#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
HYKK	123688	genome.wustl.edu	37	15	78825858	78825858	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr15:78825858C>G	ENST00000569878.1	+	4	968	c.968C>G	c.(967-969)tCt>tGt	p.S323C	HYKK_ENST00000563233.1_Intron|HYKK_ENST00000388988.4_Missense_Mutation_p.S323C|HYKK_ENST00000408962.2_Intron			A2RU49	HYKK_HUMAN	hydroxylysine kinase	323						cytoplasm (GO:0005737)	hydroxylysine kinase activity (GO:0047992)										GCTGCATACTCTTGCCAGCTA	0.443																																						dbGAP											0													185.0	155.0	165.0					15																	78825858		1885	4115	6000	-	-	-	SO:0001583	missense	0			BC132753, BC144383, BM045979	CCDS42063.1, CCDS45318.1	15q25.1	2013-06-11	2013-06-11	2013-06-11	ENSG00000188266	ENSG00000188266	2.7.1.81		34403	protein-coding gene	gene with protein product	"""5-hydroxylysine kinase"""	614681	"""aminoglycoside phosphotransferase domain containing 1"""	AGPHD1		18780872, 22241472	Standard	NM_001013619		Approved	LOC123688	uc010unc.2	A2RU49		ENST00000569878.1:c.968C>G	15.37:g.78825858C>G	ENSP00000455459:p.Ser323Cys		B7ZMA5|F8W6X5|Q6ZTN0	Missense_Mutation	SNP	pfam_Aminoglycoside_PTrfase,superfamily_Kinase-like_dom	p.S323C	ENST00000569878.1	37	c.968	CCDS42063.1	15	.	.	.	.	.	.	.	.	.	.	C	19.14	3.770318	0.69992	.	.	ENSG00000188266	ENST00000388988	T	0.31510	1.49	5.85	5.85	0.93711	.	0.189916	0.46145	D	0.000304	T	0.52549	0.1741	M	0.78049	2.395	0.80722	D	1	D	0.63046	0.992	P	0.57776	0.827	T	0.54063	-0.8349	10	0.59425	D	0.04	-5.8854	15.6181	0.76784	0.0:0.8632:0.1368:0.0	.	323	A2RU49	AGPD1_HUMAN	C	323	ENSP00000373640:S323C	ENSP00000373640:S323C	S	+	2	0	AGPHD1	76612913	0.966000	0.33281	0.999000	0.59377	0.994000	0.84299	2.803000	0.47924	2.767000	0.95098	0.655000	0.94253	TCT	AGPHD1	-	NULL	ENSG00000188266		0.443	HYKK-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	AGPHD1	HGNC	protein_coding	OTTHUMT00000435834.1	446	0.00	0	C	NM_001013619		78825858	78825858	+1	no_errors	ENST00000388988	ensembl	human	known	69_37n	missense	283	10.38	33	SNP	1.000	G
ASH1L	55870	genome.wustl.edu	37	1	155311856	155311856	+	Silent	SNP	G	G	A			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr1:155311856G>A	ENST00000368346.3	-	25	8985	c.8346C>T	c.(8344-8346)atC>atT	p.I2782I	ASH1L_ENST00000392403.3_Silent_p.I2777I			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	2782	BAH. {ECO:0000255|PROSITE- ProRule:PRU00370}.				cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			GATAATCACAGATGTACACAT	0.483																																						dbGAP											0													236.0	218.0	224.0					1																	155311856		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.8346C>T	1.37:g.155311856G>A			Q59GP1|Q5T714|Q5T715|Q9P2C7	Silent	SNP	pfam_SET_dom,pfam_BAH_dom,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_AT_hook_DNA-bd_motif,smart_AWS,smart_SET_dom,smart_Bromodomain,smart_Znf_PHD,smart_BAH_dom,pfscan_AWS,pfscan_BAH_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Bromodomain	p.I2782	ENST00000368346.3	37	c.8346		1																																																																																			ASH1L	-	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	ENSG00000116539		0.483	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	ASH1L	HGNC	protein_coding	OTTHUMT00000039400.1	292	0.00	0	G	NM_018489		155311856	155311856	-1	no_errors	ENST00000368346	ensembl	human	known	69_37n	silent	194	11.42	25	SNP	1.000	A
ATP6V1B2	526	genome.wustl.edu	37	8	20067922	20067922	+	Silent	SNP	C	C	G			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr8:20067922C>G	ENST00000276390.2	+	4	397	c.357C>G	c.(355-357)ctC>ctG	p.L119L		NM_001693.3	NP_001684.2	P21281	VATB2_HUMAN	ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2	119					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|ruffle (GO:0001726)	ATP binding (GO:0005524)|hydrogen ion transmembrane transporter activity (GO:0015078)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			endometrium(1)|kidney(2)|lung(5)|prostate(1)	9				Colorectal(74;0.0535)|COAD - Colon adenocarcinoma(73;0.211)	Gallium nitrate(DB05260)	GGGATATTCTCCGAACACCGG	0.358																																					Pancreas(119;1230 1726 3901 4036 31644)	dbGAP											0													111.0	116.0	114.0					8																	20067922		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L35249	CCDS6014.1	8p21.3	2010-04-21	2006-01-13	2002-05-10	ENSG00000147416	ENSG00000147416	3.6.3.14	"""ATPases / V-type"""	854	protein-coding gene	gene with protein product		606939	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), beta polypeptide, 56/58kD, isoform 2"", ""ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 2"""	VPP3, ATP6B2		2145275, 14580332	Standard	NM_001693		Approved	VATB, Vma2, HO57	uc003wzp.3	P21281	OTTHUMG00000131073	ENST00000276390.2:c.357C>G	8.37:g.20067922C>G			B2R5Z3|D3DSQ5|Q14544|Q15859|Q96IR0	Missense_Mutation	SNP	pfam_ATPase_F1/V1/A1-cplx_a/bsu_N	p.P109A	ENST00000276390.2	37	c.325	CCDS6014.1	8	.	.	.	.	.	.	.	.	.	.	C	9.577	1.122487	0.20877	.	.	ENSG00000147416	ENST00000519667	.	.	.	5.43	0.958	0.19619	.	.	.	.	.	T	0.51244	0.1663	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38802	-0.9644	4	.	.	.	-14.4145	4.9508	0.14013	0.0:0.4769:0.1742:0.3489	.	.	.	.	A	109	.	.	P	+	1	0	ATP6V1B2	20112202	0.893000	0.30496	1.000000	0.80357	0.999000	0.98932	-0.051000	0.11885	0.332000	0.23536	0.643000	0.83706	CCG	ATP6V1B2	-	NULL	ENSG00000147416		0.358	ATP6V1B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V1B2	HGNC	protein_coding	OTTHUMT00000253732.1	304	0.00	0	C	NM_001693		20067922	20067922	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000519667	ensembl	human	putative	69_37n	missense	191	10.75	23	SNP	0.998	G
C9orf41	138199	genome.wustl.edu	37	9	77631273	77631273	+	Silent	SNP	T	T	C			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr9:77631273T>C	ENST00000376834.3	-	3	653	c.501A>G	c.(499-501)agA>agG	p.R167R	C9orf41_ENST00000376837.3_Silent_p.R167R|RP11-197P3.5_ENST00000455336.2_RNA	NM_152420.1	NP_689633.1	Q8N4J0	CI041_HUMAN	chromosome 9 open reading frame 41	167										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|urinary_tract(2)	17						CACTCCAGTCTCTCACAAACT	0.358																																						dbGAP											0													181.0	185.0	183.0					9																	77631273		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK098661	CCDS6649.1	9q21.31	2012-03-15			ENSG00000156017	ENSG00000156017			23435	protein-coding gene	gene with protein product						12477932	Standard	NM_152420		Approved	FLJ25795	uc004ajq.3	Q8N4J0	OTTHUMG00000020032	ENST00000376834.3:c.501A>G	9.37:g.77631273T>C			Q7Z383|Q8N7C5	Silent	SNP	pfam_N2227	p.R167	ENST00000376834.3	37	c.501	CCDS6649.1	9																																																																																			C9orf41	-	pfam_N2227	ENSG00000156017		0.358	C9orf41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf41	HGNC	protein_coding	OTTHUMT00000052703.1	410	0.00	0	T	NM_152420		77631273	77631273	-1	no_errors	ENST00000376834	ensembl	human	known	69_37n	silent	220	15.38	40	SNP	1.000	C
CCDC34	91057	genome.wustl.edu	37	11	27379074	27379074	+	Nonsense_Mutation	SNP	G	G	C			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr11:27379074G>C	ENST00000328697.6	-	2	1047	c.374C>G	c.(373-375)tCa>tGa	p.S125*	CCDC34_ENST00000317945.6_Nonsense_Mutation_p.S125*	NM_030771.1	NP_110398.1	Q96HJ3	CCD34_HUMAN	coiled-coil domain containing 34	125										endometrium(2)|large_intestine(4)|lung(1)|prostate(1)|urinary_tract(1)	9						GTTATTTTCTGATTCAACCTG	0.413																																						dbGAP											0													130.0	120.0	123.0					11																	27379074		2202	4299	6501	-	-	-	SO:0001587	stop_gained	0			AF382034	CCDS7863.1, CCDS31448.1	11p14.1	2010-03-30			ENSG00000109881	ENSG00000109881			25079	protein-coding gene	gene with protein product		612324				11173847	Standard	NM_080654		Approved	NY-REN-41, L15, RAMA3	uc001mrh.1	Q96HJ3	OTTHUMG00000166211	ENST00000328697.6:c.374C>G	11.37:g.27379074G>C	ENSP00000330240:p.Ser125*		B2R8G2|Q8IX69|Q9H2A6|Q9Y599	Nonsense_Mutation	SNP	NULL	p.S125*	ENST00000328697.6	37	c.374	CCDS31448.1	11	.	.	.	.	.	.	.	.	.	.	G	42	9.682215	0.99237	.	.	ENSG00000109881	ENST00000328697;ENST00000317945	.	.	.	5.39	3.49	0.39957	.	0.774560	0.11339	N	0.574234	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	0.1012	4.9556	0.14038	0.2254:0.0:0.6131:0.1615	.	.	.	.	X	125	.	ENSP00000321563:S125X	S	-	2	0	CCDC34	27335650	0.268000	0.24133	0.030000	0.17652	0.812000	0.45895	2.031000	0.41117	1.414000	0.47017	0.643000	0.83706	TCA	CCDC34	-	NULL	ENSG00000109881		0.413	CCDC34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC34	HGNC	protein_coding	OTTHUMT00000388396.2	241	0.00	0	G	NM_030771		27379074	27379074	-1	no_errors	ENST00000328697	ensembl	human	known	69_37n	nonsense	195	12.56	28	SNP	0.001	C
CD101	9398	genome.wustl.edu	37	1	117568312	117568312	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr1:117568312G>C	ENST00000256652.4	+	8	2668	c.2610G>C	c.(2608-2610)ttG>ttC	p.L870F	RP11-27K13.3_ENST00000421254.1_RNA|CD101_ENST00000369470.1_Missense_Mutation_p.L870F|RP11-27K13.3_ENST00000445523.1_RNA	NM_001256106.1|NM_001256109.1|NM_001256111.1|NM_004258.4	NP_001243035.1|NP_001243038.1|NP_001243040.1|NP_004249.2	Q93033	IGSF2_HUMAN	CD101 molecule	870	Ig-like C2-type 7.				cell surface receptor signaling pathway (GO:0007166)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(14)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						ATGATGGCTTGCTGGAGTATG	0.507																																						dbGAP											0													161.0	143.0	149.0					1																	117568312		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z33642	CCDS891.1	1p13	2013-01-29	2009-10-27	2009-10-27	ENSG00000134256	ENSG00000134256		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5949	protein-coding gene	gene with protein product		604516	"""immunoglobulin superfamily, member 2"""	IGSF2		7722300	Standard	NM_004258		Approved	V7	uc010oxb.2	Q93033	OTTHUMG00000012029	ENST00000256652.4:c.2610G>C	1.37:g.117568312G>C	ENSP00000256652:p.Leu870Phe		Q15856	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.L870F	ENST00000256652.4	37	c.2610	CCDS891.1	1	.	.	.	.	.	.	.	.	.	.	G	11.98	1.801629	0.31869	.	.	ENSG00000134256	ENST00000256652;ENST00000369470	T;T	0.65364	-0.15;-0.15	5.28	3.34	0.38264	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.680989	0.13266	N	0.400934	T	0.63271	0.2497	M	0.67953	2.075	0.31975	N	0.606575	D	0.76494	0.999	D	0.69479	0.964	T	0.60924	-0.7166	10	0.62326	D	0.03	-5.2496	6.4466	0.21879	0.0984:0.1993:0.7023:0.0	.	870	Q93033	IGSF2_HUMAN	F	870	ENSP00000256652:L870F;ENSP00000358482:L870F	ENSP00000256652:L870F	L	+	3	2	CD101	117369835	0.996000	0.38824	1.000000	0.80357	0.071000	0.16799	1.671000	0.37513	1.460000	0.47911	0.655000	0.94253	TTG	CD101	-	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000134256		0.507	CD101-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CD101	HGNC	protein_coding	OTTHUMT00000033274.1	186	0.00	0	G	NM_004258		117568312	117568312	+1	no_errors	ENST00000256652	ensembl	human	known	69_37n	missense	143	10.06	16	SNP	0.992	C
CD40	958	genome.wustl.edu	37	20	44750513	44750513	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr20:44750513C>T	ENST00000372285.3	+	2	178	c.106C>T	c.(106-108)Cag>Tag	p.Q36*	CD40_ENST00000372276.3_Nonsense_Mutation_p.Q36*|CD40_ENST00000489304.1_3'UTR	NM_001250.4	NP_001241.1	P25942	TNR5_HUMAN	CD40 molecule, TNF receptor superfamily member 5	36					B cell proliferation (GO:0042100)|cellular calcium ion homeostasis (GO:0006874)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|inflammatory response (GO:0006954)|platelet activation (GO:0030168)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|protein complex assembly (GO:0006461)|regulation of immune response (GO:0050776)|regulation of immunoglobulin secretion (GO:0051023)	CD40 receptor complex (GO:0035631)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|enzyme binding (GO:0019899)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10		Myeloproliferative disorder(115;0.0122)				AATAAACAGTCAGTGCTGTTC	0.478									Immune Deficiency with Hyper-IgM																													dbGAP											0													137.0	127.0	130.0					20																	44750513		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	Hypogammaglobulinemia with Hyper-IgM, HIGM type I-V, XLHIGM	X60592	CCDS13393.1, CCDS13394.1	20q12-q13.2	2014-09-17	2006-03-28	2005-01-14	ENSG00000101017	ENSG00000101017		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11919	protein-coding gene	gene with protein product		109535	"""tumor necrosis factor receptor superfamily, member 5"""	TNFRSF5		7687385, 2998589	Standard	XM_005260617		Approved	p50, Bp50	uc002xrg.1	P25942	OTTHUMG00000033053	ENST00000372285.3:c.106C>T	20.37:g.44750513C>T	ENSP00000361359:p.Gln36*		E1P5S9|Q53GN5|Q5JY15|Q5U007|Q7M4Q8|Q86YK5|Q9BYU0	Nonsense_Mutation	SNP	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg,prints_TNFR_5,prints_Fas_rcpt	p.Q36*	ENST00000372285.3	37	c.106	CCDS13393.1	20	.	.	.	.	.	.	.	.	.	.	C	32	5.157160	0.94686	.	.	ENSG00000101017	ENST00000372285;ENST00000372276	.	.	.	3.78	1.72	0.24424	.	0.667577	0.14182	N	0.335927	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.4238	10.0104	0.41984	0.0:0.6017:0.3983:0.0	.	.	.	.	X	36	.	ENSP00000361350:Q36X	Q	+	1	0	CD40	44183920	0.001000	0.12720	0.005000	0.12908	0.871000	0.50021	1.042000	0.30303	0.522000	0.28464	0.467000	0.42956	CAG	CD40	-	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg	ENSG00000101017		0.478	CD40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD40	HGNC	protein_coding	OTTHUMT00000080376.1	182	0.00	0	C	NM_001250		44750513	44750513	+1	no_errors	ENST00000372285	ensembl	human	known	69_37n	nonsense	117	10.61	14	SNP	0.005	T
CERS2	29956	genome.wustl.edu	37	1	150939642	150939642	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr1:150939642T>C	ENST00000271688.6	-	8	1035	c.649A>G	c.(649-651)Atc>Gtc	p.I217V	RP11-316M1.12_ENST00000560481.1_RNA|RP11-316M1.12_ENST00000561111.1_RNA|CERS2_ENST00000561294.1_Missense_Mutation_p.I208V|CERS2_ENST00000345896.4_5'UTR|CERS2_ENST00000368954.5_Missense_Mutation_p.I217V	NM_181746.3	NP_859530.1	Q96G23	CERS2_HUMAN	ceramide synthase 2	217	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear membrane (GO:0031965)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										ATGAGAATGATGGTGGCCACA	0.498																																						dbGAP											0													104.0	99.0	101.0					1																	150939642		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF189062	CCDS973.1	1q21.3	2012-09-20	2011-07-08	2011-07-08	ENSG00000143418	ENSG00000143418		"""Homeoboxes / CERS class"""	14076	protein-coding gene	gene with protein product		606920	"""longevity assurance (LAG1, S. cerevisiae) homolog 2"", ""LAG1 longevity assurance homolog 2 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 2"""	LASS2		11543633	Standard	NM_181746		Approved	SP260, FLJ10243	uc001evz.3	Q96G23	OTTHUMG00000035064	ENST00000271688.6:c.649A>G	1.37:g.150939642T>C	ENSP00000271688:p.Ile217Val		D3DV06|Q5SZE5|Q9HD96|Q9NW79	Missense_Mutation	SNP	pirsf_Longevity_assurance_LAG1_LAC1,pfam_TLC-dom,pfam_Homeodomain,superfamily_Homeodomain-like,smart_TLC-dom,pfscan_TLC-dom,pfscan_Homeodomain	p.I217V	ENST00000271688.6	37	c.649	CCDS973.1	1	.	.	.	.	.	.	.	.	.	.	T	14.36	2.511949	0.44660	.	.	ENSG00000143418	ENST00000368954;ENST00000271688;ENST00000345896;ENST00000368949;ENST00000361419	D;D;D;D;D	0.85629	-2.01;-2.01;-2.01;-2.01;-2.01	5.29	5.29	0.74685	TRAM/LAG1/CLN8 homology domain (3);	0.000000	0.85682	D	0.000000	T	0.77150	0.4088	L	0.48877	1.53	0.80722	D	1	P	0.35944	0.529	B	0.42916	0.402	T	0.76160	-0.3061	10	0.21540	T	0.41	-26.1518	14.8817	0.70537	0.0:0.0:0.0:1.0	.	217	Q96G23	CERS2_HUMAN	V	217;217;67;237;217	ENSP00000357950:I217V;ENSP00000271688:I217V;ENSP00000337842:I67V;ENSP00000357945:I237V;ENSP00000355020:I217V	ENSP00000271688:I217V	I	-	1	0	CERS2	149206266	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.694000	0.84235	2.003000	0.58678	0.459000	0.35465	ATC	CERS2	-	pirsf_Longevity_assurance_LAG1_LAC1,pfam_TLC-dom,smart_TLC-dom,pfscan_TLC-dom	ENSG00000143418		0.498	CERS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CERS2	HGNC	protein_coding	OTTHUMT00000084897.2	115	0.00	0	T	NM_022075		150939642	150939642	-1	no_errors	ENST00000271688	ensembl	human	known	69_37n	missense	70	12.50	10	SNP	1.000	C
CNTNAP1	8506	genome.wustl.edu	37	17	40849571	40849571	+	Splice_Site	SNP	G	G	C			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr17:40849571G>C	ENST00000264638.4	+	22	3785		c.e22-1		CTD-3193K9.3_ENST00000592440.1_RNA	NM_003632.2	NP_003623.1	P78357	CNTP1_HUMAN	contactin associated protein 1						axon cargo transport (GO:0008088)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|neuron projection morphogenesis (GO:0048812)|neuronal action potential propagation (GO:0019227)|paranodal junction assembly (GO:0030913)|positive regulation of signal transduction (GO:0009967)|protein localization to paranode region of axon (GO:0002175)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|paranode region of axon (GO:0033270)|voltage-gated potassium channel complex (GO:0008076)	receptor activity (GO:0004872)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|lung(15)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		CTCTCTCTCAGAGACAGGAGT	0.582																																						dbGAP											0													69.0	69.0	69.0					17																	40849571		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U87223	CCDS11436.1	17q21	2008-07-18				ENSG00000108797			8011	protein-coding gene	gene with protein product	"""neurexin 4"""	602346		NRXN4		9118959	Standard	NM_003632		Approved	p190, Caspr, CNTNAP	uc002iay.3	P78357		ENST00000264638.4:c.3569-1G>C	17.37:g.40849571G>C				Splice_Site	SNP	-	e22-1	ENST00000264638.4	37	c.3569-1	CCDS11436.1	17	.	.	.	.	.	.	.	.	.	.	G	26.2	4.712227	0.89112	.	.	ENSG00000108797	ENST00000264638	.	.	.	5.48	5.48	0.80851	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9588	0.92670	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CNTNAP1	38103097	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.114000	0.94329	2.564000	0.86499	0.650000	0.86243	.	CNTNAP1	-	-	ENSG00000108797		0.582	CNTNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP1	HGNC	protein_coding	OTTHUMT00000452342.1	105	0.00	0	G	NM_003632	Intron	40849571	40849571	+1	no_errors	ENST00000264638	ensembl	human	known	69_37n	splice_site	61	12.86	9	SNP	1.000	C
EDEM3	80267	genome.wustl.edu	37	1	184686738	184686738	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr1:184686738C>G	ENST00000318130.8	-	12	1447	c.1181G>C	c.(1180-1182)aGa>aCa	p.R394T	EDEM3_ENST00000367512.3_Missense_Mutation_p.R351T	NM_025191.3	NP_079467.3	Q9BZQ6	EDEM3_HUMAN	ER degradation enhancer, mannosidase alpha-like 3	394					cellular protein metabolic process (GO:0044267)|glycoprotein catabolic process (GO:0006516)|post-translational protein modification (GO:0043687)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|response to unfolded protein (GO:0006986)	endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|glycoprotein endo-alpha-1,2-mannosidase activity (GO:0004569)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						CCAGTGTACTCTGAAATCTGT	0.303																																						dbGAP											0													78.0	84.0	82.0					1																	184686738		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF288393	CCDS1363.2	1q25	2008-02-05	2006-03-31	2006-03-31	ENSG00000116406	ENSG00000116406			16787	protein-coding gene	gene with protein product		610214	"""chromosome 1 open reading frame 22"""	C1orf22		15537790, 15579471	Standard	NM_025191		Approved		uc010pok.2	Q9BZQ6	OTTHUMG00000035387	ENST00000318130.8:c.1181G>C	1.37:g.184686738C>G	ENSP00000318147:p.Arg394Thr		B2RCH6|B7ZLZ2|Q0VGM5|Q5TEZ0|Q9HCW1|Q9UFV7	Missense_Mutation	SNP	pfam_Glyco_hydro_47,pfam_Protease-assoc_domain,superfamily_Glyco_hydro_47,prints_Glyco_hydro_47	p.R394T	ENST00000318130.8	37	c.1181	CCDS1363.2	1	.	.	.	.	.	.	.	.	.	.	C	18.10	3.548468	0.65311	.	.	ENSG00000116406	ENST00000318130;ENST00000367512	T;T	0.71934	-0.61;-0.61	4.99	4.99	0.66335	.	0.041576	0.85682	D	0.000000	T	0.68256	0.2981	L	0.49571	1.57	0.80722	D	1	B	0.28605	0.217	B	0.29077	0.098	T	0.68413	-0.5415	10	0.52906	T	0.07	.	18.6512	0.91431	0.0:1.0:0.0:0.0	.	394	Q9BZQ6	EDEM3_HUMAN	T	394;351	ENSP00000318147:R394T;ENSP00000356482:R351T	ENSP00000318147:R394T	R	-	2	0	EDEM3	182953361	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.624000	0.83124	2.469000	0.83416	0.585000	0.79938	AGA	EDEM3	-	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47	ENSG00000116406		0.303	EDEM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDEM3	HGNC	protein_coding	OTTHUMT00000085785.3	274	0.00	0	C	NM_025191		184686738	184686738	-1	no_errors	ENST00000318130	ensembl	human	known	69_37n	missense	191	10.33	22	SNP	1.000	G
EPB41L1	2036	genome.wustl.edu	37	20	34778680	34778680	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr20:34778680T>G	ENST00000338074.2	+	11	1422	c.1261T>G	c.(1261-1263)Tcc>Gcc	p.S421A	EPB41L1_ENST00000373950.2_Missense_Mutation_p.S324A|EPB41L1_ENST00000202028.5_Missense_Mutation_p.S359A|EPB41L1_ENST00000441639.1_Missense_Mutation_p.S359A|EPB41L1_ENST00000373946.3_Missense_Mutation_p.S390A|EPB41L1_ENST00000373941.1_Missense_Mutation_p.S421A	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	421					cortical actin cytoskeleton organization (GO:0030866)|synaptic transmission (GO:0007268)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(10)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	37	Breast(12;0.0239)					TGAGCGTTCTTCCAGCAAACG	0.617																																						dbGAP											0													60.0	53.0	55.0					20																	34778680		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002336	CCDS13271.1, CCDS13272.1, CCDS58771.1	20q11.2-q12	2003-03-17			ENSG00000088367	ENSG00000088367			3378	protein-coding gene	gene with protein product		602879				9570967, 9828140	Standard	NM_012156		Approved	KIAA0338	uc002xfb.3	Q9H4G0	OTTHUMG00000032378	ENST00000338074.2:c.1261T>G	20.37:g.34778680T>G	ENSP00000337168:p.Ser421Ala		O15046|Q4VXM6|Q4VXM7|Q4VXM8|Q4VXN4|Q6ZT61|Q8IUU7|Q96CV5|Q96L65	Missense_Mutation	SNP	pfam_Band_4.1_C,pfam_FERM_PH-like_C,pfam_FERM_N,pfam_FERM_central,pfam_SAB,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pirsf_Band_41_protein,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin	p.S421A	ENST00000338074.2	37	c.1261	CCDS13271.1	20	.	.	.	.	.	.	.	.	.	.	T	17.88	3.497485	0.64186	.	.	ENSG00000088367	ENST00000202028;ENST00000373950;ENST00000397315;ENST00000373951;ENST00000441639;ENST00000373946;ENST00000338074;ENST00000373941	D;D;D;D;D;D	0.86497	-2.13;-2.13;-2.13;-2.13;-2.13;-2.13	5.48	5.48	0.80851	FERM adjacent (FA) (1);	.	.	.	.	D	0.83737	0.5319	L	0.50847	1.595	0.30926	N	0.727403	B;P;P;B;P;P	0.44578	0.236;0.838;0.539;0.425;0.62;0.584	B;B;B;B;B;B	0.39876	0.262;0.312;0.236;0.061;0.243;0.195	T	0.82653	-0.0351	9	0.30078	T	0.28	.	14.4057	0.67081	0.0:0.0:0.0:1.0	.	421;421;390;324;324;359	B7Z653;Q9H4G0;Q9H4G0-4;Q9H4G0-3;B3KUB6;Q9H4G0-2	.;E41L1_HUMAN;.;.;.;.	A	359;324;421;324;359;390;421;421	ENSP00000202028:S359A;ENSP00000363061:S324A;ENSP00000399214:S359A;ENSP00000363057:S390A;ENSP00000337168:S421A;ENSP00000363052:S421A	ENSP00000202028:S359A	S	+	1	0	EPB41L1	34242094	0.998000	0.40836	1.000000	0.80357	0.973000	0.67179	3.167000	0.50793	2.068000	0.61886	0.459000	0.35465	TCC	EPB41L1	-	pfam_FERM-adjacent,pirsf_Band_41_protein	ENSG00000088367		0.617	EPB41L1-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPB41L1	HGNC	protein_coding	OTTHUMT00000078978.3	96	0.00	0	T	NM_012156		34778680	34778680	+1	no_errors	ENST00000338074	ensembl	human	known	69_37n	missense	70	10.26	8	SNP	0.998	G
EPSTI1	94240	genome.wustl.edu	37	13	43469228	43469229	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr13:43469228_43469229insAA	ENST00000398762.3	-	11	863_864	c.864_865insTT	c.(862-867)tttctgfs	p.L289fs	EPSTI1_ENST00000313624.7_Frame_Shift_Ins_p.L278fs|EPSTI1_ENST00000313640.7_Frame_Shift_Ins_p.L289fs			Q96J88	ESIP1_HUMAN	epithelial stromal interaction 1 (breast)	289										endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|skin(1)	17		Lung NSC(96;3.6e-06)|Breast(139;0.00869)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		GBM - Glioblastoma multiforme(144;0.000528)|BRCA - Breast invasive adenocarcinoma(63;0.0858)		AGTCGGTCCAGAAAAGCATTAT	0.416																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF396928	CCDS9387.1, CCDS31964.1	13q13.3	2011-06-27			ENSG00000133106	ENSG00000133106			16465	protein-coding gene	gene with protein product	"""epithelial stromal interaction protein 1"""	607441				11991720	Standard	NM_033255		Approved	BRESI1, MGC29634	uc001uyw.2	Q96J88	OTTHUMG00000016814	ENST00000398762.3:c.863_864dupTT	13.37:g.43469231_43469232dupAA	ENSP00000381746:p.Leu289fs		Q8IVC7|Q8NDQ7	Frame_Shift_Ins	INS	NULL	p.L288fs	ENST00000398762.3	37	c.865_864	CCDS9387.1	13																																																																																			EPSTI1	-	NULL	ENSG00000133106		0.416	EPSTI1-010	PUTATIVE	basic|CCDS	protein_coding	EPSTI1	HGNC	protein_coding	OTTHUMT00000400321.1	153	0.00	0	-	NM_001002264		43469228	43469229	-1	no_errors	ENST00000313640	ensembl	human	known	69_37n	frame_shift_ins	107	10.08	12	INS	1.000:0.998	AA
FAM221A	340277	genome.wustl.edu	37	7	23729011	23729011	+	Silent	SNP	C	C	G			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr7:23729011C>G	ENST00000344962.4	+	3	452	c.363C>G	c.(361-363)ccC>ccG	p.P121P	FAM221A_ENST00000409994.3_Silent_p.P63P|FAM221A_ENST00000409653.1_Silent_p.P63P|FAM221A_ENST00000409192.3_Silent_p.P121P	NM_199136.3	NP_954587.2	A4D161	F221A_HUMAN	family with sequence similarity 221, member A	121																	GTAGCCAGCCCATTCGCTGCA	0.493																																						dbGAP											0													89.0	80.0	83.0					7																	23729011		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5385.1, CCDS47561.1, CCDS47562.1, CCDS75570.1	7p15.3	2012-04-02	2012-04-02	2012-04-02	ENSG00000188732	ENSG00000188732			27977	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 46"""	C7orf46		12477932	Standard	XR_242080		Approved	FLJ45875, MGC72075, DKFZp686F0810	uc003swo.4	A4D161	OTTHUMG00000128463	ENST00000344962.4:c.363C>G	7.37:g.23729011C>G			Q05CG4|Q4G0Q7|Q6P519	Silent	SNP	NULL	p.P121	ENST00000344962.4	37	c.363	CCDS5385.1	7																																																																																			FAM221A	-	NULL	ENSG00000188732		0.493	FAM221A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM221A	HGNC	protein_coding	OTTHUMT00000250261.1	105	0.00	0	C	NM_199136		23729011	23729011	+1	no_errors	ENST00000344962	ensembl	human	known	69_37n	silent	56	21.13	15	SNP	1.000	G
BRINP3	339479	genome.wustl.edu	37	1	190195266	190195266	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr1:190195266G>A	ENST00000367462.3	-	6	1138	c.907C>T	c.(907-909)Ctt>Ttt	p.L303F	BRINP3_ENST00000463404.1_5'UTR|BRINP3_ENST00000534846.1_Missense_Mutation_p.L201F	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	303					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											ATTCGAAGAAGATTCTCTTCC	0.378																																						dbGAP											0													76.0	74.0	74.0					1																	190195266		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.907C>T	1.37:g.190195266G>A	ENSP00000356432:p.Leu303Phe		B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	pfam_MACPF,smart_MACPF	p.L303F	ENST00000367462.3	37	c.907	CCDS1373.1	1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.168677	0.78339	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	T;T	0.32272	1.7;1.46	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.57301	0.2044	M	0.72353	2.195	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.80764	0.994;0.986	T	0.56721	-0.7932	10	0.87932	D	0	.	18.1531	0.89682	0.0:0.0:1.0:0.0	.	201;303	B7Z260;Q76B58	.;FAM5C_HUMAN	F	303;201	ENSP00000356432:L303F;ENSP00000438022:L201F	ENSP00000356432:L303F	L	-	1	0	FAM5C	188461889	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.242000	0.72376	2.885000	0.99019	0.655000	0.94253	CTT	FAM5C	-	NULL	ENSG00000162670		0.378	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM5C	HGNC	protein_coding	OTTHUMT00000086278.1	156	0.00	0	G	NM_199051		190195266	190195266	-1	no_errors	ENST00000367462	ensembl	human	known	69_37n	missense	111	13.95	18	SNP	1.000	A
FSHR	2492	genome.wustl.edu	37	2	49217745	49217745	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr2:49217745G>A	ENST00000406846.2	-	5	525	c.406C>T	c.(406-408)Cca>Tca	p.P136S	FSHR_ENST00000469138.1_5'UTR|FSHR_ENST00000541117.1_5'UTR|FSHR_ENST00000304421.4_Missense_Mutation_p.P136S|FSHR_ENST00000346173.3_Missense_Mutation_p.P136S	NM_000145.3	NP_000136.2	P23945	FSHR_HUMAN	follicle stimulating hormone receptor	136					female gamete generation (GO:0007292)|female gonad development (GO:0008585)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor signaling pathway (GO:0007186)|gonad development (GO:0008406)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	follicle-stimulating hormone receptor activity (GO:0004963)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|liver(1)|lung(45)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	73		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)	TGAACATCTGGAAGGTGCTTA	0.378									Gonadal Dysgenesis, 46 XX																													dbGAP											0													136.0	145.0	142.0					2																	49217745		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database			CCDS1843.1, CCDS1844.1, CCDS1844.2	2p21-p16	2014-09-17			ENSG00000170820	ENSG00000170820		"""GPCR / Class A : Gonadotropin and TSH receptors"""	3969	protein-coding gene	gene with protein product		136435		ODG1		8230163, 8855829	Standard	NM_000145		Approved	FSHRO, LGR1	uc002rww.3	P23945	OTTHUMG00000129259	ENST00000406846.2:c.406C>T	2.37:g.49217745G>A	ENSP00000384708:p.Pro136Ser		A8K947|G5CBS7|G5E967|J3KQ00|Q05AH0|Q16225|Q4QRJ3|Q4ZFZ2|Q53RW2	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_GnHR_TM,pfam_LRR-contain_N,pfam_Leu-rich_rpt,smart_LRR-contain_N,pfscan_GPCR_Rhodpsn_supfam,prints_FSH_rcpt,prints_Gphrmn_rcpt,prints_7TM_GPCR_Rhodpsn,prints_TSH_rcpt	p.P136S	ENST00000406846.2	37	c.406	CCDS1843.1	2	.	.	.	.	.	.	.	.	.	.	G	21.5	4.163671	0.78226	.	.	ENSG00000170820	ENST00000406846;ENST00000346173;ENST00000304421;ENST00000454032	D;D;D;D	0.85773	-2.03;-2.03;-2.03;-2.03	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	D	0.93481	0.7920	M	0.88842	2.985	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.94057	0.7323	9	.	.	.	.	17.3311	0.87264	0.0:0.0:1.0:0.0	.	136;136;136	Q05AH0;G5E967;P23945	.;.;FSHR_HUMAN	S	136	ENSP00000384708:P136S;ENSP00000333908:P136S;ENSP00000306780:P136S;ENSP00000415504:P136S	.	P	-	1	0	FSHR	49071249	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	6.290000	0.72712	2.658000	0.90341	0.591000	0.81541	CCA	FSHR	-	prints_FSH_rcpt,prints_TSH_rcpt	ENSG00000170820		0.378	FSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSHR	HGNC	protein_coding	OTTHUMT00000251367.2	298	0.33	1	G			49217745	49217745	-1	no_errors	ENST00000406846	ensembl	human	known	69_37n	missense	234	10.69	28	SNP	1.000	A
GRXCR1	389207	genome.wustl.edu	37	4	42964964	42964964	+	Missense_Mutation	SNP	G	G	A	rs142351714		TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr4:42964964G>A	ENST00000399770.2	+	2	440	c.440G>A	c.(439-441)cGt>cAt	p.R147H		NM_001080476.2	NP_001073945.1	A8MXD5	GRCR1_HUMAN	glutaredoxin, cysteine rich 1	147	Glutaredoxin. {ECO:0000255|PROSITE- ProRule:PRU00686}.				auditory receptor cell differentiation (GO:0042491)|cell redox homeostasis (GO:0045454)|inner ear receptor cell development (GO:0060119)|inner ear receptor stereocilium organization (GO:0060122)|negative regulation of phosphatase activity (GO:0010923)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of sound (GO:0007605)|vestibular receptor cell development (GO:0060118)	kinocilium (GO:0060091)|stereocilium (GO:0032420)	electron carrier activity (GO:0009055)|protein disulfide oxidoreductase activity (GO:0015035)	p.R147L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(22)|ovary(1)|prostate(2)|skin(1)	32						ACCTGCCTTCGTGTGGTCCGG	0.388													G|||	1	0.000199681	0.0	0.0	5008	,	,		18530	0.001		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - Missense(1)	lung(1)											170.0	165.0	166.0					4																	42964964		1871	4103	5974	-	-	-	SO:0001583	missense	0				CCDS43225.1	4p14	2014-06-12			ENSG00000215203	ENSG00000215203			31673	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 88"""	613283	"""deafness, autosomal recessive 25"""	DFNB25		20137778	Standard	NM_001080476		Approved	PPP1R88	uc003gwt.3	A8MXD5	OTTHUMG00000160434	ENST00000399770.2:c.440G>A	4.37:g.42964964G>A	ENSP00000382670:p.Arg147His			Missense_Mutation	SNP	pfam_Glutaredoxin,superfamily_Thioredoxin-like_fold,superfamily_HSP_DnaJ_Cys-rich_dom	p.R147H	ENST00000399770.2	37	c.440	CCDS43225.1	4	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	G	26.9	4.778734	0.90195	.	.	ENSG00000215203	ENST00000399770	T	0.77358	-1.09	5.78	5.78	0.91487	Glutaredoxin (2);Thioredoxin-like fold (2);	0.000000	0.64402	U	0.000002	D	0.87018	0.6073	M	0.64404	1.975	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	D	0.85789	0.1366	10	0.45353	T	0.12	-22.0975	18.9873	0.92777	0.0:0.0:1.0:0.0	.	147	A8MXD5	GRCR1_HUMAN	H	147	ENSP00000382670:R147H	ENSP00000382670:R147H	R	+	2	0	GRXCR1	42659721	1.000000	0.71417	0.997000	0.53966	0.939000	0.58152	9.476000	0.97823	2.724000	0.93272	0.655000	0.94253	CGT	GRXCR1	-	pfam_Glutaredoxin,superfamily_Thioredoxin-like_fold	ENSG00000215203		0.388	GRXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRXCR1	HGNC	protein_coding	OTTHUMT00000360576.1	226	0.00	0	G	NM_001080476		42964964	42964964	+1	no_errors	ENST00000399770	ensembl	human	known	69_37n	missense	169	14.21	28	SNP	1.000	A
HEATR1	55127	genome.wustl.edu	37	1	236746159	236746159	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr1:236746159C>G	ENST00000366582.3	-	19	2553	c.2439G>C	c.(2437-2439)tgG>tgC	p.W813C	HEATR1_ENST00000366581.2_Missense_Mutation_p.W813C	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	813					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			GTTCAGGATTCCACCATATAT	0.433																																						dbGAP											0													138.0	110.0	120.0					1																	236746159		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.2439G>C	1.37:g.236746159C>G	ENSP00000355541:p.Trp813Cys		Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	pfam_BP28_C_dom,pfam_U3snoRNP10,superfamily_ARM-type_fold	p.W813C	ENST00000366582.3	37	c.2439	CCDS31066.1	1	.	.	.	.	.	.	.	.	.	.	C	20.0	3.929739	0.73327	.	.	ENSG00000119285	ENST00000366582;ENST00000366581	T;T	0.36878	1.77;1.23	5.62	5.62	0.85841	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.62624	0.2443	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.99	T	0.64618	-0.6365	10	0.87932	D	0	.	19.6611	0.95871	0.0:1.0:0.0:0.0	.	813;813	Q5T3Q7;Q9H583	.;HEAT1_HUMAN	C	813	ENSP00000355541:W813C;ENSP00000355540:W813C	ENSP00000355540:W813C	W	-	3	0	HEATR1	234812782	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	5.916000	0.69981	2.643000	0.89663	0.655000	0.94253	TGG	HEATR1	-	superfamily_ARM-type_fold	ENSG00000119285		0.433	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR1	HGNC	protein_coding	OTTHUMT00000096635.1	172	0.00	0	C	XM_375853		236746159	236746159	-1	no_errors	ENST00000366582	ensembl	human	known	69_37n	missense	101	10.62	12	SNP	1.000	G
HMOX2	3163	genome.wustl.edu	37	16	4559694	4559694	+	Silent	SNP	C	C	G			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr16:4559694C>G	ENST00000570646.1	+	6	1493	c.888C>G	c.(886-888)ctC>ctG	p.L296L	HMOX2_ENST00000219700.6_Silent_p.L296L|HMOX2_ENST00000458134.3_Silent_p.L296L|HMOX2_ENST00000575120.1_Silent_p.L267L|HMOX2_ENST00000414777.1_Silent_p.L296L|HMOX2_ENST00000398595.3_Silent_p.L296L|HMOX2_ENST00000406590.2_Silent_p.L296L	NM_002134.3	NP_002125.3	P30519	HMOX2_HUMAN	heme oxygenase (decycling) 2	296					cellular iron ion homeostasis (GO:0006879)|heme catabolic process (GO:0042167)|heme oxidation (GO:0006788)|porphyrin-containing compound metabolic process (GO:0006778)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heme oxygenase (decyclizing) activity (GO:0004392)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	8						AGCCCAGCCTCCAGTTCATCC	0.607																																						dbGAP											0													79.0	71.0	74.0					16																	4559694		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0				CCDS10517.1, CCDS66931.1, CCDS73818.1	16p13.3	2008-02-05			ENSG00000103415	ENSG00000103415	1.14.99.3		5014	protein-coding gene	gene with protein product		141251				1575508	Standard	NM_002134		Approved	HO-2	uc002cwq.4	P30519	OTTHUMG00000129473	ENST00000570646.1:c.888C>G	16.37:g.4559694C>G			A8MT35|D3DUD5|I3L430|O60605	Silent	SNP	pfam_Haem_Oase-like,superfamily_Haem_Oase-like_multi-hlx,pirsf_Haem_Oase,prints_Haem_Oase	p.L296	ENST00000570646.1	37	c.888	CCDS10517.1	16																																																																																			HMOX2	-	NULL	ENSG00000103415		0.607	HMOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMOX2	HGNC	protein_coding	OTTHUMT00000251636.2	81	0.00	0	C			4559694	4559694	+1	no_errors	ENST00000219700	ensembl	human	known	69_37n	silent	51	20.31	13	SNP	0.990	G
IGLV5-48	28780	genome.wustl.edu	37	22	22707309	22707309	+	RNA	SNP	C	C	T	rs35779014	byFrequency	TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr22:22707309C>T	ENST00000390293.1	+	0	21									immunoglobulin lambda variable 5-48 (non-functional)																		ATCCTCTCCTCCTCCTGTTCC	0.567													.|||	984	0.196486	0.1785	0.1585	5008	,	,		16100	0.2054		0.2217	False		,,,				2504	0.2127					dbGAP											0																																										-	-	-			0			Z73649		22q11.2	2012-02-08	2008-09-15		ENSG00000211647	ENSG00000211647		"""Immunoglobulins / IGL locus"""	5925	other	immunoglobulin gene			"""immunoglobulin lambda variable 5-48"""				Standard	NG_000002		Approved				OTTHUMG00000151041		22.37:g.22707309C>T				Silent	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.L7	ENST00000390293.1	37	c.21		22																																																																																			IGLV5-48	-	NULL	ENSG00000211647		0.567	IGLV5-48-001	KNOWN	not_best_in_genome_evidence|mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGLV5-48	HGNC	IG_V_gene	OTTHUMT00000321100.2	9	0.00	0	C	NG_000002		22707309	22707309	+1	no_stop_codon	ENST00000390293	ensembl	human	known	69_37n	silent	11	31.25	5	SNP	0.007	T
INTS5	80789	genome.wustl.edu	37	11	62414645	62414645	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr11:62414645G>T	ENST00000330574.2	-	2	2959	c.2907C>A	c.(2905-2907)ttC>ttA	p.F969L	GANAB_ENST00000534779.1_5'Flank|GANAB_ENST00000346178.4_5'Flank|GANAB_ENST00000540933.1_5'Flank|GANAB_ENST00000356638.3_5'Flank	NM_030628.1	NP_085131.1	Q6P9B9	INT5_HUMAN	integrator complex subunit 5	969					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)				breast(1)|endometrium(4)|large_intestine(6)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	36						AGTCCCGAATGAAGCGACCCC	0.592																																						dbGAP											0													126.0	125.0	126.0					11																	62414645		2202	4299	6501	-	-	-	SO:0001583	missense	0			AK123587	CCDS8027.1	11q12.3	2006-04-26	2006-03-15	2006-03-15	ENSG00000185085	ENSG00000185085			29352	protein-coding gene	gene with protein product		611349	"""KIAA1698"""	KIAA1698		16239144	Standard	NM_030628		Approved	INT5	uc001nud.3	Q6P9B9	OTTHUMG00000167605	ENST00000330574.2:c.2907C>A	11.37:g.62414645G>T	ENSP00000327889:p.Phe969Leu		Q8N6W5|Q9C0G5	Missense_Mutation	SNP	NULL	p.F969L	ENST00000330574.2	37	c.2907	CCDS8027.1	11	.	.	.	.	.	.	.	.	.	.	G	9.834	1.189076	0.21954	.	.	ENSG00000185085	ENST00000330574	.	.	.	5.96	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.57373	0.2049	L	0.34521	1.04	0.36440	D	0.865441	D	0.67145	0.996	D	0.70935	0.971	T	0.59994	-0.7349	9	0.37606	T	0.19	-16.0888	9.7211	0.40304	0.1568:0.0:0.8432:0.0	.	969	Q6P9B9	INT5_HUMAN	L	969	.	ENSP00000327889:F969L	F	-	3	2	INTS5	62171221	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.135000	0.50546	2.823000	0.97156	0.650000	0.86243	TTC	INTS5	-	NULL	ENSG00000185085		0.592	INTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS5	HGNC	protein_coding	OTTHUMT00000395327.1	58	0.00	0	G	NM_030628		62414645	62414645	-1	no_errors	ENST00000330574	ensembl	human	known	69_37n	missense	32	11.11	4	SNP	1.000	T
INTS5	80789	genome.wustl.edu	37	11	62415402	62415402	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr11:62415402G>A	ENST00000330574.2	-	2	2202	c.2150C>T	c.(2149-2151)tCa>tTa	p.S717L	GANAB_ENST00000534779.1_5'Flank|GANAB_ENST00000346178.4_5'Flank|GANAB_ENST00000540933.1_5'Flank|GANAB_ENST00000356638.3_5'Flank	NM_030628.1	NP_085131.1	Q6P9B9	INT5_HUMAN	integrator complex subunit 5	717					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)				breast(1)|endometrium(4)|large_intestine(6)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	36						TGAAACAACTGAGAGAGTCTC	0.537																																						dbGAP											0													83.0	85.0	85.0					11																	62415402		2202	4299	6501	-	-	-	SO:0001583	missense	0			AK123587	CCDS8027.1	11q12.3	2006-04-26	2006-03-15	2006-03-15	ENSG00000185085	ENSG00000185085			29352	protein-coding gene	gene with protein product		611349	"""KIAA1698"""	KIAA1698		16239144	Standard	NM_030628		Approved	INT5	uc001nud.3	Q6P9B9	OTTHUMG00000167605	ENST00000330574.2:c.2150C>T	11.37:g.62415402G>A	ENSP00000327889:p.Ser717Leu		Q8N6W5|Q9C0G5	Missense_Mutation	SNP	NULL	p.S717L	ENST00000330574.2	37	c.2150	CCDS8027.1	11	.	.	.	.	.	.	.	.	.	.	G	8.420	0.846087	0.16963	.	.	ENSG00000185085	ENST00000330574	.	.	.	5.44	5.44	0.79542	.	0.288499	0.32287	N	0.006313	T	0.34337	0.0894	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.30794	-0.9966	9	0.56958	D	0.05	.	16.8112	0.85720	0.0:0.0:1.0:0.0	.	717	Q6P9B9	INT5_HUMAN	L	717	.	ENSP00000327889:S717L	S	-	2	0	INTS5	62171978	0.948000	0.32251	0.590000	0.28732	0.651000	0.38670	4.916000	0.63362	2.837000	0.97791	0.655000	0.94253	TCA	INTS5	-	NULL	ENSG00000185085		0.537	INTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS5	HGNC	protein_coding	OTTHUMT00000395327.1	136	0.00	0	G	NM_030628		62415402	62415402	-1	no_errors	ENST00000330574	ensembl	human	known	69_37n	missense	69	11.54	9	SNP	0.034	A
INTS5	80789	genome.wustl.edu	37	11	62417233	62417233	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr11:62417233G>C	ENST00000330574.2	-	2	371	c.319C>G	c.(319-321)Cca>Gca	p.P107A	RP11-831H9.11_ENST00000528405.1_3'UTR	NM_030628.1	NP_085131.1	Q6P9B9	INT5_HUMAN	integrator complex subunit 5	107					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)				breast(1)|endometrium(4)|large_intestine(6)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	36						TGAGAGGGTGGAGGTGGACGG	0.597																																						dbGAP											0													116.0	123.0	121.0					11																	62417233		2202	4299	6501	-	-	-	SO:0001583	missense	0			AK123587	CCDS8027.1	11q12.3	2006-04-26	2006-03-15	2006-03-15	ENSG00000185085	ENSG00000185085			29352	protein-coding gene	gene with protein product		611349	"""KIAA1698"""	KIAA1698		16239144	Standard	NM_030628		Approved	INT5	uc001nud.3	Q6P9B9	OTTHUMG00000167605	ENST00000330574.2:c.319C>G	11.37:g.62417233G>C	ENSP00000327889:p.Pro107Ala		Q8N6W5|Q9C0G5	Missense_Mutation	SNP	NULL	p.P107A	ENST00000330574.2	37	c.319	CCDS8027.1	11	.	.	.	.	.	.	.	.	.	.	G	1.089	-0.664712	0.03428	.	.	ENSG00000185085	ENST00000330574	.	.	.	4.61	2.72	0.32119	.	0.342457	0.23832	N	0.044124	T	0.14056	0.0340	N	0.08118	0	0.26869	N	0.967798	B	0.18166	0.026	B	0.16289	0.015	T	0.32693	-0.9897	9	0.02654	T	1	.	7.8254	0.29311	0.0916:0.164:0.7444:0.0	.	107	Q6P9B9	INT5_HUMAN	A	107	.	ENSP00000327889:P107A	P	-	1	0	INTS5	62173809	0.997000	0.39634	0.998000	0.56505	0.954000	0.61252	1.394000	0.34509	0.551000	0.29008	0.561000	0.74099	CCA	INTS5	-	NULL	ENSG00000185085		0.597	INTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS5	HGNC	protein_coding	OTTHUMT00000395327.1	158	0.00	0	G	NM_030628		62417233	62417233	-1	no_errors	ENST00000330574	ensembl	human	known	69_37n	missense	98	10.91	12	SNP	0.995	C
INTU	27152	genome.wustl.edu	37	4	128564824	128564824	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr4:128564824G>C	ENST00000335251.6	+	2	398	c.295G>C	c.(295-297)Gat>Cat	p.D99H	INTU_ENST00000296461.5_Missense_Mutation_p.D99H	NM_015693.3	NP_056508.2	Q9ULD6	INTU_HUMAN	inturned planar cell polarity protein	99					cilium assembly (GO:0042384)|hair follicle morphogenesis (GO:0031069)|keratinocyte differentiation (GO:0030216)|limb development (GO:0060173)|negative regulation of cell division (GO:0051782)|negative regulation of keratinocyte proliferation (GO:0010839)|nervous system development (GO:0007399)|positive regulation of smoothened signaling pathway (GO:0045880)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord dorsal/ventral patterning (GO:0021513)	cytoplasm (GO:0005737)				breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	43						TATCATTGAAGATGACTACAA	0.353																																						dbGAP											0													101.0	110.0	107.0					4																	128564824		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC051698	CCDS34061.1	4q28.2	2013-03-05	2013-03-05	2006-10-24	ENSG00000164066	ENSG00000164066			29239	protein-coding gene	gene with protein product		610621	"""PDZ domain containing 6"", ""inturned planar cell polarity effector homolog (Drosophila)"""	PDZK6, PDZD6		10574462, 21761479	Standard	NM_015693		Approved	KIAA1284	uc003ifk.2	Q9ULD6	OTTHUMG00000161202	ENST00000335251.6:c.295G>C	4.37:g.128564824G>C	ENSP00000334003:p.Asp99His		A1L4N5|D6RAE6|D6RBT4|Q4W5I8|Q86V55	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.D99H	ENST00000335251.6	37	c.295	CCDS34061.1	4	.	.	.	.	.	.	.	.	.	.	G	15.10	2.732898	0.48939	.	.	ENSG00000164066	ENST00000504491;ENST00000335251;ENST00000296461	T	0.48522	0.81	5.0	5.0	0.66597	.	0.577445	0.18637	N	0.135419	T	0.47764	0.1463	L	0.29908	0.895	0.34778	D	0.734471	P	0.52692	0.955	P	0.53593	0.73	T	0.60068	-0.7335	10	0.66056	D	0.02	-8.6836	11.1435	0.48417	0.0837:0.0:0.9163:0.0	.	99	Q9ULD6	PDZD6_HUMAN	H	80;99;99	ENSP00000296461:D99H	ENSP00000296461:D99H	D	+	1	0	INTU	128784274	1.000000	0.71417	0.994000	0.49952	0.609000	0.37215	2.113000	0.41902	2.593000	0.87608	0.655000	0.94253	GAT	INTU	-	NULL	ENSG00000164066		0.353	INTU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	INTU	HGNC	protein_coding	OTTHUMT00000364147.2	84	0.00	0	G	XM_371707		128564824	128564824	+1	no_errors	ENST00000335251	ensembl	human	known	69_37n	missense	57	10.94	7	SNP	0.998	C
KCTD19	146212	genome.wustl.edu	37	16	67325298	67325298	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr16:67325298G>T	ENST00000304372.5	-	14	2534	c.2479C>A	c.(2479-2481)Ctg>Atg	p.L827M		NM_001100915.1	NP_001094385.1	Q17RG1	KCD19_HUMAN	potassium channel tetramerization domain containing 19	827					protein homooligomerization (GO:0051260)					endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)	23		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0311)|Epithelial(162;0.0906)		ATGTCAGCCAGGAAGCAGTGA	0.512																																						dbGAP											0													83.0	81.0	82.0					16																	67325298		1999	4188	6187	-	-	-	SO:0001583	missense	0			AK097481	CCDS42179.1	16q22.1	2013-06-20	2013-06-20			ENSG00000168676			24753	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 19"""				Standard	NM_001100915		Approved	FLJ40162	uc002esu.2	Q17RG1		ENST00000304372.5:c.2479C>A	16.37:g.67325298G>T	ENSP00000305702:p.Leu827Met		B4DZ49|Q8N804	Missense_Mutation	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold	p.L827M	ENST00000304372.5	37	c.2479	CCDS42179.1	16	.	.	.	.	.	.	.	.	.	.	G	18.99	3.739196	0.69304	.	.	ENSG00000168676	ENST00000304372	T	0.72942	-0.7	5.8	5.8	0.92144	.	0.000000	0.43260	D	0.000598	T	0.76793	0.4037	L	0.27053	0.805	0.36198	D	0.850545	D	0.76494	0.999	D	0.85130	0.997	T	0.82133	-0.0608	10	0.87932	D	0	-7.6098	16.7783	0.85557	0.0:0.0:1.0:0.0	.	827	Q17RG1	KCD19_HUMAN	M	827	ENSP00000305702:L827M	ENSP00000305702:L827M	L	-	1	2	KCTD19	65882799	1.000000	0.71417	1.000000	0.80357	0.648000	0.38561	4.677000	0.61634	2.753000	0.94483	0.455000	0.32223	CTG	KCTD19	-	NULL	ENSG00000168676		0.512	KCTD19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD19	HGNC	protein_coding	OTTHUMT00000422061.1	146	0.00	0	G	XM_085367		67325298	67325298	-1	no_errors	ENST00000304372	ensembl	human	known	69_37n	missense	69	13.75	11	SNP	1.000	T
LPIN2	9663	genome.wustl.edu	37	18	2960806	2960806	+	Silent	SNP	C	C	T			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr18:2960806C>T	ENST00000261596.4	-	2	271	c.33G>A	c.(31-33)gtG>gtA	p.V11V	RP11-737O24.2_ENST00000584431.1_RNA	NM_014646.2	NP_055461.1	Q92539	LPIN2_HUMAN	lipin 2	11	N-LIP.				cellular lipid metabolic process (GO:0044255)|dephosphorylation (GO:0016311)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)|transcription coactivator activity (GO:0003713)			autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	29				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		CAGTGACAATCACCTGCCCAG	0.443																																						dbGAP											0													85.0	74.0	78.0					18																	2960806		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D87436	CCDS11829.1	18p	2014-09-17			ENSG00000101577	ENSG00000101577			14450	protein-coding gene	gene with protein product		605519				11138012, 9039502	Standard	NM_014646		Approved	KIAA0249	uc002klo.3	Q92539	OTTHUMG00000131508	ENST00000261596.4:c.33G>A	18.37:g.2960806C>T			A7MD25|D3DUH3	Silent	SNP	pfam_LNS2,pfam_Lipin_N,superfamily_HAD-like_dom,smart_LNS2	p.V11	ENST00000261596.4	37	c.33	CCDS11829.1	18																																																																																			LPIN2	-	pfam_Lipin_N	ENSG00000101577		0.443	LPIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPIN2	HGNC	protein_coding	OTTHUMT00000254363.2	118	0.00	0	C	NM_014646		2960806	2960806	-1	no_errors	ENST00000261596	ensembl	human	known	69_37n	silent	70	23.91	22	SNP	1.000	T
LAMA1	284217	genome.wustl.edu	37	18	7032992	7032992	+	Silent	SNP	G	G	C			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr18:7032992G>C	ENST00000389658.3	-	15	2247	c.2154C>G	c.(2152-2154)acC>acG	p.T718T		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	718	Laminin EGF-like 5; second part. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				CCTCACAGGAGGTCCCTGTGT	0.522																																						dbGAP											0													106.0	80.0	89.0					18																	7032992		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.2154C>G	18.37:g.7032992G>C				Silent	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_B_type_IV,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_II,superfamily_ConA-like_lec_gl,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.T718	ENST00000389658.3	37	c.2154	CCDS32787.1	18																																																																																			LAMA1	-	pfam_EGF_laminin,smart_EGF_laminin	ENSG00000101680		0.522	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	HGNC	protein_coding	OTTHUMT00000257369.1	95	0.00	0	G	NM_005559		7032992	7032992	-1	no_errors	ENST00000389658	ensembl	human	known	69_37n	silent	65	10.96	8	SNP	1.000	C
NDFIP1	80762	genome.wustl.edu	37	5	141511786	141511786	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr5:141511786A>T	ENST00000253814.4	+	3	631	c.161A>T	c.(160-162)gAc>gTc	p.D54V	NDFIP1_ENST00000509436.1_Intron	NM_030571.3	NP_085048.1	Q9BT67	NFIP1_HUMAN	Nedd4 family interacting protein 1	54					cellular iron ion homeostasis (GO:0006879)|negative regulation of gene expression (GO:0010629)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-4 production (GO:0032713)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of protein transport (GO:0051224)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transporter activity (GO:0032410)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein ubiquitination (GO:0031398)|regulation of isotype switching to IgG isotypes (GO:0048302)|regulation of lymphocyte differentiation (GO:0045619)|regulation of myeloid leukocyte differentiation (GO:0002761)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	cell cortex (GO:0005938)|endosome (GO:0005768)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	signal transducer activity (GO:0004871)			large_intestine(3)|lung(1)|ovary(1)	5		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCATATTTTGACTACAAGGAT	0.413																																						dbGAP											0													84.0	80.0	81.0					5																	141511786		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC004317	CCDS4273.1	5q31.3	2008-02-05			ENSG00000131507	ENSG00000131507			17592	protein-coding gene	gene with protein product		612050				11042109, 11748237	Standard	NM_030571		Approved	N4WBP5, MGC10924	uc003lmi.4	Q9BT67	OTTHUMG00000129659	ENST00000253814.4:c.161A>T	5.37:g.141511786A>T	ENSP00000253814:p.Asp54Val		B2RDB8|D3DQF0|Q658T8|Q8N2E3|Q8N2F9	Missense_Mutation	SNP	pfam_NEDD4/BSD2	p.D54V	ENST00000253814.4	37	c.161	CCDS4273.1	5	.	.	.	.	.	.	.	.	.	.	A	23.9	4.468915	0.84533	.	.	ENSG00000131507	ENST00000253814;ENST00000313129	.	.	.	5.4	5.4	0.78164	.	0.044008	0.85682	D	0.000000	T	0.67878	0.2940	L	0.40543	1.245	0.80722	D	1	D;P	0.89917	1.0;0.72	D;P	0.74674	0.984;0.54	T	0.67791	-0.5579	9	0.44086	T	0.13	-25.7054	15.7033	0.77558	1.0:0.0:0.0:0.0	.	54;54	Q9BT67-2;Q9BT67	.;NFIP1_HUMAN	V	54	.	ENSP00000253814:D54V	D	+	2	0	NDFIP1	141491970	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.001000	0.76297	2.182000	0.69389	0.402000	0.26972	GAC	NDFIP1	-	NULL	ENSG00000131507		0.413	NDFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDFIP1	HGNC	protein_coding	OTTHUMT00000251859.2	208	0.00	0	A	NM_030571		141511786	141511786	+1	no_errors	ENST00000253814	ensembl	human	known	69_37n	missense	137	10.46	16	SNP	1.000	T
PFKFB3	5209	genome.wustl.edu	37	10	6262763	6262763	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr10:6262763G>A	ENST00000379775.4	+	8	1096	c.766G>A	c.(766-768)Gag>Aag	p.E256K	PFKFB3_ENST00000379785.1_Missense_Mutation_p.E256K|PFKFB3_ENST00000360521.2_Missense_Mutation_p.E256K|PFKFB3_ENST00000317350.4_Missense_Mutation_p.E256K|PFKFB3_ENST00000540253.1_Missense_Mutation_p.E270K|PFKFB3_ENST00000379782.3_Missense_Mutation_p.E256K|PFKFB3_ENST00000536985.1_3'UTR|PFKFB3_ENST00000379789.4_Missense_Mutation_p.E236K	NM_004566.3	NP_004557.1	Q16875	F263_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3	256	Fructose-2,6-bisphosphatase.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|liver(2)|lung(10)|ovary(3)|upper_aerodigestive_tract(1)	22						CCGGCACGGCGAGAACGAGCA	0.657																																						dbGAP											0													98.0	90.0	93.0					10																	6262763		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS7078.1, CCDS44353.1, CCDS60479.1	10p15.1	2008-05-14			ENSG00000170525	ENSG00000170525			8874	protein-coding gene	gene with protein product		605319				9146922, 10072580	Standard	NM_004566		Approved		uc001ije.3	Q16875	OTTHUMG00000017621	ENST00000379775.4:c.766G>A	10.37:g.6262763G>A	ENSP00000369100:p.Glu256Lys		B7Z955|O43622|O75902|Q5VX15|Q5VX18|Q5VX19	Missense_Mutation	SNP	pfam_6Phosfructo_kin,pfam_His_Pase_superF_clade-1,pfam_Chromatin_KTI12,smart_His_Pase_superF_clade-1,pirsf_Bifunct_6PFK/fruc_bisP_Ptase,prints_6Pfruct_kin	p.E270K	ENST00000379775.4	37	c.808	CCDS7078.1	10	.	.	.	.	.	.	.	.	.	.	G	37	6.103616	0.97286	.	.	ENSG00000170525	ENST00000379789;ENST00000379784;ENST00000540253;ENST00000317350;ENST00000379785;ENST00000379782;ENST00000360521;ENST00000379775;ENST00000358499	T;T;T;T;T;T;T	0.75367	-0.93;-0.93;-0.93;-0.93;-0.93;-0.93;-0.93	5.93	5.93	0.95920	Histidine phosphatase superfamily, clade-1 (2);	0.093787	0.64402	D	0.000001	D	0.90546	0.7037	M	0.93507	3.425	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.996;0.997;0.997	D	0.91974	0.5589	10	0.87932	D	0	-13.601	20.3437	0.98782	0.0:0.0:1.0:0.0	.	270;256;256;236	B7Z955;Q16875-2;Q16875;Q5VX15	.;.;F263_HUMAN;.	K	236;17;270;256;256;256;256;256;256	ENSP00000369115:E236K;ENSP00000446384:E270K;ENSP00000369105:E256K;ENSP00000369111:E256K;ENSP00000369108:E256K;ENSP00000353712:E256K;ENSP00000369100:E256K	ENSP00000369105:E256K	E	+	1	0	PFKFB3	6302769	1.000000	0.71417	0.985000	0.45067	0.981000	0.71138	9.603000	0.98315	2.815000	0.96918	0.561000	0.74099	GAG	PFKFB3	-	pfam_His_Pase_superF_clade-1,smart_His_Pase_superF_clade-1,pirsf_Bifunct_6PFK/fruc_bisP_Ptase,prints_6Pfruct_kin	ENSG00000170525		0.657	PFKFB3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PFKFB3	HGNC	protein_coding	OTTHUMT00000046647.1	70	0.00	0	G			6262763	6262763	+1	no_errors	ENST00000540253	ensembl	human	known	69_37n	missense	48	15.79	9	SNP	1.000	A
PHC1	1911	genome.wustl.edu	37	12	9070338	9070338	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr12:9070338C>G	ENST00000543824.1	+	3	397	c.65C>G	c.(64-66)tCt>tGt	p.S22C	PHC1_ENST00000544916.1_Missense_Mutation_p.S22C|PHC1_ENST00000536844.1_5'UTR|PHC1_ENST00000433083.2_Missense_Mutation_p.S22C|PHC1_ENST00000433847.2_3'UTR			P78364	PHC1_HUMAN	polyhomeotic homolog 1 (Drosophila)	22					cellular response to retinoic acid (GO:0071300)|histone ubiquitination (GO:0016574)|multicellular organismal development (GO:0007275)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|large_intestine(8)|liver(2)|lung(3)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	27						GGGGGCAGCTCTCGGCCCCAG	0.552																																						dbGAP											0													43.0	39.0	40.0					12																	9070338		2203	4297	6500	-	-	-	SO:0001583	missense	0			U89277	CCDS8597.1	12p13	2013-01-10	2006-09-12	2002-11-15	ENSG00000111752	ENSG00000111752		"""Sterile alpha motif (SAM) domain containing"""	3182	protein-coding gene	gene with protein product		602978	"""early development regulator 1 (homolog of polyhomeotic 1)"", ""polyhomeotic-like 1 (Drosophila)"""	EDR1		9121482	Standard	XM_005253334		Approved	HPH1, RAE28	uc001qvd.3	P78364	OTTHUMG00000168275	ENST00000543824.1:c.65C>G	12.37:g.9070338C>G	ENSP00000440674:p.Ser22Cys		D3DUV4|Q8WVM3|Q9BU63	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,pfam_Znf_MYM,superfamily_SAM/pointed,smart_SAM,pfscan_SAM,pfscan_Znf_FCS	p.S22C	ENST00000543824.1	37	c.65	CCDS8597.1	12	.	.	.	.	.	.	.	.	.	.	C	19.40	3.819551	0.71028	.	.	ENSG00000111752	ENST00000538657;ENST00000543824;ENST00000251757;ENST00000433083;ENST00000544916;ENST00000544539;ENST00000539063;ENST00000541181	T;T;T;T	0.28255	1.74;1.74;1.62;1.74	4.86	4.86	0.63082	.	0.081983	0.50627	D	0.000115	T	0.32071	0.0817	L	0.27053	0.805	0.80722	D	1	P;P;P	0.45283	0.8;0.855;0.698	P;B;B	0.46758	0.526;0.326;0.243	T	0.12167	-1.0558	10	0.72032	D	0.01	-16.8015	18.1391	0.89633	0.0:1.0:0.0:0.0	.	22;22;22	B4DF21;P78364;B2RXH1	.;PHC1_HUMAN;.	C	22	ENSP00000440674:S22C;ENSP00000251757:S22C;ENSP00000399194:S22C;ENSP00000437659:S22C	ENSP00000251757:S22C	S	+	2	0	PHC1	8961605	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.412000	0.66392	2.685000	0.91497	0.655000	0.94253	TCT	PHC1	-	NULL	ENSG00000111752		0.552	PHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHC1	HGNC	protein_coding	OTTHUMT00000399115.1	52	0.00	0	C	NM_004426		9070338	9070338	+1	no_errors	ENST00000251757	ensembl	human	known	69_37n	missense	29	12.12	4	SNP	1.000	G
PNISR	25957	genome.wustl.edu	37	6	99860583	99860583	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr6:99860583A>G	ENST00000369239.5	-	4	325	c.121T>C	c.(121-123)Tgg>Cgg	p.W41R	PNISR_ENST00000466057.1_5'UTR|PNISR_ENST00000438806.1_Missense_Mutation_p.W41R	NM_032870.2	NP_116259.2	Q8TF01	PNISR_HUMAN	PNN-interacting serine/arginine-rich protein	41	Gln-rich.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24						TGGGCAATCCAAGCTTGGGCC	0.433																																						dbGAP											0													128.0	115.0	120.0					6																	99860583		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027759	CCDS5043.1	6q16.3	2011-06-06	2011-06-06	2011-06-06	ENSG00000132424	ENSG00000132424			21222	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 111"", ""splicing factor, arginine/serine-rich 18"""	C6orf111, SFRS18		14578391	Standard	NM_032870		Approved	FLJ14752, bA98I9.2, DKFZp564B0769, SRrp130	uc021zdd.1	Q8TF01	OTTHUMG00000015262	ENST00000369239.5:c.121T>C	6.37:g.99860583A>G	ENSP00000358242:p.Trp41Arg		A8K540|E1P5D2|Q5T064|Q5T065|Q6P2B4|Q6P2N4|Q6PJ93|Q6PK36|Q7Z640|Q8N2L1|Q8TF00|Q96K10|Q96SI3|Q96SM5|Q9P076|Q9P0C0|Q9Y4N3	Missense_Mutation	SNP	NULL	p.W41R	ENST00000369239.5	37	c.121	CCDS5043.1	6	.	.	.	.	.	.	.	.	.	.	A	24.9	4.579885	0.86645	.	.	ENSG00000132424	ENST00000369239;ENST00000438806	T;T	0.50548	0.74;0.74	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.50103	0.1596	L	0.29908	0.895	0.80722	D	1	D;D	0.76494	0.994;0.999	D;D	0.87578	0.986;0.998	T	0.57745	-0.7758	10	0.87932	D	0	.	16.1832	0.81925	1.0:0.0:0.0:0.0	.	41;41	E1P5D4;Q8TF01	.;PNISR_HUMAN	R	41	ENSP00000358242:W41R;ENSP00000387997:W41R	ENSP00000358242:W41R	W	-	1	0	PNISR	99967304	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.904000	0.92590	2.228000	0.72767	0.533000	0.62120	TGG	PNISR	-	NULL	ENSG00000132424		0.433	PNISR-007	KNOWN	basic|appris_principal|CCDS	protein_coding	PNISR	HGNC	protein_coding	OTTHUMT00000041598.1	264	0.00	0	A	NM_032870		99860583	99860583	-1	no_errors	ENST00000369239	ensembl	human	known	69_37n	missense	112	12.50	16	SNP	1.000	G
POLR3A	11128	genome.wustl.edu	37	10	79784369	79784369	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr10:79784369G>C	ENST00000372371.3	-	5	720	c.583C>G	c.(583-585)Cag>Gag	p.Q195E		NM_007055.3	NP_008986.2	O14802	RPC1_HUMAN	polymerase (RNA) III (DNA directed) polypeptide A, 155kDa	195					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|ribonucleoside binding (GO:0032549)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)			TCAAAAGACTGAAGGAAATTT	0.448																																						dbGAP											0													117.0	113.0	114.0					10																	79784369		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF021351	CCDS7354.1	10q22-q23	2013-01-21			ENSG00000148606	ENSG00000148606		"""RNA polymerase subunits"""	30074	protein-coding gene	gene with protein product		614258				9331371, 12391170	Standard	NM_007055		Approved	RPC1, RPC155, hRPC155	uc001jzn.3	O14802	OTTHUMG00000018550	ENST00000372371.3:c.583C>G	10.37:g.79784369G>C	ENSP00000361446:p.Gln195Glu		Q8IW34|Q8TCW5	Missense_Mutation	SNP	pfam_RNA_pol_Rpb1_1,pfam_RNA_pol_Rpb1_5,pfam_RNA_pol_asu,pfam_RNA_pol_Rpb1_3,pfam_RNA_pol_Rpb1_4,smart_RNA_pol_N	p.Q195E	ENST00000372371.3	37	c.583	CCDS7354.1	10	.	.	.	.	.	.	.	.	.	.	G	10.38	1.332920	0.24167	.	.	ENSG00000148606	ENST00000372371;ENST00000540842	T	0.19806	2.12	5.52	5.52	0.82312	RNA polymerase Rpb1, domain 1 (1);	0.053370	0.85682	D	0.000000	T	0.09818	0.0241	N	0.01824	-0.7	0.80722	D	1	B	0.06786	0.001	B	0.09377	0.004	T	0.28776	-1.0033	9	.	.	.	-8.7889	19.4533	0.94876	0.0:0.0:1.0:0.0	.	195	O14802	RPC1_HUMAN	E	195	ENSP00000361446:Q195E	.	Q	-	1	0	POLR3A	79454375	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.168000	0.94781	2.604000	0.88044	0.555000	0.69702	CAG	POLR3A	-	pfam_RNA_pol_Rpb1_1	ENSG00000148606		0.448	POLR3A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR3A	HGNC	protein_coding	OTTHUMT00000048923.1	276	0.00	0	G	NM_007055		79784369	79784369	-1	no_errors	ENST00000372371	ensembl	human	known	69_37n	missense	185	12.32	26	SNP	1.000	C
PTK2B	2185	genome.wustl.edu	37	8	27293815	27293815	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr8:27293815C>A	ENST00000397501.1	+	20	2099	c.1291C>A	c.(1291-1293)Ctt>Att	p.L431I	PTK2B_ENST00000517339.1_Missense_Mutation_p.L431I|PTK2B_ENST00000338238.4_Missense_Mutation_p.L431I|PTK2B_ENST00000397497.4_Missense_Mutation_p.L177I|PTK2B_ENST00000346049.5_Missense_Mutation_p.L431I|PTK2B_ENST00000544172.1_Missense_Mutation_p.L431I|PTK2B_ENST00000420218.2_Missense_Mutation_p.L431I	NM_173174.2	NP_775266.1	Q14289	FAK2_HUMAN	protein tyrosine kinase 2 beta	431	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of Janus kinase activity (GO:0042976)|activation of Rac GTPase activity (GO:0032863)|apoptotic process (GO:0006915)|blood vessel endothelial cell migration (GO:0043534)|bone resorption (GO:0045453)|cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|cellular response to retinoic acid (GO:0071300)|chemokine-mediated signaling pathway (GO:0070098)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|glial cell proliferation (GO:0014009)|integrin-mediated signaling pathway (GO:0007229)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term synaptic potentiation (GO:0060291)|MAPK cascade (GO:0000165)|marginal zone B cell differentiation (GO:0002315)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cell proliferation (GO:0008285)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of potassium ion transport (GO:0043267)|neuron projection development (GO:0031175)|oocyte maturation (GO:0001556)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell chemotaxis (GO:2000538)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell adhesion (GO:0030155)|regulation of cell shape (GO:0008360)|regulation of establishment of cell polarity (GO:2000114)|regulation of inositol trisphosphate biosynthetic process (GO:0032960)|regulation of macrophage chemotaxis (GO:0010758)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000058)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to hormone (GO:0009725)|response to hydrogen peroxide (GO:0042542)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to osmotic stress (GO:0006970)|response to stress (GO:0006950)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|stress fiber assembly (GO:0043149)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	apical dendrite (GO:0097440)|axon (GO:0030424)|cell body (GO:0044297)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(17)|ovary(4)|skin(12)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Ovarian(32;2.72e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)	Leflunomide(DB01097)	GAATCGTATTCTTGGGGAAGG	0.488																																						dbGAP											0													301.0	271.0	281.0					8																	27293815		2203	4300	6503	-	-	-	SO:0001583	missense	0			U33284	CCDS6057.1, CCDS6058.1	8p21.1	2013-02-18	2013-02-18		ENSG00000120899	ENSG00000120899			9612	protein-coding gene	gene with protein product		601212	"""protein tyrosine kinase 2 beta"", ""PTK2B protein tyrosine kinase 2 beta"""	FAK2		7544443, 7499242	Standard	NM_173174		Approved	CAKB, PYK2, RAFTK, PTK, CADTK	uc003xfp.2	Q14289	OTTHUMG00000102082	ENST00000397501.1:c.1291C>A	8.37:g.27293815C>A	ENSP00000380638:p.Leu431Ile		D3DST0|Q13475|Q14290|Q16709|Q6PID4	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Focal_adhesion_kin_target_dom,pfam_Prot_kinase_cat_dom,pfam_FERM_central,superfamily_Kinase-like_dom,superfamily_Focal_adhesion_kin_target_dom,superfamily_FERM_central,smart_Band_41_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_FERM_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.L431I	ENST00000397501.1	37	c.1291	CCDS6057.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.85|10.85	1.465736|1.465736	0.26335|0.26335	.|.	.|.	ENSG00000120899|ENSG00000120899	ENST00000397501;ENST00000539100;ENST00000338238;ENST00000544172;ENST00000346049;ENST00000420218;ENST00000517339;ENST00000397497|ENST00000519512	T;T;T;T;T;T;T|.	0.68025|.	-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;-0.3|.	5.44|5.44	4.57|4.57	0.56435|0.56435	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.51856|0.51856	0.1699|0.1699	L|L	0.31294|0.31294	0.92|0.92	0.80722|0.80722	D|D	1|1	B;B;B;B|.	0.18310|.	0.009;0.027;0.021;0.009|.	B;B;B;B|.	0.28465|.	0.071;0.087;0.09;0.071|.	T|T	0.46665|0.46665	-0.9175|-0.9175	10|5	0.02654|.	T|.	1|.	.|.	11.9563|11.9563	0.52983|0.52983	0.0:0.9157:0.0:0.0843|0.0:0.9157:0.0:0.0843	.|.	436;177;431;431|.	Q59GM4;E9PBI4;Q14289-2;Q14289|.	.;.;.;FAK2_HUMAN|.	I|Y	431;436;431;431;431;431;431;177|191	ENSP00000380638:L431I;ENSP00000342242:L431I;ENSP00000440926:L431I;ENSP00000332816:L431I;ENSP00000391995:L431I;ENSP00000427931:L431I;ENSP00000380634:L177I|.	ENSP00000342242:L431I|.	L|S	+|+	1|2	0|0	PTK2B|PTK2B	27349732|27349732	1.000000|1.000000	0.71417|0.71417	0.409000|0.409000	0.26459|0.26459	0.603000|0.603000	0.37013|0.37013	7.144000|7.144000	0.77357|0.77357	1.308000|1.308000	0.44962|0.44962	0.655000|0.655000	0.94253|0.94253	CTT|TCT	PTK2B	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000120899		0.488	PTK2B-009	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PTK2B	HGNC	protein_coding	OTTHUMT00000219916.1	359	0.00	0	C	NM_004103		27293815	27293815	+1	no_errors	ENST00000346049	ensembl	human	known	69_37n	missense	207	14.46	35	SNP	1.000	A
SLAMF1	6504	genome.wustl.edu	37	1	160582299	160582299	+	Silent	SNP	C	C	T			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr1:160582299C>T	ENST00000302035.6	-	6	1285	c.936G>A	c.(934-936)gaG>gaA	p.E312E	SLAMF1_ENST00000538290.1_3'UTR|SLAMF1_ENST00000235739.5_Silent_p.E282E	NM_003037.2	NP_003028.1	Q13291	SLAF1_HUMAN	signaling lymphocytic activation molecule family member 1	312					lymphocyte activation (GO:0046649)|positive regulation of cell proliferation (GO:0008284)|regulation of catalytic activity (GO:0050790)|regulation of vesicle fusion (GO:0031338)|signal transduction (GO:0007165)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|phagocytic vesicle (GO:0045335)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(52;4.94e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			CTGGGACAGGCTCTGTGGCAG	0.468																																						dbGAP											0													57.0	53.0	54.0					1																	160582299		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U33017	CCDS1207.1	1q23.3	2013-01-11	2003-10-29	2003-10-31	ENSG00000117090	ENSG00000117090		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10903	protein-coding gene	gene with protein product		603492	"""signaling lymphocytic activation molecule"""	SLAM		7617038	Standard	XM_005245456		Approved	CD150	uc001fwl.4	Q13291	OTTHUMG00000024006	ENST00000302035.6:c.936G>A	1.37:g.160582299C>T			Q5W172|Q9HBE8	Silent	SNP	pfam_Sig_lymph_act_molc_N,pfscan_Ig-like	p.E312	ENST00000302035.6	37	c.936	CCDS1207.1	1																																																																																			SLAMF1	-	NULL	ENSG00000117090		0.468	SLAMF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLAMF1	HGNC	protein_coding	OTTHUMT00000060454.1	161	0.00	0	C			160582299	160582299	-1	no_errors	ENST00000302035	ensembl	human	known	69_37n	silent	115	12.21	16	SNP	0.997	T
SMC1A	8243	genome.wustl.edu	37	X	53430747	53430747	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chrX:53430747C>G	ENST00000322213.4	-	14	2402	c.2275G>C	c.(2275-2277)Gag>Cag	p.E759Q		NM_006306.2	NP_006297.2	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	759					DNA repair (GO:0006281)|gene expression (GO:0010467)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid cohesion (GO:0007064)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA endoreduplication (GO:0032876)|response to radiation (GO:0009314)|RNA splicing (GO:0008380)|signal transduction in response to DNA damage (GO:0042770)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin core heterodimer (GO:0008280)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|meiotic cohesin complex (GO:0030893)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(8)|ovary(5)|upper_aerodigestive_tract(2)	49						ATTTCCCTCTCTCGGCTCTGA	0.517																																						dbGAP											0													172.0	132.0	145.0					X																	53430747		2203	4300	6503	-	-	-	SO:0001583	missense	0			S78271	CCDS14352.1, CCDS75985.1	Xp11.22-p11.21	2014-09-17	2006-07-06	2006-07-06	ENSG00000072501	ENSG00000072501		"""Structural maintenance of chromosomes proteins"""	11111	protein-coding gene	gene with protein product		300040	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 1 (yeast)"""	SMC1L1		7757074	Standard	NM_006306		Approved	DXS423E, KIAA0178, SB1.8, Smcb	uc004dsg.3	Q14683	OTTHUMG00000021614	ENST00000322213.4:c.2275G>C	X.37:g.53430747C>G	ENSP00000323421:p.Glu759Gln		O14995|Q16351|Q2M228	Missense_Mutation	SNP	pfam_RecF/RecN/SMC,pfam_SMC_hinge,superfamily_SMC_hinge,smart_SMC_hinge,prints_Tropomyosin	p.E759Q	ENST00000322213.4	37	c.2275	CCDS14352.1	X	.	.	.	.	.	.	.	.	.	.	C	13.64	2.298465	0.40694	.	.	ENSG00000072501	ENST00000322213	T	0.78924	-1.22	4.45	4.45	0.53987	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	T	0.64271	0.2583	N	0.25992	0.78	0.80722	D	1	B;B	0.25563	0.129;0.004	B;B	0.20184	0.028;0.018	T	0.60281	-0.7294	10	0.13108	T	0.6	.	15.3885	0.74723	0.0:1.0:0.0:0.0	.	737;759	Q6MZR8;Q14683	.;SMC1A_HUMAN	Q	759	ENSP00000323421:E759Q	ENSP00000323421:E759Q	E	-	1	0	SMC1A	53447472	0.998000	0.40836	1.000000	0.80357	0.965000	0.64279	3.741000	0.55090	2.230000	0.72887	0.529000	0.55759	GAG	SMC1A	-	pfam_RecF/RecN/SMC	ENSG00000072501		0.517	SMC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC1A	HGNC	protein_coding	OTTHUMT00000056756.2	520	0.19	1	C	NM_006306		53430747	53430747	-1	no_errors	ENST00000322213	ensembl	human	known	69_37n	missense	266	11.92	36	SNP	1.000	G
SNX11	29916	genome.wustl.edu	37	17	46189979	46189979	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr17:46189979A>G	ENST00000393405.2	+	4	440	c.86A>G	c.(85-87)gAg>gGg	p.E29G	SNX11_ENST00000578861.1_3'UTR|SNX11_ENST00000582104.1_Missense_Mutation_p.E21G|SNX11_ENST00000439357.2_Missense_Mutation_p.R2G|SNX11_ENST00000452859.2_Intron|SNX11_ENST00000580219.1_Missense_Mutation_p.E21G|SNX11_ENST00000359238.2_Missense_Mutation_p.E29G	NM_152244.1	NP_689450.1	Q9Y5W9	SNX11_HUMAN	sorting nexin 11	29	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				intracellular protein transport (GO:0006886)|vesicle organization (GO:0016050)	endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol phosphate binding (GO:1901981)			breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(5)|prostate(1)|skin(1)	14						GTGCAGAATGAGGGCTCCTGG	0.512																																						dbGAP											0													189.0	183.0	185.0					17																	46189979		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF121861	CCDS11526.1	17q21.32	2011-05-03			ENSG00000002919	ENSG00000002919		"""Sorting nexins"""	14975	protein-coding gene	gene with protein product		614906					Standard	NM_013323		Approved		uc002ing.1	Q9Y5W9		ENST00000393405.2:c.86A>G	17.37:g.46189979A>G	ENSP00000377059:p.Glu29Gly		B3KRL6|B4DPY5|D3DTV0|Q53YC0|Q9H885	Missense_Mutation	SNP	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.E29G	ENST00000393405.2	37	c.86	CCDS11526.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.34|14.34	2.506271|2.506271	0.44558|0.44558	.|.	.|.	ENSG00000002919|ENSG00000002919	ENST00000393405;ENST00000359238|ENST00000439357	T;T|.	0.36157|.	1.27;1.27|.	5.22|5.22	4.11|4.11	0.48088|0.48088	Phox homologous domain (5);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.32346|0.32346	0.0826|0.0826	L|L	0.48260|0.48260	1.515|1.515	0.26645|0.26645	N|N	0.972201|0.972201	P;P|P	0.46859|0.44627	0.885;0.885|0.839	P;P|B	0.48770|0.41236	0.589;0.492|0.351	T|T	0.07966|0.07966	-1.0745|-1.0745	10|7	0.66056|.	D|.	0.02|.	-3.7204|-3.7204	9.9384|9.9384	0.41565|0.41565	0.8287:0.1713:0.0:0.0|0.8287:0.1713:0.0:0.0	.|.	21;29|2	B4DPY5;Q9Y5W9|B4DKH7	.;SNX11_HUMAN|.	G|G	29|2	ENSP00000377059:E29G;ENSP00000352175:E29G|.	ENSP00000352175:E29G|.	E|R	+|+	2|1	0|2	SNX11|SNX11	43544978|43544978	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	6.819000|6.819000	0.75262|0.75262	0.798000|0.798000	0.33994|0.33994	0.374000|0.374000	0.22700|0.22700	GAG|AGG	SNX11	-	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	ENSG00000002919		0.512	SNX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX11	HGNC	protein_coding	OTTHUMT00000443423.1	182	0.00	0	A			46189979	46189979	+1	no_errors	ENST00000359238	ensembl	human	known	69_37n	missense	137	15.43	25	SNP	1.000	G
SPRTN	83932	genome.wustl.edu	37	1	231474280	231474280	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr1:231474280C>T	ENST00000295050.7	+	1	487	c.151C>T	c.(151-153)Cag>Tag	p.Q51*	SPRTN_ENST00000391858.4_Nonsense_Mutation_p.Q51*|EXOC8_ENST00000360394.2_5'Flank|SPRTN_ENST00000008440.9_Nonsense_Mutation_p.Q51*|EXOC8_ENST00000366645.1_5'Flank	NM_001010984.2|NM_032018.5	NP_001010984.1|NP_114407.3	Q9H040	SPRTN_HUMAN	SprT-like N-terminal domain	51	SprT-like.				cellular response to DNA damage stimulus (GO:0006974)|positive regulation of protein ubiquitination (GO:0031398)|response to UV (GO:0009411)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|K63-linked polyubiquitin binding (GO:0070530)|metal ion binding (GO:0046872)|ubiquitin binding (GO:0043130)										ACTGTTTGTTCAGTTTAACGA	0.622																																						dbGAP											0													125.0	125.0	125.0					1																	231474280		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AL512744	CCDS1594.1, CCDS31054.1, CCDS58066.1	1q42.12-q43	2013-01-30	2012-06-18	2012-06-18	ENSG00000010072	ENSG00000010072			25356	protein-coding gene	gene with protein product	"""SprT-like domain at the N terminus"", ""DNA damage-targeting VCP (p97) adaptor"""		"""chromosome 1 open reading frame 124"""	C1orf124		22681887	Standard	NM_032018		Approved	DKFZP547N043, Spartan, DVC1	uc001hur.4	Q9H040	OTTHUMG00000038022	ENST00000295050.7:c.151C>T	1.37:g.231474280C>T	ENSP00000295050:p.Gln51*		B1AKT0|B5MEF7|Q5TE78|Q6UWW6|Q96BC5|Q96KA0	Nonsense_Mutation	SNP	pfam_SprT-like_domain,smart_SprT-like_domain,smart_Znf_Rad18_put	p.Q51*	ENST00000295050.7	37	c.151	CCDS1594.1	1	.	.	.	.	.	.	.	.	.	.	C	37	6.068738	0.97251	.	.	ENSG00000010072	ENST00000391858;ENST00000295050;ENST00000008440;ENST00000545269	.	.	.	4.86	4.86	0.63082	.	0.169147	0.52532	D	0.000061	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	-14.6758	13.8778	0.63665	0.0:0.8474:0.1526:0.0	.	.	.	.	X	51	.	ENSP00000008440:Q51X	Q	+	1	0	C1orf124	229540903	1.000000	0.71417	0.999000	0.59377	0.962000	0.63368	3.525000	0.53502	2.532000	0.85374	0.462000	0.41574	CAG	SPRTN	-	pfam_SprT-like_domain,smart_SprT-like_domain	ENSG00000010072		0.622	SPRTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRTN	HGNC	protein_coding	OTTHUMT00000092858.1	143	0.69	1	C	NM_032018		231474280	231474280	+1	no_errors	ENST00000295050	ensembl	human	known	69_37n	nonsense	109	12.10	15	SNP	1.000	T
SPTB	6710	genome.wustl.edu	37	14	65263386	65263386	+	Silent	SNP	C	C	T			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr14:65263386C>T	ENST00000389721.5	-	10	1262	c.1230G>A	c.(1228-1230)ctG>ctA	p.L410L	SPTB_ENST00000556626.1_Silent_p.L410L|SPTB_ENST00000389720.3_Silent_p.L410L|SPTB_ENST00000542895.1_Silent_p.L410L|SPTB_ENST00000389722.3_Silent_p.L410L	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	410					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		GCTCATTTCTCAGGGCCAGCT	0.572																																						dbGAP											0													50.0	53.0	52.0					14																	65263386		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.1230G>A	14.37:g.65263386C>T			Q15510|Q15519	Silent	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_CAMSAP_CH,pfam_Pleckstrin_homology,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.L410	ENST00000389721.5	37	c.1230	CCDS32100.1	14																																																																																			SPTB	-	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000070182		0.572	SPTB-004	KNOWN	basic|CCDS	protein_coding	SPTB	HGNC	protein_coding	OTTHUMT00000414080.1	107	0.00	0	C			65263386	65263386	-1	no_errors	ENST00000389722	ensembl	human	known	69_37n	silent	53	10.17	6	SNP	1.000	T
STX17	55014	genome.wustl.edu	37	9	102677570	102677570	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr9:102677570A>G	ENST00000259400.6	+	2	185	c.49A>G	c.(49-51)Atc>Gtc	p.I17V	STX17_ENST00000525640.1_Missense_Mutation_p.I17V|RP11-60I3.4_ENST00000524512.1_RNA|STX17_ENST00000534052.1_Missense_Mutation_p.I17V	NM_017919.2	NP_060389.2	P56962	STX17_HUMAN	syntaxin 17	17					autophagic vacuole fusion (GO:0000046)|endoplasmic reticulum-Golgi intermediate compartment organization (GO:0097111)|ER to Golgi vesicle-mediated transport (GO:0006888)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|protein localization to pre-autophagosomal structure (GO:0034497)	autophagic vacuole membrane (GO:0000421)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|ER to Golgi transport vesicle (GO:0030134)|ER-mitochondrion membrane contact site (GO:0044233)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|smooth endoplasmic reticulum membrane (GO:0030868)|SNARE complex (GO:0031201)	protein phosphatase binding (GO:0019903)|SNAP receptor activity (GO:0005484)|SNARE binding (GO:0000149)			endometrium(2)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)				TGAACCAGCTATCCAGAAATT	0.383																																						dbGAP											0													108.0	109.0	109.0					9																	102677570		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL834371	CCDS6745.1	9q31.1	2008-02-05			ENSG00000136874	ENSG00000136874			11432	protein-coding gene	gene with protein product		604204				9852078	Standard	NM_017919		Approved	FLJ20651	uc004bal.4	P56962	OTTHUMG00000020359	ENST00000259400.6:c.49A>G	9.37:g.102677570A>G	ENSP00000259400:p.Ile17Val		Q4VXC2	Missense_Mutation	SNP	pfam_T_SNARE_dom,superfamily_t-SNARE,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.I17V	ENST00000259400.6	37	c.49	CCDS6745.1	9	.	.	.	.	.	.	.	.	.	.	A	15.96	2.987945	0.53934	.	.	ENSG00000136874	ENST00000259400;ENST00000531035;ENST00000525640;ENST00000534052;ENST00000526607	T;T;T	0.21932	1.98;1.98;1.98	5.32	4.16	0.48862	t-SNARE (1);	0.000000	0.85682	D	0.000000	T	0.19406	0.0466	L	0.46741	1.465	0.42632	D	0.993385	B;P	0.37731	0.274;0.607	B;B	0.36418	0.13;0.224	T	0.02728	-1.1118	10	0.87932	D	0	-10.1213	10.4014	0.44231	0.8358:0.1642:0.0:0.0	.	17;17	P56962;B4DJ69	STX17_HUMAN;.	V	17	ENSP00000259400:I17V;ENSP00000435981:I17V;ENSP00000433484:I17V	ENSP00000259400:I17V	I	+	1	0	STX17	101717391	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	3.063000	0.49978	0.948000	0.37687	0.528000	0.53228	ATC	STX17	-	superfamily_t-SNARE	ENSG00000136874		0.383	STX17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	STX17	HGNC	protein_coding	OTTHUMT00000053398.3	248	0.00	0	A	NM_017919		102677570	102677570	+1	no_errors	ENST00000259400	ensembl	human	known	69_37n	missense	150	12.28	21	SNP	1.000	G
TCEB3	6924	genome.wustl.edu	37	1	24086048	24086048	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr1:24086048A>C	ENST00000418390.2	+	11	2653	c.2382A>C	c.(2380-2382)agA>agC	p.R794S	TCEB3_ENST00000609199.1_Missense_Mutation_p.R768S|RP5-886K2.3_ENST00000427796.1_RNA	NM_003198.2	NP_003189.2	Q14241	ELOA1_HUMAN	transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A)	794					gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	19		Colorectal(325;3.46e-05)|Lung NSC(340;0.000112)|all_lung(284;0.00016)|Renal(390;0.000219)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;2.42e-24)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;4.74e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000973)|KIRC - Kidney renal clear cell carcinoma(1967;0.00334)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		TCAAGAACAGATTCTCCCGAC	0.478																																						dbGAP											0													68.0	65.0	66.0					1																	24086048		2203	4300	6503	-	-	-	SO:0001583	missense	0			L47345	CCDS239.2	1p36.1	2010-06-22	2002-08-29		ENSG00000011007	ENSG00000011007			11620	protein-coding gene	gene with protein product		600786	"""transcription elongation factor B (SIII), polypeptide 3 (110kD, elongin A)"""			8586449, 7660129	Standard	NM_003198		Approved	SIII, TCEB3A	uc001bho.3	Q14241	OTTHUMG00000002957	ENST00000418390.2:c.2382A>C	1.37:g.24086048A>C	ENSP00000395574:p.Arg794Ser		B2R7Q8|Q8IXH1	Missense_Mutation	SNP	pfam_RNA_pol_II_trans_fac_SIII_A,pfam_TFIIS_N,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub,pfscan_F-box_dom_cyclin-like	p.R794S	ENST00000418390.2	37	c.2382	CCDS239.2	1	.	.	.	.	.	.	.	.	.	.	A	18.41	3.617742	0.66787	.	.	ENSG00000011007	ENST00000418390	T	0.19532	2.14	5.32	0.393	0.16294	.	0.000000	0.64402	D	0.000002	T	0.38054	0.1026	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.10520	-1.0626	10	0.72032	D	0.01	-22.314	9.8075	0.40801	0.6047:0.0:0.3953:0.0	.	794	Q14241	ELOA1_HUMAN	S	794	ENSP00000395574:R794S	ENSP00000395574:R794S	R	+	3	2	TCEB3	23958635	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.926000	0.40084	0.095000	0.17434	0.448000	0.29417	AGA	TCEB3	-	NULL	ENSG00000011007		0.478	TCEB3-001	KNOWN	basic|CCDS	protein_coding	TCEB3	HGNC	protein_coding	OTTHUMT00000008230.2	108	0.00	0	A	NM_003198		24086048	24086048	+1	no_errors	ENST00000418390	ensembl	human	known	69_37n	missense	79	10.23	9	SNP	1.000	C
SYT6	148281	genome.wustl.edu	37	1	114640500	114640500	+	Splice_Site	SNP	C	C	T			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr1:114640500C>T	ENST00000610222.1	-	6	1511		c.e6-1		SYT6_ENST00000609117.1_Splice_Site|SYT6_ENST00000369547.1_Splice_Site|SYT6_ENST00000607941.1_Splice_Site|SYT6_ENST00000393296.1_Splice_Site			Q5T7P8	SYT6_HUMAN	synaptotagmin VI						acrosomal vesicle exocytosis (GO:0060478)	cell junction (GO:0030054)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	clathrin binding (GO:0030276)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|syntaxin binding (GO:0019905)|transporter activity (GO:0005215)	p.?(1)		central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37	Lung SC(450;0.184)	all_cancers(81;4.41e-08)|all_epithelial(167;5.18e-08)|all_lung(203;1.58e-05)|Lung NSC(69;2.82e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GTGGCCCACTCTGAGGGAGAA	0.577																																						dbGAP											1	Unknown(1)	lung(1)											72.0	67.0	69.0					1																	114640500		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS871.1	1p13.1	2013-01-21			ENSG00000134207	ENSG00000134207		"""Synaptotagmins"""	18638	protein-coding gene	gene with protein product		607718				11543631	Standard	NM_205848		Approved		uc021orz.1	Q5T7P8	OTTHUMG00000011755	ENST00000610222.1:c.1365-1G>A	1.37:g.114640500C>T			B1AMB8|B3KPK1	Splice_Site	SNP	-	e6-1	ENST00000610222.1	37	c.1365-1		1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.092412	0.76756	.	.	ENSG00000134207	ENST00000369547;ENST00000393296;ENST00000369546;ENST00000369545	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4355	0.94792	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SYT6	114442023	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	7.780000	0.85658	2.593000	0.87608	0.462000	0.41574	.	SYT6	-	-	ENSG00000134207		0.577	SYT6-004	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	SYT6	HGNC	protein_coding	OTTHUMT00000314819.2	95	0.00	0	C	NM_205848	Intron	114640500	114640500	-1	no_errors	ENST00000369545	ensembl	human	known	69_37n	splice_site	55	15.38	10	SNP	1.000	T
TCHHL1	126637	genome.wustl.edu	37	1	152058642	152058642	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr1:152058642C>G	ENST00000368806.1	-	3	1580	c.1516G>C	c.(1516-1518)Gag>Cag	p.E506Q		NM_001008536.1	NP_001008536.1	Q5QJ38	TCHL1_HUMAN	trichohyalin-like 1	506							calcium ion binding (GO:0005509)	p.E506Q(1)		breast(4)|endometrium(1)|kidney(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(1)|skin(7)|stomach(1)	60	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.246)			GACTGCTTCTCAAGTGGTGCT	0.493																																						dbGAP											1	Substitution - Missense(1)	breast(1)											215.0	184.0	195.0					1																	152058642		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS30857.1	1q21.3	2011-10-11	2004-10-05	2006-01-27	ENSG00000182898	ENSG00000182898		"""S100 calcium binding proteins"""	31796	protein-coding gene	gene with protein product			"""S100 calcium binding protein A17"""	S100A17, THHL1			Standard	NM_001008536		Approved		uc001ezo.1	Q5QJ38	OTTHUMG00000013058	ENST00000368806.1:c.1516G>C	1.37:g.152058642C>G	ENSP00000357796:p.Glu506Gln		B2RPK8|Q5VTJ9	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub	p.E506Q	ENST00000368806.1	37	c.1516	CCDS30857.1	1	.	.	.	.	.	.	.	.	.	.	.	14.46	2.543028	0.45280	.	.	ENSG00000182898	ENST00000368806	T	0.29655	1.56	5.59	0.283	0.15696	.	1.048770	0.07585	N	0.920927	T	0.11750	0.0286	L	0.46157	1.445	0.09310	N	1	P	0.50943	0.94	P	0.46144	0.505	T	0.15350	-1.0440	10	0.22109	T	0.4	1.3176	4.9245	0.13887	0.0:0.5119:0.1437:0.3444	.	506	Q5QJ38	TCHL1_HUMAN	Q	506	ENSP00000357796:E506Q	ENSP00000357796:E506Q	E	-	1	0	TCHHL1	150325266	0.000000	0.05858	0.000000	0.03702	0.094000	0.18550	0.592000	0.23984	-0.194000	0.10399	-0.127000	0.14921	GAG	TCHHL1	-	NULL	ENSG00000182898		0.493	TCHHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHHL1	HGNC	protein_coding	OTTHUMT00000036638.2	139	0.00	0	C	XM_060104		152058642	152058642	-1	no_errors	ENST00000368806	ensembl	human	known	69_37n	missense	97	10.19	11	SNP	0.000	G
TLR10	81793	genome.wustl.edu	37	4	38775802	38775802	+	Silent	SNP	T	T	C			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr4:38775802T>C	ENST00000308973.4	-	4	2015	c.1410A>G	c.(1408-1410)gaA>gaG	p.E470E	TLR10_ENST00000506111.1_Silent_p.E470E|TLR10_ENST00000507953.1_5'Flank|TLR10_ENST00000361424.2_Silent_p.E470E|TLR10_ENST00000508334.1_Silent_p.E470E	NM_001017388.2|NM_001195107.1|NM_030956.3	NP_001017388.1|NP_001182036.1|NP_112218.2	Q9BXR5	TLR10_HUMAN	toll-like receptor 10	470					immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of inflammatory response (GO:0050729)|regulation of cytokine secretion (GO:0050707)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor signaling pathway (GO:0002224)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(11)|prostate(1)|urinary_tract(2)	25						CAATATTTAGTTCTCGTAAGG	0.358																																						dbGAP											0													89.0	96.0	94.0					4																	38775802		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF296673	CCDS3445.1	4p14	2009-11-23			ENSG00000174123	ENSG00000174123		"""CD molecules"""	15634	protein-coding gene	gene with protein product		606270				11267672	Standard	NM_030956		Approved	CD290	uc003gtk.3	Q9BXR5	OTTHUMG00000128578	ENST00000308973.4:c.1410A>G	4.37:g.38775802T>C			A8K7L1|B3Y668|D1CS21|D1CS22|Q32MI7|Q32MI8|Q5FWG4|Q6UXL3	Silent	SNP	pirsf_Toll-like_receptor,pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.E470	ENST00000308973.4	37	c.1410	CCDS3445.1	4																																																																																			TLR10	-	pirsf_Toll-like_receptor	ENSG00000174123		0.358	TLR10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR10	HGNC	protein_coding	OTTHUMT00000250430.1	78	0.00	0	T			38775802	38775802	-1	no_errors	ENST00000308973	ensembl	human	known	69_37n	silent	42	14.29	7	SNP	0.861	C
TMEM87A	25963	genome.wustl.edu	37	15	42564268	42564268	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr15:42564268G>C	ENST00000389834.4	-	2	462	c.198C>G	c.(196-198)ttC>ttG	p.F66L	GANC_ENST00000318010.8_5'Flank|GANC_ENST00000566442.1_5'Flank|TMEM87A_ENST00000568432.1_5'UTR|GANC_ENST00000440615.2_5'Flank|TMEM87A_ENST00000307216.6_Missense_Mutation_p.F66L|TMEM87A_ENST00000448392.1_Intron	NM_015497.3	NP_056312.2	Q8NBN3	TM87A_HUMAN	transmembrane protein 87A	66						integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(4)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	24		all_cancers(109;4.28e-16)|all_epithelial(112;1.04e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;1.03e-06)		CACACTTCAGGAAGATAGTGG	0.269																																						dbGAP											0													37.0	38.0	37.0					15																	42564268		2201	4294	6495	-	-	-	SO:0001583	missense	0			AF132733	CCDS32205.1, CCDS45243.1, CCDS66742.1	15q15.1	2005-10-30				ENSG00000103978			24522	protein-coding gene	gene with protein product						12477932	Standard	XM_005254287		Approved	DKFZP564G2022	uc021sjr.1	Q8NBN3		ENST00000389834.4:c.198C>G	15.37:g.42564268G>C	ENSP00000374484:p.Phe66Leu		Q6NT77|Q8NCA4|Q9BS46|Q9P103|Q9Y3Y7	Missense_Mutation	SNP	pfam_TM_rcpt_euk	p.F66L	ENST00000389834.4	37	c.198	CCDS32205.1	15	.	.	.	.	.	.	.	.	.	.	G	13.17	2.155976	0.38021	.	.	ENSG00000103978	ENST00000389834;ENST00000535305;ENST00000307216	.	.	.	5.25	2.32	0.28847	.	0.167126	0.53938	N	0.000060	T	0.31295	0.0792	L	0.27053	0.805	0.80722	D	1	B;B	0.09022	0.0;0.002	B;B	0.09377	0.0;0.004	T	0.05500	-1.0881	9	0.18276	T	0.48	-5.2139	4.5129	0.11921	0.1831:0.0:0.6347:0.1822	.	66;66	Q8NBN3;Q8NBN3-2	TM87A_HUMAN;.	L	66;42;66	.	ENSP00000305894:F66L	F	-	3	2	TMEM87A	40351560	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	0.426000	0.21363	0.343000	0.23821	-0.145000	0.13849	TTC	TMEM87A	-	NULL	ENSG00000103978		0.269	TMEM87A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	TMEM87A	HGNC	protein_coding	OTTHUMT00000420482.2	95	0.00	0	G	NM_015497		42564268	42564268	-1	no_errors	ENST00000389834	ensembl	human	known	69_37n	missense	69	10.39	8	SNP	1.000	C
TNKS1BP1	85456	genome.wustl.edu	37	11	57076132	57076132	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr11:57076132C>G	ENST00000532437.1	-	5	4364	c.4053G>C	c.(4051-4053)caG>caC	p.Q1351H	TNKS1BP1_ENST00000530920.1_5'Flank|TNKS1BP1_ENST00000358252.3_Missense_Mutation_p.Q1351H			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	1351	Acidic.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)			breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				GCTCCACATTCTGGGGCGCCA	0.637																																						dbGAP											0													81.0	91.0	87.0					11																	57076132		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.4053G>C	11.37:g.57076132C>G	ENSP00000437271:p.Gln1351His		A7E2F8|Q6PJ35|Q6ZV74	Missense_Mutation	SNP	NULL	p.Q1351H	ENST00000532437.1	37	c.4053	CCDS7951.1	11	.	.	.	.	.	.	.	.	.	.	C	1.932	-0.445779	0.04604	.	.	ENSG00000149115	ENST00000358252;ENST00000532437	T;T	0.30981	1.51;1.51	4.81	-2.5	0.06384	.	0.945274	0.08732	N	0.901998	T	0.09818	0.0241	N	0.01352	-0.895	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.25779	-1.0122	10	0.72032	D	0.01	-3.1267	4.8886	0.13715	0.1405:0.3994:0.0:0.4601	.	1351	Q9C0C2	TB182_HUMAN	H	1351	ENSP00000350990:Q1351H;ENSP00000437271:Q1351H	ENSP00000350990:Q1351H	Q	-	3	2	TNKS1BP1	56832708	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	0.213000	0.17521	-0.951000	0.03654	-0.448000	0.05591	CAG	TNKS1BP1	-	NULL	ENSG00000149115		0.637	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TNKS1BP1	HGNC	protein_coding	OTTHUMT00000392455.1	57	0.00	0	C	NM_033396		57076132	57076132	-1	no_errors	ENST00000358252	ensembl	human	known	69_37n	missense	39	13.33	6	SNP	0.000	G
TP53	7157	genome.wustl.edu	37	17	7577120	7577120	+	Missense_Mutation	SNP	C	C	T	rs28934576		TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr17:7577120C>T	ENST00000269305.4	-	8	1007	c.818G>A	c.(817-819)cGt>cAt	p.R273H	TP53_ENST00000455263.2_Missense_Mutation_p.R273H|TP53_ENST00000359597.4_Missense_Mutation_p.R273H|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.R273H|TP53_ENST00000445888.2_Missense_Mutation_p.R273H|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273H(521)|p.R273L(93)|p.R273P(32)|p.0?(8)|p.?(2)|p.R273fs*32(2)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273S(1)|p.E258fs*71(1)|p.R273fs*72(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.R273fs*33(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCACAAACACGCACCTCAAA	0.542	R273H(EN_ENDOMETRIUM)|R273H(HEC59_ENDOMETRIUM)|R273H(HEC6_ENDOMETRIUM)|R273H(HT29_LARGE_INTESTINE)|R273H(HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(MDAMB468_BREAST)|R273H(MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(NCIH1155_LUNG)|R273H(NCIH1793_LUNG)|R273H(NCIH1975_LUNG)|R273H(NCIH2405_LUNG)|R273H(NCIH508_LARGE_INTESTINE)|R273H(OC314_OVARY)|R273H(PANC1_PANCREAS)|R273H(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SKMEL30_SKIN)|R273H(SNB19_CENTRAL_NERVOUS_SYSTEM)|R273H(SUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SUIT2_PANCREAS)|R273H(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273H(SW480_LARGE_INTESTINE)|R273H(SW620_LARGE_INTESTINE)|R273H(U251MG_CENTRAL_NERVOUS_SYSTEM)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			C|||	1	0.000199681	0.0	0.0	5008	,	,		18620	0.0		0.001	False		,,,				2504	0.0				Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	669	Substitution - Missense(647)|Whole gene deletion(8)|Deletion - Frameshift(6)|Deletion - In frame(5)|Unknown(2)|Insertion - Frameshift(1)	large_intestine(136)|lung(99)|breast(74)|ovary(59)|upper_aerodigestive_tract(55)|central_nervous_system(46)|oesophagus(35)|haematopoietic_and_lymphoid_tissue(30)|stomach(26)|urinary_tract(25)|pancreas(15)|endometrium(13)|liver(12)|skin(11)|bone(9)|biliary_tract(7)|penis(4)|cervix(2)|genital_tract(2)|NS(2)|soft_tissue(2)|vulva(1)|thyroid(1)|fallopian_tube(1)|prostate(1)|thymus(1)	GRCh37	CM004342|CM010472|CM920677	TP53	M	rs28934576						67.0	58.0	61.0					17																	7577120		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.818G>A	17.37:g.7577120C>T	ENSP00000269305:p.Arg273His		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R273H	ENST00000269305.4	37	c.818	CCDS11118.1	17	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	18.03	3.532510	0.64972	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99868	-7.32;-7.32;-7.32;-7.32;-7.32;-7.32	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.79475	2.455	0.80722	A	1	P;D;P;P	0.89917	0.631;1.0;0.831;0.48	B;D;P;B	0.77004	0.274;0.989;0.516;0.242	D	0.96531	0.9393	9	0.72032	D	0.01	-11.9995	15.662	0.77193	0.0:1.0:0.0:0.0	rs28934576	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	H	273;273;273;273;273;262;141	ENSP00000352610:R273H;ENSP00000269305:R273H;ENSP00000398846:R273H;ENSP00000391127:R273H;ENSP00000391478:R273H;ENSP00000425104:R141H	ENSP00000269305:R273H	R	-	2	0	TP53	7517845	1.000000	0.71417	0.068000	0.19968	0.665000	0.39181	7.587000	0.82613	2.556000	0.86216	0.462000	0.41574	CGT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	196	0.00	0	C	NM_000546		7577120	7577120	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	122	11.59	16	SNP	0.864	T
TRIM58	25893	genome.wustl.edu	37	1	248028177	248028177	+	Silent	SNP	G	G	A			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr1:248028177G>A	ENST00000366481.3	+	3	735	c.687G>A	c.(685-687)ctG>ctA	p.L229L		NM_015431.3	NP_056246.3	Q8NG06	TRI58_HUMAN	tripartite motif containing 58	229						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(39)|ovary(4)|pancreas(1)|skin(7)|stomach(1)	63	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GCAAGGCCCTGAAGGAGCTGG	0.677																																						dbGAP											0													16.0	20.0	19.0					1																	248028177		2200	4299	6499	-	-	-	SO:0001819	synonymous_variant	0			AF327057	CCDS1636.1	1q44	2013-01-09	2011-01-25		ENSG00000162722	ENSG00000162722		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	24150	protein-coding gene	gene with protein product			"""tripartite motif-containing 58"""				Standard	NM_015431		Approved	BIA2	uc001ido.3	Q8NG06	OTTHUMG00000040203	ENST00000366481.3:c.687G>A	1.37:g.248028177G>A			Q6B0H9	Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.L229	ENST00000366481.3	37	c.687	CCDS1636.1	1																																																																																			TRIM58	-	NULL	ENSG00000162722		0.677	TRIM58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM58	HGNC	protein_coding	OTTHUMT00000096860.1	36	0.00	0	G	NM_015431		248028177	248028177	+1	no_errors	ENST00000366481	ensembl	human	known	69_37n	silent	27	22.86	8	SNP	0.987	A
TXNDC11	51061	genome.wustl.edu	37	16	11782228	11782228	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr16:11782228C>A	ENST00000356957.3	-	10	2162	c.2055G>T	c.(2053-2055)caG>caT	p.Q685H	TXNDC11_ENST00000283033.5_Missense_Mutation_p.Q658H|TXNDC11_ENST00000570917.1_5'UTR			Q6PKC3	TXD11_HUMAN	thioredoxin domain containing 11	685	Thioredoxin 2. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)			endometrium(3)|large_intestine(5)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	21						GAGACGGGAACTGGGCAGAGC	0.398																																						dbGAP											0													81.0	80.0	80.0					16																	11782228		2197	4300	6497	-	-	-	SO:0001583	missense	0			BC013727	CCDS32387.1	16p13.13	2008-09-29				ENSG00000153066			28030	protein-coding gene	gene with protein product	"""EF-hand binding protein 1"""					8619474, 9110174	Standard	XM_005255346		Approved	EFP1	uc002dbg.1	Q6PKC3		ENST00000356957.3:c.2055G>T	16.37:g.11782228C>A	ENSP00000349439:p.Gln685His		O95887|Q6PJA6|Q8N2Q4|Q96K45|Q96K53	Missense_Mutation	SNP	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	p.Q685H	ENST00000356957.3	37	c.2055		16	.	.	.	.	.	.	.	.	.	.	C	7.705	0.693951	0.15039	.	.	ENSG00000153066	ENST00000356957;ENST00000283033	T;T	0.26067	1.76;1.76	5.77	3.68	0.42216	Thioredoxin-like fold (2);	0.523815	0.21611	N	0.071798	T	0.10380	0.0254	N	0.02802	-0.49	0.35548	D	0.803592	B;B	0.09022	0.001;0.002	B;B	0.10450	0.003;0.005	T	0.10291	-1.0636	10	0.36615	T	0.2	-9.6788	7.8407	0.29397	0.3524:0.529:0.1186:0.0	.	685;658	Q6PKC3;Q6PKC3-2	TXD11_HUMAN;.	H	685;658	ENSP00000349439:Q685H;ENSP00000283033:Q658H	ENSP00000283033:Q658H	Q	-	3	2	TXNDC11	11689729	1.000000	0.71417	1.000000	0.80357	0.387000	0.30353	2.492000	0.45311	1.425000	0.47237	-0.302000	0.09304	CAG	TXNDC11	-	superfamily_Thioredoxin-like_fold	ENSG00000153066		0.398	TXNDC11-002	KNOWN	basic|appris_candidate_longest	protein_coding	TXNDC11	HGNC	protein_coding	OTTHUMT00000437057.1	144	0.00	0	C	NM_015914		11782228	11782228	-1	no_errors	ENST00000356957	ensembl	human	known	69_37n	missense	93	13.08	14	SNP	1.000	A
UBR1	197131	genome.wustl.edu	37	15	43244537	43244537	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr15:43244537C>G	ENST00000290650.4	-	45	5023	c.4945G>C	c.(4945-4947)Gag>Cag	p.E1649Q	UBR1_ENST00000382177.2_3'UTR	NM_174916.2	NP_777576.1	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin 1	1649					cellular response to leucine (GO:0071233)|negative regulation of TOR signaling (GO:0032007)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|proteasome complex (GO:0000502)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(7)|large_intestine(12)|lung(25)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	58		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		GCTCCAACCTCTTCCCCGTTC	0.468																																						dbGAP											0													144.0	145.0	145.0					15																	43244537		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS10091.1	15q13	2008-06-23			ENSG00000159459	ENSG00000159459		"""Ubiquitin protein ligase E3 component n-recognins"""	16808	protein-coding gene	gene with protein product		605981				9653112	Standard	NM_174916		Approved		uc001zqq.3	Q8IWV7	OTTHUMG00000130702	ENST00000290650.4:c.4945G>C	15.37:g.43244537C>G	ENSP00000290650:p.Glu1649Gln		O60708|O75492|Q14D45|Q68DN9|Q8IWY6|Q96JY4	Missense_Mutation	SNP	pfam_ClpS_core,pfam_Znf_N-recognin,superfamily_Ribosomal_L7/12_C/ClpS-like,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.E1649Q	ENST00000290650.4	37	c.4945	CCDS10091.1	15	.	.	.	.	.	.	.	.	.	.	C	21.4	4.145850	0.77888	.	.	ENSG00000159459	ENST00000290650	T	0.49432	0.78	4.72	4.72	0.59763	.	0.171340	0.50627	D	0.000107	T	0.45716	0.1356	N	0.14661	0.345	0.80722	D	1	D	0.63880	0.993	P	0.56343	0.796	T	0.35822	-0.9773	10	0.22109	T	0.4	-30.4346	17.8752	0.88823	0.0:1.0:0.0:0.0	.	1649	Q8IWV7	UBR1_HUMAN	Q	1649	ENSP00000290650:E1649Q	ENSP00000290650:E1649Q	E	-	1	0	UBR1	41031829	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	5.913000	0.69957	2.432000	0.82394	0.467000	0.42956	GAG	UBR1	-	NULL	ENSG00000159459		0.468	UBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR1	HGNC	protein_coding	OTTHUMT00000253202.1	137	0.00	0	C	NM_174916		43244537	43244537	-1	no_errors	ENST00000290650	ensembl	human	known	69_37n	missense	83	11.58	11	SNP	1.000	G
WNT2B	7482	genome.wustl.edu	37	1	113052034	113052034	+	Silent	SNP	G	G	C			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr1:113052034G>C	ENST00000369684.4	+	1	635	c.150G>C	c.(148-150)ctG>ctC	p.L50L	WNT2B_ENST00000256640.5_Intron|WNT2B_ENST00000369686.5_Intron	NM_024494.2	NP_078613.1	Q93097	WNT2B_HUMAN	wingless-type MMTV integration site family, member 2B	50					canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular response to starvation (GO:0009267)|chondrocyte differentiation (GO:0002062)|cornea development in camera-type eye (GO:0061303)|forebrain regionalization (GO:0021871)|hematopoietic stem cell proliferation (GO:0071425)|iris morphogenesis (GO:0061072)|lens development in camera-type eye (GO:0002088)|lung induction (GO:0060492)|male gonad development (GO:0008584)|mesenchymal-epithelial cell signaling (GO:0060638)|neuron differentiation (GO:0030182)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(4)|ovary(2)|skin(1)|stomach(1)	18	Lung SC(450;0.246)	all_cancers(81;7.31e-07)|all_epithelial(167;4.59e-06)|all_lung(203;2.56e-05)|Lung NSC(69;4.38e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGCTGCTGCTGACGCTGCCGG	0.736																																						dbGAP											0													24.0	27.0	26.0					1																	113052034		2191	4253	6444	-	-	-	SO:0001819	synonymous_variant	0			AB045116	CCDS847.1, CCDS846.1	1p13	2008-07-18			ENSG00000134245	ENSG00000134245		"""Wingless-type MMTV integration sites"""	12781	protein-coding gene	gene with protein product	"""XWNT2, Xenopus, homolog of"", ""wingless-type MMTV integration site family, member 13"""	601968		WNT13		8761309, 10944466	Standard	NM_024494		Approved	XWNT2	uc001ecb.3	Q93097	OTTHUMG00000011157	ENST00000369684.4:c.150G>C	1.37:g.113052034G>C			O14903|Q5TEH9|Q5TEI2|Q9HDC1|Q9HDC2	Silent	SNP	pfam_Wnt,smart_Wnt,prints_Wnt,prints_Wnt2	p.L50	ENST00000369684.4	37	c.150	CCDS847.1	1																																																																																			WNT2B	-	NULL	ENSG00000134245		0.736	WNT2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT2B	HGNC	protein_coding	OTTHUMT00000030692.1	38	0.00	0	G	NM_004185		113052034	113052034	+1	no_errors	ENST00000369684	ensembl	human	known	69_37n	silent	23	17.86	5	SNP	1.000	C
ZMYM2	7750	genome.wustl.edu	37	13	20641001	20641001	+	Missense_Mutation	SNP	G	G	A	rs573398506		TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr13:20641001G>A	ENST00000382874.2	+	21	3333	c.3143G>A	c.(3142-3144)aGa>aAa	p.R1048K	ZMYM2_ENST00000382869.3_Missense_Mutation_p.R1048K|ZMYM2_ENST00000494061.2_3'UTR|ZMYM2_ENST00000382871.2_Missense_Mutation_p.R1048K	NM_001190964.1	NP_001177893.1	Q9UBW7	ZMYM2_HUMAN	zinc finger, MYM-type 2	1048					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|PML body (GO:0016605)	ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)			large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	10		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		GGAGCCAAGAGAAAGGCTGTA	0.343																																						dbGAP											0													84.0	77.0	79.0					13																	20641001		1836	4081	5917	-	-	-	SO:0001583	missense	0			AF012126	CCDS45016.1	13q11-q12	2013-01-08	2006-07-13	2006-07-13	ENSG00000121741	ENSG00000121741		"""Zinc fingers, MYM type"""	12989	protein-coding gene	gene with protein product		602221	"""zinc finger protein 198"""	ZNF198		9499416, 9425908	Standard	XM_005266517		Approved	RAMP, FIM, MYM	uc001ums.3	Q9UBW7	OTTHUMG00000016507	ENST00000382874.2:c.3143G>A	13.37:g.20641001G>A	ENSP00000372327:p.Arg1048Lys		A6NDG0|A6NI02|O43212|O43434|O60898|Q5W0Q4|Q5W0T3|Q63HP0|Q8NE39|Q9H0V5|Q9H538|Q9UEU2	Missense_Mutation	SNP	pfam_Znf_MYM,pfam_DUF3504,smart_TRASH	p.R1048K	ENST00000382874.2	37	c.3143	CCDS45016.1	13	.	.	.	.	.	.	.	.	.	.	G	14.20	2.463188	0.43736	.	.	ENSG00000121741	ENST00000382869;ENST00000456228;ENST00000382874;ENST00000382871;ENST00000382870	T	0.17213	2.29	5.06	5.06	0.68205	.	0.214319	0.50627	D	0.000107	T	0.11367	0.0277	N	0.16478	0.41	0.80722	D	1	B	0.32781	0.384	B	0.26517	0.07	T	0.17837	-1.0356	10	0.20519	T	0.43	-21.7861	18.4254	0.90607	0.0:0.0:1.0:0.0	.	1048	Q9UBW7	ZMYM2_HUMAN	K	1048;1048;1046;1046;426	ENSP00000372322:R1048K	ENSP00000372322:R1048K	R	+	2	0	ZMYM2	19539001	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.558000	0.82253	2.354000	0.79902	0.455000	0.32223	AGA	ZMYM2	-	NULL	ENSG00000121741		0.343	ZMYM2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYM2	HGNC	protein_coding	OTTHUMT00000044051.2	225	0.00	0	G	NM_003453		20641001	20641001	+1	no_errors	ENST00000382869	ensembl	human	known	69_37n	missense	205	10.48	24	SNP	1.000	A
ZMYM2	7750	genome.wustl.edu	37	13	20657091	20657091	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr13:20657091T>C	ENST00000382874.2	+	24	3929	c.3739T>C	c.(3739-3741)Tgg>Cgg	p.W1247R	ZMYM2_ENST00000382869.3_Missense_Mutation_p.W1247R|ZMYM2_ENST00000494061.2_3'UTR|ZMYM2_ENST00000382871.2_Missense_Mutation_p.W1247R	NM_001190964.1	NP_001177893.1	Q9UBW7	ZMYM2_HUMAN	zinc finger, MYM-type 2	1247					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|PML body (GO:0016605)	ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)			large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	10		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		GTTTAGGCATTGGAAAAAAAA	0.373																																						dbGAP											0													103.0	96.0	98.0					13																	20657091		1861	4098	5959	-	-	-	SO:0001583	missense	0			AF012126	CCDS45016.1	13q11-q12	2013-01-08	2006-07-13	2006-07-13	ENSG00000121741	ENSG00000121741		"""Zinc fingers, MYM type"""	12989	protein-coding gene	gene with protein product		602221	"""zinc finger protein 198"""	ZNF198		9499416, 9425908	Standard	XM_005266517		Approved	RAMP, FIM, MYM	uc001ums.3	Q9UBW7	OTTHUMG00000016507	ENST00000382874.2:c.3739T>C	13.37:g.20657091T>C	ENSP00000372327:p.Trp1247Arg		A6NDG0|A6NI02|O43212|O43434|O60898|Q5W0Q4|Q5W0T3|Q63HP0|Q8NE39|Q9H0V5|Q9H538|Q9UEU2	Missense_Mutation	SNP	pfam_Znf_MYM,pfam_DUF3504,smart_TRASH	p.W1247R	ENST00000382874.2	37	c.3739	CCDS45016.1	13	.	.	.	.	.	.	.	.	.	.	T	16.93	3.258816	0.59321	.	.	ENSG00000121741	ENST00000382869;ENST00000456228;ENST00000382874;ENST00000382871;ENST00000382870	T	0.17370	2.28	5.2	5.2	0.72013	.	0.412136	0.30602	N	0.009271	T	0.14013	0.0339	L	0.32530	0.975	0.80722	D	1	P	0.35411	0.5	B	0.36289	0.221	T	0.05257	-1.0896	10	0.45353	T	0.12	-7.9389	9.8275	0.40921	0.0:0.0774:0.0:0.9226	.	1247	Q9UBW7	ZMYM2_HUMAN	R	1247;1247;1245;1245;625	ENSP00000372322:W1247R	ENSP00000372322:W1247R	W	+	1	0	ZMYM2	19555091	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.582000	0.60957	2.080000	0.62538	0.397000	0.26171	TGG	ZMYM2	-	pfam_DUF3504	ENSG00000121741		0.373	ZMYM2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYM2	HGNC	protein_coding	OTTHUMT00000044051.2	235	0.00	0	T	NM_003453		20657091	20657091	+1	no_errors	ENST00000382869	ensembl	human	known	69_37n	missense	131	18.63	30	SNP	0.998	C
ZNF695	57116	genome.wustl.edu	37	1	247150838	247150838	+	Nonsense_Mutation	SNP	C	C	A			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr1:247150838C>A	ENST00000339986.7	-	4	1126	c.979G>T	c.(979-981)Gaa>Taa	p.E327*	ZNF695_ENST00000487338.2_Intron|ZNF695_ENST00000498046.2_Intron	NM_020394.4	NP_065127	Q8IW36	ZN695_HUMAN	zinc finger protein 695	327					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(1)|large_intestine(1)|lung(9)|prostate(1)|urinary_tract(1)	13	all_cancers(71;4.01e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			CCACATTCTTCACACTTGTAG	0.368																																						dbGAP											0													32.0	34.0	33.0					1																	247150838		2104	4262	6366	-	-	-	SO:0001587	stop_gained	0				CCDS44344.1, CCDS55694.1	1q44	2013-01-08			ENSG00000197472	ENSG00000197472		"""Zinc fingers, C2H2-type"", ""-"""	30954	protein-coding gene	gene with protein product						12477932	Standard	NM_020394		Approved	SBZF3	uc009xgu.3	Q8IW36	OTTHUMG00000040707	ENST00000339986.7:c.979G>T	1.37:g.247150838C>A	ENSP00000341236:p.Glu327*		Q5T0N9|Q5T0P1|Q5T0P3|Q7Z2W8|Q7Z648	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E327*	ENST00000339986.7	37	c.979	CCDS44344.1	1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.473622	0.84640	.	.	ENSG00000197472	ENST00000339986	.	.	.	0.642	-0.575	0.11734	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	.	3.9503	0.09366	0.0:0.4408:0.0:0.5592	.	.	.	.	X	327	.	ENSP00000341236:E327X	E	-	1	0	ZNF695	245217461	0.000000	0.05858	0.030000	0.17652	0.880000	0.50808	-2.800000	0.00761	-0.247000	0.09597	0.205000	0.17691	GAA	ZNF695	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197472		0.368	ZNF695-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF695	HGNC	protein_coding	OTTHUMT00000097823.5	116	0.00	0	C	NM_020394		247150838	247150838	-1	no_errors	ENST00000339986	ensembl	human	known	69_37n	nonsense	57	14.93	10	SNP	0.022	A
ZNF785	146540	genome.wustl.edu	37	16	30596468	30596468	+	Silent	SNP	G	G	A			TCGA-E2-A108-01A-13D-A10M-09	TCGA-E2-A108-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e3e394d4-2593-4bf9-86e4-2e79d8cb8dab	ddbcaa72-c832-4944-aebe-2324670d568f	g.chr16:30596468G>A	ENST00000395216.2	-	2	468	c.309C>T	c.(307-309)ttC>ttT	p.F103F	RP11-146F11.5_ENST00000563540.1_RNA|AC002310.7_ENST00000486926.1_RNA|ZNF785_ENST00000470110.1_Intron|AC002310.7_ENST00000492040.1_RNA	NM_152458.6	NP_689671.2	A8K8V0	ZN785_HUMAN	zinc finger protein 785	103					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	9						GGCCCCTGCTGAAAGCTGCAG	0.597																																						dbGAP											0													45.0	47.0	47.0					16																	30596468		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			BC040642	CCDS10685.1	16p11.2	2013-01-08			ENSG00000197162	ENSG00000197162		"""Zinc fingers, C2H2-type"", ""-"""	26496	protein-coding gene	gene with protein product						10493829	Standard	NM_152458		Approved	FLJ32130	uc002dyu.3	A8K8V0	OTTHUMG00000132398	ENST00000395216.2:c.309C>T	16.37:g.30596468G>A			O75701|Q8IW91|Q8WV14|Q96MN0	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F103	ENST00000395216.2	37	c.309	CCDS10685.1	16																																																																																			ZNF785	-	NULL	ENSG00000197162		0.597	ZNF785-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF785	HGNC	protein_coding	OTTHUMT00000255529.2	82	0.00	0	G	NM_152458		30596468	30596468	-1	no_errors	ENST00000395216	ensembl	human	known	69_37n	silent	67	10.67	8	SNP	0.000	A
