#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAMTSL3	57188	genome.wustl.edu	37	15	84488589	84488589	+	Silent	SNP	C	C	T			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr15:84488589C>T	ENST00000286744.5	+	6	614	c.390C>T	c.(388-390)ttC>ttT	p.F130F	ADAMTSL3_ENST00000567476.1_Silent_p.F130F	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	130						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			CAGAAGATTTCAGAGCCCAGC	0.517																																						dbGAP											0													72.0	62.0	66.0					15																	84488589		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.390C>T	15.37:g.84488589C>T			A1A566|A1A567|Q9ULI7	Silent	SNP	pfam_Thrombospondin_1_rpt,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like,prints_Peptidase_M12B_ADAM-TS	p.F130	ENST00000286744.5	37	c.390	CCDS10326.1	15																																																																																			ADAMTSL3	-	NULL	ENSG00000156218		0.517	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTSL3	HGNC	protein_coding	OTTHUMT00000304007.2	70	0.00	0	C	NM_207517		84488589	84488589	+1	no_errors	ENST00000286744	ensembl	human	known	69_37n	silent	42	32.26	20	SNP	1.000	T
AMPH	273	genome.wustl.edu	37	7	38502653	38502653	+	Silent	SNP	G	G	T			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr7:38502653G>T	ENST00000356264.2	-	10	1025	c.810C>A	c.(808-810)ctC>ctA	p.L270L	AMPH_ENST00000428293.2_Silent_p.L270L|AMPH_ENST00000325590.5_Silent_p.L270L	NM_001635.3	NP_001626.1	P49418	AMPH_HUMAN	amphiphysin	270					endocytosis (GO:0006897)|learning (GO:0007612)|synaptic transmission (GO:0007268)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|leading edge membrane (GO:0031256)|synaptic vesicle (GO:0008021)	phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|kidney(3)|large_intestine(12)|liver(3)|lung(27)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)	62						TCGGGCTCGGGAGGGGTGAAG	0.562																																						dbGAP											0													166.0	157.0	160.0					7																	38502653		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5456.1, CCDS47574.1	7p14-p13	2007-06-19	2007-06-19		ENSG00000078053	ENSG00000078053			471	protein-coding gene	gene with protein product		600418	"""amphiphysin (Stiff-Mann syndrome with breast cancer 128kD autoantigen)"", ""amphiphysin (Stiff-Man syndrome with breast cancer 128kDa autoantigen)"""			8245793	Standard	NM_139316		Approved		uc003tgu.3	P49418	OTTHUMG00000023725	ENST00000356264.2:c.810C>A	7.37:g.38502653G>T			A4D1X8|A4D1X9|O43538|Q75MJ8|Q75MK5|Q75MM3|Q8N4G0	Missense_Mutation	SNP	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_Amphiphysin,prints_SH3_domain	p.P21T	ENST00000356264.2	37	c.61	CCDS5456.1	7	.	.	.	.	.	.	.	.	.	.	G	9.384	1.073794	0.20147	.	.	ENSG00000078053	ENST00000441628	.	.	.	6.17	-0.621	0.11564	.	.	.	.	.	T	0.20981	0.0505	.	.	.	0.23577	N	0.997377	.	.	.	.	.	.	T	0.24512	-1.0158	4	.	.	.	-1.9832	2.5145	0.04665	0.1342:0.1917:0.3614:0.3127	.	.	.	.	T	21	.	.	P	-	1	0	AMPH	38469178	0.003000	0.15002	0.748000	0.31131	0.958000	0.62258	-1.162000	0.03141	-0.050000	0.13356	0.655000	0.94253	CCC	AMPH	-	NULL	ENSG00000078053		0.562	AMPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AMPH	HGNC	protein_coding	OTTHUMT00000226953.2	213	0.00	0	G	NM_001635		38502653	38502653	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000441628	ensembl	human	novel	69_37n	missense	195	15.22	35	SNP	0.004	T
ARFGEF1	10565	genome.wustl.edu	37	8	68139523	68139523	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr8:68139523C>T	ENST00000262215.3	-	27	4154	c.3765G>A	c.(3763-3765)atG>atA	p.M1255I	ARFGEF1_ENST00000518230.1_Missense_Mutation_p.M93I|ARFGEF1_ENST00000520381.1_Missense_Mutation_p.M709I	NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	1255					endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)			breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			ACCGTACAACCATATCTCGAA	0.363																																						dbGAP											0													124.0	127.0	126.0					8																	68139523		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.3765G>A	8.37:g.68139523C>T	ENSP00000262215:p.Met1255Ile		Q9NV46|Q9UFV2|Q9UNL0	Missense_Mutation	SNP	pfam_Sec7,pfam_DUF1981_SEC7_assoc,superfamily_Sec7,superfamily_ARM-type_fold,smart_Sec7,pfscan_Sec7	p.M1255I	ENST00000262215.3	37	c.3765	CCDS6199.1	8	.	.	.	.	.	.	.	.	.	.	C	34	5.334142	0.95758	.	.	ENSG00000066777	ENST00000520381;ENST00000262215;ENST00000518230;ENST00000517631	T;T;T;T	0.64618	-0.05;-0.08;-0.11;1.48	5.56	5.56	0.83823	Domain of unknown function DUF1981, SEC7 associated (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.84727	0.5536	M	0.92691	3.335	0.80722	D	1	D;D;D	0.76494	0.999;0.986;0.986	D;D;D	0.80764	0.994;0.93;0.93	D	0.88080	0.2806	10	0.87932	D	0	.	19.5224	0.95190	0.0:1.0:0.0:0.0	.	1255;733;709	Q9Y6D6;Q59FY5;E5RIF2	BIG1_HUMAN;.;.	I	709;1255;93;104	ENSP00000428429:M709I;ENSP00000262215:M1255I;ENSP00000430891:M93I;ENSP00000429138:M104I	ENSP00000262215:M1255I	M	-	3	0	ARFGEF1	68302077	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.818000	0.86416	2.611000	0.88343	0.585000	0.79938	ATG	ARFGEF1	-	pfam_DUF1981_SEC7_assoc,superfamily_ARM-type_fold	ENSG00000066777		0.363	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFGEF1	HGNC	protein_coding	OTTHUMT00000379441.4	108	0.00	0	C	NM_006421		68139523	68139523	-1	no_errors	ENST00000262215	ensembl	human	known	69_37n	missense	95	13.64	15	SNP	1.000	T
ASL	435	genome.wustl.edu	37	7	65552371	65552371	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr7:65552371C>T	ENST00000304874.9	+	9	755	c.653C>T	c.(652-654)gCa>gTa	p.A218V	AC068533.7_ENST00000450043.1_5'Flank|ASL_ENST00000395331.3_Missense_Mutation_p.A218V|ASL_ENST00000395332.3_Missense_Mutation_p.A218V|ASL_ENST00000380839.4_Missense_Mutation_p.A192V	NM_000048.3	NP_000039.2	P04424	ARLY_HUMAN	argininosuccinate lyase	218					arginine biosynthetic process via ornithine (GO:0042450)|arginine catabolic process (GO:0006527)|cellular nitrogen compound metabolic process (GO:0034641)|internal protein amino acid acetylation (GO:0006475)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	argininosuccinate lyase activity (GO:0004056)			breast(3)|endometrium(3)|large_intestine(2)|lung(9)|upper_aerodigestive_tract(1)	18					L-Arginine(DB00125)	CTGCTCCGAGCAGGTGAGACG	0.657																																						dbGAP											0													72.0	61.0	65.0					7																	65552371		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5531.1, CCDS47597.1, CCDS47598.1	7q11.21	2012-10-02			ENSG00000126522	ENSG00000126522	4.3.2.1		746	protein-coding gene	gene with protein product		608310					Standard	NM_001024943		Approved		uc003tuo.3	P04424	OTTHUMG00000022876	ENST00000304874.9:c.653C>T	7.37:g.65552371C>T	ENSP00000307188:p.Ala218Val		E7EMI0|E9PE48|Q6LDS5|Q96HS2	Missense_Mutation	SNP	pfam_Lyase1_N,superfamily_L-Aspartase-like,prints_D_crystallin,prints_Fumarate_lyase,tigrfam_Argininosuccinate_lyase	p.A218V	ENST00000304874.9	37	c.653	CCDS5531.1	7	.	.	.	.	.	.	.	.	.	.	c	10.69	1.421296	0.25639	.	.	ENSG00000126522	ENST00000304874;ENST00000380839;ENST00000395332;ENST00000362000;ENST00000395331	D;D;D;D;D	0.99201	-5.55;-5.55;-5.55;-5.55;-5.55	5.72	4.77	0.60923	Lyase 1, N-terminal (1);L-Aspartase-like (1);	0.619602	0.16777	N	0.199956	D	0.96728	0.8932	L	0.38692	1.165	0.31586	N	0.65454	B;B;B	0.14438	0.006;0.01;0.009	B;B;B	0.22152	0.038;0.008;0.013	D	0.95048	0.8184	10	0.56958	D	0.05	.	7.6842	0.28530	0.2181:0.6226:0.1593:0.0	.	192;218;218	E9PE48;E7EMI0;P04424	.;.;ARLY_HUMAN	V	218;192;218;153;218	ENSP00000307188:A218V;ENSP00000370219:A192V;ENSP00000378741:A218V;ENSP00000354710:A153V;ENSP00000378740:A218V	ENSP00000307188:A218V	A	+	2	0	ASL	65189806	0.990000	0.36364	1.000000	0.80357	0.020000	0.10135	0.566000	0.23593	2.700000	0.92200	0.561000	0.74099	GCA	ASL	-	pfam_Lyase1_N,superfamily_L-Aspartase-like,tigrfam_Argininosuccinate_lyase	ENSG00000126522		0.657	ASL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASL	HGNC	protein_coding	OTTHUMT00000251695.2	35	0.00	0	C	NM_000048		65552371	65552371	+1	no_errors	ENST00000304874	ensembl	human	known	69_37n	missense	21	32.26	10	SNP	0.997	T
ATP2B2	491	genome.wustl.edu	37	3	10387191	10387192	+	Missense_Mutation	DNP	GC	GC	TG			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	G|C	G|C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr3:10387191_10387192GC>TG	ENST00000352432.4	-	17	2648_2649	c.2579_2580GC>CA	c.(2578-2580)aGC>aCA	p.S860T	ATP2B2_ENST00000383800.4_Missense_Mutation_p.S815T|ATP2B2_ENST00000360273.2_Missense_Mutation_p.S860T|ATP2B2_ENST00000343816.4_Missense_Mutation_p.S846T|ATP2B2_ENST00000397077.1_Missense_Mutation_p.S815T			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	860					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						CCTTGACGATGCTGCTGAAATT	0.584																																					Ovarian(125;1619 1709 15675 19819 38835)	dbGAP											0																																										-	-	-	SO:0001583	missense	0			X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.2579_2580delinsTG	3.37:g.10387191_10387192delinsTG	ENSP00000324172:p.Ser860Thr		O00766|Q12994|Q16818	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,pfam_HAD-SF_hydro-like_3,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,prints_ATPase_P-typ_cation-exchng_asu,tigrfam_ATPase_P-typ_Ca-transp_PMCA,tigrfam_ATPase_P-typ_ion-transptr	p.S860R|p.S860T	ENST00000352432.4	37	c.2580|c.2579	CCDS33701.1	3																																																																																			ATP2B2	-	pfam_HAD-SF_hydro-like_3,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Ca-transp_PMCA,tigrfam_ATPase_P-typ_ion-transptr	ENSG00000157087		0.584	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	ATP2B2	HGNC	protein_coding	OTTHUMT00000250576.2	227	0.00	0	G|C	NM_001683		10387191|10387192	10387191|10387192	-1	no_errors	ENST00000352432	ensembl	human	known	69_37n	missense	94|92	32.37|32.61	45	SNP	1.000	T|G
BBS10	79738	genome.wustl.edu	37	12	76741020	76741020	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr12:76741020G>T	ENST00000393262.3	-	2	828	c.745C>A	c.(745-747)Cgc>Agc	p.R249S		NM_024685.3	NP_078961.3	Q8TAM1	BBS10_HUMAN	Bardet-Biedl syndrome 10	249					cellular protein metabolic process (GO:0044267)|chaperone-mediated protein complex assembly (GO:0051131)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|regulation of protein complex assembly (GO:0043254)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cell projection (GO:0042995)	ATP binding (GO:0005524)|RNA polymerase II repressing transcription factor binding (GO:0001103)			endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)	19						TCTGCTGGGCGGTACACAGAA	0.423									Bardet-Biedl syndrome																													dbGAP											0													75.0	65.0	69.0					12																	76741020		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	BC026355	CCDS9014.2	12q21.2	2014-06-17	2006-04-28	2006-04-28	ENSG00000179941	ENSG00000179941		"""Heat Shock Proteins / Chaperonins"""	26291	protein-coding gene	gene with protein product		610148	"""chromosome 12 open reading frame 58"""	C12orf58		16582908	Standard	NM_024685		Approved	FLJ23560	uc001syd.1	Q8TAM1	OTTHUMG00000147352	ENST00000393262.3:c.745C>A	12.37:g.76741020G>T	ENSP00000376946:p.Arg249Ser		Q96CW2|Q9H5D2	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1	p.R249S	ENST00000393262.3	37	c.745	CCDS9014.2	12	.	.	.	.	.	.	.	.	.	.	g	12.05	1.822834	0.32237	.	.	ENSG00000179941	ENST00000393262	T	0.77489	-1.1	5.13	1.48	0.22813	.	0.186307	0.48286	D	0.000192	T	0.59487	0.2197	N	0.22421	0.69	0.22127	N	0.999348	B	0.02656	0.0	B	0.10450	0.005	T	0.39961	-0.9588	10	0.18710	T	0.47	-0.7116	8.7625	0.34683	0.7802:0.0:0.2198:0.0	.	249	Q8TAM1	BBS10_HUMAN	S	249	ENSP00000376946:R249S	ENSP00000376946:R249S	R	-	1	0	BBS10	75265151	1.000000	0.71417	0.999000	0.59377	0.982000	0.71751	2.436000	0.44819	0.156000	0.19299	-0.295000	0.09555	CGC	BBS10	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1	ENSG00000179941		0.423	BBS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BBS10	HGNC	protein_coding	OTTHUMT00000303983.2	91	0.00	0	G	NM_024685		76741020	76741020	-1	no_errors	ENST00000393262	ensembl	human	known	69_37n	missense	42	34.38	22	SNP	1.000	T
BLMH	642	genome.wustl.edu	37	17	28613877	28613877	+	Nonsense_Mutation	SNP	A	A	C			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr17:28613877A>C	ENST00000261714.6	-	5	681	c.507T>G	c.(505-507)taT>taG	p.Y169*	BLMH_ENST00000394819.3_Nonsense_Mutation_p.Y82*|RNU6-1267P_ENST00000410747.1_RNA|BLMH_ENST00000582669.1_5'Flank	NM_000386.3	NP_000377.1	Q13867	BLMH_HUMAN	bleomycin hydrolase	169					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|carboxypeptidase activity (GO:0004180)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(2)|ovary(1)|prostate(1)|stomach(1)	13					Bleomycin(DB00290)	CCTCTGTTGTATAAGATTCAG	0.338																																					Pancreas(127;628 1772 12912 33293 36203)	dbGAP											0													116.0	103.0	107.0					17																	28613877		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			X92106	CCDS32604.1	17q11.2	2004-02-16				ENSG00000108578			1059	protein-coding gene	gene with protein product		602403				9407121, 9331073	Standard	NM_000386		Approved	BH	uc002hez.2	Q13867		ENST00000261714.6:c.507T>G	17.37:g.28613877A>C	ENSP00000261714:p.Tyr169*		B2R796|Q53F86|Q9UER9	Nonsense_Mutation	SNP	pfam_Peptidase_C1B,pirsf_Peptidase_C1B	p.Y169*	ENST00000261714.6	37	c.507	CCDS32604.1	17	.	.	.	.	.	.	.	.	.	.	A	18.27	3.585943	0.66105	.	.	ENSG00000108578	ENST00000261714;ENST00000394819	.	.	.	5.69	-5.77	0.02369	.	0.141600	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	-0.913	16.5035	0.84263	0.348:0.0:0.652:0.0	.	.	.	.	X	169;82	.	ENSP00000261714:Y169X	Y	-	3	2	BLMH	25638003	0.740000	0.28207	0.913000	0.36048	0.991000	0.79684	-0.157000	0.10085	-0.992000	0.03472	0.460000	0.39030	TAT	BLMH	-	pfam_Peptidase_C1B,pirsf_Peptidase_C1B	ENSG00000108578		0.338	BLMH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLMH	HGNC	protein_coding	OTTHUMT00000447940.1	127	0.00	0	A	NM_000386		28613877	28613877	-1	no_errors	ENST00000261714	ensembl	human	known	69_37n	nonsense	85	33.07	42	SNP	0.852	C
C10orf12	26148	genome.wustl.edu	37	10	98742390	98742390	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr10:98742390G>T	ENST00000286067.2	+	1	1350	c.1243G>T	c.(1243-1245)Gac>Tac	p.D415Y		NM_015652.2	NP_056467.2	Q8N655	CJ012_HUMAN	chromosome 10 open reading frame 12	415										NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(3)|prostate(2)|skin(2)|stomach(4)	45		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		AAAGGCTGAGGACAACCAAAG	0.498																																						dbGAP											0													122.0	135.0	131.0					10																	98742390		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC024315	CCDS7452.1	10q24.2	2014-03-11			ENSG00000155640	ENSG00000155640			23420	protein-coding gene	gene with protein product						24550272	Standard	NM_015652		Approved	DKFZP564P1916, FLJ13022	uc001kmv.3	Q8N655	OTTHUMG00000018840	ENST00000286067.2:c.1243G>T	10.37:g.98742390G>T	ENSP00000286067:p.Asp415Tyr		Q9H945|Q9Y457	Missense_Mutation	SNP	NULL	p.D415Y	ENST00000286067.2	37	c.1243	CCDS7452.1	10	.	.	.	.	.	.	.	.	.	.	G	3.190	-0.166084	0.06461	.	.	ENSG00000155640	ENST00000286067;ENST00000539886	T	0.07327	3.2	5.92	0.262	0.15597	.	2.060680	0.02344	N	0.075199	T	0.06735	0.0172	N	0.19112	0.55	0.09310	N	1	P;P	0.36959	0.575;0.575	B;B	0.34242	0.178;0.178	T	0.34279	-0.9835	10	0.56958	D	0.05	-0.0068	7.0385	0.25006	0.2874:0.2631:0.4494:0.0	.	249;415	A0PJI9;Q8N655	.;CJ012_HUMAN	Y	415;249	ENSP00000286067:D415Y	ENSP00000286067:D415Y	D	+	1	0	C10orf12	98732380	0.006000	0.16342	0.045000	0.18777	0.179000	0.23085	-0.037000	0.12164	0.125000	0.18397	0.561000	0.74099	GAC	C10orf12	-	NULL	ENSG00000155640		0.498	C10orf12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf12	HGNC	protein_coding	OTTHUMT00000049627.1	39	0.00	0	G	NM_015652		98742390	98742390	+1	no_errors	ENST00000286067	ensembl	human	known	69_37n	missense	21	19.23	5	SNP	0.000	T
C10orf12	26148	genome.wustl.edu	37	10	98742978	98742978	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr10:98742978A>G	ENST00000286067.2	+	1	1938	c.1831A>G	c.(1831-1833)Aag>Gag	p.K611E		NM_015652.2	NP_056467.2	Q8N655	CJ012_HUMAN	chromosome 10 open reading frame 12	611										NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(3)|prostate(2)|skin(2)|stomach(4)	45		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		CAAAGAAGTCAAGGAGTTACG	0.507																																						dbGAP											0													66.0	73.0	71.0					10																	98742978		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC024315	CCDS7452.1	10q24.2	2014-03-11			ENSG00000155640	ENSG00000155640			23420	protein-coding gene	gene with protein product						24550272	Standard	NM_015652		Approved	DKFZP564P1916, FLJ13022	uc001kmv.3	Q8N655	OTTHUMG00000018840	ENST00000286067.2:c.1831A>G	10.37:g.98742978A>G	ENSP00000286067:p.Lys611Glu		Q9H945|Q9Y457	Missense_Mutation	SNP	NULL	p.K611E	ENST00000286067.2	37	c.1831	CCDS7452.1	10	.	.	.	.	.	.	.	.	.	.	A	11.31	1.599575	0.28534	.	.	ENSG00000155640	ENST00000286067;ENST00000539886	T	0.07216	3.21	5.67	3.25	0.37280	.	0.530450	0.17052	N	0.188882	T	0.06142	0.0159	L	0.29908	0.895	0.09310	N	1	B	0.24368	0.102	B	0.21917	0.037	T	0.37865	-0.9687	10	0.24483	T	0.36	-2.348	7.8777	0.29603	0.8279:0.0:0.1721:0.0	.	611	Q8N655	CJ012_HUMAN	E	611;445	ENSP00000286067:K611E	ENSP00000286067:K611E	K	+	1	0	C10orf12	98732968	0.014000	0.17966	0.015000	0.15790	0.203000	0.24098	1.744000	0.38268	0.954000	0.37851	0.459000	0.35465	AAG	C10orf12	-	NULL	ENSG00000155640		0.507	C10orf12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf12	HGNC	protein_coding	OTTHUMT00000049627.1	36	0.00	0	A	NM_015652		98742978	98742978	+1	no_errors	ENST00000286067	ensembl	human	known	69_37n	missense	37	13.95	6	SNP	0.001	G
SLC35F6	54978	genome.wustl.edu	37	2	26998432	26998432	+	Silent	SNP	G	G	A			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr2:26998432G>A	ENST00000344420.5	+	4	485	c.423G>A	c.(421-423)gtG>gtA	p.V141V	SLC35F6_ENST00000482746.1_3'UTR|SLC35F6_ENST00000416475.2_Silent_p.V58V|CENPA_ENST00000475662.1_Intron	NM_017877.3	NP_060347.2	Q8N357	S35F6_HUMAN	solute carrier family 35, member F6	141	EamA.				negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)|positive regulation of cell proliferation (GO:0008284)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)											GGAGGCTGGTGCTGAGCCAGT	0.632																																						dbGAP											0													53.0	47.0	49.0					2																	26998432		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK075164	CCDS1728.1	2p24.1	2012-12-13	2012-12-07	2012-12-07	ENSG00000213699	ENSG00000213699			26055	protein-coding gene	gene with protein product	"""ANT2-binding protein"", ""transport and golgi organization 9 homolog (Drosophila)"""		"""chromosome 2 open reading frame 18"""	C2orf18		15911612, 19154410	Standard	NM_017877		Approved	FLJ20555, ANT2BP, TANGO9	uc002rhp.1	Q8N357	OTTHUMG00000128407	ENST00000344420.5:c.423G>A	2.37:g.26998432G>A			D6W543|Q53GK2|Q8NBX6|Q9NWX0	Silent	SNP	pfam_DUF914_euk,pfam_Nuc_sug_transpt,pfam_DMT,pfam_DUF250,pfam_UAA,pirsf_UCP036436	p.V141	ENST00000344420.5	37	c.423	CCDS1728.1	2																																																																																			C2orf18	-	pfam_DUF914_euk,pfam_Nuc_sug_transpt,pfam_DMT,pfam_UAA,pirsf_UCP036436	ENSG00000213699		0.632	SLC35F6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf18	HGNC	protein_coding	OTTHUMT00000250187.2	80	0.00	0	G	NM_017877		26998432	26998432	+1	no_errors	ENST00000344420	ensembl	human	known	69_37n	silent	21	62.71	37	SNP	0.011	A
CASP8	841	genome.wustl.edu	37	2	202141566	202141566	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr2:202141566A>T	ENST00000432109.2	+	8	866	c.677A>T	c.(676-678)tAc>tTc	p.Y226F	CASP8_ENST00000323492.7_Missense_Mutation_p.Y211F|CASP8_ENST00000264274.9_Intron|CASP8_ENST00000392259.2_Missense_Mutation_p.L204F|CASP8_ENST00000392266.3_Missense_Mutation_p.L189F|CASP8_ENST00000392258.3_Missense_Mutation_p.L204F|CASP8_ENST00000264275.5_Missense_Mutation_p.Y243F|CASP8_ENST00000358485.4_Missense_Mutation_p.Y285F	NM_033355.3	NP_203519.1	Q14790	CASP8_HUMAN	caspase 8, apoptosis-related cysteine peptidase	226					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|heart development (GO:0007507)|hepatocyte apoptotic process (GO:0097284)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|macrophage differentiation (GO:0030225)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|natural killer cell activation (GO:0030101)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of necroptotic process (GO:0060546)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of proteolysis (GO:0045862)|protein heterooligomerization (GO:0051291)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of thymocyte apoptotic process (GO:0070243)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to cold (GO:0009409)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell activation (GO:0042110)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|Noc1p-Noc2p complex (GO:0030690)|nucleus (GO:0005634)|ripoptosome (GO:0097342)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097199)|cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|peptidase activity (GO:0008233)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(5)|cervix(2)|endometrium(6)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(9)|urinary_tract(3)	52						GACAAAGTTTACCAAATGAAA	0.433										HNSCC(4;0.00038)																											Melanoma(82;831 1348 20716 36952 40159)	dbGAP											0													73.0	72.0	72.0					2																	202141566		2203	4300	6503	-	-	-	SO:0001583	missense	0			U60520	CCDS2342.1, CCDS2343.1, CCDS2345.1, CCDS42798.1, CCDS42799.1	2q33-q34	2014-09-17	2005-08-17		ENSG00000064012	ENSG00000064012		"""Caspases"""	1509	protein-coding gene	gene with protein product		601763	"""caspase 8, apoptosis-related cysteine protease"""			8681376, 8681377	Standard	NM_033355		Approved	MCH5, MACH, FLICE, Casp-8	uc002uxt.1	Q14790	OTTHUMG00000132821	ENST00000432109.2:c.677A>T	2.37:g.202141566A>T	ENSP00000412523:p.Tyr226Phe		O14676|Q14791|Q14792|Q14793|Q14794|Q14795|Q14796|Q15780|Q15806|Q53TT5|Q8TDI1|Q8TDI2|Q8TDI3|Q8TDI4|Q8TDI5|Q96T22|Q9C0K4|Q9UQ81	Missense_Mutation	SNP	pfam_DED,pfam_Pept_C14_cat,superfamily_DEATH-like,smart_DED,smart_Pept_C14_p45_core,pfscan_DED,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14_p45_core	p.Y285F	ENST00000432109.2	37	c.854	CCDS2342.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.74|15.74	2.922243|2.922243	0.52653|0.52653	.|.	.|.	ENSG00000064012|ENSG00000064012	ENST00000392259;ENST00000392266;ENST00000392258;ENST00000447616;ENST00000424461|ENST00000392263;ENST00000432109;ENST00000264275;ENST00000450491;ENST00000358485;ENST00000392261;ENST00000323492	D;D;D|D;D;D;D;D;D	0.83419|0.89746	-1.72;-1.72;-1.72|-2.56;-2.56;-2.56;-1.61;-2.56;-2.56	5.6|5.6	5.6|5.6	0.85130|0.85130	.|Peptidase C14, caspase precursor p45, core (1);DEATH-like (1);	.|0.062931	.|0.64402	.|D	.|0.000003	D|D	0.90103|0.90103	0.6908|0.6908	N|N	0.24115|0.24115	0.695|0.695	0.36349|0.36349	D|D	0.859999|0.859999	D;D|D;D;D;D;D;D	0.89917|0.89917	1.0;1.0|1.0;1.0;1.0;1.0;1.0;1.0	D;D|D;D;D;D;D;D	0.91635|0.97110	0.999;0.999|1.0;0.999;1.0;1.0;1.0;1.0	D|D	0.93161|0.93161	0.6558|0.6558	8|10	.|0.87932	.|D	.|0	.|.	13.5196|13.5196	0.61559|0.61559	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	189;204|226;211;285;226;211;243	Q14790-6;Q14790-5|Q14790-7;A8MU92;Q14790-9;Q14790;Q14790-2;Q14790-4	.;.|.;.;.;CASP8_HUMAN;.;.	F|F	204;189;204;189;52|211;226;243;108;285;211;211	ENSP00000376094:L189F;ENSP00000388306:L189F;ENSP00000390346:L52F|ENSP00000376091:Y211F;ENSP00000412523:Y226F;ENSP00000264275:Y243F;ENSP00000391709:Y108F;ENSP00000351273:Y285F;ENSP00000325722:Y211F	.|ENSP00000264275:Y243F	L|Y	+|+	3|2	2|0	CASP8|CASP8	201849811|201849811	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.121000|0.121000	0.20230|0.20230	7.883000|7.883000	0.87264|0.87264	2.121000|2.121000	0.65114|0.65114	0.459000|0.459000	0.35465|0.35465	TTA|TAC	CASP8	-	superfamily_DEATH-like,smart_Pept_C14_p45_core	ENSG00000064012		0.433	CASP8-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	CASP8	HGNC	protein_coding	OTTHUMT00000336853.2	135	0.00	0	A	NM_001228		202141566	202141566	+1	no_errors	ENST00000358485	ensembl	human	known	69_37n	missense	45	56.73	59	SNP	1.000	T
CFAP58	159686	genome.wustl.edu	37	10	106160488	106160488	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr10:106160488T>A	ENST00000369704.3	+	13	2000	c.1866T>A	c.(1864-1866)gaT>gaA	p.D622E	snoU13_ENST00000458914.1_RNA	NM_001008723.1	NP_001008723.1	Q5T655	CC147_HUMAN		622						extracellular space (GO:0005615)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	52		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)		GGCGCAATGATGAGTTAGCTT	0.502																																						dbGAP											0													166.0	142.0	150.0					10																	106160488		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000369704.3:c.1866T>A	10.37:g.106160488T>A	ENSP00000358718:p.Asp622Glu		D3DRA6|Q8NA27	Missense_Mutation	SNP	superfamily_Homeodomain-like	p.D622E	ENST00000369704.3	37	c.1866	CCDS31282.1	10	.	.	.	.	.	.	.	.	.	.	T	15.73	2.919812	0.52653	.	.	ENSG00000120051	ENST00000369704	T	0.44881	0.91	5.62	-9.51	0.00581	.	0.099113	0.64402	D	0.000002	T	0.27313	0.0670	L	0.57130	1.785	0.80722	D	1	B	0.30824	0.296	B	0.29353	0.101	T	0.50651	-0.8803	10	0.07813	T	0.8	-25.1886	14.4098	0.67109	0.0:0.6621:0.0908:0.2471	.	622	Q5T655	CC147_HUMAN	E	622	ENSP00000358718:D622E	ENSP00000358718:D622E	D	+	3	2	CCDC147	106150478	0.003000	0.15002	0.440000	0.26846	0.941000	0.58515	-1.327000	0.02682	-2.209000	0.00739	-2.066000	0.00396	GAT	CCDC147	-	NULL	ENSG00000120051		0.502	CCDC147-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC147	HGNC	protein_coding	OTTHUMT00000050216.1	133	0.00	0	T			106160488	106160488	+1	no_errors	ENST00000369704	ensembl	human	known	69_37n	missense	72	10.00	8	SNP	0.580	A
CCDC74B	91409	genome.wustl.edu	37	2	130900856	130900856	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr2:130900856G>A	ENST00000310463.6	-	2	418	c.281C>T	c.(280-282)aCa>aTa	p.T94I	CCDC74B_ENST00000409943.3_Missense_Mutation_p.T94I|CCDC74B_ENST00000409128.1_Missense_Mutation_p.T136I|CCDC74B_ENST00000392984.3_5'UTR|CCDC74B_ENST00000409234.3_Missense_Mutation_p.T94I	NM_207310.2	NP_997193.1	Q96LY2	CC74B_HUMAN	coiled-coil domain containing 74B	94										endometrium(2)|large_intestine(1)|lung(3)	6	Colorectal(110;0.1)					CTTCTGTGATGTCTGATTCAT	0.537																																						dbGAP											0													151.0	135.0	140.0					2																	130900856		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2155.1, CCDS58726.1	2q21.1	2006-11-29		2006-02-16	ENSG00000152076	ENSG00000152076			25267	protein-coding gene	gene with protein product							Standard	NM_001258307		Approved	DKFZp434E2321	uc002tqn.2	Q96LY2	OTTHUMG00000131629	ENST00000310463.6:c.281C>T	2.37:g.130900856G>A	ENSP00000308873:p.Thr94Ile		Q6NW18	Missense_Mutation	SNP	NULL	p.T94I	ENST00000310463.6	37	c.281	CCDS2155.1	2	.	.	.	.	.	.	.	.	.	.	.	6.901	0.535860	0.13188	.	.	ENSG00000152076	ENST00000409943;ENST00000310463;ENST00000409488;ENST00000409128;ENST00000418636;ENST00000409234;ENST00000441670	T;T;T;T	0.49139	0.89;0.89;0.79;0.89	2.21	0.903	0.19296	.	.	.	.	.	T	0.25606	0.0623	N	0.08118	0	0.80722	D	1	P;B;P	0.35982	0.531;0.257;0.531	B;B;B	0.38500	0.275;0.098;0.201	T	0.04885	-1.0920	9	0.56958	D	0.05	.	5.2275	0.15404	0.0:0.0:0.3126:0.6874	.	94;94;94	E9PG54;Q96LY2-2;Q96LY2	.;.;CC74B_HUMAN	I	94;94;94;136;136;94;136	ENSP00000386294:T94I;ENSP00000308873:T94I;ENSP00000386644:T136I;ENSP00000386303:T94I	ENSP00000308873:T94I	T	-	2	0	CCDC74B	130617326	0.980000	0.34600	0.401000	0.26359	0.143000	0.21401	0.794000	0.26958	0.104000	0.17725	-0.887000	0.02937	ACA	CCDC74B	-	NULL	ENSG00000152076		0.537	CCDC74B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC74B	HGNC	protein_coding	OTTHUMT00000254522.3	218	0.00	0	G	NM_207310		130900856	130900856	-1	no_errors	ENST00000310463	ensembl	human	known	69_37n	missense	120	21.05	32	SNP	0.830	A
AMN	81693	genome.wustl.edu	37	14	103400160	103400160	+	IGR	SNP	T	T	G			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr14:103400160T>G	ENST00000299155.5	+	0	1907				CDC42BPB_ENST00000361246.2_Missense_Mutation_p.K1675N|RP11-365N19.2_ENST00000560931.1_RNA	NM_030943.3	NP_112205.2	Q9BXJ7	AMNLS_HUMAN	amnion associated transmembrane protein						cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|excretion (GO:0007588)|Golgi to plasma membrane protein transport (GO:0043001)|lipoprotein metabolic process (GO:0042157)|multicellular organismal development (GO:0007275)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			kidney(2)|large_intestine(1)|lung(2)|skin(1)	6				Colorectal(3;0.00739)|READ - Rectum adenocarcinoma(2;0.0336)|Epithelial(152;0.0363)|all cancers(159;0.147)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GAGTTGAGTGTTTGGTGGAGT	0.647																																						dbGAP											0													115.0	108.0	110.0					14																	103400160		2194	4290	6484	-	-	-	SO:0001628	intergenic_variant	0			AF328788	CCDS9977.1	14q32.32	2014-09-17	2012-12-07		ENSG00000166126	ENSG00000166126			14604	protein-coding gene	gene with protein product		605799	"""amnionless homolog (mouse)"""			11279523	Standard	NM_030943		Approved	amnionless	uc001ymg.4	Q9BXJ7			14.37:g.103400160T>G			Q6UX83	Missense_Mutation	SNP	pfam_Citron,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Myotonic_dystrophy_kinase_coil,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,smart_PAK_box_Rho-bd,prints_DAG/PE-bd,pfscan_PAK_box_Rho-bd,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.K1675N	ENST00000299155.5	37	c.5025	CCDS9977.1	14	.	.	.	.	.	.	.	.	.	.	T	22.3	4.277536	0.80580	.	.	ENSG00000198752	ENST00000361246	T	0.68903	-0.36	4.91	-0.263	0.12954	.	0.045674	0.85682	D	0.000000	T	0.69142	0.3078	M	0.75447	2.3	0.54753	D	0.999987	P	0.51449	0.945	P	0.50860	0.652	T	0.67738	-0.5593	10	0.62326	D	0.03	.	8.8938	0.35451	0.0:0.2961:0.0:0.7039	.	1675	Q9Y5S2	MRCKB_HUMAN	N	1675	ENSP00000355237:K1675N	ENSP00000355237:K1675N	K	-	3	2	CDC42BPB	102469913	1.000000	0.71417	0.992000	0.48379	0.992000	0.81027	0.924000	0.28777	-0.317000	0.08677	0.379000	0.24179	AAA	CDC42BPB	-	NULL	ENSG00000198752		0.647	AMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42BPB	HGNC	protein_coding	OTTHUMT00000415704.1	133	0.75	1	T			103400160	103400160	-1	no_errors	ENST00000361246	ensembl	human	known	69_37n	missense	46	43.21	35	SNP	1.000	G
CDIPT	10423	genome.wustl.edu	37	16	29872462	29872462	+	Silent	SNP	A	A	G			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr16:29872462A>G	ENST00000219789.6	-	3	1175	c.297T>C	c.(295-297)agT>agC	p.S99S	CDIPT_ENST00000566113.1_Silent_p.S54S|CDIPT-AS1_ENST00000565014.1_RNA|CDIPT_ENST00000567459.1_5'Flank|CDIPT-AS1_ENST00000398859.3_RNA|CDIPT_ENST00000563415.1_Silent_p.S99S|CDIPT_ENST00000570016.1_Silent_p.S99S|CDIPT_ENST00000561555.1_Silent_p.S123S|CDIPT_ENST00000569956.1_Silent_p.S99S	NM_006319.3	NP_006310.1	O14735	CDIPT_HUMAN	CDP-diacylglycerol--inositol 3-phosphatidyltransferase	99					CDP-diacylglycerol metabolic process (GO:0046341)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alcohol binding (GO:0043178)|carbohydrate binding (GO:0030246)|CDP-diacylglycerol-inositol 3-phosphatidyltransferase activity (GO:0003881)|diacylglycerol binding (GO:0019992)|manganese ion binding (GO:0030145)			endometrium(1)|lung(3)	4						CCACATCCAAACTCATGCTGA	0.597																																						dbGAP											0													81.0	66.0	71.0					16																	29872462		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AF014807	CCDS10657.1, CCDS67002.1	16p11.2	2012-11-19	2010-04-29		ENSG00000103502	ENSG00000103502	2.7.8.11		1769	protein-coding gene	gene with protein product	"""phosphatidylinositol synthase"""	605893	"""CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase)"""			9407135	Standard	NM_006319		Approved	PIS1, PIS	uc002dum.3	O14735	OTTHUMG00000177144	ENST00000219789.6:c.297T>C	16.37:g.29872462A>G			B4DUV0|H3BTV1|Q6FGU1|Q6ZN70	Silent	SNP	pfam_CDP-OH_P_trans,pirsf_CDP_diag_ino_3_P_euk	p.S99	ENST00000219789.6	37	c.297	CCDS10657.1	16																																																																																			CDIPT	-	pirsf_CDP_diag_ino_3_P_euk	ENSG00000103502		0.597	CDIPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDIPT	HGNC	protein_coding	OTTHUMT00000255147.3	103	0.00	0	A	NM_006319		29872462	29872462	-1	no_errors	ENST00000219789	ensembl	human	known	69_37n	silent	60	25.61	21	SNP	0.997	G
CECR2	27443	genome.wustl.edu	37	22	18028881	18028881	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr22:18028881C>A	ENST00000400585.2	+	17	3850	c.3412C>A	c.(3412-3414)Cat>Aat	p.H1138N	CECR2_ENST00000400573.5_Missense_Mutation_p.H1280N|CECR2_ENST00000262608.8_Missense_Mutation_p.H1281N			Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	1322					apoptotic DNA fragmentation (GO:0006309)|ATP-dependent chromatin remodeling (GO:0043044)|cytokinesis (GO:0000910)|cytoskeleton organization (GO:0007010)|execution phase of apoptosis (GO:0097194)|neural tube development (GO:0021915)|vesicle-mediated transport (GO:0016192)	CERF complex (GO:0090537)|nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	59		all_epithelial(15;0.139)		Lung(27;0.146)		CCTGGACAACCATAACGCAGC	0.512																																						dbGAP											0													78.0	82.0	81.0					22																	18028881		1921	4130	6051	-	-	-	SO:0001583	missense	0			AF336133		22q11.2	2012-04-19			ENSG00000099954	ENSG00000099954			1840	protein-coding gene	gene with protein product		607576				11381032	Standard	XM_006724077		Approved	KIAA1740	uc002zml.2	Q9BXF3	OTTHUMG00000150072	ENST00000400585.2:c.3412C>A	22.37:g.18028881C>A	ENSP00000383428:p.His1138Asn		A8MS90|A8MX16|Q658Z4|Q96P58|Q9C0C3	Missense_Mutation	SNP	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.H1280N	ENST00000400585.2	37	c.3838		22	.	.	.	.	.	.	.	.	.	.	C	17.46	3.394823	0.62066	.	.	ENSG00000099954	ENST00000400585;ENST00000400573;ENST00000262608	T;T;T	0.56103	0.62;0.6;0.48	4.68	4.68	0.58851	.	0.000000	0.50627	D	0.000114	T	0.71953	0.3401	M	0.69823	2.125	0.51767	D	0.999933	D;D;D	0.69078	0.997;0.997;0.997	D;D;D	0.73380	0.98;0.98;0.98	T	0.76168	-0.3058	10	0.72032	D	0.01	-21.553	17.9619	0.89087	0.0:1.0:0.0:0.0	.	1322;1138;1280	Q9BXF3;B7WPH3;E2QRE6	CECR2_HUMAN;.;.	N	1138;1280;1281	ENSP00000383428:H1138N;ENSP00000383417:H1280N;ENSP00000262608:H1281N	ENSP00000262608:H1281N	H	+	1	0	CECR2	16408881	1.000000	0.71417	1.000000	0.80357	0.700000	0.40528	6.463000	0.73530	2.318000	0.78349	0.555000	0.69702	CAT	CECR2	-	NULL	ENSG00000099954		0.512	CECR2-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	CECR2	HGNC	protein_coding	OTTHUMT00000316226.2	46	0.00	0	C	NM_031413		18028881	18028881	+1	no_errors	ENST00000400573	ensembl	human	novel	69_37n	missense	27	47.06	24	SNP	1.000	A
CPT1A	1374	genome.wustl.edu	37	11	68566686	68566686	+	Splice_Site	SNP	G	G	T	rs146551320		TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr11:68566686G>T	ENST00000265641.5	-	6	847	c.693C>A	c.(691-693)taC>taA	p.Y231*	CPT1A_ENST00000538994.1_5'UTR|CPT1A_ENST00000540367.1_Splice_Site_p.Y231*|CPT1A_ENST00000539743.1_Splice_Site_p.Y231*|CPT1A_ENST00000376618.2_Splice_Site_p.Y231*	NM_001876.3	NP_001867.2	P50416	CPT1A_HUMAN	carnitine palmitoyltransferase 1A (liver)	231					carnitine metabolic process (GO:0009437)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|eating behavior (GO:0042755)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|glucose metabolic process (GO:0006006)|long-chain fatty acid metabolic process (GO:0001676)|positive regulation of fatty acid beta-oxidation (GO:0032000)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	Esophageal squamous(3;3.28e-14)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		Glyburide(DB01016)|L-Carnitine(DB00583)|Perhexiline(DB01074)	ACAGACTTACGTAATTTGTAG	0.398																																						dbGAP											0													81.0	80.0	80.0					11																	68566686		2200	4294	6494	-	-	-	SO:0001630	splice_region_variant	0			L39211	CCDS8185.1, CCDS31624.1	11q13.2	2007-07-26				ENSG00000110090	2.3.1.21		2328	protein-coding gene	gene with protein product		600528		CPT1		7892212, 9070950	Standard	NM_001876		Approved	CPT1-L, L-CPT1	uc001oog.4	P50416		ENST00000265641.5:c.693+1C>A	11.37:g.68566686G>T			Q8TCU0|Q9BWK0	Nonsense_Mutation	SNP	pfam_Carn_acyl_trans	p.Y231*	ENST00000265641.5	37	c.693	CCDS8185.1	11	.	.	.	.	.	.	.	.	.	.	g	21.7	4.188435	0.78789	.	.	ENSG00000110090	ENST00000540367;ENST00000376618;ENST00000265641;ENST00000538308;ENST00000539743	.	.	.	4.72	-9.44	0.00603	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.3351	0.49498	0.4147:0.095:0.4903:0.0	.	.	.	.	X	231	.	.	Y	-	3	2	CPT1A	68323262	0.266000	0.24112	0.028000	0.17463	0.600000	0.36913	-0.172000	0.09868	-2.541000	0.00485	-0.379000	0.06801	TAC	CPT1A	-	pfam_Carn_acyl_trans	ENSG00000110090		0.398	CPT1A-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CPT1A	HGNC	protein_coding	OTTHUMT00000397457.2	110	0.00	0	G	NM_001876	Nonsense_Mutation	68566686	68566686	-1	no_errors	ENST00000265641	ensembl	human	known	69_37n	nonsense	74	29.52	31	SNP	0.427	T
DIAPH1	1729	genome.wustl.edu	37	5	140953199	140953199	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr5:140953199G>C	ENST00000398557.4	-	16	2358	c.2218C>G	c.(2218-2220)Cca>Gca	p.P740A	DIAPH1_ENST00000389057.5_Missense_Mutation_p.P731A|DIAPH1_ENST00000518047.1_Missense_Mutation_p.P731A|DIAPH1_ENST00000389054.3_Missense_Mutation_p.P740A|DIAPH1_ENST00000398562.2_Missense_Mutation_p.P719A|DIAPH1_ENST00000520569.1_Missense_Mutation_p.P686A|DIAPH1_ENST00000253811.6_Missense_Mutation_p.P740A|DIAPH1_ENST00000398566.3_Missense_Mutation_p.P731A	NM_005219.4	NP_005210.3	O60610	DIAP1_HUMAN	diaphanous-related formin 1	740	FH1.				actin filament polymerization (GO:0030041)|cellular response to histamine (GO:0071420)|cytoskeleton organization (GO:0007010)|positive regulation of cell migration (GO:0030335)|protein localization to microtubule (GO:0035372)|regulation of cell shape (GO:0008360)|regulation of microtubule-based process (GO:0032886)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|mitotic spindle (GO:0072686)|ruffle membrane (GO:0032587)	ion channel binding (GO:0044325)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|pancreas(1)|skin(2)|stomach(2)	23			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTGGAGGTGGAGGAATGCCA	0.577																																						dbGAP											0													29.0	33.0	32.0					5																	140953199		1882	4107	5989	-	-	-	SO:0001583	missense	0			BC007411		5q31	2013-05-24	2013-05-24		ENSG00000131504	ENSG00000131504			2876	protein-coding gene	gene with protein product		602121	"""diaphanous (Drosophila, homolog) 1"", ""diaphanous homolog 1 (Drosophila)"""	DFNA1		9360932, 1350680	Standard	NM_005219		Approved	hDIA1, LFHL1	uc003llb.4	O60610	OTTHUMG00000149893	ENST00000398557.4:c.2218C>G	5.37:g.140953199G>C	ENSP00000381565:p.Pro740Ala		A6NF18|B7ZKW2|E9PEZ2|Q17RN4|Q59FH8|Q9UC76	Missense_Mutation	SNP	pfam_FH2_actin-bd,pfam_Drf_FH3,pfam_Drf_GTPase-bd,pfam_Formin_homology_1,pfam_Drf_DAD,superfamily_ARM-type_fold,superfamily_FH2_actin-bd,superfamily_tRNA-bd_arm,smart_Actin-bd_FH2/DRF_autoreg	p.P740A	ENST00000398557.4	37	c.2218	CCDS43374.1	5	.	.	.	.	.	.	.	.	.	.	g	14.83	2.652736	0.47362	.	.	ENSG00000131504	ENST00000389054;ENST00000520569;ENST00000398562;ENST00000389057;ENST00000398566;ENST00000398557;ENST00000253811;ENST00000518047;ENST00000546094	D;D;D;D;D;D;D;D	0.87491	-2.26;-2.26;-2.26;-2.26;-2.26;-2.26;-2.26;-2.26	4.45	4.45	0.53987	Actin-binding FH2 (1);Formin Homology 1 (1);	0.253086	0.31461	N	0.007605	D	0.93363	0.7884	M	0.87682	2.9	0.58432	D	0.999991	D;D;D	0.71674	0.998;0.998;0.998	D;D;D	0.67725	0.936;0.953;0.953	D	0.92805	0.6259	10	0.32370	T	0.25	.	16.0437	0.80704	0.0:0.0:1.0:0.0	.	686;731;740	E7ERW8;E9PEZ2;O60610	.;.;DIAP1_HUMAN	A	740;686;719;731;731;740;740;731;179	ENSP00000373706:P740A;ENSP00000429282:P686A;ENSP00000381570:P719A;ENSP00000373709:P731A;ENSP00000381572:P731A;ENSP00000381565:P740A;ENSP00000253811:P740A;ENSP00000428268:P731A	ENSP00000253811:P740A	P	-	1	0	DIAPH1	140933383	.	.	1.000000	0.80357	0.980000	0.70556	.	.	2.299000	0.77371	0.586000	0.80456	CCA	DIAPH1	-	pfam_Formin_homology_1,superfamily_FH2_actin-bd	ENSG00000131504		0.577	DIAPH1-203	KNOWN	basic|appris_candidate|CCDS	protein_coding	DIAPH1	HGNC	protein_coding		58	0.00	0	G	NM_005219		140953199	140953199	-1	no_errors	ENST00000253811	ensembl	human	known	69_37n	missense	40	16.67	8	SNP	1.000	C
DNAH3	55567	genome.wustl.edu	37	16	20997028	20997028	+	Frame_Shift_Del	DEL	G	G	-			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr16:20997028delG	ENST00000261383.3	-	48	7035	c.7036delC	c.(7036-7038)cacfs	p.H2346fs	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	2346					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		GGTGACAAGTGGATAAGCACC	0.478																																						dbGAP											0													76.0	77.0	76.0					16																	20997028		2201	4300	6501	-	-	-	SO:0001589	frameshift_variant	0			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.7036delC	16.37:g.20997028delG	ENSP00000261383:p.His2346fs		O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Frame_Shift_Del	DEL	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_Prefoldin,smart_AAA+_ATPase	p.H2346fs	ENST00000261383.3	37	c.7036	CCDS10594.1	16																																																																																			DNAH3	-	NULL	ENSG00000158486		0.478	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	HGNC	protein_coding	OTTHUMT00000207361.1	43	0.00	0	G	NM_017539		20997028	20997028	-1	no_errors	ENST00000261383	ensembl	human	known	69_37n	frame_shift_del	31	30.43	14	DEL	1.000	-
DNASE1L1	1774	genome.wustl.edu	37	X	153631301	153631301	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chrX:153631301G>C	ENST00000393638.1	-	7	1042	c.756C>G	c.(754-756)ttC>ttG	p.F252L	SNORA70_ENST00000384436.1_RNA|DNASE1L1_ENST00000369809.1_Missense_Mutation_p.F252L	NM_001009934.1	NP_001009934.1	P49184	DNSL1_HUMAN	deoxyribonuclease I-like 1	252					DNA metabolic process (GO:0006259)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)			lung(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CGGTGAGCTGGAAGCTCGTGG	0.682																																						dbGAP											0													36.0	33.0	34.0					X																	153631301		2203	4298	6501	-	-	-	SO:0001583	missense	0			L40817	CCDS14747.1	Xq28	2008-02-05			ENSG00000013563	ENSG00000013563			2957	protein-coding gene	gene with protein product	"""DNase X"""	300081		DNL1L		8541839, 8654957	Standard	XM_005277829		Approved	DNAS1L1, XIB, DNASEX	uc004fkw.1	P49184	OTTHUMG00000033188	ENST00000393638.1:c.756C>G	X.37:g.153631301G>C	ENSP00000377255:p.Phe252Leu		D3DWW7|Q5HY41	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_DNase_I_euk,pirsf_DNase_I_euk,prints_DNase_I_euk	p.F252L	ENST00000393638.1	37	c.756	CCDS14747.1	X	.	.	.	.	.	.	.	.	.	.	G	11.94	1.788761	0.31685	.	.	ENSG00000013563	ENST00000369809;ENST00000393638;ENST00000014935;ENST00000369808;ENST00000369807;ENST00000309585	T;T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55;1.55	4.16	2.35	0.29111	Endonuclease/exonuclease/phosphatase (2);	0.274613	0.36778	N	0.002404	T	0.25232	0.0613	L	0.43554	1.36	0.09310	N	1	B	0.22746	0.074	B	0.31614	0.133	T	0.21109	-1.0255	10	0.35671	T	0.21	-7.8936	7.0668	0.25157	0.2365:0.0:0.7635:0.0	.	252	P49184	DNSL1_HUMAN	L	252	ENSP00000358824:F252L;ENSP00000377255:F252L;ENSP00000014935:F252L;ENSP00000358823:F252L;ENSP00000358822:F252L;ENSP00000309168:F252L	ENSP00000014935:F252L	F	-	3	2	DNASE1L1	153284495	0.086000	0.21541	0.019000	0.16419	0.255000	0.26057	0.902000	0.28459	0.260000	0.21731	0.597000	0.82753	TTC	DNASE1L1	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_DNase_I_euk,pirsf_DNase_I_euk,prints_DNase_I_euk	ENSG00000013563		0.682	DNASE1L1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	DNASE1L1	HGNC	protein_coding	OTTHUMT00000080928.2	39	0.00	0	G			153631301	153631301	-1	no_errors	ENST00000014935	ensembl	human	known	69_37n	missense	4	73.68	14	SNP	0.002	C
DYX1C1	161582	genome.wustl.edu	37	15	55727258	55727258	+	Splice_Site	SNP	T	T	C			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr15:55727258T>C	ENST00000321149.3	-	8	1261		c.e8-2		DYX1C1_ENST00000457155.2_Splice_Site|DYX1C1_ENST00000380679.1_Splice_Site|DYX1C1-CCPG1_ENST00000565113.1_RNA|DYX1C1_ENST00000348518.3_Splice_Site|DYX1C1_ENST00000448430.2_Splice_Site	NM_130810.3	NP_570722.2	Q8WXU2	DYXC1_HUMAN	dyslexia susceptibility 1 candidate 1						cilium movement (GO:0003341)|determination of left/right symmetry (GO:0007368)|inner dynein arm assembly (GO:0036159)|neuron migration (GO:0001764)|outer dynein arm assembly (GO:0036158)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of proteasomal protein catabolic process (GO:0061136)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	estrogen receptor binding (GO:0030331)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18				all cancers(107;0.0118)|GBM - Glioblastoma multiforme(80;0.171)		AACAATTTGCTAATGAGACAA	0.313																																						dbGAP											0													52.0	55.0	54.0					15																	55727258		2191	4290	6481	-	-	-	SO:0001630	splice_region_variant	0				CCDS10154.1, CCDS32243.1, CCDS32244.1	15q21.3	2014-09-11			ENSG00000256061	ENSG00000256061		"""Tetratricopeptide (TTC) repeat domain containing"""	21493	protein-coding gene	gene with protein product		608706				12954984	Standard	NM_130810		Approved	EKN1, FLJ37882, CILD25	uc002adc.3	Q8WXU2	OTTHUMG00000132008	ENST00000321149.3:c.894-2A>G	15.37:g.55727258T>C			Q6P5Y9|Q8N1S6	Splice_Site	SNP	-	e7-2	ENST00000321149.3	37	c.894-2	CCDS10154.1	15	.	.	.	.	.	.	.	.	.	.	T	16.49	3.137312	0.56936	.	.	ENSG00000256061	ENST00000448430;ENST00000380679;ENST00000457155;ENST00000321149;ENST00000348518	.	.	.	5.05	3.93	0.45458	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.7491	0.28886	0.0:0.0965:0.0:0.9035	.	.	.	.	.	-1	.	.	.	-	.	.	DYX1C1	53514550	1.000000	0.71417	0.997000	0.53966	0.930000	0.56654	6.815000	0.75242	0.867000	0.35654	-0.376000	0.06991	.	DYX1C1	-	-	ENSG00000256061		0.313	DYX1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYX1C1	HGNC	protein_coding	OTTHUMT00000254976.1	101	0.00	0	T	NM_130810	Intron	55727258	55727258	-1	no_errors	ENST00000321149	ensembl	human	known	69_37n	splice_site	45	40.79	31	SNP	0.997	C
EWSR1	2130	genome.wustl.edu	37	22	29670255	29670255	+	Intron	SNP	A	A	G			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr22:29670255A>G	ENST00000397938.2	+	4	545				EWSR1_ENST00000333395.6_Intron|EWSR1_ENST00000332035.6_Intron|EWSR1_ENST00000414183.2_Splice_Site_p.V76V|EWSR1_ENST00000332050.6_Intron|EWSR1_ENST00000406548.1_Intron|EWSR1_ENST00000331029.7_Intron	NM_001163285.1|NM_001163286.1|NM_005243.3|NM_013986.3	NP_001156757.1|NP_001156758.1|NP_005234.1|NP_053733.2	Q01844	EWS_HUMAN	EWS RNA-binding protein 1						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		EWSR1/ATF1(347)|EWSR1/POU5F1(10)|EWSR1/PBX1(3)|EWSR1/DDIT3(45)|EWSR1/FEV(11)|EWSR1/CREB1(44)|EWSR1/SMARCA5(2)|EWSR1/ETV4(6)|EWSR1/ERG(178)|EWSR1/ZNF384(4)|EWSR1/ETV1(7)|EWSR1/FLI1(2569)|EWSR1/NR4A3(146)|EWSR1/SP3(3)|EWSR1/PATZ1(2)|EWSR1/WT1(234)|EWSR1/NFATC2(9)	breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|liver(1)|lung(6)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						TTTCCACAGTAGAAGGGACCA	0.378			T	"""FLI1, ERG, ZNF278, NR4A3, FEV, ATF1, ETV1, ETV4, WT1, ZNF384, CREB1, POU5F1,  PBX1"""	"""Ewing sarcoma,  desmoplastic small round cell tumor , ALL, clear cell sarcoma, sarcoma, myoepithelioma"""																																	dbGAP		Dom	yes		22	22q12	2130	Ewing sarcoma breakpoint region 1 (EWS)		"""L, M"""	0													237.0	209.0	217.0					22																	29670255		1568	3582	5150	-	-	-	SO:0001627	intron_variant	0				CCDS13851.1, CCDS13852.1, CCDS13852.2, CCDS54512.1, CCDS54513.1, CCDS54514.1	22q12.2	2013-05-24	2013-05-24		ENSG00000182944	ENSG00000182944		"""RNA binding motif (RRM) containing"""	3508	protein-coding gene	gene with protein product		133450	"""Ewing sarcoma breakpoint region 1"""			1522903	Standard	NM_005243		Approved	EWS	uc003aev.3	Q01844	OTTHUMG00000151107	ENST00000397938.2:c.226+402A>G	22.37:g.29670255A>G			B0QYK1|Q5THL0|Q92635|Q96FE8|Q96MN4|Q96MX4|Q9BWA2	Splice_Site	SNP	-	e5-2	ENST00000397938.2	37	c.230-2	CCDS13851.1	22	.	.	.	.	.	.	.	.	.	.	A	16.05	3.013130	0.54468	.	.	ENSG00000182944	ENST00000447973	.	.	.	4.94	4.94	0.65067	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.7629	0.40543	0.9193:0.0:0.0807:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	EWSR1	28000255	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.181000	0.50903	2.199000	0.70637	0.533000	0.62120	.	EWSR1	-	-	ENSG00000182944		0.378	EWSR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	EWSR1	HGNC	protein_coding	OTTHUMT00000321345.1	197	0.00	0	A	NM_005243		29670255	29670255	+1	no_stop_codon	ENST00000447973	ensembl	human	putative	69_37n	splice_site	216	28.95	88	SNP	1.000	G
FAM186A	121006	genome.wustl.edu	37	12	50748233	50748233	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr12:50748233C>A	ENST00000327337.5	-	4	2381	c.2382G>T	c.(2380-2382)atG>atT	p.M794I	FAM186A_ENST00000543111.1_Missense_Mutation_p.M794I	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	794																	CAGCCAAGATCATTTGTATTA	0.373																																					NSCLC(138;1796 1887 12511 19463 37884)	dbGAP											0													130.0	103.0	111.0					12																	50748233		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.2382G>T	12.37:g.50748233C>A	ENSP00000329995:p.Met794Ile			Missense_Mutation	SNP	NULL	p.M794I	ENST00000327337.5	37	c.2382	CCDS44878.1	12	.	.	.	.	.	.	.	.	.	.	C	12.23	1.876944	0.33162	.	.	ENSG00000185958	ENST00000543111;ENST00000327337	T;T	0.10860	2.83;2.83	4.4	2.55	0.30701	.	.	.	.	.	T	0.07234	0.0183	L	0.27053	0.805	0.20563	N	0.999886	P;B	0.43287	0.802;0.058	B;B	0.37989	0.262;0.026	T	0.30736	-0.9968	9	0.30854	T	0.27	.	8.2425	0.31669	0.1561:0.7587:0.0:0.0851	.	794;794	F5GYN0;A6NE01	.;F186A_HUMAN	I	794	ENSP00000441337:M794I;ENSP00000329995:M794I	ENSP00000329995:M794I	M	-	3	0	FAM186A	49034500	0.007000	0.16637	0.003000	0.11579	0.484000	0.33280	0.355000	0.20163	0.598000	0.29829	0.491000	0.48974	ATG	FAM186A	-	NULL	ENSG00000185958		0.373	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM186A	HGNC	protein_coding	OTTHUMT00000396838.1	148	0.00	0	C	XM_001718353		50748233	50748233	-1	no_errors	ENST00000327337	ensembl	human	known	69_37n	missense	77	25.96	27	SNP	0.003	A
SPATA31A6	389730	genome.wustl.edu	37	9	43626815	43626815	+	Silent	SNP	G	G	A			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr9:43626815G>A	ENST00000332857.6	-	4	1900	c.1872C>T	c.(1870-1872)gaC>gaT	p.D624D	SPATA31A6_ENST00000496386.1_5'Flank	NM_001145196.1	NP_001138668.1	Q5VVP1	S31A6_HUMAN	SPATA31 subfamily A, member 6	624					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CTGGTGATTCGTCCCGAAGCT	0.547																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0				CCDS75837.1	9p11.2	2012-10-15	2012-10-12	2012-10-12	ENSG00000185775	ENSG00000185775			32006	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A6"""	FAM75A6		20850414	Standard	NM_001145196		Approved	OTTHUMG00000013224	uc011lrb.2	Q5VVP1	OTTHUMG00000013224	ENST00000332857.6:c.1872C>T	9.37:g.43626815G>A				Silent	SNP	NULL	p.D624	ENST00000332857.6	37	c.1872	CCDS47973.1	9																																																																																			FAM75A6	-	NULL	ENSG00000185775		0.547	SPATA31A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM75A6	HGNC	protein_coding	OTTHUMT00000036987.1	43	0.00	0	G	NM_001145196		43626815	43626815	-1	no_errors	ENST00000332857	ensembl	human	known	69_37n	silent	32	11.11	4	SNP	0.000	A
FAM83F	113828	genome.wustl.edu	37	22	40417461	40417461	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr22:40417461C>T	ENST00000333407.6	+	4	1041	c.947C>T	c.(946-948)tCc>tTc	p.S316F	FAM83F_ENST00000473717.1_Missense_Mutation_p.S148F	NM_138435.2	NP_612444.2	Q8NEG4	FA83F_HUMAN	family with sequence similarity 83, member F	316										breast(1)|endometrium(2)|large_intestine(1)|lung(4)|skin(4)|urinary_tract(2)	14						CATTACTCCTCCACTGTGGCT	0.642																																						dbGAP											0													81.0	81.0	81.0					22																	40417461		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14000.2	22q13.1	2006-03-22			ENSG00000133477	ENSG00000133477			25148	protein-coding gene	gene with protein product						12477932	Standard	NM_138435		Approved		uc003ayk.1	Q8NEG4	OTTHUMG00000150688	ENST00000333407.6:c.947C>T	22.37:g.40417461C>T	ENSP00000330432:p.Ser316Phe		Q96FD6	Missense_Mutation	SNP	pfam_DUF1669	p.S316F	ENST00000333407.6	37	c.947	CCDS14000.2	22	.	.	.	.	.	.	.	.	.	.	C	16.42	3.119367	0.56505	.	.	ENSG00000133477	ENST00000333407	T	0.09723	2.95	4.79	3.76	0.43208	.	0.201780	0.35615	N	0.003085	T	0.12561	0.0305	L	0.36672	1.1	0.38664	D	0.952144	P	0.50272	0.933	P	0.44647	0.456	T	0.07309	-1.0779	10	0.66056	D	0.02	-30.2191	15.0389	0.71770	0.0:0.8571:0.1429:0.0	.	316	Q8NEG4	FA83F_HUMAN	F	316	ENSP00000330432:S316F	ENSP00000330432:S316F	S	+	2	0	FAM83F	38747407	.	.	1.000000	0.80357	0.637000	0.38172	.	.	1.215000	0.43411	0.561000	0.74099	TCC	FAM83F	-	NULL	ENSG00000133477		0.642	FAM83F-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM83F	HGNC	protein_coding	OTTHUMT00000319624.3	36	0.00	0	C	NM_138435		40417461	40417461	+1	no_errors	ENST00000333407	ensembl	human	known	69_37n	missense	31	41.51	22	SNP	1.000	T
FBXO15	201456	genome.wustl.edu	37	18	71740756	71740756	+	Silent	SNP	G	G	C			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr18:71740756G>C	ENST00000419743.2	-	10	1552	c.1473C>G	c.(1471-1473)gtC>gtG	p.V491V	FBXO15_ENST00000580806.1_5'UTR|FBXO15_ENST00000269500.5_Silent_p.V415V	NM_001142958.1	NP_001136430.1	Q8NCQ5	FBX15_HUMAN	F-box protein 15	491						SCF ubiquitin ligase complex (GO:0019005)				autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)	27		Esophageal squamous(42;0.103)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.143)		GGACCAGGTTGACAATAAGGT	0.418																																						dbGAP											0													214.0	209.0	211.0					18																	71740756		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK094215	CCDS45884.1	18q22.3	2006-03-09	2004-06-15		ENSG00000141665	ENSG00000141665		"""F-boxes /  ""other"""""	13617	protein-coding gene	gene with protein product		609093	"""F-box only protein 15"""			12665572	Standard	NM_152676		Approved	MGC39671, FBX15	uc002llf.2	Q8NCQ5	OTTHUMG00000132842	ENST00000419743.2:c.1473C>G	18.37:g.71740756G>C			B3KST3	Silent	SNP	pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like	p.V491	ENST00000419743.2	37	c.1473	CCDS45884.1	18																																																																																			FBXO15	-	NULL	ENSG00000141665		0.418	FBXO15-002	KNOWN	basic|CCDS	protein_coding	FBXO15	HGNC	protein_coding	OTTHUMT00000444223.1	205	0.96	2	G	NM_152676		71740756	71740756	-1	no_errors	ENST00000419743	ensembl	human	known	69_37n	silent	144	12.73	21	SNP	1.000	C
FLT4	2324	genome.wustl.edu	37	5	180046347	180046347	+	Silent	SNP	C	C	T			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr5:180046347C>T	ENST00000261937.6	-	19	2745	c.2667G>A	c.(2665-2667)gaG>gaA	p.E889E	FLT4_ENST00000393347.3_Silent_p.E889E|FLT4_ENST00000424276.2_5'Flank|FLT4_ENST00000502649.1_Silent_p.E889E	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	889	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GCGCGCGGTGCTCGCTGGCCG	0.697																																					Colon(97;1075 1466 27033 27547 35871)	dbGAP											0													38.0	35.0	36.0					5																	180046347		2199	4296	6495	-	-	-	SO:0001819	synonymous_variant	0			X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.2667G>A	5.37:g.180046347C>T			A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Tyr_kinase_VEGFR3_rcpt_N,prints_Tyr_kinase_VEGFR_rcpt_N	p.E889	ENST00000261937.6	37	c.2667	CCDS4457.1	5																																																																																			FLT4	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000037280		0.697	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLT4	HGNC	protein_coding	OTTHUMT00000253527.4	22	0.00	0	C			180046347	180046347	-1	no_errors	ENST00000261937	ensembl	human	known	69_37n	silent	0	100.00	5	SNP	1.000	T
FMNL1	752	genome.wustl.edu	37	17	43314962	43314962	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr17:43314962G>A	ENST00000331495.3	+	9	1186	c.850G>A	c.(850-852)Gga>Aga	p.G284R	CTD-2020K17.3_ENST00000393507.2_RNA|CTD-2020K17.3_ENST00000587534.1_RNA|FMNL1_ENST00000328118.3_Missense_Mutation_p.G284R|FMNL1_ENST00000592006.1_3'UTR	NM_005892.3	NP_005883	O95466	FMNL_HUMAN	formin-like 1	284	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament severing (GO:0051014)|cortical actin cytoskeleton organization (GO:0030866)|regulation of cell shape (GO:0008360)|substrate-dependent cell migration (GO:0006929)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|GTPase activating protein binding (GO:0032794)|Rac GTPase binding (GO:0048365)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(12)|pancreas(1)|skin(1)|urinary_tract(2)	33						CTTGGTGCGGGGAGGACATGA	0.587																																					GBM(164;1247 1997 8702 11086 51972)	dbGAP											0													147.0	137.0	140.0					17																	43314962		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ008112	CCDS11497.1	17q21.31	2008-05-14	2003-12-02	2003-12-03		ENSG00000184922			1212	protein-coding gene	gene with protein product		604656	"""formin-like"""	C17orf1B, FMNL		9799091	Standard	NM_005892		Approved	C17orf1	uc002iin.3	O95466		ENST00000331495.3:c.850G>A	17.37:g.43314962G>A	ENSP00000329219:p.Gly284Arg		D2DGW2|Q6DKG5|Q6IBP3|Q86UH1|Q8N671|Q8TDH1|Q96H10	Missense_Mutation	SNP	pfam_FH2_actin-bd,pfam_Drf_FH3,pfam_Drf_GTPase-bd,superfamily_FH2_actin-bd,superfamily_ARM-type_fold,smart_Actin-bd_FH2/DRF_autoreg	p.G284R	ENST00000331495.3	37	c.850	CCDS11497.1	17	.	.	.	.	.	.	.	.	.	.	G	20.3	3.964542	0.74131	.	.	ENSG00000184922	ENST00000328118;ENST00000331495	D;D	0.88046	-2.33;-2.33	3.93	3.93	0.45458	GTPase-binding/formin homology 3 (1);Diaphanous FH3 (1);Armadillo-type fold (1);	0.114476	0.64402	D	0.000016	D	0.93697	0.7986	M	0.86178	2.8	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94428	0.7647	10	0.62326	D	0.03	.	16.2101	0.82150	0.0:0.0:1.0:0.0	.	284	O95466	FMNL_HUMAN	R	284	ENSP00000327442:G284R;ENSP00000329219:G284R	ENSP00000327442:G284R	G	+	1	0	FMNL1	40670745	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.657000	0.98554	2.472000	0.83506	0.462000	0.41574	GGA	FMNL1	-	pfam_Drf_FH3,superfamily_ARM-type_fold	ENSG00000184922		0.587	FMNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMNL1	HGNC	protein_coding	OTTHUMT00000450198.1	84	0.00	0	G	NM_005892		43314962	43314962	+1	no_errors	ENST00000328118	ensembl	human	known	69_37n	missense	20	69.23	45	SNP	1.000	A
FNDC7	163479	genome.wustl.edu	37	1	109256138	109256138	+	Silent	SNP	T	T	G			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr1:109256138T>G	ENST00000370017.3	+	2	346	c.69T>G	c.(67-69)gcT>gcG	p.A23A	FNDC7_ENST00000271311.2_Silent_p.A24A	NM_001144937.1	NP_001138409.1	Q5VTL7	FNDC7_HUMAN	fibronectin type III domain containing 7	23						extracellular region (GO:0005576)				breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|skin(4)|stomach(1)|urinary_tract(1)	20		all_lung(203;0.00439)|Lung NSC(277;0.00683)|all_epithelial(167;0.00728)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.173)|all cancers(265;0.244)		TTCAGGTTGCTTCAGCAAAAT	0.328																																						dbGAP											0													288.0	220.0	240.0					1																	109256138		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS44185.1	1p13.3	2013-02-11			ENSG00000143107	ENSG00000143107		"""Fibronectin type III domain containing"""	26668	protein-coding gene	gene with protein product						12477932	Standard	NM_001144937		Approved	FLJ35838	uc001dvx.3	Q5VTL7	OTTHUMG00000011120	ENST00000370017.3:c.69T>G	1.37:g.109256138T>G			A1L468|E9PAZ5|Q6PF16|Q8NA51	Silent	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.A24	ENST00000370017.3	37	c.72	CCDS44185.1	1																																																																																			FNDC7	-	superfamily_Fibronectin_type3	ENSG00000143107		0.328	FNDC7-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FNDC7	HGNC	protein_coding	OTTHUMT00000030589.4	386	0.00	0	T	NM_173532		109256138	109256138	+1	no_errors	ENST00000271311	ensembl	human	known	69_37n	silent	503	12.06	69	SNP	1.000	G
FSTL5	56884	genome.wustl.edu	37	4	162307095	162307095	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr4:162307095T>C	ENST00000306100.5	-	16	2784	c.2348A>G	c.(2347-2349)aAg>aGg	p.K783R	FSTL5_ENST00000379164.4_Missense_Mutation_p.K782R|FSTL5_ENST00000427802.2_Missense_Mutation_p.K773R|RP11-234O6.2_ENST00000508189.1_RNA|FSTL5_ENST00000536695.1_Missense_Mutation_p.K782R	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	783						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		GAGTGGTTCCTTGAGACTCTT	0.468																																						dbGAP											0													192.0	174.0	180.0					4																	162307095		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.2348A>G	4.37:g.162307095T>C	ENSP00000305334:p.Lys783Arg		E9PCP6|Q9NSW7|Q9ULF7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Kazal-type_dom,pfam_Ig_V-set,pfam_Prot_inh_Kazal,smart_Prot_inh_Kazal,smart_Ig_sub,smart_Ig_sub2,pfscan_EF_HAND_2,pfscan_Ig-like	p.K783R	ENST00000306100.5	37	c.2348	CCDS3802.1	4	.	.	.	.	.	.	.	.	.	.	T	18.36	3.606690	0.66558	.	.	ENSG00000168843	ENST00000306100;ENST00000379164;ENST00000427802;ENST00000536695	T;T;T;T	0.28666	1.6;1.6;1.6;1.6	5.55	5.55	0.83447	.	0.092956	0.85682	D	0.000000	T	0.56906	0.2017	M	0.79693	2.465	0.58432	D	0.999999	D;D;D	0.71674	0.998;0.995;0.996	D;D;P	0.81914	0.995;0.921;0.899	T	0.57837	-0.7742	10	0.35671	T	0.21	.	14.8894	0.70597	0.0:0.0:0.0:1.0	.	773;782;783	E9PCP6;F8VZ90;Q8N475	.;.;FSTL5_HUMAN	R	783;782;773;782	ENSP00000305334:K783R;ENSP00000368462:K782R;ENSP00000389270:K773R;ENSP00000440409:K782R	ENSP00000305334:K783R	K	-	2	0	FSTL5	162526545	1.000000	0.71417	0.988000	0.46212	0.986000	0.74619	7.587000	0.82613	2.096000	0.63516	0.533000	0.62120	AAG	FSTL5	-	NULL	ENSG00000168843		0.468	FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FSTL5	HGNC	protein_coding	OTTHUMT00000364773.2	179	0.00	0	T	NM_020116		162307095	162307095	-1	no_errors	ENST00000306100	ensembl	human	known	69_37n	missense	102	24.44	33	SNP	1.000	C
GIGYF1	64599	genome.wustl.edu	37	7	100284335	100284337	+	In_Frame_Del	DEL	CCT	CCT	-			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	CCT	CCT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr7:100284335_100284337delCCT	ENST00000275732.5	-	7	1838_1840	c.629_631delAGG	c.(628-633)gagggc>ggc	p.E210del	GIGYF1_ENST00000471340.2_Intron	NM_022574.4	NP_072096.2	O75420	PERQ1_HUMAN	GRB10 interacting GYF protein 1	210	Poly-Glu.				insulin-like growth factor receptor signaling pathway (GO:0048009)			p.E210delE(1)		central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					CTCCAGCTGCcctcctcctcctc	0.7																																						dbGAP											1	Deletion - In frame(1)	large_intestine(1)								14,2,4238		0,0,14,0,2,2111						5.0	1.0			29	36,2,8190		0,0,36,0,2,4076	no	codingComplex	GIGYF1	NM_022574.4		0,0,50,0,4,6187	A1A1,A1A2,A1R,A2A2,A2R,RR		0.4618,0.3761,0.4326				50,4,12428				-	-	-	SO:0001651	inframe_deletion	0			AF053356	CCDS34708.1	7q22	2008-02-11	2008-02-11	2008-02-11	ENSG00000146830	ENSG00000146830			9126	protein-coding gene	gene with protein product	"""GYF domain containing 1"""	612064	"""PERQ amino acid rich, with GYF domain 1"""	PERQ1		9799793, 12771153	Standard	NM_022574		Approved	GYF1	uc003uwg.1	O75420	OTTHUMG00000157036	ENST00000275732.5:c.629_631delAGG	7.37:g.100284344_100284346delCCT	ENSP00000275732:p.Glu210del		Q6Y7W7|Q8WZ38	In_Frame_Del	DEL	pfam_GYF,superfamily_GYF,smart_GYF,pfscan_GYF	p.E210in_frame_del	ENST00000275732.5	37	c.631_629	CCDS34708.1	7																																																																																			GIGYF1	-	NULL	ENSG00000146830		0.700	GIGYF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIGYF1	HGNC	protein_coding	OTTHUMT00000347205.2	32	0.00	0	CCT	NM_022574		100284335	100284337	-1	no_errors	ENST00000275732	ensembl	human	known	69_37n	in_frame_del	10	16.67	2	DEL	1.000:0.992:0.999	-
GLIS3	169792	genome.wustl.edu	37	9	3856175	3856175	+	Silent	SNP	A	A	C			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr9:3856175A>C	ENST00000324333.10	-	8	2035	c.1842T>G	c.(1840-1842)ccT>ccG	p.P614P	GLIS3_ENST00000381971.3_Silent_p.P769P|GLIS3_ENST00000461870.1_5'UTR	NM_152629.3	NP_689842.3	Q8NEA6	GLIS3_HUMAN	GLIS family zinc finger 3	614					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(12)|lung(4)|ovary(2)|prostate(1)|skin(1)	26		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)		ATGGAGCAGAAGGTGCAAACC	0.468																																						dbGAP											0													80.0	75.0	77.0					9																	3856175		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC033899	CCDS6451.1, CCDS43784.1	9p24.2	2008-05-02	2004-07-16	2004-07-16	ENSG00000107249	ENSG00000107249		"""Zinc fingers, C2H2-type"""	28510	protein-coding gene	gene with protein product		610192	"""zinc finger protein 515"""	ZNF515		14500813	Standard	NM_152629		Approved	MGC33662	uc003zhx.1	Q8NEA6	OTTHUMG00000019463	ENST00000324333.10:c.1842T>G	9.37:g.3856175A>C			B1AL19|Q1PHK5	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P769	ENST00000324333.10	37	c.2307	CCDS6451.1	9																																																																																			GLIS3	-	NULL	ENSG00000107249		0.468	GLIS3-003	KNOWN	basic|CCDS	protein_coding	GLIS3	HGNC	protein_coding	OTTHUMT00000051559.1	133	0.00	0	A	NM_152629		3856175	3856175	-1	no_errors	ENST00000381971	ensembl	human	known	69_37n	silent	117	26.42	42	SNP	0.978	C
GP6	51206	genome.wustl.edu	37	19	55526258	55526258	+	3'UTR	SNP	C	C	G			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr19:55526258C>G	ENST00000417454.1	-	0	1078				GP6_ENST00000310373.3_Missense_Mutation_p.R352T|GP6_ENST00000333884.2_3'UTR|CTC-550B14.7_ENST00000586845.1_RNA|CTC-550B14.7_ENST00000593060.1_RNA	NM_016363.4	NP_057447	Q9HCN6	GPVI_HUMAN	glycoprotein VI (platelet)						blood coagulation (GO:0007596)|enzyme linked receptor protein signaling pathway (GO:0007167)|leukocyte migration (GO:0050900)|platelet activation (GO:0030168)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	collagen binding (GO:0005518)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19			BRCA - Breast invasive adenocarcinoma(297;0.156)	GBM - Glioblastoma multiforme(193;0.0515)		TGATCCCTCCCTTGGATACGA	0.607																																						dbGAP											0													57.0	63.0	61.0					19																	55526258		2183	4271	6454	-	-	-	SO:0001624	3_prime_UTR_variant	0			AB035073	CCDS42626.1, CCDS46184.1, CCDS58678.1	19q13.4	2013-01-29			ENSG00000088053	ENSG00000088053		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14388	protein-coding gene	gene with protein product		605546				11027634	Standard	NM_001083899		Approved	GPVI	uc002qil.3	Q9HCN6	OTTHUMG00000159709	ENST00000417454.1:c.*31G>C	19.37:g.55526258C>G			Q9HCN7|Q9UIF2	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2	p.R352T	ENST00000417454.1	37	c.1055	CCDS46184.1	19	.	.	.	.	.	.	.	.	.	.	C	10.08	1.253476	0.22965	.	.	ENSG00000088053	ENST00000310373	T	0.00561	6.59	2.65	-2.88	0.05682	.	.	.	.	.	T	0.00384	0.0012	.	.	.	0.09310	N	0.999996	B	0.23540	0.087	B	0.26517	0.07	T	0.45920	-0.9228	8	0.87932	D	0	.	1.1145	0.01711	0.3871:0.2895:0.1909:0.1325	.	352	Q9HCN6-3	.	T	352	ENSP00000308782:R352T	ENSP00000308782:R352T	R	-	2	0	GP6	60218070	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	0.012000	0.13287	-0.516000	0.06470	0.561000	0.74099	AGG	GP6	-	NULL	ENSG00000088053		0.607	GP6-001	KNOWN	basic|CCDS	protein_coding	GP6	HGNC	protein_coding	OTTHUMT00000357006.1	78	0.00	0	C			55526258	55526258	-1	no_errors	ENST00000310373	ensembl	human	known	69_37n	missense	37	25.49	13	SNP	0.000	G
GPR126	57211	genome.wustl.edu	37	6	142726951	142726951	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr6:142726951A>G	ENST00000230173.6	+	15	2730	c.2254A>G	c.(2254-2256)Act>Gct	p.T752A	GPR126_ENST00000296932.8_Missense_Mutation_p.T724A|GPR126_ENST00000367608.2_Missense_Mutation_p.T724A|GPR126_ENST00000367609.3_Missense_Mutation_p.T752A	NM_020455.5	NP_065188	Q86SQ4	GP126_HUMAN	G protein-coupled receptor 126	752					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(12)|lung(10)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36	Breast(32;0.176)			OV - Ovarian serous cystadenocarcinoma(155;9.33e-06)|GBM - Glioblastoma multiforme(68;0.00121)		CTTCAACAAAACTGGACTTTT	0.323																																						dbGAP											0													65.0	60.0	62.0					6																	142726951		1810	4076	5886	-	-	-	SO:0001583	missense	0			AK027843	CCDS47489.1, CCDS47490.1, CCDS47491.1, CCDS55064.1	6q23.1-q24.3	2014-08-08			ENSG00000112414	ENSG00000112414		"""-"", ""GPCR / Class B : Orphans"""	13841	protein-coding gene	gene with protein product		612243				12565841	Standard	NM_001032395		Approved	FLJ14937	uc010khe.3	Q86SQ4	OTTHUMG00000015709	ENST00000230173.6:c.2254A>G	6.37:g.142726951A>G	ENSP00000230173:p.Thr752Ala		Q5TGN7|Q6DHZ4|Q6F3F5|Q6F3F6|Q6F3F7|Q6F3F8|Q6MZU7|Q8IXA4|Q8NC14|Q96JW0	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_CUB,pfam_GPS_dom,pfam_Pentaxin,superfamily_CUB,superfamily_ConA-like_lec_gl,smart_CUB,smart_Pentaxin,smart_GPS_dom,pfscan_CUB,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.T752A	ENST00000230173.6	37	c.2254	CCDS47490.1	6	.	.	.	.	.	.	.	.	.	.	A	19.28	3.796417	0.70567	.	.	ENSG00000112414	ENST00000230173;ENST00000367608;ENST00000296932;ENST00000367609	T;T;T;T	0.25579	1.8;1.79;1.8;1.79	5.67	5.67	0.87782	.	0.088127	0.49305	D	0.000146	T	0.25865	0.0630	M	0.61703	1.905	0.39437	D	0.967183	D;D;D;P	0.54207	0.965;0.965;0.965;0.941	P;P;P;P	0.51516	0.539;0.539;0.672;0.472	T	0.08207	-1.0733	10	0.66056	D	0.02	.	11.0553	0.47913	0.8615:0.0:0.0:0.1385	.	724;752;724;752	Q86SQ4-4;Q86SQ4-3;Q86SQ4-2;Q86SQ4	.;.;.;GP126_HUMAN	A	752;724;724;752	ENSP00000230173:T752A;ENSP00000356580:T724A;ENSP00000296932:T724A;ENSP00000356581:T752A	ENSP00000230173:T752A	T	+	1	0	GPR126	142768644	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.795000	0.69074	2.139000	0.66308	0.533000	0.62120	ACT	GPR126	-	NULL	ENSG00000112414		0.323	GPR126-001	KNOWN	basic|CCDS	protein_coding	GPR126	HGNC	protein_coding	OTTHUMT00000042487.2	114	0.00	0	A			142726951	142726951	+1	no_errors	ENST00000367609	ensembl	human	known	69_37n	missense	32	64.04	57	SNP	1.000	G
GRID1	2894	genome.wustl.edu	37	10	88123716	88123717	+	Missense_Mutation	DNP	AT	AT	TA			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	A|T	A|T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr10:88123716_88123717AT>TA	ENST00000327946.7	-	2	301_302	c.216_217AT>TA	c.(214-219)ccATtc>ccTAtc	p.F73I		NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	73					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						ACAGCCTGGAATGGGTTGTTGG	0.624										Multiple Myeloma(13;0.14)																												dbGAP											0																																										-	-	-	SO:0001583	missense	0			AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.216_217delinsTA	10.37:g.88123716_88123717delinsTA	ENSP00000330148:p.Phe73Ile		B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation|Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.F73I|p.P72	ENST00000327946.7	37	c.217|c.216	CCDS31236.1	10																																																																																			GRID1	-	pfam_ANF_lig-bd_rcpt	ENSG00000182771		0.624	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID1	HGNC	protein_coding	OTTHUMT00000049148.3	143|144	0.00	0	A|T	XM_043613		88123716|88123717	88123716|88123717	-1	no_errors	ENST00000327946	ensembl	human	known	69_37n	missense|silent	46	33.33	23	SNP	1.000|0.996	T|A
HIST1H3I	8354	genome.wustl.edu	37	6	27840018	27840018	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr6:27840018C>G	ENST00000328488.2	-	1	81	c.76G>C	c.(76-78)Gct>Cct	p.A26P		NM_003533.2	NP_003524.1	P68431	H31_HUMAN	histone cluster 1, H3i	26					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			endometrium(2)|kidney(1)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						CTCTTGCGAGCCGCCTTGGTG	0.662																																						dbGAP											0													24.0	28.0	26.0					6																	27840018		2200	4298	6498	-	-	-	SO:0001583	missense	0			X83550	CCDS4636.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000182572	ENSG00000275379		"""Histones / Replication-dependent"""	4771	protein-coding gene	gene with protein product		602814	"""H3 histone family, member F"", ""histone 1, H3i"""	H3FF		9031620, 9439656, 12408966	Standard	NM_003533		Approved	H3/f, H3.f	uc003njy.3	P68431	OTTHUMG00000016184	ENST00000328488.2:c.76G>C	6.37:g.27840018C>G	ENSP00000329554:p.Ala26Pro		A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.A26P	ENST00000328488.2	37	c.76	CCDS4636.1	6	.	.	.	.	.	.	.	.	.	.	C	15.83	2.947626	0.53186	.	.	ENSG00000182572	ENST00000328488	T	0.47528	0.84	4.12	4.12	0.48240	.	.	.	.	.	T	0.58750	0.2144	.	.	.	0.45150	D	0.99816	.	.	.	.	.	.	T	0.64499	-0.6393	6	0.87932	D	0	.	16.6345	0.85043	0.0:1.0:0.0:0.0	.	.	.	.	P	26	ENSP00000329554:A26P	ENSP00000329554:A26P	A	-	1	0	HIST1H3I	27947997	1.000000	0.71417	0.996000	0.52242	0.707000	0.40811	7.292000	0.78731	2.580000	0.87095	0.650000	0.86243	GCT	HIST1H3I	-	superfamily_Histone-fold,prints_Histone_H3	ENSG00000182572		0.662	HIST1H3I-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H3I	HGNC	protein_coding	OTTHUMT00000043452.1	28	0.00	0	C	NM_003533		27840018	27840018	-1	no_errors	ENST00000328488	ensembl	human	known	69_37n	missense	25	18.75	6	SNP	1.000	G
HNRNPD	3184	genome.wustl.edu	37	4	83278494	83278495	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	TT	TT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr4:83278494_83278495delTT	ENST00000313899.7	-	5	1001_1002	c.724_725delAA	c.(724-726)aagfs	p.K243fs	HNRNPD_ENST00000508119.1_5'UTR|HNRNPD_ENST00000541060.1_Frame_Shift_Del_p.K89fs|HNRNPD_ENST00000543098.1_Frame_Shift_Del_p.K191fs|HNRNPD_ENST00000353341.4_Frame_Shift_Del_p.K243fs|HNRNPD_ENST00000352301.4_Frame_Shift_Del_p.K224fs	NM_031370.2	NP_112738.1	Q14103	HNRPD_HUMAN	heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa)	243	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				circadian regulation of translation (GO:0097167)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|regulation of circadian rhythm (GO:0042752)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|RNA catabolic process (GO:0006401)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|telomeric DNA binding (GO:0042162)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(1)	7						GTGGTATTTCTTTTCCATTATC	0.376																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF026126	CCDS3590.1, CCDS3591.1, CCDS3592.1	4q21	2013-02-12	2002-08-29	2008-04-18	ENSG00000138668	ENSG00000138668		"""RNA binding motif (RRM) containing"""	5036	protein-coding gene	gene with protein product		601324	"""heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA-binding protein 1, 37kD)"""	AUF1, HNRPD		9615222	Standard	NM_001003810		Approved		uc003hmm.1	Q14103	OTTHUMG00000130290	ENST00000313899.7:c.724_725delAA	4.37:g.83278496_83278497delTT	ENSP00000313199:p.Lys243fs		A8K9J2|P07029|Q01858|Q14100|Q14101|Q14102|Q4W5A1|Q9UCE8|Q9UCE9	Frame_Shift_Del	DEL	pfam_RRM_dom,pfam_CARG-binding_factor_N,smart_RRM_dom,pfscan_RRM_dom	p.K242fs	ENST00000313899.7	37	c.725_724	CCDS3592.1	4																																																																																			HNRNPD	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000138668		0.376	HNRNPD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HNRNPD	HGNC	protein_coding	OTTHUMT00000252630.2	287	0.00	0	TT	NM_031370		83278494	83278495	-1	no_errors	ENST00000313899	ensembl	human	known	69_37n	frame_shift_del	97	47.57	88	DEL	1.000:1.000	-
HNRNPD	3184	genome.wustl.edu	37	4	83278498	83278499	+	Nonsense_Mutation	DNP	CC	CC	AA			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr4:83278498_83278499CC>AA	ENST00000313899.7	-	5	997_998	c.720_721GG>TT	c.(718-723)atGGaa>atTTaa	p.240_241ME>I*	HNRNPD_ENST00000508119.1_5'UTR|HNRNPD_ENST00000541060.1_Nonsense_Mutation_p.86_87ME>I*|HNRNPD_ENST00000543098.1_Nonsense_Mutation_p.188_189ME>I*|HNRNPD_ENST00000353341.4_Nonsense_Mutation_p.240_241ME>I*|HNRNPD_ENST00000352301.4_Nonsense_Mutation_p.221_222ME>I*	NM_031370.2	NP_112738.1	Q14103	HNRPD_HUMAN	heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa)	240	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				circadian regulation of translation (GO:0097167)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|regulation of circadian rhythm (GO:0042752)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|RNA catabolic process (GO:0006401)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|telomeric DNA binding (GO:0042162)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(1)	7						TATTTCTTTTCCATTATCTTCT	0.376																																						dbGAP											0																																										-	-	-	SO:0001587	stop_gained	0			AF026126	CCDS3590.1, CCDS3591.1, CCDS3592.1	4q21	2013-02-12	2002-08-29	2008-04-18	ENSG00000138668	ENSG00000138668		"""RNA binding motif (RRM) containing"""	5036	protein-coding gene	gene with protein product		601324	"""heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA-binding protein 1, 37kD)"""	AUF1, HNRPD		9615222	Standard	NM_001003810		Approved		uc003hmm.1	Q14103	OTTHUMG00000130290	ENST00000313899.7:c.720_721delinsAA	4.37:g.83278498_83278499delinsAA	ENSP00000313199:p.M240_E241delinsI*		A8K9J2|P07029|Q01858|Q14100|Q14101|Q14102|Q4W5A1|Q9UCE8|Q9UCE9	Nonsense_Mutation	SNP	pfam_RRM_dom,pfam_CARG-binding_factor_N,smart_RRM_dom,pfscan_RRM_dom|pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.E241*|p.G144*	ENST00000313899.7	37	c.721|c.430	CCDS3592.1	4																																																																																			HNRNPD	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000138668		0.376	HNRNPD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HNRNPD	HGNC	protein_coding	OTTHUMT00000252630.2	279|276	0.36|0.00	1|0	C	NM_031370		83278498|83278499	83278498|83278499	-1	no_errors|no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000313899|ENST00000514671	ensembl	human	known	69_37n	nonsense	72|73	57.89|56.14	99|96	SNP	1.000	A
HS6ST1	9394	genome.wustl.edu	37	2	129075877	129075877	+	Missense_Mutation	SNP	G	G	T	rs200979099		TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr2:129075877G>T	ENST00000259241.6	-	1	274	c.261C>A	c.(259-261)gaC>gaA	p.D87E	HS6ST1_ENST00000494089.1_5'UTR	NM_004807.2	NP_004798.3	O60243	H6ST1_HUMAN	heparan sulfate 6-O-sulfotransferase 1	87					angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|labyrinthine layer blood vessel development (GO:0060716)|lung alveolus development (GO:0048286)|neuron development (GO:0048666)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)|sulfotransferase activity (GO:0008146)			endometrium(3)|liver(1)|lung(7)|pancreas(1)|prostate(2)|skin(1)	15	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.117)		AGACGATCACGTCGTCGCCCT	0.657																																						dbGAP											0													10.0	16.0	14.0					2																	129075877		1658	4004	5662	-	-	-	SO:0001583	missense	0			AB006179	CCDS42748.1	2q21	2010-03-19		2002-08-23	ENSG00000136720	ENSG00000136720		"""Sulfotransferases, membrane-bound"""	5201	protein-coding gene	gene with protein product		604846		HS6ST		9535912	Standard	NM_004807		Approved		uc002tpt.4	O60243	OTTHUMG00000153542	ENST00000259241.6:c.261C>A	2.37:g.129075877G>T	ENSP00000259241:p.Asp87Glu		B4DEP2|B4DJ29|Q53SL2|Q9BVI1	Missense_Mutation	SNP	pfam_Sulfotransferase	p.D87E	ENST00000259241.6	37	c.261	CCDS42748.1	2	.	.	.	.	.	.	.	.	.	.	g	21.7	4.181914	0.78677	.	.	ENSG00000136720	ENST00000259241	T	0.74947	-0.89	3.69	2.78	0.32641	.	0.000000	0.85682	U	0.000000	D	0.84924	0.5580	M	0.88031	2.925	0.80722	D	1	D	0.69078	0.997	D	0.78314	0.991	D	0.84908	0.0846	9	.	.	.	.	6.5213	0.22277	0.2434:0.0:0.7566:0.0	.	87	O60243	H6ST1_HUMAN	E	87	ENSP00000259241:D87E	.	D	-	3	2	HS6ST1	128792347	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	1.938000	0.40203	1.600000	0.50102	0.313000	0.20887	GAC	HS6ST1	-	pfam_Sulfotransferase	ENSG00000136720		0.657	HS6ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS6ST1	HGNC	protein_coding	OTTHUMT00000331572.1	17	0.00	0	G	NM_004807		129075877	129075877	-1	no_errors	ENST00000259241	ensembl	human	known	69_37n	missense	14	30.00	6	SNP	1.000	T
IGSF1	3547	genome.wustl.edu	37	X	130416483	130416483	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chrX:130416483T>C	ENST00000361420.3	-	7	1260	c.1181A>G	c.(1180-1182)tAt>tGt	p.Y394C	IGSF1_ENST00000370910.1_Missense_Mutation_p.Y385C|IGSF1_ENST00000370903.3_Missense_Mutation_p.Y394C|IGSF1_ENST00000370904.1_Missense_Mutation_p.Y385C			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	394	Ig-like C2-type 4.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						GGTGAGAAGATAGTGGCAGCT	0.418																																						dbGAP											0													131.0	105.0	114.0					X																	130416483		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.1181A>G	X.37:g.130416483T>C	ENSP00000355010:p.Tyr394Cys		B5MEG2|H9KV64|O15070|Q9NTC8	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.Y394C	ENST00000361420.3	37	c.1181	CCDS14629.1	X	.	.	.	.	.	.	.	.	.	.	T	7.504	0.653199	0.14580	.	.	ENSG00000147255	ENST00000370910;ENST00000361420;ENST00000370904;ENST00000370903	T;T;T;T	0.13196	2.61;2.61;2.61;2.61	3.91	0.188	0.15114	Immunoglobulin subtype 2 (1);Immunoglobulin-like fold (1);	0.863945	0.09863	N	0.745982	T	0.34019	0.0883	M	0.82056	2.57	0.09310	N	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.988;0.997	T	0.10567	-1.0624	10	0.59425	D	0.04	.	5.7806	0.18304	0.0:0.3741:0.0:0.6259	.	385;394	Q8N6C5-2;Q8N6C5	.;IGSF1_HUMAN	C	385;394;385;394	ENSP00000359947:Y385C;ENSP00000355010:Y394C;ENSP00000359941:Y385C;ENSP00000359940:Y394C	ENSP00000355010:Y394C	Y	-	2	0	IGSF1	130244164	0.968000	0.33430	0.001000	0.08648	0.159000	0.22180	0.341000	0.19909	-0.062000	0.13088	0.481000	0.45027	TAT	IGSF1	-	smart_Ig_sub,smart_Ig_sub2	ENSG00000147255		0.418	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGSF1	HGNC	protein_coding	OTTHUMT00000058288.1	160	0.00	0	T			130416483	130416483	-1	no_errors	ENST00000370903	ensembl	human	known	69_37n	missense	47	58.41	66	SNP	0.002	C
IL1RAP	3556	genome.wustl.edu	37	3	190321988	190321988	+	Nonsense_Mutation	SNP	A	A	T			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr3:190321988A>T	ENST00000412504.2	+	3	388	c.136A>T	c.(136-138)Aag>Tag	p.K46*	IL1RAP_ENST00000422940.1_Nonsense_Mutation_p.K46*|IL1RAP_ENST00000072516.3_Nonsense_Mutation_p.K46*|IL1RAP_ENST00000443369.2_Nonsense_Mutation_p.K46*|IL1RAP_ENST00000447382.1_Nonsense_Mutation_p.K46*|IL1RAP_ENST00000439062.1_Nonsense_Mutation_p.K46*|IL1RAP_ENST00000317757.3_Nonsense_Mutation_p.K46*|IL1RAP_ENST00000422485.1_Nonsense_Mutation_p.K46*|IL1RAP_ENST00000434491.1_Intron			Q9NPH3	IL1AP_HUMAN	interleukin 1 receptor accessory protein	46	Ig-like C2-type 1.				immune response (GO:0006955)|inflammatory response (GO:0006954)|interleukin-2 biosynthetic process (GO:0042094)|protein complex assembly (GO:0006461)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20	all_cancers(143;3.61e-10)|Ovarian(172;0.0733)|Breast(254;0.21)		Lung(62;1.95e-06)|LUSC - Lung squamous cell carcinoma(58;2.05e-06)	GBM - Glioblastoma multiforme(93;0.00851)		AGCTCGCATCAAGTGCCCACT	0.483																																						dbGAP											0													110.0	100.0	103.0					3																	190321988		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB006537	CCDS3298.1, CCDS46982.1, CCDS54696.1	3q28	2013-01-11			ENSG00000196083	ENSG00000196083		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5995	protein-coding gene	gene with protein product		602626				9479509, 9065432	Standard	NM_002182		Approved	IL-1RAcP, IL1R3, C3orf13	uc003fsq.3	Q9NPH3	OTTHUMG00000156211	ENST00000412504.2:c.136A>T	3.37:g.190321988A>T	ENSP00000412053:p.Lys46*		B1NLD0|D3DNW0|O14915|Q86WJ7	Nonsense_Mutation	SNP	pfam_TIR_dom,superfamily_TIR_dom,smart_Ig_sub,smart_TIR_dom,pfscan_TIR_dom,pfscan_Ig-like,prints_IL1_rcpt_1,prints_IL1_rcpt_I/II	p.K46*	ENST00000412504.2	37	c.136	CCDS3298.1	3	.	.	.	.	.	.	.	.	.	.	A	23.0	4.362276	0.82353	.	.	ENSG00000196083	ENST00000072516;ENST00000443369;ENST00000412504;ENST00000439062;ENST00000447382;ENST00000422625;ENST00000422485;ENST00000422940;ENST00000317757;ENST00000453359	.	.	.	5.61	1.52	0.23074	.	0.421051	0.25642	N	0.029269	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.9652	0.58480	0.6204:0.3796:0.0:0.0	.	.	.	.	X	46	.	ENSP00000072516:K46X	K	+	1	0	IL1RAP	191804682	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	4.383000	0.59600	0.457000	0.26962	0.533000	0.62120	AAG	IL1RAP	-	smart_Ig_sub,prints_IL1_rcpt_I/II	ENSG00000196083		0.483	IL1RAP-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	IL1RAP	HGNC	protein_coding	OTTHUMT00000343497.1	116	0.85	1	A			190321988	190321988	+1	no_errors	ENST00000443369	ensembl	human	known	69_37n	nonsense	86	31.20	39	SNP	1.000	T
IMMT	10989	genome.wustl.edu	37	2	86400803	86400803	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr2:86400803G>C	ENST00000410111.3	-	4	778	c.391C>G	c.(391-393)Caa>Gaa	p.Q131E	IMMT_ENST00000442664.2_Missense_Mutation_p.Q131E|IMMT_ENST00000490238.1_5'Flank|IMMT_ENST00000409051.2_Missense_Mutation_p.Q131E|IMMT_ENST00000254636.5_Missense_Mutation_p.Q44E|IMMT_ENST00000449247.2_Missense_Mutation_p.Q131E	NM_001100169.1|NM_001100170.1|NM_006839.2	NP_001093639.1|NP_001093640.1|NP_006830.2	Q16891	MIC60_HUMAN	inner membrane protein, mitochondrial	131					mitochondrial calcium ion homeostasis (GO:0051560)|response to cold (GO:0009409)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						TCTCCCTTTTGTTTTTGGAGT	0.323																																						dbGAP											0													145.0	118.0	127.0					2																	86400803		1826	4078	5904	-	-	-	SO:0001583	missense	0			D21094	CCDS46355.1, CCDS46356.1, CCDS46357.1	2p11.2	2011-10-04	2010-04-29		ENSG00000132305	ENSG00000132305			6047	protein-coding gene	gene with protein product	"""mitofilin"", ""mitochondrial inner membrane organizing system 2"""	600378	"""inner membrane protein, mitochondrial (mitofilin)"""			9168817, 8039717	Standard	NM_001100169		Approved	P87, P89, HMP, MINOS2	uc002sqz.4	Q16891	OTTHUMG00000153170	ENST00000410111.3:c.391C>G	2.37:g.86400803G>C	ENSP00000387262:p.Gln131Glu		B1H0U5|B2R5N6|Q14539|Q15092|Q68D41|Q69HW5|Q6IBL0|Q7Z3X1|Q8TAJ5|Q9P0V2	Missense_Mutation	SNP	pfam_Mt-IM_prot_Mitofilin	p.Q131E	ENST00000410111.3	37	c.391	CCDS46355.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	1.615|1.615	-0.522891|-0.522891	0.04141|0.04141	.|.	.|.	ENSG00000132305|ENSG00000132305	ENST00000254636;ENST00000449247;ENST00000410111;ENST00000442664;ENST00000409051;ENST00000545283;ENST00000377310;ENST00000398211;ENST00000409715|ENST00000419070	T;T;T;T;T|.	0.28454|.	1.61;1.61;1.61;1.61;1.61|.	4.86|4.86	2.84|2.84	0.33178|0.33178	.|.	1.383890|.	0.04298|.	N|.	0.346852|.	T|T	0.10423|0.10423	0.0255|0.0255	N|N	0.01874|0.01874	-0.695|-0.695	0.09310|0.09310	N|N	0.999999|0.999999	B;B;B;B;B;B;B;B;B|.	0.06786|.	0.0;0.0;0.0;0.001;0.001;0.0;0.0;0.0;0.0|.	B;B;B;B;B;B;B;B;B|.	0.13407|.	0.001;0.001;0.002;0.005;0.009;0.001;0.001;0.001;0.002|.	T|T	0.28170|0.28170	-1.0052|-1.0052	10|5	0.02654|.	T|.	1|.	0.4355|0.4355	7.7558|7.7558	0.28923|0.28923	0.0:0.1328:0.358:0.5092|0.0:0.1328:0.358:0.5092	.|.	131;131;131;131;131;131;131;131;131|.	F5GZ32;B9A067;B4DKR1;Q05DN3;B4E2B5;F8W9I1;Q16891-2;Q16891-3;Q16891|.	.;.;.;.;.;.;.;.;IMMT_HUMAN|.	E|R	44;131;131;131;131;131;131;131;131|28	ENSP00000254636:Q44E;ENSP00000396899:Q131E;ENSP00000387262:Q131E;ENSP00000407788:Q131E;ENSP00000387227:Q131E|.	ENSP00000254636:Q44E|.	Q|T	-|-	1|2	0|0	IMMT|IMMT	86254314|86254314	0.012000|0.012000	0.17670|0.17670	0.828000|0.828000	0.32881|0.32881	0.826000|0.826000	0.46750|0.46750	0.651000|0.651000	0.24873|0.24873	0.976000|0.976000	0.38417|0.38417	0.561000|0.561000	0.74099|0.74099	CAA|ACA	IMMT	-	pfam_Mt-IM_prot_Mitofilin	ENSG00000132305		0.323	IMMT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IMMT	HGNC	protein_coding	OTTHUMT00000329909.2	465	0.00	0	G	NM_006839		86400803	86400803	-1	no_errors	ENST00000410111	ensembl	human	known	69_37n	missense	265	25.49	91	SNP	0.417	C
ITPKC	80271	genome.wustl.edu	37	19	41231346	41231346	+	Splice_Site	SNP	T	T	G			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr19:41231346T>G	ENST00000263370.2	+	2	1288		c.e2+2			NM_025194.2	NP_079470.1	Q96DU7	IP3KC_HUMAN	inositol-trisphosphate 3-kinase C						inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)	14			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			GACATGCTGGTAAGTGGGGTG	0.532																																						dbGAP											0													109.0	102.0	104.0					19																	41231346		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			Y11999	CCDS12563.1	19q13.1	2011-04-28	2011-04-28		ENSG00000086544	ENSG00000086544	2.7.1.127		14897	protein-coding gene	gene with protein product		606476	"""inositol 1,4,5-trisphosphate 3-kinase C"""			11085927	Standard	NM_025194		Approved	IP3KC, IP3-3KC	uc002oot.3	Q96DU7		ENST00000263370.2:c.1255+2T>G	19.37:g.41231346T>G			Q9UE25|Q9Y475	Splice_Site	SNP	-	e2+2	ENST00000263370.2	37	c.1255+2	CCDS12563.1	19	.	.	.	.	.	.	.	.	.	.	T	12.92	2.081386	0.36758	.	.	ENSG00000086544	ENST00000263370	.	.	.	5.92	4.89	0.63831	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.3761	0.55281	0.0:0.0:0.1412:0.8588	.	.	.	.	.	-1	.	.	.	+	.	.	ITPKC	45923186	1.000000	0.71417	0.984000	0.44739	0.166000	0.22503	7.947000	0.87758	1.037000	0.40024	0.533000	0.62120	.	ITPKC	-	-	ENSG00000086544		0.532	ITPKC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPKC	HGNC	protein_coding	OTTHUMT00000463104.1	82	0.00	0	T	NM_025194	Intron	41231346	41231346	+1	no_errors	ENST00000263370	ensembl	human	known	69_37n	splice_site	72	19.10	17	SNP	1.000	G
KCNT1	57582	genome.wustl.edu	37	9	138669336	138669336	+	Silent	SNP	C	C	T	rs139958448		TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr9:138669336C>T	ENST00000263604.3	+	21	2445	c.2445C>T	c.(2443-2445)atC>atT	p.I815I	KCNT1_ENST00000491806.2_Silent_p.I801I|KCNT1_ENST00000371757.2_Silent_p.I834I|KCNT1_ENST00000487664.1_Silent_p.I789I|KCNT1_ENST00000488444.2_Silent_p.I815I|KCNT1_ENST00000486577.2_Silent_p.I793I|KCNT1_ENST00000298480.5_Silent_p.I834I|KCNT1_ENST00000490355.2_Silent_p.I813I			Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	815					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		TGAACCCCATCGTGCTGCTGC	0.652													C|||	1	0.000199681	0.0008	0.0	5008	,	,		12575	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													65.0	55.0	59.0					9																	138669336		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB037843	CCDS35175.1, CCDS35175.2, CCDS65188.1	9q34.3	2012-07-05			ENSG00000107147	ENSG00000107147		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18865	protein-coding gene	gene with protein product		608167				10718198, 16382103	Standard	NM_020822		Approved	KCa4.1, KIAA1422	uc011mdq.2	Q5JUK3	OTTHUMG00000020917	ENST00000263604.3:c.2445C>T	9.37:g.138669336C>T			B3KXF7|B7ZVY4|B9EGP2|G5E9V0|Q9P2C5	Silent	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_Ion_trans_2	p.I834	ENST00000263604.3	37	c.2502		9																																																																																			KCNT1	-	NULL	ENSG00000107147		0.652	KCNT1-201	KNOWN	basic|appris_candidate	protein_coding	KCNT1	HGNC	protein_coding		28	0.00	0	C	NM_020822		138669336	138669336	+1	no_errors	ENST00000298480	ensembl	human	known	69_37n	silent	11	38.89	7	SNP	0.298	T
LNX1	84708	genome.wustl.edu	37	4	54374205	54374205	+	Silent	SNP	G	G	A			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr4:54374205G>A	ENST00000263925.7	-	3	884	c.570C>T	c.(568-570)gaC>gaT	p.D190D	LNX1_ENST00000306888.2_Silent_p.D94D|LNX1-AS1_ENST00000511989.1_RNA|LNX1-AS1_ENST00000510785.1_RNA|FIP1L1_ENST00000507166.1_Intron|LNX1-AS1_ENST00000514364.1_RNA	NM_001126328.2	NP_001119800.1	Q8TBB1	LNX1_HUMAN	ligand of numb-protein X 1, E3 ubiquitin protein ligase	190	Interaction with MAGEB18.				protein homooligomerization (GO:0051260)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|endometrium(3)|large_intestine(11)|lung(6)|ovary(3)|urinary_tract(4)	32	all_neural(26;0.153)		GBM - Glioblastoma multiforme(3;8.2e-46)|LUSC - Lung squamous cell carcinoma(32;0.0134)			CTGGCTGCCCGTCCTCTGCCG	0.612																																						dbGAP											0													26.0	25.0	25.0					4																	54374205		2197	4293	6490	-	-	-	SO:0001819	synonymous_variant	0			AF237782	CCDS3492.1, CCDS47057.1	4q12	2013-01-09	2012-02-23	2005-11-04	ENSG00000072201	ENSG00000072201		"""RING-type (C3HC4) zinc fingers"""	6657	protein-coding gene	gene with protein product		609732	"""ligand of numb-protein X"", ""ligand of numb-protein X 1"""	LNX		11521506, 11782429	Standard	NM_032622		Approved	MPDZ, PDZRN2	uc003hag.5	Q8TBB1	OTTHUMG00000102099	ENST00000263925.7:c.570C>T	4.37:g.54374205G>A			Q4W5K7|Q8N4C2|Q96MJ7|Q9BY20	Silent	SNP	pfam_PDZ,superfamily_PDZ,smart_Znf_RING,smart_PDZ,pfscan_PDZ,pfscan_Znf_RING	p.D190	ENST00000263925.7	37	c.570	CCDS47057.1	4																																																																																			LNX1	-	NULL	ENSG00000072201		0.612	LNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LNX1	HGNC	protein_coding	OTTHUMT00000219934.2	32	0.00	0	G			54374205	54374205	-1	no_errors	ENST00000263925	ensembl	human	known	69_37n	silent	19	45.71	16	SNP	0.250	A
LTN1	26046	genome.wustl.edu	37	21	30331787	30331787	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr21:30331787A>C	ENST00000361371.5	-	13	2665	c.2586T>G	c.(2584-2586)caT>caG	p.H862Q	LTN1_ENST00000389194.2_Missense_Mutation_p.H908Q			O94822	LTN1_HUMAN	listerin E3 ubiquitin protein ligase 1	862					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(19)|ovary(5)|pancreas(1)|prostate(2)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)	60						TACCTGGCAAATGTGTTTTTT	0.383																																						dbGAP											0													102.0	105.0	104.0					21																	30331787		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001915	CCDS33527.1, CCDS33527.2	21q21.3	2013-01-09	2010-09-17	2010-09-17	ENSG00000198862	ENSG00000198862		"""RING-type (C3HC4) zinc fingers"""	13082	protein-coding gene	gene with protein product	"""listerin"""	613083	"""chromosome 21 open reading frame 98"", ""zinc finger protein 294"", ""ring finger protein 160"""	C21orf98, C21orf10, ZNF294, RNF160		20835226, 19196968	Standard	NM_015565		Approved	KIAA0714, FLJ11053, LISTERIN	uc002ymr.2	O94822	OTTHUMG00000078803	ENST00000361371.5:c.2586T>G	21.37:g.30331787A>C	ENSP00000354977:p.His862Gln		A6NL41|A7E2D0|B2RTS0|C9J7U3|J3KPL4|Q05C47|Q9H8M4|Q9NUY5|Q9P0E9	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,superfamily_ARM-type_fold,smart_Znf_RING-CH,pfscan_Znf_RING	p.H862Q	ENST00000361371.5	37	c.2586		21	.	.	.	.	.	.	.	.	.	.	A	12.86	2.064707	0.36470	.	.	ENSG00000198862	ENST00000389194;ENST00000361371	T;T	0.16597	2.33;2.34	5.55	-1.5	0.08691	.	0.188657	0.46442	D	0.000299	T	0.10895	0.0266	L	0.32530	0.975	0.28786	N	0.899566	P	0.39216	0.664	B	0.32864	0.154	T	0.12941	-1.0528	10	0.54805	T	0.06	.	13.2535	0.60066	0.448:0.0:0.552:0.0	.	862	O94822	LTN1_HUMAN	Q	908;862	ENSP00000373846:H908Q;ENSP00000354977:H862Q	ENSP00000354977:H862Q	H	-	3	2	LTN1	29253658	1.000000	0.71417	0.915000	0.36163	0.996000	0.88848	0.919000	0.28692	-0.128000	0.11641	0.533000	0.62120	CAT	LTN1	-	NULL	ENSG00000198862		0.383	LTN1-008	NOVEL	basic|appris_principal	protein_coding	LTN1	HGNC	protein_coding	OTTHUMT00000472108.1	58	0.00	0	A	NM_015565		30331787	30331787	-1	no_errors	ENST00000361371	ensembl	human	known	69_37n	missense	63	22.22	18	SNP	0.406	C
MED25	81857	genome.wustl.edu	37	19	50333113	50333113	+	Frame_Shift_Del	DEL	C	C	-			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr19:50333113delC	ENST00000312865.6	+	6	649	c.596delC	c.(595-597)gccfs	p.A199fs	MED25_ENST00000538643.1_Intron	NM_030973.3	NP_112235.2	Q71SY5	MED25_HUMAN	mediator complex subunit 25	199	Interaction with the Mediator complex.				cell death (GO:0008219)|gene expression (GO:0010467)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of chromatin binding (GO:0035563)|positive regulation of mediator complex assembly (GO:2001178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|transcription factor binding (GO:0008134)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|stomach(1)|urinary_tract(1)	17		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00822)|GBM - Glioblastoma multiforme(134;0.0122)		GAGAAGGCAGCCCCCCCGGCC	0.657																																					GBM(51;894 1657 37868)	dbGAP											0										26,24,4204		0,0,26,2,20,2079	16.0	17.0	17.0			5.5	0.4	19		17	31,33,8184		0,0,31,4,25,4064	no	codingComplex	MED25	NM_030973.3		0,0,57,6,45,6143	A1A1,A1A2,A1R,A2A2,A2R,RR		0.7759,1.1754,0.9119			50333113	57,57,12388	2203	4299	6502	-	-	-	SO:0001589	frameshift_variant	0			AL136746	CCDS33075.1	19q13.3	2014-09-17	2007-07-30			ENSG00000104973			28845	protein-coding gene	gene with protein product		610197	"""mediator of RNA polymerase II transcription, subunit 25 homolog (S. cerevisiae)"""			9110174, 11230166	Standard	NM_030973		Approved	ARC92, ACID1, TCBAP0758, DKFZp434K0512	uc002ppw.2	Q71SY5		ENST00000312865.6:c.596delC	19.37:g.50333113delC	ENSP00000326767:p.Ala199fs		A8K095|B9TX30|O95783|Q6P143|Q6QMH5|Q707U4|Q8TB55|Q9H0L5|Q9HB34	Frame_Shift_Del	DEL	pfam_Mediator_Med25_VWA,pfam_Mediator_Med25,pfam_Mediator_Med25_SD1,pfam_Mediator_Med25_NR-box	p.P201fs	ENST00000312865.6	37	c.596	CCDS33075.1	19																																																																																			MED25	-	pfam_Mediator_Med25_VWA	ENSG00000104973		0.657	MED25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED25	HGNC	protein_coding	OTTHUMT00000465316.1	23	0.00	0	C	NM_030973		50333113	50333113	+1	no_errors	ENST00000312865	ensembl	human	known	69_37n	frame_shift_del	14	12.50	2	DEL	0.380	-
HOXD3	3232	genome.wustl.edu	37	2	177015045	177015045	+	5'Flank	SNP	G	G	A	rs570521775		TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr2:177015045G>A	ENST00000468418.3	+	0	0				HOXD4_ENST00000306324.3_5'Flank|MIR10B_ENST00000385011.1_RNA			P31249	HXD3_HUMAN	homeobox D3						anterior/posterior pattern specification (GO:0009952)|cartilage development (GO:0051216)|cell-matrix adhesion (GO:0007160)|embryonic skeletal system morphogenesis (GO:0048704)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron differentiation (GO:0045666)|thyroid gland development (GO:0030878)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(11)|prostate(1)|upper_aerodigestive_tract(2)	23			OV - Ovarian serous cystadenocarcinoma(117;0.00569)|Epithelial(96;0.0864)|all cancers(119;0.226)	Colorectal(32;0.247)		AGGTTGTAACGTTGTCTATAT	0.507																																						dbGAP											0													68.0	62.0	64.0					2																	177015045		1568	3582	5150	-	-	-	SO:0001631	upstream_gene_variant	0				CCDS2270.1	2q31.1	2011-06-20	2005-12-22		ENSG00000128652	ENSG00000128652		"""Homeoboxes / ANTP class : HOXL subclass"""	5137	protein-coding gene	gene with protein product		142980	"""homeo box D3"""	HOX4A, HOX4, HOX1D		1973146, 1358459	Standard	NM_006898		Approved		uc002ukt.1	P31249	OTTHUMG00000132517		2.37:g.177015045G>A	Exception_encountered		Q99955|Q9BSC5	RNA	SNP	-	NULL	ENST00000468418.3	37	NULL	CCDS2270.1	2																																																																																			MIR10B	-	-	ENSG00000207744		0.507	HOXD3-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	MIR10B	HGNC	protein_coding	OTTHUMT00000334246.4	111	0.00	0	G			177015045	177015045	+1	no_errors	ENST00000385011	ensembl	human	known	69_37n	rna	83	10.75	10	SNP	1.000	A
MYO1A	4640	genome.wustl.edu	37	12	57441140	57441140	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr12:57441140T>C	ENST00000442789.2	-	6	664	c.377A>G	c.(376-378)gAg>gGg	p.E126G	MYO1A_ENST00000300119.3_Missense_Mutation_p.E126G|MYO1A_ENST00000544473.1_5'UTR	NM_001256041.1	NP_001242970.1	Q9UBC5	MYO1A_HUMAN	myosin IA	126	Myosin motor.				microvillus assembly (GO:0030033)|sensory perception of sound (GO:0007605)|vesicle localization (GO:0051648)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|brush border (GO:0005903)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|lateral plasma membrane (GO:0016328)|microvillus (GO:0005902)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(7)|urinary_tract(3)	50						GTTCACCTGCTCTCCTTTCCC	0.577																																						dbGAP											0													93.0	84.0	87.0					12																	57441140		2203	4300	6503	-	-	-	SO:0001583	missense	0			L29137	CCDS8929.1	12q13-q15	2011-09-27			ENSG00000166866	ENSG00000166866		"""Myosins / Myosin superfamily : Class I"""	7595	protein-coding gene	gene with protein product		601478		MYHL, DFNA48		8884266, 12736868	Standard	NM_001256041		Approved		uc009zpd.3	Q9UBC5	OTTHUMG00000149899	ENST00000442789.2:c.377A>G	12.37:g.57441140T>C	ENSP00000393392:p.Glu126Gly		Q9UQD7	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,pfam_IQ_motif_EF-hand-BS,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E126G	ENST00000442789.2	37	c.377	CCDS8929.1	12	.	.	.	.	.	.	.	.	.	.	T	15.52	2.857527	0.51376	.	.	ENSG00000166866	ENST00000300119;ENST00000442789	D;D	0.87650	-2.28;-2.28	5.19	3.96	0.45880	Myosin head, motor domain (2);	0.245199	0.41396	D	0.000898	D	0.85044	0.5607	N	0.25144	0.715	0.80722	D	1	D	0.61080	0.989	P	0.60236	0.871	D	0.83545	0.0098	10	0.38643	T	0.18	.	9.2575	0.37593	0.0:0.0:0.3058:0.6942	.	126	Q9UBC5	MYO1A_HUMAN	G	126	ENSP00000300119:E126G;ENSP00000393392:E126G	ENSP00000300119:E126G	E	-	2	0	MYO1A	55727407	0.990000	0.36364	1.000000	0.80357	0.946000	0.59487	1.678000	0.37586	2.093000	0.63338	0.533000	0.62120	GAG	MYO1A	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000166866		0.577	MYO1A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MYO1A	HGNC	protein_coding	OTTHUMT00000313833.2	43	0.00	0	T	NM_005379		57441140	57441140	-1	no_errors	ENST00000300119	ensembl	human	known	69_37n	missense	30	40.00	20	SNP	1.000	C
NBEAL1	65065	genome.wustl.edu	37	2	203992635	203992635	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr2:203992635T>C	ENST00000449802.1	+	23	3626	c.3293T>C	c.(3292-3294)aTa>aCa	p.I1098T		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	1098										NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						ATGGGGTACATAGCTGCTACT	0.333																																						dbGAP											0													135.0	122.0	126.0					2																	203992635		692	1591	2283	-	-	-	SO:0001583	missense	0			AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.3293T>C	2.37:g.203992635T>C	ENSP00000399903:p.Ile1098Thr		A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.I1098T	ENST00000449802.1	37	c.3293	CCDS46495.1	2	.	.	.	.	.	.	.	.	.	.	T	16.75	3.208226	0.58343	.	.	ENSG00000144426	ENST00000449802;ENST00000340268	T	0.32515	1.45	5.44	5.44	0.79542	.	.	.	.	.	T	0.39860	0.1094	M	0.71581	2.175	0.42444	D	0.992721	P	0.48911	0.917	P	0.44477	0.451	T	0.46762	-0.9168	9	0.87932	D	0	.	15.138	0.72583	0.0:0.0:0.0:1.0	.	1098	Q6ZS30	NBEL1_HUMAN	T	1098	ENSP00000399903:I1098T	ENSP00000344985:I1098T	I	+	2	0	NBEAL1	203700880	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.975000	0.76128	2.047000	0.60756	0.477000	0.44152	ATA	NBEAL1	-	NULL	ENSG00000144426		0.333	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL1	HGNC	protein_coding	OTTHUMT00000333982.4	91	0.00	0	T			203992635	203992635	+1	no_errors	ENST00000449802	ensembl	human	known	69_37n	missense	61	36.46	35	SNP	1.000	C
NUAK1	9891	genome.wustl.edu	37	12	106461184	106461184	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr12:106461184G>A	ENST00000261402.2	-	7	2761	c.1382C>T	c.(1381-1383)aCg>aTg	p.T461M		NM_014840.2	NP_055655.1	O60285	NUAK1_HUMAN	NUAK family, SNF1-like kinase, 1	461					cell adhesion (GO:0007155)|cellular response to DNA damage stimulus (GO:0006974)|regulation of cell adhesion (GO:0030155)|regulation of cell proliferation (GO:0042127)|regulation of cellular senescence (GO:2000772)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37						CTTGGGCATCGTGGCCGACTG	0.547																																						dbGAP											0													68.0	65.0	66.0					12																	106461184		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011109	CCDS31892.1	12q23.3	2005-08-09				ENSG00000074590			14311	protein-coding gene	gene with protein product	"""AMP-activated protein kinase family member 5"""	608130				12409306, 13679856	Standard	NM_014840		Approved	ARK5, KIAA0537, NuaK1	uc001tlj.1	O60285	OTTHUMG00000169763	ENST00000261402.2:c.1382C>T	12.37:g.106461184G>A	ENSP00000261402:p.Thr461Met		A7MD39|Q96KA8	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.T461M	ENST00000261402.2	37	c.1382	CCDS31892.1	12	.	.	.	.	.	.	.	.	.	.	G	13.89	2.372225	0.42003	.	.	ENSG00000074590	ENST00000261402	T	0.73047	-0.71	5.56	5.56	0.83823	.	0.214441	0.32624	N	0.005845	T	0.56877	0.2015	N	0.25647	0.755	0.35277	D	0.780964	B	0.20671	0.047	B	0.17979	0.02	T	0.62412	-0.6860	10	0.46703	T	0.11	.	10.6247	0.45500	0.1167:0.0:0.8833:0.0	.	461	O60285	NUAK1_HUMAN	M	461	ENSP00000261402:T461M	ENSP00000261402:T461M	T	-	2	0	NUAK1	104985314	1.000000	0.71417	0.972000	0.41901	0.912000	0.54170	4.704000	0.61831	2.617000	0.88574	0.491000	0.48974	ACG	NUAK1	-	NULL	ENSG00000074590		0.547	NUAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUAK1	HGNC	protein_coding	OTTHUMT00000405767.2	90	0.00	0	G	NM_014840		106461184	106461184	-1	no_errors	ENST00000261402	ensembl	human	known	69_37n	missense	46	25.81	16	SNP	0.984	A
OR1A2	26189	genome.wustl.edu	37	17	3101122	3101122	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr17:3101122A>T	ENST00000381951.1	+	1	310	c.310A>T	c.(310-312)Atg>Ttg	p.M104L		NM_012352.1	NP_036484.1	Q9Y585	OR1A2_HUMAN	olfactory receptor, family 1, subfamily A, member 2	104					positive regulation of cytokinesis (GO:0032467)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|large_intestine(2)|lung(5)|skin(4)|stomach(2)	18						GATGTATTTCATGATAGCCTT	0.493																																						dbGAP											0													144.0	121.0	129.0					17																	3101122		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF155225	CCDS11021.1	17p13.3	2012-08-09			ENSG00000172150	ENSG00000172150		"""GPCR / Class A : Olfactory receptors"""	8180	protein-coding gene	gene with protein product						10673334	Standard	NM_012352		Approved	OR17-6	uc002fvd.1	Q9Y585	OTTHUMG00000090638	ENST00000381951.1:c.310A>T	17.37:g.3101122A>T	ENSP00000371377:p.Met104Leu		Q3KPH3|Q6IFM0|Q6NTD8|Q96R86	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.M104L	ENST00000381951.1	37	c.310	CCDS11021.1	17	.	.	.	.	.	.	.	.	.	.	A	5.090	0.202168	0.09652	.	.	ENSG00000172150	ENST00000381951	T	0.00311	8.15	4.09	0.168	0.15012	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000010	T	0.00073	0.0002	N	0.00666	-1.275	0.22171	N	0.999317	B	0.09022	0.002	B	0.06405	0.002	T	0.25882	-1.0119	10	0.38643	T	0.18	.	4.1755	0.10349	0.396:0.0:0.1028:0.5012	.	104	Q9Y585	OR1A2_HUMAN	L	104	ENSP00000371377:M104L	ENSP00000371377:M104L	M	+	1	0	OR1A2	3047872	0.137000	0.22531	0.951000	0.38953	0.279000	0.26890	1.331000	0.33793	0.206000	0.20587	-0.333000	0.08304	ATG	OR1A2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000172150		0.493	OR1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1A2	HGNC	protein_coding	OTTHUMT00000207293.1	211	0.00	0	A	NM_012352		3101122	3101122	+1	no_errors	ENST00000381951	ensembl	human	known	69_37n	missense	96	34.69	51	SNP	0.883	T
OR2T1	26696	genome.wustl.edu	37	1	248570049	248570049	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr1:248570049T>A	ENST00000366474.1	+	1	754	c.754T>A	c.(754-756)Tgc>Agc	p.C252S		NM_030904.1	NP_112166.1	O43869	OR2T1_HUMAN	olfactory receptor, family 2, subfamily T, member 1	252						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(24)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	39	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GATGTATGTGTGCTGTGTTTT	0.507																																						dbGAP											0													264.0	223.0	237.0					1																	248570049		2203	4300	6503	-	-	-	SO:0001583	missense	0			U86215	CCDS31115.1	1q44	2012-08-09			ENSG00000175143	ENSG00000175143		"""GPCR / Class A : Olfactory receptors"""	8277	protein-coding gene	gene with protein product						9500546	Standard	NM_030904		Approved	OR1-25	uc010pzm.2	O43869	OTTHUMG00000040450	ENST00000366474.1:c.754T>A	1.37:g.248570049T>A	ENSP00000355430:p.Cys252Ser		Q6IEZ9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.C252S	ENST00000366474.1	37	c.754	CCDS31115.1	1	.	.	.	.	.	.	.	.	.	.	t	16.73	3.205166	0.58234	.	.	ENSG00000175143	ENST00000366474	T	0.00063	8.78	4.75	4.75	0.60458	GPCR, rhodopsin-like superfamily (1);	0.000000	0.40222	U	0.001155	T	0.00178	0.0005	N	0.03324	-0.35	0.37009	D	0.895659	D	0.89917	1.0	D	0.97110	1.0	D	0.99979	1.2384	10	0.29301	T	0.29	.	13.3845	0.60789	0.0:0.0:0.0:1.0	.	252	O43869	OR2T1_HUMAN	S	252	ENSP00000355430:C252S	ENSP00000355430:C252S	C	+	1	0	OR2T1	246636672	0.000000	0.05858	0.990000	0.47175	0.911000	0.54048	-0.413000	0.07123	1.993000	0.58246	0.528000	0.53228	TGC	OR2T1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000175143		0.507	OR2T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T1	HGNC	protein_coding	OTTHUMT00000097346.2	421	0.00	0	T			248570049	248570049	+1	no_errors	ENST00000366474	ensembl	human	known	69_37n	missense	276	35.58	153	SNP	0.964	A
OR2T29	343563	genome.wustl.edu	37	1	248722668	248722668	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr1:248722668G>A	ENST00000328570.3	-	1	129	c.125C>T	c.(124-126)gCg>gTg	p.A42V	RP11-438F14.3_ENST00000438623.1_RNA	NM_001004694.2	NP_001004694.2	Q8NH02	O2T29_HUMAN	olfactory receptor, family 2, subfamily T, member 29	42						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|lung(4)	5	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TCCAGACAACGCCTTCAGGAA	0.468																																						dbGAP											0													24.0	14.0	18.0					1																	248722668		2118	3772	5890	-	-	-	SO:0001583	missense	0				CCDS55695.1	1q44	2012-08-09			ENSG00000182783	ENSG00000182783		"""GPCR / Class A : Olfactory receptors"""	31253	protein-coding gene	gene with protein product							Standard	NM_001004694		Approved		uc001ieo.2	Q8NH02	OTTHUMG00000040382	ENST00000328570.3:c.125C>T	1.37:g.248722668G>A	ENSP00000331774:p.Ala42Val			Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.A42V	ENST00000328570.3	37	c.125	CCDS55695.1	1	.	.	.	.	.	.	.	.	.	.	g	5.468	0.271487	0.10349	.	.	ENSG00000182783	ENST00000328570	T	0.00281	8.32	2.73	1.7	0.24286	.	0.150767	0.30800	N	0.008848	T	0.00178	0.0005	L	0.56769	1.78	0.09310	N	1	P	0.37955	0.612	B	0.31290	0.127	T	0.42447	-0.9451	10	0.72032	D	0.01	.	3.9369	0.09310	0.1505:0.2525:0.597:0.0	.	42	Q8NH02	O2T29_HUMAN	V	42	ENSP00000331774:A42V	ENSP00000331774:A42V	A	-	2	0	OR2T29	246789291	0.017000	0.18338	0.996000	0.52242	0.022000	0.10575	2.060000	0.41394	1.371000	0.46172	0.196000	0.17591	GCG	OR2T29	-	prints_7TM_GPCR_Rhodpsn	ENSG00000182783		0.468	OR2T29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T29	HGNC	protein_coding	OTTHUMT00000097132.1	207	0.00	0	G	NM_001004694		248722668	248722668	-1	no_errors	ENST00000328570	ensembl	human	known	69_37n	missense	229	11.54	30	SNP	0.001	A
OR8D1	283159	genome.wustl.edu	37	11	124180486	124180486	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr11:124180486C>G	ENST00000357821.2	-	1	247	c.177G>C	c.(175-177)atG>atC	p.M59I		NM_001002917.1	NP_001002917.1	Q8WZ84	OR8D1_HUMAN	olfactory receptor, family 8, subfamily D, member 1	59						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(1)|lung(7)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0528)		GGAAATAGTACATGGGGGTGT	0.483																																						dbGAP											0													90.0	85.0	87.0					11																	124180486		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF238489	CCDS31706.1	11q25	2012-08-09			ENSG00000196341	ENSG00000196341		"""GPCR / Class A : Olfactory receptors"""	8481	protein-coding gene	gene with protein product				OR8D3			Standard	NM_001002917		Approved	OST004	uc010sag.2	Q8WZ84	OTTHUMG00000165977	ENST00000357821.2:c.177G>C	11.37:g.124180486C>G	ENSP00000350474:p.Met59Ile		B2RNL4|Q6IEW1|Q8NGH0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.M59I	ENST00000357821.2	37	c.177	CCDS31706.1	11	.	.	.	.	.	.	.	.	.	.	c	17.69	3.452713	0.63290	.	.	ENSG00000196341	ENST00000357821	T	0.09350	2.99	4.29	4.29	0.51040	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44688	U	0.000426	T	0.37046	0.0989	H	0.97682	4.055	0.47276	D	0.999374	P	0.50943	0.94	P	0.48454	0.578	T	0.64223	-0.6458	10	0.87932	D	0	.	16.5818	0.84717	0.0:1.0:0.0:0.0	.	59	Q8WZ84	OR8D1_HUMAN	I	59	ENSP00000350474:M59I	ENSP00000350474:M59I	M	-	3	0	OR8D1	123685696	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	5.250000	0.65432	2.236000	0.73375	0.508000	0.49915	ATG	OR8D1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000196341		0.483	OR8D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8D1	HGNC	protein_coding	OTTHUMT00000387285.1	83	0.00	0	C	NM_001002917		124180486	124180486	-1	no_errors	ENST00000357821	ensembl	human	known	69_37n	missense	86	12.24	12	SNP	1.000	G
PACSIN2	11252	genome.wustl.edu	37	22	43287157	43287157	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr22:43287157C>G	ENST00000263246.3	-	4	450	c.249G>C	c.(247-249)tgG>tgC	p.W83C	PACSIN2_ENST00000402229.1_Missense_Mutation_p.W83C|PACSIN2_ENST00000407585.1_Missense_Mutation_p.W83C|PACSIN2_ENST00000403744.3_Missense_Mutation_p.W83C|PACSIN2_ENST00000337959.4_Missense_Mutation_p.W83C	NM_001184970.1	NP_001171899.1	Q9UNF0	PACN2_HUMAN	protein kinase C and casein kinase substrate in neurons 2	83	F-BAR domain.				actin cytoskeleton organization (GO:0030036)|caveola assembly (GO:0070836)|caveolin-mediated endocytosis (GO:0072584)|cell projection morphogenesis (GO:0048858)|membrane tubulation (GO:0097320)|negative regulation of endocytosis (GO:0045806)|protein localization to endosome (GO:0036010)	caveola (GO:0005901)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|recycling endosome membrane (GO:0055038)	identical protein binding (GO:0042802)|phosphatidic acid binding (GO:0070300)|transporter activity (GO:0005215)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)	19		Glioma(61;0.222)				TGAAGGCCATCCAGGCCTTCT	0.617																																						dbGAP											0													47.0	45.0	46.0					22																	43287157		2087	4245	6332	-	-	-	SO:0001583	missense	0			AF128536	CCDS43023.1, CCDS54536.1	22q13.2-q13.33	2009-05-08			ENSG00000100266	ENSG00000100266			8571	protein-coding gene	gene with protein product	"""syndapin II"""	604960				10431838, 11082044	Standard	NM_007229		Approved	SDPII	uc003bdg.4	Q9UNF0	OTTHUMG00000150701	ENST00000263246.3:c.249G>C	22.37:g.43287157C>G	ENSP00000263246:p.Trp83Cys		O95921|Q96HV9|Q9H0D3|Q9NPN1|Q9Y4V2	Missense_Mutation	SNP	pfam_FCH,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_FCH,smart_SH3_domain,pfscan_FCH,pfscan_SH3_domain,prints_SH3_domain	p.W83C	ENST00000263246.3	37	c.249	CCDS43023.1	22	.	.	.	.	.	.	.	.	.	.	C	20.4	3.978462	0.74360	.	.	ENSG00000100266	ENST00000263246;ENST00000337959;ENST00000407585;ENST00000403744;ENST00000402229;ENST00000453643;ENST00000418133;ENST00000422336	T;T;T;T;T;T;T;T	0.25579	1.96;1.96;1.96;1.96;1.96;1.79;1.79;1.79	4.63	4.63	0.57726	Fps/Fes/Fer/CIP4 homology (2);	0.000000	0.85682	D	0.000000	T	0.59891	0.2227	M	0.90483	3.12	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.69038	-0.5251	10	0.62326	D	0.03	-13.3477	18.0425	0.89323	0.0:1.0:0.0:0.0	.	83;83	Q6FIA3;Q9UNF0	.;PACN2_HUMAN	C	83	ENSP00000263246:W83C;ENSP00000338379:W83C;ENSP00000385952:W83C;ENSP00000385372:W83C;ENSP00000385040:W83C;ENSP00000398573:W83C;ENSP00000396816:W83C;ENSP00000403435:W83C	ENSP00000263246:W83C	W	-	3	0	PACSIN2	41617101	1.000000	0.71417	0.956000	0.39512	0.623000	0.37688	7.568000	0.82369	2.572000	0.86782	0.542000	0.68232	TGG	PACSIN2	-	pfam_FCH,smart_FCH	ENSG00000100266		0.617	PACSIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PACSIN2	HGNC	protein_coding	OTTHUMT00000319665.1	45	0.00	0	C	NM_007229		43287157	43287157	-1	no_errors	ENST00000263246	ensembl	human	known	69_37n	missense	52	28.77	21	SNP	1.000	G
PADI1	29943	genome.wustl.edu	37	1	17548919	17548919	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr1:17548919T>A	ENST00000375471.4	+	2	319	c.227T>A	c.(226-228)aTg>aAg	p.M76K		NM_013358.2	NP_037490.2	Q9ULC6	PADI1_HUMAN	peptidyl arginine deiminase, type I	76					protein citrullination (GO:0018101)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	28		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00054)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00522)|BRCA - Breast invasive adenocarcinoma(304;1.3e-05)|COAD - Colon adenocarcinoma(227;1.31e-05)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(196;0.0069)|READ - Rectum adenocarcinoma(331;0.0681)|Lung(427;0.197)	L-Citrulline(DB00155)	GATGCAGACATGGTCGTATCT	0.532																																					Esophageal Squamous(80;414 1257 4580 27746 50832)	dbGAP											0													130.0	126.0	127.0					1																	17548919		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033768	CCDS178.1	1p36.13	2008-07-18			ENSG00000142623	ENSG00000142623	3.5.3.15	"""Peptidyl arginine deiminases"""	18367	protein-coding gene	gene with protein product	"""peptidylarginine deiminase type I"", ""protein-arginine deiminase type-1"", ""hPAD-colony 10"""	607934				12416996	Standard	NM_013358		Approved	HPAD10, PDI1, PDI, PAD1	uc001bah.1	Q9ULC6	OTTHUMG00000002294	ENST00000375471.4:c.227T>A	1.37:g.17548919T>A	ENSP00000364620:p.Met76Lys		A1L4K6|Q70SX6	Missense_Mutation	SNP	pfam_PAD_C,pfam_Prot_Arg_deaminase_cen_dom,pfam_PAD_N,superfamily_Prot_Arg_deaminase_cen_dom,superfamily_Cupredoxin,pirsf_Protein-arginine_deiminase_sub	p.M76K	ENST00000375471.4	37	c.227	CCDS178.1	1	.	.	.	.	.	.	.	.	.	.	t	8.480	0.859475	0.17178	.	.	ENSG00000142623	ENST00000375471	T	0.09723	2.95	4.04	4.04	0.47022	Cupredoxin (1);Protein-arginine deiminase (PAD) N-terminal (1);	0.509483	0.16953	U	0.192782	T	0.09818	0.0241	N	0.22421	0.69	0.33763	D	0.622081	B	0.26876	0.162	B	0.34722	0.188	T	0.11916	-1.0568	10	0.87932	D	0	-9.8723	9.6665	0.39988	0.0:0.0:0.0:1.0	.	76	Q9ULC6	PADI1_HUMAN	K	76	ENSP00000364620:M76K	ENSP00000364620:M76K	M	+	2	0	PADI1	17421506	0.532000	0.26346	0.022000	0.16811	0.203000	0.24098	3.949000	0.56668	1.605000	0.50152	0.255000	0.18592	ATG	PADI1	-	pfam_PAD_N,superfamily_Cupredoxin,pirsf_Protein-arginine_deiminase_sub	ENSG00000142623		0.532	PADI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PADI1	HGNC	protein_coding	OTTHUMT00000006621.1	71	0.00	0	T	NM_013358		17548919	17548919	+1	no_errors	ENST00000375471	ensembl	human	known	69_37n	missense	40	25.93	14	SNP	0.034	A
PAH	5053	genome.wustl.edu	37	12	103288660	103288660	+	Missense_Mutation	SNP	G	G	A	rs199475678|rs199475570		TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr12:103288660G>A	ENST00000553106.1	-	3	677	c.205C>T	c.(205-207)Cct>Tct	p.P69S	PAH_ENST00000551988.1_5'UTR|PAH_ENST00000307000.2_Missense_Mutation_p.P64S	NM_000277.1	NP_000268.1	P00439	PH4H_HUMAN	phenylalanine hydroxylase	69	ACT. {ECO:0000255|PROSITE- ProRule:PRU01007}.				catecholamine biosynthetic process (GO:0042423)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|neurotransmitter biosynthetic process (GO:0042136)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|phenylalanine 4-monooxygenase activity (GO:0004505)			endometrium(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(5)|skin(2)|urinary_tract(1)	27					Droxidopa(DB06262)|Epinephrine(DB00668)|L-Phenylalanine(DB00120)|Norepinephrine(DB00368)|Tetrahydrobiopterin(DB00360)	AAACGAGAAGGTCTAGATTCA	0.438																																						dbGAP											0			GRCh37	CM045074	PAH	M							132.0	124.0	127.0					12																	103288660		2203	4300	6503	-	-	-	SO:0001583	missense	0			U49897	CCDS9092.1	12q22-q24.2	2010-04-27				ENSG00000171759	1.14.16.1		8582	protein-coding gene	gene with protein product	"""phenylalanine 4-monooxygenase"""	612349				2063869	Standard	NM_000277		Approved	PH	uc001tjq.1	P00439		ENST00000553106.1:c.205C>T	12.37:g.103288660G>A	ENSP00000448059:p.Pro69Ser		Q16717|Q8TC14	Missense_Mutation	SNP	pfam_Aromatic-AA_hydroxylase_C,pfam_ACT_dom,superfamily_Aromatic-AA_hydroxylase_C,pirsf_Tyrosine_3-monooxygenase-like,prints_Aromatic-AA_hydroxylase_C,tigrfam_Phe-4-hydroxylase_tetra	p.P69S	ENST00000553106.1	37	c.205	CCDS9092.1	12	.	.	.	.	.	.	.	.	.	.	G	18.28	3.589450	0.66105	.	.	ENSG00000171759	ENST00000553106;ENST00000307000;ENST00000551337;ENST00000546844	D;D;D;D	0.99252	-5.63;-5.63;-5.63;-5.63	6.17	6.17	0.99709	Amino acid-binding ACT (1);	0.000000	0.85682	D	0.000000	D	0.99272	0.9746	M	0.89353	3.025	0.80722	D	1	P;P	0.41748	0.761;0.728	B;P	0.48114	0.305;0.567	D	0.99628	1.0985	10	0.48119	T	0.1	-18.2525	20.8794	0.99867	0.0:0.0:1.0:0.0	rs62652683	69;69	B4DPN2;P00439	.;PH4H_HUMAN	S	69;64;69;69	ENSP00000448059:P69S;ENSP00000303500:P64S;ENSP00000447620:P69S;ENSP00000446658:P69S	ENSP00000303500:P64S	P	-	1	0	PAH	101812790	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.877000	0.92386	2.941000	0.99782	0.655000	0.94253	CCT	PAH	-	pfam_ACT_dom,pirsf_Tyrosine_3-monooxygenase-like,tigrfam_Phe-4-hydroxylase_tetra	ENSG00000171759		0.438	PAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAH	HGNC	protein_coding	OTTHUMT00000406692.1	118	0.00	0	G			103288660	103288660	-1	no_errors	ENST00000553106	ensembl	human	known	69_37n	missense	65	20.73	17	SNP	1.000	A
PCDHB16	57717	genome.wustl.edu	37	5	140564371	140564371	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr5:140564371C>T	ENST00000361016.2	+	1	3392	c.2237C>T	c.(2236-2238)tCc>tTc	p.S746F		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	746					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGGACCCTGTCCCAGAGCTAC	0.607																																						dbGAP											0													96.0	100.0	99.0					5																	140564371		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.2237C>T	5.37:g.140564371C>T	ENSP00000354293:p.Ser746Phe		B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S746F	ENST00000361016.2	37	c.2237	CCDS4251.1	5	.	.	.	.	.	.	.	.	.	.	c	10.24	1.296680	0.23650	.	.	ENSG00000196963	ENST00000361016	T	0.56444	0.46	4.12	4.12	0.48240	.	0.000000	0.33364	N	0.004990	T	0.68256	0.2981	H	0.96970	3.915	0.29429	N	0.860017	B	0.20780	0.048	B	0.25614	0.062	T	0.68712	-0.5336	10	0.37606	T	0.19	.	15.9724	0.80031	0.0:1.0:0.0:0.0	.	746	Q9NRJ7	PCDBG_HUMAN	F	746	ENSP00000354293:S746F	ENSP00000354293:S746F	S	+	2	0	PCDHB16	140544555	0.006000	0.16342	0.977000	0.42913	0.119000	0.20118	1.559000	0.36320	1.818000	0.53035	0.484000	0.47621	TCC	PCDHB16	-	NULL	ENSG00000196963		0.607	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB16	HGNC	protein_coding	OTTHUMT00000251800.1	67	0.00	0	C	NM_020957		140564371	140564371	+1	no_errors	ENST00000361016	ensembl	human	known	69_37n	missense	32	54.29	38	SNP	0.953	T
PHF20	51230	genome.wustl.edu	37	20	34528959	34528959	+	Silent	SNP	G	G	A			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr20:34528959G>A	ENST00000374012.3	+	17	3015	c.2886G>A	c.(2884-2886)aaG>aaA	p.K962K	PHF20_ENST00000439301.1_3'UTR			Q9BVI0	PHF20_HUMAN	PHD finger protein 20	962					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(5)|endometrium(1)|kidney(7)|large_intestine(6)|lung(11)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(12;0.00631)|all_lung(11;0.0145)					CCATTGAGAAGGAGTTGGATG	0.557																																						dbGAP											0													71.0	58.0	63.0					20																	34528959		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL109965	CCDS13268.1	20q11.22-q11.23	2013-01-28	2004-12-01	2004-12-01	ENSG00000025293	ENSG00000025293		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	16098	protein-coding gene	gene with protein product	"""tudor domain containing 20A"""	610335	"""chromosome 20 open reading frame 104"""	C20orf104			Standard	NM_016436		Approved	dJ1121G12.1, TDRD20A	uc002xek.1	Q9BVI0	OTTHUMG00000032367	ENST00000374012.3:c.2886G>A	20.37:g.34528959G>A			A7E235|B2RB56|E1P5S3|Q566Q2|Q5JWY9|Q66K49|Q9BWV4|Q9BXA3|Q9BZW3|Q9H421|Q9H4J6|Q9NZ22	Silent	SNP	pfam_DUF3776,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Tudor,smart_Znf_PHD,pfscan_Znf_C2H2	p.K962	ENST00000374012.3	37	c.2886	CCDS13268.1	20																																																																																			PHF20	-	NULL	ENSG00000025293		0.557	PHF20-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF20	HGNC	protein_coding	OTTHUMT00000078949.2	65	0.00	0	G	NM_016436		34528959	34528959	+1	no_errors	ENST00000374012	ensembl	human	known	69_37n	silent	27	49.06	26	SNP	1.000	A
PMFBP1	83449	genome.wustl.edu	37	16	72166723	72166723	+	Silent	SNP	C	C	T			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr16:72166723C>T	ENST00000237353.10	-	10	1632	c.1371G>A	c.(1369-1371)gaG>gaA	p.E457E	PMFBP1_ENST00000537465.1_Silent_p.E457E|PMFBP1_ENST00000355636.6_Silent_p.E312E	NM_031293.2	NP_112583.2	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	457						cytoplasm (GO:0005737)				NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	45		Ovarian(137;0.179)				GGGCCTTGCACTCCGCCTCCT	0.577																																						dbGAP											0													158.0	126.0	137.0					16																	72166723		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			AF239683	CCDS32483.1	16q23.1	2008-08-04			ENSG00000118557	ENSG00000118557			17728	protein-coding gene	gene with protein product						11468771	Standard	NM_031293		Approved		uc002fcd.3	Q8TBY8	OTTHUMG00000167827	ENST00000237353.10:c.1371G>A	16.37:g.72166723C>T			B3KVI9|H7BY07|Q8NA09|Q9BY16|Q9H0H4	Silent	SNP	NULL	p.E457	ENST00000237353.10	37	c.1371	CCDS32483.1	16																																																																																			PMFBP1	-	NULL	ENSG00000118557		0.577	PMFBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PMFBP1	HGNC	protein_coding	OTTHUMT00000396473.2	127	0.00	0	C	NM_031293		72166723	72166723	-1	no_errors	ENST00000537465	ensembl	human	known	69_37n	silent	105	28.08	41	SNP	0.006	T
PTPRJ	5795	genome.wustl.edu	37	11	48149442	48149442	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr11:48149442C>T	ENST00000418331.2	+	7	1556	c.1204C>T	c.(1204-1206)Cat>Tat	p.H402Y	PTPRJ_ENST00000440289.2_Missense_Mutation_p.H402Y	NM_002843.3	NP_002834.3	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	402	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				contact inhibition (GO:0060242)|heart development (GO:0007507)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of vascular permeability (GO:0043116)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of cell adhesion (GO:0045785)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion (GO:0030155)|vasculogenesis (GO:0001570)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|mitogen-activated protein kinase binding (GO:0051019)|phosphatase activity (GO:0016791)|platelet-derived growth factor receptor binding (GO:0005161)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|endometrium(7)|kidney(7)|large_intestine(5)|lung(15)|ovary(1)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						CTACAAGATACATGTGGCGGG	0.522																																						dbGAP											0													167.0	140.0	149.0					11																	48149442		2201	4298	6499	-	-	-	SO:0001583	missense	0			U10886	CCDS7945.1, CCDS44596.1	11p11.2	2013-02-11			ENSG00000149177	ENSG00000149177		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9673	protein-coding gene	gene with protein product		600925				7937872, 7994032	Standard	NM_001098503		Approved	DEP1, HPTPeta, CD148	uc001ngp.4	Q12913	OTTHUMG00000166573	ENST00000418331.2:c.1204C>T	11.37:g.48149442C>T	ENSP00000400010:p.His402Tyr		Q15255|Q6P4H4|Q8NHM2|Q9UDA9	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.H402Y	ENST00000418331.2	37	c.1204	CCDS7945.1	11	.	.	.	.	.	.	.	.	.	.	C	10.02	1.236746	0.22711	.	.	ENSG00000149177	ENST00000278456;ENST00000418331;ENST00000440289	T;T	0.56941	0.43;0.43	6.17	3.27	0.37495	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	T	0.34164	0.0888	N	0.22421	0.69	0.09310	N	1	B;B	0.33777	0.003;0.425	B;B	0.36378	0.013;0.223	T	0.21415	-1.0246	9	0.05959	T	0.93	.	9.0673	0.36471	0.0:0.648:0.2772:0.0748	.	402;402	Q12913;Q6P4H4	PTPRJ_HUMAN;.	Y	402	ENSP00000400010:H402Y;ENSP00000409733:H402Y	ENSP00000278456:H402Y	H	+	1	0	PTPRJ	48106018	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	-0.065000	0.11617	0.458000	0.26988	-0.929000	0.02709	CAT	PTPRJ	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000149177		0.522	PTPRJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRJ	HGNC	protein_coding	OTTHUMT00000390525.1	87	0.00	0	C			48149442	48149442	+1	no_errors	ENST00000418331	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	0.003	T
QTRTD1	79691	genome.wustl.edu	37	3	113785093	113785093	+	Silent	SNP	C	C	G			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr3:113785093C>G	ENST00000281273.4	+	4	476	c.219C>G	c.(217-219)gtC>gtG	p.V73V	QTRTD1_ENST00000479882.1_5'UTR|QTRTD1_ENST00000493014.1_Intron|QTRTD1_ENST00000485050.1_Silent_p.V85V|QTRTD1_ENST00000466050.1_3'UTR	NM_024638.3	NP_078914.1			queuine tRNA-ribosyltransferase domain containing 1											central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|skin(2)	10						ATCATGAAGTCTTGACAGAAT	0.343																																						dbGAP											0													129.0	132.0	131.0					3																	113785093		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK023022	CCDS33828.1, CCDS58846.1, CCDS58845.1, CCDS58844.1	3q13.31	2010-11-16			ENSG00000151576	ENSG00000151576			25771	protein-coding gene	gene with protein product						12477932	Standard	NM_024638		Approved	FLJ12960	uc003eaz.4	Q9H974	OTTHUMG00000159336	ENST00000281273.4:c.219C>G	3.37:g.113785093C>G				Silent	SNP	pfam_tRNA_ribo_trans,superfamily_tRNA_ribo_trans,tigrfam_tRNA_ribo_trans	p.V73	ENST00000281273.4	37	c.219	CCDS33828.1	3																																																																																			QTRTD1	-	superfamily_tRNA_ribo_trans	ENSG00000151576		0.343	QTRTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QTRTD1	HGNC	protein_coding	OTTHUMT00000354708.2	257	0.00	0	C	NM_024638		113785093	113785093	+1	no_errors	ENST00000281273	ensembl	human	known	69_37n	silent	126	30.77	56	SNP	1.000	G
RAB11FIP1	80223	genome.wustl.edu	37	8	37720609	37720609	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr8:37720609G>C	ENST00000330843.4	-	6	3668	c.3656C>G	c.(3655-3657)gCa>gGa	p.A1219G	RAB11FIP1_ENST00000523182.1_5'UTR|RAB11FIP1_ENST00000522727.1_Missense_Mutation_p.A437G|RAB11FIP1_ENST00000287263.4_Missense_Mutation_p.A585G	NM_001002814.2	NP_001002814.2	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 (class I)	1219	FIP-RBD. {ECO:0000255|PROSITE- ProRule:PRU00844}.|Necessary for interaction with RAB4A and RAB11A, subcellular location and endosomal recycling.				protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(4)|endometrium(3)|large_intestine(6)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	49		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)			ATATGCAAATGCAGGGTCCGA	0.463																																						dbGAP											0													101.0	105.0	103.0					8																	37720609		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK092296	CCDS34881.1, CCDS34882.1	8p11.22	2005-10-04			ENSG00000156675	ENSG00000156675			30265	protein-coding gene	gene with protein product		608737				11786538, 11495908	Standard	NM_001002814		Approved	RCP, FLJ22622, FLJ22524, Rab11-FIP1	uc003xkm.2	Q6WKZ4	OTTHUMG00000164026	ENST00000330843.4:c.3656C>G	8.37:g.37720609G>C	ENSP00000331342:p.Ala1219Gly		J3KNP0|Q307T1|Q6AZK4|Q6WKZ2|Q6WKZ6|Q86YV4|Q8TDL1|Q9H642	Missense_Mutation	SNP	pfam_Rab-bd_FIP-RBD,pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.A1219G	ENST00000330843.4	37	c.3656	CCDS34882.1	8	.	.	.	.	.	.	.	.	.	.	G	16.29	3.081025	0.55753	.	.	ENSG00000156675	ENST00000287263;ENST00000330843;ENST00000522727	T;T;T	0.34072	2.1;2.45;1.38	6.03	5.09	0.68999	Rab-binding domain FIP-RBD (1);	0.110178	0.40640	N	0.001050	T	0.48960	0.1529	L	0.36672	1.1	0.80722	D	1	D;D;P	0.69078	0.997;0.971;0.951	P;P;P	0.62885	0.877;0.908;0.904	T	0.38134	-0.9675	10	0.48119	T	0.1	-20.8918	18.0638	0.89385	0.0:0.0:0.8714:0.1286	.	437;585;1219	E7EX40;Q6WKZ4-3;Q6WKZ4	.;.;RFIP1_HUMAN	G	585;1219;437	ENSP00000287263:A585G;ENSP00000331342:A1219G;ENSP00000430009:A437G	ENSP00000287263:A585G	A	-	2	0	RAB11FIP1	37839767	1.000000	0.71417	0.996000	0.52242	0.443000	0.32047	5.657000	0.67996	2.868000	0.98415	0.557000	0.71058	GCA	RAB11FIP1	-	NULL	ENSG00000156675		0.463	RAB11FIP1-002	KNOWN	basic|CCDS	protein_coding	RAB11FIP1	HGNC	protein_coding	OTTHUMT00000376816.1	135	0.00	0	G	NM_025151		37720609	37720609	-1	no_errors	ENST00000330843	ensembl	human	known	69_37n	missense	94	16.07	18	SNP	0.970	C
RAD54B	25788	genome.wustl.edu	37	8	95399325	95399325	+	Silent	SNP	T	T	C			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr8:95399325T>C	ENST00000336148.5	-	11	1996	c.1872A>G	c.(1870-1872)ctA>ctG	p.L624L		NM_012415.3	NP_036547.1	Q9Y620	RA54B_HUMAN	RAD54 homolog B (S. cerevisiae)	624					ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair via homologous recombination (GO:0000724)|mitotic recombination (GO:0006312)|reciprocal meiotic recombination (GO:0007131)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|RNA helicase activity (GO:0003724)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(10)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)			GAAACACACTTAGCAAGCCTT	0.393								Direct reversal of damage;Homologous recombination																														dbGAP											0													144.0	131.0	135.0					8																	95399325		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF112481	CCDS6262.1, CCDS56546.1, CCDS75768.1	8q22.1	2014-08-08			ENSG00000197275	ENSG00000197275			17228	protein-coding gene	gene with protein product		604289				10362364, 10851248	Standard	NM_012415		Approved	RDH54	uc003ygk.3	Q9Y620	OTTHUMG00000133658	ENST00000336148.5:c.1872A>G	8.37:g.95399325T>C			F6WBS8	Silent	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_HDA_complex_subunit-2/3,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.L624	ENST00000336148.5	37	c.1872	CCDS6262.1	8																																																																																			RAD54B	-	pfam_HDA_complex_subunit-2/3	ENSG00000197275		0.393	RAD54B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD54B	HGNC	protein_coding	OTTHUMT00000257806.3	202	0.00	0	T	NM_012415		95399325	95399325	-1	no_errors	ENST00000336148	ensembl	human	known	69_37n	silent	281	15.57	52	SNP	0.000	C
RGS22	26166	genome.wustl.edu	37	8	101078504	101078504	+	Frame_Shift_Del	DEL	T	T	-			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr8:101078504delT	ENST00000360863.6	-	7	809	c.615delA	c.(613-615)aaafs	p.K205fs	RGS22_ENST00000523437.1_Frame_Shift_Del_p.K193fs|RGS22_ENST00000523287.1_Frame_Shift_Del_p.K24fs	NM_015668.3	NP_056483.3	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	205					positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)		RGS22/SYCP1(2)	breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(33)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	68			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			CAAACCAATCTTTTGTTTGAG	0.343																																						dbGAP											0													154.0	144.0	147.0					8																	101078504		1873	4112	5985	-	-	-	SO:0001589	frameshift_variant	0			AY009106	CCDS43758.1, CCDS69521.1, CCDS75775.1	8q22.2	2014-01-21	2007-08-14		ENSG00000132554	ENSG00000132554		"""Regulators of G-protein signaling"""	24499	protein-coding gene	gene with protein product		615650	"""regulator of G-protein signalling 22"""				Standard	XM_005250856		Approved	DKFZP434I092, PRTD-NY2, CT145	uc003yjb.1	Q8NE09	OTTHUMG00000164802	ENST00000360863.6:c.615delA	8.37:g.101078504delT	ENSP00000354109:p.Lys205fs		A8K944|Q569L2|Q86Y71|Q9BYZ4|Q9UFN6	Frame_Shift_Del	DEL	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal	p.D206fs	ENST00000360863.6	37	c.615	CCDS43758.1	8																																																																																			RGS22	-	NULL	ENSG00000132554		0.343	RGS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RGS22	HGNC	protein_coding	OTTHUMT00000380365.1	149	0.00	0	T	NM_015668		101078504	101078504	-1	no_errors	ENST00000360863	ensembl	human	known	69_37n	frame_shift_del	186	17.54	40	DEL	1.000	-
RSPH6A	81492	genome.wustl.edu	37	19	46299287	46299287	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr19:46299287A>C	ENST00000221538.3	-	6	2136	c.1994T>G	c.(1993-1995)aTt>aGt	p.I665S	RSPH6A_ENST00000597055.1_Missense_Mutation_p.F664V|RSPH6A_ENST00000600188.1_Missense_Mutation_p.I401S	NM_030785.3	NP_110412.1	Q9H0K4	RSH6A_HUMAN	radial spoke head 6 homolog A (Chlamydomonas)	665	Glu-rich.					intracellular (GO:0005622)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	32						CTCTTGTTGAATGGGGGCTGG	0.567																																						dbGAP											0													121.0	132.0	128.0					19																	46299287		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL136761	CCDS12675.1	19q13.3	2010-02-17	2009-11-18	2009-11-18	ENSG00000104941	ENSG00000104941			14241	protein-coding gene	gene with protein product		607548	"""radial spokehead-like 1"""	RSHL1		11237735	Standard	NM_030785		Approved	RSP4, RSP6, RSPH4B	uc002pdm.3	Q9H0K4		ENST00000221538.3:c.1994T>G	19.37:g.46299287A>C	ENSP00000221538:p.Ile665Ser		Q53FE2|Q6PEZ9	Missense_Mutation	SNP	pfam_Radial_spoke	p.I665S	ENST00000221538.3	37	c.1994	CCDS12675.1	19	.	.	.	.	.	.	.	.	.	.	a	17.99	3.524114	0.64747	.	.	ENSG00000104941	ENST00000221538	T	0.18810	2.19	4.25	4.25	0.50352	.	0.572720	0.18114	N	0.151277	T	0.25457	0.0619	L	0.61218	1.895	0.23720	N	0.997027	B	0.33413	0.411	B	0.40165	0.321	T	0.23440	-1.0188	10	0.72032	D	0.01	-9.126	6.5465	0.22408	0.8924:0.0:0.1076:0.0	.	665	Q9H0K4	RSH6A_HUMAN	S	665	ENSP00000221538:I665S	ENSP00000221538:I665S	I	-	2	0	RSPH6A	50991127	0.806000	0.28996	0.873000	0.34254	0.987000	0.75469	4.491000	0.60326	1.929000	0.55896	0.451000	0.29950	ATT	RSPH6A	-	pfam_Radial_spoke	ENSG00000104941		0.567	RSPH6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH6A	HGNC	protein_coding	OTTHUMT00000461657.1	90	0.00	0	A			46299287	46299287	-1	no_errors	ENST00000221538	ensembl	human	known	69_37n	missense	83	13.54	13	SNP	0.587	C
SDK1	221935	genome.wustl.edu	37	7	4285355	4285355	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr7:4285355A>G	ENST00000404826.2	+	44	6438	c.6299A>G	c.(6298-6300)gAc>gGc	p.D2100G	SDK1_ENST00000389531.3_Missense_Mutation_p.D2080G|SDK1_ENST00000466611.1_3'UTR	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	2100					cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		TCAGACGAGGACATCTGCAAC	0.607																																						dbGAP											0													82.0	72.0	76.0					7																	4285355		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.6299A>G	7.37:g.4285355A>G	ENSP00000385899:p.Asp2100Gly		Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.D2100G	ENST00000404826.2	37	c.6299	CCDS34590.1	7	.	.	.	.	.	.	.	.	.	.	A	29.4	4.998764	0.93227	.	.	ENSG00000146555	ENST00000404826;ENST00000446104;ENST00000389531	T;T	0.66815	-0.21;-0.23	5.09	5.09	0.68999	.	0.000000	0.64402	D	0.000001	T	0.81749	0.4888	M	0.80183	2.485	0.54753	D	0.999988	D;D;D;D	0.89917	0.999;1.0;0.995;1.0	D;D;P;D	0.91635	0.975;0.999;0.883;0.998	D	0.84407	0.0563	10	0.72032	D	0.01	.	13.4353	0.61079	1.0:0.0:0.0:0.0	.	2080;160;587;2100	F8W6X9;Q7Z5N4-2;F2Z3E9;Q7Z5N4	.;.;.;SDK1_HUMAN	G	2100;348;2080	ENSP00000385899:D2100G;ENSP00000374182:D2080G	ENSP00000374182:D2080G	D	+	2	0	SDK1	4251881	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	8.700000	0.91322	1.905000	0.55150	0.533000	0.62120	GAC	SDK1	-	NULL	ENSG00000146555		0.607	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK1	HGNC	protein_coding	OTTHUMT00000323702.1	57	0.00	0	A	NM_152744		4285355	4285355	+1	no_errors	ENST00000404826	ensembl	human	known	69_37n	missense	14	53.33	16	SNP	1.000	G
SH3BP4	23677	genome.wustl.edu	37	2	235950855	235950855	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr2:235950855C>G	ENST00000409212.1	+	4	1949	c.1442C>G	c.(1441-1443)cCt>cGt	p.P481R	SH3BP4_ENST00000344528.4_Missense_Mutation_p.P481R|SH3BP4_ENST00000392011.2_Missense_Mutation_p.P481R			Q9P0V3	SH3B4_HUMAN	SH3-domain binding protein 4	481					cellular response to amino acid stimulus (GO:0071230)|endocytosis (GO:0006897)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of GTPase activity (GO:0034260)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|protein localization to lysosome (GO:0061462)|regulation of catalytic activity (GO:0050790)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	GDP-dissociation inhibitor activity (GO:0005092)|identical protein binding (GO:0042802)|Ras GTPase binding (GO:0017016)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(6)|stomach(3)|urinary_tract(2)	44		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)		CTCTACGGCCCTAAACACATC	0.552																																						dbGAP											0													74.0	79.0	77.0					2																	235950855		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF147747	CCDS2513.1	2q37.1-q37.2	2008-05-15			ENSG00000130147	ENSG00000130147			10826	protein-coding gene	gene with protein product		605611				10644451	Standard	NM_014521		Approved		uc002vvp.3	Q9P0V3	OTTHUMG00000133292	ENST00000409212.1:c.1442C>G	2.37:g.235950855C>G	ENSP00000386862:p.Pro481Arg		O95082|Q309A3|Q53QD0|Q53TD1	Missense_Mutation	SNP	pfam_SH3_2,pfam_SH3_domain,pfam_ZU5,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.P481R	ENST00000409212.1	37	c.1442	CCDS2513.1	2	.	.	.	.	.	.	.	.	.	.	C	17.27	3.347295	0.61183	.	.	ENSG00000130147	ENST00000392011;ENST00000420127;ENST00000409212;ENST00000344528	T;T;T	0.44881	0.91;0.91;0.91	5.42	4.54	0.55810	.	0.050481	0.85682	D	0.000000	T	0.64283	0.2584	M	0.76838	2.35	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.68758	-0.5324	10	0.87932	D	0	-16.155	12.6316	0.56661	0.0:0.9199:0.0:0.0801	.	481;481	A8K594;Q9P0V3	.;SH3B4_HUMAN	R	481	ENSP00000375867:P481R;ENSP00000386862:P481R;ENSP00000340237:P481R	ENSP00000340237:P481R	P	+	2	0	SH3BP4	235615594	1.000000	0.71417	0.994000	0.49952	0.940000	0.58332	7.571000	0.82399	1.278000	0.44430	0.655000	0.94253	CCT	SH3BP4	-	NULL	ENSG00000130147		0.552	SH3BP4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SH3BP4	HGNC	protein_coding	OTTHUMT00000329763.1	47	0.00	0	C			235950855	235950855	+1	no_errors	ENST00000344528	ensembl	human	known	69_37n	missense	28	34.88	15	SNP	1.000	G
SIK2	23235	genome.wustl.edu	37	11	111594680	111594680	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr11:111594680G>A	ENST00000304987.3	+	15	2781	c.2608G>A	c.(2608-2610)Gat>Aat	p.D870N		NM_015191.1	NP_056006.1	Q9H0K1	SIK2_HUMAN	salt-inducible kinase 2	870					insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of insulin receptor signaling pathway (GO:0046626)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	30						GTATCCTGTGGATGGAGCCCA	0.617																																						dbGAP											0													50.0	52.0	51.0					11																	111594680		2201	4297	6498	-	-	-	SO:0001583	missense	0			AB018324	CCDS8347.1	11q23.1	2008-12-23	2008-12-23	2008-12-23	ENSG00000170145	ENSG00000170145			21680	protein-coding gene	gene with protein product		608973	"""SNF1-like kinase 2"""	SNF1LK2		15067358	Standard	NM_015191		Approved	KIAA0781, QIK, DKFZp434K1115, LOH11CR1I	uc001plt.3	Q9H0K1	OTTHUMG00000150644	ENST00000304987.3:c.2608G>A	11.37:g.111594680G>A	ENSP00000305976:p.Asp870Asn		A8K5B8|B0YJ94|O94878|Q17RV0|Q6AZE2|Q76N03|Q8NCV7|Q96CZ8	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ser/Thr_kinase_SIK1/2,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.D870N	ENST00000304987.3	37	c.2608	CCDS8347.1	11	.	.	.	.	.	.	.	.	.	.	G	9.208	1.030264	0.19512	.	.	ENSG00000170145	ENST00000304987	T	0.75367	-0.93	5.13	4.2	0.49525	.	0.104155	0.64402	D	0.000005	T	0.61489	0.2351	L	0.43152	1.355	0.46317	D	0.998983	B	0.06786	0.001	B	0.06405	0.002	T	0.54708	-0.8253	10	0.23891	T	0.37	.	6.362	0.21433	0.0905:0.0:0.7258:0.1837	.	870	Q9H0K1	SIK2_HUMAN	N	870	ENSP00000305976:D870N	ENSP00000305976:D870N	D	+	1	0	SIK2	111099890	1.000000	0.71417	0.630000	0.29268	0.015000	0.08874	2.329000	0.43876	1.361000	0.45981	0.655000	0.94253	GAT	SIK2	-	pirsf_Ser/Thr_kinase_SIK1/2	ENSG00000170145		0.617	SIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIK2	HGNC	protein_coding	OTTHUMT00000319352.3	68	0.00	0	G	NM_015191		111594680	111594680	+1	no_errors	ENST00000304987	ensembl	human	known	69_37n	missense	71	23.66	22	SNP	1.000	A
SLC6A3	6531	genome.wustl.edu	37	5	1406352	1406352	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr5:1406352C>G	ENST00000270349.9	-	12	1677	c.1550G>C	c.(1549-1551)aGc>aCc	p.S517T	SLC6A3_ENST00000453492.2_Missense_Mutation_p.S517T	NM_001044.4	NP_001035.1	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 3	517					adenohypophysis development (GO:0021984)|aging (GO:0007568)|cation transmembrane transport (GO:0098655)|cell death (GO:0008219)|dopamine biosynthetic process (GO:0042416)|dopamine catabolic process (GO:0042420)|dopamine transport (GO:0015872)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|neurotransmitter biosynthetic process (GO:0042136)|positive regulation of multicellular organism growth (GO:0040018)|prepulse inhibition (GO:0060134)|regulation of dopamine metabolic process (GO:0042053)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to iron ion (GO:0010039)|response to nicotine (GO:0035094)|sensory perception of smell (GO:0007608)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine transmembrane transporter activity (GO:0005329)|dopamine:sodium symporter activity (GO:0005330)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)			breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(19)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Benzatropine(DB00245)|Benzphetamine(DB00865)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Cocaine(DB00907)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Diphenylpyraline(DB01146)|Dopamine(DB00988)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fencamfamine(DB01463)|Imipramine(DB00458)|Ioflupane I 123(DB08824)|Lisdexamfetamine(DB01255)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Mirtazapine(DB00370)|Modafinil(DB00745)|Nefazodone(DB01149)|Pethidine(DB00454)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Trimipramine(DB00726)|Venlafaxine(DB00285)	CCAGTACAGGCTGGGCCGCTG	0.657																																						dbGAP											0													64.0	63.0	64.0					5																	1406352		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3863.1	5p15.3	2013-07-19	2013-07-19		ENSG00000142319	ENSG00000142319		"""Solute carriers"""	11049	protein-coding gene	gene with protein product	"""dopamine transporter"""	126455	"""solute carrier family 6 (neurotransmitter transporter, dopamine), member 3"", ""dopamine transporter 1"""	DAT1		1406597	Standard	NM_001044		Approved	DAT	uc003jck.3	Q01959	OTTHUMG00000131016	ENST00000270349.9:c.1550G>C	5.37:g.1406352C>G	ENSP00000270349:p.Ser517Thr		A2RUN4|Q14996	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_dopamine	p.S517T	ENST00000270349.9	37	c.1550	CCDS3863.1	5	.	.	.	.	.	.	.	.	.	.	c	14.98	2.697957	0.48307	.	.	ENSG00000142319	ENST00000270349;ENST00000453492	T;T	0.74842	-0.88;-0.88	4.19	2.97	0.34412	.	0.343265	0.30714	N	0.009039	T	0.69922	0.3165	L	0.58428	1.81	0.23988	N	0.996253	B	0.20459	0.045	B	0.32211	0.142	T	0.62196	-0.6905	10	0.49607	T	0.09	.	7.8662	0.29539	0.0:0.8308:0.0:0.1692	.	517	Q01959	SC6A3_HUMAN	T	517	ENSP00000270349:S517T;ENSP00000399806:S517T	ENSP00000270349:S517T	S	-	2	0	SLC6A3	1459352	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	5.244000	0.65400	0.436000	0.26393	0.298000	0.19748	AGC	SLC6A3	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport	ENSG00000142319		0.657	SLC6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A3	HGNC	protein_coding	OTTHUMT00000253650.3	10	0.00	0	C	NM_001044		1406352	1406352	-1	no_errors	ENST00000270349	ensembl	human	known	69_37n	missense	6	70.00	14	SNP	1.000	G
SLC7A4	6545	genome.wustl.edu	37	22	21385708	21385708	+	Missense_Mutation	SNP	C	C	T	rs370470814	byFrequency	TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr22:21385708C>T	ENST00000382932.2	-	2	461	c.394G>A	c.(394-396)Gcc>Acc	p.A132T	MIR649_ENST00000384843.1_RNA|SLC7A4_ENST00000403586.1_Missense_Mutation_p.A132T|AC002472.11_ENST00000450652.1_RNA	NM_004173.2	NP_004164.2	O43246	CTR4_HUMAN	solute carrier family 7, member 4	132					basic amino acid transport (GO:0015802)|cellular amino acid metabolic process (GO:0006520)|transport (GO:0006810)	integral component of membrane (GO:0016021)	basic amino acid transmembrane transporter activity (GO:0015174)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(7)|ovary(1)|prostate(2)	18	all_cancers(11;2.85e-22)|Lung NSC(8;4.21e-14)|all_lung(8;6.08e-13)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0968)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)		L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	CGGGCCACGGCGGCGCCACCG	0.607													C|||	16	0.00319489	0.0	0.0	5008	,	,		16333	0.001		0.0	False		,,,				2504	0.0153					dbGAP											0													39.0	36.0	37.0					22																	21385708		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ000730	CCDS33608.1	22q11.21	2013-07-19	2013-07-19		ENSG00000099960	ENSG00000099960		"""Solute carriers"""	11062	protein-coding gene	gene with protein product		603752	"""solute carrier family 7 (cationic amino acid transporter, y+ system), member 4"", ""solute carrier family 7 (orphan transporter), member 4"""			9598310, 11665818	Standard	NM_004173		Approved	HCAT3, CAT-4, VH	uc002zud.3	O43246	OTTHUMG00000150896	ENST00000382932.2:c.394G>A	22.37:g.21385708C>T	ENSP00000372390:p.Ala132Thr		Q0P5U2|Q3KNQ6|Q4VC45|Q6IBY8|Q96H88	Missense_Mutation	SNP	pfam_AA-permease_dom,pirsf_AA/rel_permease1	p.A132T	ENST00000382932.2	37	c.394	CCDS33608.1	22	.	.	.	.	.	.	.	.	.	.	C	17.15	3.315238	0.60524	.	.	ENSG00000099960	ENST00000403586;ENST00000382932	D;D	0.90004	-2.6;-2.6	5.28	4.24	0.50183	Amino acid permease domain (1);	0.111405	0.64402	N	0.000011	D	0.90137	0.6918	L	0.59967	1.855	0.58432	D	0.999998	P	0.50156	0.932	P	0.54026	0.74	D	0.89284	0.3614	10	0.46703	T	0.11	.	11.2283	0.48897	0.0:0.9056:0.0:0.0944	.	132	O43246	CTR4_HUMAN	T	132	ENSP00000384278:A132T;ENSP00000372390:A132T	ENSP00000372390:A132T	A	-	1	0	SLC7A4	19715708	1.000000	0.71417	0.020000	0.16555	0.015000	0.08874	5.683000	0.68189	1.293000	0.44690	0.561000	0.74099	GCC	SLC7A4	-	pfam_AA-permease_dom,pirsf_AA/rel_permease1	ENSG00000099960		0.607	SLC7A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A4	HGNC	protein_coding	OTTHUMT00000320467.1	24	0.00	0	C	NM_004173		21385708	21385708	-1	no_errors	ENST00000382932	ensembl	human	known	69_37n	missense	10	33.33	5	SNP	0.978	T
SOAT1	6646	genome.wustl.edu	37	1	179308636	179308636	+	Silent	SNP	C	C	T			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr1:179308636C>T	ENST00000367619.3	+	6	596	c.453C>T	c.(451-453)ctC>ctT	p.L151L	SOAT1_ENST00000540564.1_Silent_p.L93L|SOAT1_ENST00000539888.1_Silent_p.L86L|SOAT1_ENST00000535686.1_5'UTR	NM_003101.5	NP_003092.4	P35610	SOAT1_HUMAN	sterol O-acyltransferase 1	151					cholesterol efflux (GO:0033344)|cholesterol esterification (GO:0034435)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol storage (GO:0010878)|macrophage derived foam cell differentiation (GO:0010742)|positive regulation of amyloid precursor protein biosynthetic process (GO:0042986)|very-low-density lipoprotein particle assembly (GO:0034379)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	cholesterol binding (GO:0015485)|cholesterol O-acyltransferase activity (GO:0034736)|fatty-acyl-CoA binding (GO:0000062)|sterol O-acyltransferase activity (GO:0004772)			central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(10)|prostate(1)|skin(3)|stomach(1)	20					Ezetimibe(DB00973)|Hesperetin(DB01094)	TCCTCATTCTCTTTATCCTCA	0.363																																						dbGAP											0													177.0	167.0	171.0					1																	179308636		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L21934	CCDS1330.1, CCDS58047.1, CCDS58048.1	1q25	2008-08-26	2008-08-26		ENSG00000057252	ENSG00000057252	2.3.1.26		11177	protein-coding gene	gene with protein product	"""acyl-Coenzyme A: cholesterol acyltransferase"""	102642	"""sterol O-acyltransferase (acyl-Coenzyme A: cholesterol acyltransferase) 1"""	SOAT, STAT		8407899	Standard	NM_003101		Approved	ACAT	uc001gml.3	P35610	OTTHUMG00000035253	ENST00000367619.3:c.453C>T	1.37:g.179308636C>T			A6NC40|A8K3P4|A9Z1V7|B4DU95|Q5T0X4|Q8N1E4	Silent	SNP	pfam_MBOAT_fam	p.L151	ENST00000367619.3	37	c.453	CCDS1330.1	1																																																																																			SOAT1	-	NULL	ENSG00000057252		0.363	SOAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOAT1	HGNC	protein_coding	OTTHUMT00000085286.2	247	0.00	0	C	NM_003101		179308636	179308636	+1	no_errors	ENST00000367619	ensembl	human	known	69_37n	silent	198	22.35	57	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7578554	7578554	+	Splice_Site	SNP	A	A	T			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr17:7578554A>T	ENST00000269305.4	-	5	565	c.376T>A	c.(376-378)Tac>Aac	p.Y126N	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Splice_Site_p.Y126N|TP53_ENST00000420246.2_Splice_Site_p.Y126N|TP53_ENST00000413465.2_Splice_Site_p.Y126N|TP53_ENST00000455263.2_Splice_Site_p.Y126N|TP53_ENST00000359597.4_Splice_Site_p.Y126N	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	126	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> G (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|Y -> H (in sporadic cancers; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y126D(9)|p.0?(8)|p.Y126N(6)|p.Y126_K132delYSPALNK(6)|p.Y126_N131delYSPALN(3)|p.Y33D(2)|p.V73fs*9(1)|p.?(1)|p.Y126fs*11(1)|p.P13fs*18(1)|p.T125_Y126insX(1)|p.Y126fs*18(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCAGGGGAGTACTGTAGGAAG	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	40	Substitution - Missense(17)|Deletion - In frame(9)|Whole gene deletion(8)|Deletion - Frameshift(4)|Insertion - In frame(1)|Unknown(1)	central_nervous_system(6)|haematopoietic_and_lymphoid_tissue(6)|upper_aerodigestive_tract(4)|large_intestine(4)|lung(4)|prostate(4)|bone(4)|breast(3)|ovary(2)|stomach(1)|liver(1)|oesophagus(1)	GRCh37	CI004819	TP53	I							42.0	43.0	43.0					17																	7578554		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.376-1T>A	17.37:g.7578554A>T			Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.Y126N	ENST00000269305.4	37	c.376	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	25.5	4.639687	0.87760	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000514944;ENST00000508793;ENST00000503591	D;D;D;D;D;D;D;D;D	0.99869	-7.33;-7.33;-7.33;-7.33;-7.33;-7.33;-7.33;-7.33;-7.33	5.48	5.48	0.80851	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99869	0.9938	M	0.90483	3.12	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.998;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.999;0.999;1.0;0.961;1.0;1.0;1.0	D	0.96375	0.9277	10	0.87932	D	0	-28.2517	13.8301	0.63375	1.0:0.0:0.0:0.0	.	87;126;126;33;126;126;126	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	N	126;126;126;126;126;126;115;33;33;126;126	ENSP00000410739:Y126N;ENSP00000352610:Y126N;ENSP00000269305:Y126N;ENSP00000398846:Y126N;ENSP00000391127:Y126N;ENSP00000391478:Y126N;ENSP00000423862:Y33N;ENSP00000424104:Y126N;ENSP00000426252:Y126N	ENSP00000269305:Y126N	Y	-	1	0	TP53	7519279	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	9.240000	0.95396	2.206000	0.71126	0.533000	0.62120	TAC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	80	0.00	0	A	NM_000546	Missense_Mutation	7578554	7578554	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	21	61.11	33	SNP	1.000	T
TPD52L2	7165	genome.wustl.edu	37	20	62520553	62520553	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr20:62520553A>C	ENST00000346249.4	+	6	563	c.487A>C	c.(487-489)Acc>Ccc	p.T163P	TPD52L2_ENST00000217121.5_Missense_Mutation_p.T186P|TPD52L2_ENST00000369927.4_Missense_Mutation_p.T120P|TPD52L2_ENST00000348257.5_Missense_Mutation_p.T143P|TPD52L2_ENST00000351424.4_Missense_Mutation_p.T166P|TPD52L2_ENST00000358548.4_Missense_Mutation_p.T157P|TPD52L2_ENST00000352482.4_Missense_Mutation_p.T177P	NM_001243891.1|NM_003288.3	NP_001230820.1|NP_003279.2	O43399	TPD54_HUMAN	tumor protein D52-like 2	163					regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8	all_cancers(38;1.3e-12)|all_epithelial(29;2.23e-14)|Lung NSC(23;5.92e-10)|all_lung(23;2.08e-09)					GAACTCTGCGACCTTCAAGTC	0.512																																						dbGAP											0													136.0	111.0	119.0					20																	62520553		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF004430	CCDS13540.1, CCDS13541.1, CCDS13542.1, CCDS13543.1, CCDS13544.1, CCDS13545.1, CCDS58785.1, CCDS74752.1, CCDS74753.1	20q13.2-q13.3	2007-12-19			ENSG00000101150	ENSG00000101150			12007	protein-coding gene	gene with protein product		603747				9484778	Standard	NM_199360		Approved	D54, hD54	uc002ygy.3	O43399	OTTHUMG00000033009	ENST00000346249.4:c.487A>C	20.37:g.62520553A>C	ENSP00000343547:p.Thr163Pro		B4DPJ6|E1P5G7|O43398|Q5JWU5|Q5JWU6|Q5JWU8|Q5U0E0|Q9H3Z6	Missense_Mutation	SNP	pfam_TPD52	p.T186P	ENST00000346249.4	37	c.556	CCDS13540.1	20	.	.	.	.	.	.	.	.	.	.	A	19.95	3.921920	0.73213	.	.	ENSG00000101150	ENST00000369927;ENST00000346249;ENST00000348257;ENST00000352482;ENST00000351424;ENST00000217121;ENST00000358548	T;T;T;T;T;T;T	0.27720	1.65;1.65;1.65;1.65;1.65;1.65;1.65	5.26	4.14	0.48551	.	0.056258	0.64402	D	0.000001	T	0.55194	0.1905	M	0.85859	2.78	0.43372	D	0.995468	D;D;D;D;D;P;D;D;D	0.71674	0.961;0.981;0.979;0.967;0.979;0.951;0.987;0.998;0.998	P;P;P;P;P;P;P;D;D	0.71656	0.756;0.908;0.906;0.908;0.906;0.886;0.854;0.962;0.974	T	0.58200	-0.7678	10	0.87932	D	0	-16.6348	8.8719	0.35320	0.9128:0.0:0.0872:0.0	.	120;114;163;143;163;157;166;177;186	B4DPJ6;B4DDV4;Q6FGS1;Q68E05;O43399;O43399-4;O43399-3;Q5U0E0;Q5JWU6	.;.;.;.;TPD54_HUMAN;.;.;.;.	P	120;163;143;177;166;186;157	ENSP00000358943:T120P;ENSP00000343547:T163P;ENSP00000343554:T143P;ENSP00000344647:T177P;ENSP00000340006:T166P;ENSP00000217121:T186P;ENSP00000351350:T157P	ENSP00000217121:T186P	T	+	1	0	TPD52L2	61990997	0.996000	0.38824	0.799000	0.32177	0.958000	0.62258	3.430000	0.52807	0.810000	0.34279	0.460000	0.39030	ACC	TPD52L2	-	pfam_TPD52	ENSG00000101150		0.512	TPD52L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPD52L2	HGNC	protein_coding	OTTHUMT00000080248.1	186	0.53	1	A			62520553	62520553	+1	no_errors	ENST00000217121	ensembl	human	known	69_37n	missense	107	47.32	97	SNP	0.962	C
TPSB2	64499	genome.wustl.edu	37	16	1279650	1279650	+	RNA	SNP	G	G	C			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr16:1279650G>C	ENST00000339687.6	-	0	172				TPSB2_ENST00000445910.1_RNA|TPSB2_ENST00000430512.2_RNA			P20231	TRYB2_HUMAN	tryptase beta 2 (gene/pseudogene)							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			lung(1)|upper_aerodigestive_tract(1)	2		Hepatocellular(780;0.00369)				ATCGGTCGCGGACTCTCAGGC	0.706																																						dbGAP											0													40.0	51.0	47.0					16																	1279650		2151	4299	6450	-	-	-			0			AF099143		16p13.3	2009-11-20	2009-11-18		ENSG00000197253	ENSG00000197253			14120	protein-coding gene	gene with protein product	"""tryptase beta II"", ""tryptase beta III"""	191081	"""tryptase beta 2"""			19748655	Standard	NM_024164		Approved		uc002cky.3	P20231	OTTHUMG00000155926		16.37:g.1279650G>C			D2E6S0|D2E6S2|O95827|Q15664|Q9UQI6|Q9UQI7	Silent	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.V50	ENST00000339687.6	37	c.150		16																																																																																			TPSB2	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000197253		0.706	TPSB2-002	KNOWN	basic	processed_transcript	TPSB2	HGNC	polymorphic_pseudogene	OTTHUMT00000342364.1	40	0.00	0	G	NM_024164		1279650	1279650	-1	no_errors	ENST00000430512	ensembl	human	known	69_37n	silent	9	70.59	24	SNP	0.000	C
TRHDE	29953	genome.wustl.edu	37	12	72956000	72956000	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr12:72956000C>T	ENST00000261180.4	+	8	1805	c.1709C>T	c.(1708-1710)aCa>aTa	p.T570I	TRHDE_ENST00000549138.1_3'UTR	NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	570					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						CTCTGGAATACATTATCGGAG	0.294																																						dbGAP											0													41.0	43.0	42.0					12																	72956000		2200	4272	6472	-	-	-	SO:0001583	missense	0			AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.1709C>T	12.37:g.72956000C>T	ENSP00000261180:p.Thr570Ile		A5PL19|Q6UWJ4	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.T570I	ENST00000261180.4	37	c.1709	CCDS9004.1	12	.	.	.	.	.	.	.	.	.	.	C	13.71	2.318736	0.41096	.	.	ENSG00000072657	ENST00000261180	T	0.04603	3.59	5.98	5.98	0.97165	.	0.101398	0.64402	D	0.000002	T	0.05227	0.0139	N	0.21282	0.65	0.41780	D	0.989815	B	0.32324	0.364	B	0.24974	0.057	T	0.48703	-0.9012	10	0.45353	T	0.12	.	20.452	0.99131	0.0:1.0:0.0:0.0	.	570	Q9UKU6	TRHDE_HUMAN	I	570	ENSP00000261180:T570I	ENSP00000261180:T570I	T	+	2	0	TRHDE	71242267	1.000000	0.71417	0.956000	0.39512	0.954000	0.61252	3.442000	0.52900	2.838000	0.97847	0.591000	0.81541	ACA	TRHDE	-	NULL	ENSG00000072657		0.294	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRHDE	HGNC	protein_coding	OTTHUMT00000405380.1	65	0.00	0	C	NM_013381		72956000	72956000	+1	no_errors	ENST00000261180	ensembl	human	known	69_37n	missense	47	28.79	19	SNP	1.000	T
TRIM51HP	440041	genome.wustl.edu	37	11	55065515	55065515	+	RNA	SNP	G	G	T			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr11:55065515G>T	ENST00000526016.1	-	0	193					NR_038174.2				tripartite motif-containing 51H, pseudogene																		TGGCTTTTCTGGCAATGGAAG	0.463																																						dbGAP											0																																										-	-	-			0					11q11	2012-11-02			ENSG00000166007	ENSG00000166007		"""Triparite motif-containing / Pseudogenes"""	43977	pseudogene	pseudogene							Standard	NR_038174		Approved		uc021qjb.1		OTTHUMG00000166775		11.37:g.55065515G>T				RNA	SNP	-	NULL	ENST00000526016.1	37	NULL		11																																																																																			TRIM51HP	-	-	ENSG00000166007		0.463	TRIM51HP-002	PUTATIVE	basic|exp_conf	processed_transcript	TRIM51HP	HGNC	pseudogene	OTTHUMT00000391438.1	26	0.00	0	G			55065515	55065515	-1	no_errors	ENST00000526016	ensembl	human	putative	69_37n	rna	21	36.36	12	SNP	0.232	T
TRIM52	84851	genome.wustl.edu	37	5	180687133	180687133	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr5:180687133A>C	ENST00000327767.4	-	1	986	c.682T>G	c.(682-684)Ttt>Gtt	p.F228V	TRIM52-AS1_ENST00000514146.1_RNA|CTC-338M12.4_ENST00000505151.1_RNA|TRIM52-AS1_ENST00000509252.1_RNA|CTC-338M12.4_ENST00000511331.1_RNA|CTC-338M12.4_ENST00000506340.1_RNA|TRIM52_ENST00000514805.1_5'UTR|TRIM52-AS1_ENST00000507434.1_RNA|CTC-338M12.4_ENST00000417281.2_RNA	NM_032765.2	NP_116154.1	Q96A61	TRI52_HUMAN	tripartite motif containing 52	228					positive regulation of NF-kappaB transcription factor activity (GO:0051092)	intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(3)|skin(1)|stomach(1)	8	all_cancers(89;8.79e-06)|all_epithelial(37;1.13e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0654)	all_cancers(40;0.0106)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.0588)|all_lung(500;0.149)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.232)		TGGTGTTTAAAGCACATGCCC	0.532																																						dbGAP											0													114.0	111.0	112.0					5																	180687133		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4467.1	5q35.3	2013-01-09	2011-01-25		ENSG00000183718	ENSG00000183718		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19024	protein-coding gene	gene with protein product			"""tripartite motif-containing 52"""				Standard	NM_032765		Approved	RNF102	uc003mnp.3	Q96A61	OTTHUMG00000130964	ENST00000327767.4:c.682T>G	5.37:g.180687133A>C	ENSP00000332152:p.Phe228Val			Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_Znf_B-box,pfscan_Znf_B-box,pfscan_Znf_RING	p.F228V	ENST00000327767.4	37	c.682	CCDS4467.1	5	.	.	.	.	.	.	.	.	.	.	a	2.081	-0.410820	0.04799	.	.	ENSG00000183718	ENST00000327767	T	0.41758	0.99	3.5	-3.35	0.04928	Zinc finger, B-box (3);	.	.	.	.	T	0.11367	0.0277	N	0.00566	-1.37	0.09310	N	1	B	0.13594	0.008	B	0.08055	0.003	T	0.31779	-0.9931	9	0.25751	T	0.34	.	7.8965	0.29710	0.2356:0.1677:0.5967:0.0	.	228	Q96A61	TRI52_HUMAN	V	228	ENSP00000332152:F228V	ENSP00000332152:F228V	F	-	1	0	TRIM52	180619739	0.000000	0.05858	0.003000	0.11579	0.005000	0.04900	-0.329000	0.07935	-0.561000	0.06094	-0.385000	0.06624	TTT	TRIM52	-	pfam_Znf_B-box,smart_Znf_B-box,pfscan_Znf_B-box	ENSG00000183718		0.532	TRIM52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM52	HGNC	protein_coding	OTTHUMT00000253572.3	82	0.00	0	A	NM_032765		180687133	180687133	-1	no_errors	ENST00000327767	ensembl	human	known	69_37n	missense	18	45.45	15	SNP	0.002	C
USH2A	7399	genome.wustl.edu	37	1	215847722	215847722	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr1:215847722C>A	ENST00000307340.3	-	63	13917	c.13531G>T	c.(13531-13533)Gcc>Tcc	p.A4511S	USH2A_ENST00000366943.2_Missense_Mutation_p.A4511S	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4511	Fibronectin type-III 30. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CTGTTGCTGGCAGTTACTGTG	0.502										HNSCC(13;0.011)																												dbGAP											0													116.0	111.0	113.0					1																	215847722		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.13531G>T	1.37:g.215847722C>A	ENSP00000305941:p.Ala4511Ser		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.A4511S	ENST00000307340.3	37	c.13531	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	C	17.96	3.515438	0.64634	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.75704	-0.38;-0.96	4.29	4.29	0.51040	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.39759	U	0.001268	D	0.89543	0.6745	M	0.93638	3.44	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.92382	0.5914	10	0.59425	D	0.04	.	17.1095	0.86672	0.0:1.0:0.0:0.0	.	4511	O75445	USH2A_HUMAN	S	4511	ENSP00000305941:A4511S;ENSP00000355910:A4511S	ENSP00000305941:A4511S	A	-	1	0	USH2A	213914345	1.000000	0.71417	0.976000	0.42696	0.217000	0.24651	7.476000	0.81055	2.091000	0.63221	0.467000	0.42956	GCC	USH2A	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000042781		0.502	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	109	0.00	0	C	NM_007123		215847722	215847722	-1	no_errors	ENST00000366943	ensembl	human	known	69_37n	missense	82	29.06	34	SNP	1.000	A
TRIM67	440730	genome.wustl.edu	37	1	231335936	231335936	+	Nonsense_Mutation	SNP	C	C	T			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr1:231335936C>T	ENST00000366653.5	+	4	1306	c.1306C>T	c.(1306-1308)Cag>Tag	p.Q436*	TRIM67_ENST00000449018.3_Nonsense_Mutation_p.Q374*|TRIM67_ENST00000366652.2_Nonsense_Mutation_p.Q436*|TRIM67_ENST00000444294.3_Nonsense_Mutation_p.Q436*			Q6ZTA4	TRI67_HUMAN	tripartite motif containing 67	436					negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)				GAAGCTGCGTCAGTCCACCGG	0.532																																						dbGAP											0													154.0	156.0	155.0					1																	231335936		2022	4183	6205	-	-	-	SO:0001587	stop_gained	0			AK126782	CCDS44333.1, CCDS73048.1	1q42.2	2014-02-17	2011-01-25		ENSG00000119283	ENSG00000119283		"""Tripartite motif containing / Tripartite motif containing"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	31859	protein-coding gene	gene with protein product		610584	"""tripartite motif-containing 67"""				Standard	NM_001004342		Approved	TNL	uc009xfn.1	Q6ZTA4	OTTHUMG00000037958	ENST00000366653.5:c.1306C>T	1.37:g.231335936C>T	ENSP00000355613:p.Gln436*		Q5TER7|Q5TER8|Q7Z4K7	Nonsense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Fibronectin_type3,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box	p.Q436*	ENST00000366653.5	37	c.1306	CCDS44333.1	1	.	.	.	.	.	.	.	.	.	.	C	43	10.454749	0.99408	.	.	ENSG00000119283	ENST00000444294;ENST00000366652;ENST00000449018;ENST00000366653	.	.	.	5.31	5.31	0.75309	.	0.054054	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	.	18.9705	0.92713	0.0:1.0:0.0:0.0	.	.	.	.	X	436;436;374;436	.	ENSP00000355612:Q436X	Q	+	1	0	TRIM67	229402559	1.000000	0.71417	0.997000	0.53966	0.010000	0.07245	7.776000	0.85560	2.482000	0.83794	0.555000	0.69702	CAG	TRIM67	-	smart_Bbox_C	ENSG00000119283		0.532	TRIM67-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	TRIM67	HGNC	protein_coding	OTTHUMT00000092649.3	78	0.00	0	C	NM_001004342		231335936	231335936	+1	no_errors	ENST00000366652	ensembl	human	known	69_37n	nonsense	89	18.35	20	SNP	1.000	T
VPS26B	112936	genome.wustl.edu	37	11	134115368	134115368	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr11:134115368G>A	ENST00000281187.5	+	6	1373	c.895G>A	c.(895-897)Gta>Ata	p.V299I	VPS26B_ENST00000525095.2_Missense_Mutation_p.V299I	NM_052875.3	NP_443107.1	Q4G0F5	VP26B_HUMAN	vacuolar protein sorting 26 homolog B (S. pombe)	299					protein transport (GO:0015031)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)				breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)	14	all_hematologic(175;0.127)	all_cancers(12;1.1e-21)|all_epithelial(12;3.77e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;2.43e-10)|all cancers(11;2.94e-09)|BRCA - Breast invasive adenocarcinoma(10;9.57e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00164)|Lung(977;0.216)		GGGTGACATCGTACGGAAGAG	0.607																																					Colon(171;1263 1952 15904 45703 47982)	dbGAP											0													103.0	82.0	89.0					11																	134115368		2201	4297	6498	-	-	-	SO:0001583	missense	0				CCDS8495.1	11q25	2008-02-05	2007-01-12		ENSG00000151502	ENSG00000151502			28119	protein-coding gene	gene with protein product		610027	"""vacuolar protein sorting 26 homolog B (yeast)"""			16190980	Standard	NM_052875		Approved	MGC10485, Pep8b	uc001qhe.3	Q4G0F5	OTTHUMG00000167175	ENST00000281187.5:c.895G>A	11.37:g.134115368G>A	ENSP00000281187:p.Val299Ile		Q96A55	Missense_Mutation	SNP	pfam_VPS26,superfamily_Ig_E-set	p.V299I	ENST00000281187.5	37	c.895	CCDS8495.1	11	.	.	.	.	.	.	.	.	.	.	G	15.71	2.912454	0.52439	.	.	ENSG00000151502	ENST00000281187;ENST00000525095	.	.	.	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.51601	0.1684	N	0.22421	0.69	0.80722	D	1	B	0.10296	0.003	B	0.04013	0.001	T	0.41592	-0.9500	9	0.36615	T	0.2	-17.9202	19.2118	0.93758	0.0:0.0:1.0:0.0	.	299	Q4G0F5	VP26B_HUMAN	I	299;298	.	ENSP00000281187:V299I	V	+	1	0	VPS26B	133620578	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	6.438000	0.73426	2.554000	0.86153	0.561000	0.74099	GTA	VPS26B	-	NULL	ENSG00000151502		0.607	VPS26B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS26B	HGNC	protein_coding	OTTHUMT00000393591.1	101	0.00	0	G	NM_052875		134115368	134115368	+1	no_errors	ENST00000281187	ensembl	human	known	69_37n	missense	29	52.46	32	SNP	1.000	A
YLPM1	56252	genome.wustl.edu	37	14	75248373	75248373	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr14:75248373C>A	ENST00000552421.1	+	4	1751	c.1627C>A	c.(1627-1629)Cca>Aca	p.P543T	YLPM1_ENST00000238571.3_Intron|YLPM1_ENST00000325680.7_Missense_Mutation_p.P543T			P49750	YLPM1_HUMAN	YLP motif containing 1	0					regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		TCCTTCATTGCCACCACCAGT	0.562																																						dbGAP											0													221.0	227.0	225.0					14																	75248373		2106	4213	6319	-	-	-	SO:0001583	missense	0			AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000552421.1:c.1627C>A	14.37:g.75248373C>A	ENSP00000447921:p.Pro543Thr		P49752|Q96I64|Q9P1V7	Missense_Mutation	SNP	superfamily_FH2_actin-bd	p.P543T	ENST00000552421.1	37	c.1627		14	.	.	.	.	.	.	.	.	.	.	C	14.41	2.527241	0.44969	.	.	ENSG00000119596	ENST00000552421;ENST00000325680;ENST00000423680	.	.	.	5.66	5.66	0.87406	.	.	.	.	.	T	0.68357	0.2992	L	0.55990	1.75	0.80722	D	1	D	0.63880	0.993	P	0.60886	0.88	T	0.66006	-0.6030	8	0.39692	T	0.17	.	15.285	0.73822	0.0:0.8192:0.1808:0.0	.	543	P49750-4	.	T	543;543;256	.	ENSP00000324463:P543T	P	+	1	0	YLPM1	74318126	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.163000	0.50763	2.677000	0.91161	0.591000	0.81541	CCA	YLPM1	-	NULL	ENSG00000119596		0.562	YLPM1-008	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	YLPM1	HGNC	protein_coding	OTTHUMT00000404450.1	248	0.00	0	C	NM_019589		75248373	75248373	+1	no_errors	ENST00000325680	ensembl	human	known	69_37n	missense	62	50.40	63	SNP	1.000	A
ZBTB11	27107	genome.wustl.edu	37	3	101370349	101370349	+	Silent	SNP	C	C	T			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr3:101370349C>T	ENST00000312938.4	-	11	3403	c.2823G>A	c.(2821-2823)gtG>gtA	p.V941V		NM_014415.3	NP_055230.2	O95625	ZBT11_HUMAN	zinc finger and BTB domain containing 11	941					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						TTTTGCAAGGCACATAGTCTC	0.443																																						dbGAP											0													133.0	130.0	131.0					3																	101370349		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U69274	CCDS2943.1	3q12.3	2013-01-09			ENSG00000066422	ENSG00000066422		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	16740	protein-coding gene	gene with protein product							Standard	NM_014415		Approved	ZNF-U69274, ZNF913	uc003dve.4	O95625	OTTHUMG00000159133	ENST00000312938.4:c.2823G>A	3.37:g.101370349C>T			Q2NKP9	Silent	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.V941	ENST00000312938.4	37	c.2823	CCDS2943.1	3																																																																																			ZBTB11	-	pfscan_Znf_C2H2	ENSG00000066422		0.443	ZBTB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB11	HGNC	protein_coding	OTTHUMT00000353441.2	131	0.00	0	C	NM_014415		101370349	101370349	-1	no_errors	ENST00000312938	ensembl	human	known	69_37n	silent	50	15.25	9	SNP	1.000	T
ZFAT	57623	genome.wustl.edu	37	8	135622886	135622886	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr8:135622886T>C	ENST00000377838.3	-	4	635	c.461A>G	c.(460-462)gAc>gGc	p.D154G	ZFAT_ENST00000520356.1_Missense_Mutation_p.D142G|ZFAT_ENST00000523399.1_Intron|ZFAT_ENST00000520727.1_Missense_Mutation_p.D142G|ZFAT_ENST00000520214.1_Missense_Mutation_p.D142G|ZFAT_ENST00000429442.2_Missense_Mutation_p.D142G	NM_001174157.1|NM_020863.3	NP_001167628.1|NP_065914.2	Q9P243	ZFAT_HUMAN	zinc finger and AT hook domain containing	154					hematopoietic progenitor cell differentiation (GO:0002244)|spongiotrophoblast layer development (GO:0060712)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(9)|large_intestine(8)|lung(16)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			TAGTTCAAGGTCAGACTCGTT	0.428																																						dbGAP											0													148.0	137.0	141.0					8																	135622886		1932	4129	6061	-	-	-	SO:0001583	missense	0			BC025423	CCDS43768.1, CCDS47924.1, CCDS43768.2, CCDS55275.1, CCDS55276.1	8q24.23	2008-06-05	2008-01-25	2008-01-25	ENSG00000066827	ENSG00000066827		"""Zinc fingers, C2H2-type"""	19899	protein-coding gene	gene with protein product		610931	"""zinc finger protein 406"""	ZNF406, ZFAT1		10819331, 18329245	Standard	NM_020863		Approved	KIAA1485	uc003yup.3	Q9P243	OTTHUMG00000164321	ENST00000377838.3:c.461A>G	8.37:g.135622886T>C	ENSP00000367069:p.Asp154Gly		B7ZL15|E9PER3|Q3MIM5|Q6PJ01|Q75PJ6|Q75PJ7|Q75PJ9|Q86X64	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D154G	ENST00000377838.3	37	c.461	CCDS47924.1	8	.	.	.	.	.	.	.	.	.	.	T	16.66	3.186092	0.57909	.	.	ENSG00000066827	ENST00000520356;ENST00000520727;ENST00000429442;ENST00000377838;ENST00000520214;ENST00000318135;ENST00000398946;ENST00000522257	T;T;T;T;T;T	0.49720	2.98;2.92;2.93;2.91;2.92;0.77	5.36	5.36	0.76844	.	0.191393	0.46442	D	0.000290	T	0.47060	0.1425	L	0.29908	0.895	0.80722	D	1	P;D;P	0.54047	0.842;0.964;0.734	B;P;B	0.52823	0.169;0.71;0.243	T	0.31971	-0.9924	10	0.23891	T	0.37	-41.6781	14.5371	0.67969	0.0:0.0:0.0:1.0	.	142;142;154	E9PBN4;Q9P243-3;Q9P243	.;.;ZFAT_HUMAN	G	142;142;142;154;142;142;142;92	ENSP00000427879:D142G;ENSP00000427831:D142G;ENSP00000394501:D142G;ENSP00000367069:D154G;ENSP00000428483:D142G;ENSP00000429983:D92G	ENSP00000326997:D142G	D	-	2	0	ZFAT	135692068	1.000000	0.71417	0.990000	0.47175	0.997000	0.91878	5.567000	0.67378	2.021000	0.59480	0.533000	0.62120	GAC	ZFAT	-	NULL	ENSG00000066827		0.428	ZFAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFAT	HGNC	protein_coding	OTTHUMT00000378272.1	192	0.00	0	T	NM_001029939		135622886	135622886	-1	no_errors	ENST00000377838	ensembl	human	known	69_37n	missense	314	12.01	43	SNP	0.999	C
ZFHX3	463	genome.wustl.edu	37	16	72830766	72830766	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr16:72830766C>G	ENST00000268489.5	-	9	6487	c.5815G>C	c.(5815-5817)Gat>Cat	p.D1939H	ZFHX3_ENST00000397992.5_Missense_Mutation_p.D1025H	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	1939					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				CCTCTGGCATCTGAAGCAATG	0.517																																						dbGAP											0													97.0	96.0	97.0					16																	72830766		2198	4300	6498	-	-	-	SO:0001583	missense	0			D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.5815G>C	16.37:g.72830766C>G	ENSP00000268489:p.Asp1939His		D3DWS8|O15101|Q13719	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.D1939H	ENST00000268489.5	37	c.5815	CCDS10908.1	16	.	.	.	.	.	.	.	.	.	.	C	15.20	2.764103	0.49574	.	.	ENSG00000140836	ENST00000268489;ENST00000397992	T;T	0.75154	-0.91;-0.89	5.73	5.73	0.89815	.	0.000000	0.49916	D	0.000137	T	0.81795	0.4898	L	0.39898	1.24	0.80722	D	1	D	0.89917	1.0	D	0.68192	0.956	T	0.80120	-0.1515	10	0.41790	T	0.15	.	19.9064	0.97008	0.0:1.0:0.0:0.0	.	1939	Q15911	ZFHX3_HUMAN	H	1939;1025	ENSP00000268489:D1939H;ENSP00000438926:D1025H	ENSP00000268489:D1939H	D	-	1	0	ZFHX3	71388267	1.000000	0.71417	0.996000	0.52242	0.994000	0.84299	7.810000	0.86072	2.693000	0.91896	0.655000	0.94253	GAT	ZFHX3	-	NULL	ENSG00000140836		0.517	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFHX3	HGNC	protein_coding	OTTHUMT00000269008.1	130	0.00	0	C	NM_006885		72830766	72830766	-1	no_errors	ENST00000268489	ensembl	human	known	69_37n	missense	78	27.78	30	SNP	1.000	G
ZNF208	7757	genome.wustl.edu	37	19	22171632	22171632	+	Nonsense_Mutation	SNP	A	A	C			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr19:22171632A>C	ENST00000397126.4	-	2	231	c.83T>G	c.(82-84)tTa>tGa	p.L28*	ZNF208_ENST00000599916.1_Nonsense_Mutation_p.L28*|ZNF208_ENST00000601773.1_Nonsense_Mutation_p.L28*|ZNF208_ENST00000597040.1_5'UTR	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	28	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				ATTTCTATATAAATTCTGCTG	0.403																																						dbGAP											0													135.0	144.0	141.0					19																	22171632		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.83T>G	19.37:g.22171632A>C	ENSP00000380315:p.Leu28*			Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L28*	ENST00000397126.4	37	c.83	CCDS54240.1	19	.	.	.	.	.	.	.	.	.	.	A	25.7	4.664800	0.88251	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	.	.	.	1.32	1.32	0.21799	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.1196	0.14852	1.0:0.0:0.0:0.0	.	.	.	.	X	28	.	ENSP00000380315:L28X	L	-	2	0	ZNF208	21963472	0.034000	0.19679	0.001000	0.08648	0.846000	0.48090	1.813000	0.38962	0.534000	0.28695	0.234000	0.17832	TTA	ZNF208	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000160321		0.403	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	HGNC	protein_coding	OTTHUMT00000464302.1	316	0.00	0	A	NM_007153		22171632	22171632	-1	no_errors	ENST00000397126	ensembl	human	known	69_37n	nonsense	332	20.38	85	SNP	0.007	C
ZNF219	51222	genome.wustl.edu	37	14	21560535	21560535	+	Silent	SNP	G	G	A			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr14:21560535G>A	ENST00000360947.3	-	3	1332	c.921C>T	c.(919-921)tgC>tgT	p.C307C	ZNF219_ENST00000421093.2_Silent_p.C307C|ZNF219_ENST00000451119.2_Silent_p.C307C|RP11-998D10.7_ENST00000554733.2_lincRNA|ZNF219_ENST00000556101.1_5'Flank	NM_016423.2	NP_057507.2	Q9P2Y4	ZN219_HUMAN	zinc finger protein 219	307					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of neurotransmitter levels (GO:0001505)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histamine receptor activity (GO:0004969)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(2)	8	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;9.86e-11)|Epithelial(56;1.27e-08)|all cancers(55;6.06e-08)	GBM - Glioblastoma multiforme(265;0.0191)		AGCAGCGGCCGCACACCGGAC	0.627																																						dbGAP											0													18.0	17.0	17.0					14																	21560535		2190	4294	6484	-	-	-	SO:0001819	synonymous_variant	0			AB015427	CCDS9568.1	14q11	2013-01-08			ENSG00000165804	ENSG00000165804		"""Zinc fingers, C2H2-type"""	13011	protein-coding gene	gene with protein product		605036				10819330	Standard	NM_016423		Approved		uc001vzs.2	Q9P2Y4	OTTHUMG00000029647	ENST00000360947.3:c.921C>T	14.37:g.21560535G>A			D3DS16|Q53Y57|Q8IYC1|Q9BW28	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2,prints_Histamine_H3_recept	p.C307	ENST00000360947.3	37	c.921	CCDS9568.1	14																																																																																			ZNF219	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000165804		0.627	ZNF219-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF219	HGNC	protein_coding	OTTHUMT00000073931.2	25	0.00	0	G			21560535	21560535	-1	no_errors	ENST00000360947	ensembl	human	known	69_37n	silent	8	55.56	10	SNP	0.981	A
ZNF263	10127	genome.wustl.edu	37	16	3339518	3339518	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr16:3339518C>T	ENST00000219069.5	+	6	1888	c.1012C>T	c.(1012-1014)Cat>Tat	p.H338Y	ZNF263_ENST00000574253.1_Silent_p.L171L|ZNF263_ENST00000538765.1_5'UTR	NM_005741.4	NP_005732.2	O14978	ZN263_HUMAN	zinc finger protein 263	338					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|skin(4)|urinary_tract(3)	20						GGGAAGACCTCATGACCGGTC	0.632																																						dbGAP											0													48.0	52.0	51.0					16																	3339518		2197	4300	6497	-	-	-	SO:0001583	missense	0			AC004232	CCDS10499.1	16p13.3	2013-01-09			ENSG00000006194	ENSG00000006194		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13056	protein-coding gene	gene with protein product		604191				9256059	Standard	NM_005741		Approved	FPM315, ZKSCAN12, ZSCAN44	uc002cuq.3	O14978	OTTHUMG00000129323	ENST00000219069.5:c.1012C>T	16.37:g.3339518C>T	ENSP00000219069:p.His338Tyr		B2R634|O43387|Q96H95	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.H338Y	ENST00000219069.5	37	c.1012	CCDS10499.1	16	.	.	.	.	.	.	.	.	.	.	C	4.552	0.102555	0.08731	.	.	ENSG00000006194	ENST00000219069	T	0.04970	3.52	4.63	0.235	0.15431	.	1.888230	0.02428	N	0.083315	T	0.03434	0.0099	N	0.08118	0	0.21652	N	0.999606	B	0.17268	0.021	B	0.14578	0.011	T	0.36456	-0.9747	10	0.02654	T	1	.	8.0684	0.30674	0.0:0.5788:0.3114:0.1099	.	338	O14978	ZN263_HUMAN	Y	338	ENSP00000219069:H338Y	ENSP00000219069:H338Y	H	+	1	0	ZNF263	3279519	0.000000	0.05858	0.071000	0.20095	0.312000	0.27988	-0.038000	0.12144	0.085000	0.17107	0.655000	0.94253	CAT	ZNF263	-	NULL	ENSG00000006194		0.632	ZNF263-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF263	HGNC	protein_coding	OTTHUMT00000251463.2	33	0.00	0	C			3339518	3339518	+1	no_errors	ENST00000219069	ensembl	human	known	69_37n	missense	33	21.43	9	SNP	0.236	T
ZNF568	374900	genome.wustl.edu	37	19	37427682	37427682	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1XW-01A-11D-A14K-09	TCGA-D8-A1XW-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f29405cc-d712-4562-ac02-ca3c89fb82af	df416cf7-8ddc-4ee0-b925-78a7e849ad84	g.chr19:37427682T>A	ENST00000333987.7	+	5	676	c.170T>A	c.(169-171)cTt>cAt	p.L57H	ZNF568_ENST00000455427.2_5'UTR|ZNF568_ENST00000427117.1_Missense_Mutation_p.L57H|ZNF568_ENST00000415168.1_5'UTR	NM_001204835.1|NM_198539.3	NP_001191764.1|NP_940941.2	Q3ZCX4	ZN568_HUMAN	zinc finger protein 568	57	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(9)|ovary(1)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GCTGTTGACCTTACCCAGGAG	0.403																																						dbGAP											0													89.0	90.0	90.0					19																	37427682		2201	4300	6501	-	-	-	SO:0001583	missense	0			BX640681	CCDS42558.1, CCDS56092.1, CCDS56093.1, CCDS74351.1	19q13.12	2013-09-20			ENSG00000198453	ENSG00000198453		"""Zinc fingers, C2H2-type"", ""-"""	25392	protein-coding gene	gene with protein product							Standard	NM_198539		Approved	DKFZp686B0797	uc002ofc.3	Q3ZCX4	OTTHUMG00000048160	ENST00000333987.7:c.170T>A	19.37:g.37427682T>A	ENSP00000334685:p.Leu57His		B4DS92|E7ER33|Q6N060|Q8NA64	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L57H	ENST00000333987.7	37	c.170	CCDS42558.1	19	.	.	.	.	.	.	.	.	.	.	T	16.88	3.245527	0.59103	.	.	ENSG00000198453	ENST00000427117;ENST00000333987;ENST00000444991	T;T;T	0.01963	4.53;4.53;4.53	4.69	3.65	0.41850	Krueppel-associated box (4);	.	.	.	.	T	0.07638	0.0192	L	0.54323	1.7	0.80722	D	1	D;P	0.89917	1.0;0.921	D;P	0.77557	0.99;0.771	T	0.06267	-1.0836	9	0.87932	D	0	.	7.123	0.25456	0.0:0.1031:0.0:0.8969	.	57;57	C9JZ58;Q3ZCX4	.;ZN568_HUMAN	H	57	ENSP00000407012:L57H;ENSP00000334685:L57H;ENSP00000389794:L57H	ENSP00000334685:L57H	L	+	2	0	ZNF568	42119522	0.835000	0.29415	0.993000	0.49108	0.930000	0.56654	2.773000	0.47686	0.783000	0.33636	0.533000	0.62120	CTT	ZNF568	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000198453		0.403	ZNF568-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF568	HGNC	protein_coding	OTTHUMT00000109572.2	143	0.00	0	T	NM_198539		37427682	37427682	+1	no_errors	ENST00000333987	ensembl	human	known	69_37n	missense	89	19.82	22	SNP	0.987	A
