#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AMMECR1	9949	genome.wustl.edu	37	X	109561207	109561209	+	In_Frame_Del	DEL	GGA	GGA	-			TCGA-E2-A14O-01A-31D-A10Y-09	TCGA-E2-A14O-10A-01D-A110-09	GGA	GGA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d6ab6f8d-0e65-40a3-bf98-7249e4075395	3315cbc2-91d3-407d-b030-0d20dc9f4aff	g.chrX:109561207_109561209delGGA	ENST00000262844.5	-	1	258_260	c.91_93delTCC	c.(91-93)tccdel	p.S31del	AMMECR1_ENST00000372059.2_In_Frame_Del_p.S31del|AMMECR1_ENST00000372057.1_Intron|AMMECR1_ENST00000496695.1_5'Flank	NM_015365.2	NP_056180.1	Q9Y4X0	AMMR1_HUMAN	Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1	31	Gly/Ser-rich.									large_intestine(1)|lung(4)|ovary(1)|stomach(1)	7						CGCTGCAGTGGGAGGAGGAGGAG	0.68																																						dbGAP											0									,,	2,55,3416		0,0,1,1,5,34,11,1461,459					,,	4.6	1.0			8	1,159,5901		0,0,1,0,5,91,58,2161,1487	no	codingComplex,intron,codingComplex	AMMECR1	NM_015365.2,NM_001171689.1,NM_001025580.1	,,	0,0,2,1,10,125,69,3622,1946	A1A1,A1A2,A1R,A1,A2A2,A2R,A2,RR,R		2.6398,1.6412,2.2761	,,	,,		3,214,9317				-	-	-	SO:0001651	inframe_deletion	0			AJ007014	CCDS14551.1, CCDS35368.1, CCDS55476.1	Xq22.3	2014-06-17	2008-09-12		ENSG00000101935	ENSG00000101935			467	protein-coding gene	gene with protein product		300195				10049589, 9480748	Standard	NM_001171689		Approved		uc004eoo.3	Q9Y4X0	OTTHUMG00000022197	ENST00000262844.5:c.91_93delTCC	X.37:g.109561216_109561218delGGA	ENSP00000262844:p.Ser31del		Q5JYV9|Q6P9D8|Q8WX22|Q9UIQ8	In_Frame_Del	DEL	pfam_AMMECR1_domain,pfscan_AMMECR1_domain,tigrfam_AMMECR1	p.S31in_frame_del	ENST00000262844.5	37	c.93_91	CCDS14551.1	X																																																																																			AMMECR1	-	NULL	ENSG00000101935		0.680	AMMECR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMMECR1	HGNC	protein_coding	OTTHUMT00000057907.1	9	0.00	0	GGA			109561207	109561209	-1	no_errors	ENST00000262844	ensembl	human	known	69_37n	in_frame_del	6	25.00	2	DEL	0.359:0.594:0.602	-
ARHGAP11A	9824	genome.wustl.edu	37	15	32929250	32929250	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A14O-01A-31D-A10Y-09	TCGA-E2-A14O-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d6ab6f8d-0e65-40a3-bf98-7249e4075395	3315cbc2-91d3-407d-b030-0d20dc9f4aff	g.chr15:32929250C>A	ENST00000361627.3	+	12	2998	c.2276C>A	c.(2275-2277)gCt>gAt	p.A759D	ARHGAP11A_ENST00000543522.1_Missense_Mutation_p.A570D|ARHGAP11A_ENST00000565905.1_Missense_Mutation_p.A570D	NM_014783.3	NP_055598.1	Q6P4F7	RHGBA_HUMAN	Rho GTPase activating protein 11A	759					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		all_lung(180;1.3e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)		AAGGACGAGGCTAGATCCTCT	0.398																																					Colon(45;757 1134 30003 36652)	dbGAP											0													85.0	79.0	81.0					15																	32929250		2201	4300	6501	-	-	-	SO:0001583	missense	0			D87717	CCDS10028.1, CCDS58349.1, CCDS66730.1	15q13.3	2006-09-19			ENSG00000198826	ENSG00000198826		"""Rho GTPase activating proteins"""	15783	protein-coding gene	gene with protein product	"""GAP (1-12)"""	610589				11829490	Standard	NM_199357		Approved	KIAA0013	uc001zgy.1	Q6P4F7	OTTHUMG00000129289	ENST00000361627.3:c.2276C>A	15.37:g.32929250C>A	ENSP00000355090:p.Ala759Asp		B4DZN9|Q6PI96|Q9Y3S6	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.A759D	ENST00000361627.3	37	c.2276	CCDS10028.1	15	.	.	.	.	.	.	.	.	.	.	.	4.817	0.151891	0.09185	.	.	ENSG00000198826	ENST00000361627;ENST00000543522	T	0.12672	2.66	4.92	4.92	0.64577	.	0.570206	0.15446	N	0.261903	T	0.18215	0.0437	L	0.59436	1.845	0.09310	N	1	B	0.34329	0.449	B	0.36418	0.224	T	0.10428	-1.0630	10	0.66056	D	0.02	.	13.1365	0.59411	0.0:0.8398:0.1602:0.0	.	759	Q6P4F7	RHGBA_HUMAN	D	759;570	ENSP00000355090:A759D	ENSP00000355090:A759D	A	+	2	0	ARHGAP11A	30716542	0.021000	0.18746	0.021000	0.16686	0.030000	0.12068	1.047000	0.30367	2.547000	0.85894	0.650000	0.86243	GCT	ARHGAP11A	-	NULL	ENSG00000198826		0.398	ARHGAP11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP11A	HGNC	protein_coding	OTTHUMT00000251417.1	33	0.00	0	C	NM_014783		32929250	32929250	+1	no_errors	ENST00000361627	ensembl	human	known	69_37n	missense	19	57.78	26	SNP	0.007	A
ASTN2	23245	genome.wustl.edu	37	9	119188282	119188282	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14O-01A-31D-A10Y-09	TCGA-E2-A14O-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d6ab6f8d-0e65-40a3-bf98-7249e4075395	3315cbc2-91d3-407d-b030-0d20dc9f4aff	g.chr9:119188282C>T	ENST00000313400.4	-	23	3968	c.3868G>A	c.(3868-3870)Gtg>Atg	p.V1290M	ASTN2_ENST00000341734.4_Missense_Mutation_p.V342M|ASTN2_ENST00000361209.2_Missense_Mutation_p.V1239M|ASTN2_ENST00000361477.3_Missense_Mutation_p.V342M|ASTN2_ENST00000373996.3_Missense_Mutation_p.V1286M|ASTN2_ENST00000288520.5_Missense_Mutation_p.V391M			O75129	ASTN2_HUMAN	astrotactin 2	1290					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						ACTGTTTCCACGCGGCTCTGG	0.582																																						dbGAP											0													81.0	69.0	73.0					9																	119188282		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.3868G>A	9.37:g.119188282C>T	ENSP00000314038:p.Val1290Met		A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	pfam_MACPF,superfamily_Fibronectin_type3,smart_MACPF	p.V1290M	ENST00000313400.4	37	c.3868		9	.	.	.	.	.	.	.	.	.	.	C	15.58	2.877017	0.51801	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000288520;ENST00000341734;ENST00000373986;ENST00000361209;ENST00000361477	T;T;T;T;T;T;T	0.14766	2.9;2.9;2.48;2.49;2.72;2.91;2.49	5.86	5.86	0.93980	.	0.187931	0.46442	D	0.000285	T	0.10551	0.0258	N	0.08118	0	0.39656	D	0.970535	P;P;D;D;D;P;P	0.63046	0.567;0.567;0.992;0.987;0.989;0.567;0.882	B;B;P;B;P;B;B	0.51193	0.141;0.141;0.607;0.403;0.662;0.216;0.388	T	0.07520	-1.0768	10	0.51188	T	0.08	-23.4177	7.6948	0.28587	0.0:0.808:0.0:0.192	.	342;342;1239;1290;1286;342;391	B7ZKP4;B7ZKP5;O75129-2;O75129;O75129-3;O75129-6;O75129-4	.;.;.;ASTN2_HUMAN;.;.;.	M	1290;1286;391;342;1013;1239;342	ENSP00000314038:V1290M;ENSP00000363108:V1286M;ENSP00000288520:V391M;ENSP00000339925:V342M;ENSP00000363098:V1013M;ENSP00000354504:V1239M;ENSP00000355116:V342M	ENSP00000288520:V391M	V	-	1	0	ASTN2	118228103	1.000000	0.71417	0.966000	0.40874	0.836000	0.47400	4.208000	0.58486	2.761000	0.94854	0.655000	0.94253	GTG	ASTN2	-	NULL	ENSG00000148219		0.582	ASTN2-201	KNOWN	basic	protein_coding	ASTN2	HGNC	protein_coding		94	0.00	0	C	NM_014010		119188282	119188282	-1	no_errors	ENST00000313400	ensembl	human	known	69_37n	missense	28	75.00	84	SNP	0.996	T
BTBD6	90135	genome.wustl.edu	37	14	105716214	105716214	+	Silent	SNP	C	C	T			TCGA-E2-A14O-01A-31D-A10Y-09	TCGA-E2-A14O-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d6ab6f8d-0e65-40a3-bf98-7249e4075395	3315cbc2-91d3-407d-b030-0d20dc9f4aff	g.chr14:105716214C>T	ENST00000392554.3	+	4	960	c.663C>T	c.(661-663)tcC>tcT	p.S221S	BTBD6_ENST00000536364.1_Silent_p.S221S|BRF1_ENST00000379932.4_5'Flank|BRF1_ENST00000392557.4_5'Flank|BRF1_ENST00000379937.2_Intron|BTBD6_ENST00000327471.3_Silent_p.S146S|BRF1_ENST00000327359.3_Intron|BRF1_ENST00000440513.3_Intron|BTBD6_ENST00000463376.2_Silent_p.S146S|BRF1_ENST00000446501.2_5'Flank|BRF1_ENST00000551787.1_5'Flank|BRF1_ENST00000546474.1_Intron			Q96KE9	BTBD6_HUMAN	BTB (POZ) domain containing 6	221						cytoplasm (GO:0005737)				endometrium(1)|lung(3)	4		Melanoma(154;0.226)	OV - Ovarian serous cystadenocarcinoma(23;0.0163)|Epithelial(46;0.0391)	Epithelial(152;0.18)		CCCTACGGTCCGAAGGCTTCT	0.627																																						dbGAP											0													35.0	34.0	35.0					14																	105716214		2200	4300	6500	-	-	-	SO:0001819	synonymous_variant	0			AF353674	CCDS10002.1, CCDS10002.2	14q32.33	2013-01-08			ENSG00000184887	ENSG00000184887		"""BTB/POZ domain containing"""	19897	protein-coding gene	gene with protein product							Standard	NM_033271		Approved	BDPL	uc010tyq.2	Q96KE9	OTTHUMG00000029887	ENST00000392554.3:c.663C>T	14.37:g.105716214C>T			Q8IVQ7|Q9BR94	Silent	SNP	pfam_PHR,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,pfscan_BTB/POZ-like	p.S221	ENST00000392554.3	37	c.663	CCDS10002.2	14																																																																																			BTBD6	-	pfam_BACK,smart_BACK	ENSG00000184887		0.627	BTBD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BTBD6	HGNC	protein_coding	OTTHUMT00000074556.4	21	0.00	0	C			105716214	105716214	+1	no_errors	ENST00000392554	ensembl	human	known	69_37n	silent	24	41.46	17	SNP	0.003	T
C1orf185	284546	genome.wustl.edu	37	1	51584393	51584393	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14O-01A-31D-A10Y-09	TCGA-E2-A14O-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d6ab6f8d-0e65-40a3-bf98-7249e4075395	3315cbc2-91d3-407d-b030-0d20dc9f4aff	g.chr1:51584393C>T	ENST00000371759.2	+	3	178	c.178C>T	c.(178-180)Cca>Tca	p.P60S	C1orf185_ENST00000474016.1_3'UTR|C1orf185_ENST00000467127.1_5'UTR	NM_001136508.1	NP_001129980.1	Q5T7R7	CA185_HUMAN	chromosome 1 open reading frame 185	60						integral component of membrane (GO:0016021)		p.0?(2)		endometrium(1)	1						CAGGCAAAGACCATCAATGGC	0.284																																						dbGAP											2	Whole gene deletion(2)	thyroid(1)|central_nervous_system(1)											115.0	102.0	106.0					1																	51584393		692	1587	2279	-	-	-	SO:0001583	missense	0			AK130995	CCDS44142.1	1p32.3	2012-07-27			ENSG00000204006	ENSG00000204006			28096	protein-coding gene	gene with protein product							Standard	NM_001136508		Approved	FLJ27485	uc001csh.3	Q5T7R7	OTTHUMG00000008084	ENST00000371759.2:c.178C>T	1.37:g.51584393C>T	ENSP00000360824:p.Pro60Ser		A6NHS3	Missense_Mutation	SNP	NULL	p.P60S	ENST00000371759.2	37	c.178	CCDS44142.1	1	.	.	.	.	.	.	.	.	.	.	C	5.368	0.253146	0.10185	.	.	ENSG00000204006	ENST00000371759	.	.	.	4.69	-0.0288	0.13920	.	0.974151	0.08311	N	0.965351	T	0.13586	0.0329	N	0.04508	-0.205	0.09310	N	1	B	0.12013	0.005	B	0.10450	0.005	T	0.29822	-0.9999	9	0.02654	T	1	0.0033	6.7898	0.23693	0.0:0.3668:0.0:0.6332	.	60	Q5T7R7	CA185_HUMAN	S	60	.	ENSP00000360824:P60S	P	+	1	0	C1orf185	51356981	0.000000	0.05858	0.099000	0.21106	0.338000	0.28826	-0.398000	0.07259	0.102000	0.17638	0.591000	0.81541	CCA	C1orf185	-	NULL	ENSG00000204006		0.284	C1orf185-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf185	HGNC	protein_coding	OTTHUMT00000022123.1	41	0.00	0	C	NM_001136508		51584393	51584393	+1	no_errors	ENST00000371759	ensembl	human	known	69_37n	missense	36	60.87	56	SNP	0.133	T
COL1A1	1277	genome.wustl.edu	37	17	48267939	48267939	+	Missense_Mutation	SNP	C	C	T	rs67879854		TCGA-E2-A14O-01A-31D-A10Y-09	TCGA-E2-A14O-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d6ab6f8d-0e65-40a3-bf98-7249e4075395	3315cbc2-91d3-407d-b030-0d20dc9f4aff	g.chr17:48267939C>T	ENST00000225964.5	-	34	2480	c.2362G>A	c.(2362-2364)Ggc>Agc	p.G788S		NM_000088.3	NP_000079	P02452	CO1A1_HUMAN	collagen, type I, alpha 1	788	Triple-helical region.				blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|bone trabecula formation (GO:0060346)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to amino acid stimulus (GO:0071230)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal system development (GO:0048706)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|leukocyte migration (GO:0050900)|negative regulation of cell-substrate adhesion (GO:0010812)|osteoblast differentiation (GO:0001649)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterotrimerization (GO:0070208)|protein localization to nucleus (GO:0034504)|protein transport (GO:0015031)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to estradiol (GO:0032355)|response to hydrogen peroxide (GO:0042542)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|tooth mineralization (GO:0034505)|visual perception (GO:0007601)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)		COL1A1/PDGFB(429)	NS(1)|breast(3)|central_nervous_system(8)|endometrium(3)|kidney(4)|large_intestine(17)|liver(3)|lung(18)|ovary(1)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	71					Collagenase(DB00048)	CCAGCAGGGCCGCTGGGACCA	0.612			T	"""PDGFB, USP6"""	"""dermatofibrosarcoma protuberans, aneurysmal bone cyst """		Osteogenesis imperfecta																															dbGAP		Dom	yes		17	17q21.31-q22	1277	"""collagen, type I, alpha 1"""	yes	M	0			GRCh37	CM042009|CM070687	COL1A1	M	rs67879854						79.0	92.0	87.0					17																	48267939		2202	4300	6502	-	-	-	SO:0001583	missense	0			Z74615	CCDS11561.1	17q21.33	2014-09-17			ENSG00000108821	ENSG00000108821		"""Collagens"""	2197	protein-coding gene	gene with protein product		120150				3178743, 2857713	Standard	NM_000088		Approved	OI4	uc002iqm.3	P02452	OTTHUMG00000148674	ENST00000225964.5:c.2362G>A	17.37:g.48267939C>T	ENSP00000225964:p.Gly788Ser		O76045|P78441|Q13896|Q13902|Q13903|Q14037|Q14992|Q15176|Q15201|Q16050|Q59F64|Q7KZ30|Q7KZ34|Q8IVI5|Q8N473|Q9UML6|Q9UMM7	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_VWF_C,superfamily_Fibrinogen_a/b/g_C,smart_VWF_C,smart_Fib_collagen_C,pfscan_VWF_C	p.G788S	ENST00000225964.5	37	c.2362	CCDS11561.1	17	.	.	.	.	.	.	.	.	.	.	C	19.77	3.889999	0.72524	.	.	ENSG00000108821	ENST00000225964	D	0.99329	-5.75	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	D	0.99588	0.9851	H	0.98682	4.3	0.58432	D	0.999998	D	0.55385	0.971	P	0.56751	0.805	D	0.97688	1.0177	10	0.87932	D	0	.	16.6036	0.84822	0.0:1.0:0.0:0.0	.	788	P02452	CO1A1_HUMAN	S	788	ENSP00000225964:G788S	ENSP00000225964:G788S	G	-	1	0	COL1A1	45622938	1.000000	0.71417	0.998000	0.56505	0.899000	0.52679	5.954000	0.70298	2.206000	0.71126	0.462000	0.41574	GGC	COL1A1	-	pfam_Collagen	ENSG00000108821		0.612	COL1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL1A1	HGNC	protein_coding	OTTHUMT00000309036.2	100	0.00	0	C			48267939	48267939	-1	no_errors	ENST00000225964	ensembl	human	known	69_37n	missense	98	44.32	78	SNP	1.000	T
DAZAP1	26528	genome.wustl.edu	37	19	1418354	1418354	+	Silent	SNP	G	G	T	rs201675830		TCGA-E2-A14O-01A-31D-A10Y-09	TCGA-E2-A14O-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d6ab6f8d-0e65-40a3-bf98-7249e4075395	3315cbc2-91d3-407d-b030-0d20dc9f4aff	g.chr19:1418354G>T	ENST00000233078.4	+	3	383	c.222G>T	c.(220-222)acG>acT	p.T74T	DAZAP1_ENST00000586579.1_3'UTR|DAZAP1_ENST00000336761.6_Silent_p.T74T	NM_018959.2	NP_061832.2	Q96EP5	DAZP1_HUMAN	DAZ associated protein 1	74	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|maternal placenta development (GO:0001893)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	9		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GACCGCACACGCTAGATGGCC	0.532																																						dbGAP											0													61.0	59.0	60.0					19																	1418354		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS12065.1, CCDS12066.1	19p13.3	2013-07-16			ENSG00000071626	ENSG00000071626		"""RNA binding motif (RRM) containing"""	2683	protein-coding gene	gene with protein product	"""deleted in azoospermia associated protein 1"""	607430				10857750, 23658607	Standard	XM_005259530		Approved	MGC19907	uc002lsn.3	Q96EP5		ENST00000233078.4:c.222G>T	19.37:g.1418354G>T			Q96MJ3|Q9NRR9	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R17L	ENST00000233078.4	37	c.50	CCDS12065.1	19																																																																																			DAZAP1	-	NULL	ENSG00000071626		0.532	DAZAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAZAP1	HGNC	protein_coding	OTTHUMT00000449522.3	30	0.00	0	G	NM_170711		1418354	1418354	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000591830	ensembl	human	novel	69_37n	missense	42	22.22	12	SNP	0.140	T
DHX32	55760	genome.wustl.edu	37	10	127530353	127530353	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A14O-01A-31D-A10Y-09	TCGA-E2-A14O-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d6ab6f8d-0e65-40a3-bf98-7249e4075395	3315cbc2-91d3-407d-b030-0d20dc9f4aff	g.chr10:127530353T>G	ENST00000284690.3	-	7	1992	c.1502A>C	c.(1501-1503)gAc>gCc	p.D501A	AL360176.1_ENST00000401153.1_RNA|DHX32_ENST00000368721.1_Missense_Mutation_p.D125A|BCCIP_ENST00000429863.2_3'UTR|DHX32_ENST00000284688.6_Missense_Mutation_p.D420A|BCCIP_ENST00000368759.5_Intron|BCCIP_ENST00000299130.3_3'UTR	NM_018180.2	NP_060650.2	Q7L7V1	DHX32_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 32	501						mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(2)|stomach(1)	29		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				ATCTACACAGTCAAATTCACA	0.378																																						dbGAP											0													89.0	82.0	84.0					10																	127530353		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS7652.1	10q26.11-q26.2	2008-01-07	2004-01-29	2004-01-30	ENSG00000089876	ENSG00000089876		"""DEAH-boxes"""	16717	protein-coding gene	gene with protein product		607960	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32"""	DDX32			Standard	NM_018180		Approved	FLJ10889, FLJ10694, DHLP1	uc001ljf.1	Q7L7V1	OTTHUMG00000019238	ENST00000284690.3:c.1502A>C	10.37:g.127530353T>G	ENSP00000284690:p.Asp501Ala		A8MSV2|D3DRF9|Q49AG5|Q5T3L0|Q5T3L5|Q96NY1|Q9BUN0|Q9H769|Q9NSL5|Q9NV74|Q9NVJ7	Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_DUF1605,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd	p.D501A	ENST00000284690.3	37	c.1502	CCDS7652.1	10	.	.	.	.	.	.	.	.	.	.	T	21.5	4.155332	0.78114	.	.	ENSG00000089876	ENST00000368721;ENST00000284690;ENST00000284688	T;T;T	0.28895	1.59;1.59;1.59	4.61	4.61	0.57282	Helicase-associated domain (2);	0.118165	0.56097	D	0.000038	T	0.42494	0.1205	M	0.62723	1.935	0.58432	D	0.999999	D	0.56746	0.977	P	0.51324	0.666	T	0.46219	-0.9207	10	0.87932	D	0	-42.0611	13.8728	0.63629	0.0:0.0:0.0:1.0	.	501	Q7L7V1	DHX32_HUMAN	A	125;501;420	ENSP00000357710:D125A;ENSP00000284690:D501A;ENSP00000284688:D420A	ENSP00000284688:D420A	D	-	2	0	DHX32	127520343	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.640000	0.83355	1.944000	0.56390	0.533000	0.62120	GAC	DHX32	-	pfam_Helicase-assoc_dom,smart_Helicase-assoc_dom	ENSG00000089876		0.378	DHX32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX32	HGNC	protein_coding	OTTHUMT00000050945.2	43	0.00	0	T	NM_018180		127530353	127530353	-1	no_errors	ENST00000284690	ensembl	human	known	69_37n	missense	93	42.33	69	SNP	1.000	G
EIF5	1983	genome.wustl.edu	37	14	103802230	103802230	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14O-01A-31D-A10Y-09	TCGA-E2-A14O-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d6ab6f8d-0e65-40a3-bf98-7249e4075395	3315cbc2-91d3-407d-b030-0d20dc9f4aff	g.chr14:103802230C>G	ENST00000216554.3	+	3	709	c.33C>G	c.(31-33)gaC>gaG	p.D11E	SNORA28_ENST00000606769.1_RNA|EIF5_ENST00000392715.2_Missense_Mutation_p.D11E|EIF5_ENST00000558506.1_Missense_Mutation_p.D11E|EIF5_ENST00000560200.1_3'UTR	NM_001969.4	NP_001960.2	P55010	IF5_HUMAN	eukaryotic translation initiation factor 5	11					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|regulation of translational initiation (GO:0006446)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(3)|kidney(2)|large_intestine(3)|lung(5)|pancreas(2)|skin(2)|upper_aerodigestive_tract(1)	18		Melanoma(154;0.155)	Epithelial(46;0.182)			GCGTGTCAGACCAGTTCTATC	0.378																																						dbGAP											0													152.0	142.0	146.0					14																	103802230		2203	4300	6503	-	-	-	SO:0001583	missense	0			U49436	CCDS9980.1	14q32.32	2006-05-11				ENSG00000100664			3299	protein-coding gene	gene with protein product		601710				8663286	Standard	NM_001969		Approved		uc001ymq.4	P55010		ENST00000216554.3:c.33C>G	14.37:g.103802230C>G	ENSP00000216554:p.Asp11Glu		Q53XB3|Q9H5N2|Q9UG48	Missense_Mutation	SNP	pfam_Transl_init_fac_IF2/IF5,pfam_W2_domain,superfamily_ARM-type_fold,superfamily_Transl_init_fac_IF2/IF5_N,superfamily_Transl_init_fac_IF2/IF5_Zn-bd,smart_Transl_init_fac_IF2/IF5,smart_W2_domain	p.D11E	ENST00000216554.3	37	c.33	CCDS9980.1	14	.	.	.	.	.	.	.	.	.	.	.	25.6	4.652040	0.88056	.	.	ENSG00000100664	ENST00000216554;ENST00000392715	T;T	0.44482	0.92;0.92	5.79	4.8	0.61643	Translation initiation factor IF2/IF5, N-terminal (1);Translation initiation factor IF2/IF5 (1);	0.140512	0.64402	D	0.000007	T	0.67344	0.2883	H	0.95884	3.735	0.58432	D	0.999998	D	0.53151	0.958	P	0.62014	0.897	T	0.73839	-0.3856	10	0.87932	D	0	.	3.8349	0.08889	0.0:0.6743:0.0:0.3257	.	11	P55010	IF5_HUMAN	E	11	ENSP00000216554:D11E;ENSP00000376477:D11E	ENSP00000216554:D11E	D	+	3	2	EIF5	102871983	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.427000	0.59888	2.752000	0.94435	0.650000	0.86243	GAC	EIF5	-	pfam_Transl_init_fac_IF2/IF5,superfamily_Transl_init_fac_IF2/IF5_N	ENSG00000100664		0.378	EIF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF5	HGNC	protein_coding	OTTHUMT00000415329.2	110	0.00	0	C	NM_001969		103802230	103802230	+1	no_errors	ENST00000216554	ensembl	human	known	69_37n	missense	113	52.12	123	SNP	1.000	G
EMR2	30817	genome.wustl.edu	37	19	14866468	14866468	+	Missense_Mutation	SNP	G	G	A	rs561706740	byFrequency	TCGA-E2-A14O-01A-31D-A10Y-09	TCGA-E2-A14O-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d6ab6f8d-0e65-40a3-bf98-7249e4075395	3315cbc2-91d3-407d-b030-0d20dc9f4aff	g.chr19:14866468G>A	ENST00000315576.3	-	13	1865	c.1414C>T	c.(1414-1416)Cgt>Tgt	p.R472C	EMR2_ENST00000392965.3_Missense_Mutation_p.R472C|EMR2_ENST00000392964.3_Intron|EMR2_ENST00000594076.1_Missense_Mutation_p.R379C|EMR2_ENST00000353876.1_Missense_Mutation_p.R379C|EMR2_ENST00000346057.1_Missense_Mutation_p.R423C|EMR2_ENST00000595839.1_Missense_Mutation_p.R330C|EMR2_ENST00000596991.2_Missense_Mutation_p.R461C|EMR2_ENST00000601345.1_Missense_Mutation_p.R461C|EMR2_ENST00000353005.1_Missense_Mutation_p.R330C|EMR2_ENST00000392967.2_Missense_Mutation_p.R461C|EMR2_ENST00000594294.1_Missense_Mutation_p.R423C	NM_013447.3	NP_038475.2	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 2	472					cell adhesion (GO:0007155)|cell migration (GO:0016477)|G-protein coupled receptor signaling pathway (GO:0007186)|granulocyte chemotaxis (GO:0071621)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	48						GCACTCACACGGTGGGAGAAG	0.577													G|||	3	0.000599042	0.0	0.0	5008	,	,		20422	0.0		0.0	False		,,,				2504	0.0031					dbGAP											0													167.0	149.0	156.0					19																	14866468		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF114491	CCDS32935.1, CCDS59361.1	19p13.1	2014-08-08	2003-11-26			ENSG00000127507		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	3337	protein-coding gene	gene with protein product		606100	"""egf-like module containing, mucin-like, hormone receptor-like sequence 2"""				Standard	NM_013447		Approved	CD312	uc002mzp.2	Q9UHX3		ENST00000315576.3:c.1414C>T	19.37:g.14866468G>A	ENSP00000319883:p.Arg472Cys		B4DQ96|E7ESD7|E9PBR1|E9PEL6|E9PFQ5|E9PG91|Q8NG96|Q9Y4B1	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_EGF-like_Ca-bd,pfam_GPS_dom,pfam_EGF-like_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_GPS_dom,prints_GPCR_2_CD97,prints_GPCR_2_EMR1_rcpt,prints_GPCR_2_secretin-like,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like	p.R472C	ENST00000315576.3	37	c.1414	CCDS32935.1	19	.	.	.	.	.	.	.	.	.	.	G	14.65	2.599347	0.46318	.	.	ENSG00000127507	ENST00000315576;ENST00000392967;ENST00000346057;ENST00000353876;ENST00000353005;ENST00000392965	T;T;T;T;T;T	0.77489	-0.97;-1.1;-0.51;0.28;1.01;1.14	3.94	1.7	0.24286	.	.	.	.	.	T	0.72170	0.3427	N	0.24115	0.695	0.09310	N	1	D;D;D;D;D;P;D;B	0.61697	0.983;0.987;0.981;0.976;0.987;0.955;0.99;0.132	B;P;P;P;P;P;P;B	0.55667	0.353;0.781;0.54;0.781;0.781;0.608;0.608;0.058	T	0.60393	-0.7272	9	0.54805	T	0.06	.	6.0884	0.19980	0.1104:0.191:0.6986:0.0	.	472;379;472;330;423;472;472;461	E7ESD7;Q9UHX3-4;A0JNV7;Q9UHX3-5;Q9UHX3-3;A8K6W1;Q9UHX3;Q9UHX3-2	.;.;.;.;.;.;EMR2_HUMAN;.	C	472;461;423;379;330;472	ENSP00000319883:R472C;ENSP00000376694:R461C;ENSP00000263380:R423C;ENSP00000319454:R379C;ENSP00000319838:R330C;ENSP00000376692:R472C	ENSP00000319883:R472C	R	-	1	0	EMR2	14727468	0.093000	0.21703	0.010000	0.14722	0.017000	0.09413	0.061000	0.14366	0.382000	0.24878	-0.182000	0.12963	CGT	EMR2	-	NULL	ENSG00000127507		0.577	EMR2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	EMR2	HGNC	protein_coding	OTTHUMT00000466502.2	221	0.00	0	G			14866468	14866468	-1	no_errors	ENST00000315576	ensembl	human	known	69_37n	missense	178	39.66	117	SNP	0.047	A
ERVW-1	30816	genome.wustl.edu	37	7	92098206	92098206	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A14O-01A-31D-A10Y-09	TCGA-E2-A14O-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d6ab6f8d-0e65-40a3-bf98-7249e4075395	3315cbc2-91d3-407d-b030-0d20dc9f4aff	g.chr7:92098206A>T	ENST00000493463.2	-	1	2413	c.1490T>A	c.(1489-1491)aTc>aAc	p.I497N	AC007566.10_ENST00000427458.1_RNA|ERVW-1_ENST00000604270.1_5'UTR|ERVW-1_ENST00000603053.1_Missense_Mutation_p.I497N	NM_014590.3	NP_055405.3	Q9UQF0	SYCY1_HUMAN	endogenous retrovirus group W, member 1	497					anatomical structure morphogenesis (GO:0009653)|syncytium formation (GO:0006949)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|viral envelope (GO:0019031)				endometrium(1)|large_intestine(1)|lung(15)	17						tctgcggtagatcttagtctt	0.478																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF208161	CCDS5626.1	7q21.2	2011-06-16	2011-05-05	2011-05-05	ENSG00000242950	ENSG00000242950			13525	other	endogenous retrovirus	"""envelope protein"", ""HERV-W Env glycoprotein"", ""enverin"", ""syncytin-1"", ""HERV-tryptophan envelope protein"", ""HERV-W{7q21.1} provirus ancestral Env polyprotein"", ""HERV-7q envelope protein"", ""envelope glycoprotein"", ""syncytin"""	604659	"""endogenous retroviral family W, env(C7), member 1"""	ERVWE1		9835022, 9882319, 21542922	Standard	NM_001130925		Approved	HERV-W, HERV-W-ENV, HERVW, HERV-7q	uc022ahe.1	Q9UQF0	OTTHUMG00000131249	ENST00000493463.2:c.1490T>A	7.37:g.92098206A>T	ENSP00000419945:p.Ile497Asn		B2RPD4|O95244|O95245|Q8NHY7|Q9NRZ2|Q9NZG3	Missense_Mutation	SNP	pfam_TLV/ENV_coat_polyprotein	p.I497N	ENST00000493463.2	37	c.1490	CCDS5626.1	7	.	.	.	.	.	.	.	.	.	.	A	5.378	0.254998	0.10185	.	.	ENSG00000242950	ENST00000493463	T	0.21543	2.0	0.0465	0.0465	0.14256	.	163.763000	0.02969	U	0.144154	T	0.12433	0.0302	N	0.19112	0.55	0.09310	N	1	.	.	.	.	.	.	T	0.19160	-1.0314	7	0.13470	T	0.59	.	.	.	.	.	.	.	.	N	497	ENSP00000419945:I497N	ENSP00000419945:I497N	I	-	2	0	ERVW-1	91936142	0.032000	0.19561	0.343000	0.25615	0.346000	0.29079	-1.178000	0.03093	0.115000	0.18071	0.113000	0.15668	ATC	ERVW-1	-	NULL	ENSG00000242950		0.478	ERVW-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERVW-1	HGNC	protein_coding	OTTHUMT00000254009.2	15	0.00	0	A	NM_014590		92098206	92098206	-1	no_errors	ENST00000493463	ensembl	human	known	69_37n	missense	7	46.15	6	SNP	0.371	T
FLII	2314	genome.wustl.edu	37	17	18149307	18149307	+	Missense_Mutation	SNP	C	C	T	rs201173622		TCGA-E2-A14O-01A-31D-A10Y-09	TCGA-E2-A14O-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d6ab6f8d-0e65-40a3-bf98-7249e4075395	3315cbc2-91d3-407d-b030-0d20dc9f4aff	g.chr17:18149307C>T	ENST00000327031.4	-	26	3562	c.3337G>A	c.(3337-3339)Gaa>Aaa	p.E1113K	FLII_ENST00000579294.1_Missense_Mutation_p.E1102K|FLII_ENST00000545457.2_Missense_Mutation_p.E1058K|FLII_ENST00000578558.1_Intron|FLII_ENST00000379450.4_Missense_Mutation_p.E1027K	NM_002018.3	NP_002009.1	Q13045	FLII_HUMAN	flightless I homolog (Drosophila)	1113					multicellular organismal development (GO:0007275)|muscle contraction (GO:0006936)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)	actin binding (GO:0003779)			central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32	all_neural(463;0.228)					AACTTGGCTTCGTCAGGGTCT	0.622																																						dbGAP											0													90.0	81.0	84.0					17																	18149307		2203	4300	6503	-	-	-	SO:0001583	missense	0			U01184	CCDS11192.1, CCDS58521.1, CCDS58522.1	17p11.2	2008-07-18	2001-11-28		ENSG00000177731	ENSG00000177731			3750	protein-coding gene	gene with protein product		600362	"""flightless I (Drosophila) homolog"""			7825574	Standard	NM_002018		Approved	FLI, FLIL, Fli1, MGC39265	uc002gsr.2	Q13045	OTTHUMG00000059389	ENST00000327031.4:c.3337G>A	17.37:g.18149307C>T	ENSP00000324573:p.Glu1113Lys		B4DIL0|F5H407|J3QLG3	Missense_Mutation	SNP	pfam_Gelsolin_dom,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Gelsolin,prints_Gelsolin	p.E1113K	ENST00000327031.4	37	c.3337	CCDS11192.1	17	.	.	.	.	.	.	.	.	.	.	C	35	5.519024	0.96416	.	.	ENSG00000177731	ENST00000327031;ENST00000545457;ENST00000379450	T;T	0.34667	1.35;1.35	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.70789	0.3264	H	0.95402	3.665	0.80722	D	1	D;D;D;D	0.67145	0.996;0.996;0.958;0.992	P;P;B;P	0.61477	0.889;0.889;0.404;0.74	T	0.79614	-0.1730	10	0.62326	D	0.03	-22.0159	19.7945	0.96474	0.0:1.0:0.0:0.0	.	1027;1027;1113;1082	E7EPM0;B4DIL0;Q13045;B4DIX0	.;.;FLII_HUMAN;.	K	1113;992;1027	ENSP00000324573:E1113K;ENSP00000368763:E1027K	ENSP00000324573:E1113K	E	-	1	0	FLII	18090032	1.000000	0.71417	0.965000	0.40720	0.992000	0.81027	7.421000	0.80204	2.690000	0.91761	0.655000	0.94253	GAA	FLII	-	smart_Gelsolin	ENSG00000177731		0.622	FLII-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLII	HGNC	protein_coding	OTTHUMT00000132032.2	107	0.00	0	C	NM_002018		18149307	18149307	-1	no_errors	ENST00000327031	ensembl	human	known	69_37n	missense	461	13.99	75	SNP	1.000	T
FRG1B	284802	genome.wustl.edu	37	20	29632638	29632638	+	Missense_Mutation	SNP	C	C	A	rs9647043	byFrequency	TCGA-E2-A14O-01A-31D-A10Y-09	TCGA-E2-A14O-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d6ab6f8d-0e65-40a3-bf98-7249e4075395	3315cbc2-91d3-407d-b030-0d20dc9f4aff	g.chr20:29632638C>A	ENST00000278882.3	+	8	833	c.453C>A	c.(451-453)caC>caA	p.H151Q	FRG1B_ENST00000358464.4_Missense_Mutation_p.H151Q			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	151										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TCCAAGACCACAAACTTAAAA	0.294																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.453C>A	20.37:g.29632638C>A	ENSP00000278882:p.His151Gln		C4AME5	Missense_Mutation	SNP	pfam_FRG1,superfamily_Actin_cross-linking	p.H151Q	ENST00000278882.3	37	c.453		20	.	.	.	.	.	.	.	.	.	.	c	7.065	0.567065	0.13560	.	.	ENSG00000149531	ENST00000278882;ENST00000358464	.	.	.	1.44	0.459	0.16678	.	0.391955	0.28360	N	0.015622	T	0.23370	0.0565	.	.	.	0.19945	N	0.99994	B	0.19331	0.035	B	0.14578	0.011	T	0.11012	-1.0605	8	0.30078	T	0.28	.	5.6181	0.17442	0.0:0.799:0.0:0.201	rs9647043;rs57196803	151	Q9BZ01	FRG1B_HUMAN	Q	151	.	ENSP00000278882:H151Q	H	+	3	2	FRG1B	28246299	0.988000	0.35896	0.998000	0.56505	0.964000	0.63967	0.124000	0.15728	0.179000	0.19938	0.398000	0.26397	CAC	FRG1B	-	pfam_FRG1	ENSG00000149531		0.294	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FRG1B	HGNC	protein_coding	OTTHUMT00000078494.2	20	0.00	0	C	NR_003579		29632638	29632638	+1	no_errors	ENST00000278882	ensembl	human	known	69_37n	missense	51	25.00	17	SNP	0.999	A
GLYR1	84656	genome.wustl.edu	37	16	4862120	4862122	+	In_Frame_Del	DEL	AGC	AGC	-			TCGA-E2-A14O-01A-31D-A10Y-09	TCGA-E2-A14O-10A-01D-A110-09	AGC	AGC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d6ab6f8d-0e65-40a3-bf98-7249e4075395	3315cbc2-91d3-407d-b030-0d20dc9f4aff	g.chr16:4862120_4862122delAGC	ENST00000321919.9	-	13	1323_1325	c.1247_1249delGCT	c.(1246-1251)tgcttc>ttc	p.C416del	GLYR1_ENST00000381983.3_In_Frame_Del_p.C399del|GLYR1_ENST00000436648.5_In_Frame_Del_p.C335del|GLYR1_ENST00000591451.1_In_Frame_Del_p.C410del	NM_032569.3	NP_115958	Q49A26	GLYR1_HUMAN	glyoxylate reductase 1 homolog (Arabidopsis)	416					pentose-phosphate shunt (GO:0006098)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|NAD binding (GO:0051287)|phosphogluconate dehydrogenase (decarboxylating) activity (GO:0004616)			endometrium(1)|kidney(1)|large_intestine(7)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	19						ATCGCCTGGAAGCAGCTGCTGCA	0.571																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AF244907	CCDS10524.1	16p13.3	2010-02-17			ENSG00000140632	ENSG00000140632			24434	protein-coding gene	gene with protein product	"""nuclear protein 60kDa"""	610660				16352664	Standard	NM_032569		Approved	BM045, HIBDL, NP60, N-PAC	uc002cxx.4	Q49A26	OTTHUMG00000129530	ENST00000321919.9:c.1247_1249delGCT	16.37:g.4862123_4862125delAGC	ENSP00000322716:p.Cys416del		B4DL47|C9JJ40|C9JJ60|Q5U632|Q6P1Q2|Q6V3W7|Q9BTI1|Q9BXK2	In_Frame_Del	DEL	pfam_6PGDH_NADP-bd,pfam_PWWP,pfam_NADP_OxRdtase_F420,superfamily_6-PGluconate_DH_C-like,smart_PWWP,pfscan_PWWP	p.C416in_frame_del	ENST00000321919.9	37	c.1249_1247	CCDS10524.1	16																																																																																			GLYR1	-	pfam_6PGDH_NADP-bd	ENSG00000140632		0.571	GLYR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GLYR1	HGNC	protein_coding	OTTHUMT00000251717.2	54	0.00	0	AGC	NM_032569		4862120	4862122	-1	no_errors	ENST00000321919	ensembl	human	known	69_37n	in_frame_del	74	41.98	55	DEL	1.000:1.000:1.000	-
IGKV1-39	28930	genome.wustl.edu	37	2	89619806	89619806	+	RNA	SNP	G	G	A	rs114472229	byFrequency	TCGA-E2-A14O-01A-31D-A10Y-09	TCGA-E2-A14O-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d6ab6f8d-0e65-40a3-bf98-7249e4075395	3315cbc2-91d3-407d-b030-0d20dc9f4aff	g.chr2:89619806G>A	ENST00000498574.1	-	0	98									immunoglobulin kappa variable 1-39 (gene/pseudogene)																		TCCTTACCTCGGAGCCAGAGT	0.522																																						dbGAP											0													6.0	7.0	7.0					2																	89619806		1093	2290	3383	-	-	-			0			X59315		2p11.2	2012-02-08	2008-09-12		ENSG00000242371	ENSG00000242371		"""Immunoglobulins / IGK locus"""	5740	other	immunoglobulin gene			"""immunoglobulin kappa variable 1-39"""				Standard	NG_000834		Approved				OTTHUMG00000151678		2.37:g.89619806G>A				Nonsense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.R18*	ENST00000498574.1	37	c.52		2																																																																																			IGKV1-39	-	NULL	ENSG00000242371		0.522	IGKV1-39-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGKV1-39	HGNC	IG_V_gene	OTTHUMT00000323476.1	44	0.00	0	G	NG_000834		89619806	89619806	-1	no_stop_codon	ENST00000498574	ensembl	human	known	69_37n	nonsense	26	31.58	12	SNP	0.010	A
IRAK1	3654	genome.wustl.edu	37	X	153284685	153284685	+	Silent	SNP	C	C	A			TCGA-E2-A14O-01A-31D-A10Y-09	TCGA-E2-A14O-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d6ab6f8d-0e65-40a3-bf98-7249e4075395	3315cbc2-91d3-407d-b030-0d20dc9f4aff	g.chrX:153284685C>A	ENST00000369980.3	-	3	566	c.399G>T	c.(397-399)cgG>cgT	p.R133R	IRAK1_ENST00000369974.2_Silent_p.R133R|MIR718_ENST00000390190.2_RNA|IRAK1_ENST00000429936.2_Silent_p.R159R|IRAK1_ENST00000393687.2_Silent_p.R133R|IRAK1_ENST00000477274.1_5'Flank|IRAK1_ENST00000393682.1_Silent_p.R159R	NM_001025242.1|NM_001569.3	NP_001020413.1|NP_001560.2	P51617	IRAK1_HUMAN	interleukin-1 receptor-associated kinase 1	133	ProST region.				activation of MAPK activity (GO:0000187)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to hypoxia (GO:0071456)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cytokine-mediated signaling pathway (GO:0001959)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to peptidoglycan (GO:0032494)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|interleukin-1 receptor complex (GO:0045323)|lipid particle (GO:0005811)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|NF-kappaB-inducing kinase activity (GO:0004704)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(15)|ovary(2)	25	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ATGGCAACTTCCGGGGGCTCC	0.697																																						dbGAP											0													26.0	33.0	31.0					X																	153284685		2167	4259	6426	-	-	-	SO:0001819	synonymous_variant	0			L76191	CCDS14740.1, CCDS35443.1, CCDS35444.1	Xq28	2011-07-08			ENSG00000184216	ENSG00000184216			6112	protein-coding gene	gene with protein product		300283				9374458, 8599092	Standard	XM_005274668		Approved	IRAK, pelle	uc004fjs.1	P51617	OTTHUMG00000024228	ENST00000369980.3:c.399G>T	X.37:g.153284685C>A			D3DWW3|D3DWW4|Q7Z5V4|Q96C06|Q96RL2	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Death,superfamily_Kinase-like_dom,superfamily_DEATH-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.R133	ENST00000369980.3	37	c.399	CCDS14740.1	X																																																																																			IRAK1	-	NULL	ENSG00000184216		0.697	IRAK1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	IRAK1	HGNC	protein_coding	OTTHUMT00000061143.3	52	0.00	0	C			153284685	153284685	-1	no_errors	ENST00000369980	ensembl	human	known	69_37n	silent	52	27.78	20	SNP	0.037	A
MARVELD3	91862	genome.wustl.edu	37	16	71660364	71660365	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-E2-A14O-01A-31D-A10Y-09	TCGA-E2-A14O-10A-01D-A110-09	GA	GA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d6ab6f8d-0e65-40a3-bf98-7249e4075395	3315cbc2-91d3-407d-b030-0d20dc9f4aff	g.chr16:71660364_71660365delGA	ENST00000268485.3	+	1	276_277	c.232_233delGA	c.(232-234)gagfs	p.E78fs	MARVELD3_ENST00000299952.4_Frame_Shift_Del_p.E78fs|RP11-432I5.2_ENST00000562763.1_RNA|MARVELD3_ENST00000565261.1_Frame_Shift_Del_p.E78fs|MARVELD3_ENST00000567566.1_Frame_Shift_Del_p.E78fs|MARVELD3_ENST00000567501.1_5'Flank	NM_052858.4	NP_443090.4	Q96A59	MALD3_HUMAN	MARVEL domain containing 3	78	Arg-rich.				cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|tight junction (GO:0005923)				NS(1)|endometrium(3)|large_intestine(5)|lung(6)|skin(2)	17		Ovarian(137;0.125)				CCgggagagggagagagagagg	0.703																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC013376	CCDS10904.1, CCDS32478.1, CCDS59270.1	16q22.2	2008-02-05	2004-07-12	2004-07-14	ENSG00000140832	ENSG00000140832			30525	protein-coding gene	gene with protein product		614094	"""MARVEL (membrane-associating) domain containing 3"""	MRVLDC3			Standard	NM_001017967		Approved		uc002fat.4	Q96A59	OTTHUMG00000137591	ENST00000268485.3:c.232_233delGA	16.37:g.71660372_71660373delGA	ENSP00000268485:p.Glu78fs		A8K820|H3BQM5|Q96MJ4	Frame_Shift_Del	DEL	NULL	p.R81fs	ENST00000268485.3	37	c.232_233	CCDS10904.1	16																																																																																			MARVELD3	-	NULL	ENSG00000140832		0.703	MARVELD3-002	KNOWN	basic|CCDS	protein_coding	MARVELD3	HGNC	protein_coding	OTTHUMT00000268991.2	30	0.00	0	GA	NM_052858		71660364	71660365	+1	no_errors	ENST00000299952	ensembl	human	known	69_37n	frame_shift_del	19	13.64	3	DEL	0.012:0.012	-
MLLT10	8028	genome.wustl.edu	37	10	21959565	21959565	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14O-01A-31D-A10Y-09	TCGA-E2-A14O-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d6ab6f8d-0e65-40a3-bf98-7249e4075395	3315cbc2-91d3-407d-b030-0d20dc9f4aff	g.chr10:21959565G>A	ENST00000307729.7	+	10	1161	c.983G>A	c.(982-984)aGg>aAg	p.R328K	MLLT10_ENST00000377059.3_Missense_Mutation_p.R328K|MLLT10_ENST00000377072.3_Missense_Mutation_p.R328K|MLLT10_ENST00000446906.2_Missense_Mutation_p.R328K			P55197	AF10_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10	328	DNA-binding.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6						TCAGGTCAAAGGGGAAGAAAG	0.458			T	"""MLL, PICALM, CDK6"""	AL																																	dbGAP		Dom	yes		10	10p12	8028	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (AF10)"""		L	0													89.0	85.0	87.0					10																	21959565		2203	4300	6503	-	-	-	SO:0001583	missense	0			U13948	CCDS7135.1, CCDS55706.1, CCDS55707.1, CCDS55708.1	10p12	2013-01-28	2001-11-28		ENSG00000078403	ENSG00000078403		"""Zinc fingers, PHD-type"""	16063	protein-coding gene	gene with protein product		602409	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 10"""			7888665	Standard	NM_004641		Approved	AF10	uc021pny.1	P55197	OTTHUMG00000017799	ENST00000307729.7:c.983G>A	10.37:g.21959565G>A	ENSP00000307411:p.Arg328Lys		B1ANA8|Q5JT37|Q5VX90|Q66K63	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.R328K	ENST00000307729.7	37	c.983	CCDS55708.1	10	.	.	.	.	.	.	.	.	.	.	G	17.46	3.395838	0.62177	.	.	ENSG00000078403	ENST00000377072;ENST00000446906;ENST00000307729;ENST00000396529;ENST00000377059;ENST00000438473;ENST00000538639	T;T;T;T	0.18174	2.34;2.32;2.23;2.32	5.71	5.71	0.89125	.	0.360606	0.33419	N	0.004938	T	0.31606	0.0802	L	0.33485	1.01	0.80722	D	1	D;P;P;P	0.67145	0.996;0.769;0.956;0.769	D;B;D;B	0.76071	0.987;0.253;0.931;0.253	T	0.01800	-1.1271	10	0.16896	T	0.51	.	19.8404	0.96679	0.0:0.0:1.0:0.0	.	174;328;328;328	F5H541;E9PBP4;Q5VX90;P55197	.;.;.;AF10_HUMAN	K	328;328;328;174;328;68;67	ENSP00000366272:R328K;ENSP00000401406:R328K;ENSP00000307411:R328K;ENSP00000366258:R328K	ENSP00000307411:R328K	R	+	2	0	MLLT10	21999571	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.562000	0.82300	2.689000	0.91719	0.655000	0.94253	AGG	MLLT10	-	NULL	ENSG00000078403		0.458	MLLT10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLLT10	HGNC	protein_coding	OTTHUMT00000047136.1	72	0.00	0	G			21959565	21959565	+1	no_errors	ENST00000307729	ensembl	human	known	69_37n	missense	91	50.00	91	SNP	1.000	A
NBPF1	55672	genome.wustl.edu	37	1	16909220	16909220	+	Silent	SNP	T	T	C	rs201826071		TCGA-E2-A14O-01A-31D-A10Y-09	TCGA-E2-A14O-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d6ab6f8d-0e65-40a3-bf98-7249e4075395	3315cbc2-91d3-407d-b030-0d20dc9f4aff	g.chr1:16909220T>C	ENST00000430580.2	-	14	2012	c.1125A>G	c.(1123-1125)cgA>cgG	p.R375R		NM_017940.3	NP_060410.2	Q3BBV0	NBPF1_HUMAN	neuroblastoma breakpoint family, member 1	375						cytoplasm (GO:0005737)									UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		GGGTCAGCTCTCGTTCCTGAG	0.488																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AB051480		1p36.13	2013-01-30			ENSG00000219481	ENSG00000219481		"""neuroblastoma breakpoint family"""	26088	protein-coding gene	gene with protein product		610501				11214970, 16079250	Standard	NM_017940		Approved	FLJ20719, KIAA1693	uc001ayw.4	Q3BBV0	OTTHUMG00000002487	ENST00000430580.2:c.1125A>G	1.37:g.16909220T>C			Q8N4E8|Q9C0H0	RNA	SNP	-	NULL	ENST00000430580.2	37	NULL		1																																																																																			NBPF1	-	-	ENSG00000219481		0.488	NBPF1-005	NOVEL	upstream_uORF|basic|appris_principal	protein_coding	NBPF1	HGNC	protein_coding	OTTHUMT00000106436.3	9	0.00	0	T	NM_017940		16909220	16909220	-1	no_errors	ENST00000392963	ensembl	human	known	69_37n	rna	3	57.14	4	SNP	0.950	C
NKTR	4820	genome.wustl.edu	37	3	42659115	42659115	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A14O-01A-31D-A10Y-09	TCGA-E2-A14O-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d6ab6f8d-0e65-40a3-bf98-7249e4075395	3315cbc2-91d3-407d-b030-0d20dc9f4aff	g.chr3:42659115A>G	ENST00000232978.8	+	3	300	c.112A>G	c.(112-114)Aac>Gac	p.N38D	RP4-613B23.1_ENST00000445452.1_RNA|RP4-613B23.1_ENST00000438017.1_RNA|NKTR_ENST00000442970.1_Missense_Mutation_p.N38D	NM_005385.3	NP_005376.2	P30414	NKTR_HUMAN	natural killer cell triggering receptor	38	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				protein folding (GO:0006457)	membrane (GO:0016020)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	41				KIRC - Kidney renal clear cell carcinoma(284;0.24)		AACATGCAAAAACTTCCTTTG	0.328																																						dbGAP											0													139.0	125.0	130.0					3																	42659115		2203	4298	6501	-	-	-	SO:0001583	missense	0				CCDS2702.1	3p22.1	2014-01-20	2014-01-20		ENSG00000114857	ENSG00000114857			7833	protein-coding gene	gene with protein product	"""NK-tumor recognition protein"", ""natural-killer cells cyclophilin-related protein"", ""NK-TR protein"""	161565	"""natural killer-tumor recognition sequence"""			8314596, 8144875	Standard	XM_005265173		Approved	p104	uc003clo.3	P30414	OTTHUMG00000133037	ENST00000232978.8:c.112A>G	3.37:g.42659115A>G	ENSP00000232978:p.Asn38Asp			Missense_Mutation	SNP	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom	p.N38D	ENST00000232978.8	37	c.112	CCDS2702.1	3	.	.	.	.	.	.	.	.	.	.	A	29.0	4.965050	0.92855	.	.	ENSG00000114857	ENST00000232978;ENST00000442970;ENST00000445842	T;T;T	0.33654	1.4;1.4;1.4	5.45	5.45	0.79879	Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (4);Cyclophilin-like (1);	0.000000	0.85682	D	0.000000	T	0.76863	0.4047	H	0.99182	4.46	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.986	D	0.87212	0.2248	10	0.87932	D	0	-24.4646	15.7856	0.78300	1.0:0.0:0.0:0.0	.	38;38	P30414;A8K7K2	NKTR_HUMAN;.	D	38	ENSP00000232978:N38D;ENSP00000390259:N38D;ENSP00000408660:N38D	ENSP00000232978:N38D	N	+	1	0	NKTR	42634119	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.216000	0.95154	2.190000	0.69967	0.533000	0.62120	AAC	NKTR	-	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom	ENSG00000114857		0.328	NKTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKTR	HGNC	protein_coding	OTTHUMT00000256642.2	192	0.00	0	A	NM_005385		42659115	42659115	+1	no_errors	ENST00000232978	ensembl	human	known	69_37n	missense	397	37.62	240	SNP	1.000	G
OR2T2	401992	genome.wustl.edu	37	1	248616513	248616513	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14O-01A-31D-A10Y-09	TCGA-E2-A14O-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d6ab6f8d-0e65-40a3-bf98-7249e4075395	3315cbc2-91d3-407d-b030-0d20dc9f4aff	g.chr1:248616513C>T	ENST00000342927.3	+	1	437	c.415C>T	c.(415-417)Cgc>Tgc	p.R139C		NM_001004136.1	NP_001004136.1	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T, member 2	139						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(21)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	37	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CCTCATGAACCGCAGGGTTTG	0.542																																						dbGAP											0													49.0	57.0	55.0					1																	248616513		2202	4280	6482	-	-	-	SO:0001583	missense	0			BK004462	CCDS31116.1	1q44	2012-08-09	2002-11-13	2002-11-15	ENSG00000196240	ENSG00000196240		"""GPCR / Class A : Olfactory receptors"""	14725	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 2 pseudogene"""	OR2T2P		14983052	Standard	NM_001004136		Approved		uc001iek.1	Q6IF00	OTTHUMG00000040480	ENST00000342927.3:c.415C>T	1.37:g.248616513C>T	ENSP00000343062:p.Arg139Cys		B2RNM1|B9EH01	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.R139C	ENST00000342927.3	37	c.415	CCDS31116.1	1	.	.	.	.	.	.	.	.	.	.	c	1.990	-0.431920	0.04669	.	.	ENSG00000196240	ENST00000342927	T	0.01388	4.95	3.72	-1.95	0.07548	GPCR, rhodopsin-like superfamily (1);	0.286741	0.25275	N	0.031842	T	0.01800	0.0057	M	0.76938	2.355	0.09310	N	1	B	0.12630	0.006	B	0.06405	0.002	T	0.42632	-0.9440	10	0.59425	D	0.04	.	1.7384	0.02947	0.1388:0.2758:0.1364:0.4489	.	139	Q6IF00	OR2T2_HUMAN	C	139	ENSP00000343062:R139C	ENSP00000343062:R139C	R	+	1	0	OR2T2	246683136	0.000000	0.05858	0.092000	0.20876	0.072000	0.16883	0.194000	0.17135	-0.302000	0.08869	-0.403000	0.06358	CGC	OR2T2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000196240		0.542	OR2T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T2	HGNC	protein_coding	OTTHUMT00000097421.1	210	0.00	0	C	NM_001004136		248616513	248616513	+1	no_errors	ENST00000342927	ensembl	human	known	69_37n	missense	350	17.06	72	SNP	0.000	T
PCDH7	5099	genome.wustl.edu	37	4	30725334	30725334	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A14O-01A-31D-A10Y-09	TCGA-E2-A14O-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d6ab6f8d-0e65-40a3-bf98-7249e4075395	3315cbc2-91d3-407d-b030-0d20dc9f4aff	g.chr4:30725334G>T	ENST00000361762.2	+	1	3298	c.2290G>T	c.(2290-2292)Gct>Tct	p.A764S	PCDH7_ENST00000543491.1_Missense_Mutation_p.A764S	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	764	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						GACAGTAGTAGCTACAGTGTT	0.438																																						dbGAP											0													69.0	65.0	66.0					4																	30725334		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.2290G>T	4.37:g.30725334G>T	ENSP00000355243:p.Ala764Ser		O60246|O60247|Q4W5C4	Missense_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A764S	ENST00000361762.2	37	c.2290	CCDS33971.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	4.623|4.623	0.115890|0.115890	0.08831|0.08831	.|.	.|.	ENSG00000169851|ENSG00000169851	ENST00000361762;ENST00000543491;ENST00000333135|ENST00000511884	T;T|.	0.53423|.	0.62;0.62|.	5.16|5.16	5.16|5.16	0.70880|0.70880	Cadherin (3);Cadherin-like (1);|.	.|.	.|.	.|.	.|.	T|T	0.53850|0.53850	0.1822|0.1822	N|N	0.20304|0.20304	0.555|0.555	0.39162|0.39162	D|D	0.962438|0.962438	B;B;B|.	0.20459|.	0.02;0.036;0.045|.	B;B;B|.	0.15052|.	0.007;0.007;0.012|.	T|T	0.51411|0.51411	-0.8709|-0.8709	9|5	0.07175|.	T|.	0.84|.	.|.	18.8391|18.8391	0.92174|0.92174	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	764;717;764|.	F5GWJ1;O60245-3;O60245|.	.;.;PCDH7_HUMAN|.	S|I	764;764;717|453	ENSP00000355243:A764S;ENSP00000441802:A764S|.	ENSP00000330302:A717S|.	A|S	+|+	1|2	0|0	PCDH7|PCDH7	30334432|30334432	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	3.393000|3.393000	0.52544|0.52544	2.683000|2.683000	0.91414|0.91414	0.655000|0.655000	0.94253|0.94253	GCT|AGC	PCDH7	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000169851		0.438	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PCDH7	HGNC	protein_coding	OTTHUMT00000360366.1	54	0.00	0	G	NM_032457, NM_002589		30725334	30725334	+1	no_errors	ENST00000543491	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	1.000	T
PITPNM1	9600	genome.wustl.edu	37	11	67269453	67269453	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14O-01A-31D-A10Y-09	TCGA-E2-A14O-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d6ab6f8d-0e65-40a3-bf98-7249e4075395	3315cbc2-91d3-407d-b030-0d20dc9f4aff	g.chr11:67269453C>T	ENST00000534749.1	-	4	708	c.520G>A	c.(520-522)Gat>Aat	p.D174N	PITPNM1_ENST00000356404.3_Missense_Mutation_p.D174N|PITPNM1_ENST00000436757.2_Missense_Mutation_p.D174N			O00562	PITM1_HUMAN	phosphatidylinositol transfer protein, membrane-associated 1	174					brain development (GO:0007420)|lipid metabolic process (GO:0006629)|phospholipid transport (GO:0015914)|phototransduction (GO:0007602)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol transporter activity (GO:0008526)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(3)	18						GCCCAGTCATCAGACAGTGGC	0.607																																					GBM(28;144 709 4607 5525)	dbGAP											0													60.0	54.0	56.0					11																	67269453		2200	4294	6494	-	-	-	SO:0001583	missense	0			X98654	CCDS31620.1, CCDS44659.1	11q13	2008-07-21		2003-05-16	ENSG00000110697	ENSG00000110697			9003	protein-coding gene	gene with protein product	"""PYK2 N-terminal domain-interacting receptor 2"", ""retinal degeneration B alpha 1"""	608794		PITPNM		9680295	Standard	NM_004910		Approved	DRES9, NIR2, RDGB1, RDGBA1, Rd9, RDGB	uc001oly.3	O00562	OTTHUMG00000167675	ENST00000534749.1:c.520G>A	11.37:g.67269453C>T	ENSP00000437286:p.Asp174Asn		A6NME4|Q6T7X3|Q8TBN3|Q9BZ73	Missense_Mutation	SNP	pfam_PI_transfer,pfam_DDHD,pfam_LNS2,superfamily_HAD-like_dom,smart_LNS2,pfscan_DDHD,prints_PI_transfer	p.D174N	ENST00000534749.1	37	c.520	CCDS31620.1	11	.	.	.	.	.	.	.	.	.	.	C	20.7	4.027584	0.75390	.	.	ENSG00000110697	ENST00000534749;ENST00000436757;ENST00000356404	T;T;T	0.42900	0.96;0.96;0.96	4.23	4.23	0.50019	START-like domain (1);	0.131566	0.34133	N	0.004228	T	0.53899	0.1825	M	0.70595	2.14	0.49130	D	0.999755	B;P	0.39809	0.051;0.689	B;P	0.47705	0.042;0.555	T	0.61377	-0.7075	10	0.72032	D	0.01	-7.3331	15.7356	0.77839	0.0:1.0:0.0:0.0	.	174;174	O00562-2;O00562	.;PITM1_HUMAN	N	174	ENSP00000437286:D174N;ENSP00000398787:D174N;ENSP00000348772:D174N	ENSP00000348772:D174N	D	-	1	0	PITPNM1	67026029	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.369000	0.79578	2.359000	0.80004	0.655000	0.94253	GAT	PITPNM1	-	pfam_PI_transfer	ENSG00000110697		0.607	PITPNM1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	PITPNM1	HGNC	protein_coding	OTTHUMT00000395520.1	58	0.00	0	C	NM_004910		67269453	67269453	-1	no_errors	ENST00000356404	ensembl	human	known	69_37n	missense	260	13.58	41	SNP	1.000	T
PJA1	64219	genome.wustl.edu	37	X	68382547	68382547	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E2-A14O-01A-31D-A10Y-09	TCGA-E2-A14O-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d6ab6f8d-0e65-40a3-bf98-7249e4075395	3315cbc2-91d3-407d-b030-0d20dc9f4aff	g.chrX:68382547G>A	ENST00000361478.1	-	2	912	c.535C>T	c.(535-537)Cga>Tga	p.R179*	PJA1_ENST00000374583.1_Nonsense_Mutation_p.R179*|PJA1_ENST00000374584.3_Intron|PJA1_ENST00000477231.1_5'UTR|PJA1_ENST00000374571.4_Nonsense_Mutation_p.R124*	NM_001032396.2|NM_022368.4|NM_145119.3	NP_001027568.1|NP_071763.2|NP_660095.1	Q8NG27	PJA1_HUMAN	praja ring finger 1, E3 ubiquitin protein ligase	179					protein catabolic process (GO:0030163)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(5)|lung(12)|ovary(1)	21						AACTTGTCTCGCTCCTCTCTC	0.507																																						dbGAP											0													78.0	49.0	59.0					X																	68382547		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK021892	CCDS14392.1, CCDS14393.1, CCDS35316.1	Xq13.1	2013-01-09	2012-02-23		ENSG00000181191	ENSG00000181191		"""RING-type (C3HC4) zinc fingers"""	16648	protein-coding gene	gene with protein product		300420	"""praja 1"", ""praja ring finger 1"""			12036302	Standard	NM_001032396		Approved	FLJ11830, RNF70	uc004dxh.3	Q8NG27	OTTHUMG00000021753	ENST00000361478.1:c.535C>T	X.37:g.68382547G>A	ENSP00000355014:p.Arg179*		A2A322|Q5JUT8|Q5JUT9|Q8NG28|Q9HAC1	Nonsense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.R179*	ENST00000361478.1	37	c.535	CCDS14393.1	X	.	.	.	.	.	.	.	.	.	.	G	15.63	2.891122	0.52014	.	.	ENSG00000181191	ENST00000374583;ENST00000361478;ENST00000374571	.	.	.	3.36	-0.688	0.11317	.	1.290660	0.05888	U	0.627623	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	.	0.4062	0.00433	0.2611:0.1838:0.3435:0.2116	.	.	.	.	X	179;179;124	.	ENSP00000355014:R179X	R	-	1	2	PJA1	68299272	0.927000	0.31430	0.001000	0.08648	0.054000	0.15201	0.322000	0.19576	-0.270000	0.09285	0.464000	0.42555	CGA	PJA1	-	NULL	ENSG00000181191		0.507	PJA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PJA1	HGNC	protein_coding	OTTHUMT00000057031.2	61	0.00	0	G	NM_145119		68382547	68382547	-1	no_errors	ENST00000361478	ensembl	human	known	69_37n	nonsense	121	26.51	44	SNP	0.001	A
PLXNA4	91584	genome.wustl.edu	37	7	131908302	131908302	+	Missense_Mutation	SNP	C	C	T	rs200493064		TCGA-E2-A14O-01A-31D-A10Y-09	TCGA-E2-A14O-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d6ab6f8d-0e65-40a3-bf98-7249e4075395	3315cbc2-91d3-407d-b030-0d20dc9f4aff	g.chr7:131908302C>T	ENST00000359827.3	-	9	3043	c.2081G>A	c.(2080-2082)cGa>cAa	p.R694Q	PLXNA4_ENST00000321063.4_Missense_Mutation_p.R694Q			Q9HCM2	PLXA4_HUMAN	plexin A4	694	PSI 2.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						CAGCTTCACTCGGCCTTCCTG	0.572													C|||	1	0.000199681	0.0	0.0	5008	,	,		18945	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													40.0	43.0	42.0					7																	131908302		2055	4223	6278	-	-	-	SO:0001583	missense	0			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.2081G>A	7.37:g.131908302C>T	ENSP00000352882:p.Arg694Gln		A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semaphorin/CD100_Ag,pfam_IPT_TIG_rcpt,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.R694Q	ENST00000359827.3	37	c.2081	CCDS43646.1	7	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	35	5.563667	0.96527	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.17213	2.29;2.29	5.8	5.8	0.92144	.	0.000000	0.64402	D	0.000001	T	0.43919	0.1269	M	0.79258	2.445	0.80722	D	1	D	0.89917	1.0	D	0.69307	0.963	T	0.09185	-1.0686	10	0.26408	T	0.33	.	19.6559	0.95842	0.0:1.0:0.0:0.0	.	694	Q9HCM2	PLXA4_HUMAN	Q	694	ENSP00000323194:R694Q;ENSP00000352882:R694Q	ENSP00000323194:R694Q	R	-	2	0	PLXNA4	131558842	1.000000	0.71417	0.996000	0.52242	0.968000	0.65278	7.630000	0.83225	2.755000	0.94549	0.655000	0.94253	CGA	PLXNA4	-	pfam_Plexin_repeat,superfamily_Plexin-like_fold,smart_Plexin-like	ENSG00000221866		0.572	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA4	HGNC	protein_coding	OTTHUMT00000338422.2	65	0.00	0	C	NM_181775		131908302	131908302	-1	no_errors	ENST00000321063	ensembl	human	known	69_37n	missense	84	26.32	30	SNP	1.000	T
PLXND1	23129	genome.wustl.edu	37	3	129289712	129289712	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14O-01A-31D-A10Y-09	TCGA-E2-A14O-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d6ab6f8d-0e65-40a3-bf98-7249e4075395	3315cbc2-91d3-407d-b030-0d20dc9f4aff	g.chr3:129289712C>T	ENST00000324093.4	-	19	3845	c.3667G>A	c.(3667-3669)Gac>Aac	p.D1223N	PLXND1_ENST00000393239.1_Missense_Mutation_p.D1223N	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	1223					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)		PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						ATCTGGATGTCGCAGCTTACT	0.612																																					Ovarian(97;366 1484 3738 22084 39045)	dbGAP											0													269.0	278.0	275.0					3																	129289712		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.3667G>A	3.37:g.129289712C>T	ENSP00000317128:p.Asp1223Asn		A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT_TIG_rcpt,pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.D1223N	ENST00000324093.4	37	c.3667	CCDS33854.1	3	.	.	.	.	.	.	.	.	.	.	C	13.66	2.304774	0.40795	.	.	ENSG00000004399	ENST00000324093;ENST00000393239	D;D	0.83837	-1.77;-1.77	4.78	4.78	0.61160	Immunoglobulin-like fold (1);	0.276690	0.34879	N	0.003608	T	0.64549	0.2608	N	0.02315	-0.6	0.40135	D	0.976763	B	0.09022	0.002	B	0.04013	0.001	T	0.61768	-0.6995	10	0.30854	T	0.27	.	16.3488	0.83191	0.0:1.0:0.0:0.0	.	1223	Q9Y4D7	PLXD1_HUMAN	N	1223	ENSP00000317128:D1223N;ENSP00000376931:D1223N	ENSP00000317128:D1223N	D	-	1	0	PLXND1	130772402	1.000000	0.71417	0.991000	0.47740	0.901000	0.52897	4.528000	0.60580	2.366000	0.80165	0.491000	0.48974	GAC	PLXND1	-	superfamily_Ig_E-set	ENSG00000004399		0.612	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXND1	HGNC	protein_coding	OTTHUMT00000356132.4	95	0.00	0	C	NM_015103		129289712	129289712	-1	no_errors	ENST00000324093	ensembl	human	known	69_37n	missense	96	42.51	71	SNP	0.998	T
PPM1D	8493	genome.wustl.edu	37	17	58740624	58740624	+	Frame_Shift_Del	DEL	A	A	-			TCGA-E2-A14O-01A-31D-A10Y-09	TCGA-E2-A14O-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d6ab6f8d-0e65-40a3-bf98-7249e4075395	3315cbc2-91d3-407d-b030-0d20dc9f4aff	g.chr17:58740624delA	ENST00000305921.3	+	6	1761	c.1529delA	c.(1528-1530)caafs	p.Q510fs	RNU6-623P_ENST00000363143.1_RNA	NM_003620.3	NP_003611.1	O15297	PPM1D_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1D	510					G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of cell proliferation (GO:0008285)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)|response to bacterium (GO:0009617)|response to radiation (GO:0009314)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)	p.N512fs*2(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	15	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;6.75e-12)|all cancers(12;1.96e-10)			GTCATGGACCAAAAAAATTTG	0.378											OREG0031485	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																										dbGAP											1	Deletion - Frameshift(1)	large_intestine(1)											71.0	73.0	72.0					17																	58740624		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			U78305	CCDS11625.1	17q23.3	2014-09-17	2010-03-05		ENSG00000170836	ENSG00000170836		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9277	protein-coding gene	gene with protein product	"""wild-type p53-induced phosphatase 1"", ""protein phosphatase 2C, delta isoform"""	605100	"""protein phosphatase 1D magnesium-dependent, delta isoform"""			9177166	Standard	NM_003620		Approved	Wip1, PP2C-DELTA	uc002iyt.2	O15297		ENST00000305921.3:c.1529delA	17.37:g.58740624delA	ENSP00000306682:p.Gln510fs	1033	Q53XP4|Q6P991|Q8IVR6	Frame_Shift_Del	DEL	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	p.N512fs	ENST00000305921.3	37	c.1529	CCDS11625.1	17																																																																																			PPM1D	-	NULL	ENSG00000170836		0.378	PPM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPM1D	HGNC	protein_coding	OTTHUMT00000449474.1	23	0.00	0	A	NM_003620		58740624	58740624	+1	no_errors	ENST00000305921	ensembl	human	known	69_37n	frame_shift_del	44	24.59	15	DEL	0.997	-
RASAL3	64926	genome.wustl.edu	37	19	15565621	15565621	+	Missense_Mutation	SNP	C	C	T	rs367775756		TCGA-E2-A14O-01A-31D-A10Y-09	TCGA-E2-A14O-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d6ab6f8d-0e65-40a3-bf98-7249e4075395	3315cbc2-91d3-407d-b030-0d20dc9f4aff	g.chr19:15565621C>T	ENST00000343625.7	-	12	1890	c.1805G>A	c.(1804-1806)cGa>cAa	p.R602Q	RASAL3_ENST00000608577.1_5'Flank	NM_022904.1	NP_075055.1	Q86YV0	RASL3_HUMAN	RAS protein activator like 3	602	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)	Ras GTPase activator activity (GO:0005099)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|skin(1)	18						GCACACCAGTCGGGGGCCCAG	0.642											OREG0025322	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													29.0	39.0	35.0					19																	15565621		2155	4247	6402	-	-	-	SO:0001583	missense	0				CCDS46006.1	19p13.12	2008-12-18			ENSG00000105122	ENSG00000105122			26129	protein-coding gene	gene with protein product						12477932	Standard	NM_022904		Approved	FLJ21438	uc002nbe.2	Q86YV0		ENST00000343625.7:c.1805G>A	19.37:g.15565621C>T	ENSP00000341905:p.Arg602Gln	703	Q8N2T9|Q9H735	Missense_Mutation	SNP	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_RasGAP,pfscan_RasGAP	p.R602Q	ENST00000343625.7	37	c.1805	CCDS46006.1	19	.	.	.	.	.	.	.	.	.	.	C	23.0	4.362469	0.82353	.	.	ENSG00000105122	ENST00000343625	T	0.78924	-1.22	4.79	3.76	0.43208	Rho GTPase activation protein (1);Ras GTPase-activating protein (4);	0.000000	0.29692	U	0.011451	T	0.80686	0.4670	L	0.49126	1.545	0.44469	D	0.997406	D;D	0.67145	0.996;0.992	P;P	0.57776	0.643;0.827	T	0.81621	-0.0850	10	0.87932	D	0	.	10.6885	0.45856	0.0:0.9055:0.0:0.0945	.	602;602	Q86YV0-2;Q86YV0	.;RASL3_HUMAN	Q	602	ENSP00000341905:R602Q	ENSP00000341905:R602Q	R	-	2	0	RASAL3	15426621	1.000000	0.71417	0.606000	0.28943	0.701000	0.40568	6.059000	0.71133	1.151000	0.42436	0.561000	0.74099	CGA	RASAL3	-	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,smart_RasGAP,pfscan_RasGAP	ENSG00000105122		0.642	RASAL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASAL3	HGNC	protein_coding	OTTHUMT00000461331.3	91	0.00	0	C	NM_022904		15565621	15565621	-1	no_errors	ENST00000343625	ensembl	human	known	69_37n	missense	52	35.00	28	SNP	0.992	T
SEMA4G	57715	genome.wustl.edu	37	10	102732993	102732993	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A14O-01A-31D-A10Y-09	TCGA-E2-A14O-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d6ab6f8d-0e65-40a3-bf98-7249e4075395	3315cbc2-91d3-407d-b030-0d20dc9f4aff	g.chr10:102732993T>G	ENST00000370250.4	+	2	605	c.232T>G	c.(232-234)Tct>Gct	p.S78A	SEMA4G_ENST00000210633.3_Missense_Mutation_p.S78A|SEMA4G_ENST00000519756.1_3'UTR|MIR608_ENST00000384820.1_RNA|SEMA4G_ENST00000517724.1_Missense_Mutation_p.S78A	NM_017893.3	NP_060363.2	Q9NTN9	SEM4G_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G	78	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		Colorectal(252;0.234)		Epithelial(162;3.71e-09)|all cancers(201;2.1e-07)		TGCCCTGTTCTCTCTCAGTGC	0.607																																						dbGAP											0													40.0	42.0	41.0					10																	102732993		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046839	CCDS7501.1, CCDS55724.1	10q24.31	2013-01-11			ENSG00000095539	ENSG00000095539		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10735	protein-coding gene	gene with protein product							Standard	NM_017893		Approved	FLJ20590, KIAA1619	uc001krw.2	Q9NTN9	OTTHUMG00000018922	ENST00000370250.4:c.232T>G	10.37:g.102732993T>G	ENSP00000359270:p.Ser78Ala		A1A5C6|A6NJY8|Q58EY1|Q9HCF3	Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_Ig_sub,pfscan_Semaphorin/CD100_Ag,pfscan_Ig-like	p.S78A	ENST00000370250.4	37	c.232		10	.	.	.	.	.	.	.	.	.	.	T	5.514	0.279865	0.10458	.	.	ENSG00000095539	ENST00000519649;ENST00000518124;ENST00000457585;ENST00000370250;ENST00000517724;ENST00000210633	T;T;T;T;T	0.10763	2.84;2.84;2.84;2.84;2.84	5.18	5.18	0.71444	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.067522	0.64402	D	0.000010	T	0.04588	0.0125	N	0.05383	-0.06	0.31869	N	0.619986	B;B;B	0.22146	0.057;0.065;0.012	B;B;B	0.29663	0.045;0.105;0.009	T	0.30238	-0.9985	10	0.05351	T	0.99	.	6.2473	0.20825	0.1574:0.0:0.1637:0.6789	.	78;78;78	Q9NTN9;A1A5C6;Q9NTN9-2	SEM4G_HUMAN;.;.	A	78	ENSP00000428896:S78A;ENSP00000430103:S78A;ENSP00000359270:S78A;ENSP00000430175:S78A;ENSP00000210633:S78A	ENSP00000210633:S78A	S	+	1	0	SEMA4G	102722983	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	3.900000	0.56295	1.935000	0.56089	0.477000	0.44152	TCT	SEMA4G	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000095539		0.607	SEMA4G-002	KNOWN	basic	protein_coding	SEMA4G	HGNC	protein_coding	OTTHUMT00000049920.2	42	0.00	0	T			102732993	102732993	+1	no_errors	ENST00000210633	ensembl	human	known	69_37n	missense	25	48.98	24	SNP	1.000	G
SPRYD4	283377	genome.wustl.edu	37	12	56862936	56862936	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A14O-01A-31D-A10Y-09	TCGA-E2-A14O-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d6ab6f8d-0e65-40a3-bf98-7249e4075395	3315cbc2-91d3-407d-b030-0d20dc9f4aff	g.chr12:56862936A>C	ENST00000338146.5	+	2	274	c.199A>C	c.(199-201)Aat>Cat	p.N67H	MIP_ENST00000555551.1_5'UTR	NM_207344.3	NP_997227	Q8WW59	SPRY4_HUMAN	SPRY domain containing 4	67	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					mitochondrion (GO:0005739)|nucleus (GO:0005634)				kidney(1)|large_intestine(3)|lung(1)|ovary(1)|prostate(1)	7						GGTGGCCTTGAATGTGGAGCG	0.567																																						dbGAP											0													59.0	61.0	60.0					12																	56862936		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL832247	CCDS8920.1	12q13.3	2006-03-09				ENSG00000176422			27468	protein-coding gene	gene with protein product							Standard	NM_207344		Approved	DKFZp686N0877	uc001sli.4	Q8WW59		ENST00000338146.5:c.199A>C	12.37:g.56862936A>C	ENSP00000338034:p.Asn67His		A8K7A5	Missense_Mutation	SNP	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	p.N67H	ENST00000338146.5	37	c.199	CCDS8920.1	12	.	.	.	.	.	.	.	.	.	.	A	24.8	4.575080	0.86542	.	.	ENSG00000176422	ENST00000338146	T	0.61274	0.12	5.46	5.46	0.80206	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);	0.083573	0.85682	D	0.000000	T	0.69557	0.3124	L	0.49126	1.545	0.54753	D	0.999989	D	0.89917	1.0	D	0.68192	0.956	T	0.70063	-0.4975	10	0.48119	T	0.1	-18.5582	14.8255	0.70107	1.0:0.0:0.0:0.0	.	67	Q8WW59	SPRY4_HUMAN	H	67	ENSP00000338034:N67H	ENSP00000338034:N67H	N	+	1	0	SPRYD4	55149203	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.528000	0.60580	2.208000	0.71279	0.459000	0.35465	AAT	SPRYD4	-	superfamily_ConA-like_lec_gl,pfscan_B30.2/SPRY	ENSG00000176422		0.567	SPRYD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRYD4	HGNC	protein_coding		23	0.00	0	A	NM_207344		56862936	56862936	+1	no_errors	ENST00000338146	ensembl	human	known	69_37n	missense	35	33.96	18	SNP	1.000	C
STMN4	81551	genome.wustl.edu	37	8	27098633	27098633	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14O-01A-31D-A10Y-09	TCGA-E2-A14O-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d6ab6f8d-0e65-40a3-bf98-7249e4075395	3315cbc2-91d3-407d-b030-0d20dc9f4aff	g.chr8:27098633G>A	ENST00000265770.7	-	4	392	c.256C>T	c.(256-258)Cgg>Tgg	p.R86W	STMN4_ENST00000522908.1_Missense_Mutation_p.R113W|STMN4_ENST00000519997.1_Missense_Mutation_p.R77W|STMN4_ENST00000350889.4_Missense_Mutation_p.R113W|STMN4_ENST00000519614.1_Missense_Mutation_p.R86W|STMN4_ENST00000523048.1_Missense_Mutation_p.R113W			Q9H169	STMN4_HUMAN	stathmin-like 4	86	SLD. {ECO:0000255|PROSITE- ProRule:PRU00998}.				regulation of microtubule polymerization or depolymerization (GO:0031110)	cell projection (GO:0042995)|Golgi apparatus (GO:0005794)				endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)	11		Ovarian(32;0.00167)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0214)|Epithelial(17;9.82e-10)|Colorectal(74;0.142)	Lomustine(DB01206)	GGGTCTCGCCGCCTTGGCAGG	0.552																																						dbGAP											0													103.0	93.0	96.0					8																	27098633		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6055.1, CCDS64851.1, CCDS64852.1, CCDS64854.1	8p21.2	2006-12-09			ENSG00000015592	ENSG00000015592			16078	protein-coding gene	gene with protein product						11230166	Standard	NM_001283054		Approved	RB3	uc003xfj.3	Q9H169	OTTHUMG00000099461	ENST00000265770.7:c.256C>T	8.37:g.27098633G>A	ENSP00000265770:p.Arg86Trp		B7Z2Z7|B7Z4I9|D3DSS8|D3DSS9|G5EA16|Q2TAB9	Missense_Mutation	SNP	pfam_Stathmin,superfamily_Stathmin,pirsf_Stathmin,prints_Stathmin	p.R113W	ENST00000265770.7	37	c.337		8	.	.	.	.	.	.	.	.	.	.	G	21.0	4.086049	0.76642	.	.	ENSG00000015592	ENST00000350889;ENST00000519997;ENST00000265770;ENST00000523048;ENST00000519614;ENST00000522908	.	.	.	5.71	0.414	0.16406	.	0.104154	0.64402	D	0.000003	T	0.76737	0.4029	M	0.75264	2.295	0.48571	D	0.999678	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;P;D	0.77557	0.987;0.984;0.979;0.99;0.889;0.979	T	0.79640	-0.1719	9	0.87932	D	0	-11.9454	15.5961	0.76583	0.0:0.0:0.3341:0.6659	.	113;77;113;86;86;113	E7EVN3;B7Z2Z7;G5EA16;E5RIR6;Q9H169;Q9H169-2	.;.;.;.;STMN4_HUMAN;.	W	113;77;86;113;86;113	.	ENSP00000265770:R86W	R	-	1	2	STMN4	27154550	0.998000	0.40836	0.499000	0.27577	0.985000	0.73830	1.393000	0.34497	0.042000	0.15717	0.462000	0.41574	CGG	STMN4	-	pfam_Stathmin,superfamily_Stathmin,pirsf_Stathmin,prints_Stathmin	ENSG00000015592		0.552	STMN4-006	KNOWN	basic|appris_principal	protein_coding	STMN4	HGNC	protein_coding	OTTHUMT00000375941.1	127	0.00	0	G	NM_030795		27098633	27098633	-1	no_errors	ENST00000350889	ensembl	human	known	69_37n	missense	212	21.19	57	SNP	1.000	A
SYT12	91683	genome.wustl.edu	37	11	66811295	66811295	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A14O-01A-31D-A10Y-09	TCGA-E2-A14O-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d6ab6f8d-0e65-40a3-bf98-7249e4075395	3315cbc2-91d3-407d-b030-0d20dc9f4aff	g.chr11:66811295G>T	ENST00000393946.2	+	8	1970	c.808G>T	c.(808-810)Ggc>Tgc	p.G270C	SYT12_ENST00000525457.1_Missense_Mutation_p.G270C|SYT12_ENST00000527043.1_Missense_Mutation_p.G270C			Q8IV01	SYT12_HUMAN	synaptotagmin XII	270	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.					cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|synapse (GO:0045202)				NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|urinary_tract(1)	20						GCCCTTCAGTGGCTGGCTCTA	0.547																																					Ovarian(65;2862 3307)	dbGAP											0													87.0	66.0	73.0					11																	66811295		2200	4295	6495	-	-	-	SO:0001583	missense	0			AK024280	CCDS8154.1	11q13.2	2014-07-02			ENSG00000173227	ENSG00000173227		"""Synaptotagmins"""	18381	protein-coding gene	gene with protein product		606436				8987811	Standard	NM_177963		Approved	SRG1	uc001oju.3	Q8IV01	OTTHUMG00000167101	ENST00000393946.2:c.808G>T	11.37:g.66811295G>T	ENSP00000377520:p.Gly270Cys			Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.G270C	ENST00000393946.2	37	c.808	CCDS8154.1	11	.	.	.	.	.	.	.	.	.	.	G	16.43	3.120505	0.56613	.	.	ENSG00000173227	ENST00000393946;ENST00000525457;ENST00000527043	T;T;T	0.72282	-0.64;-0.64;-0.64	5.27	4.36	0.52297	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.133642	0.51477	D	0.000100	T	0.57169	0.2035	L	0.29908	0.895	0.37424	D	0.913745	D	0.57571	0.98	B	0.43701	0.428	T	0.61426	-0.7065	10	0.39692	T	0.17	.	7.9068	0.29767	0.184:0.0:0.816:0.0	.	270	Q8IV01	SYT12_HUMAN	C	270	ENSP00000377520:G270C;ENSP00000431400:G270C;ENSP00000435316:G270C	ENSP00000377520:G270C	G	+	1	0	SYT12	66567871	1.000000	0.71417	0.918000	0.36340	0.841000	0.47740	5.709000	0.68384	1.228000	0.43614	0.462000	0.41574	GGC	SYT12	-	superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep	ENSG00000173227		0.547	SYT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT12	HGNC	protein_coding	OTTHUMT00000393129.1	71	0.00	0	G	NM_177963		66811295	66811295	+1	no_errors	ENST00000393946	ensembl	human	known	69_37n	missense	352	12.22	49	SNP	0.998	T
TANC2	26115	genome.wustl.edu	37	17	61498828	61498828	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A14O-01A-31D-A10Y-09	TCGA-E2-A14O-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d6ab6f8d-0e65-40a3-bf98-7249e4075395	3315cbc2-91d3-407d-b030-0d20dc9f4aff	g.chr17:61498828A>G	ENST00000424789.2	+	25	5489	c.5485A>G	c.(5485-5487)Act>Gct	p.T1829A	RP11-269G24.3_ENST00000583552.1_RNA|TANC2_ENST00000389520.4_Missense_Mutation_p.T1839A	NM_025185.3	NP_079461.2	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2	1829					in utero embryonic development (GO:0001701)					breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|upper_aerodigestive_tract(3)	44						AGTGTCTCCAACTCAAGGAGG	0.542																																						dbGAP											0													81.0	86.0	84.0					17																	61498828		2104	4209	6313	-	-	-	SO:0001583	missense	0			AB032974	CCDS45754.1	17q23.3	2013-01-11				ENSG00000170921		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30212	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	615047					Standard	NM_025185		Approved	DKFZP564D166, FLJ10215, FLJ11824, KIAA1148, KIAA1636, rols, ROLSA	uc002jal.4	Q9HCD6		ENST00000424789.2:c.5485A>G	17.37:g.61498828A>G	ENSP00000387593:p.Thr1829Ala		Q9HAC3|Q9NW88|Q9NXY9|Q9ULS2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_TPR_repeat,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_Ankyrin_rpt	p.T1829A	ENST00000424789.2	37	c.5485	CCDS45754.1	17	.	.	.	.	.	.	.	.	.	.	A	9.748	1.166830	0.21621	.	.	ENSG00000170921	ENST00000389520;ENST00000424789	T;T	0.65364	-0.15;-0.15	5.74	5.74	0.90152	.	0.125206	0.56097	D	0.000032	T	0.44265	0.1285	N	0.08118	0	0.36469	D	0.867138	B	0.21905	0.062	B	0.21708	0.036	T	0.50154	-0.8861	10	0.41790	T	0.15	.	14.901	0.70678	1.0:0.0:0.0:0.0	.	1829	Q9HCD6	TANC2_HUMAN	A	1839;1829	ENSP00000374171:T1839A;ENSP00000387593:T1829A	ENSP00000374171:T1839A	T	+	1	0	TANC2	58852560	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	2.732000	0.47352	2.317000	0.78254	0.459000	0.35465	ACT	TANC2	-	NULL	ENSG00000170921		0.542	TANC2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TANC2	HGNC	protein_coding	OTTHUMT00000444765.1	85	0.00	0	A			61498828	61498828	+1	no_errors	ENST00000424789	ensembl	human	known	69_37n	missense	111	40.84	78	SNP	1.000	G
TBL3	10607	genome.wustl.edu	37	16	2027601	2027601	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14O-01A-31D-A10Y-09	TCGA-E2-A14O-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d6ab6f8d-0e65-40a3-bf98-7249e4075395	3315cbc2-91d3-407d-b030-0d20dc9f4aff	g.chr16:2027601G>A	ENST00000568546.1	+	17	1957	c.1829G>A	c.(1828-1830)gGg>gAg	p.G610E		NM_006453.2	NP_006444.2	Q12788	TBL3_HUMAN	transducin (beta)-like 3	610					G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|intracellular signal transduction (GO:0035556)|rRNA processing (GO:0006364)	nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)|receptor signaling protein activity (GO:0005057)			breast(1)|endometrium(2)|kidney(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	18						AAGGTCTGGGGGCTGCACTGC	0.642																																					Melanoma(118;616 1651 35077 38081 48633)	dbGAP											0													35.0	30.0	31.0					16																	2027601		2185	4287	6472	-	-	-	SO:0001583	missense	0			U02609	CCDS10453.1	16p13.3	2013-01-10			ENSG00000183751	ENSG00000183751		"""WD repeat domain containing"""	11587	protein-coding gene	gene with protein product		605915				8307582	Standard	NM_006453		Approved	SAZD, UTP13	uc002cnu.1	Q12788	OTTHUMG00000128710	ENST00000568546.1:c.1829G>A	16.37:g.2027601G>A	ENSP00000454836:p.Gly610Glu		Q59GD6|Q8IVB7|Q96A78	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_SSU_processome_Utp13,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.G610E	ENST00000568546.1	37	c.1829	CCDS10453.1	16	.	.	.	.	.	.	.	.	.	.	G	20.3	3.966374	0.74131	.	.	ENSG00000183751	ENST00000332704	.	.	.	5.54	5.54	0.83059	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.77658	0.4163	M	0.83603	2.65	0.80722	D	1	P;D	0.56287	0.67;0.975	P;P	0.55260	0.516;0.772	T	0.80955	-0.1151	9	0.66056	D	0.02	-35.6844	18.4479	0.90691	0.0:0.0:1.0:0.0	.	372;610	A0JLS5;Q12788	.;TBL3_HUMAN	E	610	.	ENSP00000331815:G610E	G	+	2	0	TBL3	1967602	1.000000	0.71417	0.960000	0.40013	0.829000	0.46940	6.378000	0.73150	2.601000	0.87937	0.561000	0.74099	GGG	TBL3	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000183751		0.642	TBL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBL3	HGNC	protein_coding	OTTHUMT00000250615.3	37	0.00	0	G	NM_006453		2027601	2027601	+1	no_errors	ENST00000568546	ensembl	human	known	69_37n	missense	34	48.48	32	SNP	1.000	A
TRIP10	9322	genome.wustl.edu	37	19	6750615	6750615	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A14O-01A-31D-A10Y-09	TCGA-E2-A14O-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d6ab6f8d-0e65-40a3-bf98-7249e4075395	3315cbc2-91d3-407d-b030-0d20dc9f4aff	g.chr19:6750615G>T	ENST00000313244.9	+	14	1663	c.1628G>T	c.(1627-1629)gGt>gTt	p.G543V	CTD-3128G10.6_ENST00000594056.1_RNA|TRIP10_ENST00000313285.8_Missense_Mutation_p.G487V|TRIP10_ENST00000600428.1_Missense_Mutation_p.G379V|TRIP10_ENST00000596758.1_Missense_Mutation_p.G487V			Q15642	CIP4_HUMAN	thyroid hormone receptor interactor 10	543	Interaction with DNM1 and WASL.|Interaction with PDE6G. {ECO:0000250}.|Required for interaction with FASLG and localization to lysosomes.|Required for podosome formation.|SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin cytoskeleton organization (GO:0030036)|cell communication (GO:0007154)|endocytosis (GO:0006897)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			NS(1)|breast(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	16						TCCCCCATAGGTCACTGTGTG	0.542																																						dbGAP											0													90.0	75.0	80.0					19																	6750615		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB072596	CCDS12172.1, CCDS74271.1, CCDS74272.1	19p13.3	2008-02-05			ENSG00000125733	ENSG00000125733			12304	protein-coding gene	gene with protein product	"""Cdc42-interacting protein"""	604504	"""salt tolerator"""	STOT		7776974, 9210375, 11294612	Standard	XM_005259683		Approved	STP, HSTP, CIP4	uc002mfr.3	Q15642	OTTHUMG00000150255	ENST00000313244.9:c.1628G>T	19.37:g.6750615G>T	ENSP00000320117:p.Gly543Val		B2R8A6|B7WP22|D6W645|O15184|Q53G22|Q5TZN1|Q6FI24|Q8NFL1|Q8TCY1|Q8TDX3|Q96RJ1	Missense_Mutation	SNP	pfam_FCH,pfam_SH3_domain,superfamily_SH3_domain,smart_FCH,smart_SH3_domain,pfscan_FCH,pfscan_SH3_domain	p.G543V	ENST00000313244.9	37	c.1628		19	.	.	.	.	.	.	.	.	.	.	G	18.37	3.608987	0.66558	.	.	ENSG00000125733	ENST00000313285;ENST00000313244;ENST00000420690	D;D	0.83163	-1.69;-1.69	4.78	4.78	0.61160	Src homology-3 domain (2);	0.136110	0.49305	D	0.000146	D	0.88448	0.6439	L	0.49571	1.57	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.997;1.0	D	0.89477	0.3747	10	0.87932	D	0	-19.6874	15.361	0.74475	0.0:0.0:1.0:0.0	.	487;543;487	G5E9U1;Q15642;Q15642-2	.;CIP4_HUMAN;.	V	487;543;487	ENSP00000320493:G487V;ENSP00000320117:G543V	ENSP00000320117:G543V	G	+	2	0	TRIP10	6701615	1.000000	0.71417	0.972000	0.41901	0.509000	0.34042	8.274000	0.89889	2.477000	0.83638	0.313000	0.20887	GGT	TRIP10	-	superfamily_SH3_domain,smart_SH3_domain	ENSG00000125733		0.542	TRIP10-003	KNOWN	basic	protein_coding	TRIP10	HGNC	protein_coding	OTTHUMT00000317129.2	68	0.00	0	G			6750615	6750615	+1	no_errors	ENST00000313244	ensembl	human	known	69_37n	missense	79	31.30	36	SNP	1.000	T
ZNF705G	100131980	genome.wustl.edu	37	8	7217792	7217792	+	Nonsense_Mutation	SNP	C	C	A			TCGA-E2-A14O-01A-31D-A10Y-09	TCGA-E2-A14O-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d6ab6f8d-0e65-40a3-bf98-7249e4075395	3315cbc2-91d3-407d-b030-0d20dc9f4aff	g.chr8:7217792C>A	ENST00000400156.4	-	5	483	c.202G>T	c.(202-204)Gaa>Taa	p.E68*	ZNF705G_ENST00000400078.2_Nonsense_Mutation_p.E68*			A8MUZ8	Z705G_HUMAN	zinc finger protein 705G	68	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E68K(2)		lung(9)	9						ACTCTTCCTTCCCTCCACAGC	0.403																																						dbGAP											2	Substitution - Missense(2)	lung(2)											57.0	84.0	76.0					8																	7217792		671	1590	2261	-	-	-	SO:0001587	stop_gained	0				CCDS47773.1	8p23.1	2013-01-08			ENSG00000215372	ENSG00000215372		"""Zinc fingers, C2H2-type"", ""-"""	37134	protein-coding gene	gene with protein product							Standard	NM_001164457		Approved		uc022are.1	A8MUZ8	OTTHUMG00000165384	ENST00000400156.4:c.202G>T	8.37:g.7217792C>A	ENSP00000383020:p.Glu68*			Nonsense_Mutation	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E68*	ENST00000400156.4	37	c.202		8	.	.	.	.	.	.	.	.	.	.	C	11.13	1.548085	0.27652	.	.	ENSG00000215372	ENST00000400156;ENST00000400078	.	.	.	0.803	0.803	0.18691	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11182	T	0.66	.	5.0761	0.14632	0.0:1.0:0.0:0.0	.	.	.	.	X	68	.	ENSP00000445477:E68X	E	-	1	0	ZNF705G	7205202	0.009000	0.17119	0.158000	0.22627	0.010000	0.07245	1.176000	0.31957	0.788000	0.33755	0.121000	0.15741	GAA	ZNF705G	-	pfscan_Krueppel-associated_box	ENSG00000215372		0.403	ZNF705G-001	KNOWN	basic|appris_principal	protein_coding	ZNF705G	HGNC	protein_coding	OTTHUMT00000383776.1	294	0.00	0	C	XM_001720517		7217792	7217792	-1	no_errors	ENST00000400078	ensembl	human	known	69_37n	nonsense	434	33.23	216	SNP	0.514	A
