#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACTG1	71	genome.wustl.edu	37	17	79478289	79478289	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A146-01A-31D-A10Y-09	TCGA-D8-A146-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9a7548dc-fc79-4ad4-a324-0e9f63c91a20	6d63e128-669b-4ac6-b2d3-10f6d7cf82d1	g.chr17:79478289G>C	ENST00000575842.1	-	3	1153	c.727C>G	c.(727-729)Ccc>Gcc	p.P243A	ACTG1_ENST00000331925.2_Missense_Mutation_p.P243A|AC139149.1_ENST00000584254.1_RNA|ACTG1_ENST00000575087.1_Missense_Mutation_p.P243A|ACTG1_ENST00000573283.1_Missense_Mutation_p.P243A|RP13-766D20.2_ENST00000430912.1_RNA			P63261	ACTG_HUMAN	actin, gamma 1	243			P -> L (in dbSNP:rs11546899).		adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|lung(8)|ovary(2)|prostate(5)|urinary_tract(1)	29	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0547)			TGGCCATCGGGCAGCTCGTAG	0.597																																						dbGAP											0													60.0	64.0	62.0					17																	79478289		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS11782.1	17q25	2010-04-23	2004-05-19		ENSG00000184009	ENSG00000184009			144	protein-coding gene	gene with protein product		102560	"""deafness, autosomal dominant 20; deafness, autosomal dominant 26"""	ACTG, DFNA20, DFNA26		14684684	Standard	NM_001614		Approved		uc002kal.2	P63261		ENST00000575842.1:c.727C>G	17.37:g.79478289G>C	ENSP00000458162:p.Pro243Ala		A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Missense_Mutation	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.P243A	ENST00000575842.1	37	c.727	CCDS11782.1	17	.	.	.	.	.	.	.	.	.	.	g	12.96	2.095033	0.36952	.	.	ENSG00000184009	ENST00000331925;ENST00000447294	D	0.99711	-6.49	4.56	2.52	0.30459	.	0.000000	0.64402	D	0.000001	D	0.99809	0.9917	H	0.99104	4.43	0.48571	D	0.999675	P	0.50369	0.934	D	0.69142	0.962	D	0.97969	1.0342	10	0.87932	D	0	.	8.1022	0.30863	0.0855:0.0:0.757:0.1575	.	243	P63261	ACTG_HUMAN	A	243;201	ENSP00000331514:P243A	ENSP00000331514:P243A	P	-	1	0	ACTG1	77092884	1.000000	0.71417	0.902000	0.35471	0.493000	0.33554	9.315000	0.96313	0.369000	0.24510	0.553000	0.69018	CCC	ACTG1	-	pfam_Actin-like,smart_Actin-like,prints_Actin-like	ENSG00000184009		0.597	ACTG1-012	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ACTG1	HGNC	protein_coding	OTTHUMT00000439935.2	25	0.00	0	G	NM_001614		79478289	79478289	-1	no_errors	ENST00000331925	ensembl	human	known	69_37n	missense	56	21.92	16	SNP	1.000	C
C17orf62	79415	genome.wustl.edu	37	17	80401964	80401964	+	Silent	SNP	G	G	A			TCGA-D8-A146-01A-31D-A10Y-09	TCGA-D8-A146-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9a7548dc-fc79-4ad4-a324-0e9f63c91a20	6d63e128-669b-4ac6-b2d3-10f6d7cf82d1	g.chr17:80401964G>A	ENST00000437807.2	-	8	797	c.480C>T	c.(478-480)ttC>ttT	p.F160F	C17orf62_ENST00000585080.1_Silent_p.F160F|C17orf62_ENST00000583617.1_Intron|C17orf62_ENST00000585064.1_Silent_p.F160F|C17orf62_ENST00000342572.8_Silent_p.F36F|C17orf62_ENST00000583359.1_5'Flank|C17orf62_ENST00000306645.5_Silent_p.F160F|C17orf62_ENST00000336995.7_Missense_Mutation_p.S12F|C17orf62_ENST00000578919.1_Silent_p.F160F|C17orf62_ENST00000577732.1_Silent_p.F160F|C17orf62_ENST00000434650.2_Silent_p.F146F|C17orf62_ENST00000577436.1_Silent_p.F146F	NM_001193653.1|NM_001193657.1	NP_001180582.1|NP_001180586.1	Q9BQA9	CQ062_HUMAN	chromosome 17 open reading frame 62	160						integral component of membrane (GO:0016021)				breast(2)|large_intestine(2)|skin(2)|urinary_tract(2)	8	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			GCAGCTCCAGGAAGCTGGTGA	0.637																																						dbGAP											0													100.0	88.0	92.0					17																	80401964		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK074950	CCDS32776.1, CCDS45817.1	17q25.3	2014-06-09			ENSG00000178927	ENSG00000178927			28672	protein-coding gene	gene with protein product							Standard	NM_001100407		Approved	MGC4368, FLJ90469	uc021ufr.1	Q9BQA9		ENST00000437807.2:c.480C>T	17.37:g.80401964G>A			E1B6X3|Q96NR1	Missense_Mutation	SNP	NULL	p.S12F	ENST00000437807.2	37	c.35	CCDS32776.1	17	.	.	.	.	.	.	.	.	.	.	G	15.27	2.784694	0.49997	.	.	ENSG00000178927	ENST00000342572;ENST00000536759;ENST00000336995	.	.	.	4.98	4.0	0.46444	.	.	.	.	.	T	0.57242	0.2040	.	.	.	0.26074	N	0.981172	D	0.89917	1.0	D	0.91635	0.999	T	0.45041	-0.9288	6	.	.	.	.	7.2579	0.26187	0.2577:0.0:0.7423:0.0	.	50	Q8NEZ9	.	F	50;17;12	.	.	S	-	2	0	C17orf62	77995253	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	1.174000	0.31932	2.317000	0.78254	0.561000	0.74099	TCC	C17orf62	-	NULL	ENSG00000178927		0.637	C17orf62-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C17orf62	HGNC	protein_coding	OTTHUMT00000443260.1	58	0.00	0	G	NM_001033046		80401964	80401964	-1	no_errors	ENST00000336995	ensembl	human	known	69_37n	missense	44	32.31	21	SNP	1.000	A
CELF1	10658	genome.wustl.edu	37	11	47498507	47498507	+	Splice_Site	SNP	C	C	A			TCGA-D8-A146-01A-31D-A10Y-09	TCGA-D8-A146-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9a7548dc-fc79-4ad4-a324-0e9f63c91a20	6d63e128-669b-4ac6-b2d3-10f6d7cf82d1	g.chr11:47498507C>A	ENST00000358597.3	-	9	893	c.894G>T	c.(892-894)ggG>ggT	p.G298G	CELF1_ENST00000310513.5_Splice_Site_p.G294G|CELF1_ENST00000361904.3_Silent_p.G295G|CELF1_ENST00000532048.1_Splice_Site_p.G324G|CELF1_ENST00000395292.2_Silent_p.G295G|CELF1_ENST00000531165.1_Silent_p.G326G|CELF1_ENST00000539455.1_5'Flank|CELF1_ENST00000395290.2_Splice_Site_p.G297G			Q92879	CELF1_HUMAN	CUGBP, Elav-like family member 1	298	Ser-rich.				embryo development (GO:0009790)|germ cell development (GO:0007281)|mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|negative regulation of translation (GO:0017148)|positive regulation of multicellular organism growth (GO:0040018)|regulation of RNA splicing (GO:0043484)|RNA interference (GO:0016246)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	BRE binding (GO:0042835)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation repressor activity, nucleic acid binding (GO:0000900)			central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|ovary(2)	18						TAGGTGAGGACCCTGCTATTA	0.458																																					Pancreas(163;1949 1966 9906 43218 43785)	dbGAP											0													88.0	85.0	86.0					11																	47498507		2201	4298	6499	-	-	-	SO:0001630	splice_region_variant	0			U63289	CCDS7938.1, CCDS7939.1, CCDS31482.1, CCDS53622.1, CCDS53623.1	11p11	2013-02-12	2010-02-19	2010-02-19				"""RNA binding motif (RRM) containing"""	2549	protein-coding gene	gene with protein product	"""CUG RNA-binding protein"", ""nuclear polyadenylated RNA-binding protein, 50-kD"", ""bruno-like 2"", ""embryo deadenylation element binding protein"""	601074	"""CUG triplet repeat, RNA-binding protein 1"", ""CUG triplet repeat, RNA binding protein 1"""	CUGBP1		8948631, 9371827	Standard	NM_006560		Approved	CUG-BP, hNab50, BRUNOL2, NAB50, CUGBP, NAPOR, EDEN-BP	uc001nfl.3	Q92879		ENST00000358597.3:c.893-1G>T	11.37:g.47498507C>A			B4E2U5|D3DQS0|F8W940|Q4LE52|Q9NP83|Q9NR06	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.G324	ENST00000358597.3	37	c.972	CCDS31482.1	11																																																																																			CELF1	-	NULL	ENSG00000149187		0.458	CELF1-024	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CELF1	HGNC	protein_coding	OTTHUMT00000398352.1	122	0.00	0	C	NM_006560	Silent	47498507	47498507	-1	no_errors	ENST00000532048	ensembl	human	known	69_37n	silent	134	12.42	19	SNP	1.000	A
COG3	83548	genome.wustl.edu	37	13	46054421	46054421	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A146-01A-31D-A10Y-09	TCGA-D8-A146-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9a7548dc-fc79-4ad4-a324-0e9f63c91a20	6d63e128-669b-4ac6-b2d3-10f6d7cf82d1	g.chr13:46054421A>G	ENST00000349995.5	+	4	657	c.545A>G	c.(544-546)gAa>gGa	p.E182G		NM_031431.3	NP_113619	Q96JB2	COG3_HUMAN	component of oligomeric golgi complex 3	182					ER to Golgi vesicle-mediated transport (GO:0006888)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|skin(2)|stomach(1)	24		Lung NSC(96;0.000145)|Breast(56;0.000596)|Prostate(109;0.00438)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000124)		CTCCTAAAAGAACAGGTAATT	0.333																																					Ovarian(150;1048 1859 18083 21577 42700)	dbGAP											0													78.0	75.0	76.0					13																	46054421		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF131829	CCDS9398.1	13q14.11	2008-02-05			ENSG00000136152	ENSG00000136152		"""Components of oligomeric golgi complex"""	18619	protein-coding gene	gene with protein product		606975				11980916	Standard	NM_031431		Approved	SEC34	uc001vak.3	Q96JB2	OTTHUMG00000016855	ENST00000349995.5:c.545A>G	13.37:g.46054421A>G	ENSP00000258654:p.Glu182Gly		B2RAW5|Q5VT70|Q8IXX4|Q9BZ92	Missense_Mutation	SNP	pfam_COG_su3,superfamily_Cullin_repeat-like_dom	p.E182G	ENST00000349995.5	37	c.545	CCDS9398.1	13	.	.	.	.	.	.	.	.	.	.	A	21.4	4.143929	0.77888	.	.	ENSG00000136152	ENST00000349995	T	0.54866	0.55	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.74869	0.3773	M	0.85197	2.74	0.80722	D	1	D;D;P	0.69078	0.997;0.994;0.919	D;D;P	0.70227	0.968;0.946;0.636	T	0.79215	-0.1895	10	0.66056	D	0.02	-17.9324	15.2574	0.73596	1.0:0.0:0.0:0.0	.	19;182;182	B4E2F3;Q96JB2;Q96JB2-2	.;COG3_HUMAN;.	G	182	ENSP00000258654:E182G	ENSP00000258654:E182G	E	+	2	0	COG3	44952422	1.000000	0.71417	1.000000	0.80357	0.716000	0.41182	8.906000	0.92626	2.200000	0.70718	0.482000	0.46254	GAA	COG3	-	pfam_COG_su3	ENSG00000136152		0.333	COG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COG3	HGNC	protein_coding	OTTHUMT00000044777.2	289	0.34	1	A			46054421	46054421	+1	no_errors	ENST00000349995	ensembl	human	known	69_37n	missense	225	11.76	30	SNP	1.000	G
COL6A5	256076	genome.wustl.edu	37	3	130145079	130145079	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A146-01A-31D-A10Y-09	TCGA-D8-A146-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9a7548dc-fc79-4ad4-a324-0e9f63c91a20	6d63e128-669b-4ac6-b2d3-10f6d7cf82d1	g.chr3:130145079C>A	ENST00000432398.2	+	30	5679	c.5185C>A	c.(5185-5187)Cag>Aag	p.Q1729K	COL6A5_ENST00000265379.6_Missense_Mutation_p.Q1729K	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	1729	Nonhelical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						CATGGCAGGGCAGCCTGTATA	0.358																																						dbGAP											0													164.0	142.0	148.0					3																	130145079		692	1591	2283	-	-	-	SO:0001583	missense	0			AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.5185C>A	3.37:g.130145079C>A	ENSP00000390895:p.Gln1729Lys		A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.Q1729K	ENST00000432398.2	37	c.5185		3	.	.	.	.	.	.	.	.	.	.	C	12.83	2.054453	0.36277	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	D;D	0.93426	-3.22;-3.22	4.96	-3.23	0.05109	.	.	.	.	.	D	0.82314	0.5010	N	0.17474	0.49	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.68606	-0.5364	9	0.06365	T	0.9	.	8.4652	0.32951	0.4114:0.2462:0.3424:0.0	.	1729	A8TX70-2	.	K	1729	ENSP00000390895:Q1729K;ENSP00000265379:Q1729K	ENSP00000265379:Q1729K	Q	+	1	0	COL6A5	131627769	0.000000	0.05858	0.000000	0.03702	0.975000	0.68041	-0.524000	0.06222	-0.998000	0.03446	0.491000	0.48974	CAG	COL6A5	-	pfam_Collagen	ENSG00000172752		0.358	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	COL6A5	HGNC	protein_coding		506	0.00	0	C	NM_153264		130145079	130145079	+1	no_errors	ENST00000265379	ensembl	human	known	69_37n	missense	535	15.14	96	SNP	0.000	A
CXorf40B	541578	genome.wustl.edu	37	X	149101992	149101992	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A146-01A-31D-A10Y-09	TCGA-D8-A146-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9a7548dc-fc79-4ad4-a324-0e9f63c91a20	6d63e128-669b-4ac6-b2d3-10f6d7cf82d1	g.chrX:149101992T>C	ENST00000370406.3	-	4	929	c.101A>G	c.(100-102)cAg>cGg	p.Q34R	CXorf40B_ENST00000462691.1_Missense_Mutation_p.Q34R|CXorf40B_ENST00000370404.1_Missense_Mutation_p.Q34R|CXorf40B_ENST00000355203.2_Missense_Mutation_p.Q34R			Q96DE9	CX04B_HUMAN	chromosome X open reading frame 40B	34										endometrium(1)|lung(4)	5	Acute lymphoblastic leukemia(192;6.56e-05)					ACAGTTCCGCTGGCTGCTCAG	0.582																																						dbGAP											0													77.0	70.0	73.0					X																	149101992		2175	4297	6472	-	-	-	SO:0001583	missense	0			BC009523	CCDS35426.1	Xq28	2012-11-28			ENSG00000197021	ENSG00000197021			17402	protein-coding gene	gene with protein product							Standard	XM_005274698		Approved		uc004fdy.3	Q96DE9	OTTHUMG00000034327	ENST00000370406.3:c.101A>G	X.37:g.149101992T>C	ENSP00000359434:p.Gln34Arg			Missense_Mutation	SNP	superfamily_PUA-like_domain	p.Q34R	ENST00000370406.3	37	c.101	CCDS35426.1	X	.	.	.	.	.	.	.	.	.	.	t	1.583	-0.531119	0.04112	.	.	ENSG00000197021	ENST00000462691;ENST00000370406;ENST00000355203;ENST00000370404	D;D;D;D	0.92199	-2.99;-2.99;-2.99;-2.99	3.57	3.57	0.40892	PUA-like domain (1);	0.649000	0.16327	N	0.219313	D	0.85548	0.5722	L	0.36672	1.1	0.09310	N	1	B	0.11235	0.004	B	0.13407	0.009	T	0.71984	-0.4427	10	0.25751	T	0.34	-8.9377	6.8718	0.24125	0.2092:0.0:0.0:0.7908	.	34	Q96DE9	CX04B_HUMAN	R	34	ENSP00000417546:Q34R;ENSP00000359434:Q34R;ENSP00000347339:Q34R;ENSP00000359432:Q34R	ENSP00000347339:Q34R	Q	-	2	0	CXorf40B	148852650	0.844000	0.29557	0.004000	0.12327	0.052000	0.14988	3.189000	0.50965	1.119000	0.41883	0.371000	0.22339	CAG	CXorf40B	-	superfamily_PUA-like_domain	ENSG00000197021		0.582	CXorf40B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf40B	HGNC	protein_coding	OTTHUMT00000082896.2	148	0.00	0	T	NP_001013867		149101992	149101992	-1	no_errors	ENST00000355203	ensembl	human	known	69_37n	missense	195	26.87	72	SNP	0.005	C
DNAH3	55567	genome.wustl.edu	37	16	20994169	20994169	+	Missense_Mutation	SNP	C	C	T	rs541798583		TCGA-D8-A146-01A-31D-A10Y-09	TCGA-D8-A146-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9a7548dc-fc79-4ad4-a324-0e9f63c91a20	6d63e128-669b-4ac6-b2d3-10f6d7cf82d1	g.chr16:20994169C>T	ENST00000261383.3	-	49	7732	c.7733G>A	c.(7732-7734)cGg>cAg	p.R2578Q	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	2578	AAA 4. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		AGGGAACATCCGCAGGCGGTT	0.498													C|||	1	0.000199681	0.0	0.0	5008	,	,		16591	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													107.0	102.0	103.0					16																	20994169		2201	4300	6501	-	-	-	SO:0001583	missense	0			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.7733G>A	16.37:g.20994169C>T	ENSP00000261383:p.Arg2578Gln		O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_Prefoldin,smart_AAA+_ATPase	p.R2578Q	ENST00000261383.3	37	c.7733	CCDS10594.1	16	.	.	.	.	.	.	.	.	.	.	C	33	5.242696	0.95272	.	.	ENSG00000158486	ENST00000261383	T	0.56611	0.45	5.83	5.83	0.93111	Dynein heavy chain, P-loop containing D4 domain (1);	0.143017	0.43579	D	0.000553	T	0.77638	0.4160	M	0.84948	2.725	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79738	-0.1677	10	0.72032	D	0.01	.	20.1381	0.98040	0.0:1.0:0.0:0.0	.	2578	Q8TD57	DYH3_HUMAN	Q	2578	ENSP00000261383:R2578Q	ENSP00000261383:R2578Q	R	-	2	0	DNAH3	20901670	0.919000	0.31177	0.817000	0.32601	0.972000	0.66771	5.956000	0.70315	2.769000	0.95229	0.655000	0.94253	CGG	DNAH3	-	NULL	ENSG00000158486		0.498	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	HGNC	protein_coding	OTTHUMT00000207361.1	89	0.00	0	C	NM_017539		20994169	20994169	-1	no_errors	ENST00000261383	ensembl	human	known	69_37n	missense	182	12.92	27	SNP	0.964	T
MICU3	286097	genome.wustl.edu	37	8	16921636	16921636	+	Frame_Shift_Del	DEL	C	C	-			TCGA-D8-A146-01A-31D-A10Y-09	TCGA-D8-A146-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9a7548dc-fc79-4ad4-a324-0e9f63c91a20	6d63e128-669b-4ac6-b2d3-10f6d7cf82d1	g.chr8:16921636delC	ENST00000318063.5	+	2	467	c.425delC	c.(424-426)gccfs	p.A142fs		NM_181723.2	NP_859074.1	Q86XE3	MICU3_HUMAN	mitochondrial calcium uptake family, member 3	142						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)										GACCTTTATGCCACATCTCGG	0.378																																						dbGAP											0													198.0	176.0	184.0					8																	16921636		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			BC032868	CCDS5999.1	8p22	2013-03-26	2013-03-26	2013-03-14	ENSG00000155970	ENSG00000155970		"""EF-hand domain containing"""	27820	protein-coding gene	gene with protein product		610633	"""EF hand domain family A2"", ""EF-hand domain family, member A2"""	EFHA2		23409044	Standard	NM_181723		Approved	DKFZp313A0139	uc003wxd.2	Q86XE3	OTTHUMG00000096965	ENST00000318063.5:c.425delC	8.37:g.16921636delC	ENSP00000321455:p.Ala142fs		Q8IYZ3	Frame_Shift_Del	DEL	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.T143fs	ENST00000318063.5	37	c.425	CCDS5999.1	8																																																																																			EFHA2	-	NULL	ENSG00000155970		0.378	MICU3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFHA2	HGNC	protein_coding	OTTHUMT00000214031.1	437	0.00	0	C	NM_181723		16921636	16921636	+1	no_errors	ENST00000318063	ensembl	human	known	69_37n	frame_shift_del	317	24.29	103	DEL	0.997	-
NUTM2B	729262	genome.wustl.edu	37	10	81466181	81466181	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A146-01A-31D-A10Y-09	TCGA-D8-A146-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9a7548dc-fc79-4ad4-a324-0e9f63c91a20	6d63e128-669b-4ac6-b2d3-10f6d7cf82d1	g.chr10:81466181C>T	ENST00000429828.1	+	2	1149	c.766C>T	c.(766-768)Cct>Tct	p.P256S	RP11-119F19.2_ENST00000596088.1_RNA|RP11-119F19.2_ENST00000600376.1_RNA|RP11-119F19.2_ENST00000601369.1_RNA|NUTM2B_ENST00000372321.1_Missense_Mutation_p.P189S|NUTM2B_ENST00000448135.1_Missense_Mutation_p.P256S	NM_001278495.1	NP_001265424.1	A6NNL0	NTM2B_HUMAN	NUT family member 2B	256																	TCCTGTGGTGCCTGTTATGGC	0.677																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS60574.1	10q22.3	2014-08-13	2013-03-14	2013-03-14	ENSG00000188199	ENSG00000188199			23445	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member B"""	FAM22B			Standard	NM_001278495		Approved	bA119F19.1		A6NNL0	OTTHUMG00000018572	ENST00000429828.1:c.766C>T	10.37:g.81466181C>T	ENSP00000394623:p.Pro256Ser		A6NM73	Missense_Mutation	SNP	NULL	p.P256S	ENST00000429828.1	37	c.766		10	.	.	.	.	.	.	.	.	.	.	.	0.235	-1.017891	0.02078	.	.	ENSG00000188199	ENST00000448135;ENST00000429828;ENST00000372321	T;T;T	0.21361	2.01;2.01;2.01	1.22	-0.0733	0.13735	.	.	.	.	.	T	0.15955	0.0384	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.30966	-0.9960	6	0.33141	T	0.24	.	5.7518	0.18150	0.4191:0.5809:0.0:0.0	.	.	.	.	S	256;256;189	ENSP00000391631:P256S;ENSP00000394623:P256S;ENSP00000361396:P189S	ENSP00000361396:P189S	P	+	1	0	FAM22B	81136187	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.327000	0.07955	-0.441000	0.07201	-1.162000	0.01777	CCT	FAM22B	-	NULL	ENSG00000188199		0.677	NUTM2B-201	KNOWN	basic|appris_principal	protein_coding	FAM22B	HGNC	protein_coding		9	0.00	0	C	NG_012780		81466181	81466181	+1	no_errors	ENST00000429828	ensembl	human	known	69_37n	missense	13	38.10	8	SNP	0.000	T
CMTR1	23070	genome.wustl.edu	37	6	37429325	37429325	+	Splice_Site	SNP	G	G	T			TCGA-D8-A146-01A-31D-A10Y-09	TCGA-D8-A146-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9a7548dc-fc79-4ad4-a324-0e9f63c91a20	6d63e128-669b-4ac6-b2d3-10f6d7cf82d1	g.chr6:37429325G>T	ENST00000373451.4	+	11	1260	c.1096G>T	c.(1096-1098)Ggt>Tgt	p.G366C	CMTR1_ENST00000493656.1_3'UTR	NM_015050.2	NP_055865.1	Q8N1G2	CMTR1_HUMAN	cap methyltransferase 1	366	RrmJ-type SAM-dependent 2'-O-MTase. {ECO:0000255|PROSITE-ProRule:PRU00945}.				7-methylguanosine mRNA capping (GO:0006370)|cap1 mRNA methylation (GO:0097309)|mRNA methylation (GO:0080009)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA (nucleoside-2'-O-)-methyltransferase activity (GO:0004483)|nucleic acid binding (GO:0003676)										CTCATTTCAGGGTTTCTCGGT	0.498																																						dbGAP											0													100.0	98.0	99.0					6																	37429325		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC031890	CCDS4835.1	6p21.2	2013-07-23	2013-07-23	2013-07-23	ENSG00000137200	ENSG00000137200	2.1.1.57	"""G patch domain containing"""	21077	protein-coding gene	gene with protein product			"""KIAA0082"", ""FtsJ methyltransferase domain containing 2"""	KIAA0082, FTSJD2		20713356	Standard	NM_015050		Approved	MTr1, ISG95	uc003ons.3	Q8N1G2	OTTHUMG00000014624	ENST00000373451.4:c.1096-1G>T	6.37:g.37429325G>T			A8K949|Q14670|Q96FJ9	Missense_Mutation	SNP	pfam_rRNA_MeTrfase_FtsJ_dom,pfam_G_patch_dom,smart_G_patch_dom,smart_WW_Rsp5_WWP,pfscan_G_patch_dom	p.G366C	ENST00000373451.4	37	c.1096	CCDS4835.1	6	.	.	.	.	.	.	.	.	.	.	G	28.6	4.932839	0.92458	.	.	ENSG00000137200	ENST00000373451;ENST00000455891;ENST00000373427	T;T	0.45276	0.9;0.9	5.5	5.5	0.81552	Ribosomal RNA methyltransferase RrmJ/FtsJ (1);	0.000000	0.85682	D	0.000000	T	0.70710	0.3255	M	0.93507	3.425	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.994;0.997	T	0.79112	-0.1937	9	.	.	.	-16.6678	18.3686	0.90399	0.0:0.0:1.0:0.0	.	310;366	Q5T7F5;Q8N1G2	.;MTR1_HUMAN	C	366;310;310	ENSP00000362550:G366C;ENSP00000414233:G310C	.	G	+	1	0	FTSJD2	37537303	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.618000	0.98365	2.585000	0.87301	0.591000	0.81541	GGT	FTSJD2	-	pfam_rRNA_MeTrfase_FtsJ_dom	ENSG00000137200		0.498	CMTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FTSJD2	HGNC	protein_coding	OTTHUMT00000040408.1	159	0.00	0	G	NM_015050	Missense_Mutation	37429325	37429325	+1	no_errors	ENST00000373451	ensembl	human	known	69_37n	missense	166	35.91	93	SNP	1.000	T
HS6ST1	9394	genome.wustl.edu	37	2	129025860	129025860	+	Missense_Mutation	SNP	C	C	T	rs147436494		TCGA-D8-A146-01A-31D-A10Y-09	TCGA-D8-A146-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9a7548dc-fc79-4ad4-a324-0e9f63c91a20	6d63e128-669b-4ac6-b2d3-10f6d7cf82d1	g.chr2:129025860C>T	ENST00000259241.6	-	2	1125	c.1112G>A	c.(1111-1113)cGc>cAc	p.R371H		NM_004807.2	NP_004798.3	O60243	H6ST1_HUMAN	heparan sulfate 6-O-sulfotransferase 1	371					angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|labyrinthine layer blood vessel development (GO:0060716)|lung alveolus development (GO:0048286)|neuron development (GO:0048666)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)|sulfotransferase activity (GO:0008146)			endometrium(3)|liver(1)|lung(7)|pancreas(1)|prostate(2)|skin(1)	15	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.117)		GCTCCTCAGGCGCTGCTCCCT	0.677																																						dbGAP											0													32.0	41.0	38.0					2																	129025860		2097	4251	6348	-	-	-	SO:0001583	missense	0			AB006179	CCDS42748.1	2q21	2010-03-19		2002-08-23	ENSG00000136720	ENSG00000136720		"""Sulfotransferases, membrane-bound"""	5201	protein-coding gene	gene with protein product		604846		HS6ST		9535912	Standard	NM_004807		Approved		uc002tpt.4	O60243	OTTHUMG00000153542	ENST00000259241.6:c.1112G>A	2.37:g.129025860C>T	ENSP00000259241:p.Arg371His		B4DEP2|B4DJ29|Q53SL2|Q9BVI1	Missense_Mutation	SNP	pfam_Sulfotransferase	p.R371H	ENST00000259241.6	37	c.1112	CCDS42748.1	2	591	0.2706043956043956	87	0.17682926829268292	106	0.292817679558011	168	0.2937062937062937	230	0.3034300791556728	C	28.0	4.883726	0.91814	.	.	ENSG00000136720	ENST00000259241	D	0.85339	-1.97	4.3	4.3	0.51218	.	0.000000	0.85682	D	0.000000	T	0.00039	0.0001	M	0.74647	2.275	0.09310	P	0.99999999795479	D	0.76494	0.999	D	0.76071	0.987	T	0.00000	-1.3594	8	.	.	.	-12.2845	17.1367	0.86742	0.0:1.0:0.0:0.0	.	371	O60243	H6ST1_HUMAN	H	371	ENSP00000259241:R371H	.	R	-	2	0	HS6ST1	128742330	1.000000	0.71417	0.999000	0.59377	0.982000	0.71751	7.243000	0.78219	2.099000	0.63709	0.462000	0.41574	CGC	HS6ST1	-	NULL	ENSG00000136720		0.677	HS6ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS6ST1	HGNC	protein_coding	OTTHUMT00000331572.1	32	0.00	0	C	NM_004807		129025860	129025860	-1	no_errors	ENST00000259241	ensembl	human	known	69_37n	missense	31	13.89	5	SNP	1.000	T
ITIH4	3700	genome.wustl.edu	37	3	52863161	52863161	+	Silent	SNP	C	C	T			TCGA-D8-A146-01A-31D-A10Y-09	TCGA-D8-A146-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9a7548dc-fc79-4ad4-a324-0e9f63c91a20	6d63e128-669b-4ac6-b2d3-10f6d7cf82d1	g.chr3:52863161C>T	ENST00000266041.4	-	2	321	c.225G>A	c.(223-225)aaG>aaA	p.K75K	ITIH4_ENST00000346281.5_Silent_p.K75K|ITIH4_ENST00000406595.1_Silent_p.K75K|ITIH4_ENST00000485816.1_Silent_p.K75K|ITIH4_ENST00000434759.3_Intron|RP5-966M1.6_ENST00000513520.1_5'Flank|RP5-966M1.6_ENST00000468472.1_3'UTR	NM_002218.4	NP_002209.2	Q14624	ITIH4_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 4	75	VIT. {ECO:0000255|PROSITE- ProRule:PRU00801}.				acute-phase response (GO:0006953)|hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)|response to cytokine (GO:0034097)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		TGAAGGCTTTCTTGGGCAGCT	0.587																																						dbGAP											0													158.0	126.0	137.0					3																	52863161		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D38535	CCDS2865.1, CCDS54596.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055955	ENSG00000055955			6169	protein-coding gene	gene with protein product	"""plasma Kallikrein-sensitive glycoprotein"""	600564	"""inter-alpha (globulin) inhibitor H4 (plasma Kallikrein-sensitive glycoprotein)"""	ITIHL1		9480842, 7805892	Standard	NM_002218		Approved	IHRP, H4P	uc003dfz.3	Q14624	OTTHUMG00000159023	ENST00000266041.4:c.225G>A	3.37:g.52863161C>T			B7Z545|E9PGN5|Q15135|Q9P190|Q9UQ54	Silent	SNP	pfam_VIT,pfam_ITI_HC_C,pfam_VWF_A,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.K75	ENST00000266041.4	37	c.225	CCDS2865.1	3																																																																																			ITIH4	-	pfam_VIT,smart_VIT	ENSG00000055955		0.587	ITIH4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITIH4	HGNC	protein_coding	OTTHUMT00000317715.1	121	0.00	0	C	NM_002218		52863161	52863161	-1	no_errors	ENST00000266041	ensembl	human	known	69_37n	silent	130	29.57	55	SNP	1.000	T
KIAA2022	340533	genome.wustl.edu	37	X	73961112	73961112	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A146-01A-31D-A10Y-09	TCGA-D8-A146-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9a7548dc-fc79-4ad4-a324-0e9f63c91a20	6d63e128-669b-4ac6-b2d3-10f6d7cf82d1	g.chrX:73961112T>C	ENST00000055682.6	-	3	3891	c.3280A>G	c.(3280-3282)Aca>Gca	p.T1094A		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	1094					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						CCCTTTAGTGTTCCTAGTGTC	0.502																																						dbGAP											0													76.0	73.0	74.0					X																	73961112		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.3280A>G	X.37:g.73961112T>C	ENSP00000055682:p.Thr1094Ala		A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	NULL	p.T1094A	ENST00000055682.6	37	c.3280	CCDS35337.1	X	.	.	.	.	.	.	.	.	.	.	T	8.143	0.785667	0.16189	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.30981	1.51;1.51	5.05	2.32	0.28847	.	0.561924	0.19848	N	0.104718	T	0.20414	0.0491	L	0.27053	0.805	0.09310	N	0.999999	B	0.06786	0.001	B	0.08055	0.003	T	0.18840	-1.0324	10	0.54805	T	0.06	-3.056	9.4062	0.38462	0.0:0.1784:0.0:0.8216	.	1094	Q5QGS0	K2022_HUMAN	A	1094	ENSP00000362567:T1094A;ENSP00000055682:T1094A	ENSP00000055682:T1094A	T	-	1	0	KIAA2022	73877837	1.000000	0.71417	0.890000	0.34922	0.589000	0.36550	4.738000	0.62073	0.613000	0.30089	0.486000	0.48141	ACA	KIAA2022	-	NULL	ENSG00000050030		0.502	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA2022	HGNC	protein_coding	OTTHUMT00000057270.2	185	0.00	0	T	NM_001008537		73961112	73961112	-1	no_errors	ENST00000055682	ensembl	human	known	69_37n	missense	201	31.42	93	SNP	0.258	C
LRRTM3	347731	genome.wustl.edu	37	10	68687255	68687255	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A146-01A-31D-A10Y-09	TCGA-D8-A146-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9a7548dc-fc79-4ad4-a324-0e9f63c91a20	6d63e128-669b-4ac6-b2d3-10f6d7cf82d1	g.chr10:68687255G>A	ENST00000361320.4	+	2	1159	c.581G>A	c.(580-582)cGa>cAa	p.R194Q	CTNNA3_ENST00000433211.2_Intron|CTNNA3_ENST00000373744.4_Intron	NM_178011.3	NP_821079.3	Q86VH5	LRRT3_HUMAN	leucine rich repeat transmembrane neuronal 3	194					positive regulation of beta-amyloid formation (GO:1902004)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	41						AACCGGATCCGAAGTTTAGCC	0.468																																						dbGAP											0													82.0	87.0	85.0					10																	68687255		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX640611	CCDS7270.1	10q22.1	2007-01-22				ENSG00000198739			19410	protein-coding gene	gene with protein product		610869				12676565	Standard	XR_247527		Approved		uc001jmz.1	Q86VH5		ENST00000361320.4:c.581G>A	10.37:g.68687255G>A	ENSP00000355187:p.Arg194Gln		A8K2A3|Q2NKX7|Q6N0A3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	p.R194Q	ENST00000361320.4	37	c.581	CCDS7270.1	10	.	.	.	.	.	.	.	.	.	.	G	18.09	3.546727	0.65198	.	.	ENSG00000198739	ENST00000361320;ENST00000373722	T	0.56444	0.46	5.42	5.42	0.78866	.	0.000000	0.50627	D	0.000117	T	0.60340	0.2261	N	0.25094	0.71	0.58432	D	0.999995	D;D	0.89917	1.0;1.0	D;D	0.74674	0.984;0.973	T	0.60188	-0.7312	10	0.39692	T	0.17	.	17.9918	0.89171	0.0:0.0:1.0:0.0	.	194;194	Q86VH5;Q86VH5-2	LRRT3_HUMAN;.	Q	194	ENSP00000355187:R194Q	ENSP00000355187:R194Q	R	+	2	0	LRRTM3	68357261	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.538000	0.85594	0.650000	0.86243	CGA	LRRTM3	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000198739		0.468	LRRTM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRTM3	HGNC	protein_coding	OTTHUMT00000048277.2	136	0.00	0	G	NM_178011		68687255	68687255	+1	no_errors	ENST00000361320	ensembl	human	known	69_37n	missense	137	23.46	42	SNP	1.000	A
MAMLD1	10046	genome.wustl.edu	37	X	149638546	149638546	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A146-01A-31D-A10Y-09	TCGA-D8-A146-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9a7548dc-fc79-4ad4-a324-0e9f63c91a20	6d63e128-669b-4ac6-b2d3-10f6d7cf82d1	g.chrX:149638546C>T	ENST00000370401.2	+	4	1011	c.701C>T	c.(700-702)gCt>gTt	p.A234V	MAMLD1_ENST00000426613.2_Missense_Mutation_p.A209V|MAMLD1_ENST00000432680.2_Missense_Mutation_p.A209V|MAMLD1_ENST00000455522.2_5'Flank|MAMLD1_ENST00000262858.5_Missense_Mutation_p.A234V			Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	234					male gonad development (GO:0008584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(3)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)	37	Acute lymphoblastic leukemia(192;6.56e-05)					GAGAGCCTGGCTTCCAGCAAG	0.527																																						dbGAP											0													186.0	165.0	172.0					X																	149638546		2203	4300	6503	-	-	-	SO:0001583	missense	0			U46023	CCDS14693.2, CCDS55525.1, CCDS55526.1	Xq28	2008-02-05	2008-01-03	2008-01-03	ENSG00000013619	ENSG00000013619			2568	protein-coding gene	gene with protein product		300120	"""chromosome X open reading frame 6"""	CXorf6		9169146, 17086185, 18162467	Standard	NM_001177465		Approved	CG1, F18	uc011mxu.2	Q13495	OTTHUMG00000024157	ENST00000370401.2:c.701C>T	X.37:g.149638546C>T	ENSP00000359428:p.Ala234Val		B2RCQ4|B4DG93|B9EGA5	Missense_Mutation	SNP	NULL	p.A209V	ENST00000370401.2	37	c.626	CCDS14693.2	X	.	.	.	.	.	.	.	.	.	.	C	3.817	-0.038614	0.07497	.	.	ENSG00000013619	ENST00000445612;ENST00000370401;ENST00000432680;ENST00000262858;ENST00000426613	T;T;T;T	0.60299	0.56;0.2;0.56;0.57	5.23	-4.53	0.03462	.	1.234140	0.05463	N	0.551547	T	0.35537	0.0935	N	0.20530	0.585	0.09310	N	1	B;P;B;P	0.41848	0.023;0.634;0.009;0.763	B;B;B;B	0.39027	0.006;0.215;0.002;0.288	T	0.25187	-1.0139	9	.	.	.	2.7488	4.2565	0.10719	0.0888:0.4307:0.2026:0.2779	.	196;209;209;234	F6WVG1;Q13495-4;Q13495-3;Q13495	.;.;.;MAMD1_HUMAN	V	196;234;209;234;209	ENSP00000359428:A234V;ENSP00000414517:A209V;ENSP00000262858:A234V;ENSP00000397438:A209V	.	A	+	2	0	MAMLD1	149389204	0.001000	0.12720	0.000000	0.03702	0.242000	0.25591	1.098000	0.31000	-0.844000	0.04184	-0.343000	0.07986	GCT	MAMLD1	-	NULL	ENSG00000013619		0.527	MAMLD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAMLD1	HGNC	protein_coding	OTTHUMT00000060844.2	129	0.00	0	C	NM_005491		149638546	149638546	+1	no_errors	ENST00000432680	ensembl	human	known	69_37n	missense	105	10.26	12	SNP	0.000	T
METTL5	29081	genome.wustl.edu	37	2	170672017	170672017	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A146-01A-31D-A10Y-09	TCGA-D8-A146-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9a7548dc-fc79-4ad4-a324-0e9f63c91a20	6d63e128-669b-4ac6-b2d3-10f6d7cf82d1	g.chr2:170672017C>T	ENST00000260953.5	-	5	827	c.511G>A	c.(511-513)Gaa>Aaa	p.E171K	METTL5_ENST00000409965.1_Missense_Mutation_p.E171K|METTL5_ENST00000409837.1_Missense_Mutation_p.E171K|METTL5_ENST00000409340.1_Missense_Mutation_p.E72K|METTL5_ENST00000308099.3_Intron|METTL5_ENST00000392640.2_Missense_Mutation_p.E171K|METTL5_ENST00000410097.1_Missense_Mutation_p.E171K|U3_ENST00000517172.1_RNA	NM_014168.2	NP_054887.2	Q9NRN9	METL5_HUMAN	methyltransferase like 5	171							methyltransferase activity (GO:0008168)|nucleic acid binding (GO:0003676)			breast(2)|central_nervous_system(1)|large_intestine(5)|lung(1)|prostate(1)	10						ATTTTCCATTCTGCAGCTTTC	0.299																																						dbGAP											0													108.0	101.0	103.0					2																	170672017		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF201938	CCDS33320.1	2q31.1	2011-01-28			ENSG00000138382	ENSG00000138382			25006	protein-coding gene	gene with protein product						11042152	Standard	XM_005246478		Approved	HSPC133	uc002ufn.3	Q9NRN9	OTTHUMG00000154117	ENST00000260953.5:c.511G>A	2.37:g.170672017C>T	ENSP00000260953:p.Glu171Lys		D3DPC9|Q9NVX1	Missense_Mutation	SNP	pfam_Small_mtfrase_dom,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_RNA_methylase_dom,pfam_RNA_MeTrfase_RsmD,pfam_RNA_cap_Gua-N2-MeTrfase,pfam_Methyltransf_11	p.E171K	ENST00000260953.5	37	c.511	CCDS33320.1	2	.	.	.	.	.	.	.	.	.	.	C	18.80	3.700151	0.68501	.	.	ENSG00000138382	ENST00000409837;ENST00000409340;ENST00000260953;ENST00000409965;ENST00000392640;ENST00000410097	T;T;T;T	0.45276	0.94;0.9;0.9;0.9	5.42	5.42	0.78866	.	0.051206	0.85682	D	0.000000	T	0.41465	0.1160	L	0.46157	1.445	0.80722	D	1	B;B	0.29085	0.232;0.08	B;B	0.32393	0.145;0.05	T	0.15809	-1.0424	10	0.24483	T	0.36	-23.1467	19.1712	0.93578	0.0:1.0:0.0:0.0	.	171;171	B8ZZC8;Q9NRN9	.;METL5_HUMAN	K	171;72;171;171;171;171	ENSP00000387106:E72K;ENSP00000260953:E171K;ENSP00000386582:E171K;ENSP00000376415:E171K	ENSP00000260953:E171K	E	-	1	0	METTL5	170380263	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.275000	0.78548	2.699000	0.92147	0.561000	0.74099	GAA	METTL5	-	pfam_RNA_MeTrfase_RsmD	ENSG00000138382		0.299	METTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	METTL5	HGNC	protein_coding	OTTHUMT00000333957.1	524	0.00	0	C	NM_014168		170672017	170672017	-1	no_errors	ENST00000260953	ensembl	human	known	69_37n	missense	527	11.58	69	SNP	1.000	T
NPTXR	23467	genome.wustl.edu	37	22	39218663	39218663	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A146-01A-31D-A10Y-09	TCGA-D8-A146-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9a7548dc-fc79-4ad4-a324-0e9f63c91a20	6d63e128-669b-4ac6-b2d3-10f6d7cf82d1	g.chr22:39218663C>T	ENST00000333039.2	-	5	1577	c.1454G>A	c.(1453-1455)gGt>gAt	p.G485D		NM_014293.3	NP_055108	O95502	NPTXR_HUMAN	neuronal pentraxin receptor	485	Pentaxin.					integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			central_nervous_system(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14	Melanoma(58;0.04)					CTTTGTTGCACCCCCAAAGGC	0.632																																					Pancreas(139;2521 3281 36965)	dbGAP											0													54.0	37.0	43.0					22																	39218663		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF052163	CCDS33647.1	22q13.1	2007-01-25			ENSG00000221890	ENSG00000221890			7954	protein-coding gene	gene with protein product		609474				16497176	Standard	NM_014293		Approved		uc003awk.3	O95502	OTTHUMG00000150458	ENST00000333039.2:c.1454G>A	22.37:g.39218663C>T	ENSP00000327545:p.Gly485Asp			Missense_Mutation	SNP	pfam_Pentaxin,superfamily_ConA-like_lec_gl,smart_Pentaxin,prints_Pentaxin	p.G485D	ENST00000333039.2	37	c.1454	CCDS33647.1	22	.	.	.	.	.	.	.	.	.	.	C	19.06	3.753679	0.69648	.	.	ENSG00000221890	ENST00000333039	T	0.59224	0.28	3.76	3.76	0.43208	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.78078	0.4227	M	0.85041	2.73	0.46874	D	0.999233	D	0.89917	1.0	D	0.97110	1.0	D	0.84987	0.0892	9	0.87932	D	0	-21.9884	16.0451	0.80714	0.0:1.0:0.0:0.0	.	485	O95502	NPTXR_HUMAN	D	485	ENSP00000327545:G485D	ENSP00000327545:G485D	G	-	2	0	NPTXR	37548609	1.000000	0.71417	0.950000	0.38849	0.474000	0.32979	6.035000	0.70940	2.037000	0.60232	0.462000	0.41574	GGT	NPTXR	-	superfamily_ConA-like_lec_gl,smart_Pentaxin	ENSG00000221890		0.632	NPTXR-001	KNOWN	non_ATG_start|basic|appris_principal|CCDS	protein_coding	NPTXR	HGNC	protein_coding	OTTHUMT00000318194.2	26	0.00	0	C	NM_014293		39218663	39218663	-1	no_errors	ENST00000333039	ensembl	human	known	69_37n	missense	26	31.58	12	SNP	1.000	T
PIK3CA	5290	genome.wustl.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-D8-A146-01A-31D-A10Y-09	TCGA-D8-A146-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9a7548dc-fc79-4ad4-a324-0e9f63c91a20	6d63e128-669b-4ac6-b2d3-10f6d7cf82d1	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)											61.0	60.0	60.0					3																	178936091		1813	4072	5885	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E545K	ENST00000263967.3	37	c.1633	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	145	0.00	0	G			178936091	178936091	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	191	34.81	102	SNP	1.000	A
PITPNM1	9600	genome.wustl.edu	37	11	67264729	67264729	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A146-01A-31D-A10Y-09	TCGA-D8-A146-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9a7548dc-fc79-4ad4-a324-0e9f63c91a20	6d63e128-669b-4ac6-b2d3-10f6d7cf82d1	g.chr11:67264729G>A	ENST00000534749.1	-	13	2307	c.2119C>T	c.(2119-2121)Cgc>Tgc	p.R707C	PITPNM1_ENST00000356404.3_Missense_Mutation_p.R707C|PITPNM1_ENST00000526450.1_5'Flank|PITPNM1_ENST00000436757.2_Missense_Mutation_p.R707C			O00562	PITM1_HUMAN	phosphatidylinositol transfer protein, membrane-associated 1	707	DDHD. {ECO:0000255|PROSITE- ProRule:PRU00378}.				brain development (GO:0007420)|lipid metabolic process (GO:0006629)|phospholipid transport (GO:0015914)|phototransduction (GO:0007602)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol transporter activity (GO:0008526)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(3)	18						ACAGTTTTGCGCAGAGCCAGC	0.657																																					GBM(28;144 709 4607 5525)	dbGAP											0													28.0	30.0	29.0					11																	67264729		2199	4291	6490	-	-	-	SO:0001583	missense	0			X98654	CCDS31620.1, CCDS44659.1	11q13	2008-07-21		2003-05-16	ENSG00000110697	ENSG00000110697			9003	protein-coding gene	gene with protein product	"""PYK2 N-terminal domain-interacting receptor 2"", ""retinal degeneration B alpha 1"""	608794		PITPNM		9680295	Standard	NM_004910		Approved	DRES9, NIR2, RDGB1, RDGBA1, Rd9, RDGB	uc001oly.3	O00562	OTTHUMG00000167675	ENST00000534749.1:c.2119C>T	11.37:g.67264729G>A	ENSP00000437286:p.Arg707Cys		A6NME4|Q6T7X3|Q8TBN3|Q9BZ73	Missense_Mutation	SNP	pfam_PI_transfer,pfam_DDHD,pfam_LNS2,superfamily_HAD-like_dom,smart_LNS2,pfscan_DDHD,prints_PI_transfer	p.R707C	ENST00000534749.1	37	c.2119	CCDS31620.1	11	.	.	.	.	.	.	.	.	.	.	G	19.34	3.807961	0.70797	.	.	ENSG00000110697	ENST00000534749;ENST00000436757;ENST00000356404	T;T;T	0.65549	-0.05;-0.16;-0.05	4.44	4.44	0.53790	DDHD (2);	0.253151	0.27881	N	0.017463	D	0.82595	0.5071	M	0.93854	3.465	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.86285	0.1670	10	0.87932	D	0	-15.6329	11.3303	0.49473	0.0:0.0:0.8181:0.1819	.	707;707	O00562-2;O00562	.;PITM1_HUMAN	C	707	ENSP00000437286:R707C;ENSP00000398787:R707C;ENSP00000348772:R707C	ENSP00000348772:R707C	R	-	1	0	PITPNM1	67021305	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.040000	0.49799	2.212000	0.71576	0.561000	0.74099	CGC	PITPNM1	-	pfam_DDHD,pfscan_DDHD	ENSG00000110697		0.657	PITPNM1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	PITPNM1	HGNC	protein_coding	OTTHUMT00000395520.1	41	0.00	0	G	NM_004910		67264729	67264729	-1	no_errors	ENST00000356404	ensembl	human	known	69_37n	missense	46	26.98	17	SNP	1.000	A
POTEJ	653781	genome.wustl.edu	37	2	131379061	131379061	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A146-01A-31D-A10Y-09	TCGA-D8-A146-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9a7548dc-fc79-4ad4-a324-0e9f63c91a20	6d63e128-669b-4ac6-b2d3-10f6d7cf82d1	g.chr2:131379061T>A	ENST00000409602.1	+	5	881	c.829T>A	c.(829-831)Tgt>Agt	p.C277S	RNU6-848P_ENST00000515948.1_RNA	NM_001277083.1	NP_001264012.1	P0CG39	POTEJ_HUMAN	POTE ankyrin domain family, member J	277					retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				lung(5)	5						ACTTGCTGTATGTTGTGGATC	0.353																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS59432.1	2q21.1	2013-01-10			ENSG00000222038	ENSG00000222038		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37094	protein-coding gene	gene with protein product						16364570	Standard	NM_001277083		Approved	POTE2beta	uc021vor.2	P0CG39	OTTHUMG00000154050	ENST00000409602.1:c.829T>A	2.37:g.131379061T>A	ENSP00000387176:p.Cys277Ser			Missense_Mutation	SNP	pfam_Actin-like,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Actin-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Actin-like	p.C277S	ENST00000409602.1	37	c.829	CCDS59432.1	2	.	.	.	.	.	.	.	.	.	.	.	10.57	1.387384	0.25031	.	.	ENSG00000222038	ENST00000409602	T	0.62364	0.03	0.906	-0.57	0.11753	.	.	.	.	.	T	0.26738	0.0654	N	0.01405	-0.89	0.09310	N	1	.	.	.	.	.	.	T	0.18272	-1.0342	7	0.62326	D	0.03	.	2.8406	0.05528	0.571:0.0:0.0:0.429	.	.	.	.	S	277	ENSP00000387176:C277S	ENSP00000387176:C277S	C	+	1	0	POTEJ	131095531	0.003000	0.15002	0.150000	0.22450	0.119000	0.20118	-0.290000	0.08354	-0.177000	0.10690	0.155000	0.16302	TGT	POTEJ	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000222038		0.353	POTEJ-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	POTEJ	HGNC	protein_coding	OTTHUMT00000333665.1	90	0.00	0	T	XM_929706		131379061	131379061	+1	no_errors	ENST00000409602	ensembl	human	novel	69_37n	missense	483	11.01	60	SNP	0.207	A
PPFIA3	8541	genome.wustl.edu	37	19	49643310	49643310	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A146-01A-31D-A10Y-09	TCGA-D8-A146-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9a7548dc-fc79-4ad4-a324-0e9f63c91a20	6d63e128-669b-4ac6-b2d3-10f6d7cf82d1	g.chr19:49643310G>A	ENST00000334186.4	+	18	2682	c.2333G>A	c.(2332-2334)cGa>cAa	p.R778Q	PPFIA3_ENST00000602351.1_Missense_Mutation_p.R778Q	NM_003660.2	NP_003651.1	O75145	LIPA3_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3	778					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|presynaptic active zone (GO:0048786)				NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(16)|pancreas(1)|prostate(1)|skin(4)|urinary_tract(1)	35		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000203)|GBM - Glioblastoma multiforme(486;0.00307)|Epithelial(262;0.00677)		GAGAAGGGACGAATGGGACCC	0.547																																						dbGAP											0													104.0	103.0	103.0					19																	49643310		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF034800	CCDS12758.1	19q13.33	2013-09-23			ENSG00000177380	ENSG00000177380		"""Sterile alpha motif (SAM) domain containing"""	9247	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase, receptor type, f polypeptide, alpha 3"", ""liprin-alpha 3"", ""liprin"""	603144				9624153, 9734811	Standard	NM_003660		Approved	KIAA0654, LPNA3, MGC126567, MGC126569	uc002pmr.3	O75145	OTTHUMG00000183213	ENST00000334186.4:c.2333G>A	19.37:g.49643310G>A	ENSP00000335614:p.Arg778Gln		A8K142|Q3MJA0|Q9H8B5|Q9UEW4	Missense_Mutation	SNP	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.R778Q	ENST00000334186.4	37	c.2333	CCDS12758.1	19	.	.	.	.	.	.	.	.	.	.	g	19.16	3.773879	0.69992	.	.	ENSG00000177380	ENST00000334186	T	0.56776	0.44	3.64	3.64	0.41730	.	0.000000	0.41938	U	0.000785	T	0.52613	0.1745	M	0.70842	2.15	0.80722	D	1	B;B	0.31040	0.291;0.305	B;B	0.31442	0.117;0.13	T	0.59193	-0.7500	10	0.45353	T	0.12	-6.4894	14.6272	0.68629	0.0:0.0:1.0:0.0	.	778;778	O75145-2;O75145	.;LIPA3_HUMAN	Q	778	ENSP00000335614:R778Q	ENSP00000335614:R778Q	R	+	2	0	PPFIA3	54335122	1.000000	0.71417	0.887000	0.34795	0.958000	0.62258	9.516000	0.98017	2.041000	0.60428	0.450000	0.29827	CGA	PPFIA3	-	NULL	ENSG00000177380		0.547	PPFIA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPFIA3	HGNC	protein_coding	OTTHUMT00000465688.1	118	0.00	0	G	NM_003660		49643310	49643310	+1	no_errors	ENST00000334186	ensembl	human	known	69_37n	missense	168	12.50	24	SNP	0.962	A
SCRN3	79634	genome.wustl.edu	37	2	175264705	175264705	+	Missense_Mutation	SNP	G	G	A	rs542985134		TCGA-D8-A146-01A-31D-A10Y-09	TCGA-D8-A146-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9a7548dc-fc79-4ad4-a324-0e9f63c91a20	6d63e128-669b-4ac6-b2d3-10f6d7cf82d1	g.chr2:175264705G>A	ENST00000272732.6	+	3	297	c.215G>A	c.(214-216)cGc>cAc	p.R72H	SCRN3_ENST00000409673.3_Missense_Mutation_p.R65H	NM_001193528.1|NM_024583.4	NP_001180457.1|NP_078859.2	Q0VDG4	SCRN3_HUMAN	secernin 3	72							dipeptidase activity (GO:0016805)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|urinary_tract(3)	13			OV - Ovarian serous cystadenocarcinoma(117;0.229)			GTCCTGAGTCGCCCAGCGTGG	0.408													G|||	1	0.000199681	0.0	0.0	5008	,	,		13113	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													116.0	113.0	114.0					2																	175264705		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF279776	CCDS2258.1, CCDS54420.1	2q31	2008-02-05			ENSG00000144306	ENSG00000144306			30382	protein-coding gene	gene with protein product		614967				12221138	Standard	NM_024583		Approved	FLJ23142	uc002uiq.3	Q0VDG4	OTTHUMG00000132332	ENST00000272732.6:c.215G>A	2.37:g.175264705G>A	ENSP00000272732:p.Arg72His		B4DI11|C9JPC1|D3DPE0|Q7L1C5|Q9H5R5	Missense_Mutation	SNP	pfam_Peptidase_C69	p.R72H	ENST00000272732.6	37	c.215	CCDS2258.1	2	.	.	.	.	.	.	.	.	.	.	G	25.3	4.620301	0.87460	.	.	ENSG00000144306	ENST00000458563;ENST00000409673;ENST00000272732;ENST00000424069;ENST00000427038;ENST00000548031	T;T;T;T;T;T	0.36699	2.15;2.93;2.94;1.24;1.24;2.12	5.8	5.8	0.92144	.	0.048523	0.85682	D	0.000000	T	0.66577	0.2803	M	0.85777	2.775	0.50039	D	0.999847	D;D	0.89917	1.0;1.0	D;D	0.70935	0.947;0.971	T	0.70506	-0.4853	10	0.87932	D	0	-8.0216	20.0483	0.97617	0.0:0.0:1.0:0.0	.	65;72	B4DI11;Q0VDG4	.;SCRN3_HUMAN	H	72;65;72;72;72;72	ENSP00000396884:R72H;ENSP00000387142:R65H;ENSP00000272732:R72H;ENSP00000402086:R72H;ENSP00000408376:R72H;ENSP00000446727:R72H	ENSP00000272732:R72H	R	+	2	0	SCRN3	174972951	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.697000	0.61782	2.756000	0.94617	0.579000	0.79373	CGC	SCRN3	-	NULL	ENSG00000144306		0.408	SCRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCRN3	HGNC	protein_coding	OTTHUMT00000255451.2	170	0.00	0	G	NM_024583		175264705	175264705	+1	no_errors	ENST00000272732	ensembl	human	known	69_37n	missense	214	29.08	89	SNP	1.000	A
SFXN4	119559	genome.wustl.edu	37	10	120917220	120917220	+	Nonsense_Mutation	SNP	A	A	C			TCGA-D8-A146-01A-31D-A10Y-09	TCGA-D8-A146-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9a7548dc-fc79-4ad4-a324-0e9f63c91a20	6d63e128-669b-4ac6-b2d3-10f6d7cf82d1	g.chr10:120917220A>C	ENST00000355697.2	-	9	516	c.497T>G	c.(496-498)tTa>tGa	p.L166*	SFXN4_ENST00000461438.1_5'UTR|SFXN4_ENST00000330036.6_Nonsense_Mutation_p.L157*	NM_213649.1	NP_998814.1	Q6P4A7	SFXN4_HUMAN	sideroflexin 4	166					iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)			central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	11		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0261)		CGCCATTAGTAATGATCTTTC	0.328																																						dbGAP											0													53.0	62.0	59.0					10																	120917220		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS7610.1	10q26.11	2006-03-13			ENSG00000183605	ENSG00000183605		"""Sideroflexins"""	16088	protein-coding gene	gene with protein product		615564				14756423	Standard	NM_213649		Approved		uc001leb.3	Q6P4A7	OTTHUMG00000019147	ENST00000355697.2:c.497T>G	10.37:g.120917220A>C	ENSP00000347924:p.Leu166*		Q6WSU4|Q86TD9	Nonsense_Mutation	SNP	pfam_Mtc	p.L166*	ENST00000355697.2	37	c.497	CCDS7610.1	10	.	.	.	.	.	.	.	.	.	.	A	35	5.577002	0.96565	.	.	ENSG00000183605	ENST00000355697;ENST00000330036;ENST00000392875;ENST00000369131;ENST00000419372	.	.	.	4.92	4.92	0.64577	.	0.331422	0.22344	N	0.061287	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	-7.0956	12.309	0.54918	1.0:0.0:0.0:0.0	.	.	.	.	X	166;157;49;50;50	.	ENSP00000333200:L157X	L	-	2	0	SFXN4	120907210	0.016000	0.18221	0.003000	0.11579	0.001000	0.01503	3.613000	0.54152	2.192000	0.70111	0.454000	0.30748	TTA	SFXN4	-	pfam_Mtc	ENSG00000183605		0.328	SFXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFXN4	HGNC	protein_coding	OTTHUMT00000050642.3	251	0.39	1	A	XM_058406		120917220	120917220	-1	no_errors	ENST00000355697	ensembl	human	known	69_37n	nonsense	247	22.33	71	SNP	0.006	C
SLC12A5	57468	genome.wustl.edu	37	20	44680375	44680375	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A146-01A-31D-A10Y-09	TCGA-D8-A146-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9a7548dc-fc79-4ad4-a324-0e9f63c91a20	6d63e128-669b-4ac6-b2d3-10f6d7cf82d1	g.chr20:44680375C>T	ENST00000454036.2	+	18	2361	c.2312C>T	c.(2311-2313)tCc>tTc	p.S771F	SLC12A5_ENST00000243964.3_Missense_Mutation_p.S748F	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	771					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	GTGATCTCCTCCAACTTGCGT	0.627																																						dbGAP											0													122.0	110.0	114.0					20																	44680375		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.2312C>T	20.37:g.44680375C>T	ENSP00000387694:p.Ser771Phe		A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Missense_Mutation	SNP	pfam_AA-permease_dom,prints_KCL_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.S771F	ENST00000454036.2	37	c.2312	CCDS46610.1	20	.	.	.	.	.	.	.	.	.	.	C	25.1	4.598919	0.87055	.	.	ENSG00000124140	ENST00000454036;ENST00000243964	D;D	0.94000	-3.33;-3.33	4.19	4.19	0.49359	.	0.060879	0.64402	D	0.000002	D	0.96097	0.8728	M	0.86573	2.825	0.80722	D	1	P;P	0.47962	0.903;0.692	P;B	0.54924	0.764;0.205	D	0.96933	0.9682	10	0.72032	D	0.01	.	16.0375	0.80640	0.0:1.0:0.0:0.0	.	771;748	Q9H2X9;Q9H2X9-2	S12A5_HUMAN;.	F	771;748	ENSP00000387694:S771F;ENSP00000243964:S748F	ENSP00000243964:S748F	S	+	2	0	SLC12A5	44113782	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.844000	0.69430	2.302000	0.77476	0.462000	0.41574	TCC	SLC12A5	-	tigrfam_Na/K/Cl_cotransptS	ENSG00000124140		0.627	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	SLC12A5	HGNC	protein_coding	OTTHUMT00000471538.1	119	0.00	0	C			44680375	44680375	+1	no_errors	ENST00000454036	ensembl	human	known	69_37n	missense	148	22.11	42	SNP	1.000	T
SLC5A6	8884	genome.wustl.edu	37	2	27430388	27430388	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A146-01A-31D-A10Y-09	TCGA-D8-A146-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9a7548dc-fc79-4ad4-a324-0e9f63c91a20	6d63e128-669b-4ac6-b2d3-10f6d7cf82d1	g.chr2:27430388A>C	ENST00000310574.3	-	3	604	c.131T>G	c.(130-132)cTc>cGc	p.L44R	SLC5A6_ENST00000408041.1_Missense_Mutation_p.L44R	NM_021095.2	NP_066918.2	Q9Y289	SC5A6_HUMAN	solute carrier family 5 (sodium/multivitamin and iodide cotransporter), member 6	44					biotin metabolic process (GO:0006768)|biotin transport (GO:0015878)|pantothenate metabolic process (GO:0015939)|pantothenate transmembrane transport (GO:0015887)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)			endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|ovary(3)|prostate(1)|skin(1)	20	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Biotin(DB00121)|gabapentin enacarbil(DB08872)|Lipoic Acid(DB00166)	AGCATGGTAGAGCCCAATGGC	0.597																																						dbGAP											0													150.0	121.0	131.0					2																	27430388		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF069307	CCDS1740.1	2p23	2013-07-19	2013-07-19		ENSG00000138074	ENSG00000138074		"""Solute carriers"""	11041	protein-coding gene	gene with protein product		604024	"""solute carrier family 5 (sodium-dependent vitamin transporter), member 6"""			9516450, 10329687	Standard	NM_021095		Approved	SMVT	uc002rjd.3	Q9Y289	OTTHUMG00000097075	ENST00000310574.3:c.131T>G	2.37:g.27430388A>C	ENSP00000310208:p.Leu44Arg		B2RB85|D6W549|Q969Y5	Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.L44R	ENST00000310574.3	37	c.131	CCDS1740.1	2	.	.	.	.	.	.	.	.	.	.	A	23.3	4.402240	0.83230	.	.	ENSG00000138074	ENST00000310574;ENST00000408041;ENST00000412471;ENST00000401463;ENST00000432106;ENST00000426119;ENST00000414408;ENST00000428518	T;T;T;T;T;T;T;T	0.21932	1.98;1.98;1.98;1.98;1.98;1.98;1.98;1.98	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.49881	0.1583	M	0.86028	2.79	0.80722	D	1	D	0.89917	1.0	D	0.72075	0.976	T	0.57412	-0.7816	10	0.87932	D	0	.	13.3949	0.60846	1.0:0.0:0.0:0.0	.	44	Q9Y289	SC5A6_HUMAN	R	44	ENSP00000310208:L44R;ENSP00000384853:L44R;ENSP00000403851:L44R;ENSP00000384265:L44R;ENSP00000411536:L44R;ENSP00000401347:L44R;ENSP00000404032:L44R;ENSP00000402903:L44R	ENSP00000310208:L44R	L	-	2	0	SLC5A6	27283892	1.000000	0.71417	1.000000	0.80357	0.814000	0.46013	9.297000	0.96120	2.044000	0.60594	0.460000	0.39030	CTC	SLC5A6	-	pfscan_Na/solute_symporter	ENSG00000138074		0.597	SLC5A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A6	HGNC	protein_coding	OTTHUMT00000214194.1	136	0.72	1	A	NM_021095		27430388	27430388	-1	no_errors	ENST00000310574	ensembl	human	known	69_37n	missense	112	29.56	47	SNP	1.000	C
SOX30	11063	genome.wustl.edu	37	5	157073789	157073789	+	Nonsense_Mutation	SNP	G	G	A			TCGA-D8-A146-01A-31D-A10Y-09	TCGA-D8-A146-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9a7548dc-fc79-4ad4-a324-0e9f63c91a20	6d63e128-669b-4ac6-b2d3-10f6d7cf82d1	g.chr5:157073789G>A	ENST00000265007.6	-	3	1584	c.1243C>T	c.(1243-1245)Cga>Tga	p.R415*	SOX30_ENST00000519442.1_Nonsense_Mutation_p.R110*|SOX30_ENST00000311371.5_Nonsense_Mutation_p.R415*	NM_178424.1	NP_848511.1	O94993	SOX30_HUMAN	SRY (sex determining region Y)-box 30	415					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to corticosteroid (GO:0031960)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.R415*(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	23	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AGAGGGAATCGTTTTCGCTTC	0.368																																					Esophageal Squamous(31;525 799 19355 21125 41744)	dbGAP											1	Substitution - Nonsense(1)	pancreas(1)											119.0	118.0	119.0					5																	157073789		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB022083	CCDS4339.1, CCDS4340.1	5q33	2010-10-21			ENSG00000039600	ENSG00000039600		"""SRY (sex determining region Y)-boxes"""	30635	protein-coding gene	gene with protein product		606698				15019997, 11678506	Standard	NM_178424		Approved		uc003lxb.1	O94993	OTTHUMG00000130247	ENST00000265007.6:c.1243C>T	5.37:g.157073789G>A	ENSP00000265007:p.Arg415*		O94995|Q8IYX6	Nonsense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.R415*	ENST00000265007.6	37	c.1243	CCDS4339.1	5	.	.	.	.	.	.	.	.	.	.	G	40	8.234387	0.98719	.	.	ENSG00000039600	ENST00000311371;ENST00000265007;ENST00000519442	.	.	.	5.39	5.39	0.77823	.	0.000000	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.8914	0.70611	0.0:0.1424:0.8576:0.0	.	.	.	.	X	415;415;110	.	ENSP00000265007:R415X	R	-	1	2	SOX30	157006367	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.664000	0.54525	2.688000	0.91661	0.650000	0.86243	CGA	SOX30	-	NULL	ENSG00000039600		0.368	SOX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SOX30	HGNC	protein_coding	OTTHUMT00000252571.2	245	0.00	0	G	NM_007017		157073789	157073789	-1	no_errors	ENST00000265007	ensembl	human	known	69_37n	nonsense	275	17.91	60	SNP	1.000	A
TAS2R43	259289	genome.wustl.edu	37	12	11244166	11244166	+	Silent	SNP	G	G	C	rs35720106	byFrequency	TCGA-D8-A146-01A-31D-A10Y-09	TCGA-D8-A146-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9a7548dc-fc79-4ad4-a324-0e9f63c91a20	6d63e128-669b-4ac6-b2d3-10f6d7cf82d1	g.chr12:11244166G>C	ENST00000531678.1	-	1	746	c.663C>G	c.(661-663)acC>acG	p.T221T	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176884.2	NP_795365.2	P59537	T2R43_HUMAN	taste receptor, type 2, member 43	221					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)	p.T221T(1)		endometrium(1)|ovary(1)|prostate(2)|urinary_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		TGTGGACCTTGGTGCTGGGAT	0.398													.|||	3199	0.638778	0.1218	0.7205	5008	,	,		13366	0.9405		0.7793	False		,,,				2504	0.8241					dbGAP											1	Substitution - coding silent(1)	prostate(1)											130.0	112.0	118.0					12																	11244166		2176	4249	6425	-	-	-	SO:0001819	synonymous_variant	0			AF494237	CCDS53749.1	12p13.2	2012-08-22				ENSG00000255374		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18875	protein-coding gene	gene with protein product		612668				12379855	Standard	NM_176884		Approved	T2R52	uc001qzq.1	P59537		ENST00000531678.1:c.663C>G	12.37:g.11244166G>C			P59546|Q645X4	Silent	SNP	pfam_TAS2_rcpt	p.T221	ENST00000531678.1	37	c.663	CCDS53749.1	12																																																																																			TAS2R43	-	pfam_TAS2_rcpt	ENSG00000255374		0.398	TAS2R43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R43	HGNC	protein_coding	OTTHUMT00000383561.1	30	0.00	0	G	NM_176884		11244166	11244166	-1	no_errors	ENST00000531678	ensembl	human	known	69_37n	silent	84	10.64	10	SNP	0.185	C
UGT1A6	54578	genome.wustl.edu	37	2	234680926	234680926	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A146-01A-31D-A10Y-09	TCGA-D8-A146-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9a7548dc-fc79-4ad4-a324-0e9f63c91a20	6d63e128-669b-4ac6-b2d3-10f6d7cf82d1	g.chr2:234680926G>A	ENST00000305139.6	+	5	1459	c.1320G>A	c.(1318-1320)atG>atA	p.M440I	UGT1A9_ENST00000354728.4_Missense_Mutation_p.M438I|UGT1A7_ENST00000373426.3_Missense_Mutation_p.M438I|UGT1A1_ENST00000609637.1_Missense_Mutation_p.M438I|UGT1A6_ENST00000373424.1_Missense_Mutation_p.M173I|UGT1A1_ENST00000609767.1_Missense_Mutation_p.M442I|UGT1A1_ENST00000608383.1_Missense_Mutation_p.M441I|UGT1A8_ENST00000305208.5_Missense_Mutation_p.M441I|UGT1A5_ENST00000373414.3_Missense_Mutation_p.M442I|UGT1A1_ENST00000608381.1_Missense_Mutation_p.M442I|UGT1A3_ENST00000482026.1_Missense_Mutation_p.M442I|UGT1A1_ENST00000373450.4_Missense_Mutation_p.M438I|UGT1A10_ENST00000344644.5_Missense_Mutation_p.M438I|UGT1A4_ENST00000373409.3_Missense_Mutation_p.M442I	NM_001072.3	NP_001063.2	P19224	UD16_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A6	440					cellular glucuronidation (GO:0052695)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;5.86e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000384)|Lung(119;0.00306)|LUSC - Lung squamous cell carcinoma(224;0.00702)	Acetaminophen(DB00316)|Deferiprone(DB08826)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Propofol(DB00818)|Valproic Acid(DB00313)	AGAACATCATGCGCCTCTCCA	0.537																																						dbGAP											0													54.0	53.0	53.0					2																	234680926		2203	4300	6503	-	-	-	SO:0001583	missense	0			M84130	CCDS2507.1, CCDS2508.1	2q37	2010-03-05	2005-07-20		ENSG00000167165	ENSG00000167165		"""UDP glucuronosyltransferases"""	12538	other	complex locus constituent		606431	"""UDP glycosyltransferase 1 family, polypeptide A6"""			9295054, 1339448	Standard	NM_001072		Approved	HLUGP, GNT1, UGT1F		P19224	OTTHUMG00000059122	ENST00000305139.6:c.1320G>A	2.37:g.234680926G>A	ENSP00000303174:p.Met440Ile		A6NKK6|B8K289|Q96TE7	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.M442I	ENST00000305139.6	37	c.1326	CCDS2507.1	2	.	.	.	.	.	.	.	.	.	.	G	15.90	2.968371	0.53614	.	.	ENSG00000242366;ENSG00000242515;ENSG00000241119;ENSG00000244122;ENSG00000167165;ENSG00000167165;ENSG00000240224;ENSG00000244474;ENSG00000243135;ENSG00000241635	ENST00000373450;ENST00000344644;ENST00000354728;ENST00000373426;ENST00000373424;ENST00000305139;ENST00000373414;ENST00000373409;ENST00000482026;ENST00000305208	T;T;T;T;T;T;T;T;T;T	0.66995	-0.24;-0.24;-0.24;-0.24;-0.24;-0.24;-0.24;-0.24;-0.24;-0.24	5.83	4.96	0.65561	.	0.507438	0.22816	N	0.055286	T	0.72415	0.3457	M	0.85462	2.755	0.80722	D	1	B;B;B;B;B;B;B;B;B	0.23806	0.002;0.0;0.0;0.0;0.009;0.0;0.091;0.0;0.034	B;B;B;B;B;B;B;B;B	0.27262	0.033;0.001;0.001;0.001;0.022;0.001;0.078;0.001;0.057	T	0.73151	-0.4073	10	0.66056	D	0.02	.	15.2268	0.73357	0.0672:0.0:0.9328:0.0	.	441;442;442;442;440;438;438;438;438	P22309;P35503;P22310;P35504;P19224;Q9HAW7;O60656;Q9HAW8;Q9HAW9	UD11_HUMAN;UD13_HUMAN;UD14_HUMAN;UD15_HUMAN;UD16_HUMAN;UD17_HUMAN;UD19_HUMAN;UD110_HUMAN;UD18_HUMAN	I	438;438;438;438;173;440;442;442;442;441	ENSP00000362549:M438I;ENSP00000343838:M438I;ENSP00000346768:M438I;ENSP00000362525:M438I;ENSP00000362523:M173I;ENSP00000303174:M440I;ENSP00000362513:M442I;ENSP00000362508:M442I;ENSP00000418532:M442I;ENSP00000304845:M441I	ENSP00000343838:M438I	M	+	3	0	UGT1A7;UGT1A6;UGT1A10;UGT1A9;UGT1A8;UGT1A3;UGT1A5;UGT1A4;UGT1A1	234345665	0.998000	0.40836	1.000000	0.80357	0.708000	0.40852	4.464000	0.60134	1.493000	0.48517	-0.126000	0.14955	ATG	UGT1A4	-	pfam_UDP_glucos_trans	ENSG00000244474		0.537	UGT1A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT1A4	HGNC	protein_coding	OTTHUMT00000130988.1	82	0.00	0	G	NM_205862		234680926	234680926	+1	no_errors	ENST00000373409	ensembl	human	known	69_37n	missense	100	18.70	23	SNP	1.000	A
USP15	9958	genome.wustl.edu	37	12	62786084	62786084	+	Silent	SNP	A	A	G			TCGA-D8-A146-01A-31D-A10Y-09	TCGA-D8-A146-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9a7548dc-fc79-4ad4-a324-0e9f63c91a20	6d63e128-669b-4ac6-b2d3-10f6d7cf82d1	g.chr12:62786084A>G	ENST00000280377.5	+	18	2395	c.2337A>G	c.(2335-2337)aaA>aaG	p.K779K	USP15_ENST00000353364.3_Silent_p.K750K|USP15_ENST00000393654.3_Silent_p.K754K	NM_001252078.1	NP_001239007.1	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15	779	USP.				BMP signaling pathway (GO:0030509)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|protein deubiquitination (GO:0016579)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|identical protein binding (GO:0042802)|SMAD binding (GO:0046332)|transforming growth factor beta receptor binding (GO:0005160)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(15)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	37			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		TGGAGTATAAACCTCCTAAAA	0.308																																					Melanoma(181;615 2041 39364 49691 50001)	dbGAP											0													36.0	40.0	39.0					12																	62786084		2201	4283	6484	-	-	-	SO:0001819	synonymous_variant	0			AB011101	CCDS8963.1, CCDS58250.1, CCDS58251.1	12q14	2006-07-18	2005-08-08					"""Ubiquitin-specific peptidases"""	12613	protein-coding gene	gene with protein product		604731	"""ubiquitin specific protease 15"""			12838346	Standard	NM_001252078		Approved	KIAA0529, UNPH4	uc001src.2	Q9Y4E8	OTTHUMG00000170186	ENST00000280377.5:c.2337A>G	12.37:g.62786084A>G			Q08AL5|Q9H8G9|Q9HCA6|Q9UNP0|Q9Y5B5	Silent	SNP	pfam_Peptidase_C19,pfam_Pept_C19_DUSP,superfamily_RNA3'P_cycl/enolpyr_Trfase_a/b,smart_Pept_C19_DUSP,pfscan_Peptidase_C19	p.K779	ENST00000280377.5	37	c.2337	CCDS58251.1	12																																																																																			USP15	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000135655		0.308	USP15-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP15	HGNC	protein_coding	OTTHUMT00000407831.2	230	0.00	0	A	NM_006313		62786084	62786084	+1	no_errors	ENST00000280377	ensembl	human	known	69_37n	silent	161	28.32	64	SNP	1.000	G
ZNF181	339318	genome.wustl.edu	37	19	35232612	35232612	+	Silent	SNP	C	C	T			TCGA-D8-A146-01A-31D-A10Y-09	TCGA-D8-A146-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9a7548dc-fc79-4ad4-a324-0e9f63c91a20	6d63e128-669b-4ac6-b2d3-10f6d7cf82d1	g.chr19:35232612C>T	ENST00000492450.1	+	4	1415	c.1326C>T	c.(1324-1326)ttC>ttT	p.F442F	ZNF181_ENST00000459757.2_Silent_p.F441F|ZNF181_ENST00000392232.3_Silent_p.F486F			Q2M3W8	ZN181_HUMAN	zinc finger protein 181	442					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(6)|kidney(2)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|skin(1)	22	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)			GGAAATCCTTCAACCAGCTTG	0.378																																						dbGAP											0													35.0	34.0	34.0					19																	35232612		2201	4293	6494	-	-	-	SO:0001819	synonymous_variant	0			BC104759, H54888	CCDS32990.2, CCDS46043.1	19q13.13	2013-01-08	2006-04-27		ENSG00000197841	ENSG00000197841		"""Zinc fingers, C2H2-type"", ""-"""	12971	protein-coding gene	gene with protein product		606741	"""zinc finger protein 181 (HHZ181)"""				Standard	NM_001029997		Approved	HHZ181, MGC44316	uc002nvu.3	Q2M3W8	OTTHUMG00000157508	ENST00000492450.1:c.1326C>T	19.37:g.35232612C>T			B7ZKX3|Q49A75	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,smart_Znf_BED_prd,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F442	ENST00000492450.1	37	c.1326	CCDS32990.2	19																																																																																			ZNF181	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197841		0.378	ZNF181-002	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	ZNF181	HGNC	protein_coding	OTTHUMT00000349005.3	64	0.00	0	C	NM_001029997		35232612	35232612	+1	no_errors	ENST00000492450	ensembl	human	known	69_37n	silent	165	22.90	49	SNP	0.170	T
ZNF587	84914	genome.wustl.edu	37	19	58370865	58370865	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A146-01A-31D-A10Y-09	TCGA-D8-A146-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9a7548dc-fc79-4ad4-a324-0e9f63c91a20	6d63e128-669b-4ac6-b2d3-10f6d7cf82d1	g.chr19:58370865G>A	ENST00000339656.5	+	3	1267	c.1085G>A	c.(1084-1086)cGt>cAt	p.R362H	ZNF814_ENST00000597652.1_5'Flank|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF587_ENST00000419854.1_Missense_Mutation_p.R319H|ZNF587_ENST00000423137.1_Missense_Mutation_p.R361H|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000596604.1_Intron	NM_001204817.1|NM_032828.3	NP_001191746.1|NP_116217.1	Q96SQ5	ZN587_HUMAN	zinc finger protein 587	362					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	15		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)		AAATCTTTTCGTCAGAAGTTC	0.443																																					Pancreas(59;641 1233 1885 20055 50741)	dbGAP											0													76.0	86.0	83.0					19																	58370865		2203	4296	6499	-	-	-	SO:0001583	missense	0			AF294842	CCDS12964.1, CCDS56110.1	19q13.43	2013-01-08				ENSG00000198466		"""Zinc fingers, C2H2-type"", ""-"""	30955	protein-coding gene	gene with protein product						10520746	Standard	NM_032828		Approved	ZF6, FLJ14710, UBF-fl, FLJ20813	uc002qql.3	Q96SQ5	OTTHUMG00000154901	ENST00000339656.5:c.1085G>A	19.37:g.58370865G>A	ENSP00000345479:p.Arg362His		A0AV72|G3V0H5|Q6ZMK8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R362H	ENST00000339656.5	37	c.1085	CCDS12964.1	19	.	.	.	.	.	.	.	.	.	.	.	0.458	-0.890703	0.02491	.	.	ENSG00000198466	ENST00000376209;ENST00000423137;ENST00000339656;ENST00000540851;ENST00000419854	T;T;T	0.18016	2.24;2.24;2.24	1.76	-3.53	0.04667	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.11153	0.0272	L	0.43598	1.365	0.21897	N	0.999486	B;B	0.10296	0.003;0.0	B;B	0.11329	0.006;0.001	T	0.36529	-0.9744	8	0.41790	T	0.15	.	2.2222	0.03975	0.1343:0.3171:0.387:0.1615	.	361;362	G3V0H5;Q96SQ5	.;ZN587_HUMAN	H	319;361;362;362;319	ENSP00000393865:R361H;ENSP00000345479:R362H;ENSP00000406999:R319H	ENSP00000345479:R362H	R	+	2	0	ZNF587	63062677	.	.	0.002000	0.10522	0.034000	0.12701	.	.	-0.414000	0.07495	-1.152000	0.01820	CGT	ZNF587	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198466		0.443	ZNF587-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF587	HGNC	protein_coding	OTTHUMT00000337594.2	116	0.00	0	G	NM_032828		58370865	58370865	+1	no_errors	ENST00000339656	ensembl	human	known	69_37n	missense	356	20.54	92	SNP	0.000	A
ZNFX1	57169	genome.wustl.edu	37	20	47863858	47863858	+	Nonsense_Mutation	SNP	C	C	T			TCGA-D8-A146-01A-31D-A10Y-09	TCGA-D8-A146-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9a7548dc-fc79-4ad4-a324-0e9f63c91a20	6d63e128-669b-4ac6-b2d3-10f6d7cf82d1	g.chr20:47863858C>T	ENST00000396105.1	-	14	5949	c.5703G>A	c.(5701-5703)tgG>tgA	p.W1901*	ZNFX1_ENST00000371754.4_Intron|ZNFX1_ENST00000371752.1_Nonsense_Mutation_p.W1901*|ZNFX1_ENST00000469991.1_5'Flank	NM_021035.2	NP_066363.1	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	1901							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(8)|kidney(7)|large_intestine(15)|liver(1)|lung(17)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	60			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			CCGTGTCAGACCAGGCAGCAT	0.512																																						dbGAP											0													135.0	117.0	123.0					20																	47863858		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK022641	CCDS13417.1	20q13.13	2014-02-12			ENSG00000124201	ENSG00000124201			29271	protein-coding gene	gene with protein product						10718198	Standard	NM_021035		Approved	KIAA1404, FLJ11277	uc002xui.3	Q9P2E3	OTTHUMG00000032696	ENST00000396105.1:c.5703G>A	20.37:g.47863858C>T	ENSP00000379412:p.Trp1901*		Q9BQM7|Q9BQM8|Q9H8C1|Q9H9S2|Q9NUM1|Q9NWW1	Nonsense_Mutation	SNP	superfamily_ARM-type_fold,smart_Znf_NFX1	p.W1901*	ENST00000396105.1	37	c.5703	CCDS13417.1	20	.	.	.	.	.	.	.	.	.	.	C	45	11.664881	0.99589	.	.	ENSG00000124201	ENST00000371752;ENST00000396105	.	.	.	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.9349	18.6331	0.91368	0.0:1.0:0.0:0.0	.	.	.	.	X	1901	.	ENSP00000360817:W1901X	W	-	3	0	ZNFX1	47297265	1.000000	0.71417	1.000000	0.80357	0.812000	0.45895	6.014000	0.70784	2.758000	0.94735	0.563000	0.77884	TGG	ZNFX1	-	NULL	ENSG00000124201		0.512	ZNFX1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNFX1	HGNC	protein_coding	OTTHUMT00000079647.2	173	0.00	0	C	NM_021035		47863858	47863858	-1	no_errors	ENST00000371752	ensembl	human	known	69_37n	nonsense	184	38.74	117	SNP	1.000	T
