#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AGPAT4	56895	genome.wustl.edu	37	6	161560589	161560589	+	Frame_Shift_Del	DEL	G	G	-			TCGA-D8-A1XB-01A-11D-A14G-09	TCGA-D8-A1XB-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e5ca0f82-6fa9-4d54-adc7-385721f351f3	665d057d-7d5f-41ef-98f1-5d71dded62b5	g.chr6:161560589delG	ENST00000320285.4	-	8	1119	c.907delC	c.(907-909)cggfs	p.R304fs	AGPAT4_ENST00000366911.5_3'UTR|AGPAT4_ENST00000457520.2_Frame_Shift_Del_p.R142fs	NM_020133.2	NP_064518.1	Q9NRZ5	PLCD_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 4	304					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)	p.R303fs*7(2)|p.R303fs*60(1)		endometrium(1)|large_intestine(10)|lung(10)|ovary(2)|skin(2)	25		Breast(66;0.000289)|Ovarian(120;0.0266)|Prostate(117;0.0285)		OV - Ovarian serous cystadenocarcinoma(65;2.23e-17)|BRCA - Breast invasive adenocarcinoma(81;3.58e-05)		CAGGGCCGCCGGGGGGGCACC	0.627																																						dbGAP											3	Deletion - Frameshift(2)|Insertion - Frameshift(1)	large_intestine(2)|ovary(1)											60.0	70.0	66.0					6																	161560589		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF156776	CCDS5280.1	6q25.3	2013-02-05	2013-02-05		ENSG00000026652	ENSG00000026652	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	20885	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, delta"""	614795	"""1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta)"""				Standard	XM_005267052		Approved	LPAAT-delta, dJ473J16.2	uc003qtr.1	Q9NRZ5	OTTHUMG00000015966	ENST00000320285.4:c.907delC	6.37:g.161560589delG	ENSP00000314036:p.Arg304fs		B4DSF9|Q5TEF0	Frame_Shift_Del	DEL	pfam_Acyltransferase,smart_Acyltransferase	p.R303fs	ENST00000320285.4	37	c.907	CCDS5280.1	6																																																																																			AGPAT4	-	NULL	ENSG00000026652		0.627	AGPAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGPAT4	HGNC	protein_coding	OTTHUMT00000042983.1	20	0.00	0	G	NM_020133		161560589	161560589	-1	no_errors	ENST00000320285	ensembl	human	known	69_37n	frame_shift_del	18	10.00	2	DEL	0.011	-
ANKRD37	353322	genome.wustl.edu	37	4	186318102	186318102	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XB-01A-11D-A14G-09	TCGA-D8-A1XB-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e5ca0f82-6fa9-4d54-adc7-385721f351f3	665d057d-7d5f-41ef-98f1-5d71dded62b5	g.chr4:186318102G>A	ENST00000335174.4	+	1	465	c.25G>A	c.(25-27)Gag>Aag	p.E9K	ANKRD37_ENST00000507479.1_Intron|LRP2BP_ENST00000505916.1_5'Flank	NM_181726.2	NP_859077.1	Q7Z713	ANR37_HUMAN	ankyrin repeat domain 37	9						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.E9K(1)		NS(1)|large_intestine(1)|lung(1)	3		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;0.00109)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;1.27e-25)|Epithelial(43;1.02e-22)|OV - Ovarian serous cystadenocarcinoma(60;1.14e-11)|BRCA - Breast invasive adenocarcinoma(30;7.72e-05)|GBM - Glioblastoma multiforme(59;0.000118)|STAD - Stomach adenocarcinoma(60;0.000756)|LUSC - Lung squamous cell carcinoma(40;0.00902)|COAD - Colon adenocarcinoma(29;0.00939)|READ - Rectum adenocarcinoma(43;0.155)		TTGCAACCCCGAGGTGAGATT	0.577																																						dbGAP											1	Substitution - Missense(1)	NS(1)											73.0	77.0	76.0					4																	186318102		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY296056	CCDS3841.1	4q35.1	2013-01-11						"""Ankyrin repeat domain containing"""	29593	protein-coding gene	gene with protein product							Standard	NM_181726		Approved	Lrp2bp	uc003ixm.3	Q7Z713		ENST00000335174.4:c.25G>A	4.37:g.186318102G>A	ENSP00000335147:p.Glu9Lys			Missense_Mutation	SNP	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E9K	ENST00000335174.4	37	c.25	CCDS3841.1	4	.	.	.	.	.	.	.	.	.	.	G	14.89	2.669555	0.47677	.	.	ENSG00000186352	ENST00000507753;ENST00000335174	T	0.32988	1.43	4.09	4.09	0.47781	.	0.186810	0.35708	N	0.003021	T	0.27524	0.0676	N	0.11255	0.115	0.32134	N	0.586363	D;D	0.76494	0.999;0.999	P;P	0.57057	0.812;0.812	T	0.31916	-0.9926	9	0.33940	T	0.23	-14.813	12.0255	0.53368	0.0:0.0:1.0:0.0	.	9;9	B4E066;Q7Z713	.;ANR37_HUMAN	K	9	ENSP00000335147:E9K	ENSP00000335147:E9K	E	+	1	0	ANKRD37	186555096	0.997000	0.39634	0.953000	0.39169	0.048000	0.14542	3.119000	0.50422	2.296000	0.77279	0.456000	0.33151	GAG	ANKRD37	-	NULL	ENSG00000186352		0.577	ANKRD37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD37	HGNC	protein_coding	OTTHUMT00000360673.1	65	0.00	0	G	NM_181726		186318102	186318102	+1	no_errors	ENST00000335174	ensembl	human	known	69_37n	missense	62	17.33	13	SNP	0.942	A
GSKIP	51527	genome.wustl.edu	37	14	96851896	96851896	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1XB-01A-11D-A14G-09	TCGA-D8-A1XB-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e5ca0f82-6fa9-4d54-adc7-385721f351f3	665d057d-7d5f-41ef-98f1-5d71dded62b5	g.chr14:96851896T>A	ENST00000556095.1	+	4	2107	c.295T>A	c.(295-297)Tta>Ata	p.L99I	GSKIP_ENST00000438650.1_Missense_Mutation_p.L99I|GSKIP_ENST00000554182.1_Missense_Mutation_p.L99I|GSKIP_ENST00000555181.1_Missense_Mutation_p.L99I|RNU2-33P_ENST00000410344.1_RNA	NM_001271904.1	NP_001258833.1	Q9P0R6	GSKIP_HUMAN	GSK3B interacting protein	99						cytoplasm (GO:0005737)											AGATGATCATTTACAGACTCC	0.438																																						dbGAP											0													169.0	150.0	157.0					14																	96851896		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF151044	CCDS32153.1	14q32.2	2012-09-25	2012-09-25	2012-09-25	ENSG00000100744	ENSG00000100744			20343	protein-coding gene	gene with protein product	"""GSK3beta interaction protein"""		"""chromosome 14 open reading frame 129"""	C14orf129		16981698, 21328310	Standard	NM_001271904		Approved		uc031qqf.1	Q9P0R6	OTTHUMG00000171420	ENST00000556095.1:c.295T>A	14.37:g.96851896T>A	ENSP00000451188:p.Leu99Ile		B3KSZ0|Q9BST1|Q9NWK0	Missense_Mutation	SNP	pfam_DUF727,superfamily_GSKIP/TIF31_domain	p.L99I	ENST00000556095.1	37	c.295	CCDS32153.1	14	.	.	.	.	.	.	.	.	.	.	T	9.927	1.213649	0.22289	.	.	ENSG00000100744	ENST00000555181;ENST00000554182;ENST00000556095;ENST00000438650;ENST00000555757	.	.	.	5.54	-2.6	0.06190	GSKIP/TIF31 domain (1);	0.494253	0.20283	N	0.095414	T	0.25269	0.0614	L	0.35487	1.065	0.32131	N	0.586803	B	0.02656	0.0	B	0.13407	0.009	T	0.04467	-1.0949	9	0.33940	T	0.23	-16.2148	0.3728	0.00382	0.2321:0.2024:0.2747:0.2908	.	99	Q9P0R6	GSKIP_HUMAN	I	99	.	ENSP00000412315:L99I	L	+	1	2	C14orf129	95921649	0.000000	0.05858	0.057000	0.19452	0.975000	0.68041	-0.649000	0.05384	-0.227000	0.09884	-0.263000	0.10527	TTA	C14orf129	-	pfam_DUF727,superfamily_GSKIP/TIF31_domain	ENSG00000100744		0.438	GSKIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf129	HGNC	protein_coding	OTTHUMT00000413338.1	74	0.00	0	T	NM_016472		96851896	96851896	+1	no_errors	ENST00000438650	ensembl	human	known	69_37n	missense	58	26.58	21	SNP	0.004	A
C19orf26	255057	genome.wustl.edu	37	19	1235064	1235064	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XB-01A-11D-A14G-09	TCGA-D8-A1XB-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e5ca0f82-6fa9-4d54-adc7-385721f351f3	665d057d-7d5f-41ef-98f1-5d71dded62b5	g.chr19:1235064G>A	ENST00000382477.2	-	5	647	c.373C>T	c.(373-375)Cgg>Tgg	p.R125W	C19orf26_ENST00000215376.6_Missense_Mutation_p.R125W|C19orf26_ENST00000590083.1_Missense_Mutation_p.R131W			Q8N350	DOS_HUMAN	chromosome 19 open reading frame 26	125						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)	9		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AAGGAGACCCGGCGGCCCGTG	0.687										HNSCC(14;0.022)																												dbGAP											0													22.0	25.0	24.0					19																	1235064		2198	4296	6494	-	-	-	SO:0001583	missense	0			BC028156	CCDS12057.1, CCDS12057.2	19p13.3	2012-10-24			ENSG00000099625	ENSG00000099625			28617	protein-coding gene	gene with protein product	"""downstream of STK11"""					12477932	Standard	NM_152769		Approved	MGC40084, DOS	uc002lrm.3	Q8N350	OTTHUMG00000180141	ENST00000382477.2:c.373C>T	19.37:g.1235064G>A	ENSP00000371917:p.Arg125Trp		O43385	Missense_Mutation	SNP	NULL	p.R125W	ENST00000382477.2	37	c.373		19	.	.	.	.	.	.	.	.	.	.	G	14.24	2.474964	0.43942	.	.	ENSG00000099625	ENST00000382477;ENST00000215376	.	.	.	3.64	-0.358	0.12575	.	0.067284	0.56097	D	0.000031	T	0.60599	0.2281	L	0.29908	0.895	0.52501	D	0.999958	D	0.89917	1.0	D	0.91635	0.999	T	0.61744	-0.7000	9	0.87932	D	0	.	11.189	0.48675	0.0:0.0:0.5399:0.4601	.	125	Q8N350-2	.	W	125	.	ENSP00000215376:R125W	R	-	1	2	C19orf26	1186064	1.000000	0.71417	0.945000	0.38365	0.165000	0.22458	0.997000	0.29731	0.273000	0.22049	-0.314000	0.08810	CGG	C19orf26	-	NULL	ENSG00000099625		0.687	C19orf26-202	KNOWN	basic|appris_candidate_longest	protein_coding	C19orf26	HGNC	protein_coding		15	0.00	0	G	NM_152769		1235064	1235064	-1	no_errors	ENST00000382477	ensembl	human	known	69_37n	missense	13	26.32	5	SNP	0.994	A
CFAP74	85452	genome.wustl.edu	37	1	1888142	1888142	+	IGR	SNP	C	C	T			TCGA-D8-A1XB-01A-11D-A14G-09	TCGA-D8-A1XB-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e5ca0f82-6fa9-4d54-adc7-385721f351f3	665d057d-7d5f-41ef-98f1-5d71dded62b5	g.chr1:1888142C>T								TMEM52 (37430 upstream) : C1orf222 (31420 downstream)																							AAGCCCCCAACGTTGGTCAGC	0.572																																						dbGAP											0													71.0	78.0	76.0					1																	1888142		2163	4276	6439	-	-	-	SO:0001628	intergenic_variant	0																															1.37:g.1888142C>T				Missense_Mutation	SNP	NULL	p.V645I		37	c.1933		1	.	.	.	.	.	.	.	.	.	.	C	0.081	-1.183686	0.01620	.	.	ENSG00000142609	ENST00000270720;ENST00000461752	.	.	.	4.75	-9.5	0.00584	.	2.720810	0.01303	N	0.010353	T	0.25827	0.0629	N	0.16307	0.4	0.20926	N	0.999823	B;B	0.20261	0.043;0.014	B;B	0.15870	0.014;0.005	T	0.20140	-1.0284	9	0.17369	T	0.5	0.3105	15.0979	0.72250	0.0:0.673:0.2226:0.1044	.	645;645	Q9C0B2-2;Q9C0B2	.;K1751_HUMAN	I	645;92	.	ENSP00000270720:V645I	V	-	1	0	C1orf222	1878002	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.358000	0.01085	-3.090000	0.00248	-1.731000	0.00696	GTT	C1orf222	-	NULL	ENSG00000142609	0	0.572					C1orf222	HGNC			50	0.00	0	C			1888142	1888142	-1	no_errors	ENST00000270720	ensembl	human	known	69_37n	missense	46	19.30	11	SNP	0.000	T
TBC1D32	221322	genome.wustl.edu	37	6	121526246	121526246	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1XB-01A-11D-A14G-09	TCGA-D8-A1XB-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e5ca0f82-6fa9-4d54-adc7-385721f351f3	665d057d-7d5f-41ef-98f1-5d71dded62b5	g.chr6:121526246C>T	ENST00000398212.2	-	22	2594	c.2545G>A	c.(2545-2547)Gaa>Aaa	p.E849K	TBC1D32_ENST00000275159.6_Missense_Mutation_p.E849K|TBC1D32_ENST00000398197.2_Intron	NM_152730.4	NP_689943.4	Q96NH3	BROMI_HUMAN	TBC1 domain family, member 32	849					cilium morphogenesis (GO:0060271)|embryonic digit morphogenesis (GO:0042733)|lens development in camera-type eye (GO:0002088)|protein localization to cilium (GO:0061512)|retinal pigment epithelium development (GO:0003406)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cilium (GO:0005929)|cytoplasm (GO:0005737)	Rab GTPase activator activity (GO:0005097)										TGTGATTGTTCATAGTTGAAT	0.264																																						dbGAP											0													55.0	54.0	54.0					6																	121526246		1784	4038	5822	-	-	-	SO:0001583	missense	0			AK055461	CCDS43501.1	6q22.31	2014-02-20	2013-07-10	2013-07-10	ENSG00000146350	ENSG00000146350			21485	protein-coding gene	gene with protein product	"""broad-minded homolog"""	615867	"""chromosome 6 open reading frame 171"", ""chromosome 6 open reading frame 170"""	C6orf171, C6orf170		20159594, 24285566	Standard	NM_152730		Approved	FLJ30899, dJ310J6.1, FLJ34235, bA57L9.1, BROMI	uc003pyo.1	Q96NH3	OTTHUMG00000015474	ENST00000398212.2:c.2545G>A	6.37:g.121526246C>T	ENSP00000381270:p.Glu849Lys		Q5SZD6|Q5SZM6|Q6ZMY4|Q6ZUR7|Q8NB47	Missense_Mutation	SNP	superfamily_Rab-GTPase-TBC_dom	p.E849K	ENST00000398212.2	37	c.2545	CCDS43501.1	6	.	.	.	.	.	.	.	.	.	.	C	29.0	4.966577	0.92855	.	.	ENSG00000146350	ENST00000275159;ENST00000398212	T;T	0.25250	1.81;1.81	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.44871	0.1314	M	0.71581	2.175	0.80722	D	1	D;D	0.71674	0.998;0.996	D;D	0.78314	0.991;0.97	T	0.33240	-0.9876	10	0.72032	D	0.01	.	17.1967	0.86894	0.0:1.0:0.0:0.0	.	849;849	Q96NH3-4;Q96NH3	.;BROMI_HUMAN	K	849	ENSP00000275159:E849K;ENSP00000381270:E849K	ENSP00000275159:E849K	E	-	1	0	C6orf170	121567945	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.853000	0.69496	2.873000	0.98535	0.561000	0.74099	GAA	C6orf170	-	NULL	ENSG00000146350		0.264	TBC1D32-005	PUTATIVE	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	C6orf170	HGNC	protein_coding	OTTHUMT00000380937.2	39	0.00	0	C	NM_152730		121526246	121526246	-1	no_errors	ENST00000275159	ensembl	human	putative	69_37n	missense	33	19.51	8	SNP	1.000	T
CCDC13	152206	genome.wustl.edu	37	3	42777253	42777253	+	Silent	SNP	C	C	T			TCGA-D8-A1XB-01A-11D-A14G-09	TCGA-D8-A1XB-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e5ca0f82-6fa9-4d54-adc7-385721f351f3	665d057d-7d5f-41ef-98f1-5d71dded62b5	g.chr3:42777253C>T	ENST00000310232.6	-	10	1400	c.1317G>A	c.(1315-1317)gaG>gaA	p.E439E	CCDC13-AS1_ENST00000418161.1_RNA|CCDC13-AS1_ENST00000446950.1_RNA	NM_144719.3	NP_653320.3	Q8IYE1	CCD13_HUMAN	coiled-coil domain containing 13	439										endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	25						TGGCCTCCCGCTCAGCTACCA	0.602																																						dbGAP											0													117.0	102.0	107.0					3																	42777253		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK058196	CCDS2705.1	3p22.1	2005-01-25			ENSG00000244607	ENSG00000244607			26358	protein-coding gene	gene with protein product						12477932	Standard	NM_144719		Approved	FLJ25467	uc003cly.4	Q8IYE1	OTTHUMG00000133046	ENST00000310232.6:c.1317G>A	3.37:g.42777253C>T				Silent	SNP	superfamily_Prefoldin	p.E439	ENST00000310232.6	37	c.1317	CCDS2705.1	3																																																																																			CCDC13	-	NULL	ENSG00000244607		0.602	CCDC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC13	HGNC	protein_coding	OTTHUMT00000256652.1	60	0.00	0	C	NM_144719		42777253	42777253	-1	no_errors	ENST00000310232	ensembl	human	known	69_37n	silent	43	24.56	14	SNP	1.000	T
CLDN14	23562	genome.wustl.edu	37	21	37833546	37833546	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1XB-01A-11D-A14G-09	TCGA-D8-A1XB-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e5ca0f82-6fa9-4d54-adc7-385721f351f3	665d057d-7d5f-41ef-98f1-5d71dded62b5	g.chr21:37833546G>C	ENST00000399137.1	-	3	1314	c.448C>G	c.(448-450)Ccg>Gcg	p.P150A	CLDN14_ENST00000342108.2_Missense_Mutation_p.P150A|CLDN14_ENST00000399139.1_Missense_Mutation_p.P150A|AP000695.4_ENST00000454980.1_RNA|AP000695.6_ENST00000429588.1_RNA|CLDN14_ENST00000399136.1_Missense_Mutation_p.P150A|CLDN14_ENST00000399135.1_Missense_Mutation_p.P150A|AP000695.4_ENST00000428667.1_RNA	NM_144492.2	NP_652763.1	O95500	CLD14_HUMAN	claudin 14	150					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|protein complex assembly (GO:0006461)|tight junction assembly (GO:0070830)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(1)|lung(5)|skin(1)	7						GGCAGCAGCGGGTTGTAGAAG	0.617																																						dbGAP											0													81.0	77.0	79.0					21																	37833546		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ132445	CCDS13645.1	21q22.3	2008-07-31			ENSG00000159261	ENSG00000159261		"""Claudins"""	2035	protein-coding gene	gene with protein product		605608		DFNB29		11163249	Standard	NM_144492		Approved		uc002yvk.2	O95500	OTTHUMG00000086638	ENST00000399137.1:c.448C>G	21.37:g.37833546G>C	ENSP00000382090:p.Pro150Ala			Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin14,prints_Claudin,prints_Claudin2	p.P150A	ENST00000399137.1	37	c.448	CCDS13645.1	21	.	.	.	.	.	.	.	.	.	.	G	26.2	4.717326	0.89205	.	.	ENSG00000159261	ENST00000399139;ENST00000399137;ENST00000399135;ENST00000399136;ENST00000342108	D;D;D;D;D	0.88818	-2.43;-2.43;-2.43;-2.43;-2.43	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.95392	0.8504	M	0.86864	2.845	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95675	0.8727	10	0.66056	D	0.02	.	19.2271	0.93821	0.0:0.0:1.0:0.0	.	150	O95500	CLD14_HUMAN	A	150	ENSP00000382092:P150A;ENSP00000382090:P150A;ENSP00000382087:P150A;ENSP00000382088:P150A;ENSP00000339292:P150A	ENSP00000339292:P150A	P	-	1	0	CLDN14	36755416	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.722000	0.98770	2.526000	0.85167	0.462000	0.41574	CCG	CLDN14	-	pfam_PMP22/EMP/MP20/Claudin	ENSG00000159261		0.617	CLDN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN14	HGNC	protein_coding	OTTHUMT00000194697.1	51	0.00	0	G	NM_144492		37833546	37833546	-1	no_errors	ENST00000342108	ensembl	human	known	69_37n	missense	25	29.73	11	SNP	1.000	C
CLEC4A	50856	genome.wustl.edu	37	12	8288271	8288271	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XB-01A-11D-A14G-09	TCGA-D8-A1XB-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e5ca0f82-6fa9-4d54-adc7-385721f351f3	665d057d-7d5f-41ef-98f1-5d71dded62b5	g.chr12:8288271G>A	ENST00000229332.5	+	4	636	c.389G>A	c.(388-390)aGt>aAt	p.S130N	CLEC4A_ENST00000352620.3_Missense_Mutation_p.S97N|CLEC4A_ENST00000360500.3_Missense_Mutation_p.S91N|CLEC4A_ENST00000345999.3_Missense_Mutation_p.S58N	NM_016184.3|NM_194447.2|NM_194450.2	NP_057268.1|NP_919429.2|NP_919432.1	Q9UMR7	CLC4A_HUMAN	C-type lectin domain family 4, member A	130	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.			S -> C (in Ref. 4; AAF75560). {ECO:0000305}.	cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(3)|large_intestine(2)|lung(4)|prostate(1)	11				Kidney(36;0.0915)		TGGCAAGACAGTGAGAAGGAC	0.463																																						dbGAP											0													105.0	94.0	98.0					12																	8288271		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ133532	CCDS8590.1, CCDS8591.1, CCDS8592.1, CCDS41745.1	12p13	2005-02-09	2005-02-09	2005-02-09	ENSG00000111729	ENSG00000111729		"""C-type lectin domain containing"""	13257	protein-coding gene	gene with protein product		605306	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 6"""	CLECSF6		10438934	Standard	NM_016184		Approved	DCIR, DDB27	uc001qtz.1	Q9UMR7	OTTHUMG00000168571	ENST00000229332.5:c.389G>A	12.37:g.8288271G>A	ENSP00000229332:p.Ser130Asn		Q17R69|Q8WXW9|Q9H2Z9|Q9NS33|Q9UI34	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	p.S130N	ENST00000229332.5	37	c.389	CCDS8590.1	12	.	.	.	.	.	.	.	.	.	.	G	16.62	3.175227	0.57692	.	.	ENSG00000111729	ENST00000229332;ENST00000345999;ENST00000352620;ENST00000360500	T;T;T;T	0.20332	2.08;2.08;2.08;2.08	4.06	4.06	0.47325	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.45126	D	0.000382	T	0.59348	0.2187	H	0.97291	3.975	0.18873	N	0.999986	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.997;0.996;0.997;0.999	T	0.61327	-0.7085	10	0.87932	D	0	.	12.042	0.53458	0.0:0.0:1.0:0.0	.	91;58;97;130	Q9UMR7-3;Q9UMR7-4;Q9UMR7-2;Q9UMR7	.;.;.;CLC4A_HUMAN	N	130;58;97;91	ENSP00000229332:S130N;ENSP00000344646:S58N;ENSP00000247243:S97N;ENSP00000353690:S91N	ENSP00000229332:S130N	S	+	2	0	CLEC4A	8179538	0.974000	0.33945	0.118000	0.21660	0.093000	0.18481	4.054000	0.57434	2.557000	0.86248	0.650000	0.86243	AGT	CLEC4A	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	ENSG00000111729		0.463	CLEC4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC4A	HGNC	protein_coding	OTTHUMT00000400257.1	65	0.00	0	G	NM_194450		8288271	8288271	+1	no_errors	ENST00000229332	ensembl	human	known	69_37n	missense	41	28.07	16	SNP	0.136	A
DCLK3	85443	genome.wustl.edu	37	3	36759619	36759619	+	Silent	SNP	G	G	A			TCGA-D8-A1XB-01A-11D-A14G-09	TCGA-D8-A1XB-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e5ca0f82-6fa9-4d54-adc7-385721f351f3	665d057d-7d5f-41ef-98f1-5d71dded62b5	g.chr3:36759619G>A	ENST00000416516.2	-	4	2125	c.1635C>T	c.(1633-1635)atC>atT	p.I545I	DCLK3_ENST00000498047.1_5'UTR	NM_033403.1	NP_208382.1	Q9C098	DCLK3_HUMAN	doublecortin-like kinase 3	545	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.I545I(1)		breast(3)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	48						CACACAGCAGGATATAGAGGA	0.572																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											155.0	168.0	164.0					3																	36759619		2114	4272	6386	-	-	-	SO:0001819	synonymous_variant	0			AB051552	CCDS43064.1	3p22.3	2007-04-02	2007-04-02	2007-04-02	ENSG00000163673	ENSG00000163673			19005	protein-coding gene	gene with protein product		613167	"""doublecortin and CaM kinase-like 3"""	DCAMKL3		11214970, 16869982	Standard	NM_033403		Approved	KIAA1765, DCDC3C	uc003cgi.2	Q9C098	OTTHUMG00000155805	ENST00000416516.2:c.1635C>T	3.37:g.36759619G>A				Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.I545	ENST00000416516.2	37	c.1635	CCDS43064.1	3																																																																																			DCLK3	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000163673		0.572	DCLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCLK3	HGNC	protein_coding	OTTHUMT00000341727.1	75	0.00	0	G	XM_047355		36759619	36759619	-1	no_errors	ENST00000416516	ensembl	human	known	69_37n	silent	56	25.33	19	SNP	1.000	A
GLRA3	8001	genome.wustl.edu	37	4	175649752	175649752	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A1XB-01A-11D-A14G-09	TCGA-D8-A1XB-10A-01D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e5ca0f82-6fa9-4d54-adc7-385721f351f3	665d057d-7d5f-41ef-98f1-5d71dded62b5	g.chr4:175649752A>T	ENST00000274093.3	-	4	867	c.365T>A	c.(364-366)aTg>aAg	p.M122K	GLRA3_ENST00000340217.5_Missense_Mutation_p.M122K|GLRA3_ENST00000436738.1_5'UTR	NM_006529.2	NP_006520.2	O75311	GLRA3_HUMAN	glycine receptor, alpha 3	122					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|transmitter-gated ion channel activity (GO:0022824)			endometrium(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(3)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	35		Prostate(90;0.00601)|Breast(14;0.0091)|Melanoma(52;0.00959)|Renal(120;0.0183)|all_neural(102;0.0891)|all_hematologic(60;0.107)		all cancers(43;4.99e-18)|Epithelial(43;1.18e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.88e-09)|STAD - Stomach adenocarcinoma(60;0.00442)|GBM - Glioblastoma multiforme(59;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0421)	Glycine(DB00145)|Ivermectin(DB00602)|Lindane(DB00431)	GGAGTCCAACATGGAGGGGTC	0.418																																						dbGAP											0													110.0	119.0	116.0					4																	175649752		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF017724	CCDS3822.1, CCDS43283.1	4q34.1	2012-02-07			ENSG00000145451	ENSG00000145451		"""Ligand-gated ion channels / Glycine receptors"""	4328	protein-coding gene	gene with protein product		600421				9677400	Standard	NM_001042543		Approved		uc003ity.1	O75311	OTTHUMG00000149816	ENST00000274093.3:c.365T>A	4.37:g.175649752A>T	ENSP00000274093:p.Met122Lys		D3DP44|O75816|Q5D0E3	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_Glycine_rcpt_A3,prints_Glycine_rcpt_A,prints_Neur_channel,tigrfam_Neur_channel	p.M122K	ENST00000274093.3	37	c.365	CCDS3822.1	4	.	.	.	.	.	.	.	.	.	.	A	27.0	4.786667	0.90367	.	.	ENSG00000145451	ENST00000274093;ENST00000340217	T;T	0.77489	-1.1;-1.1	4.65	4.65	0.58169	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.84866	0.5567	M	0.75777	2.31	0.80722	D	1	P;P	0.52316	0.82;0.952	P;P	0.56865	0.596;0.808	D	0.87094	0.2174	10	0.72032	D	0.01	.	14.3733	0.66857	1.0:0.0:0.0:0.0	.	122;122	O75311-2;O75311	.;GLRA3_HUMAN	K	122	ENSP00000274093:M122K;ENSP00000345284:M122K	ENSP00000274093:M122K	M	-	2	0	GLRA3	175886327	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.303000	0.96183	1.864000	0.54056	0.455000	0.32223	ATG	GLRA3	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_Glycine_rcpt_A,tigrfam_Neur_channel	ENSG00000145451		0.418	GLRA3-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	GLRA3	HGNC	protein_coding	OTTHUMT00000313427.1	95	0.00	0	A			175649752	175649752	-1	no_errors	ENST00000274093	ensembl	human	known	69_37n	missense	53	29.33	22	SNP	1.000	T
GRIPAP1	56850	genome.wustl.edu	37	X	48839811	48839811	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1XB-01A-11D-A14G-09	TCGA-D8-A1XB-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e5ca0f82-6fa9-4d54-adc7-385721f351f3	665d057d-7d5f-41ef-98f1-5d71dded62b5	g.chrX:48839811C>T	ENST00000376441.1	-	16	1348	c.1314G>A	c.(1312-1314)atG>atA	p.M438I	GRIPAP1_ENST00000473581.1_5'UTR|GRIPAP1_ENST00000376444.3_Missense_Mutation_p.M393I|GRIPAP1_ENST00000376423.4_Missense_Mutation_p.M385I|GRIPAP1_ENST00000376425.3_Missense_Mutation_p.M407I	NM_020137.3	NP_064522.3	Q4V328	GRAP1_HUMAN	GRIP1 associated protein 1	438						blood microparticle (GO:0072562)|endosome (GO:0005768)				breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)	10						GCAGCGTTTCCATTGCTAGCT	0.577																																						dbGAP											0													121.0	91.0	101.0					X																	48839811		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB032993	CCDS35248.1	Xp11.23	2008-02-05			ENSG00000068400	ENSG00000068400			18706	protein-coding gene	gene with protein product		300408				10896157	Standard	NM_020137		Approved	GRASP-1, GRASP1, KIAA1167, MPMGp800B12492Q3, DKFZp434P0630	uc004dly.1	Q4V328	OTTHUMG00000033192	ENST00000376441.1:c.1314G>A	X.37:g.48839811C>T	ENSP00000365624:p.Met438Ile		A6NL78|Q3MJ75|Q4V327|Q4V330|Q5HYG1|Q6N046|Q96DH8|Q9NQ43|Q9ULQ3	Missense_Mutation	SNP	superfamily_Prefoldin	p.M438I	ENST00000376441.1	37	c.1314	CCDS35248.1	X	.	.	.	.	.	.	.	.	.	.	-	0.027	-1.364212	0.01235	.	.	ENSG00000068400	ENST00000376425;ENST00000376444;ENST00000376441;ENST00000537291;ENST00000376423	T;T;T;T	0.22539	1.95;1.95;1.95;1.95	4.29	2.21	0.28008	.	0.538685	0.17936	N	0.156994	T	0.08133	0.0203	N	0.02916	-0.46	0.21933	N	0.999469	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.06405	0.0;0.002;0.0	T	0.29243	-1.0018	10	0.36615	T	0.2	-0.7306	7.671	0.28460	0.2188:0.6737:0.0:0.1075	.	385;328;438	Q4V328-2;Q4V328-3;Q4V328	.;.;GRAP1_HUMAN	I	407;393;438;407;385	ENSP00000365608:M407I;ENSP00000365627:M393I;ENSP00000365624:M438I;ENSP00000365606:M385I	ENSP00000365606:M385I	M	-	3	0	GRIPAP1	48724755	0.890000	0.30428	0.564000	0.28396	0.048000	0.14542	-0.216000	0.09266	0.644000	0.30656	0.476000	0.43555	ATG	GRIPAP1	-	NULL	ENSG00000068400		0.577	GRIPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIPAP1	HGNC	protein_coding	OTTHUMT00000080970.2	57	0.00	0	C	NM_207672		48839811	48839811	-1	no_errors	ENST00000376441	ensembl	human	known	69_37n	missense	66	19.51	16	SNP	0.979	T
HRNR	388697	genome.wustl.edu	37	1	152185882	152185882	+	Silent	SNP	G	G	A	rs41266126	byFrequency	TCGA-D8-A1XB-01A-11D-A14G-09	TCGA-D8-A1XB-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e5ca0f82-6fa9-4d54-adc7-385721f351f3	665d057d-7d5f-41ef-98f1-5d71dded62b5	g.chr1:152185882G>A	ENST00000368801.2	-	3	8298	c.8223C>T	c.(8221-8223)ggC>ggT	p.G2741G	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	2741					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.G2741G(1)		autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGGAAGACTGGCCTGTGCTAG	0.577																																						dbGAP											1	Substitution - coding silent(1)	prostate(1)											28.0	16.0	20.0					1																	152185882		2167	4065	6232	-	-	-	SO:0001819	synonymous_variant	0			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.8223C>T	1.37:g.152185882G>A			Q5DT20|Q5U1F4	Silent	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.G2741	ENST00000368801.2	37	c.8223	CCDS30859.1	1																																																																																			HRNR	-	NULL	ENSG00000197915		0.577	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	HGNC	protein_coding	OTTHUMT00000034016.1	28	0.00	0	G	XM_373868		152185882	152185882	-1	no_errors	ENST00000368801	ensembl	human	known	69_37n	silent	18	33.33	9	SNP	0.060	A
INO80	54617	genome.wustl.edu	37	15	41372096	41372096	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XB-01A-11D-A14G-09	TCGA-D8-A1XB-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e5ca0f82-6fa9-4d54-adc7-385721f351f3	665d057d-7d5f-41ef-98f1-5d71dded62b5	g.chr15:41372096G>A	ENST00000361937.3	-	9	1358	c.934C>T	c.(934-936)Cac>Tac	p.H312Y	INO80_ENST00000401393.3_Missense_Mutation_p.H312Y			Q9ULG1	INO80_HUMAN	INO80 complex subunit	312	Assembles INO80 complex module consisting of conserved components ACTR8, ACTL6A and YY1.|DBINO. {ECO:0000255|PROSITE- ProRule:PRU00746}.				ATP catabolic process (GO:0006200)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|mitotic sister chromatid segregation (GO:0000070)|positive regulation of cell growth (GO:0030307)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|spindle assembly (GO:0051225)|UV-damage excision repair (GO:0070914)	Ino80 complex (GO:0031011)|microtubule (GO:0005874)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			NS(1)|breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						ATGCACTGGTGAGCAAGCTGA	0.527																																						dbGAP											0													88.0	87.0	87.0					15																	41372096		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033085	CCDS10071.1	15q15.1	2013-08-21	2013-08-21	2008-08-07	ENSG00000128908	ENSG00000128908	3.6.1.3	"""INO80 complex subunits"""	26956	protein-coding gene	gene with protein product	"""INO80 complex subunit A"""	610169	"""INO80 complex homolog 1 (S. cerevisiae)"", ""INO80 homolog (S. cerevisiae)"""	INOC1		16298340, 16230350, 20237820	Standard	NM_017553		Approved	KIAA1259, Ino80, hINO80, INO80A	uc001zni.3	Q9ULG1	OTTHUMG00000130209	ENST00000361937.3:c.934C>T	15.37:g.41372096G>A	ENSP00000355205:p.His312Tyr		A6H8X4|Q9NTG6	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.H312Y	ENST00000361937.3	37	c.934	CCDS10071.1	15	.	.	.	.	.	.	.	.	.	.	G	9.038	0.988924	0.18966	.	.	ENSG00000128908	ENST00000361937;ENST00000401393	D;D	0.90620	-2.7;-2.7	4.91	4.91	0.64330	DNA binding domain, INO80 (1);	0.000000	0.85682	D	0.000000	D	0.84483	0.5482	N	0.19112	0.55	0.58432	D	0.999999	P	0.41748	0.761	B	0.39562	0.303	D	0.86103	0.1557	10	0.48119	T	0.1	.	16.4549	0.84009	0.0:0.0:1.0:0.0	.	312	Q9ULG1	INO80_HUMAN	Y	312	ENSP00000355205:H312Y;ENSP00000384686:H312Y	ENSP00000355205:H312Y	H	-	1	0	INO80	39159388	1.000000	0.71417	1.000000	0.80357	0.109000	0.19521	9.375000	0.97178	2.566000	0.86566	0.467000	0.42956	CAC	INO80	-	NULL	ENSG00000128908		0.527	INO80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INO80	HGNC	protein_coding	OTTHUMT00000252527.2	45	0.00	0	G	NM_017553		41372096	41372096	-1	no_errors	ENST00000361937	ensembl	human	known	69_37n	missense	37	26.92	14	SNP	1.000	A
MAP3K1	4214	genome.wustl.edu	37	5	56177099	56177099	+	Splice_Site	SNP	G	G	T			TCGA-D8-A1XB-01A-11D-A14G-09	TCGA-D8-A1XB-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e5ca0f82-6fa9-4d54-adc7-385721f351f3	665d057d-7d5f-41ef-98f1-5d71dded62b5	g.chr5:56177099G>T	ENST00000399503.3	+	13	2369	c.2369G>T	c.(2368-2370)aGg>aTg	p.R790M		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	790					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)	p.?(2)|p.R627K(1)		NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		GTTGAAATCAGGTAATTTTTC	0.373																																						dbGAP											3	Unknown(2)|Substitution - Missense(1)	breast(2)|skin(1)											113.0	100.0	104.0					5																	56177099		1839	4083	5922	-	-	-	SO:0001630	splice_region_variant	0			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.2369+1G>T	5.37:g.56177099G>T				Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Prot_kinase_cat_dom	p.R790M	ENST00000399503.3	37	c.2369	CCDS43318.1	5	.	.	.	.	.	.	.	.	.	.	G	16.50	3.140407	0.56936	.	.	ENSG00000095015	ENST00000399503	T	0.60424	0.19	5.87	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.55097	0.1899	L	0.51422	1.61	0.80722	D	1	B	0.15719	0.014	B	0.14578	0.011	T	0.55016	-0.8206	10	0.87932	D	0	.	16.7815	0.85564	0.0:0.0:0.87:0.13	.	790	Q13233	M3K1_HUMAN	M	790	ENSP00000382423:R790M	ENSP00000382423:R790M	R	+	2	0	MAP3K1	56212856	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	5.388000	0.66249	1.602000	0.50124	0.655000	0.94253	AGG	MAP3K1	-	NULL	ENSG00000095015		0.373	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	HGNC	protein_coding	OTTHUMT00000132309.2	141	0.00	0	G	XM_042066	Missense_Mutation	56177099	56177099	+1	no_errors	ENST00000399503	ensembl	human	novel	69_37n	missense	113	31.52	52	SNP	1.000	T
MAP3K1	4214	genome.wustl.edu	37	5	56179396	56179396	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1XB-01A-11D-A14G-09	TCGA-D8-A1XB-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e5ca0f82-6fa9-4d54-adc7-385721f351f3	665d057d-7d5f-41ef-98f1-5d71dded62b5	g.chr5:56179396T>A	ENST00000399503.3	+	15	3709	c.3709T>A	c.(3709-3711)Tat>Aat	p.Y1237N		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	1237					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		AAAACAACCGTATAGAGAAGA	0.388																																						dbGAP											0													150.0	143.0	145.0					5																	56179396		1866	4086	5952	-	-	-	SO:0001583	missense	0			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.3709T>A	5.37:g.56179396T>A	ENSP00000382423:p.Tyr1237Asn			Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Prot_kinase_cat_dom	p.Y1237N	ENST00000399503.3	37	c.3709	CCDS43318.1	5	.	.	.	.	.	.	.	.	.	.	T	20.7	4.032948	0.75504	.	.	ENSG00000095015	ENST00000399503	T	0.69435	-0.4	5.76	5.76	0.90799	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.79505	0.4457	L	0.56769	1.78	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.81104	-0.1084	10	0.72032	D	0.01	.	16.3786	0.83431	0.0:0.0:0.0:1.0	.	1237	Q13233	M3K1_HUMAN	N	1237	ENSP00000382423:Y1237N	ENSP00000382423:Y1237N	Y	+	1	0	MAP3K1	56215153	1.000000	0.71417	0.124000	0.21820	0.701000	0.40568	6.926000	0.75835	2.323000	0.78572	0.528000	0.53228	TAT	MAP3K1	-	superfamily_Kinase-like_dom	ENSG00000095015		0.388	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	HGNC	protein_coding	OTTHUMT00000132309.2	122	0.00	0	T	XM_042066		56179396	56179396	+1	no_errors	ENST00000399503	ensembl	human	novel	69_37n	missense	97	35.76	54	SNP	0.993	A
MEIOB	254528	genome.wustl.edu	37	16	1889430	1889430	+	Silent	SNP	A	A	G			TCGA-D8-A1XB-01A-11D-A14G-09	TCGA-D8-A1XB-10A-01D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e5ca0f82-6fa9-4d54-adc7-385721f351f3	665d057d-7d5f-41ef-98f1-5d71dded62b5	g.chr16:1889430A>G	ENST00000397344.3	-	12	1238	c.1044T>C	c.(1042-1044)tgT>tgC	p.C348C	MEIOB_ENST00000452149.2_Silent_p.C348C|FAHD1_ENST00000382668.4_3'UTR|FAHD1_ENST00000382666.4_3'UTR|LA16c-429E7.1_ENST00000570247.1_RNA|MEIOB_ENST00000412554.2_Silent_p.C348C|MEIOB_ENST00000470044.1_Silent_p.C141C|MEIOB_ENST00000325962.3_Silent_p.C348C	NM_152764.2	NP_689977.2	Q8N635	MEIOB_HUMAN	meiosis specific with OB domains	348					double-strand break repair via homologous recombination (GO:0000724)|female meiosis I (GO:0007144)|fertilization (GO:0009566)|male meiosis (GO:0007140)|male meiosis I (GO:0007141)|resolution of meiotic recombination intermediates (GO:0000712)|synapsis (GO:0007129)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|single-stranded DNA 3'-5' exodeoxyribonuclease activity (GO:0008310)|single-stranded DNA binding (GO:0003697)										CAATATAACCACAGCTGGAAC	0.348																																						dbGAP											0													64.0	64.0	64.0					16																	1889430		2199	4300	6499	-	-	-	SO:0001819	synonymous_variant	0			BC029829	CCDS10449.2, CCDS53983.1	16p13.3	2012-08-13	2012-08-13	2012-08-13	ENSG00000162039	ENSG00000162039			28569	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 73"""	C16orf73		12477932	Standard	NM_152764		Approved	MGC35212	uc010uvq.1	Q8N635	OTTHUMG00000128683	ENST00000397344.3:c.1044T>C	16.37:g.1889430A>G			B1AK39|C9J0S1|Q96RY0	Silent	SNP	superfamily_NA-bd_OB-fold-like	p.C348	ENST00000397344.3	37	c.1044	CCDS10449.2	16																																																																																			MEIOB	-	superfamily_NA-bd_OB-fold-like	ENSG00000162039		0.348	MEIOB-001	KNOWN	basic|CCDS	protein_coding	MEIOB	HGNC	protein_coding	OTTHUMT00000250580.1	86	0.00	0	A	NM_152764		1889430	1889430	-1	no_errors	ENST00000325962	ensembl	human	known	69_37n	silent	62	33.33	31	SNP	0.998	G
MFSD11	79157	genome.wustl.edu	37	17	74734448	74734448	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1XB-01A-11D-A14G-09	TCGA-D8-A1XB-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e5ca0f82-6fa9-4d54-adc7-385721f351f3	665d057d-7d5f-41ef-98f1-5d71dded62b5	g.chr17:74734448C>G	ENST00000588460.1	+	1	2056	c.14C>G	c.(13-15)tCt>tGt	p.S5C	SRSF2_ENST00000392485.2_5'Flank|MFSD11_ENST00000591864.1_Missense_Mutation_p.S5C|MFSD11_ENST00000593181.1_Missense_Mutation_p.S5C|RP11-318A15.7_ENST00000587459.1_3'UTR|MFSD11_ENST00000590393.1_Missense_Mutation_p.S5C|SRSF2_ENST00000508921.3_5'Flank|MFSD11_ENST00000586622.1_Missense_Mutation_p.S5C|MFSD11_ENST00000590514.1_Missense_Mutation_p.S5C|MFSD11_ENST00000355954.3_Missense_Mutation_p.S5C|SRSF2_ENST00000359995.5_5'Flank|MIR636_ENST00000384825.1_RNA|MFSD11_ENST00000336509.4_Missense_Mutation_p.S5C	NM_001242534.1	NP_001229463.1	O43934	MFS11_HUMAN	major facilitator superfamily domain containing 11	5						integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)	17						TCCCCGGAATCTAAAAAGCTT	0.483																																						dbGAP											0													103.0	98.0	100.0					17																	74734448		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC002753	CCDS11750.1, CCDS56045.1	17q25.1	2012-03-09			ENSG00000092931	ENSG00000092931			25458	protein-coding gene	gene with protein product						9358160	Standard	NM_001242532		Approved	FLJ22196, FLJ20226	uc002jte.3	O43934		ENST00000588460.1:c.14C>G	17.37:g.74734448C>G	ENSP00000464932:p.Ser5Cys		O43442|Q9NXI5	Missense_Mutation	SNP	pfam_Ion_channel_UNC-93,pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.S5C	ENST00000588460.1	37	c.14	CCDS11750.1	17	.	.	.	.	.	.	.	.	.	.	C	21.7	4.184180	0.78677	.	.	ENSG00000092931	ENST00000336509;ENST00000355954	T;T	0.09255	3.28;3.0	5.64	4.66	0.58398	Major facilitator superfamily domain, general substrate transporter (1);	0.107907	0.64402	D	0.000005	T	0.20740	0.0499	L	0.55481	1.735	0.26387	N	0.976642	D;D	0.67145	0.996;0.991	P;P	0.56514	0.8;0.635	T	0.02244	-1.1189	10	0.66056	D	0.02	-24.5106	11.1699	0.48565	0.0:0.8013:0.1269:0.0718	.	5;5	O43934-2;O43934	.;MFS11_HUMAN	C	5	ENSP00000337240:S5C;ENSP00000348225:S5C	ENSP00000337240:S5C	S	+	2	0	MFSD11	72246043	0.942000	0.31987	0.983000	0.44433	0.998000	0.95712	2.666000	0.46799	2.642000	0.89623	0.650000	0.86243	TCT	MFSD11	-	superfamily_MFS_dom_general_subst_transpt	ENSG00000092931		0.483	MFSD11-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MFSD11	HGNC	protein_coding	OTTHUMT00000451516.1	129	0.00	0	C	NM_024311		74734448	74734448	+1	no_errors	ENST00000336509	ensembl	human	known	69_37n	missense	125	15.54	23	SNP	0.404	G
OR13G1	441933	genome.wustl.edu	37	1	247835571	247835571	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1XB-01A-11D-A14G-09	TCGA-D8-A1XB-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e5ca0f82-6fa9-4d54-adc7-385721f351f3	665d057d-7d5f-41ef-98f1-5d71dded62b5	g.chr1:247835571C>T	ENST00000359688.2	-	1	794	c.773G>A	c.(772-774)cGc>cAc	p.R258H	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005487.1	NP_001005487.1	Q8NGZ3	O13G1_HUMAN	olfactory receptor, family 13, subfamily G, member 1	258						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(1)|large_intestine(2)|lung(28)|skin(2)	35	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			GGAAGCAGGGCGGATATAGGT	0.463																																						dbGAP											0													136.0	123.0	127.0					1																	247835571		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB065623	CCDS31094.1	1q44	2012-08-09			ENSG00000197437	ENSG00000197437		"""GPCR / Class A : Olfactory receptors"""	14999	protein-coding gene	gene with protein product		611677					Standard	NM_001005487		Approved		uc001idi.1	Q8NGZ3	OTTHUMG00000040212	ENST00000359688.2:c.773G>A	1.37:g.247835571C>T	ENSP00000352717:p.Arg258His		B2RN80|Q5T2T2|Q6IF86	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.R258H	ENST00000359688.2	37	c.773	CCDS31094.1	1	.	.	.	.	.	.	.	.	.	.	C	12.97	2.096846	0.37048	.	.	ENSG00000197437	ENST00000359688	T	0.37752	1.18	4.2	2.29	0.28610	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43416	D	0.000580	T	0.24044	0.0582	L	0.31664	0.95	0.26015	N	0.981932	B	0.21225	0.053	B	0.21546	0.035	T	0.16988	-1.0384	10	0.52906	T	0.07	-14.7377	7.0944	0.25301	0.1695:0.7365:0.0:0.0941	.	258	Q8NGZ3	O13G1_HUMAN	H	258	ENSP00000352717:R258H	ENSP00000352717:R258H	R	-	2	0	OR13G1	245902194	0.000000	0.05858	0.080000	0.20451	0.987000	0.75469	-0.130000	0.10498	0.512000	0.28257	0.563000	0.77884	CGC	OR13G1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000197437		0.463	OR13G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13G1	HGNC	protein_coding	OTTHUMT00000096869.1	86	0.00	0	C	NM_001005487		247835571	247835571	-1	no_errors	ENST00000359688	ensembl	human	known	69_37n	missense	56	50.85	60	SNP	0.823	T
OR6X1	390260	genome.wustl.edu	37	11	123624563	123624563	+	Missense_Mutation	SNP	C	C	T	rs181689044		TCGA-D8-A1XB-01A-11D-A14G-09	TCGA-D8-A1XB-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e5ca0f82-6fa9-4d54-adc7-385721f351f3	665d057d-7d5f-41ef-98f1-5d71dded62b5	g.chr11:123624563C>T	ENST00000327930.2	-	1	690	c.664G>A	c.(664-666)Gca>Aca	p.A222T		NM_001005188.1	NP_001005188.1	Q8NH79	OR6X1_HUMAN	olfactory receptor, family 6, subfamily X, member 1	222						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A222S(1)		breast(3)|endometrium(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)	23		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		CGTAGGATTGCGGACAGAATG	0.483													C|||	1	0.000199681	0.0	0.0	5008	,	,		17686	0.001		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - Missense(1)	lung(1)											97.0	88.0	91.0					11																	123624563		2202	4299	6501	-	-	-	SO:0001583	missense	0			AB065510	CCDS31695.1	11q24.1	2012-08-09			ENSG00000221931	ENSG00000221931		"""GPCR / Class A : Olfactory receptors"""	14737	protein-coding gene	gene with protein product							Standard	NM_001005188		Approved		uc010rzy.2	Q8NH79	OTTHUMG00000166011	ENST00000327930.2:c.664G>A	11.37:g.123624563C>T	ENSP00000333724:p.Ala222Thr		B9EGW9|Q6IFA0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.A222T	ENST00000327930.2	37	c.664	CCDS31695.1	11	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	0.004	-2.303284	0.00240	.	.	ENSG00000221931	ENST00000327930	T	0.00188	8.59	4.37	3.24	0.37175	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00073	0.0002	N	0.02708	-0.52	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.14117	-1.0484	9	0.02654	T	1	-6.652	5.9591	0.19289	0.0:0.2052:0.0:0.7948	.	222	Q8NH79	OR6X1_HUMAN	T	222	ENSP00000333724:A222T	ENSP00000333724:A222T	A	-	1	0	OR6X1	123129773	0.000000	0.05858	0.377000	0.26055	0.180000	0.23129	-0.399000	0.07250	0.717000	0.32145	-0.295000	0.09555	GCA	OR6X1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000221931		0.483	OR6X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6X1	HGNC	protein_coding	OTTHUMT00000387436.1	50	0.00	0	C	NM_001005188		123624563	123624563	-1	no_errors	ENST00000327930	ensembl	human	known	69_37n	missense	38	36.67	22	SNP	0.054	T
OST4	100128731	genome.wustl.edu	37	2	27294263	27294265	+	In_Frame_Del	DEL	ACG	ACG	-			TCGA-D8-A1XB-01A-11D-A14G-09	TCGA-D8-A1XB-10A-01D-A14G-09	ACG	ACG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e5ca0f82-6fa9-4d54-adc7-385721f351f3	665d057d-7d5f-41ef-98f1-5d71dded62b5	g.chr2:27294263_27294265delACG	ENST00000456793.1	-	2	239_241	c.66_68delCGT	c.(64-69)gtcgtt>gtt	p.22_23VV>V	OST4_ENST00000447619.1_In_Frame_Del_p.22_23VV>V|OST4_ENST00000429985.1_In_Frame_Del_p.22_23VV>V	NM_001134693.1	NP_001128165.1	P0C6T2	OST4_HUMAN	oligosaccharyltransferase 4 homolog (S. cerevisiae)	22						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											GTGATAGAGAACGACAAGCAAGA	0.611																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			BC105283	CCDS58703.1	2p23.3	2012-04-19			ENSG00000228474	ENSG00000228474			32483	protein-coding gene	gene with protein product						16317064	Standard	NM_001134693		Approved		uc002rig.3	P0C6T2	OTTHUMG00000151990	ENST00000456793.1:c.66_68delCGT	2.37:g.27294263_27294265delACG	ENSP00000457935:p.Val23del			In_Frame_Del	DEL	pfam_Oligosaccaryltransferase,superfamily_Oligosaccaryltransferase	p.V23in_frame_del	ENST00000456793.1	37	c.68_66	CCDS58703.1	2																																																																																			OST4	-	pfam_Oligosaccaryltransferase,superfamily_Oligosaccaryltransferase	ENSG00000228474		0.611	OST4-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	OST4	HGNC	protein_coding	OTTHUMT00000324704.2	35	0.00	0	ACG	NM_001134693		27294263	27294265	-1	no_errors	ENST00000429985	ensembl	human	known	69_37n	in_frame_del	43	18.87	10	DEL	1.000:1.000:0.433	-
PKP4	8502	genome.wustl.edu	37	2	159481627	159481627	+	Missense_Mutation	SNP	T	T	G			TCGA-D8-A1XB-01A-11D-A14G-09	TCGA-D8-A1XB-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e5ca0f82-6fa9-4d54-adc7-385721f351f3	665d057d-7d5f-41ef-98f1-5d71dded62b5	g.chr2:159481627T>G	ENST00000389759.3	+	7	953	c.841T>G	c.(841-843)Tcc>Gcc	p.S281A	PKP4_ENST00000389757.3_Missense_Mutation_p.S281A	NM_003628.3	NP_003619.2	Q99569	PKP4_HUMAN	plakophilin 4	281					cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|positive regulation of cytokinesis (GO:0032467)|positive regulation of gene expression (GO:0010628)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell adhesion (GO:0030155)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|desmosome (GO:0030057)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)				breast(2)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(21)|ovary(6)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	61						GAGACCCGCCTCCCCAACAGC	0.612										HNSCC(62;0.18)																												dbGAP											0													49.0	47.0	48.0					2																	159481627		2203	4300	6503	-	-	-	SO:0001583	missense	0			X81889	CCDS33305.1, CCDS33306.1	2q24.1	2013-02-14			ENSG00000144283	ENSG00000144283		"""Armadillo repeat containing"""	9026	protein-coding gene	gene with protein product		604276				9342840, 8937994	Standard	NM_003628		Approved	p0071	uc002tzv.3	Q99569	OTTHUMG00000153969	ENST00000389759.3:c.841T>G	2.37:g.159481627T>G	ENSP00000374409:p.Ser281Ala		Q86W91	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.S281A	ENST00000389759.3	37	c.841	CCDS33305.1	2	.	.	.	.	.	.	.	.	.	.	T	18.42	3.619172	0.66787	.	.	ENSG00000144283	ENST00000428353;ENST00000389757;ENST00000389759	T;T	0.76060	-0.99;-0.99	5.87	5.87	0.94306	.	1.368040	0.04182	N	0.326749	D	0.83885	0.5351	M	0.66939	2.045	0.58432	D	0.999999	P;P;P;P	0.45902	0.792;0.829;0.86;0.868	P;B;B;P	0.51657	0.546;0.359;0.256;0.676	T	0.68857	-0.5298	10	0.35671	T	0.21	-9.6653	16.5764	0.84681	0.0:0.0:0.0:1.0	.	133;281;281;133	Q6LCG8;Q99569-2;Q99569;F8W7E2	.;.;PKP4_HUMAN;.	A	133;281;281	ENSP00000374407:S281A;ENSP00000374409:S281A	ENSP00000374407:S281A	S	+	1	0	PKP4	159189873	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.430000	0.66501	2.371000	0.80710	0.533000	0.62120	TCC	PKP4	-	NULL	ENSG00000144283		0.612	PKP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PKP4	HGNC	protein_coding	OTTHUMT00000333250.1	49	0.00	0	T			159481627	159481627	+1	no_errors	ENST00000389759	ensembl	human	known	69_37n	missense	27	18.18	6	SNP	1.000	G
PLK4	10733	genome.wustl.edu	37	4	128811154	128811154	+	Frame_Shift_Del	DEL	T	T	-			TCGA-D8-A1XB-01A-11D-A14G-09	TCGA-D8-A1XB-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e5ca0f82-6fa9-4d54-adc7-385721f351f3	665d057d-7d5f-41ef-98f1-5d71dded62b5	g.chr4:128811154delT	ENST00000270861.5	+	7	1867	c.1593delT	c.(1591-1593)tctfs	p.S531fs	PLK4_ENST00000514379.1_Frame_Shift_Del_p.S490fs|PLK4_ENST00000513090.1_Frame_Shift_Del_p.S499fs|PLK4_ENST00000515069.1_Intron|RNU6-583P_ENST00000516012.1_RNA|PLK4_ENST00000507249.1_Frame_Shift_Del_p.S497fs	NM_014264.4	NP_055079.3	O00444	PLK4_HUMAN	polo-like kinase 4	531					centriole replication (GO:0007099)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of centriole replication (GO:0046601)|protein phosphorylation (GO:0006468)|trophoblast giant cell differentiation (GO:0060707)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	31						CTGATGCTTCTGATAATGCAC	0.403																																					Colon(135;508 1718 19061 31832 42879)	dbGAP											0													86.0	82.0	83.0					4																	128811154		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			Y13115	CCDS3735.1, CCDS54803.1, CCDS54804.1	4q27-q28	2013-01-18	2010-06-24	2004-01-28	ENSG00000142731	ENSG00000142731			11397	protein-coding gene	gene with protein product		605031	"""serine/threonine kinase 18"", ""polo-like kinase 4 (Drosophila)"""	STK18			Standard	NM_014264		Approved	Sak	uc003ifo.3	O00444	OTTHUMG00000133301	ENST00000270861.5:c.1593delT	4.37:g.128811154delT	ENSP00000270861:p.Ser531fs		B2RAL0|B7Z837|B7Z8G7|Q8IYF0|Q96Q95|Q9UD84|Q9UDE2	Frame_Shift_Del	DEL	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_POLO_box_duplicated_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_POLO_box_duplicated_dom,pfscan_Prot_kinase_cat_dom	p.D532fs	ENST00000270861.5	37	c.1593	CCDS3735.1	4																																																																																			PLK4	-	NULL	ENSG00000142731		0.403	PLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLK4	HGNC	protein_coding	OTTHUMT00000257095.3	94	0.00	0	T			128811154	128811154	+1	no_errors	ENST00000270861	ensembl	human	known	69_37n	frame_shift_del	60	16.44	12	DEL	0.184	-
POTEF	728378	genome.wustl.edu	37	2	130832873	130832873	+	Silent	SNP	G	G	A	rs62165872	byFrequency	TCGA-D8-A1XB-01A-11D-A14G-09	TCGA-D8-A1XB-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e5ca0f82-6fa9-4d54-adc7-385721f351f3	665d057d-7d5f-41ef-98f1-5d71dded62b5	g.chr2:130832873G>A	ENST00000409914.2	-	17	2571	c.2172C>T	c.(2170-2172)gaC>gaT	p.D724D	POTEF_ENST00000357462.5_Silent_p.D724D	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	724	Actin-like.				retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						GGGGGGCATCGTCGCCCGCAA	0.592													.|||	130	0.0259585	0.0174	0.0331	5008	,	,		19488	0.0139		0.0437	False		,,,				2504	0.0266					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.2172C>T	2.37:g.130832873G>A			A6NC34	Silent	SNP	pfam_Actin-like,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Actin-like,prints_Actin-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.D724	ENST00000409914.2	37	c.2172	CCDS46409.1	2																																																																																			POTEF	-	pfam_Actin-like,smart_Actin-like	ENSG00000196604		0.592	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEF	HGNC	protein_coding	OTTHUMT00000331889.2	59	0.00	0	G	NM_001099771		130832873	130832873	-1	no_errors	ENST00000357462	ensembl	human	known	69_37n	silent	50	10.53	6	SNP	1.000	A
PPM1H	57460	genome.wustl.edu	37	12	63061084	63061084	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1XB-01A-11D-A14G-09	TCGA-D8-A1XB-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e5ca0f82-6fa9-4d54-adc7-385721f351f3	665d057d-7d5f-41ef-98f1-5d71dded62b5	g.chr12:63061084T>C	ENST00000228705.6	-	9	1571	c.1271A>G	c.(1270-1272)tAt>tGt	p.Y424C	PPM1H_ENST00000551214.1_5'UTR	NM_020700.1	NP_065751.1	Q9ULR3	PPM1H_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1H	424	PP2C-like.						phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)	18			GBM - Glioblastoma multiforme(1;0.000443)|BRCA - Breast invasive adenocarcinoma(9;0.209)	GBM - Glioblastoma multiforme(28;0.0126)		TCCATGATCATATTTTGAAAG	0.363																																						dbGAP											0													87.0	84.0	85.0					12																	63061084		1880	4126	6006	-	-	-	SO:0001583	missense	0			AB032983	CCDS44934.1	12q14.1	2012-04-17	2010-03-05	2004-03-26	ENSG00000111110	ENSG00000111110	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	18583	protein-coding gene	gene with protein product	"""neurite extension-related protein phosphatase related to PP2C"""		"""ras homolog gene family, member C like 1"", ""protein phosphatase 1H (PP2C domain containing)"""	ARHCL1			Standard	NM_020700		Approved	KIAA1157, FLJ13253, NERPP-2C	uc001srk.3	Q9ULR3	OTTHUMG00000169990	ENST00000228705.6:c.1271A>G	12.37:g.63061084T>C	ENSP00000228705:p.Tyr424Cys		B1Q2A9|B2RXG4|Q6PI86	Missense_Mutation	SNP	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	p.Y424C	ENST00000228705.6	37	c.1271	CCDS44934.1	12	.	.	.	.	.	.	.	.	.	.	T	12.86	2.063126	0.36373	.	.	ENSG00000111110	ENST00000228705	T	0.16897	2.31	5.8	5.8	0.92144	Protein phosphatase 2C-like (5);	0.119960	0.64402	D	0.000016	T	0.18173	0.0436	L	0.43923	1.385	0.51233	D	0.999915	B	0.12630	0.006	B	0.23852	0.049	T	0.04551	-1.0943	9	.	.	.	0.4778	16.1475	0.81580	0.0:0.0:0.0:1.0	.	424	Q9ULR3	PPM1H_HUMAN	C	424	ENSP00000228705:Y424C	.	Y	-	2	0	PPM1H	61347351	1.000000	0.71417	0.993000	0.49108	0.788000	0.44548	3.622000	0.54217	2.213000	0.71641	0.528000	0.53228	TAT	PPM1H	-	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	ENSG00000111110		0.363	PPM1H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPM1H	HGNC	protein_coding	OTTHUMT00000406760.2	81	0.00	0	T	NM_020700		63061084	63061084	-1	no_errors	ENST00000228705	ensembl	human	known	69_37n	missense	71	31.73	33	SNP	0.999	C
PRRC2C	23215	genome.wustl.edu	37	1	171549015	171549015	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XB-01A-11D-A14G-09	TCGA-D8-A1XB-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e5ca0f82-6fa9-4d54-adc7-385721f351f3	665d057d-7d5f-41ef-98f1-5d71dded62b5	g.chr1:171549015G>A	ENST00000338920.4	+	28	7552	c.7315G>A	c.(7315-7317)Ggg>Agg	p.G2439R	PRRC2C_ENST00000367742.3_Missense_Mutation_p.G2441R|PRRC2C_ENST00000392078.3_Missense_Mutation_p.G2441R|PRRC2C_ENST00000426496.2_Missense_Mutation_p.G2374R	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	2439	Gln-rich.				hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										ACCACTGCAAGGGCAGCATCA	0.438																																						dbGAP											0													94.0	90.0	91.0					1																	171549015		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.7315G>A	1.37:g.171549015G>A	ENSP00000343629:p.Gly2439Arg		Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Missense_Mutation	SNP	pfam_BAT2_N	p.G2441R	ENST00000338920.4	37	c.7321	CCDS1296.2	1	.	.	.	.	.	.	.	.	.	.	G	15.46	2.841485	0.51057	.	.	ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080	T;T;T;T	0.02236	4.38;4.39;4.39;4.39	5.5	4.59	0.56863	.	0.000000	0.44688	D	0.000435	T	0.02494	0.0076	L	0.36672	1.1	0.33610	D	0.603416	D	0.56746	0.977	P	0.58873	0.847	T	0.43605	-0.9381	10	0.87932	D	0	.	10.6608	0.45702	0.1471:0.0:0.8529:0.0	.	2439	Q9Y520-4	.	R	2441;2393;2374;2441;2439;2196	ENSP00000375928:G2441R;ENSP00000410219:G2374R;ENSP00000356716:G2441R;ENSP00000343629:G2439R	ENSP00000343629:G2439R	G	+	1	0	PRRC2C	169815639	1.000000	0.71417	0.991000	0.47740	0.928000	0.56348	5.388000	0.66249	1.320000	0.45209	0.313000	0.20887	GGG	PRRC2C	-	NULL	ENSG00000117523		0.438	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRRC2C	HGNC	protein_coding	OTTHUMT00000314826.4	89	0.00	0	G	NM_015172		171549015	171549015	+1	no_errors	ENST00000392078	ensembl	human	known	69_37n	missense	57	60.14	86	SNP	1.000	A
SLC25A42	284439	genome.wustl.edu	37	19	19218751	19218751	+	Silent	SNP	G	G	T			TCGA-D8-A1XB-01A-11D-A14G-09	TCGA-D8-A1XB-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e5ca0f82-6fa9-4d54-adc7-385721f351f3	665d057d-7d5f-41ef-98f1-5d71dded62b5	g.chr19:19218751G>T	ENST00000318596.7	+	7	697	c.546G>T	c.(544-546)ggG>ggT	p.G182G	SLC25A42_ENST00000600275.1_3'UTR	NM_178526.4	NP_848621.2	Q86VD7	S2542_HUMAN	solute carrier family 25, member 42	182					ADP transport (GO:0015866)|AMP transport (GO:0080121)|ATP transport (GO:0015867)|coenzyme A transmembrane transport (GO:0035349)|metabolic process (GO:0008152)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	adenosine-diphosphatase activity (GO:0043262)|ADP transmembrane transporter activity (GO:0015217)|AMP transmembrane transporter activity (GO:0080122)|ATP transmembrane transporter activity (GO:0005347)|coenzyme A transmembrane transporter activity (GO:0015228)			cervix(1)|large_intestine(2)|lung(3)	6			OV - Ovarian serous cystadenocarcinoma(5;5.4e-06)|Epithelial(12;0.000497)			GAGAAGAGGGGCTGAAGACTC	0.567																																						dbGAP											0													118.0	104.0	109.0					19																	19218751		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32966.1	19p13.11	2013-05-22			ENSG00000181035	ENSG00000181035		"""Solute carriers"""	28380	protein-coding gene	gene with protein product		610823				16949250, 19429682	Standard	NM_178526		Approved	MGC26694	uc002nlf.3	Q86VD7		ENST00000318596.7:c.546G>T	19.37:g.19218751G>T			D2T2J5|O14553|O43378	Silent	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,prints_Mit_carrier,prints_Graves_DC,pfscan_Mitochondrial_sb/sol_carrier	p.G182	ENST00000318596.7	37	c.546	CCDS32966.1	19																																																																																			SLC25A42	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000181035		0.567	SLC25A42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A42	HGNC	protein_coding	OTTHUMT00000465931.1	46	0.00	0	G	NM_178526		19218751	19218751	+1	no_errors	ENST00000318596	ensembl	human	known	69_37n	silent	26	33.33	13	SNP	0.459	T
WTAP	9589	genome.wustl.edu	37	6	160174524	160174524	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1XB-01A-11D-A14G-09	TCGA-D8-A1XB-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e5ca0f82-6fa9-4d54-adc7-385721f351f3	665d057d-7d5f-41ef-98f1-5d71dded62b5	g.chr6:160174524G>C	ENST00000358372.4	+	7	2242	c.485G>C	c.(484-486)cGa>cCa	p.R162P	SOD2_ENST00000546087.1_Intron	NM_001270531.1|NM_004906.4	NP_001257460.1|NP_004897.2	Q15007	FL2D_HUMAN	Wilms tumor 1 associated protein	162					cell cycle (GO:0007049)|mRNA methylation (GO:0080009)|mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	MIS complex (GO:0036396)|nuclear membrane (GO:0031965)|nuclear speck (GO:0016607)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	18		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.75e-18)|BRCA - Breast invasive adenocarcinoma(81;5.93e-06)		GCGAAGTGTCGAATGCTTATC	0.428																																						dbGAP											0													124.0	117.0	120.0					6																	160174524		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ276706	CCDS5266.1, CCDS5267.1, CCDS75542.1	6q25-q27	2008-02-05			ENSG00000146457	ENSG00000146457			16846	protein-coding gene	gene with protein product		605442				7788527, 11001926	Standard	NM_004906		Approved	KIAA0105, MGC3925	uc003qsl.4	Q15007	OTTHUMG00000015933	ENST00000358372.4:c.485G>C	6.37:g.160174524G>C	ENSP00000351141:p.Arg162Pro		Q5TCL8|Q5TCL9|Q96T28|Q9BYJ7|Q9H4E2	Missense_Mutation	SNP	NULL	p.R162P	ENST00000358372.4	37	c.485	CCDS5266.1	6	.	.	.	.	.	.	.	.	.	.	G	35	5.508377	0.96386	.	.	ENSG00000146457	ENST00000358372	T	0.49432	0.78	6.17	6.17	0.99709	.	0.066055	0.64402	D	0.000005	T	0.69387	0.3105	M	0.83953	2.67	0.80722	D	1	D;D	0.76494	0.999;0.998	D;P	0.71656	0.974;0.899	T	0.70809	-0.4771	10	0.72032	D	0.01	-1.0237	20.8794	0.99867	0.0:0.0:1.0:0.0	.	162;162	A8K489;Q15007	.;FL2D_HUMAN	P	162	ENSP00000351141:R162P	ENSP00000351141:R162P	R	+	2	0	WTAP	160094514	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.841000	0.99482	2.941000	0.99782	0.655000	0.94253	CGA	WTAP	-	NULL	ENSG00000146457		0.428	WTAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WTAP	HGNC	protein_coding	OTTHUMT00000042905.1	105	0.00	0	G	NM_152857		160174524	160174524	+1	no_errors	ENST00000358372	ensembl	human	known	69_37n	missense	60	37.11	36	SNP	1.000	C
WWTR1	25937	genome.wustl.edu	37	3	149374905	149374905	+	Silent	SNP	G	G	C			TCGA-D8-A1XB-01A-11D-A14G-09	TCGA-D8-A1XB-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e5ca0f82-6fa9-4d54-adc7-385721f351f3	665d057d-7d5f-41ef-98f1-5d71dded62b5	g.chr3:149374905G>C	ENST00000465804.1	-	3	445	c.189C>G	c.(187-189)cgC>cgG	p.R63R	WWTR1-AS1_ENST00000466836.1_RNA|WWTR1-AS1_ENST00000495094.1_RNA|WWTR1_ENST00000360632.3_Silent_p.R63R|WWTR1_ENST00000467467.1_Silent_p.R63R|WWTR1-AS1_ENST00000479752.1_RNA	NM_001168278.1	NP_001161750.1	Q9GZV5	WWTR1_HUMAN	WW domain containing transcription regulator 1	63					cilium morphogenesis (GO:0060271)|gene expression (GO:0010467)|glomerulus development (GO:0032835)|hippo signaling (GO:0035329)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoblast differentiation (GO:0001649)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of SMAD protein import into nucleus (GO:0060390)|regulation of transcription, DNA-templated (GO:0006355)|stem cell division (GO:0017145)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(5)|cervix(1)|endometrium(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)	23			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			TGCTGGACTGGCGCGAGTGCG	0.657			T	CAMTA1	epitheliod hemangioendothelioma																																	dbGAP		Dom	yes		3	3q23-q24	607392	WW domain containing transcription regulator 1		M	0													14.0	15.0	14.0					3																	149374905		2197	4291	6488	-	-	-	SO:0001819	synonymous_variant	0			AK022036	CCDS3144.1	3q23-q24	2004-12-03			ENSG00000018408	ENSG00000018408			24042	protein-coding gene	gene with protein product		607392				11118213, 15096513	Standard	NM_015472		Approved	TAZ, DKFZp586I1419	uc021xfm.1	Q9GZV5	OTTHUMG00000159614	ENST00000465804.1:c.189C>G	3.37:g.149374905G>C			D3DNH7|Q8N3P2|Q9Y3W6	Silent	SNP	pfam_WW_Rsp5_WWP,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,pfscan_WW_Rsp5_WWP	p.R63	ENST00000465804.1	37	c.189	CCDS3144.1	3																																																																																			WWTR1	-	NULL	ENSG00000018408		0.657	WWTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WWTR1	HGNC	protein_coding	OTTHUMT00000356498.1	15	0.00	0	G	NM_015472		149374905	149374905	-1	no_errors	ENST00000360632	ensembl	human	known	69_37n	silent	13	23.53	4	SNP	0.999	C
ZNF461	92283	genome.wustl.edu	37	19	37130642	37130642	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1XB-01A-11D-A14G-09	TCGA-D8-A1XB-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e5ca0f82-6fa9-4d54-adc7-385721f351f3	665d057d-7d5f-41ef-98f1-5d71dded62b5	g.chr19:37130642C>T	ENST00000588268.1	-	6	832	c.605G>A	c.(604-606)aGt>aAt	p.S202N	ZNF461_ENST00000540605.2_5'UTR|ZNF461_ENST00000360357.4_Missense_Mutation_p.S179N	NM_153257.2	NP_694989.2	Q8TAF7	ZN461_HUMAN	zinc finger protein 461	202					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(4)|lung(17)|prostate(1)|urinary_tract(2)	29	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			TAAATGGTAACTGAAGATTTT	0.294																																						dbGAP											0													82.0	81.0	81.0					19																	37130642		1813	4077	5890	-	-	-	SO:0001583	missense	0			BX649031	CCDS54257.1, CCDS74348.1	19q13.13	2013-01-08				ENSG00000197808		"""Zinc fingers, C2H2-type"", ""-"""	21629	protein-coding gene	gene with protein product		608640				11579202, 15004467	Standard	XM_005259402		Approved	GIOT-1, MGC33911	uc002oem.3	Q8TAF7		ENST00000588268.1:c.605G>A	19.37:g.37130642C>T	ENSP00000467931:p.Ser202Asn		A8K9W9|Q6VSF7|Q9ULZ8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S202N	ENST00000588268.1	37	c.605	CCDS54257.1	19	.	.	.	.	.	.	.	.	.	.	C	5.042	0.193346	0.09599	.	.	ENSG00000197808	ENST00000396893;ENST00000360357;ENST00000540605;ENST00000396892	T	0.44881	0.91	3.22	-0.322	0.12713	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	.	.	.	.	T	0.24812	0.0602	L	0.38838	1.175	0.09310	N	1	B;B;B	0.12630	0.003;0.006;0.006	B;B;B	0.12837	0.005;0.008;0.008	T	0.22941	-1.0202	9	0.25751	T	0.34	.	0.5091	0.00592	0.1798:0.3186:0.1757:0.3258	.	179;124;202	B4DRP8;Q59G30;Q8TAF7	.;.;ZN461_HUMAN	N	202;179;75;137	ENSP00000353515:S179N	ENSP00000353515:S179N	S	-	2	0	ZNF461	41822482	0.000000	0.05858	0.129000	0.21949	0.147000	0.21601	-1.661000	0.01972	0.028000	0.15324	-0.218000	0.12543	AGT	ZNF461	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197808		0.294	ZNF461-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF461	HGNC	protein_coding	OTTHUMT00000453202.1	113	0.00	0	C	NM_153257		37130642	37130642	-1	no_errors	ENST00000588268	ensembl	human	known	69_37n	missense	88	27.87	34	SNP	0.000	T
ZNF112	7771	genome.wustl.edu	37	19	44831587	44831587	+	Nonstop_Mutation	SNP	C	C	A			TCGA-D8-A1XB-01A-11D-A14G-09	TCGA-D8-A1XB-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e5ca0f82-6fa9-4d54-adc7-385721f351f3	665d057d-7d5f-41ef-98f1-5d71dded62b5	g.chr19:44831587C>A	ENST00000337401.4	-	5	2829	c.2741G>T	c.(2740-2742)tGa>tTa	p.*914L	ZNF112_ENST00000354340.4_Nonstop_Mutation_p.*908L|ZNF112_ENST00000536500.1_Nonstop_Mutation_p.*931L	NM_001083335.1	NP_001076804.1	Q9UJU3	ZN112_HUMAN	zinc finger protein 112	0					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										TTGAGGACTTCAAAACAAAAC	0.333																																						dbGAP											0													38.0	39.0	38.0					19																	44831587		2203	4299	6502	-	-	-	SO:0001578	stop_lost	0			AF198358		19q13.2	2014-02-06	2012-11-27		ENSG00000062370	ENSG00000062370		"""Zinc fingers, C2H2-type"""	12892	protein-coding gene	gene with protein product		603994	"""zinc finger protein 112 homolog (mouse)"", ""zinc finger protein 228"""	ZFP112, ZNF228			Standard	NM_013380		Approved			Q9UJU3	OTTHUMG00000182357	ENST00000337401.4:c.2741G>T	19.37:g.44831587C>A			A4FU53|Q9HCA7	Nonstop_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.*931L	ENST00000337401.4	37	c.2792	CCDS54276.1	19	.	.	.	.	.	.	.	.	.	.	C	11.62	1.693296	0.30052	.	.	ENSG00000062370	ENST00000337401;ENST00000412927;ENST00000354340;ENST00000536500;ENST00000253426	.	.	.	3.5	2.45	0.29901	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.0285	0.42085	0.2382:0.7618:0.0:0.0	.	.	.	.	L	914;914;908;931;913	.	.	X	-	2	2	ZNF285	49523427	0.000000	0.05858	0.342000	0.25602	0.836000	0.47400	-0.086000	0.11233	0.983000	0.38602	0.655000	0.94253	TGA	ZFP112	-	NULL	ENSG00000062370		0.333	ZNF112-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFP112	HGNC	protein_coding	OTTHUMT00000460744.1	58	0.00	0	C	NM_013380		44831587	44831587	-1	no_errors	ENST00000536500	ensembl	human	known	69_37n	nonstop	54	10.00	6	SNP	0.629	A
