#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AAK1	22848	genome.wustl.edu	37	2	69870164	69870166	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	CTT	CTT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr2:69870164_69870166delCTT	ENST00000409085.4	-	2	383_385	c.7_9delAAG	c.(7-9)aagdel	p.K3del	AAK1_ENST00000406297.3_In_Frame_Del_p.K3del|AAK1_ENST00000409068.1_In_Frame_Del_p.K3del	NM_014911.3	NP_055726	Q2M2I8	AAK1_HUMAN	AP2 associated kinase 1	3					endocytosis (GO:0006897)|positive regulation of Notch signaling pathway (GO:0045747)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of clathrin-mediated endocytosis (GO:2000369)|regulation of protein localization (GO:0032880)	cell leading edge (GO:0031252)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extrinsic component of plasma membrane (GO:0019897)|terminal bouton (GO:0043195)	AP-2 adaptor complex binding (GO:0035612)|ATP binding (GO:0005524)|Notch binding (GO:0005112)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)	17						AGTCGAAAAACTTCTTCATCTTG	0.498																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AB028971	CCDS1893.2	2p13.3	2012-07-10			ENSG00000115977	ENSG00000115977			19679	protein-coding gene	gene with protein product						11877461, 12471243	Standard	NM_014911		Approved	KIAA1048, DKFZp686K16132	uc002sfp.2	Q2M2I8	OTTHUMG00000129648	ENST00000409085.4:c.7_9delAAG	2.37:g.69870167_69870169delCTT	ENSP00000386456:p.Lys3del		Q4ZFZ3|Q53RX6|Q9UPV4	In_Frame_Del	DEL	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.K3in_frame_del	ENST00000409085.4	37	c.9_7	CCDS1893.2	2																																																																																			AAK1	-	NULL	ENSG00000115977		0.498	AAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AAK1	HGNC	protein_coding	OTTHUMT00000251847.4	29	0.00	0	CTT	NM_014911		69870164	69870166	-1	no_errors	ENST00000409085	ensembl	human	known	69_37n	in_frame_del	27	25.00	9	DEL	1.000:1.000:1.000	-
ADAM2	2515	genome.wustl.edu	37	8	39695672	39695672	+	Silent	SNP	G	G	A			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr8:39695672G>A	ENST00000265708.4	-	1	136	c.33C>T	c.(31-33)ctC>ctT	p.L11L	ADAM2_ENST00000379853.2_Silent_p.L11L|ADAM2_ENST00000347580.4_Silent_p.L11L|ADAM2_ENST00000521880.1_Silent_p.L11L|ADAM2_ENST00000523181.1_5'UTR	NM_001464.3	NP_001455.3	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2	11					adult behavior (GO:0030534)|binding of sperm to zona pellucida (GO:0007339)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|visual learning (GO:0008542)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(29)|ovary(3)|prostate(1)|skin(5)|urinary_tract(1)	53		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		GCAGCCCGCCGAGCCCGCTGA	0.572																																						dbGAP											0													79.0	79.0	79.0					8																	39695672		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U52370	CCDS34884.1, CCDS64882.1, CCDS64883.1	8p11.2	2009-03-25	2008-07-31		ENSG00000104755	ENSG00000104755		"""ADAM metallopeptidase domain containing"""	198	protein-coding gene	gene with protein product	"""cancer/testis antigen 15"""	601533	"""fertilin beta"""	FTNB		8702389, 9070941	Standard	NM_001278113		Approved	PH-30b, PH30, CT15	uc003xnj.4	Q99965	OTTHUMG00000164041	ENST00000265708.4:c.33C>T	8.37:g.39695672G>A			P78326|Q9UQQ8	Silent	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.L11	ENST00000265708.4	37	c.33	CCDS34884.1	8																																																																																			ADAM2	-	NULL	ENSG00000104755		0.572	ADAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM2	HGNC	protein_coding	OTTHUMT00000376926.1	220	0.00	0	G	NM_001464		39695672	39695672	-1	no_errors	ENST00000265708	ensembl	human	known	69_37n	silent	98	28.78	40	SNP	0.073	A
AGAP2	116986	genome.wustl.edu	37	12	58125611	58125611	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr12:58125611C>A	ENST00000547588.1	-	8	1933	c.1934G>T	c.(1933-1935)cGc>cTc	p.R645L	AGAP2_ENST00000257897.3_Missense_Mutation_p.R309L	NM_001122772.2	NP_001116244.1	Q99490	AGAP2_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 2	645					axon guidance (GO:0007411)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|large_intestine(7)|lung(20)|prostate(3)|skin(1)|stomach(1)	48						GCTGGTCCTGCGCTTGGCTGC	0.627																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF413077	CCDS8951.1, CCDS44932.1	12q13.2	2013-05-30	2008-09-22	2008-09-22	ENSG00000135439	ENSG00000135439		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16921	protein-coding gene	gene with protein product		605476	"""centaurin, gamma 1"""	CENTG1			Standard	NM_001122772		Approved		uc001spq.3	Q99490	OTTHUMG00000170285	ENST00000547588.1:c.1934G>T	12.37:g.58125611C>A	ENSP00000449241:p.Arg645Leu		A8K9F7|O00578|Q548E0|Q8IWU3	Missense_Mutation	SNP	pfam_ArfGAP,pfam_MIRO-like,pfam_Small_GTPase,pfam_Ankyrin_rpt,pfam_Pleckstrin_homology,superfamily_ArfGAP,superfamily_Ankyrin_rpt-contain_dom,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Pleckstrin_homology,smart_ArfGAP,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP,prints_Small_GTPase	p.R645L	ENST00000547588.1	37	c.1934	CCDS44932.1	12	.	.	.	.	.	.	.	.	.	.	C	28.4	4.917161	0.92249	.	.	ENSG00000135439	ENST00000257897;ENST00000547588;ENST00000549129	T;T	0.39787	1.16;1.06	4.63	4.63	0.57726	.	0.132957	0.45867	D	0.000334	T	0.62036	0.2395	M	0.64997	1.995	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.998	D;D;D	0.81914	0.995;0.978;0.965	T	0.64309	-0.6438	10	0.59425	D	0.04	.	16.778	0.85556	0.0:1.0:0.0:0.0	.	309;645;645	Q99490-2;F8VVT9;Q99490	.;.;AGAP2_HUMAN	L	309;645;1	ENSP00000257897:R309L;ENSP00000449241:R645L	ENSP00000257897:R309L	R	-	2	0	AGAP2	56411878	1.000000	0.71417	0.986000	0.45419	0.970000	0.65996	6.418000	0.73341	2.571000	0.86741	0.561000	0.74099	CGC	AGAP2	-	NULL	ENSG00000135439		0.627	AGAP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AGAP2	HGNC	protein_coding	OTTHUMT00000408367.1	50	0.00	0	C	NM_014770		58125611	58125611	-1	no_errors	ENST00000547588	ensembl	human	known	69_37n	missense	29	25.64	10	SNP	0.999	A
AKR1CL1	340811	genome.wustl.edu	37	10	5200861	5200861	+	IGR	SNP	C	C	A	rs2020172	byFrequency	TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr10:5200861C>A	ENST00000334314.3	-	0	492				AKR1CL1_ENST00000465430.1_Intron			Q5T2L2	AKCL1_HUMAN	aldo-keto reductase family 1, member C-like 1							cytoplasm (GO:0005737)	oxidoreductase activity (GO:0016491)			cervix(1)|endometrium(1)|large_intestine(2)|lung(2)	6						CTTGGACTTGCAGAACTCCAG	0.448													C|||	864	0.172524	0.1732	0.183	5008	,	,		17338	0.0		0.3579	False		,,,				2504	0.1513				Ovarian(129;1623 1737 25446 28757 47467)	dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0					10p15.2	2014-05-06			ENSG00000196326	ENSG00000264006			23469	protein-coding gene	gene with protein product						15164054	Standard	NR_027916		Approved		uc009xhz.2	Q5T2L2	OTTHUMG00000184213		10.37:g.5200861C>A			A6NF66|Q6ZN81	Missense_Mutation	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_Aldo/keto_reductase_subgr	p.C34F	ENST00000334314.3	37	c.101		10	440	0.20146520146520147	99	0.20121951219512196	81	0.22375690607734808	0	0.0	260	0.34300791556728233	C	19.60	3.858582	0.71834	.	.	ENSG00000196326	ENST00000473890	T	0.28454	1.61	3.73	3.73	0.42828	.	0.000000	0.64402	U	0.000012	T	0.00012	0.0000	.	.	.	0.09310	P	1.0	.	.	.	.	.	.	T	0.31752	-0.9932	6	0.87932	D	0	.	13.7685	0.63010	0.0:1.0:0.0:0.0	rs2020172;rs2020172	.	.	.	F	34	ENSP00000417959:C34F	ENSP00000417959:C34F	C	-	2	0	AKR1CL1	5190861	1.000000	0.71417	0.989000	0.46669	0.951000	0.60555	3.694000	0.54742	2.014000	0.59158	0.484000	0.47621	TGC	AKR1CL1	-	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_Aldo/keto_reductase_subgr	ENSG00000196326		0.448	AKR1CL1-201	KNOWN	basic|appris_candidate_longest	protein_coding	AKR1CL1	HGNC	protein_coding		13	0.00	0	C	NR_027916		5200861	5200861	-1	no_errors	ENST00000473890	ensembl	human	novel	69_37n	missense	8	42.86	6	SNP	1.000	A
ARHGAP31	57514	genome.wustl.edu	37	3	119099788	119099788	+	Missense_Mutation	SNP	C	C	A	rs371169065		TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr3:119099788C>A	ENST00000264245.4	+	4	918	c.386C>A	c.(385-387)gCc>gAc	p.A129D		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	129	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						GGCCAACTGGCCCGAATCCAA	0.507																																					Pancreas(7;176 297 5394 51128 51241)	dbGAP											0													93.0	97.0	96.0					3																	119099788		2054	4201	6255	-	-	-	SO:0001583	missense	0				CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.386C>A	3.37:g.119099788C>A	ENSP00000264245:p.Ala129Asp		Q9ULL6	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.A129D	ENST00000264245.4	37	c.386	CCDS43135.1	3	.	.	.	.	.	.	.	.	.	.	C	14.01	2.409107	0.42715	.	.	ENSG00000031081	ENST00000264245;ENST00000543280;ENST00000482743	T;T	0.18657	2.2;2.2	5.38	5.38	0.77491	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.173345	0.40385	N	0.001117	T	0.26085	0.0636	N	0.12471	0.22	0.37540	D	0.918251	D	0.57571	0.98	P	0.61533	0.89	T	0.12243	-1.0555	10	0.35671	T	0.21	.	16.4525	0.83996	0.0:1.0:0.0:0.0	.	129	Q2M1Z3	RHG31_HUMAN	D	129;129;100	ENSP00000264245:A129D;ENSP00000418429:A100D	ENSP00000264245:A129D	A	+	2	0	ARHGAP31	120582478	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.851000	0.39338	2.793000	0.96121	0.655000	0.94253	GCC	ARHGAP31	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000031081		0.507	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP31	HGNC	protein_coding	OTTHUMT00000354942.2	157	0.00	0	C			119099788	119099788	+1	no_errors	ENST00000264245	ensembl	human	known	69_37n	missense	129	20.73	34	SNP	0.999	A
ARHGEF25	115557	genome.wustl.edu	37	12	58010663	58010663	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr12:58010663G>A	ENST00000286494.4	+	15	2189	c.1729G>A	c.(1729-1731)Gaa>Aaa	p.E577K	AC025165.8_ENST00000444467.1_RNA|AC025165.8_ENST00000610219.1_RNA|ARHGEF25_ENST00000477314.1_3'UTR|ARHGEF25_ENST00000333972.7_Missense_Mutation_p.E616K|AC025165.8_ENST00000593846.1_RNA|AC025165.8_ENST00000356672.3_RNA	NM_182947.3	NP_891992	Q86VW2	ARHGP_HUMAN	Rho guanine nucleotide exchange factor (GEF) 25	577						cytosol (GO:0005829)|myofibril (GO:0030016)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	28						CAAGCTGGATGAAGATGAGCT	0.572																																						dbGAP											0													85.0	93.0	90.0					12																	58010663		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8947.1, CCDS44931.1	12q13.3	2011-11-16			ENSG00000240771	ENSG00000240771		"""Rho guanine nucleotide exchange factors"""	30275	protein-coding gene	gene with protein product	"""RAC/CDC42 exchange factor"""	610215				12547822	Standard	NM_182947		Approved	GEFT, p63RhoGEF	uc009zpy.4	Q86VW2	OTTHUMG00000152516	ENST00000286494.4:c.1729G>A	12.37:g.58010663G>A	ENSP00000286494:p.Glu577Lys		A6NJH5|A9CQZ6|F8W7Z4|Q8WV84|Q96E63	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.E616K	ENST00000286494.4	37	c.1846	CCDS8947.1	12	.	.	.	.	.	.	.	.	.	.	g	27.1	4.802130	0.90538	.	.	ENSG00000240771	ENST00000333972;ENST00000286494	T;T	0.53857	0.6;0.73	5.35	5.35	0.76521	.	0.000000	0.39146	N	0.001442	T	0.62696	0.2449	L	0.29908	0.895	0.44711	D	0.997705	D;D	0.67145	0.996;0.993	D;D	0.76071	0.987;0.971	T	0.61247	-0.7101	10	0.41790	T	0.15	.	18.2361	0.89949	0.0:0.0:1.0:0.0	.	616;577	F8W7Z4;Q86VW2	.;ARHGP_HUMAN	K	616;577	ENSP00000335560:E616K;ENSP00000286494:E577K	ENSP00000286494:E577K	E	+	1	0	ARHGEF25	56296930	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.442000	0.66575	2.677000	0.91161	0.563000	0.77884	GAA	ARHGEF25	-	NULL	ENSG00000240771		0.572	ARHGEF25-001	KNOWN	basic|CCDS	protein_coding	ARHGEF25	HGNC	protein_coding	OTTHUMT00000326561.1	272	0.00	0	G	NM_133483		58010663	58010663	+1	no_errors	ENST00000333972	ensembl	human	known	69_37n	missense	223	21.75	62	SNP	1.000	A
ASZ1	136991	genome.wustl.edu	37	7	117021097	117021097	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr7:117021097G>C	ENST00000284629.2	-	9	975	c.913C>G	c.(913-915)Ctt>Gtt	p.L305V		NM_130768.2	NP_570124.1			ankyrin repeat, SAM and basic leucine zipper domain containing 1											breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(3)|skin(1)	24	Lung NSC(10;0.00156)|all_lung(10;0.00175)		STAD - Stomach adenocarcinoma(10;0.000512)			ATGGTCAAAAGATGTCTTAAC	0.313																																						dbGAP											0													154.0	162.0	160.0					7																	117021097		2202	4296	6498	-	-	-	SO:0001583	missense	0			AF461259	CCDS5772.1	7q31.2	2013-01-10	2005-03-15	2004-07-16	ENSG00000154438	ENSG00000154438		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	1350	protein-coding gene	gene with protein product		605797	"""ankyrin-like 1"""	C7orf7, ANKL1		12040005, 11279520	Standard	NM_130768		Approved	Orf3, GASZ, ALP1, CT1.19	uc003vjb.2	Q8WWH4	OTTHUMG00000064565	ENST00000284629.2:c.913C>G	7.37:g.117021097G>C	ENSP00000284629:p.Leu305Val			Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SAM_2,pfam_SAM_type1,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.L305V	ENST00000284629.2	37	c.913	CCDS5772.1	7	.	.	.	.	.	.	.	.	.	.	G	20.2	3.943866	0.73672	.	.	ENSG00000154438	ENST00000284629	D	0.88354	-2.37	5.57	5.57	0.84162	Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 2 (1);	0.000000	0.85682	D	0.000000	D	0.94042	0.8091	M	0.74258	2.255	0.58432	D	0.999994	D;D	0.76494	0.997;0.999	D;D	0.72338	0.958;0.977	D	0.94271	0.7511	10	0.87932	D	0	-10.2374	16.8356	0.85956	0.0:0.0:1.0:0.0	.	305;305	B7ZM20;Q8WWH4	.;ASZ1_HUMAN	V	305	ENSP00000284629:L305V	ENSP00000284629:L305V	L	-	1	0	ASZ1	116808333	1.000000	0.71417	0.998000	0.56505	0.912000	0.54170	6.154000	0.71826	2.785000	0.95823	0.655000	0.94253	CTT	ASZ1	-	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed	ENSG00000154438		0.313	ASZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASZ1	HGNC	protein_coding	OTTHUMT00000138907.7	244	0.00	0	G	NM_130768		117021097	117021097	-1	no_errors	ENST00000284629	ensembl	human	known	69_37n	missense	237	13.19	36	SNP	0.998	C
BIRC8	112401	genome.wustl.edu	37	19	53793014	53793014	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr19:53793014C>T	ENST00000426466.1	-	1	1861	c.614G>A	c.(613-615)gGa>gAa	p.G205E		NM_033341.4	NP_203127.3	Q96P09	BIRC8_HUMAN	baculoviral IAP repeat containing 8	205					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(10)|urinary_tract(1)	19				GBM - Glioblastoma multiforme(134;0.00304)		GACCAGATGTCCACAAGGAAT	0.428																																						dbGAP											0													127.0	126.0	127.0					19																	53793014		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF164682	CCDS12863.1	19q13.3-q13.4	2011-01-25	2011-01-25			ENSG00000163098		"""Baculoviral IAP repeat containing"""	14878	protein-coding gene	gene with protein product	"""IAP-like protein 2"", ""inhibitor of apoptosis-like protein 2"""		"""baculoviral IAP repeat-containing 8"""			11390657	Standard	NM_033341		Approved	ILP-2, hILP2	uc002qbk.3	Q96P09		ENST00000426466.1:c.614G>A	19.37:g.53793014C>T	ENSP00000412957:p.Gly205Glu		Q6IPY1|Q96RW5	Missense_Mutation	SNP	pfam_BIR,smart_BIR,smart_Znf_RING,pfscan_BIR,pfscan_Znf_RING	p.G205E	ENST00000426466.1	37	c.614	CCDS12863.1	19	.	.	.	.	.	.	.	.	.	.	C	15.91	2.971450	0.53614	.	.	ENSG00000163098	ENST00000426466	D	0.81996	-1.56	0.502	0.502	0.16932	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	.	.	.	.	D	0.92061	0.7484	H	0.96111	3.77	0.51767	D	0.999931	D	0.89917	1.0	D	0.91635	0.999	D	0.90088	0.4175	9	0.87932	D	0	-14.4329	6.9506	0.24542	0.0:0.9999:0.0:1.0E-4	.	205	Q96P09	BIRC8_HUMAN	E	205	ENSP00000412957:G205E	ENSP00000412957:G205E	G	-	2	0	BIRC8	58484826	0.963000	0.33076	0.798000	0.32154	0.138000	0.21146	2.406000	0.44557	0.578000	0.29487	0.420000	0.28162	GGA	BIRC8	-	smart_Znf_RING,pfscan_Znf_RING	ENSG00000163098		0.428	BIRC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIRC8	HGNC	protein_coding	OTTHUMT00000464357.1	221	0.45	1	C	NM_033341		53793014	53793014	-1	no_errors	ENST00000426466	ensembl	human	known	69_37n	missense	161	26.48	58	SNP	1.000	T
C1orf94	84970	genome.wustl.edu	37	1	34663261	34663261	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr1:34663261G>T	ENST00000488417.1	+	2	876	c.756G>T	c.(754-756)aaG>aaT	p.K252N	C1orf94_ENST00000373374.3_Missense_Mutation_p.K62N	NM_001134734.1	NP_001128206.1	Q6P1W5	CA094_HUMAN	chromosome 1 open reading frame 94	252										central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(15)|skin(4)|upper_aerodigestive_tract(2)	32		Myeloproliferative disorder(586;0.0393)				AGACATCCAAGGTCCCTGACA	0.567																																						dbGAP											0													89.0	79.0	82.0					1																	34663261		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK123355	CCDS381.1, CCDS44108.1	1p34.3	2012-06-26			ENSG00000142698	ENSG00000142698			28250	protein-coding gene	gene with protein product						12477932	Standard	NM_001134734		Approved	MGC15882	uc001bxt.3	Q6P1W5	OTTHUMG00000004012	ENST00000488417.1:c.756G>T	1.37:g.34663261G>T	ENSP00000435634:p.Lys252Asn		B3KVT1|D3DPR3|E9PJ76|Q96IC8	Missense_Mutation	SNP	NULL	p.K252N	ENST00000488417.1	37	c.756	CCDS44108.1	1	.	.	.	.	.	.	.	.	.	.	G	11.93	1.786558	0.31593	.	.	ENSG00000142698	ENST00000373374;ENST00000488417	T;T	0.38077	1.16;1.16	4.88	3.0	0.34707	.	0.097784	0.44688	D	0.000423	T	0.50701	0.1631	L	0.59436	1.845	0.34312	D	0.68554	D	0.89917	1.0	D	0.87578	0.998	T	0.61182	-0.7114	10	0.87932	D	0	-3.0403	7.1552	0.25632	0.2077:0.0:0.7923:0.0	.	252	Q6P1W5	CA094_HUMAN	N	62;252	ENSP00000362472:K62N;ENSP00000435634:K252N	ENSP00000362472:K62N	K	+	3	2	C1orf94	34435848	0.976000	0.34144	0.528000	0.27938	0.011000	0.07611	1.563000	0.36364	0.467000	0.27218	0.563000	0.77884	AAG	C1orf94	-	NULL	ENSG00000142698		0.567	C1orf94-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf94	HGNC	protein_coding	OTTHUMT00000036845.2	77	0.00	0	G	NM_032884		34663261	34663261	+1	no_errors	ENST00000488417	ensembl	human	known	69_37n	missense	26	55.17	32	SNP	0.997	T
CACNA1E	777	genome.wustl.edu	37	1	181684488	181684488	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr1:181684488G>T	ENST00000367573.2	+	9	1186	c.1186G>T	c.(1186-1188)Gct>Tct	p.A396S	CACNA1E_ENST00000357570.5_Missense_Mutation_p.A347S|CACNA1E_ENST00000367570.1_Missense_Mutation_p.A396S|CACNA1E_ENST00000526775.1_Missense_Mutation_p.A396S|CACNA1E_ENST00000358338.5_Missense_Mutation_p.A347S|CACNA1E_ENST00000360108.3_Missense_Mutation_p.A396S|CACNA1E_ENST00000367567.4_Missense_Mutation_p.A3S	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	396					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						AGTCATGCTCGCTGAAGAAAA	0.398																																						dbGAP											0													52.0	50.0	51.0					1																	181684488		1846	4103	5949	-	-	-	SO:0001583	missense	0			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.1186G>T	1.37:g.181684488G>T	ENSP00000356545:p.Ala396Ser		B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_HAND_2,prints_VDCCAlpha1,prints_VDCC_R_a1su	p.A396S	ENST00000367573.2	37	c.1186	CCDS55664.1	1	.	.	.	.	.	.	.	.	.	.	G	36	5.615161	0.96649	.	.	ENSG00000198216	ENST00000524607;ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D;D	0.97114	-3.2;-3.2;-3.2;-3.2;-3.2;-4.25;-3.2;-3.2	5.16	5.16	0.70880	.	1.957170	0.02650	N	0.106313	D	0.98507	0.9502	L	0.58925	1.835	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.81914	0.995;0.995	D	0.91772	0.5428	10	0.72032	D	0.01	.	18.6139	0.91295	0.0:0.0:1.0:0.0	.	396;396	Q15878-2;Q15878-3	.;.	S	396;396;396;347;347;3;396;396	ENSP00000432038:A396S;ENSP00000356542:A396S;ENSP00000434814:A396S;ENSP00000350183:A347S;ENSP00000351101:A347S;ENSP00000356539:A3S;ENSP00000353222:A396S;ENSP00000356545:A396S	ENSP00000350183:A347S	A	+	1	0	CACNA1E	179951111	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.730000	0.74780	2.567000	0.86603	0.655000	0.94253	GCT	CACNA1E	-	NULL	ENSG00000198216		0.398	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	HGNC	protein_coding	OTTHUMT00000090793.2	169	0.00	0	G	NM_000721		181684488	181684488	+1	no_errors	ENST00000367573	ensembl	human	known	69_37n	missense	240	13.36	37	SNP	1.000	T
CATSPERD	257062	genome.wustl.edu	37	19	5776305	5776305	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr19:5776305C>T	ENST00000381624.3	+	21	2136	c.2075C>T	c.(2074-2076)tCg>tTg	p.S692L	CATSPERD_ENST00000309164.7_3'UTR	NM_152784.3	NP_689997.3	Q86XM0	CTSRD_HUMAN	catsper channel auxiliary subunit delta	692					multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)											TTCTACATTTCGATCGTGGAT	0.587																																						dbGAP											0													86.0	85.0	86.0					19																	5776305		1925	4126	6051	-	-	-	SO:0001583	missense	0			BC043005	CCDS12149.2	19p13.3	2013-10-11	2012-02-22	2012-02-22	ENSG00000174898	ENSG00000174898			28598	protein-coding gene	gene with protein product			"""transmembrane protein 146"""	TMEM146		21224844	Standard	NM_152784		Approved	MGC39581	uc002mda.3	Q86XM0	OTTHUMG00000143036	ENST00000381624.3:c.2075C>T	19.37:g.5776305C>T	ENSP00000371037:p.Ser692Leu		Q6ZRP1	Missense_Mutation	SNP	superfamily_WD40_repeat_dom	p.S692L	ENST00000381624.3	37	c.2075	CCDS12149.2	19	.	.	.	.	.	.	.	.	.	.	C	12.55	1.970305	0.34754	.	.	ENSG00000174898	ENST00000381624;ENST00000381613;ENST00000448307	T	0.26373	1.74	3.97	2.9	0.33743	.	1.475740	0.04639	N	0.405053	T	0.30039	0.0752	L	0.52573	1.65	0.09310	N	0.999993	D	0.57899	0.981	P	0.44518	0.452	T	0.25950	-1.0117	10	0.56958	D	0.05	-10.4036	8.9424	0.35738	0.2222:0.7778:0.0:0.0	.	692	Q86XM0	TM146_HUMAN	L	692;361;61	ENSP00000371037:S692L	ENSP00000371026:S361L	S	+	2	0	TMEM146	5727305	0.002000	0.14202	0.001000	0.08648	0.059000	0.15707	0.994000	0.29693	0.994000	0.38892	0.313000	0.20887	TCG	CATSPERD	-	NULL	ENSG00000174898		0.587	CATSPERD-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	CATSPERD	HGNC	protein_coding	OTTHUMT00000286953.2	129	0.00	0	C	NM_152784		5776305	5776305	+1	no_errors	ENST00000381624	ensembl	human	known	69_37n	missense	110	15.38	20	SNP	0.002	T
CCDC172	374355	genome.wustl.edu	37	10	118117417	118117417	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr10:118117417G>T	ENST00000333254.3	+	7	871	c.620G>T	c.(619-621)aGt>aTt	p.S207I		NM_198515.2	NP_940917.1	P0C7W6	CC172_HUMAN	coiled-coil domain containing 172	207																	ATAAAAATCAGTGAAAAGCCT	0.279																																						dbGAP											0													48.0	50.0	49.0					10																	118117417		2199	4282	6481	-	-	-	SO:0001583	missense	0			BC044830	CCDS31291.1	10q26.11-q26.12	2012-05-31	2012-05-31	2012-05-31	ENSG00000182645	ENSG00000182645			30524	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 96"""	C10orf96		12477932	Standard	NM_198515		Approved	MGC35062	uc001lck.3	P0C7W6	OTTHUMG00000019098	ENST00000333254.3:c.620G>T	10.37:g.118117417G>T	ENSP00000329860:p.Ser207Ile			Missense_Mutation	SNP	NULL	p.S207I	ENST00000333254.3	37	c.620	CCDS31291.1	10	.	.	.	.	.	.	.	.	.	.	G	3.730	-0.055800	0.07362	.	.	ENSG00000182645	ENST00000333254	.	.	.	5.71	-11.4	0.00090	.	0.848184	0.10522	N	0.664842	T	0.34483	0.0899	L	0.38175	1.15	0.09310	N	1	B	0.10296	0.003	B	0.12156	0.007	T	0.38308	-0.9667	9	0.59425	D	0.04	-5.7778	18.3698	0.90403	0.0929:0.0894:0.7476:0.0701	.	207	P0C7W6	CJ096_HUMAN	I	207	.	ENSP00000329860:S207I	S	+	2	0	C10orf96	118107407	0.000000	0.05858	0.007000	0.13788	0.380000	0.30137	-1.820000	0.01714	-3.067000	0.00255	-2.173000	0.00322	AGT	CCDC172	-	NULL	ENSG00000182645		0.279	CCDC172-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC172	HGNC	protein_coding	OTTHUMT00000050516.2	210	0.00	0	G	NM_198515		118117417	118117417	+1	no_errors	ENST00000333254	ensembl	human	known	69_37n	missense	153	11.56	20	SNP	0.004	T
CDCA7L	55536	genome.wustl.edu	37	7	21946010	21946010	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr7:21946010C>T	ENST00000406877.3	-	6	1097	c.818G>A	c.(817-819)cGg>cAg	p.R273Q	CDCA7L_ENST00000465490.1_5'UTR|CDCA7L_ENST00000373934.4_Missense_Mutation_p.R227Q|CDCA7L_ENST00000356195.5_Missense_Mutation_p.R239Q	NM_018719.4	NP_061189.2	Q96GN5	CDA7L_HUMAN	cell division cycle associated 7-like	273					positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(8)|prostate(2)|skin(1)|urinary_tract(1)	29						CCGCGCACTCCGGGTTGGGTT	0.527																																						dbGAP											0													95.0	106.0	102.0					7																	21946010		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5374.1, CCDS47558.1, CCDS47559.1	7p15.3	2007-04-27			ENSG00000164649	ENSG00000164649			30777	protein-coding gene	gene with protein product		609685				16829576	Standard	NM_018719		Approved	RAM2, R1, JPO2	uc010kuk.3	Q96GN5	OTTHUMG00000128429	ENST00000406877.3:c.818G>A	7.37:g.21946010C>T	ENSP00000383986:p.Arg273Gln		A4D141|A6NF50|B3KTR5|B4DUT3|C9K0Y1|Q6PIL4|Q86YT0|Q8IXN5|Q96C70|Q9H9A2|Q9NPV2	Missense_Mutation	SNP	pfam_Znf-4CXXC_R1	p.R273Q	ENST00000406877.3	37	c.818	CCDS5374.1	7	.	.	.	.	.	.	.	.	.	.	C	29.0	4.971204	0.92919	.	.	ENSG00000164649	ENST00000356195;ENST00000406877;ENST00000373934	T;T;T	0.61274	0.17;0.14;0.12	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.79879	0.4522	M	0.83953	2.67	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.996;0.998	T	0.81529	-0.0891	10	0.87932	D	0	.	20.0953	0.97838	0.0:1.0:0.0:0.0	.	227;273;272	C9K0Y1;Q96GN5;Q96GN5-2	.;CDA7L_HUMAN;.	Q	239;273;227	ENSP00000348523:R239Q;ENSP00000383986:R273Q;ENSP00000363045:R227Q	ENSP00000348523:R239Q	R	-	2	0	CDCA7L	21912535	1.000000	0.71417	0.985000	0.45067	0.335000	0.28730	6.573000	0.74009	2.767000	0.95098	0.655000	0.94253	CGG	CDCA7L	-	NULL	ENSG00000164649		0.527	CDCA7L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCA7L	HGNC	protein_coding	OTTHUMT00000250218.4	84	0.00	0	C	NM_018719		21946010	21946010	-1	no_errors	ENST00000406877	ensembl	human	known	69_37n	missense	86	20.72	23	SNP	1.000	T
CDH9	1007	genome.wustl.edu	37	5	26885845	26885845	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr5:26885845C>T	ENST00000231021.4	-	11	1932	c.1760G>A	c.(1759-1761)cGt>cAt	p.R587H		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	587	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						GGCACACACACGGATAGTGAG	0.483																																					Melanoma(8;187 585 15745 40864 52829)	dbGAP											0													88.0	71.0	77.0					5																	26885845		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.1760G>A	5.37:g.26885845C>T	ENSP00000231021:p.Arg587His		Q3B7I5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R587H	ENST00000231021.4	37	c.1760	CCDS3893.1	5	.	.	.	.	.	.	.	.	.	.	C	18.46	3.628043	0.66901	.	.	ENSG00000113100	ENST00000231021	T	0.51574	0.7	5.89	5.02	0.67125	Cadherin (4);Cadherin-like (1);	0.051284	0.85682	D	0.000000	T	0.63827	0.2544	M	0.69463	2.115	0.49213	D	0.999768	D;D	0.76494	0.999;0.999	D;D	0.74348	0.964;0.983	T	0.62497	-0.6842	9	.	.	.	.	11.8729	0.52531	0.0:0.8673:0.0:0.1327	.	180;587	B4DFP0;Q9ULB4	.;CADH9_HUMAN	H	587	ENSP00000231021:R587H	.	R	-	2	0	CDH9	26921602	1.000000	0.71417	0.247000	0.24249	0.765000	0.43378	4.932000	0.63476	2.797000	0.96272	0.563000	0.77884	CGT	CDH9	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000113100		0.483	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH9	HGNC	protein_coding	OTTHUMT00000207352.1	95	0.00	0	C	NM_016279		26885845	26885845	-1	no_errors	ENST00000231021	ensembl	human	known	69_37n	missense	53	40.45	36	SNP	0.993	T
CFH	3075	genome.wustl.edu	37	1	196694377	196694377	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr1:196694377C>A	ENST00000367429.4	+	12	2063	c.1823C>A	c.(1822-1824)tCc>tAc	p.S608Y		NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H	608	Sushi 10. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						GGACCTAATTCCGTTCAGTGC	0.383																																						dbGAP											0													119.0	108.0	112.0					1																	196694377		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.1823C>A	1.37:g.196694377C>A	ENSP00000356399:p.Ser608Tyr		A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.S608Y	ENST00000367429.4	37	c.1823	CCDS1385.1	1	.	.	.	.	.	.	.	.	.	.	C	11.24	1.580093	0.28180	.	.	ENSG00000000971	ENST00000367429	T	0.64803	-0.12	6.04	4.17	0.49024	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.77350	0.4117	M	0.80616	2.505	0.21933	N	0.999465	D	0.89917	1.0	D	0.75020	0.985	T	0.66184	-0.5987	9	0.48119	T	0.1	.	9.5912	0.39548	0.0:0.838:0.0:0.162	.	608	P08603	CFAH_HUMAN	Y	608	ENSP00000356399:S608Y	ENSP00000356399:S608Y	S	+	2	0	CFH	194961000	0.365000	0.25006	0.080000	0.20451	0.017000	0.09413	1.808000	0.38912	0.880000	0.35969	-0.142000	0.14014	TCC	CFH	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000000971		0.383	CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFH	HGNC	protein_coding	OTTHUMT00000086412.2	178	0.00	0	C	NM_000186		196694377	196694377	+1	no_errors	ENST00000367429	ensembl	human	known	69_37n	missense	222	14.56	38	SNP	0.020	A
CHGB	1114	genome.wustl.edu	37	20	5903673	5903673	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr20:5903673C>G	ENST00000378961.4	+	4	1087	c.883C>G	c.(883-885)Caa>Gaa	p.Q295E		NM_001819.2	NP_001810.2	P05060	SCG1_HUMAN	chromogranin B (secretogranin 1)	295						extracellular region (GO:0005576)|secretory granule (GO:0030141)	hormone activity (GO:0005179)			breast(7)|kidney(2)|large_intestine(8)|lung(19)|ovary(1)|pancreas(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	47						CAGGTCCTCTCAAGGAGGGAG	0.582																																						dbGAP											0													26.0	27.0	27.0					20																	5903673		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13092.1	20p12.3	2013-09-19			ENSG00000089199	ENSG00000089199			1930	protein-coding gene	gene with protein product	"""secretogranin B"""	118920		SCG1		3608978	Standard	NM_001819		Approved		uc002wmg.3	P05060	OTTHUMG00000031821	ENST00000378961.4:c.883C>G	20.37:g.5903673C>G	ENSP00000368244:p.Gln295Glu		A8K021|Q59EU9|Q6IBS6|Q9BQV6|Q9UC25|Q9UJA6	Missense_Mutation	SNP	pfam_Granin,prints_Chromogranin_AB	p.Q295E	ENST00000378961.4	37	c.883	CCDS13092.1	20	.	.	.	.	.	.	.	.	.	.	C	5.375	0.254379	0.10185	.	.	ENSG00000089199	ENST00000378961;ENST00000455042	T;T	0.01613	4.73;4.73	4.58	2.5	0.30297	.	0.879417	0.09680	N	0.769941	T	0.01800	0.0057	L	0.45137	1.4	0.22648	N	0.998894	B	0.13594	0.008	B	0.19946	0.027	T	0.49995	-0.8879	10	0.05620	T	0.96	-6.2126	6.7907	0.23697	0.0:0.4923:0.3922:0.1155	.	295	P05060	SCG1_HUMAN	E	295;275	ENSP00000368244:Q295E;ENSP00000416643:Q275E	ENSP00000368244:Q295E	Q	+	1	0	CHGB	5851673	0.966000	0.33281	0.909000	0.35828	0.518000	0.34316	2.098000	0.41757	1.114000	0.41781	0.563000	0.77884	CAA	CHGB	-	pfam_Granin	ENSG00000089199		0.582	CHGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHGB	HGNC	protein_coding	OTTHUMT00000077897.2	73	0.00	0	C	NM_001819		5903673	5903673	+1	no_errors	ENST00000378961	ensembl	human	known	69_37n	missense	105	13.82	17	SNP	0.997	G
CYB5R2	51700	genome.wustl.edu	37	11	7689777	7689777	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr11:7689777C>G	ENST00000533558.1	-	6	960	c.404G>C	c.(403-405)aGa>aCa	p.R135T	CYB5R2_ENST00000299498.6_Missense_Mutation_p.R135T|CYB5R2_ENST00000299497.9_Missense_Mutation_p.R135T|CYB5R2_ENST00000524790.1_Missense_Mutation_p.R135T|CYB5R2_ENST00000528585.1_5'UTR			Q6BCY4	NB5R2_HUMAN	cytochrome b5 reductase 2	135					oxidation-reduction process (GO:0055114)|sterol biosynthetic process (GO:0016126)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)	11				Epithelial(150;5.48e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CTGGTCTGGTCTGATTCCAAG	0.498																																						dbGAP											0													184.0	176.0	178.0					11																	7689777		2201	4296	6497	-	-	-	SO:0001583	missense	0			AF169802	CCDS7780.1	11p15.4	2014-08-12			ENSG00000166394	ENSG00000166394	1.6.2.2		24376	protein-coding gene	gene with protein product		608342				10611283	Standard	XM_005252973		Approved		uc001mfm.3	Q6BCY4	OTTHUMG00000165665	ENST00000533558.1:c.404G>C	11.37:g.7689777C>G	ENSP00000437041:p.Arg135Thr		Q9BVA3|Q9UF68|Q9UHJ0	Missense_Mutation	SNP	pfam_OxRdtase_FAD-bd_dom,pfam_OxRdtase_FAD/NAD-bd,superfamily_Riboflavin_synthase-like_b-brl,prints_NADH-Cyt_B5_reductase,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase	p.R135T	ENST00000533558.1	37	c.404	CCDS7780.1	11	.	.	.	.	.	.	.	.	.	.	C	14.49	2.550057	0.45383	.	.	ENSG00000166394	ENST00000524790;ENST00000299498;ENST00000533558;ENST00000299497;ENST00000531096;ENST00000527542	D;D;D;D;D;D	0.87179	-1.99;-2.22;-2.22;-1.99;-1.7;-1.51	5.5	-5.3	0.02738	.	0.570626	0.19011	N	0.125075	T	0.77738	0.4175	L	0.42581	1.335	0.34842	D	0.740732	B	0.28801	0.223	B	0.29862	0.108	T	0.63107	-0.6711	10	0.62326	D	0.03	-0.2349	7.9468	0.29991	0.1032:0.3921:0.0:0.5047	.	135	Q6BCY4	NB5R2_HUMAN	T	135	ENSP00000435916:R135T;ENSP00000299498:R135T;ENSP00000437041:R135T;ENSP00000299497:R135T;ENSP00000434969:R135T;ENSP00000433856:R135T	ENSP00000299497:R135T	R	-	2	0	CYB5R2	7646353	0.982000	0.34865	0.001000	0.08648	0.115000	0.19883	0.476000	0.22180	-0.853000	0.04136	-0.150000	0.13652	AGA	CYB5R2	-	NULL	ENSG00000166394		0.498	CYB5R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYB5R2	HGNC	protein_coding	OTTHUMT00000385679.1	347	0.00	0	C	NM_016229		7689777	7689777	-1	no_errors	ENST00000299498	ensembl	human	known	69_37n	missense	299	16.85	61	SNP	0.890	G
DGKQ	1609	genome.wustl.edu	37	4	955823	955823	+	Silent	SNP	C	C	G			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr4:955823C>G	ENST00000273814.3	-	19	2335	c.2262G>C	c.(2260-2262)ctG>ctC	p.L754L	DGKQ_ENST00000502309.1_5'Flank	NM_001347.3	NP_001338.2	P52824	DGKQ_HUMAN	diacylglycerol kinase, theta 110kDa	754					blood coagulation (GO:0007596)|cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|protein kinase C signaling (GO:0070528)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to ATP (GO:0033198)|thrombin receptor signaling pathway (GO:0070493)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|phospholipase binding (GO:0043274)			breast(1)|endometrium(2)|kidney(2)|lung(2)|prostate(2)	9			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			AGTCCAGGCTCAGCTCCGCGT	0.637																																					Esophageal Squamous(17;537 645 4447 26373)	dbGAP											0													127.0	120.0	122.0					4																	955823		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L38707	CCDS3342.1	4p16.3	2008-08-29	2002-08-29		ENSG00000145214	ENSG00000145214			2856	protein-coding gene	gene with protein product		601207	"""diacylglycerol kinase, theta (110kD)"""	DAGK4		8617502, 9099683	Standard	NM_001347		Approved	DAGK, DAGK7	uc003gbw.4	P52824	OTTHUMG00000088629	ENST00000273814.3:c.2262G>C	4.37:g.955823C>G			Q6P3W4	Nonstop_Mutation	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Ras-assoc,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ras-assoc,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,pfscan_Ras-assoc,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_DAG/PE-bd	p.*688S	ENST00000273814.3	37	c.2063	CCDS3342.1	4	.	.	.	.	.	.	.	.	.	.	C	10.74	1.435362	0.25813	.	.	ENSG00000145214	ENST00000509465	.	.	.	5.35	-2.13	0.07144	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.9613	0.41697	0.0:0.6334:0.2466:0.1199	.	.	.	.	S	688	.	.	X	-	2	2	DGKQ	945823	0.014000	0.17966	0.947000	0.38551	0.968000	0.65278	-0.496000	0.06436	-0.995000	0.03459	0.556000	0.70494	TGA	DGKQ	-	pfam_Diacylglycerol_kin_accessory,smart_Diacylglycerol_kin_accessory	ENSG00000145214		0.637	DGKQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGKQ	HGNC	protein_coding	OTTHUMT00000200888.1	81	0.00	0	C			955823	955823	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000509465	ensembl	human	novel	69_37n	nonstop	75	12.79	11	SNP	0.989	G
DIRC1	116093	genome.wustl.edu	37	2	189599494	189599494	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr2:189599494C>A	ENST00000308100.4	-	2	424	c.154G>T	c.(154-156)Gct>Tct	p.A52S	AC079613.1_ENST00000431708.1_RNA	NM_052952.2	NP_443184.1	Q969H9	DIRC1_HUMAN	disrupted in renal carcinoma 1	52										large_intestine(1)|lung(6)	7			OV - Ovarian serous cystadenocarcinoma(117;0.00842)|Epithelial(96;0.102)			GTTGCAGCAGCAGAAGAACAA	0.438																																						dbGAP											0													164.0	154.0	157.0					2																	189599494		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY039011	CCDS2296.1	2q33	2008-05-22			ENSG00000174325	ENSG00000174325			15760	protein-coding gene	gene with protein product		606423				11587072	Standard	NM_052952		Approved		uc002uqi.1	Q969H9	OTTHUMG00000132646	ENST00000308100.4:c.154G>T	2.37:g.189599494C>A	ENSP00000307860:p.Ala52Ser		Q08AK1	Missense_Mutation	SNP	NULL	p.A52S	ENST00000308100.4	37	c.154	CCDS2296.1	2	.	.	.	.	.	.	.	.	.	.	C	9.975	1.226533	0.22542	.	.	ENSG00000174325	ENST00000308100	T	0.34072	1.38	3.32	-1.24	0.09435	.	.	.	.	.	T	0.15305	0.0369	N	0.08118	0	0.09310	N	1	P	0.38677	0.642	B	0.35353	0.201	T	0.13818	-1.0495	9	0.87932	D	0	.	3.9685	0.09443	0.0:0.3555:0.38:0.2645	.	52	Q969H9	DIRC1_HUMAN	S	52	ENSP00000307860:A52S	ENSP00000307860:A52S	A	-	1	0	DIRC1	189307739	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.210000	0.17455	-0.274000	0.09232	-0.345000	0.07892	GCT	DIRC1	-	NULL	ENSG00000174325		0.438	DIRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DIRC1	HGNC	protein_coding	OTTHUMT00000255897.2	390	0.76	3	C	NM_052952		189599494	189599494	-1	no_errors	ENST00000308100	ensembl	human	known	69_37n	missense	253	21.43	69	SNP	0.000	A
DISP1	84976	genome.wustl.edu	37	1	223176630	223176630	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr1:223176630C>T	ENST00000284476.6	+	8	2055	c.1891C>T	c.(1891-1893)Cga>Tga	p.R631*		NM_032890.3	NP_116279.2	Q96F81	DISP1_HUMAN	dispatched homolog 1 (Drosophila)	631	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				determination of left/right symmetry (GO:0007368)|diaphragm development (GO:0060539)|dorsal/ventral pattern formation (GO:0009953)|embryonic pattern specification (GO:0009880)|patched ligand maturation (GO:0007225)|peptide transport (GO:0015833)|protein homotrimerization (GO:0070207)|regulation of protein secretion (GO:0050708)|smoothened signaling pathway (GO:0007224)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)|peptide transporter activity (GO:0015197)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(20)|lung(25)|prostate(4)|skin(1)|stomach(1)|urinary_tract(5)	69				GBM - Glioblastoma multiforme(131;0.102)		TACAGCAATCCGATGCTTTGG	0.473																																						dbGAP											0													128.0	117.0	121.0					1																	223176630		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK056569	CCDS1536.1	1q42.12	2008-02-05			ENSG00000154309	ENSG00000154309			19711	protein-coding gene	gene with protein product		607502				10619433	Standard	NM_032890		Approved	DISPA, MGC13130, DKFZP434I0428, MGC16796	uc001hnu.2	Q96F81	OTTHUMG00000037893	ENST00000284476.6:c.1891C>T	1.37:g.223176630C>T	ENSP00000284476:p.Arg631*		Q8N7C2|Q96I92|Q9H698|Q9H8H9|Q9UFA2	Nonsense_Mutation	SNP	pfam_Patched,pfam_MMPL-typ,pfscan_SSD	p.R631*	ENST00000284476.6	37	c.1891	CCDS1536.1	1	.	.	.	.	.	.	.	.	.	.	C	35	5.517647	0.96416	.	.	ENSG00000154309	ENST00000284476	.	.	.	5.91	-9.23	0.00672	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-30.9162	23.6724	0.99985	0.2789:0.7211:0.0:0.0	.	.	.	.	X	631	.	ENSP00000284476:R631X	R	+	1	2	DISP1	221243253	0.822000	0.29219	0.361000	0.25849	0.880000	0.50808	0.514000	0.22786	-1.453000	0.01928	-0.266000	0.10368	CGA	DISP1	-	pfam_Patched,pfam_MMPL-typ,pfscan_SSD	ENSG00000154309		0.473	DISP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	DISP1	HGNC	protein_coding	OTTHUMT00000092512.1	116	0.00	0	C	NM_032890		223176630	223176630	+1	no_errors	ENST00000284476	ensembl	human	known	69_37n	nonsense	121	44.75	98	SNP	0.935	T
DNAH3	55567	genome.wustl.edu	37	16	20976354	20976354	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr16:20976354T>G	ENST00000261383.3	-	53	8851	c.8852A>C	c.(8851-8853)aAg>aCg	p.K2951T	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	2951	Stalk. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		CTCCAAGTCCTTTTTCTTGGT	0.498																																						dbGAP											0													174.0	167.0	169.0					16																	20976354		2201	4300	6501	-	-	-	SO:0001583	missense	0			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.8852A>C	16.37:g.20976354T>G	ENSP00000261383:p.Lys2951Thr		O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_Prefoldin,smart_AAA+_ATPase	p.K2951T	ENST00000261383.3	37	c.8852	CCDS10594.1	16	.	.	.	.	.	.	.	.	.	.	T	0.081	-1.183192	0.01620	.	.	ENSG00000158486	ENST00000261383	T	0.73897	-0.79	5.93	-1.81	0.07882	Dynein heavy chain, coiled coil stalk (1);	0.710478	0.14064	N	0.343836	T	0.61874	0.2382	M	0.64404	1.975	0.36784	D	0.884489	B	0.32753	0.383	B	0.34590	0.186	T	0.52026	-0.8630	10	0.21014	T	0.42	.	1.5651	0.02602	0.4366:0.2698:0.1122:0.1814	.	2951	Q8TD57	DYH3_HUMAN	T	2951	ENSP00000261383:K2951T	ENSP00000261383:K2951T	K	-	2	0	DNAH3	20883855	0.102000	0.21896	0.062000	0.19696	0.003000	0.03518	0.427000	0.21379	-0.360000	0.08138	-0.327000	0.08410	AAG	DNAH3	-	superfamily_Prefoldin	ENSG00000158486		0.498	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	HGNC	protein_coding	OTTHUMT00000207361.1	247	0.00	0	T	NM_017539		20976354	20976354	-1	no_errors	ENST00000261383	ensembl	human	known	69_37n	missense	187	37.25	111	SNP	0.004	G
EFTUD1	79631	genome.wustl.edu	37	15	82450123	82450123	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr15:82450123G>A	ENST00000268206.7	-	17	2129	c.1961C>T	c.(1960-1962)aCg>aTg	p.T654M	EFTUD1_ENST00000359445.3_Missense_Mutation_p.T603M	NM_024580.5	NP_078856.4	Q7Z2Z2	ETUD1_HUMAN	elongation factor Tu GTP binding domain containing 1	654					GTP catabolic process (GO:0006184)|mature ribosome assembly (GO:0042256)		GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ribosome binding (GO:0043022)|translation elongation factor activity (GO:0003746)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(14)|ovary(1)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32						GTGCTCTCCCGTTTCCTGAAT	0.428																																						dbGAP											0													138.0	134.0	135.0					15																	82450123		1908	4124	6032	-	-	-	SO:0001583	missense	0			AK056656	CCDS42070.1, CCDS42071.1	15q25.2	2012-07-04			ENSG00000140598	ENSG00000140598			25789	protein-coding gene	gene with protein product	"""ribosome assembly 1 homolog (yeast)"""					14702039	Standard	NM_024580		Approved	FLJ13119, FAM42A, HsT19294, RIA1	uc002bgt.1	Q7Z2Z2	OTTHUMG00000172573	ENST00000268206.7:c.1961C>T	15.37:g.82450123G>A	ENSP00000268206:p.Thr654Met		A6NKY5|B7Z6I0|Q9H8Z6	Missense_Mutation	SNP	pfam_ProtSyn_GTP-bd,pfam_Transl_elong_EFG/EF2_C,pfam_Transl_elong_EFTu/EF1A_2,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_Elongation_fac_G/III/V,superfamily_Transl_elong_init/rib_B-barrel,smart_Transl_elong_EFG/EF2_C,prints_ProtSyn_GTP-bd,tigrfam_Small_GTP-bd_dom	p.T654M	ENST00000268206.7	37	c.1961	CCDS42071.1	15	.	.	.	.	.	.	.	.	.	.	G	28.7	4.941533	0.92526	.	.	ENSG00000140598	ENST00000268206;ENST00000359445	D;D	0.83673	-1.75;-1.75	5.83	5.83	0.93111	Elongation factor G/III/V (1);	0.000000	0.43747	D	0.000529	D	0.93019	0.7778	M	0.88979	2.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.991	D	0.93514	0.6855	10	0.87932	D	0	-0.1462	20.1123	0.97915	0.0:0.0:1.0:0.0	.	603;654	Q7Z2Z2-2;Q7Z2Z2	.;ETUD1_HUMAN	M	654;603	ENSP00000268206:T654M;ENSP00000352418:T603M	ENSP00000268206:T654M	T	-	2	0	EFTUD1	80237178	1.000000	0.71417	0.907000	0.35723	0.839000	0.47603	9.391000	0.97249	2.742000	0.94016	0.650000	0.86243	ACG	EFTUD1	-	superfamily_Elongation_fac_G/III/V	ENSG00000140598		0.428	EFTUD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EFTUD1	HGNC	protein_coding	OTTHUMT00000419252.1	263	0.00	0	G	NM_024580		82450123	82450123	-1	no_errors	ENST00000268206	ensembl	human	known	69_37n	missense	145	39.08	93	SNP	1.000	A
EHBP1	23301	genome.wustl.edu	37	2	63169992	63169992	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr2:63169992C>G	ENST00000263991.5	+	12	1912	c.1430C>G	c.(1429-1431)tCt>tGt	p.S477C	EHBP1_ENST00000354487.3_Missense_Mutation_p.S442C|EHBP1_ENST00000405289.1_Missense_Mutation_p.S442C|EHBP1_ENST00000431489.1_Missense_Mutation_p.S442C|EHBP1_ENST00000405015.3_Missense_Mutation_p.S442C	NM_015252.3	NP_056067.2	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1	477	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.					cytoplasm (GO:0005737)|membrane (GO:0016020)		p.S477C(1)		biliary_tract(1)|breast(3)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(22)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	47	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			AATGGTTTATCTTTTTGTGCA	0.318																																						dbGAP											1	Substitution - Missense(1)	lung(1)											75.0	78.0	77.0					2																	63169992		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL833968	CCDS1872.1, CCDS46299.1, CCDS46300.1	2p15	2008-02-05			ENSG00000115504	ENSG00000115504			29144	protein-coding gene	gene with protein product		609922				10048485	Standard	NM_015252		Approved	KIAA0903, NACSIN	uc002sby.3	Q8NDI1	OTTHUMG00000129453	ENST00000263991.5:c.1430C>G	2.37:g.63169992C>G	ENSP00000263991:p.Ser477Cys		O94977|Q53TG7|Q53TV6|Q580X2|Q6NX72|Q6PIT3|Q6QNV2|Q9NWI9	Missense_Mutation	SNP	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.S477C	ENST00000263991.5	37	c.1430	CCDS1872.1	2	.	.	.	.	.	.	.	.	.	.	C	25.4	4.629387	0.87660	.	.	ENSG00000115504	ENST00000405015;ENST00000431489;ENST00000263991;ENST00000354487;ENST00000405289	D;D;D;D;D	0.94828	-3.53;-3.53;-3.53;-3.53;-3.53	5.98	5.98	0.97165	Calponin homology domain (5);	0.133602	0.50627	D	0.000107	D	0.95452	0.8523	L	0.34521	1.04	0.51482	D	0.999929	D;P;D	0.55800	0.966;0.912;0.973	P;P;P	0.62184	0.838;0.706;0.899	D	0.95619	0.8679	10	0.87932	D	0	.	20.452	0.99131	0.0:1.0:0.0:0.0	.	442;442;477	Q8NDI1-2;Q8NDI1-3;Q8NDI1	.;.;EHBP1_HUMAN	C	442;442;477;442;442	ENSP00000384143:S442C;ENSP00000403783:S442C;ENSP00000263991:S477C;ENSP00000346482:S442C;ENSP00000385524:S442C	ENSP00000263991:S477C	S	+	2	0	EHBP1	63023496	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.487000	0.81328	2.838000	0.97847	0.591000	0.81541	TCT	EHBP1	-	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000115504		0.318	EHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHBP1	HGNC	protein_coding	OTTHUMT00000251616.1	119	0.00	0	C	NM_015252		63169992	63169992	+1	no_errors	ENST00000263991	ensembl	human	known	69_37n	missense	92	22.03	26	SNP	1.000	G
EIF2S1	1965	genome.wustl.edu	37	14	67847477	67847477	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr14:67847477G>A	ENST00000256383.4	+	5	1036	c.575G>A	c.(574-576)cGa>cAa	p.R192Q	EIF2S1_ENST00000466499.2_Missense_Mutation_p.R192Q	NM_004094.4	NP_004085.1	P05198	IF2A_HUMAN	eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa	192					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|gene expression (GO:0010467)|protein autophosphorylation (GO:0046777)|regulation of translational initiation in response to stress (GO:0043558)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2 complex (GO:0005850)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)	poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|translation initiation factor activity (GO:0003743)			breast(1)|cervix(2)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	9				all cancers(60;0.000683)|OV - Ovarian serous cystadenocarcinoma(108;0.00579)|BRCA - Breast invasive adenocarcinoma(234;0.00937)		GTCAAAATTCGAGCAGGTAAA	0.318																																						dbGAP											0													42.0	45.0	44.0					14																	67847477		2199	4294	6493	-	-	-	SO:0001583	missense	0			J02645	CCDS9781.1	14q21.3	2011-01-07	2002-08-29		ENSG00000134001	ENSG00000134001			3265	protein-coding gene	gene with protein product		603907	"""eukaryotic translation initiation factor 2, subunit 1 (alpha, 35kD )"""	EIF2		2948954	Standard	NM_004094		Approved	EIF-2alpha, EIF2A	uc001xjg.3	P05198	OTTHUMG00000029800	ENST00000256383.4:c.575G>A	14.37:g.67847477G>A	ENSP00000256383:p.Arg192Gln			Missense_Mutation	SNP	pfam_TIF_2_asu,pfam_Rbsml_prot_S1_RNA-bd_dom,superfamily_TIF2_asu_C,superfamily_TIF2_asu_middle,superfamily_NA-bd_OB-fold-like,smart_RNA-binding_domain_S1,pfscan_Rbsml_prot_S1_RNA-bd_dom	p.R192Q	ENST00000256383.4	37	c.575	CCDS9781.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.543371|5.543371	0.96474|0.96474	.|.	.|.	ENSG00000134001|ENSG00000134001	ENST00000555876|ENST00000256383;ENST00000557310;ENST00000466499	.|.	.|.	.|.	5.92|5.92	5.02|5.02	0.67125|0.67125	.|Translation initiation factor 2, alpha subunit, C-terminal (2);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.79429|0.79429	0.4444|0.4444	M|M	0.90814|0.90814	3.15|3.15	0.80722|0.80722	D|D	1|1	.|D	.|0.67145	.|0.996	.|P	.|0.55785	.|0.784	D|D	0.84940|0.84940	0.0865|0.0865	5|9	.|0.87932	.|D	.|0	-0.461|-0.461	16.2123|16.2123	0.82170|0.82170	0.0:0.0:0.8591:0.1409|0.0:0.0:0.8591:0.1409	.|.	.|192	.|P05198	.|IF2A_HUMAN	K|Q	149|192	.|.	.|ENSP00000256383:R192Q	E|R	+|+	1|2	0|0	EIF2S1|EIF2S1	66917230|66917230	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	9.869000|9.869000	0.99810|0.99810	1.466000|1.466000	0.48025|0.48025	0.650000|0.650000	0.86243|0.86243	GAG|CGA	EIF2S1	-	pfam_TIF_2_asu,superfamily_TIF2_asu_C	ENSG00000134001		0.318	EIF2S1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2S1	HGNC	protein_coding	OTTHUMT00000074342.3	103	0.00	0	G	NM_004094		67847477	67847477	+1	no_errors	ENST00000256383	ensembl	human	known	69_37n	missense	53	29.33	22	SNP	1.000	A
ENTPD4	9583	genome.wustl.edu	37	8	23302096	23302096	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr8:23302096G>C	ENST00000358689.4	-	5	671	c.436C>G	c.(436-438)Cca>Gca	p.P146A	ENTPD4_ENST00000356206.6_Missense_Mutation_p.P146A|ENTPD4_ENST00000417069.2_Missense_Mutation_p.P146A	NM_001128930.2|NM_004901.4	NP_001122402.1|NP_004892.1	Q9Y227	ENTP4_HUMAN	ectonucleoside triphosphate diphosphohydrolase 4	146					UDP catabolic process (GO:0006256)	cytoplasmic vesicle (GO:0031410)|integral component of Golgi membrane (GO:0030173)|intracellular membrane-bounded organelle (GO:0043231)	uridine-diphosphatase activity (GO:0045134)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	25		Prostate(55;0.114)		Colorectal(74;0.0161)|COAD - Colon adenocarcinoma(73;0.0649)		ACTTTCTCTGGAGAGGTAGCA	0.398																																						dbGAP											0													97.0	98.0	98.0					8																	23302096		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ131358	CCDS6041.1, CCDS47827.1	8p21.3	2014-05-16	2004-09-22	2004-09-22	ENSG00000197217	ENSG00000197217			14573	protein-coding gene	gene with protein product		607577	"""lysosomal apyrase-like 1"""	LYSAL1		10393803, 9205841	Standard	NM_001128930		Approved	LALP70, LAP70, KIAA0392, NTPDase-4, UDPase	uc003xdl.3	Q9Y227	OTTHUMG00000097852	ENST00000358689.4:c.436C>G	8.37:g.23302096G>C	ENSP00000351520:p.Pro146Ala		D3DSS3|O15092	Missense_Mutation	SNP	pfam_GDA1_CD39_NTPase	p.P146A	ENST00000358689.4	37	c.436	CCDS6041.1	8	.	.	.	.	.	.	.	.	.	.	G	25.7	4.660657	0.88154	.	.	ENSG00000197217	ENST00000356206;ENST00000358689;ENST00000417069;ENST00000518718	T;T;T;T	0.12774	2.65;2.65;2.65;2.65	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.45196	0.1330	M	0.87617	2.895	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.994;0.996;0.993;0.998	T	0.38887	-0.9640	10	0.44086	T	0.13	-13.2082	18.5873	0.91194	0.0:0.0:1.0:0.0	.	146;146;146;146	B4DU21;Q8NE73;Q9Y227-2;Q9Y227	.;.;.;ENTP4_HUMAN	A	146;146;146;112	ENSP00000348536:P146A;ENSP00000351520:P146A;ENSP00000408573:P146A;ENSP00000429455:P112A	ENSP00000348536:P146A	P	-	1	0	ENTPD4	23358041	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.447000	0.97595	2.727000	0.93392	0.563000	0.77884	CCA	ENTPD4	-	pfam_GDA1_CD39_NTPase	ENSG00000197217		0.398	ENTPD4-001	KNOWN	basic|CCDS	protein_coding	ENTPD4	HGNC	protein_coding	OTTHUMT00000215142.1	250	0.00	0	G	NM_004901		23302096	23302096	-1	no_errors	ENST00000358689	ensembl	human	known	69_37n	missense	138	21.35	38	SNP	1.000	C
EXOC2	55770	genome.wustl.edu	37	6	497377	497377	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr6:497377C>G	ENST00000230449.4	-	25	2684	c.2549G>C	c.(2548-2550)gGa>gCa	p.G850A	EXOC2_ENST00000448181.3_Missense_Mutation_p.G445A	NM_018303.5	NP_060773.3	Q96KP1	EXOC2_HUMAN	exocyst complex component 2	850					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|liver(1)|lung(16)|ovary(4)|pancreas(1)|prostate(2)	46	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)		CTGTAAAGCTCCATTTTTGCT	0.363																																						dbGAP											0													102.0	102.0	102.0					6																	497377		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ420556	CCDS34327.1	6p25.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000112685	ENSG00000112685			24968	protein-coding gene	gene with protein product		615329	"""SEC5-like 1 (S. cerevisiae)"""	SEC5L1		12575951, 12459492	Standard	NM_018303		Approved	FLJ11026, Sec5p	uc003mtd.4	Q96KP1	OTTHUMG00000137437	ENST00000230449.4:c.2549G>C	6.37:g.497377C>G	ENSP00000230449:p.Gly850Ala		B2RBE6|Q5JPC8|Q96AN6|Q9NUZ8|Q9UJM7	Missense_Mutation	SNP	pfam_IPT_TIG_rcpt,superfamily_Ig_E-set,superfamily_Cullin_repeat-like_dom	p.G850A	ENST00000230449.4	37	c.2549	CCDS34327.1	6	.	.	.	.	.	.	.	.	.	.	C	17.13	3.311705	0.60414	.	.	ENSG00000112685	ENST00000230449;ENST00000448181	T;T	0.42513	0.97;0.97	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.42337	0.1198	M	0.78049	2.395	0.80722	D	1	P	0.45011	0.848	B	0.42851	0.4	T	0.36286	-0.9754	10	0.34782	T	0.22	-17.8003	20.6244	0.99512	0.0:1.0:0.0:0.0	.	850	Q96KP1	EXOC2_HUMAN	A	850;445	ENSP00000230449:G850A;ENSP00000398113:G445A	ENSP00000230449:G850A	G	-	2	0	EXOC2	442377	1.000000	0.71417	0.971000	0.41717	0.580000	0.36256	7.487000	0.81328	2.879000	0.98667	0.650000	0.86243	GGA	EXOC2	-	NULL	ENSG00000112685		0.363	EXOC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC2	HGNC	protein_coding	OTTHUMT00000039627.1	279	0.00	0	C	NM_018303		497377	497377	-1	no_errors	ENST00000230449	ensembl	human	known	69_37n	missense	177	17.29	37	SNP	1.000	G
KAT7	11143	genome.wustl.edu	37	17	47866424	47866424	+	Intron	DEL	C	C	-			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr17:47866424delC	ENST00000259021.4	+	1	295				KAT7_ENST00000454930.2_Intron|FAM117A_ENST00000514018.1_5'Flank|KAT7_ENST00000510819.1_Intron|KAT7_ENST00000424009.2_Intron|KAT7_ENST00000509773.1_Intron|KAT7_ENST00000503935.2_5'Flank|FAM117A_ENST00000513602.1_5'Flank|KAT7_ENST00000435742.2_5'Flank	NM_007067.4	NP_008998.1	O95251	KAT7_HUMAN	K(lysine) acetyltransferase 7						chromatin organization (GO:0006325)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										CCTCTGCTTGCCTGGATCGGA	0.557																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF074606	CCDS11554.1, CCDS56035.1, CCDS56036.1, CCDS56037.1, CCDS56038.1	17q21.32	2013-01-10	2011-07-21	2011-07-21	ENSG00000136504	ENSG00000136504	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	17016	protein-coding gene	gene with protein product	"""histone acetyltransferase binding to ORC1"""	609880	"""MYST histone acetyltransferase 2"""	MYST2		10438470, 10930412	Standard	NM_001199155		Approved	HBOA, HBO1, ZC2HC7	uc002ipm.3	O95251	OTTHUMG00000161770	ENST00000259021.4:c.15+213C>-	17.37:g.47866424delC			B3KN74|B4DF85|B4DFB4|B4DFE0|B4DGY4|E7ER15|G5E9K7	Splice_Site	DEL	-	NULL	ENST00000259021.4	37	c.NULL	CCDS11554.1	17																																																																																			FAM117A	-	-	ENSG00000121104		0.557	KAT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM117A	HGNC	protein_coding	OTTHUMT00000366032.1	22	0.00	0	C	NM_007067		47866424	47866424	-1	no_errors	ENST00000505159	ensembl	human	known	69_37n	splice_site_del	161	21.74	45	DEL	0.992	-
KAT7	11143	genome.wustl.edu	37	17	47866431	47866431	+	Intron	SNP	C	C	A			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr17:47866431C>A	ENST00000259021.4	+	1	295				KAT7_ENST00000454930.2_Intron|FAM117A_ENST00000514018.1_5'Flank|KAT7_ENST00000510819.1_Intron|KAT7_ENST00000424009.2_Intron|KAT7_ENST00000509773.1_Intron|KAT7_ENST00000503935.2_5'Flank|FAM117A_ENST00000513602.1_5'Flank|KAT7_ENST00000435742.2_5'Flank	NM_007067.4	NP_008998.1	O95251	KAT7_HUMAN	K(lysine) acetyltransferase 7						chromatin organization (GO:0006325)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										TTGCCTGGATCGGAGGCGTTC	0.572																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF074606	CCDS11554.1, CCDS56035.1, CCDS56036.1, CCDS56037.1, CCDS56038.1	17q21.32	2013-01-10	2011-07-21	2011-07-21	ENSG00000136504	ENSG00000136504	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	17016	protein-coding gene	gene with protein product	"""histone acetyltransferase binding to ORC1"""	609880	"""MYST histone acetyltransferase 2"""	MYST2		10438470, 10930412	Standard	NM_001199155		Approved	HBOA, HBO1, ZC2HC7	uc002ipm.3	O95251	OTTHUMG00000161770	ENST00000259021.4:c.15+220C>A	17.37:g.47866431C>A			B3KN74|B4DF85|B4DFB4|B4DFE0|B4DGY4|E7ER15|G5E9K7	RNA	SNP	-	NULL	ENST00000259021.4	37	NULL	CCDS11554.1	17																																																																																			FAM117A	-	-	ENSG00000121104		0.572	KAT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM117A	HGNC	protein_coding	OTTHUMT00000366032.1	20	0.00	0	C	NM_007067		47866431	47866431	-1	no_errors	ENST00000505159	ensembl	human	known	69_37n	rna	144	23.81	45	SNP	0.938	A
FAM58A	92002	genome.wustl.edu	37	X	152853866	152853866	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chrX:152853866G>A	ENST00000406277.2	-	7	800	c.698C>T	c.(697-699)tCt>tTt	p.S233F	FAM58A_ENST00000370175.4_5'UTR	NM_001130997.1|NM_152274.3	NP_001124469.1|NP_689487.2	Q8N1B3	FA58A_HUMAN	family with sequence similarity 58, member A	235					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)					endometrium(2)|kidney(1)|large_intestine(1)|liver(1)|lung(1)	6	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AATGAGATCAGACACAATATT	0.468																																						dbGAP											0													131.0	118.0	122.0					X																	152853866		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC032121	CCDS76054.1	Xq28	2014-08-12	2012-11-30	2012-11-30	ENSG00000147382	ENSG00000262919			28434	protein-coding gene	gene with protein product	"""cyclin M"""	300708				18297069, 24218572	Standard	NM_152274		Approved	MGC29729, FLJ21610	uc011myr.2	Q8N1B3	OTTHUMG00000024206	ENST00000406277.2:c.698C>T	X.37:g.152853866G>A	ENSP00000384396:p.Ser233Phe		Q2I380|Q330J9|Q96IU5|Q9BUU1	Missense_Mutation	SNP	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like	p.S233F	ENST00000406277.2	37	c.698		X	.	.	.	.	.	.	.	.	.	.	G	10.68	1.418781	0.25552	.	.	ENSG00000147382	ENST00000370175;ENST00000406277;ENST00000276345	T	0.33438	1.41	4.43	4.43	0.53597	Cyclin-like (2);	0.199754	0.43919	D	0.000508	T	0.23806	0.0576	L	0.39397	1.21	0.47037	D	0.999298	B;B	0.13594	0.003;0.008	B;B	0.09377	0.003;0.004	T	0.04781	-1.0927	10	0.33141	T	0.24	-13.6489	10.0757	0.42360	0.1042:0.0:0.8958:0.0	.	235;233	Q8N1B3;B5MD73	FA58A_HUMAN;.	F	201;233;233	ENSP00000384396:S233F	ENSP00000276345:S233F	S	-	2	0	FAM58A	152507060	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.082000	0.41605	2.139000	0.66308	0.529000	0.55759	TCT	FAM58A	-	superfamily_Cyclin-like,smart_Cyclin-like	ENSG00000147382		0.468	FAM58A-201	KNOWN	basic|appris_principal	protein_coding	FAM58A	HGNC	protein_coding		382	0.00	0	G	NM_152274		152853866	152853866	-1	no_errors	ENST00000406277	ensembl	human	known	69_37n	missense	273	15.69	51	SNP	1.000	A
GOLGA2P5	55592	genome.wustl.edu	37	12	100562921	100562921	+	RNA	DEL	T	T	-			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr12:100562921delT	ENST00000397112.4	-	0	599					NR_036632.1		Q9HBQ8	GGA2B_HUMAN								Golgi apparatus (GO:0005794)				large_intestine(1)|lung(3)	4						GTCTCATTTGTTTTttttttt	0.403																																						dbGAP											0																																										-	-	-			0																															12.37:g.100562921delT			Q9NSV2	RNA	DEL	-	NULL	ENST00000397112.4	37	NULL		12																																																																																			GOLGA2P5	-	-	ENSG00000238105		0.403	GOLGA2B-004	KNOWN	basic	processed_transcript	GOLGA2P5	HGNC	pseudogene	OTTHUMT00000396439.2	25	0.00	0	T			100562921	100562921	-1	no_errors	ENST00000421840	ensembl	human	known	69_37n	rna	36	10.00	4	DEL	0.000	-
GCN1L1	10985	genome.wustl.edu	37	12	120613011	120613011	+	Silent	SNP	C	C	T			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr12:120613011C>T	ENST00000300648.6	-	12	1059	c.1047G>A	c.(1045-1047)tcG>tcA	p.S349S		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	349					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GTTTTCCTTCCGAGCCTGAGA	0.408																																						dbGAP											0													108.0	101.0	103.0					12																	120613011		1915	4144	6059	-	-	-	SO:0001819	synonymous_variant	0			U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.1047G>A	12.37:g.120613011C>T			A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Silent	SNP	pfam_DUF3554,pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.S349	ENST00000300648.6	37	c.1047	CCDS41847.1	12																																																																																			GCN1L1	-	superfamily_ARM-type_fold	ENSG00000089154		0.408	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCN1L1	HGNC	protein_coding	OTTHUMT00000403592.1	168	0.00	0	C			120613011	120613011	-1	no_errors	ENST00000300648	ensembl	human	known	69_37n	silent	131	17.90	29	SNP	0.051	T
IGSF9	57549	genome.wustl.edu	37	1	159900122	159900122	+	Silent	SNP	G	G	A			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr1:159900122G>A	ENST00000368094.1	-	15	2118	c.1921C>T	c.(1921-1923)Ctg>Ttg	p.L641L	IGSF9_ENST00000361509.3_Silent_p.L625L|IGSF9_ENST00000493195.1_5'UTR	NM_001135050.1	NP_001128522.1	Q9P2J2	TUTLA_HUMAN	immunoglobulin superfamily, member 9	641	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				dendrite development (GO:0016358)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(17)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_hematologic(112;0.0597)	Breast(1374;0.000126)	BRCA - Breast invasive adenocarcinoma(70;0.111)			TCCCAATGCAGGAGTACCCCC	0.672																																						dbGAP											0													76.0	84.0	81.0					1																	159900122		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB037776	CCDS1190.1, CCDS44254.1	1q22-q23	2013-02-11			ENSG00000085552	ENSG00000085552		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	18132	protein-coding gene	gene with protein product		609738				11991715	Standard	NM_020789		Approved	KIAA1355, Nrt1, IGSF9A	uc001fur.2	Q9P2J2	OTTHUMG00000022794	ENST00000368094.1:c.1921C>T	1.37:g.159900122G>A				Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.L641	ENST00000368094.1	37	c.1921	CCDS44254.1	1																																																																																			IGSF9	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000085552		0.672	IGSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF9	HGNC	protein_coding	OTTHUMT00000059115.1	61	0.00	0	G	NM_020789		159900122	159900122	-1	no_errors	ENST00000368094	ensembl	human	known	69_37n	silent	56	16.18	11	SNP	0.770	A
ITLN2	142683	genome.wustl.edu	37	1	160920836	160920836	+	Nonsense_Mutation	SNP	G	G	C			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr1:160920836G>C	ENST00000368029.3	-	4	495	c.438C>G	c.(436-438)taC>taG	p.Y146*	ITLN2_ENST00000494442.1_5'Flank|RP11-544M22.1_ENST00000356006.3_RNA	NM_080878.2	NP_543154.1	Q8WWU7	ITLN2_HUMAN	intelectin 2	146	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.					extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			endometrium(4)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(1)	19	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			CACCAACCTTGTAGTCATCGC	0.602																																						dbGAP											0													209.0	177.0	188.0					1																	160920836		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AY065973	CCDS1212.1	1q22-q23.5	2013-02-06			ENSG00000158764	ENSG00000158764		"""Fibrinogen C domain containing"""	20599	protein-coding gene	gene with protein product		609874				11181563	Standard	NM_080878		Approved	HL-2	uc001fxd.3	Q8WWU7	OTTHUMG00000028605	ENST00000368029.3:c.438C>G	1.37:g.160920836G>C	ENSP00000357008:p.Tyr146*		Q17RR2|Q5VYI0	Nonsense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C	p.Y146*	ENST00000368029.3	37	c.438	CCDS1212.1	1	.	.	.	.	.	.	.	.	.	.	G	16.71	3.199046	0.58126	.	.	ENSG00000158764	ENST00000368029	.	.	.	3.85	3.85	0.44370	.	0.247728	0.26258	U	0.025405	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.2096	13.6108	0.62076	0.0:0.0:1.0:0.0	.	.	.	.	X	146	.	ENSP00000357008:Y146X	Y	-	3	2	ITLN2	159187460	1.000000	0.71417	1.000000	0.80357	0.033000	0.12548	2.219000	0.42899	2.106000	0.64143	0.561000	0.74099	TAC	ITLN2	-	superfamily_Fibrinogen_a/b/g_C	ENSG00000158764		0.602	ITLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITLN2	HGNC	protein_coding	OTTHUMT00000071465.1	219	0.45	1	G	NM_080878		160920836	160920836	-1	no_errors	ENST00000368029	ensembl	human	known	69_37n	nonsense	280	12.73	41	SNP	1.000	C
ITPRIP	85450	genome.wustl.edu	37	10	106075563	106075563	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr10:106075563G>A	ENST00000337478.1	-	2	418	c.247C>T	c.(247-249)Cgc>Tgc	p.R83C	ITPRIP_ENST00000358187.2_Missense_Mutation_p.R83C|RP11-127L20.5_ENST00000472915.2_RNA|ITPRIP_ENST00000278071.2_Missense_Mutation_p.R83C	NM_001272013.1	NP_001258942.1	Q8IWB1	IPRI_HUMAN	inositol 1,4,5-trisphosphate receptor interacting protein	83						membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|large_intestine(5)|liver(1)|lung(9)|upper_aerodigestive_tract(1)	20						CAGGCCACGCGTGTCTCGTTC	0.667																																						dbGAP											0													86.0	80.0	82.0					10																	106075563		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB051541	CCDS7557.1	10q25.1	2011-04-28	2011-04-28	2008-08-11	ENSG00000148841	ENSG00000148841			29370	protein-coding gene	gene with protein product			"""KIAA1754"", ""inositol 1,4,5-triphosphate receptor interacting protein"""	KIAA1754		11214970, 16990268	Standard	NM_001272012		Approved	bA127L20.2, DANGER	uc001kye.4	Q8IWB1	OTTHUMG00000019003	ENST00000337478.1:c.247C>T	10.37:g.106075563G>A	ENSP00000337178:p.Arg83Cys		D3DRA5|Q5JU17|Q96MS8|Q9C0A9	Missense_Mutation	SNP	NULL	p.R83C	ENST00000337478.1	37	c.247	CCDS7557.1	10	.	.	.	.	.	.	.	.	.	.	G	3.378	-0.127029	0.06795	.	.	ENSG00000148841	ENST00000337478;ENST00000278071;ENST00000358187;ENST00000458723	T;T;T	0.23950	1.88;1.88;1.88	5.44	4.53	0.55603	.	0.569773	0.16061	N	0.231480	T	0.19327	0.0464	L	0.44542	1.39	0.09310	N	1	D	0.56968	0.978	B	0.41299	0.353	T	0.15607	-1.0431	10	0.38643	T	0.18	-19.4743	5.329	0.15922	0.1676:0.0:0.6576:0.1747	.	83	Q8IWB1	IPRI_HUMAN	C	83	ENSP00000337178:R83C;ENSP00000278071:R83C;ENSP00000350915:R83C	ENSP00000278071:R83C	R	-	1	0	ITPRIP	106065553	0.001000	0.12720	0.002000	0.10522	0.016000	0.09150	0.917000	0.28665	1.305000	0.44909	0.563000	0.77884	CGC	ITPRIP	-	NULL	ENSG00000148841		0.667	ITPRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPRIP	HGNC	protein_coding	OTTHUMT00000050204.1	24	0.00	0	G	NM_033397		106075563	106075563	-1	no_errors	ENST00000278071	ensembl	human	known	69_37n	missense	24	20.00	6	SNP	0.001	A
KCNJ16	3773	genome.wustl.edu	37	17	68128510	68128510	+	Silent	SNP	C	C	T	rs150792127		TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr17:68128510C>T	ENST00000589377.1	+	2	445	c.282C>T	c.(280-282)ctC>ctT	p.L94L	KCNJ16_ENST00000392670.1_Silent_p.L94L|KCNJ16_ENST00000585558.1_Silent_p.L129L|KCNJ16_ENST00000392671.1_Silent_p.L94L|KCNJ16_ENST00000586462.1_Silent_p.L133L|KCNJ16_ENST00000283936.1_Silent_p.L94L	NM_001270422.1	NP_001257351.1	Q9NPI9	KCJ16_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 16	94					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)			breast(3)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	32	Breast(10;2.96e-09)					TCTTTTGGCTCATAGCCTTTC	0.418																																						dbGAP											0													210.0	187.0	195.0					17																	68128510		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF153815	CCDS11687.1, CCDS74141.1	17q24.3	2011-07-05				ENSG00000153822		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6262	protein-coding gene	gene with protein product		605722				11240146, 16382105	Standard	NM_018658		Approved	Kir5.1, BIR9	uc002jio.4	Q9NPI9		ENST00000589377.1:c.282C>T	17.37:g.68128510C>T				Silent	SNP	pfam_K_chnl_inward-rec_Kir_Cr2,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir5,prints_K_chnl_inward-rec_Kir_Cr2	p.L94	ENST00000589377.1	37	c.282	CCDS11687.1	17																																																																																			KCNJ16	-	pfam_K_chnl_inward-rec_Kir_Cr2,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir_Cr2	ENSG00000153822		0.418	KCNJ16-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ16	HGNC	protein_coding	OTTHUMT00000450880.1	571	0.00	0	C	NM_018658		68128510	68128510	+1	no_errors	ENST00000283936	ensembl	human	known	69_37n	silent	324	24.59	106	SNP	1.000	T
KIAA0319	9856	genome.wustl.edu	37	6	24566862	24566862	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr6:24566862T>C	ENST00000378214.3	-	14	2779	c.2255A>G	c.(2254-2256)tAt>tGt	p.Y752C	KIAA0319_ENST00000537886.1_Missense_Mutation_p.Y752C|KIAA0319_ENST00000543707.1_Missense_Mutation_p.Y752C|KIAA0319_ENST00000430948.2_Missense_Mutation_p.Y707C|KIAA0319_ENST00000535378.1_Missense_Mutation_p.Y743C	NM_001168375.1|NM_014809.3	NP_001161847.1|NP_055624.2	Q5VV43	K0319_HUMAN	KIAA0319	752	PKD 5. {ECO:0000255|PROSITE- ProRule:PRU00151}.				negative regulation of dendrite development (GO:2000171)|neuron migration (GO:0001764)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|endometrium(6)|kidney(3)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	53						GATCCACAGATAGGACACAAT	0.488																																						dbGAP											0													106.0	103.0	104.0					6																	24566862		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002317	CCDS34348.1, CCDS54969.1, CCDS54970.1, CCDS54971.1, CCDS75409.1	6p22.3	2013-12-13			ENSG00000137261	ENSG00000137261			21580	protein-coding gene	gene with protein product	"""neuronal migration"""	609269				9205841, 15514892	Standard	NM_014809		Approved	NMIG	uc003neh.1	Q5VV43	OTTHUMG00000014358	ENST00000378214.3:c.2255A>G	6.37:g.24566862T>C	ENSP00000367459:p.Tyr752Cys		A7MD37|B2RTU7|B4DHA7|B4DK75|B7ZML3|F5H123|Q9UJC8|Q9Y4G7	Missense_Mutation	SNP	pfam_PKD/REJ-like,superfamily_PKD_dom,smart_MANSC_N,smart_Fibronectin_type3,smart_PKD/Chitinase_dom,pfscan_MANSC,pfscan_PKD_dom	p.Y752C	ENST00000378214.3	37	c.2255	CCDS34348.1	6	.	.	.	.	.	.	.	.	.	.	T	15.31	2.794290	0.50102	.	.	ENSG00000137261	ENST00000537886;ENST00000535378;ENST00000430948;ENST00000378214;ENST00000543707	T;T;T;T;T	0.18960	2.18;2.18;2.18;2.18;2.18	4.01	4.01	0.46588	PKD/Chitinase domain (1);Fibronectin, type III (1);PKD domain (2);	0.081885	0.49916	D	0.000136	T	0.47414	0.1444	M	0.93420	3.415	0.42457	D	0.992778	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.63157	-0.6700	10	0.87932	D	0	-6.0619	13.097	0.59197	0.0:0.0:0.0:1.0	.	752;743;752	F5H123;Q5VV43-2;Q5VV43	.;.;K0319_HUMAN	C	752;743;707;752;752	ENSP00000439700:Y752C;ENSP00000442403:Y743C;ENSP00000401086:Y707C;ENSP00000367459:Y752C;ENSP00000437656:Y752C	ENSP00000367459:Y752C	Y	-	2	0	KIAA0319	24674841	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.101000	0.41787	1.671000	0.50874	0.482000	0.46254	TAT	KIAA0319	-	pfam_PKD/REJ-like,superfamily_PKD_dom,smart_Fibronectin_type3,smart_PKD/Chitinase_dom	ENSG00000137261		0.488	KIAA0319-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0319	HGNC	protein_coding	OTTHUMT00000040009.1	128	0.00	0	T	NM_014809		24566862	24566862	-1	no_errors	ENST00000378214	ensembl	human	known	69_37n	missense	134	17.79	29	SNP	1.000	C
LAMA1	284217	genome.wustl.edu	37	18	6942104	6942104	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr18:6942104G>A	ENST00000389658.3	-	63	9295	c.9202C>T	c.(9202-9204)Cat>Tat	p.H3068Y		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	3068	Laminin G-like 5. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				GGACAGGAATGAAGGAAAACT	0.478																																						dbGAP											0													111.0	116.0	114.0					18																	6942104		2203	4300	6503	-	-	-	SO:0001583	missense	0			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.9202C>T	18.37:g.6942104G>A	ENSP00000374309:p.His3068Tyr			Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_B_type_IV,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_II,superfamily_ConA-like_lec_gl,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.H3068Y	ENST00000389658.3	37	c.9202	CCDS32787.1	18	.	.	.	.	.	.	.	.	.	.	G	12.12	1.843123	0.32606	.	.	ENSG00000101680	ENST00000389658	T	0.44083	0.93	5.76	3.88	0.44766	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.247892	0.32836	N	0.005590	T	0.49712	0.1573	M	0.76838	2.35	0.33859	D	0.633572	P;D	0.55605	0.926;0.972	B;P	0.48334	0.218;0.574	T	0.62685	-0.6802	10	0.17369	T	0.5	.	14.595	0.68397	0.0:0.0:0.733:0.267	.	3068;398	P25391;B3KSD8	LAMA1_HUMAN;.	Y	3068	ENSP00000374309:H3068Y	ENSP00000374309:H3068Y	H	-	1	0	LAMA1	6932104	1.000000	0.71417	1.000000	0.80357	0.659000	0.38960	3.902000	0.56310	0.701000	0.31803	0.591000	0.81541	CAT	LAMA1	-	superfamily_ConA-like_lec_gl,pfscan_Laminin_G	ENSG00000101680		0.478	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	HGNC	protein_coding	OTTHUMT00000257369.1	140	0.00	0	G	NM_005559		6942104	6942104	-1	no_errors	ENST00000389658	ensembl	human	known	69_37n	missense	83	24.55	27	SNP	1.000	A
LPL	4023	genome.wustl.edu	37	8	19805748	19805748	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr8:19805748C>T	ENST00000311322.8	+	2	616	c.146C>T	c.(145-147)aCa>aTa	p.T49I	LPL_ENST00000521994.1_3'UTR	NM_000237.2	NP_000228.1	P06858	LIPL_HUMAN	lipoprotein lipase	49					chylomicron remodeling (GO:0034371)|fatty acid biosynthetic process (GO:0006633)|lipoprotein metabolic process (GO:0042157)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of sequestering of triglyceride (GO:0010890)|response to cold (GO:0009409)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|triglyceride metabolic process (GO:0006641)|very-low-density lipoprotein particle remodeling (GO:0034372)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|chylomicron (GO:0042627)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	apolipoprotein binding (GO:0034185)|heparin binding (GO:0008201)|lipoprotein lipase activity (GO:0004465)|phospholipase activity (GO:0004620)|receptor binding (GO:0005102)|triglyceride binding (GO:0017129)|triglyceride lipase activity (GO:0004806)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	36				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	AST-120(DB05269)|Tyloxapol(DB06439)	CCTGAAGACACAGCTGAGGAC	0.468																																						dbGAP											0													146.0	134.0	138.0					8																	19805748		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6012.1	8p22	2012-10-02			ENSG00000175445	ENSG00000175445	3.1.1.34		6677	protein-coding gene	gene with protein product		609708		LIPD			Standard	NM_000237		Approved		uc003wzk.4	P06858	OTTHUMG00000036645	ENST00000311322.8:c.146C>T	8.37:g.19805748C>T	ENSP00000309757:p.Thr49Ile		B2R5T9|Q16282|Q16283|Q96FC4	Missense_Mutation	SNP	pirsf_Lipoprotein_lipase_LIPH,pfam_Lipase_N,pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_LipOase_LH2,pfscan_LipOase_LH2,prints_Lipo_Lipase,prints_Lipase,tigrfam_Lipo_Lipase	p.T49I	ENST00000311322.8	37	c.146	CCDS6012.1	8	.	.	.	.	.	.	.	.	.	.	C	14.65	2.598865	0.46318	.	.	ENSG00000175445	ENST00000524029;ENST00000522701;ENST00000311322;ENST00000535763	D;D;D	0.90844	-2.74;-2.74;-2.74	5.23	3.4	0.38934	Lipase, N-terminal (1);	0.125084	0.37095	N	0.002259	D	0.83959	0.5367	L	0.38953	1.18	0.25126	N	0.99061	B	0.02656	0.0	B	0.15052	0.012	T	0.81508	-0.0901	8	.	.	.	-8.0529	10.5551	0.45112	0.0:0.8291:0.0:0.1709	.	49	P06858	LIPL_HUMAN	I	49;49;49;35	ENSP00000428237:T49I;ENSP00000428557:T49I;ENSP00000309757:T49I	.	T	+	2	0	LPL	19850028	0.994000	0.37717	1.000000	0.80357	0.997000	0.91878	3.993000	0.56987	1.332000	0.45431	0.655000	0.94253	ACA	LPL	-	pirsf_Lipoprotein_lipase_LIPH,pfam_Lipase_N,prints_Lipo_Lipase,tigrfam_Lipo_Lipase	ENSG00000175445		0.468	LPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPL	HGNC	protein_coding	OTTHUMT00000089113.3	249	0.40	1	C			19805748	19805748	+1	no_errors	ENST00000311322	ensembl	human	known	69_37n	missense	164	16.75	33	SNP	1.000	T
MBTD1	54799	genome.wustl.edu	37	17	49270286	49270286	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr17:49270286C>T	ENST00000586178.1	-	15	1890	c.1547G>A	c.(1546-1548)cGa>cAa	p.R516Q	MBTD1_ENST00000415868.1_Missense_Mutation_p.R516Q|MBTD1_ENST00000376381.2_3'UTR	NM_017643.2	NP_060113.2	Q05BQ5	MBTD1_HUMAN	mbt domain containing 1	516					chromatin modification (GO:0016568)|embryonic skeletal system development (GO:0048706)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)			ATGAATAATTCGAGTTACTGT	0.433																																						dbGAP											0													178.0	169.0	172.0					17																	49270286		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000062	CCDS11581.2	17q24.1	2003-01-15			ENSG00000011258	ENSG00000011258			19866	protein-coding gene	gene with protein product							Standard	NM_017643		Approved	SA49P01, FLJ20055	uc002itr.4	Q05BQ5	OTTHUMG00000150442	ENST00000586178.1:c.1547G>A	17.37:g.49270286C>T	ENSP00000468304:p.Arg516Gln		Q6ZVU7|Q9NXU1	Missense_Mutation	SNP	pfam_Mbt,smart_Mbt,pfscan_Mbt,pfscan_Znf_FCS	p.R516Q	ENST00000586178.1	37	c.1547	CCDS11581.2	17	.	.	.	.	.	.	.	.	.	.	C	36	5.832450	0.97003	.	.	ENSG00000011258	ENST00000405860;ENST00000415868	T	0.29655	1.56	5.89	5.89	0.94794	.	0.122741	0.56097	D	0.000037	T	0.32912	0.0845	L	0.41710	1.295	0.80722	D	1	D;P	0.56035	0.974;0.793	B;B	0.43413	0.419;0.15	T	0.03175	-1.1064	10	0.49607	T	0.09	.	20.2435	0.98387	0.0:1.0:0.0:0.0	.	516;352	Q05BQ5;Q05BQ5-3	MBTD1_HUMAN;.	Q	516	ENSP00000403946:R516Q	ENSP00000386072:R516Q	R	-	2	0	MBTD1	46625285	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.040000	0.70980	2.784000	0.95788	0.650000	0.86243	CGA	MBTD1	-	pfam_Mbt,smart_Mbt,pfscan_Mbt	ENSG00000011258		0.433	MBTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBTD1	HGNC	protein_coding	OTTHUMT00000318124.1	272	0.36	1	C			49270286	49270286	-1	no_errors	ENST00000415868	ensembl	human	known	69_37n	missense	343	28.09	134	SNP	1.000	T
MTBP	27085	genome.wustl.edu	37	8	121468800	121468800	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr8:121468800C>G	ENST00000305949.1	+	7	682	c.637C>G	c.(637-639)Cag>Gag	p.Q213E		NM_022045.4	NP_071328.2	Q96DY7	MTBP_HUMAN	MDM2 binding protein	213					cell cycle arrest (GO:0007050)|mitotic spindle checkpoint (GO:0071174)|negative regulation of cell proliferation (GO:0008285)|protein localization to kinetochore (GO:0034501)|traversing start control point of mitotic cell cycle (GO:0007089)	chromatin (GO:0000785)|kinetochore (GO:0000776)				NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	30	Lung NSC(37;5.68e-08)|Ovarian(258;0.00769)|all_neural(195;0.0804)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00503)			TAGAAACTGTCAGAAAATTGC	0.299																																						dbGAP											0													66.0	76.0	73.0					8																	121468800		2203	4292	6495	-	-	-	SO:0001583	missense	0				CCDS6333.1	8q24.1-q24.2	2014-03-03	2014-03-03		ENSG00000172167	ENSG00000172167			7417	protein-coding gene	gene with protein product		605927	"""MDM2 (mouse double minute 2)-binding protein, 104kD"", ""Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104kDa"""			10906133, 11060448	Standard	NM_022045		Approved		uc003ypc.2	Q96DY7	OTTHUMG00000165040	ENST00000305949.1:c.637C>G	8.37:g.121468800C>G	ENSP00000303398:p.Gln213Glu		B4DUR5|Q9HA89	Missense_Mutation	SNP	NULL	p.Q213E	ENST00000305949.1	37	c.637	CCDS6333.1	8	.	.	.	.	.	.	.	.	.	.	C	20.5	4.007902	0.75046	.	.	ENSG00000172167	ENST00000305949	.	.	.	5.56	5.56	0.83823	.	0.154810	0.46758	D	0.000272	T	0.78817	0.4343	M	0.72894	2.215	0.58432	D	0.999998	D	0.67145	0.996	D	0.76071	0.987	T	0.75792	-0.3193	9	0.33940	T	0.23	-13.625	19.5296	0.95223	0.0:1.0:0.0:0.0	.	213	Q96DY7	MTBP_HUMAN	E	213	.	ENSP00000303398:Q213E	Q	+	1	0	MTBP	121537981	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	3.999000	0.57031	2.624000	0.88883	0.453000	0.30009	CAG	MTBP	-	NULL	ENSG00000172167		0.299	MTBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTBP	HGNC	protein_coding	OTTHUMT00000381530.1	202	0.00	0	C	NM_022045		121468800	121468800	+1	no_errors	ENST00000305949	ensembl	human	known	69_37n	missense	135	16.56	27	SNP	1.000	G
NLRC3	197358	genome.wustl.edu	37	16	3611719	3611719	+	RNA	SNP	G	G	A	rs545030726	byFrequency	TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr16:3611719G>A	ENST00000301749.7	-	0	2404				NLRC3_ENST00000419350.2_RNA|NLRC3_ENST00000359128.5_RNA|NLRC3_ENST00000603507.1_RNA|NLRC3_ENST00000324659.8_RNA|NLRC3_ENST00000448023.2_RNA	NM_178844.2	NP_849172.2	Q7RTR2	NLRC3_HUMAN	NLR family, CARD domain containing 3						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of protein ubiquitination (GO:0031396)|response to lipopolysaccharide (GO:0032496)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(16)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						TTCTGAATGCGACAGTCCTTC	0.592																																						dbGAP											0													92.0	102.0	99.0					16																	3611719		2103	4215	6318	-	-	-			0			BK001112	CCDS73817.1	16p13.3	2014-03-25			ENSG00000167984	ENSG00000167984		"""Nucleotide-binding domain and leucine rich repeat containing"""	29889	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 3"", ""NOD-like receptor C3"""	615648				15705585, 12766759	Standard	NM_178844		Approved	CLR16.2, FLJ00348, NOD3	uc010btn.3	Q7RTR2	OTTHUMG00000177561		16.37:g.3611719G>A			Q5EY36|Q8NF48|Q8NI01|Q8NI02|Q8TEL3	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase	p.R714C	ENST00000301749.7	37	c.2140		16	.	.	.	.	.	.	.	.	.	.	G	17.47	3.398049	0.62177	.	.	ENSG00000167984	ENST00000419350;ENST00000301749;ENST00000359128;ENST00000448023	T;T;T	0.54071	0.59;0.59;0.59	5.55	3.57	0.40892	.	0.481828	0.22726	N	0.056399	T	0.44932	0.1317	.	.	.	0.30602	N	0.760454	P	0.35780	0.52	B	0.42522	0.39	T	0.47799	-0.9089	9	0.37606	T	0.19	.	6.3422	0.21328	0.167:0.1506:0.6823:0.0	.	714	C9JLH9	.	C	667;667;667;714	ENSP00000301749:R667C;ENSP00000352039:R667C;ENSP00000414415:R714C	ENSP00000301749:R667C	R	-	1	0	NLRC3	3551720	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.991000	0.63883	1.361000	0.45981	0.555000	0.69702	CGC	NLRC3	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000167984		0.592	NLRC3-201	KNOWN	basic|appris_principal	protein_coding	NLRC3	HGNC	polymorphic_pseudogene		71	0.00	0	G	NM_178844		3611719	3611719	-1	no_errors	ENST00000448023	ensembl	human	known	69_37n	missense	87	12.87	13	SNP	1.000	A
NXPE2	120406	genome.wustl.edu	37	11	114569175	114569175	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr11:114569175C>G	ENST00000389586.4	+	3	731	c.541C>G	c.(541-543)Ctg>Gtg	p.L181V	NXPE2_ENST00000375475.5_Missense_Mutation_p.L181V	NM_182495.5	NP_872301.2	Q96DL1	NXPE2_HUMAN	neurexophilin and PC-esterase domain family, member 2	181						integral component of membrane (GO:0016021)											CAGCTTCACTCTGTTCTGGGA	0.547																																						dbGAP											0													116.0	122.0	120.0					11																	114569175		692	1591	2283	-	-	-	SO:0001583	missense	0			AK057953	CCDS44738.1	11q23.2	2012-06-14	2012-06-11	2012-06-11	ENSG00000204361	ENSG00000204361			26331	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member B"""	FAM55B			Standard	NM_182495		Approved	FLJ25224	uc009yyy.2	Q96DL1	OTTHUMG00000168293	ENST00000389586.4:c.541C>G	11.37:g.114569175C>G	ENSP00000374237:p.Leu181Val		Q2NKI8	Missense_Mutation	SNP	superfamily_Ig_E-set	p.L181V	ENST00000389586.4	37	c.541	CCDS44738.1	11	.	.	.	.	.	.	.	.	.	.	C	13.46	2.243132	0.39697	.	.	ENSG00000204361	ENST00000389586;ENST00000375475;ENST00000505358	T;T	0.58210	1.24;0.35	4.66	1.17	0.20885	Immunoglobulin E-set (1);	0.000000	0.46758	D	0.000280	T	0.77725	0.4173	H	0.95780	3.72	0.33391	D	0.576089	D	0.89917	1.0	D	0.97110	1.0	D	0.84295	0.0502	10	0.66056	D	0.02	.	11.777	0.51991	0.0:0.7304:0.0:0.2696	.	181	Q96DL1	FA55B_HUMAN	V	181	ENSP00000374237:L181V;ENSP00000364624:L181V	ENSP00000364624:L181V	L	+	1	2	FAM55B	114074385	0.024000	0.19004	0.997000	0.53966	0.608000	0.37181	0.001000	0.13038	0.086000	0.17137	-1.094000	0.02160	CTG	NXPE2	-	superfamily_Ig_E-set	ENSG00000204361		0.547	NXPE2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	NXPE2	HGNC	protein_coding	OTTHUMT00000399181.1	251	0.00	0	C	NM_182495		114569175	114569175	+1	no_errors	ENST00000389586	ensembl	human	known	69_37n	missense	151	29.44	63	SNP	0.962	G
OMD	4958	genome.wustl.edu	37	9	95178955	95178956	+	Frame_Shift_Ins	INS	-	-	TGCT			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr9:95178955_95178956insTGCT	ENST00000375550.4	-	2	1160_1161	c.885_886insAGCA	c.(883-888)gcattcfs	p.F296fs	CENPP_ENST00000375587.3_Intron	NM_005014.2	NP_005005.1	Q99983	OMD_HUMAN	osteomodulin	296					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(3)|skin(2)	16						GGAATATAGAATGCTTGCTTCA	0.312			T	USP6	aneurysmal bone cysts																																	dbGAP		Dom	yes		9	9q22.31	4958	osteomodulin		M	0																																										-	-	-	SO:0001589	frameshift_variant	0			AB000114	CCDS6696.1	9q22.31	2008-02-05			ENSG00000127083	ENSG00000127083		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	8134	protein-coding gene	gene with protein product	"""osteoadherin proteoglycan"""						Standard	NM_005014		Approved	osteoadherin, SLRR2C	uc004asd.4	Q99983	OTTHUMG00000020225	ENST00000375550.4:c.882_885dupAGCA	9.37:g.95178960_95178963dupTGCT	ENSP00000364700:p.Phe296fs		Q5TBF4	Frame_Shift_Ins	INS	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	p.F295fs	ENST00000375550.4	37	c.886_885	CCDS6696.1	9																																																																																			OMD	-	NULL	ENSG00000127083		0.312	OMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OMD	HGNC	protein_coding	OTTHUMT00000053090.1	259	0.00	0	-	NM_005014		95178955	95178956	-1	no_errors	ENST00000375550	ensembl	human	known	69_37n	frame_shift_ins	203	12.12	28	INS	1.000:0.998	TGCT
OR11H6	122748	genome.wustl.edu	37	14	20691885	20691885	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr14:20691885A>T	ENST00000315519.2	+	1	95	c.17A>T	c.(16-18)cAt>cTt	p.H6L		NM_001004480.1	NP_001004480.1	Q8NGC7	O11H6_HUMAN	olfactory receptor, family 11, subfamily H, member 6	6						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(13)|ovary(2)|prostate(1)|skin(2)	29	all_cancers(95;0.00108)		Epithelial(56;1.75e-06)|all cancers(55;1.22e-05)	GBM - Glioblastoma multiforme(265;0.0143)		tttattattCATTCTTTGGTT	0.363																																						dbGAP											0													67.0	73.0	71.0					14																	20691885		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32033.1	14q11.2	2013-09-24			ENSG00000176219	ENSG00000176219		"""GPCR / Class A : Olfactory receptors"""	15349	protein-coding gene	gene with protein product							Standard	NM_001004480		Approved		uc010tlc.2	Q8NGC7	OTTHUMG00000170850	ENST00000315519.2:c.17A>T	14.37:g.20691885A>T	ENSP00000319071:p.His6Leu		Q6IF08	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.H6L	ENST00000315519.2	37	c.17	CCDS32033.1	14	.	.	.	.	.	.	.	.	.	.	a	11.95	1.790418	0.31685	.	.	ENSG00000176219	ENST00000315519	T	0.00531	6.76	4.21	4.21	0.49690	.	1.272140	0.06182	U	0.679610	T	0.00328	0.0010	N	0.08118	0	0.28491	N	0.914487	P	0.37864	0.61	B	0.32393	0.145	T	0.46484	-0.9188	10	0.72032	D	0.01	.	6.8236	0.23870	0.8916:0.0:0.1084:0.0	.	6	Q8NGC7	O11H6_HUMAN	L	6	ENSP00000319071:H6L	ENSP00000319071:H6L	H	+	2	0	OR11H6	19761725	0.000000	0.05858	0.408000	0.26446	0.229000	0.25112	-0.170000	0.09897	1.842000	0.53543	0.363000	0.22086	CAT	OR11H6	-	NULL	ENSG00000176219		0.363	OR11H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR11H6	HGNC	protein_coding	OTTHUMT00000410676.1	80	0.00	0	A			20691885	20691885	+1	no_errors	ENST00000315519	ensembl	human	known	69_37n	missense	58	24.68	19	SNP	0.728	T
OR7G1	125962	genome.wustl.edu	37	19	9226091	9226091	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr19:9226091C>A	ENST00000541538.1	-	1	348	c.349G>T	c.(349-351)Gtc>Ttc	p.V117F	OR7G1_ENST00000293614.1_Missense_Mutation_p.V117F	NM_001005192.2	NP_001005192.2	Q8NGA0	OR7G1_HUMAN	olfactory receptor, family 7, subfamily G, member 1	117						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|skin(2)	20						TAGGCCATGACTGCAAGAAAG	0.488																																						dbGAP											0													147.0	147.0	147.0					19																	9226091		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32898.1, CCDS32898.2	19p13.2	2013-09-24			ENSG00000161807	ENSG00000161807		"""GPCR / Class A : Olfactory receptors"""	8465	protein-coding gene	gene with protein product				OR7G1P			Standard	NM_001005192		Approved	OR19-15	uc021uoi.1	Q8NGA0	OTTHUMG00000168067	ENST00000541538.1:c.349G>T	19.37:g.9226091C>A	ENSP00000444134:p.Val117Phe		Q6IFJ5|Q96RA1	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.V117F	ENST00000541538.1	37	c.349	CCDS32898.2	19	.	.	.	.	.	.	.	.	.	.	c	15.28	2.785440	0.49997	.	.	ENSG00000161807	ENST00000293614;ENST00000541538	T;T	0.03004	4.08;4.08	3.78	1.58	0.23477	GPCR, rhodopsin-like superfamily (1);	0.799771	0.10087	U	0.717658	T	0.13756	0.0333	M	0.88105	2.93	0.09310	N	1	P	0.48640	0.913	P	0.51135	0.66	T	0.08638	-1.0712	10	0.87932	D	0	.	8.979	0.35953	0.0:0.8062:0.0:0.1938	.	117	Q8NGA0	OR7G1_HUMAN	F	117	ENSP00000293614:V117F;ENSP00000444134:V117F	ENSP00000293614:V117F	V	-	1	0	OR7G1	9087091	0.000000	0.05858	0.000000	0.03702	0.069000	0.16628	-0.054000	0.11826	0.377000	0.24735	0.501000	0.49751	GTC	OR7G1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000161807		0.488	OR7G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7G1	HGNC	protein_coding	OTTHUMT00000397912.1	218	0.00	0	C			9226091	9226091	-1	no_errors	ENST00000293614	ensembl	human	known	69_37n	missense	190	21.81	53	SNP	0.011	A
PAQR9	344838	genome.wustl.edu	37	3	142681942	142681942	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr3:142681942C>G	ENST00000340634.3	-	1	236	c.237G>C	c.(235-237)aaG>aaC	p.K79N	RP11-372E1.6_ENST00000608686.1_RNA|RP11-372E1.6_ENST00000593321.1_RNA|RP11-372E1.6_ENST00000493825.1_RNA|RP11-372E1.6_ENST00000497652.1_RNA|RP11-372E1.6_ENST00000594095.1_RNA|RP11-372E1.6_ENST00000607937.1_RNA|RP11-372E1.6_ENST00000608349.1_RNA|RP11-372E1.6_ENST00000478823.1_RNA|RP11-372E1.6_ENST00000595248.1_RNA|RP11-372E1.6_ENST00000598787.1_RNA|RP11-372E1.6_ENST00000595774.1_RNA|RP11-372E1.6_ENST00000598139.1_RNA	NM_198504.2	NP_940906.1	Q6ZVX9	PAQR9_HUMAN	progestin and adipoQ receptor family member IX	79						integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			endometrium(2)|large_intestine(7)|lung(12)|prostate(1)	22						CGTTGGTAGGCTTCAGCACCG	0.637																																						dbGAP											0													85.0	84.0	84.0					3																	142681942		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY424287	CCDS3128.1	3q23	2008-05-02			ENSG00000188582	ENSG00000188582			30131	protein-coding gene	gene with protein product		614580					Standard	NM_198504		Approved	FLJ41938	uc003evg.3	Q6ZVX9	OTTHUMG00000159313	ENST00000340634.3:c.237G>C	3.37:g.142681942C>G	ENSP00000341564:p.Lys79Asn		Q147T6	Missense_Mutation	SNP	pfam_HlyIII-related	p.K79N	ENST00000340634.3	37	c.237	CCDS3128.1	3	.	.	.	.	.	.	.	.	.	.	C	12.62	1.991216	0.35131	.	.	ENSG00000188582	ENST00000340634	T	0.22539	1.95	4.64	2.81	0.32909	.	0.229589	0.32952	N	0.005445	T	0.12390	0.0301	N	0.08118	0	0.35082	D	0.76354	B	0.25351	0.124	B	0.34991	0.193	T	0.23547	-1.0185	10	0.26408	T	0.33	-9.8566	10.9003	0.47047	0.0:0.8437:0.0:0.1563	.	79	Q6ZVX9	PAQR9_HUMAN	N	79	ENSP00000341564:K79N	ENSP00000341564:K79N	K	-	3	2	PAQR9	144164632	1.000000	0.71417	0.911000	0.35937	0.998000	0.95712	2.541000	0.45735	0.483000	0.27608	0.563000	0.77884	AAG	PAQR9	-	NULL	ENSG00000188582		0.637	PAQR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAQR9	HGNC	protein_coding	OTTHUMT00000354538.1	89	0.00	0	C	NM_198504		142681942	142681942	-1	no_errors	ENST00000340634	ensembl	human	known	69_37n	missense	61	14.08	10	SNP	1.000	G
PCDHB6	56130	genome.wustl.edu	37	5	140531491	140531491	+	Silent	SNP	C	C	T			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr5:140531491C>T	ENST00000231136.1	+	1	1653	c.1653C>T	c.(1651-1653)gaC>gaT	p.D551D	PCDHB6_ENST00000543635.1_Silent_p.D415D	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	551	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGGTGCTGGACGCCAACGACA	0.701																																						dbGAP											0													40.0	48.0	45.0					5																	140531491		2202	4298	6500	-	-	-	SO:0001819	synonymous_variant	0			AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.1653C>T	5.37:g.140531491C>T			B2R8R9	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D551	ENST00000231136.1	37	c.1653	CCDS4248.1	5	.	.	.	.	.	.	.	.	.	.	C	8.085	0.773256	0.16051	.	.	ENSG00000113211	ENST00000542861	.	.	.	4.19	3.01	0.34805	.	.	.	.	.	T	0.57888	0.2084	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62651	-0.6809	5	0.87932	D	0	.	3.2049	0.06662	0.0:0.5506:0.0:0.4494	.	.	.	.	M	336	.	ENSP00000438850:T336M	T	+	2	0	PCDHB6	140511675	0.005000	0.15991	0.989000	0.46669	0.969000	0.65631	0.066000	0.14489	2.047000	0.60756	0.556000	0.70494	ACG	PCDHB6	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000113211		0.701	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB6	HGNC	protein_coding	OTTHUMT00000251818.2	42	0.00	0	C	NM_018939		140531491	140531491	+1	no_errors	ENST00000231136	ensembl	human	known	69_37n	silent	33	25.00	11	SNP	0.997	T
PDILT	204474	genome.wustl.edu	37	16	20387489	20387489	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr16:20387489C>G	ENST00000302451.4	-	4	692	c.444G>C	c.(442-444)ttG>ttC	p.L148F		NM_174924.1	NP_777584.1	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis expressed	148					cell migration (GO:0016477)|cell redox homeostasis (GO:0045454)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|spermatid development (GO:0007286)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(33)|prostate(3)|skin(1)|urinary_tract(1)	61						TTTGTCGTCTCAACCAAACGA	0.468																																						dbGAP											0													117.0	89.0	99.0					16																	20387489		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS10584.1	16p12.3	2011-11-10	2009-02-23		ENSG00000169340	ENSG00000169340		"""Protein disulfide isomerases"""	27338	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 7"", ""protein disulfide isomerase-like protein of the testis"""					15475357	Standard	NM_174924		Approved	PDIA7	uc002dhc.1	Q8N807	OTTHUMG00000131487	ENST00000302451.4:c.444G>C	16.37:g.20387489C>G	ENSP00000305465:p.Leu148Phe		Q8IVQ5	Missense_Mutation	SNP	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	p.L148F	ENST00000302451.4	37	c.444	CCDS10584.1	16	.	.	.	.	.	.	.	.	.	.	C	18.54	3.646921	0.67358	.	.	ENSG00000169340	ENST00000302451	T	0.04360	3.64	4.65	3.7	0.42460	Thioredoxin domain (1);Thioredoxin-like fold (2);	0.000000	0.64402	D	0.000001	T	0.18425	0.0442	M	0.74467	2.265	0.38869	D	0.95664	D	0.89917	1.0	D	0.79784	0.993	T	0.01056	-1.1466	10	0.72032	D	0.01	.	10.6371	0.45571	0.0:0.9067:0.0:0.0933	.	148	Q8N807	PDILT_HUMAN	F	148	ENSP00000305465:L148F	ENSP00000305465:L148F	L	-	3	2	PDILT	20294990	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	0.555000	0.23422	1.308000	0.44962	0.650000	0.86243	TTG	PDILT	-	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	ENSG00000169340		0.468	PDILT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDILT	HGNC	protein_coding	OTTHUMT00000254332.1	204	0.00	0	C	NM_174924		20387489	20387489	-1	no_errors	ENST00000302451	ensembl	human	known	69_37n	missense	139	31.86	65	SNP	1.000	G
PHYH	5264	genome.wustl.edu	37	10	13320306	13320306	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr10:13320306G>C	ENST00000263038.4	-	9	1070	c.1012C>G	c.(1012-1014)Ctt>Gtt	p.L338V	PHYH_ENST00000396920.3_Missense_Mutation_p.L321V|PHYH_ENST00000396913.2_Missense_Mutation_p.L238V	NM_006214.3	NP_006205.1	O14832	PAHX_HUMAN	phytanoyl-CoA 2-hydroxylase	338					cellular lipid metabolic process (GO:0044255)|fatty acid alpha-oxidation (GO:0001561)|isoprenoid metabolic process (GO:0006720)|methyl-branched fatty acid metabolic process (GO:0097089)|small molecule metabolic process (GO:0044281)	mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	cofactor binding (GO:0048037)|electron carrier activity (GO:0009055)|L-ascorbic acid binding (GO:0031418)|metal ion binding (GO:0046872)|phytanoyl-CoA dioxygenase activity (GO:0048244)	p.L338F(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)	25		Ovarian(717;0.0448)			Antihemophilic Factor(DB00025)|Vitamin C(DB00126)	CTATTTCAAAGATTGGTTCTT	0.358																																						dbGAP											1	Substitution - Missense(1)	NS(1)											95.0	92.0	93.0					10																	13320306		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS7097.1, CCDS41489.1	10p13	2010-04-27	2006-01-09		ENSG00000107537	ENSG00000107537	1.14.11.18		8940	protein-coding gene	gene with protein product	"""Refsum disease"", ""phytanoyl-CoA dioxygenase"""	602026	"""phytanoyl-CoA hydroxylase (Refsum disease)"", ""phytanoyl-CoA hydroxylase"""			9326939	Standard	XM_005252469		Approved	PAHX, RD, PHYH1	uc001imf.3	O14832	OTTHUMG00000017693	ENST00000263038.4:c.1012C>G	10.37:g.13320306G>C	ENSP00000263038:p.Leu338Val		A8MTS8|B1ALH5	Missense_Mutation	SNP	pfam_Phytyl_CoA_dOase	p.L338V	ENST00000263038.4	37	c.1012	CCDS7097.1	10	.	.	.	.	.	.	.	.	.	.	G	17.73	3.461400	0.63513	.	.	ENSG00000107537	ENST00000396913;ENST00000263038;ENST00000396920	D;D;D	0.93906	-3.03;-3.31;-3.26	5.67	4.76	0.60689	.	0.135555	0.51477	D	0.000088	D	0.95674	0.8593	M	0.81802	2.56	0.58432	D	0.999995	P;P	0.50443	0.935;0.935	P;P	0.54856	0.762;0.708	D	0.95942	0.8947	10	0.72032	D	0.01	-16.6069	15.8849	0.79238	0.0:0.0:0.8638:0.1362	.	321;338	B1ALH6;O14832	.;PAHX_HUMAN	V	238;338;321	ENSP00000380121:L238V;ENSP00000263038:L338V;ENSP00000380126:L321V	ENSP00000263038:L338V	L	-	1	0	PHYH	13360312	1.000000	0.71417	1.000000	0.80357	0.469000	0.32828	3.756000	0.55205	1.387000	0.46486	0.655000	0.94253	CTT	PHYH	-	NULL	ENSG00000107537		0.358	PHYH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHYH	HGNC	protein_coding	OTTHUMT00000046845.2	301	0.00	0	G			13320306	13320306	-1	no_errors	ENST00000263038	ensembl	human	known	69_37n	missense	384	23.51	118	SNP	1.000	C
PIGB	9488	genome.wustl.edu	37	15	55647072	55647072	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr15:55647072G>A	ENST00000164305.5	+	11	1705	c.1414G>A	c.(1414-1416)Gaa>Aaa	p.E472K	PIGB_ENST00000539642.1_Missense_Mutation_p.E277K|DYX1C1-CCPG1_ENST00000565113.1_RNA	NM_004855.4	NP_004846.4	Q92521	PIGB_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class B	472					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	mannosyltransferase activity (GO:0000030)			endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	11				all cancers(107;0.0255)		TTATCTTGATGAAGCAGATGT	0.403																																						dbGAP											0													80.0	72.0	74.0					15																	55647072		1873	4117	5990	-	-	-	SO:0001583	missense	0			D42138	CCDS61641.1	15q21.3	2013-02-26	2006-06-28		ENSG00000069943	ENSG00000069943		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	8959	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 3"", ""dol-P-Man dependent GPI mannosyltransferase"""	604122	"""phosphatidylinositol glycan, class B"""			8861954	Standard	NM_004855		Approved		uc002act.3	Q92521	OTTHUMG00000172654	ENST00000164305.5:c.1414G>A	15.37:g.55647072G>A	ENSP00000164305:p.Glu472Lys		Q53FF9|Q8WVN7	Missense_Mutation	SNP	pfam_GPI_mannosylTrfase	p.E472K	ENST00000164305.5	37	c.1414		15	.	.	.	.	.	.	.	.	.	.	G	28.1	4.891350	0.91889	.	.	ENSG00000069943	ENST00000164305;ENST00000539642	T;T	0.68331	0.04;-0.32	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	D	0.86314	0.5903	M	0.91561	3.22	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.88023	0.2770	10	0.62326	D	0.03	-17.3125	19.2028	0.93717	0.0:0.0:1.0:0.0	.	472	Q92521	PIGB_HUMAN	K	472;277	ENSP00000164305:E472K;ENSP00000438963:E277K	ENSP00000164305:E472K	E	+	1	0	PIGB	53434364	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.357000	0.97099	2.785000	0.95823	0.591000	0.81541	GAA	PIGB	-	NULL	ENSG00000069943		0.403	PIGB-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	PIGB	HGNC	protein_coding	OTTHUMT00000419687.1	259	0.00	0	G	NM_004855		55647072	55647072	+1	no_errors	ENST00000164305	ensembl	human	known	69_37n	missense	151	23.74	47	SNP	1.000	A
PIK3CA	5290	genome.wustl.edu	37	3	178952075	178952075	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr3:178952075A>T	ENST00000263967.3	+	21	3287	c.3130A>T	c.(3130-3132)Aat>Tat	p.N1044Y	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1044	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.N1044D(3)|p.N1044Y(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	GAAACAAATGAATGATGCACA	0.373		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	4	Substitution - Missense(4)	large_intestine(1)|central_nervous_system(1)|breast(1)|endometrium(1)											98.0	88.0	91.0					3																	178952075		1910	4122	6032	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3130A>T	3.37:g.178952075A>T	ENSP00000263967:p.Asn1044Tyr		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.N1044Y	ENST00000263967.3	37	c.3130	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	17.20	3.329635	0.60743	.	.	ENSG00000121879	ENST00000263967	D	0.81908	-1.55	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.82231	0.4992	L	0.48174	1.505	0.80722	D	1	D	0.53462	0.96	P	0.46320	0.512	T	0.83031	-0.0162	10	0.48119	T	0.1	-24.648	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1044	P42336	PK3CA_HUMAN	Y	1044	ENSP00000263967:N1044Y	ENSP00000263967:N1044Y	N	+	1	0	PIK3CA	180434769	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	AAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.373	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	201	0.00	0	A			178952075	178952075	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	110	40.22	74	SNP	1.000	T
PPIP5K2	23262	genome.wustl.edu	37	5	102482291	102482291	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr5:102482291C>T	ENST00000358359.3	+	6	1057	c.548C>T	c.(547-549)cCa>cTa	p.P183L	PPIP5K2_ENST00000321521.9_Missense_Mutation_p.P183L|PPIP5K2_ENST00000414217.1_Missense_Mutation_p.P183L|PPIP5K2_ENST00000513500.1_3'UTR	NM_001276277.1	NP_001263206.1	O43314	VIP2_HUMAN	diphosphoinositol pentakisphosphate kinase 2	183					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						TTTCAAAAGCCATTTGTAGAA	0.353																																						dbGAP											0													119.0	122.0	121.0					5																	102482291		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007893	CCDS34207.1, CCDS64212.1, CCDS75283.1	5q21.1	2014-05-06	2010-01-26	2010-01-26	ENSG00000145725	ENSG00000145725	2.7.4.24		29035	protein-coding gene	gene with protein product		611648	"""histidine acid phosphatase domain containing 1"""	HISPPD1		9455477, 17690096, 18981179	Standard	NM_001276277		Approved	KIAA0433, VIP2	uc003koe.4	O43314	OTTHUMG00000181461	ENST00000358359.3:c.548C>T	5.37:g.102482291C>T	ENSP00000351126:p.Pro183Leu		A1NI53|A6NGS8|Q8TB50	Missense_Mutation	SNP	pfam_His_Pase_superF_clade-2	p.P183L	ENST00000358359.3	37	c.548		5	.	.	.	.	.	.	.	.	.	.	C	32	5.183580	0.94885	.	.	ENSG00000145725	ENST00000321521;ENST00000507921;ENST00000358359;ENST00000451606;ENST00000414217;ENST00000507310	T;T;T;T	0.34072	1.41;2.06;1.38;1.41	5.45	5.45	0.79879	.	0.000000	0.64402	D	0.000002	T	0.73305	0.3570	H	0.95294	3.65	0.80722	D	1	P;D;D	0.89917	0.951;1.0;1.0	P;D;D	0.97110	0.695;1.0;0.999	T	0.81669	-0.0828	10	0.87932	D	0	.	19.6422	0.95763	0.0:1.0:0.0:0.0	.	105;183;183	D6RBU4;O43314-2;O43314	.;.;VIP2_HUMAN	L	183;105;183;183;183;113	ENSP00000313070:P183L;ENSP00000422525:P105L;ENSP00000351126:P183L;ENSP00000416016:P183L	ENSP00000313070:P183L	P	+	2	0	PPIP5K2	102510190	1.000000	0.71417	0.988000	0.46212	0.946000	0.59487	7.445000	0.80570	2.712000	0.92718	0.650000	0.86243	CCA	PPIP5K2	-	NULL	ENSG00000145725		0.353	PPIP5K2-003	KNOWN	basic	protein_coding	PPIP5K2	HGNC	protein_coding	OTTHUMT00000370487.1	307	0.65	2	C	NM_015216		102482291	102482291	+1	no_errors	ENST00000358359	ensembl	human	known	69_37n	missense	294	15.47	54	SNP	1.000	T
RAB21	23011	genome.wustl.edu	37	12	72176409	72176409	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr12:72176409T>C	ENST00000261263.3	+	6	762	c.506T>C	c.(505-507)aTt>aCt	p.I169T		NM_014999.2	NP_055814.1	Q9UL25	RAB21_HUMAN	RAB21, member RAS oncogene family	169					GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			large_intestine(1)|lung(4)|prostate(1)	6						AACAAAGGAATTGAGGAACTC	0.279																																						dbGAP											0													106.0	110.0	108.0					12																	72176409		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF091035	CCDS9003.1	12q21.1	2014-09-04			ENSG00000080371	ENSG00000080371		"""RAB, member RAS oncogene"""	18263	protein-coding gene	gene with protein product		612398				10887961, 11697911, 16754960	Standard	NM_014999		Approved	KIAA0118	uc001swt.3	Q9UL25	OTTHUMG00000169572	ENST00000261263.3:c.506T>C	12.37:g.72176409T>C	ENSP00000261263:p.Ile169Thr		Q14466|Q569H3	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_ProtSyn_GTP-bd,pfam_Gtr1_RagA,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.I169T	ENST00000261263.3	37	c.506	CCDS9003.1	12	.	.	.	.	.	.	.	.	.	.	T	25.3	4.628757	0.87560	.	.	ENSG00000080371	ENST00000261263	T	0.78816	-1.21	5.85	5.85	0.93711	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.89863	0.6838	M	0.89163	3.01	0.80722	D	1	D	0.71674	0.998	D	0.77004	0.989	D	0.91696	0.5370	10	0.87932	D	0	0.1054	16.2421	0.82418	0.0:0.0:0.0:1.0	.	169	Q9UL25	RAB21_HUMAN	T	169	ENSP00000261263:I169T	ENSP00000261263:I169T	I	+	2	0	RAB21	70462676	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.683000	0.84093	2.234000	0.73211	0.533000	0.62120	ATT	RAB21	-	pfam_Small_GTPase,pfam_Small_GTPase_ARF/SAR,pfam_ProtSyn_GTP-bd,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000080371		0.279	RAB21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB21	HGNC	protein_coding	OTTHUMT00000404855.1	408	0.24	1	T			72176409	72176409	+1	no_errors	ENST00000261263	ensembl	human	known	69_37n	missense	335	16.54	67	SNP	1.000	C
TATDN1	83940	genome.wustl.edu	37	8	125498596	125498596	+	IGR	SNP	G	G	A			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr8:125498596G>A	ENST00000276692.6	-	0	1018				RP11-158K1.3_ENST00000518639.1_RNA|RNF139_ENST00000303545.3_Missense_Mutation_p.D236N	NM_032026.3	NP_114415.1	Q6P1N9	TATD1_HUMAN	TatD DNase domain containing 1						DNA catabolic process (GO:0006308)	intracellular organelle (GO:0043229)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)	15	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			TCGTTTCCCAGACATACTACG	0.383																																						dbGAP											0													201.0	194.0	196.0					8																	125498596		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0			AF212250	CCDS6351.1, CCDS55273.1	8q24.13	2004-06-07			ENSG00000147687	ENSG00000147687			24220	protein-coding gene	gene with protein product						12477932	Standard	NM_032026		Approved	CDA11	uc003yrd.2	Q6P1N9	OTTHUMG00000165068		8.37:g.125498596G>A			B2R5J0|Q8TD02|Q9BY40	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH,smart_Znf_RING,pfscan_Znf_RING	p.D236N	ENST00000276692.6	37	c.706	CCDS6351.1	8	.	.	.	.	.	.	.	.	.	.	G	5.675	0.309084	0.10733	.	.	ENSG00000170881	ENST00000303545	T	0.22743	1.94	5.34	5.34	0.76211	.	0.105050	0.64402	D	0.000008	T	0.18467	0.0443	L	0.33485	1.01	0.58432	D	0.999999	B	0.26902	0.163	B	0.23716	0.048	T	0.05801	-1.0863	10	0.15952	T	0.53	-6.5174	19.4109	0.94671	0.0:0.0:1.0:0.0	.	236	Q8WU17	RN139_HUMAN	N	236	ENSP00000304051:D236N	ENSP00000304051:D236N	D	+	1	0	RNF139	125567777	1.000000	0.71417	1.000000	0.80357	0.566000	0.35808	9.031000	0.93731	2.642000	0.89623	0.650000	0.86243	GAC	RNF139	-	NULL	ENSG00000170881		0.383	TATDN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF139	HGNC	protein_coding	OTTHUMT00000381655.1	212	0.47	1	G	NM_032026		125498596	125498596	+1	no_errors	ENST00000303545	ensembl	human	known	69_37n	missense	200	18.73	47	SNP	1.000	A
RPL17	6139	genome.wustl.edu	37	18	47015767	47015767	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr18:47015767C>T	ENST00000418495.1	-	6	809	c.469G>A	c.(469-471)Gtt>Att	p.V157I	C18orf32_ENST00000579820.1_5'Flank|C18orf32_ENST00000318240.3_5'Flank|RPL17-C18orf32_ENST00000584895.1_Missense_Mutation_p.V157I|RPL17-C18orf32_ENST00000332968.6_Missense_Mutation_p.V119I|RPL17_ENST00000580210.1_Missense_Mutation_p.V147I|SNORD58A_ENST00000383875.1_RNA|RPL17_ENST00000580261.1_Missense_Mutation_p.V157I|RPL17_ENST00000581091.1_5'UTR|C18orf32_ENST00000582392.1_5'Flank|MIR1539_ENST00000410758.1_RNA|RPL17_ENST00000581373.1_Missense_Mutation_p.V119I|SNORD58C_ENST00000365223.1_RNA|RPL17_ENST00000579408.1_Missense_Mutation_p.V157I|MIR1539_ENST00000581232.1_RNA|SNORD58B_ENST00000607313.1_RNA|RPL17_ENST00000579248.1_Missense_Mutation_p.V157I	NM_000985.4|NM_001199340.1	NP_000976.1|NP_001186269.1	P18621	RL17_HUMAN	ribosomal protein L17	157					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|lung(3)	5						GGTTTAGGAACAATCTGTTCC	0.448																																						dbGAP											0													183.0	170.0	174.0					18																	47015767		1843	4087	5930	-	-	-	SO:0001583	missense	0			AB007174	CCDS45865.1, CCDS56070.1	18q21	2011-04-06				ENSG00000265681		"""L ribosomal proteins"""	10307	protein-coding gene	gene with protein product		603661				2402465, 9582194	Standard	NM_000985		Approved	rpL23, L17		P18621		ENST00000418495.1:c.469G>A	18.37:g.47015767C>T	ENSP00000397798:p.Val157Ile		B2R4H3|B4E3C2|B5ME31|J3QL51|Q3KQW2|Q6NZ54|Q7M4M5	Missense_Mutation	SNP	pfam_Ribosomal_L22,superfamily_Ribosomal_L22,tigrfam_Ribosomal_L22/L17_euk/arc	p.V157I	ENST00000418495.1	37	c.469	CCDS45865.1	18	.	.	.	.	.	.	.	.	.	.	C	18.66	3.671616	0.67928	.	.	ENSG00000215472	ENST00000418495;ENST00000441578;ENST00000332968	.	.	.	4.89	4.89	0.63831	.	.	.	.	.	T	0.63988	0.2558	L	0.52364	1.645	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.08055	0.002;0.003	T	0.61865	-0.6975	8	0.52906	T	0.07	.	18.4295	0.90620	0.0:1.0:0.0:0.0	.	157;119	P18621;B4E3C2	RL17_HUMAN;.	I	157;157;119	.	ENSP00000352143:V119I	V	-	1	0	RPL17	45269765	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.358000	0.79466	2.437000	0.82529	0.650000	0.86243	GTT	RP11-110H1.2	-	NULL	ENSG00000215472		0.448	RPL17-201	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL17-C18ORF32	Clone_based_vega_gene	protein_coding	OTTHUMT00000447589.2	448	0.22	1	C	NM_000985		47015767	47015767	-1	no_errors	ENST00000418495	ensembl	human	known	69_37n	missense	393	15.67	73	SNP	1.000	T
RSAD1	55316	genome.wustl.edu	37	17	48560768	48560768	+	Silent	SNP	G	G	T			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr17:48560768G>T	ENST00000258955.2	+	6	1057	c.972G>T	c.(970-972)ctG>ctT	p.L324L		NM_018346.1	NP_060816.1	Q9HA92	RSAD1_HUMAN	radical S-adenosyl methionine domain containing 1	324					porphyrin-containing compound biosynthetic process (GO:0006779)	mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|coproporphyrinogen oxidase activity (GO:0004109)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	16	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			TCCAGACACTGGAGCCTGACA	0.607																																						dbGAP											0													49.0	52.0	51.0					17																	48560768		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK002026	CCDS11569.1	17q21.33	2004-11-08			ENSG00000136444	ENSG00000136444			25634	protein-coding gene	gene with protein product						12477932	Standard	NM_018346		Approved	FLJ11164	uc002iqw.1	Q9HA92	OTTHUMG00000162126	ENST00000258955.2:c.972G>T	17.37:g.48560768G>T			B4DMW0|Q53HV8|Q86VC4|Q9BRY7|Q9NUS7	Missense_Mutation	SNP	NULL	p.W190L	ENST00000258955.2	37	c.569	CCDS11569.1	17																																																																																			RSAD1	-	NULL	ENSG00000136444		0.607	RSAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSAD1	HGNC	protein_coding	OTTHUMT00000367413.1	101	0.98	1	G	NM_018346		48560768	48560768	+1	no_errors	ENST00000515221	ensembl	human	known	69_37n	missense	144	11.59	19	SNP	1.000	T
RYR2	6262	genome.wustl.edu	37	1	237777585	237777585	+	Silent	SNP	C	C	T			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr1:237777585C>T	ENST00000366574.2	+	37	5474	c.5157C>T	c.(5155-5157)ctC>ctT	p.L1719L	RYR2_ENST00000360064.6_Silent_p.L1717L|RYR2_ENST00000542537.1_Silent_p.L1703L	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1719	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTGCCAGGCTCATGATGAACA	0.522																																						dbGAP											0													59.0	59.0	59.0					1																	237777585		2154	4263	6417	-	-	-	SO:0001819	synonymous_variant	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.5157C>T	1.37:g.237777585C>T			Q15411|Q546N8|Q5T3P2	Silent	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.L1717	ENST00000366574.2	37	c.5151	CCDS55691.1	1																																																																																			RYR2	-	NULL	ENSG00000198626		0.522	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	81	0.00	0	C	NM_001035		237777585	237777585	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	silent	83	20.19	21	SNP	0.901	T
SCN5A	6331	genome.wustl.edu	37	3	38592777	38592777	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr3:38592777T>C	ENST00000333535.4	-	28	5235	c.5086A>G	c.(5086-5088)Acc>Gcc	p.T1696A	SCN5A_ENST00000423572.2_Missense_Mutation_p.T1695A|SCN5A_ENST00000414099.2_Missense_Mutation_p.T1678A|SCN5A_ENST00000455624.2_Missense_Mutation_p.T1663A|SCN5A_ENST00000425664.1_Missense_Mutation_p.T1678A|SCN5A_ENST00000443581.1_Missense_Mutation_p.T1695A|SCN5A_ENST00000450102.2_Missense_Mutation_p.T1642A|SCN5A_ENST00000449557.2_Missense_Mutation_p.T1642A|SCN5A_ENST00000451551.2_Missense_Mutation_p.T1642A|SCN5A_ENST00000413689.1_Missense_Mutation_p.T1696A|SCN5A_ENST00000464652.1_5'Flank			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	1696					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	TTGGCGAAGGTCTGGAAGTTG	0.577																																						dbGAP											0													170.0	168.0	169.0					3																	38592777		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.5086A>G	3.37:g.38592777T>C	ENSP00000328968:p.Thr1696Ala		A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,prints_Na_channel_a5su,prints_Na_channel_asu	p.T1696A	ENST00000333535.4	37	c.5086	CCDS46796.1	3	.	.	.	.	.	.	.	.	.	.	T	20.5	3.995408	0.74703	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D;D;D	0.97791	-4.54;-4.54;-4.54;-4.54;-4.54;-4.54;-4.54;-4.54;-4.54;-4.54	4.68	4.68	0.58851	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99245	0.9737	H	0.98407	4.225	0.58432	D	0.999992	D;D;D;D;D;D	0.89917	1.0;0.997;1.0;1.0;1.0;0.968	D;D;D;D;D;P	0.91635	0.997;0.992;0.998;0.998;0.999;0.782	D	0.98638	1.0674	10	0.87932	D	0	.	14.302	0.66359	0.0:0.0:0.0:1.0	.	1642;1663;1678;1696;1695;1696	E9PEF3;E9PHB6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;SCN5A_HUMAN;.;.	A	1678;1695;1696;1642;1695;1678;1696;1663;1642;1642	ENSP00000398962:T1678A;ENSP00000398266:T1695A;ENSP00000410257:T1696A;ENSP00000388797:T1642A;ENSP00000397915:T1695A;ENSP00000416634:T1678A;ENSP00000328968:T1696A;ENSP00000399524:T1663A;ENSP00000403355:T1642A;ENSP00000413996:T1642A	ENSP00000328968:T1696A	T	-	1	0	SCN5A	38567781	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.856000	0.86956	1.962000	0.57031	0.533000	0.62120	ACC	SCN5A	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel	ENSG00000183873		0.577	SCN5A-014	KNOWN	basic|CCDS	protein_coding	SCN5A	HGNC	protein_coding	OTTHUMT00000377958.1	178	0.53	1	T	NM_198056		38592777	38592777	-1	no_errors	ENST00000333535	ensembl	human	known	69_37n	missense	141	24.87	49	SNP	1.000	C
SETD2	29072	genome.wustl.edu	37	3	47158198	47158198	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr3:47158198A>G	ENST00000409792.3	-	4	4543	c.4501T>C	c.(4501-4503)Tgt>Cgt	p.C1501R		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1501	AWS. {ECO:0000255|PROSITE- ProRule:PRU00562}.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)	p.C998G(1)		breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		AGAGGTGTACACTCACACTGC	0.318			"""N, F, S, Mis"""		clear cell renal carcinoma																																	dbGAP		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	1	Substitution - Missense(1)	central_nervous_system(1)											112.0	109.0	110.0					3																	47158198		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.4501T>C	3.37:g.47158198A>G	ENSP00000386759:p.Cys1501Arg		O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	pfam_SRI,pfam_SET_dom,pfam_WW_Rsp5_WWP,superfamily_WW_Rsp5_WWP,superfamily_Ferritin/RR-like,smart_AWS,smart_SET_dom,smart_Post-SET_dom,smart_WW_Rsp5_WWP,pfscan_AWS,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_WW_Rsp5_WWP	p.C1501R	ENST00000409792.3	37	c.4501	CCDS2749.2	3	.	.	.	.	.	.	.	.	.	.	A	24.5	4.542949	0.86022	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792	D	0.85411	-1.98	5.93	5.93	0.95920	AWS (2);	0.000000	0.64402	D	0.000007	D	0.95204	0.8445	H	0.96691	3.865	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.96713	0.9527	10	0.87932	D	0	.	16.3871	0.83514	1.0:0.0:0.0:0.0	.	1501;1501	F2Z317;Q9BYW2	.;SETD2_HUMAN	R	1501	ENSP00000386759:C1501R	ENSP00000386759:C1501R	C	-	1	0	SETD2	47133202	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.310000	0.96267	2.270000	0.75569	0.482000	0.46254	TGT	SETD2	-	smart_AWS,pfscan_AWS	ENSG00000181555		0.318	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD2	HGNC	protein_coding	OTTHUMT00000257479.2	273	0.72	2	A	NM_014159		47158198	47158198	-1	no_errors	ENST00000409792	ensembl	human	known	69_37n	missense	152	18.72	35	SNP	1.000	G
SLC22A18	5002	genome.wustl.edu	37	11	2943415	2943415	+	Silent	SNP	C	C	A			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr11:2943415C>A	ENST00000380574.1	+	9	1379	c.948C>A	c.(946-948)atC>atA	p.I316I	SLC22A18_ENST00000347936.2_Silent_p.I316I|SLC22A18_ENST00000449793.2_Silent_p.I218I|SLC22A18_ENST00000312221.5_Silent_p.I316I|SLC22A18_ENST00000441077.1_3'UTR			Q96BI1	S22AI_HUMAN	solute carrier family 22, member 18	316					drug transmembrane transport (GO:0006855)|drug transport (GO:0015893)|excretion (GO:0007588)|organic cation transport (GO:0015695)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|symporter activity (GO:0015293)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(2)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	8		all_epithelial(84;0.000124)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)|all_lung(207;0.198)		BRCA - Breast invasive adenocarcinoma(625;0.00256)|LUSC - Lung squamous cell carcinoma(625;0.192)		TGGTCTTCATCGTGGTGGGCC	0.652																																						dbGAP											0													74.0	81.0	79.0					11																	2943415		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			AF028738	CCDS7740.1	11p15.5	2013-05-22	2008-01-11	2004-01-21	ENSG00000110628	ENSG00000110628		"""Solute carriers"""	10964	protein-coding gene	gene with protein product		602631	"""solute carrier family 22 (organic cation transporter), member 1-like"""	ORCTL2, BWSCR1A, IMPT1, SLC22A1L		9499412, 9520460	Standard	NM_183233		Approved	BWR1A, TSSC5, ITM	uc001lwx.3	Q96BI1	OTTHUMG00000010037	ENST00000380574.1:c.948C>A	11.37:g.2943415C>A			O14906|O43562|O60485|O60680|Q7LDS5|Q7LGF7	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,prints_Tet-R_TetA/multi-R_MdtG	p.I316	ENST00000380574.1	37	c.948	CCDS7740.1	11																																																																																			SLC22A18	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000110628		0.652	SLC22A18-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC22A18	HGNC	protein_coding	OTTHUMT00000027770.1	64	0.00	0	C	NM_183233		2943415	2943415	+1	no_errors	ENST00000312221	ensembl	human	known	69_37n	silent	48	33.33	24	SNP	0.000	A
SLC7A7	9056	genome.wustl.edu	37	14	23248035	23248035	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr14:23248035T>G	ENST00000397532.3	-	4	1262	c.737A>C	c.(736-738)aAc>aCc	p.N246T	SLC7A7_ENST00000397529.2_Missense_Mutation_p.N246T|SLC7A7_ENST00000285850.7_Missense_Mutation_p.N246T|SLC7A7_ENST00000554061.1_5'UTR|SLC7A7_ENST00000555702.1_Missense_Mutation_p.N246T|SLC7A7_ENST00000554517.1_5'UTR|SLC7A7_ENST00000397528.4_Missense_Mutation_p.N246T			Q9UM01	YLAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, y+L system), member 7	246					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|protein complex assembly (GO:0006461)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(2)	20	all_cancers(95;8.44e-05)			GBM - Glioblastoma multiforme(265;0.00741)		AGTGACATAGTTGAGGGTGTC	0.473																																						dbGAP											0													162.0	125.0	137.0					14																	23248035		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF092032	CCDS9574.1	14q11.2	2014-09-17	2011-07-12		ENSG00000155465	ENSG00000155465		"""Solute carriers"""	11065	protein-coding gene	gene with protein product		603593		LPI		9829974	Standard	NM_001126106		Approved	y+LAT-1	uc001wgs.4	Q9UM01	OTTHUMG00000028692	ENST00000397532.3:c.737A>C	14.37:g.23248035T>G	ENSP00000380666:p.Asn246Thr		B2RAU0|D3DS26|O95984|Q53XC1|Q86U07|Q9P2V5	Missense_Mutation	SNP	pfam_AA-permease_dom,pirsf_AA/rel_permease1	p.N246T	ENST00000397532.3	37	c.737	CCDS9574.1	14	.	.	.	.	.	.	.	.	.	.	T	26.5	4.739278	0.89573	.	.	ENSG00000155465	ENST00000285850;ENST00000555702;ENST00000397532;ENST00000404278;ENST00000397529;ENST00000397528	D;D;D;D;D	0.89875	-2.58;-2.58;-2.58;-2.58;-2.58	5.41	5.41	0.78517	Amino acid permease domain (1);	0.045214	0.85682	D	0.000000	D	0.93494	0.7924	M	0.83118	2.625	0.80722	D	1	P	0.45396	0.857	P	0.55999	0.789	D	0.94330	0.7561	10	0.87932	D	0	.	14.427	0.67222	0.0:0.0:0.0:1.0	.	246	Q9UM01	YLAT1_HUMAN	T	246;246;246;219;246;246	ENSP00000285850:N246T;ENSP00000451881:N246T;ENSP00000380666:N246T;ENSP00000380663:N246T;ENSP00000380662:N246T	ENSP00000285850:N246T	N	-	2	0	SLC7A7	22317875	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.680000	0.84062	2.052000	0.61016	0.459000	0.35465	AAC	SLC7A7	-	pfam_AA-permease_dom,pirsf_AA/rel_permease1	ENSG00000155465		0.473	SLC7A7-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC7A7	HGNC	protein_coding	OTTHUMT00000071636.3	205	0.00	0	T			23248035	23248035	-1	no_errors	ENST00000285850	ensembl	human	known	69_37n	missense	168	22.37	49	SNP	1.000	G
SLCO6A1	133482	genome.wustl.edu	37	5	101813402	101813402	+	Silent	SNP	T	T	A			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr5:101813402T>A	ENST00000506729.1	-	3	951	c.780A>T	c.(778-780)acA>acT	p.T260T	SLCO6A1_ENST00000514551.1_Intron|SLCO6A1_ENST00000379807.3_Silent_p.T260T|SLCO6A1_ENST00000513675.1_Intron|SLCO6A1_ENST00000389019.3_Intron|SLCO6A1_ENST00000379810.1_Intron			Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family, member 6A1	260						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(17)|lung(22)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	60		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		CAGCTGAGTGTGTAGCAACAT	0.383																																						dbGAP											0													138.0	130.0	133.0					5																	101813402		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF505657	CCDS34206.1, CCDS75282.1	5q21.2	2013-05-22			ENSG00000205359	ENSG00000205359		"""Solute carriers"""	23613	protein-coding gene	gene with protein product	"""cancer/testis antigen 48"""	613365					Standard	XM_005271874		Approved	OATP6A1, OATPY, MGC26949, CT48	uc003knp.3	Q86UG4	OTTHUMG00000162759	ENST00000506729.1:c.780A>T	5.37:g.101813402T>A			A6NHC1|Q6ZMY5|Q86UV2|Q8IYU5	Silent	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal-type_dom,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	p.T260	ENST00000506729.1	37	c.780	CCDS34206.1	5																																																																																			SLCO6A1	-	pfam_OA_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	ENSG00000205359		0.383	SLCO6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO6A1	HGNC	protein_coding	OTTHUMT00000370335.1	191	0.52	1	T	NM_173488		101813402	101813402	-1	no_errors	ENST00000379807	ensembl	human	known	69_37n	silent	139	26.46	50	SNP	0.001	A
SMG1	23049	genome.wustl.edu	37	16	18903661	18903662	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr16:18903661_18903662insAA	ENST00000446231.2	-	4	839_840	c.427_428insTT	c.(427-429)tatfs	p.Y143fs	SMG1_ENST00000565224.1_Frame_Shift_Ins_p.Y117fs|SMG1_ENST00000389467.3_Frame_Shift_Ins_p.Y143fs			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	143	Interaction with SMG8 and SMG9.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						CTCATCAGAATAAGACATCGAT	0.322																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.426_427dupTT	16.37:g.18903662_18903663dupAA	ENSP00000402515:p.Tyr143fs		O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Frame_Shift_Ins	INS	pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.Y143fs	ENST00000446231.2	37	c.428_427	CCDS45430.1	16																																																																																			SMG1	-	NULL	ENSG00000157106		0.322	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMG1	HGNC	protein_coding	OTTHUMT00000391817.1	190	0.00	0	-	NM_015092		18903661	18903662	-1	no_errors	ENST00000389467	ensembl	human	known	69_37n	frame_shift_ins	142	16.96	29	INS	1.000:1.000	AA
SORCS3	22986	genome.wustl.edu	37	10	106737218	106737218	+	Silent	SNP	G	G	A			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr10:106737218G>A	ENST00000369701.3	+	4	1148	c.921G>A	c.(919-921)gaG>gaA	p.E307E		NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	307					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		CCAAGCAAGAGGACTGGGTGC	0.453																																					NSCLC(116;1497 1690 7108 13108 14106)	dbGAP											0													110.0	99.0	103.0					10																	106737218		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.921G>A	10.37:g.106737218G>A			Q5VXF9|Q9NQJ2	Silent	SNP	pfam_PKD_dom,superfamily_PKD_dom,smart_VPS10,pfscan_PKD_dom	p.E307	ENST00000369701.3	37	c.921	CCDS7558.1	10																																																																																			SORCS3	-	smart_VPS10	ENSG00000156395		0.453	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORCS3	HGNC	protein_coding	OTTHUMT00000050221.1	254	0.00	0	G	NM_014978		106737218	106737218	+1	no_errors	ENST00000369701	ensembl	human	known	69_37n	silent	199	18.44	45	SNP	0.998	A
SRCAP	10847	genome.wustl.edu	37	16	30724033	30724033	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr16:30724033C>G	ENST00000262518.4	+	14	2412	c.2027C>G	c.(2026-2028)aCc>aGc	p.T676S	SRCAP_ENST00000395059.2_Missense_Mutation_p.T676S|SRCAP_ENST00000344771.4_Missense_Mutation_p.T676S|SNORA30_ENST00000384028.1_RNA	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	676	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			ATTGTTCCCACCAGCGTGATG	0.443																																						dbGAP											0													156.0	135.0	142.0					16																	30724033		2197	4300	6497	-	-	-	SO:0001583	missense	0			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.2027C>G	16.37:g.30724033C>G	ENSP00000262518:p.Thr676Ser		B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	pfam_SNF2_N,pfam_HSA,pfam_Helicase_C,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,smart_AT_hook_DNA-bd_motif,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_AT_hook-like	p.T676S	ENST00000262518.4	37	c.2027	CCDS10689.2	16	.	.	.	.	.	.	.	.	.	.	C	15.46	2.841145	0.51057	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	D;D;D	0.94280	-3.39;-3.39;-3.39	4.98	4.98	0.66077	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.64402	D	0.000016	D	0.93403	0.7896	L	0.37850	1.14	0.51233	D	0.999919	D;P;P	0.57571	0.98;0.884;0.905	D;P;P	0.65987	0.94;0.54;0.67	D	0.91072	0.4893	10	0.30078	T	0.28	-15.68	11.748	0.51832	0.0:0.8224:0.1776:0.0	.	676;676;676	Q6ZRS2-3;Q6ZRS2-2;Q6ZRS2	.;.;SRCAP_HUMAN	S	676	ENSP00000262518:T676S;ENSP00000378499:T676S;ENSP00000343042:T676S	ENSP00000262518:T676S	T	+	2	0	SRCAP	30631534	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.064000	0.49986	2.747000	0.94245	0.462000	0.41574	ACC	SRCAP	-	pfam_SNF2_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000080603		0.443	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRCAP	HGNC	protein_coding	OTTHUMT00000255523.1	285	0.00	0	C	NM_006662		30724033	30724033	+1	no_errors	ENST00000262518	ensembl	human	known	69_37n	missense	248	19.68	61	SNP	1.000	G
SYCP2	10388	genome.wustl.edu	37	20	58444998	58444998	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr20:58444998C>G	ENST00000357552.3	-	36	3821	c.3596G>C	c.(3595-3597)aGa>aCa	p.R1199T	SYCP2_ENST00000371001.2_Missense_Mutation_p.R1199T			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	1199					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			TATTTTTTTTCTATTTACAAT	0.328																																						dbGAP											0													97.0	93.0	95.0					20																	58444998		2195	4294	6489	-	-	-	SO:0001583	missense	0			Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.3596G>C	20.37:g.58444998C>G	ENSP00000350162:p.Arg1199Thr		A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Missense_Mutation	SNP	NULL	p.R1199T	ENST00000357552.3	37	c.3596	CCDS13482.1	20	.	.	.	.	.	.	.	.	.	.	C	4.426	0.078816	0.08533	.	.	ENSG00000196074	ENST00000371001;ENST00000357552	T;T	0.13420	2.59;2.59	4.75	-9.51	0.00581	.	1.633760	0.03560	N	0.226890	T	0.03871	0.0109	N	0.04959	-0.14	0.09310	N	1	B	0.27732	0.187	B	0.24155	0.051	T	0.30765	-0.9967	10	0.10636	T	0.68	1.5525	2.2904	0.04137	0.5153:0.1594:0.0983:0.2269	.	1199	Q9BX26	SYCP2_HUMAN	T	1199	ENSP00000360040:R1199T;ENSP00000350162:R1199T	ENSP00000350162:R1199T	R	-	2	0	SYCP2	57878393	0.008000	0.16893	0.000000	0.03702	0.007000	0.05969	-0.083000	0.11286	-1.413000	0.02027	-0.251000	0.11542	AGA	SYCP2	-	NULL	ENSG00000196074		0.328	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP2	HGNC	protein_coding	OTTHUMT00000079930.3	369	0.00	0	C	NM_014258		58444998	58444998	-1	no_errors	ENST00000357552	ensembl	human	known	69_37n	missense	524	11.49	68	SNP	0.000	G
SYNPO	11346	genome.wustl.edu	37	5	150028362	150028362	+	Silent	SNP	G	G	A			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr5:150028362G>A	ENST00000394243.1	+	3	1631	c.1257G>A	c.(1255-1257)acG>acA	p.T419T	SYNPO_ENST00000518872.1_3'UTR|SYNPO_ENST00000522122.1_Silent_p.T419T|SYNPO_ENST00000519664.1_Silent_p.T175T|SYNPO_ENST00000307662.4_Silent_p.T175T	NM_001166208.1	NP_001159680.1	Q8N3V7	SYNPO_HUMAN	synaptopodin	419					positive regulation of actin filament bundle assembly (GO:0032233)|regulation of stress fiber assembly (GO:0051492)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic membrane (GO:0045211)|stress fiber (GO:0001725)|tight junction (GO:0005923)	actin binding (GO:0003779)			NS(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(4)|prostate(1)|urinary_tract(2)	18		Medulloblastoma(196;0.134)|all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GAGAAGCTACGCTCATCCCCA	0.562																																						dbGAP											0													157.0	171.0	166.0					5																	150028362		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF499137	CCDS4308.1, CCDS54937.1, CCDS54938.1	5q33.1	2008-02-05			ENSG00000171992	ENSG00000171992			30672	protein-coding gene	gene with protein product		608155				9314539, 10470851	Standard	NM_007286		Approved	KIAA1029	uc003lsn.3	Q8N3V7	OTTHUMG00000130078	ENST00000394243.1:c.1257G>A	5.37:g.150028362G>A			A5PKZ8|D3DQG8|O15271|Q9UPX1	Silent	SNP	NULL	p.T419	ENST00000394243.1	37	c.1257	CCDS54937.1	5																																																																																			SYNPO	-	NULL	ENSG00000171992		0.562	SYNPO-002	KNOWN	basic|CCDS	protein_coding	SYNPO	HGNC	protein_coding	OTTHUMT00000252371.1	170	0.58	1	G	NM_007286		150028362	150028362	+1	no_errors	ENST00000394243	ensembl	human	known	69_37n	silent	121	18.54	28	SNP	0.000	A
THRA	7067	genome.wustl.edu	37	17	38230773	38230773	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr17:38230773G>T	ENST00000264637.4	+	2	612	c.32G>T	c.(31-33)gGg>gTg	p.G11V	THRA_ENST00000584985.1_Missense_Mutation_p.G11V|THRA_ENST00000546243.1_Missense_Mutation_p.G11V|THRA_ENST00000450525.2_Missense_Mutation_p.G11V|THRA_ENST00000394121.4_Missense_Mutation_p.G11V	NM_003250.5	NP_003241.2	P10827	THA_HUMAN	thyroid hormone receptor, alpha	11	Modulating.				cartilage condensation (GO:0001502)|cytoplasmic sequestering of transcription factor (GO:0042994)|erythrocyte differentiation (GO:0030218)|female courtship behavior (GO:0008050)|gene expression (GO:0010467)|hormone-mediated signaling pathway (GO:0009755)|learning or memory (GO:0007611)|negative regulation of DNA-templated transcription, initiation (GO:2000143)|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0017055)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of female receptivity (GO:0045925)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart contraction (GO:0008016)|regulation of lipid catabolic process (GO:0050994)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of thyroid hormone mediated signaling pathway (GO:0002155)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cold (GO:0009409)|thyroid gland development (GO:0030878)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Type I pneumocyte differentiation (GO:0060509)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|steroid receptor RNA activator RNA binding (GO:0002153)|TBP-class protein binding (GO:0017025)|thyroid hormone binding (GO:0070324)|thyroid hormone receptor activity (GO:0004887)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(3)|large_intestine(2)|lung(4)|prostate(1)	11	Colorectal(19;0.000442)	Myeloproliferative disorder(1115;0.0255)			Dextrothyroxine(DB00509)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	GTGGAGTGTGGGTCAGACCCA	0.582																																						dbGAP											0													193.0	163.0	173.0					17																	38230773		2203	4300	6503	-	-	-	SO:0001583	missense	0			J03239	CCDS11360.1, CCDS42316.1, CCDS58546.1	17q21.1	2013-01-16	2011-05-19		ENSG00000126351	ENSG00000126351		"""Nuclear hormone receptors"""	11796	protein-coding gene	gene with protein product		190120	"""thyroid hormone receptor, alpha (avian erythroblastic leukemia viral (v-erb-a) oncogene homolog)"", ""thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian)"""	THRA1, THRA2, ERBA1		6323162, 6589608	Standard	NM_003250		Approved	EAR-7.1/EAR-7.2, THRA3, AR7, ERBA, NR1A1	uc002htw.3	P10827	OTTHUMG00000133332	ENST00000264637.4:c.32G>T	17.37:g.38230773G>T	ENSP00000264637:p.Gly11Val		A8K3B5|P21205|Q8N6A1|Q96H73	Missense_Mutation	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_ThyrH_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.G11V	ENST00000264637.4	37	c.32	CCDS11360.1	17	.	.	.	.	.	.	.	.	.	.	G	12.93	2.085143	0.36758	.	.	ENSG00000126351	ENST00000394121;ENST00000264637;ENST00000450525;ENST00000546243	D;D;D;D	0.93307	-3.1;-3.1;-3.2;-3.2	4.03	4.03	0.46877	.	0.311947	0.22048	U	0.065350	D	0.82554	0.5062	N	0.08118	0	0.54753	D	0.999985	P;B;B	0.35982	0.531;0.244;0.074	B;B;B	0.28709	0.093;0.08;0.023	D	0.83931	0.0306	10	0.62326	D	0.03	.	9.5258	0.39162	0.0:0.0:0.7323:0.2677	.	11;11;11	P10827-3;P10827;Q6FH41	.;THA_HUMAN;.	V	11	ENSP00000377679:G11V;ENSP00000264637:G11V;ENSP00000395641:G11V;ENSP00000443972:G11V	ENSP00000264637:G11V	G	+	2	0	THRA	35484299	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	2.558000	0.45879	2.243000	0.73865	0.407000	0.27541	GGG	THRA	-	NULL	ENSG00000126351		0.582	THRA-001	KNOWN	basic|CCDS	protein_coding	THRA	HGNC	protein_coding	OTTHUMT00000257160.2	205	0.96	2	G			38230773	38230773	+1	no_errors	ENST00000264637	ensembl	human	known	69_37n	missense	691	25.35	235	SNP	1.000	T
UTP14A	10813	genome.wustl.edu	37	X	129063526	129063526	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chrX:129063526A>T	ENST00000394422.3	+	15	2286	c.2258A>T	c.(2257-2259)aAt>aTt	p.N753I	UTP14A_ENST00000425117.2_Missense_Mutation_p.N701I|UTP14A_ENST00000371042.3_Missense_Mutation_p.N585I|UTP14A_ENST00000371051.5_Missense_Mutation_p.N699I|RP4-537K23.4_ENST00000432062.1_RNA	NM_006649.3	NP_006640.2	Q9BVJ6	UT14A_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)	753					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(16)|ovary(3)|urinary_tract(1)	32						ATACAGAGGAATCCAAAACGA	0.498																																						dbGAP											0													121.0	104.0	109.0					X																	129063526		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF039694	CCDS14615.1, CCDS55489.1	Xq26.1	2009-01-15	2004-06-01	2004-06-01	ENSG00000156697	ENSG00000156697			10665	protein-coding gene	gene with protein product		300508	"""serologically defined colon cancer antigen 16"""	SDCCAG16		9610721, 16354793	Standard	NM_006649		Approved	NY-CO-16	uc004euz.3	Q9BVJ6	OTTHUMG00000022378	ENST00000394422.3:c.2258A>T	X.37:g.129063526A>T	ENSP00000377944:p.Asn753Ile		A8K7A3|A8MVQ1|B4DQ08|E9PEL7|Q5JYF1	Missense_Mutation	SNP	pfam_SSU_processome_Utp14	p.N753I	ENST00000394422.3	37	c.2258	CCDS14615.1	X	.	.	.	.	.	.	.	.	.	.	-	9.072	0.997182	0.19043	.	.	ENSG00000156697	ENST00000425117;ENST00000394422;ENST00000371051;ENST00000371042	T;T;T;T	0.31769	2.22;2.22;2.22;1.48	4.59	4.59	0.56863	.	0.889113	0.09819	N	0.751813	T	0.32010	0.0815	M	0.64997	1.995	0.09310	N	1	B;B;B	0.15473	0.012;0.013;0.007	B;B;B	0.18561	0.022;0.009;0.01	T	0.21449	-1.0245	10	0.46703	T	0.11	-6.2922	7.3304	0.26580	0.8977:0.0:0.1023:0.0	.	699;701;753	F8WD00;E9PEL7;Q9BVJ6	.;.;UT14A_HUMAN	I	701;753;699;585	ENSP00000388669:N701I;ENSP00000377944:N753I;ENSP00000360090:N699I;ENSP00000360081:N585I	ENSP00000360081:N585I	N	+	2	0	UTP14A	128891207	0.935000	0.31712	0.895000	0.35142	0.375000	0.29983	1.494000	0.35616	1.641000	0.50575	0.474000	0.43551	AAT	UTP14A	-	NULL	ENSG00000156697		0.498	UTP14A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UTP14A	HGNC	protein_coding	OTTHUMT00000058221.1	260	0.00	0	A	NM_006649		129063526	129063526	+1	no_errors	ENST00000394422	ensembl	human	known	69_37n	missense	188	10.90	23	SNP	0.132	T
WDFY3	23001	genome.wustl.edu	37	4	85642669	85642669	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr4:85642669C>T	ENST00000295888.4	-	47	7905	c.7498G>A	c.(7498-7500)Gag>Aag	p.E2500K	WDFY3_ENST00000322366.6_Missense_Mutation_p.E2483K	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	2500	Sufficient for translocalization to p62 bodies/ALIS.				aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		TCCTGGTTCTCCTCATCTCCT	0.502																																						dbGAP											0													148.0	133.0	138.0					4																	85642669		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.7498G>A	4.37:g.85642669C>T	ENSP00000295888:p.Glu2500Lys		Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_Znf_FYVE,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Znf_FYVE_PHD,superfamily_ConA-like_lec_gl,superfamily_Cyclin-like,superfamily_ARM-type_fold,smart_WD40_repeat,smart_Znf_FYVE,pfscan_BEACH_dom,pfscan_Znf_FYVE-rel,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E2500K	ENST00000295888.4	37	c.7498	CCDS3609.1	4	.	.	.	.	.	.	.	.	.	.	C	25.0	4.592417	0.86953	.	.	ENSG00000163625	ENST00000322366;ENST00000295888;ENST00000514711	T;T;T	0.65364	-0.15;-0.09;-0.06	5.77	5.77	0.91146	.	0.044991	0.85682	D	0.000000	T	0.57548	0.2061	L	0.43152	1.355	0.80722	D	1	B	0.23937	0.094	B	0.16722	0.016	T	0.49661	-0.8916	10	0.29301	T	0.29	.	20.3559	0.98840	0.0:1.0:0.0:0.0	.	2500	Q8IZQ1	WDFY3_HUMAN	K	2483;2500;103	ENSP00000318466:E2483K;ENSP00000295888:E2500K;ENSP00000424987:E103K	ENSP00000295888:E2500K	E	-	1	0	WDFY3	85861693	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.445000	0.80570	2.890000	0.99128	0.585000	0.79938	GAG	WDFY3	-	NULL	ENSG00000163625		0.502	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY3	HGNC	protein_coding	OTTHUMT00000252811.2	327	0.00	0	C	NM_014991		85642669	85642669	-1	no_errors	ENST00000295888	ensembl	human	known	69_37n	missense	253	21.67	70	SNP	1.000	T
WDR36	134430	genome.wustl.edu	37	5	110447003	110447003	+	Intron	SNP	C	C	A			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr5:110447003C>A	ENST00000513710.2	+	15	1888				WDR36_ENST00000506538.2_Intron|WDR36_ENST00000505303.1_Missense_Mutation_p.T581N			Q8NI36	WDR36_HUMAN	WD repeat domain 36						regulation of axon extension (GO:0030516)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|rRNA processing (GO:0006364)|visual perception (GO:0007601)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(9)|kidney(4)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)		ACTAATAAAACTTGACTCATT	0.318																																						dbGAP											0													62.0	67.0	66.0					5																	110447003		2202	4297	6499	-	-	-	SO:0001627	intron_variant	0			AF385437	CCDS4102.1	5q22.2	2013-01-09			ENSG00000134987	ENSG00000134987		"""WD repeat domain containing"""	30696	protein-coding gene	gene with protein product		609669	"""glaucoma 1, open angle, G"""	GLC1G		15590835, 15677485	Standard	NM_139281		Approved	TA-WDRP, UTP21	uc003kpd.3	Q8NI36	OTTHUMG00000128790	ENST00000513710.2:c.1884+26C>A	5.37:g.110447003C>A			A2RUS4|Q68E02|Q8N1Q2	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T581N	ENST00000513710.2	37	c.1742	CCDS4102.1	5	.	.	.	.	.	.	.	.	.	.	C	7.041	0.562614	0.13498	.	.	ENSG00000134987	ENST00000505303	T	0.58210	0.35	4.75	-0.759	0.11045	.	.	.	.	.	T	0.35624	0.0938	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.27706	-1.0066	5	.	.	.	.	3.8113	0.08798	0.124:0.2539:0.4622:0.1599	.	.	.	.	N	581	ENSP00000422158:T581N	.	T	+	2	0	WDR36	110474902	0.000000	0.05858	0.003000	0.11579	0.094000	0.18550	-1.071000	0.03437	0.013000	0.14918	0.555000	0.69702	ACT	WDR36	-	NULL	ENSG00000134987		0.318	WDR36-008	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	WDR36	HGNC	protein_coding	OTTHUMT00000373504.3	115	0.00	0	C	NM_139281		110447003	110447003	+1	no_errors	ENST00000505303	ensembl	human	novel	69_37n	missense	70	21.35	19	SNP	0.000	A
XKR3	150165	genome.wustl.edu	37	22	17288863	17288863	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr22:17288863G>T	ENST00000331428.5	-	2	203	c.101C>A	c.(100-102)cCt>cAt	p.P34H		NM_175878.3	NP_787074.2	Q5GH77	XKR3_HUMAN	XK, Kell blood group complex subunit-related family, member 3	34						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(6)|ovary(1)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				AATGCTAAAAGGAAAGCTTAG	0.393																																						dbGAP											0													116.0	112.0	114.0					22																	17288863		1884	4109	5993	-	-	-	SO:0001583	missense	0			AY989815	CCDS42975.1	22q11.1	2007-01-16	2006-01-12		ENSG00000172967	ENSG00000172967			28778	protein-coding gene	gene with protein product		611674	"""X Kell blood group precursor-related family, member 3"""			16431037	Standard	NM_175878		Approved	MGC57211, XTES	uc002zlv.3	Q5GH77	OTTHUMG00000143726	ENST00000331428.5:c.101C>A	22.37:g.17288863G>T	ENSP00000331704:p.Pro34His		B2RPN1|Q52PG8|Q8N7E1	Missense_Mutation	SNP	pfam_Transport_prot_XK	p.P34H	ENST00000331428.5	37	c.101	CCDS42975.1	22	.	.	.	.	.	.	.	.	.	.	.	11.87	1.768428	0.31320	.	.	ENSG00000172967	ENST00000331428	T	0.73575	-0.76	0.539	0.539	0.17156	.	0.000000	0.64402	U	0.000001	T	0.79281	0.4419	L	0.57536	1.79	0.28571	N	0.910608	D	0.89917	1.0	D	0.81914	0.995	T	0.69833	-0.5038	10	0.72032	D	0.01	.	7.0016	0.24813	1.0E-4:0.0:0.9999:0.0	.	34	Q5GH77	XKR3_HUMAN	H	34	ENSP00000331704:P34H	ENSP00000331704:P34H	P	-	2	0	XKR3	15668863	0.981000	0.34729	0.047000	0.18901	0.044000	0.14063	1.429000	0.34903	0.580000	0.29522	0.297000	0.19635	CCT	XKR3	-	NULL	ENSG00000172967		0.393	XKR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XKR3	HGNC	protein_coding	OTTHUMT00000289789.1	194	0.00	0	G	NM_175878		17288863	17288863	-1	no_errors	ENST00000331428	ensembl	human	known	69_37n	missense	123	21.15	33	SNP	0.709	T
ZNF483	158399	genome.wustl.edu	37	9	114305318	114305318	+	Silent	SNP	T	T	C			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr9:114305318T>C	ENST00000309235.5	+	6	2261	c.2103T>C	c.(2101-2103)agT>agC	p.S701S	ZNF483_ENST00000358151.4_Intron	NM_133464.2	NP_597721.2	Q8TF39	ZN483_HUMAN	zinc finger protein 483	701					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(11)|ovary(1)|skin(5)	31						CAACCTTTAGTCGAAGCTCAA	0.403																																						dbGAP											0													75.0	74.0	74.0					9																	114305318		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB075842	CCDS35105.1, CCDS35106.1	9q32	2013-01-09			ENSG00000173258	ENSG00000173258		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23384	protein-coding gene	gene with protein product							Standard	NM_001007169		Approved	ZKSCAN16, KIAA1962, ZSCAN48	uc004bff.2	Q8TF39	OTTHUMG00000020490	ENST00000309235.5:c.2103T>C	9.37:g.114305318T>C			Q5VZN2|Q8NAE1	Silent	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.S701	ENST00000309235.5	37	c.2103	CCDS35106.1	9																																																																																			ZNF483	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000173258		0.403	ZNF483-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF483	HGNC	protein_coding	OTTHUMT00000053641.1	106	0.00	0	T	XM_088567		114305318	114305318	+1	no_errors	ENST00000309235	ensembl	human	known	69_37n	silent	68	26.88	25	SNP	0.201	C
ZSWIM4	65249	genome.wustl.edu	37	19	13941680	13941680	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr19:13941680C>T	ENST00000254323.2	+	13	2975	c.2786C>T	c.(2785-2787)tCg>tTg	p.S929L	ZSWIM4_ENST00000440752.2_Missense_Mutation_p.S763L	NM_023072.2	NP_075560.2	Q9H7M6	ZSWM4_HUMAN	zinc finger, SWIM-type containing 4	929							zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27			OV - Ovarian serous cystadenocarcinoma(19;2.94e-23)|Epithelial(5;4.58e-19)			ACCAGCCACTCGCGCCTCACG	0.697																																						dbGAP											0													35.0	37.0	36.0					19																	13941680		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK022283	CCDS32924.1	19p13.13	2012-02-23			ENSG00000132003	ENSG00000132003		"""Zinc fingers, SWIM-type"""	25704	protein-coding gene	gene with protein product							Standard	NM_023072		Approved	FLJ12221	uc002mxh.1	Q9H7M6		ENST00000254323.2:c.2786C>T	19.37:g.13941680C>T	ENSP00000254323:p.Ser929Leu			Missense_Mutation	SNP	pfscan_Znf_SWIM	p.S929L	ENST00000254323.2	37	c.2786	CCDS32924.1	19	.	.	.	.	.	.	.	.	.	.	C	20.4	3.981719	0.74474	.	.	ENSG00000132003	ENST00000254323;ENST00000440752	T;T	0.49432	0.78;0.78	4.37	3.3	0.37823	.	0.000000	0.56097	D	0.000033	T	0.64560	0.2609	M	0.72894	2.215	0.46437	D	0.999047	D;P	0.76494	0.999;0.879	D;P	0.77557	0.99;0.653	T	0.64748	-0.6334	10	0.49607	T	0.09	-12.7358	11.7645	0.51922	0.0:0.82:0.18:0.0	.	763;929	E7ERX2;Q9H7M6	.;ZSWM4_HUMAN	L	929;763	ENSP00000254323:S929L;ENSP00000405278:S763L	ENSP00000254323:S929L	S	+	2	0	ZSWIM4	13802680	1.000000	0.71417	0.973000	0.42090	0.753000	0.42808	5.425000	0.66470	0.776000	0.33473	0.491000	0.48974	TCG	ZSWIM4	-	NULL	ENSG00000132003		0.697	ZSWIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSWIM4	HGNC	protein_coding	OTTHUMT00000457457.1	45	0.00	0	C	XM_031342		13941680	13941680	+1	no_errors	ENST00000254323	ensembl	human	known	69_37n	missense	25	32.43	12	SNP	0.997	T
ZNF530	348327	genome.wustl.edu	37	19	58117885	58117885	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A14V-01A-11D-A12B-09	TCGA-E2-A14V-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	703314fe-bfd5-45d5-9ed5-fcdce8a19fd6	e49f6bc1-0933-4500-9068-aa7d8c276b22	g.chr19:58117885C>A	ENST00000332854.6	+	3	1212	c.992C>A	c.(991-993)tCt>tAt	p.S331Y	ZNF530_ENST00000597864.1_Intron	NM_020880.3	NP_065931.3	Q6P9A1	ZN530_HUMAN	zinc finger protein 530	331					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(6)|skin(1)	20		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0443)|Breast(46;0.0848)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		TGTGGGAAATCTTTTAGCCAC	0.463																																						dbGAP											0													111.0	102.0	105.0					19																	58117885		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK096831	CCDS12955.1	19q13.43	2013-01-08				ENSG00000183647		"""Zinc fingers, C2H2-type"", ""-"""	29297	protein-coding gene	gene with protein product						10819331	Standard	NM_020880		Approved	KIAA1508	uc002qpk.2	Q6P9A1		ENST00000332854.6:c.992C>A	19.37:g.58117885C>A	ENSP00000332861:p.Ser331Tyr		O43340|Q9P220	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S331Y	ENST00000332854.6	37	c.992	CCDS12955.1	19	.	.	.	.	.	.	.	.	.	.	C	11.17	1.560160	0.27827	.	.	ENSG00000183647	ENST00000332854	T	0.51574	0.7	2.39	-1.91	0.07641	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.60715	0.2290	M	0.76938	2.355	0.09310	N	1	D	0.76494	0.999	D	0.70716	0.97	T	0.51317	-0.8721	9	0.87932	D	0	.	4.3595	0.11196	0.0:0.3536:0.3352:0.3112	.	331	Q6P9A1	ZN530_HUMAN	Y	331	ENSP00000332861:S331Y	ENSP00000332861:S331Y	S	+	2	0	ZNF530	62809697	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	-4.481000	0.00227	-0.203000	0.10251	-0.222000	0.12452	TCT	ZNF530	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000183647		0.463	ZNF530-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF530	HGNC	protein_coding	OTTHUMT00000466797.1	272	0.00	0	C	NM_020880		58117885	58117885	+1	no_errors	ENST00000332854	ensembl	human	known	69_37n	missense	180	22.75	53	SNP	0.000	A
