#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ATP13A1	57130	genome.wustl.edu	37	19	19767522	19767522	+	Missense_Mutation	SNP	G	G	C	rs371113170		TCGA-D8-A1XV-01A-11D-A14K-09	TCGA-D8-A1XV-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a76adfd1-8c89-4c13-b570-5ccc47043a70	679a76a2-1e0a-4289-a8e2-b460b9da28af	g.chr19:19767522G>C	ENST00000357324.6	-	7	1056	c.1030C>G	c.(1030-1032)Cgc>Ggc	p.R344G	ATP13A1_ENST00000496082.1_5'Flank|ATP13A1_ENST00000291503.5_Missense_Mutation_p.R226G	NM_020410.2	NP_065143.2	Q9HD20	AT131_HUMAN	ATPase type 13A1	344						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)	p.R344C(1)		central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						ACGATGCAGCGGCCTCGCAGC	0.637																																					Esophageal Squamous(142;920 1789 9047 14684 24777)	dbGAP											1	Substitution - Missense(1)	ovary(1)											57.0	51.0	53.0					19																	19767522		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056420	CCDS32970.2	19p13.11	2010-04-20	2005-01-12	2005-01-12	ENSG00000105726	ENSG00000105726		"""ATPases / P-type"""	24215	protein-coding gene	gene with protein product	"""cation transporting ATPase"""		"""ATPase type 13A"""	ATP13A		11347906	Standard	NM_020410		Approved	KIAA1825, FLJ31858, CGI-152	uc002nnh.4	Q9HD20	OTTHUMG00000153016	ENST00000357324.6:c.1030C>G	19.37:g.19767522G>C	ENSP00000349877:p.Arg344Gly		B3KPJ2|B3KTA7|Q6NT90|Q6ZMG7|Q9H6C6	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_unknown-pump-sp,tigrfam_ATPase_P-typ_ion-transptr	p.R344G	ENST00000357324.6	37	c.1030	CCDS32970.2	19	.	.	.	.	.	.	.	.	.	.	G	19.29	3.800123	0.70567	.	.	ENSG00000105726	ENST00000291503;ENST00000357324	D;D	0.90385	-2.66;-2.66	4.89	4.89	0.63831	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.85682	D	0.000000	D	0.85716	0.5761	L	0.29908	0.895	0.80722	D	1	B;B	0.17038	0.02;0.011	B;B	0.17433	0.018;0.003	T	0.82145	-0.0602	10	0.46703	T	0.11	-33.9359	15.9147	0.79503	0.0:0.0:1.0:0.0	.	344;226	Q9HD20;Q9HD20-2	AT131_HUMAN;.	G	226;344	ENSP00000291503:R226G;ENSP00000349877:R344G	ENSP00000291503:R226G	R	-	1	0	ATP13A1	19628522	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	5.054000	0.64275	2.413000	0.81919	0.563000	0.77884	CGC	ATP13A1	-	pfam_ATPase_P-typ_ATPase-assoc-dom,tigrfam_ATPase_P-typ_unknown-pump-sp	ENSG00000105726		0.637	ATP13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A1	HGNC	protein_coding	OTTHUMT00000329005.1	57	0.00	0	G	NM_020410		19767522	19767522	-1	no_errors	ENST00000357324	ensembl	human	known	69_37n	missense	38	38.71	24	SNP	1.000	C
CCDC17	149483	genome.wustl.edu	37	1	46088465	46088465	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XV-01A-11D-A14K-09	TCGA-D8-A1XV-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a76adfd1-8c89-4c13-b570-5ccc47043a70	679a76a2-1e0a-4289-a8e2-b460b9da28af	g.chr1:46088465G>A	ENST00000528266.1	-	5	845	c.698C>T	c.(697-699)cCa>cTa	p.P233L	CCDC17_ENST00000464739.1_5'Flank|CCDC17_ENST00000445048.2_Intron|CCDC17_ENST00000421127.2_Missense_Mutation_p.P224L|CCDC17_ENST00000343901.2_Missense_Mutation_p.P201L			Q96LX7	CCD17_HUMAN	coiled-coil domain containing 17	233										kidney(1)|large_intestine(1)|lung(1)|ovary(2)	5	Acute lymphoblastic leukemia(166;0.155)					CTTTTGCACTGGAGAATAAAG	0.647																																						dbGAP											0													19.0	19.0	19.0					1																	46088465		2202	4296	6498	-	-	-	SO:0001583	missense	0				CCDS44131.1, CCDS44131.2, CCDS53314.1	1p34.1	2014-02-12			ENSG00000159588	ENSG00000159588			26574	protein-coding gene	gene with protein product							Standard	NM_001190182		Approved	FLJ33084	uc010olt.2	Q96LX7	OTTHUMG00000007822	ENST00000528266.1:c.698C>T	1.37:g.46088465G>A	ENSP00000432172:p.Pro233Leu		A1A4Y7|B4DNX7|B4E1Q5|C9J8L2|Q0P683|Q5T629	Missense_Mutation	SNP	NULL	p.P201L	ENST00000528266.1	37	c.602	CCDS44131.2	1	.	.	.	.	.	.	.	.	.	.	G	11.68	1.711645	0.30322	.	.	ENSG00000159588	ENST00000421127;ENST00000343901;ENST00000528266	T;T;T	0.18016	2.24;2.24;2.25	5.15	2.0	0.26442	.	0.459218	0.22449	N	0.059919	T	0.08846	0.0219	L	0.28192	0.835	0.09310	N	1	B;B;B	0.28552	0.003;0.033;0.215	B;B;B	0.26770	0.005;0.027;0.073	T	0.29027	-1.0025	10	0.18710	T	0.47	-16.663	4.1017	0.10017	0.2918:0.1742:0.5339:0.0	.	233;224;201	Q96LX7;Q96LX7-5;F2Z395	CCD17_HUMAN;.;.	L	224;201;233	ENSP00000389415:P224L;ENSP00000341451:P201L;ENSP00000432172:P233L	ENSP00000341451:P201L	P	-	2	0	CCDC17	45861052	0.000000	0.05858	0.015000	0.15790	0.014000	0.08584	0.240000	0.18042	0.662000	0.31006	0.561000	0.74099	CCA	CCDC17	-	NULL	ENSG00000159588		0.647	CCDC17-008	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	CCDC17	HGNC	protein_coding	OTTHUMT00000386833.1	17	0.00	0	G	NM_152500		46088465	46088465	-1	no_errors	ENST00000343901	ensembl	human	known	69_37n	missense	12	47.83	11	SNP	0.010	A
CD200R1L	344807	genome.wustl.edu	37	3	112545931	112545931	+	Silent	SNP	A	A	G			TCGA-D8-A1XV-01A-11D-A14K-09	TCGA-D8-A1XV-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a76adfd1-8c89-4c13-b570-5ccc47043a70	679a76a2-1e0a-4289-a8e2-b460b9da28af	g.chr3:112545931A>G	ENST00000398214.1	-	4	813	c.588T>C	c.(586-588)agT>agC	p.S196S	CD200R1L_ENST00000448932.1_Silent_p.S175S|CD200R1L_ENST00000488794.1_Silent_p.S175S	NM_001008784.2	NP_001008784.2	Q6Q8B3	MO2R2_HUMAN	CD200 receptor 1-like	196	Ig-like C2-type.					integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|urinary_tract(2)	19						AGGGGCATGTACTCTTAACCG	0.522																																						dbGAP											0													66.0	69.0	68.0					3																	112545931		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY284976	CCDS43131.1, CCDS56267.1	3q13.2	2014-05-15	2008-10-08		ENSG00000206531	ENSG00000206531		"""Immunoglobulin superfamily / C2-set domain containing"""	24665	protein-coding gene	gene with protein product	"""CD200 receptor 2"""						Standard	NM_001008784		Approved	CD200RLa, CD200R2	uc003dzi.1	Q6Q8B3	OTTHUMG00000159283	ENST00000398214.1:c.588T>C	3.37:g.112545931A>G			Q6WHB7	Silent	SNP	pfam_CD80_C2-set,pfscan_Ig-like	p.S196	ENST00000398214.1	37	c.588	CCDS43131.1	3																																																																																			CD200R1L	-	pfam_CD80_C2-set,pfscan_Ig-like	ENSG00000206531		0.522	CD200R1L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD200R1L	HGNC	protein_coding	OTTHUMT00000354365.1	52	0.00	0	A	NM_001008784		112545931	112545931	-1	no_errors	ENST00000398214	ensembl	human	known	69_37n	silent	62	31.11	28	SNP	0.050	G
CEACAM16	388551	genome.wustl.edu	37	19	45209123	45209123	+	Missense_Mutation	SNP	G	G	A	rs545264324		TCGA-D8-A1XV-01A-11D-A14K-09	TCGA-D8-A1XV-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a76adfd1-8c89-4c13-b570-5ccc47043a70	679a76a2-1e0a-4289-a8e2-b460b9da28af	g.chr19:45209123G>A	ENST00000405314.2	+	4	1022	c.925G>A	c.(925-927)Gtg>Atg	p.V309M	CTB-171A8.1_ENST00000590796.1_RNA|CEACAM16_ENST00000587331.1_Missense_Mutation_p.V309M			Q2WEN9	CEA16_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 16	309	Ig-like C2-type 2.				sensory perception of sound (GO:0007605)	extracellular region (GO:0005576)|stereocilium bundle tip (GO:0032426)				endometrium(3)|large_intestine(2)|lung(3)|ovary(1)	9	Lung NSC(12;0.000698)|all_lung(12;0.002)	Prostate(69;0.0376)|Ovarian(192;0.231)				TGCCTCAGTCGTGGTCAAGCT	0.582													G|||	1	0.000199681	0.0	0.0	5008	,	,		18900	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													129.0	139.0	136.0					19																	45209123		2085	4225	6310	-	-	-	SO:0001583	missense	0				CCDS54278.1	19q13.31	2014-01-27			ENSG00000213892	ENSG00000213892		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31948	protein-coding gene	gene with protein product		614591				21368133	Standard	NM_001039213		Approved	DFNA4B	uc010xxd.2	Q2WEN9	OTTHUMG00000151519	ENST00000405314.2:c.925G>A	19.37:g.45209123G>A	ENSP00000385576:p.Val309Met		A7LI12	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.V309M	ENST00000405314.2	37	c.925	CCDS54278.1	19	.	.	.	.	.	.	.	.	.	.	G	15.07	2.723033	0.48728	.	.	ENSG00000213892	ENST00000396750;ENST00000405314	T	0.44482	0.92	5.24	4.18	0.49190	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.346744	0.16283	U	0.221280	T	0.31231	0.0790	L	0.36672	1.1	0.29222	N	0.873886	P	0.39862	0.692	B	0.37888	0.26	T	0.13442	-1.0509	10	0.33141	T	0.24	-24.2978	9.4654	0.38809	0.0:0.0:0.7349:0.2651	.	368	Q2WEN9	CEA16_HUMAN	M	374;309	ENSP00000385576:V309M	ENSP00000379974:V374M	V	+	1	0	CEACAM16	49900963	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	2.105000	0.41825	2.458000	0.83093	0.650000	0.86243	GTG	CEACAM16	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000213892		0.582	CEACAM16-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	CEACAM16	HGNC	protein_coding		95	0.00	0	G	XM_371177		45209123	45209123	+1	no_errors	ENST00000405314	ensembl	human	known	69_37n	missense	85	40.14	57	SNP	1.000	A
CLPX	10845	genome.wustl.edu	37	15	65459107	65459107	+	Silent	SNP	G	G	C			TCGA-D8-A1XV-01A-11D-A14K-09	TCGA-D8-A1XV-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a76adfd1-8c89-4c13-b570-5ccc47043a70	679a76a2-1e0a-4289-a8e2-b460b9da28af	g.chr15:65459107G>C	ENST00000300107.3	-	4	563	c.375C>G	c.(373-375)gtC>gtG	p.V125V		NM_006660.3	NP_006651.2	O76031	CLPX_HUMAN	caseinolytic mitochondrial matrix peptidase chaperone subunit	125					ATP catabolic process (GO:0006200)|positive regulation of peptidase activity (GO:0010952)|protein folding (GO:0006457)|proteolysis involved in cellular protein catabolic process (GO:0051603)	endopeptidase Clp complex (GO:0009368)|mitochondrial endopeptidase Clp complex (GO:0009841)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|metal ion binding (GO:0046872)|peptidase activator activity (GO:0016504)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(4)|prostate(1)|skin(2)	16						TTTCACACTTGACAAAACGGG	0.333																																						dbGAP											0													99.0	98.0	98.0					15																	65459107		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			AJ006267	CCDS10202.1	15q22.31	2013-09-12	2013-09-12		ENSG00000166855	ENSG00000166855		"""ATPases / AAA-type"""	2088	protein-coding gene	gene with protein product		615611	"""ClpX (caseinolytic protease X, E. coli) homolog"", ""ClpX caseinolytic protease X homolog (E. coli)"", ""ClpX caseinolytic peptidase X homolog (E. coli)"""			22841477	Standard	NM_006660		Approved		uc002aom.3	O76031	OTTHUMG00000133139	ENST00000300107.3:c.375C>G	15.37:g.65459107G>C			A1L428|A8K8F1|B9EGI8|Q9H4D9	Silent	SNP	pfam_ATPase_AAA-2,pfam_Clp_ATPase_C,pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,pfam_Sigma_54_int,smart_AAA+_ATPase,tigrfam_Clp_protease_ATP-bd_su_ClpX	p.V125	ENST00000300107.3	37	c.375	CCDS10202.1	15																																																																																			CLPX	-	NULL	ENSG00000166855		0.333	CLPX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLPX	HGNC	protein_coding	OTTHUMT00000256828.2	152	0.00	0	G	NM_006660		65459107	65459107	-1	no_errors	ENST00000300107	ensembl	human	known	69_37n	silent	88	45.34	73	SNP	1.000	C
NDUFA6-AS1	100132273	genome.wustl.edu	37	22	42537569	42537569	+	RNA	SNP	G	G	T			TCGA-D8-A1XV-01A-11D-A14K-09	TCGA-D8-A1XV-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a76adfd1-8c89-4c13-b570-5ccc47043a70	679a76a2-1e0a-4289-a8e2-b460b9da28af	g.chr22:42537569G>T	ENST00000416037.2	+	0	8970				CYP2D7P1_ENST00000433992.1_RNA|CYP2D7P1_ENST00000424775.1_RNA|CYP2D7P1_ENST00000358097.4_RNA|RP4-669P10.16_ENST00000428786.1_RNA	NR_034118.1				NDUFA6 antisense RNA 1 (head to head)																		GTAGGATCATGAGCAGGAGGC	0.622																																						dbGAP											0																																										-	-	-			0			BC039542		22q13.2	2013-03-18	2013-03-18		ENSG00000237037	ENSG00000237037		"""Long non-coding RNAs"""	45273	non-coding RNA	RNA, long non-coding							Standard	NR_034118		Approved		uc003bcd.1		OTTHUMG00000150917		22.37:g.42537569G>T				Missense_Mutation	SNP	NULL	p.H321N	ENST00000416037.2	37	c.961		22																																																																																			CYP2D7P1	-	NULL	ENSG00000205702		0.622	NDUFA6-AS1-001	KNOWN	basic|exp_conf	antisense	CYP2D7P1	HGNC	processed_transcript	OTTHUMT00000320522.4	45	0.00	0	G	NR_034118		42537569	42537569	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000433992	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	1.000	T
DDX6	1656	genome.wustl.edu	37	11	118626189	118626189	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1XV-01A-11D-A14K-09	TCGA-D8-A1XV-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a76adfd1-8c89-4c13-b570-5ccc47043a70	679a76a2-1e0a-4289-a8e2-b460b9da28af	g.chr11:118626189T>A	ENST00000526070.2	-	12	1558	c.1198A>T	c.(1198-1200)Ata>Tta	p.I400L	DDX6_ENST00000534980.1_Missense_Mutation_p.I400L|DDX6_ENST00000264018.4_Missense_Mutation_p.I400L	NM_001257191.1	NP_001244120.1	P26196	DDX6_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 6	400	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cytoplasmic mRNA processing body assembly (GO:0033962)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)	13	all_hematologic(175;0.0839)	Renal(330;0.0183)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)|Hepatocellular(160;0.0893)|Breast(348;0.0979)|all_hematologic(192;0.103)		OV - Ovarian serous cystadenocarcinoma(223;3.39e-06)|BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Colorectal(284;0.0377)		ACAGCTTGTATATCAATACCT	0.328			T	IGH@	B-NHL																																	dbGAP		Dom	yes		11	11q23.3	1656	DEAD (Asp-Glu-Ala-Asp) box polypeptide 6		L	0													84.0	77.0	79.0					11																	118626189		1802	4061	5863	-	-	-	SO:0001583	missense	0			D17532	CCDS44751.1	11q23.3	2012-02-23	2012-02-23		ENSG00000110367	ENSG00000110367		"""DEAD-boxes"""	2747	protein-coding gene	gene with protein product		600326	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 6 (RNA helicase, 54kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 6"""	HLR2		1579499, 11839790	Standard	NM_004397		Approved	RCK	uc001pub.2	P26196	OTTHUMG00000166411	ENST00000526070.2:c.1198A>T	11.37:g.118626189T>A	ENSP00000433704:p.Ile400Leu		Q5D048	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.I400L	ENST00000526070.2	37	c.1198	CCDS44751.1	11	.	.	.	.	.	.	.	.	.	.	T	34	5.295679	0.95574	.	.	ENSG00000110367	ENST00000264018;ENST00000534980;ENST00000526070	T;T;T	0.74421	-0.84;-0.84;-0.84	5.39	5.39	0.77823	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.81029	0.4738	L	0.46614	1.455	0.80722	D	1	P	0.39181	0.663	P	0.55577	0.779	T	0.82610	-0.0372	10	0.87932	D	0	.	15.38	0.74648	0.0:0.0:0.0:1.0	.	400	P26196	DDX6_HUMAN	L	400	ENSP00000264018:I400L;ENSP00000442266:I400L;ENSP00000433704:I400L	ENSP00000264018:I400L	I	-	1	0	DDX6	118131399	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.950000	0.87804	2.171000	0.68590	0.528000	0.53228	ATA	DDX6	-	pfam_Helicase_C,smart_Helicase_C,pfscan_Helicase_C	ENSG00000110367		0.328	DDX6-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	DDX6	HGNC	protein_coding	OTTHUMT00000389647.2	69	0.00	0	T	NM_004397		118626189	118626189	-1	no_errors	ENST00000264018	ensembl	human	known	69_37n	missense	39	40.00	26	SNP	1.000	A
C1ORF220	400798	genome.wustl.edu	37	1	178514983	178514983	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1XV-01A-11D-A14K-09	TCGA-D8-A1XV-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a76adfd1-8c89-4c13-b570-5ccc47043a70	679a76a2-1e0a-4289-a8e2-b460b9da28af	g.chr1:178514983C>G	ENST00000367636.4	+	2	707	c.369C>G	c.(367-369)aaC>aaG	p.N123K	C1orf220_ENST00000319387.2_3'UTR|C1orf220_ENST00000521244.1_3'UTR																							ATGCCCTAAACCAAAAAATAA	0.438																																						dbGAP											0													88.0	86.0	86.0					1																	178514983		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000367636.4:c.369C>G	1.37:g.178514983C>G	ENSP00000356608:p.Asn123Lys			Missense_Mutation	SNP	NULL	p.N123K	ENST00000367636.4	37	c.369		1	.	.	.	.	.	.	.	.	.	.	C	5.506	0.278251	0.10403	.	.	ENSG00000184909	ENST00000367636	T	0.23147	1.92	3.76	0.796	0.18648	.	.	.	.	.	T	0.35422	0.0931	.	.	.	0.09310	N	1	D	0.65815	0.995	P	0.61003	0.882	T	0.13737	-1.0498	7	.	.	.	.	3.2882	0.06939	0.2038:0.5734:0.0:0.2228	.	123	Q5T0J3	CA220_HUMAN	K	123	ENSP00000356608:N123K	.	N	+	3	2	AL513013.1	176781606	0.000000	0.05858	0.000000	0.03702	0.088000	0.18126	-0.212000	0.09319	0.185000	0.20105	-0.448000	0.05591	AAC	AL513013.1	-	NULL	ENSG00000184909		0.438	C1ORF220-201	NOVEL	basic|appris_principal	protein_coding	ENSG00000184909	Clone_based_ensembl_gene	protein_coding		111	0.00	0	C			178514983	178514983	+1	no_errors	ENST00000367636	ensembl	human	known	69_37n	missense	158	21.78	44	SNP	0.000	G
FAM126A	84668	genome.wustl.edu	37	7	22985376	22985376	+	Silent	SNP	C	C	T			TCGA-D8-A1XV-01A-11D-A14K-09	TCGA-D8-A1XV-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a76adfd1-8c89-4c13-b570-5ccc47043a70	679a76a2-1e0a-4289-a8e2-b460b9da28af	g.chr7:22985376C>T	ENST00000432176.2	-	11	1630	c.1398G>A	c.(1396-1398)ccG>ccA	p.P466P	FAM126A_ENST00000498833.1_5'Flank|FAM126A_ENST00000409923.1_3'UTR	NM_032581.3	NP_115970.2	Q9BYI3	HYCCI_HUMAN	family with sequence similarity 126, member A	466					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(8)|urinary_tract(2)	23						CAGCAGATGACGGGTTATGTG	0.463																																						dbGAP											0													102.0	95.0	98.0					7																	22985376		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC018710	CCDS5377.1	7p15.3	2008-10-02			ENSG00000122591	ENSG00000122591			24587	protein-coding gene	gene with protein product	"""down regulated by Ctnnb1, a"""	610531				10910037, 16951682	Standard	NM_032581		Approved	DRCTNNB1A, HCC, HYCC1, hyccin	uc003svm.4	Q9BYI3	OTTHUMG00000128435	ENST00000432176.2:c.1398G>A	7.37:g.22985376C>T			A4D145|Q6N010|Q75MR4|Q7LDZ4|Q96MX1|Q96NQ6	Silent	SNP	pfam_Hyccin	p.P466	ENST00000432176.2	37	c.1398	CCDS5377.1	7																																																																																			FAM126A	-	NULL	ENSG00000122591		0.463	FAM126A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM126A	HGNC	protein_coding	OTTHUMT00000250230.1	66	0.00	0	C	NM_032581		22985376	22985376	-1	no_errors	ENST00000432176	ensembl	human	known	69_37n	silent	74	11.90	10	SNP	0.032	T
FBXO24	26261	genome.wustl.edu	37	7	100187289	100187289	+	Intron	SNP	G	G	A			TCGA-D8-A1XV-01A-11D-A14K-09	TCGA-D8-A1XV-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a76adfd1-8c89-4c13-b570-5ccc47043a70	679a76a2-1e0a-4289-a8e2-b460b9da28af	g.chr7:100187289G>A	ENST00000241071.6	+	2	361				FBXO24_ENST00000465843.1_Intron|FBXO24_ENST00000360609.2_Intron|FBXO24_ENST00000468962.1_Intron|FBXO24_ENST00000498195.1_Intron|FBXO24_ENST00000427939.2_Missense_Mutation_p.R9Q|PCOLCE-AS1_ENST00000442166.2_RNA	NM_033506.2	NP_277041.1	O75426	FBX24_HUMAN	F-box protein 24						protein ubiquitination (GO:0016567)	ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(3)|ovary(3)|skin(4)|urinary_tract(2)	28	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					CAGCAGGAACGGGGGGGCCAA	0.647																																						dbGAP											0													31.0	35.0	34.0					7																	100187289		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AF174604	CCDS5698.1, CCDS5699.1, CCDS5699.2, CCDS55138.1	7q22	2005-10-07	2004-06-15		ENSG00000106336	ENSG00000106336		"""F-boxes /  ""other"""""	13595	protein-coding gene	gene with protein product		609097	"""F-box only protein 24"""			10531035, 10531037	Standard	NM_012172		Approved	FBX24	uc011kjz.1	O75426	OTTHUMG00000159543	ENST00000241071.6:c.40-311G>A	7.37:g.100187289G>A			A4D2D4|B4DX91|B4DY42|Q9H0G1	Missense_Mutation	SNP	pfam_F-box_dom_cyclin-like,pfam_Reg_chr_condens,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like,pfscan_Reg_chr_condens	p.R9Q	ENST00000241071.6	37	c.26	CCDS5698.1	7	.	.	.	.	.	.	.	.	.	.	g	4.423	0.078205	0.08485	.	.	ENSG00000106336	ENST00000427939	T	0.14022	2.54	2.59	0.365	0.16131	.	.	.	.	.	T	0.09555	0.0235	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31916	-0.9926	8	0.87932	D	0	.	4.4001	0.11383	0.2602:0.4827:0.2571:0.0	.	9	B4DX91	.	Q	9	ENSP00000416558:R9Q	ENSP00000416558:R9Q	R	+	2	0	FBXO24	100025225	0.719000	0.27986	0.002000	0.10522	0.217000	0.24651	0.736000	0.26130	0.416000	0.25844	-0.993000	0.02533	CGG	FBXO24	-	NULL	ENSG00000106336		0.647	FBXO24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO24	HGNC	protein_coding	OTTHUMT00000356104.1	50	0.00	0	G			100187289	100187289	+1	no_errors	ENST00000427939	ensembl	human	known	69_37n	missense	18	57.14	24	SNP	0.000	A
FFAR3	2865	genome.wustl.edu	37	19	35849945	35849945	+	Silent	SNP	C	C	T	rs372231935	byFrequency	TCGA-D8-A1XV-01A-11D-A14K-09	TCGA-D8-A1XV-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a76adfd1-8c89-4c13-b570-5ccc47043a70	679a76a2-1e0a-4289-a8e2-b460b9da28af	g.chr19:35849945C>T	ENST00000327809.4	+	2	354	c.153C>T	c.(151-153)gaC>gaT	p.D51D	FFAR3_ENST00000594310.1_Silent_p.D51D	NM_005304.3	NP_005295.1	O14843	FFAR3_HUMAN	free fatty acid receptor 3	51					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to fatty acid (GO:0071398)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|mucosal immune response (GO:0002385)|negative regulation of blood pressure (GO:0045776)|positive regulation of acute inflammatory response to non-antigenic stimulus (GO:0002879)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine production involved in immune response (GO:0002720)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|regulation of hormone biosynthetic process (GO:0046885)|regulation of norepinephrine secretion (GO:0014061)|regulation of peptide hormone secretion (GO:0090276)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)			endometrium(3)|large_intestine(2)|lung(9)|ovary(1)|skin(1)|stomach(1)	17	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;1.29e-19)|OV - Ovarian serous cystadenocarcinoma(14;4.63e-18)|all cancers(14;5.19e-17)|LUSC - Lung squamous cell carcinoma(66;0.0221)			TGGCCGTGGACGTGCTCCTGC	0.662													C|||	2	0.000399361	0.0008	0.0	5008	,	,		24102	0.001		0.0	False		,,,				2504	0.0				Esophageal Squamous(185;1742 2042 21963 24215 27871)	dbGAP											0													139.0	129.0	132.0					19																	35849945		2199	4294	6493	-	-	-	SO:0001819	synonymous_variant	0			AF024688	CCDS12459.1	19q13.1	2012-08-08	2006-02-15	2006-02-15	ENSG00000185897	ENSG00000185897		"""GPCR / Class A : Fatty acid receptors"""	4499	protein-coding gene	gene with protein product		603821	"""G protein-coupled receptor 41"""	GPR41		9344866, 22493486	Standard	NM_005304		Approved	FFA3R	uc002nzd.3	O14843	OTTHUMG00000172514	ENST00000327809.4:c.153C>T	19.37:g.35849945C>T			B2RWM8|Q14CM7	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_GPR40-rel_recept	p.D51	ENST00000327809.4	37	c.153	CCDS12459.1	19																																																																																			FFAR3	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000185897		0.662	FFAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FFAR3	HGNC	protein_coding	OTTHUMT00000418873.2	194	0.00	0	C	NM_005304		35849945	35849945	+1	no_errors	ENST00000327809	ensembl	human	known	69_37n	silent	184	35.66	102	SNP	0.720	T
FOXA1	3169	genome.wustl.edu	37	14	38060754	38060754	+	Frame_Shift_Del	DEL	T	T	-			TCGA-D8-A1XV-01A-11D-A14K-09	TCGA-D8-A1XV-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a76adfd1-8c89-4c13-b570-5ccc47043a70	679a76a2-1e0a-4289-a8e2-b460b9da28af	g.chr14:38060754delT	ENST00000250448.2	-	2	1296	c.1235delA	c.(1234-1236)cagfs	p.Q412fs	FOXA1_ENST00000545425.2_5'UTR|FOXA1_ENST00000540786.1_Frame_Shift_Del_p.Q379fs	NM_004496.3	NP_004487.2	P55317	FOXA1_HUMAN	forkhead box A1	412					anatomical structure formation involved in morphogenesis (GO:0048646)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|epithelial cell maturation involved in prostate gland development (GO:0060743)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|epithelial-mesenchymal signaling involved in prostate gland development (GO:0060738)|glucose homeostasis (GO:0042593)|hormone metabolic process (GO:0042445)|lung epithelial cell differentiation (GO:0060487)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|prostate gland stromal morphogenesis (GO:0060741)|response to estradiol (GO:0032355)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)	microvillus (GO:0005902)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|large_intestine(2)|lung(3)|prostate(12)	19	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)		CAGCTTATGCTGCTGCTCCGA	0.597																																						dbGAP											0													127.0	94.0	105.0					14																	38060754		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			U39840	CCDS9665.1	14q12-q13	2008-04-10		2002-09-20	ENSG00000129514	ENSG00000129514		"""Forkhead boxes"""	5021	protein-coding gene	gene with protein product		602294	"""hepatocyte nuclear factor 3, alpha"""	HNF3A		9119385, 8652662	Standard	NM_004496		Approved		uc001wuf.4	P55317	OTTHUMG00000140253	ENST00000250448.2:c.1235delA	14.37:g.38060754delT	ENSP00000250448:p.Gln412fs		B2R9H6|B7ZAP5|Q9H2A0	Frame_Shift_Del	DEL	pfam_TF_fork_head,pfam_Fork-head_N,pfam_Forkhead_box_C,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.Q412fs	ENST00000250448.2	37	c.1235	CCDS9665.1	14																																																																																			FOXA1	-	pfam_Forkhead_box_C	ENSG00000129514		0.597	FOXA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXA1	HGNC	protein_coding	OTTHUMT00000276735.1	79	0.00	0	T			38060754	38060754	-1	no_errors	ENST00000250448	ensembl	human	known	69_37n	frame_shift_del	81	44.59	66	DEL	1.000	-
GOLGB1	2804	genome.wustl.edu	37	3	121416391	121416391	+	Silent	SNP	A	A	G			TCGA-D8-A1XV-01A-11D-A14K-09	TCGA-D8-A1XV-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a76adfd1-8c89-4c13-b570-5ccc47043a70	679a76a2-1e0a-4289-a8e2-b460b9da28af	g.chr3:121416391A>G	ENST00000340645.5	-	13	3089	c.2964T>C	c.(2962-2964)aaT>aaC	p.N988N	GOLGB1_ENST00000393667.3_Silent_p.N993N	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	988					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		TTCTCTGCTCATTTTCTTTCT	0.388																																						dbGAP											0													71.0	73.0	72.0					3																	121416391		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.2964T>C	3.37:g.121416391A>G			B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	NULL	p.M859T	ENST00000340645.5	37	c.2576	CCDS3004.1	3	.	.	.	.	.	.	.	.	.	.	A	3.411	-0.120104	0.06838	.	.	ENSG00000173230	ENST00000489400	.	.	.	5.35	2.97	0.34412	.	.	.	.	.	T	0.57710	0.2072	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50759	-0.8790	4	.	.	.	.	8.2725	0.31853	0.837:0.0:0.163:0.0	.	.	.	.	T	859	.	.	M	-	2	0	GOLGB1	122899081	0.965000	0.33210	1.000000	0.80357	0.970000	0.65996	0.398000	0.20899	0.483000	0.27608	-0.290000	0.09829	ATG	GOLGB1	-	NULL	ENSG00000173230		0.388	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGB1	HGNC	protein_coding	OTTHUMT00000355159.1	73	0.00	0	A	NM_004487		121416391	121416391	-1	no_start_codon:pseudogene:no_stop_codon	ENST00000489400	ensembl	human	novel	69_37n	missense	58	22.67	17	SNP	1.000	G
HOMER1	9456	genome.wustl.edu	37	5	78671930	78671930	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XV-01A-11D-A14K-09	TCGA-D8-A1XV-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a76adfd1-8c89-4c13-b570-5ccc47043a70	679a76a2-1e0a-4289-a8e2-b460b9da28af	g.chr5:78671930G>A	ENST00000334082.6	-	9	2409	c.967C>T	c.(967-969)Cgc>Tgc	p.R323C	HOMER1_ENST00000508576.1_3'UTR|HOMER1_ENST00000535690.1_Missense_Mutation_p.R149C|HOMER1_ENST00000282260.6_Missense_Mutation_p.R193C	NM_004272.3	NP_004263.1	Q86YM7	HOME1_HUMAN	homer homolog 1 (Drosophila)	323					behavioral response to cocaine (GO:0048148)|chemical homeostasis within a tissue (GO:0048875)|circadian rhythm (GO:0007623)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of signal transduction (GO:0009967)|protein localization to synapse (GO:0035418)|regulation of calcium ion import (GO:0090279)|regulation of cation channel activity (GO:2001257)|regulation of store-operated calcium entry (GO:2001256)|response to calcium ion (GO:0051592)|response to nicotine (GO:0035094)|skeletal muscle contraction (GO:0003009)|skeletal muscle fiber development (GO:0048741)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell junction (GO:0030054)|costamere (GO:0043034)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|Z disc (GO:0030018)	ion channel binding (GO:0044325)|signaling adaptor activity (GO:0035591)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|prostate(2)|skin(1)	14		Lung NSC(167;0.00131)|all_lung(232;0.00151)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.87e-44)|Epithelial(54;7.07e-41)|all cancers(79;5.5e-36)		AGGTTATTGCGAAAAGCTTCT	0.403																																						dbGAP											0													125.0	114.0	118.0					5																	78671930		1834	4080	5914	-	-	-	SO:0001583	missense	0			BC015502	CCDS43335.1, CCDS64188.1, CCDS64189.1	5q14.2	2008-02-05			ENSG00000152413	ENSG00000152413			17512	protein-coding gene	gene with protein product		604798				9808459, 9808458	Standard	NM_004272		Approved	Ves-1, SYN47, HOMER-1B	uc003kfy.4	Q86YM7	OTTHUMG00000134278	ENST00000334082.6:c.967C>T	5.37:g.78671930G>A	ENSP00000334382:p.Arg323Cys		B2R688|O96003|Q86YM5	Missense_Mutation	SNP	pfam_EVH1,smart_EVH1,pfscan_EVH1	p.R323C	ENST00000334082.6	37	c.967	CCDS43335.1	5	.	.	.	.	.	.	.	.	.	.	G	15.26	2.781137	0.49891	.	.	ENSG00000152413	ENST00000334082;ENST00000282260;ENST00000535690	T;T;T	0.79653	-1.29;3.21;-1.29	5.7	5.7	0.88788	.	0.047289	0.85682	D	0.000000	D	0.85796	0.5780	L	0.46157	1.445	0.58432	D	0.999999	D;P;D	0.76494	0.999;0.894;0.999	P;B;P	0.59288	0.855;0.312;0.836	D	0.86640	0.1891	10	0.87932	D	0	-13.4322	19.8254	0.96616	0.0:0.0:1.0:0.0	.	149;193;323	Q86YM6;Q86YM7-2;Q86YM7	.;.;HOME1_HUMAN	C	323;193;149	ENSP00000334382:R323C;ENSP00000282260:R193C;ENSP00000441587:R149C	ENSP00000282260:R193C	R	-	1	0	HOMER1	78707686	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.350000	0.59392	2.665000	0.90641	0.591000	0.81541	CGC	HOMER1	-	NULL	ENSG00000152413		0.403	HOMER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOMER1	HGNC	protein_coding	OTTHUMT00000258856.1	150	0.00	0	G	NM_004272		78671930	78671930	-1	no_errors	ENST00000334082	ensembl	human	known	69_37n	missense	125	19.87	31	SNP	1.000	A
HPSE	10855	genome.wustl.edu	37	4	84231232	84231232	+	Splice_Site	SNP	C	C	A			TCGA-D8-A1XV-01A-11D-A14K-09	TCGA-D8-A1XV-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a76adfd1-8c89-4c13-b570-5ccc47043a70	679a76a2-1e0a-4289-a8e2-b460b9da28af	g.chr4:84231232C>A	ENST00000405413.2	-	7	979		c.e7-1		HPSE_ENST00000513463.1_Splice_Site|HPSE_ENST00000512196.1_Splice_Site|HPSE_ENST00000311412.5_Splice_Site	NM_006665.5	NP_006656.2	Q9Y251	HPSE_HUMAN	heparanase						carbohydrate metabolic process (GO:0005975)|cell-matrix adhesion (GO:0007160)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan catabolic process (GO:0030200)|positive regulation of blood coagulation (GO:0030194)|positive regulation of hair follicle development (GO:0051798)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation vascular endothelial growth factor production (GO:0010575)|proteoglycan metabolic process (GO:0006029)|regulation of hair follicle development (GO:0051797)|small molecule metabolic process (GO:0044281)|vascular wound healing (GO:0061042)	extracellular region (GO:0005576)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|membrane raft (GO:0045121)|nucleus (GO:0005634)	beta-glucuronidase activity (GO:0004566)|heparanase activity (GO:0030305)|protein dimerization activity (GO:0046983)|syndecan binding (GO:0045545)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	20		Hepatocellular(203;0.114)		COAD - Colon adenocarcinoma(81;0.141)	Dalteparin(DB06779)|Heparin(DB01109)	CTTCAGGAAGCTAGAAAAAAA	0.338																																						dbGAP											0													93.0	105.0	101.0					4																	84231232		2203	4297	6500	-	-	-	SO:0001630	splice_region_variant	0			AF144325	CCDS3602.1, CCDS54774.1, CCDS56337.1	4q21.3	2008-02-05			ENSG00000173083	ENSG00000173083			5164	protein-coding gene	gene with protein product		604724				10395325, 10395326	Standard	NM_006665		Approved	HPA, HSE1, HPSE1	uc003hoj.4	Q9Y251	OTTHUMG00000130425	ENST00000405413.2:c.843-1G>T	4.37:g.84231232C>A			A9JIG7|C7F7I3|C7F7I4|E9PCA9|E9PGR1|Q53GE5|Q9UL39	Splice_Site	SNP	-	e6-1	ENST00000405413.2	37	c.843-1	CCDS3602.1	4	.	.	.	.	.	.	.	.	.	.	C	15.47	2.842301	0.51057	.	.	ENSG00000173083	ENST00000311412;ENST00000405413;ENST00000512196;ENST00000513463	.	.	.	4.87	4.87	0.63330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.785	0.88534	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	HPSE	84450256	1.000000	0.71417	0.996000	0.52242	0.547000	0.35210	6.241000	0.72369	2.540000	0.85666	0.484000	0.47621	.	HPSE	-	-	ENSG00000173083		0.338	HPSE-001	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	HPSE	HGNC	protein_coding	OTTHUMT00000252812.2	96	0.00	0	C	NM_006665	Intron	84231232	84231232	-1	no_errors	ENST00000311412	ensembl	human	known	69_37n	splice_site	74	39.84	49	SNP	1.000	A
IGSF8	93185	genome.wustl.edu	37	1	160062103	160062103	+	Silent	SNP	T	T	C			TCGA-D8-A1XV-01A-11D-A14K-09	TCGA-D8-A1XV-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a76adfd1-8c89-4c13-b570-5ccc47043a70	679a76a2-1e0a-4289-a8e2-b460b9da28af	g.chr1:160062103T>C	ENST00000368086.1	-	5	1911	c.1695A>G	c.(1693-1695)tcA>tcG	p.S565S	IGSF8_ENST00000460351.1_5'Flank|IGSF8_ENST00000314485.7_Silent_p.S565S			Q969P0	IGSF8_HUMAN	immunoglobulin superfamily, member 8	565					cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|nervous system development (GO:0007399)|single fertilization (GO:0007338)|skeletal muscle tissue development (GO:0007519)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(19)|pancreas(1)|prostate(1)|skin(1)	33	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			TAACAGGCCCTGAGCGGGCAC	0.647																																						dbGAP											0													70.0	78.0	75.0					1																	160062103		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF407274	CCDS1195.1	1q23.1	2013-01-11			ENSG00000162729	ENSG00000162729		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	17813	protein-coding gene	gene with protein product		606644				11504738, 11673522	Standard	NM_001206665		Approved	CD81P3, EWI2, PGRL, CD316	uc009wtf.3	Q969P0	OTTHUMG00000024075	ENST00000368086.1:c.1695A>G	1.37:g.160062103T>C			Q8NG09|Q96DP4|Q9BTG9	Silent	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	p.S565	ENST00000368086.1	37	c.1695	CCDS1195.1	1																																																																																			IGSF8	-	smart_Ig_sub	ENSG00000162729		0.647	IGSF8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF8	HGNC	protein_coding	OTTHUMT00000060636.1	52	0.00	0	T	NM_052868		160062103	160062103	-1	no_errors	ENST00000314485	ensembl	human	known	69_37n	silent	73	21.88	21	SNP	0.001	C
INO80C	125476	genome.wustl.edu	37	18	33048579	33048579	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XV-01A-11D-A14K-09	TCGA-D8-A1XV-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a76adfd1-8c89-4c13-b570-5ccc47043a70	679a76a2-1e0a-4289-a8e2-b460b9da28af	g.chr18:33048579G>A	ENST00000334598.7	-	5	691	c.575C>T	c.(574-576)cCc>cTc	p.P192L	INO80C_ENST00000592173.1_Intron|INO80C_ENST00000586489.1_Missense_Mutation_p.P137L|INO80C_ENST00000590757.1_Missense_Mutation_p.P95L|RP11-322E11.5_ENST00000591141.1_lincRNA|INO80C_ENST00000441607.2_Missense_Mutation_p.P228L|RP11-322E11.6_ENST00000589258.1_Intron	NM_194281.3	NP_919257.2	Q6PI98	IN80C_HUMAN	INO80 complex subunit C	192					chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)				central_nervous_system(1)|endometrium(1)|lung(3)|prostate(2)|skin(1)	8						TGGGGCTCAGGGAACGATGCT	0.517																																						dbGAP											0													118.0	123.0	121.0					18																	33048579		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11914.1, CCDS45853.1	18q12.2	2011-07-06	2008-08-07	2008-08-07	ENSG00000153391	ENSG00000153391		"""INO80 complex subunits"""	26994	protein-coding gene	gene with protein product	"""IES6 homolog (S. cerevisiae)"""		"""chromosome 18 open reading frame 37"""	C18orf37		16230350	Standard	NM_001098817		Approved	FLJ38183, hIes6, IES6	uc010dmt.3	Q6PI98	OTTHUMG00000132564	ENST00000334598.7:c.575C>T	18.37:g.33048579G>A	ENSP00000334473:p.Pro192Leu		B4DUI4|E9PCS7|Q86WR1|Q8N994	Missense_Mutation	SNP	pfam_YL1_C	p.P228L	ENST00000334598.7	37	c.683	CCDS11914.1	18	.	.	.	.	.	.	.	.	.	.	G	28.7	4.940206	0.92526	.	.	ENSG00000153391	ENST00000441607;ENST00000334598	.	.	.	5.27	5.27	0.74061	.	.	.	.	.	T	0.62344	0.2420	L	0.51422	1.61	0.58432	D	0.999999	D;P	0.53619	0.961;0.745	P;B	0.49637	0.617;0.351	T	0.66705	-0.5856	8	0.87932	D	0	.	16.7354	0.85445	0.0:0.0:1.0:0.0	.	228;192	E9PCS7;Q6PI98	.;IN80C_HUMAN	L	228;192	.	ENSP00000334473:P192L	P	-	2	0	INO80C	31302577	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	9.407000	0.97325	2.615000	0.88500	0.557000	0.71058	CCC	INO80C	-	NULL	ENSG00000153391		0.517	INO80C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INO80C	HGNC	protein_coding	OTTHUMT00000255768.1	54	0.00	0	G	NM_194281		33048579	33048579	-1	no_errors	ENST00000441607	ensembl	human	known	69_37n	missense	44	37.14	26	SNP	1.000	A
KIF18B	146909	genome.wustl.edu	37	17	43011380	43011380	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1XV-01A-11D-A14K-09	TCGA-D8-A1XV-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a76adfd1-8c89-4c13-b570-5ccc47043a70	679a76a2-1e0a-4289-a8e2-b460b9da28af	g.chr17:43011380T>A	ENST00000593135.1	-	7	1070	c.973A>T	c.(973-975)Atc>Ttc	p.I325F	KIF18B_ENST00000587309.1_Missense_Mutation_p.I325F|KIF18B_ENST00000339151.4_Missense_Mutation_p.I325F|KIF18B_ENST00000438933.2_Missense_Mutation_p.I325F|KIF18B_ENST00000590129.1_Missense_Mutation_p.I334F	NM_001265577.1	NP_001252506.1	Q86Y91	KI18B_HUMAN	kinesin family member 18B	334	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|regulation of cell division (GO:0051302)	astral microtubule (GO:0000235)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule plus-end (GO:0035371)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)	21		Prostate(33;0.155)				ATGGCAGCGATCATCACTGTG	0.632																																						dbGAP											0													47.0	49.0	48.0					17																	43011380		2138	4273	6411	-	-	-	SO:0001583	missense	0				CCDS45709.1, CCDS58555.1, CCDS45709.2	17q21.31	2014-09-04			ENSG00000186185			"""Kinesins"""	27102	protein-coding gene	gene with protein product		614570				16084724	Standard	NM_001264573		Approved		uc010wjh.3	Q86Y91	OTTHUMG00000179867	ENST00000593135.1:c.973A>T	17.37:g.43011380T>A	ENSP00000465992:p.Ile325Phe		A6NJI2|B7ZM49|B9EGM8|D5L6I1	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.I325F	ENST00000593135.1	37	c.973	CCDS45709.2	17	.	.	.	.	.	.	.	.	.	.	T	24.4	4.528176	0.85706	.	.	ENSG00000186185	ENST00000438933;ENST00000339151;ENST00000376982	T;T	0.79454	-1.27;-1.27	5.5	4.41	0.53225	Kinesin, motor domain (3);	0.220262	0.23003	N	0.053046	D	0.87200	0.6118	M	0.81179	2.53	0.50171	D	0.999851	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.996;0.996	D	0.87229	0.2259	10	0.87932	D	0	.	10.713	0.45995	0.0:0.0778:0.0:0.9222	.	334;334;334	Q86Y91;Q86Y91-3;Q86Y91-2	KI18B_HUMAN;.;.	F	325	ENSP00000412798:I325F;ENSP00000341466:I325F	ENSP00000341466:I325F	I	-	1	0	KIF18B	40366906	1.000000	0.71417	0.994000	0.49952	0.993000	0.82548	3.515000	0.53429	0.896000	0.36366	0.528000	0.53228	ATC	KIF18B	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom	ENSG00000186185		0.632	KIF18B-001	PUTATIVE	basic|appris_candidate|exp_conf|CCDS	protein_coding	KIF18B	HGNC	protein_coding	OTTHUMT00000448724.1	131	0.00	0	T	NM_001080443		43011380	43011380	-1	no_errors	ENST00000339151	ensembl	human	known	69_37n	missense	94	48.91	90	SNP	1.000	A
MGAT4B	11282	genome.wustl.edu	37	5	179226297	179226297	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1XV-01A-11D-A14K-09	TCGA-D8-A1XV-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a76adfd1-8c89-4c13-b570-5ccc47043a70	679a76a2-1e0a-4289-a8e2-b460b9da28af	g.chr5:179226297C>T	ENST00000292591.7	-	10	1405	c.1055G>A	c.(1054-1056)cGg>cAg	p.R352Q	MGAT4B_ENST00000337755.5_Missense_Mutation_p.R367Q|MGAT4B_ENST00000521305.1_5'Flank|MIR1229_ENST00000408467.1_RNA	NM_014275.4	NP_055090.1	Q9UQ53	MGT4B_HUMAN	mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B	352					cellular protein metabolic process (GO:0044267)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	13	all_cancers(89;0.000201)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0525)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGCTTTCTGCCGGTCACAGTG	0.632																																					GBM(13;414 434 4098 22176 23230)	dbGAP											0													76.0	75.0	76.0					5																	179226297		2201	4300	6501	-	-	-	SO:0001583	missense	0			AB000624	CCDS4448.1, CCDS4449.1	5q35	2013-02-25	2005-11-16		ENSG00000161013	ENSG00000161013	2.4.1.145	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7048	protein-coding gene	gene with protein product		604561	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isoenzyme B"""			10372966	Standard	NM_014275		Approved	GnT-Ivb	uc003mks.3	Q9UQ53	OTTHUMG00000130912	ENST00000292591.7:c.1055G>A	5.37:g.179226297C>T	ENSP00000292591:p.Arg352Gln		A8MPR0|Q86TF1|Q96GH4|Q9NSK6	Missense_Mutation	SNP	pfam_Glyco_transf_54	p.R367Q	ENST00000292591.7	37	c.1100	CCDS4448.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.8|21.8	4.207615|4.207615	0.79240|0.79240	.|.	.|.	ENSG00000161013|ENSG00000161013	ENST00000520969|ENST00000337755;ENST00000292591	.|T;T	.|0.44083	.|0.93;0.93	3.74|3.74	2.85|2.85	0.33270|0.33270	.|.	.|0.068485	.|0.53938	.|N	.|0.000042	T|T	0.55784|0.55784	0.1942|0.1942	L|L	0.53780|0.53780	1.695|1.695	0.58432|0.58432	D|D	0.999995|0.999995	.|D;D;D	.|0.71674	.|0.997;0.995;0.998	.|P;P;D	.|0.72982	.|0.695;0.784;0.979	T|T	0.52079|0.52079	-0.8623|-0.8623	5|10	.|0.34782	.|T	.|0.22	-31.3931|-31.3931	13.1121|13.1121	0.59278|0.59278	0.0:0.8376:0.1624:0.0|0.0:0.8376:0.1624:0.0	.|.	.|352;367;351	.|Q9UQ53;A8MPR0;Q9UQ53-2	.|MGT4B_HUMAN;.;.	S|Q	49|367;352	.|ENSP00000338487:R367Q;ENSP00000292591:R352Q	.|ENSP00000292591:R352Q	G|R	-|-	1|2	0|0	MGAT4B|MGAT4B	179158903|179158903	0.998000|0.998000	0.40836|0.40836	1.000000|1.000000	0.80357|0.80357	0.938000|0.938000	0.57974|0.57974	4.752000|4.752000	0.62176|0.62176	0.749000|0.749000	0.32854|0.32854	0.561000|0.561000	0.74099|0.74099	GGC|CGG	MGAT4B	-	pfam_Glyco_transf_54	ENSG00000161013		0.632	MGAT4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGAT4B	HGNC	protein_coding	OTTHUMT00000253503.3	83	0.00	0	C	NM_014275		179226297	179226297	-1	no_errors	ENST00000337755	ensembl	human	known	69_37n	missense	72	40.50	49	SNP	0.980	T
MTMR6	9107	genome.wustl.edu	37	13	25823617	25823617	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1XV-01A-11D-A14K-09	TCGA-D8-A1XV-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a76adfd1-8c89-4c13-b570-5ccc47043a70	679a76a2-1e0a-4289-a8e2-b460b9da28af	g.chr13:25823617C>T	ENST00000381801.5	-	14	2380	c.1619G>A	c.(1618-1620)cGc>cAc	p.R540H	AL590787.1_ENST00000408397.1_RNA|MTMR6_ENST00000540661.1_Intron	NM_004685.3	NP_004676.3	Q9Y217	MTMR6_HUMAN	myotubularin related protein 6	540					peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|potassium ion transmembrane transport (GO:0071805)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	calcium-activated potassium channel activity (GO:0015269)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(5)|stomach(3)	36		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.00927)|Epithelial(112;0.0474)|OV - Ovarian serous cystadenocarcinoma(117;0.164)		CTTATTTTTGCGTTGTTTAAT	0.318																																						dbGAP											0													107.0	102.0	104.0					13																	25823617		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF072928	CCDS9313.1	13q12	2011-06-09			ENSG00000139505	ENSG00000139505		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7453	protein-coding gene	gene with protein product		603561				9736772	Standard	NM_004685		Approved		uc001uqf.4	Q9Y217	OTTHUMG00000016606	ENST00000381801.5:c.1619G>A	13.37:g.25823617C>T	ENSP00000371221:p.Arg540His		B2RBB5|B3KSB4|Q5JRG6|Q86TB7|Q86YH4|Q96P80	Missense_Mutation	SNP	pfam_Myotub-related,smart_Tyr_Pase_cat	p.R540H	ENST00000381801.5	37	c.1619	CCDS9313.1	13	.	.	.	.	.	.	.	.	.	.	C	6.236	0.411750	0.11812	.	.	ENSG00000139505	ENST00000381801;ENST00000319298	D	0.94376	-3.41	5.75	-4.97	0.03029	.	1.635640	0.02831	N	0.126816	D	0.86272	0.5893	N	0.25890	0.77	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.75342	-0.3351	10	0.14252	T	0.57	.	9.0946	0.36632	0.0:0.1947:0.1182:0.687	.	540	Q9Y217	MTMR6_HUMAN	H	540;108	ENSP00000371221:R540H	ENSP00000317987:R108H	R	-	2	0	MTMR6	24721617	0.000000	0.05858	0.000000	0.03702	0.758000	0.43043	-1.143000	0.03200	-0.696000	0.05098	0.655000	0.94253	CGC	MTMR6	-	NULL	ENSG00000139505		0.318	MTMR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR6	HGNC	protein_coding	OTTHUMT00000044225.1	179	0.00	0	C	NM_004685		25823617	25823617	-1	no_errors	ENST00000381801	ensembl	human	known	69_37n	missense	132	42.61	98	SNP	0.000	T
NCDN	23154	genome.wustl.edu	37	1	36030851	36030851	+	Nonsense_Mutation	SNP	C	C	T			TCGA-D8-A1XV-01A-11D-A14K-09	TCGA-D8-A1XV-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a76adfd1-8c89-4c13-b570-5ccc47043a70	679a76a2-1e0a-4289-a8e2-b460b9da28af	g.chr1:36030851C>T	ENST00000373243.2	+	7	2160	c.1777C>T	c.(1777-1779)Cga>Tga	p.R593*	NCDN_ENST00000373253.3_Nonsense_Mutation_p.R576*|NCDN_ENST00000356090.4_Nonsense_Mutation_p.R593*	NM_014284.2	NP_055099.1	Q9UBB6	NCDN_HUMAN	neurochondrin	593					bone resorption (GO:0045453)|neuron projection development (GO:0031175)|regulation of neuronal synaptic plasticity (GO:0048168)	cytosol (GO:0005829)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)				breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|pancreas(1)|skin(2)	16		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				ACCAGCATCCCGAGGGTTCTT	0.617											OREG0013355	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													114.0	124.0	121.0					1																	36030851		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB011179	CCDS392.1, CCDS30672.1	1p34.3	2008-02-05			ENSG00000020129	ENSG00000020129			17597	protein-coding gene	gene with protein product		608458				15007648	Standard	NM_014284		Approved	NCDN-1, NCDN-2	uc001bza.3	Q9UBB6	OTTHUMG00000059204	ENST00000373243.2:c.1777C>T	1.37:g.36030851C>T	ENSP00000362340:p.Arg593*	859	D3DPR9|Q9UBY2|Q9Y4A6|Q9Y4D9	Nonsense_Mutation	SNP	NULL	p.R593*	ENST00000373243.2	37	c.1777	CCDS392.1	1	.	.	.	.	.	.	.	.	.	.	C	40	8.147650	0.98678	.	.	ENSG00000020129	ENST00000373253;ENST00000356090;ENST00000373243;ENST00000397922	.	.	.	5.1	2.0	0.26442	.	0.142736	0.45867	D	0.000337	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.9815	0.64308	0.5771:0.4229:0.0:0.0	.	.	.	.	X	576;593;593;18	.	ENSP00000348394:R593X	R	+	1	2	NCDN	35803438	0.049000	0.20398	0.996000	0.52242	0.949000	0.60115	-0.190000	0.09615	0.102000	0.17638	0.563000	0.77884	CGA	NCDN	-	NULL	ENSG00000020129		0.617	NCDN-003	KNOWN	basic|appris_principal|CCDS	protein_coding	NCDN	HGNC	protein_coding	OTTHUMT00000131298.1	84	0.00	0	C	NM_014284		36030851	36030851	+1	no_errors	ENST00000356090	ensembl	human	known	69_37n	nonsense	57	43.56	44	SNP	0.991	T
ODF2L	57489	genome.wustl.edu	37	1	86841953	86841953	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1XV-01A-11D-A14K-09	TCGA-D8-A1XV-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a76adfd1-8c89-4c13-b570-5ccc47043a70	679a76a2-1e0a-4289-a8e2-b460b9da28af	g.chr1:86841953C>A	ENST00000359242.3	-	8	1054	c.773G>T	c.(772-774)gGa>gTa	p.G258V	ODF2L_ENST00000317336.7_Missense_Mutation_p.G258V|ODF2L_ENST00000370566.3_Missense_Mutation_p.G258V|ODF2L_ENST00000524695.1_5'Flank|ODF2L_ENST00000394731.1_Missense_Mutation_p.G127V|ODF2L_ENST00000370567.1_Missense_Mutation_p.G258V|ODF2L_ENST00000294678.2_Missense_Mutation_p.G258V	NM_001007022.2	NP_001007023.2	Q9ULJ1	ODF2L_HUMAN	outer dense fiber of sperm tails 2-like	258						centrosome (GO:0005813)				endometrium(2)|kidney(2)|large_intestine(10)|lung(6)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	24				all cancers(265;0.0313)|Epithelial(280;0.0611)		TTCAATAGCTCCTGTAAAATG	0.294																																						dbGAP											0													104.0	96.0	98.0					1																	86841953		2200	4299	6499	-	-	-	SO:0001583	missense	0				CCDS30763.1, CCDS41354.1, CCDS30763.2, CCDS41354.2, CCDS53339.1	1p22.3	2008-02-05			ENSG00000122417	ENSG00000122417			29225	protein-coding gene	gene with protein product						10574462	Standard	NM_020729		Approved	KIAA1229	uc001dll.2	Q9ULJ1	OTTHUMG00000010080	ENST00000359242.3:c.773G>T	1.37:g.86841953C>A	ENSP00000359600:p.Gly258Val		A8MU56|B4E037|Q05C40|Q5BJG5|Q5TBX3|Q5TBX4|Q86X31	Nonsense_Mutation	SNP	superfamily_tRNA-bd_arm	p.E107*	ENST00000359242.3	37	c.319	CCDS41354.2	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.75|13.75	2.328956|2.328956	0.41197|0.41197	.|.	.|.	ENSG00000122417|ENSG00000122417	ENST00000459999|ENST00000441121;ENST00000370566;ENST00000359242;ENST00000460698;ENST00000317336;ENST00000370567;ENST00000394731;ENST00000294678;ENST00000479890	.|T;T;T;T;T;T;T;D	.|0.82893	.|1.94;1.93;1.95;1.94;1.94;1.95;1.93;-1.66	5.77|5.77	2.27|2.27	0.28462|0.28462	.|.	.|0.398011	.|0.30085	.|N	.|0.010453	.|T	.|0.76278	.|0.3965	L|L	0.51422|0.51422	1.61|1.61	0.25634|0.25634	N|N	0.986271|0.986271	.|P;D;P;P;D;D	.|0.69078	.|0.928;0.994;0.935;0.935;0.997;0.982	.|B;P;B;P;D;P	.|0.64410	.|0.408;0.823;0.407;0.524;0.925;0.745	.|T	.|0.65590	.|-0.6131	.|10	.|0.36615	.|T	.|0.2	-4.0219|-4.0219	4.7751|4.7751	0.13175|0.13175	0.0:0.5143:0.1971:0.2886|0.0:0.5143:0.1971:0.2886	.|.	.|258;258;258;258;258;258	.|B4E037;B4DZ83;Q9ULJ1-2;Q9ULJ1-4;Q9ULJ1-3;Q9ULJ1	.|.;.;.;.;.;ODF2L_HUMAN	X|V	107|258;258;258;134;258;258;127;258;88	.|ENSP00000359597:G258V;ENSP00000359600:G258V;ENSP00000433092:G134V;ENSP00000320165:G258V;ENSP00000359598:G258V;ENSP00000378219:G127V;ENSP00000294678:G258V;ENSP00000432834:G88V	.|ENSP00000294678:G258V	E|G	-|-	1|2	0|0	ODF2L|ODF2L	86614541|86614541	0.058000|0.058000	0.20735|0.20735	0.541000|0.541000	0.28102|0.28102	0.597000|0.597000	0.36814|0.36814	0.033000|0.033000	0.13754|0.13754	0.768000|0.768000	0.33290|0.33290	0.655000|0.655000	0.94253|0.94253	GAG|GGA	ODF2L	-	NULL	ENSG00000122417		0.294	ODF2L-001	KNOWN	basic|CCDS	protein_coding	ODF2L	HGNC	protein_coding	OTTHUMT00000027873.2	223	0.00	0	C			86841953	86841953	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000459999	ensembl	human	putative	69_37n	nonsense	100	45.95	85	SNP	0.129	A
PCDHGA3	56112	genome.wustl.edu	37	5	140725686	140725686	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1XV-01A-11D-A14K-09	TCGA-D8-A1XV-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a76adfd1-8c89-4c13-b570-5ccc47043a70	679a76a2-1e0a-4289-a8e2-b460b9da28af	g.chr5:140725686G>C	ENST00000253812.6	+	1	2086	c.2086G>C	c.(2086-2088)Gcg>Ccg	p.A696P	PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	696					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTGGTGGTGGCGGTGGCCGC	0.687																																						dbGAP											0													43.0	50.0	47.0					5																	140725686		2196	4288	6484	-	-	-	SO:0001583	missense	0			AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.2086G>C	5.37:g.140725686G>C	ENSP00000253812:p.Ala696Pro		Q9Y5D4	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A696P	ENST00000253812.6	37	c.2086	CCDS47290.1	5	.	.	.	.	.	.	.	.	.	.	.	16.95	3.264085	0.59431	.	.	ENSG00000254245	ENST00000253812	T	0.25250	1.81	5.16	4.29	0.51040	.	0.000000	0.33005	U	0.005387	T	0.63908	0.2551	H	0.96460	3.825	0.31968	N	0.607532	D;D	0.76494	0.999;0.991	D;D	0.78314	0.991;0.966	T	0.80151	-0.1502	10	0.87932	D	0	.	15.1213	0.72443	0.0:0.0:0.8571:0.1429	.	696;696	Q9Y5H0-2;Q9Y5H0	.;PCDG3_HUMAN	P	696	ENSP00000253812:A696P	ENSP00000253812:A696P	A	+	1	0	PCDHGA3	140705870	1.000000	0.71417	0.993000	0.49108	0.154000	0.21943	3.302000	0.51849	1.306000	0.44926	-0.261000	0.10672	GCG	PCDHGA3	-	NULL	ENSG00000254245		0.687	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA3	HGNC	protein_coding	OTTHUMT00000377017.1	105	0.94	1	G	NM_018916		140725686	140725686	+1	no_errors	ENST00000253812	ensembl	human	known	69_37n	missense	74	41.41	53	SNP	1.000	C
PLA2R1	22925	genome.wustl.edu	37	2	160824180	160824180	+	Missense_Mutation	SNP	C	C	T	rs538507767	byFrequency	TCGA-D8-A1XV-01A-11D-A14K-09	TCGA-D8-A1XV-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a76adfd1-8c89-4c13-b570-5ccc47043a70	679a76a2-1e0a-4289-a8e2-b460b9da28af	g.chr2:160824180C>T	ENST00000283243.7	-	20	2980	c.2774G>A	c.(2773-2775)gGt>gAt	p.G925D	PLA2R1_ENST00000392771.1_Missense_Mutation_p.G925D	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	925	C-type lectin 5. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)		PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						CTCTTCACTACCCCAGAGTCC	0.398																																						dbGAP											0													104.0	97.0	99.0					2																	160824180		2203	4300	6503	-	-	-	SO:0001583	missense	0			U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.2774G>A	2.37:g.160824180C>T	ENSP00000283243:p.Gly925Asp		B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_FN_type2_col-bd,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin	p.G925D	ENST00000283243.7	37	c.2774	CCDS33309.1	2	.	.	.	.	.	.	.	.	.	.	C	4.163	0.028701	0.08054	.	.	ENSG00000153246	ENST00000283243;ENST00000392771	T;T	0.18016	2.24;2.24	5.76	1.76	0.24704	C-type lectin fold (1);C-type lectin, conserved site (1);C-type lectin-like (1);C-type lectin (3);	0.826981	0.11526	N	0.555236	T	0.08891	0.0220	N	0.16903	0.455	0.21527	N	0.999656	B;B;B	0.13594	0.006;0.008;0.008	B;B;B	0.16289	0.012;0.008;0.015	T	0.43637	-0.9379	10	0.11794	T	0.64	.	6.9276	0.24424	0.0:0.5616:0.1746:0.2639	.	925;925;925	B7ZML4;Q13018-2;Q13018	.;.;PLA2R_HUMAN	D	925	ENSP00000283243:G925D;ENSP00000376524:G925D	ENSP00000283243:G925D	G	-	2	0	PLA2R1	160532426	0.265000	0.24102	0.263000	0.24496	0.997000	0.91878	0.484000	0.22308	0.100000	0.17581	0.650000	0.86243	GGT	PLA2R1	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000153246		0.398	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2R1	HGNC	protein_coding	OTTHUMT00000333820.1	126	0.00	0	C			160824180	160824180	-1	no_errors	ENST00000283243	ensembl	human	known	69_37n	missense	73	44.70	59	SNP	0.197	T
PSMA8	143471	genome.wustl.edu	37	18	23713974	23713974	+	Silent	SNP	C	C	T			TCGA-D8-A1XV-01A-11D-A14K-09	TCGA-D8-A1XV-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a76adfd1-8c89-4c13-b570-5ccc47043a70	679a76a2-1e0a-4289-a8e2-b460b9da28af	g.chr18:23713974C>T	ENST00000308268.6	+	1	134	c.45C>T	c.(43-45)gaC>gaT	p.D15D	PSMA8_ENST00000343848.6_Silent_p.D15D|PSMA8_ENST00000415576.2_Silent_p.D15D	NM_001025096.1|NM_144662.2	NP_001020267.1|NP_653263.2	Q8TAA3	PSA7L_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 8	15					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|proteasome core complex, alpha-subunit complex (GO:0019773)|spermatoproteasome complex (GO:1990111)	threonine-type endopeptidase activity (GO:0004298)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|skin(2)	16	all_cancers(21;0.000585)|Lung NSC(5;0.00148)|all_lung(6;0.0038)|Ovarian(20;0.124)		OV - Ovarian serous cystadenocarcinoma(3;0.000324)|all cancers(3;0.000954)|LUSC - Lung squamous cell carcinoma(2;0.181)			TCTCCCCAGACGGACACCTTT	0.562																																						dbGAP											0													122.0	110.0	114.0					18																	23713974		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC047355	CCDS32808.1, CCDS45842.1, CCDS45843.1	18q11.2	2006-12-18				ENSG00000154611		"""Proteasome (prosome, macropain) subunits"""	22985	protein-coding gene	gene with protein product							Standard	XM_005258199		Approved	MGC26605, PSMA7L	uc002kvq.3	Q8TAA3		ENST00000308268.6:c.45C>T	18.37:g.23713974C>T			B0YJ75|Q8IVP4|Q8TA98|Q8TAA2	Silent	SNP	pfam_Proteasome_sua/b,pfam_Proteasome_asu_N,smart_Proteasome_asu_N	p.D15	ENST00000308268.6	37	c.45	CCDS32808.1	18																																																																																			PSMA8	-	pfam_Proteasome_asu_N,smart_Proteasome_asu_N	ENSG00000154611		0.562	PSMA8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSMA8	HGNC	protein_coding	OTTHUMT00000446255.1	52	0.00	0	C	NM_144662		23713974	23713974	+1	no_errors	ENST00000308268	ensembl	human	known	69_37n	silent	34	47.69	31	SNP	0.797	T
PTRF	284119	genome.wustl.edu	37	17	40575012	40575012	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XV-01A-11D-A14K-09	TCGA-D8-A1XV-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a76adfd1-8c89-4c13-b570-5ccc47043a70	679a76a2-1e0a-4289-a8e2-b460b9da28af	g.chr17:40575012G>A	ENST00000357037.5	-	1	523	c.104C>T	c.(103-105)cCg>cTg	p.P35L		NM_012232.5	NP_036364.2			polymerase I and transcript release factor											breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|urinary_tract(1)	17		all_cancers(22;0.00146)|Breast(137;0.00116)|all_epithelial(22;0.0134)		BRCA - Breast invasive adenocarcinoma(366;0.193)		GGCCCCCGACGGCTCCTCCGC	0.672																																						dbGAP											0													17.0	17.0	17.0					17																	40575012		2192	4277	6469	-	-	-	SO:0001583	missense	0			AF000421	CCDS11425.1	17q21.31	2011-04-20				ENSG00000177469			9688	protein-coding gene	gene with protein product		603198				9582279	Standard	NM_012232		Approved	cavin-1, CAVIN1	uc002hzo.3	Q6NZI2		ENST00000357037.5:c.104C>T	17.37:g.40575012G>A	ENSP00000349541:p.Pro35Leu			Missense_Mutation	SNP	NULL	p.P35L	ENST00000357037.5	37	c.104	CCDS11425.1	17	.	.	.	.	.	.	.	.	.	.	G	12.10	1.835379	0.32421	.	.	ENSG00000177469	ENST00000357037	T	0.60040	0.22	5.13	3.94	0.45596	.	0.592407	0.16817	N	0.198332	T	0.39886	0.1095	N	0.17082	0.46	0.46044	D	0.998835	B;B	0.13594	0.008;0.003	B;B	0.06405	0.002;0.002	T	0.31336	-0.9947	10	0.46703	T	0.11	-43.5536	10.3864	0.44143	0.0861:0.0:0.7671:0.1468	.	35;35	B4DNU9;Q6NZI2	.;PTRF_HUMAN	L	35	ENSP00000349541:P35L	ENSP00000349541:P35L	P	-	2	0	PTRF	37828538	1.000000	0.71417	1.000000	0.80357	0.507000	0.33981	2.118000	0.41949	2.373000	0.80994	0.561000	0.74099	CCG	PTRF	-	NULL	ENSG00000177469		0.672	PTRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTRF	HGNC	protein_coding	OTTHUMT00000449938.1	16	0.00	0	G	NM_012232		40575012	40575012	-1	no_errors	ENST00000357037	ensembl	human	known	69_37n	missense	12	50.00	12	SNP	1.000	A
REST	5978	genome.wustl.edu	37	4	57777582	57777582	+	Nonsense_Mutation	SNP	G	G	T			TCGA-D8-A1XV-01A-11D-A14K-09	TCGA-D8-A1XV-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a76adfd1-8c89-4c13-b570-5ccc47043a70	679a76a2-1e0a-4289-a8e2-b460b9da28af	g.chr4:57777582G>T	ENST00000309042.7	+	2	1092	c.778G>T	c.(778-780)Gag>Tag	p.E260*	REST_ENST00000514063.1_3'UTR	NM_001193508.1|NM_005612.4	NP_001180437.1|NP_005603.3	Q13127	REST_HUMAN	RE1-silencing transcription factor	260					cardiac muscle cell myoblast differentiation (GO:0060379)|cellular response to drug (GO:0035690)|cellular response to electrical stimulus (GO:0071257)|cellular response to glucocorticoid stimulus (GO:0071385)|hematopoietic progenitor cell differentiation (GO:0002244)|histone H4 deacetylation (GO:0070933)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of amniotic stem cell differentiation (GO:2000798)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of dense core granule biogenesis (GO:2000706)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin secretion (GO:0046676)|negative regulation of mesenchymal stem cell differentiation (GO:2000740)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of transcription, DNA-templated (GO:0045893)|potassium ion transmembrane transport (GO:0071805)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|outward rectifier potassium channel activity (GO:0015271)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	50	Glioma(25;0.08)|all_neural(26;0.181)					AACAGTGAGCGAGTATCACTG	0.383																																						dbGAP											0													61.0	59.0	59.0					4																	57777582		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U13879	CCDS3509.1	4q12	2008-02-05			ENSG00000084093	ENSG00000084093			9966	protein-coding gene	gene with protein product		600571				7871435, 7697725	Standard	NM_005612		Approved	NRSF, XBR	uc003hci.3	Q13127	OTTHUMG00000128770	ENST00000309042.7:c.778G>T	4.37:g.57777582G>T	ENSP00000311816:p.Glu260*		A2RUE0|B9EGJ0|Q12956|Q12957|Q13134|Q59ER1|Q8IWI3	Nonsense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E260*	ENST00000309042.7	37	c.778	CCDS3509.1	4	.	.	.	.	.	.	.	.	.	.	G	38	7.242930	0.98157	.	.	ENSG00000084093	ENST00000456010;ENST00000309042;ENST00000358605	.	.	.	5.25	5.25	0.73442	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	-35.8572	18.6399	0.91392	0.0:0.0:1.0:0.0	.	.	.	.	X	260	.	ENSP00000311816:E260X	E	+	1	0	REST	57472339	1.000000	0.71417	0.997000	0.53966	0.772000	0.43724	6.753000	0.74904	2.749000	0.94314	0.655000	0.94253	GAG	REST	-	smart_Znf_C2H2-like	ENSG00000084093		0.383	REST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REST	HGNC	protein_coding	OTTHUMT00000250691.2	63	0.00	0	G	NM_005612		57777582	57777582	+1	no_errors	ENST00000309042	ensembl	human	known	69_37n	nonsense	56	30.86	25	SNP	1.000	T
TNFRSF6B	8771	genome.wustl.edu	37	20	62328257	62328257	+	Missense_Mutation	SNP	G	G	A	rs572993898		TCGA-D8-A1XV-01A-11D-A14K-09	TCGA-D8-A1XV-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a76adfd1-8c89-4c13-b570-5ccc47043a70	679a76a2-1e0a-4289-a8e2-b460b9da28af	g.chr20:62328257G>A	ENST00000369996.1	+	1	237	c.137G>A	c.(136-138)cGg>cAg	p.R46Q	RTEL1_ENST00000318100.4_Silent_p.A1348A|ARFRP1_ENST00000485858.1_5'Flank|RTEL1-TNFRSF6B_ENST00000482936.1_Silent_p.A1348A	NM_003823.3	NP_003814.1	O95407	TNF6B_HUMAN	tumor necrosis factor receptor superfamily, member 6b, decoy	46					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)	extracellular space (GO:0005615)	receptor activity (GO:0004872)			central_nervous_system(1)|lung(2)|skin(1)	4	all_cancers(38;4.66e-12)|all_epithelial(29;2.56e-13)|Lung NSC(23;1.06e-08)|all_lung(23;3.34e-08)		Epithelial(9;1.78e-08)|all cancers(9;7.89e-08)|OV - Ovarian serous cystadenocarcinoma(5;0.00504)			ACAGGGGAGCGGCTGGTGTGC	0.716																																						dbGAP											0													17.0	20.0	19.0					20																	62328257		2168	4268	6436	-	-	-	SO:0001583	missense	0			AF104419	CCDS13532.1	20q13.33	2012-06-27						"""Tumor necrosis factor receptor superfamily"""	11921	protein-coding gene	gene with protein product		603361				9872321, 10318773	Standard	NM_003823		Approved	DcR3, DCR3, TR6, M68	uc002yfz.3	O95407	OTTHUMG00000143724	ENST00000369996.1:c.137G>A	20.37:g.62328257G>A	ENSP00000359013:p.Arg46Gln			Missense_Mutation	SNP	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg	p.R46Q	ENST00000369996.1	37	c.137	CCDS13532.1	20	.	.	.	.	.	.	.	.	.	.	G	10.18	1.280000	0.23392	.	.	ENSG00000243509	ENST00000370006;ENST00000369996;ENST00000342852	T	0.73363	-0.74	4.06	3.1	0.35709	TNFR/CD27/30/40/95 cysteine-rich region (1);	.	.	.	.	T	0.42063	0.1186	N	0.03608	-0.345	0.20703	N	0.999868	B	0.28880	0.226	B	0.10450	0.005	T	0.26503	-1.0101	9	0.11485	T	0.65	-9.7769	3.7024	0.08387	0.0928:0.1646:0.5733:0.1693	.	46	O95407	TNF6B_HUMAN	Q	46	ENSP00000359013:R46Q	ENSP00000342328:R46Q	R	+	2	0	TNFRSF6B	61798701	0.043000	0.20138	0.567000	0.28434	0.061000	0.15899	0.228000	0.17814	0.694000	0.31654	0.462000	0.41574	CGG	TNFRSF6B	-	smart_TNFR/NGFR_Cys_rich_reg	ENSG00000243509		0.716	TNFRSF6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF6B	HGNC	protein_coding	OTTHUMT00000080182.1	19	0.00	0	G			62328257	62328257	+1	no_errors	ENST00000369996	ensembl	human	known	69_37n	missense	4	55.56	5	SNP	0.522	A
ZNF689	115509	genome.wustl.edu	37	16	30616444	30616444	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XV-01A-11D-A14K-09	TCGA-D8-A1XV-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a76adfd1-8c89-4c13-b570-5ccc47043a70	679a76a2-1e0a-4289-a8e2-b460b9da28af	g.chr16:30616444G>A	ENST00000287461.3	-	3	981	c.644C>T	c.(643-645)tCc>tTc	p.S215F	ZNF689_ENST00000566673.1_5'UTR|RP11-146F11.5_ENST00000563540.1_RNA	NM_138447.1	NP_612456.1	Q96CS4	ZN689_HUMAN	zinc finger protein 689	215					regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|prostate(1)|urinary_tract(1)	14			Colorectal(24;0.198)			CTTGCGCTGGGAGAAACGTTT	0.612																																						dbGAP											0													87.0	79.0	82.0					16																	30616444		2197	4300	6497	-	-	-	SO:0001583	missense	0			BC014000	CCDS10686.1	16p11.2	2013-01-08			ENSG00000156853	ENSG00000156853		"""Zinc fingers, C2H2-type"", ""-"""	25173	protein-coding gene	gene with protein product							Standard	NM_138447		Approved	FLJ90415	uc031qvq.1	Q96CS4	OTTHUMG00000132415	ENST00000287461.3:c.644C>T	16.37:g.30616444G>A	ENSP00000287461:p.Ser215Phe		Q658J5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S215F	ENST00000287461.3	37	c.644	CCDS10686.1	16	.	.	.	.	.	.	.	.	.	.	g	18.31	3.596419	0.66332	.	.	ENSG00000156853	ENST00000287461;ENST00000443190	T	0.16597	2.33	4.64	4.64	0.57946	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.41097	D	0.000951	T	0.30978	0.0782	L	0.37507	1.11	0.44595	D	0.997564	D	0.89917	1.0	D	0.70487	0.969	T	0.01894	-1.1252	10	0.52906	T	0.07	-23.0857	15.0459	0.71827	0.0:0.0:1.0:0.0	.	215	Q96CS4	ZN689_HUMAN	F	215	ENSP00000287461:S215F	ENSP00000287461:S215F	S	-	2	0	ZNF689	30523945	0.001000	0.12720	1.000000	0.80357	0.847000	0.48162	0.563000	0.23547	2.411000	0.81874	0.455000	0.32223	TCC	ZNF689	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000156853		0.612	ZNF689-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF689	HGNC	protein_coding	OTTHUMT00000255552.1	87	0.00	0	G	NM_138447		30616444	30616444	-1	no_errors	ENST00000287461	ensembl	human	known	69_37n	missense	38	43.28	29	SNP	0.998	A
