012-02-03	2012-02-03	ENSG00000119703	ENSG00000119703		"""Zinc fingers, C2HC-type containing"""	20354	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 140"", ""family with sequence similarity 164, member C"""	C14orf140, FAM164C			Standard	XM_005268062		Approved		uc001xrh.3	Q53FD0	OTTHUMG00000167439	ENST00000524913.1:c.*67G>A	14.37:g.75544334G>A			E9PJQ0|Q9BTA8|Q9H5S9	RNA	SNP	-	NULL	ENST00000524913.1	37	NULL	CCDS41972.1	14																																																																																			ZC2HC1C	-	-	ENSG00000119703		0.527	ZC2HC1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC2HC1C	HGNC	protein_coding	OTTHUMT00000394616.4	32	0.00	0	G	NM_001042430		75544334	75544334	+1	no_errors	ENST00000526748	ensembl	human	putative	69_37n	rna	38	19.15	9	SNP	1.000	A
ZC3H7B	23264	genome.wustl.edu	37	22	41753373	41753373	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr22:41753373C>G	ENST00000352645.4	+	23	3131	c.2874C>G	c.(2872-2874)gaC>gaG	p.D958E	ZC3H7B_ENST00000351589.4_Missense_Mutation_p.D958E	NM_017590.4	NP_060060.3	Q9UGR2	Z3H7B_HUMAN	zinc finger CCCH-type containing 7B	974					viral process (GO:0016032)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						AGGACGGGGACCTTGCCGGTG	0.637																																						dbGAP											0													81.0	86.0	85.0					22																	41753373		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14013.1	22q13.2	2013-01-10		2005-08-09	ENSG00000100403	ENSG00000100403		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30869	protein-coding gene	gene with protein product						10470851, 11230166	Standard	NM_017590		Approved	RoXaN, FLJ13787, DKFZp434K0920, KIAA1031	uc003azw.4	Q9UGR2	OTTHUMG00000150969	ENST00000352645.4:c.2874C>G	22.37:g.41753373C>G	ENSP00000345793:p.Asp958Glu		A7YY88|B2RCA4|Q5TFX9|Q8TBT9|Q9H8B6|Q9UGQ9|Q9UGR0|Q9UGR1|Q9UK03|Q9UPW9	Missense_Mutation	SNP	pfam_Znf_CCCH,pfam_TPR-1,smart_TPR_repeat,smart_Znf_CCCH,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.D958E	ENST00000352645.4	37	c.2874	CCDS14013.1	22	.	.	.	.	.	.	.	.	.	.	C	14.15	2.448731	0.43531	.	.	ENSG00000100403	ENST00000352645;ENST00000351589	T;T	0.11604	2.76;2.76	4.49	1.05	0.20165	.	1.445860	0.04183	N	0.326835	T	0.06096	0.0158	N	0.08118	0	0.09310	N	1	B	0.24721	0.11	B	0.22152	0.038	T	0.36286	-0.9754	10	0.34782	T	0.22	-6.2014	5.0088	0.14302	0.0:0.6348:0.1707:0.1945	.	958	Q9UGR2-2	.	E	958	ENSP00000345793:D958E;ENSP00000263243:D958E	ENSP00000263243:D958E	D	+	3	2	ZC3H7B	40083319	0.000000	0.05858	0.001000	0.08648	0.039000	0.13416	0.202000	0.17295	0.214000	0.20742	0.313000	0.20887	GAC	ZC3H7B	-	NULL	ENSG00000100403		0.637	ZC3H7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H7B	HGNC	protein_coding	OTTHUMT00000320696.1	44	0.00	0	C	NM_017590		41753373	41753373	+1	no_errors	ENST00000351589	ensembl	human	known	69_37n	missense	57	26.92	21	SNP	0.002	G
ZC3HAV1	56829	genome.wustl.edu	37	7	138738312	138738312	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr7:138738312C>T	ENST00000242351.5	-	12	2650	c.2334G>A	c.(2332-2334)atG>atA	p.M778I	ZC3HAV1_ENST00000464606.1_Missense_Mutation_p.M900I	NM_020119.3	NP_064504.2	Q7Z2W4	ZCCHV_HUMAN	zinc finger CCCH-type, antiviral 1	778	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of mRNA catabolic process (GO:0061014)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(4)|skin(1)	37						CTTCTTCCTTCATCTGCGATT	0.388																																						dbGAP											0													139.0	138.0	139.0					7																	138738312		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX571742	CCDS5851.1, CCDS55171.1	7q34	2012-07-05			ENSG00000105939	ENSG00000105939		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	23721	protein-coding gene	gene with protein product	"""zinc finger antiviral protein"", "" CCCH-type zinc finger antiviral protein"""	607312				12215647, 12851707	Standard	NM_024625		Approved	ZAP, FLB6421, FLJ13288, MGC48898, ZC3HDC2, ZC3H2, PARP13	uc003vun.3	Q7Z2W4	OTTHUMG00000157471	ENST00000242351.5:c.2334G>A	7.37:g.138738312C>T	ENSP00000242351:p.Met778Ile		A4D1R2|A4D1S4|Q8IW57|Q8TAJ3|Q96N79|Q9H8R9|Q9P0Y7	Missense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_WWE-dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.M778I	ENST00000242351.5	37	c.2334	CCDS5851.1	7	.	.	.	.	.	.	.	.	.	.	C	21.6	4.177860	0.78564	.	.	ENSG00000105939	ENST00000242351;ENST00000464606	T;T	0.13657	2.57;2.57	5.06	5.06	0.68205	Poly(ADP-ribose) polymerase, catalytic domain (2);	0.000000	0.56097	D	0.000024	T	0.21921	0.0528	M	0.72118	2.19	0.80722	D	1	B	0.29531	0.247	B	0.35931	0.214	T	0.02053	-1.1222	10	0.54805	T	0.06	.	14.306	0.66384	0.0:1.0:0.0:0.0	.	778	Q7Z2W4	ZCCHV_HUMAN	I	778;900	ENSP00000242351:M778I;ENSP00000418385:M900I	ENSP00000242351:M778I	M	-	3	0	ZC3HAV1	138388852	0.469000	0.25846	0.506000	0.27664	0.023000	0.10783	2.286000	0.43496	2.496000	0.84212	0.563000	0.77884	ATG	ZC3HAV1	-	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	ENSG00000105939		0.388	ZC3HAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3HAV1	HGNC	protein_coding	OTTHUMT00000348915.1	40	0.00	0	C	NM_020119		138738312	138738312	-1	no_errors	ENST00000242351	ensembl	human	known	69_37n	missense	44	16.98	9	SNP	0.991	T
ZNF292	23036	genome.wustl.edu	37	6	87964456	87964456	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr6:87964456C>T	ENST00000369577.3	+	8	1152	c.1109C>T	c.(1108-1110)tCt>tTt	p.S370F	ZNF292_ENST00000339907.4_Missense_Mutation_p.S365F	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	370						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		GTGAAAATATCTATTTGCAAG	0.403																																						dbGAP											0													135.0	129.0	131.0					6																	87964456		1870	4111	5981	-	-	-	SO:0001583	missense	0			AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.1109C>T	6.37:g.87964456C>T	ENSP00000358590:p.Ser370Phe		Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S370F	ENST00000369577.3	37	c.1109	CCDS47457.1	6	.	.	.	.	.	.	.	.	.	.	C	18.66	3.671777	0.67928	.	.	ENSG00000188994	ENST00000369577;ENST00000339907	T;T	0.44482	0.92;0.92	5.92	5.92	0.95590	.	0.048954	0.85682	D	0.000000	T	0.56949	0.2020	L	0.54323	1.7	0.51482	D	0.999925	D	0.89917	1.0	D	0.80764	0.994	T	0.57148	-0.7861	10	0.87932	D	0	.	20.3172	0.98658	0.0:1.0:0.0:0.0	.	370	O60281	ZN292_HUMAN	F	370;365	ENSP00000358590:S370F;ENSP00000342847:S365F	ENSP00000342847:S365F	S	+	2	0	ZNF292	88021175	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	2.801000	0.96364	0.650000	0.86243	TCT	ZNF292	-	NULL	ENSG00000188994		0.403	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF292	HGNC	protein_coding	OTTHUMT00000376192.2	22	0.00	0	C	NM_015021		87964456	87964456	+1	no_errors	ENST00000369577	ensembl	human	known	69_37n	missense	34	19.05	8	SNP	1.000	T
ZNF479	90827	genome.wustl.edu	37	7	57188761	57188761	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr7:57188761C>T	ENST00000331162.4	-	5	631	c.361G>A	c.(361-363)Gag>Aag	p.E121K		NM_033273.1	NP_150376.1	Q96JC4	ZN479_HUMAN	zinc finger protein 479	121					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(53)|ovary(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	84			GBM - Glioblastoma multiforme(1;9.18e-12)			TGTAATTTCTCATGTCCACAT	0.388																																						dbGAP											0													67.0	62.0	63.0					7																	57188761		1826	4076	5902	-	-	-	SO:0001583	missense	0			AF277624	CCDS43590.1	7p11.2	2013-01-08			ENSG00000185177	ENSG00000185177		"""Zinc fingers, C2H2-type"", ""-"""	23258	protein-coding gene	gene with protein product						11410164	Standard	NM_033273		Approved	KR19	uc010kzo.3	Q96JC4	OTTHUMG00000156682	ENST00000331162.4:c.361G>A	7.37:g.57188761C>T	ENSP00000333776:p.Glu121Lys			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E121K	ENST00000331162.4	37	c.361	CCDS43590.1	7	.	.	.	.	.	.	.	.	.	.	c	6.306	0.424613	0.11928	.	.	ENSG00000185177	ENST00000331162	T	0.06608	3.28	1.6	-1.08	0.09936	.	.	.	.	.	T	0.04634	0.0126	L	0.50333	1.59	0.09310	N	1	P	0.35745	0.518	B	0.30401	0.115	T	0.37291	-0.9712	9	0.28530	T	0.3	.	1.7129	0.02896	0.3316:0.4183:0.0:0.2501	.	121	Q96JC4	ZN479_HUMAN	K	121	ENSP00000333776:E121K	ENSP00000333776:E121K	E	-	1	0	ZNF479	57192703	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	-0.264000	0.08658	-0.067000	0.12976	0.400000	0.26472	GAG	ZNF479	-	NULL	ENSG00000185177		0.388	ZNF479-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF479	HGNC	protein_coding	OTTHUMT00000345302.1	60	0.00	0	C	XM_291202		57188761	57188761	-1	no_errors	ENST00000331162	ensembl	human	known	69_37n	missense	79	12.22	11	SNP	0.000	T
ZNF467	168544	genome.wustl.edu	37	7	149461947	149461947	+	Silent	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr7:149461947G>A	ENST00000302017.3	-	5	2057	c.1644C>T	c.(1642-1644)tgC>tgT	p.C548C	ZNF467_ENST00000484747.1_Intron	NM_207336.1	NP_997219.1	Q7Z7K2	ZN467_HUMAN	zinc finger protein 467	548					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(2)|liver(1)|lung(7)|urinary_tract(1)	13	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			AGCTCTTTCCGCACTGCGGGC	0.701																																						dbGAP											0													32.0	38.0	36.0					7																	149461947		2177	4291	6468	-	-	-	SO:0001819	synonymous_variant	0			BC029296	CCDS5899.1	7q36.1	2013-01-08			ENSG00000181444	ENSG00000181444		"""Zinc fingers, C2H2-type"""	23154	protein-coding gene	gene with protein product		614040				12426389	Standard	NM_207336		Approved	EZI, Zfp467	uc003wgd.2	Q7Z7K2	OTTHUMG00000157883	ENST00000302017.3:c.1644C>T	7.37:g.149461947G>A				Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.C548	ENST00000302017.3	37	c.1644	CCDS5899.1	7																																																																																			ZNF467	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000181444		0.701	ZNF467-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF467	HGNC	protein_coding	OTTHUMT00000349833.1	50	0.00	0	G	NM_207336		149461947	149461947	-1	no_errors	ENST00000302017	ensembl	human	known	69_37n	silent	63	42.73	47	SNP	0.999	A
ZNF595	152687	genome.wustl.edu	37	4	87197	87197	+	3'UTR	SNP	C	C	T			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr4:87197C>T	ENST00000339368.6	+	0	2006							Q8IYB9	ZN595_HUMAN	zinc finger protein 595						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)	20		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		GCAAAGCCTTCAATTGGTCCT	0.393																																						dbGAP											0													38.0	41.0	40.0					4																	87197		2147	4271	6418	-	-	-	SO:0001624	3_prime_UTR_variant	0			BX537887	CCDS75075.1, CCDS75076.1, CCDS75077.1	4p16.3	2013-01-08				ENSG00000272602		"""Zinc fingers, C2H2-type"", ""-"""	27196	protein-coding gene	gene with protein product						12477932	Standard	NM_182524		Approved	FLJ31740		Q8IYB9		ENST00000339368.6:c.*2003C>T	4.37:g.87197C>T				RNA	SNP	-	NULL	ENST00000339368.6	37	NULL		4																																																																																			ZNF595	-	-	ENSG00000197701		0.393	ZNF595-001	KNOWN	basic	processed_transcript	ZNF595	HGNC	protein_coding	OTTHUMT00000357814.2	50	0.00	0	C	NM_182524		87197	87197	+1	no_errors	ENST00000339368	ensembl	human	known	69_37n	rna	40	29.82	17	SNP	0.859	T
ZNF518B	85460	genome.wustl.edu	37	4	10445844	10445844	+	Silent	SNP	G	G	T	rs147795710		TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr4:10445844G>T	ENST00000326756.3	-	3	2547	c.2109C>A	c.(2107-2109)acC>acA	p.T703T		NM_053042.2	NP_444270.2	Q9C0D4	Z518B_HUMAN	zinc finger protein 518B	703					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	42						TACCTTCAGAGGTAGCTTTTG	0.458																																						dbGAP											0													99.0	99.0	99.0					4																	10445844		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB051516	CCDS33960.1	4p16.1	2007-12-07				ENSG00000178163		"""Zinc fingers, C2H2-type"""	29365	protein-coding gene	gene with protein product						11214970	Standard	XM_005248193		Approved	KIAA1729	uc003gmn.3	Q9C0D4		ENST00000326756.3:c.2109C>A	4.37:g.10445844G>T			Q96LN8	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T703	ENST00000326756.3	37	c.2109	CCDS33960.1	4																																																																																			ZNF518B	-	NULL	ENSG00000178163		0.458	ZNF518B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF518B	HGNC	protein_coding	OTTHUMT00000359040.1	23	0.00	0	G	NM_053042		10445844	10445844	-1	no_errors	ENST00000326756	ensembl	human	known	69_37n	silent	26	13.33	4	SNP	0.000	T
ZNF598	90850	genome.wustl.edu	37	16	2052577	2052577	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr16:2052577G>A	ENST00000563630.1	-	4	699	c.457C>T	c.(457-459)Cgc>Tgc	p.R153C	ZNF598_ENST00000431526.1_Missense_Mutation_p.R208C|ZNF598_ENST00000562103.1_Missense_Mutation_p.R153C			Q86UK7	ZN598_HUMAN	zinc finger protein 598	208							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						TAGTGGTCGCGGCGCAGGTGC	0.642																																						dbGAP											0													61.0	67.0	65.0					16																	2052577		2158	4261	6419	-	-	-	SO:0001583	missense	0			BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000563630.1:c.457C>T	16.37:g.2052577G>A	ENSP00000455882:p.Arg153Cys		Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Missense_Mutation	SNP	superfamily_PAH,smart_Znf_C2H2-like,pfscan_Znf_RING	p.R208C	ENST00000563630.1	37	c.622		16	.	.	.	.	.	.	.	.	.	.	.	14.27	2.485033	0.44147	.	.	ENSG00000167962	ENST00000431526	T	0.33216	1.42	4.98	3.92	0.45320	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	T	0.51466	0.1676	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.55438	-0.8141	10	0.72032	D	0.01	-14.8	14.0269	0.64590	0.0:0.0:0.7591:0.2409	.	208	Q86UK7	ZN598_HUMAN	C	208	ENSP00000411409:R208C	ENSP00000411409:R208C	R	-	1	0	ZNF598	1992578	0.995000	0.38212	0.958000	0.39756	0.993000	0.82548	1.998000	0.40796	2.310000	0.77875	0.561000	0.74099	CGC	ZNF598	-	smart_Znf_C2H2-like	ENSG00000167962		0.642	ZNF598-001	NOVEL	basic	protein_coding	ZNF598	HGNC	protein_coding	OTTHUMT00000434439.1	35	0.00	0	G	NM_178167		2052577	2052577	-1	no_errors	ENST00000431526	ensembl	human	known	69_37n	missense	68	20.00	17	SNP	0.811	A
ZNF689	115509	genome.wustl.edu	37	16	30615847	30615847	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr16:30615847G>A	ENST00000287461.3	-	3	1578	c.1241C>T	c.(1240-1242)tCa>tTa	p.S414L	RP11-146F11.5_ENST00000563540.1_RNA|ZNF689_ENST00000566673.1_5'Flank	NM_138447.1	NP_612456.1	Q96CS4	ZN689_HUMAN	zinc finger protein 689	414					regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|prostate(1)|urinary_tract(1)	14			Colorectal(24;0.198)			GGCCAGCAGTGAGGGGTAGGC	0.682																																						dbGAP											0													13.0	13.0	13.0					16																	30615847		2190	4294	6484	-	-	-	SO:0001583	missense	0			BC014000	CCDS10686.1	16p11.2	2013-01-08			ENSG00000156853	ENSG00000156853		"""Zinc fingers, C2H2-type"", ""-"""	25173	protein-coding gene	gene with protein product							Standard	NM_138447		Approved	FLJ90415	uc031qvq.1	Q96CS4	OTTHUMG00000132415	ENST00000287461.3:c.1241C>T	16.37:g.30615847G>A	ENSP00000287461:p.Ser414Leu		Q658J5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S414L	ENST00000287461.3	37	c.1241	CCDS10686.1	16	.	.	.	.	.	.	.	.	.	.	g	17.27	3.346054	0.61073	.	.	ENSG00000156853	ENST00000287461;ENST00000443190	T	0.06687	3.27	5.28	5.28	0.74379	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.42053	D	0.000768	T	0.32255	0.0823	M	0.82433	2.59	0.38031	D	0.935174	D	0.57899	0.981	D	0.69824	0.966	T	0.10965	-1.0607	10	0.62326	D	0.03	-8.9799	16.4488	0.83973	0.0:0.0:1.0:0.0	.	414	Q96CS4	ZN689_HUMAN	L	414	ENSP00000287461:S414L	ENSP00000287461:S414L	S	-	2	0	ZNF689	30523348	0.002000	0.14202	0.775000	0.31657	0.441000	0.31987	1.311000	0.33562	2.752000	0.94435	0.555000	0.69702	TCA	ZNF689	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000156853		0.682	ZNF689-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF689	HGNC	protein_coding	OTTHUMT00000255552.1	30	0.00	0	G	NM_138447		30615847	30615847	-1	no_errors	ENST00000287461	ensembl	human	known	69_37n	missense	52	13.33	8	SNP	0.879	A
ZNF716	441234	genome.wustl.edu	37	7	57529366	57529366	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr7:57529366G>A	ENST00000420713.1	+	4	1311	c.1199G>A	c.(1198-1200)aGa>aAa	p.R400K		NM_001159279.1	NP_001152751.1	A6NP11	ZN716_HUMAN	zinc finger protein 716	400					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(1)|lung(20)|ovary(2)	24						TACCACAAGAGAACTCATACT	0.403																																						dbGAP											0													28.0	29.0	29.0					7																	57529366		692	1591	2283	-	-	-	SO:0001583	missense	0			AK131575	CCDS55112.1	7p11.1	2013-01-08			ENSG00000182111	ENSG00000182111		"""Zinc fingers, C2H2-type"", ""-"""	32458	protein-coding gene	gene with protein product							Standard	NM_001159279		Approved	FLJ46189	uc011kdi.1	A6NP11	OTTHUMG00000156689	ENST00000420713.1:c.1199G>A	7.37:g.57529366G>A	ENSP00000394248:p.Arg400Lys			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R400K	ENST00000420713.1	37	c.1199	CCDS55112.1	7	.	.	.	.	.	.	.	.	.	.	G	13.92	2.381296	0.42207	.	.	ENSG00000182111	ENST00000420713;ENST00000418732	T	0.02197	4.4	0.195	0.195	0.15151	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02156	0.0067	L	0.31664	0.95	0.29371	N	0.863962	P	0.52061	0.95	P	0.44772	0.46	T	0.49331	-0.8951	9	0.33141	T	0.24	.	6.2336	0.20750	3.0E-4:0.0:0.9997:0.0	.	388	A6NP11	ZN716_HUMAN	K	400;388	ENSP00000394248:R400K	ENSP00000387687:R388K	R	+	2	0	ZNF716	57533308	0.001000	0.12720	0.038000	0.18304	0.038000	0.13279	0.933000	0.28897	0.300000	0.22699	0.306000	0.20318	AGA	ZNF716	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000182111		0.403	ZNF716-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF716	HGNC	protein_coding	OTTHUMT00000345309.1	14	0.00	0	G	NM_001159279		57529366	57529366	+1	no_errors	ENST00000420713	ensembl	human	known	69_37n	missense	23	17.86	5	SNP	1.000	A
ZNF800	168850	genome.wustl.edu	37	7	127014569	127014569	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A3M7-01A-12D-A21Q-09	TCGA-C8-A3M7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1cbe3a4c-23ef-45a3-a01c-59ba13f053e4	d04ce8a0-807d-478f-adae-56fdef6c1ecc	g.chr7:127014569G>A	ENST00000393313.1	-	5	1412	c.821C>T	c.(820-822)tCt>tTt	p.S274F	ZNF800_ENST00000265827.3_Missense_Mutation_p.S274F|ZNF800_ENST00000485577.1_5'Flank|ZNF800_ENST00000393312.1_Missense_Mutation_p.S274F			Q2TB10	ZN800_HUMAN	zinc finger protein 800	274					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(8)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	32						GCGTCCTTTAGAGGATTGGTT	0.373																																						dbGAP											0													247.0	233.0	238.0					7																	127014569		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF218032	CCDS5795.1	7q31.33	2008-05-02			ENSG00000048405	ENSG00000048405		"""Zinc fingers, C2H2-type"""	27267	protein-coding gene	gene with protein product						12477932	Standard	NM_176814		Approved		uc003vly.1	Q2TB10	OTTHUMG00000023456	ENST00000393313.1:c.821C>T	7.37:g.127014569G>A	ENSP00000376989:p.Ser274Phe		Q9HBN0	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S274F	ENST00000393313.1	37	c.821	CCDS5795.1	7	.	.	.	.	.	.	.	.	.	.	G	10.86	1.470630	0.26423	.	.	ENSG00000048405	ENST00000393313;ENST00000265827;ENST00000393312	T;T;T	0.16743	2.32;2.32;2.32	5.41	5.41	0.78517	.	0.379952	0.29233	N	0.012750	T	0.11922	0.0290	N	0.14661	0.345	0.30185	N	0.800054	P;P	0.39964	0.697;0.697	B;B	0.38562	0.276;0.276	T	0.26467	-1.0102	8	.	.	.	-7.031	16.3668	0.83335	0.0:0.0:1.0:0.0	.	177;274	B7Z4V7;Q2TB10	.;ZN800_HUMAN	F	274	ENSP00000376989:S274F;ENSP00000265827:S274F;ENSP00000376988:S274F	.	S	-	2	0	ZNF800	126801805	1.000000	0.71417	0.893000	0.35052	0.887000	0.51463	4.596000	0.61055	2.536000	0.85505	0.650000	0.86243	TCT	ZNF800	-	NULL	ENSG00000048405		0.373	ZNF800-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	ZNF800	HGNC	protein_coding	OTTHUMT00000141823.1	38	0.00	0	G	NM_176814		127014569	127014569	-1	no_errors	ENST00000265827	ensembl	human	known	69_37n	missense	71	12.35	10	SNP	1.000	A
