#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AHI1	54806	genome.wustl.edu	37	6	135751072	135751072	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JB-01A-11D-A13L-09	TCGA-D8-A1JB-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	54621c54-b7ef-48e4-aa68-e2fe10bf0afb	999fc643-568d-4513-9a75-6c68987a2628	g.chr6:135751072G>A	ENST00000367800.4	-	16	2656	c.2440C>T	c.(2440-2442)Cgt>Tgt	p.R814C	AHI1_ENST00000417892.2_Missense_Mutation_p.R168C|AHI1_ENST00000327035.6_Missense_Mutation_p.R814C|AHI1_ENST00000457866.2_Missense_Mutation_p.R814C	NM_001134830.1	NP_001128302.1	Q8N157	AHI1_HUMAN	Abelson helper integration site 1	814					cellular protein localization (GO:0034613)|central nervous system development (GO:0007417)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|cloaca development (GO:0035844)|heart looping (GO:0001947)|hindbrain development (GO:0030902)|Kupffer's vesicle development (GO:0070121)|left/right axis specification (GO:0070986)|morphogenesis of a polarized epithelium (GO:0001738)|negative regulation of apoptotic process (GO:0043066)|otic vesicle development (GO:0071599)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of polarized epithelial cell differentiation (GO:0030862)|positive regulation of receptor internalization (GO:0002092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pronephric duct morphogenesis (GO:0039023)|pronephric nephron tubule morphogenesis (GO:0039008)|protein localization to organelle (GO:0033365)|regulation of behavior (GO:0050795)|retina layer formation (GO:0010842)|specification of axis polarity (GO:0065001)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vesicle targeting (GO:0006903)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|nonmotile primary cilium (GO:0031513)|photoreceptor outer segment (GO:0001750)|primary cilium (GO:0072372)|TCTN-B9D complex (GO:0036038)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)	37	Breast(56;0.239)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00904)|OV - Ovarian serous cystadenocarcinoma(155;0.00991)		ATTAACAAACGTTTTCCATTG	0.308																																						dbGAP											0													64.0	61.0	62.0					6																	135751072		1805	4073	5878	-	-	-	SO:0001583	missense	0			AJ459824	CCDS47483.1, CCDS47484.1	6q23.2	2013-01-10	2005-11-29		ENSG00000135541	ENSG00000135541		"""WD repeat domain containing"""	21575	protein-coding gene	gene with protein product	"""Jouberin"""	608894	"""Abelson helper integration site"""			15060101, 16240161	Standard	NM_017651		Approved	FLJ20069, ORF1, JBTS3	uc003qgj.3	Q8N157	OTTHUMG00000015631	ENST00000367800.4:c.2440C>T	6.37:g.135751072G>A	ENSP00000356774:p.Arg814Cys		E1P584|Q4FD35|Q504T3|Q5TCP9|Q6P098|Q6PIT6|Q8NDX0|Q9H0H2	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_SH3_domain,pfam_SH3_2,superfamily_WD40_repeat_dom,superfamily_SH3_domain,smart_WD40_repeat,smart_SH3_domain,pfscan_SH3_domain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_SH3_domain	p.R814C	ENST00000367800.4	37	c.2440	CCDS47483.1	6	.	.	.	.	.	.	.	.	.	.	G	18.74	3.689552	0.68271	.	.	ENSG00000135541	ENST00000367800;ENST00000457866;ENST00000417892;ENST00000265602;ENST00000327035;ENST00000367801	T;T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23;-0.23	4.92	4.92	0.64577	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.171886	0.50627	D	0.000101	T	0.69940	0.3167	M	0.65498	2.005	0.80722	D	1	P;P;D	0.76494	0.941;0.902;0.999	B;B;P	0.53689	0.244;0.173;0.732	T	0.74372	-0.3687	10	0.59425	D	0.04	-12.5208	18.1127	0.89540	0.0:0.0:1.0:0.0	.	814;814;814	Q8N157-2;Q8N157;Q4FD35	.;AHI1_HUMAN;.	C	814;814;168;814;814;814	ENSP00000356774:R814C;ENSP00000388650:R814C;ENSP00000416867:R168C;ENSP00000265602:R814C;ENSP00000322478:R814C	ENSP00000265602:R814C	R	-	1	0	AHI1	135792765	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.707000	0.68370	2.257000	0.74773	0.585000	0.79938	CGT	AHI1	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom	ENSG00000135541		0.308	AHI1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	AHI1	HGNC	protein_coding	OTTHUMT00000391948.1	72	0.00	0	G	NM_017651		135751072	135751072	-1	no_errors	ENST00000265602	ensembl	human	known	69_37n	missense	32	17.95	7	SNP	1.000	A
ARAF	369	genome.wustl.edu	37	X	47422467	47422467	+	Intron	SNP	G	G	A			TCGA-D8-A1JB-01A-11D-A13L-09	TCGA-D8-A1JB-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	54621c54-b7ef-48e4-aa68-e2fe10bf0afb	999fc643-568d-4513-9a75-6c68987a2628	g.chrX:47422467G>A	ENST00000377045.4	+	2	290				ARAF_ENST00000290277.6_Intron|ARAF_ENST00000377039.2_Intron	NM_001256196.1|NM_001654.4	NP_001243125.1|NP_001645.1	P10398	ARAF_HUMAN	A-Raf proto-oncogene, serine/threonine kinase						cellular protein modification process (GO:0006464)|negative regulation of apoptotic process (GO:0043066)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|regulation of TOR signaling (GO:0032006)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			biliary_tract(1)|endometrium(4)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	29					Adenosine triphosphate(DB00171)	ACGGTGGTGAGTCATGGAAGC	0.607											OREG0019758	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													39.0	35.0	36.0					X																	47422467		2198	4297	6495	-	-	-	SO:0001627	intron_variant	0			X04790	CCDS35232.1, CCDS59164.1, CCDS75970.1	Xp11.3-p11.23	2014-06-26	2014-06-26	2005-01-19	ENSG00000078061	ENSG00000078061			646	protein-coding gene	gene with protein product		311010	"""v-raf murine sarcoma 3611 viral oncogene homolog 1"""	ARAF1			Standard	NM_001654		Approved		uc004dic.2	P10398	OTTHUMG00000021446	ENST00000377045.4:c.96+5G>A	X.37:g.47422467G>A		946	P07557|Q5H9B2|Q5H9B3	Splice_Site	SNP	-	NULL	ENST00000377045.4	37	c.NULL	CCDS35232.1	X																																																																																			ARAF	-	-	ENSG00000078061		0.607	ARAF-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	ARAF	HGNC	protein_coding	OTTHUMT00000056418.1	37	0.00	0	G			47422467	47422467	+1	no_errors	ENST00000489496	ensembl	human	known	69_37n	splice_site	33	17.50	7	SNP	1.000	A
SPECC1	92521	genome.wustl.edu	37	17	20224726	20224726	+	IGR	SNP	G	G	A			TCGA-D8-A1JB-01A-11D-A13L-09	TCGA-D8-A1JB-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	54621c54-b7ef-48e4-aa68-e2fe10bf0afb	999fc643-568d-4513-9a75-6c68987a2628	g.chr17:20224726G>A	ENST00000395530.2	+	0	8133				AC004702.2_ENST00000580225.1_lincRNA|U6_ENST00000517027.1_RNA|CCDC144CP_ENST00000340196.4_RNA	NM_001033555.2	NP_001028727.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1						cell adhesion (GO:0007155)	nucleus (GO:0005634)				breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)		CAGGAGCCAGGAGGACCAGTG	0.632																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487			30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793				15602574, 18763323, 15087372	Standard	NM_001033553		Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808		17.37:g.20224726G>A			B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	RNA	SNP	-	NULL	ENST00000395530.2	37	NULL	CCDS42281.1	17	.	.	.	.	.	.	.	.	.	.	.	1.419	-0.573351	0.03882	.	.	ENSG00000154898	ENST00000340196;ENST00000425519	.	.	.	0.361	-0.721	0.11189	.	.	.	.	.	T	0.12263	0.0298	.	.	.	0.23506	N	0.997538	.	.	.	.	.	.	T	0.38478	-0.9659	3	0.05833	T	0.94	.	.	.	.	.	.	.	.	K	33	.	ENSP00000343605:E33K	E	+	1	0	CCDC144C	20165318	0.014000	0.17966	0.001000	0.08648	0.001000	0.01503	0.219000	0.17641	-0.487000	0.06735	-0.474000	0.04947	GAG	CCDC144C	-	-	ENSG00000154898		0.632	SPECC1-004	KNOWN	basic|CCDS	protein_coding	CCDC144C	HGNC	protein_coding	OTTHUMT00000132368.3	38	0.00	0	G	NM_152904		20224726	20224726	+1	no_errors	ENST00000340196	ensembl	human	known	69_37n	rna	22	15.38	4	SNP	0.001	A
CDC37	11140	genome.wustl.edu	37	19	10502337	10502337	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JB-01A-11D-A13L-09	TCGA-D8-A1JB-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	54621c54-b7ef-48e4-aa68-e2fe10bf0afb	999fc643-568d-4513-9a75-6c68987a2628	g.chr19:10502337C>T	ENST00000222005.2	-	8	1080	c.1027G>A	c.(1027-1029)Gtc>Atc	p.V343I		NM_007065.3	NP_008996.1	Q16543	CDC37_HUMAN	cell division cycle 37	343					protein targeting (GO:0006605)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	heat shock protein binding (GO:0031072)|unfolded protein binding (GO:0051082)			breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	16			OV - Ovarian serous cystadenocarcinoma(20;4.65e-10)|Epithelial(33;6.48e-07)|all cancers(31;2.31e-06)	GBM - Glioblastoma multiforme(1328;0.0318)		GAGTTGGGGACCCAGAGGCCA	0.622											OREG0025234	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													79.0	69.0	73.0					19																	10502337		2203	4300	6503	-	-	-	SO:0001583	missense	0			U63131	CCDS12237.1	19p13.2	2013-01-17	2013-01-17		ENSG00000105401	ENSG00000105401			1735	protein-coding gene	gene with protein product	"""CDC37 cell division cycle 37 homolog"", ""Hsp90 co-chaperone Cdc37"", ""CDC37 (cell division cycle 37, S. cerevisiae, homolog)"""	605065	"""CDC37 (cell division cycle 37, S. cerevisiae, homolog)"", ""CDC37 cell division cycle 37 homolog (S. cerevisiae)"", ""cell division cycle 37 homolog (S. cerevisiae)"""			8703009, 8666233	Standard	NM_007065		Approved	P50CDC37	uc002mof.1	Q16543		ENST00000222005.2:c.1027G>A	19.37:g.10502337C>T	ENSP00000222005:p.Val343Ile	665	Q53YA2	Missense_Mutation	SNP	pfam_Cdc37_Hsp90-bd,pfam_Cdc37_N_dom,pfam_Cdc37_C	p.V343I	ENST00000222005.2	37	c.1027	CCDS12237.1	19	.	.	.	.	.	.	.	.	.	.	C	14.84	2.656130	0.47467	.	.	ENSG00000105401	ENST00000222005	T	0.45276	0.9	4.03	4.03	0.46877	Cdc37, C-terminal (1);	0.000000	0.64402	D	0.000001	T	0.40909	0.1136	L	0.60455	1.87	0.80722	D	1	B;B;B	0.15930	0.002;0.002;0.015	B;B;B	0.17722	0.006;0.006;0.019	T	0.39313	-0.9620	10	0.48119	T	0.1	.	14.0205	0.64550	0.0:1.0:0.0:0.0	.	343;343;75	Q6FG59;Q16543;A1L0W4	.;CDC37_HUMAN;.	I	343	ENSP00000222005:V343I	ENSP00000222005:V343I	V	-	1	0	CDC37	10363337	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	7.094000	0.76944	1.970000	0.57323	0.448000	0.29417	GTC	CDC37	-	pfam_Cdc37_C	ENSG00000105401		0.622	CDC37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC37	HGNC	protein_coding	OTTHUMT00000451987.1	24	0.00	0	C	NM_007065		10502337	10502337	-1	no_errors	ENST00000222005	ensembl	human	known	69_37n	missense	31	16.22	6	SNP	1.000	T
CLDND1	56650	genome.wustl.edu	37	3	98240072	98240072	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1JB-01A-11D-A13L-09	TCGA-D8-A1JB-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	54621c54-b7ef-48e4-aa68-e2fe10bf0afb	999fc643-568d-4513-9a75-6c68987a2628	g.chr3:98240072T>C	ENST00000503004.1	-	2	1076	c.197A>G	c.(196-198)gAt>gGt	p.D66G	CLDND1_ENST00000394180.2_Missense_Mutation_p.D66G|CLDND1_ENST00000341181.6_Missense_Mutation_p.D66G|CLDND1_ENST00000502288.1_Intron|CLDND1_ENST00000510545.1_Missense_Mutation_p.D66G|CLDND1_ENST00000437922.1_Missense_Mutation_p.D89G|CLDND1_ENST00000394181.2_Missense_Mutation_p.D66G|CLDND1_ENST00000511081.1_Intron|CLDND1_ENST00000394185.2_Missense_Mutation_p.D66G|RP11-227H4.5_ENST00000502999.1_RNA|CLDND1_ENST00000508503.1_5'UTR|CLDND1_ENST00000507874.1_Missense_Mutation_p.D66G|CLDND1_ENST00000513287.1_Missense_Mutation_p.D66G			Q9NY35	CLDN1_HUMAN	claudin domain containing 1	66						apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)	9						AAAAAGTGCATCATTATAAGT	0.388																																						dbGAP											0													156.0	140.0	146.0					3																	98240072		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF116664	CCDS2930.1, CCDS43116.1	3q12.1	2005-12-23	2005-12-23	2005-12-23		ENSG00000080822			1322	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 4"""	C3orf4			Standard	NM_001040181		Approved		uc003dst.3	Q9NY35		ENST00000503004.1:c.197A>G	3.37:g.98240072T>C	ENSP00000421226:p.Asp66Gly		B3KQR1|D3DN36|F2Z2D9|Q502Y8|Q6UVX2|Q9BUZ9|Q9NZZ5|Q9Y4S9	Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin	p.D89G	ENST00000503004.1	37	c.266	CCDS2930.1	3	.	.	.	.	.	.	.	.	.	.	T	23.8	4.456310	0.84317	.	.	ENSG00000080822	ENST00000507874;ENST00000341181;ENST00000437922;ENST00000394180;ENST00000506885;ENST00000503004;ENST00000394185;ENST00000394181;ENST00000510545;ENST00000513287;ENST00000511667;ENST00000513452;ENST00000502299;ENST00000508902;ENST00000514537;ENST00000515620;ENST00000507944;ENST00000508659;ENST00000503621;ENST00000508071;ENST00000513130;ENST00000506575	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.69685	-0.22;-0.22;-0.22;-0.22;-0.42;-0.22;-0.22;-0.22;-0.22;-0.22;-0.22;-0.22;-0.22;-0.22;-0.22;-0.22;-0.22;-0.22	5.0	5.0	0.66597	.	0.046415	0.85682	D	0.000000	T	0.76104	0.3941	M	0.68952	2.095	0.80722	D	1	D;D;D	0.61697	0.99;0.99;0.987	P;P;P	0.60949	0.881;0.808;0.856	T	0.75833	-0.3178	10	0.37606	T	0.19	-18.879	12.6766	0.56897	0.0:0.0:0.0:1.0	.	66;66;66	D6RCR8;Q9NY35;Q9NY35-2	.;CLDN1_HUMAN;.	G	66;66;89;66;19;66;66;66;66;66;44;66;66;66;66;66;66;66;44;66;66;66	ENSP00000422428:D66G;ENSP00000340247:D66G;ENSP00000388457:D89G;ENSP00000377734:D66G;ENSP00000422116:D19G;ENSP00000421226:D66G;ENSP00000377739:D66G;ENSP00000377735:D66G;ENSP00000423590:D66G;ENSP00000426869:D66G;ENSP00000423732:D44G;ENSP00000425539:D66G;ENSP00000420913:D66G;ENSP00000421413:D66G;ENSP00000423151:D66G;ENSP00000423093:D66G;ENSP00000425204:D66G;ENSP00000427658:D66G	ENSP00000340247:D66G	D	-	2	0	CLDND1	99722762	1.000000	0.71417	0.974000	0.42286	0.996000	0.88848	5.394000	0.66285	1.881000	0.54492	0.533000	0.62120	GAT	CLDND1	-	NULL	ENSG00000080822		0.388	CLDND1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CLDND1	HGNC	protein_coding	OTTHUMT00000359071.1	71	0.00	0	T	NM_019895		98240072	98240072	-1	no_errors	ENST00000437922	ensembl	human	known	69_37n	missense	53	15.87	10	SNP	0.959	C
CST9	128822	genome.wustl.edu	37	20	23584193	23584193	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JB-01A-11D-A13L-09	TCGA-D8-A1JB-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	54621c54-b7ef-48e4-aa68-e2fe10bf0afb	999fc643-568d-4513-9a75-6c68987a2628	g.chr20:23584193C>T	ENST00000376971.3	-	2	445	c.434G>A	c.(433-435)gGc>gAc	p.G145D		NM_001008693.2	NP_001008693.2	Q5W186	CST9_HUMAN	cystatin 9 (testatin)	145						extracellular region (GO:0005576)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			central_nervous_system(2)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	12	Colorectal(13;0.0993)					TGCTCCTGTGCCCACACCACA	0.572																																						dbGAP											0													148.0	110.0	123.0					20																	23584193		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF494536	CCDS33450.1	20p11.21	2012-08-14			ENSG00000173335	ENSG00000173335			13261	protein-coding gene	gene with protein product						20565543	Standard	NM_001008693		Approved	CLM, CTES7A	uc002wtl.3	Q5W186	OTTHUMG00000032076	ENST00000376971.3:c.434G>A	20.37:g.23584193C>T	ENSP00000366170:p.Gly145Asp		B2RP76|Q8TD53	Missense_Mutation	SNP	pfam_Prot_inh_cystat	p.G145D	ENST00000376971.3	37	c.434	CCDS33450.1	20	.	.	.	.	.	.	.	.	.	.	c	12.11	1.840924	0.32513	.	.	ENSG00000173335	ENST00000376971	D	0.99121	-5.45	2.19	-0.954	0.10359	.	3.546850	0.01692	N	0.026738	D	0.95338	0.8487	N	0.08118	0	0.09310	N	1	B	0.31290	0.318	B	0.33750	0.169	D	0.93422	0.6778	10	0.62326	D	0.03	.	1.9938	0.03452	0.2622:0.3908:0.0:0.347	.	145	Q5W186	CST9_HUMAN	D	145	ENSP00000366170:G145D	ENSP00000366170:G145D	G	-	2	0	CST9	23532193	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.622000	0.05553	-0.237000	0.09739	-0.217000	0.12591	GGC	CST9	-	NULL	ENSG00000173335		0.572	CST9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CST9	HGNC	protein_coding	OTTHUMT00000078341.1	54	0.00	0	C	NM_001008693.1		23584193	23584193	-1	no_errors	ENST00000376971	ensembl	human	known	69_37n	missense	112	14.50	19	SNP	0.000	T
DOCK2	1794	genome.wustl.edu	37	5	169138958	169138958	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A1JB-01A-11D-A13L-09	TCGA-D8-A1JB-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	54621c54-b7ef-48e4-aa68-e2fe10bf0afb	999fc643-568d-4513-9a75-6c68987a2628	g.chr5:169138958A>T	ENST00000256935.8	+	16	1582	c.1502A>T	c.(1501-1503)gAc>gTc	p.D501V	DOCK2_ENST00000540750.1_5'UTR|DOCK2_ENST00000520908.1_Missense_Mutation_p.T28S	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	501	DHR-1.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CCTATTGAAGACATGCAGAGG	0.522																																						dbGAP											0													190.0	159.0	170.0					5																	169138958		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.1502A>T	5.37:g.169138958A>T	ENSP00000256935:p.Asp501Val		Q2M3I0|Q96AK7	Missense_Mutation	SNP	pfam_DOCK,pfam_SH3_2,superfamily_SH3_domain,superfamily_Cyt_c_dom,superfamily_ARM-type_fold,superfamily_Ferritin/RR-like,smart_SH3_domain,pfscan_SH3_domain	p.D501V	ENST00000256935.8	37	c.1502	CCDS4371.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	21.7|21.7	4.181067|4.181067	0.78677|0.78677	.|.	.|.	ENSG00000134516|ENSG00000134516	ENST00000256935;ENST00000343291|ENST00000520908	T|T	0.12774|0.04809	2.65|3.55	5.7|5.7	5.7|5.7	0.88788|0.88788	.|.	0.148199|.	0.64402|.	D|.	0.000011|.	T|T	0.08088|0.08088	0.0202|0.0202	L|L	0.61387|0.61387	1.9|1.9	0.80722|0.80722	D|D	1|1	B;B|B	0.29766|0.19817	0.195;0.256|0.039	B;B|B	0.40702|0.16722	0.338;0.259|0.016	T|T	0.19128|0.19128	-1.0315|-1.0315	10|9	0.45353|0.22109	T|T	0.12|0.4	.|.	15.9662|15.9662	0.79974|0.79974	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	501;501|28	E5RFJ0;Q92608|E7ERW7	.;DOCK2_HUMAN|.	V|S	501;19|28	ENSP00000256935:D501V|ENSP00000429283:T28S	ENSP00000256935:D501V|ENSP00000429283:T28S	D|T	+|+	2|1	0|0	DOCK2|DOCK2	169071536|169071536	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.463000|7.463000	0.80869|0.80869	2.170000|2.170000	0.68504|0.68504	0.533000|0.533000	0.62120|0.62120	GAC|ACA	DOCK2	-	NULL	ENSG00000134516		0.522	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	HGNC	protein_coding	OTTHUMT00000252828.2	87	0.00	0	A	NM_004946		169138958	169138958	+1	no_errors	ENST00000256935	ensembl	human	known	69_37n	missense	103	25.90	36	SNP	1.000	T
FAM21C	253725	genome.wustl.edu	37	10	46254848	46254848	+	Splice_Site	SNP	A	A	T			TCGA-D8-A1JB-01A-11D-A13L-09	TCGA-D8-A1JB-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	54621c54-b7ef-48e4-aa68-e2fe10bf0afb	999fc643-568d-4513-9a75-6c68987a2628	g.chr10:46254848A>T	ENST00000336378.4	+	17	1752	c.1634A>T	c.(1633-1635)gAg>gTg	p.E545V	FAM21C_ENST00000540872.1_Splice_Site_p.E545V|FAM21C_ENST00000374362.2_Splice_Site_p.E545V|FAM21C_ENST00000537517.1_Splice_Site_p.E521V|FAM21C_ENST00000359860.4_Splice_Site_p.E489V	NM_015262.2	NP_056077.2	Q9Y4E1	FA21C_HUMAN	family with sequence similarity 21, member C	545					retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|endosome (GO:0005768)|plasma membrane (GO:0005886)|WASH complex (GO:0071203)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28						GAGGACTCTGAGGTATGGAAT	0.363																																						dbGAP											0													11.0	14.0	13.0					10																	46254848		1733	4009	5742	-	-	-	SO:0001630	splice_region_variant	0				CCDS44374.1, CCDS44374.2, CCDS53528.1, CCDS53529.1	10q11.22	2014-05-09			ENSG00000172661	ENSG00000172661			23414	protein-coding gene	gene with protein product		613631				20498093	Standard	NM_015262		Approved	Em:AC012044.3, KIAA0592	uc001jcu.3	Q9Y4E1	OTTHUMG00000018089	ENST00000336378.4:c.1635+1A>T	10.37:g.46254848A>T			B4DZQ6|B9EK53|F5H0J6|F5H871|Q5SQU4|Q5SQU5|Q7L521|Q9UG79	Missense_Mutation	SNP	NULL	p.E545V	ENST00000336378.4	37	c.1634		10	.	.	.	.	.	.	.	.	.	.	A	16.91	3.253831	0.59212	.	.	ENSG00000172661	ENST00000336378;ENST00000540872;ENST00000537517;ENST00000374362;ENST00000399588;ENST00000359860;ENST00000436993	.	.	.	3.26	3.26	0.37387	.	0.328436	0.32952	N	0.005457	T	0.76162	0.3949	M	0.78916	2.43	0.80722	D	1	P;D;D;D	0.89917	0.675;0.975;0.975;1.0	B;P;P;D	0.91635	0.265;0.794;0.794;0.999	T	0.77892	-0.2418	9	0.62326	D	0.03	-19.8372	9.8834	0.41247	1.0:0.0:0.0:0.0	.	521;545;545;490	F5H871;Q9Y4E1-4;Q9Y4E1;Q9Y4E1-3	.;.;FA21C_HUMAN;.	V	545;545;521;545;545;489;457	.	ENSP00000337541:E545V	E	+	2	0	FAM21C	45574854	1.000000	0.71417	1.000000	0.80357	0.781000	0.44180	5.067000	0.64357	1.493000	0.48517	0.347000	0.21830	GAG	FAM21C	-	NULL	ENSG00000172661		0.363	FAM21C-201	KNOWN	basic|appris_candidate	protein_coding	FAM21C	HGNC	protein_coding		61	0.00	0	A		Missense_Mutation	46254848	46254848	+1	no_errors	ENST00000374362	ensembl	human	known	69_37n	missense	72	12.20	10	SNP	1.000	T
FAT1	2195	genome.wustl.edu	37	4	187518179	187518179	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1JB-01A-11D-A13L-09	TCGA-D8-A1JB-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	54621c54-b7ef-48e4-aa68-e2fe10bf0afb	999fc643-568d-4513-9a75-6c68987a2628	g.chr4:187518179G>T	ENST00000441802.2	-	25	12724	c.12515C>A	c.(12514-12516)tCc>tAc	p.S4172Y	FAT1_ENST00000512347.1_5'Flank	NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	4172					actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						CCACGGCGTGGACACATACTG	0.547										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)	dbGAP											0													98.0	98.0	98.0					4																	187518179		2064	4213	6277	-	-	-	SO:0001583	missense	0			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.12515C>A	4.37:g.187518179G>T	ENSP00000406229:p.Ser4172Tyr			Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_Laminin_G,smart_EGF-like_Ca-bd,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.S4172Y	ENST00000441802.2	37	c.12515	CCDS47177.1	4	.	.	.	.	.	.	.	.	.	.	G	17.12	3.309243	0.60414	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.72282	-0.64	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	D	0.84995	0.5596	M	0.79926	2.475	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.86424	0.1756	10	0.56958	D	0.05	.	18.1658	0.89724	0.0:0.0:1.0:0.0	.	4172	Q14517	FAT1_HUMAN	Y	4172;4174	ENSP00000406229:S4172Y	ENSP00000260147:S4174Y	S	-	2	0	FAT1	187755173	1.000000	0.71417	0.983000	0.44433	0.111000	0.19643	9.657000	0.98554	2.541000	0.85698	0.561000	0.74099	TCC	FAT1	-	NULL	ENSG00000083857		0.547	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT1	HGNC	protein_coding	OTTHUMT00000360209.3	45	0.00	0	G	NM_005245		187518179	187518179	-1	no_errors	ENST00000441802	ensembl	human	known	69_37n	missense	61	11.59	8	SNP	1.000	T
FBXO28	23219	genome.wustl.edu	37	1	224345435	224345435	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JB-01A-11D-A13L-09	TCGA-D8-A1JB-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	54621c54-b7ef-48e4-aa68-e2fe10bf0afb	999fc643-568d-4513-9a75-6c68987a2628	g.chr1:224345435G>A	ENST00000366862.5	+	5	1137	c.1094G>A	c.(1093-1095)cGg>cAg	p.R365Q	FBXO28_ENST00000424254.2_3'UTR	NM_015176.3	NP_055991.1	Q9NVF7	FBX28_HUMAN	F-box protein 28	365										endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(3)|ovary(2)|skin(1)	10	Breast(184;0.206)			GBM - Glioblastoma multiforme(131;0.0363)		AAACGTCTTCGGAATAGAAAG	0.448																																						dbGAP											0													41.0	45.0	44.0					1																	224345435		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001628	CCDS1539.1, CCDS44320.1	1q42.12	2011-08-12			ENSG00000143756	ENSG00000143756		"""F-boxes /  ""other"""""	29046	protein-coding gene	gene with protein product	"""centromere protein 30"""	609100				9455484	Standard	NM_015176		Approved	FLJ10766, KIAA0483, Fbx28, CENP-30	uc001hoh.3	Q9NVF7	OTTHUMG00000037495	ENST00000366862.5:c.1094G>A	1.37:g.224345435G>A	ENSP00000355827:p.Arg365Gln		E9PEM8|O75070	Missense_Mutation	SNP	pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like	p.R365Q	ENST00000366862.5	37	c.1094	CCDS1539.1	1	.	.	.	.	.	.	.	.	.	.	G	17.19	3.327684	0.60743	.	.	ENSG00000143756	ENST00000366862	.	.	.	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.35566	0.0936	N	0.19112	0.55	0.80722	D	1	P	0.41450	0.75	B	0.25759	0.063	T	0.20571	-1.0271	9	0.32370	T	0.25	-7.3445	20.4387	0.99107	0.0:0.0:1.0:0.0	.	365	Q9NVF7	FBX28_HUMAN	Q	365	.	ENSP00000355827:R365Q	R	+	2	0	FBXO28	222412058	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.453000	0.80700	2.836000	0.97738	0.655000	0.94253	CGG	FBXO28	-	NULL	ENSG00000143756		0.448	FBXO28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO28	HGNC	protein_coding	OTTHUMT00000091283.2	24	0.00	0	G	NM_015176		224345435	224345435	+1	no_errors	ENST00000366862	ensembl	human	known	69_37n	missense	28	17.65	6	SNP	1.000	A
FXYD5	53827	genome.wustl.edu	37	19	35651628	35651628	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1JB-01A-11D-A13L-09	TCGA-D8-A1JB-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	54621c54-b7ef-48e4-aa68-e2fe10bf0afb	999fc643-568d-4513-9a75-6c68987a2628	g.chr19:35651628G>T	ENST00000342879.3	+	4	994	c.216G>T	c.(214-216)caG>caT	p.Q72H	FXYD5_ENST00000423817.3_Missense_Mutation_p.Q72H|FXYD5_ENST00000591716.2_3'UTR|FXYD5_ENST00000590686.1_Missense_Mutation_p.Q72H|FXYD5_ENST00000543307.1_Missense_Mutation_p.Q72H|FXYD5_ENST00000588699.1_Missense_Mutation_p.Q72H|FXYD5_ENST00000541435.2_Missense_Mutation_p.Q72H|FXYD5_ENST00000392219.2_Missense_Mutation_p.Q72H			Q96DB9	FXYD5_HUMAN	FXYD domain containing ion transport regulator 5	72					microvillus assembly (GO:0030033)|negative regulation of calcium-dependent cell-cell adhesion (GO:0046588)	integral component of membrane (GO:0016021)	actin binding (GO:0003779)|cadherin binding (GO:0045296)|ion channel activity (GO:0005216)			endometrium(2)|kidney(1)|large_intestine(3)|lung(3)	9	all_lung(56;9.4e-09)|Lung NSC(56;1.4e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.75e-22)|OV - Ovarian serous cystadenocarcinoma(14;3.17e-20)|all cancers(14;7.07e-19)|LUSC - Lung squamous cell carcinoma(66;0.0221)			CACAACCCCAGACCCAGACCC	0.547																																						dbGAP											0													164.0	161.0	162.0					19																	35651628		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF161462	CCDS12447.1	19q13.12	2008-02-05	2002-01-14		ENSG00000089327	ENSG00000089327			4029	protein-coding gene	gene with protein product	"""dysadherin"""	606669	"""FXYD domain-containing ion transport regulator 5"""				Standard	NM_144779		Approved	OIT2	uc002nyg.2	Q96DB9	OTTHUMG00000048092	ENST00000342879.3:c.216G>T	19.37:g.35651628G>T	ENSP00000344254:p.Gln72His		B7WNZ8|Q6UW44|Q9HC34|Q9P039	Missense_Mutation	SNP	pfam_Ion-transport_regulator_FXYD	p.Q72H	ENST00000342879.3	37	c.216	CCDS12447.1	19	.	.	.	.	.	.	.	.	.	.	G	9.226	1.034630	0.19590	.	.	ENSG00000089327	ENST00000543307;ENST00000392219;ENST00000541435;ENST00000342879;ENST00000423817	T;T;T;T;T	0.67523	-0.27;0.76;0.76;0.76;0.76	3.19	-1.54	0.08584	.	1.779740	0.03634	N	0.238448	T	0.43033	0.1229	L	0.27053	0.805	0.09310	N	1	P;P	0.46064	0.804;0.872	B;B	0.32289	0.143;0.073	T	0.44267	-0.9339	10	0.54805	T	0.06	0.0505	0.4591	0.00513	0.253:0.1982:0.3464:0.2024	.	72;72	F5H4X8;Q96DB9	.;FXYD5_HUMAN	H	72	ENSP00000444839:Q72H;ENSP00000376053:Q72H;ENSP00000443390:Q72H;ENSP00000344254:Q72H;ENSP00000393848:Q72H	ENSP00000344254:Q72H	Q	+	3	2	FXYD5	40343468	0.001000	0.12720	0.004000	0.12327	0.032000	0.12392	-0.016000	0.12613	-0.207000	0.10187	-0.310000	0.09108	CAG	FXYD5	-	NULL	ENSG00000089327		0.547	FXYD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FXYD5	HGNC	protein_coding	OTTHUMT00000109443.1	85	0.00	0	G	NM_014164		35651628	35651628	+1	no_errors	ENST00000342879	ensembl	human	known	69_37n	missense	99	10.81	12	SNP	0.006	T
HLA-B	3106	genome.wustl.edu	37	6	31323567	31323567	+	Intron	SNP	G	G	A	rs4081560	byFrequency	TCGA-D8-A1JB-01A-11D-A13L-09	TCGA-D8-A1JB-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	54621c54-b7ef-48e4-aa68-e2fe10bf0afb	999fc643-568d-4513-9a75-6c68987a2628	g.chr6:31323567G>A	ENST00000412585.2	-	4	648					NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B						antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)			endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						CGGGGAACAGGGACTTCTGCT	0.552									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of				G|||	452	0.0902556	0.0605	0.1585	5008	,	,		19073	0.0804		0.1143	False		,,,				2504	0.0675					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0	Familial Cancer Database	;Lichen Sclerosis, Familial	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.620-198C>T	6.37:g.31323567G>A			Q29764	Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog,prints_MHC_I_a_a1/a2	p.P213L	ENST00000412585.2	37	c.638	CCDS34394.1	6																																																																																			HLA-B	-	NULL	ENSG00000234745		0.552	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-B	HGNC	protein_coding	OTTHUMT00000076280.4	8	0.00	0	G	NM_005514		31323567	31323567	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000426590	ensembl	human	known	69_37n	missense	5	54.55	6	SNP	0.000	A
HNRNPUL1	11100	genome.wustl.edu	37	19	41778020	41778020	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1JB-01A-11D-A13L-09	TCGA-D8-A1JB-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	54621c54-b7ef-48e4-aa68-e2fe10bf0afb	999fc643-568d-4513-9a75-6c68987a2628	g.chr19:41778020C>A	ENST00000392006.3	+	3	625	c.452C>A	c.(451-453)aCc>aAc	p.T151N	HNRNPUL1_ENST00000263367.3_Missense_Mutation_p.T62N|HNRNPUL1_ENST00000593587.1_Missense_Mutation_p.T51N|HNRNPUL1_ENST00000378215.4_Missense_Mutation_p.T108N|HNRNPUL1_ENST00000602130.1_Missense_Mutation_p.T151N|HNRNPUL1_ENST00000595018.1_Missense_Mutation_p.T51N|HNRNPUL1_ENST00000352456.3_Missense_Mutation_p.T51N|HNRNPUL1_ENST00000594207.1_3'UTR	NM_007040.3	NP_008971.2	Q9BUJ2	HNRL1_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 1	151					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	29						GGAGCACCCACCAGCTTCCTC	0.502																																						dbGAP											0													116.0	123.0	121.0					19																	41778020		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ007509	CCDS12576.1, CCDS12577.1	19q13.2	2013-06-12		2008-04-18	ENSG00000105323	ENSG00000105323			17011	protein-coding gene	gene with protein product	"""E1B 55kDa associated protein 5"""	605800		HNRPUL1		9733834, 12489984	Standard	XM_005258459		Approved	E1B-AP5, E1BAP5, FLJ12944	uc002oqb.4	Q9BUJ2	OTTHUMG00000182740	ENST00000392006.3:c.452C>A	19.37:g.41778020C>A	ENSP00000375863:p.Thr151Asn		B3KMW7|O76022|Q6ZSZ0|Q7L8P4|Q8N6Z4|Q96G37|Q9HAL3|Q9UG75	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_SAP_DNA-bd,superfamily_ConA-like_lec_gl,smart_SAP_DNA-bd,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_SAP_DNA-bd	p.T151N	ENST00000392006.3	37	c.452	CCDS12576.1	19	.	.	.	.	.	.	.	.	.	.	C	8.343	0.829092	0.16749	.	.	ENSG00000105323	ENST00000352456;ENST00000392006;ENST00000378215;ENST00000263367	T;D;T;D	0.92099	0.97;-2.97;1.56;-2.94	6.08	2.69	0.31865	.	0.905807	0.09642	N	0.774858	D	0.83459	0.5259	N	0.08118	0	0.09310	N	1	B;B;B;B;B;B	0.14012	0.005;0.003;0.009;0.009;0.005;0.009	B;B;B;B;B;B	0.28139	0.004;0.001;0.015;0.086;0.007;0.01	T	0.67772	-0.5584	10	0.17369	T	0.5	-0.1398	10.8148	0.46569	0.0:0.5581:0.374:0.0679	.	62;51;151;108;151;51	B7Z4B8;A8K3W4;Q9BUJ2-2;Q9BUJ2-3;Q9BUJ2;Q9BUJ2-4	.;.;.;.;HNRL1_HUMAN;.	N	51;151;108;62	ENSP00000340857:T51N;ENSP00000375863:T151N;ENSP00000367460:T108N;ENSP00000263367:T62N	ENSP00000263367:T62N	T	+	2	0	HNRNPUL1	46469860	0.002000	0.14202	0.003000	0.11579	0.875000	0.50365	1.133000	0.31430	0.412000	0.25729	0.591000	0.81541	ACC	HNRNPUL1	-	NULL	ENSG00000105323		0.502	HNRNPUL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPUL1	HGNC	protein_coding	OTTHUMT00000463406.1	33	0.00	0	C	NM_144732, NM_007040		41778020	41778020	+1	no_errors	ENST00000392006	ensembl	human	known	69_37n	missense	47	12.96	7	SNP	0.001	A
HPS3	84343	genome.wustl.edu	37	3	148877913	148877913	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JB-01A-11D-A13L-09	TCGA-D8-A1JB-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	54621c54-b7ef-48e4-aa68-e2fe10bf0afb	999fc643-568d-4513-9a75-6c68987a2628	g.chr3:148877913G>A	ENST00000296051.2	+	11	2093	c.1953G>A	c.(1951-1953)atG>atA	p.M651I	HPS3_ENST00000460120.1_Missense_Mutation_p.M486I	NM_032383.3	NP_115759.2	Q969F9	HPS3_HUMAN	Hermansky-Pudlak syndrome 3	651					organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)				breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	34			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			GTCCTTCTATGAAGAATATTA	0.433									Hermansky-Pudlak syndrome																													dbGAP											0													153.0	154.0	153.0					3																	148877913		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	HPS, HPS1-8	AY033141	CCDS3140.1	3q24	2014-06-18			ENSG00000163755	ENSG00000163755			15597	protein-coding gene	gene with protein product		606118				11455388	Standard	NM_032383		Approved	SUTAL	uc003ewu.1	Q969F9	OTTHUMG00000159548	ENST00000296051.2:c.1953G>A	3.37:g.148877913G>A	ENSP00000296051:p.Met651Ile		A8K6G6|Q8WTV6|Q96AP1|Q96MR3|Q9H608	Missense_Mutation	SNP	pirsf_BLOC-2_complex_Hps3_subunit	p.M651I	ENST00000296051.2	37	c.1953	CCDS3140.1	3	.	.	.	.	.	.	.	.	.	.	G	14.32	2.501650	0.44455	.	.	ENSG00000163755	ENST00000296051;ENST00000460120	T;T	0.64803	-0.12;-0.11	5.41	5.41	0.78517	.	0.120606	0.85682	D	0.000000	T	0.57725	0.2073	L	0.50333	1.59	0.51482	D	0.999926	B;B	0.29716	0.255;0.07	B;B	0.29716	0.106;0.099	T	0.58752	-0.7581	10	0.52906	T	0.07	-26.0057	14.4012	0.67047	0.0:0.0:0.8524:0.1476	.	486;651	G5E9V4;Q969F9	.;HPS3_HUMAN	I	651;486	ENSP00000296051:M651I;ENSP00000418230:M486I	ENSP00000296051:M651I	M	+	3	0	HPS3	150360603	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.871000	0.69628	2.701000	0.92244	0.563000	0.77884	ATG	HPS3	-	pirsf_BLOC-2_complex_Hps3_subunit	ENSG00000163755		0.433	HPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPS3	HGNC	protein_coding	OTTHUMT00000356151.1	95	0.00	0	G	NM_032383		148877913	148877913	+1	no_errors	ENST00000296051	ensembl	human	known	69_37n	missense	87	14.56	15	SNP	1.000	A
IGHG2	3501	genome.wustl.edu	37	14	106110114	106110114	+	RNA	SNP	T	T	C			TCGA-D8-A1JB-01A-11D-A13L-09	TCGA-D8-A1JB-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	54621c54-b7ef-48e4-aa68-e2fe10bf0afb	999fc643-568d-4513-9a75-6c68987a2628	g.chr14:106110114T>C	ENST00000390545.2	-	0	503							P01859	IGHG2_HUMAN	immunoglobulin heavy constant gamma 2 (G2m marker)						complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)										CCCGTGGCTTTGTCTTGGCAT	0.607																																						dbGAP											0													235.0	209.0	217.0					14																	106110114		2186	4274	6460	-	-	-			0			J00230		14q32.33	2012-10-02			ENSG00000211893	ENSG00000211893		"""Immunoglobulins / IGH locus"""	5526	other	immunoglobulin gene		147110					Standard	NG_001019		Approved			P01859	OTTHUMG00000152482		14.37:g.106110114T>C			A6NE66	Silent	SNP	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like	p.T168	ENST00000390545.2	37	c.504		14																																																																																			IGHG2	-	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like	ENSG00000211893		0.607	IGHG2-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	IG_C_gene	IGHG2	HGNC	IG_C_gene	OTTHUMT00000326391.1	95	0.00	0	T	NG_001019		106110114	106110114	-1	no_start_codon	ENST00000390545	ensembl	human	known	69_37n	silent	163	14.21	27	SNP	0.000	C
KIF21B	23046	genome.wustl.edu	37	1	200959275	200959275	+	Silent	SNP	C	C	T			TCGA-D8-A1JB-01A-11D-A13L-09	TCGA-D8-A1JB-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	54621c54-b7ef-48e4-aa68-e2fe10bf0afb	999fc643-568d-4513-9a75-6c68987a2628	g.chr1:200959275C>T	ENST00000422435.2	-	20	3337	c.3021G>A	c.(3019-3021)gaG>gaA	p.E1007E	KIF21B_ENST00000360529.5_Silent_p.E1007E|KIF21B_ENST00000332129.2_Silent_p.E1007E|KIF21B_ENST00000461742.2_Silent_p.E1007E	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	1007					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						CCTTGGTCTCCTCCAGCTGCA	0.662																																						dbGAP											0													82.0	81.0	81.0					1																	200959275		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.3021G>A	1.37:g.200959275C>T			B2RP62|B7ZMI0|Q5T4J3	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_Prefoldin,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R126K	ENST00000422435.2	37	c.377	CCDS58056.1	1																																																																																			KIF21B	-	superfamily_Prefoldin	ENSG00000116852		0.662	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF21B	HGNC	protein_coding	OTTHUMT00000382635.1	23	0.00	0	C	XM_371332		200959275	200959275	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000477146	ensembl	human	known	69_37n	missense	26	27.78	10	SNP	1.000	T
LRRFIP2	9209	genome.wustl.edu	37	3	37114294	37114294	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1JB-01A-11D-A13L-09	TCGA-D8-A1JB-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	54621c54-b7ef-48e4-aa68-e2fe10bf0afb	999fc643-568d-4513-9a75-6c68987a2628	g.chr3:37114294T>C	ENST00000336686.4	-	21	1531	c.1451A>G	c.(1450-1452)gAt>gGt	p.D484G	LRRFIP2_ENST00000396428.2_Missense_Mutation_p.D300G|LRRFIP2_ENST00000421276.2_Intron|LRRFIP2_ENST00000440230.1_Intron|LRRFIP2_ENST00000354379.4_Intron|LRRFIP2_ENST00000421307.1_Missense_Mutation_p.D484G			Q9Y608	LRRF2_HUMAN	leucine rich repeat (in FLII) interacting protein 2	484					Wnt signaling pathway (GO:0016055)		LRR domain binding (GO:0030275)	p.0?(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						AATTTTTTTATCTTTCCAAAG	0.413																																						dbGAP											1	Whole gene deletion(1)	ovary(1)											107.0	115.0	112.0					3																	37114294		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF115509	CCDS2664.1, CCDS2665.1, CCDS46791.1, CCDS63592.1	3p22.1	2008-07-18			ENSG00000093167	ENSG00000093167			6703	protein-coding gene	gene with protein product		614043				10366446	Standard	NM_017724		Approved	HUFI-2	uc003cgp.2	Q9Y608	OTTHUMG00000130796	ENST00000336686.4:c.1451A>G	3.37:g.37114294T>C	ENSP00000338727:p.Asp484Gly		A8K649|A8MXR0|B4DY63|Q68CV3|Q9NXH5	Missense_Mutation	SNP	pfam_Leu-rich_rep_flightless-int_pr,superfamily_HLH_DNA-bd,superfamily_Prefoldin	p.D484G	ENST00000336686.4	37	c.1451	CCDS2664.1	3	.	.	.	.	.	.	.	.	.	.	T	25.9	4.681866	0.88542	.	.	ENSG00000093167	ENST00000421307;ENST00000336686;ENST00000396428	T;T;T	0.57595	0.97;0.97;0.39	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.73001	0.3531	M	0.74258	2.255	0.58432	D	0.999996	D;D	0.76494	0.999;0.996	D;D	0.85130	0.997;0.965	T	0.75133	-0.3425	10	0.56958	D	0.05	-15.1983	16.3627	0.83275	0.0:0.0:0.0:1.0	.	300;484	A8MXR0;Q9Y608	.;LRRF2_HUMAN	G	484;484;300	ENSP00000392217:D484G;ENSP00000338727:D484G;ENSP00000379705:D300G	ENSP00000338727:D484G	D	-	2	0	LRRFIP2	37089298	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.473000	0.81007	2.263000	0.75096	0.528000	0.53228	GAT	LRRFIP2	-	pfam_Leu-rich_rep_flightless-int_pr,superfamily_HLH_DNA-bd	ENSG00000093167		0.413	LRRFIP2-001	KNOWN	basic|CCDS	protein_coding	LRRFIP2	HGNC	protein_coding	OTTHUMT00000253335.3	111	0.00	0	T	NM_006309		37114294	37114294	-1	no_errors	ENST00000336686	ensembl	human	known	69_37n	missense	121	12.32	17	SNP	1.000	C
MUC4	4585	genome.wustl.edu	37	3	195506940	195506940	+	Missense_Mutation	SNP	G	G	C	rs201483428	byFrequency	TCGA-D8-A1JB-01A-11D-A13L-09	TCGA-D8-A1JB-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	54621c54-b7ef-48e4-aa68-e2fe10bf0afb	999fc643-568d-4513-9a75-6c68987a2628	g.chr3:195506940G>C	ENST00000463781.3	-	2	11970	c.11511C>G	c.(11509-11511)caC>caG	p.H3837Q	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.H3837Q|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGGGTGGCGTGACCTGTGG	0.587													.|||	209	0.0417332	0.1059	0.0346	5008	,	,		8776	0.006		0.0368	False		,,,				2504	0.002					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11511C>G	3.37:g.195506940G>C	ENSP00000417498:p.His3837Gln		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.H3837Q	ENST00000463781.3	37	c.11511	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	g	3.250	-0.153373	0.06585	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.31510	1.54;1.49	.	.	.	.	.	.	.	.	T	0.15782	0.0380	N	0.19112	0.55	0.09310	N	1	B	0.18610	0.029	B	0.04013	0.001	T	0.28933	-1.0028	7	.	.	.	.	5.844	0.18652	9.0E-4:0.0:0.9991:0.0	rs2911269	3709	E7ESK3	.	Q	3837	ENSP00000417498:H3837Q;ENSP00000420243:H3837Q	.	H	-	3	2	MUC4	196991719	0.000000	0.05858	0.116000	0.21606	0.116000	0.19942	-1.654000	0.01984	0.064000	0.16427	0.064000	0.15345	CAC	MUC4	-	NULL	ENSG00000145113		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	26	0.00	0	G	NM_018406		195506940	195506940	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	missense	55	20.29	14	SNP	0.197	C
NBPF10	100132406	genome.wustl.edu	37	1	145354324	145354324	+	Missense_Mutation	SNP	G	G	A	rs372557852		TCGA-D8-A1JB-01A-11D-A13L-09	TCGA-D8-A1JB-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	54621c54-b7ef-48e4-aa68-e2fe10bf0afb	999fc643-568d-4513-9a75-6c68987a2628	g.chr1:145354324G>A	ENST00000369339.3	+	11	1323	c.1070G>A	c.(1069-1071)gGg>gAg	p.G357E	NBPF10_ENST00000369338.1_Intron|NBPF10_ENST00000342960.5_Missense_Mutation_p.G2751E			Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	628						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GATGAGAAAGGGCCTGAAGTC	0.478																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000369339.3:c.1070G>A	1.37:g.145354324G>A	ENSP00000358345:p.Gly357Glu		Q5RHC0|Q9NWN6	Missense_Mutation	SNP	pfam_NBPF_dom	p.G2751E	ENST00000369339.3	37	c.8252		1	.	.	.	.	.	.	.	.	.	.	.	0	-2.674612	0.00104	.	.	ENSG00000163386	ENST00000448873;ENST00000342960	T	0.02579	4.24	0.557	0.557	0.17260	.	.	.	.	.	T	0.00178	0.0005	N	0.00237	-1.79	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.36817	-0.9732	8	0.02654	T	1	.	.	.	.	.	2507	A6NDV3	.	E	553;2751	ENSP00000345684:G2751E	ENSP00000345684:G2751E	G	+	2	0	NBPF10	144065681	0.001000	0.12720	0.017000	0.16124	0.016000	0.09150	0.195000	0.17155	-0.360000	0.08138	-1.353000	0.01230	GGG	NBPF10	-	pfam_NBPF_dom	ENSG00000163386		0.478	NBPF10-001	KNOWN	not_best_in_genome_evidence|basic	protein_coding	NBPF10	HGNC	protein_coding	OTTHUMT00000038550.3	17	0.00	0	G	NM_001039703		145354324	145354324	+1	no_errors	ENST00000342960	ensembl	human	known	69_37n	missense	22	31.25	10	SNP	0.022	A
OLAH	55301	genome.wustl.edu	37	10	15115160	15115160	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1JB-01A-11D-A13L-09	TCGA-D8-A1JB-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	54621c54-b7ef-48e4-aa68-e2fe10bf0afb	999fc643-568d-4513-9a75-6c68987a2628	g.chr10:15115160G>T	ENST00000378228.3	+	8	984	c.730G>T	c.(730-732)Gcg>Tcg	p.A244S	OLAH_ENST00000378217.3_Missense_Mutation_p.A297S|OLAH_ENST00000485251.1_3'UTR	NM_001039702.2	NP_001034791.1	Q9NV23	SAST_HUMAN	oleoyl-ACP hydrolase	244					fatty acid biosynthetic process (GO:0006633)		myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)			endometrium(2)|large_intestine(1)|lung(14)|stomach(1)	18						TCTGGATCCTGCGAACGAGAA	0.328																																						dbGAP											0													79.0	84.0	82.0					10																	15115160		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001844	CCDS7106.1, CCDS31152.1	10p13	2010-11-23	2006-07-07	2006-07-07	ENSG00000152463	ENSG00000152463	3.1.2.14		25625	protein-coding gene	gene with protein product			"""thioesterase domain containing 1"""	THEDC1			Standard	NM_018324		Approved	FLJ11106, SAST	uc001inu.2	Q9NV23	OTTHUMG00000017724	ENST00000378228.3:c.730G>T	10.37:g.15115160G>T	ENSP00000367473:p.Ala244Ser		Q5VUB6|Q9NUW1	Missense_Mutation	SNP	pfam_Thioesterase	p.A297S	ENST00000378228.3	37	c.889	CCDS31152.1	10	.	.	.	.	.	.	.	.	.	.	g	2.483	-0.319141	0.05386	.	.	ENSG00000152463	ENST00000378228;ENST00000378217	.	.	.	5.35	-0.647	0.11468	Thioesterase (1);	0.774367	0.12363	N	0.475429	T	0.06917	0.0176	N	0.01297	-0.9	0.09310	N	1	B;B	0.20261	0.027;0.043	B;B	0.19666	0.026;0.019	T	0.30475	-0.9977	9	0.06891	T	0.86	0.3991	0.882	0.01236	0.3158:0.0944:0.2606:0.3291	.	244;297	Q9NV23;Q9NV23-2	SAST_HUMAN;.	S	244;297	.	ENSP00000367462:A297S	A	+	1	0	OLAH	15155166	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.029000	0.13666	-0.239000	0.09710	0.637000	0.83480	GCG	OLAH	-	pfam_Thioesterase	ENSG00000152463		0.328	OLAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OLAH	HGNC	protein_coding	OTTHUMT00000046964.1	51	0.00	0	G	NM_018324		15115160	15115160	+1	no_errors	ENST00000378217	ensembl	human	known	69_37n	missense	55	15.38	10	SNP	0.000	T
SEZ6	124925	genome.wustl.edu	37	17	27286098	27286098	+	Silent	SNP	C	C	A	rs372776647		TCGA-D8-A1JB-01A-11D-A13L-09	TCGA-D8-A1JB-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	54621c54-b7ef-48e4-aa68-e2fe10bf0afb	999fc643-568d-4513-9a75-6c68987a2628	g.chr17:27286098C>A	ENST00000317338.12	-	10	2480	c.2052G>T	c.(2050-2052)tcG>tcT	p.S684S	SEZ6_ENST00000442608.3_Silent_p.S684S|SEZ6_ENST00000360295.9_Silent_p.S684S|SEZ6_ENST00000335960.6_Intron|PIPOX_ENST00000583215.1_Intron			Q53EL9	SEZ6_HUMAN	seizure related 6 homolog (mouse)	684	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|negative regulation of dendrite development (GO:2000171)|positive regulation of dendrite development (GO:1900006)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	apical dendrite (GO:0097440)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)		p.S684S(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(4)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	29	Lung NSC(42;0.0137)		Epithelial(11;4.73e-06)|all cancers(11;2.91e-05)|BRCA - Breast invasive adenocarcinoma(11;8.06e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.111)			TCCCGGGGTCCGACTGGAACT	0.597																																						dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											54.0	61.0	59.0					17																	27286098		1956	4145	6101	-	-	-	SO:0001819	synonymous_variant	0			AY038048	CCDS45638.1, CCDS45639.1	17q11.2	2008-03-06	2001-11-28		ENSG00000063015	ENSG00000063015			15955	protein-coding gene	gene with protein product			"""seizure related gene 6 (mouse) homolog"""			17086543	Standard	NM_178860		Approved		uc002hdp.2	Q53EL9	OTTHUMG00000168010	ENST00000317338.12:c.2052G>T	17.37:g.27286098C>A			B6ZDN1|Q8N701|Q8NB57|Q8ND50|Q8TD25|Q96NI5|Q96NQ3	Silent	SNP	pfam_Sushi_SCR_CCP,pfam_CUB,superfamily_CUB,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,smart_CUB,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.S684	ENST00000317338.12	37	c.2052	CCDS45639.1	17																																																																																			SEZ6	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000063015		0.597	SEZ6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEZ6	HGNC	protein_coding	OTTHUMT00000397475.3	44	0.00	0	C			27286098	27286098	-1	no_errors	ENST00000317338	ensembl	human	known	69_37n	silent	40	13.04	6	SNP	0.136	A
RECQL5	9400	genome.wustl.edu	37	17	73624831	73624831	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JB-01A-11D-A13L-09	TCGA-D8-A1JB-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	54621c54-b7ef-48e4-aa68-e2fe10bf0afb	999fc643-568d-4513-9a75-6c68987a2628	g.chr17:73624831G>A	ENST00000317905.5	-	17	2660	c.2501C>T	c.(2500-2502)cCc>cTc	p.P834L	RECQL5_ENST00000423245.2_Missense_Mutation_p.P807L|RECQL5_ENST00000443199.2_5'UTR	NM_004259.6	NP_004250.4	O94762	RECQ5_HUMAN	RecQ protein-like 5	834					chromosome separation (GO:0051304)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|mitotic nuclear division (GO:0007067)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA helicase activity (GO:0003678)|nucleic acid binding (GO:0003676)|RNA polymerase II core binding (GO:0000993)			breast(1)|cervix(3)|endometrium(3)|kidney(7)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	36	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			CTGGTCTCTGGGCGGGCAGGT	0.652								Other identified genes with known or suspected DNA repair function																														dbGAP											0													64.0	69.0	67.0					17																	73624831		2020	4199	6219	-	-	-	SO:0001583	missense	0			AB006533	CCDS32735.1, CCDS42380.1, CCDS45777.1	17q25	2014-03-07	2014-03-07	2014-03-07	ENSG00000108469	ENSG00000108469			9950	protein-coding gene	gene with protein product	"""RecQ protein 5"""	603781				9878247	Standard	NM_004259		Approved	RecQ5, FLJ90603	uc010dgl.3	O94762		ENST00000317905.5:c.2501C>T	17.37:g.73624831G>A	ENSP00000317636:p.Pro834Leu		Q9H0B1|Q9P1W7|Q9UNC8	Missense_Mutation	SNP	pfam_RecQ_helicase-like_5,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.P834L	ENST00000317905.5	37	c.2501	CCDS42380.1	17	.	.	.	.	.	.	.	.	.	.	G	2.379	-0.342619	0.05243	.	.	ENSG00000108469	ENST00000443199;ENST00000423245;ENST00000317905	T	0.54279	0.58	4.87	-0.328	0.12690	.	0.845655	0.10224	N	0.700592	T	0.15046	0.0363	N	0.00419	-1.52	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.24083	-1.0170	10	0.22109	T	0.4	-6.1557	3.3278	0.07074	0.5379:0.0:0.1761:0.286	.	834;807;30	O94762;Q6P4G0;Q6FIC9	RECQ5_HUMAN;.;.	L	429;834;834	ENSP00000317636:P834L	ENSP00000317636:P834L	P	-	2	0	RECQL5	71136426	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	0.005000	0.13129	0.029000	0.15352	-0.471000	0.05019	CCC	RECQL5	-	NULL	ENSG00000108469		0.652	RECQL5-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	RECQL5	HGNC	protein_coding	OTTHUMT00000448207.1	54	0.00	0	G	NM_004259		73624831	73624831	-1	no_errors	ENST00000317905	ensembl	human	known	69_37n	missense	68	11.69	9	SNP	0.001	A
SI	6476	genome.wustl.edu	37	3	164710170	164710170	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1JB-01A-11D-A13L-09	TCGA-D8-A1JB-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	54621c54-b7ef-48e4-aa68-e2fe10bf0afb	999fc643-568d-4513-9a75-6c68987a2628	g.chr3:164710170T>A	ENST00000264382.3	-	42	4919	c.4857A>T	c.(4855-4857)aaA>aaT	p.K1619N		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1619	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	CCCAGGTTGGTTTTTCATCAA	0.313										HNSCC(35;0.089)																												dbGAP											0													43.0	44.0	44.0					3																	164710170		2203	4300	6503	-	-	-	SO:0001583	missense	0			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.4857A>T	3.37:g.164710170T>A	ENSP00000264382:p.Lys1619Asn		A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd,smart_P_trefoil	p.K1619N	ENST00000264382.3	37	c.4857	CCDS3196.1	3	.	.	.	.	.	.	.	.	.	.	T	6.489	0.458330	0.12342	.	.	ENSG00000090402	ENST00000264382	D	0.91464	-2.85	4.88	0.93	0.19454	.	0.324189	0.35525	N	0.003149	D	0.85274	0.5659	L	0.52364	1.645	0.09310	N	1	B	0.18461	0.028	B	0.24974	0.057	T	0.70425	-0.4875	10	0.23891	T	0.37	.	9.0428	0.36327	0.0:0.4974:0.0:0.5026	.	1619	P14410	SUIS_HUMAN	N	1619	ENSP00000264382:K1619N	ENSP00000264382:K1619N	K	-	3	2	SI	166192864	0.000000	0.05858	0.000000	0.03702	0.472000	0.32918	0.497000	0.22514	0.045000	0.15804	-0.248000	0.11899	AAA	SI	-	pfam_Glyco_hydro_31	ENSG00000090402		0.313	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SI	HGNC	protein_coding	OTTHUMT00000350116.1	53	0.00	0	T	NM_001041		164710170	164710170	-1	no_errors	ENST00000264382	ensembl	human	known	69_37n	missense	45	10.00	5	SNP	0.000	A
SUPT7L	9913	genome.wustl.edu	37	2	27876556	27876556	+	Missense_Mutation	SNP	T	T	G			TCGA-D8-A1JB-01A-11D-A13L-09	TCGA-D8-A1JB-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	54621c54-b7ef-48e4-aa68-e2fe10bf0afb	999fc643-568d-4513-9a75-6c68987a2628	g.chr2:27876556T>G	ENST00000337768.5	-	6	1610	c.1041A>C	c.(1039-1041)caA>caC	p.Q347H	SUPT7L_ENST00000464789.2_Missense_Mutation_p.Q345H|SUPT7L_ENST00000404798.2_Missense_Mutation_p.Q212H|SUPT7L_ENST00000406540.1_Missense_Mutation_p.Q345H|SUPT7L_ENST00000405491.1_Missense_Mutation_p.Q345H	NM_001282729.1|NM_014860.1	NP_001269658.1|NP_055675.1	O94864	ST65G_HUMAN	suppressor of Ty 7 (S. cerevisiae)-like	347					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|maintenance of protein location in nucleus (GO:0051457)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)			endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|prostate(2)|skin(2)|urinary_tract(1)	16	Acute lymphoblastic leukemia(172;0.155)					CTTCACTTTCTTGAGGCTCCA	0.488																																						dbGAP											0													185.0	183.0	184.0					2																	27876556		2028	4181	6209	-	-	-	SO:0001583	missense	0			AF197954	CCDS42667.1, CCDS62885.1, CCDS62886.1	2p23.3	2008-02-05			ENSG00000119760	ENSG00000119760			30632	protein-coding gene	gene with protein product		612762				9872452, 11564863	Standard	NM_001282732		Approved	STAF65, gamma, KIAA0764, SPT7L	uc002rli.1	O94864	OTTHUMG00000151947	ENST00000337768.5:c.1041A>C	2.37:g.27876556T>G	ENSP00000336750:p.Gln347His		B4E3W3|Q6IB21|Q9H2T6	Missense_Mutation	SNP	pfam_BTP,smart_BTP	p.Q347H	ENST00000337768.5	37	c.1041	CCDS42667.1	2	.	.	.	.	.	.	.	.	.	.	T	20.7	4.036937	0.75617	.	.	ENSG00000119760	ENST00000337768;ENST00000406540;ENST00000405491;ENST00000464789;ENST00000404798	.	.	.	5.96	1.96	0.26148	.	0.109105	0.64402	D	0.000004	T	0.53302	0.1788	L	0.27053	0.805	0.58432	D	0.999999	D;D;D	0.69078	0.995;0.997;0.995	D;D;D	0.81914	0.99;0.995;0.99	T	0.49173	-0.8967	9	0.45353	T	0.12	-18.9354	7.2386	0.26084	0.0:0.4378:0.0:0.5622	.	212;345;347	B4E3W3;O94864-2;O94864	.;.;ST65G_HUMAN	H	347;345;345;345;212	.	ENSP00000336750:Q347H	Q	-	3	2	SUPT7L	27730060	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.700000	0.37815	0.523000	0.28482	-0.250000	0.11733	CAA	SUPT7L	-	NULL	ENSG00000119760		0.488	SUPT7L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SUPT7L	HGNC	protein_coding	OTTHUMT00000324568.1	55	0.00	0	T	NM_014860		27876556	27876556	-1	no_errors	ENST00000337768	ensembl	human	known	69_37n	missense	46	19.30	11	SNP	1.000	G
TBP	6908	genome.wustl.edu	37	6	170871004	170871004	+	Silent	SNP	G	G	A			TCGA-D8-A1JB-01A-11D-A13L-09	TCGA-D8-A1JB-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	54621c54-b7ef-48e4-aa68-e2fe10bf0afb	999fc643-568d-4513-9a75-6c68987a2628	g.chr6:170871004G>A	ENST00000392092.2	+	3	459	c.180G>A	c.(178-180)caG>caA	p.Q60Q	TBP_ENST00000230354.6_Silent_p.Q60Q|TBP_ENST00000540980.1_Silent_p.Q40Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	60	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		Ggcagcagcagcaacaacaac	0.542																																						dbGAP											0													43.0	45.0	44.0					6																	170871004		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.180G>A	6.37:g.170871004G>A			B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	pfam_TBP,prints_TBP	p.Q60	ENST00000392092.2	37	c.180	CCDS5315.1	6																																																																																			TBP	-	NULL	ENSG00000112592		0.542	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBP	HGNC	protein_coding	OTTHUMT00000043271.2	13	0.00	0	G	NM_003194		170871004	170871004	+1	no_errors	ENST00000230354	ensembl	human	known	69_37n	silent	31	22.50	9	SNP	0.991	A
THAP2	83591	genome.wustl.edu	37	12	72068026	72068026	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1JB-01A-11D-A13L-09	TCGA-D8-A1JB-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	54621c54-b7ef-48e4-aa68-e2fe10bf0afb	999fc643-568d-4513-9a75-6c68987a2628	g.chr12:72068026G>T	ENST00000308086.2	+	2	1616	c.115G>T	c.(115-117)Gtt>Ttt	p.V39F	RP11-293I14.2_ENST00000548802.1_Missense_Mutation_p.V15F	NM_031435.3	NP_113623.1	Q9H0W7	THAP2_HUMAN	THAP domain containing, apoptosis associated protein 2	39						nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)	10						GGTTCGCCTGGTTAGGCGCAA	0.378																																						dbGAP											0													89.0	89.0	89.0					12																	72068026		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC008358	CCDS9001.1	12q21.1	2013-01-25				ENSG00000173451		"""THAP (C2CH-type zinc finger) domain containing"""	20854	protein-coding gene	gene with protein product		612531				12575992	Standard	NM_031435		Approved	DKFZP564I0422	uc001swq.3	Q9H0W7	OTTHUMG00000169556	ENST00000308086.2:c.115G>T	12.37:g.72068026G>T	ENSP00000310796:p.Val39Phe		B2R8P3	Missense_Mutation	SNP	pfam_Znf_C2CH,smart_Znf_C2CH,pfscan_Znf_C2CH	p.V39F	ENST00000308086.2	37	c.115	CCDS9001.1	12	.	.	.	.	.	.	.	.	.	.	G	21.4	4.141643	0.77775	.	.	ENSG00000173451	ENST00000308086	D	0.96554	-4.05	5.86	4.97	0.65823	Zinc finger, C2CH-type (4);	0.084638	0.44902	D	0.000417	D	0.96327	0.8802	M	0.73598	2.24	0.80722	D	1	B	0.33413	0.411	P	0.45428	0.48	D	0.95649	0.8705	10	0.72032	D	0.01	-6.8792	8.2477	0.31698	0.0826:0.1704:0.747:0.0	.	39	Q9H0W7	THAP2_HUMAN	F	39	ENSP00000310796:V39F	ENSP00000310796:V39F	V	+	1	0	THAP2	70354293	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.669000	0.46825	1.470000	0.48102	0.591000	0.81541	GTT	THAP2	-	pfam_Znf_C2CH,smart_Znf_C2CH,pfscan_Znf_C2CH	ENSG00000173451		0.378	THAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THAP2	HGNC	protein_coding	OTTHUMT00000404796.1	43	0.00	0	G	NM_031435		72068026	72068026	+1	no_errors	ENST00000308086	ensembl	human	known	69_37n	missense	44	16.98	9	SNP	1.000	T
TOP2B	7155	genome.wustl.edu	37	3	25668734	25668734	+	Silent	SNP	T	T	G			TCGA-D8-A1JB-01A-11D-A13L-09	TCGA-D8-A1JB-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	54621c54-b7ef-48e4-aa68-e2fe10bf0afb	999fc643-568d-4513-9a75-6c68987a2628	g.chr3:25668734T>G	ENST00000264331.4	-	16	1959	c.1960A>C	c.(1960-1962)Agg>Cgg	p.R654R	TOP2B_ENST00000435706.2_Silent_p.R649R	NM_001068.2	NP_001059.2	Q02880	TOP2B_HUMAN	topoisomerase (DNA) II beta 180kDa	654					ATP catabolic process (GO:0006200)|axonogenesis (GO:0007409)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|forebrain development (GO:0030900)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|neuron migration (GO:0001764)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein kinase C binding (GO:0005080)			breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|skin(2)|stomach(1)	36					Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Etoposide(DB00773)	ATGCGATGCCTTTCCATATCA	0.353																																						dbGAP											0													172.0	172.0	172.0					3																	25668734		1892	4112	6004	-	-	-	SO:0001819	synonymous_variant	0			X68060	CCDS46776.1	3p24.2	2012-08-30	2002-08-29		ENSG00000077097	ENSG00000077097	5.99.1.3		11990	protein-coding gene	gene with protein product		126431	"""topoisomerase (DNA) II beta (180kD)"""			1309226, 1333583	Standard	NM_001068		Approved		uc003cdj.3	Q02880	OTTHUMG00000155596	ENST00000264331.4:c.1960A>C	3.37:g.25668734T>G			Q13600|Q9UMG8|Q9UQP8	Silent	SNP	pfam_Topo_IIA_A/C,pfam_Topo_IIA_bsu_dom2,pfam_DTHCT,pfam_ATPase-like_ATP-bd,superfamily_Topo_IIA_cen,superfamily_ATPase-like_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,smart_Topo_IIA,smart_Topo_IIA_A/C,prints_TopoII_euk,prints_Topo_IIA,prints_Transcrpt_fac_CBFA/NFYB_topo	p.R654	ENST00000264331.4	37	c.1960		3																																																																																			TOP2B	-	superfamily_Topo_IIA_cen,smart_Topo_IIA	ENSG00000077097		0.353	TOP2B-201	KNOWN	basic|appris_candidate_longest	protein_coding	TOP2B	HGNC	protein_coding		50	0.00	0	T			25668734	25668734	-1	no_errors	ENST00000264331	ensembl	human	known	69_37n	silent	64	15.79	12	SNP	1.000	G
