#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCB6	10058	genome.wustl.edu	37	2	220080803	220080803	+	Nonsense_Mutation	SNP	G	G	C			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr2:220080803G>C	ENST00000265316.3	-	5	1386	c.1070C>G	c.(1069-1071)tCa>tGa	p.S357*	ABCB6_ENST00000439002.2_Nonsense_Mutation_p.S311*	NM_005689.2	NP_005680.1	Q9NP58	ABCB6_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 6 (Langereis blood group)	357	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				brain development (GO:0007420)|cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|porphyrin-containing compound biosynthetic process (GO:0006779)|skin development (GO:0043588)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrial envelope (GO:0005740)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|efflux transmembrane transporter activity (GO:0015562)|heme binding (GO:0020037)|heme transporter activity (GO:0015232)|heme-transporting ATPase activity (GO:0015439)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	34		Renal(207;0.0474)		Epithelial(149;1.22e-06)|all cancers(144;0.000201)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCAGCGCAGTGAGAGCTCGTG	0.672																																						dbGAP											0													24.0	27.0	26.0					2																	220080803		2200	4296	6496	-	-	-	SO:0001587	stop_gained	0			AF070598	CCDS2436.1	2q36	2014-08-27	2014-08-27		ENSG00000115657	ENSG00000115657		"""ATP binding cassette transporters / subfamily B"""	47	protein-coding gene	gene with protein product	"""ATP-binding cassette half-transporter"""	605452	"""ATP-binding cassette, sub-family B (MDR/TAP), member 6"""			8894702, 9110174	Standard	NM_005689		Approved	EST45597, umat, MTABC3	uc002vkc.2	Q9NP58	OTTHUMG00000133131	ENST00000265316.3:c.1070C>G	2.37:g.220080803G>C	ENSP00000265316:p.Ser357*		O75542|Q49A66|Q59GQ5|Q6ZME6|Q96ME8|Q9HAQ6|Q9HAQ7	Nonsense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.S357*	ENST00000265316.3	37	c.1070	CCDS2436.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	41|41	8.755620|8.755620	0.98941|0.98941	.|.	.|.	ENSG00000115657|ENSG00000115657	ENST00000295750|ENST00000265316;ENST00000439002	.|.	.|.	.|.	5.08|5.08	5.08|5.08	0.68730|0.68730	.|.	.|0.059729	.|0.64402	.|D	.|0.000002	T|.	0.78780|.	0.4337|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.81167|.	-0.1056|.	4|.	.|0.87932	.|D	.|0	-7.6|-7.6	19.0333|19.0333	0.92967|0.92967	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	D|X	205|357;311	.|.	.|ENSP00000265316:S357X	H|S	-|-	1|2	0|0	ABCB6|ABCB6	219789047|219789047	1.000000|1.000000	0.71417|0.71417	0.975000|0.975000	0.42487|0.42487	0.997000|0.997000	0.91878|0.91878	7.533000|7.533000	0.81994|0.81994	2.793000|2.793000	0.96121|0.96121	0.655000|0.655000	0.94253|0.94253	CAC|TCA	ABCB6	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1	ENSG00000115657		0.672	ABCB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB6	HGNC	protein_coding	OTTHUMT00000256820.2	16	0.00	0	G	NM_005689		220080803	220080803	-1	no_errors	ENST00000265316	ensembl	human	known	69_37n	nonsense	12	29.41	5	SNP	1.000	C
ABCB6	10058	genome.wustl.edu	37	2	220082409	220082409	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr2:220082409C>A	ENST00000265316.3	-	2	986	c.670G>T	c.(670-672)Gat>Tat	p.D224Y	ABCB6_ENST00000439002.2_Intron	NM_005689.2	NP_005680.1	Q9NP58	ABCB6_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 6 (Langereis blood group)	224					brain development (GO:0007420)|cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|porphyrin-containing compound biosynthetic process (GO:0006779)|skin development (GO:0043588)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrial envelope (GO:0005740)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|efflux transmembrane transporter activity (GO:0015562)|heme binding (GO:0020037)|heme transporter activity (GO:0015232)|heme-transporting ATPase activity (GO:0015439)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	34		Renal(207;0.0474)		Epithelial(149;1.22e-06)|all cancers(144;0.000201)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTTTCCACATCTTGGTCCTCT	0.537																																						dbGAP											0													91.0	97.0	95.0					2																	220082409		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF070598	CCDS2436.1	2q36	2014-08-27	2014-08-27		ENSG00000115657	ENSG00000115657		"""ATP binding cassette transporters / subfamily B"""	47	protein-coding gene	gene with protein product	"""ATP-binding cassette half-transporter"""	605452	"""ATP-binding cassette, sub-family B (MDR/TAP), member 6"""			8894702, 9110174	Standard	NM_005689		Approved	EST45597, umat, MTABC3	uc002vkc.2	Q9NP58	OTTHUMG00000133131	ENST00000265316.3:c.670G>T	2.37:g.220082409C>A	ENSP00000265316:p.Asp224Tyr		O75542|Q49A66|Q59GQ5|Q6ZME6|Q96ME8|Q9HAQ6|Q9HAQ7	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.D224Y	ENST00000265316.3	37	c.670	CCDS2436.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.62|15.62	2.886167|2.886167	0.51908|0.51908	.|.	.|.	ENSG00000115657|ENSG00000115657	ENST00000265316|ENST00000427013	D|.	0.88277|.	-2.36|.	5.62|5.62	4.75|4.75	0.60458|0.60458	ABC transporter, transmembrane domain, type 1 (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.70491|0.70491	0.3230|0.3230	M|M	0.63843|0.63843	1.955|1.955	0.80722|0.80722	D|D	1|1	P|.	0.37038|.	0.579|.	B|.	0.36186|.	0.219|.	T|T	0.70156|0.70156	-0.4949|-0.4949	10|5	0.72032|.	D|.	0.01|.	-9.7287|-9.7287	14.7031|14.7031	0.69168|0.69168	0.0:0.9303:0.0:0.0697|0.0:0.9303:0.0:0.0697	.|.	224|.	Q9NP58|.	ABCB6_HUMAN|.	Y|N	224|201	ENSP00000265316:D224Y|.	ENSP00000265316:D224Y|.	D|K	-|-	1|3	0|2	ABCB6|ABCB6	219790653|219790653	1.000000|1.000000	0.71417|0.71417	0.939000|0.939000	0.37840|0.37840	0.672000|0.672000	0.39443|0.39443	7.445000|7.445000	0.80570|0.80570	1.517000|1.517000	0.48917|0.48917	0.561000|0.561000	0.74099|0.74099	GAT|AAG	ABCB6	-	superfamily_ABC_transptrTM_dom_typ1	ENSG00000115657		0.537	ABCB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB6	HGNC	protein_coding	OTTHUMT00000256820.2	56	0.00	0	C	NM_005689		220082409	220082409	-1	no_errors	ENST00000265316	ensembl	human	known	69_37n	missense	42	36.36	24	SNP	1.000	A
ACACA	31	genome.wustl.edu	37	17	35597396	35597396	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr17:35597396C>G	ENST00000394406.2	-	24	3196	c.3006G>C	c.(3004-3006)caG>caC	p.Q1002H	ACACA_ENST00000353139.5_Missense_Mutation_p.Q1039H|ACACA_ENST00000335166.5_Missense_Mutation_p.Q924H|ACACA_ENST00000360679.3_Missense_Mutation_p.Q944H	NM_198836.1	NP_942133.1	Q13085	ACACA_HUMAN	acetyl-CoA carboxylase alpha	1002					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|lipid homeostasis (GO:0055088)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|malonyl-CoA biosynthetic process (GO:2001295)|multicellular organismal protein metabolic process (GO:0044268)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(2)|breast(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(24)|lung(23)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	83		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	GCTTACCATTCTGGAATTGTG	0.498																																					Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)	dbGAP											0													102.0	85.0	91.0					17																	35597396		2203	4300	6503	-	-	-	SO:0001583	missense	0			U19822	CCDS11317.1, CCDS11318.1, CCDS42302.1, CCDS42303.1	17q21	2014-05-06	2010-04-30		ENSG00000132142	ENSG00000278540	6.4.1.2		84	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 1"""	200350	"""acetyl-Coenzyme A carboxylase alpha"""	ACAC, ACC			Standard	NM_198837		Approved	ACC1	uc002hno.3	Q13085	OTTHUMG00000188463	ENST00000394406.2:c.3006G>C	17.37:g.35597396C>G	ENSP00000377928:p.Gln1002His		B2RP68|Q6KEV6|Q6XDA8|Q7Z2G8|Q7Z561|Q7Z563|Q7Z564|Q86WB2|Q86WB3	Missense_Mutation	SNP	pfam_AcCoA_COase_cen,pfam_Carboxyl_trans,pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_Biotin_lipoyl,pfam_Dala_Dala_lig_C,pfam_ATP-grasp_carboxylate-amine,superfamily_PreATP-grasp_fold,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_COA_CT_N,pfscan_COA_CT_C,pfscan_Biotin_lipoyl	p.Q1039H	ENST00000394406.2	37	c.3117	CCDS11317.1	17	.	.	.	.	.	.	.	.	.	.	C	20.7	4.033203	0.75504	.	.	ENSG00000132142	ENST00000353139;ENST00000360679;ENST00000394406;ENST00000452074;ENST00000335166	T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17	5.52	4.55	0.56014	Acetyl-CoA carboxylase, central domain (1);	0.000000	0.85682	D	0.000000	T	0.76456	0.3990	M	0.83603	2.65	0.80722	D	1	P;P;P	0.52316	0.906;0.952;0.941	P;P;P	0.61874	0.817;0.895;0.753	T	0.78575	-0.2151	10	0.56958	D	0.05	-13.3488	9.8899	0.41283	0.0:0.8469:0.0:0.1531	.	1039;1002;944	Q13085-4;Q13085;Q13085-2	.;ACACA_HUMAN;.	H	1039;944;1002;1026;924	ENSP00000344789:Q1039H;ENSP00000353898:Q944H;ENSP00000377928:Q1002H;ENSP00000335323:Q924H	ENSP00000335323:Q924H	Q	-	3	2	ACACA	32671509	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.641000	0.46587	1.571000	0.49722	0.563000	0.77884	CAG	ACACA	-	pfam_AcCoA_COase_cen	ENSG00000132142		0.498	ACACA-009	KNOWN	basic|appris_principal|CCDS	protein_coding	ACACA	HGNC	protein_coding	OTTHUMT00000256696.1	48	0.00	0	C	NM_198836		35597396	35597396	-1	no_errors	ENST00000353139	ensembl	human	known	69_37n	missense	103	18.90	24	SNP	1.000	G
ACSF2	80221	genome.wustl.edu	37	17	48551306	48551306	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr17:48551306C>T	ENST00000300441.4	+	14	1773	c.1669C>T	c.(1669-1671)Cgg>Tgg	p.R557W	ACSF2_ENST00000504392.1_Missense_Mutation_p.R514W|ACSF2_ENST00000502667.1_Missense_Mutation_p.R544W|ACSF2_ENST00000506085.1_3'UTR|ACSF2_ENST00000427954.2_Missense_Mutation_p.R582W|ACSF2_ENST00000541920.1_Missense_Mutation_p.R397W	NM_025149.4	NP_079425.3	Q96CM8	ACSF2_HUMAN	acyl-CoA synthetase family member 2	557					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ligase activity (GO:0016874)			endometrium(7)|kidney(3)|large_intestine(1)|lung(1)|stomach(1)	13	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			TGCCTGCATTCGGCTGAAGGA	0.532																																						dbGAP											0													73.0	70.0	71.0					17																	48551306		2199	4300	6499	-	-	-	SO:0001583	missense	0			AK024573, BC012053	CCDS11567.1, CCDS74103.1, CCDS74104.1, CCDS74105.1	17q21.33	2007-10-17			ENSG00000167107	ENSG00000167107		"""Acyl-CoA synthetase family"""	26101	protein-coding gene	gene with protein product		610465				17762044	Standard	NM_001288968		Approved	FLJ20920, ACSMW	uc002iqu.2	Q96CM8	OTTHUMG00000162128	ENST00000300441.4:c.1669C>T	17.37:g.48551306C>T	ENSP00000300441:p.Arg557Trp		B4DFQ6|B4DHT5|B4DUF5|Q9H7G2	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.R557W	ENST00000300441.4	37	c.1669	CCDS11567.1	17	.	.	.	.	.	.	.	.	.	.	C	19.98	3.927328	0.73327	.	.	ENSG00000167107	ENST00000300441;ENST00000541920;ENST00000504392;ENST00000427954;ENST00000502667	T;T;T;T;T	0.57595	0.39;0.39;0.39;0.39;0.39	5.02	4.02	0.46733	.	0.057432	0.64402	D	0.000001	T	0.76688	0.4022	M	0.90425	3.115	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.997;0.999;0.999	T	0.81915	-0.0714	10	0.66056	D	0.02	-9.5203	14.4283	0.67230	0.1487:0.8513:0.0:0.0	.	544;582;514;557	B4DHT5;B4DFQ6;E9PF16;Q96CM8	.;.;.;ACSF2_HUMAN	W	557;397;514;582;544	ENSP00000300441:R557W;ENSP00000437987:R397W;ENSP00000425964:R514W;ENSP00000401831:R582W;ENSP00000421884:R544W	ENSP00000300441:R557W	R	+	1	2	ACSF2	45906305	1.000000	0.71417	0.999000	0.59377	0.947000	0.59692	1.378000	0.34328	1.056000	0.40484	0.561000	0.74099	CGG	ACSF2	-	NULL	ENSG00000167107		0.532	ACSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSF2	HGNC	protein_coding	OTTHUMT00000367423.3	85	0.00	0	C	NM_025149		48551306	48551306	+1	no_errors	ENST00000300441	ensembl	human	known	69_37n	missense	34	51.43	36	SNP	1.000	T
ADCK3	56997	genome.wustl.edu	37	1	227149179	227149179	+	Silent	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr1:227149179C>T	ENST00000366779.1	+	7	2864	c.93C>T	c.(91-93)ggC>ggT	p.G31G	ADCK3_ENST00000458507.2_Intron|ADCK3_ENST00000478406.1_Intron|ADCK3_ENST00000366777.3_Silent_p.G31G|ADCK3_ENST00000366778.1_Intron			Q8NI60	ADCK3_HUMAN	aarF domain containing kinase 3	31					cell death (GO:0008219)|ubiquinone biosynthetic process (GO:0006744)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|kidney(2)|large_intestine(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	9						AGCACTTGGGCATCGGAGGGG	0.617																																						dbGAP											0													44.0	45.0	44.0					1																	227149179		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ278126	CCDS1557.1	1q42.11	2011-05-03	2010-10-01	2010-10-01	ENSG00000163050	ENSG00000163050			16812	protein-coding gene	gene with protein product	"""coenzyme Q8 homolog (yeast)"""	606980	"""chaperone-ABC1 (activity of bc1 complex, S.pombe)-like"", ""chaperone, ABC1 activity of bc1 complex like (S. pombe)"", ""chaperone, ABC1 activity of bc1 complex homolog (S. pombe)"""	CABC1			Standard	NM_020247		Approved	COQ8, SCAR9	uc001hqn.1	Q8NI60	OTTHUMG00000037621	ENST00000366779.1:c.93C>T	1.37:g.227149179C>T			Q5T7A5|Q63HK0|Q8NCJ6|Q9HBQ1|Q9NQ67	Silent	SNP	pfam_UbiB_dom,superfamily_Kinase-like_dom	p.G31	ENST00000366779.1	37	c.93	CCDS1557.1	1																																																																																			ADCK3	-	NULL	ENSG00000163050		0.617	ADCK3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ADCK3	HGNC	protein_coding	OTTHUMT00000091712.1	33	0.00	0	C	NM_020247		227149179	227149179	+1	no_errors	ENST00000366777	ensembl	human	known	69_37n	silent	31	22.50	9	SNP	0.471	T
ALDH1L2	160428	genome.wustl.edu	37	12	105440687	105440687	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr12:105440687C>G	ENST00000258494.9	-	14	1887	c.1747G>C	c.(1747-1749)Gag>Cag	p.E583Q	C12orf45_ENST00000548583.1_Intron	NM_001034173.3	NP_001029345.2	Q3SY69	AL1L2_HUMAN	aldehyde dehydrogenase 1 family, member L2	583	Aldehyde dehydrogenase.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|prostate(2)|skin(3)|stomach(2)	35						CCGAGTGGCTCTTTCTTGGTG	0.403																																						dbGAP											0													209.0	206.0	207.0					12																	105440687		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095827	CCDS31891.1	12q23.3	2014-09-11			ENSG00000136010	ENSG00000136010	1.5.1.6	"""Aldehyde dehydrogenases"""	26777	protein-coding gene	gene with protein product	"""mitochondrial 10-formyltetrahydrofolate dehydrogenase"""	613584				20498374	Standard	NM_001034173		Approved	FLJ38508, mtFDH	uc001tlc.3	Q3SY69	OTTHUMG00000169823	ENST00000258494.9:c.1747G>C	12.37:g.105440687C>G	ENSP00000258494:p.Glu583Gln		Q3SY68|Q68D62|Q6AI55|Q8N922	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,pfam_Formyl_transf_N,pfam_Formyl_trans_C,pfam_Acyl_carrier_prot-like,superfamily_Ald_DH/histidinol_DH,superfamily_Formyl_transf_N,superfamily_Formyl_transferase_C-like,superfamily_Acyl_carrier_prot-like,pirsf_10_FTHF_DH,pfscan_Acyl_carrier_prot-like	p.E583Q	ENST00000258494.9	37	c.1747	CCDS31891.1	12	.	.	.	.	.	.	.	.	.	.	C	29.7	5.025272	0.93518	.	.	ENSG00000136010	ENST00000258494	T	0.77877	-1.13	5.9	5.9	0.94986	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.092309	0.85682	D	0.000000	D	0.87533	0.6201	L	0.61036	1.89	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.87519	0.2445	10	0.87932	D	0	.	20.2631	0.98458	0.0:1.0:0.0:0.0	.	583	Q3SY69	AL1L2_HUMAN	Q	583	ENSP00000258494:E583Q	ENSP00000258494:E583Q	E	-	1	0	ALDH1L2	103964817	1.000000	0.71417	1.000000	0.80357	0.797000	0.45037	7.711000	0.84669	2.788000	0.95919	0.655000	0.94253	GAG	ALDH1L2	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH,pirsf_10_FTHF_DH	ENSG00000136010		0.403	ALDH1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1L2	HGNC	protein_coding	OTTHUMT00000406098.1	155	0.00	0	C	XM_090294		105440687	105440687	-1	no_errors	ENST00000258494	ensembl	human	known	69_37n	missense	133	30.73	59	SNP	1.000	G
AMBN	258	genome.wustl.edu	37	4	71469607	71469607	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr4:71469607G>C	ENST00000322937.6	+	12	870	c.767G>C	c.(766-768)aGa>aCa	p.R256T	AMBN_ENST00000449493.2_Missense_Mutation_p.R241T	NM_016519.5	NP_057603.1	Q9NP70	AMBN_HUMAN	ameloblastin (enamel matrix protein)	256					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|odontogenesis of dentin-containing tooth (GO:0042475)	proteinaceous extracellular matrix (GO:0005578)	growth factor activity (GO:0008083)|structural constituent of tooth enamel (GO:0030345)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)	29			Lung(101;0.235)			GCCCCTGCCAGACTTGGCATC	0.393																																						dbGAP											0													90.0	86.0	88.0					4																	71469607		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF209780	CCDS3543.1	4q21	2006-11-28	2006-04-27		ENSG00000178522	ENSG00000178522			452	protein-coding gene	gene with protein product		601259	"""ameloblastin, enamel matrix protein"""			9126491	Standard	NM_016519		Approved		uc003hfl.3	Q9NP70	OTTHUMG00000129913	ENST00000322937.6:c.767G>C	4.37:g.71469607G>C	ENSP00000313809:p.Arg256Thr		Q3B862|Q9H2X1|Q9H4L1	Missense_Mutation	SNP	pfam_Amelin,smart_Amelin	p.R256T	ENST00000322937.6	37	c.767	CCDS3543.1	4	.	.	.	.	.	.	.	.	.	.	G	19.12	3.766379	0.69878	.	.	ENSG00000178522	ENST00000322937;ENST00000538728;ENST00000449493	T;T	0.37584	1.19;1.19	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.60274	0.2256	M	0.72894	2.215	0.45415	D	0.998391	D	0.89917	1.0	D	0.87578	0.998	T	0.61436	-0.7063	10	0.87932	D	0	-19.3701	15.7206	0.77708	0.0:0.0:1.0:0.0	.	256	Q9NP70	AMBN_HUMAN	T	256;255;241	ENSP00000313809:R256T;ENSP00000391234:R241T	ENSP00000313809:R256T	R	+	2	0	AMBN	71504196	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.575000	0.46025	2.859000	0.98148	0.591000	0.81541	AGA	AMBN	-	pfam_Amelin,smart_Amelin	ENSG00000178522		0.393	AMBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMBN	HGNC	protein_coding	OTTHUMT00000252165.1	63	0.00	0	G	NM_016519		71469607	71469607	+1	no_errors	ENST00000322937	ensembl	human	known	69_37n	missense	51	37.80	31	SNP	1.000	C
ANKRD36	375248	genome.wustl.edu	37	2	97860646	97860646	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr2:97860646C>A	ENST00000461153.2	+	40	2787	c.2543C>A	c.(2542-2544)tCt>tAt	p.S848Y	ANKRD36_ENST00000420699.2_Missense_Mutation_p.S848Y			A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	848										endometrium(9)|kidney(5)|liver(1)|lung(3)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23						GGAGAAATATCTAGGAAAGGT	0.368																																						dbGAP											0													107.0	115.0	112.0					2																	97860646		692	1591	2283	-	-	-	SO:0001583	missense	0			BC046186	CCDS54379.1	2q11.2	2013-09-24			ENSG00000135976	ENSG00000135976		"""Ankyrin repeat domain containing"""	24079	protein-coding gene	gene with protein product						12975309	Standard	NM_001164315		Approved	UNQ2430	uc010yva.2	A6QL64	OTTHUMG00000155256	ENST00000461153.2:c.2543C>A	2.37:g.97860646C>A	ENSP00000419530:p.Ser848Tyr		B4E3I8|Q6UX02|Q86X62|Q9HCD1	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S848Y	ENST00000461153.2	37	c.2543	CCDS54379.1	2	.	.	.	.	.	.	.	.	.	.	.	10.70	1.425388	0.25639	.	.	ENSG00000135976	ENST00000461153;ENST00000420699;ENST00000461694	D;D	0.81739	-1.53;-1.53	0.659	0.659	0.17861	.	.	.	.	.	T	0.74076	0.3669	L	0.38175	1.15	0.09310	N	1	D	0.54964	0.969	P	0.47430	0.547	T	0.64407	-0.6415	8	0.87932	D	0	.	.	.	.	.	848	A6QL64	AN36A_HUMAN	Y	848;848;210	ENSP00000419530:S848Y;ENSP00000391950:S848Y	ENSP00000391950:S848Y	S	+	2	0	ANKRD36	97224373	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.342000	0.07801	0.623000	0.30267	0.194000	0.17425	TCT	ANKRD36	-	NULL	ENSG00000135976		0.368	ANKRD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD36	HGNC	protein_coding	OTTHUMT00000339154.5	213	0.00	0	C			97860646	97860646	+1	no_errors	ENST00000420699	ensembl	human	known	69_37n	missense	264	16.72	53	SNP	0.001	A
APH1B	83464	genome.wustl.edu	37	15	63569883	63569884	+	Frame_Shift_Del	DEL	TA	TA	-			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	TA	TA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr15:63569883_63569884delTA	ENST00000261879.5	+	1	131_132	c.61_62delTA	c.(61-63)tatfs	p.Y21fs	APH1B_ENST00000380343.4_Frame_Shift_Del_p.Y21fs	NM_001145646.1|NM_031301.3	NP_001139118.1|NP_112591.2	Q8WW43	APH1B_HUMAN	APH1B gamma secretase subunit	21					apoptotic signaling pathway (GO:0097190)|membrane protein intracellular domain proteolysis (GO:0031293)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|protein processing (GO:0016485)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|transport vesicle (GO:0030133)	peptidase activity (GO:0008233)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)	12						GCTCGCCCTTTATGTCTTCACC	0.693																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AY358698	CCDS10184.1, CCDS45276.1	15q22.2	2013-05-01	2013-05-01		ENSG00000138613	ENSG00000138613			24080	protein-coding gene	gene with protein product		607630	"""anterior pharynx defective 1 homolog B (C. elegans)"""			12110170, 11230166	Standard	NM_031301		Approved	PSFL, APH-1B, DKFZp564D0372	uc002ama.3	Q8WW43	OTTHUMG00000132863	ENST00000261879.5:c.61_62delTA	15.37:g.63569883_63569884delTA	ENSP00000261879:p.Tyr21fs		A8K589|Q564N3|Q6UWQ1|Q9H0S0	Frame_Shift_Del	DEL	pfam_Aph-1	p.Y21fs	ENST00000261879.5	37	c.61_62	CCDS10184.1	15																																																																																			APH1B	-	pfam_Aph-1	ENSG00000138613		0.693	APH1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APH1B	HGNC	protein_coding	OTTHUMT00000256337.1	34	0.00	0	TA	NM_031301		63569883	63569884	+1	no_errors	ENST00000261879	ensembl	human	known	69_37n	frame_shift_del	16	30.43	7	DEL	0.986:0.882	-
APOBR	55911	genome.wustl.edu	37	16	28507855	28507855	+	Missense_Mutation	SNP	G	G	C	rs200832612		TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr16:28507855G>C	ENST00000431282.1	+	3	1476	c.1466G>C	c.(1465-1467)aGa>aCa	p.R489T	APOBR_ENST00000328423.5_Missense_Mutation_p.R489T|APOBR_ENST00000564831.1_Missense_Mutation_p.R498T|CLN3_ENST00000567160.1_5'Flank|CLN3_ENST00000569430.1_5'Flank			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor	489	Glu-rich.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						CAGGAGGAGAGAGGGAGCAGC	0.642																																						dbGAP											0													21.0	26.0	25.0					16																	28507855		2136	4233	6369	-	-	-	SO:0001583	missense	0			AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83		ENST00000431282.1:c.1466G>C	16.37:g.28507855G>C	ENSP00000416094:p.Arg489Thr		H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Missense_Mutation	SNP	NULL	p.R498T	ENST00000431282.1	37	c.1493		16	.	.	.	.	.	.	.	.	.	.	G	14.40	2.524720	0.44969	.	.	ENSG00000184730	ENST00000328423;ENST00000431282	T;T	0.73047	-0.71;-0.71	4.54	-3.87	0.04218	.	.	.	.	.	T	0.47600	0.1454	N	0.24115	0.695	0.09310	N	1	P;B	0.45827	0.867;0.337	B;B	0.41202	0.35;0.055	T	0.42207	-0.9465	9	0.27082	T	0.32	-1.5824	3.2541	0.06826	0.2899:0.1371:0.4389:0.1341	.	489;489	Q0VD83;Q9NS13	APOBR_HUMAN;.	T	489	ENSP00000327669:R489T;ENSP00000416094:R489T	ENSP00000327669:R489T	R	+	2	0	APOBR	28415356	0.000000	0.05858	0.000000	0.03702	0.130000	0.20726	-0.396000	0.07278	-1.116000	0.02969	-0.482000	0.04802	AGA	APOBR	-	NULL	ENSG00000184730		0.642	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	APOBR	HGNC	protein_coding		25	0.00	0	G	NM_182804		28507855	28507855	+1	no_errors	ENST00000564831	ensembl	human	known	69_37n	missense	29	30.95	13	SNP	0.001	C
ARPC5	10092	genome.wustl.edu	37	1	183599740	183599740	+	Silent	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr1:183599740G>A	ENST00000359856.6	-	3	315	c.249C>T	c.(247-249)ctC>ctT	p.L83L	ARPC5_ENST00000462965.1_5'UTR|ARPC5_ENST00000367534.1_Silent_p.L83L|ARPC5_ENST00000294742.6_Silent_p.L86L	NM_005717.3	NP_005708.1	O15511	ARPC5_HUMAN	actin related protein 2/3 complex, subunit 5, 16kDa	83					actin cytoskeleton organization (GO:0030036)|Arp2/3 complex-mediated actin nucleation (GO:0034314)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	structural constituent of cytoskeleton (GO:0005200)			cervix(1)|large_intestine(1)|lung(2)	4						TAAAAGAGATGAGCACCTTCA	0.388																																					Melanoma(136;1596 1789 3041 4830 41075)	dbGAP											0													76.0	79.0	78.0					1																	183599740		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF017807	CCDS1357.1, CCDS58050.1	1q	2011-07-06	2002-08-29		ENSG00000162704	ENSG00000162704		"""Actin related protein 2/3 complex subunits"""	708	protein-coding gene	gene with protein product	"""Arp2/3 protein complex subunit p16"""	604227	"""actin related protein 2/3 complex, subunit 5 (16 kD)"""			9359840, 9230079	Standard	NM_005717		Approved	p16-Arc, ARC16, dJ127C7.3	uc021pgb.2	O15511	OTTHUMG00000035326	ENST00000359856.6:c.249C>T	1.37:g.183599740G>A			A6NEC4|Q6PG42	Silent	SNP	pfam_ARP2/3_p16_Arc,superfamily_ARP2/3_p16_Arc	p.L86	ENST00000359856.6	37	c.258	CCDS1357.1	1																																																																																			ARPC5	-	pfam_ARP2/3_p16_Arc,superfamily_ARP2/3_p16_Arc	ENSG00000162704		0.388	ARPC5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARPC5	HGNC	protein_coding	OTTHUMT00000085477.1	66	0.00	0	G	NM_005717		183599740	183599740	-1	no_errors	ENST00000294742	ensembl	human	known	69_37n	silent	105	23.74	33	SNP	1.000	A
ATF7IP	55729	genome.wustl.edu	37	12	14614037	14614037	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr12:14614037G>A	ENST00000540793.1	+	8	2922	c.2767G>A	c.(2767-2769)Gaa>Aaa	p.E923K	ATF7IP_ENST00000536444.1_Missense_Mutation_p.E922K|ATF7IP_ENST00000543189.1_Missense_Mutation_p.E922K|ATF7IP_ENST00000544627.1_Missense_Mutation_p.E931K|ATF7IP_ENST00000261168.4_Missense_Mutation_p.E923K			Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting protein	923					DNA methylation (GO:0006306)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045898)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)				cervix(1)|endometrium(7)|kidney(5)|large_intestine(10)|liver(2)|lung(22)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	54						GTCTGCTGCAGAACAGAACAG	0.398																																						dbGAP											0													57.0	56.0	57.0					12																	14614037		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ242978	CCDS8663.1, CCDS66326.1, CCDS66327.1, CCDS73449.1	12p13.1	2005-11-18				ENSG00000171681			20092	protein-coding gene	gene with protein product		613644				10976766, 10777215	Standard	XM_005253424		Approved	FLJ10688, p621	uc001rbw.3	Q6VMQ6		ENST00000540793.1:c.2767G>A	12.37:g.14614037G>A	ENSP00000444589:p.Glu923Lys		F5GX74|G3V1U0|Q4G0T9|Q6P3T3|Q86XW5|Q9NVJ9|Q9NWC2|Q9Y4X8	Missense_Mutation	SNP	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.E923K	ENST00000540793.1	37	c.2767	CCDS8663.1	12	.	.	.	.	.	.	.	.	.	.	G	27.5	4.836907	0.91117	.	.	ENSG00000171681	ENST00000261168;ENST00000543189;ENST00000536444;ENST00000544627;ENST00000540793	T;T;T;T;T	0.20463	2.07;2.08;2.07;2.07;2.07	6.16	6.16	0.99307	.	0.075598	0.56097	D	0.000030	T	0.43964	0.1271	L	0.59436	1.845	0.58432	D	0.999996	D;D;D;D	0.63046	0.971;0.971;0.992;0.992	P;P;D;D	0.63113	0.783;0.783;0.911;0.911	T	0.01630	-1.1308	9	.	.	.	-14.5064	20.8598	0.99761	0.0:0.0:1.0:0.0	.	922;923;922;534	G3V1U0;Q6VMQ6;Q6VMQ6-2;B3KQF8	.;MCAF1_HUMAN;.;.	K	923;922;922;931;923	ENSP00000261168:E923K;ENSP00000443179:E922K;ENSP00000445955:E922K;ENSP00000440440:E931K;ENSP00000444589:E923K	.	E	+	1	0	ATF7IP	14505304	1.000000	0.71417	1.000000	0.80357	0.825000	0.46686	6.740000	0.74832	2.937000	0.99478	0.650000	0.86243	GAA	ATF7IP	-	NULL	ENSG00000171681		0.398	ATF7IP-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATF7IP	HGNC	protein_coding	OTTHUMT00000401400.1	29	0.00	0	G	NM_018179		14614037	14614037	+1	no_errors	ENST00000261168	ensembl	human	known	69_37n	missense	22	33.33	11	SNP	1.000	A
ATM	472	genome.wustl.edu	37	11	108124566	108124566	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr11:108124566G>A	ENST00000452508.2	+	14	2113	c.1924G>A	c.(1924-1926)Gaa>Aaa	p.E642K	ATM_ENST00000278616.4_Missense_Mutation_p.E642K			Q13315	ATM_HUMAN	ATM serine/threonine kinase	642					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	AGATAAAGAAGAACTTTCATT	0.308			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																												dbGAP	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	0													64.0	65.0	65.0					11																	108124566		2201	4298	6499	-	-	-	SO:0001583	missense	0	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.1924G>A	11.37:g.108124566G>A	ENSP00000388058:p.Glu642Lys		B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.E642K	ENST00000452508.2	37	c.1924	CCDS31669.1	11	.	.	.	.	.	.	.	.	.	.	G	17.83	3.485490	0.63962	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508	T;T;T	0.01963	4.53;4.83;4.83	6.11	6.11	0.99139	Armadillo-type fold (1);	0.163738	0.53938	D	0.000052	T	0.04543	0.0124	M	0.69823	2.125	0.34071	D	0.658502	B	0.22276	0.067	B	0.15052	0.012	T	0.31779	-0.9931	10	0.16896	T	0.51	.	17.4535	0.87599	0.0:0.0:1.0:0.0	.	642	Q13315	ATM_HUMAN	K	642	ENSP00000435747:E642K;ENSP00000278616:E642K;ENSP00000388058:E642K	ENSP00000278616:E642K	E	+	1	0	ATM	107629776	1.000000	0.71417	0.992000	0.48379	0.908000	0.53690	6.149000	0.71795	2.906000	0.99361	0.655000	0.94253	GAA	ATM	-	superfamily_ARM-type_fold	ENSG00000149311		0.308	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	HGNC	protein_coding	OTTHUMT00000389938.1	68	0.00	0	G	NM_000051		108124566	108124566	+1	no_errors	ENST00000278616	ensembl	human	known	69_37n	missense	13	71.11	32	SNP	0.994	A
BCAP31	10134	genome.wustl.edu	37	X	152986357	152986357	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chrX:152986357G>A	ENST00000345046.6	-	3	570	c.163C>T	c.(163-165)Ctc>Ttc	p.L55F	BCAP31_ENST00000458587.2_Missense_Mutation_p.L122F|BCAP31_ENST00000468947.1_5'UTR|BCAP31_ENST00000441714.1_Missense_Mutation_p.L55F	NM_001256447.1	NP_001243376.1	P51572	BAP31_HUMAN	B-cell receptor-associated protein 31	55					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|protein localization to endoplasmic reticulum exit site (GO:0070973)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of plasma membrane (GO:0005887)|lipid particle (GO:0005811)|membrane (GO:0016020)				endometrium(2)|large_intestine(2)|lung(2)|prostate(1)	7	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ATGACAATGAGAACCACAAAG	0.502																																						dbGAP											0													201.0	140.0	161.0					X																	152986357		2203	4300	6503	-	-	-	SO:0001583	missense	0			X81109	CCDS14727.1, CCDS48191.1	Xq28	2005-10-11			ENSG00000185825	ENSG00000185825			16695	protein-coding gene	gene with protein product		300398					Standard	NM_001139441		Approved	DXS1357E, BAP31, 6C6-Ag, CDM	uc011mza.1	P51572	OTTHUMG00000024218	ENST00000345046.6:c.163C>T	X.37:g.152986357G>A	ENSP00000343458:p.Leu55Phe		B3KQ79|D3DWV5|Q13836|Q96CF0	Missense_Mutation	SNP	pfam_Bap31	p.L122F	ENST00000345046.6	37	c.364	CCDS14727.1	X	.	.	.	.	.	.	.	.	.	.	G	21.4	4.138458	0.77775	.	.	ENSG00000185825	ENST00000441714;ENST00000345046;ENST00000426131;ENST00000458587;ENST00000442093;ENST00000429550;ENST00000416815;ENST00000423827;ENST00000430088	.	.	.	5.77	5.77	0.91146	.	0.195270	0.46758	D	0.000280	T	0.64560	0.2609	L	0.39692	1.235	0.44214	D	0.997048	D;P	0.56287	0.975;0.743	P;B	0.60609	0.877;0.248	T	0.57283	-0.7838	9	0.14656	T	0.56	-15.7073	17.5629	0.87912	0.0:0.0:1.0:0.0	.	55;122	P51572;B3KQ79	BAP31_HUMAN;.	F	55;55;122;122;55;55;55;55;55	.	ENSP00000343458:L55F	L	-	1	0	BCAP31	152639551	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.634000	0.61325	2.418000	0.82041	0.600000	0.82982	CTC	BCAP31	-	pfam_Bap31	ENSG00000185825		0.502	BCAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCAP31	HGNC	protein_coding	OTTHUMT00000061071.1	59	0.00	0	G	NM_005745		152986357	152986357	-1	no_errors	ENST00000458587	ensembl	human	known	69_37n	missense	65	24.42	21	SNP	1.000	A
BCAS2	10286	genome.wustl.edu	37	1	115113352	115113352	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr1:115113352C>G	ENST00000369541.3	-	5	486	c.439G>C	c.(439-441)Gaa>Caa	p.E147Q	BCAS2_ENST00000485021.1_5'UTR	NM_005872.2	NP_005863.1	O75934	SPF27_HUMAN	breast carcinoma amplified sequence 2	147					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	cell junction (GO:0030054)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)				biliary_tract(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(4)	13	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGTGCGTGTTCAATCATATGA	0.284																																						dbGAP											0													32.0	27.0	29.0					1																	115113352		2186	4293	6479	-	-	-	SO:0001583	missense	0			AB020623	CCDS874.1	1p13.2	2010-01-25			ENSG00000116752	ENSG00000116752			975	protein-coding gene	gene with protein product		605783				9731529, 10403562	Standard	NM_005872		Approved	DAM1, SPF27, Snt309	uc001efa.3	O75934	OTTHUMG00000011898	ENST00000369541.3:c.439G>C	1.37:g.115113352C>G	ENSP00000358554:p.Glu147Gln		Q6FGS0	Missense_Mutation	SNP	pfam_BCAS2	p.E147Q	ENST00000369541.3	37	c.439	CCDS874.1	1	.	.	.	.	.	.	.	.	.	.	C	15.85	2.953504	0.53293	.	.	ENSG00000116752	ENST00000369541	.	.	.	5.68	5.68	0.88126	.	0.043630	0.85682	D	0.000000	T	0.40570	0.1122	L	0.34521	1.04	0.80722	D	1	B	0.17038	0.02	B	0.23716	0.048	T	0.32745	-0.9895	9	0.15952	T	0.53	-24.1074	20.1467	0.98079	0.0:1.0:0.0:0.0	.	147	O75934	SPF27_HUMAN	Q	147	.	ENSP00000358554:E147Q	E	-	1	0	BCAS2	114914875	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.172000	0.77604	2.838000	0.97847	0.655000	0.94253	GAA	BCAS2	-	pfam_BCAS2	ENSG00000116752		0.284	BCAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCAS2	HGNC	protein_coding	OTTHUMT00000032871.1	62	0.00	0	C	NM_005872		115113352	115113352	-1	no_errors	ENST00000369541	ensembl	human	known	69_37n	missense	35	42.62	26	SNP	1.000	G
BCL2L11	10018	genome.wustl.edu	37	2	111907684	111907684	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr2:111907684G>C	ENST00000393256.3	+	3	731	c.458G>C	c.(457-459)cGg>cCg	p.R153P	BCL2L11_ENST00000308659.8_Missense_Mutation_p.R93P|BCL2L11_ENST00000357757.2_Missense_Mutation_p.R153P|BCL2L11_ENST00000393253.2_Missense_Mutation_p.R63P	NM_001204106.1|NM_006538.4|NM_138621.4|NM_138627.3	NP_001191035.1|NP_006529.1|NP_619527.1|NP_619533.1	O43521	B2L11_HUMAN	BCL2-like 11 (apoptosis facilitator)	153					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|apoptotic signaling pathway (GO:0097190)|B cell apoptotic process (GO:0001783)|B cell homeostasis (GO:0001782)|brain development (GO:0007420)|cell-matrix adhesion (GO:0007160)|cellular process regulating host cell cycle in response to virus (GO:0060154)|developmental pigmentation (GO:0048066)|ear development (GO:0043583)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|kidney development (GO:0001822)|male gonad development (GO:0008584)|mammary gland development (GO:0030879)|myeloid cell homeostasis (GO:0002262)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic process by virus (GO:0060139)|positive regulation of cell cycle (GO:0045787)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902110)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|post-embryonic organ morphogenesis (GO:0048563)|regulation of developmental pigmentation (GO:0048070)|regulation of organ growth (GO:0046620)|response to endoplasmic reticulum stress (GO:0034976)|spermatogenesis (GO:0007283)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|thymocyte apoptotic process (GO:0070242)|thymus development (GO:0048538)|tube formation (GO:0035148)	BIM-BCL-2 complex (GO:0097141)|BIM-BCL-xl complex (GO:0097140)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|mitochondrial outer membrane (GO:0005741)		p.R153P(1)		endometrium(4)|large_intestine(3)|lung(2)|prostate(2)	11						CAAGAGTTGCGGCGTATTGGA	0.458																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											154.0	116.0	129.0					2																	111907684		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF032458	CCDS2089.1, CCDS2092.1, CCDS42731.1, CCDS56131.1, CCDS56132.1, CCDS56133.1, CCDS56134.1, CCDS56135.1, CCDS56136.1, CCDS74560.1, CCDS74561.1, CCDS74559.1	2q13	2014-09-17			ENSG00000153094	ENSG00000153094			994	protein-coding gene	gene with protein product		603827				9731710, 9430630	Standard	NM_006538		Approved	BOD, BimL, BimEL, BimS, BIM	uc002tgv.1	O43521	OTTHUMG00000131256	ENST00000393256.3:c.458G>C	2.37:g.111907684G>C	ENSP00000376943:p.Arg153Pro		A8K2W2|O43522|Q0MSE7|Q0MSE8|Q0MSE9|Q53R28|Q6JTU6|Q6T851|Q6TE14|Q6TE15|Q6TE16|Q6V402|Q8WYL6|Q8WYL7|Q8WYL8|Q8WYL9|Q8WYM0|Q8WYM1	Missense_Mutation	SNP	pfam_Bcl-x_interacting,pfam_Apoptosis_Bim_N,pirsf_Bcl-2-like_11	p.R153P	ENST00000393256.3	37	c.458	CCDS2089.1	2	.	.	.	.	.	.	.	.	.	.	G	26.7	4.760917	0.89932	.	.	ENSG00000153094	ENST00000308659;ENST00000357757;ENST00000393253;ENST00000393256;ENST00000452033	.	.	.	5.89	5.89	0.94794	Bcl-x interacting (1);	0.000000	0.53938	D	0.000049	T	0.67515	0.2901	L	0.32530	0.975	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.87578	0.997;0.998;0.994	T	0.69243	-0.5196	9	0.87932	D	0	-17.1285	15.7362	0.77846	0.0:0.0:1.0:0.0	.	63;153;93	O43521-3;O43521;O43521-2	.;B2L11_HUMAN;.	P	93;153;63;153;20	.	ENSP00000309226:R93P	R	+	2	0	BCL2L11	111624155	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	5.870000	0.69620	2.791000	0.96007	0.591000	0.81541	CGG	BCL2L11	-	pfam_Bcl-x_interacting,pirsf_Bcl-2-like_11	ENSG00000153094		0.458	BCL2L11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCL2L11	HGNC	protein_coding	OTTHUMT00000254022.3	38	0.00	0	G			111907684	111907684	+1	no_errors	ENST00000393256	ensembl	human	known	69_37n	missense	31	42.59	23	SNP	1.000	C
BNC1	646	genome.wustl.edu	37	15	83931995	83931995	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr15:83931995C>T	ENST00000345382.2	-	4	2093	c.2008G>A	c.(2008-2010)Gac>Aac	p.D670N	BNC1_ENST00000569704.1_Missense_Mutation_p.D663N|RP11-382A20.4_ENST00000565495.1_RNA	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	670					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						TCCATGTAGTCAGAAAAAGGA	0.512																																						dbGAP											0													76.0	79.0	78.0					15																	83931995		2203	4300	6503	-	-	-	SO:0001583	missense	0			L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.2008G>A	15.37:g.83931995C>T	ENSP00000307041:p.Asp670Asn		Q15840	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D670N	ENST00000345382.2	37	c.2008	CCDS10324.1	15	.	.	.	.	.	.	.	.	.	.	C	15.61	2.884417	0.51908	.	.	ENSG00000169594	ENST00000345382;ENST00000541809	T	0.47869	0.83	4.79	3.87	0.44632	.	0.301734	0.34025	N	0.004322	T	0.42810	0.1219	M	0.62723	1.935	0.35341	D	0.786498	B;B	0.20052	0.041;0.0	B;B	0.14578	0.011;0.001	T	0.52442	-0.8575	10	0.52906	T	0.07	-29.1461	8.804	0.34927	0.0:0.7703:0.1502:0.0795	.	663;670	F5GY04;Q01954	.;BNC1_HUMAN	N	670;663	ENSP00000307041:D670N	ENSP00000307041:D670N	D	-	1	0	BNC1	81722999	0.747000	0.28283	0.974000	0.42286	0.904000	0.53231	1.595000	0.36708	1.231000	0.43661	0.655000	0.94253	GAC	BNC1	-	NULL	ENSG00000169594		0.512	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BNC1	HGNC	protein_coding	OTTHUMT00000304006.1	73	0.00	0	C	NM_001717		83931995	83931995	-1	no_errors	ENST00000345382	ensembl	human	known	69_37n	missense	55	23.61	17	SNP	0.805	T
BOLA1	51027	genome.wustl.edu	37	1	149871844	149871844	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr1:149871844G>C	ENST00000369153.2	+	3	896	c.232G>C	c.(232-234)Gag>Cag	p.E78Q	BOLA1_ENST00000369150.1_Missense_Mutation_p.E78Q|BOLA1_ENST00000369152.5_Missense_Mutation_p.E78Q|BOLA1_ENST00000476344.1_3'UTR			Q9Y3E2	BOLA1_HUMAN	bolA family member 1	78						extracellular region (GO:0005576)|mitochondrion (GO:0005739)				endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)	10	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			CTCTCGTTTCGAGGGACTGAG	0.687																																						dbGAP											0													37.0	35.0	36.0					1																	149871844		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF151901	CCDS939.1	1q21	2013-09-02	2013-09-02		ENSG00000178096	ENSG00000178096			24263	protein-coding gene	gene with protein product		613181	"""bolA-like 1 (E. coli)"", ""bolA homolog 1 (E. coli)"""			14718656	Standard	NM_016074		Approved	CGI-143	uc001etf.3	Q9Y3E2	OTTHUMG00000012087	ENST00000369153.2:c.232G>C	1.37:g.149871844G>C	ENSP00000358149:p.Glu78Gln		B2R7K2|D3DUZ4|Q5QNY0	Missense_Mutation	SNP	pfam_BolA,superfamily_BolA	p.E78Q	ENST00000369153.2	37	c.232	CCDS939.1	1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.183862	0.78677	.	.	ENSG00000178096	ENST00000369153;ENST00000369152;ENST00000369150	T;T;T	0.65916	-0.18;-0.18;-0.18	5.35	5.35	0.76521	.	0.059208	0.64402	D	0.000004	T	0.67776	0.2929	M	0.70108	2.13	0.53005	D	0.999964	D	0.61697	0.99	D	0.67725	0.953	T	0.67337	-0.5696	10	0.36615	T	0.2	-5.7721	10.3942	0.44190	0.0895:0.0:0.9105:0.0	.	78	Q9Y3E2	BOLA1_HUMAN	Q	78	ENSP00000358149:E78Q;ENSP00000358148:E78Q;ENSP00000358146:E78Q	ENSP00000358146:E78Q	E	+	1	0	BOLA1	148138468	1.000000	0.71417	0.996000	0.52242	0.509000	0.34042	4.407000	0.59754	2.668000	0.90789	0.462000	0.41574	GAG	BOLA1	-	pfam_BolA,superfamily_BolA	ENSG00000178096		0.687	BOLA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BOLA1	HGNC	protein_coding	OTTHUMT00000033443.2	14	0.00	0	G	NM_016074		149871844	149871844	+1	no_errors	ENST00000369150	ensembl	human	known	69_37n	missense	10	61.54	16	SNP	0.998	C
BTN3A3	10384	genome.wustl.edu	37	6	26452288	26452288	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr6:26452288G>C	ENST00000244519.2	+	11	1647	c.1404G>C	c.(1402-1404)gaG>gaC	p.E468D	BTN3A3_ENST00000361232.3_Missense_Mutation_p.E419D|BTN3A3_ENST00000339789.4_Missense_Mutation_p.E426D	NM_006994.4	NP_008925.1	O00478	BT3A3_HUMAN	butyrophilin, subfamily 3, member A3	468	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				T cell mediated immunity (GO:0002456)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	30						TGGACTATGAGACTGGAGAGA	0.478																																						dbGAP											0													118.0	110.0	112.0					6																	26452288		2203	4300	6503	-	-	-	SO:0001583	missense	0			U90548	CCDS4611.1, CCDS4612.1, CCDS4612.2	6p22.1	2014-01-14			ENSG00000111801	ENSG00000111801		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	1140	protein-coding gene	gene with protein product		613595				10354554, 9149941	Standard	NM_006994		Approved	BTF3, BTN3.3	uc003nhz.3	O00478	OTTHUMG00000014451	ENST00000244519.2:c.1404G>C	6.37:g.26452288G>C	ENSP00000244519:p.Glu468Asp		B4DWI7|E9PCP5	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Ig_V-set,superfamily_ConA-like_lec_gl,smart_Ig_sub,smart_Ig_V-set_subgr,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Ig-like,prints_Butyrophylin	p.E468D	ENST00000244519.2	37	c.1404	CCDS4611.1	6	.	.	.	.	.	.	.	.	.	.	G	10.63	1.404919	0.25378	.	.	ENSG00000111801	ENST00000244519;ENST00000339789;ENST00000361232	T;T;T	0.62941	-0.01;-0.01;-0.01	3.15	-1.37	0.09056	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	T	0.58090	0.2098	M	0.70108	2.13	0.25982	N	0.98236	P;D	0.76494	0.788;0.999	P;D	0.76071	0.498;0.987	T	0.48885	-0.8995	9	0.46703	T	0.11	.	4.8207	0.13389	0.3076:0.161:0.5314:0.0	.	419;468	E9PCP5;O00478	.;BT3A3_HUMAN	D	468;426;419	ENSP00000244519:E468D;ENSP00000344968:E426D;ENSP00000355238:E419D	ENSP00000244519:E468D	E	+	3	2	BTN3A3	26560267	0.000000	0.05858	0.043000	0.18650	0.038000	0.13279	-1.264000	0.02847	-0.530000	0.06349	0.455000	0.32223	GAG	BTN3A3	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	ENSG00000111801		0.478	BTN3A3-001	KNOWN	basic|CCDS	protein_coding	BTN3A3	HGNC	protein_coding	OTTHUMT00000040116.2	59	0.00	0	G	NM_006994		26452288	26452288	+1	no_errors	ENST00000244519	ensembl	human	known	69_37n	missense	47	41.25	33	SNP	0.990	C
C12orf5	57103	genome.wustl.edu	37	12	4433901	4433901	+	Intron	DEL	T	T	-			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr12:4433901delT	ENST00000179259.4	+	1	99					NM_020375.2	NP_065108.1	Q9NQ88	TIGAR_HUMAN	chromosome 12 open reading frame 5						intestinal epithelial cell development (GO:0060576)|negative regulation of macromitophagy (GO:1901525)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|response to gamma radiation (GO:0010332)|response to xenobiotic stimulus (GO:0009410)	intracellular (GO:0005622)	fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)			endometrium(1)|large_intestine(1)|lung(5)|skin(3)	10			all cancers(3;1.15e-07)|Colorectal(7;0.00165)|OV - Ovarian serous cystadenocarcinoma(31;0.00596)|COAD - Colon adenocarcinoma(12;0.0229)|GBM - Glioblastoma multiforme(3;0.0266)|STAD - Stomach adenocarcinoma(119;0.206)			ACACGTCCCGTCCCGCAGCTG	0.622																																					Colon(1;100 192 35375 49454 52532)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AJ272206	CCDS8525.1	12p13.32	2014-05-29	2009-11-24	2009-11-24	ENSG00000078237	ENSG00000078237	3.1.3.46		1185	protein-coding gene	gene with protein product	"""TP53-induced glycolysis and apoptosis regulator"""	610775				16140933, 16839880, 18945750, 19713938	Standard	NM_020375		Approved	TIGAR	uc001qmp.3	Q9NQ88		ENST00000179259.4:c.32+3432T>-	12.37:g.4433901delT			B2R840	RNA	DEL	-	NULL	ENST00000179259.4	37	NULL	CCDS8525.1	12																																																																																			C12orf5	-	-	ENSG00000078237		0.622	C12orf5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf5	HGNC	protein_coding	OTTHUMT00000398290.1	9	0.00	0	T	NM_020375		4433901	4433901	+1	no_errors	ENST00000539671	ensembl	human	putative	69_37n	rna	4	33.33	2	DEL	0.999	-
HMCES	56941	genome.wustl.edu	37	3	128998666	128998666	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr3:128998666G>C	ENST00000383463.4	+	2	180	c.91G>C	c.(91-93)Gag>Cag	p.E31Q	HMCES_ENST00000389735.3_Missense_Mutation_p.E31Q|HMCES_ENST00000417226.2_Missense_Mutation_p.E31Q|HMCES_ENST00000502878.2_Missense_Mutation_p.E31Q	NM_020187.2	NP_064572.2	Q96FZ2	HMCES_HUMAN	5-hydroxymethylcytosine (hmC) binding, ES cell-specific	31							DNA binding (GO:0003677)|peptidase activity (GO:0008233)										GCGGCTCCCGGAGTGGAGGGA	0.552																																						dbGAP											0													57.0	52.0	53.0					3																	128998666		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF201934	CCDS33852.1	3q21.3	2013-08-30	2013-08-30	2013-08-30	ENSG00000183624	ENSG00000183624			24446	protein-coding gene	gene with protein product	"""SOS response associated peptidase domain containing 1"""		"""chromosome 3 open reading frame 37"""	C3orf37		23434322, 23945014	Standard	XM_005247636		Approved	DC12, SRAPD1	uc003elt.3	Q96FZ2	OTTHUMG00000159452	ENST00000383463.4:c.91G>C	3.37:g.128998666G>C	ENSP00000372955:p.Glu31Gln		A6NJR9|Q96G34|Q9NRP3	Missense_Mutation	SNP	pfam_DUF159	p.E31Q	ENST00000383463.4	37	c.91	CCDS33852.1	3	.	.	.	.	.	.	.	.	.	.	G	8.206	0.799220	0.16397	.	.	ENSG00000183624	ENST00000509042;ENST00000383463;ENST00000417226;ENST00000510314;ENST00000502878;ENST00000389735;ENST00000509551;ENST00000511665	.	.	.	4.8	3.89	0.44902	.	0.412572	0.28853	N	0.013933	T	0.40546	0.1121	L	0.58302	1.8	0.09310	N	1	B;B	0.20261	0.043;0.036	B;B	0.23150	0.044;0.026	T	0.31668	-0.9935	9	0.36615	T	0.2	-17.4464	6.3841	0.21552	0.1015:0.1982:0.7004:0.0	.	31;31	E7EMP6;Q96FZ2	.;CC037_HUMAN	Q	31	.	ENSP00000372955:E31Q	E	+	1	0	C3orf37	130481356	0.371000	0.25056	0.499000	0.27577	0.006000	0.05464	1.109000	0.31135	0.936000	0.37367	0.655000	0.94253	GAG	C3orf37	-	pfam_DUF159	ENSG00000183624		0.552	HMCES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf37	HGNC	protein_coding	OTTHUMT00000355470.2	41	0.00	0	G	NM_020187		128998666	128998666	+1	no_errors	ENST00000383463	ensembl	human	known	69_37n	missense	32	28.89	13	SNP	0.104	C
HMCES	56941	genome.wustl.edu	37	3	129007811	129007811	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr3:129007811G>A	ENST00000383463.4	+	3	387	c.298G>A	c.(298-300)Gat>Aat	p.D100N	HMCES_ENST00000389735.3_Missense_Mutation_p.D100N|HMCES_ENST00000417226.2_Missense_Mutation_p.D100N|HMCES_ENST00000502878.2_Missense_Mutation_p.D100N	NM_020187.2	NP_064572.2	Q96FZ2	HMCES_HUMAN	5-hydroxymethylcytosine (hmC) binding, ES cell-specific	100							DNA binding (GO:0003677)|peptidase activity (GO:0008233)										CTGTCGTAGTGATACCGTAAT	0.473																																						dbGAP											0													125.0	108.0	114.0					3																	129007811		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF201934	CCDS33852.1	3q21.3	2013-08-30	2013-08-30	2013-08-30	ENSG00000183624	ENSG00000183624			24446	protein-coding gene	gene with protein product	"""SOS response associated peptidase domain containing 1"""		"""chromosome 3 open reading frame 37"""	C3orf37		23434322, 23945014	Standard	XM_005247636		Approved	DC12, SRAPD1	uc003elt.3	Q96FZ2	OTTHUMG00000159452	ENST00000383463.4:c.298G>A	3.37:g.129007811G>A	ENSP00000372955:p.Asp100Asn		A6NJR9|Q96G34|Q9NRP3	Missense_Mutation	SNP	pfam_DUF159	p.D100N	ENST00000383463.4	37	c.298	CCDS33852.1	3	.	.	.	.	.	.	.	.	.	.	G	30	5.051558	0.93793	.	.	ENSG00000183624	ENST00000383463;ENST00000417226;ENST00000502878;ENST00000389735;ENST00000509551	.	.	.	5.12	5.12	0.69794	.	0.098297	0.64402	D	0.000002	D	0.85366	0.5680	M	0.92970	3.365	0.58432	D	0.999998	D;D	0.89917	1.0;0.999	D;D	0.71870	0.975;0.961	D	0.88984	0.3410	9	0.72032	D	0.01	-23.4084	16.0607	0.80836	0.0:0.0:1.0:0.0	.	100;100	E7EMP6;Q96FZ2	.;CC037_HUMAN	N	100	.	ENSP00000372955:D100N	D	+	1	0	C3orf37	130490501	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	8.618000	0.90932	2.392000	0.81423	0.591000	0.81541	GAT	C3orf37	-	pfam_DUF159	ENSG00000183624		0.473	HMCES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf37	HGNC	protein_coding	OTTHUMT00000355470.2	41	0.00	0	G	NM_020187		129007811	129007811	+1	no_errors	ENST00000383463	ensembl	human	known	69_37n	missense	40	31.03	18	SNP	1.000	A
CALD1	800	genome.wustl.edu	37	7	134643006	134643006	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr7:134643006G>C	ENST00000361675.2	+	11	2255	c.2026G>C	c.(2026-2028)Gac>Cac	p.D676H	CALD1_ENST00000361388.2_Missense_Mutation_p.D447H|CALD1_ENST00000495522.1_Missense_Mutation_p.D440H|CALD1_ENST00000361901.2_Missense_Mutation_p.D421H|CALD1_ENST00000393118.2_Missense_Mutation_p.D441H|CALD1_ENST00000466704.1_3'UTR|CALD1_ENST00000422748.1_Missense_Mutation_p.D446H|CALD1_ENST00000417172.1_Missense_Mutation_p.D421H|CALD1_ENST00000424922.1_Missense_Mutation_p.D415H|CALD1_ENST00000543443.1_Missense_Mutation_p.D426H			Q05682	CALD1_HUMAN	caldesmon 1	676	Strong actin-binding. {ECO:0000250}.				cellular component movement (GO:0006928)|muscle contraction (GO:0006936)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|calmodulin binding (GO:0005516)|tropomyosin binding (GO:0005523)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(15)|lung(10)	43						CTCCAAGATTGACAGCAGACT	0.398																																						dbGAP											0													170.0	165.0	167.0					7																	134643006		2203	4300	6503	-	-	-	SO:0001583	missense	0			M64110	CCDS5834.1, CCDS5835.1, CCDS5836.1, CCDS47716.1, CCDS47717.1, CCDS5836.2	7q33	2007-04-23			ENSG00000122786	ENSG00000122786			1441	protein-coding gene	gene with protein product		114213				1885618	Standard	NM_004342		Approved	CDM, H-CAD, L-CAD	uc003vrz.3	Q05682	OTTHUMG00000155407	ENST00000361675.2:c.2026G>C	7.37:g.134643006G>C	ENSP00000354826:p.Asp676His		A8K0X1|Q13978|Q13979|Q14741|Q14742|Q9UD91	Missense_Mutation	SNP	pfam_Caldesmon_LSP,prints_Caldesmon	p.D447H	ENST00000361675.2	37	c.1339	CCDS5835.1	7	.	.	.	.	.	.	.	.	.	.	G	28.5	4.921849	0.92319	.	.	ENSG00000122786	ENST00000417172;ENST00000436461;ENST00000361388;ENST00000422748;ENST00000432646;ENST00000361675;ENST00000361901;ENST00000393118;ENST00000424922;ENST00000495522;ENST00000543443	T;T;T;T;T;T;T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25;-0.25;-0.25;-0.25;-0.25;-0.25;-0.25	5.51	5.51	0.81932	.	0.000000	0.51477	D	0.000086	D	0.85039	0.5606	M	0.86343	2.81	0.58432	D	0.999993	D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.997;0.997;0.999;0.999;0.999;0.999	D	0.87259	0.2278	10	0.87932	D	0	-39.4413	19.4213	0.94723	0.0:0.0:1.0:0.0	.	370;426;446;440;415;441;421;447;676;421	B4DPW5;F5H1Z9;A8K0X1;E7EX44;Q05682-5;Q05682-3;Q05682-4;Q05682-2;Q05682;Q9NYG1	.;.;.;.;.;.;.;.;CALD1_HUMAN;.	H	421;421;447;446;54;676;421;441;415;440;426	ENSP00000398826:D421H;ENSP00000411476:D421H;ENSP00000355000:D447H;ENSP00000395710:D446H;ENSP00000354826:D676H;ENSP00000354513:D421H;ENSP00000376826:D441H;ENSP00000393621:D415H;ENSP00000419673:D440H;ENSP00000445641:D426H	ENSP00000355000:D447H	D	+	1	0	CALD1	134293546	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.330000	0.96422	2.589000	0.87451	0.655000	0.94253	GAC	CALD1	-	pfam_Caldesmon_LSP,prints_Caldesmon	ENSG00000122786		0.398	CALD1-005	NOVEL	basic|appris_principal|CCDS	protein_coding	CALD1	HGNC	protein_coding	OTTHUMT00000339939.1	118	0.00	0	G	NM_033138		134643006	134643006	+1	no_errors	ENST00000361388	ensembl	human	known	69_37n	missense	105	36.75	61	SNP	1.000	C
CATSPERB	79820	genome.wustl.edu	37	14	92083994	92083994	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr14:92083994C>T	ENST00000256343.3	-	20	2503	c.2347G>A	c.(2347-2349)Gat>Aat	p.D783N		NM_024764.2	NP_079040.2	Q9H7T0	CTSRB_HUMAN	catsper channel auxiliary subunit beta	783					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|cilium (GO:0005929)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|kidney(3)|large_intestine(15)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(2)	54		all_cancers(154;0.0663)|all_epithelial(191;0.236)				CTGTCAGTATCATCAAAAGTC	0.333																																						dbGAP											0													96.0	87.0	90.0					14																	92083994		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK024360	CCDS32142.1	14q32.12	2012-02-22	2012-02-22	2007-10-18	ENSG00000133962	ENSG00000133962			20500	protein-coding gene	gene with protein product		611169	"""chromosome 14 open reading frame 161"", ""cation channel, sperm-associated, beta"""	C14orf161		17478420	Standard	NM_024764		Approved	FLJ14298	uc001xzs.1	Q9H7T0	OTTHUMG00000171118	ENST00000256343.3:c.2347G>A	14.37:g.92083994C>T	ENSP00000256343:p.Asp783Asn		A0AV51	Missense_Mutation	SNP	superfamily_Neuraminidase	p.D783N	ENST00000256343.3	37	c.2347	CCDS32142.1	14	.	.	.	.	.	.	.	.	.	.	C	10.09	1.254521	0.22965	.	.	ENSG00000133962	ENST00000256343	T	0.45276	0.9	5.76	-0.81	0.10860	.	1.375320	0.05125	N	0.491463	T	0.31136	0.0787	L	0.50333	1.59	0.09310	N	0.999991	B	0.17268	0.021	B	0.18263	0.021	T	0.13072	-1.0523	10	0.14656	T	0.56	-6.385	1.7056	0.02881	0.1278:0.4315:0.1319:0.3087	.	783	Q9H7T0	CTSRB_HUMAN	N	783	ENSP00000256343:D783N	ENSP00000256343:D783N	D	-	1	0	CATSPERB	91153747	0.186000	0.23225	0.010000	0.14722	0.105000	0.19272	-0.279000	0.08479	-0.451000	0.07097	0.467000	0.42956	GAT	CATSPERB	-	NULL	ENSG00000133962		0.333	CATSPERB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CATSPERB	HGNC	protein_coding	OTTHUMT00000411769.1	85	0.00	0	C	NM_024764		92083994	92083994	-1	no_errors	ENST00000256343	ensembl	human	known	69_37n	missense	70	38.05	43	SNP	0.269	T
CCDC87	55231	genome.wustl.edu	37	11	66360198	66360198	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr11:66360198C>T	ENST00000333861.3	-	1	356	c.289G>A	c.(289-291)Gag>Aag	p.E97K	CCS_ENST00000310190.4_5'Flank|CCS_ENST00000533244.1_5'Flank	NM_018219.2	NP_060689.2	Q9NVE4	CCD87_HUMAN	coiled-coil domain containing 87	97					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)					central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						GCGGGCGGCTCCCGCCAGCTG	0.632											OREG0021111	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													38.0	42.0	41.0					11																	66360198		2200	4295	6495	-	-	-	SO:0001583	missense	0			BC034469	CCDS8145.1	11q13.2	2006-03-15			ENSG00000182791	ENSG00000182791			25579	protein-coding gene	gene with protein product						12477932	Standard	NM_018219		Approved	FLJ10786	uc001oiq.4	Q9NVE4	OTTHUMG00000167237	ENST00000333861.3:c.289G>A	11.37:g.66360198C>T	ENSP00000328487:p.Glu97Lys	1091	Q8NE76	Missense_Mutation	SNP	pfam_Microtubule-assoc_MAP65_ASE1	p.E97K	ENST00000333861.3	37	c.289	CCDS8145.1	11	.	.	.	.	.	.	.	.	.	.	C	23.6	4.439057	0.83885	.	.	ENSG00000182791	ENST00000333861	T	0.33438	1.41	5.39	4.41	0.53225	.	0.576513	0.14740	N	0.301220	T	0.38081	0.1027	M	0.68317	2.08	0.37096	D	0.89965	P	0.52842	0.956	P	0.50825	0.651	T	0.18461	-1.0336	10	0.26408	T	0.33	.	8.1564	0.31171	0.0:0.8916:0.0:0.1084	.	97	Q9NVE4	CCD87_HUMAN	K	97	ENSP00000328487:E97K	ENSP00000328487:E97K	E	-	1	0	CCDC87	66116774	1.000000	0.71417	1.000000	0.80357	0.596000	0.36781	2.408000	0.44574	2.808000	0.96608	0.655000	0.94253	GAG	CCDC87	-	NULL	ENSG00000182791		0.632	CCDC87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC87	HGNC	protein_coding	OTTHUMT00000393825.1	24	0.00	0	C	NM_018219		66360198	66360198	-1	no_errors	ENST00000333861	ensembl	human	known	69_37n	missense	22	31.25	10	SNP	1.000	T
CCS	9973	genome.wustl.edu	37	11	66373005	66373005	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr11:66373005G>T	ENST00000533244.1	+	7	1054	c.613G>T	c.(613-615)Gat>Tat	p.D205Y	CCS_ENST00000310190.4_Missense_Mutation_p.D186Y	NM_005125.1	NP_005116.1	O14618	CCS_HUMAN	copper chaperone for superoxide dismutase	205	Superoxide dismutase-like.				copper ion transmembrane transport (GO:0035434)|intracellular copper ion transport (GO:0015680)|positive regulation of oxidoreductase activity (GO:0051353)|removal of superoxide radicals (GO:0019430)|superoxide metabolic process (GO:0006801)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	copper ion binding (GO:0005507)|copper ion transmembrane transporter activity (GO:0005375)|protein disulfide oxidoreductase activity (GO:0015035)|superoxide dismutase activity (GO:0004784)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|large_intestine(2)|lung(3)|stomach(1)	9						TGAGGGAGAAGATGACCTGGG	0.587																																						dbGAP											0													93.0	96.0	95.0					11																	66373005		2200	4295	6495	-	-	-	SO:0001583	missense	0			AF002210	CCDS8146.1	11q13.2	2012-09-20			ENSG00000173992	ENSG00000173992			1613	protein-coding gene	gene with protein product		603864				9295278	Standard	NM_005125		Approved		uc001oir.3	O14618	OTTHUMG00000167238	ENST00000533244.1:c.613G>T	11.37:g.66373005G>T	ENSP00000436318:p.Asp205Tyr		Q2M366|Q8NEV0	Missense_Mutation	SNP	pfam_SOD_Cu_Zn_dom,pfam_HeavyMe-assoc_HMA,superfamily_SOD_Cu_Zn_dom,superfamily_HeavyMe-assoc_HMA,pfscan_HeavyMe-assoc_HMA,prints_SOD_Cu_Zn_dom	p.D205Y	ENST00000533244.1	37	c.613	CCDS8146.1	11	.	.	.	.	.	.	.	.	.	.	G	30	5.055606	0.93793	.	.	ENSG00000173992	ENST00000533244;ENST00000310190;ENST00000534763	D;D;D	0.99814	-6.89;-6.89;-6.89	5.84	5.84	0.93424	Superoxide dismutase, copper/zinc binding domain (4);	0.000000	0.85682	D	0.000000	D	0.99898	0.9951	H	0.99169	4.455	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96385	0.9284	10	0.87932	D	0	.	17.637	0.88125	0.0:0.0:1.0:0.0	.	205	O14618	CCS_HUMAN	Y	205;186;23	ENSP00000436318:D205Y;ENSP00000307870:D186Y;ENSP00000436379:D23Y	ENSP00000307870:D186Y	D	+	1	0	CCS	66129581	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.006000	0.93592	2.769000	0.95229	0.561000	0.74099	GAT	CCS	-	pfam_SOD_Cu_Zn_dom,superfamily_SOD_Cu_Zn_dom,prints_SOD_Cu_Zn_dom	ENSG00000173992		0.587	CCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCS	HGNC	protein_coding	OTTHUMT00000393826.1	58	0.00	0	G	NM_005125		66373005	66373005	+1	no_errors	ENST00000533244	ensembl	human	known	69_37n	missense	90	21.74	25	SNP	1.000	T
CCT4	10575	genome.wustl.edu	37	2	62099221	62099221	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr2:62099221C>T	ENST00000394440.3	-	12	1783	c.1487G>A	c.(1486-1488)cGa>cAa	p.R496Q	CCT4_ENST00000544079.1_Missense_Mutation_p.R466Q|CCT4_ENST00000538252.1_Missense_Mutation_p.R440Q|CCT4_ENST00000461540.2_Intron|CCT4_ENST00000544185.1_Missense_Mutation_p.R346Q|AC107081.5_ENST00000425779.1_RNA	NM_006430.3	NP_006421.2	P50991	TCPD_HUMAN	chaperonin containing TCP1, subunit 4 (delta)	496					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			breast(1)|large_intestine(2)|lung(6)|ovary(2)	11	Lung NSC(7;0.035)|all_lung(7;0.0691)		LUSC - Lung squamous cell carcinoma(7;6.5e-06)|Epithelial(17;0.0647)|all cancers(80;0.221)			GATTACCTTTCGGACATTAAT	0.353																																						dbGAP											0													68.0	66.0	67.0					2																	62099221		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33206.1, CCDS58711.1	2p15	2011-09-02			ENSG00000115484	ENSG00000115484		"""Heat Shock Proteins / Chaperonins"""	1617	protein-coding gene	gene with protein product		605142				9819444	Standard	NM_001256721		Approved	Cctd	uc002sbo.4	P50991	OTTHUMG00000152166	ENST00000394440.3:c.1487G>A	2.37:g.62099221C>T	ENSP00000377958:p.Arg496Gln		B2R6I3|B7Z8B1|F5H5W3|O14870|Q53QP9|Q96C51	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,prints_Chaperone_TCP-1,prints_Chaprnin_Cpn60,tigrfam_Chap_CCT_delta	p.R496Q	ENST00000394440.3	37	c.1487	CCDS33206.1	2	.	.	.	.	.	.	.	.	.	.	C	34	5.300882	0.95601	.	.	ENSG00000115484	ENST00000394440;ENST00000544079;ENST00000544185;ENST00000538252	T;T;T;T	0.78924	-1.22;-1.22;-1.22;-1.22	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.88415	0.6430	M	0.81179	2.53	0.80722	D	1	D;D	0.76494	0.999;0.999	P;D	0.66084	0.906;0.941	D	0.88125	0.2834	10	0.51188	T	0.08	-6.6431	19.5713	0.95421	0.0:1.0:0.0:0.0	.	466;496	F5H5W3;P50991	.;TCPD_HUMAN	Q	496;466;346;440	ENSP00000377958:R496Q;ENSP00000443061:R466Q;ENSP00000443451:R346Q;ENSP00000442174:R440Q	ENSP00000377958:R496Q	R	-	2	0	CCT4	61952725	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.747000	0.85070	2.783000	0.95769	0.655000	0.94253	CGA	CCT4	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,tigrfam_Chap_CCT_delta	ENSG00000115484		0.353	CCT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT4	HGNC	protein_coding	OTTHUMT00000325548.2	85	0.00	0	C			62099221	62099221	-1	no_errors	ENST00000394440	ensembl	human	known	69_37n	missense	82	29.31	34	SNP	1.000	T
CCT4	10575	genome.wustl.edu	37	2	62107467	62107467	+	Silent	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr2:62107467G>A	ENST00000394440.3	-	4	629	c.333C>T	c.(331-333)atC>atT	p.I111I	CCT4_ENST00000544079.1_Silent_p.I81I|CCT4_ENST00000538252.1_Silent_p.I55I|CCT4_ENST00000544185.1_Intron|AC107081.5_ENST00000425779.1_RNA	NM_006430.3	NP_006421.2	P50991	TCPD_HUMAN	chaperonin containing TCP1, subunit 4 (delta)	111					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			breast(1)|large_intestine(2)|lung(6)|ovary(2)	11	Lung NSC(7;0.035)|all_lung(7;0.0691)		LUSC - Lung squamous cell carcinoma(7;6.5e-06)|Epithelial(17;0.0647)|all cancers(80;0.221)			AGCCAGCAATGATGACTACTG	0.393																																						dbGAP											0													148.0	152.0	151.0					2																	62107467		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS33206.1, CCDS58711.1	2p15	2011-09-02			ENSG00000115484	ENSG00000115484		"""Heat Shock Proteins / Chaperonins"""	1617	protein-coding gene	gene with protein product		605142				9819444	Standard	NM_001256721		Approved	Cctd	uc002sbo.4	P50991	OTTHUMG00000152166	ENST00000394440.3:c.333C>T	2.37:g.62107467G>A			B2R6I3|B7Z8B1|F5H5W3|O14870|Q53QP9|Q96C51	Silent	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,prints_Chaperone_TCP-1,prints_Chaprnin_Cpn60,tigrfam_Chap_CCT_delta	p.I111	ENST00000394440.3	37	c.333	CCDS33206.1	2																																																																																			CCT4	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,prints_Chaperone_TCP-1,prints_Chaprnin_Cpn60,tigrfam_Chap_CCT_delta	ENSG00000115484		0.393	CCT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT4	HGNC	protein_coding	OTTHUMT00000325548.2	70	0.00	0	G			62107467	62107467	-1	no_errors	ENST00000394440	ensembl	human	known	69_37n	silent	54	38.64	34	SNP	1.000	A
CD3G	917	genome.wustl.edu	37	11	118220523	118220523	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr11:118220523G>A	ENST00000532917.1	+	3	213	c.145G>A	c.(145-147)Gaa>Aaa	p.E49K	CD3G_ENST00000392883.2_5'UTR|CD3G_ENST00000532903.1_3'UTR	NM_000073.2	NP_000064.1	P09693	CD3G_HUMAN	CD3g molecule, gamma (CD3-TCR complex)	49	Ig-like.				cell surface receptor signaling pathway (GO:0007166)|establishment or maintenance of cell polarity (GO:0007163)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)|protein transport (GO:0015031)|regulation of immune response (GO:0050776)|regulation of lymphocyte apoptotic process (GO:0070228)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	alpha-beta T cell receptor complex (GO:0042105)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	protein heterodimerization activity (GO:0046982)|receptor signaling complex scaffold activity (GO:0030159)|T cell receptor binding (GO:0042608)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|kidney(1)|large_intestine(2)|skin(1)	6	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.04e-05)	Muromonab(DB00075)	TTGTGATGCAGAAGCCAAAAA	0.403																																						dbGAP											0													102.0	97.0	99.0					11																	118220523		2200	4296	6496	-	-	-	SO:0001583	missense	0			X60491	CCDS8395.1	11q23	2014-09-17	2006-03-28		ENSG00000160654	ENSG00000160654		"""CD molecules"""	1675	protein-coding gene	gene with protein product		186740	"""CD3g antigen, gamma polypeptide (TiT3 complex)"""				Standard	NM_000073		Approved		uc001psu.2	P09693	OTTHUMG00000166971	ENST00000532917.1:c.145G>A	11.37:g.118220523G>A	ENSP00000431445:p.Glu49Lys		Q2HIZ6	Missense_Mutation	SNP	pfam_Phos_immunorcpt_sig_ITAM,smart_Ig_sub2,smart_Phos_immunorcpt_sig_ITAM,pfscan_Phos_immunorcpt_sig_ITAM	p.E49K	ENST00000532917.1	37	c.145	CCDS8395.1	11	.	.	.	.	.	.	.	.	.	.	G	1.217	-0.627932	0.03610	.	.	ENSG00000160654	ENST00000532917	T	0.54071	0.59	5.94	-11.9	0.00025	Immunoglobulin subtype 2 (1);Immunoglobulin-like fold (1);	2.737130	0.00957	N	0.003054	T	0.20047	0.0482	N	0.01109	-1.01	0.09310	N	0.999998	B	0.02656	0.0	B	0.01281	0.0	T	0.46400	-0.9194	10	0.06236	T	0.91	.	16.953	0.86250	0.1117:0.5954:0.2929:0.0	.	49	P09693	CD3G_HUMAN	K	49	ENSP00000431445:E49K	ENSP00000431445:E49K	E	+	1	0	CD3G	117725733	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-5.237000	0.00138	-3.894000	0.00094	-1.450000	0.01041	GAA	CD3G	-	smart_Ig_sub2	ENSG00000160654		0.403	CD3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD3G	HGNC	protein_coding	OTTHUMT00000392135.1	77	0.00	0	G	NM_000073		118220523	118220523	+1	no_errors	ENST00000532917	ensembl	human	known	69_37n	missense	36	12.20	5	SNP	0.000	A
CHTF18	63922	genome.wustl.edu	37	16	844160	844160	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr16:844160C>A	ENST00000262315.9	+	15	1972	c.1909C>A	c.(1909-1911)Cat>Aat	p.H637N	CHTF18_ENST00000455171.2_Missense_Mutation_p.H665N|CHTF18_ENST00000317063.6_Missense_Mutation_p.H846N	NM_022092.2	NP_071375.1	Q8WVB6	CTF18_HUMAN	CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)	637					cell cycle (GO:0007049)|DNA replication (GO:0006260)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			endometrium(1)|kidney(3)|liver(2)|lung(4)|prostate(1)	11		Hepatocellular(780;0.00335)				CCGTGTCCTGCATGCCGCTGC	0.677																																						dbGAP											0													40.0	48.0	45.0					16																	844160		2178	4276	6454	-	-	-	SO:0001583	missense	0			BC018184	CCDS45371.1	16p13.3	2010-04-21	2003-12-09		ENSG00000127586	ENSG00000127586		"""ATPases / AAA-type"""	18435	protein-coding gene	gene with protein product		613201	"""chromosome 16 open reading frame 41"""	C16orf41		12171929	Standard	NM_022092		Approved	CHL12, C321D2.4, Ctf18	uc002cke.4	Q8WVB6	OTTHUMG00000047838	ENST00000262315.9:c.1909C>A	16.37:g.844160C>A	ENSP00000262315:p.His637Asn		B7ZBA2|D3DU68|Q7Z6Y4|Q7Z6Y6|Q9BR83|Q9BRG5|Q9H7K3	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,pfam_DNA_helicase_Holl-junc_RuvB_N,smart_AAA+_ATPase	p.H846N	ENST00000262315.9	37	c.2536	CCDS45371.1	16	.	.	.	.	.	.	.	.	.	.	C	12.72	2.024012	0.35701	.	.	ENSG00000127586	ENST00000317063;ENST00000455171;ENST00000262315	T;T;T	0.10573	2.86;2.9;2.89	5.71	5.71	0.89125	.	0.334507	0.38897	N	0.001530	T	0.13157	0.0319	L	0.52759	1.655	0.52501	D	0.999959	B;B	0.29862	0.259;0.168	B;B	0.29077	0.098;0.045	T	0.07009	-1.0795	10	0.23891	T	0.37	-11.8048	17.3328	0.87271	0.0:1.0:0.0:0.0	.	665;637	Q8WVB6-2;Q8WVB6	.;CTF18_HUMAN	N	846;665;637	ENSP00000313029:H846N;ENSP00000406252:H665N;ENSP00000262315:H637N	ENSP00000262315:H637N	H	+	1	0	CHTF18	784161	0.691000	0.27709	0.709000	0.30452	0.004000	0.04260	1.905000	0.39878	2.692000	0.91855	0.655000	0.94253	CAT	CHTF18	-	NULL	ENSG00000127586		0.677	CHTF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHTF18	HGNC	protein_coding	OTTHUMT00000109061.3	19	0.00	0	C	NM_022092		844160	844160	+1	no_errors	ENST00000317063	ensembl	human	known	69_37n	missense	27	28.95	11	SNP	0.995	A
CDH16	1014	genome.wustl.edu	37	16	66946466	66946466	+	Nonsense_Mutation	SNP	C	C	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr16:66946466C>A	ENST00000299752.4	-	11	1493	c.1300G>T	c.(1300-1302)Gaa>Taa	p.E434*	CDH16_ENST00000570262.1_Nonsense_Mutation_p.E354*|CDH16_ENST00000565796.1_Nonsense_Mutation_p.E434*|CDH16_ENST00000394055.3_Nonsense_Mutation_p.E434*|CDH16_ENST00000568632.1_Nonsense_Mutation_p.E337*	NM_001204744.1|NM_001204745.1|NM_004062.3	NP_001191673.1|NP_001191674.1|NP_004053.1	O75309	CAD16_HUMAN	cadherin 16, KSP-cadherin	434	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(3)|large_intestine(10)|lung(15)|ovary(2)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0877)|Epithelial(162;0.203)		ACTTCGACTTCACACGTGCTG	0.577																																						dbGAP											0													123.0	112.0	116.0					16																	66946466		2200	4300	6500	-	-	-	SO:0001587	stop_gained	0			AF016272	CCDS10823.1, CCDS56002.1, CCDS58471.1, CCDS58472.1	16q22.1	2010-01-26			ENSG00000166589	ENSG00000166589		"""Cadherins / Major cadherins"""	1755	protein-coding gene	gene with protein product		603118				9721215, 7615566	Standard	NM_004062		Approved		uc002eql.3	O75309	OTTHUMG00000137518	ENST00000299752.4:c.1300G>T	16.37:g.66946466C>A	ENSP00000299752:p.Glu434*		B4DPA8|H3BPD3|Q6UW93	Nonsense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E434*	ENST00000299752.4	37	c.1300	CCDS10823.1	16	.	.	.	.	.	.	.	.	.	.	C	14.79	2.640138	0.47153	.	.	ENSG00000166589	ENST00000394055;ENST00000299752;ENST00000544875	.	.	.	4.72	4.72	0.59763	.	0.289610	0.35124	N	0.003424	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11794	T	0.64	-20.3384	13.0469	0.58931	0.0:1.0:0.0:0.0	.	.	.	.	X	434;434;398	.	ENSP00000299752:E434X	E	-	1	0	CDH16	65503967	1.000000	0.71417	0.983000	0.44433	0.045000	0.14185	2.758000	0.47565	2.468000	0.83385	0.561000	0.74099	GAA	CDH16	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000166589		0.577	CDH16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH16	HGNC	protein_coding	OTTHUMT00000268839.2	79	0.00	0	C	NM_004062		66946466	66946466	-1	no_errors	ENST00000299752	ensembl	human	known	69_37n	nonsense	25	48.98	24	SNP	1.000	A
CLIP1	6249	genome.wustl.edu	37	12	122825432	122825432	+	Silent	SNP	G	G	C			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr12:122825432G>C	ENST00000540338.1	-	10	2360	c.2319C>G	c.(2317-2319)ctC>ctG	p.L773L	CLIP1_ENST00000358808.2_Silent_p.L762L|CLIP1_ENST00000537178.1_Silent_p.L727L|CLIP1_ENST00000302528.7_Silent_p.L762L|CLIP1_ENST00000361654.4_Intron|CLIP1_ENST00000545889.1_Intron			P30622	CLIP1_HUMAN	CAP-GLY domain containing linker protein 1	773					microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|positive regulation of microtubule polymerization (GO:0031116)|transport (GO:0006810)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|intermediate filament (GO:0005882)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	metal ion binding (GO:0046872)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|nucleic acid binding (GO:0003676)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)	p.L762L(1)		NS(1)|breast(5)|endometrium(4)|kidney(5)|large_intestine(16)|liver(1)|lung(21)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		CAAGATCCAAGAGCTTTTCTT	0.403																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											195.0	183.0	187.0					12																	122825432		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS9232.1, CCDS9233.1, CCDS58285.1	12q24.3	2013-01-17	2007-01-05	2007-01-05	ENSG00000130779	ENSG00000130779			10461	protein-coding gene	gene with protein product	"""restin"""	179838	"""restin (Reed-Steinberg cell-expressed intermediate filament-associated protein)"""	RSN		8222754	Standard	NM_001247997		Approved	CYLN1, CLIP170, CLIP, CLIP-170	uc001ucg.2	P30622	OTTHUMG00000168922	ENST00000540338.1:c.2319C>G	12.37:g.122825432G>C			A0AVD3|Q17RS4|Q29RG0	Silent	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,superfamily_Znf_CCHC,superfamily_Prefoldin,pfscan_CAP-Gly_domain	p.L773	ENST00000540338.1	37	c.2319	CCDS58285.1	12																																																																																			CLIP1	-	NULL	ENSG00000130779		0.403	CLIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLIP1	HGNC	protein_coding	OTTHUMT00000401625.1	118	0.00	0	G	NM_002956		122825432	122825432	-1	no_errors	ENST00000540338	ensembl	human	known	69_37n	silent	105	37.87	64	SNP	0.925	C
CNST	163882	genome.wustl.edu	37	1	246810526	246810526	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr1:246810526G>C	ENST00000366513.4	+	9	1292	c.1023G>C	c.(1021-1023)caG>caC	p.Q341H	CNST_ENST00000366512.3_Missense_Mutation_p.Q341H|CNST_ENST00000483271.1_3'UTR	NM_152609.2	NP_689822.2	Q6PJW8	CNST_HUMAN	consortin, connexin sorting protein	341					negative regulation of phosphatase activity (GO:0010923)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)	connexin binding (GO:0071253)|phosphatase binding (GO:0019902)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|prostate(1)|urinary_tract(2)	28						GCTGTCATCAGATGGACGTGC	0.517											OREG0014367	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													85.0	87.0	86.0					1																	246810526		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056563	CCDS1628.1, CCDS44343.1	1q44	2012-04-17	2009-11-03	2009-11-03	ENSG00000162852	ENSG00000162852		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	26486	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 64"""	613439	"""chromosome 1 open reading frame 71"""	C1orf71		19864490	Standard	NM_152609		Approved	FLJ32001, PPP1R64	uc001ibp.3	Q6PJW8	OTTHUMG00000040090	ENST00000366513.4:c.1023G>C	1.37:g.246810526G>C	ENSP00000355470:p.Gln341His	2468	Q5VSY9|Q5VTM7|Q8IYA9|Q8N3L5|Q8NB09|Q8TEI2|Q96MR5	Missense_Mutation	SNP	NULL	p.Q341H	ENST00000366513.4	37	c.1023	CCDS1628.1	1	.	.	.	.	.	.	.	.	.	.	G	11.48	1.649856	0.29336	.	.	ENSG00000162852	ENST00000366513;ENST00000366512	T;T	0.20463	2.1;2.07	5.48	-2.6	0.06190	.	0.611530	0.15573	N	0.255345	T	0.14313	0.0346	L	0.41236	1.265	0.09310	N	0.999998	B;B	0.15141	0.012;0.012	B;B	0.14023	0.01;0.01	T	0.18713	-1.0328	10	0.49607	T	0.09	-13.0018	7.8705	0.29563	0.2527:0.4549:0.2924:0.0	.	341;341	Q6PJW8;Q6PJW8-2	CNST_HUMAN;.	H	341	ENSP00000355470:Q341H;ENSP00000355469:Q341H	ENSP00000355469:Q341H	Q	+	3	2	CNST	244877149	0.015000	0.18098	0.000000	0.03702	0.019000	0.09904	0.123000	0.15708	-0.417000	0.07461	0.467000	0.42956	CAG	CNST	-	NULL	ENSG00000162852		0.517	CNST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNST	HGNC	protein_coding	OTTHUMT00000096780.1	24	0.00	0	G	NM_152609		246810526	246810526	+1	no_errors	ENST00000366513	ensembl	human	known	69_37n	missense	23	28.12	9	SNP	0.000	C
CWC25	54883	genome.wustl.edu	37	17	36966009	36966009	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr17:36966009C>A	ENST00000225428.5	-	6	933	c.636G>T	c.(634-636)aaG>aaT	p.K212N	CWC25_ENST00000536127.1_Missense_Mutation_p.K149N	NM_017748.3	NP_060218.1	Q9NXE8	CWC25_HUMAN	CWC25 spliceosome-associated protein homolog (S. cerevisiae)	212										central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)	14						TTGCCATCTTCTTCTGTGATC	0.408																																						dbGAP											0													92.0	83.0	86.0					17																	36966009		1881	4111	5992	-	-	-	SO:0001583	missense	0			AK000298	CCDS45663.1	17q12	2010-01-26	2010-01-26	2010-01-26		ENSG00000273559			25989	protein-coding gene	gene with protein product			"""coiled-coil domain containing 49"""	CCDC49		19941820	Standard	NM_017748		Approved	FLJ20291	uc002hqu.4	Q9NXE8		ENST00000225428.5:c.636G>T	17.37:g.36966009C>A	ENSP00000225428:p.Lys212Asn		A0JLM3|Q68DK5	Missense_Mutation	SNP	pfam_CWC25,pfam_CIR_N_dom	p.K212N	ENST00000225428.5	37	c.636	CCDS45663.1	17	.	.	.	.	.	.	.	.	.	.	C	11.76	1.733812	0.30684	.	.	ENSG00000108296	ENST00000225428;ENST00000536127	T;T	0.63255	-0.03;-0.03	5.25	4.29	0.51040	.	0.450847	0.26773	N	0.022567	T	0.54743	0.1877	M	0.63843	1.955	0.42674	D	0.993526	P;B	0.35433	0.501;0.376	B;B	0.32864	0.058;0.154	T	0.52888	-0.8515	10	0.22706	T	0.39	.	10.9451	0.47296	0.0:0.9134:0.0:0.0866	.	149;212	B4DJK2;Q9NXE8	.;CWC25_HUMAN	N	212;149	ENSP00000225428:K212N;ENSP00000438566:K149N	ENSP00000225428:K212N	K	-	3	2	CWC25	34219535	1.000000	0.71417	0.998000	0.56505	0.073000	0.16967	2.832000	0.48152	1.457000	0.47850	0.563000	0.77884	AAG	CWC25	-	NULL	ENSG00000108296		0.408	CWC25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CWC25	HGNC	protein_coding	OTTHUMT00000442186.6	81	0.00	0	C	NM_017748		36966009	36966009	-1	no_errors	ENST00000225428	ensembl	human	known	69_37n	missense	24	63.08	41	SNP	1.000	A
CYP2A7	1549	genome.wustl.edu	37	19	41388071	41388071	+	Silent	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr19:41388071C>T	ENST00000301146.4	-	1	586	c.45G>A	c.(43-45)ctG>ctA	p.L15L	CYP2A7_ENST00000291764.3_Silent_p.L15L|CTC-490E21.12_ENST00000601627.1_Intron	NM_000764.2	NP_000755.2	P20853	CP2A7_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 7	15						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			CCATCACAGTCAGGCAGGCCA	0.587																																						dbGAP											0													82.0	71.0	74.0					19																	41388071		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			NM_000764	CCDS12569.1, CCDS42570.1	19q13.2	2013-07-25	2003-01-14		ENSG00000198077	ENSG00000198077		"""Cytochrome P450s"""	2611	protein-coding gene	gene with protein product		608054	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 7"""			7668294, 15128046	Standard	NM_030589		Approved	CYP2A	uc002opm.3	P20853	OTTHUMG00000182715	ENST00000301146.4:c.45G>A	19.37:g.41388071C>T			Q13121	Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-I_CYP2A-like,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I_CYP2B-like	p.L15	ENST00000301146.4	37	c.45	CCDS12569.1	19																																																																																			CYP2A7	-	prints_Cyt_P450_E_grp-I_CYP2B-like	ENSG00000198077		0.587	CYP2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2A7	HGNC	protein_coding	OTTHUMT00000463269.2	60	0.00	0	C	NM_030589		41388071	41388071	-1	no_errors	ENST00000301146	ensembl	human	known	69_37n	silent	72	39.17	47	SNP	0.010	T
CYP2A13	1553	genome.wustl.edu	37	19	41595962	41595962	+	Silent	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr19:41595962C>T	ENST00000330436.3	+	3	354	c.354C>T	c.(352-354)ttC>ttT	p.F118F		NM_000766.4	NP_000757.2	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 13	118					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(6)|kidney(4)|large_intestine(8)|lung(13)|ovary(3)|prostate(3)|skin(2)	42					Methoxsalen(DB00553)|Nicotine(DB00184)|Testosterone(DB00624)	GCGTGGCGTTCAGCAACGGGG	0.697																																						dbGAP											0													15.0	16.0	16.0					19																	41595962		2196	4292	6488	-	-	-	SO:0001819	synonymous_variant	0			U22028	CCDS12571.1	19q13.2	2013-11-11	2003-01-14		ENSG00000197838	ENSG00000197838		"""Cytochrome P450s"""	2608	protein-coding gene	gene with protein product		608055	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 13"""			7668294, 15128046	Standard	NM_000766		Approved	CPAD, CYP2A	uc002opt.4	Q16696	OTTHUMG00000182762	ENST00000330436.3:c.354C>T	19.37:g.41595962C>T			Q53YR8|Q6R569|Q6R570|Q9H2X2	Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-I_CYP2A-like,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV	p.F118	ENST00000330436.3	37	c.354	CCDS12571.1	19																																																																																			CYP2A13	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000197838		0.697	CYP2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2A13	HGNC	protein_coding	OTTHUMT00000463505.1	8	0.00	0	C	NM_000766		41595962	41595962	+1	no_errors	ENST00000330436	ensembl	human	known	69_37n	silent	9	40.00	6	SNP	0.983	T
CYP2E1	1571	genome.wustl.edu	37	10	135340993	135340993	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr10:135340993C>G	ENST00000463117.2	+	3	366	c.94C>G	c.(94-96)Ctg>Gtg	p.L32V	SPRN_ENST00000541506.1_Intron|CYP2E1_ENST00000252945.3_Missense_Mutation_p.L32V			P05181	CP2E1_HUMAN	cytochrome P450, family 2, subfamily E, polypeptide 1	32				L -> N (in Ref. 12; AA sequence). {ECO:0000305}.	drug metabolic process (GO:0017144)|heterocycle metabolic process (GO:0046483)|monoterpenoid metabolic process (GO:0016098)|oxidation-reduction process (GO:0055114)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to organonitrogen compound (GO:0010243)|response to ozone (GO:0010193)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|triglyceride metabolic process (GO:0006641)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|mitochondrion (GO:0005739)	enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)			NS(1)|central_nervous_system(3)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(7)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)	Acetaminophen(DB00316)|Aldesleukin(DB00041)|Almotriptan(DB00918)|Alosetron(DB00969)|Aminophylline(DB01223)|Amitriptyline(DB00321)|Antipyrine(DB01435)|Azelastine(DB00972)|Benzyl alcohol(DB06770)|Bifonazole(DB04794)|Bromazepam(DB01558)|Brompheniramine(DB00835)|Bupropion(DB01156)|Caffeine(DB00201)|Carbinoxamine(DB00748)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Chlorzoxazone(DB00356)|Cimetidine(DB00501)|Citalopram(DB00215)|Clevidipine(DB04920)|Clofibrate(DB00636)|Clomifene(DB00882)|Clonazepam(DB01068)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Dacarbazine(DB00851)|Dalfampridine(DB06637)|Dapsone(DB00250)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Dexmedetomidine(DB00633)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Disulfiram(DB00822)|Econazole(DB01127)|Enflurane(DB00228)|Enfuvirtide(DB00109)|Estrone(DB00655)|Ethanol(DB00898)|Ethanolamine Oleate(DB06689)|Ethosuximide(DB00593)|Etoposide(DB00773)|Etoricoxib(DB01628)|Felbamate(DB00949)|Fingolimod(DB08868)|Flunitrazepam(DB01544)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluvoxamine(DB00176)|Folic Acid(DB00158)|Fomepizole(DB01213)|Glucosamine(DB01296)|Halothane(DB01159)|Hexobarbital(DB01355)|Iloperidone(DB04946)|Imipramine(DB00458)|Isoflurane(DB00753)|Isoniazid(DB00951)|Isosorbide Dinitrate(DB00883)|Itraconazole(DB01167)|Menadione(DB00170)|Meprobamate(DB00371)|Methazolamide(DB00703)|Methimazole(DB00763)|Methotrimeprazine(DB01403)|Methoxyflurane(DB01028)|Metyrapone(DB01011)|Mexiletine(DB00379)|Miconazole(DB01110)|Midazolam(DB00683)|Mitoxantrone(DB01204)|Nicardipine(DB00622)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nitrazepam(DB01595)|Nortriptyline(DB00540)|Ondansetron(DB00904)|Orphenadrine(DB01173)|Oxaliplatin(DB00526)|Paramethadione(DB00617)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Pilocarpine(DB01085)|Pimozide(DB01100)|Proguanil(DB01131)|Propofol(DB00818)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rufinamide(DB06201)|S-Adenosylmethionine(DB00118)|Selegiline(DB01037)|Sevoflurane(DB01236)|Sildenafil(DB00203)|Streptozocin(DB00428)|Sulfadiazine(DB00359)|Sulfanilamide(DB00259)|Tamoxifen(DB00675)|Thalidomide(DB01041)|Theobromine(DB01412)|Theophylline(DB00277)|Thiopental(DB00599)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Trabectedin(DB05109)|Tranylcypromine(DB00752)|Trimethadione(DB00347)|Ursodeoxycholic acid(DB01586)|Zafirlukast(DB00549)|Zopiclone(DB01198)	CAGCTGGAATCTGCCCCCAGG	0.587									Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of																													dbGAP											0													51.0	51.0	51.0					10																	135340993		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	incl.: Familial Head and Neck Cancer	J02843	CCDS7686.1	10q26.3	2013-05-03	2003-01-14	2002-09-13	ENSG00000130649	ENSG00000130649		"""Cytochrome P450s"""	2631	protein-coding gene	gene with protein product		124040	"""cytochrome P450, subfamily IIE (ethanol-inducible), polypeptide 1"""	CYP2E			Standard	NM_000773		Approved		uc001lnj.1	P05181	OTTHUMG00000019322	ENST00000463117.2:c.94C>G	10.37:g.135340993C>G	ENSP00000440689:p.Leu32Val		Q5VZD5|Q6NWT9|Q9UK47	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-I_CYP2E-like,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.L32V	ENST00000463117.2	37	c.94	CCDS7686.1	10	.	.	.	.	.	.	.	.	.	.	C	16.28	3.077424	0.55753	.	.	ENSG00000130649	ENST00000463117;ENST00000541261;ENST00000252945	T;T;T	0.70869	4.85;-0.52;4.85	4.86	3.02	0.34903	.	0.251924	0.33813	N	0.004532	T	0.80314	0.4600	M	0.71581	2.175	0.26220	N	0.979177	D	0.76494	0.999	D	0.78314	0.991	T	0.70730	-0.4792	10	0.87932	D	0	.	9.0756	0.36519	0.0:0.8207:0.0:0.1793	.	32	P05181	CP2E1_HUMAN	V	32	ENSP00000440689:L32V;ENSP00000437799:L32V;ENSP00000252945:L32V	ENSP00000252945:L32V	L	+	1	2	CYP2E1	135190983	0.125000	0.22332	0.897000	0.35233	0.788000	0.44548	0.121000	0.15667	0.770000	0.33336	0.563000	0.77884	CTG	CYP2E1	-	superfamily_Cyt_P450	ENSG00000130649		0.587	CYP2E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2E1	HGNC	protein_coding	OTTHUMT00000051161.2	18	0.00	0	C	NM_000773		135340993	135340993	+1	no_errors	ENST00000252945	ensembl	human	known	69_37n	missense	12	33.33	6	SNP	0.875	G
DDR1	780	genome.wustl.edu	37	6	30864588	30864588	+	Silent	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr6:30864588C>T	ENST00000324771.8	+	15	2363	c.1815C>T	c.(1813-1815)ttC>ttT	p.F605F	DDR1_ENST00000376567.2_Silent_p.F568F|DDR1_ENST00000376570.4_Silent_p.F568F|DDR1_ENST00000446312.1_3'UTR|DDR1_ENST00000513240.1_Silent_p.F605F|DDR1_ENST00000361741.4_Silent_p.F272F|DDR1_ENST00000376569.3_Silent_p.F568F|DDR1_ENST00000376568.3_Silent_p.F605F|DDR1_ENST00000454612.2_Silent_p.F568F|DDR1_ENST00000508312.1_Silent_p.F586F|DDR1_ENST00000418800.2_Silent_p.F568F|DDR1_ENST00000452441.1_Silent_p.F605F|DDR1_ENST00000376575.3_Silent_p.F605F			Q08345	DDR1_HUMAN	discoidin domain receptor tyrosine kinase 1	605					branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|ear development (GO:0043583)|embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine autophosphorylation (GO:0038083)|protein autophosphorylation (GO:0046777)|regulation of cell growth (GO:0001558)|regulation of cell-matrix adhesion (GO:0001952)|regulation of extracellular matrix disassembly (GO:0010715)|smooth muscle cell migration (GO:0014909)|smooth muscle cell-matrix adhesion (GO:0061302)|wound healing, spreading of cells (GO:0044319)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|metal ion binding (GO:0046872)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(1)|prostate(1)|skin(1)	29					Imatinib(DB00619)	GAGTGGATTTCCCTCGATCTC	0.622																																						dbGAP											0													56.0	63.0	61.0					6																	30864588		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X99031	CCDS4690.1, CCDS34385.1, CCDS47396.1, CCDS56411.1, CCDS75419.1	6p21.33	2010-02-17	2008-01-23		ENSG00000204580	ENSG00000204580	2.7.10.1	"""CD molecules"""	2730	protein-coding gene	gene with protein product		600408	"""discoidin domain receptor family, member 1"""	NTRK4, PTK3A, NEP, CAK, EDDR1		7789998	Standard	NM_001954		Approved	RTK6, CD167	uc003nrv.3	Q08345	OTTHUMG00000031236	ENST00000324771.8:c.1815C>T	6.37:g.30864588C>T			B5A975|B5A976|B7Z2K0|Q14196|Q16562|Q2L6H3|Q4LE50|Q5ST11|Q5ST12|Q6NSK4|Q9UD35|Q9UD36|Q9UD37|Q9UD86|Q9UDL2	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,pfscan_Prot_kinase_cat_dom	p.P97S	ENST00000324771.8	37	c.289	CCDS34385.1	6	.	.	.	.	.	.	.	.	.	.	C	8.687	0.906607	0.17833	.	.	ENSG00000204580	ENST00000514434	.	.	.	5.21	3.44	0.39384	.	.	.	.	.	T	0.45816	0.1361	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40001	-0.9586	4	.	.	.	.	9.7177	0.40284	0.0:0.831:0.0:0.169	.	.	.	.	S	97	.	.	P	+	1	0	DDR1	30972567	1.000000	0.71417	0.999000	0.59377	0.795000	0.44927	1.291000	0.33330	0.597000	0.29811	0.561000	0.74099	CCC	DDR1	-	superfamily_Kinase-like_dom	ENSG00000204580		0.622	DDR1-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	DDR1	HGNC	protein_coding	OTTHUMT00000076494.3	29	0.00	0	C	NM_013994		30864588	30864588	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000514434	ensembl	human	novel	69_37n	missense	21	33.33	11	SNP	1.000	T
DDR2	4921	genome.wustl.edu	37	1	162729640	162729640	+	Silent	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr1:162729640C>T	ENST00000367922.3	+	9	1164	c.726C>T	c.(724-726)ttC>ttT	p.F242F	DDR2_ENST00000367921.3_Silent_p.F242F	NM_001014796.1	NP_001014796.1	Q16832	DDR2_HUMAN	discoidin domain receptor tyrosine kinase 2	242					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|chondrocyte proliferation (GO:0035988)|collagen fibril organization (GO:0030199)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|endochondral bone growth (GO:0003416)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autophosphorylation (GO:0046777)|regulation of bone mineralization (GO:0030500)|regulation of extracellular matrix disassembly (GO:0010715)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(2)|kidney(1)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)		Regorafenib(DB08896)	TGGACGATTTCACCCAGACCC	0.527																																					NSCLC(161;314 2006 8283 19651 23192)	dbGAP											0													118.0	102.0	108.0					1																	162729640		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK095975	CCDS1241.1	1q12-q23	2009-07-10	2008-01-23		ENSG00000162733	ENSG00000162733	2.7.10.1		2731	protein-coding gene	gene with protein product		191311	"""discoidin domain receptor family, member 2"""	TYRO10, NTRKR3		9659899	Standard	XM_005245221		Approved	TKT	uc001gcg.3	Q16832	OTTHUMG00000034423	ENST00000367922.3:c.726C>T	1.37:g.162729640C>T			Q7Z730	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Kinase-like_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.F242	ENST00000367922.3	37	c.726	CCDS1241.1	1																																																																																			DDR2	-	NULL	ENSG00000162733		0.527	DDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDR2	HGNC	protein_coding	OTTHUMT00000083213.2	63	0.00	0	C	NM_006182		162729640	162729640	+1	no_errors	ENST00000367921	ensembl	human	known	69_37n	silent	66	25.00	22	SNP	1.000	T
DEPDC4	120863	genome.wustl.edu	37	12	100657603	100657603	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr12:100657603C>G	ENST00000416321.1	-	2	228	c.226G>C	c.(226-228)Gaa>Caa	p.E76Q		NM_152317.2	NP_689530.1	Q8N2C3	DEPD4_HUMAN	DEP domain containing 4	76	DEP. {ECO:0000255|PROSITE- ProRule:PRU00066}.				intracellular signal transduction (GO:0035556)					NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|pancreas(1)|urinary_tract(1)	15						CTTTTTATTTCCACTTGGGCC	0.383																																						dbGAP											0													127.0	121.0	123.0					12																	100657603		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK090824	CCDS9075.1	12q23	2006-03-30				ENSG00000166153			22952	protein-coding gene	gene with protein product						12477932	Standard	XM_005268628		Approved	DEP.4, FLJ33505	uc001thi.3	Q8N2C3		ENST00000416321.1:c.226G>C	12.37:g.100657603C>G	ENSP00000396234:p.Glu76Gln		Q496C8|Q96BW0	Missense_Mutation	SNP	pfam_DEP_dom,smart_DEP_dom,pfscan_DEP_dom	p.E76Q	ENST00000416321.1	37	c.226	CCDS9075.1	12	.	.	.	.	.	.	.	.	.	.	C	16.54	3.151338	0.57151	.	.	ENSG00000166153	ENST00000422147;ENST00000416321;ENST00000550587;ENST00000551642	T;T;T	0.22336	1.96;1.96;1.96	4.92	3.08	0.35506	DEP domain (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	.	.	.	.	T	0.37433	0.1003	M	0.69248	2.105	0.29350	N	0.86538	P;P	0.47604	0.898;0.898	P;P	0.54372	0.75;0.686	T	0.28681	-1.0036	9	0.87932	D	0	.	12.6557	0.56786	0.0:0.8447:0.0:0.1553	.	76;76	E9PGM3;Q8N2C3	.;DEPD4_HUMAN	Q	76;76;76;69	ENSP00000396234:E76Q;ENSP00000448385:E76Q;ENSP00000449590:E69Q	ENSP00000367490:E76Q	E	-	1	0	DEPDC4	99181734	1.000000	0.71417	0.999000	0.59377	0.733000	0.41908	4.965000	0.63708	0.149000	0.19098	-1.151000	0.01829	GAA	DEPDC4	-	pfam_DEP_dom,smart_DEP_dom,pfscan_DEP_dom	ENSG00000166153		0.383	DEPDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEPDC4	HGNC	protein_coding	OTTHUMT00000408482.1	52	0.00	0	C	NM_152317		100657603	100657603	-1	no_errors	ENST00000378244	ensembl	human	known	69_37n	missense	73	13.10	11	SNP	1.000	G
DPF2	5977	genome.wustl.edu	37	11	65113788	65113788	+	Silent	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr11:65113788C>T	ENST00000528416.1	+	9	1108	c.975C>T	c.(973-975)atC>atT	p.I325I	DPF2_ENST00000415073.2_Intron|DPF2_ENST00000252268.4_Silent_p.I339I	NM_006268.4	NP_006259.1	Q92785	REQU_HUMAN	D4, zinc and double PHD fingers family 2	325					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|prostate(1)	23						GGCAGTGCATCGAGTGCAAAT	0.552																																						dbGAP											0													155.0	115.0	129.0					11																	65113788		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0			U94585	CCDS8100.1	11q13.1	2014-05-13	2003-10-06	2003-10-08	ENSG00000133884	ENSG00000133884		"""Zinc fingers, PHD-type"""	9964	protein-coding gene	gene with protein product		601671	"""requiem, apoptosis response zinc finger gene"""	REQ		11845289	Standard	NM_006268		Approved	ubi-d4, BAF45d	uc001odm.3	Q92785	OTTHUMG00000165985	ENST00000528416.1:c.975C>T	11.37:g.65113788C>T			A8K7C9|B4DT58	Silent	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_C2H2-like,smart_Znf_PHD,pfscan_Znf_PHD-finger,pfscan_Znf_C2H2	p.I325	ENST00000528416.1	37	c.975	CCDS8100.1	11																																																																																			DPF2	-	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	ENSG00000133884		0.552	DPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPF2	HGNC	protein_coding	OTTHUMT00000387293.3	72	0.00	0	C	NM_006268		65113788	65113788	+1	no_errors	ENST00000528416	ensembl	human	known	69_37n	silent	107	27.70	41	SNP	1.000	T
DRG2	1819	genome.wustl.edu	37	17	17997277	17997277	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr17:17997277C>G	ENST00000225729.3	+	2	353	c.215C>G	c.(214-216)tCt>tGt	p.S72C	DRG2_ENST00000583355.1_Missense_Mutation_p.S72C|DRG2_ENST00000395726.4_Missense_Mutation_p.S72C	NM_001388.4	NP_001379.1	P55039	DRG2_HUMAN	developmentally regulated GTP binding protein 2	72	OBG-type G. {ECO:0000255|PROSITE- ProRule:PRU01047}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	14	all_neural(463;0.228)					GGATTTCCCTCTGTGGGTAAG	0.567																																						dbGAP											0													168.0	137.0	148.0					17																	17997277		2203	4300	6503	-	-	-	SO:0001583	missense	0			X80754	CCDS11191.1	17p13-p12	2008-07-18	2001-11-28		ENSG00000108591	ENSG00000108591			3030	protein-coding gene	gene with protein product		602986	"""developmentally regulated GTP-binding protein 2"""			9605870, 7929244	Standard	NM_001388		Approved		uc002gsh.2	P55039	OTTHUMG00000059399	ENST00000225729.3:c.215C>G	17.37:g.17997277C>G	ENSP00000225729:p.Ser72Cys		B2R8G5|Q53Y50|Q9BWB2	Missense_Mutation	SNP	pfam_TGS,pfam_GTP_binding_domain,pfam_Fe2_transport_prot_B_N,superfamily_TGS-like,prints_GTP_binding_domain,tigrfam_Small_GTP-bd_dom	p.S72C	ENST00000225729.3	37	c.215	CCDS11191.1	17	.	.	.	.	.	.	.	.	.	.	C	16.18	3.049231	0.55110	.	.	ENSG00000108591	ENST00000395726;ENST00000225729	T;T	0.17854	2.25;2.25	5.54	5.54	0.83059	Small GTP-binding protein domain (1);GTP1/OBG (1);	0.000000	0.85682	D	0.000000	T	0.63534	0.2519	H	0.99011	4.4	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	T	0.79918	-0.1600	10	0.87932	D	0	-30.9102	19.4719	0.94966	0.0:1.0:0.0:0.0	.	72;72;72	B4DIG2;A8MZF9;P55039	.;.;DRG2_HUMAN	C	72	ENSP00000379076:S72C;ENSP00000225729:S72C	ENSP00000225729:S72C	S	+	2	0	DRG2	17938002	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.725000	0.84808	2.610000	0.88304	0.655000	0.94253	TCT	DRG2	-	pfam_Fe2_transport_prot_B_N,prints_GTP_binding_domain,tigrfam_Small_GTP-bd_dom	ENSG00000108591		0.567	DRG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DRG2	HGNC	protein_coding	OTTHUMT00000132075.3	139	0.00	0	C	NM_001388		17997277	17997277	+1	no_errors	ENST00000225729	ensembl	human	known	69_37n	missense	119	32.39	57	SNP	1.000	G
DSE	29940	genome.wustl.edu	37	6	116757740	116757740	+	Silent	SNP	C	C	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr6:116757740C>A	ENST00000331677.3	+	7	2553	c.2109C>A	c.(2107-2109)gcC>gcA	p.A703A	DSE_ENST00000359564.2_Silent_p.A703A|DSE_ENST00000537543.1_Silent_p.A722A|DSE_ENST00000452085.3_Silent_p.A703A			Q9UL01	DSE_HUMAN	dermatan sulfate epimerase	703					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin-glucuronate 5-epimerase activity (GO:0047757)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)		CAGGTGAGGCCACAGGACAGT	0.512																																						dbGAP											0													108.0	104.0	105.0					6																	116757740		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF098066	CCDS5107.1	6q22	2008-02-05	2007-01-29	2007-01-29	ENSG00000111817	ENSG00000111817	5.1.3.19		21144	protein-coding gene	gene with protein product		605942	"""squamous cell carcinoma antigen recognized by T cells 2"""	SART2		11920522, 16505484	Standard	NM_001080976		Approved	DSEPI	uc003pws.3	Q9UL01	OTTHUMG00000015434	ENST00000331677.3:c.2109C>A	6.37:g.116757740C>A			Q5R3K6	Silent	SNP	superfamily_Chondroitin_lyas	p.A722	ENST00000331677.3	37	c.2166	CCDS5107.1	6																																																																																			DSE	-	NULL	ENSG00000111817		0.512	DSE-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DSE	HGNC	protein_coding	OTTHUMT00000041940.2	36	0.00	0	C	NM_013352		116757740	116757740	+1	no_errors	ENST00000537543	ensembl	human	known	69_37n	silent	25	24.24	8	SNP	0.000	A
ECM2	1842	genome.wustl.edu	37	9	95277329	95277329	+	Missense_Mutation	SNP	G	G	A	rs13291847		TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr9:95277329G>A	ENST00000344604.5	-	4	787	c.638C>T	c.(637-639)tCt>tTt	p.S213F	ECM2_ENST00000444490.2_Missense_Mutation_p.S191F|CENPP_ENST00000375587.3_Intron	NM_001197295.1|NM_001393.3	NP_001184224.1|NP_001384.1	O94769	ECM2_HUMAN	extracellular matrix protein 2, female organ and adipocyte specific	213					cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	interstitial matrix (GO:0005614)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27						ATCCTCCTCAGATTGAAGTGC	0.438																																						dbGAP											0													140.0	151.0	147.0					9																	95277329		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011792	CCDS6698.1, CCDS56578.1	9q22.3	2008-07-21			ENSG00000106823	ENSG00000106823			3154	protein-coding gene	gene with protein product	"""matrix glycoprotein SC1/ECM2"""	603479				9790758	Standard	NM_001393		Approved		uc011lty.2	O94769	OTTHUMG00000020226	ENST00000344604.5:c.638C>T	9.37:g.95277329G>A	ENSP00000344758:p.Ser213Phe		B2R730|E2PU11|Q5T9F2|Q7Z3D0	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_VWF_C,smart_VWF_C,smart_Leu-rich_rpt_typical-subtyp,pfscan_VWF_C	p.S213F	ENST00000344604.5	37	c.638	CCDS6698.1	9	.	.	.	.	.	.	.	.	.	.	G	0.043	-1.275062	0.01410	.	.	ENSG00000106823	ENST00000444490;ENST00000344604	T;T	0.51071	0.72;0.76	4.84	0.44	0.16572	.	1.787160	0.02303	N	0.071393	T	0.18425	0.0442	N	0.01048	-1.04	0.09310	N	1	B;B;B	0.11235	0.003;0.001;0.004	B;B;B	0.09377	0.001;0.001;0.004	T	0.26087	-1.0113	10	0.09338	T	0.73	.	6.5504	0.22431	0.2894:0.0:0.5771:0.1335	.	213;191;191	O94769;B4DK93;O94769-2	ECM2_HUMAN;.;.	F	191;213	ENSP00000393971:S191F;ENSP00000344758:S213F	ENSP00000344758:S213F	S	-	2	0	ECM2	94317150	0.000000	0.05858	0.132000	0.22025	0.508000	0.34012	0.211000	0.17474	0.106000	0.17784	0.655000	0.94253	TCT	ECM2	-	NULL	ENSG00000106823		0.438	ECM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECM2	HGNC	protein_coding	OTTHUMT00000053091.1	87	0.00	0	G	NM_001393		95277329	95277329	-1	no_errors	ENST00000344604	ensembl	human	known	69_37n	missense	131	13.73	21	SNP	0.013	A
ERI3	79033	genome.wustl.edu	37	1	44820585	44820585	+	Silent	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr1:44820585C>T	ENST00000372257.2	-	1	295	c.114G>A	c.(112-114)ccG>ccA	p.P38P	ERI3_ENST00000537474.1_5'Flank|ERI3_ENST00000495828.1_5'UTR	NM_024066.1	NP_076971.1	O43414	ERI3_HUMAN	ERI1 exoribonuclease family member 3	38							exonuclease activity (GO:0004527)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(2)|lung(7)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						GCCCCCAACTCGGGCCCATCC	0.697																																						dbGAP											0													12.0	15.0	14.0					1																	44820585		2173	4246	6419	-	-	-	SO:0001819	synonymous_variant	0			AF007157	CCDS30696.1	1p34.1	2009-10-07	2009-10-07	2008-12-16	ENSG00000117419	ENSG00000117419		"""Enhanced RNAi three prime mRNA exonucleases"""	17276	protein-coding gene	gene with protein product	"""enhanced RNAi three prime mRNA exonuclease homolog 3 (C.elegans)"", ""exoribonuclease 3"""	609917	"""prion protein interacting protein"""	PRNPIP			Standard	XM_005271184		Approved	FLJ22943, PINT1	uc001clt.3	O43414	OTTHUMG00000007637	ENST00000372257.2:c.114G>A	1.37:g.44820585C>T			B1AK98|Q5T2T7|Q5T2T9|Q5TG35|Q9BQA0|Q9UEB4	Silent	SNP	pfam_Exonuclease_RNaseT/DNA_pol3,superfamily_RNaseH-like_dom,smart_Exonuclease	p.P38	ENST00000372257.2	37	c.114	CCDS30696.1	1																																																																																			ERI3	-	NULL	ENSG00000117419		0.697	ERI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERI3	HGNC	protein_coding	OTTHUMT00000020243.1	9	0.00	0	C	NM_024066		44820585	44820585	-1	no_errors	ENST00000372257	ensembl	human	known	69_37n	silent	4	60.00	6	SNP	1.000	T
FAM171B	165215	genome.wustl.edu	37	2	187559029	187559030	+	In_Frame_Ins	INS	-	-	CAG	rs549897920|rs56669143	byFrequency	TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr2:187559029_187559030insCAG	ENST00000304698.5	+	1	332_333	c.129_130insCAG	c.(130-132)cag>CAGcag	p.44_44Q>QQ	AC017101.10_ENST00000453665.1_RNA	NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	44	Gln-rich.					integral component of membrane (GO:0016021)	DNA binding (GO:0003677)			NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						GCCTCATCcaacagcagcagca	0.644														949	0.189497	0.1778	0.1398	5008	,	,		13517	0.1448		0.2078	False		,,,				2504	0.2679					dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.145_147dupCAG	2.37:g.187559036_187559038dupCAG	ENSP00000304108:p.Gln56dup		Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	In_Frame_Ins	INS	pfam_Uncharacterised_FAM171	p.47in_frame_insQ	ENST00000304698.5	37	c.129_130	CCDS33347.1	2																																																																																			FAM171B	-	NULL	ENSG00000144369		0.644	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM171B	HGNC	protein_coding	OTTHUMT00000334679.1	8	0.00	0	-	NM_177454		187559029	187559030	+1	no_errors	ENST00000304698	ensembl	human	known	69_37n	in_frame_ins	12	25.00	4	INS	0.998:1.000	CAG
FAM179A	165186	genome.wustl.edu	37	2	29246027	29246027	+	Silent	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr2:29246027G>A	ENST00000379558.4	+	12	1938	c.1587G>A	c.(1585-1587)ctG>ctA	p.L529L	FAM179A_ENST00000403861.2_Silent_p.L474L|FAM179A_ENST00000465300.1_3'UTR	NM_199280.2	NP_954974.2	Q6ZUX3	F179A_HUMAN	family with sequence similarity 179, member A	529										breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						CCGGGAAGCTGCACGACGTGT	0.627																																						dbGAP											0													30.0	36.0	34.0					2																	29246027		2086	4203	6289	-	-	-	SO:0001819	synonymous_variant	0			AK125239, AK125744	CCDS1769.2	2p23.2	2008-10-30			ENSG00000189350	ENSG00000189350			33715	protein-coding gene	gene with protein product						16344560	Standard	NM_199280		Approved	FLJ43249, LOC165186	uc010ezl.3	Q6ZUX3	OTTHUMG00000128432	ENST00000379558.4:c.1587G>A	2.37:g.29246027G>A			Q6ZUF5	Silent	SNP	pfam_CLASP_N_dom,superfamily_ARM-type_fold	p.L529	ENST00000379558.4	37	c.1587	CCDS1769.2	2																																																																																			FAM179A	-	pfam_CLASP_N_dom,superfamily_ARM-type_fold	ENSG00000189350		0.627	FAM179A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FAM179A	HGNC	protein_coding	OTTHUMT00000317848.4	27	0.00	0	G	NM_199280		29246027	29246027	+1	no_errors	ENST00000379558	ensembl	human	known	69_37n	silent	15	28.57	6	SNP	0.999	A
FAM208A	23272	genome.wustl.edu	37	3	56681156	56681156	+	Nonsense_Mutation	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr3:56681156G>A	ENST00000493960.2	-	14	1619	c.1609C>T	c.(1609-1611)Cag>Tag	p.Q537*	FAM208A_ENST00000431842.2_Nonsense_Mutation_p.Q141*|FAM208A_ENST00000355628.5_Nonsense_Mutation_p.Q537*	NM_001112736.1	NP_001106207.1	Q9UK61	F208A_HUMAN	family with sequence similarity 208, member A	537							poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(11)|prostate(3)|skin(1)	32						TTTCGACACTGAATCAAAGAA	0.348																																						dbGAP											0													43.0	47.0	46.0					3																	56681156		2202	4297	6499	-	-	-	SO:0001587	stop_gained	0			AF180425	CCDS2877.1, CCDS46853.1	3p14.3	2011-09-14	2011-09-14	2011-09-14	ENSG00000163946	ENSG00000163946			30314	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 63"""	C3orf63		10470851, 11149944	Standard	NM_015224		Approved	se89-1, RAP140, KIAA1105	uc003die.4	Q9UK61	OTTHUMG00000158827	ENST00000493960.2:c.1609C>T	3.37:g.56681156G>A	ENSP00000417509:p.Gln537*		A1L3A4|B5ME28|Q9H2F7|Q9UPP7	Nonsense_Mutation	SNP	pfam_DUF3715	p.Q537*	ENST00000493960.2	37	c.1609	CCDS46853.1	3	.	.	.	.	.	.	.	.	.	.	G	38	7.207046	0.98136	.	.	ENSG00000163946	ENST00000431842;ENST00000493960;ENST00000355628	.	.	.	5.38	5.38	0.77491	.	0.309953	0.28171	N	0.016326	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	-0.0274	12.98	0.58557	0.0:0.0:0.7234:0.2766	.	.	.	.	X	141;537;537	.	ENSP00000347845:Q537X	Q	-	1	0	C3orf63	56656196	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.591000	0.53986	2.793000	0.96121	0.655000	0.94253	CAG	FAM208A	-	NULL	ENSG00000163946		0.348	FAM208A-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	FAM208A	HGNC	protein_coding	OTTHUMT00000352352.2	36	0.00	0	G	NM_015224		56681156	56681156	-1	no_errors	ENST00000355628	ensembl	human	known	69_37n	nonsense	14	51.72	15	SNP	1.000	A
FANCA	2175	genome.wustl.edu	37	16	89882319	89882319	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr16:89882319C>A	ENST00000389301.3	-	2	185	c.155G>T	c.(154-156)cGa>cTa	p.R52L	FANCA_ENST00000534992.1_Missense_Mutation_p.R52L|FANCA_ENST00000563673.1_Missense_Mutation_p.R52L|FANCA_ENST00000568369.1_Missense_Mutation_p.R52L|FANCA_ENST00000389302.3_Missense_Mutation_p.R52L|FANCA_ENST00000543736.1_Missense_Mutation_p.R52L	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	52					DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		CTGATGGCTTCGCAGGAGGCG	0.522			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													dbGAP	yes	Rec		Fanconi anaemia A	16	16q24.3	2175	"""Fanconi anemia, complementation group A"""		L	0													135.0	127.0	129.0					16																	89882319		2198	4300	6498	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.155G>T	16.37:g.89882319C>A	ENSP00000373952:p.Arg52Leu		A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Missense_Mutation	SNP	pfam_Fanconia,prints_Fanconia	p.R52L	ENST00000389301.3	37	c.155	CCDS32515.1	16	.	.	.	.	.	.	.	.	.	.	C	14.68	2.607108	0.46527	.	.	ENSG00000187741	ENST00000389301;ENST00000389302;ENST00000534992;ENST00000543736	T;T;T;T	0.38722	1.12;1.12;1.12;1.12	5.47	2.09	0.27110	.	0.378804	0.22832	N	0.055097	T	0.47801	0.1465	L	0.57536	1.79	0.26131	N	0.980414	D;D;D;D;D;D	0.63880	0.965;0.993;0.993;0.993;0.993;0.965	P;D;D;D;P;P	0.63033	0.468;0.91;0.91;0.91;0.881;0.468	T	0.26608	-1.0098	10	0.25106	T	0.35	-5.197	4.1274	0.10133	0.0:0.5921:0.1949:0.213	.	52;52;52;52;52;52	B4DRI7;Q0VAP4;A0PJU8;F5H8D5;O15360-2;O15360	.;.;.;.;.;FANCA_HUMAN	L	52	ENSP00000373952:R52L;ENSP00000373953:R52L;ENSP00000443675:R52L;ENSP00000443409:R52L	ENSP00000373952:R52L	R	-	2	0	FANCA	88409820	0.707000	0.27866	0.837000	0.33122	0.026000	0.11368	1.146000	0.31589	1.318000	0.45170	0.645000	0.84053	CGA	FANCA	-	NULL	ENSG00000187741		0.522	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FANCA	HGNC	protein_coding	OTTHUMT00000421927.1	79	0.00	0	C			89882319	89882319	-1	no_errors	ENST00000389301	ensembl	human	known	69_37n	missense	23	56.60	30	SNP	0.488	A
FCRL3	115352	genome.wustl.edu	37	1	157660235	157660235	+	Silent	SNP	C	C	G			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr1:157660235C>G	ENST00000368184.3	-	9	1791	c.1500G>C	c.(1498-1500)ctG>ctC	p.L500L	FCRL3_ENST00000473231.1_5'UTR|FCRL3_ENST00000368186.5_Silent_p.L500L|RP11-367J7.3_ENST00000453692.1_RNA	NM_052939.3	NP_443171.2	Q96P31	FCRL3_HUMAN	Fc receptor-like 3	500	Ig-like C2-type 6.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(1)|large_intestine(13)|lung(31)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)	69	all_hematologic(112;0.0378)					AGGAGCCTCTCAGGGACTCAC	0.622																																						dbGAP											0													52.0	54.0	53.0					1																	157660235		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF459027	CCDS1167.1	1q21-q22	2013-01-11			ENSG00000160856	ENSG00000160856		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18506	protein-coding gene	gene with protein product		606510				11493702, 12014205	Standard	XR_241065		Approved	FCRH3, IRTA3, IFGP3, SPAP2a, SPAP2, SPAP2b, SPAP2c, SPAP2d, SPAP2e, CD307c	uc001frb.3	Q96P31	OTTHUMG00000019400	ENST00000368184.3:c.1500G>C	1.37:g.157660235C>G			A0N0M4|A8MTH7|D3DVD2|Q5VXZ8|Q8N6S2|Q96LA4|Q96P27|Q96P28|Q96P29|Q96P30	Silent	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L500	ENST00000368184.3	37	c.1500	CCDS1167.1	1																																																																																			FCRL3	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000160856		0.622	FCRL3-006	NOVEL	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	FCRL3	HGNC	protein_coding	OTTHUMT00000051419.2	47	0.00	0	C	NM_052939		157660235	157660235	-1	no_errors	ENST00000368186	ensembl	human	known	69_37n	silent	47	25.40	16	SNP	0.005	G
FREM1	158326	genome.wustl.edu	37	9	14776228	14776228	+	Intron	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr9:14776228C>T	ENST00000380880.3	-	25	5226				FREM1_ENST00000422223.2_Intron|FREM1_ENST00000380881.4_Intron|FREM1_ENST00000380894.1_Silent_p.L8L|FREM1_ENST00000486223.1_5'Flank			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1						cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		AGGCAGCCTTCAGCATGGATT	0.458																																						dbGAP											0													28.0	30.0	29.0					9																	14776228		2030	4177	6207	-	-	-	SO:0001627	intron_variant	0			AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.4443-27G>A	9.37:g.14776228C>T			B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Silent	SNP	pfam_C-type_lectin,pfam_Calx_beta,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.L8	ENST00000380880.3	37	c.24	CCDS47952.1	9																																																																																			FREM1	-	NULL	ENSG00000164946		0.458	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FREM1	HGNC	protein_coding	OTTHUMT00000339474.2	26	0.00	0	C	NM_144966		14776228	14776228	-1	no_errors	ENST00000380894	ensembl	human	known	69_37n	silent	13	23.53	4	SNP	1.000	T
FUK	197258	genome.wustl.edu	37	16	70513502	70513502	+	Silent	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr16:70513502C>T	ENST00000288078.6	+	24	3406	c.3174C>T	c.(3172-3174)atC>atT	p.I1058I	FUK_ENST00000378912.2_Silent_p.I1064I|FUK_ENST00000571514.1_Silent_p.I549I	NM_145059.2	NP_659496.2	Q8N0W3	FUK_HUMAN	fucokinase	1058						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|fucokinase activity (GO:0050201)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(11)|ovary(2)|prostate(2)	23		Ovarian(137;0.0694)				ATTACAGCATCCACCTGGTTG	0.567																																						dbGAP											0													74.0	82.0	80.0					16																	70513502		1964	4137	6101	-	-	-	SO:0001819	synonymous_variant	0				CCDS10891.2	16q22.1	2008-02-05			ENSG00000157353	ENSG00000157353	2.7.1.52		29500	protein-coding gene	gene with protein product	"""L-fucose kinase"""	608675				12056818	Standard	XM_006721161		Approved	FLJ39408	uc002eyy.3	Q8N0W3	OTTHUMG00000074085	ENST00000288078.6:c.3174C>T	16.37:g.70513502C>T			Q5PSM3|Q5XKL6|Q6ZRA0|Q96MT9	Silent	SNP	pfam_Fucokinase,pfam_GHMP_kinase_C_dom,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_Trimer_LpxA-like,prints_Galkinase	p.I1064	ENST00000288078.6	37	c.3192	CCDS10891.2	16																																																																																			FUK	-	NULL	ENSG00000157353		0.567	FUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUK	HGNC	protein_coding	OTTHUMT00000157291.2	77	0.00	0	C	NM_145059		70513502	70513502	+1	no_errors	ENST00000378912	ensembl	human	known	69_37n	silent	25	56.14	32	SNP	1.000	T
GALNT8	26290	genome.wustl.edu	37	12	4853841	4853841	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr12:4853841G>T	ENST00000252318.2	+	4	1172	c.835G>T	c.(835-837)Gct>Tct	p.A279S		NM_017417.1	NP_059113.1	Q9NY28	GALT8_HUMAN	polypeptide N-acetylgalactosaminyltransferase 8	279	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	35						CATCTTGGATGCTCACATTGA	0.493																																					Colon(108;631 1558 7270 20097 39846)	dbGAP											0													72.0	54.0	60.0					12																	4853841		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ271385	CCDS8533.1	12p13.32	2014-03-13	2014-03-13		ENSG00000130035	ENSG00000130035	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4130	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 8"""	606250	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8)"""			10767557	Standard	NM_017417		Approved	GALNAC-T8	uc001qne.1	Q9NY28	OTTHUMG00000166188	ENST00000252318.2:c.835G>T	12.37:g.4853841G>T	ENSP00000252318:p.Ala279Ser		B2RU02	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.A279S	ENST00000252318.2	37	c.835	CCDS8533.1	12	.	.	.	.	.	.	.	.	.	.	G	22.0	4.234917	0.79800	.	.	ENSG00000130035	ENST00000252318	T	0.62232	0.04	4.5	3.61	0.41365	Glycosyl transferase, family 2 (1);	0.000000	0.85682	D	0.000000	T	0.63379	0.2506	N	0.24115	0.695	0.35296	D	0.782638	D	0.89917	1.0	D	0.80764	0.994	T	0.68119	-0.5493	9	.	.	.	.	10.36	0.43987	0.0966:0.0:0.9034:0.0	.	279	Q9NY28	GALT8_HUMAN	S	279	ENSP00000252318:A279S	.	A	+	1	0	GALNT8	4724102	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	6.726000	0.74758	1.108000	0.41662	0.484000	0.47621	GCT	GALNT8	-	pfam_Glyco_trans_2	ENSG00000130035		0.493	GALNT8-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	GALNT8	HGNC	protein_coding	OTTHUMT00000388277.2	19	0.00	0	G	NM_017417		4853841	4853841	+1	no_errors	ENST00000252318	ensembl	human	known	69_37n	missense	38	26.92	14	SNP	1.000	T
GBP4	115361	genome.wustl.edu	37	1	89651146	89651146	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr1:89651146C>T	ENST00000355754.6	-	11	1811	c.1714G>A	c.(1714-1716)Gaa>Aaa	p.E572K	GBP4_ENST00000471938.1_5'Flank	NM_052941.4	NP_443173.2	Q96PP9	GBP4_HUMAN	guanylate binding protein 4	572						cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(19)|skin(1)|stomach(2)|urinary_tract(1)	33				all cancers(265;0.00723)|Epithelial(280;0.0291)		AGCATTTCTTCTTGTACCTAT	0.289																																						dbGAP											0													61.0	59.0	60.0					1																	89651146		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF288814	CCDS721.1	1p22.2	2008-02-05			ENSG00000162654	ENSG00000162654			20480	protein-coding gene	gene with protein product		612466				16689661	Standard	NM_052941		Approved	Mpa2	uc001dnb.3	Q96PP9	OTTHUMG00000010663	ENST00000355754.6:c.1714G>A	1.37:g.89651146C>T	ENSP00000359490:p.Glu572Lys		B2R630|Q05D63|Q6NSL0|Q86T99	Missense_Mutation	SNP	pfam_Guanylate-bd_C,pfam_Guanylate-bd_N,superfamily_Guanylate-bd_C	p.E572K	ENST00000355754.6	37	c.1714	CCDS721.1	1	.	.	.	.	.	.	.	.	.	.	C	8.177	0.792879	0.16327	.	.	ENSG00000162654	ENST00000355754	T	0.02050	4.48	4.54	-5.41	0.02648	Guanylate-binding protein, C-terminal (3);	0.755390	0.12009	N	0.508079	T	0.00271	0.0008	N	0.05158	-0.105	0.09310	N	1	B	0.06786	0.001	B	0.13407	0.009	T	0.43015	-0.9417	10	0.09590	T	0.72	.	3.095	0.06307	0.1116:0.3178:0.1102:0.4604	.	572	Q96PP9	GBP4_HUMAN	K	572	ENSP00000359490:E572K	ENSP00000359490:E572K	E	-	1	0	GBP4	89423734	0.145000	0.22656	0.000000	0.03702	0.085000	0.17905	-0.298000	0.08265	-0.694000	0.05113	0.650000	0.86243	GAA	GBP4	-	pfam_Guanylate-bd_C,superfamily_Guanylate-bd_C	ENSG00000162654		0.289	GBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP4	HGNC	protein_coding	OTTHUMT00000029409.1	85	0.00	0	C	NM_052941		89651146	89651146	-1	no_errors	ENST00000355754	ensembl	human	known	69_37n	missense	103	26.24	37	SNP	0.000	T
GID4	79018	genome.wustl.edu	37	17	17965159	17965159	+	Splice_Site	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr17:17965159G>A	ENST00000268719.4	+	5	882	c.709G>A	c.(709-711)Gaa>Aaa	p.E237K		NM_024052.4	NP_076957.3	Q8IVV7	GID4_HUMAN	GID complex subunit 4	237																	CTGTGTGCAGGAACAGTTTCT	0.502																																						dbGAP											0													168.0	155.0	160.0					17																	17965159		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK127580	CCDS11190.1	17p11.2	2013-07-31	2013-07-31	2012-07-20	ENSG00000141034	ENSG00000141034			28453	protein-coding gene	gene with protein product	"""vacuolar import and degradation 24"""		"""chromosome 17 open reading frame 39"", ""GID complex subunit 4, VID24 homolog (S. cerevisiae)"""	C17orf39		11997338	Standard	NM_024052		Approved	VID24	uc002gsg.1	Q8IVV7	OTTHUMG00000059398	ENST00000268719.4:c.709-1G>A	17.37:g.17965159G>A			Q8TEB5|Q9BW50	Missense_Mutation	SNP	pfam_Vacuolar_import/degrad_Vid24	p.E237K	ENST00000268719.4	37	c.709	CCDS11190.1	17	.	.	.	.	.	.	.	.	.	.	G	35	5.596436	0.96602	.	.	ENSG00000141034	ENST00000268719	.	.	.	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	D	0.87577	0.6212	H	0.95470	3.675	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.91510	0.5226	8	.	.	.	-1.6904	18.4182	0.90577	0.0:0.0:1.0:0.0	.	237	Q8IVV7	CQ039_HUMAN	K	237	.	.	E	+	1	0	C17orf39	17905884	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.561000	0.98142	2.436000	0.82500	0.585000	0.79938	GAA	GID4	-	pfam_Vacuolar_import/degrad_Vid24	ENSG00000141034		0.502	GID4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GID4	HGNC	protein_coding	OTTHUMT00000132071.2	66	0.00	0	G	NM_024052	Missense_Mutation	17965159	17965159	+1	no_errors	ENST00000268719	ensembl	human	known	69_37n	missense	76	26.42	28	SNP	1.000	A
GCGR	2642	genome.wustl.edu	37	17	79770714	79770714	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr17:79770714C>G	ENST00000400723.3	+	12	1362	c.1069C>G	c.(1069-1071)Ctg>Gtg	p.L357V	GCGR_ENST00000570996.1_Missense_Mutation_p.L387V	NM_000160.3	NP_000151.1	P47871	GLR_HUMAN	glucagon receptor	357					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|exocytosis (GO:0006887)|generation of precursor metabolites and energy (GO:0006091)|glucose homeostasis (GO:0042593)|hormone-mediated signaling pathway (GO:0009755)|positive regulation of GTPase activity (GO:0043547)|regulation of blood pressure (GO:0008217)|regulation of glycogen metabolic process (GO:0070873)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glucagon receptor activity (GO:0004967)|guanyl-nucleotide exchange factor activity (GO:0005085)|peptide hormone binding (GO:0017046)			endometrium(2)	2					Glucagon recombinant(DB00040)	CCTCATCCCTCTGCTGGGCGT	0.672																																						dbGAP											0													25.0	32.0	30.0					17																	79770714		692	1591	2283	-	-	-	SO:0001583	missense	0			U03469, L20316	CCDS54177.1	17q25	2012-08-10			ENSG00000215644	ENSG00000215644		"""GPCR / Class B : Glucagon receptors"""	4192	protein-coding gene	gene with protein product		138033				8020989	Standard	XM_006722276		Approved	GGR	uc010wuw.2	P47871		ENST00000400723.3:c.1069C>G	17.37:g.79770714C>G	ENSP00000383558:p.Leu357Val		Q2M3M5	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_glucagon_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_GLP1/glucagon_rcpt,prints_GPCR_2_GIP_rcpt	p.L357V	ENST00000400723.3	37	c.1069	CCDS54177.1	17	.	.	.	.	.	.	.	.	.	.	c	18.95	3.731603	0.69189	.	.	ENSG00000215644	ENST00000400723	T	0.66280	-0.2	4.88	3.91	0.45181	GPCR, family 2-like (1);	.	.	.	.	T	0.79341	0.4429	M	0.87758	2.905	0.51482	D	0.999923	D	0.89917	1.0	D	0.97110	1.0	T	0.80788	-0.1226	9	0.52906	T	0.07	.	10.4133	0.44307	0.0:0.8391:0.0:0.1609	.	357	P47871	GLR_HUMAN	V	357	ENSP00000383558:L357V	ENSP00000383558:L357V	L	+	1	2	GCGR	.	0.218000	0.23608	1.000000	0.80357	0.975000	0.68041	0.833000	0.27504	1.268000	0.44264	0.655000	0.94253	CTG	GCGR	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	ENSG00000215644		0.672	GCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCGR	HGNC	protein_coding	OTTHUMT00000439676.1	10	0.00	0	C	NM_000160		79770714	79770714	+1	no_errors	ENST00000400723	ensembl	human	known	69_37n	missense	14	22.22	4	SNP	0.999	G
COLGALT2	23127	genome.wustl.edu	37	1	183920242	183920242	+	Silent	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr1:183920242G>A	ENST00000361927.4	-	8	1406	c.1035C>T	c.(1033-1035)ttC>ttT	p.F345F	COLGALT2_ENST00000367520.3_Silent_p.F82F|COLGALT2_ENST00000546159.1_Silent_p.F345F	NM_015101.2	NP_055916.1	Q8IYK4	GT252_HUMAN	collagen beta(1-O)galactosyltransferase 2	345					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)	procollagen galactosyltransferase activity (GO:0050211)										GGTTTATCATGAAAATCTAAT	0.403																																						dbGAP											0													179.0	176.0	177.0					1																	183920242		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF288389	CCDS1360.1	1q25	2013-02-27	2013-02-27	2013-02-27	ENSG00000198756	ENSG00000198756			16790	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 17"", ""glycosyltransferase 25 domain containing 2"""	C1orf17, GLT25D2		19075007	Standard	XM_005245008		Approved	KIAA0584	uc001gqr.3	Q8IYK4	OTTHUMG00000035460	ENST00000361927.4:c.1035C>T	1.37:g.183920242G>A			O60327|Q9BZR0	Silent	SNP	pfam_Glyco_trans_25	p.F345	ENST00000361927.4	37	c.1035	CCDS1360.1	1																																																																																			GLT25D2	-	pfam_Glyco_trans_25	ENSG00000198756		0.403	COLGALT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLT25D2	HGNC	protein_coding	OTTHUMT00000086128.1	77	0.00	0	G	NM_015101		183920242	183920242	-1	no_errors	ENST00000361927	ensembl	human	known	69_37n	silent	89	41.83	64	SNP	1.000	A
GPR149	344758	genome.wustl.edu	37	3	154055753	154055753	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr3:154055753G>C	ENST00000389740.2	-	4	2030	c.1931C>G	c.(1930-1932)tCc>tGc	p.S644C		NM_001038705.1	NP_001033794.1	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	644					antral ovarian follicle growth (GO:0001547)|estrous cycle phase (GO:0060206)|negative regulation of ovulation (GO:0060280)|preantral ovarian follicle growth (GO:0001546)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(22)|ovary(7)|prostate(1)|skin(1)|urinary_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			GACTTGTGTGGAGGACTGACT	0.438																																						dbGAP											0													153.0	140.0	144.0					3																	154055753		1980	4158	6138	-	-	-	SO:0001583	missense	0			AY255534	CCDS43162.1	3q25.2	2012-08-21			ENSG00000174948	ENSG00000174948		"""GPCR / Class A : Orphans"""	23627	protein-coding gene	gene with protein product						12679517	Standard	NM_001038705		Approved	PGR10, IEDA	uc003faa.3	Q86SP6	OTTHUMG00000159131	ENST00000389740.2:c.1931C>G	3.37:g.154055753G>C	ENSP00000374390:p.Ser644Cys			Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.S644C	ENST00000389740.2	37	c.1931	CCDS43162.1	3	.	.	.	.	.	.	.	.	.	.	G	24.5	4.534933	0.85812	.	.	ENSG00000174948	ENST00000389740	.	.	.	5.7	5.7	0.88788	.	0.060845	0.64402	D	0.000002	T	0.66557	0.2801	N	0.24115	0.695	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	T	0.70193	-0.4939	9	0.87932	D	0	-17.7895	19.8361	0.96658	0.0:0.0:1.0:0.0	.	644	Q86SP6	GP149_HUMAN	C	644	.	ENSP00000374390:S644C	S	-	2	0	GPR149	155538447	1.000000	0.71417	0.972000	0.41901	0.997000	0.91878	9.455000	0.97625	2.703000	0.92315	0.650000	0.86243	TCC	GPR149	-	NULL	ENSG00000174948		0.438	GPR149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR149	HGNC	protein_coding	OTTHUMT00000353430.1	79	0.00	0	G	XM_293580		154055753	154055753	-1	no_errors	ENST00000389740	ensembl	human	known	69_37n	missense	138	20.69	36	SNP	1.000	C
GPR39	2863	genome.wustl.edu	37	2	133402996	133402996	+	Silent	SNP	C	C	G			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr2:133402996C>G	ENST00000329321.3	+	2	1648	c.1179C>G	c.(1177-1179)ctC>ctG	p.L393L	GPR39_ENST00000470071.1_3'UTR|LYPD1_ENST00000397463.2_3'UTR	NM_001508.2	NP_001499.1	O43194	GPR39_HUMAN	G protein-coupled receptor 39	393					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GCCCGTTGCTCTTCGCGTCCC	0.617																																						dbGAP											0													42.0	45.0	44.0					2																	133402996		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF034633	CCDS2170.1	2q21-q22	2012-08-21			ENSG00000183840	ENSG00000183840		"""GPCR / Class A : Orphans"""	4496	protein-coding gene	gene with protein product		602886				9441746	Standard	NM_001508		Approved		uc002ttl.3	O43194	OTTHUMG00000131679	ENST00000329321.3:c.1179C>G	2.37:g.133402996C>G			B2RC12|B6V9G4|Q08AS2|Q53R01	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.L393	ENST00000329321.3	37	c.1179	CCDS2170.1	2																																																																																			GPR39	-	NULL	ENSG00000183840		0.617	GPR39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR39	HGNC	protein_coding	OTTHUMT00000254582.1	20	0.00	0	C			133402996	133402996	+1	no_errors	ENST00000329321	ensembl	human	known	69_37n	silent	15	37.50	9	SNP	0.925	G
GPR98	84059	genome.wustl.edu	37	5	89981683	89981683	+	Nonsense_Mutation	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr5:89981683C>T	ENST00000405460.2	+	29	6457	c.6361C>T	c.(6361-6363)Cag>Tag	p.Q2121*		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	2121	Calx-beta 15. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TGGAACTCTTCAGCTCTCAGC	0.428																																						dbGAP											0													110.0	100.0	103.0					5																	89981683		1940	4138	6078	-	-	-	SO:0001587	stop_gained	0			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.6361C>T	5.37:g.89981683C>T	ENSP00000384582:p.Gln2121*		O75171|Q8TF58|Q9H0X5|Q9UL61	Nonsense_Mutation	SNP	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.Q2121*	ENST00000405460.2	37	c.6361	CCDS47246.1	5	.	.	.	.	.	.	.	.	.	.	C	48	14.923311	0.99815	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043	.	.	.	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	20.0503	0.97624	0.0:1.0:0.0:0.0	.	.	.	.	X	2121	.	ENSP00000296619:Q2121X	Q	+	1	0	GPR98	90017439	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.625000	0.83145	2.736000	0.93811	0.591000	0.81541	CAG	GPR98	-	pfam_Calx_beta,smart_Calx_beta	ENSG00000164199		0.428	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	HGNC	protein_coding	OTTHUMT00000369993.2	79	0.00	0	C	NM_032119		89981683	89981683	+1	no_errors	ENST00000405460	ensembl	human	known	69_37n	nonsense	77	32.46	37	SNP	1.000	T
GRB7	2886	genome.wustl.edu	37	17	37899229	37899229	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr17:37899229G>C	ENST00000309156.4	+	4	642	c.385G>C	c.(385-387)Gaa>Caa	p.E129Q	GRB7_ENST00000445327.2_Missense_Mutation_p.E152Q|GRB7_ENST00000394204.1_Missense_Mutation_p.E129Q|GRB7_ENST00000309185.3_Missense_Mutation_p.E129Q|GRB7_ENST00000578702.1_Intron|GRB7_ENST00000394211.3_Missense_Mutation_p.E129Q|GRB7_ENST00000394209.2_Missense_Mutation_p.E129Q	NM_005310.3	NP_005301.2	Q14451	GRB7_HUMAN	growth factor receptor-bound protein 7	129	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|leukocyte migration (GO:0050900)|negative regulation of translation (GO:0017148)|positive regulation of cell migration (GO:0030335)|positive regulation of signal transduction (GO:0009967)|stress granule assembly (GO:0034063)	cell projection (GO:0042995)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)|protein kinase binding (GO:0019901)|RNA binding (GO:0003723)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;6.86e-60)|all cancers(3;1.65e-53)|BRCA - Breast invasive adenocarcinoma(8;2.03e-43)|STAD - Stomach adenocarcinoma(3;1.43e-12)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			CCACGTGTGTGAAATGCTGGT	0.612																																						dbGAP											0													66.0	63.0	64.0					17																	37899229		2203	4300	6503	-	-	-	SO:0001583	missense	0			D43772	CCDS11345.1, CCDS56028.1	17q12	2013-02-14			ENSG00000141738	ENSG00000141738		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4567	protein-coding gene	gene with protein product		601522					Standard	NM_005310		Approved		uc021twu.1	Q14451	OTTHUMG00000133253	ENST00000309156.4:c.385G>C	17.37:g.37899229G>C	ENSP00000310771:p.Glu129Gln		B2RAV1|B3KNL0|B3KWP9|B7WP75|J3KQM4|Q53YD3|Q92568|Q96DF9|Q9Y220	Missense_Mutation	SNP	pfam_BPS-dom,pfam_SH2,pfam_Ras-assoc,pfam_Pleckstrin_homology,smart_Ras-assoc,smart_Pleckstrin_homology,smart_SH2,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SH2,prints_SH2	p.E152Q	ENST00000309156.4	37	c.454	CCDS11345.1	17	.	.	.	.	.	.	.	.	.	.	G	12.64	1.998447	0.35226	.	.	ENSG00000141738	ENST00000309185;ENST00000309156;ENST00000394211;ENST00000394209;ENST00000445327;ENST00000394204	T;T;T;T;T;T	0.74632	-0.86;-0.86;-0.86;-0.86;-0.86;-0.86	4.77	4.77	0.60923	Ras-association (3);	0.205842	0.51477	D	0.000095	T	0.48132	0.1483	N	0.02721	-0.515	0.49582	D	0.999808	B;B	0.28419	0.211;0.005	B;B	0.26094	0.066;0.019	T	0.54781	-0.8242	10	0.02654	T	1	-20.9653	17.0724	0.86578	0.0:0.0:1.0:0.0	.	129;129	Q14451-2;Q14451	.;GRB7_HUMAN	Q	129;129;129;129;152;129	ENSP00000311752:E129Q;ENSP00000310771:E129Q;ENSP00000377761:E129Q;ENSP00000377759:E129Q;ENSP00000403459:E152Q;ENSP00000377754:E129Q	ENSP00000310771:E129Q	E	+	1	0	GRB7	35152755	1.000000	0.71417	0.999000	0.59377	0.461000	0.32589	3.723000	0.54955	2.653000	0.90120	0.561000	0.74099	GAA	GRB7	-	pfam_Ras-assoc,smart_Ras-assoc,pfscan_Ras-assoc	ENSG00000141738		0.612	GRB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRB7	HGNC	protein_coding	OTTHUMT00000257024.2	30	0.00	0	G	NM_005310		37899229	37899229	+1	no_errors	ENST00000445327	ensembl	human	known	69_37n	missense	346	15.40	63	SNP	1.000	C
GRHL3	57822	genome.wustl.edu	37	1	24669202	24669202	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr1:24669202C>T	ENST00000350501.5	+	10	1352	c.1225C>T	c.(1225-1227)Cgc>Tgc	p.R409C	GRHL3_ENST00000342072.4_Missense_Mutation_p.R316C|GRHL3_ENST00000236255.4_Missense_Mutation_p.R414C|GRHL3_ENST00000356046.2_Missense_Mutation_p.R363C|GRHL3_ENST00000361548.4_Missense_Mutation_p.R409C	NM_198174.2	NP_937817.3	Q8TE85	GRHL3_HUMAN	grainyhead-like 3 (Drosophila)	409					central nervous system development (GO:0007417)|cochlea morphogenesis (GO:0090103)|ectoderm development (GO:0007398)|epidermis development (GO:0008544)|establishment of planar polarity (GO:0001736)|eyelid development in camera-type eye (GO:0061029)|pattern specification process (GO:0007389)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of actin cytoskeleton organization (GO:0032956)|wound healing (GO:0042060)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.00171)|all_lung(284;0.00226)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;8.72e-25)|Colorectal(126;4.38e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|GBM - Glioblastoma multiforme(114;0.000132)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00151)|KIRC - Kidney renal clear cell carcinoma(1967;0.00377)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.143)		GAGGAAGATGCGCGATGACGA	0.602																																						dbGAP											0													89.0	90.0	90.0					1																	24669202		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY231161	CCDS251.1, CCDS252.1, CCDS44088.1, CCDS252.2, CCDS53284.1	1p36	2008-02-05	2005-07-11	2005-07-11	ENSG00000158055	ENSG00000158055			25839	protein-coding gene	gene with protein product		608317	"""transcription factor CP2-like 4"""	TFCP2L4		12549979	Standard	NM_021180		Approved	SOM	uc021oiw.1	Q8TE85	OTTHUMG00000003040	ENST00000350501.5:c.1225C>T	1.37:g.24669202C>T	ENSP00000288955:p.Arg409Cys		A2A297|B2RCL1|G3XAF0|Q5TH78|Q86Y06|Q8N407	Missense_Mutation	SNP	pfam_CP2,superfamily_C2_Ca/lipid-bd_dom_CaLB	p.R409C	ENST00000350501.5	37	c.1225	CCDS252.2	1	.	.	.	.	.	.	.	.	.	.	C	18.77	3.694695	0.68386	.	.	ENSG00000158055	ENST00000361548;ENST00000342072;ENST00000350501;ENST00000356046;ENST00000236255	T;T;T;T;T	0.19250	2.16;2.16;2.16;2.16;2.16	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	T	0.45657	0.1353	M	0.80616	2.505	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.69824	0.963;0.966;0.966	T	0.46233	-0.9206	10	0.87932	D	0	-26.275	10.9458	0.47299	0.2909:0.7091:0.0:0.0	.	363;414;409	A2A297;Q8TE85-2;G3XAF0	.;.;.	C	409;316;409;363;414	ENSP00000354943:R409C;ENSP00000340543:R316C;ENSP00000288955:R409C;ENSP00000348333:R363C;ENSP00000236255:R414C	ENSP00000236255:R414C	R	+	1	0	GRHL3	24541789	0.988000	0.35896	1.000000	0.80357	0.991000	0.79684	0.145000	0.16157	2.585000	0.87301	0.655000	0.94253	CGC	GRHL3	-	pfam_CP2	ENSG00000158055		0.602	GRHL3-002	KNOWN	basic|CCDS	protein_coding	GRHL3	HGNC	protein_coding	OTTHUMT00000009047.2	33	0.00	0	C	NM_021180		24669202	24669202	+1	no_errors	ENST00000350501	ensembl	human	known	69_37n	missense	34	34.62	18	SNP	1.000	T
GRIN2A	2903	genome.wustl.edu	37	16	9934583	9934583	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr16:9934583G>C	ENST00000396573.2	-	8	1881	c.1572C>G	c.(1570-1572)ttC>ttG	p.F524L	GRIN2A_ENST00000330684.3_Missense_Mutation_p.F524L|GRIN2A_ENST00000396575.2_Missense_Mutation_p.F524L|GRIN2A_ENST00000562109.1_Missense_Mutation_p.F524L|GRIN2A_ENST00000535259.1_Missense_Mutation_p.F367L|GRIN2A_ENST00000404927.2_Missense_Mutation_p.F524L	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	524					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	AGGGCACAGAGAAGTCCACCA	0.463																																						dbGAP											0													126.0	98.0	108.0					16																	9934583		2197	4300	6497	-	-	-	SO:0001583	missense	0				CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.1572C>G	16.37:g.9934583G>C	ENSP00000379818:p.Phe524Leu		O00669|Q17RZ6	Missense_Mutation	SNP	pfam_NMDAR2_C,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.F524L	ENST00000396573.2	37	c.1572	CCDS10539.1	16	.	.	.	.	.	.	.	.	.	.	G	26.0	4.696835	0.88830	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	T;T;T;T;T	0.72282	-0.64;-0.64;-0.64;-0.64;-0.64	5.3	4.25	0.50352	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	D	0.85856	0.5794	H	0.96048	3.76	0.80722	D	1	D;D;P	0.89917	1.0;1.0;0.888	D;D;P	0.91635	0.999;0.999;0.571	D	0.86497	0.1801	9	.	.	.	.	3.805	0.08773	0.3188:0.0:0.6812:0.0	.	367;524;524	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	L	524;524;367;524;524	ENSP00000379818:F524L;ENSP00000385872:F524L;ENSP00000441572:F367L;ENSP00000332549:F524L;ENSP00000379820:F524L	.	F	-	3	2	GRIN2A	9842084	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.737000	0.55060	2.469000	0.83416	0.655000	0.94253	TTC	GRIN2A	-	pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000183454		0.463	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2A	HGNC	protein_coding	OTTHUMT00000251930.3	47	0.00	0	G			9934583	9934583	-1	no_errors	ENST00000330684	ensembl	human	known	69_37n	missense	68	19.05	16	SNP	1.000	C
GRIN2B	2904	genome.wustl.edu	37	12	13716151	13716151	+	Missense_Mutation	SNP	C	C	G	rs371762359		TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr12:13716151C>G	ENST00000609686.1	-	13	4230	c.4021G>C	c.(4021-4023)Gag>Cag	p.E1341Q		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	1341					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GCTGACATCTCAAACATGTGG	0.612																																						dbGAP											0													57.0	57.0	57.0					12																	13716151		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.4021G>C	12.37:g.13716151C>G	ENSP00000477455:p.Glu1341Gln		Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Missense_Mutation	SNP	pfam_NMDAR2_C,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.E1341Q	ENST00000609686.1	37	c.4021	CCDS8662.1	12	.	.	.	.	.	.	.	.	.	.	C	17.88	3.496169	0.64186	.	.	ENSG00000150086	ENST00000279593	T	0.13657	2.57	5.11	5.11	0.69529	Glutamate [NMDA] receptor, epsilon subunit, C-terminal (1);	0.182827	0.48767	D	0.000180	T	0.22044	0.0531	L	0.36672	1.1	0.80722	D	1	P	0.51147	0.942	P	0.52710	0.707	T	0.00397	-1.1765	10	0.37606	T	0.19	.	18.736	0.91755	0.0:1.0:0.0:0.0	.	1341	Q13224	NMDE2_HUMAN	Q	1341	ENSP00000279593:E1341Q	ENSP00000279593:E1341Q	E	-	1	0	GRIN2B	13607418	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	6.913000	0.75759	2.637000	0.89404	0.563000	0.77884	GAG	GRIN2B	-	pfam_NMDAR2_C	ENSG00000150086		0.612	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2B	HGNC	protein_coding	OTTHUMT00000268014.2	54	0.00	0	C			13716151	13716151	-1	no_errors	ENST00000279593	ensembl	human	known	69_37n	missense	48	28.36	19	SNP	1.000	G
GTF2IRD2B	389524	genome.wustl.edu	37	7	74564242	74564242	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr7:74564242G>C	ENST00000312575.7	+	16	2164	c.1989G>C	c.(1987-1989)caG>caC	p.Q663H	GTF2IRD2B_ENST00000418185.2_Missense_Mutation_p.Q210H	NM_001003795.2	NP_001003795.1	Q6EKJ0	GTD2B_HUMAN	GTF2I repeat domain containing 2B	663					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|ovary(2)|prostate(1)	4						tctgtgctcagaagttgaaga	0.512																																						dbGAP											0													10.0	10.0	10.0					7																	74564242		2086	4164	6250	-	-	-	SO:0001583	missense	0			AY312850	CCDS34659.1	7q11.23	2014-05-06			ENSG00000174428	ENSG00000174428			33125	protein-coding gene	gene with protein product		608900				15100712	Standard	XM_005277580		Approved		uc003ubt.3	Q6EKJ0	OTTHUMG00000181534	ENST00000312575.7:c.1989G>C	7.37:g.74564242G>C	ENSP00000308080:p.Gln663His		B2RNE9|Q69GU6|Q8N979|Q9H739	Missense_Mutation	SNP	pfam_GTF2I,superfamily_GTF2I,superfamily_RNaseH-like_dom,pfscan_GTF2I	p.Q663H	ENST00000312575.7	37	c.1989	CCDS34659.1	7	.	.	.	.	.	.	.	.	.	.	G	1.131	-0.652353	0.03480	.	.	ENSG00000174428	ENST00000312575;ENST00000418185;ENST00000412484	T;T	0.22743	1.94;1.94	1.53	-1.67	0.08238	Ribonuclease H-like (1);	.	.	.	.	T	0.25717	0.0626	L	0.33485	1.01	0.18873	N	0.999986	P;D	0.61697	0.924;0.99	P;D	0.70487	0.461;0.969	T	0.15292	-1.0442	9	0.72032	D	0.01	-8.057	2.0122	0.03490	0.3635:0.0:0.3783:0.2582	.	158;663	Q86Y00;Q6EKJ0	.;GTD2B_HUMAN	H	663;210;78	ENSP00000308080:Q663H;ENSP00000411454:Q210H	ENSP00000308080:Q663H	Q	+	3	2	GTF2IRD2B	74202178	0.011000	0.17503	0.141000	0.22245	0.240000	0.25518	-2.935000	0.00686	-0.567000	0.06046	-1.421000	0.01109	CAG	GTF2IRD2B	-	superfamily_RNaseH-like_dom	ENSG00000174428		0.512	GTF2IRD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2IRD2B	HGNC	protein_coding	OTTHUMT00000342728.1	20	0.00	0	G	NM_001003795		74564242	74564242	+1	no_errors	ENST00000312575	ensembl	human	known	69_37n	missense	17	26.09	6	SNP	0.263	C
GUSBP11	91316	genome.wustl.edu	37	22	23980988	23980988	+	RNA	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr22:23980988G>A	ENST00000455485.1	-	0	3501				AP000347.4_ENST00000430707.2_RNA|KB-1572G7.3_ENST00000390329.3_RNA			Q6P575	BGP11_HUMAN	glucuronidase, beta pseudogene 11						carbohydrate metabolic process (GO:0005975)		hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)										TCTGGGTGATGAGGGTACCAT	0.567																																						dbGAP											0																																										-	-	-			0					22q11.23	2011-06-09			ENSG00000228315	ENSG00000228315			42325	pseudogene	pseudogene							Standard	NR_024448		Approved		uc011aiz.2	Q6P575	OTTHUMG00000150709		22.37:g.23980988G>A				RNA	SNP	-	NULL	ENST00000455485.1	37	NULL		22																																																																																			GUSBP11	-	-	ENSG00000228315		0.567	GUSBP11-005	KNOWN	basic|readthrough_transcript	processed_transcript	GUSBP11	HGNC	processed_transcript	OTTHUMT00000319697.1	69	0.00	0	G			23980988	23980988	-1	no_errors	ENST00000422506	ensembl	human	known	69_37n	rna	49	27.94	19	SNP	0.283	A
HEATR5B	54497	genome.wustl.edu	37	2	37284541	37284541	+	Silent	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr2:37284541G>A	ENST00000233099.5	-	15	2237	c.2142C>T	c.(2140-2142)ctC>ctT	p.L714L	HEATR5B_ENST00000354531.2_Silent_p.L714L	NM_019024.1	NP_061897.1	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	714						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|pancreas(1)|prostate(1)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	77		all_hematologic(82;0.21)				AGAGGGATCTGAGGAGGGAAG	0.388																																						dbGAP											0													145.0	146.0	146.0					2																	37284541		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB037835	CCDS33181.1	2p22.2	2007-01-02			ENSG00000008869	ENSG00000008869			29273	protein-coding gene	gene with protein product						10718198	Standard	XM_005264379		Approved	KIAA1414, DKFZp686P15184	uc002rpp.1	Q9P2D3	OTTHUMG00000152158	ENST00000233099.5:c.2142C>T	2.37:g.37284541G>A			B5MDU8|Q7Z3B2|Q9NVL7	Silent	SNP	superfamily_ARM-type_fold	p.L714	ENST00000233099.5	37	c.2142	CCDS33181.1	2																																																																																			HEATR5B	-	superfamily_ARM-type_fold	ENSG00000008869		0.388	HEATR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR5B	HGNC	protein_coding	OTTHUMT00000325492.1	130	0.00	0	G	NM_019024		37284541	37284541	-1	no_errors	ENST00000233099	ensembl	human	known	69_37n	silent	138	30.65	61	SNP	1.000	A
HERC1	8925	genome.wustl.edu	37	15	63958297	63958297	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr15:63958297C>T	ENST00000443617.2	-	42	8463	c.8376G>A	c.(8374-8376)atG>atA	p.M2792I		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	2792					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						GGTGCTCTATCATCCACATGG	0.547																																						dbGAP											0													47.0	48.0	48.0					15																	63958297		2035	4186	6221	-	-	-	SO:0001583	missense	0			U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.8376G>A	15.37:g.63958297C>T	ENSP00000390158:p.Met2792Ile		Q8IW65	Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_WD40_repeat,pfam_SPRY_rcpt,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_HECT,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl,superfamily_UBA-like,superfamily_ARM-type_fold,smart_SPla/RYanodine_receptor_subgr,smart_WD40_repeat,smart_HECT,pfscan_B30.2/SPRY,pfscan_HECT,pfscan_Reg_chr_condens,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Reg_chr_condens	p.M2792I	ENST00000443617.2	37	c.8376	CCDS45277.1	15	.	.	.	.	.	.	.	.	.	.	C	29.7	5.030478	0.93575	.	.	ENSG00000103657	ENST00000443617	T	0.17854	2.25	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.36826	0.0981	L	0.50333	1.59	0.80722	D	1	P	0.45126	0.851	P	0.58391	0.838	T	0.01711	-1.1290	10	0.87932	D	0	.	19.8218	0.96599	0.0:1.0:0.0:0.0	.	2792	Q15751	HERC1_HUMAN	I	2792	ENSP00000390158:M2792I	ENSP00000390158:M2792I	M	-	3	0	HERC1	61745350	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.800000	0.85949	2.678000	0.91216	0.655000	0.94253	ATG	HERC1	-	superfamily_UBA-like	ENSG00000103657		0.547	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC1	HGNC	protein_coding	OTTHUMT00000418523.1	35	0.00	0	C	NM_003922		63958297	63958297	-1	no_errors	ENST00000443617	ensembl	human	known	69_37n	missense	20	44.44	16	SNP	1.000	T
HES4	57801	genome.wustl.edu	37	1	934931	934931	+	Silent	SNP	C	C	G			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr1:934931C>G	ENST00000304952.6	-	3	404	c.267G>C	c.(265-267)cgG>cgC	p.R89R	HES4_ENST00000484667.2_Silent_p.R57R|RP11-54O7.17_ENST00000606034.1_lincRNA|HES4_ENST00000428771.2_Silent_p.R115R			Q9HCC6	HES4_HUMAN	hes family bHLH transcription factor 4	89	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription factor binding (GO:0008134)			lung(2)	2	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;9.36e-38)|OV - Ovarian serous cystadenocarcinoma(86;4.41e-23)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00237)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		GACGCAGGCTCCGCAGGTGTC	0.736																																						dbGAP											0													10.0	13.0	12.0					1																	934931		2142	4241	6383	-	-	-	SO:0001819	synonymous_variant	0			BC012351	CCDS5.1, CCDS44034.1	1p36	2013-10-17	2013-10-17		ENSG00000188290	ENSG00000188290		"""Basic helix-loop-helix proteins"""	24149	protein-coding gene	gene with protein product		608060	"""hairy and enhancer of split 4 (Drosophila)"""			11260262, 15254753	Standard	NM_021170		Approved	bHLHb42	uc001aci.2	Q9HCC6	OTTHUMG00000040758	ENST00000304952.6:c.267G>C	1.37:g.934931C>G			Q5SVA5	Silent	SNP	pfam_Orange,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_Orange_subgr,pfscan_Orange,pfscan_HLH_DNA-bd	p.R115	ENST00000304952.6	37	c.345	CCDS5.1	1																																																																																			HES4	-	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	ENSG00000188290		0.736	HES4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HES4	HGNC	protein_coding	OTTHUMT00000097944.1	10	0.00	0	C	NM_021170		934931	934931	-1	no_errors	ENST00000428771	ensembl	human	known	69_37n	silent	16	38.46	10	SNP	1.000	G
HIATL2	84278	genome.wustl.edu	37	9	99721158	99721158	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr9:99721158G>C	ENST00000375223.4	-	3	439	c.226C>G	c.(226-228)Caa>Gaa	p.Q76E	HIATL2_ENST00000602917.1_Missense_Mutation_p.Q76E			Q5VZR4	HIAL2_HUMAN	hippocampus abundant transcript-like 2	76					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)										AATGTGTGTTGAGAAAATGTT	0.328																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			BC005058		9q22.33	2008-09-12	2008-09-12		ENSG00000196312	ENSG00000196312			23672	protein-coding gene	gene with protein product						12477932	Standard	NR_002894		Approved	MGC12945	uc004aws.3	Q5VZR4	OTTHUMG00000020317	ENST00000375223.4:c.226C>G	9.37:g.99721158G>C	ENSP00000364371:p.Gln76Glu		Q9BSG7	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.Q76E	ENST00000375223.4	37	c.226		9	.	.	.	.	.	.	.	.	.	.	G	8.834	0.940717	0.18281	.	.	ENSG00000196312	ENST00000375223	T	0.80738	-1.41	2.21	2.21	0.28008	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.327832	0.18440	N	0.141175	T	0.62865	0.2463	.	.	.	0.37016	D	0.895953	B	0.23185	0.081	B	0.21360	0.034	T	0.57768	-0.7754	9	0.10111	T	0.7	.	10.5494	0.45079	0.0:0.0:1.0:0.0	.	76	Q5VZR4	HIAL2_HUMAN	E	76	ENSP00000364371:Q76E	ENSP00000364371:Q76E	Q	-	1	0	HIATL2	98760979	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	3.002000	0.49496	1.540000	0.49301	0.479000	0.44913	CAA	HIATL2	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000196312		0.328	HIATL2-201	KNOWN	basic|appris_candidate	protein_coding	HIATL2	HGNC	protein_coding		115	0.00	0	G	NM_032318		99721158	99721158	-1	no_errors	ENST00000375223	ensembl	human	known	69_37n	missense	196	22.53	57	SNP	1.000	C
HIST1H2AM	8336	genome.wustl.edu	37	6	27860646	27860646	+	Silent	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr6:27860646G>A	ENST00000359611.2	-	1	317	c.282C>T	c.(280-282)ctC>ctT	p.L94L	HIST1H3J_ENST00000479986.1_5'UTR|HIST1H2BO_ENST00000303806.4_5'Flank|HIST1H3J_ENST00000359303.2_5'Flank	NM_003514.2	NP_003505.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2am	94						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)			endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|ovary(2)	14						GCAGCTTGTTGAGCTCCTCGT	0.592																																						dbGAP											0													149.0	145.0	146.0					6																	27860646		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X57138	CCDS4639.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000233224	ENSG00000278677		"""Histones / Replication-dependent"""	4735	protein-coding gene	gene with protein product		602796	"""H2A histone family, member N"", ""histone 1, H2am"""	H2AFN		1768865, 9439656, 12408966	Standard	NM_003514		Approved	H2A/n, H2A.1	uc003nkb.1	P0C0S8	OTTHUMG00000014494	ENST00000359611.2:c.282C>T	6.37:g.27860646G>A			P02261|Q2M1R2|Q76PA6	Silent	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.L94	ENST00000359611.2	37	c.282	CCDS4639.1	6																																																																																			HIST1H2AM	-	superfamily_Histone-fold,smart_Histone_H2A	ENSG00000233224		0.592	HIST1H2AM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2AM	HGNC	protein_coding	OTTHUMT00000040162.1	113	0.00	0	G	NM_003514		27860646	27860646	-1	no_errors	ENST00000359611	ensembl	human	known	69_37n	silent	132	32.32	64	SNP	1.000	A
HMGB3	3149	genome.wustl.edu	37	X	150156319	150156319	+	Nonsense_Mutation	SNP	A	A	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chrX:150156319A>T	ENST00000325307.7	+	5	631	c.535A>T	c.(535-537)Aag>Tag	p.K179*	HMGB3_ENST00000448905.2_Nonsense_Mutation_p.K179*	NM_005342.2	NP_005333.2	O15347	HMGB3_HUMAN	high mobility group box 3	179					DNA recombination (GO:0006310)|multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)			endometrium(3)|large_intestine(2)|lung(2)|skin(1)	8	Acute lymphoblastic leukemia(192;6.56e-05)					TGCCCGGAAAAaggtggaaga	0.443																																						dbGAP											0													61.0	58.0	59.0					X																	150156319		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF274572	CCDS35428.1	Xq28	2011-07-01	2011-04-05	2002-08-16	ENSG00000029993	ENSG00000029993		"""High-mobility group / Canonical"""	5004	protein-coding gene	gene with protein product	"""non-histone chromosomal protein"""	300193	"""high-mobility group (nonhistone chromosomal) protein 4"", ""high-mobility group box 3"""	HMG4		9598312	Standard	XM_005274665		Approved	HMG2A, MGC90319	uc004fep.3	O15347	OTTHUMG00000024162	ENST00000325307.7:c.535A>T	X.37:g.150156319A>T	ENSP00000359393:p.Lys179*		O95556|Q6NS40	Nonsense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.K179*	ENST00000325307.7	37	c.535	CCDS35428.1	X	.	.	.	.	.	.	.	.	.	.	a	15.02	2.709403	0.48517	.	.	ENSG00000029993	ENST00000419110;ENST00000325307;ENST00000455596;ENST00000448905	.	.	.	5.0	5.0	0.66597	.	0.220345	0.37261	N	0.002164	.	.	.	.	.	.	0.39683	D	0.970927	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.6076	0.56532	1.0:0.0:0.0:0.0	.	.	.	.	X	179	.	ENSP00000359393:K179X	K	+	1	0	HMGB3	149906977	1.000000	0.71417	1.000000	0.80357	0.106000	0.19336	4.862000	0.62976	1.655000	0.50712	0.486000	0.48141	AAG	HMGB3	-	NULL	ENSG00000029993		0.443	HMGB3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HMGB3	HGNC	protein_coding	OTTHUMT00000060867.1	77	0.00	0	A	NM_005342		150156319	150156319	+1	no_errors	ENST00000325307	ensembl	human	known	69_37n	nonsense	113	12.40	16	SNP	1.000	T
HMGXB4	10042	genome.wustl.edu	37	22	35661391	35661391	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr22:35661391A>G	ENST00000216106.5	+	5	1138	c.1010A>G	c.(1009-1011)aAg>aGg	p.K337R	HMGXB4_ENST00000444518.2_Missense_Mutation_p.K228R	NM_001003681.2	NP_001003681.1	Q9UGU5	HMGX4_HUMAN	HMG box domain containing 4	337					endosome to lysosome transport (GO:0008333)|negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)	NURF complex (GO:0016589)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|large_intestine(6)|liver(1)|lung(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						CATAAAGAGAAGCGACACTCC	0.468																																						dbGAP											0													91.0	95.0	93.0					22																	35661391		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ010069	CCDS33641.1	22q13	2011-07-01	2009-01-05	2009-01-05	ENSG00000100281	ENSG00000100281		"""High mobility group / Non-canonical"""	5003	protein-coding gene	gene with protein product		604702	"""high-mobility group protein 2-like 1"""	HMG2L1		10329004, 10591208, 20511232	Standard	NM_001003681		Approved	THC211630	uc003anl.3	Q9UGU5	OTTHUMG00000150439	ENST00000216106.5:c.1010A>G	22.37:g.35661391A>G	ENSP00000216106:p.Lys337Arg		O75672|O75673|Q9UMT5	Missense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.K337R	ENST00000216106.5	37	c.1010	CCDS33641.1	22	.	.	.	.	.	.	.	.	.	.	A	14.93	2.682123	0.47991	.	.	ENSG00000100281	ENST00000420166;ENST00000444518;ENST00000455359;ENST00000216106	T;T;T;T	0.51574	0.7;2.13;0.71;2.13	5.22	-6.48	0.01896	.	0.665977	0.17233	N	0.181865	T	0.28599	0.0708	N	0.14661	0.345	0.32782	N	0.502416	B	0.02656	0.0	B	0.04013	0.001	T	0.00449	-1.1732	10	0.38643	T	0.18	-2.3244	19.0056	0.92849	0.3088:0.0:0.6912:0.0	.	337	Q9UGU5	HMGX4_HUMAN	R	228;228;228;337	ENSP00000401658:K228R;ENSP00000398302:K228R;ENSP00000415500:K228R;ENSP00000216106:K337R	ENSP00000216106:K337R	K	+	2	0	HMGXB4	33991391	0.983000	0.35010	0.241000	0.24154	0.996000	0.88848	0.300000	0.19156	-1.988000	0.00980	0.528000	0.53228	AAG	HMGXB4	-	NULL	ENSG00000100281		0.468	HMGXB4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HMGXB4	HGNC	protein_coding	OTTHUMT00000318104.2	69	0.00	0	A	NM_005487		35661391	35661391	+1	no_errors	ENST00000216106	ensembl	human	known	69_37n	missense	56	24.32	18	SNP	0.766	G
HOXA6	3203	genome.wustl.edu	37	7	27185451	27185451	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr7:27185451G>C	ENST00000222728.3	-	2	552	c.528C>G	c.(526-528)ttC>ttG	p.F176L	HOXA6_ENST00000521478.1_5'UTR|RP1-170O19.23_ENST00000498652.1_RNA|HOXA-AS3_ENST00000521197.1_RNA|HOXA5_ENST00000222726.3_5'Flank|HOXA-AS3_ENST00000518848.1_RNA|HOXA-AS3_ENST00000518947.2_RNA|RP1-170O19.22_ENST00000467897.2_RNA|HOXA-AS3_ENST00000521231.1_RNA	NM_024014.3	NP_076919.1	P31267	HXA6_HUMAN	homeobox A6	176					anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(5)|lung(3)|ovary(1)	10						GGTAGCGGTTGAAGTGGAACT	0.622																																						dbGAP											0													149.0	134.0	139.0					7																	27185451		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5407.1	7p15.2	2011-06-20	2005-12-22		ENSG00000106006	ENSG00000106006		"""Homeoboxes / ANTP class : HOXL subclass"""	5107	protein-coding gene	gene with protein product		142951	"""homeo box A6"""	HOX1B, HOX1		1973146, 1358459	Standard	NM_024014		Approved		uc003syo.2	P31267	OTTHUMG00000023216	ENST00000222728.3:c.528C>G	7.37:g.27185451G>C	ENSP00000222728:p.Phe176Leu		A4D192|Q2M3G3|Q9UPM0	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa,prints_Homeobox_antennapedia	p.F176L	ENST00000222728.3	37	c.528	CCDS5407.1	7	.	.	.	.	.	.	.	.	.	.	G	26.5	4.740291	0.89573	.	.	ENSG00000106006	ENST00000222728	D	0.95980	-3.87	5.6	3.77	0.43336	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.90577	0.7046	L	0.37750	1.13	0.58432	D	0.999994	P	0.41420	0.749	B	0.39339	0.297	D	0.89228	0.3575	10	0.87932	D	0	.	5.7913	0.18361	0.3134:0.0:0.6866:0.0	.	176	P31267	HXA6_HUMAN	L	176	ENSP00000222728:F176L	ENSP00000222728:F176L	F	-	3	2	HOXA6	27151976	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.703000	0.37846	2.627000	0.88993	0.561000	0.74099	TTC	HOXA6	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000106006		0.622	HOXA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXA6	HGNC	protein_coding	OTTHUMT00000358697.1	87	0.00	0	G			27185451	27185451	-1	no_errors	ENST00000222728	ensembl	human	known	69_37n	missense	34	57.50	46	SNP	1.000	C
HTR1A	3350	genome.wustl.edu	37	5	63256550	63256550	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr5:63256550G>A	ENST00000323865.3	-	1	1230	c.997C>T	c.(997-999)Cgc>Tgc	p.R333C	RP11-158J3.2_ENST00000502882.1_RNA	NM_000524.3	NP_000515.2	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled	333					adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198)|behavioral fear response (GO:0001662)|cell proliferation (GO:0008283)|exploration behavior (GO:0035640)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cell proliferation (GO:0008284)|regulation of behavior (GO:0050795)|regulation of dopamine metabolic process (GO:0042053)|regulation of hormone secretion (GO:0046883)|regulation of serotonin secretion (GO:0014062)|serotonin metabolic process (GO:0042428)|serotonin receptor signaling pathway (GO:0007210)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(29)|ovary(2)|pancreas(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	56		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Acepromazine(DB01614)|Alprenolol(DB00866)|Alverine(DB01616)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinitapride(DB08810)|Clozapine(DB00363)|Desipramine(DB01151)|Dopamine(DB00988)|Doxepin(DB01142)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Methysergide(DB00247)|Mianserin(DB06148)|Molindone(DB01618)|Naratriptan(DB00952)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Ondansetron(DB00904)|Paliperidone(DB01267)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sumatriptan(DB00669)|Thioproperazine(DB01622)|Trazodone(DB00656)|Trimipramine(DB00726)|Vilazodone(DB06684)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	GCCATCTTGCGCTTCGCCTCG	0.602																																						dbGAP											0													90.0	93.0	92.0					5																	63256550		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF498978	CCDS34168.1	5q11.2-q13	2012-08-08	2012-02-03			ENSG00000178394		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5286	protein-coding gene	gene with protein product		109760	"""5-hydroxytryptamine (serotonin) receptor 1A"""	ADRB2RL1, ADRBRL1		2591972, 12969265	Standard	NM_000524		Approved	5-HT1A	uc011cqt.3	P08908		ENST00000323865.3:c.997C>T	5.37:g.63256550G>A	ENSP00000316244:p.Arg333Cys		Q6LAE7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_5HT1A_rcpt,prints_7TM_GPCR_Rhodpsn,prints_5HT_rcpt,prints_NPY_rcpt	p.R333C	ENST00000323865.3	37	c.997	CCDS34168.1	5	.	.	.	.	.	.	.	.	.	.	G	16.72	3.202691	0.58234	.	.	ENSG00000178394	ENST00000323865	T	0.40476	1.03	5.7	4.75	0.60458	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.70422	0.3222	M	0.91090	3.175	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.77512	-0.2560	10	0.87932	D	0	.	14.8098	0.69985	0.0:0.0:0.7745:0.2255	.	333	P08908	5HT1A_HUMAN	C	333	ENSP00000316244:R333C	ENSP00000316244:R333C	R	-	1	0	HTR1A	63292306	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	1.208000	0.32345	2.692000	0.91855	0.655000	0.94253	CGC	HTR1A	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000178394		0.602	HTR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR1A	HGNC	protein_coding	OTTHUMT00000368397.1	39	0.00	0	G	NM_000524		63256550	63256550	-1	no_errors	ENST00000323865	ensembl	human	known	69_37n	missense	40	31.03	18	SNP	1.000	A
HTT	3064	genome.wustl.edu	37	4	3179079	3179079	+	Silent	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr4:3179079G>A	ENST00000355072.5	+	34	4573	c.4428G>A	c.(4426-4428)ttG>ttA	p.L1476L		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	1476					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		GCTTTGTATTGAAACAGTTTG	0.299																																						dbGAP											0													153.0	134.0	140.0					4																	3179079		1799	4064	5863	-	-	-	SO:0001819	synonymous_variant	0			L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.4428G>A	4.37:g.3179079G>A			Q9UQB7	Silent	SNP	pfam_Huntingtin_middle-repeat,pfam_HEAT,superfamily_ARM-type_fold,prints_Huntingtin	p.L1476	ENST00000355072.5	37	c.4428	CCDS43206.1	4																																																																																			HTT	-	prints_Huntingtin	ENSG00000197386		0.299	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTT	HGNC	protein_coding	OTTHUMT00000358234.2	204	0.00	0	G	NM_002111		3179079	3179079	+1	no_errors	ENST00000355072	ensembl	human	known	69_37n	silent	201	28.98	82	SNP	1.000	A
IFT140	9742	genome.wustl.edu	37	16	1570261	1570261	+	Silent	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr16:1570261G>A	ENST00000426508.2	-	28	4107	c.3744C>T	c.(3742-3744)atC>atT	p.I1248I	IFT140_ENST00000361339.5_Silent_p.I442I	NM_014714.3	NP_055529.2	Q96RY7	IF140_HUMAN	intraflagellar transport 140	1248					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)|protein localization to cilium (GO:0061512)|regulation of cilium assembly (GO:1902017)|renal system development (GO:0072001)|retina development in camera-type eye (GO:0060041)|skeletal system morphogenesis (GO:0048705)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)|photoreceptor connecting cilium (GO:0032391)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(12)|lung(10)|ovary(5)|pancreas(1)|prostate(4)|skin(4)|stomach(2)|urinary_tract(1)	53		Hepatocellular(780;0.219)				TAGCAGCCATGATGTAGATTT	0.577																																						dbGAP											0													143.0	137.0	139.0					16																	1570261		2199	4300	6499	-	-	-	SO:0001819	synonymous_variant	0			AB011162	CCDS10439.1	16p13.3	2014-07-03	2014-07-03	2005-11-02	ENSG00000187535	ENSG00000187535		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29077	protein-coding gene	gene with protein product		614620	"""WD and tetratricopeptide repeats 2"", ""intraflagellar transport 140 homolog (Chlamydomonas)"""	WDTC2		9628581	Standard	NM_014714		Approved	gs114, KIAA0590	uc002cmb.3	Q96RY7	OTTHUMG00000128585	ENST00000426508.2:c.3744C>T	16.37:g.1570261G>A			A2A2A8|D3DU75|O60332|Q9UG52	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.I1248	ENST00000426508.2	37	c.3744	CCDS10439.1	16																																																																																			IFT140	-	NULL	ENSG00000187535		0.577	IFT140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT140	HGNC	protein_coding	OTTHUMT00000250438.2	93	0.00	0	G	NM_014714		1570261	1570261	-1	no_errors	ENST00000426508	ensembl	human	known	69_37n	silent	94	23.58	29	SNP	1.000	A
IGKV3-15	28913	genome.wustl.edu	37	2	89384739	89384739	+	RNA	SNP	G	G	C			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr2:89384739G>C	ENST00000390252.2	-	0	375									immunoglobulin kappa variable 3-15																		TGCTGATGGTGAGAGTGAACT	0.512																																						dbGAP											0													27.0	27.0	27.0					2																	89384739		1808	3995	5803	-	-	-			0			M23090		2p11.2	2012-02-08			ENSG00000244437	ENSG00000244437		"""Immunoglobulins / IGK locus"""	5816	other	immunoglobulin gene							Standard	NG_000834		Approved				OTTHUMG00000151653		2.37:g.89384739G>C				Silent	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.L93	ENST00000390252.2	37	c.279		2																																																																																			IGKV3-15	-	pfam_Ig_V-set,pfam_Immunoglobulin,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000244437		0.512	IGKV3-15-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGKV3-15	HGNC	IG_V_gene	OTTHUMT00000323402.1	81	0.00	0	G	NG_000834		89384739	89384739	-1	no_stop_codon	ENST00000390252	ensembl	human	known	69_37n	silent	70	28.57	28	SNP	0.965	C
INF2	64423	genome.wustl.edu	37	14	105175628	105175628	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr14:105175628G>A	ENST00000392634.4	+	11	2072	c.1960G>A	c.(1960-1962)Gag>Aag	p.E654K	INF2_ENST00000330634.7_Missense_Mutation_p.E654K	NM_022489.3	NP_071934.3	Q27J81	INF2_HUMAN	inverted formin, FH2 and WH2 domain containing	654	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)|cell death (GO:0008219)|regulation of cellular component size (GO:0032535)|regulation of mitochondrial fission (GO:0090140)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00188)|OV - Ovarian serous cystadenocarcinoma(23;0.0191)|Epithelial(46;0.047)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.176)		CTCCAACGAGGAGGTCGCTGC	0.587											OREG0022959	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													58.0	63.0	61.0					14																	105175628		1970	4144	6114	-	-	-	SO:0001583	missense	0			AK025709	CCDS9989.2, CCDS45173.1	14q32.33	2009-09-07	2007-11-29	2007-11-29	ENSG00000203485	ENSG00000203485			23791	protein-coding gene	gene with protein product	"""inverted formin 2"""	610982	"""chromosome 14 open reading frame 151"", ""chromosome 14 open reading frame 173"""	C14orf151, C14orf173		16818491	Standard	NM_001031714		Approved	MGC13251	uc001ypb.2	Q27J81	OTTHUMG00000029811	ENST00000392634.4:c.1960G>A	14.37:g.105175628G>A	ENSP00000376410:p.Glu654Lys	1387	Q27J83|Q69YL8|Q6P1X7|Q6PK22|Q86TR7|Q9BRM1|Q9H6N1	Missense_Mutation	SNP	pfam_FH2_actin-bd,pfam_Drf_FH3,pfam_Drf_GTPase-bd,pfam_WH2_dom,superfamily_FH2_actin-bd,superfamily_ARM-type_fold,smart_Actin-bd_FH2/DRF_autoreg,pfscan_WH2_dom	p.E654K	ENST00000392634.4	37	c.1960	CCDS9989.2	14	.	.	.	.	.	.	.	.	.	.	G	15.72	2.915719	0.52546	.	.	ENSG00000203485	ENST00000330634;ENST00000392634	T;T	0.22336	1.96;1.96	4.47	4.47	0.54385	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.187383	0.45361	U	0.000380	T	0.51244	0.1663	M	0.90309	3.105	0.80722	D	1	D;D	0.56968	0.972;0.978	P;P	0.60236	0.797;0.871	T	0.64976	-0.6280	10	0.66056	D	0.02	.	17.1217	0.86704	0.0:0.0:1.0:0.0	.	654;654	Q27J81-2;Q27J81	.;INF2_HUMAN	K	654	ENSP00000376406:E654K;ENSP00000376410:E654K	ENSP00000252527:E122K	E	+	1	0	INF2	104246673	1.000000	0.71417	0.940000	0.37924	0.059000	0.15707	9.554000	0.98121	2.017000	0.59298	0.561000	0.74099	GAG	INF2	-	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg	ENSG00000203485		0.587	INF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INF2	HGNC	protein_coding	OTTHUMT00000074371.4	43	0.00	0	G	NM_022489		105175628	105175628	+1	no_errors	ENST00000392634	ensembl	human	known	69_37n	missense	19	40.62	13	SNP	1.000	A
JAG1	182	genome.wustl.edu	37	20	10639266	10639266	+	Nonsense_Mutation	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr20:10639266G>A	ENST00000254958.5	-	4	1059	c.544C>T	c.(544-546)Cag>Tag	p.Q182*	JAG1_ENST00000423891.2_Nonsense_Mutation_p.Q23*	NM_000214.2	NP_000205.1	P78504	JAG1_HUMAN	jagged 1	182					angiogenesis (GO:0001525)|aorta morphogenesis (GO:0035909)|auditory receptor cell differentiation (GO:0042491)|blood vessel remodeling (GO:0001974)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cell fate determination (GO:0001709)|ciliary body morphogenesis (GO:0061073)|distal tubule development (GO:0072017)|endocardial cushion cell development (GO:0061444)|endothelial cell differentiation (GO:0045446)|hemopoiesis (GO:0030097)|keratinocyte differentiation (GO:0030216)|loop of Henle development (GO:0072070)|morphogenesis of an epithelial sheet (GO:0002011)|myoblast differentiation (GO:0045445)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of stem cell differentiation (GO:2000737)|nervous system development (GO:0007399)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|response to muramyl dipeptide (GO:0032495)|T cell mediated immunity (GO:0002456)	apical part of cell (GO:0045177)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|urinary_tract(1)	44						ACGCGGATCTGATACTCAAAG	0.517									Alagille Syndrome																													dbGAP											0													157.0	136.0	143.0					20																	10639266		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	U61276	CCDS13112.1	20p12.1-p11.23	2011-05-12	2010-06-24		ENSG00000101384	ENSG00000101384		"""CD molecules"""	6188	protein-coding gene	gene with protein product		601920	"""Alagille syndrome"""	AGS, JAGL1		7697721, 9207788	Standard	NM_000214		Approved	AHD, AWS, HJ1, CD339	uc002wnw.2	P78504	OTTHUMG00000031872	ENST00000254958.5:c.544C>T	20.37:g.10639266G>A	ENSP00000254958:p.Gln182*		A0AV43|B4DYR1|E9PCF9|O14902|O15122|Q15816	Nonsense_Mutation	SNP	pfam_EGF-like_dom,pfam_Notch_ligand_N,pfam_DSL,pfam_EGF_extracell,pfam_EGF-like_Ca-bd,smart_DSL,smart_EGF-like,smart_EGF-like_Ca-bd,smart_VWC_out,smart_VWF_C,pfscan_DSL,pfscan_EG-like_dom	p.Q182*	ENST00000254958.5	37	c.544	CCDS13112.1	20	.	.	.	.	.	.	.	.	.	.	G	41	8.715095	0.98927	.	.	ENSG00000101384	ENST00000254958;ENST00000423891	.	.	.	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	19.2314	0.93842	0.0:0.0:1.0:0.0	.	.	.	.	X	182;23	.	ENSP00000254958:Q182X	Q	-	1	0	JAG1	10587266	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	7.939000	0.87685	2.552000	0.86080	0.563000	0.77884	CAG	JAG1	-	pfam_DSL,smart_DSL	ENSG00000101384		0.517	JAG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	JAG1	HGNC	protein_coding		81	0.00	0	G	NM_000214		10639266	10639266	-1	no_errors	ENST00000254958	ensembl	human	known	69_37n	nonsense	65	49.62	65	SNP	1.000	A
JAK3	3718	genome.wustl.edu	37	19	17949174	17949174	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr19:17949174C>G	ENST00000527670.1	-	10	1496	c.1467G>C	c.(1465-1467)caG>caC	p.Q489H	JAK3_ENST00000458235.1_Missense_Mutation_p.Q489H|JAK3_ENST00000526008.1_5'UTR|JAK3_ENST00000534444.1_Missense_Mutation_p.Q489H			P52333	JAK3_HUMAN	Janus kinase 3	489					B cell differentiation (GO:0030183)|enzyme linked receptor protein signaling pathway (GO:0007167)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of dendritic cell cytokine production (GO:0002731)|negative regulation of FasL biosynthetic process (GO:0045221)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of thymocyte apoptotic process (GO:0070244)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of T cell apoptotic process (GO:0070232)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to interleukin-9 (GO:0071104)|STAT protein import into nucleus (GO:0007262)|T cell homeostasis (GO:0043029)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(85)|kidney(4)|large_intestine(11)|lung(22)|ovary(3)|prostate(5)|skin(1)|stomach(2)|upper_aerodigestive_tract(5)	147					Tofacitinib(DB08895)	TGTGACCTCTCTGGACCACGA	0.507		2	Mis		"""acute megakaryocytic leukemia, ETP ALL"""																																	dbGAP		Dom	yes		19	19p13.1	3718	Janus kinase 3		L	0													198.0	176.0	183.0					19																	17949174		2203	4300	6503	-	-	-	SO:0001583	missense	0			U31601	CCDS12366.1	19p13-p12	2014-09-17	2009-04-23		ENSG00000105639	ENSG00000105639	2.7.10.1		6193	protein-coding gene	gene with protein product	"""tyrosine-protein kinase JAK3"", ""leukocyte Janus kinase"""	600173				8921370, 9226382	Standard	NM_000215		Approved	L-JAK, JAKL, LJAK, JAK3_HUMAN, JAK-3	uc002nhn.4	P52333	OTTHUMG00000165648	ENST00000527670.1:c.1467G>C	19.37:g.17949174C>G	ENSP00000432511:p.Gln489His		Q13259|Q13260|Q13611|Q8N1E8|Q99699|Q9Y6S2	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_FERM_central,smart_Band_41_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Tyr_kinase_non-rcpt_Jak3,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_FERM_domain,pfscan_Prot_kinase_cat_dom	p.Q489H	ENST00000527670.1	37	c.1467	CCDS12366.1	19	.	.	.	.	.	.	.	.	.	.	C	8.788	0.929883	0.18131	.	.	ENSG00000105639	ENST00000458235;ENST00000428406;ENST00000527670;ENST00000534444	T;T;T	0.75821	-0.95;-0.95;-0.97	4.65	0.833	0.18875	.	0.069363	0.64402	D	0.000015	T	0.51295	0.1666	N	0.08118	0	0.22728	N	0.998805	B;B	0.23058	0.026;0.079	B;B	0.30029	0.011;0.11	T	0.47249	-0.9132	10	0.87932	D	0	-19.6311	5.2915	0.15729	0.1576:0.6434:0.0:0.199	.	489;489	P52333-2;P52333	.;JAK3_HUMAN	H	489	ENSP00000391676:Q489H;ENSP00000432511:Q489H;ENSP00000436421:Q489H	ENSP00000413248:Q489H	Q	-	3	2	JAK3	17810174	0.984000	0.35163	0.953000	0.39169	0.138000	0.21146	0.062000	0.14389	-0.019000	0.14055	0.313000	0.20887	CAG	JAK3	-	pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2	ENSG00000105639		0.507	JAK3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	JAK3	HGNC	protein_coding	OTTHUMT00000385549.1	164	0.00	0	C	NM_000215		17949174	17949174	-1	no_errors	ENST00000458235	ensembl	human	known	69_37n	missense	107	30.07	46	SNP	0.985	G
ZSWIM8	23053	genome.wustl.edu	37	10	75557294	75557294	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr10:75557294C>T	ENST00000605216.1	+	18	3795	c.3578C>T	c.(3577-3579)tCa>tTa	p.S1193L	ZSWIM8_ENST00000603114.1_Missense_Mutation_p.S1160L|ZSWIM8-AS1_ENST00000456638.2_RNA|ZSWIM8_ENST00000604524.1_Missense_Mutation_p.S1193L|ZSWIM8_ENST00000398706.2_Missense_Mutation_p.S1198L|RP11-574K11.31_ENST00000603027.1_3'UTR|ZSWIM8_ENST00000604729.1_Missense_Mutation_p.S1198L	NM_001242487.1	NP_001229416.1	A7E2V4	ZSWM8_HUMAN	zinc finger, SWIM-type containing 8	1193	Ser-rich.						zinc ion binding (GO:0008270)										CTGGGCTCCTCATCCTCCAGT	0.632																																						dbGAP											0													51.0	58.0	56.0					10																	75557294		1950	4127	6077	-	-	-	SO:0001583	missense	0			BC151206, BC040726	CCDS44440.1, CCDS60560.1	10q22.3	2012-11-02	2012-11-02	2012-11-02	ENSG00000214655	ENSG00000214655		"""Zinc fingers, SWIM-type"""	23528	protein-coding gene	gene with protein product			"""KIAA0913"""	KIAA0913			Standard	NM_015037		Approved	4832404P21Rik	uc001jvj.3	A7E2V4	OTTHUMG00000018486	ENST00000605216.1:c.3578C>T	10.37:g.75557294C>T	ENSP00000474748:p.Ser1193Leu		B2RP37|O94987|Q17RS8|Q2TAB8|Q6P439|Q8IW81|Q8NB34|Q9H8F3	Missense_Mutation	SNP	pfscan_Znf_SWIM	p.S1198L	ENST00000605216.1	37	c.3593		10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.0|22.0	4.231839|4.231839	0.79688|0.79688	.|.	.|.	ENSG00000214655|ENSG00000214655	ENST00000412198|ENST00000398706	.|T	.|0.51071	.|0.72	5.63|5.63	5.63|5.63	0.86233|0.86233	.|.	.|0.086182	.|0.47852	.|U	.|0.000203	T|T	0.69663|0.69663	0.3136|0.3136	M|M	0.71581|0.71581	2.175|2.175	0.58432|0.58432	D|D	0.999997|0.999997	.|D;D;D;D	.|0.61080	.|0.989;0.989;0.989;0.989	.|D;D;D;D	.|0.72625	.|0.978;0.978;0.978;0.978	T|T	0.70378|0.70378	-0.4888|-0.4888	5|10	.|0.59425	.|D	.|0.04	-4.0737|-4.0737	19.6824|19.6824	0.95969|0.95969	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1193;1205;1193;1198	.|A7E2V4;A7E2V4-3;A7E2V4-5;A7E2V4-4	.|K0913_HUMAN;.;.;.	Y|L	468|1198	.|ENSP00000381693:S1198L	.|ENSP00000381693:S1198L	H|S	+|+	1|2	0|0	KIAA0913|KIAA0913	75227300|75227300	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.863000|0.863000	0.49368|0.49368	7.396000|7.396000	0.79891|0.79891	2.665000|2.665000	0.90641|0.90641	0.655000|0.655000	0.94253|0.94253	CAT|TCA	KIAA0913	-	NULL	ENSG00000214655		0.632	ZSWIM8-012	NOVEL	basic|appris_principal	protein_coding	KIAA0913	HGNC	protein_coding	OTTHUMT00000468545.1	35	0.00	0	C	NM_001242487		75557294	75557294	+1	no_errors	ENST00000398706	ensembl	human	known	69_37n	missense	21	34.38	11	SNP	1.000	T
KIF13A	63971	genome.wustl.edu	37	6	17773736	17773736	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr6:17773736T>C	ENST00000259711.6	-	36	4402	c.4297A>G	c.(4297-4299)Agg>Ggg	p.R1433G	KIF13A_ENST00000378814.5_Missense_Mutation_p.R1420G|KIF13A_ENST00000378843.2_Missense_Mutation_p.R1420G|KIF13A_ENST00000378826.2_Missense_Mutation_p.R1433G|KIF13A_ENST00000378816.5_Missense_Mutation_p.R1433G	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	1433					ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			GGAGAATCCCTGGGTAAAGTT	0.368																																						dbGAP											0													129.0	120.0	123.0					6																	17773736		1834	4089	5923	-	-	-	SO:0001583	missense	0			AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.4297A>G	6.37:g.17773736T>C	ENSP00000259711:p.Arg1433Gly		A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_KIF1B,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R1433G	ENST00000259711.6	37	c.4297	CCDS47381.1	6	.	.	.	.	.	.	.	.	.	.	T	14.50	2.555212	0.45487	.	.	ENSG00000137177	ENST00000378814;ENST00000502297;ENST00000259711;ENST00000378826;ENST00000378843;ENST00000378816	T;T;T;T;T;T	0.71817	-0.56;1.86;-0.6;-0.56;-0.57;-0.56	5.72	1.54	0.23209	.	0.130847	0.50627	D	0.000116	T	0.45196	0.1330	L	0.47716	1.5	0.36181	D	0.849441	B;B;B;B	0.30236	0.274;0.228;0.032;0.228	B;B;B;B	0.30943	0.122;0.083;0.028;0.083	T	0.34750	-0.9816	10	0.20519	T	0.43	.	14.0689	0.64849	0.0:0.0:0.4883:0.5117	.	1420;1433;1433;1420	Q9H1H9-4;Q9H1H9-2;Q9H1H9;Q9H1H9-3	.;.;KI13A_HUMAN;.	G	1420;437;1433;1433;1420;1433	ENSP00000368091:R1420G;ENSP00000425616:R437G;ENSP00000259711:R1433G;ENSP00000368103:R1433G;ENSP00000368120:R1420G;ENSP00000368093:R1433G	ENSP00000259711:R1433G	R	-	1	2	KIF13A	17881715	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.678000	0.37586	0.457000	0.26962	0.528000	0.53228	AGG	KIF13A	-	NULL	ENSG00000137177		0.368	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF13A	HGNC	protein_coding	OTTHUMT00000039954.4	108	0.00	0	T			17773736	17773736	-1	no_errors	ENST00000259711	ensembl	human	known	69_37n	missense	87	30.95	39	SNP	1.000	C
KRTAP10-4	386672	genome.wustl.edu	37	21	45994492	45994492	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr21:45994492C>G	ENST00000400374.3	+	1	887	c.857C>G	c.(856-858)tCt>tGt	p.S286C	TSPEAR_ENST00000397916.1_5'Flank|TSPEAR_ENST00000323084.4_Intron	NM_198687.1	NP_941960.1	P60372	KR104_HUMAN	keratin associated protein 10-4	286	36 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				NS(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|prostate(1)	18						CCTGTCGGCTCTGTGCCCATC	0.642																																						dbGAP											0													116.0	121.0	119.0					21																	45994492		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB076351	CCDS42957.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000215454	ENSG00000215454		"""Keratin associated proteins"""	20521	protein-coding gene	gene with protein product			"""keratin associated protein 18-4"""	KRTAP18-4			Standard	NM_198687		Approved	KRTAP18.4, KAP10.4	uc002zfk.1	P60372	OTTHUMG00000057641	ENST00000400374.3:c.857C>G	21.37:g.45994492C>G	ENSP00000383225:p.Ser286Cys		Q08AS0	Missense_Mutation	SNP	NULL	p.S286C	ENST00000400374.3	37	c.857	CCDS42957.1	21	.	.	.	.	.	.	.	.	.	.	c	0.001	-2.881685	0.00061	.	.	ENSG00000215454	ENST00000400374	T	0.00832	5.64	3.71	-7.41	0.01392	.	.	.	.	.	T	0.00241	0.0007	N	0.00068	-2.285	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.44236	-0.9341	9	0.02654	T	1	.	10.4717	0.44640	0.2264:0.6353:0.1383:0.0	.	286	P60372	KR104_HUMAN	C	286	ENSP00000383225:S286C	ENSP00000383225:S286C	S	+	2	0	KRTAP10-4	44818920	0.018000	0.18449	0.000000	0.03702	0.033000	0.12548	-0.571000	0.05889	-1.958000	0.01019	-0.189000	0.12847	TCT	KRTAP10-4	-	NULL	ENSG00000215454		0.642	KRTAP10-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-4	HGNC	protein_coding	OTTHUMT00000128045.1	74	0.00	0	C	NM_198687		45994492	45994492	+1	no_errors	ENST00000400374	ensembl	human	known	69_37n	missense	95	30.15	41	SNP	0.000	G
LHX9	56956	genome.wustl.edu	37	1	197898203	197898203	+	Silent	SNP	A	A	G			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr1:197898203A>G	ENST00000367387.4	+	5	1433	c.1008A>G	c.(1006-1008)aaA>aaG	p.K336K	LHX9_ENST00000367391.1_Intron|LHX9_ENST00000561173.1_Intron|LHX9_ENST00000367390.3_Silent_p.K327K|LHX9_ENST00000337020.2_Intron	NM_020204.2	NP_064589.2	Q9NQ69	LHX9_HUMAN	LIM homeobox 9	336					cell proliferation (GO:0008283)|female gonad development (GO:0008585)|gonad morphogenesis (GO:0035262)|male gonad development (GO:0008584)|motor neuron axon guidance (GO:0008045)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			endometrium(8)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(2)|skin(1)|stomach(1)	35						GTGTTGATAAAGCTGACGGCA	0.537																																						dbGAP											0													67.0	70.0	69.0					1																	197898203		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ277915	CCDS1393.1, CCDS30962.1	1q31.1	2011-06-20			ENSG00000143355	ENSG00000143355		"""Homeoboxes / LIM class"""	14222	protein-coding gene	gene with protein product		606066					Standard	NM_020204		Approved		uc001guk.1	Q9NQ69	OTTHUMG00000035656	ENST00000367387.4:c.1008A>G	1.37:g.197898203A>G			Q5VUE2|Q5VUE3|Q5VUE6|Q86UH2|Q9BYU6|Q9NQ70	Silent	SNP	pfam_Znf_LIM,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_LIM,smart_Homeodomain,pfscan_Znf_LIM,pfscan_Homeodomain	p.K336	ENST00000367387.4	37	c.1008	CCDS1393.1	1																																																																																			LHX9	-	NULL	ENSG00000143355		0.537	LHX9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LHX9	HGNC	protein_coding	OTTHUMT00000086547.2	37	0.00	0	A	NM_020204		197898203	197898203	+1	no_errors	ENST00000367387	ensembl	human	known	69_37n	silent	25	56.14	32	SNP	1.000	G
LILRB5	10990	genome.wustl.edu	37	19	54760586	54760586	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr19:54760586G>A	ENST00000316219.5	-	3	228	c.121C>T	c.(121-123)Cgg>Tgg	p.R41W	LILRB5_ENST00000450632.1_Missense_Mutation_p.R41W|LILRB5_ENST00000345866.6_Missense_Mutation_p.R41W|LILRB5_ENST00000449561.2_Missense_Mutation_p.R41W	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5	41	Ig-like C2-type 1.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GGCTTCCCCCGAGCTATCACA	0.612																																						dbGAP											0													62.0	69.0	67.0					19																	54760586		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.121C>T	19.37:g.54760586G>A	ENSP00000320390:p.Arg41Trp		Q8N760	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.R41W	ENST00000316219.5	37	c.121	CCDS12885.1	19	.	.	.	.	.	.	.	.	.	.	G	0.985	-0.695909	0.03279	.	.	ENSG00000105609	ENST00000316219;ENST00000450632;ENST00000449561;ENST00000345866	T;T;T;T	0.12774	2.65;2.65;2.65;2.65	3.18	-6.35	0.01975	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	3.063890	0.00892	N	0.002247	T	0.07324	0.0185	N	0.11106	0.095	0.09310	N	1	B;B;B;B;B	0.20780	0.02;0.014;0.007;0.048;0.009	B;B;B;B;B	0.20184	0.012;0.002;0.001;0.028;0.022	T	0.18053	-1.0349	10	0.40728	T	0.16	.	5.2383	0.15458	0.2357:0.0:0.4763:0.288	.	41;32;41;41;41	C9JMK7;Q8NF80;O75023-2;O75023-3;O75023	.;.;.;.;LIRB5_HUMAN	W	41	ENSP00000320390:R41W;ENSP00000414225:R41W;ENSP00000406478:R41W;ENSP00000263430:R41W	ENSP00000320390:R41W	R	-	1	2	LILRB5	59452398	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-5.150000	0.00146	-5.062000	0.00023	-3.589000	0.00028	CGG	LILRB5	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000105609		0.612	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB5	HGNC	protein_coding	OTTHUMT00000142877.2	42	0.00	0	G			54760586	54760586	-1	no_errors	ENST00000450632	ensembl	human	known	69_37n	missense	41	37.88	25	SNP	0.000	A
LRRC37A5P	652972	genome.wustl.edu	37	9	114371402	114371402	+	RNA	SNP	G	G	C			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr9:114371402G>C	ENST00000374304.1	-	0	397							Q49AS3	L37A5_HUMAN	leucine rich repeat containing 37, member A5, pseudogene																		GCCTGTCCTAGAGATGAGCTT	0.483																																						dbGAP											0																																										-	-	-			0			BC031236		9q31.3	2012-10-16	2012-03-07	2012-03-07	ENSG00000204173	ENSG00000204173			23369	pseudogene	pseudogene			"""chromosome 9 open reading frame 29"""	C9orf29			Standard	NR_034087		Approved		uc022bly.1	Q49AS3	OTTHUMG00000020494		9.37:g.114371402G>C			Q5JVP0	RNA	SNP	-	NULL	ENST00000374304.1	37	NULL		9	.	.	.	.	.	.	.	.	.	.	g	2.327	-0.354315	0.05173	.	.	ENSG00000204173	ENST00000374306;ENST00000536054	.	.	.	0.957	0.957	0.19613	.	.	.	.	.	T	0.45796	0.1360	.	.	.	0.23325	N	0.997902	.	.	.	.	.	.	T	0.56092	-0.8036	4	0.87932	D	0	.	5.429	0.16442	0.0:0.0:1.0:0.0	.	.	.	.	C	69;61	.	ENSP00000363425:S69C	S	-	2	0	C9orf29	113411223	0.999000	0.42202	0.032000	0.17829	0.023000	0.10783	2.187000	0.42602	0.861000	0.35504	0.433000	0.28618	TCT	LRRC37A5P	-	-	ENSG00000204173		0.483	LRRC37A5P-002	KNOWN	basic	processed_transcript	LRRC37A5P	HGNC	pseudogene	OTTHUMT00000053655.2	31	0.00	0	G	NR_034087		114371402	114371402	-1	no_errors	ENST00000374304	ensembl	human	known	69_37n	rna	46	20.69	12	SNP	0.043	C
ANAPC15	25906	genome.wustl.edu	37	11	71819713	71819713	+	IGR	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr11:71819713G>A	ENST00000227618.4	-	0	886				LRTOMT_ENST00000307198.7_Silent_p.L206L|LRTOMT_ENST00000439209.1_3'UTR|LRTOMT_ENST00000419228.1_Silent_p.L166L|LRTOMT_ENST00000435085.1_Silent_p.L206L|ANAPC15_ENST00000543015.1_5'Flank|ANAPC15_ENST00000502597.2_Intron|ANAPC15_ENST00000543050.1_Intron	NM_001278487.1|NM_001278491.1|NM_014042.2	NP_001265416.1|NP_001265420.1|NP_054761.1	P60006	APC15_HUMAN	anaphase promoting complex subunit 15						mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)	anaphase-promoting complex (GO:0005680)|intracellular (GO:0005622)											AGTATCAGCTGAGTCGGGCAG	0.662																																						dbGAP											0													49.0	47.0	47.0					11																	71819713		692	1591	2283	-	-	-	SO:0001628	intergenic_variant	0			AL080071	CCDS8210.1, CCDS60880.1	11q13.4	2012-10-17	2012-05-31	2012-05-31	ENSG00000110200	ENSG00000110200		"""Anaphase promoting complex subunits"""	24531	protein-coding gene	gene with protein product		614717	"""chromosome 11 open reading frame 51"""	C11orf51		21926987	Standard	NM_014042		Approved	HSPC020, DKFZP564M082, APC15	uc001orw.3	P60006	OTTHUMG00000167865		11.37:g.71819713G>A			G3V1Q3|Q9CXK2|Q9Y269	Silent	SNP	pfam_O-MeTrfase_3	p.L206	ENST00000227618.4	37	c.618	CCDS8210.1	11																																																																																			LRTOMT	-	pfam_O-MeTrfase_3	ENSG00000184154		0.662	ANAPC15-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LRTOMT	HGNC	protein_coding	OTTHUMT00000396695.1	17	0.00	0	G	NM_014042		71819713	71819713	+1	no_errors	ENST00000307198	ensembl	human	known	69_37n	silent	37	24.00	12	SNP	0.630	A
LY75	4065	genome.wustl.edu	37	2	160667156	160667156	+	Nonsense_Mutation	SNP	G	G	C			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr2:160667156G>C	ENST00000263636.4	-	32	4607	c.4580C>G	c.(4579-4581)tCa>tGa	p.S1527*	LY75_ENST00000554112.1_Nonsense_Mutation_p.S1527*|LY75-CD302_ENST00000504764.1_Nonsense_Mutation_p.S1527*|LY75_ENST00000553424.1_Nonsense_Mutation_p.S1527*|LY75-CD302_ENST00000505052.1_Nonsense_Mutation_p.S1527*	NM_002349.3	NP_002340.2	O60449	LY75_HUMAN	lymphocyte antigen 75	1527					endocytosis (GO:0006897)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(22)|prostate(7)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	59				COAD - Colon adenocarcinoma(177;0.132)		TGGACATCTTGATGAATATGT	0.398																																						dbGAP											0													163.0	168.0	166.0					2																	160667156		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF011333	CCDS2211.1	2q24	2011-08-30			ENSG00000054219	ENSG00000054219		"""CD molecules"", ""C-type lectin domain containing"""	6729	protein-coding gene	gene with protein product		604524				9553150	Standard	NM_002349		Approved	DEC-205, CLEC13B, CD205		O60449	OTTHUMG00000132025	ENST00000263636.4:c.4580C>G	2.37:g.160667156G>C	ENSP00000263636:p.Ser1527*		O75913|Q53R46|Q53TF5|Q7Z575|Q7Z577	Nonsense_Mutation	SNP	pfam_C-type_lectin,pfam_FN_type2_col-bd,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin	p.S1527*	ENST00000263636.4	37	c.4580	CCDS2211.1	2	.	.	.	.	.	.	.	.	.	.	G	40	7.994009	0.98599	.	.	ENSG00000054219;ENSG00000054219;ENSG00000054219;ENSG00000248672;ENSG00000248672	ENST00000554112;ENST00000553424;ENST00000263636;ENST00000504764;ENST00000505052	.	.	.	4.82	4.82	0.62117	.	0.369668	0.15656	U	0.251140	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-1.5407	16.027	0.80551	0.0:0.0:1.0:0.0	.	.	.	.	X	1527	.	ENSP00000423463:S1527X	S	-	2	0	LY75;LY75-CD302	160375402	1.000000	0.71417	0.993000	0.49108	0.256000	0.26092	5.504000	0.66968	2.394000	0.81467	0.491000	0.48974	TCA	LY75	-	superfamily_C-type_lectin_fold	ENSG00000054219		0.398	LY75-001	KNOWN	basic|CCDS	protein_coding	LY75	HGNC	protein_coding	OTTHUMT00000255035.1	52	0.00	0	G			160667156	160667156	-1	no_errors	ENST00000554112	ensembl	human	known	69_37n	nonsense	57	26.92	21	SNP	0.995	C
MACF1	23499	genome.wustl.edu	37	1	39824490	39824490	+	Nonsense_Mutation	SNP	C	C	G			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr1:39824490C>G	ENST00000372915.3	+	45	12167	c.12080C>G	c.(12079-12081)tCa>tGa	p.S4027*	MACF1_ENST00000476350.1_3'UTR|MACF1_ENST00000361689.2_Nonsense_Mutation_p.S1960*|MACF1_ENST00000545844.1_Nonsense_Mutation_p.S1960*|MACF1_ENST00000317713.7_Nonsense_Mutation_p.S1960*|MACF1_ENST00000289893.4_Nonsense_Mutation_p.S2462*|MACF1_ENST00000539005.1_Nonsense_Mutation_p.S1960*|MACF1_ENST00000564288.1_Nonsense_Mutation_p.S4022*|MACF1_ENST00000567887.1_Nonsense_Mutation_p.S4059*			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	4027					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AAGCTCCTCTCAGATACTGTT	0.507																																						dbGAP											0													74.0	67.0	70.0					1																	39824490		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.12080C>G	1.37:g.39824490C>G	ENSP00000362006:p.Ser4027*		B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Nonsense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_Ca-bd,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_HAND_2	p.S1960*	ENST00000372915.3	37	c.5879		1	.	.	.	.	.	.	.	.	.	.	C	40	8.016323	0.98610	.	.	ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893	.	.	.	5.32	5.32	0.75619	.	0.132942	0.34676	N	0.003770	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.364	0.94454	0.0:1.0:0.0:0.0	.	.	.	.	X	1960;4027;1960;1960;1960;2462	.	ENSP00000289893:S2462X	S	+	2	0	MACF1	39597077	1.000000	0.71417	1.000000	0.80357	0.599000	0.36880	4.933000	0.63484	2.642000	0.89623	0.655000	0.94253	TCA	MACF1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000127603		0.507	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	26	0.00	0	C	NM_033044		39824490	39824490	+1	no_errors	ENST00000317713	ensembl	human	known	69_37n	nonsense	26	38.10	16	SNP	1.000	G
MAGEA3	4102	genome.wustl.edu	37	X	151935227	151935227	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chrX:151935227C>T	ENST00000393902.3	-	3	1507	c.940G>A	c.(940-942)Gag>Aag	p.E314K	MAGEA3_ENST00000370278.3_Missense_Mutation_p.E314K			P43357	MAGA3_HUMAN	melanoma antigen family A, 3	314										endometrium(4)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)	15	Acute lymphoblastic leukemia(192;6.56e-05)					CAGACTCACTCTTCCCCCTCT	0.572																																						dbGAP											0													104.0	104.0	104.0					X																	151935227		2202	4294	6496	-	-	-	SO:0001583	missense	0				CCDS76045.1	Xq28	2009-03-13			ENSG00000221867	ENSG00000221867			6801	protein-coding gene	gene with protein product	"""melanoma-associated antigen 3"", ""antigen MZ2-D"", ""MAGE-3 antigen"", ""cancer/testis antigen family 1, member 3"""	300174		MAGE3		1840703, 8575766	Standard	NM_005362		Approved	HYPD, HIP8, MGC14613, CT1.3	uc004fgp.3	P43357	OTTHUMG00000022640	ENST00000393902.3:c.940G>A	X.37:g.151935227C>T	ENSP00000377480:p.Glu314Lys		Q6FHI6	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.E314K	ENST00000393902.3	37	c.940	CCDS14715.1	X	.	.	.	.	.	.	.	.	.	.	c	15.16	2.751137	0.49257	.	.	ENSG00000221867	ENST00000370278;ENST00000393902	T;T	0.01998	4.51;4.51	1.42	1.42	0.22433	.	3.625120	0.00799	N	0.001406	T	0.12987	0.0315	M	0.81802	2.56	0.09310	N	1	D	0.76494	0.999	D	0.80764	0.994	T	0.08229	-1.0732	10	0.87932	D	0	.	5.7818	0.18310	0.0:1.0:0.0:0.0	.	314	P43357	MAGA3_HUMAN	K	314	ENSP00000359301:E314K;ENSP00000377480:E314K	ENSP00000359301:E314K	E	-	1	0	MAGEA3	151685883	0.000000	0.05858	0.040000	0.18447	0.032000	0.12392	-0.485000	0.06520	1.002000	0.39104	0.358000	0.22013	GAG	MAGEA3	-	NULL	ENSG00000221867		0.572	MAGEA3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEA3	HGNC	protein_coding	OTTHUMT00000058744.1	89	0.00	0	C	NM_005362		151935227	151935227	-1	no_errors	ENST00000370278	ensembl	human	known	69_37n	missense	76	29.09	32	SNP	0.038	T
MAPK4	5596	genome.wustl.edu	37	18	48255621	48255621	+	Silent	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr18:48255621G>A	ENST00000400384.2	+	6	2197	c.1161G>A	c.(1159-1161)gcG>gcA	p.A387A	MAPK4_ENST00000540640.1_Silent_p.A176A|MAPK4_ENST00000592595.1_3'UTR	NM_002747.3	NP_002738.2	P31152	MK04_HUMAN	mitogen-activated protein kinase 4	387					cell cycle (GO:0007049)|MAPK cascade (GO:0000165)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)	p.A387A(1)		lung(4)|skin(3)|upper_aerodigestive_tract(1)	8		Colorectal(6;0.0297)		Colorectal(21;0.156)		CGGGTTCGGCGCCACTGGCTG	0.697																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											20.0	24.0	23.0					18																	48255621		2069	4172	6241	-	-	-	SO:0001819	synonymous_variant	0			X59727	CCDS42437.1	18q21.1	2012-10-02			ENSG00000141639	ENSG00000141639		"""Mitogen-activated protein kinase cascade / Kinases"""	6878	protein-coding gene	gene with protein product		176949		PRKM4		8290275	Standard	XM_005258299		Approved	Erk3-related, Erk4	uc002lev.3	P31152	OTTHUMG00000179853	ENST00000400384.2:c.1161G>A	18.37:g.48255621G>A			A1A4C4|Q0VG04	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_MAPK_ERK3/4	p.A387	ENST00000400384.2	37	c.1161	CCDS42437.1	18																																																																																			MAPK4	-	NULL	ENSG00000141639		0.697	MAPK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK4	HGNC	protein_coding	OTTHUMT00000448631.2	19	0.00	0	G	NM_002747		48255621	48255621	+1	no_errors	ENST00000400384	ensembl	human	known	69_37n	silent	11	42.11	8	SNP	0.047	A
MARCH7	64844	genome.wustl.edu	37	2	160619400	160619400	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr2:160619400G>C	ENST00000259050.4	+	8	2025	c.1903G>C	c.(1903-1905)Gag>Cag	p.E635Q	MARCH7_ENST00000409591.1_Missense_Mutation_p.E597Q|MARCH7_ENST00000409175.1_Missense_Mutation_p.E635Q|MARCH7_ENST00000539065.1_Missense_Mutation_p.E579Q	NM_001282805.1|NM_001282807.1|NM_022826.2	NP_001269734.1|NP_001269736.1|NP_073737.1	Q9H992	MARH7_HUMAN	membrane-associated ring finger (C3HC4) 7, E3 ubiquitin protein ligase	635					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(3)|prostate(1)|skin(1)|stomach(2)	18						GGCTGAGTATGAGTTTATCAG	0.378																																						dbGAP											0													123.0	110.0	115.0					2																	160619400		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK022973	CCDS2210.1, CCDS63038.1, CCDS63039.1	2q24.2	2013-01-09	2012-02-23	2005-01-27	ENSG00000136536	ENSG00000136536		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	17393	protein-coding gene	gene with protein product		613334	"""axotrophin"", ""membrane-associated ring finger (C3HC4) 7"""	AXOT		14722266	Standard	XM_005246773		Approved	MARCH-VII, RNF177	uc002uax.3	Q9H992	OTTHUMG00000132029	ENST00000259050.4:c.1903G>C	2.37:g.160619400G>C	ENSP00000259050:p.Glu635Gln		A8K9X1|B7Z7P5|D3DPB0|Q53GQ1|Q9BTR9	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH	p.E635Q	ENST00000259050.4	37	c.1903	CCDS2210.1	2	.	.	.	.	.	.	.	.	.	.	G	19.70	3.876123	0.72180	.	.	ENSG00000136536	ENST00000409175;ENST00000539065;ENST00000259050;ENST00000409591;ENST00000420397	T;T;T;T;T	0.46819	2.54;2.57;2.54;2.53;0.86	5.0	4.12	0.48240	.	0.049722	0.85682	D	0.000000	T	0.64605	0.2613	L	0.58101	1.795	0.48975	D	0.999732	D;D;D	0.69078	0.996;0.997;0.997	D;D;D	0.78314	0.991;0.986;0.986	T	0.68277	-0.5451	10	0.66056	D	0.02	0.2118	15.2266	0.73357	0.0:0.0:0.8584:0.1416	.	579;597;635	F5H6W4;B7Z7P5;Q9H992	.;.;MARH7_HUMAN	Q	635;579;635;597;68	ENSP00000386830:E635Q;ENSP00000442992:E579Q;ENSP00000259050:E635Q;ENSP00000387238:E597Q;ENSP00000391493:E68Q	ENSP00000259050:E635Q	E	+	1	0	MARCH7	160327646	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.354000	0.90080	1.216000	0.43427	0.650000	0.86243	GAG	MARCH7	-	NULL	ENSG00000136536		0.378	MARCH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH7	HGNC	protein_coding	OTTHUMT00000255040.3	78	0.00	0	G	NM_022826		160619400	160619400	+1	no_errors	ENST00000259050	ensembl	human	known	69_37n	missense	95	31.16	43	SNP	1.000	C
MASP1	5648	genome.wustl.edu	37	3	187009524	187009524	+	5'UTR	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr3:187009524C>T	ENST00000337774.5	-	0	286				MASP1_ENST00000169293.6_5'UTR|MASP1_ENST00000392472.2_5'UTR|MASP1_ENST00000392470.2_5'UTR|MASP1_ENST00000296280.6_5'UTR|MASP1_ENST00000495249.1_5'UTR	NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)						complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		TATCTTTGTTCTGAGGTCCCT	0.617																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.-104G>A	3.37:g.187009524C>T			A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Silent	SNP	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	p.Q12	ENST00000337774.5	37	c.36	CCDS33907.1	3																																																																																			MASP1	-	NULL	ENSG00000127241		0.617	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MASP1	HGNC	protein_coding	OTTHUMT00000344262.1	27	0.00	0	C	NM_001879		187009524	187009524	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000439271	ensembl	human	putative	69_37n	silent	24	44.19	19	SNP	1.000	T
MAST4	375449	genome.wustl.edu	37	5	66398395	66398395	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr5:66398395G>A	ENST00000403625.2	+	9	1397	c.1102G>A	c.(1102-1104)Gaa>Aaa	p.E368K	MAST4_ENST00000404260.3_Missense_Mutation_p.E371K|MAST4_ENST00000405643.1_Missense_Mutation_p.E189K|MAST4_ENST00000403666.1_Missense_Mutation_p.E179K|MAST4_ENST00000261569.7_Missense_Mutation_p.E174K|MAST4_ENST00000490016.2_Missense_Mutation_p.E179K	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	371						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		CTGTGACCATGAAATAATTAT	0.383																																						dbGAP											0													128.0	124.0	125.0					5																	66398395		1875	4106	5981	-	-	-	SO:0001583	missense	0			AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.1102G>A	5.37:g.66398395G>A	ENSP00000385727:p.Glu368Lys		A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Missense_Mutation	SNP	pfam_MA_Ser/Thr_Kinase_dom,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,superfamily_Kinase-like_dom,superfamily_MAST_pre-PK_dom,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PDZ,pfscan_PDZ,pfscan_Prot_kinase_cat_dom	p.E371K	ENST00000403625.2	37	c.1111	CCDS54861.1	5	.	.	.	.	.	.	.	.	.	.	G	36	5.962631	0.97151	.	.	ENSG00000069020	ENST00000404260;ENST00000403625;ENST00000490016;ENST00000403666;ENST00000405643;ENST00000380908;ENST00000261569;ENST00000432399	T;T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95;0.95	5.67	5.67	0.87782	Microtubule-associated serine/threonine-protein kinase, domain (1);	0.000000	0.64402	U	0.000007	T	0.71550	0.3353	M	0.87038	2.855	0.47245	D	0.999361	P;D;D;D;P	0.89917	0.927;1.0;1.0;0.984;0.857	P;D;D;P;P	0.83275	0.888;0.996;0.996;0.891;0.479	T	0.76044	-0.3103	10	0.87932	D	0	-12.6398	19.7667	0.96346	0.0:0.0:1.0:0.0	.	189;371;174;179;179	E7EWQ5;O15021;O15021-2;O15021-3;D6RAK1	.;MAST4_HUMAN;.;.;.	K	371;368;179;179;189;189;174;174	ENSP00000385048:E371K;ENSP00000385727:E368K;ENSP00000421739:E179K;ENSP00000384313:E179K;ENSP00000384099:E189K;ENSP00000261569:E174K	ENSP00000261569:E174K	E	+	1	0	MAST4	66434151	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.681000	0.91329	0.655000	0.94253	GAA	MAST4	-	pfam_MA_Ser/Thr_Kinase_dom	ENSG00000069020		0.383	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	MAST4	HGNC	protein_coding	OTTHUMT00000326324.2	95	0.00	0	G			66398395	66398395	+1	no_errors	ENST00000404260	ensembl	human	known	69_37n	missense	63	32.98	31	SNP	1.000	A
MBD6	114785	genome.wustl.edu	37	12	57920417	57920417	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr12:57920417G>A	ENST00000355673.3	+	7	1845	c.1489G>A	c.(1489-1491)Gaa>Aaa	p.E497K	MBD6_ENST00000431731.2_Missense_Mutation_p.E497K	NM_052897.3	NP_443129.3	Q96DN6	MBD6_HUMAN	methyl-CpG binding domain protein 6	497	Pro-rich.					chromocenter (GO:0010369)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|urinary_tract(1)	31						AAGCCCATCCGAAGGACTGGG	0.647																																						dbGAP											0													43.0	54.0	50.0					12																	57920417		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB067474	CCDS8944.1	12q13.2	2008-02-05				ENSG00000166987			20445	protein-coding gene	gene with protein product						12529184	Standard	NM_052897		Approved	KIAA1887	uc001soj.1	Q96DN6		ENST00000355673.3:c.1489G>A	12.37:g.57920417G>A	ENSP00000347896:p.Glu497Lys		Q8N3M0|Q8NA81|Q96Q00	Missense_Mutation	SNP	superfamily_DNA-bd_integrase-typ,smart_Methyl_CpG_DNA-bd,pfscan_Methyl_CpG_DNA-bd	p.E497K	ENST00000355673.3	37	c.1489	CCDS8944.1	12	.	.	.	.	.	.	.	.	.	.	G	13.71	2.319303	0.41096	.	.	ENSG00000166987	ENST00000355673;ENST00000431731;ENST00000552659	.	.	.	4.07	4.07	0.47477	.	0.606789	0.14418	N	0.320835	T	0.18045	0.0433	N	0.08118	0	0.23430	N	0.997692	B;B	0.23540	0.087;0.087	B;B	0.19148	0.024;0.019	T	0.06698	-1.0812	9	0.37606	T	0.19	-0.0028	7.8906	0.29675	0.1119:0.0:0.8881:0.0	.	497;497	Q6P0P0;Q96DN6	.;MBD6_HUMAN	K	497;497;171	.	ENSP00000347896:E497K	E	+	1	0	MBD6	56206684	0.997000	0.39634	0.974000	0.42286	0.966000	0.64601	4.206000	0.58473	2.283000	0.76528	0.561000	0.74099	GAA	MBD6	-	NULL	ENSG00000166987		0.647	MBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD6	HGNC	protein_coding	OTTHUMT00000407250.1	12	0.00	0	G			57920417	57920417	+1	no_errors	ENST00000355673	ensembl	human	known	69_37n	missense	15	34.78	8	SNP	0.865	A
MCOLN3	55283	genome.wustl.edu	37	1	85506704	85506704	+	Missense_Mutation	SNP	C	C	G	rs142799067		TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr1:85506704C>G	ENST00000370589.2	-	3	437	c.385G>C	c.(385-387)Gca>Cca	p.A129P	MCOLN3_ENST00000370587.1_Missense_Mutation_p.A129P|MCOLN3_ENST00000341115.4_Intron|WDR63_ENST00000370596.1_Intron	NM_018298.10	NP_060768.8	Q8TDD5	MCLN3_HUMAN	mucolipin 3	129					auditory receptor cell differentiation (GO:0042491)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|locomotory behavior (GO:0007626)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(6)|kidney(3)|large_intestine(9)|lung(12)|prostate(3)|skin(1)	34				all cancers(265;0.00957)|Epithelial(280;0.0254)		TGGTTTACTGCGAAGATTAAC	0.363																																						dbGAP											0													240.0	219.0	226.0					1																	85506704		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF475085	CCDS701.1, CCDS58009.1	1p22.3	2011-12-16			ENSG00000055732	ENSG00000055732		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13358	protein-coding gene	gene with protein product		607400				16382100	Standard	NM_018298		Approved	TRPML3, FLJ11006, TRP-ML3	uc001dkp.3	Q8TDD5	OTTHUMG00000009955	ENST00000370589.2:c.385G>C	1.37:g.85506704C>G	ENSP00000359621:p.Ala129Pro		Q5T4H5|Q5T4H6|Q9NV09	Missense_Mutation	SNP	pfam_PKD1_2_channel	p.A129P	ENST00000370589.2	37	c.385	CCDS701.1	1	.	.	.	.	.	.	.	.	.	.	C	16.75	3.208603	0.58343	.	.	ENSG00000055732	ENST00000370589;ENST00000302814;ENST00000370587	T;T	0.60171	0.21;0.21	5.76	4.84	0.62591	.	0.181400	0.49305	D	0.000149	T	0.64136	0.2571	M	0.84326	2.69	0.80722	D	1	D;P	0.62365	0.991;0.95	P;P	0.59424	0.857;0.615	T	0.70212	-0.4934	10	0.56958	D	0.05	-2.8216	9.5378	0.39233	0.1436:0.7861:0.0:0.0703	.	129;129	B1ANB7;Q8TDD5	.;MCLN3_HUMAN	P	129	ENSP00000359621:A129P;ENSP00000359619:A129P	ENSP00000304843:A129P	A	-	1	0	MCOLN3	85279292	1.000000	0.71417	0.901000	0.35422	0.491000	0.33493	2.124000	0.42006	1.395000	0.46643	0.655000	0.94253	GCA	MCOLN3	-	NULL	ENSG00000055732		0.363	MCOLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCOLN3	HGNC	protein_coding	OTTHUMT00000027569.2	89	0.00	0	C	NM_018298		85506704	85506704	-1	no_errors	ENST00000302814	ensembl	human	known	69_37n	missense	106	35.76	59	SNP	0.997	G
MED27	9442	genome.wustl.edu	37	9	134736049	134736049	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr9:134736049C>A	ENST00000292035.5	-	8	875	c.812G>T	c.(811-813)aGa>aTa	p.R271I	MED27_ENST00000357028.2_Missense_Mutation_p.R235I	NM_004269.3	NP_004260.2	Q6P2C8	MED27_HUMAN	mediator complex subunit 27	271					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|mediator complex (GO:0016592)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	18		Myeloproliferative disorder(178;0.206)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000193)		TATGTAACTTCTTAACCAGGT	0.537																																					Colon(41;784 923 6932 42329 52483)	dbGAP											0													32.0	31.0	32.0					9																	134736049		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF104252	CCDS6945.1, CCDS59153.1, CCDS69689.1	9q34.13	2008-02-05	2007-07-30	2007-07-30	ENSG00000160563	ENSG00000160563			2377	protein-coding gene	gene with protein product		605044	"""cofactor required for Sp1 transcriptional activation, subunit 8, 34kDa"""	CRSP8		9989412	Standard	NM_004269		Approved	TRAP37, CRSP34	uc004cbe.2	Q6P2C8	OTTHUMG00000020833	ENST00000292035.5:c.812G>T	9.37:g.134736049C>A	ENSP00000292035:p.Arg271Ile		O95401|Q4F964|Q5VTA4|Q5VTA5|Q9BU57|Q9NYR4|V9GYV9	Missense_Mutation	SNP	pfam_Mediator_Med27	p.R271I	ENST00000292035.5	37	c.812	CCDS6945.1	9	.	.	.	.	.	.	.	.	.	.	C	23.4	4.414369	0.83449	.	.	ENSG00000160563	ENST00000292035;ENST00000357028;ENST00000372184	.	.	.	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.60792	0.2296	L	0.34521	1.04	0.80722	D	1	D;D	0.64830	0.994;0.989	P;P	0.57846	0.81;0.828	T	0.55062	-0.8199	9	0.22706	T	0.39	-3.7335	16.105	0.81213	0.0:1.0:0.0:0.0	.	235;271	Q6P2C8-2;Q6P2C8	.;MED27_HUMAN	I	271;197;235	.	ENSP00000292035:R271I	R	-	2	0	MED27	133725870	1.000000	0.71417	0.977000	0.42913	0.926000	0.56050	5.893000	0.69798	2.472000	0.83506	0.655000	0.94253	AGA	MED27	-	pfam_Mediator_Med27	ENSG00000160563		0.537	MED27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED27	HGNC	protein_coding	OTTHUMT00000054770.2	28	0.00	0	C	NM_004269		134736049	134736049	-1	no_errors	ENST00000292035	ensembl	human	known	69_37n	missense	17	70.18	40	SNP	1.000	A
MSH2	4436	genome.wustl.edu	37	2	47693816	47693816	+	Missense_Mutation	SNP	G	G	C	rs587782355		TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr2:47693816G>C	ENST00000233146.2	+	10	1753	c.1530G>C	c.(1528-1530)caG>caC	p.Q510H	MSH2_ENST00000543555.1_Missense_Mutation_p.Q444H|MSH2_ENST00000406134.1_Missense_Mutation_p.Q510H	NM_000251.2	NP_000242.1	P43246	MSH2_HUMAN	mutS homolog 2	510					ATP catabolic process (GO:0006200)|B cell differentiation (GO:0030183)|B cell mediated immunity (GO:0019724)|cell cycle arrest (GO:0007050)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|germ cell development (GO:0007281)|in utero embryonic development (GO:0001701)|intra-S DNA damage checkpoint (GO:0031573)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|isotype switching (GO:0045190)|maintenance of DNA repeat elements (GO:0043570)|male gonad development (GO:0008584)|meiotic gene conversion (GO:0006311)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reciprocal meiotic recombination (GO:0045128)|oxidative phosphorylation (GO:0006119)|positive regulation of helicase activity (GO:0051096)|postreplication repair (GO:0006301)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSalpha complex (GO:0032301)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|guanine/thymine mispair binding (GO:0032137)|heteroduplex DNA loop binding (GO:0000404)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|Y-form DNA binding (GO:0000403)	p.0?(2)|p.?(2)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(5)|large_intestine(50)|lung(18)|ovary(5)|prostate(2)|skin(3)|small_intestine(1)|stomach(2)|urinary_tract(1)	112		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			CTGGCAAACAGATTAAACTGG	0.308			"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian"""	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																													dbGAP	yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p22-p21	4436	mutS homolog 2 (E. coli)		E	4	Whole gene deletion(2)|Unknown(2)	haematopoietic_and_lymphoid_tissue(3)|prostate(1)											87.0	92.0	91.0					2																	47693816		2202	4300	6502	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	U03911	CCDS1834.1, CCDS58709.1	2p21	2014-09-17	2013-09-12		ENSG00000095002	ENSG00000095002			7325	protein-coding gene	gene with protein product		609309	"""mutS (E. coli) homolog 2 (colon cancer, nonpolyposis type 1)"", ""mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)"""	COCA1		8484120, 9843200	Standard	NM_000251		Approved	HNPCC, HNPCC1	uc002rvy.2	P43246	OTTHUMG00000128861	ENST00000233146.2:c.1530G>C	2.37:g.47693816G>C	ENSP00000233146:p.Gln510His		B4E2Z2|O75488	Missense_Mutation	SNP	pfam_DNA_mismatch_repair_MutS_C,pfam_DNA_mismatch_repair_MutS_core,pfam_DNA_mismatch_repair_MutS_connt,pfam_DNA_mismatch_repair_MutS-lik_N,pfam_DNA_mismatch_repair_MutS_clamp,superfamily_DNA_mismatch_repair_MutS_core,superfamily_DNA_mismatch_repair_MutS_connt,smart_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_C,pirsf_DNA_mismatch_repair_MSH2	p.Q510H	ENST00000233146.2	37	c.1530	CCDS1834.1	2	.	.	.	.	.	.	.	.	.	.	G	13.40	2.225361	0.39300	.	.	ENSG00000095002	ENST00000233146;ENST00000543555;ENST00000406134;ENST00000419559;ENST00000432737;ENST00000413880	D;D;D	0.89681	-2.55;-2.55;-2.55	6.04	4.22	0.49857	DNA mismatch repair protein MutS, clamp (1);DNA mismatch repair protein MutS, core (3);	0.192857	0.52532	D	0.000078	T	0.80019	0.4547	L	0.29908	0.895	0.37640	D	0.921993	B;B;B	0.12013	0.003;0.005;0.0	B;B;B	0.15870	0.004;0.006;0.014	T	0.76512	-0.2932	10	0.59425	D	0.04	-12.6332	4.4177	0.11465	0.0854:0.3174:0.4696:0.1276	.	444;510;510	B4E2Z2;E9PHA6;P43246	.;.;MSH2_HUMAN	H	510;444;510;510;510;296	ENSP00000233146:Q510H;ENSP00000442697:Q444H;ENSP00000384199:Q510H	ENSP00000233146:Q510H	Q	+	3	2	MSH2	47547320	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.069000	0.30641	1.574000	0.49760	0.563000	0.77884	CAG	MSH2	-	pfam_DNA_mismatch_repair_MutS_core,pfam_DNA_mismatch_repair_MutS_clamp,superfamily_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_core,pirsf_DNA_mismatch_repair_MSH2	ENSG00000095002		0.308	MSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSH2	HGNC	protein_coding	OTTHUMT00000250805.3	57	0.00	0	G			47693816	47693816	+1	no_errors	ENST00000233146	ensembl	human	known	69_37n	missense	40	31.03	18	SNP	1.000	C
MUC16	94025	genome.wustl.edu	37	19	8976844	8976844	+	Silent	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr19:8976844C>T	ENST00000397910.4	-	73	42425	c.42222G>A	c.(42220-42222)ctG>ctA	p.L14074L	MUC16_ENST00000380951.5_Silent_p.L715L|MUC16_ENST00000596956.1_5'UTR	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	14104				Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGAGGGTCTTCAGGTGGTACC	0.542																																						dbGAP											0													106.0	109.0	108.0					19																	8976844		2012	4181	6193	-	-	-	SO:0001819	synonymous_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.42222G>A	19.37:g.8976844C>T			Q6ZQW5|Q96RK2	Silent	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.L14074	ENST00000397910.4	37	c.42222	CCDS54212.1	19																																																																																			MUC16	-	NULL	ENSG00000181143		0.542	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	100	0.00	0	C	NM_024690		8976844	8976844	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	silent	65	40.91	45	SNP	0.022	T
MYH7B	57644	genome.wustl.edu	37	20	33586315	33586315	+	Splice_Site	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr20:33586315G>A	ENST00000262873.7	+	32	4094	c.4002G>A	c.(4000-4002)ggG>ggA	p.G1334G		NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	1292						membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			TGCCTGCAGGGGAGCTGAGTC	0.652																																						dbGAP											0													39.0	44.0	42.0					20																	33586315		2083	4219	6302	-	-	-	SO:0001630	splice_region_variant	0			AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.4001-1G>A	20.37:g.33586315G>A			Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Myosin_S1_N,superfamily_Prefoldin,superfamily_tRNA-bd_arm,superfamily_t-SNARE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.G1334	ENST00000262873.7	37	c.4002	CCDS42869.1	20																																																																																			MYH7B	-	pfam_Myosin_tail,superfamily_Prefoldin	ENSG00000078814		0.652	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH7B	HGNC	protein_coding	OTTHUMT00000078833.2	29	0.00	0	G	NM_020884	Silent	33586315	33586315	+1	no_errors	ENST00000262873	ensembl	human	novel	69_37n	silent	26	39.53	17	SNP	0.983	A
NIN	51199	genome.wustl.edu	37	14	51219447	51219447	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr14:51219447G>A	ENST00000382041.3	-	21	4929	c.4739C>T	c.(4738-4740)tCa>tTa	p.S1580L	NIN_ENST00000324330.9_Missense_Mutation_p.S1580L|NIN_ENST00000530997.2_Missense_Mutation_p.S1580L|NIN_ENST00000245441.5_Missense_Mutation_p.S1580L|NIN_ENST00000382043.4_Missense_Mutation_p.S867L|NIN_ENST00000389868.3_Missense_Mutation_p.S867L|NIN_ENST00000453196.1_Missense_Mutation_p.S1580L	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	1580					centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					TTTTAATTCTGAAATCTAATT	0.274			T	PDGFRB	MPD																																	dbGAP		Dom	yes		14	14q24	51199	ninein (GSK3B interacting protein)		L	0													60.0	56.0	58.0					14																	51219447		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.4739C>T	14.37:g.51219447G>A	ENSP00000371472:p.Ser1580Leu		A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Missense_Mutation	SNP	superfamily_tRNA-bd_arm,pfscan_EF_HAND_2	p.S1580L	ENST00000382041.3	37	c.4739	CCDS32079.1	14	.	.	.	.	.	.	.	.	.	.	G	18.39	3.614026	0.66672	.	.	ENSG00000100503	ENST00000245441;ENST00000311149;ENST00000389868;ENST00000382043;ENST00000324292;ENST00000382041;ENST00000324330;ENST00000453196	T;T;T;T;T;T	0.13196	3.25;2.61;2.61;2.96;2.96;2.97	5.84	4.94	0.65067	.	0.363387	0.29676	N	0.011492	T	0.34716	0.0907	M	0.69823	2.125	0.33457	D	0.584472	P;P;B;P;D	0.67145	0.775;0.588;0.347;0.7;0.996	B;B;B;B;D	0.77557	0.334;0.334;0.069;0.132;0.99	T	0.35325	-0.9793	10	0.36615	T	0.2	-7.833	14.0107	0.64495	0.0742:0.0:0.9258:0.0	.	1586;1580;1580;867;1580	Q8N4C6-5;C9J066;Q8N4C6;Q5BKU3;Q8N4C6-7	.;.;NIN_HUMAN;.;.	L	1580;1563;867;867;1586;1580;1580;1580	ENSP00000245441:S1580L;ENSP00000374518:S867L;ENSP00000371474:S867L;ENSP00000371472:S1580L;ENSP00000324210:S1580L;ENSP00000412391:S1580L	ENSP00000245441:S1580L	S	-	2	0	NIN	50289197	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.910000	0.56371	2.764000	0.94973	0.655000	0.94253	TCA	NIN	-	NULL	ENSG00000100503		0.274	NIN-016	KNOWN	basic|CCDS	protein_coding	NIN	HGNC	protein_coding	OTTHUMT00000395207.2	109	0.00	0	G	NM_182946		51219447	51219447	-1	no_errors	ENST00000245441	ensembl	human	known	69_37n	missense	64	41.82	46	SNP	1.000	A
NIN	51199	genome.wustl.edu	37	14	51233599	51233599	+	Missense_Mutation	SNP	G	G	T	rs199695824		TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr14:51233599G>T	ENST00000382041.3	-	13	1634	c.1444C>A	c.(1444-1446)Cgt>Agt	p.R482S	NIN_ENST00000324330.9_Missense_Mutation_p.R482S|NIN_ENST00000530997.2_Missense_Mutation_p.R482S|NIN_ENST00000245441.5_Missense_Mutation_p.R482S|NIN_ENST00000382043.4_Missense_Mutation_p.R482S|NIN_ENST00000389868.3_Missense_Mutation_p.R482S|NIN_ENST00000453196.1_Missense_Mutation_p.R482S	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	482					centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					TTTTCCAGACGACTGTTTTCC	0.338			T	PDGFRB	MPD																																	dbGAP		Dom	yes		14	14q24	51199	ninein (GSK3B interacting protein)		L	0													127.0	122.0	124.0					14																	51233599		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.1444C>A	14.37:g.51233599G>T	ENSP00000371472:p.Arg482Ser		A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Missense_Mutation	SNP	superfamily_tRNA-bd_arm,pfscan_EF_HAND_2	p.R482S	ENST00000382041.3	37	c.1444	CCDS32079.1	14	.	.	.	.	.	.	.	.	.	.	G	28.0	4.880792	0.91740	.	.	ENSG00000100503	ENST00000245441;ENST00000311149;ENST00000389868;ENST00000382043;ENST00000324292;ENST00000382041;ENST00000324330;ENST00000453196	T;T;T;T;T;T	0.21191	2.02;2.02;2.02;2.02;2.02;2.02	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.50429	0.1615	M	0.78637	2.42	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.998	D;D;D;D;D	0.97110	1.0;0.999;0.999;0.997;0.994	T	0.42515	-0.9447	10	0.46703	T	0.11	-10.1144	19.1076	0.93303	0.0:0.0:1.0:0.0	.	488;482;482;482;482	Q8N4C6-5;C9J066;Q8N4C6;Q5BKU3;Q8N4C6-7	.;.;NIN_HUMAN;.;.	S	482;482;482;482;488;482;482;482	ENSP00000245441:R482S;ENSP00000374518:R482S;ENSP00000371474:R482S;ENSP00000371472:R482S;ENSP00000324210:R482S;ENSP00000412391:R482S	ENSP00000245441:R482S	R	-	1	0	NIN	50303349	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.945000	0.92985	2.759000	0.94783	0.650000	0.86243	CGT	NIN	-	NULL	ENSG00000100503		0.338	NIN-016	KNOWN	basic|CCDS	protein_coding	NIN	HGNC	protein_coding	OTTHUMT00000395207.2	118	0.00	0	G	NM_182946		51233599	51233599	-1	no_errors	ENST00000245441	ensembl	human	known	69_37n	missense	119	37.70	72	SNP	1.000	T
NINL	22981	genome.wustl.edu	37	20	25436389	25436389	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr20:25436389C>T	ENST00000278886.6	-	23	3950	c.3877G>A	c.(3877-3879)Gag>Aag	p.E1293K	NINL_ENST00000464285.1_5'UTR|NINL_ENST00000422516.1_Missense_Mutation_p.E944K	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	1293					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						TCCACCCGCTCTTCTGTGGCT	0.527																																						dbGAP											0													235.0	242.0	240.0					20																	25436389		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.3877G>A	20.37:g.25436389C>T	ENSP00000278886:p.Glu1293Lys		A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Missense_Mutation	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.E1293K	ENST00000278886.6	37	c.3877	CCDS33452.1	20	.	.	.	.	.	.	.	.	.	.	C	13.29	2.194219	0.38707	.	.	ENSG00000101004	ENST00000278886;ENST00000422516	T;T	0.39056	1.1;1.1	5.02	3.1	0.35709	.	0.557042	0.17669	N	0.166054	T	0.56062	0.1960	M	0.77103	2.36	0.09310	N	1	B;D;D	0.56746	0.383;0.977;0.975	B;P;P	0.56088	0.095;0.791;0.672	T	0.48747	-0.9008	10	0.52906	T	0.07	-3.8334	10.1593	0.42842	0.0:0.8365:0.0:0.1635	.	944;1293;84	Q9Y2I6-2;Q9Y2I6;Q9HAD5	.;NINL_HUMAN;.	K	1293;944	ENSP00000278886:E1293K;ENSP00000410431:E944K	ENSP00000278886:E1293K	E	-	1	0	NINL	25384389	0.999000	0.42202	0.001000	0.08648	0.001000	0.01503	3.288000	0.51739	0.724000	0.32296	-0.229000	0.12294	GAG	NINL	-	NULL	ENSG00000101004		0.527	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NINL	HGNC	protein_coding	OTTHUMT00000078445.3	121	0.00	0	C	NM_025176		25436389	25436389	-1	no_errors	ENST00000278886	ensembl	human	known	69_37n	missense	38	57.78	52	SNP	0.306	T
NINL	22981	genome.wustl.edu	37	20	25443172	25443172	+	Silent	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr20:25443172C>T	ENST00000278886.6	-	20	3502	c.3429G>A	c.(3427-3429)caG>caA	p.Q1143Q	NINL_ENST00000422516.1_Silent_p.Q794Q	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	1143					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						CCTTGTAGTTCTGATTCTGGG	0.373																																						dbGAP											0													109.0	109.0	109.0					20																	25443172		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.3429G>A	20.37:g.25443172C>T			A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Missense_Mutation	SNP	NULL	p.E96K	ENST00000278886.6	37	c.286	CCDS33452.1	20	.	.	.	.	.	.	.	.	.	.	C	4.607	0.112758	0.08831	.	.	ENSG00000101004	ENST00000336104	.	.	.	5.17	3.21	0.36854	.	.	.	.	.	T	0.55289	0.1911	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48833	-0.9000	4	.	.	.	-22.3163	6.7778	0.23628	0.1424:0.7005:0.0:0.1571	.	.	.	.	K	96	.	.	E	-	1	0	NINL	25391172	0.994000	0.37717	0.995000	0.50966	0.702000	0.40608	0.488000	0.22371	0.750000	0.32877	0.561000	0.74099	GAA	NINL	-	NULL	ENSG00000101004		0.373	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NINL	HGNC	protein_coding	OTTHUMT00000078445.3	72	0.00	0	C	NM_025176		25443172	25443172	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000336104	ensembl	human	known	69_37n	missense	20	58.33	28	SNP	0.996	T
NSMCE1	197370	genome.wustl.edu	37	16	27238062	27238062	+	Silent	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr16:27238062G>A	ENST00000361439.4	-	6	678	c.579C>T	c.(577-579)atC>atT	p.I193I	NSMCE1_ENST00000565384.1_5'UTR	NM_145080.3	NP_659547.2	Q8WV22	NSE1_HUMAN	non-SMC element 1 homolog (S. cerevisiae)	193					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|intracellular signal transduction (GO:0035556)|positive regulation of response to DNA damage stimulus (GO:2001022)|protein ubiquitination (GO:0016567)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|Smc5-Smc6 complex (GO:0030915)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(3)	7						GGCTGTGACAGATATTGCAGA	0.627																																						dbGAP											0													98.0	109.0	105.0					16																	27238062		2054	4181	6235	-	-	-	SO:0001819	synonymous_variant	0			AF161451	CCDS10628.2	16p12.1	2010-03-23	2006-07-05		ENSG00000169189	ENSG00000169189			29897	protein-coding gene	gene with protein product						11927594	Standard	XM_005255163		Approved	NSE1	uc002doi.1	Q8WV22	OTTHUMG00000131674	ENST00000361439.4:c.579C>T	16.37:g.27238062G>A			D3DWF6|Q9P045|Q9P049	Silent	SNP	pfam_SMC_Nse1,pfam_Znf_RING-like,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Znf_RING	p.I193	ENST00000361439.4	37	c.579	CCDS10628.2	16																																																																																			NSMCE1	-	pfam_Znf_RING-like,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Znf_RING	ENSG00000169189		0.627	NSMCE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSMCE1	HGNC	protein_coding	OTTHUMT00000254577.3	30	0.00	0	G	NM_145080		27238062	27238062	-1	no_errors	ENST00000361439	ensembl	human	known	69_37n	silent	28	20.00	7	SNP	1.000	A
NUDT17	200035	genome.wustl.edu	37	1	145588435	145588435	+	Silent	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr1:145588435C>T	ENST00000334513.5	-	4	449	c.438G>A	c.(436-438)gaG>gaA	p.E146E	NUDT17_ENST00000444015.2_5'UTR	NM_001012758.2	NP_001012776.1	P0C025	NUD17_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 17	146	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.						hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(1)|lung(2)|skin(1)|urinary_tract(2)	9	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GTAGTCCACTCTCCTCCCAAA	0.577											OREG0013751	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													81.0	81.0	81.0					1																	145588435		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC046352	CCDS72865.1	1q21.1	2008-02-05			ENSG00000186364	ENSG00000186364		"""Nudix motif containing"""	26618	protein-coding gene	gene with protein product						12477932	Standard	NM_001012758		Approved	FLJ34433	uc001eoe.3	P0C025	OTTHUMG00000013752	ENST00000334513.5:c.438G>A	1.37:g.145588435C>T		1695		Missense_Mutation	SNP	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like	p.E40K	ENST00000334513.5	37	c.118	CCDS30830.1	1	.	.	.	.	.	.	.	.	.	.	C	0.630	-0.817593	0.02776	.	.	ENSG00000186364	ENST00000444015	T	0.60040	0.22	4.49	1.61	0.23674	.	0.000000	0.85682	D	0.000000	T	0.48768	0.1518	.	.	.	0.53688	D	0.999971	.	.	.	.	.	.	T	0.52238	-0.8602	7	0.87932	D	0	-16.5406	6.3425	0.21330	0.0:0.691:0.0:0.3089	.	.	.	.	K	40	ENSP00000392616:E40K	ENSP00000392616:E40K	E	-	1	0	NUDT17	144299792	0.997000	0.39634	0.596000	0.28811	0.060000	0.15804	0.984000	0.29565	0.166000	0.19597	0.563000	0.77884	GAG	NUDT17	-	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like	ENSG00000186364		0.577	NUDT17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUDT17	HGNC	protein_coding	OTTHUMT00000038541.3	56	0.00	0	C	XM_496395		145588435	145588435	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000444015	ensembl	human	known	69_37n	missense	48	34.25	25	SNP	0.508	T
NWD1	284434	genome.wustl.edu	37	19	16860225	16860225	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr19:16860225C>G	ENST00000552788.1	+	4	772	c.772C>G	c.(772-774)Cac>Gac	p.H258D	NWD1_ENST00000524140.2_Missense_Mutation_p.H258D|NWD1_ENST00000549814.1_Missense_Mutation_p.H258D|NWD1_ENST00000523826.1_Missense_Mutation_p.H52D|NWD1_ENST00000339803.6_Missense_Mutation_p.H123D|NWD1_ENST00000379808.3_Missense_Mutation_p.H258D			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	258							ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						GAACAAGACTCACGCCTGCTA	0.602																																						dbGAP											0													50.0	47.0	48.0					19																	16860225		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.772C>G	19.37:g.16860225C>G	ENSP00000447224:p.His258Asp		C9J021|Q68CT3	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.H258D	ENST00000552788.1	37	c.772		19	.	.	.	.	.	.	.	.	.	.	c	13.77	2.337663	0.41398	.	.	ENSG00000188039	ENST00000420818;ENST00000524140;ENST00000549814;ENST00000379808;ENST00000523826;ENST00000552788;ENST00000339803	T;T;T;D;T;T	0.81739	-0.47;-0.41;-0.47;-1.53;-0.42;-0.95	4.35	4.35	0.52113	.	0.115616	0.64402	D	0.000019	D	0.83381	0.5242	L	0.34521	1.04	0.49130	D	0.999751	D;D;D	0.76494	0.997;0.996;0.999	P;P;D	0.78314	0.879;0.871;0.991	D	0.84904	0.0844	10	0.66056	D	0.02	-20.5386	12.6914	0.56976	0.0:1.0:0.0:0.0	.	258;258;123	Q149M9;Q149M9-3;C9J2Y8	NWD1_HUMAN;.;.	D	123;258;258;258;52;258;123	ENSP00000428579:H258D;ENSP00000447548:H258D;ENSP00000369136:H258D;ENSP00000428955:H52D;ENSP00000447224:H258D;ENSP00000340159:H123D	ENSP00000340159:H123D	H	+	1	0	NWD1	16721225	0.999000	0.42202	0.623000	0.29173	0.016000	0.09150	3.050000	0.49877	2.139000	0.66308	0.637000	0.83480	CAC	NWD1	-	NULL	ENSG00000188039		0.602	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	NWD1	HGNC	protein_coding	OTTHUMT00000403569.1	19	0.00	0	C	NM_001007525		16860225	16860225	+1	no_errors	ENST00000379808	ensembl	human	known	69_37n	missense	14	46.15	12	SNP	0.997	G
OR5H14	403273	genome.wustl.edu	37	3	97868793	97868793	+	Silent	SNP	T	T	C			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr3:97868793T>C	ENST00000437310.1	+	1	624	c.564T>C	c.(562-564)tcT>tcC	p.S188S	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005514.1	NP_001005514.1	A6NHG9	O5H14_HUMAN	olfactory receptor, family 5, subfamily H, member 14	188						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	31						TAAAGATTTCTTATACTGATT	0.299																																						dbGAP											0													67.0	73.0	71.0					3																	97868793		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0				CCDS33798.1	3q11.2	2013-09-23			ENSG00000236032	ENSG00000236032		"""GPCR / Class A : Olfactory receptors"""	31286	protein-coding gene	gene with protein product							Standard	NM_001005514		Approved		uc003dsg.1	A6NHG9	OTTHUMG00000160079	ENST00000437310.1:c.564T>C	3.37:g.97868793T>C			B9EH15	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S188	ENST00000437310.1	37	c.564	CCDS33798.1	3																																																																																			OR5H14	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000236032		0.299	OR5H14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5H14	HGNC	protein_coding	OTTHUMT00000359112.1	163	0.00	0	T			97868793	97868793	+1	no_errors	ENST00000437310	ensembl	human	known	69_37n	silent	138	34.91	74	SNP	1.000	C
PAPLN	89932	genome.wustl.edu	37	14	73729310	73729310	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr14:73729310C>A	ENST00000554301.1	+	18	2661	c.2498C>A	c.(2497-2499)gCa>gAa	p.A833E	PAPLN_ENST00000554314.1_3'UTR|PAPLN_ENST00000427855.1_Missense_Mutation_p.A833E|PAPLN_ENST00000340738.5_Missense_Mutation_p.A806E|PAPLN_ENST00000555445.1_Missense_Mutation_p.A817E|PAPLN_ENST00000381166.3_Missense_Mutation_p.A833E			O95428	PPN_HUMAN	papilin, proteoglycan-like sulfated glycoprotein	833						basement membrane (GO:0005604)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase inhibitor activity (GO:0004867)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(3)	42				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)		AGCAGTCCTGCAGGCGAGCAG	0.672																																						dbGAP											0													14.0	13.0	14.0					14																	73729310		2157	4247	6404	-	-	-	SO:0001583	missense	0			BC042057	CCDS32114.1	14q24.2	2013-01-11				ENSG00000100767		"""Immunoglobulin superfamily / I-set domain containing"""	19262	protein-coding gene	gene with protein product						11076767, 19734141	Standard	NM_173462		Approved	MGC50452	uc001xnw.4	O95428		ENST00000554301.1:c.2498C>A	14.37:g.73729310C>A	ENSP00000451803:p.Ala833Glu		B4DES8|B4DGE6|Q659F2|Q6UXJ4|Q6ZNM1|Q6ZUJ0|Q7Z681|Q8IVU0	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_Prot_inh_Kunz-m,pfam_PLAC,superfamily_Prot_inh_Kunz-m,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_Prot_inh_Kunz-m,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,prints_Peptidase_M12B_ADAM-TS,prints_Prot_inh_Kunz-m,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Prot_inh_Kunz-m,pfscan_Ig-like	p.A833E	ENST00000554301.1	37	c.2498		14	.	.	.	.	.	.	.	.	.	.	C	12.93	2.085686	0.36758	.	.	ENSG00000100767	ENST00000340738;ENST00000427855;ENST00000381166;ENST00000554301;ENST00000555445	T;T;T;T;T	0.62639	0.01;0.02;0.32;0.02;0.15	5.07	3.2	0.36748	.	.	.	.	.	T	0.29684	0.0741	N	0.08118	0	0.09310	N	1	P;B;P;B	0.37276	0.589;0.255;0.589;0.137	B;B;B;B	0.31101	0.124;0.026;0.083;0.037	T	0.28004	-1.0057	9	0.02654	T	1	.	5.7265	0.18017	0.1609:0.1848:0.6543:0.0	.	817;833;833;806	O95428-5;O95428;O95428-4;O95428-6	.;PPN_HUMAN;.;.	E	806;833;833;833;817	ENSP00000345395:A806E;ENSP00000403403:A833E;ENSP00000370558:A833E;ENSP00000451803:A833E;ENSP00000451729:A817E	ENSP00000345395:A806E	A	+	2	0	PAPLN	72799063	0.180000	0.23148	0.004000	0.12327	0.014000	0.08584	1.697000	0.37784	1.377000	0.46286	-0.311000	0.09066	GCA	PAPLN	-	NULL	ENSG00000100767		0.672	PAPLN-002	KNOWN	basic|appris_principal	protein_coding	PAPLN	HGNC	protein_coding	OTTHUMT00000413182.1	9	0.00	0	C	NM_173462		73729310	73729310	+1	no_errors	ENST00000427855	ensembl	human	known	69_37n	missense	11	38.89	7	SNP	0.004	A
PARD6B	84612	genome.wustl.edu	37	20	49366546	49366546	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr20:49366546G>A	ENST00000371610.2	+	3	883	c.640G>A	c.(640-642)Gaa>Aaa	p.E214K	PARD6B_ENST00000396039.1_Intron	NM_032521.2	NP_115910.1	Q9BYG5	PAR6B_HUMAN	par-6 family cell polarity regulator beta	214	Interaction with PARD3 and CDC42. {ECO:0000250}.|PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell junction assembly (GO:0034329)|cell-cell junction assembly (GO:0007043)|cell-cell junction organization (GO:0045216)|establishment or maintenance of cell polarity (GO:0007163)|protein complex assembly (GO:0006461)|regulation of cell migration (GO:0030334)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				NS(1)|breast(1)|endometrium(1)|kidney(4)|lung(3)|urinary_tract(1)	11						TGTTAATGATGAAGTTTTAGA	0.418																																						dbGAP											0													94.0	91.0	92.0					20																	49366546		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB044555	CCDS33485.1	20q13.13	2013-08-28	2013-08-28		ENSG00000124171	ENSG00000124171			16245	protein-coding gene	gene with protein product		608975	"""par-6 (partitioning defective 6, C.elegans) homolog beta"", ""par-6 partitioning defective 6 homolog beta (C. elegans)"""			11260256	Standard	NM_032521		Approved	PAR-6B	uc002xvo.3	Q9BYG5	OTTHUMG00000032732	ENST00000371610.2:c.640G>A	20.37:g.49366546G>A	ENSP00000360672:p.Glu214Lys		A2A2A7|Q9Y510	Missense_Mutation	SNP	pfam_OPR_PB1,pfam_PDZ,superfamily_PDZ,smart_OPR_PB1,smart_PDZ,pfscan_PDZ	p.E214K	ENST00000371610.2	37	c.640	CCDS33485.1	20	.	.	.	.	.	.	.	.	.	.	G	28.0	4.880029	0.91740	.	.	ENSG00000124171	ENST00000371610	T	0.23950	1.88	6.02	6.02	0.97574	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.54532	0.1864	M	0.71036	2.16	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.52495	-0.8568	10	0.87932	D	0	-39.7181	20.5407	0.99260	0.0:0.0:1.0:0.0	.	214	Q9BYG5	PAR6B_HUMAN	K	214	ENSP00000360672:E214K	ENSP00000360672:E214K	E	+	1	0	PARD6B	48799953	1.000000	0.71417	0.537000	0.28052	0.599000	0.36880	9.383000	0.97214	2.865000	0.98341	0.655000	0.94253	GAA	PARD6B	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000124171		0.418	PARD6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARD6B	HGNC	protein_coding	OTTHUMT00000079697.2	75	0.00	0	G	NM_032521		49366546	49366546	+1	no_errors	ENST00000371610	ensembl	human	known	69_37n	missense	44	18.52	10	SNP	1.000	A
PBRM1	55193	genome.wustl.edu	37	3	52584783	52584783	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr3:52584783C>G	ENST00000296302.7	-	28	4661	c.4660G>C	c.(4660-4662)Gga>Cga	p.G1554R	PBRM1_ENST00000409767.1_Missense_Mutation_p.G1462R|PBRM1_ENST00000410007.1_Missense_Mutation_p.G1474R|PBRM1_ENST00000337303.4_Missense_Mutation_p.G1447R|PBRM1_ENST00000356770.4_Missense_Mutation_p.G1467R|PBRM1_ENST00000409114.3_Missense_Mutation_p.G1517R|PBRM1_ENST00000394830.3_Missense_Mutation_p.G1447R|SMIM4_ENST00000476842.1_Intron|PBRM1_ENST00000409057.1_Missense_Mutation_p.G1499R|RNU6-856P_ENST00000516959.1_RNA			Q86U86	PB1_HUMAN	polybromo 1	1554	Pro-rich.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TATGGACTTCCACCTGGTGCT	0.468			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																	dbGAP		Rec	yes		3	3p21	55193	polybromo 1		E	0													81.0	75.0	77.0					3																	52584783		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.4660G>C	3.37:g.52584783C>G	ENSP00000296302:p.Gly1554Arg		A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Missense_Mutation	SNP	pfam_Bromodomain,pfam_BAH_dom,pfam_HMG_superfamily,superfamily_Bromodomain,superfamily_HMG_superfamily,smart_Bromodomain,smart_BAH_dom,smart_HMG_superfamily,pfscan_BAH_dom,pfscan_HMG_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.G1554R	ENST00000296302.7	37	c.4660		3	.	.	.	.	.	.	.	.	.	.	C	17.97	3.517806	0.64634	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767	T;T;T;T;T;T;T;T	0.34667	1.39;1.38;1.43;1.35;1.39;1.39;1.8;1.35	5.93	5.93	0.95920	.	0.133030	0.49916	D	0.000131	T	0.37073	0.0990	L	0.44542	1.39	0.21822	N	0.999522	P;P;P;P;B;P;B;P	0.39250	0.665;0.665;0.665;0.665;0.402;0.535;0.069;0.665	B;B;B;B;B;B;B;B	0.43018	0.405;0.405;0.405;0.405;0.232;0.229;0.047;0.405	T	0.26608	-1.0098	10	0.15499	T	0.54	-15.0749	17.5099	0.87757	0.0:1.0:0.0:0.0	.	1474;1447;1499;1517;1462;1554;1467;1447	Q86U86-9;Q86U86-4;Q86U86-2;Q86U86-8;Q86U86-7;Q86U86;Q86U86-3;Q86U86-5	.;.;.;.;.;PB1_HUMAN;.;.	R	1467;1447;1554;1447;1499;1474;1517;1462	ENSP00000349213:G1467R;ENSP00000378307:G1447R;ENSP00000296302:G1554R;ENSP00000338302:G1447R;ENSP00000386593:G1499R;ENSP00000386529:G1474R;ENSP00000386643:G1517R;ENSP00000386601:G1462R	ENSP00000296302:G1554R	G	-	1	0	PBRM1	52559823	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.359000	0.59449	2.826000	0.97356	0.655000	0.94253	GGA	PBRM1	-	NULL	ENSG00000163939		0.468	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	PBRM1	HGNC	protein_coding	OTTHUMT00000327232.1	54	0.00	0	C	NM_018165		52584783	52584783	-1	no_errors	ENST00000296302	ensembl	human	known	69_37n	missense	34	29.17	14	SNP	1.000	G
PDCD11	22984	genome.wustl.edu	37	10	105176260	105176260	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr10:105176260G>C	ENST00000369797.3	+	13	1625	c.1531G>C	c.(1531-1533)Gac>Cac	p.D511H		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	511	S1 motif 5. {ECO:0000255|PROSITE- ProRule:PRU00180}.				mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		TTTGCTTTGTGACCCTGAAGC	0.488											OREG0020494	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													149.0	143.0	145.0					10																	105176260		2203	4300	6503	-	-	-	SO:0001583	missense	0			D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.1531G>C	10.37:g.105176260G>C	ENSP00000358812:p.Asp511His	1387	Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Missense_Mutation	SNP	pfam_Rbsml_prot_S1_RNA-bd_dom,pfam_Suf,superfamily_NA-bd_OB-fold-like,smart_RNA-binding_domain_S1,smart_HAT,pfscan_TPR-contain_dom,pfscan_Rbsml_prot_S1_RNA-bd_dom,prints_Ribosomal_S1	p.D511H	ENST00000369797.3	37	c.1531	CCDS31276.1	10	.	.	.	.	.	.	.	.	.	.	G	18.40	3.616530	0.66672	.	.	ENSG00000148843	ENST00000369797;ENST00000543503	T	0.57273	0.41	5.36	3.49	0.39957	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);RNA-binding domain, S1 (1);Ribosomal protein S1, RNA-binding domain (2);	0.325266	0.38381	N	0.001710	T	0.69033	0.3066	M	0.89715	3.055	0.37136	D	0.90149	D	0.67145	0.996	D	0.71184	0.972	T	0.72374	-0.4313	10	0.15499	T	0.54	-18.6393	5.8142	0.18484	0.3083:0.0:0.6917:0.0	.	511	Q14690	RRP5_HUMAN	H	511	ENSP00000358812:D511H	ENSP00000358812:D511H	D	+	1	0	PDCD11	105166250	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.003000	0.49505	1.403000	0.46800	0.591000	0.81541	GAC	PDCD11	-	pfam_Rbsml_prot_S1_RNA-bd_dom,superfamily_NA-bd_OB-fold-like,smart_RNA-binding_domain_S1,pfscan_Rbsml_prot_S1_RNA-bd_dom	ENSG00000148843		0.488	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDCD11	HGNC	protein_coding	OTTHUMT00000050151.1	64	0.00	0	G			105176260	105176260	+1	no_errors	ENST00000369797	ensembl	human	known	69_37n	missense	37	31.48	17	SNP	1.000	C
PIKFYVE	200576	genome.wustl.edu	37	2	209190674	209190674	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr2:209190674C>G	ENST00000264380.4	+	20	3297	c.3139C>G	c.(3139-3141)Cag>Gag	p.Q1047E		NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	1047					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						GGCCTTTAAGCAGGAATTAAA	0.413																																						dbGAP											0													98.0	100.0	99.0					2																	209190674		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.3139C>G	2.37:g.209190674C>G	ENSP00000264380:p.Gln1047Glu		Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Missense_Mutation	SNP	pfam_PInositol-4-P-5-kinase_core,pfam_Cpn60/TCP-1,pfam_DEP_dom,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,smart_DEP_dom,smart_PInositol-4P-5-kinase_core_sub,pfscan_DEP_dom,pfscan_Znf_FYVE-rel	p.Q1047E	ENST00000264380.4	37	c.3139	CCDS2382.1	2	.	.	.	.	.	.	.	.	.	.	C	18.94	3.730436	0.69074	.	.	ENSG00000115020	ENST00000264380;ENST00000392200;ENST00000452564	T;T	0.27720	1.65;1.82	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.54791	0.1880	M	0.67953	2.075	0.80722	D	1	D;P	0.54964	0.969;0.951	D;P	0.64877	0.93;0.525	T	0.28808	-1.0032	10	0.29301	T	0.29	-13.1424	20.8794	0.99867	0.0:1.0:0.0:0.0	.	1047;991	Q9Y2I7;E9PDH4	FYV1_HUMAN;.	E	1047;623;991	ENSP00000264380:Q1047E;ENSP00000405736:Q991E	ENSP00000264380:Q1047E	Q	+	1	0	PIKFYVE	208898919	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	5.920000	0.70017	2.941000	0.99782	0.655000	0.94253	CAG	PIKFYVE	-	NULL	ENSG00000115020		0.413	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIKFYVE	HGNC	protein_coding	OTTHUMT00000256477.2	53	0.00	0	C	NM_015040		209190674	209190674	+1	no_errors	ENST00000264380	ensembl	human	known	69_37n	missense	46	31.34	21	SNP	1.000	G
PLBD1	79887	genome.wustl.edu	37	12	14688722	14688722	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr12:14688722C>T	ENST00000240617.5	-	6	1367	c.715G>A	c.(715-717)Gag>Aag	p.E239K	RP11-502N13.2_ENST00000544122.1_RNA	NM_024829.5	NP_079105.4	Q6P4A8	PLBL1_HUMAN	phospholipase B domain containing 1	239					glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)	hydrolase activity (GO:0016787)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	16						AGGATGTTCTCAAATCCAGGA	0.418																																						dbGAP											0													161.0	144.0	150.0					12																	14688722		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC000909	CCDS31751.1	12p13.1	2013-10-11			ENSG00000121316	ENSG00000121316			26215	protein-coding gene	gene with protein product	"""PLB homolog 1 (Dictyostelium)"""					15193148, 19019078	Standard	NM_024829		Approved	FLJ22662	uc001rcc.1	Q6P4A8	OTTHUMG00000168821	ENST00000240617.5:c.715G>A	12.37:g.14688722C>T	ENSP00000240617:p.Glu239Lys		A8K4E9|Q9BVV3|Q9H625	Missense_Mutation	SNP	pfam_PLipase_B-like	p.E239K	ENST00000240617.5	37	c.715	CCDS31751.1	12	.	.	.	.	.	.	.	.	.	.	C	34	5.304789	0.95601	.	.	ENSG00000121316	ENST00000240617	T	0.18502	2.21	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.35653	0.0939	L	0.56199	1.76	0.80722	D	1	D	0.60160	0.987	P	0.61003	0.882	T	0.01192	-1.1423	10	0.66056	D	0.02	-29.5383	17.0831	0.86603	0.0:1.0:0.0:0.0	.	239	Q6P4A8	PLBL1_HUMAN	K	239	ENSP00000240617:E239K	ENSP00000240617:E239K	E	-	1	0	PLBD1	14579989	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	6.948000	0.75965	2.773000	0.95371	0.585000	0.79938	GAG	PLBD1	-	pfam_PLipase_B-like	ENSG00000121316		0.418	PLBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLBD1	HGNC	protein_coding	OTTHUMT00000401203.1	57	0.00	0	C	NM_024829		14688722	14688722	-1	no_errors	ENST00000240617	ensembl	human	known	69_37n	missense	54	32.50	26	SNP	1.000	T
PSG4	5672	genome.wustl.edu	37	19	43699148	43699148	+	Splice_Site	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr19:43699148G>A	ENST00000405312.3	-	4	1224	c.987C>T	c.(985-987)ctC>ctT	p.L329L	PSG4_ENST00000244295.9_Intron|PSG4_ENST00000433626.2_Splice_Site_p.L236L	NM_002780.3	NP_002771.2	Q00888	PSG4_HUMAN	pregnancy specific beta-1-glycoprotein 4	329					female pregnancy (GO:0007565)	extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	24		Prostate(69;0.00682)				GATACTCACAGAGGACATTCA	0.493																																						dbGAP											0													90.0	87.0	88.0					19																	43699148		2201	4292	6493	-	-	-	SO:0001630	splice_region_variant	0				CCDS33039.1, CCDS46093.1, CCDS62695.1	19q13.2	2013-01-29			ENSG00000243137	ENSG00000243137		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9521	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1-glycoprotein 4"""	176393				2783133	Standard	NM_002780		Approved		uc002ovy.4	Q00888	OTTHUMG00000151544	ENST00000405312.3:c.988+1C>T	19.37:g.43699148G>A			E7EX79|Q13047|Q13048|Q15234|Q15240|Q9UQ76	Silent	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L329	ENST00000405312.3	37	c.987	CCDS46093.1	19																																																																																			PSG4	-	smart_Ig_sub	ENSG00000243137		0.493	PSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSG4	HGNC	protein_coding	OTTHUMT00000323073.1	131	0.00	0	G	NM_213633	Silent	43699148	43699148	-1	no_errors	ENST00000405312	ensembl	human	known	69_37n	silent	110	44.72	89	SNP	0.476	A
PTPRZ1	5803	genome.wustl.edu	37	7	121650745	121650745	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr7:121650745C>G	ENST00000393386.2	+	12	2056	c.1645C>G	c.(1645-1647)Cca>Gca	p.P549A	PTPRZ1_ENST00000449182.1_Missense_Mutation_p.P549A	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	549					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						TCTTAGATCTCCACATATGAA	0.408																																						dbGAP											0													66.0	64.0	65.0					7																	121650745		2203	4300	6503	-	-	-	SO:0001583	missense	0			M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.1645C>G	7.37:g.121650745C>G	ENSP00000377047:p.Pro549Ala		A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Carbonic_anhydrase_a,pfam_Fibronectin_type3,superfamily_Carbonic_anhydrase_a,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Carbonic_anhydrase_a	p.P549A	ENST00000393386.2	37	c.1645	CCDS34740.1	7	.	.	.	.	.	.	.	.	.	.	C	0.655	-0.808132	0.02819	.	.	ENSG00000106278	ENST00000393386;ENST00000449182	T;T	0.40476	1.07;1.03	5.81	4.75	0.60458	.	0.652152	0.15422	N	0.263206	T	0.39118	0.1066	M	0.63428	1.95	0.09310	N	1	B;P	0.37441	0.085;0.595	B;B	0.34931	0.039;0.192	T	0.37056	-0.9722	10	0.45353	T	0.12	.	10.4603	0.44575	0.0:0.8014:0.0:0.1986	.	549;549	C9JFM0;P23471	.;PTPRZ_HUMAN	A	549	ENSP00000377047:P549A;ENSP00000410000:P549A	ENSP00000377047:P549A	P	+	1	0	PTPRZ1	121437981	0.037000	0.19845	0.974000	0.42286	0.925000	0.55904	1.654000	0.37334	2.754000	0.94517	0.655000	0.94253	CCA	PTPRZ1	-	NULL	ENSG00000106278		0.408	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRZ1	HGNC	protein_coding	OTTHUMT00000347288.1	46	0.00	0	C	NM_002851		121650745	121650745	+1	no_errors	ENST00000393386	ensembl	human	known	69_37n	missense	30	23.08	9	SNP	0.079	G
PYGL	5836	genome.wustl.edu	37	14	51376618	51376618	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr14:51376618C>G	ENST00000216392.7	-	17	2504	c.2172G>C	c.(2170-2172)aaG>aaC	p.K724N	PYGL_ENST00000544180.2_Missense_Mutation_p.K690N|PYGL_ENST00000532462.1_Missense_Mutation_p.K724N|RP11-218E20.5_ENST00000557343.1_RNA	NM_002863.4	NP_002854.3	P06737	PYGL_HUMAN	phosphorylase, glycogen, liver	724					5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|carbohydrate metabolic process (GO:0005975)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|necroptotic process (GO:0070266)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	AMP binding (GO:0016208)|ATP binding (GO:0005524)|bile acid binding (GO:0032052)|drug binding (GO:0008144)|glucose binding (GO:0005536)|glycogen phosphorylase activity (GO:0008184)|protein homodimerization activity (GO:0042803)|purine nucleobase binding (GO:0002060)|pyridoxal phosphate binding (GO:0030170)|vitamin binding (GO:0019842)			NS(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)|skin(3)	25	all_epithelial(31;0.00825)|Breast(41;0.148)				Adenosine monophosphate(DB00131)	CTTACCCTTTCTTGTCCAAAG	0.527																																						dbGAP											0													191.0	185.0	187.0					14																	51376618		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32080.1, CCDS53894.1	14q11.2-q24.3	2013-03-01	2008-07-31		ENSG00000100504	ENSG00000100504	2.4.1.1	"""Glycogen phosphorylases"""	9725	protein-coding gene	gene with protein product	"""Hers disease"", ""glycogen storage disease type VI"", ""glycogen phosphorylase, liver form"""	613741	"""phosphorylase, glycogen; liver"""			2877458	Standard	NM_002863		Approved		uc001wyu.3	P06737	OTTHUMG00000166596	ENST00000216392.7:c.2172G>C	14.37:g.51376618C>G	ENSP00000216392:p.Lys724Asn		A6NDQ4|B4DUB7|F5H816|O60567|O60752|O60913|Q501V9|Q641R5|Q96G82	Missense_Mutation	SNP	pfam_Glyco_trans_35,pirsf_Glyco_trans_35,tigrfam_Glycg_phsphrylas	p.K724N	ENST00000216392.7	37	c.2172	CCDS32080.1	14	.	.	.	.	.	.	.	.	.	.	C	5.871	0.344906	0.11126	.	.	ENSG00000100504	ENST00000532462;ENST00000544180;ENST00000216392	D;D;D	0.93604	-3.25;-3.25;-3.25	5.88	3.96	0.45880	.	0.042179	0.85682	D	0.000000	D	0.90167	0.6927	L	0.58302	1.8	0.49389	D	0.999787	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.17979	0.008;0.02;0.003	D	0.85453	0.1162	10	0.15952	T	0.53	-17.1414	12.2818	0.54767	0.0:0.7949:0.1309:0.0741	.	690;690;724	F5H816;B4DUB7;P06737	.;.;PYGL_HUMAN	N	724;690;724	ENSP00000431657:K724N;ENSP00000443787:K690N;ENSP00000216392:K724N	ENSP00000216392:K724N	K	-	3	2	PYGL	50446368	1.000000	0.71417	1.000000	0.80357	0.259000	0.26198	1.276000	0.33156	1.500000	0.48636	0.655000	0.94253	AAG	PYGL	-	pfam_Glyco_trans_35,pirsf_Glyco_trans_35,tigrfam_Glycg_phsphrylas	ENSG00000100504		0.527	PYGL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYGL	HGNC	protein_coding	OTTHUMT00000390654.3	66	0.00	0	C	NM_002863		51376618	51376618	-1	no_errors	ENST00000216392	ensembl	human	known	69_37n	missense	46	40.26	31	SNP	1.000	G
RAB11FIP4	84440	genome.wustl.edu	37	17	29761087	29761087	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr17:29761087G>C	ENST00000325874.8	+	3	512	c.283G>C	c.(283-285)Gag>Cag	p.E95Q		NM_032932.3	NP_116321.2	Q86YS3	RFIP4_HUMAN	RAB11 family interacting protein 4 (class II)	95	Necessary for interaction with RAB11A, subcellular location, homo- or heterooligomerization.				cytokinesis (GO:0000910)|transport (GO:0006810)|viral process (GO:0016032)	cleavage furrow (GO:0032154)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|midbody (GO:0030496)|recycling endosome membrane (GO:0055038)	ADP-ribosylation factor binding (GO:0030306)|calcium ion binding (GO:0005509)|protein homodimerization activity (GO:0042803)|Rab GTPase binding (GO:0017137)	p.?(1)		endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_cancers(10;3.62e-13)|all_epithelial(10;0.000387)|all_lung(9;0.0132)|Breast(31;0.014)|all_hematologic(16;0.015)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0259)|Ovarian(249;0.0423)|Lung NSC(157;0.066)				GCTGTCGGTGGAGAGCGCGGG	0.667																																						dbGAP											1	Unknown(1)	autonomic_ganglia(1)											68.0	57.0	61.0					17																	29761087		2202	4298	6500	-	-	-	SO:0001583	missense	0			AB058724	CCDS11267.1	17q11.2	2013-01-10			ENSG00000131242	ENSG00000131242		"""EF-hand domain containing"""	30267	protein-coding gene	gene with protein product		611999				11347906, 11468690	Standard	NM_032932		Approved	RAB11-FIP4, KIAA1821, MGC11316, FLJ00131	uc002hgn.1	Q86YS3	OTTHUMG00000132787	ENST00000325874.8:c.283G>C	17.37:g.29761087G>C	ENSP00000312837:p.Glu95Gln		Q52LI1|Q8N829|Q8NDT7|Q969D8	Missense_Mutation	SNP	pfam_Rab-bd_FIP-RBD,pfscan_EF_HAND_2	p.E95Q	ENST00000325874.8	37	c.283	CCDS11267.1	17	.	.	.	.	.	.	.	.	.	.	G	3.924	-0.017605	0.07681	.	.	ENSG00000131242	ENST00000325874;ENST00000394744	.	.	.	4.76	3.71	0.42584	.	0.367365	0.22622	N	0.057683	T	0.41328	0.1154	L	0.29908	0.895	0.80722	D	1	B	0.11235	0.004	B	0.06405	0.002	T	0.23332	-1.0191	8	.	.	.	-23.8927	10.0911	0.42447	0.0:0.2041:0.7959:0.0	.	95	Q86YS3	RFIP4_HUMAN	Q	95	.	.	E	+	1	0	RAB11FIP4	26785213	1.000000	0.71417	0.998000	0.56505	0.075000	0.17131	2.891000	0.48617	2.208000	0.71279	0.462000	0.41574	GAG	RAB11FIP4	-	NULL	ENSG00000131242		0.667	RAB11FIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB11FIP4	HGNC	protein_coding	OTTHUMT00000256195.2	19	0.00	0	G	NM_032932		29761087	29761087	+1	no_errors	ENST00000325874	ensembl	human	known	69_37n	missense	51	20.31	13	SNP	0.995	C
RBAK	57786	genome.wustl.edu	37	7	5103430	5103430	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr7:5103430G>C	ENST00000353796.3	+	6	667	c.343G>C	c.(343-345)Gag>Cag	p.E115Q	RBAK-RBAKDN_ENST00000407184.1_Intron|RBAK_ENST00000396912.1_Missense_Mutation_p.E115Q|RBAK-RBAKDN_ENST00000396904.2_Intron	NM_001204456.1	NP_001191385.1	Q9NYW8	RBAK_HUMAN	RB-associated KRAB zinc finger	115					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(2)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	10		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)		TGAAGAGAAAGAGAATACATT	0.363																																						dbGAP											0													88.0	85.0	86.0					7																	5103430		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF226869	CCDS5337.1	7p22.1	2013-01-08			ENSG00000146587	ENSG00000146587		"""Zinc fingers, C2H2-type"", ""-"""	17680	protein-coding gene	gene with protein product		608191					Standard	NM_021163		Approved	ZNF769	uc003sns.1	Q9NYW8	OTTHUMG00000121155	ENST00000353796.3:c.343G>C	7.37:g.5103430G>C	ENSP00000275423:p.Glu115Gln		A6NDF2|A8KAK4|B2RN44|B9EGS1|F8W6M7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E115Q	ENST00000353796.3	37	c.343	CCDS5337.1	7	.	.	.	.	.	.	.	.	.	.	G	0.011	-1.720883	0.00700	.	.	ENSG00000146587	ENST00000353796;ENST00000396912	T;T	0.07021	3.23;3.23	3.38	1.55	0.23275	.	1.752930	0.02971	N	0.144432	T	0.07548	0.0190	L	0.42245	1.32	0.22378	N	0.99916	P	0.36974	0.576	B	0.28305	0.088	T	0.32666	-0.9898	8	.	.	.	.	4.814	0.13358	0.1246:0.2216:0.6538:0.0	.	115	Q9NYW8	RBAK_HUMAN	Q	115	ENSP00000275423:E115Q;ENSP00000380120:E115Q	.	E	+	1	0	RBAK	5069956	0.002000	0.14202	0.006000	0.13384	0.171000	0.22731	0.503000	0.22610	0.427000	0.26145	-0.233000	0.12211	GAG	RBAK	-	NULL	ENSG00000146587		0.363	RBAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBAK	HGNC	protein_coding	OTTHUMT00000241640.2	88	0.00	0	G	NM_021163		5103430	5103430	+1	no_errors	ENST00000353796	ensembl	human	known	69_37n	missense	16	71.93	41	SNP	0.115	C
RFWD3	55159	genome.wustl.edu	37	16	74670451	74670451	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr16:74670451G>C	ENST00000361070.4	-	8	1316	c.1219C>G	c.(1219-1221)Caa>Gaa	p.Q407E	RFWD3_ENST00000571750.1_Missense_Mutation_p.Q407E	NM_018124.3	NP_060594.3	Q6PCD5	RFWD3_HUMAN	ring finger and WD repeat domain 3	407					DNA repair (GO:0006281)|mitotic G1 DNA damage checkpoint (GO:0031571)|protein ubiquitination (GO:0016567)|regulation of DNA damage checkpoint (GO:2000001)|response to ionizing radiation (GO:0010212)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|MDM2/MDM4 family protein binding (GO:0097371)|p53 binding (GO:0002039)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	26						TTCTGACTTTGATGTGACGTA	0.408																																						dbGAP											0													59.0	62.0	61.0					16																	74670451		2198	4300	6498	-	-	-	SO:0001583	missense	0			AK001382	CCDS32486.1	16q22.3	2013-01-09						"""WD repeat domain containing"", ""RING-type (C3HC4) zinc fingers"""	25539	protein-coding gene	gene with protein product		614151				21504906	Standard	XM_005256021		Approved	FLJ10520, RNF201	uc002fda.3	Q6PCD5		ENST00000361070.4:c.1219C>G	16.37:g.74670451G>C	ENSP00000354361:p.Gln407Glu		A8K585|B2RE35|D3DUJ8|Q5XKR3|Q9H9Q3|Q9NVT4	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_WD40_repeat,pfscan_Znf_RING	p.Q407E	ENST00000361070.4	37	c.1219	CCDS32486.1	16	.	.	.	.	.	.	.	.	.	.	G	1.289	-0.608207	0.03717	.	.	ENSG00000168411	ENST00000361070	T	0.18174	2.23	4.82	3.84	0.44239	WD40/YVTN repeat-like-containing domain (1);	0.572824	0.18957	N	0.126513	T	0.15478	0.0373	M	0.62723	1.935	0.09310	N	1	B	0.21905	0.062	B	0.18263	0.021	T	0.29119	-1.0022	10	0.11485	T	0.65	-12.5351	8.0921	0.30807	0.0:0.1278:0.4558:0.4164	.	407	Q6PCD5	RFWD3_HUMAN	E	407	ENSP00000354361:Q407E	ENSP00000354361:Q407E	Q	-	1	0	RFWD3	73227952	0.877000	0.30153	0.006000	0.13384	0.003000	0.03518	1.158000	0.31737	1.321000	0.45227	0.655000	0.94253	CAA	RFWD3	-	NULL	ENSG00000168411		0.408	RFWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFWD3	HGNC	protein_coding	OTTHUMT00000436506.2	62	0.00	0	G	NM_018124		74670451	74670451	-1	no_errors	ENST00000361070	ensembl	human	known	69_37n	missense	29	55.38	36	SNP	0.014	C
WDR74	54663	genome.wustl.edu	37	11	62609220	62609220	+	5'UTR	SNP	A	A	G	rs559598154		TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr11:62609220A>G	ENST00000525239.1	-	0	61				WDR74_ENST00000525752.1_5'Flank|WDR74_ENST00000540620.1_5'Flank|WDR74_ENST00000278856.4_5'Flank|WDR74_ENST00000311713.7_5'Flank|WDR74_ENST00000529106.1_5'Flank|RNU2-2P_ENST00000410396.1_RNA			Q6RFH5	WDR74_HUMAN	WD repeat domain 74						blastocyst formation (GO:0001825)|RNA metabolic process (GO:0016070)	nucleolus (GO:0005730)|nucleus (GO:0005634)				kidney(2)|large_intestine(1)|liver(1)|lung(3)|ovary(1)	8						aggacgtatcagatattaaac	0.448																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0				CCDS44630.1	11q12.3	2013-01-09				ENSG00000133316		"""WD repeat domain containing"""	25529	protein-coding gene	gene with protein product							Standard	NM_018093		Approved	FLJ10439	uc001nvm.2	Q6RFH5		ENST00000525239.1:c.-477T>C	11.37:g.62609220A>G			A8K8G5|Q9BRC9|Q9H6X8|Q9NVY2	RNA	SNP	-	NULL	ENST00000525239.1	37	NULL	CCDS44630.1	11																																																																																			RNU2-2	-	-	ENSG00000222328		0.448	WDR74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNU2-2	HGNC	protein_coding	OTTHUMT00000395678.1	19	0.00	0	A	NM_018093		62609220	62609220	-1	no_errors	ENST00000410396	ensembl	human	known	69_37n	rna	9	40.00	6	SNP	1.000	G
SCN8A	6334	genome.wustl.edu	37	12	52082602	52082602	+	Silent	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr12:52082602G>A	ENST00000354534.6	+	6	853	c.675G>A	c.(673-675)ctG>ctA	p.L225L	SCN8A_ENST00000545061.1_Silent_p.L225L|SCN8A_ENST00000550891.1_Intron	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	225					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	TCAGGGTACTGAGGGCTTTGA	0.433																																						dbGAP											0													204.0	198.0	200.0					12																	52082602		2042	4237	6279	-	-	-	SO:0001819	synonymous_variant	0			AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.675G>A	12.37:g.52082602G>A			B9VWG8|O95788|Q9NYX2|Q9UPB2	Silent	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,prints_Na_channel_a8su,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.L225	ENST00000354534.6	37	c.675	CCDS44891.1	12																																																																																			SCN8A	-	pfam_Ion_trans_dom	ENSG00000196876		0.433	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN8A	HGNC	protein_coding	OTTHUMT00000404372.3	144	0.00	0	G	NM_014191		52082602	52082602	+1	no_errors	ENST00000354534	ensembl	human	known	69_37n	silent	127	35.86	71	SNP	1.000	A
SETD1A	9739	genome.wustl.edu	37	16	30976309	30976309	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr16:30976309G>A	ENST00000262519.8	+	7	1932	c.1246G>A	c.(1246-1248)Gag>Aag	p.E416K		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	416	Pro-rich. {ECO:0000255}.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						CCTGCCCCCCGAGCCCAGCCG	0.692																																						dbGAP											0													37.0	46.0	43.0					16																	30976309		2197	4300	6497	-	-	-	SO:0001583	missense	0			AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.1246G>A	16.37:g.30976309G>A	ENSP00000262519:p.Glu416Lys		A6NP62|Q6PIF3|Q8TAJ6	Missense_Mutation	SNP	pfam_COMPASS_Set1_N-SET,pfam_SET_dom,pfam_RRM_dom,smart_RRM_dom,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_RRM_dom	p.E416K	ENST00000262519.8	37	c.1246	CCDS32435.1	16	.	.	.	.	.	.	.	.	.	.	G	12.08	1.830349	0.32329	.	.	ENSG00000099381	ENST00000262519	D	0.94417	-3.42	5.64	5.64	0.86602	.	0.209300	0.38605	N	0.001633	D	0.88213	0.6376	L	0.36672	1.1	0.23351	N	0.997853	P	0.49635	0.926	B	0.33960	0.173	T	0.81525	-0.0893	10	0.21014	T	0.42	.	12.9051	0.58147	0.0:0.1631:0.8369:0.0	.	416	O15047	SET1A_HUMAN	K	416	ENSP00000262519:E416K	ENSP00000262519:E416K	E	+	1	0	SETD1A	30883810	0.648000	0.27313	0.999000	0.59377	0.547000	0.35210	1.026000	0.30103	2.648000	0.89879	0.561000	0.74099	GAG	SETD1A	-	NULL	ENSG00000099381		0.692	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD1A	HGNC	protein_coding	OTTHUMT00000318244.2	17	0.00	0	G	NM_014712		30976309	30976309	+1	no_errors	ENST00000262519	ensembl	human	known	69_37n	missense	33	23.26	10	SNP	0.822	A
SDR42E1	93517	genome.wustl.edu	37	16	82033756	82033756	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr16:82033756G>T	ENST00000328945.5	-	3	269	c.142C>A	c.(142-144)Cca>Aca	p.P48T	SDR42E1_ENST00000534209.1_5'UTR	NM_145168.2	NP_660151.2	Q8WUS8	D42E1_HUMAN	short chain dehydrogenase/reductase family 42E, member 1	48					steroid biosynthetic process (GO:0006694)	integral component of membrane (GO:0016021)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)			NS(2)|endometrium(1)|lung(4)|skin(3)	10						ATTCCTTCTGGAATGGTTTGA	0.468																																						dbGAP											0													166.0	158.0	161.0					16																	82033756		1935	4143	6078	-	-	-	SO:0001583	missense	0			AF161368	CCDS42205.1	16q23.3	2011-09-14				ENSG00000184860	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	29834	protein-coding gene	gene with protein product						19027726	Standard	NM_145168		Approved	HSPC105	uc002fgu.3	Q8WUS8		ENST00000328945.5:c.142C>A	16.37:g.82033756G>T	ENSP00000332407:p.Pro48Thr		B2RDS1|Q9P0D1	Missense_Mutation	SNP	pfam_3Beta_OHSteriod_DH/Estase,pfam_Epimerase_deHydtase,pfam_dTDP_dehydrorham_reduct,pfam_Male_sterile_NAD-bd,pfam_Polysac_CapD-like	p.P48T	ENST00000328945.5	37	c.142	CCDS42205.1	16	.	.	.	.	.	.	.	.	.	.	G	22.8	4.333389	0.81801	.	.	ENSG00000184860	ENST00000328945;ENST00000532128	D;D	0.88201	-1.75;-2.35	6.03	6.03	0.97812	3-beta hydroxysteroid dehydrogenase/isomerase (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.89294	0.6674	L	0.58354	1.805	0.80722	D	1	P	0.38250	0.624	B	0.40329	0.326	D	0.88573	0.3131	10	0.52906	T	0.07	-16.8899	19.545	0.95291	0.0:0.0:1.0:0.0	.	48	Q8WUS8	D42E1_HUMAN	T	48;45	ENSP00000332407:P48T;ENSP00000434529:P45T	ENSP00000332407:P48T	P	-	1	0	SDR42E1	80591257	1.000000	0.71417	0.974000	0.42286	0.866000	0.49608	9.476000	0.97823	2.861000	0.98227	0.655000	0.94253	CCA	SDR42E1	-	pfam_3Beta_OHSteriod_DH/Estase,pfam_Epimerase_deHydtase,pfam_dTDP_dehydrorham_reduct,pfam_Male_sterile_NAD-bd,pfam_Polysac_CapD-like	ENSG00000184860		0.468	SDR42E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDR42E1	HGNC	protein_coding	OTTHUMT00000388081.2	68	0.00	0	G	NM_145168		82033756	82033756	-1	no_errors	ENST00000328945	ensembl	human	known	69_37n	missense	40	49.37	39	SNP	1.000	T
SIGLEC6	946	genome.wustl.edu	37	19	52032988	52032988	+	Silent	SNP	G	G	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr19:52032988G>T	ENST00000425629.3	-	5	1156	c.1002C>A	c.(1000-1002)ctC>ctA	p.L334L	SIGLEC6_ENST00000359982.4_Silent_p.L345L|SIGLEC6_ENST00000346477.3_Silent_p.L318L|SIGLEC6_ENST00000436458.1_Silent_p.L282L|SIGLEC6_ENST00000391797.3_Silent_p.L323L|SIGLEC6_ENST00000343300.4_Silent_p.L334L|SIGLEC6_ENST00000474054.1_5'Flank	NM_001245.5	NP_001236.4	O43699	SIGL6_HUMAN	sialic acid binding Ig-like lectin 6	334					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)			endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(15)|ovary(1)|stomach(1)	28		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00115)|OV - Ovarian serous cystadenocarcinoma(262;0.0165)		AATGCACAAAGAGACTCAGAG	0.582																																						dbGAP											0													35.0	39.0	37.0					19																	52032988		2155	4276	6431	-	-	-	SO:0001819	synonymous_variant	0			D86358	CCDS12834.3, CCDS12835.3, CCDS12836.3, CCDS54307.1, CCDS54308.1, CCDS59417.1	19q13.3	2013-01-29			ENSG00000105492	ENSG00000105492		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10875	protein-coding gene	gene with protein product		604405		CD33L, CD33L1		9465907	Standard	NM_001245		Approved	OB-BP1, SIGLEC-6, CD327	uc002pwy.3	O43699	OTTHUMG00000133571	ENST00000425629.3:c.1002C>A	19.37:g.52032988G>T			A8MV71|B2RTS8|C9JBE5|F8WA78|O15388|O43700	Silent	SNP	pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L334	ENST00000425629.3	37	c.1002	CCDS12834.3	19																																																																																			SIGLEC6	-	pfam_Ig_I-set,smart_Ig_sub	ENSG00000105492		0.582	SIGLEC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIGLEC6	HGNC	protein_coding	OTTHUMT00000257670.3	73	0.00	0	G	NM_001245		52032988	52032988	-1	no_errors	ENST00000425629	ensembl	human	known	69_37n	silent	63	31.91	30	SNP	0.055	T
SLC2A10	81031	genome.wustl.edu	37	20	45354882	45354882	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr20:45354882C>T	ENST00000359271.2	+	2	1457	c.1207C>T	c.(1207-1209)Cgg>Tgg	p.R403W		NM_030777.3	NP_110404.1	O95528	GTR10_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 10	403					glucose transport (GO:0015758)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sugar:proton symporter activity (GO:0005351)			central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|liver(2)|lung(13)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	34		Myeloproliferative disorder(115;0.0122)				TCTGCCCGCTCGGGGGCATGC	0.627																																						dbGAP											0													40.0	42.0	41.0					20																	45354882		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL137188	CCDS13402.1	20q13.12	2013-05-22			ENSG00000197496	ENSG00000197496		"""Solute carriers"""	13444	protein-coding gene	gene with protein product		606145				11247674	Standard	NM_030777		Approved	GLUT10	uc002xsl.3	O95528	OTTHUMG00000032657	ENST00000359271.2:c.1207C>T	20.37:g.45354882C>T	ENSP00000352216:p.Arg403Trp		A8K4J6|Q3MIX5|Q9H4I6	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,prints_Sugar/inositol_transpt	p.R403W	ENST00000359271.2	37	c.1207	CCDS13402.1	20	.	.	.	.	.	.	.	.	.	.	C	13.13	2.146506	0.37923	.	.	ENSG00000197496	ENST00000359271	D	0.82255	-1.59	5.75	-0.0455	0.13851	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	14.972100	0.00550	N	0.000246	T	0.57989	0.2091	N	0.08118	0	0.09310	N	1	P	0.44521	0.837	B	0.25884	0.064	T	0.62343	-0.6874	10	0.56958	D	0.05	-11.0965	0.2997	0.00271	0.2284:0.292:0.2268:0.2528	.	403	O95528	GTR10_HUMAN	W	403	ENSP00000352216:R403W	ENSP00000352216:R403W	R	+	1	2	SLC2A10	44788289	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.079000	0.14782	0.335000	0.23614	0.655000	0.94253	CGG	SLC2A10	-	superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000197496		0.627	SLC2A10-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	SLC2A10	HGNC	protein_coding	OTTHUMT00000079578.2	32	0.00	0	C			45354882	45354882	+1	no_errors	ENST00000359271	ensembl	human	known	69_37n	missense	19	47.22	17	SNP	0.000	T
SLC5A11	115584	genome.wustl.edu	37	16	24921688	24921688	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr16:24921688C>T	ENST00000347898.3	+	15	2334	c.1712C>T	c.(1711-1713)cCa>cTa	p.P571L	SLC5A11_ENST00000565769.1_Missense_Mutation_p.P507L|SLC5A11_ENST00000424767.2_Missense_Mutation_p.P536L|SLC5A11_ENST00000449109.2_Missense_Mutation_p.P415L|SLC5A11_ENST00000567758.1_Missense_Mutation_p.P536L|SLC5A11_ENST00000545376.1_Missense_Mutation_p.P501L|SLC5A11_ENST00000539472.1_Missense_Mutation_p.P507L|SLC5A11_ENST00000569071.1_Missense_Mutation_p.P415L|SLC5A11_ENST00000568579.1_Missense_Mutation_p.P501L	NM_052944.3	NP_443176.2			solute carrier family 5 (sodium/inositol cotransporter), member 11											endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(30)|ovary(2)|prostate(2)|urinary_tract(1)	49				GBM - Glioblastoma multiforme(48;0.0365)		CAAGCACCACCAGCAGCTCCC	0.547																																						dbGAP											0													154.0	130.0	138.0					16																	24921688		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF292385	CCDS10625.1, CCDS58437.1, CCDS58438.1, CCDS58439.1, CCDS58440.1	16p12.1	2013-07-19	2013-07-19		ENSG00000158865	ENSG00000158865		"""Solute carriers"""	23091	protein-coding gene	gene with protein product		610238	"""solute carrier family 5 (sodium/glucose cotransporter), member 11"""			12039040, 12133831	Standard	NM_001258414		Approved	KST1, SMIT2, SGLT6	uc002dmu.4	Q8WWX8	OTTHUMG00000097003	ENST00000347898.3:c.1712C>T	16.37:g.24921688C>T	ENSP00000289932:p.Pro571Leu			Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.P571L	ENST00000347898.3	37	c.1712	CCDS10625.1	16	.	.	.	.	.	.	.	.	.	.	C	9.031	0.987383	0.18889	.	.	ENSG00000158865	ENST00000347898;ENST00000449109;ENST00000424767;ENST00000545376;ENST00000539472	T;T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01;-0.01	4.33	3.29	0.37713	.	1.200120	0.05807	N	0.613396	T	0.53965	0.1829	L	0.48642	1.525	0.24325	N	0.99503	B;B;B;B	0.20261	0.0;0.0;0.0;0.043	B;B;B;B	0.16722	0.001;0.002;0.001;0.016	T	0.37174	-0.9717	10	0.30078	T	0.28	.	6.3495	0.21367	0.0:0.8619:0.0:0.1381	.	501;536;571;415	B7Z329;Q8WWX8-2;Q8WWX8;Q05BF1	.;.;SC5AB_HUMAN;.	L	571;415;536;501;507	ENSP00000289932:P571L;ENSP00000389606:P415L;ENSP00000416782:P536L;ENSP00000441384:P501L;ENSP00000441018:P507L	ENSP00000289932:P571L	P	+	2	0	SLC5A11	24829189	0.000000	0.05858	0.688000	0.30117	0.082000	0.17680	0.800000	0.27042	2.259000	0.74868	0.514000	0.50259	CCA	SLC5A11	-	NULL	ENSG00000158865		0.547	SLC5A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A11	HGNC	protein_coding	OTTHUMT00000214091.3	36	0.00	0	C	NM_052944		24921688	24921688	+1	no_errors	ENST00000347898	ensembl	human	known	69_37n	missense	81	36.43	47	SNP	0.380	T
SLC6A16	28968	genome.wustl.edu	37	19	49796530	49796530	+	Silent	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr19:49796530G>A	ENST00000335875.4	-	10	1969	c.1728C>T	c.(1726-1728)gtC>gtT	p.V576V	SLC6A16_ENST00000454748.3_Silent_p.V576V	NM_014037.2	NP_054756.2	Q9GZN6	S6A16_HUMAN	solute carrier family 6, member 16	576					neurotransmitter transport (GO:0006836)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00099)|GBM - Glioblastoma multiforme(486;0.0336)		ATACGACAACGACGATGATGG	0.517																																						dbGAP											0													80.0	82.0	81.0					19																	49796530		1985	4167	6152	-	-	-	SO:0001819	synonymous_variant	0			AF265578	CCDS42590.1	19q13.33	2013-05-22			ENSG00000063127	ENSG00000063127		"""Solute carriers"""	13622	protein-coding gene	gene with protein product	"""NTT5 protein"""	607972	"""solute carrier family 6 (neurotransmitter transporter), member 16"""			10471414, 11112352	Standard	XM_005258820		Approved	NTT5	uc002pmz.3	Q9GZN6		ENST00000335875.4:c.1728C>T	19.37:g.49796530G>A			Q8IYV4|Q9Y5I9	Silent	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport	p.V576	ENST00000335875.4	37	c.1728	CCDS42590.1	19																																																																																			SLC6A16	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport	ENSG00000063127		0.517	SLC6A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A16	HGNC	protein_coding	OTTHUMT00000465503.2	36	0.00	0	G	NM_014037		49796530	49796530	-1	no_errors	ENST00000335875	ensembl	human	known	69_37n	silent	50	12.28	7	SNP	0.018	A
SLC9A8	23315	genome.wustl.edu	37	20	48491270	48491270	+	Missense_Mutation	SNP	C	C	G	rs144686154		TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr20:48491270C>G	ENST00000361573.2	+	11	1029	c.987C>G	c.(985-987)atC>atG	p.I329M	SLC9A8_ENST00000541138.1_Missense_Mutation_p.I29M|SLC9A8_ENST00000417961.1_Missense_Mutation_p.I345M|SLC9A8_ENST00000539601.1_Missense_Mutation_p.I110M			Q9Y2E8	SL9A8_HUMAN	solute carrier family 9, subfamily A (NHE8, cation proton antiporter 8), member 8	329					ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	potassium:proton antiporter activity (GO:0015386)|sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	30			BRCA - Breast invasive adenocarcinoma(9;3.91e-07)			TCTCAGGCATCGTGATGTCCC	0.542																																						dbGAP											0													277.0	190.0	220.0					20																	48491270		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023156	CCDS13421.1, CCDS58774.1	20q13.13	2013-05-22	2012-03-22		ENSG00000197818	ENSG00000197818		"""Solute carriers"""	20728	protein-coding gene	gene with protein product		612730	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 8"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 8"""			12409279	Standard	NM_001260491		Approved	KIAA0939, NHE8	uc002xuv.2	Q9Y2E8	OTTHUMG00000032710	ENST00000361573.2:c.987C>G	20.37:g.48491270C>G	ENSP00000354966:p.Ile329Met		B4DTQ8|Q2M1U9|Q68CZ8|Q9BX15|Q9Y507	Missense_Mutation	SNP	pfam_Cation/H_exchanger,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.I345M	ENST00000361573.2	37	c.1035	CCDS13421.1	20	.	.	.	.	.	.	.	.	.	.	C	16.20	3.056648	0.55325	.	.	ENSG00000197818	ENST00000417961;ENST00000361573;ENST00000541138;ENST00000539601	T;T;T;T	0.16073	2.37;2.37;2.37;2.37	5.79	-1.41	0.08941	Cation/H+ exchanger (1);	0.102011	0.64402	D	0.000003	T	0.35595	0.0937	M	0.76433	2.335	0.58432	D	0.999999	D;D	0.76494	0.999;0.965	D;D	0.75020	0.985;0.931	T	0.07290	-1.0780	10	0.48119	T	0.1	.	12.1455	0.54022	0.0:0.4848:0.0:0.5152	.	110;329	B4DIX7;Q9Y2E8	.;SL9A8_HUMAN	M	345;329;29;110	ENSP00000416418:I345M;ENSP00000354966:I329M;ENSP00000441615:I29M;ENSP00000441716:I110M	ENSP00000354966:I329M	I	+	3	3	SLC9A8	47924677	0.001000	0.12720	0.986000	0.45419	0.918000	0.54935	-1.576000	0.02129	-0.316000	0.08690	-0.797000	0.03246	ATC	SLC9A8	-	pfam_Cation/H_exchanger,tigrfam_NaH_exchanger	ENSG00000197818		0.542	SLC9A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A8	HGNC	protein_coding	OTTHUMT00000106483.3	78	0.00	0	C	XM_030524		48491270	48491270	+1	no_errors	ENST00000417961	ensembl	human	known	69_37n	missense	96	36.00	54	SNP	0.911	G
SLCO1B3	28234	genome.wustl.edu	37	12	21033899	21033899	+	Missense_Mutation	SNP	A	A	T	rs562512647		TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr12:21033899A>T	ENST00000381545.3	+	12	1661	c.1442A>T	c.(1441-1443)tAc>tTc	p.Y481F	SLCO1B7_ENST00000554957.1_Intron|SLCO1B3_ENST00000261196.2_Missense_Mutation_p.Y481F|LST3_ENST00000540229.1_Missense_Mutation_p.Y481F|LST3_ENST00000381541.3_Intron|SLCO1B3_ENST00000553473.1_Missense_Mutation_p.Y481F	NM_019844.3	NP_062818.1	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family, member 1B3	481	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(23)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(2)	63	Esophageal squamous(101;0.149)				Atorvastatin(DB01076)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Digoxin(DB00390)|Docetaxel(DB01248)|Estradiol(DB00783)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Olmesartan(DB00275)|Ouabain(DB01092)|Paclitaxel(DB01229)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Rosuvastatin(DB01098)|Valsartan(DB00177)	GGAATAACTTACCTGTCACCT	0.393																																						dbGAP											0													196.0	192.0	193.0					12																	21033899		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8684.1	12p12	2013-05-22	2003-11-25	2003-11-26		ENSG00000111700		"""Solute carriers"""	10961	protein-coding gene	gene with protein product		605495	"""solute carrier family 21 (organic anion transporter), member 8"""	SLC21A8			Standard	NM_019844		Approved	OATP8, OATP1B3	uc001rel.4	Q9NPD5	OTTHUMG00000169011	ENST00000381545.3:c.1442A>T	12.37:g.21033899A>T	ENSP00000370956:p.Tyr481Phe		E7EMT8|Q5JAR4	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal-type_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.Y481F	ENST00000381545.3	37	c.1442	CCDS8684.1	12	.	.	.	.	.	.	.	.	.	.	.	12.73	2.026900	0.35797	.	.	ENSG00000111700;ENSG00000111700;ENSG00000111700;ENSG00000111700;ENSG00000257046	ENST00000261196;ENST00000381545;ENST00000553473;ENST00000544370;ENST00000540229	T;T;T;T;T	0.16196	2.36;2.36;2.36;2.36;2.36	3.8	3.8	0.43715	Proteinase inhibitor I1, Kazal (1);Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);Protease inhibitor, Kazal-type (1);	0.000000	0.85682	D	0.000000	T	0.42200	0.1192	M	0.82923	2.615	0.80722	D	1	D;D;D	0.89917	1.0;0.994;0.994	D;D;D	0.87578	0.998;0.967;0.967	T	0.43766	-0.9371	10	0.87932	D	0	.	10.4274	0.44387	1.0:0.0:0.0:0.0	.	481;481;481	Q5JAR4;B3KP78;Q9NPD5	.;.;SO1B3_HUMAN	F	481;481;481;305;481	ENSP00000261196:Y481F;ENSP00000370956:Y481F;ENSP00000451758:Y481F;ENSP00000443225:Y305F;ENSP00000441269:Y481F	ENSP00000441269:Y481F	Y	+	2	0	SLCO1B3;RP11-545J16.1	20925166	1.000000	0.71417	0.113000	0.21522	0.029000	0.11900	7.089000	0.76909	1.717000	0.51406	0.383000	0.25322	TAC	SLCO1B3	-	pfam_OA_transporter,pfam_Kazal-type_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000111700		0.393	SLCO1B3-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	SLCO1B3	HGNC	protein_coding	OTTHUMT00000401936.1	83	0.00	0	A	NM_019844		21033899	21033899	+1	no_errors	ENST00000553473	ensembl	human	known	69_37n	missense	81	32.52	40	SNP	0.872	T
SLITRK3	22865	genome.wustl.edu	37	3	164908085	164908085	+	Silent	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr3:164908085C>T	ENST00000475390.1	-	2	977	c.534G>A	c.(532-534)ctG>ctA	p.L178L	SLITRK3_ENST00000241274.3_Silent_p.L178L			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	178					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						CATTTAAAATCAGAACCCTCA	0.383										HNSCC(40;0.11)																												dbGAP											0													71.0	71.0	71.0					3																	164908085		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.534G>A	3.37:g.164908085C>T			Q1RMY6	Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.L178	ENST00000475390.1	37	c.534	CCDS3197.1	3																																																																																			SLITRK3	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000121871		0.383	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLITRK3	HGNC	protein_coding	OTTHUMT00000350126.1	52	0.00	0	C	NM_014926		164908085	164908085	-1	no_errors	ENST00000241274	ensembl	human	known	69_37n	silent	52	29.73	22	SNP	0.949	T
SMC1B	27127	genome.wustl.edu	37	22	45785753	45785753	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr22:45785753G>T	ENST00000357450.4	-	10	1569	c.1570C>A	c.(1570-1572)Cat>Aat	p.H524N	SMC1B_ENST00000404354.3_Missense_Mutation_p.H524N	NM_148674.3	NP_683515.3	Q8NDV3	SMC1B_HUMAN	structural maintenance of chromosomes 1B	524	Flexible hinge.				meiotic nuclear division (GO:0007126)|sister chromatid cohesion (GO:0007062)	chromosome, centromeric region (GO:0000775)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		TGAATAGGATGACACAGGTCA	0.338																																						dbGAP											0													102.0	95.0	97.0					22																	45785753		1823	4090	5913	-	-	-	SO:0001583	missense	0			AJ504806	CCDS43027.1, CCDS74876.1	22q13	2006-07-06	2006-07-06	2006-07-06	ENSG00000077935	ENSG00000077935		"""Structural maintenance of chromosomes proteins"""	11112	protein-coding gene	gene with protein product		608685	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 2 (yeast)"""	SMC1L2		10591208, 11564881	Standard	XM_005261566		Approved	bK268H5	uc003bgc.3	Q8NDV3	OTTHUMG00000151334	ENST00000357450.4:c.1570C>A	22.37:g.45785753G>T	ENSP00000350036:p.His524Asn		A0AV46|B0QY23|B0QY24|Q5TIC3|Q6ZUF9|Q9Y3G5	Missense_Mutation	SNP	pfam_RecF/RecN/SMC,pfam_SMC_hinge,superfamily_SMC_hinge,superfamily_t-SNARE,smart_SMC_hinge	p.H524N	ENST00000357450.4	37	c.1570	CCDS43027.1	22	.	.	.	.	.	.	.	.	.	.	G	27.3	4.823343	0.90873	.	.	ENSG00000077935	ENST00000357450;ENST00000404354	D;D	0.85171	-1.95;-1.95	5.39	5.39	0.77823	SMCs flexible hinge (3);RecF/RecN/SMC (1);	0.000000	0.64402	D	0.000017	D	0.83746	0.5321	L	0.40543	1.245	0.80722	D	1	P;P;P	0.41784	0.462;0.762;0.762	B;P;P	0.46076	0.27;0.503;0.503	T	0.80176	-0.1491	10	0.18276	T	0.48	.	19.1598	0.93526	0.0:0.0:1.0:0.0	.	524;524;524	Q8NDV3;Q8NDV3-2;Q8NDV3-3	SMC1B_HUMAN;.;.	N	524	ENSP00000350036:H524N;ENSP00000385902:H524N	ENSP00000350036:H524N	H	-	1	0	SMC1B	44164417	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.532000	0.73825	2.530000	0.85305	0.655000	0.94253	CAT	SMC1B	-	pfam_RecF/RecN/SMC,pfam_SMC_hinge,superfamily_SMC_hinge,smart_SMC_hinge	ENSG00000077935		0.338	SMC1B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC1B	HGNC	protein_coding	OTTHUMT00000322256.2	53	0.00	0	G	NM_148674		45785753	45785753	-1	no_errors	ENST00000357450	ensembl	human	known	69_37n	missense	42	43.24	32	SNP	1.000	T
SOAT1	6646	genome.wustl.edu	37	1	179310328	179310328	+	Silent	SNP	C	C	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr1:179310328C>A	ENST00000367619.3	+	7	806	c.663C>A	c.(661-663)ctC>ctA	p.L221L	SOAT1_ENST00000539888.1_Silent_p.L156L|SOAT1_ENST00000535686.1_5'UTR|SOAT1_ENST00000540564.1_Silent_p.L163L	NM_003101.5	NP_003092.4	P35610	SOAT1_HUMAN	sterol O-acyltransferase 1	221					cholesterol efflux (GO:0033344)|cholesterol esterification (GO:0034435)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol storage (GO:0010878)|macrophage derived foam cell differentiation (GO:0010742)|positive regulation of amyloid precursor protein biosynthetic process (GO:0042986)|very-low-density lipoprotein particle assembly (GO:0034379)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	cholesterol binding (GO:0015485)|cholesterol O-acyltransferase activity (GO:0034736)|fatty-acyl-CoA binding (GO:0000062)|sterol O-acyltransferase activity (GO:0004772)			central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(10)|prostate(1)|skin(3)|stomach(1)	20					Ezetimibe(DB00973)|Hesperetin(DB01094)	TCCGTTCTCTCTTCCATGGCT	0.443																																						dbGAP											0													228.0	212.0	217.0					1																	179310328		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L21934	CCDS1330.1, CCDS58047.1, CCDS58048.1	1q25	2008-08-26	2008-08-26		ENSG00000057252	ENSG00000057252	2.3.1.26		11177	protein-coding gene	gene with protein product	"""acyl-Coenzyme A: cholesterol acyltransferase"""	102642	"""sterol O-acyltransferase (acyl-Coenzyme A: cholesterol acyltransferase) 1"""	SOAT, STAT		8407899	Standard	NM_003101		Approved	ACAT	uc001gml.3	P35610	OTTHUMG00000035253	ENST00000367619.3:c.663C>A	1.37:g.179310328C>A			A6NC40|A8K3P4|A9Z1V7|B4DU95|Q5T0X4|Q8N1E4	Silent	SNP	pfam_MBOAT_fam	p.L221	ENST00000367619.3	37	c.663	CCDS1330.1	1																																																																																			SOAT1	-	pfam_MBOAT_fam	ENSG00000057252		0.443	SOAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOAT1	HGNC	protein_coding	OTTHUMT00000085286.2	102	0.00	0	C	NM_003101		179310328	179310328	+1	no_errors	ENST00000367619	ensembl	human	known	69_37n	silent	148	31.80	69	SNP	0.000	A
SSX6	280657	genome.wustl.edu	37	X	47976517	47976517	+	RNA	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chrX:47976517C>T	ENST00000509958.1	+	0	52							Q7RTT6	SSX6_HUMAN	synovial sarcoma, X breakpoint 6 (pseudogene)						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			large_intestine(6)|lung(4)|skin(2)|stomach(1)	13						TGAGAAGATTCACGAGAGATC	0.537																																						dbGAP											0													108.0	103.0	105.0					X																	47976517		2195	4290	6485	-	-	-			0			BK000686		Xp11.23	2009-09-11	2009-08-26		ENSG00000171483	ENSG00000171483			19652	pseudogene	pseudogene		300541	"""SSX family pseudogene 2"", ""synovial sarcoma, X breakpoint 6"""	SSXP2		12216073	Standard	NR_028366		Approved	psiSSX2	uc011mlv.2	Q7RTT6	OTTHUMG00000021464		X.37:g.47976517C>T				Missense_Mutation	SNP	pfam_SSXRD_motif,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.H152Y	ENST00000509958.1	37	c.454		X	.	.	.	.	.	.	.	.	.	.	.	6.896	0.534774	0.13188	.	.	ENSG00000171483	ENST00000376932;ENST00000319275	T;T	0.45276	3.07;0.9	2.19	-2.43	0.06522	.	1.876730	0.03066	N	0.156480	T	0.30510	0.0767	.	.	.	0.09310	N	1	B	0.17465	0.022	B	0.23275	0.045	T	0.12477	-1.0546	9	0.40728	T	0.16	.	4.7356	0.12986	0.5859:0.1809:0.2332:0.0	.	152	Q7RTT6	SSX6_HUMAN	Y	152;54	ENSP00000366131:H152Y;ENSP00000325176:H54Y	ENSP00000325176:H54Y	H	+	1	0	SSX6	47861461	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.261000	0.01176	-1.491000	0.01840	-1.575000	0.00869	CAC	SSX6	-	NULL	ENSG00000171483		0.537	SSX6-003	KNOWN	basic	processed_transcript	SSX6	HGNC	pseudogene	OTTHUMT00000362117.1	134	0.00	0	C	NR_028366		47976517	47976517	+1	no_errors	ENST00000376932	ensembl	human	known	69_37n	missense	70	38.60	44	SNP	0.000	T
STAC	6769	genome.wustl.edu	37	3	36484978	36484978	+	Silent	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr3:36484978G>A	ENST00000273183.3	+	2	534	c.234G>A	c.(232-234)gaG>gaA	p.E78E	STAC_ENST00000476388.1_3'UTR|STAC_ENST00000457375.2_Silent_p.E78E	NM_003149.1	NP_003140.1	Q99469	STAC_HUMAN	SH3 and cysteine rich domain	78					cellular response to heat (GO:0034605)|intracellular signal transduction (GO:0035556)|signal transduction (GO:0007165)	cytosol (GO:0005829)	metal ion binding (GO:0046872)			endometrium(5)|large_intestine(9)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(5)	32						TGGTGGCTGAGATCAGCCCCA	0.557																																						dbGAP											0													103.0	86.0	92.0					3																	36484978		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D86640	CCDS2662.1	3p22.3	2007-06-08			ENSG00000144681	ENSG00000144681			11353	protein-coding gene	gene with protein product		602317	"""src homology three (SH3) and cysteine rich domain"""			8954993, 10393425	Standard	XM_006713308		Approved	STAC1	uc003cgh.1	Q99469	OTTHUMG00000130798	ENST00000273183.3:c.234G>A	3.37:g.36484978G>A			B2R8S8	Silent	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_SH3_domain,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_SH3_domain,prints_Spectrin_alpha_SH3,prints_SH3_domain,pfscan_SH3_domain,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.E78	ENST00000273183.3	37	c.234	CCDS2662.1	3																																																																																			STAC	-	NULL	ENSG00000144681		0.557	STAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAC	HGNC	protein_coding	OTTHUMT00000253338.2	37	0.00	0	G	NM_003149		36484978	36484978	+1	no_errors	ENST00000273183	ensembl	human	known	69_37n	silent	25	37.50	15	SNP	0.008	A
STAU1	6780	genome.wustl.edu	37	20	47768247	47768247	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr20:47768247G>C	ENST00000371856.2	-	5	792	c.382C>G	c.(382-384)Caa>Gaa	p.Q128E	STAU1_ENST00000371792.1_Missense_Mutation_p.Q47E|STAU1_ENST00000371802.1_Missense_Mutation_p.Q47E|STAU1_ENST00000371828.3_Missense_Mutation_p.Q47E|STAU1_ENST00000347458.5_Missense_Mutation_p.Q47E|STAU1_ENST00000360426.4_Missense_Mutation_p.Q47E|STAU1_ENST00000340954.7_Missense_Mutation_p.Q47E	NM_017453.2	NP_059347.2	O95793	STAU1_HUMAN	staufen double-stranded RNA binding protein 1	128	DRBM 1. {ECO:0000255|PROSITE- ProRule:PRU00266}.				intracellular mRNA localization (GO:0008298)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|rough endoplasmic reticulum (GO:0005791)	double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|liver(1)|lung(6)|ovary(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	23			BRCA - Breast invasive adenocarcinoma(12;0.000644)|Colorectal(8;0.198)			AGTTCCACTTGATAAAGTAAA	0.428																																						dbGAP											0													99.0	90.0	93.0					20																	47768247		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13414.1, CCDS13415.1, CCDS33481.1	20q13.1	2014-06-13	2013-06-05	2005-11-04	ENSG00000124214	ENSG00000124214			11370	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 150"""	601716	"""staufen (Drosophila, RNA-binding protein)"", ""staufen, RNA binding protein (Drosophila)"", ""staufen, RNA binding protein, homolog 1 (Drosophila)"""	STAU		8884277, 15680326	Standard	XM_005260524		Approved	PPP1R150	uc002xud.3	O95793	OTTHUMG00000032691	ENST00000371856.2:c.382C>G	20.37:g.47768247G>C	ENSP00000360922:p.Gln128Glu		A8K9Z4|E1P5Y1|E1P608|Q5JW29|Q6GTM4|Q9H5B4|Q9H5B5|Q9Y3Q2	Missense_Mutation	SNP	pfam_Ds-RNA-bd,smart_Ds-RNA-bd,pfscan_Ds-RNA-bd	p.Q128E	ENST00000371856.2	37	c.382	CCDS13414.1	20	.	.	.	.	.	.	.	.	.	.	G	18.69	3.678436	0.68042	.	.	ENSG00000124214	ENST00000371828;ENST00000340954;ENST00000371856;ENST00000360426;ENST00000347458;ENST00000371805;ENST00000371802;ENST00000371792;ENST00000437404;ENST00000456866	T;T;T;T;T;T;T;T;T	0.76186	-1.0;-1.0;-1.0;-1.0;-1.0;-1.0;-1.0;-1.0;-1.0	5.63	5.63	0.86233	Double-stranded RNA-binding (3);Double-stranded RNA-binding-like (1);	0.051189	0.85682	D	0.000000	T	0.72843	0.3511	L	0.44542	1.39	0.80722	D	1	B;B	0.29085	0.232;0.232	B;B	0.34991	0.193;0.145	T	0.69383	-0.5160	10	0.42905	T	0.14	-9.4555	19.7096	0.96089	0.0:0.0:1.0:0.0	.	128;47	O95793;Q5JW29	STAU1_HUMAN;.	E	47;47;128;47;47;47;47;47;47;87	ENSP00000360893:Q47E;ENSP00000345425:Q47E;ENSP00000360922:Q128E;ENSP00000353604:Q47E;ENSP00000323443:Q47E;ENSP00000360867:Q47E;ENSP00000360857:Q47E;ENSP00000416779:Q47E;ENSP00000398785:Q87E	ENSP00000345425:Q47E	Q	-	1	0	STAU1	47201654	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.476000	0.97823	2.652000	0.90054	0.655000	0.94253	CAA	STAU1	-	pfam_Ds-RNA-bd,smart_Ds-RNA-bd,pfscan_Ds-RNA-bd	ENSG00000124214		0.428	STAU1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STAU1	HGNC	protein_coding	OTTHUMT00000079633.1	110	0.00	0	G	NM_017453		47768247	47768247	-1	no_errors	ENST00000371856	ensembl	human	known	69_37n	missense	105	36.36	60	SNP	1.000	C
SUMO1	7341	genome.wustl.edu	37	2	203079096	203079096	+	Nonsense_Mutation	SNP	G	G	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr2:203079096G>T	ENST00000392246.2	-	3	305	c.149C>A	c.(148-150)tCa>tAa	p.S50*	SUMO1_ENST00000409712.1_Nonsense_Mutation_p.S50*|SUMO1_ENST00000409498.2_Nonsense_Mutation_p.S11*|SUMO1_ENST00000392245.1_Nonsense_Mutation_p.S50*|SUMO1_ENST00000469034.1_5'UTR|SUMO1_ENST00000392244.3_Nonsense_Mutation_p.S25*|SUMO1_ENST00000409181.1_Nonsense_Mutation_p.S50*|SUMO1_ENST00000409205.1_Nonsense_Mutation_p.S11*|SUMO1_ENST00000409368.1_Nonsense_Mutation_p.S50*	NM_003352.4	NP_003343.1	P63165	SUMO1_HUMAN	small ubiquitin-like modifier 1	50	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|DNA repair (GO:0006281)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of DNA binding (GO:0043392)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|PML body organization (GO:0030578)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein complex assembly (GO:0031334)|post-translational protein modification (GO:0043687)|protein localization to nuclear pore (GO:0090204)|protein sumoylation (GO:0016925)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of protein localization (GO:0032880)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|synapse (GO:0045202)	poly(A) RNA binding (GO:0044822)|SUMO ligase activity (GO:0019789)|ubiquitin protein ligase binding (GO:0031625)										TTGACAGTATGATTCTTTGAG	0.303																																						dbGAP											0													105.0	92.0	96.0					2																	203079096		2202	4298	6500	-	-	-	SO:0001587	stop_gained	0			U38784	CCDS2352.1, CCDS46493.1	2q33	2013-06-05	2013-06-05	2004-05-19	ENSG00000116030	ENSG00000116030			12502	protein-coding gene	gene with protein product		601912	"""ubiquitin-like 1 (sentrin)"", ""SMT3 suppressor of mif two 3 homolog 1 (yeast)"", ""SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae)"""	UBL1		8812453, 8906799	Standard	NM_003352		Approved	PIC1, GMP1, SMT3C, SUMO-1, SMT3H3, OFC10	uc002uyz.1	P63165	OTTHUMG00000132839	ENST00000392246.2:c.149C>A	2.37:g.203079096G>T	ENSP00000376077:p.Ser50*		A8MUS8|B2R4I5|P55856|Q6FGG0|Q6NZ62|Q93068	Nonsense_Mutation	SNP	pfam_SUMO,pfam_Ubiquitin,smart_Ubiquitin,pfscan_Ubiquitin_supergroup	p.S50*	ENST00000392246.2	37	c.149	CCDS2352.1	2	.	.	.	.	.	.	.	.	.	.	G	37	6.000925	0.97189	.	.	ENSG00000116030	ENST00000392246;ENST00000392245;ENST00000409368;ENST00000392244;ENST00000409712;ENST00000409181;ENST00000409498;ENST00000409205	.	.	.	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	-22.8955	19.4171	0.94706	0.0:0.0:1.0:0.0	.	.	.	.	X	50;50;50;25;50;50;11;11	.	ENSP00000376075:S25X	S	-	2	0	SUMO1	202787341	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.366000	0.97143	2.594000	0.87642	0.467000	0.42956	TCA	SUMO1	-	pfam_SUMO,pfam_Ubiquitin,smart_Ubiquitin,pfscan_Ubiquitin_supergroup	ENSG00000116030		0.303	SUMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUMO1	HGNC	protein_coding	OTTHUMT00000256312.2	176	0.00	0	G	NM_003352		203079096	203079096	-1	no_errors	ENST00000392245	ensembl	human	known	69_37n	nonsense	140	26.70	51	SNP	1.000	T
SUPT6H	6830	genome.wustl.edu	37	17	27000441	27000441	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr17:27000441G>A	ENST00000314616.6	+	2	305	c.22G>A	c.(22-24)Gag>Aag	p.E8K	SUPT6H_ENST00000347486.4_Missense_Mutation_p.E8K|AC010761.13_ENST00000578819.1_RNA	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	8	Asp/Glu-rich.|Interaction with IWS1. {ECO:0000250}.|Interaction with PAAF1.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					TGTGGAAAGCGAGGCTGAGGA	0.468																																						dbGAP											0													82.0	77.0	79.0					17																	27000441		2203	4300	6503	-	-	-	SO:0001583	missense	0			U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.22G>A	17.37:g.27000441G>A	ENSP00000319104:p.Glu8Lys		A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	pfam_Rbsml_prot_S1_RNA-bd_dom,pfam_SH2,superfamily_NA-bd_OB-fold-like,smart_YqgF/RNaseH-like_dom,smart_RNA-binding_domain_S1,smart_SH2,pirsf_TF_Spt6,pfscan_SH2,pfscan_Rbsml_prot_S1_RNA-bd_dom	p.E8K	ENST00000314616.6	37	c.22	CCDS32596.1	17	.	.	.	.	.	.	.	.	.	.	G	17.01	3.279073	0.59758	.	.	ENSG00000109111	ENST00000314616;ENST00000347486	.	.	.	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.63896	0.2550	N	0.19112	0.55	0.80722	D	1	D	0.63046	0.992	P	0.62649	0.905	T	0.65010	-0.6272	9	0.51188	T	0.08	-25.3078	20.3409	0.98764	0.0:0.0:1.0:0.0	.	8	Q7KZ85	SPT6H_HUMAN	K	8	.	ENSP00000319104:E8K	E	+	1	0	SUPT6H	24024568	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.354000	0.97083	2.814000	0.96858	0.655000	0.94253	GAG	SUPT6H	-	pirsf_TF_Spt6	ENSG00000109111		0.468	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SUPT6H	HGNC	protein_coding	OTTHUMT00000446422.2	74	0.00	0	G	NM_003170		27000441	27000441	+1	no_errors	ENST00000314616	ensembl	human	known	69_37n	missense	83	31.40	38	SNP	1.000	A
SYNE1	23345	genome.wustl.edu	37	6	152847287	152847287	+	Silent	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr6:152847287G>A	ENST00000367255.5	-	5	754	c.153C>T	c.(151-153)gaC>gaT	p.D51D	SYNE1_ENST00000466159.2_Silent_p.D51D|SYNE1_ENST00000413186.2_Silent_p.D51D|SYNE1_ENST00000341594.5_Silent_p.D51D|SYNE1_ENST00000367248.3_Silent_p.D51D|SYNE1_ENST00000265368.4_Silent_p.D51D|SYNE1_ENST00000367253.4_Silent_p.D51D|SYNE1_ENST00000448038.1_Silent_p.D51D|SYNE1_ENST00000423061.1_Silent_p.D51D	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	51	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CAAAAAGATCGTCCACCACCA	0.418										HNSCC(10;0.0054)																												dbGAP											0													104.0	93.0	97.0					6																	152847287		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.153C>T	6.37:g.152847287G>A			E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.D51	ENST00000367255.5	37	c.153	CCDS5236.2	6																																																																																			SYNE1	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000131018		0.418	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	47	0.00	0	G	NM_182961		152847287	152847287	-1	no_errors	ENST00000265368	ensembl	human	known	69_37n	silent	38	29.63	16	SNP	0.987	A
TAF1L	138474	genome.wustl.edu	37	9	32631492	32631492	+	Silent	SNP	G	G	C			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr9:32631492G>C	ENST00000242310.4	-	1	4175	c.4086C>G	c.(4084-4086)ctC>ctG	p.L1362L	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	1362					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TAGGAAACTTGAGAACCAGAG	0.413																																						dbGAP											0													209.0	208.0	209.0					9																	32631492		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.4086C>G	9.37:g.32631492G>C			Q0VG57	Silent	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.L1362	ENST00000242310.4	37	c.4086	CCDS35003.1	9																																																																																			TAF1L	-	pirsf_TAF1_animal	ENSG00000122728		0.413	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1L	HGNC	protein_coding	OTTHUMT00000052012.2	131	0.00	0	G			32631492	32631492	-1	no_errors	ENST00000242310	ensembl	human	known	69_37n	silent	55	52.17	60	SNP	1.000	C
TBC1D10B	26000	genome.wustl.edu	37	16	30369766	30369766	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr16:30369766G>C	ENST00000409939.3	-	9	2006	c.1926C>G	c.(1924-1926)atC>atG	p.I642M	RP11-347C12.10_ENST00000563252.1_lincRNA	NM_015527.3	NP_056342.3	Q4KMP7	TB10B_HUMAN	TBC1 domain family, member 10B	642					positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab GTPase activity (GO:0032313)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)			endometrium(2)|kidney(1)|lung(2)|urinary_tract(1)	6			Colorectal(24;0.193)			GCTCCTCGTGGATGGCCCGGG	0.701																																						dbGAP											0													12.0	13.0	13.0					16																	30369766		2189	4288	6477	-	-	-	SO:0001583	missense	0			BC063112	CCDS10676.2	16p11.2	2013-07-09			ENSG00000169221	ENSG00000169221			24510	protein-coding gene	gene with protein product		613620				20404108	Standard	NM_015527		Approved	DKFZP434P1750, Rab27A-GAPbeta, FLJ13130, EPI64B	uc002dxt.3	Q4KMP7	OTTHUMG00000132396	ENST00000409939.3:c.1926C>G	16.37:g.30369766G>C	ENSP00000386538:p.Ile642Met		B9A6L0|Q6IN54|Q6P530|Q71RG7|Q86VC5|Q9H8Z2|Q9NUN6|Q9UFP2	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.I642M	ENST00000409939.3	37	c.1926	CCDS10676.2	16	.	.	.	.	.	.	.	.	.	.	G	15.67	2.901958	0.52227	.	.	ENSG00000169221	ENST00000409939	D	0.97232	-4.3	4.48	2.51	0.30379	.	0.065717	0.64402	D	0.000020	D	0.97297	0.9116	M	0.66939	2.045	0.40330	D	0.97891	D	0.65815	0.995	D	0.66847	0.947	D	0.96422	0.9312	10	0.87932	D	0	.	7.4569	0.27272	0.2764:0.0:0.7236:0.0	.	642	Q4KMP7	TB10B_HUMAN	M	642	ENSP00000386538:I642M	ENSP00000386538:I642M	I	-	3	3	TBC1D10B	30277267	1.000000	0.71417	0.999000	0.59377	0.936000	0.57629	1.766000	0.38491	0.627000	0.30340	-0.339000	0.08088	ATC	TBC1D10B	-	NULL	ENSG00000169221		0.701	TBC1D10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D10B	HGNC	protein_coding	OTTHUMT00000255527.3	18	0.00	0	G	NM_015527		30369766	30369766	-1	no_errors	ENST00000409939	ensembl	human	known	69_37n	missense	22	40.54	15	SNP	1.000	C
TDRD1	56165	genome.wustl.edu	37	10	115986858	115986858	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr10:115986858C>G	ENST00000251864.2	+	23	3356	c.3203C>G	c.(3202-3204)tCt>tGt	p.S1068C	TDRD1_ENST00000422662.1_Intron|TDRD1_ENST00000369280.1_Intron|TDRD1_ENST00000369281.2_Missense_Mutation_p.S954C|TDRD1_ENST00000369282.1_Intron	NM_198795.1	NP_942090.1	Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	1068					DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ cell development (GO:0007281)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)	metal ion binding (GO:0046872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(5)	48		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		GGAAGCTCTTCTCAATTAATA	0.269																																						dbGAP											0													21.0	22.0	22.0					10																	115986858		2200	4296	6496	-	-	-	SO:0001583	missense	0			AF285606	CCDS7588.1	10q26.11	2013-01-23			ENSG00000095627	ENSG00000095627		"""Tudor domain containing"""	11712	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.1"""	605796				11279525	Standard	NM_198795		Approved	CT41.1	uc001lbg.1	Q9BXT4	OTTHUMG00000019083	ENST00000251864.2:c.3203C>G	10.37:g.115986858C>G	ENSP00000251864:p.Ser1068Cys		A6NEN3|A6NMN2|B3KVI4|B4E2L5|D3DRC2|Q4G0Y8|Q6P518|Q9H7B3	Missense_Mutation	SNP	pfam_Tudor,pfam_Znf_MYND,smart_Tudor,pfscan_Tudor,pfscan_Znf_MYND	p.S1068C	ENST00000251864.2	37	c.3203	CCDS7588.1	10	.	.	.	.	.	.	.	.	.	.	C	20.6	4.023363	0.75390	.	.	ENSG00000095627	ENST00000251864;ENST00000369281	T;T	0.20881	2.87;2.04	6.07	6.07	0.98685	.	0.000000	0.64402	D	0.000005	T	0.47414	0.1444	M	0.66939	2.045	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.996;0.996;0.998;0.999	T	0.29610	-1.0006	10	0.66056	D	0.02	-19.5819	17.7998	0.88583	0.0:1.0:0.0:0.0	.	1068;954;1068;954	Q9BXT4;B7WPM2;Q9BXT4-3;Q9BXT4-2	TDRD1_HUMAN;.;.;.	C	1068;954	ENSP00000251864:S1068C;ENSP00000358287:S954C	ENSP00000251864:S1068C	S	+	2	0	TDRD1	115976848	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	4.506000	0.60428	2.890000	0.99128	0.650000	0.86243	TCT	TDRD1	-	NULL	ENSG00000095627		0.269	TDRD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TDRD1	HGNC	protein_coding		30	0.00	0	C			115986858	115986858	+1	no_errors	ENST00000251864	ensembl	human	known	69_37n	missense	28	31.71	13	SNP	1.000	G
THSD7B	80731	genome.wustl.edu	37	2	137852504	137852504	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr2:137852504G>A	ENST00000409968.1	+	4	1190	c.1012G>A	c.(1012-1014)Gaa>Aaa	p.E338K	THSD7B_ENST00000543459.1_Missense_Mutation_p.E197K|THSD7B_ENST00000413152.2_Missense_Mutation_p.E307K|THSD7B_ENST00000272643.3_Missense_Mutation_p.E338K			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	338	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		CAAAGACTGTGAAACCTCCCA	0.498																																						dbGAP											0													112.0	116.0	115.0					2																	137852504		1890	4106	5996	-	-	-	SO:0001583	missense	0					2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.1012G>A	2.37:g.137852504G>A	ENSP00000387145:p.Glu338Lys			Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.E338K	ENST00000409968.1	37	c.1012		2	.	.	.	.	.	.	.	.	.	.	G	25.1	4.599025	0.87055	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152;ENST00000543459	T;T;T;T	0.18174	2.23;2.23;2.23;2.23	5.42	5.42	0.78866	.	0.049462	0.85682	D	0.000000	T	0.28466	0.0704	L	0.54908	1.71	0.58432	D	0.999993	P;D	0.55172	0.949;0.97	P;P	0.55161	0.692;0.77	T	0.02991	-1.1085	10	0.06625	T	0.88	.	18.802	0.92022	0.0:0.0:1.0:0.0	.	338;307	Q9C0I4;C9JKN6	THS7B_HUMAN;.	K	338;338;307;197	ENSP00000387145:E338K;ENSP00000272643:E338K;ENSP00000413841:E307K;ENSP00000443370:E197K	ENSP00000272643:E338K	E	+	1	0	THSD7B	137568974	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	4.744000	0.62118	2.547000	0.85894	0.655000	0.94253	GAA	THSD7B	-	superfamily_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000144229		0.498	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	THSD7B	HGNC	protein_coding	OTTHUMT00000331769.2	78	0.00	0	G	XM_046570.9		137852504	137852504	+1	no_errors	ENST00000272643	ensembl	human	known	69_37n	missense	66	37.14	39	SNP	1.000	A
TNFAIP6	7130	genome.wustl.edu	37	2	152230093	152230093	+	Silent	SNP	C	C	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr2:152230093C>A	ENST00000243347.3	+	5	729	c.654C>A	c.(652-654)atC>atA	p.I218I	RN7SL124P_ENST00000498656.2_RNA	NM_007115.3	NP_009046.2	P98066	TSG6_HUMAN	tumor necrosis factor, alpha-induced protein 6	218	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|inflammatory response (GO:0006954)|signal transduction (GO:0007165)		hyaluronic acid binding (GO:0005540)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.131)	Hyaluronan(DB08818)	CAGATGACATCATCAGTACAG	0.343																																						dbGAP											0													153.0	151.0	151.0					2																	152230093		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0				CCDS2193.1	2q23.3	2008-11-18			ENSG00000123610	ENSG00000123610			11898	protein-coding gene	gene with protein product		600410				1730767, 8568267, 15060082	Standard	NM_007115		Approved	TSG6, TSG-6	uc002txk.3	P98066	OTTHUMG00000131884	ENST00000243347.3:c.654C>A	2.37:g.152230093C>A			Q53TI7|Q8WWI9	Silent	SNP	pfam_CUB,pfam_Link,superfamily_CUB,superfamily_C-type_lectin_fold,smart_Link,smart_CUB,pfscan_CUB,pfscan_Link,prints_Link	p.I218	ENST00000243347.3	37	c.654	CCDS2193.1	2																																																																																			TNFAIP6	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000123610		0.343	TNFAIP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFAIP6	HGNC	protein_coding	OTTHUMT00000254834.2	126	0.00	0	C	NM_007115		152230093	152230093	+1	no_errors	ENST00000243347	ensembl	human	known	69_37n	silent	87	38.73	55	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7578413	7578413	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr17:7578413C>A	ENST00000269305.4	-	5	706	c.517G>T	c.(517-519)Gtg>Ttg	p.V173L	TP53_ENST00000413465.2_Missense_Mutation_p.V173L|TP53_ENST00000455263.2_Missense_Mutation_p.V173L|TP53_ENST00000359597.4_Missense_Mutation_p.V173L|TP53_ENST00000420246.2_Missense_Mutation_p.V173L|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000445888.2_Missense_Mutation_p.V173L	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	173	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation).|V -> E (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).|V -> M (in LFS; germline mutation and in sporadic cancers; somatic mutation).|V -> W (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V173L(68)|p.V173M(46)|p.0?(8)|p.V80L(6)|p.V41L(6)|p.V173fs*1(4)|p.V80M(3)|p.V41M(3)|p.V173fs*59(2)|p.V157_C176del20(1)|p.V172_R174delVVR(1)|p.V173fs*69(1)|p.P151_V173del23(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.V172_E180delVVRRCPHHE(1)|p.E171fs*1(1)|p.V173W(1)|p.V173fs*8(1)|p.H168fs*69(1)|p.E171_H179delEVVRRCPHH(1)|p.S149fs*72(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGCGCCTCACAACCTCCGTC	0.662		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	159	Substitution - Missense(133)|Deletion - Frameshift(12)|Whole gene deletion(8)|Deletion - In frame(5)|Insertion - Frameshift(1)	upper_aerodigestive_tract(29)|large_intestine(25)|lung(17)|stomach(16)|ovary(14)|breast(11)|oesophagus(9)|central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(6)|skin(6)|bone(5)|liver(4)|vulva(3)|soft_tissue(2)|kidney(1)|biliary_tract(1)|urinary_tract(1)|pancreas(1)|autonomic_ganglia(1)	GRCh37	CM070299	TP53	M							51.0	51.0	51.0					17																	7578413		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.517G>T	17.37:g.7578413C>A	ENSP00000269305:p.Val173Leu		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.V173L	ENST00000269305.4	37	c.517	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	26.5	4.743630	0.89663	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99846	-7.13;-7.13;-7.13;-7.13;-7.13;-7.13;-7.13;-7.13	5.59	5.59	0.84812	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99866	0.9937	M	0.92459	3.31	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;0.987;0.996;1.0;0.979;0.989;1.0	D;D;D;D;D;D;D	0.91635	0.998;0.922;0.957;0.999;0.916;0.953;0.998	D	0.96814	0.9599	10	0.87932	D	0	-25.5548	17.4784	0.87667	0.0:1.0:0.0:0.0	.	134;173;173;80;173;173;173	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	L	173;173;173;173;173;173;162;80;41;80;41	ENSP00000410739:V173L;ENSP00000352610:V173L;ENSP00000269305:V173L;ENSP00000398846:V173L;ENSP00000391127:V173L;ENSP00000391478:V173L;ENSP00000425104:V41L;ENSP00000423862:V80L	ENSP00000269305:V173L	V	-	1	0	TP53	7519138	1.000000	0.71417	0.150000	0.22450	0.458000	0.32498	7.775000	0.85489	2.804000	0.96469	0.655000	0.94253	GTG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.662	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	40	0.00	0	C	NM_000546		7578413	7578413	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	12	53.85	14	SNP	0.996	A
TPD52	7163	genome.wustl.edu	37	8	80956423	80956423	+	Intron	SNP	G	G	C			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr8:80956423G>C	ENST00000379097.3	-	5	869				TPD52_ENST00000520527.1_Nonsense_Mutation_p.S185*|TPD52_ENST00000518937.1_Nonsense_Mutation_p.S145*|TPD52_ENST00000519303.2_5'UTR|TPD52_ENST00000523395.1_Intron|TPD52_ENST00000379096.5_Intron|TPD52_ENST00000517427.1_Intron|TPD52_ENST00000537855.1_Intron|TPD52_ENST00000448733.2_Nonsense_Mutation_p.S176*	NM_001025252.1	NP_001020423.1	P55327	TPD52_HUMAN	tumor protein D52						anatomical structure morphogenesis (GO:0009653)|B cell differentiation (GO:0030183)|positive regulation of cell proliferation (GO:0008284)|secretion (GO:0046903)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	8	all_epithelial(4;1.13e-09)|Lung NSC(7;9.71e-07)|all_lung(9;3.75e-06)	Lung NSC(129;3.55e-06)|all_lung(136;1.53e-05)|Acute lymphoblastic leukemia(644;0.158)	BRCA - Breast invasive adenocarcinoma(6;0.00181)|Epithelial(68;0.0149)|all cancers(69;0.0612)			CATGCTAATTGAATGCTGAAT	0.303																																						dbGAP											0													67.0	64.0	65.0					8																	80956423		1823	4081	5904	-	-	-	SO:0001627	intron_variant	0			U18914	CCDS34912.1, CCDS47879.1, CCDS55249.1, CCDS75757.1, CCDS75758.1, CCDS75759.1	8q21.13	2014-06-24			ENSG00000076554	ENSG00000076554			12005	protein-coding gene	gene with protein product		604068				7796418	Standard	NM_001287144		Approved	D52, hD52, N8L	uc003ybr.1	P55327	OTTHUMG00000164565	ENST00000379097.3:c.507-1520C>G	8.37:g.80956423G>C			B7Z414|C9J502|D0UFD1|D0UFD2|D0UFD3|D0UFD4|D0UFD5|E5RKB4|Q13056|Q53EK8|Q6FGP3|Q6FGS3|Q86YZ2|Q9UCX8	Nonsense_Mutation	SNP	pfam_TPD52	p.S176*	ENST00000379097.3	37	c.527	CCDS34912.1	8	.	.	.	.	.	.	.	.	.	.	G	37	6.032643	0.97221	.	.	ENSG00000076554	ENST00000518937;ENST00000520527;ENST00000448733	.	.	.	6.06	6.06	0.98353	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.6243	0.99512	0.0:0.0:1.0:0.0	.	.	.	.	X	145;185;176	.	ENSP00000410222:S176X	S	-	2	0	TPD52	81118978	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.106000	0.94253	2.879000	0.98667	0.650000	0.86243	TCA	TPD52	-	pfam_TPD52	ENSG00000076554		0.303	TPD52-006	KNOWN	basic|CCDS	protein_coding	TPD52	HGNC	protein_coding	OTTHUMT00000379539.2	67	0.00	0	G	NM_005079		80956423	80956423	-1	no_errors	ENST00000448733	ensembl	human	known	69_37n	nonsense	75	34.78	40	SNP	1.000	C
TRAF5	7188	genome.wustl.edu	37	1	211526585	211526585	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr1:211526585G>C	ENST00000261464.5	+	2	58	c.4G>C	c.(4-6)Gct>Cct	p.A2P	TRAF5_ENST00000367004.3_Missense_Mutation_p.A2P|TRAF5_ENST00000462410.1_3'UTR|TRAF5_ENST00000427925.2_Missense_Mutation_p.A2P|TRAF5_ENST00000336184.2_Missense_Mutation_p.A2P	NM_001033910.2	NP_001029082.1	O00463	TRAF5_HUMAN	TNF receptor-associated factor 5	2					apoptotic process (GO:0006915)|positive regulation of cell proliferation (GO:0008284)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	CD40 receptor complex (GO:0035631)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)	signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				OV - Ovarian serous cystadenocarcinoma(81;0.00946)|all cancers(67;0.0808)|Epithelial(68;0.144)		CTGCAGAATGGCTTATTCAGA	0.448											OREG0014232	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													97.0	102.0	100.0					1																	211526585		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB000509	CCDS1497.1	1q32	2008-02-05			ENSG00000082512	ENSG00000082512		"""RING-type (C3HC4) zinc fingers"""	12035	protein-coding gene	gene with protein product		602356				9126477	Standard	NM_001033910		Approved	RNF84	uc001hii.3	O00463	OTTHUMG00000036997	ENST00000261464.5:c.4G>C	1.37:g.211526585G>C	ENSP00000261464:p.Ala2Pro	2198	B4DIS9|B4E0A2|Q6FHY1	Missense_Mutation	SNP	pfam_MATH,superfamily_TRAF-like,smart_Znf_RING,smart_MATH,pirsf_TNF_rcpt--assoc_TRAF,pfscan_MATH,pfscan_Znf_RING,pfscan_Znf_TRAF	p.A2P	ENST00000261464.5	37	c.4	CCDS1497.1	1	.	.	.	.	.	.	.	.	.	.	G	15.78	2.934541	0.52866	.	.	ENSG00000082512	ENST00000336184;ENST00000427925;ENST00000261464;ENST00000367004	T;T;T;T	0.40476	1.97;1.03;1.97;1.97	4.42	4.42	0.53409	.	0.391921	0.21254	N	0.077591	T	0.49915	0.1585	N	0.19112	0.55	0.33503	D	0.59017	D;D;D	0.76494	0.999;0.998;0.998	D;D;D	0.83275	0.996;0.99;0.99	T	0.63642	-0.6591	10	0.87932	D	0	-20.2097	15.3132	0.74053	0.0:0.0:1.0:0.0	.	2;2;2	F5H1P7;B4E0A2;O00463	.;.;TRAF5_HUMAN	P	2	ENSP00000336825:A2P;ENSP00000389891:A2P;ENSP00000261464:A2P;ENSP00000355971:A2P	ENSP00000261464:A2P	A	+	1	0	TRAF5	209593208	1.000000	0.71417	0.998000	0.56505	0.154000	0.21943	4.285000	0.58989	2.387000	0.81309	0.655000	0.94253	GCT	TRAF5	-	pirsf_TNF_rcpt--assoc_TRAF	ENSG00000082512		0.448	TRAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAF5	HGNC	protein_coding	OTTHUMT00000089825.1	47	0.00	0	G	NM_004619		211526585	211526585	+1	no_errors	ENST00000261464	ensembl	human	known	69_37n	missense	37	53.75	43	SNP	1.000	C
TRPM6	140803	genome.wustl.edu	37	9	77397680	77397680	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr9:77397680C>A	ENST00000360774.1	-	22	3246	c.3009G>T	c.(3007-3009)gaG>gaT	p.E1003D	TRPM6_ENST00000376872.3_Intron|TRPM6_ENST00000361255.3_Missense_Mutation_p.E998D|TRPM6_ENST00000449912.2_Missense_Mutation_p.E998D|TRPM6_ENST00000451710.3_Missense_Mutation_p.E1003D|TRPM6_ENST00000376871.3_Intron|TRPM6_ENST00000376864.4_Missense_Mutation_p.E1003D	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	1003					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						AAGATGGTGGCTCTTTTGGCG	0.448																																						dbGAP											0													131.0	111.0	118.0					9																	77397680		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.3009G>T	9.37:g.77397680C>A	ENSP00000354006:p.Glu1003Asp		Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ion_trans_dom,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.E1003D	ENST00000360774.1	37	c.3009	CCDS6647.1	9	.	.	.	.	.	.	.	.	.	.	C	11.83	1.754333	0.31046	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000449912;ENST00000361255;ENST00000376864;ENST00000312449;ENST00000448641	T;T;T;T;T	0.10192	2.9;2.9;2.9;2.9;2.9	5.71	1.89	0.25635	Ion transport (1);	0.240304	0.47852	D	0.000219	T	0.15696	0.0378	M	0.64080	1.96	0.32399	N	0.552152	B;B;B	0.30727	0.292;0.149;0.227	B;B;B	0.42282	0.382;0.259;0.168	T	0.09465	-1.0673	10	0.87932	D	0	.	5.952	0.19253	0.0:0.4792:0.1281:0.3927	.	666;1003;998	F5H7D1;Q9BX84;Q9BX84-3	.;TRPM6_HUMAN;.	D	1003;1003;998;998;1003;666;666	ENSP00000354006:E1003D;ENSP00000407341:E1003D;ENSP00000396672:E998D;ENSP00000354962:E998D;ENSP00000366060:E1003D	ENSP00000309693:E666D	E	-	3	2	TRPM6	76587500	0.976000	0.34144	0.968000	0.41197	0.241000	0.25554	0.262000	0.18460	0.368000	0.24481	0.561000	0.74099	GAG	TRPM6	-	pfam_Ion_trans_dom	ENSG00000119121		0.448	TRPM6-001	KNOWN	basic|CCDS	protein_coding	TRPM6	HGNC	protein_coding	OTTHUMT00000052693.1	78	0.00	0	C	NM_017662		77397680	77397680	-1	no_errors	ENST00000451710	ensembl	human	known	69_37n	missense	77	18.09	17	SNP	0.967	A
TSPYL2	64061	genome.wustl.edu	37	X	53115366	53115366	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chrX:53115366G>A	ENST00000375442.4	+	6	1924	c.1792G>A	c.(1792-1794)Gat>Aat	p.D598N		NM_022117.3	NP_071400.1	Q9H2G4	TSYL2_HUMAN	TSPY-like 2	598	Asp-rich.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell cycle (GO:0007049)|cellular protein metabolic process (GO:0044267)|chromatin modification (GO:0016568)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA replication (GO:0008156)|nucleosome assembly (GO:0006334)|regulation of protein kinase activity (GO:0045859)|regulation of signal transduction (GO:0009966)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	rDNA binding (GO:0000182)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(1)	19						aggcagcgatgatgacgaCAG	0.448																																						dbGAP											0													191.0	124.0	147.0					X																	53115366		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF273046	CCDS14350.1	Xp11	2014-06-09			ENSG00000184205	ENSG00000184205			24358	protein-coding gene	gene with protein product		300564				11318608, 11395479	Standard	NM_022117		Approved	SE20-4, HRIHFB2216, CTCL, DENTT, CDA1, CINAP, TSPX	uc004drw.3	Q9H2G4	OTTHUMG00000021597	ENST00000375442.4:c.1792G>A	X.37:g.53115366G>A	ENSP00000364591:p.Asp598Asn		O94799|Q96DG7|Q9BZW6	Missense_Mutation	SNP	pfam_NAP_family	p.D598N	ENST00000375442.4	37	c.1792	CCDS14350.1	X	.	.	.	.	.	.	.	.	.	.	G	19.61	3.860419	0.71834	.	.	ENSG00000184205	ENST00000375442	T	0.36340	1.26	2.65	2.65	0.31530	.	0.630592	0.12303	U	0.480904	T	0.42337	0.1198	N	0.24115	0.695	0.23356	N	0.997841	D;D	0.89917	1.0;0.98	D;D	0.83275	0.996;0.977	T	0.13980	-1.0489	10	0.66056	D	0.02	-10.1515	7.9763	0.30157	0.0:0.0:1.0:0.0	.	238;598	Q59GC7;Q9H2G4	.;TSYL2_HUMAN	N	598	ENSP00000364591:D598N	ENSP00000364591:D598N	D	+	1	0	TSPYL2	53132091	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	2.399000	0.44495	1.592000	0.50018	0.287000	0.19450	GAT	TSPYL2	-	NULL	ENSG00000184205		0.448	TSPYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPYL2	HGNC	protein_coding	OTTHUMT00000056718.1	102	0.00	0	G	NM_022117		53115366	53115366	+1	no_errors	ENST00000375442	ensembl	human	known	69_37n	missense	46	54.00	54	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179469849	179469849	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr2:179469849C>T	ENST00000591111.1	-	230	49356	c.49132G>A	c.(49132-49134)Gaa>Aaa	p.E16378K	TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E9146K|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E18019K|TTN_ENST00000342992.6_Missense_Mutation_p.E15451K|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E9079K|TTN_ENST00000460472.2_Missense_Mutation_p.E8954K|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000589234.1_RNA			Q8WZ42	TITIN_HUMAN	titin	16378	Ig-like 100.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GATACCTCTTCCTTGGTTATC	0.468																																						dbGAP											0													171.0	157.0	161.0					2																	179469849		1882	4108	5990	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.49132G>A	2.37:g.179469849C>T	ENSP00000465570:p.Glu16378Lys		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.E15451K	ENST00000591111.1	37	c.46351		2	.	.	.	.	.	.	.	.	.	.	C	14.75	2.628665	0.46944	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25	5.78	5.78	0.91487	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.57213	0.2038	L	0.31526	0.94	0.50313	D	0.999866	B;B;B;B	0.20550	0.046;0.046;0.046;0.046	B;B;B;B	0.22601	0.04;0.04;0.04;0.04	T	0.56098	-0.8035	9	0.87932	D	0	.	14.2012	0.65705	0.0:0.9288:0.0:0.0712	.	8954;9079;9146;16378	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	K	15451;8954;9146;9079;8954	ENSP00000343764:E15451K;ENSP00000434586:E8954K;ENSP00000340554:E9146K;ENSP00000352154:E9079K	ENSP00000340554:E9146K	E	-	1	0	TTN	179178094	0.998000	0.40836	1.000000	0.80357	0.994000	0.84299	2.632000	0.46511	2.744000	0.94065	0.563000	0.77884	GAA	TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000155657		0.468	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	79	0.00	0	C	NM_133378		179469849	179469849	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	88	38.89	56	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179613383	179613383	+	Intron	SNP	G	G	C			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr2:179613383G>C	ENST00000591111.1	-	45	10585				TTN_ENST00000342175.6_Intron|TTN_ENST00000360870.5_Missense_Mutation_p.Q4582E|TTN_ENST00000589042.1_Intron|TTN_ENST00000342992.6_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000590773.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000578746.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGTTTTATTTGAGTGTGAAAC	0.333																																						dbGAP											0													121.0	129.0	126.0					2																	179613383		2202	4300	6502	-	-	-	SO:0001627	intron_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+4467C>G	2.37:g.179613383G>C			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Titin_Z,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.Q4582E	ENST00000591111.1	37	c.13744		2	.	.	.	.	.	.	.	.	.	.	G	7.956	0.745996	0.15710	.	.	ENSG00000155657	ENST00000360870	T	0.58358	0.34	4.95	4.07	0.47477	.	.	.	.	.	T	0.35941	0.0949	N	0.24115	0.695	0.09310	N	0.999999	B	0.27732	0.187	B	0.30495	0.116	T	0.20240	-1.0281	9	0.34782	T	0.22	.	4.8701	0.13627	0.1736:0.0:0.6562:0.1702	.	4582	Q8WZ42-6	.	E	4582	ENSP00000354117:Q4582E	ENSP00000354117:Q4582E	Q	-	1	0	TTN	179321628	0.101000	0.21875	0.030000	0.17652	0.550000	0.35303	2.048000	0.41278	1.461000	0.47929	0.655000	0.94253	CAA	TTN	-	NULL	ENSG00000155657		0.333	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	100	0.00	0	G	NM_133378		179613383	179613383	-1	no_errors	ENST00000360870	ensembl	human	known	69_37n	missense	72	45.45	60	SNP	0.002	C
TUBGCP6	85378	genome.wustl.edu	37	22	50665188	50665188	+	Silent	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr22:50665188C>T	ENST00000248846.5	-	7	1679	c.1575G>A	c.(1573-1575)ctG>ctA	p.L525L	TUBGCP6_ENST00000491449.1_5'Flank|TUBGCP6_ENST00000439308.2_Silent_p.L525L			Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6	525					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|gamma-tubulin ring complex (GO:0008274)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)			breast(4)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(13)|ovary(3)|prostate(2)|skin(2)	45		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)		AGCTGGTCTTCAGCAGGGACA	0.652																																						dbGAP											0													32.0	29.0	30.0					22																	50665188		2202	4293	6495	-	-	-	SO:0001819	synonymous_variant	0			AB051456	CCDS14087.1	22q13.31-q13.33	2008-07-01			ENSG00000128159	ENSG00000128159			18127	protein-coding gene	gene with protein product	"""gamma-tubulin complex component 6"""	610053				11694571, 11258795	Standard	XR_244458		Approved	GCP6, KIAA1669, DJ402G11.6	uc003bkb.1	Q96RT7	OTTHUMG00000030150	ENST00000248846.5:c.1575G>A	22.37:g.50665188C>T			Q5JZ80|Q6PJ40|Q86YE9|Q9BY91|Q9UGX3|Q9UGX4	Silent	SNP	pfam_Spc97_Spc98	p.L525	ENST00000248846.5	37	c.1575	CCDS14087.1	22																																																																																			TUBGCP6	-	pfam_Spc97_Spc98	ENSG00000128159		0.652	TUBGCP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP6	HGNC	protein_coding	OTTHUMT00000075004.3	22	0.00	0	C	NM_020461		50665188	50665188	-1	no_errors	ENST00000248846	ensembl	human	known	69_37n	silent	25	28.57	10	SNP	0.993	T
TXLNB	167838	genome.wustl.edu	37	6	139569014	139569014	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr6:139569014G>C	ENST00000358430.3	-	8	1342	c.1110C>G	c.(1108-1110)ttC>ttG	p.F370L	RP1-225E12.3_ENST00000585874.1_RNA	NM_153235.3	NP_694967.3	Q8N3L3	TXLNB_HUMAN	taxilin beta	370						cytoplasm (GO:0005737)				breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37				OV - Ovarian serous cystadenocarcinoma(155;0.000185)|GBM - Glioblastoma multiforme(68;0.000235)		GTGTGCTCTGGAATTCTTCAA	0.373																																						dbGAP											0													153.0	151.0	152.0					6																	139569014		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34545.1	6q23.3	2008-02-05	2005-07-29	2005-07-29	ENSG00000164440	ENSG00000164440			21617	protein-coding gene	gene with protein product		611438	"""chromosome 6 open reading frame 198"""	C6orf198		15184072	Standard	NM_153235		Approved	DKFZp451A175, MDP77, dJ522B19.2	uc021zfy.1	Q8N3L3	OTTHUMG00000015688	ENST00000358430.3:c.1110C>G	6.37:g.139569014G>C	ENSP00000351206:p.Phe370Leu		Q5VTF3|Q76L25|Q86T52|Q8N3S2	Missense_Mutation	SNP	pfam_Taxilin	p.F370L	ENST00000358430.3	37	c.1110	CCDS34545.1	6	.	.	.	.	.	.	.	.	.	.	G	19.85	3.904644	0.72868	.	.	ENSG00000164440	ENST00000358430	T	0.34275	1.37	5.22	4.33	0.51752	.	0.139923	0.64402	D	0.000002	T	0.18173	0.0436	L	0.43598	1.365	0.44579	D	0.997544	P	0.48162	0.906	P	0.45610	0.487	T	0.03306	-1.1050	9	.	.	.	-13.1341	6.7252	0.23353	0.3219:0.0:0.678:0.0	.	370	Q8N3L3	TXLNB_HUMAN	L	370	ENSP00000351206:F370L	.	F	-	3	2	TXLNB	139610707	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	1.645000	0.37238	1.283000	0.44513	0.655000	0.94253	TTC	TXLNB	-	pfam_Taxilin	ENSG00000164440		0.373	TXLNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TXLNB	HGNC	protein_coding	OTTHUMT00000042458.1	101	0.00	0	G	NM_153235		139569014	139569014	-1	no_errors	ENST00000358430	ensembl	human	known	69_37n	missense	96	34.69	51	SNP	1.000	C
UBE4B	10277	genome.wustl.edu	37	1	10190626	10190626	+	Silent	SNP	C	C	G			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr1:10190626C>G	ENST00000253251.8	+	12	2216	c.1377C>G	c.(1375-1377)ctC>ctG	p.L459L	UBE4B_ENST00000343090.6_Silent_p.L588L|UBE4B_ENST00000475795.1_3'UTR|UBE4B_ENST00000377157.3_Silent_p.L343L					ubiquitination factor E4B											NS(3)|breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(14)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	48		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		TGCAGAGACTCTCTTACTTAG	0.478																																						dbGAP											0													159.0	158.0	158.0					1																	10190626		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF091093	CCDS110.1, CCDS41245.1	1p36.1	2013-01-28	2011-05-19		ENSG00000130939	ENSG00000130939		"""U-box domain containing"""	12500	protein-coding gene	gene with protein product		613565	"""ubiquitination factor E4B (homologous to yeast UFD2)"", ""ubiquitination factor E4B (UFD2 homolog, yeast)"""			9734811, 10089879	Standard	NM_006048		Approved	UBOX3, E4, UFD2, KIAA0684	uc001aqs.4	O95155	OTTHUMG00000001797	ENST00000253251.8:c.1377C>G	1.37:g.10190626C>G				Silent	SNP	pfam_Ub_conjug_fac_E4_core,pfam_Ubox_domain,smart_Ubox_domain	p.L588	ENST00000253251.8	37	c.1764	CCDS110.1	1																																																																																			UBE4B	-	NULL	ENSG00000130939		0.478	UBE4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE4B	HGNC	protein_coding	OTTHUMT00000005017.1	101	0.00	0	C	NM_006048		10190626	10190626	+1	no_errors	ENST00000343090	ensembl	human	known	69_37n	silent	93	35.42	51	SNP	0.651	G
UBAP2L	9898	genome.wustl.edu	37	1	154241261	154241261	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr1:154241261C>T	ENST00000361546.2	+	25	3041	c.2999C>T	c.(2998-3000)tCc>tTc	p.S1000F	UBAP2L_ENST00000428931.1_Missense_Mutation_p.S1000F|UBAP2L_ENST00000271877.7_Missense_Mutation_p.S1010F|UBAP2L_ENST00000484819.1_3'UTR			Q14157	UBP2L_HUMAN	ubiquitin associated protein 2-like	1000					binding of sperm to zona pellucida (GO:0007339)		poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(20)|ovary(1)|prostate(1)|urinary_tract(2)	50	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			GGTTTTCATTCCGGTACTCCT	0.532																																						dbGAP											0													154.0	144.0	147.0					1																	154241261		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC003170	CCDS1063.1, CCDS44229.1, CCDS72925.1	1q21.3	2008-02-05			ENSG00000143569	ENSG00000143569			29877	protein-coding gene	gene with protein product						8590280, 11230159	Standard	NM_014847		Approved	NICE-4, KIAA0144	uc001fep.4	Q14157	OTTHUMG00000035983	ENST00000361546.2:c.2999C>T	1.37:g.154241261C>T	ENSP00000355343:p.Ser1000Phe		B4E0U8|Q5VU75|Q5VU76|Q9BTU3|Q9UGL2|Q9UGL3|Q9UGL4|Q9UGL5	Missense_Mutation	SNP	pfam_DUF3697_Uba2,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.S1000F	ENST00000361546.2	37	c.2999	CCDS1063.1	1	.	.	.	.	.	.	.	.	.	.	C	15.15	2.747451	0.49257	.	.	ENSG00000143569	ENST00000428931;ENST00000456955;ENST00000433006;ENST00000271877;ENST00000361546	T;T;T	0.35789	1.29;1.29;1.29	5.34	5.34	0.76211	.	0.136419	0.50627	D	0.000102	T	0.34861	0.0912	L	0.36672	1.1	0.44302	D	0.997176	B;D;B;D	0.56521	0.32;0.976;0.042;0.965	B;P;B;P	0.54026	0.136;0.549;0.124;0.74	T	0.17930	-1.0353	10	0.87932	D	0	-4.3481	17.5873	0.87986	0.0:1.0:0.0:0.0	.	1010;496;1000;1000	F8W726;C9JD99;Q14157-3;Q14157	.;.;.;UBP2L_HUMAN	F	1000;496;496;1010;1000	ENSP00000389445:S1000F;ENSP00000271877:S1010F;ENSP00000355343:S1000F	ENSP00000271877:S1010F	S	+	2	0	UBAP2L	152507885	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.471000	0.80985	2.486000	0.83907	0.557000	0.71058	TCC	UBAP2L	-	NULL	ENSG00000143569		0.532	UBAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBAP2L	HGNC	protein_coding	OTTHUMT00000087673.1	66	0.00	0	C	NM_014847		154241261	154241261	+1	no_errors	ENST00000361546	ensembl	human	known	69_37n	missense	48	47.83	44	SNP	1.000	T
UNC80	285175	genome.wustl.edu	37	2	210782561	210782561	+	Nonsense_Mutation	SNP	C	C	G			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr2:210782561C>G	ENST00000439458.1	+	31	4972	c.4892C>G	c.(4891-4893)tCa>tGa	p.S1631*	UNC80_ENST00000272845.6_Nonsense_Mutation_p.S1626*	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	1631					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						ATGCTGATGTCAGAGTTCCAC	0.537																																						dbGAP											0													100.0	83.0	88.0					2																	210782561		692	1591	2283	-	-	-	SO:0001587	stop_gained	0			AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.4892C>G	2.37:g.210782561C>G	ENSP00000391088:p.Ser1631*		B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Nonsense_Mutation	SNP	NULL	p.S1631*	ENST00000439458.1	37	c.4892	CCDS46504.1	2	.	.	.	.	.	.	.	.	.	.	C	46	12.696555	0.99689	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	.	.	.	5.74	5.74	0.90152	.	0.068633	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-11.4899	19.9169	0.97065	0.0:1.0:0.0:0.0	.	.	.	.	X	1631;1626	.	ENSP00000272845:S1626X	S	+	2	0	UNC80	210490806	1.000000	0.71417	0.999000	0.59377	0.968000	0.65278	7.818000	0.86416	2.715000	0.92844	0.655000	0.94253	TCA	UNC80	-	NULL	ENSG00000144406		0.537	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC80	HGNC	protein_coding		56	0.00	0	C	NM_182587		210782561	210782561	+1	no_errors	ENST00000439458	ensembl	human	known	69_37n	nonsense	52	42.22	38	SNP	1.000	G
URB2	9816	genome.wustl.edu	37	1	229770771	229770771	+	Silent	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr1:229770771C>T	ENST00000258243.2	+	4	547	c.411C>T	c.(409-411)gtC>gtT	p.V137V		NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	137						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						CCCTGGCTGTCATCTACACGG	0.567																																						dbGAP											0													62.0	56.0	58.0					1																	229770771		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.411C>T	1.37:g.229770771C>T			Q5VYC9	Silent	SNP	pfam_Urb2/Npa2_C	p.V137	ENST00000258243.2	37	c.411	CCDS31052.1	1																																																																																			URB2	-	NULL	ENSG00000135763		0.567	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	URB2	HGNC	protein_coding	OTTHUMT00000095232.1	33	0.00	0	C	NM_014777		229770771	229770771	+1	no_errors	ENST00000258243	ensembl	human	known	69_37n	silent	28	55.56	35	SNP	0.946	T
USE1	55850	genome.wustl.edu	37	19	17330038	17330038	+	Nonsense_Mutation	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr19:17330038C>T	ENST00000263897.5	+	7	486	c.439C>T	c.(439-441)Cag>Tag	p.Q147*	USE1_ENST00000596136.1_Intron|USE1_ENST00000445667.2_Nonsense_Mutation_p.Q147*|USE1_ENST00000379776.4_Intron	NM_018467.3	NP_060937	Q9NZ43	USE1_HUMAN	unconventional SNARE in the ER 1 homolog (S. cerevisiae)	147					endoplasmic reticulum tubular network organization (GO:0071786)|lysosomal transport (GO:0007041)|protein catabolic process (GO:0030163)|protein transport (GO:0015031)|regulation of ER to Golgi vesicle-mediated transport (GO:0060628)|secretion by cell (GO:0032940)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|lung(3)	6						GGCAGGGTCCCAGCCAGTGAG	0.527																																						dbGAP											0													34.0	40.0	38.0					19																	17330038		2014	4192	6206	-	-	-	SO:0001587	stop_gained	0			AF220052	CCDS46011.1	19p13.11	2007-08-20				ENSG00000053501			30882	protein-coding gene	gene with protein product	"""Q-SNARE"", ""SNARE-like tail-anchored protein 1 homolog (S. cerevisiae)"""	610675				16354670, 15029241	Standard	NM_018467		Approved	p31, SLT1, MDS032	uc002nfo.2	Q9NZ43		ENST00000263897.5:c.439C>T	19.37:g.17330038C>T	ENSP00000263897:p.Gln147*		Q8NCK1|Q9BRT4	Nonsense_Mutation	SNP	pfam_Vesicle_transport_protein_Use1	p.Q147*	ENST00000263897.5	37	c.439	CCDS46011.1	19	.	.	.	.	.	.	.	.	.	.	C	14.28	2.487372	0.44249	.	.	ENSG00000053501	ENST00000263897;ENST00000445667	.	.	.	4.43	0.933	0.19471	.	0.915588	0.09361	N	0.812774	.	.	.	.	.	.	0.19575	N	0.999968	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	-14.4387	0.9653	0.01404	0.3592:0.3024:0.1052:0.2332	.	.	.	.	X	147	.	ENSP00000263897:Q147X	Q	+	1	0	USE1	17191038	0.822000	0.29219	0.029000	0.17559	0.021000	0.10359	1.071000	0.30666	0.680000	0.31366	-0.500000	0.04577	CAG	USE1	-	pfam_Vesicle_transport_protein_Use1	ENSG00000053501		0.527	USE1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	USE1	HGNC	protein_coding	OTTHUMT00000463295.1	43	0.00	0	C	NM_018467		17330038	17330038	+1	no_errors	ENST00000263897	ensembl	human	known	69_37n	nonsense	20	35.48	11	SNP	0.098	T
USP6	9098	genome.wustl.edu	37	17	5048769	5048769	+	Nonsense_Mutation	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr17:5048769C>T	ENST00000574788.1	+	27	4292	c.2062C>T	c.(2062-2064)Caa>Taa	p.Q688*	USP6_ENST00000332776.4_Nonsense_Mutation_p.Q688*|USP6_ENST00000304328.5_Nonsense_Mutation_p.Q371*|USP6_ENST00000250066.6_Nonsense_Mutation_p.Q688*			P35125	UBP6_HUMAN	ubiquitin specific peptidase 6	688	USP.				cellular protein modification process (GO:0006464)|protein deubiquitination (GO:0016579)|regulation of vesicle-mediated transport (GO:0060627)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	calmodulin binding (GO:0005516)|cysteine-type endopeptidase activity (GO:0004197)|nucleic acid binding (GO:0003676)|Rab GTPase activator activity (GO:0005097)|ubiquitin-specific protease activity (GO:0004843)	p.Q688E(2)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						GCTAAGATCTCAAGTCAAATG	0.378			T	"""COL1A1, CDH11, ZNF9, OMD"""	aneurysmal bone cysts																																	dbGAP		Dom	yes		17	17p13	9098	ubiquitin specific peptidase 6 (Tre-2 oncogene)		M	2	Substitution - Missense(2)	lung(2)											138.0	124.0	129.0					17																	5048769		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			X63547	CCDS11069.2	17p13	2014-06-12	2014-06-12		ENSG00000129204	ENSG00000129204	3.4.19.12	"""Ubiquitin-specific peptidases"""	12629	protein-coding gene	gene with protein product	"""ubiquitin carboxyl-terminal hydrolase 6"", ""TBC1D3 and USP32 fusion"", ""Tre-2 oncogene"""	604334	"""ubiquitin specific protease 6 (Tre-2 oncogene)"", ""TRE oncogene, Smith Magenis syndrome chromosome region"", ""ubiquitin specific peptidase 6 (Tre-2 oncogene)"""	HRP1, TRESMCR		12838346, 1349106	Standard	NM_004505		Approved	Tre-2, TRE17, Tre2	uc002gav.1	P35125	OTTHUMG00000099449	ENST00000574788.1:c.2062C>T	17.37:g.5048769C>T	ENSP00000460380:p.Gln688*		Q15634|Q86WP6|Q8IWT4	Nonsense_Mutation	SNP	pfam_Peptidase_C19,pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom,pfscan_Peptidase_C19	p.Q688*	ENST00000574788.1	37	c.2062	CCDS11069.2	17	.	.	.	.	.	.	.	.	.	.	C	51	17.821733	0.99894	.	.	ENSG00000129204	ENST00000332776;ENST00000250066;ENST00000304328	.	.	.	2.36	2.36	0.29203	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	.	10.4264	0.44380	0.0:1.0:0.0:0.0	.	.	.	.	X	688;688;371	.	ENSP00000250066:Q688X	Q	+	1	0	USP6	4989493	1.000000	0.71417	1.000000	0.80357	0.682000	0.39822	4.713000	0.61895	1.318000	0.45170	0.194000	0.17425	CAA	USP6	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000129204		0.378	USP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	USP6	HGNC	protein_coding	OTTHUMT00000438990.1	168	0.00	0	C	NM_004505		5048769	5048769	+1	no_errors	ENST00000250066	ensembl	human	known	69_37n	nonsense	124	10.71	15	SNP	1.000	T
WDR64	128025	genome.wustl.edu	37	1	241886720	241886720	+	Silent	SNP	C	C	G			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr1:241886720C>G	ENST00000366552.2	+	9	1353	c.1146C>G	c.(1144-1146)gtC>gtG	p.V382V	WDR64_ENST00000437684.2_Silent_p.V382V	NM_144625.4	NP_653226.4	B1ANS9	WDR64_HUMAN	WD repeat domain 64	382										breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(17)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			AACATGTCGTCAGCCTTTCCT	0.393																																						dbGAP											0													80.0	75.0	77.0					1																	241886720		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK057540		1q43	2013-01-09			ENSG00000162843	ENSG00000162843		"""WD repeat domain containing"""	26570	protein-coding gene	gene with protein product							Standard	NM_144625		Approved	FLJ32978	uc001hzg.2	B1ANS9	OTTHUMG00000039705	ENST00000366552.2:c.1146C>G	1.37:g.241886720C>G			B1ANT0|Q7Z573|Q96LY9	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V382	ENST00000366552.2	37	c.1146		1																																																																																			WDR64	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000162843		0.393	WDR64-201	KNOWN	basic|appris_principal	protein_coding	WDR64	HGNC	protein_coding		49	0.00	0	C	NM_144625		241886720	241886720	+1	no_errors	ENST00000366552	ensembl	human	known	69_37n	silent	51	40.23	35	SNP	0.998	G
WNK4	65266	genome.wustl.edu	37	17	40948000	40948000	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr17:40948000G>A	ENST00000246914.5	+	16	3401	c.3380G>A	c.(3379-3381)aGc>aAc	p.S1127N	CNTD1_ENST00000588408.1_5'Flank|CNTD1_ENST00000588527.1_5'Flank	NM_032387.4	NP_115763.2	Q96J92	WNK4_HUMAN	WNK lysine deficient protein kinase 4	1127					chloride transport (GO:0006821)|distal tubule morphogenesis (GO:0072156)|intracellular signal transduction (GO:0035556)|ion homeostasis (GO:0050801)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)|renal sodium ion absorption (GO:0070294)	cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|prostate(1)|skin(5)|stomach(1)	35		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		GAGTCAGAAAGCAGTGGGGAA	0.592																																					Esophageal Squamous(6;201 374 4964 23855 42828)	dbGAP											0													58.0	57.0	57.0					17																	40948000		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ309861	CCDS11439.1	17q21-q22	2005-01-19	2005-01-19	2005-01-19		ENSG00000126562			14544	protein-coding gene	gene with protein product		601844	"""protein kinase, lysine deficient 4"""	PRKWNK4			Standard	NM_032387		Approved		uc002ibj.3	Q96J92		ENST00000246914.5:c.3380G>A	17.37:g.40948000G>A	ENSP00000246914:p.Ser1127Asn		B0LPI0|Q8N8X3|Q8N8Z2|Q96DT8|Q9BYS5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S1127N	ENST00000246914.5	37	c.3380	CCDS11439.1	17	.	.	.	.	.	.	.	.	.	.	G	15.92	2.974330	0.53720	.	.	ENSG00000126562	ENST00000246914	D	0.93488	-3.23	5.18	5.18	0.71444	.	0.000000	0.56097	D	0.000036	D	0.96213	0.8765	M	0.78916	2.43	0.80722	D	1	D;D	0.89917	1.0;0.996	D;P	0.71870	0.975;0.906	D	0.96494	0.9366	10	0.72032	D	0.01	-14.4827	14.1868	0.65609	0.0:0.0:1.0:0.0	.	1127;1127	Q96J92-3;Q96J92	.;WNK4_HUMAN	N	1127	ENSP00000246914:S1127N	ENSP00000246914:S1127N	S	+	2	0	WNK4	38201526	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	6.520000	0.73773	2.412000	0.81896	0.313000	0.20887	AGC	WNK4	-	NULL	ENSG00000126562		0.592	WNK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNK4	HGNC	protein_coding	OTTHUMT00000452389.1	43	0.00	0	G			40948000	40948000	+1	no_errors	ENST00000246914	ensembl	human	known	69_37n	missense	17	57.50	23	SNP	1.000	A
XIRP2	129446	genome.wustl.edu	37	2	168106216	168106216	+	Nonsense_Mutation	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr2:168106216C>T	ENST00000409195.1	+	9	8403	c.8314C>T	c.(8314-8316)Cag>Tag	p.Q2772*	XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409273.1_Nonsense_Mutation_p.Q2550*|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000295237.9_Nonsense_Mutation_p.Q2772*|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000420519.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	2597					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						AAGACATTATCAGTTACCTAA	0.383																																						dbGAP											0													57.0	54.0	55.0					2																	168106216		1865	4105	5970	-	-	-	SO:0001587	stop_gained	0			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.8314C>T	2.37:g.168106216C>T	ENSP00000386840:p.Gln2772*		A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Nonsense_Mutation	SNP	pfam_Actin-binding_Xin_repeat,superfamily_FH2_actin-bd	p.Q2772*	ENST00000409195.1	37	c.8314	CCDS42769.1	2	.	.	.	.	.	.	.	.	.	.	C	48	13.990453	0.99774	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273;ENST00000413534	.	.	.	6.17	5.28	0.74379	.	0.885593	0.10126	N	0.712778	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	-1.4973	11.8024	0.52135	0.1381:0.7287:0.1332:0.0	.	.	.	.	X	2772;2772;2550;186	.	ENSP00000295237:Q2772X	Q	+	1	0	XIRP2	167814462	0.001000	0.12720	0.013000	0.15412	0.004000	0.04260	0.290000	0.18975	1.565000	0.49641	0.655000	0.94253	CAG	XIRP2	-	NULL	ENSG00000163092		0.383	XIRP2-001	KNOWN	basic|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333547.1	25	0.00	0	C	NM_152381		168106216	168106216	+1	no_errors	ENST00000295237	ensembl	human	known	69_37n	nonsense	27	23.68	9	SNP	0.485	T
ZBBX	79740	genome.wustl.edu	37	3	167051719	167051719	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr3:167051719C>T	ENST00000392766.2	-	10	923	c.583G>A	c.(583-585)Gat>Aat	p.D195N	ZBBX_ENST00000392767.2_Missense_Mutation_p.D195N|ZBBX_ENST00000392764.1_Missense_Mutation_p.D166N|ZBBX_ENST00000455345.2_Missense_Mutation_p.D195N|ZBBX_ENST00000307529.5_Missense_Mutation_p.D195N|ZBBX_ENST00000469220.1_Intron	NM_001199201.1|NM_024687.3	NP_001186130.1|NP_078963.2	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	195						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(9)|liver(1)|lung(38)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	70						GGATTAACATCCTTTATAAAC	0.333																																						dbGAP											0													114.0	100.0	105.0					3																	167051719		1796	4072	5868	-	-	-	SO:0001583	missense	0			AK026702	CCDS3199.2, CCDS56295.1, CCDS56296.1	3q26.1	2010-03-23			ENSG00000169064	ENSG00000169064			26245	protein-coding gene	gene with protein product						12477932	Standard	NM_024687		Approved	FLJ23049	uc011bpc.2	A8MT70	OTTHUMG00000133560	ENST00000392766.2:c.583G>A	3.37:g.167051719C>T	ENSP00000376519:p.Asp195Asn		A8MV69|B3KSC1|B5MDJ6|F2Z370|Q9H5T8	Missense_Mutation	SNP	pfam_Znf_B-box	p.D195N	ENST00000392766.2	37	c.583	CCDS3199.2	3	.	.	.	.	.	.	.	.	.	.	C	6.624	0.483593	0.12581	.	.	ENSG00000169064	ENST00000392766;ENST00000392767;ENST00000455345;ENST00000307529;ENST00000392764	T;T;T;T;T	0.10192	3.07;3.07;3.07;3.07;2.9	5.03	2.22	0.28083	.	0.519308	0.13875	U	0.356775	T	0.06690	0.0171	N	0.14661	0.345	0.20489	N	0.999895	B;B	0.19200	0.034;0.02	B;B	0.22601	0.04;0.011	T	0.36601	-0.9741	10	0.45353	T	0.12	-7.6361	7.7615	0.28955	0.0:0.6192:0.2941:0.0867	.	195;195	A8MT70-2;A8MT70	.;ZBBX_HUMAN	N	195;195;195;195;166	ENSP00000376519:D195N;ENSP00000376520:D195N;ENSP00000390232:D195N;ENSP00000305065:D195N;ENSP00000376517:D166N	ENSP00000305065:D195N	D	-	1	0	ZBBX	168534413	0.561000	0.26578	0.078000	0.20375	0.024000	0.10985	1.048000	0.30379	0.223000	0.20920	-0.932000	0.02703	GAT	ZBBX	-	NULL	ENSG00000169064		0.333	ZBBX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZBBX	HGNC	protein_coding	OTTHUMT00000257657.3	114	0.00	0	C	NM_024687		167051719	167051719	-1	no_errors	ENST00000307529	ensembl	human	known	69_37n	missense	131	25.14	44	SNP	0.617	T
ZCCHC6	79670	genome.wustl.edu	37	9	88916365	88916365	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr9:88916365G>C	ENST00000375963.3	-	26	4418	c.4246C>G	c.(4246-4248)Cag>Gag	p.Q1416E	ZCCHC6_ENST00000375957.1_Missense_Mutation_p.Q316E|ZCCHC6_ENST00000375960.2_Missense_Mutation_p.Q1180E|ZCCHC6_ENST00000375961.2_Missense_Mutation_p.Q1378E|ZCCHC6_ENST00000277141.6_Missense_Mutation_p.Q705E	NM_001185059.1|NM_024617.3	NP_001171988.1|NP_078893.2	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	1416					RNA 3'-end processing (GO:0031123)		poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	46						TTGGCTTTCTGAGGTGTGCAC	0.463																																						dbGAP											0													176.0	140.0	152.0					9																	88916365		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL832026	CCDS35057.1, CCDS55323.1	9q21	2014-03-05			ENSG00000083223	ENSG00000083223		"""Zinc fingers, CCHC domain containing"""	25817	protein-coding gene	gene with protein product	"""TUTase7"""					11214970	Standard	NM_001185059		Approved	KIAA1711, FLJ13409, PAPD6, TUT7	uc004aoq.3	Q5VYS8	OTTHUMG00000020137	ENST00000375963.3:c.4246C>G	9.37:g.88916365G>C	ENSP00000365130:p.Gln1416Glu		Q5H9T0|Q5VYS5|Q5VYS7|Q658Z9|Q659A2|Q6MZJ3|Q8N5F0|Q96N57|Q96NE8|Q9C0F2|Q9H8M6	Missense_Mutation	SNP	pfam_PAP_assoc,pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_U1,smart_Znf_CCHC,pfscan_Znf_CCHC	p.Q1416E	ENST00000375963.3	37	c.4246	CCDS35057.1	9	.	.	.	.	.	.	.	.	.	.	G	13.23	2.175298	0.38413	.	.	ENSG00000083223	ENST00000277141;ENST00000375960;ENST00000375961;ENST00000375957;ENST00000375963	T;T;T;T	0.56776	0.44;0.94;0.89;0.87	5.38	4.47	0.54385	.	0.353536	0.29059	N	0.013276	T	0.33381	0.0861	L	0.27053	0.805	0.21386	N	0.999708	B;P;B	0.36837	0.218;0.571;0.005	B;B;B	0.28011	0.059;0.085;0.004	T	0.17623	-1.0363	10	0.35671	T	0.21	-24.4941	9.5824	0.39495	0.0:0.1409:0.5919:0.2672	.	1378;1180;1416	Q5VYS8-6;Q5VYS8-4;Q5VYS8	.;.;TUT7_HUMAN	E	705;1180;1378;316;1416	ENSP00000277141:Q705E;ENSP00000365127:Q1180E;ENSP00000365128:Q1378E;ENSP00000365130:Q1416E	ENSP00000277141:Q705E	Q	-	1	0	ZCCHC6	88106185	1.000000	0.71417	0.844000	0.33320	0.992000	0.81027	2.539000	0.45718	1.459000	0.47892	0.655000	0.94253	CAG	ZCCHC6	-	NULL	ENSG00000083223		0.463	ZCCHC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC6	HGNC	protein_coding	OTTHUMT00000052918.1	136	0.00	0	G	NM_024617		88916365	88916365	-1	no_errors	ENST00000375963	ensembl	human	known	69_37n	missense	126	32.80	62	SNP	0.899	C
ZNF334	55713	genome.wustl.edu	37	20	45131108	45131108	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr20:45131108C>G	ENST00000347606.4	-	5	1052	c.870G>C	c.(868-870)gaG>gaC	p.E290D	ZNF334_ENST00000457685.2_Missense_Mutation_p.E252D|ZNF334_ENST00000593880.1_Missense_Mutation_p.E313D	NM_018102.4	NP_060572.3	Q9HCZ1	ZN334_HUMAN	zinc finger protein 334	290					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)				CATAGGGTCTCTCTCCAGTAT	0.418																																						dbGAP											0													108.0	108.0	108.0					20																	45131108		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001331	CCDS33480.1, CCDS74736.1	20q13.12	2013-09-20			ENSG00000198185	ENSG00000198185		"""Zinc fingers, C2H2-type"", ""-"""	15806	protein-coding gene	gene with protein product							Standard	NM_018102		Approved	bA179N14.1	uc002xsc.4	Q9HCZ1	OTTHUMG00000032654	ENST00000347606.4:c.870G>C	20.37:g.45131108C>G	ENSP00000255129:p.Glu290Asp		Q5T6U2|Q9NVW4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E290D	ENST00000347606.4	37	c.870	CCDS33480.1	20	.	.	.	.	.	.	.	.	.	.	C	13.54	2.268935	0.40095	.	.	ENSG00000198185	ENST00000457685;ENST00000347606	T;T	0.26810	1.71;1.71	3.3	0.153	0.14897	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.25568	0.0622	L	0.53729	1.69	0.18873	N	0.999986	P;P;P	0.39094	0.659;0.659;0.659	B;B;B	0.43536	0.423;0.423;0.423	T	0.21759	-1.0236	9	0.66056	D	0.02	.	4.1855	0.10395	0.1871:0.5852:0.0:0.2278	.	252;290;313	B3KQ93;Q9HCZ1;Q8N3P8	.;ZN334_HUMAN;.	D	252;290	ENSP00000402582:E252D;ENSP00000255129:E290D	ENSP00000255129:E290D	E	-	3	2	ZNF334	44564515	0.979000	0.34478	0.005000	0.12908	0.981000	0.71138	1.806000	0.38892	0.202000	0.20498	0.591000	0.81541	GAG	ZNF334	-	pfscan_Znf_C2H2	ENSG00000198185		0.418	ZNF334-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF334	HGNC	protein_coding	OTTHUMT00000079575.1	47	0.00	0	C			45131108	45131108	-1	no_errors	ENST00000347606	ensembl	human	known	69_37n	missense	45	38.36	28	SNP	0.166	G
ZNF460	10794	genome.wustl.edu	37	19	57802084	57802084	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr19:57802084G>A	ENST00000360338.3	+	3	497	c.175G>A	c.(175-177)Gag>Aag	p.E59K	ZNF460_ENST00000537645.1_Missense_Mutation_p.E18K	NM_006635.3	NP_006626.3	Q14592	ZN460_HUMAN	zinc finger protein 460	59	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|large_intestine(2)|lung(9)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		CACAAAACCTGAGACCGTAGA	0.453																																						dbGAP											0													61.0	54.0	56.0					19																	57802084		2203	4300	6503	-	-	-	SO:0001583	missense	0			X78931	CCDS12949.1	19q13.4	2013-01-08				ENSG00000197714		"""Zinc fingers, C2H2-type"", ""-"""	21628	protein-coding gene	gene with protein product		604755	"""zinc finger protein 272"""	ZNF272		15004467	Standard	NM_006635		Approved	HZF8	uc002qog.2	Q14592		ENST00000360338.3:c.175G>A	19.37:g.57802084G>A	ENSP00000353491:p.Glu59Lys		A4FU64|B4DNX9|Q2VPC7|Q6VSF8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E59K	ENST00000360338.3	37	c.175	CCDS12949.1	19	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.765109	0.00651	.	.	ENSG00000197714	ENST00000537645;ENST00000360338	T;T	0.13307	2.6;2.6	2.23	-4.47	0.03525	Krueppel-associated box (3);	.	.	.	.	T	0.05410	0.0143	N	0.25957	0.775	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.44787	-0.9305	9	0.05436	T	0.98	.	1.1105	0.01703	0.2866:0.2688:0.3088:0.1357	.	59	Q14592	ZN460_HUMAN	K	18;59	ENSP00000446167:E18K;ENSP00000353491:E59K	ENSP00000353491:E59K	E	+	1	0	ZNF460	62493896	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-1.637000	0.02015	-2.735000	0.00382	-1.141000	0.01876	GAG	ZNF460	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000197714		0.453	ZNF460-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF460	HGNC	protein_coding	OTTHUMT00000465727.1	15	0.00	0	G	NM_006635		57802084	57802084	+1	no_errors	ENST00000360338	ensembl	human	known	69_37n	missense	23	34.29	12	SNP	0.000	A
ZNF532	55205	genome.wustl.edu	37	18	56587083	56587083	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr18:56587083G>T	ENST00000336078.4	+	4	2340	c.1564G>T	c.(1564-1566)Gtg>Ttg	p.V522L	ZNF532_ENST00000591083.1_Missense_Mutation_p.V522L|ZNF532_ENST00000591230.1_Missense_Mutation_p.V522L|ZNF532_ENST00000591808.1_Missense_Mutation_p.V522L|ZNF532_ENST00000589288.1_Missense_Mutation_p.V522L	NM_018181.4	NP_060651.2	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	522					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(14)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(4)|urinary_tract(1)	52						GCCAAAGACTGTGCACCTTGC	0.552																																						dbGAP											0													41.0	36.0	38.0					18																	56587083		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046849	CCDS11969.1	18q21.32	2005-08-22			ENSG00000074657	ENSG00000074657		"""Zinc fingers, C2H2-type"""	30940	protein-coding gene	gene with protein product						10997877	Standard	XM_005266723		Approved	FLJ10697	uc002lho.3	Q9HCE3	OTTHUMG00000132759	ENST00000336078.4:c.1564G>T	18.37:g.56587083G>T	ENSP00000338217:p.Val522Leu		Q4G0V6|Q7L7Z7|Q96QR7|Q9NVJ6	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V522L	ENST00000336078.4	37	c.1564	CCDS11969.1	18	.	.	.	.	.	.	.	.	.	.	g	19.37	3.815213	0.70912	.	.	ENSG00000074657	ENST00000336078	T	0.01838	4.61	5.6	5.6	0.85130	.	0.061529	0.64402	N	0.000004	T	0.12561	0.0305	M	0.69823	2.125	0.58432	D	0.999997	D	0.65815	0.995	D	0.74674	0.984	T	0.00144	-1.1994	10	0.51188	T	0.08	-19.8536	18.4878	0.90835	0.0:0.0:1.0:0.0	.	522	Q9HCE3	ZN532_HUMAN	L	522	ENSP00000338217:V522L	ENSP00000338217:V522L	V	+	1	0	ZNF532	54738063	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.952000	0.87827	2.663000	0.90544	0.544000	0.68410	GTG	ZNF532	-	NULL	ENSG00000074657		0.552	ZNF532-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF532	HGNC	protein_coding	OTTHUMT00000256130.1	34	0.00	0	G	NM_018181		56587083	56587083	+1	no_errors	ENST00000336078	ensembl	human	known	69_37n	missense	26	42.22	19	SNP	1.000	T
ZNF846	162993	genome.wustl.edu	37	19	9868536	9868536	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr19:9868536G>A	ENST00000397902.2	-	6	1630	c.1217C>T	c.(1216-1218)tCc>tTc	p.S406F	ZNF846_ENST00000592859.1_Intron|ZNF846_ENST00000586293.1_3'UTR|ZNF846_ENST00000588267.1_Intron	NM_001077624.1	NP_001071092.1	Q147U1	ZN846_HUMAN	zinc finger protein 846	406					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	22						AAGCATTGAGGAATTATTAAA	0.403																																						dbGAP											0													92.0	103.0	99.0					19																	9868536		2178	4296	6474	-	-	-	SO:0001583	missense	0			AK097652	CCDS42496.1	19p13.2	2013-01-08			ENSG00000196605	ENSG00000196605		"""Zinc fingers, C2H2-type"", ""-"""	27260	protein-coding gene	gene with protein product							Standard	NM_001077624		Approved		uc002mmb.1	Q147U1		ENST00000397902.2:c.1217C>T	19.37:g.9868536G>A	ENSP00000380999:p.Ser406Phe		A8K0H1|B3KUP1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,smart_Znf_BED_prd,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S406F	ENST00000397902.2	37	c.1217	CCDS42496.1	19	.	.	.	.	.	.	.	.	.	.	.	15.06	2.720744	0.48728	.	.	ENSG00000196605	ENST00000397902	T	0.01209	5.17	2.01	0.888	0.19206	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02342	0.0072	M	0.76574	2.34	0.09310	N	1	D	0.53151	0.958	P	0.45577	0.486	T	0.43956	-0.9359	8	.	.	.	.	7.7199	0.28725	0.0:0.5239:0.4761:0.0	.	406	Q147U1	ZN846_HUMAN	F	406	ENSP00000380999:S406F	.	S	-	2	0	ZNF846	9729536	0.000000	0.05858	0.002000	0.10522	0.952000	0.60782	-0.851000	0.04313	0.385000	0.24970	0.456000	0.33151	TCC	ZNF846	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196605		0.403	ZNF846-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF846	HGNC	protein_coding	OTTHUMT00000450253.1	106	0.00	0	G	NM_001077624		9868536	9868536	-1	no_errors	ENST00000397902	ensembl	human	known	69_37n	missense	57	36.26	33	SNP	0.000	A
ZNF564	163050	genome.wustl.edu	37	19	12638670	12638670	+	Silent	SNP	G	G	A			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr19:12638670G>A	ENST00000339282.7	-	4	448	c.252C>T	c.(250-252)ttC>ttT	p.F84F	ZNF709_ENST00000428311.1_Intron|CTD-2192J16.21_ENST00000601420.1_RNA|CTD-2192J16.20_ENST00000593682.1_3'UTR	NM_144976.3	NP_659413.1	Q8TBZ8	ZN564_HUMAN	zinc finger protein 564	84					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18						GAATCTGACTGAAGGCTTCTC	0.358																																						dbGAP											0													79.0	80.0	80.0					19																	12638670		1987	4171	6158	-	-	-	SO:0001819	synonymous_variant	0			BC028367	CCDS42505.1	19p13.2	2013-09-19			ENSG00000249709	ENSG00000249709		"""Zinc fingers, C2H2-type"", ""-"""	31106	protein-coding gene	gene with protein product							Standard	NM_144976		Approved	MGC26914		Q8TBZ8	OTTHUMG00000156418	ENST00000339282.7:c.252C>T	19.37:g.12638670G>A			B9EGT4|Q6P1K6	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F84	ENST00000339282.7	37	c.252	CCDS42505.1	19																																																																																			ZNF564	-	NULL	ENSG00000249709		0.358	ZNF564-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF564	HGNC	protein_coding	OTTHUMT00000344120.2	35	0.00	0	G	NM_144976		12638670	12638670	-1	no_errors	ENST00000339282	ensembl	human	known	69_37n	silent	28	34.88	15	SNP	0.782	A
ZSCAN5C	649137	genome.wustl.edu	37	19	56720231	56720231	+	Nonsense_Mutation	SNP	C	C	T			TCGA-D8-A1J9-01A-11D-A13L-09	TCGA-D8-A1J9-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6627e4b1-b34c-4aa2-836e-093061442a6d	6014c1c1-0619-4ea0-9f83-1e7a2523a083	g.chr19:56720231C>T	ENST00000534327.1	+	5	1302	c.1153C>T	c.(1153-1155)Cag>Tag	p.Q385*	ZSCAN5C_ENST00000376267.1_Nonsense_Mutation_p.Q385*			A6NGD5	ZSA5C_HUMAN	zinc finger and SCAN domain containing 5C	385					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|lung(6)|stomach(1)	8						GAGACTCTTTCAGTGTAATCT	0.557																																						dbGAP											0																																										-	-	-	SO:0001587	stop_gained	0					19q13.43	2013-01-08			ENSG00000204532	ENSG00000204532		"""-"", ""Zinc fingers, C2H2-type"""	34294	protein-coding gene	gene with protein product							Standard	NG_012782		Approved	ZNF495C		A6NGD5	OTTHUMG00000167475	ENST00000534327.1:c.1153C>T	19.37:g.56720231C>T	ENSP00000435234:p.Gln385*			Nonsense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.Q385*	ENST00000534327.1	37	c.1153		19	.	.	.	.	.	.	.	.	.	.	C	12.56	1.974131	0.34848	.	.	ENSG00000204532	ENST00000534327;ENST00000376267	.	.	.	1.38	0.265	0.15612	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	.	4.1464	0.10217	0.6108:0.3892:0.0:0.0	.	.	.	.	X	385	.	ENSP00000365443:Q385X	Q	+	1	0	ZSCAN5C	61412043	0.000000	0.05858	0.008000	0.14137	0.023000	0.10783	-7.280000	0.00040	0.033000	0.15463	0.195000	0.17529	CAG	ZSCAN5C	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000204532		0.557	ZSCAN5C-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	ZSCAN5C	HGNC	protein_coding	OTTHUMT00000394739.1	46	0.00	0	C	XM_001131980		56720231	56720231	+1	no_errors	ENST00000376267	ensembl	human	known	69_37n	nonsense	36	28.85	15	SNP	0.076	T
