#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACSM4	341392	genome.wustl.edu	37	12	7475135	7475135	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr12:7475135G>T	ENST00000399422.4	+	7	1171	c.1123G>T	c.(1123-1125)Gtg>Ttg	p.V375L		NM_001080454.1	NP_001073923.1	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4	375					acyl-CoA metabolic process (GO:0006637)|fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty-acyl-CoA synthase activity (GO:0004321)|metal ion binding (GO:0046872)			endometrium(6)|kidney(1)|lung(14)	21						ACAGACGGAAGTGGTATATCT	0.527																																						dbGAP											0													82.0	83.0	82.0					12																	7475135		1936	4135	6071	-	-	-	SO:0001583	missense	0				CCDS44825.1	12p13.31	2008-06-12			ENSG00000215009	ENSG00000215009		"""Acyl-CoA synthetase family"""	32016	protein-coding gene	gene with protein product	"""similar to olfactory specific medium-chain acyl CoA synthetase"""	614360				17762044	Standard	NM_001080454		Approved		uc001qsx.1	P0C7M7	OTTHUMG00000154975	ENST00000399422.4:c.1123G>T	12.37:g.7475135G>T	ENSP00000382349:p.Val375Leu		A8MTI6	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.V375L	ENST00000399422.4	37	c.1123	CCDS44825.1	12	.	.	.	.	.	.	.	.	.	.	G	13.42	2.230748	0.39399	.	.	ENSG00000215009	ENST00000399422	T	0.40476	1.03	3.4	2.49	0.30216	AMP-dependent synthetase/ligase (1);	0.497413	0.14784	U	0.298657	T	0.26629	0.0651	N	0.14661	0.345	0.27114	N	0.962293	P	0.42161	0.772	B	0.44044	0.439	T	0.08493	-1.0719	10	0.56958	D	0.05	0.2013	4.2087	0.10502	0.1222:0.0:0.6467:0.2311	.	375	P0C7M7	ACSM4_HUMAN	L	375	ENSP00000382349:V375L	ENSP00000382349:V375L	V	+	1	0	ACSM4	7366402	0.063000	0.20901	0.995000	0.50966	0.599000	0.36880	0.985000	0.29578	0.747000	0.32809	0.563000	0.77884	GTG	ACSM4	-	pfam_AMP-dep_Synth/Lig	ENSG00000215009		0.527	ACSM4-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	ACSM4	HGNC	protein_coding	OTTHUMT00000337866.2	317	0.00	0	G	NM_001080454		7475135	7475135	+1	no_errors	ENST00000399422	ensembl	human	novel	69_37n	missense	228	32.74	111	SNP	1.000	T
ADAM30	11085	genome.wustl.edu	37	1	120438621	120438621	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr1:120438621C>A	ENST00000369400.1	-	1	497	c.339G>T	c.(337-339)atG>atT	p.M113I		NM_021794.3	NP_068566.2	Q9UKF2	ADA30_HUMAN	ADAM metallopeptidase domain 30	113					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(11)|lung(16)|ovary(2)|skin(2)	38	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;1.55e-06)|Lung NSC(69;1.04e-05)|all_epithelial(167;0.00138)		Lung(183;0.0204)|LUSC - Lung squamous cell carcinoma(189;0.117)		TCACGGAGCCCATGTAGTTGC	0.473																																						dbGAP											0													66.0	66.0	66.0					1																	120438621		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF171932	CCDS907.1	1p12	2012-05-16	2005-08-18		ENSG00000134249	ENSG00000134249		"""ADAM metallopeptidase domain containing"""	208	protein-coding gene	gene with protein product		604779	"""a disintegrin and metalloproteinase domain 30"""				Standard	NM_021794		Approved	svph4	uc001eij.3	Q9UKF2	OTTHUMG00000012176	ENST00000369400.1:c.339G>T	1.37:g.120438621C>A	ENSP00000358407:p.Met113Ile		A8K8W8|Q5T3X6|Q9UKF1	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.M113I	ENST00000369400.1	37	c.339	CCDS907.1	1	.	.	.	.	.	.	.	.	.	.	C	7.428	0.638138	0.14386	.	.	ENSG00000134249	ENST00000369400;ENST00000543066	T	0.05649	3.41	4.34	-0.00199	0.14031	Peptidase M12B, propeptide (1);	1.451360	0.04737	U	0.422084	T	0.00936	0.0031	N	0.05441	-0.05	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.47484	-0.9114	10	0.29301	T	0.29	.	3.923	0.09251	0.0:0.4828:0.1798:0.3374	.	113	Q9UKF2	ADA30_HUMAN	I	113	ENSP00000358407:M113I	ENSP00000358407:M113I	M	-	3	0	ADAM30	120240144	0.007000	0.16637	0.190000	0.23270	0.163000	0.22366	-0.136000	0.10405	0.078000	0.16900	0.462000	0.41574	ATG	ADAM30	-	pfam_Peptidase_M12B_N	ENSG00000134249		0.473	ADAM30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM30	HGNC	protein_coding	OTTHUMT00000033678.1	155	0.00	0	C	NM_021794		120438621	120438621	-1	no_errors	ENST00000369400	ensembl	human	known	69_37n	missense	136	29.90	58	SNP	0.031	A
AKTIP	64400	genome.wustl.edu	37	16	53534164	53534164	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr16:53534164G>C	ENST00000394657.7	-	2	182	c.8C>G	c.(7-9)cCt>cGt	p.P3R	AKTIP_ENST00000300245.4_Missense_Mutation_p.P3R|AKTIP_ENST00000570004.1_Missense_Mutation_p.P3R	NM_001012398.1|NM_022476.2	NP_001012398.1|NP_071921.1	Q9H8T0	AKTIP_HUMAN	AKT interacting protein	3					apoptotic process (GO:0006915)|early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|protein transport (GO:0015031)	FHF complex (GO:0070695)|plasma membrane (GO:0005886)	acid-amino acid ligase activity (GO:0016881)			large_intestine(1)|lung(2)|prostate(2)	5		all_cancers(37;0.14)				GCTCCAGAAAGGGTTCATAAC	0.388																																						dbGAP											0													131.0	113.0	119.0					16																	53534164		2198	4300	6498	-	-	-	SO:0001583	missense	0			AK023320	CCDS10749.1	16q12.2	2010-01-14	2007-01-16	2007-01-16	ENSG00000166971	ENSG00000166971		"""Ubiquitin-conjugating enzymes E2"""	16710	protein-coding gene	gene with protein product		608483	"""fused toes (mouse) homolog"", ""fused toes homolog (mouse)"""	FTS		7818539, 8626685	Standard	XM_005256094		Approved	FLJ13258	uc002ehl.3	Q9H8T0	OTTHUMG00000133199	ENST00000394657.7:c.8C>G	16.37:g.53534164G>C	ENSP00000378152:p.Pro3Arg		Q503B1|Q53H38	Missense_Mutation	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.P3R	ENST00000394657.7	37	c.8	CCDS10749.1	16	.	.	.	.	.	.	.	.	.	.	G	17.95	3.512687	0.64522	.	.	ENSG00000166971	ENST00000394657;ENST00000300245	D;D	0.84370	-1.84;-1.84	5.67	5.67	0.87782	.	0.046228	0.85682	D	0.000000	D	0.90960	0.7158	L	0.56769	1.78	0.80722	D	1	D;P;P	0.71674	0.998;0.944;0.906	D;P;P	0.64595	0.927;0.714;0.521	D	0.91076	0.4896	10	0.87932	D	0	-6.3458	20.1169	0.97940	0.0:0.0:1.0:0.0	.	3;3;3	B4E0S4;Q9H8T0-2;Q9H8T0	.;.;AKTIP_HUMAN	R	3	ENSP00000378152:P3R;ENSP00000300245:P3R	ENSP00000300245:P3R	P	-	2	0	AKTIP	52091665	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.017000	0.93651	2.835000	0.97688	0.591000	0.81541	CCT	AKTIP	-	NULL	ENSG00000166971		0.388	AKTIP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	AKTIP	HGNC	protein_coding	OTTHUMT00000256909.4	341	0.00	0	G	NM_022476		53534164	53534164	-1	no_errors	ENST00000300245	ensembl	human	known	69_37n	missense	357	26.99	132	SNP	1.000	C
ARFGAP2	84364	genome.wustl.edu	37	11	47193042	47193042	+	Silent	SNP	T	T	G			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr11:47193042T>G	ENST00000524782.1	-	10	1104	c.876A>C	c.(874-876)ctA>ctC	p.L292L	ARFGAP2_ENST00000426335.2_Silent_p.L156L|ARFGAP2_ENST00000419701.2_Silent_p.L185L|RP11-390K5.6_ENST00000524412.1_RNA|ARFGAP2_ENST00000395449.3_5'UTR|ARFGAP2_ENST00000319543.6_Silent_p.L23L	NM_001242832.1|NM_032389.4	NP_001229761.1|NP_115765.2	Q8N6H7	ARFG2_HUMAN	ADP-ribosylation factor GTPase activating protein 2	292	Required for interaction with coatomer.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			breast(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						CCAGATTCTGTAGCTTCTTTT	0.567																																						dbGAP											0													253.0	245.0	247.0					11																	47193042		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0			AK027482	CCDS7926.1, CCDS73283.1	11p11.2-p11.12	2012-10-05	2008-01-09	2008-01-09	ENSG00000149182	ENSG00000149182		"""ADP-ribosylation factor GTPase activating proteins"""	13504	protein-coding gene	gene with protein product		606908	"""zinc finger protein 289, ID1 regulated"""	ZNF289		11278321, 14690497	Standard	NM_032389		Approved	IRZ, Zfp289, FLJ14576	uc001ndt.3	Q8N6H7	OTTHUMG00000166773	ENST00000524782.1:c.876A>C	11.37:g.47193042T>G			B4DX29|B7Z9M7|D3DQQ9|Q3LIF2|Q8N3I1|Q96SX7	Missense_Mutation	SNP	NULL	p.T23P	ENST00000524782.1	37	c.67	CCDS7926.1	11	.	.	.	.	.	.	.	.	.	.	T	7.208	0.594821	0.13875	.	.	ENSG00000149182	ENST00000527776	.	.	.	5.66	-11.3	0.00108	.	.	.	.	.	T	0.43299	0.1241	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54234	-0.8324	4	.	.	.	-10.0039	7.3942	0.26927	0.1099:0.3312:0.449:0.1099	.	.	.	.	P	23	.	.	T	-	1	0	ARFGAP2	47149618	0.004000	0.15560	0.407000	0.26434	0.705000	0.40729	-1.351000	0.02622	-2.501000	0.00510	-0.972000	0.02603	ACA	ARFGAP2	-	NULL	ENSG00000149182		0.567	ARFGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFGAP2	HGNC	protein_coding	OTTHUMT00000391425.1	698	0.00	0	T	NM_032389		47193042	47193042	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000527776	ensembl	human	novel	69_37n	missense	54	82.18	249	SNP	0.521	G
ARID1B	57492	genome.wustl.edu	37	6	157522383	157522383	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr6:157522383G>A	ENST00000350026.5	+	17	4617	c.4616G>A	c.(4615-4617)aGg>aAg	p.R1539K	ARID1B_ENST00000275248.4_Missense_Mutation_p.R1534K|ARID1B_ENST00000367148.1_Missense_Mutation_p.R1592K|ARID1B_ENST00000346085.5_Missense_Mutation_p.R1552K	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1539	Pro-rich.				chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		CACATCTCCAGGGCGCCCAGC	0.597																																						dbGAP											0													131.0	128.0	129.0					6																	157522383		2203	4296	6499	-	-	-	SO:0001583	missense	0			AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.4616G>A	6.37:g.157522383G>A	ENSP00000055163:p.Arg1539Lys		Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Missense_Mutation	SNP	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.R1592K	ENST00000350026.5	37	c.4775	CCDS5251.2	6	.	.	.	.	.	.	.	.	.	.	G	17.91	3.503579	0.64298	.	.	ENSG00000049618	ENST00000346085;ENST00000350026;ENST00000367148;ENST00000275248;ENST00000414678	T;T;T;T;T	0.02067	4.8;4.8;4.8;4.8;4.47	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	T	0.02304	0.0071	L	0.44542	1.39	0.45108	D	0.998126	P;P;P	0.51147	0.905;0.942;0.942	B;P;P	0.47299	0.292;0.543;0.487	T	0.65425	-0.6171	10	0.39692	T	0.17	.	18.5459	0.91045	0.0:0.0:1.0:0.0	.	1539;1552;1534	Q8NFD5;Q8NFD5-2;G3XAA0	ARI1B_HUMAN;.;.	K	1552;1539;1592;1534;1061	ENSP00000344546:R1552K;ENSP00000055163:R1539K;ENSP00000356116:R1592K;ENSP00000275248:R1534K;ENSP00000412835:R1061K	ENSP00000275248:R1534K	R	+	2	0	ARID1B	157564075	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.241000	0.58707	2.459000	0.83118	0.655000	0.94253	AGG	ARID1B	-	NULL	ENSG00000049618		0.597	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARID1B	HGNC	protein_coding	OTTHUMT00000372723.1	174	0.00	0	G	NM_020732		157522383	157522383	+1	no_errors	ENST00000367148	ensembl	human	known	69_37n	missense	17	82.83	82	SNP	1.000	A
ASPM	259266	genome.wustl.edu	37	1	197073197	197073197	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr1:197073197C>A	ENST00000367409.4	-	18	5440	c.5184G>T	c.(5182-5184)atG>atT	p.M1728I	ASPM_ENST00000367408.1_Intron|ASPM_ENST00000294732.7_Intron	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	1728	IQ 6. {ECO:0000255|PROSITE- ProRule:PRU00116}.				developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						AAGATTCCCGCATCTGCATAT	0.368																																						dbGAP											0													127.0	127.0	127.0					1																	197073197		2202	4299	6501	-	-	-	SO:0001583	missense	0			AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.5184G>T	1.37:g.197073197C>A	ENSP00000356379:p.Met1728Ile		Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_CH-domain,superfamily_ARM-type_fold,smart_CH-domain,smart_IQ_motif_EF-hand-BS,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS	p.M1728I	ENST00000367409.4	37	c.5184	CCDS1389.1	1	.	.	.	.	.	.	.	.	.	.	C	9.895	1.205210	0.22205	.	.	ENSG00000066279	ENST00000367409	T	0.69306	-0.39	5.98	1.42	0.22433	.	1.075230	0.07082	N	0.837298	T	0.60843	0.2300	M	0.67953	2.075	0.24740	N	0.993044	B	0.22276	0.067	B	0.24394	0.053	T	0.45483	-0.9258	10	0.22706	T	0.39	.	4.8288	0.13430	0.1081:0.5895:0.1058:0.1966	.	1728	Q8IZT6	ASPM_HUMAN	I	1728	ENSP00000356379:M1728I	ENSP00000356379:M1728I	M	-	3	0	ASPM	195339820	0.842000	0.29525	0.067000	0.19924	0.926000	0.56050	2.119000	0.41958	0.405000	0.25532	0.585000	0.79938	ATG	ASPM	-	superfamily_ARM-type_fold,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	ENSG00000066279		0.368	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASPM	HGNC	protein_coding	OTTHUMT00000088256.1	271	0.00	0	C	NM_018136		197073197	197073197	-1	no_errors	ENST00000367409	ensembl	human	known	69_37n	missense	162	40.66	111	SNP	0.012	A
ASXL3	80816	genome.wustl.edu	37	18	31320313	31320313	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr18:31320313T>A	ENST00000269197.5	+	11	2945	c.2945T>A	c.(2944-2946)aTa>aAa	p.I982K		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	982					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						AGAGCTAGGATAGAAGATGAT	0.453																																						dbGAP											0													43.0	42.0	43.0					18																	31320313		1862	4105	5967	-	-	-	SO:0001583	missense	0			AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.2945T>A	18.37:g.31320313T>A	ENSP00000269197:p.Ile982Lys		Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD	p.I982K	ENST00000269197.5	37	c.2945	CCDS45847.1	18	.	.	.	.	.	.	.	.	.	.	T	19.75	3.885830	0.72410	.	.	ENSG00000141431	ENST00000269197	T	0.59224	0.28	5.93	5.93	0.95920	.	0.746973	0.12051	N	0.504156	T	0.74772	0.3760	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.72811	-0.4180	10	0.72032	D	0.01	.	16.3766	0.83401	0.0:0.0:0.0:1.0	.	982	Q9C0F0	ASXL3_HUMAN	K	982	ENSP00000269197:I982K	ENSP00000269197:I982K	I	+	2	0	ASXL3	29574311	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	6.959000	0.76031	2.263000	0.75096	0.533000	0.62120	ATA	ASXL3	-	NULL	ENSG00000141431		0.453	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASXL3	HGNC	protein_coding	OTTHUMT00000441865.2	151	0.00	0	T			31320313	31320313	+1	no_errors	ENST00000269197	ensembl	human	known	69_37n	missense	81	39.10	52	SNP	1.000	A
B4GALT1	2683	genome.wustl.edu	37	9	33116073	33116073	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr9:33116073A>G	ENST00000379731.4	-	4	1061	c.875T>C	c.(874-876)cTa>cCa	p.L292P	B4GALT1_ENST00000541851.1_Missense_Mutation_p.L39P|B4GALT1_ENST00000535206.1_Intron	NM_001497.3	NP_001488.2	P15291	B4GT1_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1	292				L -> S (in Ref. 5; BAA06188). {ECO:0000305}.	acute inflammatory response (GO:0002526)|angiogenesis involved in wound healing (GO:0060055)|binding of sperm to zona pellucida (GO:0007339)|branching morphogenesis of an epithelial tube (GO:0048754)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|development of secondary sexual characteristics (GO:0045136)|epithelial cell development (GO:0002064)|extracellular matrix organization (GO:0030198)|galactose metabolic process (GO:0006012)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|lactose biosynthetic process (GO:0005989)|leukocyte migration (GO:0050900)|mammary gland development (GO:0030879)|multicellular organism reproduction (GO:0032504)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|oligosaccharide biosynthetic process (GO:0009312)|penetration of zona pellucida (GO:0007341)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|regulation of acrosome reaction (GO:0060046)|regulation of cellular component movement (GO:0051270)|single fertilization (GO:0007338)|small molecule metabolic process (GO:0044281)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|desmosome (GO:0030057)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|glycocalyx (GO:0030112)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi trans cisterna (GO:0000138)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alpha-tubulin binding (GO:0043014)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|beta-tubulin binding (GO:0048487)|galactosyltransferase activity (GO:0008378)|lactose synthase activity (GO:0004461)|manganese ion binding (GO:0030145)|N-acetyllactosamine synthase activity (GO:0003945)|protein homodimerization activity (GO:0042803)|UDP-galactosyltransferase activity (GO:0035250)			endometrium(1)|large_intestine(7)|lung(4)|prostate(1)|skin(1)	14			LUSC - Lung squamous cell carcinoma(29;0.0084)	GBM - Glioblastoma multiforme(74;0.121)	N-Acetyl-D-glucosamine(DB00141)	TTGTTTACTTAGAGCAGAGAC	0.388																																						dbGAP											0													97.0	89.0	92.0					9																	33116073		2203	4300	6503	-	-	-	SO:0001583	missense	0			X14085	CCDS6535.1	9p13	2013-02-19			ENSG00000086062	ENSG00000086062	2.4.1.22	"""Beta 4-glycosyltransferases"""	924	protein-coding gene	gene with protein product		137060		GGTB2		9597550	Standard	NM_001497		Approved	beta4Gal-T1	uc003zsg.2	P15291	OTTHUMG00000019764	ENST00000379731.4:c.875T>C	9.37:g.33116073A>G	ENSP00000369055:p.Leu292Pro		B2R710|D3DRL2|Q12909|Q12910|Q12911|Q14456|Q14509|Q14523	Missense_Mutation	SNP	pfam_Galactosyl_T_2_met,prints_Galactosyl_T_2_met	p.L292P	ENST00000379731.4	37	c.875	CCDS6535.1	9	.	.	.	.	.	.	.	.	.	.	A	23.7	4.450844	0.84209	.	.	ENSG00000086062	ENST00000379731;ENST00000541701;ENST00000541851	T;T	0.37411	1.2;1.2	5.86	5.86	0.93980	.	0.121669	0.56097	D	0.000036	T	0.66177	0.2763	M	0.89030	3	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.73190	-0.4061	10	0.87932	D	0	-7.8695	14.2189	0.65812	1.0:0.0:0.0:0.0	.	292	P15291	B4GT1_HUMAN	P	292;249;39	ENSP00000369055:L292P;ENSP00000445037:L39P	ENSP00000369055:L292P	L	-	2	0	B4GALT1	33106073	1.000000	0.71417	0.995000	0.50966	0.970000	0.65996	9.287000	0.95975	2.240000	0.73641	0.533000	0.62120	CTA	B4GALT1	-	pfam_Galactosyl_T_2_met,prints_Galactosyl_T_2_met	ENSG00000086062		0.388	B4GALT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALT1	HGNC	protein_coding	OTTHUMT00000052039.1	416	0.00	0	A	NM_001497		33116073	33116073	-1	no_errors	ENST00000379731	ensembl	human	known	69_37n	missense	441	23.70	137	SNP	0.997	G
CFAP54	144535	genome.wustl.edu	37	12	97045441	97045441	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr12:97045441C>A	ENST00000524981.4	+	36	4971	c.4948C>A	c.(4948-4950)Cta>Ata	p.L1650I				Q96N23	CL055_HUMAN		0																	TACTCAGGAACTACAAATACT	0.408																																						dbGAP											0													140.0	129.0	132.0					12																	97045441		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000524981.4:c.4948C>A	12.37:g.97045441C>A	ENSP00000431759:p.Leu1650Ile			Missense_Mutation	SNP	NULL	p.L75I	ENST00000524981.4	37	c.223		12	.	.	.	.	.	.	.	.	.	.	C	13.01	2.109938	0.37242	.	.	ENSG00000188596	ENST00000524981;ENST00000342887	.	.	.	5.0	1.64	0.23874	.	0.600255	0.14039	N	0.345584	T	0.20292	0.0488	L	0.40543	1.245	0.25351	N	0.988869	P	0.46912	0.886	B	0.42555	0.391	T	0.13019	-1.0525	9	0.40728	T	0.16	-7.5933	0.5325	0.00631	0.2107:0.2946:0.1364:0.3583	.	75	Q6ZTY8	CL063_HUMAN	I	1650;75	.	ENSP00000345466:L75I	L	+	1	2	C12orf63	95569572	0.002000	0.14202	0.998000	0.56505	0.198000	0.23893	-0.897000	0.04110	0.632000	0.30432	0.563000	0.77884	CTA	C12orf55	-	NULL	ENSG00000188596		0.408	C12orf55-003	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	C12orf55	HGNC	protein_coding	OTTHUMT00000395046.4	477	0.21	1	C			97045441	97045441	+1	no_errors	ENST00000342887	ensembl	human	known	69_37n	missense	298	36.92	175	SNP	0.933	A
C2orf78	388960	genome.wustl.edu	37	2	74042839	74042839	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr2:74042839G>C	ENST00000409561.1	+	3	1610	c.1489G>C	c.(1489-1491)Gat>Cat	p.D497H		NM_001080474.1	NP_001073943.1	A6NCI8	CB078_HUMAN	chromosome 2 open reading frame 78	497										cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|soft_tissue(1)|urinary_tract(1)	34						GGGTCACTCTGATCAAGTCAG	0.473																																						dbGAP											0													84.0	79.0	81.0					2																	74042839		1941	4144	6085	-	-	-	SO:0001583	missense	0			AC092653, AC136006, AK125975	CCDS46338.1	2p13.2	2008-07-18			ENSG00000187833	ENSG00000187833			34349	protein-coding gene	gene with protein product							Standard	NM_001080474		Approved	FLJ43987, hCG1989538, COG5373	uc002sjr.1	A6NCI8	OTTHUMG00000152819	ENST00000409561.1:c.1489G>C	2.37:g.74042839G>C	ENSP00000387124:p.Asp497His			Missense_Mutation	SNP	NULL	p.D497H	ENST00000409561.1	37	c.1489	CCDS46338.1	2	.	.	.	.	.	.	.	.	.	.	G	14.36	2.512974	0.44660	.	.	ENSG00000187833	ENST00000409561;ENST00000342345	.	.	.	5.11	1.81	0.25067	.	0.279673	0.24889	N	0.034798	T	0.53965	0.1829	M	0.72894	2.215	0.09310	N	1	D	0.89917	1.0	D	0.65010	0.931	T	0.44742	-0.9308	9	0.87932	D	0	1.1519	4.9577	0.14050	0.2025:0.1717:0.6257:0.0	.	497	A6NCI8	CB078_HUMAN	H	497;467	.	ENSP00000340692:D467H	D	+	1	0	C2orf78	73896347	0.006000	0.16342	0.005000	0.12908	0.049000	0.14656	1.069000	0.30641	0.106000	0.17784	0.655000	0.94253	GAT	C2orf78	-	NULL	ENSG00000187833		0.473	C2orf78-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	C2orf78	HGNC	protein_coding	OTTHUMT00000328083.1	290	0.00	0	G	NM_001080474		74042839	74042839	+1	no_errors	ENST00000409561	ensembl	human	novel	69_37n	missense	283	26.30	101	SNP	0.004	C
C9orf84	158401	genome.wustl.edu	37	9	114464479	114464479	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr9:114464479C>A	ENST00000318737.4	-	21	2931	c.2803G>T	c.(2803-2805)Gca>Tca	p.A935S	C9orf84_ENST00000374287.3_Missense_Mutation_p.A935S|C9orf84_ENST00000394777.4_Missense_Mutation_p.A861S|C9orf84_ENST00000394779.3_Missense_Mutation_p.A896S	NM_173521.3	NP_775792.3	Q5VXU9	CI084_HUMAN	chromosome 9 open reading frame 84	935										breast(1)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(10)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						TTGTCTGATGCCTTCTCATAA	0.264																																						dbGAP											0													57.0	59.0	58.0					9																	114464479		2199	4296	6495	-	-	-	SO:0001583	missense	0			AL833535	CCDS6781.3, CCDS43863.1	9q32	2012-03-16			ENSG00000165181	ENSG00000165181			26535	protein-coding gene	gene with protein product							Standard	XM_005251738		Approved	FLJ32779	uc004bfr.3	Q5VXU9	OTTHUMG00000020495	ENST00000318737.4:c.2803G>T	9.37:g.114464479C>A	ENSP00000322108:p.Ala935Ser		A2A2V3|Q2M1H8|Q96M73	Missense_Mutation	SNP	superfamily_RuvA_2-like	p.A935S	ENST00000318737.4	37	c.2803	CCDS6781.3	9	.	.	.	.	.	.	.	.	.	.	C	18.98	3.738169	0.69304	.	.	ENSG00000165181	ENST00000394779;ENST00000394777;ENST00000394778;ENST00000374287;ENST00000318737	T;T;T;T	0.05081	3.5;3.53;3.5;3.5	5.27	5.27	0.74061	.	0.000000	0.52532	D	0.000072	T	0.15046	0.0363	L	0.34521	1.04	0.36237	D	0.853034	P;D;P	0.89917	0.946;1.0;0.946	P;D;P	0.85130	0.803;0.997;0.803	T	0.04565	-1.0942	10	0.59425	D	0.04	-16.7266	11.9238	0.52808	0.2917:0.7083:0.0:0.0	.	861;935;896	A6PVK7;Q5VXU9;A2A2V3	.;CI084_HUMAN;.	S	896;861;549;935;935	ENSP00000378259:A896S;ENSP00000378257:A861S;ENSP00000363405:A935S;ENSP00000322108:A935S	ENSP00000322108:A935S	A	-	1	0	C9orf84	113504300	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	2.745000	0.47459	2.441000	0.82636	0.591000	0.81541	GCA	C9orf84	-	NULL	ENSG00000165181		0.264	C9orf84-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C9orf84	HGNC	protein_coding	OTTHUMT00000053656.2	195	0.00	0	C	NM_173521		114464479	114464479	-1	no_errors	ENST00000318737	ensembl	human	known	69_37n	missense	103	47.98	95	SNP	1.000	A
CD86	942	genome.wustl.edu	37	3	121828123	121828123	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr3:121828123C>G	ENST00000330540.2	+	5	831	c.715C>G	c.(715-717)Cct>Gct	p.P239A	CD86_ENST00000493101.1_Missense_Mutation_p.P127A|CD86_ENST00000264468.5_Missense_Mutation_p.P26A|CD86_ENST00000469710.1_Missense_Mutation_p.P157A|CD86_ENST00000393627.2_Missense_Mutation_p.P233A	NM_175862.4	NP_787058	P42081	CD86_HUMAN	CD86 molecule	239					aging (GO:0007568)|B cell activation (GO:0042113)|cell-cell signaling (GO:0007267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to metal ion (GO:0071248)|defense response to virus (GO:0051607)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|immune response (GO:0006955)|innate immune response (GO:0045087)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of T cell anergy (GO:0002668)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 biosynthetic process (GO:0045404)|positive regulation of lymphotoxin A biosynthetic process (GO:0043017)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|response to interferon-gamma (GO:0034341)|response to yeast (GO:0001878)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)|T cell proliferation involved in immune response (GO:0002309)|toll-like receptor signaling pathway (GO:0002224)|viral process (GO:0016032)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)|receptor activity (GO:0004872)			breast(2)|endometrium(1)|kidney(1)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(3)	23				GBM - Glioblastoma multiforme(114;0.156)	Abatacept(DB01281)|Antithymocyte globulin(DB00098)|Belatacept(DB06681)	GCTTGAGGACCCTCAGCCTCC	0.418																																					GBM(67;1379 1389 36064 39806)	dbGAP											0													103.0	95.0	98.0					3																	121828123		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3009.1, CCDS43138.1, CCDS56272.1, CCDS56273.1, CCDS74991.1	3q21	2013-01-29	2006-03-28		ENSG00000114013	ENSG00000114013		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1705	protein-coding gene	gene with protein product	"""B-lymphocyte antigen B7-2"""	601020	"""CD86 antigen (CD28 antigen ligand 2, B7-2 antigen)"""	CD28LG2		7513726	Standard	NM_006889		Approved	B7.2, B7-2	uc003eet.3	P42081	OTTHUMG00000159482	ENST00000330540.2:c.715C>G	3.37:g.121828123C>G	ENSP00000332049:p.Pro239Ala		A0N0P0|B7Z2F3|B7Z702|E7ETN5|E9PC27|Q13655|Q6FHB1|Q6GTS4|Q7M4L5	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.P239A	ENST00000330540.2	37	c.715	CCDS3009.1	3	.	.	.	.	.	.	.	.	.	.	C	7.029	0.560262	0.13498	.	.	ENSG00000114013	ENST00000469710;ENST00000493101;ENST00000330540;ENST00000264468;ENST00000393627	T;T;T;T;T	0.32988	3.21;2.37;4.26;1.43;4.25	4.68	-8.65	0.00870	.	1.973920	0.02461	N	0.086600	T	0.15349	0.0370	N	0.24115	0.695	0.09310	N	1	B;B	0.14805	0.007;0.011	B;B	0.10450	0.005;0.003	T	0.12502	-1.0545	10	0.52906	T	0.07	4.0832	0.3626	0.00367	0.3884:0.1532:0.1938:0.2646	.	127;239	E9PC27;P42081	.;CD86_HUMAN	A	157;127;239;26;233	ENSP00000418988:P157A;ENSP00000420230:P127A;ENSP00000332049:P239A;ENSP00000264468:P26A;ENSP00000377248:P233A	ENSP00000264468:P26A	P	+	1	0	CD86	123310813	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.365000	0.07573	-1.863000	0.01150	0.655000	0.94253	CCT	CD86	-	NULL	ENSG00000114013		0.418	CD86-001	KNOWN	basic|CCDS	protein_coding	CD86	HGNC	protein_coding	OTTHUMT00000355671.1	257	0.00	0	C	NM_006889		121828123	121828123	+1	no_errors	ENST00000330540	ensembl	human	known	69_37n	missense	150	44.65	121	SNP	0.000	G
CHD1L	9557	genome.wustl.edu	37	1	146759365	146759365	+	Missense_Mutation	SNP	G	G	C	rs370710748		TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr1:146759365G>C	ENST00000369258.4	+	19	2293	c.2273G>C	c.(2272-2274)cGa>cCa	p.R758P	CHD1L_ENST00000369259.3_Missense_Mutation_p.R554P|CHD1L_ENST00000361293.5_Missense_Mutation_p.R477P|CHD1L_ENST00000431239.1_Missense_Mutation_p.R664P|CHD1L_ENST00000467213.1_3'UTR	NM_001256336.1|NM_004284.4|NM_024568.2	NP_001243265.1|NP_004275.4|NP_078844.2	Q86WJ1	CHD1L_HUMAN	chromodomain helicase DNA binding protein 1-like	758	Macro. {ECO:0000255|PROSITE- ProRule:PRU00490}.				ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|nucleotide binding (GO:0000166)			breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(923;0.0487)					CTGGAAAAGCGATCCGCTGAG	0.443																																						dbGAP											0													67.0	69.0	68.0					1																	146759365		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF054177	CCDS927.1, CCDS58021.1, CCDS58022.1, CCDS72882.1	1q21.1	2008-02-05			ENSG00000131778	ENSG00000131778			1916	protein-coding gene	gene with protein product		613039				9653160	Standard	NM_004284		Approved	ALC1	uc001epm.5	Q86WJ1	OTTHUMG00000150271	ENST00000369258.4:c.2273G>C	1.37:g.146759365G>C	ENSP00000358262:p.Arg758Pro		A5YM64|B4DDE1|B5MDZ7|Q53EZ3|Q5VXX7|Q6DD94|Q6PK83|Q86XH3|Q96HF7|Q96SP3|Q9BVJ1|Q9NVV8	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_A1pp,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R758P	ENST00000369258.4	37	c.2273	CCDS927.1	1	.	.	.	.	.	.	.	.	.	.	G	19.90	3.912061	0.72983	.	.	ENSG00000131778	ENST00000431239;ENST00000369259;ENST00000369258;ENST00000361293	T;T;T;T	0.51071	0.72;0.72;0.72;0.72	5.52	5.52	0.82312	Appr-1-p processing (1);	0.000000	0.85682	D	0.000000	T	0.64670	0.2619	M	0.81682	2.555	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.996;1.0;0.985	T	0.68349	-0.5432	10	0.62326	D	0.03	.	14.9458	0.71029	0.0:0.0:1.0:0.0	.	664;554;758	Q86WJ1-2;Q86WJ1-3;Q86WJ1	.;.;CHD1L_HUMAN	P	664;554;758;477	ENSP00000389031:R664P;ENSP00000358263:R554P;ENSP00000358262:R758P;ENSP00000355100:R477P	ENSP00000355100:R477P	R	+	2	0	CHD1L	145225989	1.000000	0.71417	0.918000	0.36340	0.623000	0.37688	8.517000	0.90555	2.600000	0.87896	0.561000	0.74099	CGA	CHD1L	-	pfscan_A1pp	ENSG00000131778		0.443	CHD1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD1L	HGNC	protein_coding	OTTHUMT00000040377.1	310	0.00	0	G	NM_004284		146759365	146759365	+1	no_errors	ENST00000369258	ensembl	human	known	69_37n	missense	400	31.51	184	SNP	1.000	C
CHRNA1	1134	genome.wustl.edu	37	2	175613362	175613362	+	Silent	SNP	G	G	A			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr2:175613362G>A	ENST00000261007.5	-	9	1329	c.1263C>T	c.(1261-1263)atC>atT	p.I421I	AC018890.6_ENST00000442996.1_RNA|CHRNA1_ENST00000409542.1_Silent_p.I314I|CHRNA1_ENST00000409219.1_Intron|CHRNA1_ENST00000348749.5_Silent_p.I396I	NM_001039523.2	NP_001034612.1	P02708	ACHA_HUMAN	cholinergic receptor, nicotinic, alpha 1 (muscle)	421					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|muscle cell cellular homeostasis (GO:0046716)|musculoskeletal movement (GO:0050881)|neuromuscular junction development (GO:0007528)|neuromuscular process (GO:0050905)|neuromuscular synaptic transmission (GO:0007274)|neuron cellular homeostasis (GO:0070050)|neuronal action potential (GO:0019228)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cell surface (GO:0009986)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ion channel activity (GO:0005216)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(3)|prostate(3)|skin(4)	37					Galantamine(DB00674)	TGATGCCCTCGATGGCACTTT	0.493											OREG0015079	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													137.0	127.0	130.0					2																	175613362		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y00762	CCDS2261.1, CCDS33331.1	2q31.1	2012-02-11	2006-02-01		ENSG00000138435	ENSG00000138435		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1955	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 1 (muscle)"""	100690	"""cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle)"""	CHRNA			Standard	NM_001039523		Approved		uc002uje.2	P02708	OTTHUMG00000132357	ENST00000261007.5:c.1263C>T	2.37:g.175613362G>A		1924	B4DRV6|D3DPE8	Silent	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel	p.I421	ENST00000261007.5	37	c.1263	CCDS33331.1	2																																																																																			CHRNA1	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM	ENSG00000138435		0.493	CHRNA1-002	KNOWN	basic|CCDS	protein_coding	CHRNA1	HGNC	protein_coding	OTTHUMT00000334116.1	358	0.28	1	G			175613362	175613362	-1	no_errors	ENST00000261007	ensembl	human	known	69_37n	silent	240	44.21	191	SNP	0.022	A
CLRN2	645104	genome.wustl.edu	37	4	17528460	17528460	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr4:17528460A>G	ENST00000511148.2	+	3	556	c.454A>G	c.(454-456)Atc>Gtc	p.I152V	snoU13_ENST00000459186.1_RNA	NM_001079827.2	NP_001073296.1	A0PK11	CLRN2_HUMAN	clarin 2	152						integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(3)|lung(8)|pancreas(1)|upper_aerodigestive_tract(1)	15						GGCGTTAGCCATCGCCAGCTT	0.522																																						dbGAP											0													73.0	76.0	75.0					4																	17528460		2018	4169	6187	-	-	-	SO:0001583	missense	0				CCDS47032.1	4p15.32	2008-01-17			ENSG00000249581	ENSG00000249581			33939	protein-coding gene	gene with protein product						12080385	Standard	NM_001079827		Approved		uc003gpg.1	A0PK11	OTTHUMG00000160273	ENST00000511148.2:c.454A>G	4.37:g.17528460A>G	ENSP00000424711:p.Ile152Val			Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin	p.I152V	ENST00000511148.2	37	c.454	CCDS47032.1	4	.	.	.	.	.	.	.	.	.	.	A	2.768	-0.256338	0.05829	.	.	ENSG00000249581	ENST00000511148	D	0.88277	-2.36	5.75	-0.874	0.10631	.	0.384853	0.26307	N	0.025122	T	0.60650	0.2285	N	0.00538	-1.39	0.32169	N	0.581867	B	0.02656	0.0	B	0.04013	0.001	T	0.56768	-0.7924	10	0.27785	T	0.31	-15.7867	5.2577	0.15555	0.2843:0.3278:0.3879:0.0	.	152	A0PK11	CLRN2_HUMAN	V	152	ENSP00000424711:I152V	ENSP00000424711:I152V	I	+	1	0	CLRN2	17137558	1.000000	0.71417	0.566000	0.28421	0.167000	0.22549	1.265000	0.33027	-0.107000	0.12088	0.528000	0.53228	ATC	CLRN2	-	pfam_PMP22/EMP/MP20/Claudin	ENSG00000249581		0.522	CLRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLRN2	HGNC	protein_coding	OTTHUMT00000359990.2	151	0.00	0	A	NM_001079827		17528460	17528460	+1	no_errors	ENST00000511148	ensembl	human	known	69_37n	missense	23	76.00	76	SNP	0.933	G
CNTNAP2	26047	genome.wustl.edu	37	7	146829361	146829361	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr7:146829361G>T	ENST00000361727.3	+	8	1624	c.1108G>T	c.(1108-1110)Gaa>Taa	p.E370*		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	370					adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			TTCTTGTGTGGAACCCTATAC	0.443										HNSCC(39;0.1)																												dbGAP											0													119.0	118.0	119.0					7																	146829361		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.1108G>T	7.37:g.146829361G>T	ENSP00000354778:p.Glu370*		D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Nonsense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,pfam_EGF-like_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl,superfamily_Fibrinogen_a/b/g_C,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EGF-like,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.E370*	ENST00000361727.3	37	c.1108	CCDS5889.1	7	.	.	.	.	.	.	.	.	.	.	G	44	11.030418	0.99505	.	.	ENSG00000174469	ENST00000361727	.	.	.	5.7	5.7	0.88788	.	0.000000	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	18.3986	0.90507	0.0:0.0:1.0:0.0	.	.	.	.	X	370	.	ENSP00000354778:E370X	E	+	1	0	CNTNAP2	146460294	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	9.321000	0.96353	2.686000	0.91538	0.591000	0.81541	GAA	CNTNAP2	-	superfamily_ConA-like_lec_gl	ENSG00000174469		0.443	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP2	HGNC	protein_coding	OTTHUMT00000327668.1	233	0.00	0	G			146829361	146829361	+1	no_errors	ENST00000361727	ensembl	human	known	69_37n	nonsense	157	59.69	234	SNP	1.000	T
COL5A2	1290	genome.wustl.edu	37	2	189928732	189928732	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr2:189928732C>G	ENST00000374866.3	-	26	2018	c.1744G>C	c.(1744-1746)Ggt>Cgt	p.G582R		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	582					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			CCTTCAGGACCTTGAACACCA	0.323																																						dbGAP											0													80.0	83.0	82.0					2																	189928732		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.1744G>C	2.37:g.189928732C>G	ENSP00000364000:p.Gly582Arg		P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_VWF_C,superfamily_Fibrinogen_a/b/g_C,smart_VWF_C,smart_Fib_collagen_C,pfscan_VWF_C	p.G582R	ENST00000374866.3	37	c.1744	CCDS33350.1	2	.	.	.	.	.	.	.	.	.	.	C	27.8	4.862209	0.91511	.	.	ENSG00000204262	ENST00000374866;ENST00000452536	D	0.99637	-6.29	5.35	5.35	0.76521	.	0.000000	0.49305	D	0.000159	D	0.99857	0.9933	H	0.99444	4.57	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.96310	0.9228	9	.	.	.	.	19.1006	0.93272	0.0:1.0:0.0:0.0	.	222;582	Q5PR22;P05997	.;CO5A2_HUMAN	R	582;222	ENSP00000364000:G582R	.	G	-	1	0	COL5A2	189636977	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.429000	0.66495	2.503000	0.84419	0.591000	0.81541	GGT	COL5A2	-	NULL	ENSG00000204262		0.323	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A2	HGNC	protein_coding	OTTHUMT00000313523.1	332	0.00	0	C	NM_000393		189928732	189928732	-1	no_errors	ENST00000374866	ensembl	human	known	69_37n	missense	173	45.79	147	SNP	1.000	G
CPXM1	56265	genome.wustl.edu	37	20	2775057	2775057	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	671469b6-2cc7-4236-95d3-3e3f73e08ea3	g.chr20:2775057G>A	ENST00000380605.2	-	14	2048	c.1984C>T	c.(1984-1986)Cgt>Tgt	p.R662C		NM_001184699.1|NM_019609.4	NP_001171628.1|NP_062555.1	Q96SM3	CPXM1_HUMAN	carboxypeptidase X (M14 family), member 1	662					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(8)|lung(17)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						GTCAGCAGACGCCAATAATCC	0.597																																						dbGAP											0													56.0	54.0	55.0					20																	2775057		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL035460	CCDS13033.1	20p13	2012-02-10	2006-08-24	2006-08-24	ENSG00000088882	ENSG00000088882			15771	protein-coding gene	gene with protein product	"""carboxypeptidase-like protein X1"""	609555	"""carboxypeptidase X (M14 family)"""	CPXM		14702039	Standard	NM_019609		Approved	CPX-1, CPX1	uc002wgu.3	Q96SM3	OTTHUMG00000031706	ENST00000380605.2:c.1984C>T	20.37:g.2775057G>A	ENSP00000369979:p.Arg662Cys		Q6P4G8|Q6UW65|Q9NUB5	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_CarboxyPept-like_regulatory,smart_Coagulation_fac_5/8-C_type_dom,smart_Peptidase_M14,prints_Peptidase_M14,pfscan_Coagulation_fac_5/8-C_type_dom	p.R662C	ENST00000380605.2	37	c.1984	CCDS13033.1	20	.	.	.	.	.	.	.	.	.	.	g	19.80	3.895232	0.72639	.	.	ENSG00000088882	ENST00000380605;ENST00000421947	T	0.42131	0.98	5.12	1.59	0.23543	Peptidase M14, carboxypeptidase A (1);Carboxypeptidase-like, regulatory domain (1);Carboxypeptidase, regulatory domain (1);	0.000000	0.85682	D	0.000000	T	0.74959	0.3785	H	0.98218	4.175	0.58432	D	0.999994	D	0.89917	1.0	D	0.97110	1.0	T	0.82438	-0.0457	10	0.87932	D	0	-24.3659	12.9074	0.58160	0.0:0.0:0.5127:0.4873	.	662	Q96SM3	CPXM1_HUMAN	C	662;358	ENSP00000369979:R662C	ENSP00000369979:R662C	R	-	1	0	CPXM1	2723057	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	6.179000	0.71974	0.337000	0.23665	-0.174000	0.13273	CGT	CPXM1	-	superfamily_CarboxyPept-like_regulatory,smart_Peptidase_M14	ENSG00000088882		0.597	CPXM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPXM1	HGNC	protein_coding	OTTHUMT00000077643.2	59	0.00	0	G	NM_019609		2775057	2775057	-1	no_errors	ENST00000380605	ensembl	human	known	69_37n	missense	32	37.25	19	SNP	1.000	A
CPXM1	56265	genome.wustl.edu	37	20	2775057	2775057	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr20:2775057G>A	ENST00000380605.2	-	14	2048	c.1984C>T	c.(1984-1986)Cgt>Tgt	p.R662C		NM_001184699.1|NM_019609.4	NP_001171628.1|NP_062555.1	Q96SM3	CPXM1_HUMAN	carboxypeptidase X (M14 family), member 1	662					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(8)|lung(17)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						GTCAGCAGACGCCAATAATCC	0.597																																						dbGAP											0													56.0	54.0	55.0					20																	2775057		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL035460	CCDS13033.1	20p13	2012-02-10	2006-08-24	2006-08-24	ENSG00000088882	ENSG00000088882			15771	protein-coding gene	gene with protein product	"""carboxypeptidase-like protein X1"""	609555	"""carboxypeptidase X (M14 family)"""	CPXM		14702039	Standard	NM_019609		Approved	CPX-1, CPX1	uc002wgu.3	Q96SM3	OTTHUMG00000031706	ENST00000380605.2:c.1984C>T	20.37:g.2775057G>A	ENSP00000369979:p.Arg662Cys		Q6P4G8|Q6UW65|Q9NUB5	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_CarboxyPept-like_regulatory,smart_Coagulation_fac_5/8-C_type_dom,smart_Peptidase_M14,prints_Peptidase_M14,pfscan_Coagulation_fac_5/8-C_type_dom	p.R662C	ENST00000380605.2	37	c.1984	CCDS13033.1	20	.	.	.	.	.	.	.	.	.	.	g	19.80	3.895232	0.72639	.	.	ENSG00000088882	ENST00000380605;ENST00000421947	T	0.42131	0.98	5.12	1.59	0.23543	Peptidase M14, carboxypeptidase A (1);Carboxypeptidase-like, regulatory domain (1);Carboxypeptidase, regulatory domain (1);	0.000000	0.85682	D	0.000000	T	0.74959	0.3785	H	0.98218	4.175	0.58432	D	0.999994	D	0.89917	1.0	D	0.97110	1.0	T	0.82438	-0.0457	10	0.87932	D	0	-24.3659	12.9074	0.58160	0.0:0.0:0.5127:0.4873	.	662	Q96SM3	CPXM1_HUMAN	C	662;358	ENSP00000369979:R662C	ENSP00000369979:R662C	R	-	1	0	CPXM1	2723057	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	6.179000	0.71974	0.337000	0.23665	-0.174000	0.13273	CGT	CPXM1	-	superfamily_CarboxyPept-like_regulatory,smart_Peptidase_M14	ENSG00000088882		0.597	CPXM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPXM1	HGNC	protein_coding	OTTHUMT00000077643.2	49	0.00	0	G	NM_019609		2775057	2775057	-1	no_errors	ENST00000380605	ensembl	human	known	69_37n	missense	32	37.25	19	SNP	1.000	A
CSMD2	114784	genome.wustl.edu	37	1	34254306	34254306	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr1:34254306C>A	ENST00000338325.1	-	6	794	c.382G>T	c.(382-384)Ggt>Tgt	p.G128C	CSMD2_ENST00000373381.4_Missense_Mutation_p.G520C			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	480	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				ACCGATGTACCTGTCAGGCTG	0.498																																						dbGAP											0													108.0	91.0	97.0					1																	34254306		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000338325.1:c.382G>T	1.37:g.34254306C>A	ENSP00000340311:p.Gly128Cys		B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.G520C	ENST00000338325.1	37	c.1558		1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.719813	0.89205	.	.	ENSG00000121904	ENST00000373381;ENST00000338325	T;T	0.65364	-0.15;-0.15	5.57	5.57	0.84162	CUB (5);	0.000000	0.85682	D	0.000000	D	0.88036	0.6329	H	0.99182	4.46	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.91635	0.999;0.928	D	0.91322	0.5083	10	0.40728	T	0.16	.	17.0563	0.86534	0.0:1.0:0.0:0.0	.	480;520	Q7Z408;E7EUA6	CSMD2_HUMAN;.	C	520;128	ENSP00000362479:G520C;ENSP00000340311:G128C	ENSP00000241312:G480C	G	-	1	0	CSMD2	34026893	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.199000	0.77831	2.620000	0.88729	0.563000	0.77884	GGT	CSMD2	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000121904		0.498	CSMD2-004	KNOWN	basic	protein_coding	CSMD2	HGNC	protein_coding	OTTHUMT00000036404.2	234	0.00	0	C	NM_052896		34254306	34254306	-1	no_errors	ENST00000373381	ensembl	human	known	69_37n	missense	252	30.96	113	SNP	1.000	A
CUL7	9820	genome.wustl.edu	37	6	43017144	43017144	+	Splice_Site	SNP	C	C	T			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr6:43017144C>T	ENST00000265348.3	-	7	1911		c.e7+1		CUL7_ENST00000535468.1_Splice_Site|CUL7_ENST00000478630.1_5'Flank			Q14999	CUL7_HUMAN	cullin 7						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial to mesenchymal transition (GO:0001837)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|mitotic cytokinesis (GO:0000281)|placenta development (GO:0001890)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	3M complex (GO:1990393)|anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|Cul7-RING ubiquitin ligase complex (GO:0031467)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(8)|liver(1)|lung(11)|ovary(3)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	49			all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			CTGGCACCCACCTTCCACTTT	0.532																																						dbGAP											0													147.0	125.0	133.0					6																	43017144		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC033647	CCDS4881.1, CCDS55003.1	6p21.1	2011-05-24	2004-03-22	2004-03-22	ENSG00000044090	ENSG00000044090			21024	protein-coding gene	gene with protein product		609577	"""KIAA0076"""	KIAA0076		12481031, 12904573	Standard	NM_014780		Approved	dJ20C7.5	uc011dvb.2	Q14999	OTTHUMG00000014718	ENST00000265348.3:c.1825+1G>A	6.37:g.43017144C>T			B4DYZ0|F5H0L1|Q5T654	Splice_Site	SNP	-	e7+1	ENST00000265348.3	37	c.2077+1	CCDS4881.1	6	.	.	.	.	.	.	.	.	.	.	C	15.77	2.931900	0.52866	.	.	ENSG00000044090	ENST00000265348;ENST00000535468	.	.	.	5.02	4.13	0.48395	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.8914	0.41292	0.0:0.8993:0.0:0.1007	.	.	.	.	.	-1	.	.	.	-	.	.	CUL7	43125122	1.000000	0.71417	0.994000	0.49952	0.303000	0.27691	1.618000	0.36954	2.494000	0.84150	0.561000	0.74099	.	CUL7	-	-	ENSG00000044090		0.532	CUL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL7	HGNC	protein_coding	OTTHUMT00000040575.1	152	0.00	0	C	NM_014780	Intron	43017144	43017144	-1	no_errors	ENST00000535468	ensembl	human	known	69_37n	splice_site	100	37.50	60	SNP	0.960	T
DOCK9	23348	genome.wustl.edu	37	13	99498297	99498297	+	Intron	SNP	C	C	A			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr13:99498297C>A	ENST00000376460.1	-	38	4142				DOCK9_ENST00000448493.2_Intron|DOCK9_ENST00000339416.2_Intron	NM_001130048.1|NM_015296.2	NP_001123520.1|NP_056111.1	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9						blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(18)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					AACTATGGGTCCCAACCCCTC	0.498																																						dbGAP											0													120.0	127.0	125.0					13																	99498297		1151	2188	3339	-	-	-	SO:0001627	intron_variant	0			AF527605	CCDS45062.1	13q32.3	2013-01-10			ENSG00000088387	ENSG00000088387		"""Pleckstrin homology (PH) domain containing"""	14132	protein-coding gene	gene with protein product	"""zizimin1"""	607325				12172552, 12432077	Standard	NM_015296		Approved	KIAA1058, ZIZ1	uc001vnt.2	Q9BZ29	OTTHUMG00000017260	ENST00000376460.1:c.4062-52G>T	13.37:g.99498297C>A			B3KX25|E9PFM9|Q5JUD4|Q5JUD6|Q5T2Q1|Q5TAN8|Q9BZ25|Q9BZ26|Q9BZ27|Q9BZ28|Q9UPU4	Missense_Mutation	SNP	NULL	p.D34Y	ENST00000376460.1	37	c.100	CCDS45062.1	13	.	.	.	.	.	.	.	.	.	.	C	14.03	2.413270	0.42817	.	.	ENSG00000088387	ENST00000450257	.	.	.	5.63	4.79	0.61399	.	.	.	.	.	T	0.70675	0.3251	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.70015	-0.4988	4	.	.	.	.	14.7487	0.69508	0.0:0.9308:0.0:0.0692	.	.	.	.	Y	34	.	.	D	-	1	0	DOCK9	98296298	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.452000	0.80683	1.381000	0.46364	0.655000	0.94253	GAC	DOCK9	-	NULL	ENSG00000088387		0.498	DOCK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK9	HGNC	protein_coding	OTTHUMT00000045566.1	203	0.00	0	C	NM_015296		99498297	99498297	-1	no_start_codon:pseudogene:no_stop_codon	ENST00000450257	ensembl	human	known	69_37n	missense	251	31.15	114	SNP	1.000	A
EFR3A	23167	genome.wustl.edu	37	8	132966110	132966110	+	Silent	SNP	A	A	G			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr8:132966110A>G	ENST00000254624.5	+	6	759	c.534A>G	c.(532-534)aaA>aaG	p.K178K	EFR3A_ENST00000519656.1_Silent_p.K142K|EFR3A_ENST00000334503.4_Silent_p.K178K	NM_015137.4	NP_055952.2	Q14156	EFR3A_HUMAN	EFR3 homolog A (S. cerevisiae)	178						extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|skin(1)|stomach(2)	35	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			TGGTTCGCAAAACAGTCAACG	0.353																																						dbGAP											0													71.0	59.0	63.0					8																	132966110		2202	4297	6499	-	-	-	SO:0001819	synonymous_variant	0			D63477	CCDS34942.2	8q24.22	2008-10-23			ENSG00000132294	ENSG00000132294			28970	protein-coding gene	gene with protein product		611798				15363888	Standard	NM_015137		Approved	KIAA0143	uc003yte.3	Q14156	OTTHUMG00000150552	ENST00000254624.5:c.534A>G	8.37:g.132966110A>G			A7MD19|Q2VPK2|Q63HL7|Q68DX1|Q6IQ18	Silent	SNP	superfamily_ARM-type_fold	p.K178	ENST00000254624.5	37	c.534	CCDS34942.2	8																																																																																			EFR3A	-	superfamily_ARM-type_fold	ENSG00000132294		0.353	EFR3A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EFR3A	HGNC	protein_coding	OTTHUMT00000318886.1	158	0.00	0	A	NM_015137		132966110	132966110	+1	no_errors	ENST00000254624	ensembl	human	known	69_37n	silent	67	67.94	142	SNP	1.000	G
ETS2	2114	genome.wustl.edu	37	21	40188980	40188980	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr21:40188980C>T	ENST00000360214.3	+	7	1014	c.554C>T	c.(553-555)aCc>aTc	p.T185I	ETS2_ENST00000360938.3_Missense_Mutation_p.T185I	NM_001256295.1	NP_001243224.1	P15036	ETS2_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog 2	185					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	18		Prostate(19;6.33e-08)|all_epithelial(19;0.123)				TCACACCTCACCTCCGTTCCT	0.408																																						dbGAP											0													158.0	135.0	143.0					21																	40188980		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13659.1	21q22.3	2013-07-09	2013-07-09		ENSG00000157557	ENSG00000157557			3489	protein-coding gene	gene with protein product		164740	"""v-ets erythroblastosis virus E26 oncogene homolog 2 (avian)"""			17986575	Standard	NM_001256295		Approved		uc002yxf.3	P15036	OTTHUMG00000090769	ENST00000360214.3:c.554C>T	21.37:g.40188980C>T	ENSP00000353344:p.Thr185Ile		A6NM68|D3DSH6|Q53Y89	Missense_Mutation	SNP	pfam_Ets,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets,pirsf_Transforming_factor_C-ets,pfscan_Ets,prints_Ets	p.T185I	ENST00000360214.3	37	c.554	CCDS13659.1	21	.	.	.	.	.	.	.	.	.	.	C	10.51	1.370736	0.24771	.	.	ENSG00000157557	ENST00000360214;ENST00000360938;ENST00000456966	T;T;T	0.33438	2.65;2.65;1.41	5.61	1.58	0.23477	.	0.750097	0.14146	N	0.338311	T	0.26557	0.0649	L	0.44542	1.39	0.24636	N	0.993591	B;P	0.37955	0.303;0.612	B;B	0.34722	0.121;0.188	T	0.09487	-1.0672	10	0.49607	T	0.09	.	14.2665	0.66121	0.4789:0.5211:0.0:0.0	.	185;185	P15036;C9JAG2	ETS2_HUMAN;.	I	185	ENSP00000353344:T185I;ENSP00000354194:T185I;ENSP00000411086:T185I	ENSP00000353344:T185I	T	+	2	0	ETS2	39110850	0.968000	0.33430	0.717000	0.30585	0.429000	0.31625	1.193000	0.32162	0.482000	0.27582	-0.262000	0.10625	ACC	ETS2	-	pirsf_Transforming_factor_C-ets	ENSG00000157557		0.408	ETS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETS2	HGNC	protein_coding	OTTHUMT00000207544.1	269	0.37	1	C			40188980	40188980	+1	no_errors	ENST00000360214	ensembl	human	known	69_37n	missense	139	60.29	211	SNP	0.930	T
MROH5	389690	genome.wustl.edu	37	8	142481164	142481164	+	RNA	SNP	C	C	T			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr8:142481164C>T	ENST00000430863.1	-	0	2077					NM_207414.2	NP_997297.2	Q6ZUA9	MROH5_HUMAN	maestro heat-like repeat family member 5																		ACTTTTGTGGCACATCAAGAG	0.592																																						dbGAP											0													136.0	146.0	143.0					8																	142481164		2093	4201	6294	-	-	-			0					8q24.3	2012-12-20			ENSG00000226807	ENSG00000226807		"""maestro heat-like repeat containing"""	42976	protein-coding gene	gene with protein product							Standard	NM_207414		Approved	FLJ43860	uc003ywi.2	Q6ZUA9	OTTHUMG00000155944		8.37:g.142481164C>T				Missense_Mutation	SNP	NULL	p.C666Y	ENST00000430863.1	37	c.1997		8																																																																																			AC100803.1	-	NULL	ENSG00000226807		0.592	MROH5-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	FLJ43860	Clone_based_vega_gene	polymorphic_pseudogene	OTTHUMT00000342412.4	158	0.00	0	C	NM_207414		142481164	142481164	-1	pseudogene	ENST00000430863	ensembl	human	known	69_37n	missense	167	29.83	71	SNP	0.030	T
FRAS1	80144	genome.wustl.edu	37	4	79340212	79340212	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr4:79340212A>T	ENST00000325942.6	+	33	4975	c.4535A>T	c.(4534-4536)aAt>aTt	p.N1512I	FRAS1_ENST00000264895.6_Missense_Mutation_p.N1512I	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	1512					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						CTGCATCCAAATCAAGGTAAG	0.378																																						dbGAP											0													160.0	151.0	154.0					4																	79340212		1869	4106	5975	-	-	-	SO:0001583	missense	0			AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.4535A>T	4.37:g.79340212A>T	ENSP00000326330:p.Asn1512Ile		A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	pfam_Calx_beta,pfam_VWF_C,superfamily_Growth_fac_rcpt,superfamily_Cadherin-like,smart_VWC_out,smart_VWF_C,smart_Furin_repeat,smart_EGF-like,smart_Calx_beta,pfscan_VWF_C	p.N1512I	ENST00000325942.6	37	c.4535	CCDS54772.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	1.089|1.089	-0.664721|-0.664721	0.03428|0.03428	.|.	.|.	ENSG00000138759|ENSG00000138759	ENST00000510944|ENST00000325942;ENST00000264895	.|T;T	.|0.49432	.|0.78;0.78	5.33|5.33	-4.49|-4.49	0.03504|0.03504	.|.	.|0.449979	.|0.25497	.|N	.|0.030280	T|T	0.43853|0.43853	0.1266|0.1266	L|L	0.60455|0.60455	1.87|1.87	0.09310|0.09310	N|N	0.999999|0.999999	.|P;P	.|0.48998	.|0.918;0.836	.|P;B	.|0.45167	.|0.472;0.369	T|T	0.54214|0.54214	-0.8327|-0.8327	5|10	.|0.56958	.|D	.|0.05	.|.	14.8146|14.8146	0.70024|0.70024	0.4904:0.0:0.5096:0.0|0.4904:0.0:0.5096:0.0	.|.	.|1512;1512	.|E9PHH6;A2RRR8	.|.;.	N|I	7|1512	.|ENSP00000326330:N1512I;ENSP00000264895:N1512I	.|ENSP00000264895:N1512I	K|N	+|+	3|2	2|0	FRAS1|FRAS1	79559236|79559236	0.996000|0.996000	0.38824|0.38824	0.070000|0.070000	0.20053|0.20053	0.002000|0.002000	0.02628|0.02628	0.440000|0.440000	0.21592|0.21592	-0.701000|-0.701000	0.05063|0.05063	-0.256000|-0.256000	0.11100|0.11100	AAA|AAT	FRAS1	-	NULL	ENSG00000138759		0.378	FRAS1-001	NOVEL	basic|CCDS	protein_coding	FRAS1	HGNC	protein_coding	OTTHUMT00000362706.2	332	0.00	0	A			79340212	79340212	+1	no_errors	ENST00000264895	ensembl	human	known	69_37n	missense	184	48.46	173	SNP	0.046	T
FURIN	5045	genome.wustl.edu	37	15	91423399	91423399	+	Silent	SNP	G	G	A			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr15:91423399G>A	ENST00000268171.3	+	13	1731	c.1452G>A	c.(1450-1452)ctG>ctA	p.L484L		NM_002569.2	NP_002560.1	P09958	FURIN_HUMAN	furin (paired basic amino acid cleaving enzyme)	484					cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of low-density lipoprotein particle receptor catabolic process (GO:0032804)|negative regulation of transforming growth factor beta1 production (GO:0032911)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-translational protein modification (GO:0043687)|protein processing (GO:0016485)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)|regulation of protein catabolic process (GO:0042176)|secretion by cell (GO:0032940)|signal peptide processing (GO:0006465)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	endopeptidase activity (GO:0004175)|metal ion binding (GO:0046872)|nerve growth factor binding (GO:0048406)|peptidase activity (GO:0008233)|peptide binding (GO:0042277)|protease binding (GO:0002020)|serine-type endopeptidase activity (GO:0004252)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|central_nervous_system(4)|endometrium(4)|large_intestine(3)|liver(2)|lung(13)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	36	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			TCACTCGGCTGGAGCACGCTC	0.662																																						dbGAP											0													43.0	43.0	43.0					15																	91423399		2197	4297	6494	-	-	-	SO:0001819	synonymous_variant	0			X17094	CCDS10364.1	15q26.1	2007-01-24	2002-12-04	2002-12-06	ENSG00000140564	ENSG00000140564			8568	protein-coding gene	gene with protein product		136950	"""paired basic amino acid cleaving enzyme (furin, membrane associated receptor protein)"""	PCSK3, FUR, PACE		2251280, 1741956	Standard	NM_002569		Approved	SPC1	uc002bpu.1	P09958	OTTHUMG00000149831	ENST00000268171.3:c.1452G>A	15.37:g.91423399G>A			Q14336|Q6LBS3|Q9UCZ5	Silent	SNP	pfam_Peptidase_S8/S53,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53,superfamily_Galactose-bd-like,superfamily_Prot_inh_propept,superfamily_Growth_fac_rcpt,smart_Furin_repeat,prints_Peptidase_S8_subtilisin-rel	p.L484	ENST00000268171.3	37	c.1452	CCDS10364.1	15																																																																																			FURIN	-	pfam_PrprotnconvertsP,superfamily_Galactose-bd-like	ENSG00000140564		0.662	FURIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FURIN	HGNC	protein_coding	OTTHUMT00000313492.1	27	0.00	0	G	NM_002569		91423399	91423399	+1	no_errors	ENST00000268171	ensembl	human	known	69_37n	silent	24	41.46	17	SNP	1.000	A
GPD2	2820	genome.wustl.edu	37	2	157407221	157407221	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr2:157407221A>G	ENST00000310454.6	+	8	1306	c.934A>G	c.(934-936)Agt>Ggt	p.S312G	GPD2_ENST00000409125.4_Missense_Mutation_p.S85G|GPD2_ENST00000438166.2_Missense_Mutation_p.S312G|GPD2_ENST00000540309.1_Missense_Mutation_p.S312G|GPD2_ENST00000409674.1_Missense_Mutation_p.S312G	NM_001083112.2	NP_001076581.2	P43304	GPDM_HUMAN	glycerol-3-phosphate dehydrogenase 2 (mitochondrial)	312					camera-type eye development (GO:0043010)|cellular lipid metabolic process (GO:0044255)|gluconeogenesis (GO:0006094)|glycerol catabolic process (GO:0019563)|glycerol-3-phosphate metabolic process (GO:0006072)|multicellular organism growth (GO:0035264)|small molecule metabolic process (GO:0044281)	glycerol-3-phosphate dehydrogenase complex (GO:0009331)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|glycerol-3-phosphate dehydrogenase activity (GO:0004368)|sn-glycerol-3-phosphate:ubiquinone-8 oxidoreductase activity (GO:0052591)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(1)|stomach(1)	22						CTGCCAGCCAAGTGCTGGTGT	0.468																																						dbGAP											0													95.0	87.0	89.0					2																	157407221		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2202.1	2q24.1	2013-01-10			ENSG00000115159	ENSG00000115159	1.1.1.8	"""EF-hand domain containing"""	4456	protein-coding gene	gene with protein product		138430					Standard	NM_001083112		Approved		uc002tzd.4	P43304	OTTHUMG00000131951	ENST00000310454.6:c.934A>G	2.37:g.157407221A>G	ENSP00000308610:p.Ser312Gly		A8K4V0|B3KSA9|Q59FR1|Q9HAP9	Missense_Mutation	SNP	pfam_FAD-dep_OxRdtase,pfam_FAD_bind_dom,smart_EF_hand_Ca-bd,prints_G3P_DH_FAD-dep,pfscan_EF_HAND_2	p.S312G	ENST00000310454.6	37	c.934	CCDS2202.1	2	.	.	.	.	.	.	.	.	.	.	A	25.7	4.664819	0.88251	.	.	ENSG00000115159	ENST00000310454;ENST00000409125;ENST00000438166;ENST00000540309;ENST00000409674	T;T;T;T;T	0.61980	0.06;0.06;0.06;0.06;0.06	5.78	5.78	0.91487	FAD dependent oxidoreductase (1);	0.000000	0.85682	D	0.000000	D	0.82462	0.5042	M	0.91972	3.26	0.80722	D	1	P	0.45011	0.848	P	0.60345	0.873	D	0.86093	0.1551	10	0.87932	D	0	.	16.1115	0.81266	1.0:0.0:0.0:0.0	.	312	P43304	GPDM_HUMAN	G	312;85;312;312;312	ENSP00000308610:S312G;ENSP00000386484:S85G;ENSP00000409708:S312G;ENSP00000440892:S312G;ENSP00000386425:S312G	ENSP00000308610:S312G	S	+	1	0	GPD2	157115467	1.000000	0.71417	0.869000	0.34112	0.912000	0.54170	6.238000	0.72350	2.207000	0.71202	0.460000	0.39030	AGT	GPD2	-	pfam_FAD-dep_OxRdtase	ENSG00000115159		0.468	GPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPD2	HGNC	protein_coding	OTTHUMT00000254910.3	222	0.00	0	A			157407221	157407221	+1	no_errors	ENST00000310454	ensembl	human	known	69_37n	missense	142	42.86	108	SNP	0.996	G
GPR35	2859	genome.wustl.edu	37	2	241569563	241569563	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr2:241569563C>T	ENST00000319838.5	+	6	1136	c.194C>T	c.(193-195)gCc>gTc	p.A65V	GPR35_ENST00000430267.1_Missense_Mutation_p.A65V|GPR35_ENST00000403859.1_Missense_Mutation_p.A65V|GPR35_ENST00000407714.1_Missense_Mutation_p.A65V|GPR35_ENST00000438013.2_Missense_Mutation_p.A96V	NM_001195381.1	NP_001182310.1	Q9HC97	GPR35_HUMAN	G protein-coupled receptor 35	65					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(1)|cervix(1)|endometrium(1)|lung(7)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	17		all_epithelial(40;7.49e-12)|Breast(86;0.000148)|Renal(207;0.00571)|Ovarian(221;0.104)|all_neural(83;0.107)|all_hematologic(139;0.182)|all_lung(227;0.186)|Melanoma(123;0.238)		Epithelial(32;5.29e-32)|all cancers(36;1.38e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.02e-06)|Lung(119;0.00163)|Colorectal(34;0.00463)|LUSC - Lung squamous cell carcinoma(224;0.008)|COAD - Colon adenocarcinoma(134;0.031)		CTGGCGGTGGCCGACCTCTGC	0.647																																						dbGAP											0													113.0	95.0	101.0					2																	241569563		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2541.1, CCDS56174.1	2q37.3	2012-08-21			ENSG00000178623	ENSG00000178623		"""GPCR / Class A : Orphans"""	4492	protein-coding gene	gene with protein product		602646				9479505	Standard	NM_005301		Approved		uc021vze.1	Q9HC97	OTTHUMG00000133356	ENST00000319838.5:c.194C>T	2.37:g.241569563C>T	ENSP00000322731:p.Ala65Val		J3KR30|O43495|Q17R58|Q4VBN5|Q4ZFV2|Q6FHI8|Q86UH4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.A96V	ENST00000319838.5	37	c.287	CCDS2541.1	2	.	.	.	.	.	.	.	.	.	.	C	16.47	3.131617	0.56828	.	.	ENSG00000178623	ENST00000319838;ENST00000403859;ENST00000438013;ENST00000407714;ENST00000430267	T;T;T;T;T	0.79454	-1.27;-1.27;-1.27;-1.27;-1.27	3.91	3.01	0.34805	GPCR, rhodopsin-like superfamily (1);	0.217318	0.41500	D	0.000867	D	0.87861	0.6284	M	0.90705	3.14	0.09310	N	0.999994	D;D;D	0.76494	0.993;0.999;0.997	D;D;P	0.65573	0.936;0.936;0.888	T	0.79997	-0.1567	10	0.72032	D	0.01	-14.72	10.6949	0.45892	0.1927:0.8072:0.0:0.0	.	150;96;65	Q6ZMP9;A8K2J1;Q9HC97	.;.;GPR35_HUMAN	V	65;65;96;65;65	ENSP00000322731:A65V;ENSP00000385140:A65V;ENSP00000415890:A96V;ENSP00000384263:A65V;ENSP00000411788:A65V	ENSP00000322731:A65V	A	+	2	0	GPR35	241218236	0.018000	0.18449	0.038000	0.18304	0.608000	0.37181	2.749000	0.47492	0.958000	0.37956	0.462000	0.41574	GCC	GPR35	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000178623		0.647	GPR35-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GPR35	HGNC	protein_coding	OTTHUMT00000325631.1	51	0.00	0	C	NM_001195382		241569563	241569563	+1	no_errors	ENST00000438013	ensembl	human	known	69_37n	missense	26	46.94	23	SNP	0.155	T
HLF	3131	genome.wustl.edu	37	17	53398125	53398125	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr17:53398125C>G	ENST00000226067.5	+	4	1246	c.773C>G	c.(772-774)tCg>tGg	p.S258W	HLF_ENST00000575307.1_3'UTR|HLF_ENST00000575345.1_Missense_Mutation_p.S173W|HLF_ENST00000573945.1_Missense_Mutation_p.S173W|HLF_ENST00000430986.2_Missense_Mutation_p.S173W	NM_002126.4	NP_002117.1	Q16534	HLF_HUMAN	hepatic leukemia factor	258	bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				multicellular organismal development (GO:0007275)|rhythmic process (GO:0048511)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S258W(1)		large_intestine(1)|ovary(2)	3						ATCCGGGCCTCGTTCCTGGAG	0.592			T	TCF3	ALL																																	dbGAP		Dom	yes		17	17q22	3131	hepatic leukemia factor		L	1	Substitution - Missense(1)	lung(1)											28.0	32.0	31.0					17																	53398125		2201	4295	6496	-	-	-	SO:0001583	missense	0				CCDS11585.1	17q22	2011-05-19			ENSG00000108924	ENSG00000108924			4977	protein-coding gene	gene with protein product		142385				1386162	Standard	XM_005257269		Approved	MGC33822	uc002iug.1	Q16534		ENST00000226067.5:c.773C>G	17.37:g.53398125C>G	ENSP00000226067:p.Ser258Trp		A8K1X8|Q6FHS9	Missense_Mutation	SNP	pfam_bZIP_2,smart_bZIP,pfscan_bZIP	p.S258W	ENST00000226067.5	37	c.773	CCDS11585.1	17	.	.	.	.	.	.	.	.	.	.	C	13.98	2.400243	0.42613	.	.	ENSG00000108924	ENST00000226067;ENST00000430986	T;T	0.43294	0.95;0.95	5.77	4.8	0.61643	Basic-leucine zipper (bZIP) transcription factor (2);Basic leucine zipper (1);	0.149402	0.47852	D	0.000216	T	0.63307	0.2500	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.976	T	0.67745	-0.5591	10	0.87932	D	0	.	13.9362	0.64026	0.0:0.9273:0.0:0.0727	.	206;258	B4DIQ5;Q16534	.;HLF_HUMAN	W	258;173	ENSP00000226067:S258W;ENSP00000402496:S173W	ENSP00000226067:S258W	S	+	2	0	HLF	50753124	0.730000	0.28100	0.996000	0.52242	0.634000	0.38068	2.417000	0.44653	1.449000	0.47699	-0.140000	0.14226	TCG	HLF	-	pfam_bZIP_2,smart_bZIP,pfscan_bZIP	ENSG00000108924		0.592	HLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLF	HGNC	protein_coding	OTTHUMT00000439185.1	36	0.00	0	C	NM_002126		53398125	53398125	+1	no_errors	ENST00000226067	ensembl	human	known	69_37n	missense	5	84.85	28	SNP	0.999	G
HRC	3270	genome.wustl.edu	37	19	49658427	49658427	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	671469b6-2cc7-4236-95d3-3e3f73e08ea3	g.chr19:49658427G>T	ENST00000252825.4	-	1	254	c.68C>A	c.(67-69)cCc>cAc	p.P23H	TRPM4_ENST00000427978.2_5'Flank|HRC_ENST00000595625.1_Missense_Mutation_p.P23H|TRPM4_ENST00000252826.5_5'Flank|TRPM4_ENST00000355712.5_5'Flank	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	23					cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		CATGGCCGGGGGGAGGAGCAG	0.667																																					Melanoma(37;75 1097 24567 25669 30645)	dbGAP											0													42.0	45.0	44.0					19																	49658427		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.68C>A	19.37:g.49658427G>T	ENSP00000252825:p.Pro23His		Q504Y6	Missense_Mutation	SNP	pfam_Hist_rich_Ca-bd	p.P23H	ENST00000252825.4	37	c.68	CCDS12759.1	19	.	.	.	.	.	.	.	.	.	.	G	14.39	2.520442	0.44866	.	.	ENSG00000130528	ENST00000252825;ENST00000434964	T	0.55930	0.49	3.48	1.34	0.21922	.	.	.	.	.	T	0.52549	0.1741	M	0.64997	1.995	0.28025	N	0.934379	P	0.52463	0.953	P	0.47299	0.543	T	0.49744	-0.8907	9	0.87932	D	0	-9.7761	7.9439	0.29974	0.2138:0.0:0.7862:0.0	.	23	P23327	SRCH_HUMAN	H	23	ENSP00000252825:P23H	ENSP00000252825:P23H	P	-	2	0	HRC	54350239	1.000000	0.71417	0.902000	0.35471	0.408000	0.30992	2.754000	0.47532	0.467000	0.27218	-0.997000	0.02515	CCC	HRC	-	NULL	ENSG00000130528		0.667	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRC	HGNC	protein_coding	OTTHUMT00000465649.1	86	0.00	0	G	NM_002152		49658427	49658427	-1	no_errors	ENST00000252825	ensembl	human	known	69_37n	missense	46	43.37	36	SNP	0.987	T
HRC	3270	genome.wustl.edu	37	19	49658427	49658427	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr19:49658427G>T	ENST00000252825.4	-	1	254	c.68C>A	c.(67-69)cCc>cAc	p.P23H	TRPM4_ENST00000427978.2_5'Flank|HRC_ENST00000595625.1_Missense_Mutation_p.P23H|TRPM4_ENST00000252826.5_5'Flank|TRPM4_ENST00000355712.5_5'Flank	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	23					cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		CATGGCCGGGGGGAGGAGCAG	0.667																																					Melanoma(37;75 1097 24567 25669 30645)	dbGAP											0													42.0	45.0	44.0					19																	49658427		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.68C>A	19.37:g.49658427G>T	ENSP00000252825:p.Pro23His		Q504Y6	Missense_Mutation	SNP	pfam_Hist_rich_Ca-bd	p.P23H	ENST00000252825.4	37	c.68	CCDS12759.1	19	.	.	.	.	.	.	.	.	.	.	G	14.39	2.520442	0.44866	.	.	ENSG00000130528	ENST00000252825;ENST00000434964	T	0.55930	0.49	3.48	1.34	0.21922	.	.	.	.	.	T	0.52549	0.1741	M	0.64997	1.995	0.28025	N	0.934379	P	0.52463	0.953	P	0.47299	0.543	T	0.49744	-0.8907	9	0.87932	D	0	-9.7761	7.9439	0.29974	0.2138:0.0:0.7862:0.0	.	23	P23327	SRCH_HUMAN	H	23	ENSP00000252825:P23H	ENSP00000252825:P23H	P	-	2	0	HRC	54350239	1.000000	0.71417	0.902000	0.35471	0.408000	0.30992	2.754000	0.47532	0.467000	0.27218	-0.997000	0.02515	CCC	HRC	-	NULL	ENSG00000130528		0.667	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRC	HGNC	protein_coding	OTTHUMT00000465649.1	109	0.91	1	G	NM_002152		49658427	49658427	-1	no_errors	ENST00000252825	ensembl	human	known	69_37n	missense	46	43.37	36	SNP	0.987	T
HRH3	11255	genome.wustl.edu	37	20	60794857	60794857	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	671469b6-2cc7-4236-95d3-3e3f73e08ea3	g.chr20:60794857A>T	ENST00000340177.5	-	1	454	c.170T>A	c.(169-171)cTc>cAc	p.L57H	HRH3_ENST00000317393.6_Missense_Mutation_p.L57H	NM_007232.2	NP_009163.2	Q9Y5N1	HRH3_HUMAN	histamine receptor H3	57					brain development (GO:0007420)|drinking behavior (GO:0042756)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|learning (GO:0007612)|memory (GO:0007613)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of gamma-aminobutyric acid secretion (GO:0014053)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of serotonin secretion (GO:0014063)|neurotransmitter secretion (GO:0007269)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of norepinephrine secretion (GO:0014061)|response to organic cyclic compound (GO:0014070)	integral component of plasma membrane (GO:0005887)|myelin sheath (GO:0043209)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|histamine receptor activity (GO:0004969)			breast(1)|endometrium(1)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	9	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;7.08e-07)		Betahistine(DB06698)|Histamine Phosphate(DB00667)|Mirtazapine(DB00370)	CACGAAGGCGAGCATGACCAG	0.687																																						dbGAP											0													44.0	43.0	43.0					20																	60794857		2199	4300	6499	-	-	-	SO:0001583	missense	0			AF140538	CCDS13493.1	20q13.33	2013-09-19			ENSG00000101180	ENSG00000101180		"""GPCR / Class A : Histamine receptors"""	5184	protein-coding gene	gene with protein product		604525				10347254	Standard	NM_007232		Approved	GPCR97	uc002ycf.2	Q9Y5N1	OTTHUMG00000032899	ENST00000340177.5:c.170T>A	20.37:g.60794857A>T	ENSP00000342560:p.Leu57His		Q4QRI7|Q9GZX2|Q9H4K8	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Histamine_H3_recept,prints_7TM_GPCR_Rhodpsn,prints_Musac_rcpt	p.L57H	ENST00000340177.5	37	c.170	CCDS13493.1	20	.	.	.	.	.	.	.	.	.	.	a	19.37	3.814957	0.70912	.	.	ENSG00000101180	ENST00000340177;ENST00000317393;ENST00000370797	T;T	0.22134	1.97;1.97	3.43	3.43	0.39272	GPCR, rhodopsin-like superfamily (1);	0.294146	0.27956	U	0.017178	T	0.45054	0.1323	M	0.79475	2.455	0.42268	D	0.992049	D;D;D;D	0.89917	0.997;1.0;1.0;0.999	P;D;D;D	0.81914	0.873;0.992;0.994;0.995	T	0.49418	-0.8942	10	0.87932	D	0	-16.6804	11.5326	0.50618	1.0:0.0:0.0:0.0	.	57;57;57;57	Q9Y5N1-2;E7EWA7;Q8WXZ9;Q9Y5N1	.;.;.;HRH3_HUMAN	H	57	ENSP00000342560:L57H;ENSP00000321482:L57H	ENSP00000321482:L57H	L	-	2	0	HRH3	60228252	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	5.509000	0.67012	1.183000	0.42943	0.375000	0.23000	CTC	HRH3	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000101180		0.687	HRH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRH3	HGNC	protein_coding	OTTHUMT00000079994.1	25	0.00	0	A	NM_007232		60794857	60794857	-1	no_errors	ENST00000317393	ensembl	human	known	69_37n	missense	17	34.62	9	SNP	1.000	T
HRH3	11255	genome.wustl.edu	37	20	60794857	60794857	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr20:60794857A>T	ENST00000340177.5	-	1	454	c.170T>A	c.(169-171)cTc>cAc	p.L57H	HRH3_ENST00000317393.6_Missense_Mutation_p.L57H	NM_007232.2	NP_009163.2	Q9Y5N1	HRH3_HUMAN	histamine receptor H3	57					brain development (GO:0007420)|drinking behavior (GO:0042756)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|learning (GO:0007612)|memory (GO:0007613)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of gamma-aminobutyric acid secretion (GO:0014053)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of serotonin secretion (GO:0014063)|neurotransmitter secretion (GO:0007269)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of norepinephrine secretion (GO:0014061)|response to organic cyclic compound (GO:0014070)	integral component of plasma membrane (GO:0005887)|myelin sheath (GO:0043209)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|histamine receptor activity (GO:0004969)			breast(1)|endometrium(1)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	9	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;7.08e-07)		Betahistine(DB06698)|Histamine Phosphate(DB00667)|Mirtazapine(DB00370)	CACGAAGGCGAGCATGACCAG	0.687																																						dbGAP											0													44.0	43.0	43.0					20																	60794857		2199	4300	6499	-	-	-	SO:0001583	missense	0			AF140538	CCDS13493.1	20q13.33	2013-09-19			ENSG00000101180	ENSG00000101180		"""GPCR / Class A : Histamine receptors"""	5184	protein-coding gene	gene with protein product		604525				10347254	Standard	NM_007232		Approved	GPCR97	uc002ycf.2	Q9Y5N1	OTTHUMG00000032899	ENST00000340177.5:c.170T>A	20.37:g.60794857A>T	ENSP00000342560:p.Leu57His		Q4QRI7|Q9GZX2|Q9H4K8	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Histamine_H3_recept,prints_7TM_GPCR_Rhodpsn,prints_Musac_rcpt	p.L57H	ENST00000340177.5	37	c.170	CCDS13493.1	20	.	.	.	.	.	.	.	.	.	.	a	19.37	3.814957	0.70912	.	.	ENSG00000101180	ENST00000340177;ENST00000317393;ENST00000370797	T;T	0.22134	1.97;1.97	3.43	3.43	0.39272	GPCR, rhodopsin-like superfamily (1);	0.294146	0.27956	U	0.017178	T	0.45054	0.1323	M	0.79475	2.455	0.42268	D	0.992049	D;D;D;D	0.89917	0.997;1.0;1.0;0.999	P;D;D;D	0.81914	0.873;0.992;0.994;0.995	T	0.49418	-0.8942	10	0.87932	D	0	-16.6804	11.5326	0.50618	1.0:0.0:0.0:0.0	.	57;57;57;57	Q9Y5N1-2;E7EWA7;Q8WXZ9;Q9Y5N1	.;.;.;HRH3_HUMAN	H	57	ENSP00000342560:L57H;ENSP00000321482:L57H	ENSP00000321482:L57H	L	-	2	0	HRH3	60228252	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	5.509000	0.67012	1.183000	0.42943	0.375000	0.23000	CTC	HRH3	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000101180		0.687	HRH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRH3	HGNC	protein_coding	OTTHUMT00000079994.1	22	0.00	0	A	NM_007232		60794857	60794857	-1	no_errors	ENST00000317393	ensembl	human	known	69_37n	missense	17	34.62	9	SNP	1.000	T
IGBP1	3476	genome.wustl.edu	37	X	69353826	69353826	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	671469b6-2cc7-4236-95d3-3e3f73e08ea3	g.chrX:69353826C>T	ENST00000342206.6	+	1	528	c.29C>T	c.(28-30)cCg>cTg	p.P10L	IGBP1_ENST00000356413.4_Missense_Mutation_p.P10L			P78318	IGBP1_HUMAN	immunoglobulin (CD79A) binding protein 1	10					B cell activation (GO:0042113)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of protein dephosphorylation (GO:0035308)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dephosphorylation (GO:0035306)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of microtubule-based movement (GO:0060632)|response to interleukin-1 (GO:0070555)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	protein phosphatase type 2A regulator activity (GO:0008601)			kidney(2)|large_intestine(3)|lung(3)|pancreas(1)|prostate(2)	11						TTACAGCTGCCGCGGCTCCCC	0.552											OREG0019849	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									NSCLC(167;1189 1558 6576 8216 30387 37980 41450)	dbGAP											0													25.0	23.0	24.0					X																	69353826		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y08915	CCDS14396.1	Xq13.1-q13.3	2008-02-05			ENSG00000089289	ENSG00000089289			5461	protein-coding gene	gene with protein product	"""alpha 4"""	300139		IBP1		9441740	Standard	NM_001551		Approved		uc004dxw.3	P78318	OTTHUMG00000021767	ENST00000342206.6:c.29C>T	X.37:g.69353826C>T	ENSP00000363661:p.Pro10Leu	1114	Q8TAB2	Missense_Mutation	SNP	pfam_TAP42-like	p.P10L	ENST00000342206.6	37	c.29	CCDS14396.1	X	.	.	.	.	.	.	.	.	.	.	C	13.00	2.106698	0.37145	.	.	ENSG00000089289	ENST00000342206;ENST00000356413	T;T	0.42131	0.98;0.98	4.75	4.75	0.60458	.	0.164239	0.53938	D	0.000041	T	0.41743	0.1172	M	0.64997	1.995	0.58432	D	0.99999	B	0.21452	0.056	B	0.16722	0.016	T	0.34477	-0.9827	10	0.44086	T	0.13	.	14.2921	0.66286	0.0:1.0:0.0:0.0	.	10	P78318	IGBP1_HUMAN	L	10	ENSP00000363661:P10L;ENSP00000348784:P10L	ENSP00000363661:P10L	P	+	2	0	IGBP1	69270551	0.935000	0.31712	0.730000	0.30809	0.245000	0.25701	5.112000	0.64634	2.340000	0.79590	0.600000	0.82982	CCG	IGBP1	-	NULL	ENSG00000089289		0.552	IGBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGBP1	HGNC	protein_coding	OTTHUMT00000057052.1	103	0.96	1	C			69353826	69353826	+1	no_errors	ENST00000342206	ensembl	human	known	69_37n	missense	54	46.00	46	SNP	0.979	T
IGBP1	3476	genome.wustl.edu	37	X	69353826	69353826	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chrX:69353826C>T	ENST00000342206.6	+	1	528	c.29C>T	c.(28-30)cCg>cTg	p.P10L	IGBP1_ENST00000356413.4_Missense_Mutation_p.P10L			P78318	IGBP1_HUMAN	immunoglobulin (CD79A) binding protein 1	10					B cell activation (GO:0042113)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of protein dephosphorylation (GO:0035308)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dephosphorylation (GO:0035306)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of microtubule-based movement (GO:0060632)|response to interleukin-1 (GO:0070555)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	protein phosphatase type 2A regulator activity (GO:0008601)			kidney(2)|large_intestine(3)|lung(3)|pancreas(1)|prostate(2)	11						TTACAGCTGCCGCGGCTCCCC	0.552											OREG0019849	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									NSCLC(167;1189 1558 6576 8216 30387 37980 41450)	dbGAP											0													25.0	23.0	24.0					X																	69353826		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y08915	CCDS14396.1	Xq13.1-q13.3	2008-02-05			ENSG00000089289	ENSG00000089289			5461	protein-coding gene	gene with protein product	"""alpha 4"""	300139		IBP1		9441740	Standard	NM_001551		Approved		uc004dxw.3	P78318	OTTHUMG00000021767	ENST00000342206.6:c.29C>T	X.37:g.69353826C>T	ENSP00000363661:p.Pro10Leu	1114	Q8TAB2	Missense_Mutation	SNP	pfam_TAP42-like	p.P10L	ENST00000342206.6	37	c.29	CCDS14396.1	X	.	.	.	.	.	.	.	.	.	.	C	13.00	2.106698	0.37145	.	.	ENSG00000089289	ENST00000342206;ENST00000356413	T;T	0.42131	0.98;0.98	4.75	4.75	0.60458	.	0.164239	0.53938	D	0.000041	T	0.41743	0.1172	M	0.64997	1.995	0.58432	D	0.99999	B	0.21452	0.056	B	0.16722	0.016	T	0.34477	-0.9827	10	0.44086	T	0.13	.	14.2921	0.66286	0.0:1.0:0.0:0.0	.	10	P78318	IGBP1_HUMAN	L	10	ENSP00000363661:P10L;ENSP00000348784:P10L	ENSP00000363661:P10L	P	+	2	0	IGBP1	69270551	0.935000	0.31712	0.730000	0.30809	0.245000	0.25701	5.112000	0.64634	2.340000	0.79590	0.600000	0.82982	CCG	IGBP1	-	NULL	ENSG00000089289		0.552	IGBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGBP1	HGNC	protein_coding	OTTHUMT00000057052.1	87	0.00	0	C			69353826	69353826	+1	no_errors	ENST00000342206	ensembl	human	known	69_37n	missense	54	46.00	46	SNP	0.979	T
IGSF1	3547	genome.wustl.edu	37	X	130408820	130408820	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chrX:130408820C>T	ENST00000361420.3	-	18	3583	c.3504G>A	c.(3502-3504)tgG>tgA	p.W1168*	IGSF1_ENST00000370910.1_Nonsense_Mutation_p.W1159*|IGSF1_ENST00000370904.1_Nonsense_Mutation_p.W1159*|IGSF1_ENST00000467244.1_5'Flank|IGSF1_ENST00000370903.3_Nonsense_Mutation_p.W1173*			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	1168	Ig-like C2-type 12.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						TGGTGCTGGGCCAGGCTGACA	0.488																																						dbGAP											0													103.0	109.0	107.0					X																	130408820		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.3504G>A	X.37:g.130408820C>T	ENSP00000355010:p.Trp1168*		B5MEG2|H9KV64|O15070|Q9NTC8	Nonsense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.W1173*	ENST00000361420.3	37	c.3519	CCDS14629.1	X	.	.	.	.	.	.	.	.	.	.	C	40	8.076655	0.98643	.	.	ENSG00000147255	ENST00000370910;ENST00000361420;ENST00000370904;ENST00000370903	.	.	.	5.03	5.03	0.67393	.	0.665956	0.13358	N	0.393874	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	13.0384	0.58885	0.0:1.0:0.0:0.0	.	.	.	.	X	1159;1168;1159;1173	.	ENSP00000355010:W1168X	W	-	3	0	IGSF1	130236501	1.000000	0.71417	1.000000	0.80357	0.783000	0.44284	1.394000	0.34509	2.225000	0.72522	0.594000	0.82650	TGG	IGSF1	-	smart_Ig_sub	ENSG00000147255		0.488	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGSF1	HGNC	protein_coding	OTTHUMT00000058288.1	147	0.00	0	C			130408820	130408820	-1	no_errors	ENST00000370903	ensembl	human	known	69_37n	nonsense	160	30.13	69	SNP	1.000	T
IL2RB	3560	genome.wustl.edu	37	22	37540124	37540124	+	Splice_Site	SNP	C	C	A			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr22:37540124C>A	ENST00000216223.5	-	2	287		c.e2+1			NM_000878.3	NP_000869.1	P14784	IL2RB_HUMAN	interleukin 2 receptor, beta						cytokine-mediated signaling pathway (GO:0019221)|interleukin-2-mediated signaling pathway (GO:0038110)|negative regulation of apoptotic process (GO:0043066)|protein complex assembly (GO:0006461)|signal transduction (GO:0007165)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	interleukin-2 binding (GO:0019976)|interleukin-2 receptor activity (GO:0004911)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(5)	23					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	AGGGTCCTCACCATTCACCGC	0.607																																						dbGAP											0													44.0	36.0	38.0					22																	37540124		2133	4158	6291	-	-	-	SO:0001630	splice_region_variant	0			M26062	CCDS13942.1	22q13	2011-02-15			ENSG00000100385	ENSG00000100385		"""Interleukins and interleukin receptors"", ""CD molecules"""	6009	protein-coding gene	gene with protein product		146710	"""interleukin 15 receptor, beta"""	IL15RB			Standard	NM_000878		Approved	CD122	uc003aqv.1	P14784	OTTHUMG00000150534	ENST00000216223.5:c.88+1G>T	22.37:g.37540124C>A			B2R765	Splice_Site	SNP	-	e1+1	ENST00000216223.5	37	c.88+1	CCDS13942.1	22	.	.	.	.	.	.	.	.	.	.	C	6.753	0.507853	0.12883	.	.	ENSG00000100385	ENST00000216223;ENST00000453962;ENST00000429622;ENST00000445595	.	.	.	4.75	3.71	0.42584	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.175	0.48595	0.0:0.8134:0.1866:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	IL2RB	35870070	1.000000	0.71417	0.936000	0.37596	0.015000	0.08874	3.727000	0.54984	1.096000	0.41439	0.555000	0.69702	.	IL2RB	-	-	ENSG00000100385		0.607	IL2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL2RB	HGNC	protein_coding	OTTHUMT00000318792.1	134	0.00	0	C		Intron	37540124	37540124	-1	no_errors	ENST00000216223	ensembl	human	known	69_37n	splice_site	85	41.10	60	SNP	0.989	A
IPO13	9670	genome.wustl.edu	37	1	44422562	44422562	+	Silent	SNP	T	T	C			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr1:44422562T>C	ENST00000372343.3	+	5	1847	c.1185T>C	c.(1183-1185)gaT>gaC	p.D395D	IPO13_ENST00000492152.1_3'UTR	NM_014652.3	NP_055467.3	O94829	IPO13_HUMAN	importin 13	395					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(13)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0821)				AGCTGGTGGATGTGCTTCTGC	0.517																																						dbGAP											0													72.0	68.0	69.0					1																	44422562		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB018267	CCDS503.1	1p34.1	2008-02-05			ENSG00000117408	ENSG00000117408		"""Importins"""	16853	protein-coding gene	gene with protein product		610411				9872452, 11447110	Standard	NM_014652		Approved	IMP13, KIAA0724, RANBP13	uc001ckx.3	O94829	OTTHUMG00000008297	ENST00000372343.3:c.1185T>C	1.37:g.44422562T>C			D3DPY4|Q5T4X3|Q7LC04|Q96HS3|Q9H8N3|Q9UFR1	Silent	SNP	pfam_Exportin-1/Importin-b-like,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.D395	ENST00000372343.3	37	c.1185	CCDS503.1	1																																																																																			IPO13	-	superfamily_ARM-type_fold	ENSG00000117408		0.517	IPO13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO13	HGNC	protein_coding	OTTHUMT00000022846.1	62	0.00	0	T	NM_014652		44422562	44422562	+1	no_errors	ENST00000372343	ensembl	human	known	69_37n	silent	39	40.91	27	SNP	0.996	C
IQGAP3	128239	genome.wustl.edu	37	1	156498803	156498803	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr1:156498803C>G	ENST00000361170.2	-	35	4486	c.4476G>C	c.(4474-4476)caG>caC	p.Q1492H	snoU13_ENST00000458777.1_RNA	NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	1492					activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TGCTCAGGCCCTGTAATGTGG	0.602																																						dbGAP											0													145.0	137.0	140.0					1																	156498803		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.4476G>C	1.37:g.156498803C>G	ENSP00000354451:p.Gln1492His		Q5T3H8	Missense_Mutation	SNP	pfam_RasGAP,pfam_RasGAP_C,pfam_IQ_motif_EF-hand-BS,pfam_CH-domain,superfamily_Rho_GTPase_activation_prot,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_IQ_motif_EF-hand-BS,smart_RasGAP,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS,pfscan_RasGAP	p.Q1492H	ENST00000361170.2	37	c.4476	CCDS1144.1	1	.	.	.	.	.	.	.	.	.	.	C	14.45	2.538015	0.45176	.	.	ENSG00000183856	ENST00000361170	T	0.42513	0.97	4.41	3.49	0.39957	RasGAP protein, C-terminal (1);	0.399385	0.26773	N	0.022576	T	0.44117	0.1278	L	0.51422	1.61	0.38389	D	0.945344	D	0.76494	0.999	D	0.73708	0.981	T	0.41360	-0.9513	10	0.45353	T	0.12	-13.7446	11.4494	0.50142	0.0:0.9099:0.0:0.0901	.	1492	Q86VI3	IQGA3_HUMAN	H	1492	ENSP00000354451:Q1492H	ENSP00000354451:Q1492H	Q	-	3	2	IQGAP3	154765427	0.007000	0.16637	0.986000	0.45419	0.608000	0.37181	0.059000	0.14322	1.217000	0.43442	0.491000	0.48974	CAG	IQGAP3	-	pfam_RasGAP_C	ENSG00000183856		0.602	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP3	HGNC	protein_coding	OTTHUMT00000080657.1	168	0.59	1	C	NM_178229		156498803	156498803	-1	no_errors	ENST00000361170	ensembl	human	known	69_37n	missense	167	30.58	74	SNP	0.988	G
IRAK1	3654	genome.wustl.edu	37	X	153278098	153278098	+	Silent	SNP	C	C	T			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chrX:153278098C>T	ENST00000369980.3	-	13	2129	c.1962G>A	c.(1960-1962)tcG>tcA	p.S654S	IRAK1_ENST00000369974.2_Silent_p.S575S|IRAK1_ENST00000429936.2_Silent_p.S650S|IRAK1_ENST00000477274.1_Intron|IRAK1_ENST00000393687.2_Silent_p.S624S|IRAK1_ENST00000393682.1_Silent_p.S635S	NM_001025242.1|NM_001569.3	NP_001020413.1|NP_001560.2	P51617	IRAK1_HUMAN	interleukin-1 receptor-associated kinase 1	654	Poly-Ser.				activation of MAPK activity (GO:0000187)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to hypoxia (GO:0071456)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cytokine-mediated signaling pathway (GO:0001959)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to peptidoglycan (GO:0032494)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|interleukin-1 receptor complex (GO:0045323)|lipid particle (GO:0005811)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|NF-kappaB-inducing kinase activity (GO:0004704)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(15)|ovary(2)	25	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GTGGCTCTGACGACGATGATG	0.627																																						dbGAP											0													113.0	86.0	95.0					X																	153278098		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L76191	CCDS14740.1, CCDS35443.1, CCDS35444.1	Xq28	2011-07-08			ENSG00000184216	ENSG00000184216			6112	protein-coding gene	gene with protein product		300283				9374458, 8599092	Standard	XM_005274668		Approved	IRAK, pelle	uc004fjs.1	P51617	OTTHUMG00000024228	ENST00000369980.3:c.1962G>A	X.37:g.153278098C>T			D3DWW3|D3DWW4|Q7Z5V4|Q96C06|Q96RL2	Missense_Mutation	SNP	NULL	p.R104H	ENST00000369980.3	37	c.311	CCDS14740.1	X	.	.	.	.	.	.	.	.	.	.	C	7.406	0.633682	0.14322	.	.	ENSG00000184216	ENST00000455690;ENST00000437278	T	0.24538	1.85	4.45	-8.89	0.00785	.	.	.	.	.	T	0.19208	0.0461	.	.	.	0.28637	N	0.907341	.	.	.	.	.	.	T	0.32955	-0.9887	5	.	.	.	-2.2946	12.0278	0.53382	0.0:0.5208:0.3347:0.1445	.	.	.	.	H	104;218	ENSP00000411809:R104H	.	R	-	2	0	IRAK1	152931292	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-3.331000	0.00509	-3.770000	0.00109	-2.479000	0.00199	CGT	IRAK1	-	NULL	ENSG00000184216		0.627	IRAK1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	IRAK1	HGNC	protein_coding	OTTHUMT00000061143.3	55	0.00	0	C			153278098	153278098	-1	no_start_codon	ENST00000455690	ensembl	human	putative	69_37n	missense	44	60.00	69	SNP	0.000	T
KIAA1109	84162	genome.wustl.edu	37	4	123207765	123207765	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr4:123207765C>T	ENST00000264501.4	+	53	9480	c.9107C>T	c.(9106-9108)aCa>aTa	p.T3036I	KIAA1109_ENST00000388738.3_Missense_Mutation_p.T3036I|KIAA1109_ENST00000455637.1_Missense_Mutation_p.T3036I			Q2LD37	K1109_HUMAN	KIAA1109	3036					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						GTTTCTGCCACAGATATGTCA	0.388																																						dbGAP											0													148.0	140.0	143.0					4																	123207765		1911	4116	6027	-	-	-	SO:0001583	missense	0			AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.9107C>T	4.37:g.123207765C>T	ENSP00000264501:p.Thr3036Ile		Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	pfam_Fragile_site-assoc_C	p.T3036I	ENST00000264501.4	37	c.9107	CCDS43267.1	4	.	.	.	.	.	.	.	.	.	.	C	14.09	2.432642	0.43224	.	.	ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000455637	T;T;T	0.27104	2.27;2.27;1.69	5.63	5.63	0.86233	.	0.373895	0.25011	N	0.033840	T	0.22244	0.0536	N	0.20986	0.625	0.32625	N	0.522858	B;B	0.29378	0.229;0.243	B;B	0.26770	0.073;0.048	T	0.19549	-1.0302	10	0.72032	D	0.01	.	19.6736	0.95921	0.0:1.0:0.0:0.0	.	3036;3036	Q2LD37-6;Q2LD37	.;K1109_HUMAN	I	3036	ENSP00000264501:T3036I;ENSP00000373390:T3036I;ENSP00000389925:T3036I	ENSP00000264501:T3036I	T	+	2	0	KIAA1109	123427215	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.219000	0.58561	2.660000	0.90430	0.650000	0.86243	ACA	KIAA1109	-	NULL	ENSG00000138688		0.388	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1109	HGNC	protein_coding	OTTHUMT00000316415.1	435	0.00	0	C	NM_020797		123207765	123207765	+1	no_errors	ENST00000264501	ensembl	human	known	69_37n	missense	218	44.67	176	SNP	1.000	T
KIAA1210	57481	genome.wustl.edu	37	X	118221420	118221420	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chrX:118221420A>T	ENST00000402510.2	-	11	3772	c.3773T>A	c.(3772-3774)aTg>aAg	p.M1258K		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	1258										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						AGGGTGCTTCATAGGTAGCAT	0.453																																						dbGAP											0													33.0	31.0	32.0					X																	118221420		1859	4088	5947	-	-	-	SO:0001583	missense	0			AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.3773T>A	X.37:g.118221420A>T	ENSP00000384670:p.Met1258Lys		B7ZCI8|Q5JPN4	Missense_Mutation	SNP	NULL	p.M1258K	ENST00000402510.2	37	c.3773	CCDS48156.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	7.451|7.451	0.642765|0.642765	0.14451|0.14451	.|.	.|.	ENSG00000250423|ENSG00000248857	ENST00000402510|ENST00000440399	T|.	0.10960|.	2.82|.	4.0|4.0	-8.01|-8.01	0.01122|0.01122	.|.	.|.	.|.	.|.	.|.	T|.	0.15262|.	0.0368|.	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	B|.	0.29508|.	0.246|.	B|.	0.21546|.	0.035|.	T|.	0.16129|.	-1.0413|.	9|.	0.07813|.	T|.	0.8|.	.|.	5.7864|5.7864	0.18336|0.18336	0.1582:0.1047:0.6387:0.0984|0.1582:0.1047:0.6387:0.0984	.|.	1258|.	Q9ULL0|.	K1210_HUMAN|.	K|X	1258|664	ENSP00000384670:M1258K|.	ENSP00000384670:M1258K|.	M|Y	-|-	2|3	0|2	RP13-347D8.6|KIAA1210	118105448|118105448	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.019000|0.019000	0.09904|0.09904	-1.766000|-1.766000	0.01797|0.01797	-2.846000|-2.846000	0.00333|0.00333	-0.335000|-0.335000	0.08231|0.08231	ATG|TAT	KIAA1210	-	NULL	ENSG00000250423		0.453	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1210	HGNC	protein_coding	OTTHUMT00000371251.2	104	0.00	0	A	NM_020721		118221420	118221420	-1	no_errors	ENST00000402510	ensembl	human	known	69_37n	missense	62	47.01	55	SNP	0.000	T
KRTAP4-16P	85354	genome.wustl.edu	37	17	39258031	39258031	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	671469b6-2cc7-4236-95d3-3e3f73e08ea3	g.chr17:39258031T>C	ENST00000440582.1	-	1	430	c.431A>G	c.(430-432)tAt>tGt	p.Y144C						keratin associated protein 4-16, pseudogene											haematopoietic_and_lymphoid_tissue(1)|lung(1)	2						GGTTGGGTGATAGCAAGTGAC	0.642																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AC025904		17q21.2	2013-06-25	2010-01-06	2010-01-06	ENSG00000241241	ENSG00000241241		"""Keratin associated proteins"""	18921	pseudogene	pseudogene			"""keratin associated protein 4 pseudogene 1"""	KRTAP4P1			Standard	NG_005311		Approved	KAP4A			OTTHUMG00000133590	ENST00000440582.1:c.431A>G	17.37:g.39258031T>C	ENSP00000411198:p.Tyr144Cys			Missense_Mutation	SNP	NULL	p.Y144C	ENST00000440582.1	37	c.431		17	.	.	.	.	.	.	.	.	.	.	.	0.606	-0.827098	0.02734	.	.	ENSG00000241241	ENST00000440582	T	0.00669	5.9	2.66	0.395	0.16304	.	.	.	.	.	T	0.00356	0.0011	.	.	.	0.24499	N	0.994268	.	.	.	.	.	.	T	0.43669	-0.9377	6	0.02654	T	1	.	4.2595	0.10733	0.0:0.3477:0.0:0.6523	.	.	.	.	C	144	ENSP00000411198:Y144C	ENSP00000411198:Y144C	Y	-	2	0	AC100808.7	36511557	0.904000	0.30761	0.973000	0.42090	0.004000	0.04260	0.957000	0.29215	0.264000	0.21851	-0.508000	0.04489	TAT	KRTAP4-16P	-	NULL	ENSG00000241241		0.642	KRTAP4-16P-001	PUTATIVE	basic|appris_principal	protein_coding	KRTAP4-16P	HGNC	protein_coding	OTTHUMT00000257694.1	22	0.00	0	T	NG_005311		39258031	39258031	-1	no_errors	ENST00000440582	ensembl	human	putative	69_37n	missense	1	80.00	4	SNP	0.980	C
KRTAP4-16P	85354	genome.wustl.edu	37	17	39258031	39258031	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr17:39258031T>C	ENST00000440582.1	-	1	430	c.431A>G	c.(430-432)tAt>tGt	p.Y144C						keratin associated protein 4-16, pseudogene											haematopoietic_and_lymphoid_tissue(1)|lung(1)	2						GGTTGGGTGATAGCAAGTGAC	0.642																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AC025904		17q21.2	2013-06-25	2010-01-06	2010-01-06	ENSG00000241241	ENSG00000241241		"""Keratin associated proteins"""	18921	pseudogene	pseudogene			"""keratin associated protein 4 pseudogene 1"""	KRTAP4P1			Standard	NG_005311		Approved	KAP4A			OTTHUMG00000133590	ENST00000440582.1:c.431A>G	17.37:g.39258031T>C	ENSP00000411198:p.Tyr144Cys			Missense_Mutation	SNP	NULL	p.Y144C	ENST00000440582.1	37	c.431		17	.	.	.	.	.	.	.	.	.	.	.	0.606	-0.827098	0.02734	.	.	ENSG00000241241	ENST00000440582	T	0.00669	5.9	2.66	0.395	0.16304	.	.	.	.	.	T	0.00356	0.0011	.	.	.	0.24499	N	0.994268	.	.	.	.	.	.	T	0.43669	-0.9377	6	0.02654	T	1	.	4.2595	0.10733	0.0:0.3477:0.0:0.6523	.	.	.	.	C	144	ENSP00000411198:Y144C	ENSP00000411198:Y144C	Y	-	2	0	AC100808.7	36511557	0.904000	0.30761	0.973000	0.42090	0.004000	0.04260	0.957000	0.29215	0.264000	0.21851	-0.508000	0.04489	TAT	KRTAP4-16P	-	NULL	ENSG00000241241		0.642	KRTAP4-16P-001	PUTATIVE	basic|appris_principal	protein_coding	KRTAP4-16P	HGNC	protein_coding	OTTHUMT00000257694.1	25	0.00	0	T	NG_005311		39258031	39258031	-1	no_errors	ENST00000440582	ensembl	human	putative	69_37n	missense	1	80.00	4	SNP	0.980	C
LETMD1	25875	genome.wustl.edu	37	12	51450235	51450235	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr12:51450235G>A	ENST00000262055.4	+	7	904	c.865G>A	c.(865-867)Gct>Act	p.A289T	LETMD1_ENST00000380123.2_3'UTR|LETMD1_ENST00000550929.1_Missense_Mutation_p.A233T|LETMD1_ENST00000548516.1_3'UTR|LETMD1_ENST00000547008.1_Missense_Mutation_p.A165T|LETMD1_ENST00000418425.2_Missense_Mutation_p.A302T|LETMD1_ENST00000552739.1_Missense_Mutation_p.A172T	NM_015416.4	NP_056231.3	Q6P1Q0	LTMD1_HUMAN	LETM1 domain containing 1	289	LETM1.					integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)				central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(4)|skin(1)|urinary_tract(3)	16						ACTGGACAAGGCTTTGGCAAA	0.498																																						dbGAP											0													120.0	110.0	113.0					12																	51450235		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF195651	CCDS8806.1, CCDS58231.1, CCDS73469.1	12q13.13	2006-04-12				ENSG00000050426			24241	protein-coding gene	gene with protein product	"""cervical cancer 1 protooncogene"""					12879013, 12061725	Standard	NM_015416		Approved	HCCR1	uc009zlw.3	Q6P1Q0	OTTHUMG00000169538	ENST00000262055.4:c.865G>A	12.37:g.51450235G>A	ENSP00000262055:p.Ala289Thr		A6NER7|B3KXK7|Q6X2E4|Q6X2E5|Q7L2G9|Q7L690|Q8WXW6|Q96PK7|Q9BY59|Q9Y3X3	Missense_Mutation	SNP	pfam_LETM1	p.A289T	ENST00000262055.4	37	c.865	CCDS8806.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.0|20.0	3.929963|3.929963	0.73327|0.73327	.|.	.|.	ENSG00000050426|ENSG00000050426	ENST00000551477;ENST00000550929;ENST00000262055;ENST00000549340;ENST00000548251;ENST00000550814;ENST00000547660;ENST00000418425;ENST00000448283;ENST00000547008;ENST00000552739;ENST00000547256|ENST00000553043	T;T;T;T;T;T;T;T;T;T|.	0.48836|.	0.89;0.89;0.89;0.89;0.89;0.8;0.89;0.89;0.89;0.89|.	5.49|5.49	5.49|5.49	0.81192|0.81192	LETM1-like (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.64594|0.64594	0.2612|0.2612	M|M	0.63843|0.63843	1.955|1.955	0.80722|0.80722	D|D	1|1	D;D;D;D;D|P;D	0.89917|0.53312	1.0;0.999;0.999;0.999;0.999|0.944;0.959	D;D;D;D;D|P;P	0.87578|0.48030	0.998;0.979;0.998;0.952;0.979|0.563;0.564	T|T	0.69202|0.69202	-0.5207|-0.5207	10|8	0.25751|0.87932	T|D	0.34|0	-8.5701|-8.5701	18.5409|18.5409	0.91027|0.91027	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	239;302;165;172;289|126;126	F8VVQ3;B3KXK7;F8W1Z2;F8VP71;Q6P1Q0|B7Z9A7;F8W6J0	.;.;.;.;LTMD1_HUMAN|.;.	T|D	256;233;289;239;172;97;44;302;239;165;172;71|57	ENSP00000446862:A256T;ENSP00000450163:A233T;ENSP00000262055:A289T;ENSP00000449896:A239T;ENSP00000447166:A172T;ENSP00000448222:A97T;ENSP00000450391:A44T;ENSP00000389903:A302T;ENSP00000447419:A165T;ENSP00000450333:A172T|.	ENSP00000262055:A289T|ENSP00000369478:G126D	A|G	+|+	1|2	0|0	LETMD1|LETMD1	49736502|49736502	1.000000|1.000000	0.71417|0.71417	0.969000|0.969000	0.41365|0.41365	0.250000|0.250000	0.25880|0.25880	6.815000|6.815000	0.75242|0.75242	2.756000|2.756000	0.94617|0.94617	0.655000|0.655000	0.94253|0.94253	GCT|GGC	LETMD1	-	pfam_LETM1	ENSG00000050426		0.498	LETMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LETMD1	HGNC	protein_coding	OTTHUMT00000404710.1	182	0.00	0	G	NM_015416		51450235	51450235	+1	no_errors	ENST00000262055	ensembl	human	known	69_37n	missense	93	45.09	78	SNP	0.997	A
LOXHD1	125336	genome.wustl.edu	37	18	44157812	44157812	+	Missense_Mutation	SNP	C	C	T	rs535637788		TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr18:44157812C>T	ENST00000398722.4	-	7	993	c.994G>A	c.(994-996)Gag>Aag	p.E332K	LOXHD1_ENST00000441551.2_Missense_Mutation_p.E610K|LOXHD1_ENST00000536736.1_Missense_Mutation_p.E610K			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	332	PLAT 3. {ECO:0000255|PROSITE- ProRule:PRU00152}.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						GTGACAGACTCGATAGTGAAC	0.562													C|||	1	0.000199681	0.0	0.0014	5008	,	,		20274	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													52.0	55.0	54.0					18																	44157812		692	1591	2283	-	-	-	SO:0001583	missense	0			AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.994G>A	18.37:g.44157812C>T	ENSP00000381707:p.Glu332Lys		B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Missense_Mutation	SNP	pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_LipOase_LH2,pfscan_LipOase_LH2	p.E610K	ENST00000398722.4	37	c.1828		18	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.34|13.34	2.208455|2.208455	0.39003|0.39003	.|.	.|.	ENSG00000167210|ENSG00000167210	ENST00000398722;ENST00000536736;ENST00000335730|ENST00000441551	T;T|.	0.63913|.	-0.07;-0.07|.	5.66|5.66	5.66|5.66	0.87406|0.87406	.|.	0.104661|.	0.64402|.	D|.	0.000006|.	T|T	0.74374|0.74374	0.3708|0.3708	M|M	0.62016|0.62016	1.91|1.91	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.85130|.	0.994;0.997|.	T|T	0.71220|0.71220	-0.4657|-0.4657	10|5	0.29301|.	T|.	0.29|.	.|.	19.7398|19.7398	0.96223|0.96223	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	610;332|.	F5GZB4;Q8IVV2-2|.	.;.|.	K|Q	332;610;332|590	ENSP00000381707:E332K;ENSP00000444586:E610K|.	ENSP00000338222:E332K|.	E|R	-|-	1|2	0|0	LOXHD1|LOXHD1	42411810|42411810	1.000000|1.000000	0.71417|0.71417	0.984000|0.984000	0.44739|0.44739	0.072000|0.072000	0.16883|0.16883	7.701000|7.701000	0.84566|0.84566	2.665000|2.665000	0.90641|0.90641	0.561000|0.561000	0.74099|0.74099	GAG|CGA	LOXHD1	-	pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_LipOase_LH2,pfscan_LipOase_LH2	ENSG00000167210		0.562	LOXHD1-201	KNOWN	basic	protein_coding	LOXHD1	HGNC	protein_coding		79	0.00	0	C	NM_144612		44157812	44157812	-1	no_errors	ENST00000536736	ensembl	human	known	69_37n	missense	56	42.27	41	SNP	1.000	T
LUZP1	7798	genome.wustl.edu	37	1	23419726	23419727	+	Frame_Shift_Del	DEL	TA	TA	-			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	TA	TA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr1:23419726_23419727delTA	ENST00000302291.4	-	4	1829_1830	c.1028_1029delTA	c.(1027-1029)atafs	p.I343fs	LUZP1_ENST00000418342.1_Frame_Shift_Del_p.I343fs|LUZP1_ENST00000314174.5_Frame_Shift_Del_p.I343fs|LUZP1_ENST00000374623.3_Frame_Shift_Del_p.I343fs			Q86V48	LUZP1_HUMAN	leucine zipper protein 1	343					artery development (GO:0060840)|neural fold bending (GO:0021503)|ventricular septum development (GO:0003281)	membrane (GO:0016020)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(12)|upper_aerodigestive_tract(2)	31		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Ovarian(437;0.00373)|Breast(348;0.00815)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;4.88e-27)|Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;4.31e-06)|GBM - Glioblastoma multiforme(114;8.64e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00112)|KIRC - Kidney renal clear cell carcinoma(1967;0.00176)|STAD - Stomach adenocarcinoma(196;0.0146)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.0967)|LUSC - Lung squamous cell carcinoma(448;0.199)		TTTGTAGCTTTATCTCCTCCAG	0.371																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC051733	CCDS30628.1	1p36	2008-02-05			ENSG00000169641	ENSG00000169641			14985	protein-coding gene	gene with protein product		601422				8812416	Standard	NM_033631		Approved	LUZP	uc010odv.1	Q86V48	OTTHUMG00000003227	ENST00000302291.4:c.1028_1029delTA	1.37:g.23419726_23419727delTA	ENSP00000303758:p.Ile343fs		Q5TH93|Q8N4X3|Q8TEH1	Frame_Shift_Del	DEL	NULL	p.I343fs	ENST00000302291.4	37	c.1029_1028	CCDS30628.1	1																																																																																			LUZP1	-	NULL	ENSG00000169641		0.371	LUZP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LUZP1	HGNC	protein_coding	OTTHUMT00000008900.3	678	0.00	0	TA	NM_033631		23419726	23419727	-1	no_errors	ENST00000302291	ensembl	human	known	69_37n	frame_shift_del	394	42.98	297	DEL	0.998:1.000	-
LRRN2	10446	genome.wustl.edu	37	1	204588156	204588156	+	Missense_Mutation	SNP	C	C	T	rs200960245		TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr1:204588156C>T	ENST00000367175.1	-	1	3177	c.965G>A	c.(964-966)cGg>cAg	p.R322Q	RP11-430C7.4_ENST00000453895.1_RNA|LRRN2_ENST00000367177.3_Missense_Mutation_p.R322Q|LRRN2_ENST00000367176.3_Missense_Mutation_p.R322Q|LRRN2_ENST00000496057.1_5'Flank			O75325	LRRN2_HUMAN	leucine rich repeat neuronal 2	322					cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|liver(1)|lung(22)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)			GAAGGACAGCCGTGGGTTATT	0.592																																						dbGAP											0													98.0	70.0	80.0					1																	204588156		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF030435	CCDS1448.1	1q32.1	2013-01-11	2007-01-31	2007-01-31	ENSG00000170382	ENSG00000170382		"""Immunoglobulin superfamily / I-set domain containing"""	16914	protein-coding gene	gene with protein product	"""leucine rich and ankyrin repeats 1"", ""fibronectin type III, immunoglobulin and leucine rich repeat domain 7"""	605492	"""leucine rich repeat neuronal 5"""	LRRN5		9662332	Standard	NM_006338		Approved	GAC1, LRANK1, FIGLER7	uc001hbf.1	O75325	OTTHUMG00000035989	ENST00000367175.1:c.965G>A	1.37:g.204588156C>T	ENSP00000356143:p.Arg322Gln		B2R624|Q5T0Y0|Q6UXM0|Q8N182	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.R322Q	ENST00000367175.1	37	c.965	CCDS1448.1	1	.	.	.	.	.	.	.	.	.	.	C	14.86	2.660051	0.47572	.	.	ENSG00000170382	ENST00000367176;ENST00000367177;ENST00000367175	T;T;T	0.60040	0.22;0.22;0.22	5.69	5.69	0.88448	.	0.000000	0.39615	N	0.001308	T	0.54255	0.1847	N	0.13371	0.34	0.38914	D	0.957584	D	0.76494	0.999	D	0.67103	0.949	T	0.55988	-0.8053	10	0.33141	T	0.24	.	7.8528	0.29464	0.0:0.8044:0.0:0.1956	.	322	O75325	LRRN2_HUMAN	Q	322	ENSP00000356144:R322Q;ENSP00000356145:R322Q;ENSP00000356143:R322Q	ENSP00000356143:R322Q	R	-	2	0	LRRN2	202854779	0.997000	0.39634	0.996000	0.52242	0.996000	0.88848	2.491000	0.45303	2.688000	0.91661	0.563000	0.77884	CGG	LRRN2	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000170382		0.592	LRRN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LRRN2	HGNC	protein_coding	OTTHUMT00000089894.1	69	0.00	0	C	NM_006338		204588156	204588156	-1	no_errors	ENST00000367175	ensembl	human	known	69_37n	missense	33	40.00	22	SNP	0.982	T
MAB21L2	10586	genome.wustl.edu	37	4	151504781	151504781	+	Silent	SNP	G	G	C			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr4:151504781G>C	ENST00000317605.4	+	1	1705	c.600G>C	c.(598-600)gtG>gtC	p.V200V	LRBA_ENST00000507224.1_Intron|LRBA_ENST00000510413.1_Intron|LRBA_ENST00000503716.1_5'Flank|RP11-1336O20.2_ENST00000507934.1_RNA|LRBA_ENST00000535741.1_Intron|LRBA_ENST00000357115.3_Intron	NM_006439.4	NP_006430.1	Q9Y586	MB212_HUMAN	mab-21-like 2 (C. elegans)	200					camera-type eye development (GO:0043010)|embryonic body morphogenesis (GO:0010172)|eye development (GO:0001654)|nervous system development (GO:0007399)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)				breast(2)|endometrium(6)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(2)	21	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.159)		CCAATCGGGTGGCCGAGGTCA	0.642																																						dbGAP											0													32.0	35.0	34.0					4																	151504781		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF155219	CCDS3774.1	4q31.3	2013-10-22	2001-11-28		ENSG00000181541	ENSG00000181541			6758	protein-coding gene	gene with protein product		604357	"""mab-21 (C. elegans)-like 2"""				Standard	NM_006439		Approved		uc003ilw.3	Q9Y586	OTTHUMG00000161442	ENST00000317605.4:c.600G>C	4.37:g.151504781G>C			B3KP37|Q9HBA7	Silent	SNP	pfam_Mab-21_dom,pfscan_Ricin_B_lectin	p.V200	ENST00000317605.4	37	c.600	CCDS3774.1	4																																																																																			MAB21L2	-	pfam_Mab-21_dom	ENSG00000181541		0.642	MAB21L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAB21L2	HGNC	protein_coding	OTTHUMT00000364937.1	16	0.00	0	G	NM_006439		151504781	151504781	+1	no_errors	ENST00000317605	ensembl	human	known	69_37n	silent	15	37.50	9	SNP	1.000	C
MASP2	10747	genome.wustl.edu	37	1	11107016	11107016	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr1:11107016G>A	ENST00000400897.3	-	2	181	c.166C>T	c.(166-168)Cgc>Tgc	p.R56C	MASP2_ENST00000400898.3_Missense_Mutation_p.R56C	NM_006610.3	NP_006601.2	O00187	MASP2_HUMAN	mannan-binding lectin serine peptidase 2	56	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|complement component C4b binding (GO:0001855)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			biliary_tract(1)|endometrium(2)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.071)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.12e-07)|COAD - Colon adenocarcinoma(227;7.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)|STAD - Stomach adenocarcinoma(313;0.192)		AGGCGCAGGCGGTAGCCGGGG	0.657																																					GBM(35;611 746 20780 22741 36496)	dbGAP											0													21.0	26.0	25.0					1																	11107016		2185	4276	6461	-	-	-	SO:0001583	missense	0			X98400	CCDS123.1, CCDS124.1	1p36.3-p36.2	2014-09-17	2005-08-17		ENSG00000009724	ENSG00000009724			6902	protein-coding gene	gene with protein product		605102	"""mannan-binding lectin serine protease 2"", ""mannan-binding lectin serine peptidase 1 pseudogene 1"", ""mannan-binding lectin serine protease 1 pseudogene 1"""	MASP1P1		9087411, 9777418	Standard	NM_006610		Approved		uc001aru.3	O00187	OTTHUMG00000002121	ENST00000400897.3:c.166C>T	1.37:g.11107016G>A	ENSP00000383690:p.Arg56Cys		A8K458|A8MWJ2|O75754|Q5TEQ5|Q5TER0|Q96QG4|Q9BZH0|Q9H498|Q9H499|Q9UBP3|Q9UC48|Q9ULC7|Q9UMV3|Q9Y270	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_CUB,pfam_Sushi_SCR_CCP,pfam_EGF-like_Ca-bd,superfamily_Pept_cys/ser_Trypsin-like,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_EGF-like_Ca-bd,smart_EGF-like,smart_Sushi_SCR_CCP,smart_Peptidase_S1_S6,pfscan_CUB,pfscan_Sushi_SCR_CCP,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.R56C	ENST00000400897.3	37	c.166	CCDS123.1	1	.	.	.	.	.	.	.	.	.	.	G	14.36	2.510782	0.44660	.	.	ENSG00000009724	ENST00000400897;ENST00000400898	T;T	0.19394	2.15;2.15	5.21	4.23	0.50019	CUB (5);	0.349623	0.25575	N	0.029739	T	0.48314	0.1493	M	0.83852	2.665	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.79784	0.932;0.993	T	0.54180	-0.8332	10	0.72032	D	0.01	.	13.5395	0.61666	0.0:0.2471:0.7529:0.0	.	56;56	O00187-2;O00187	.;MASP2_HUMAN	C	56	ENSP00000383690:R56C;ENSP00000383691:R56C	ENSP00000383690:R56C	R	-	1	0	MASP2	11029603	0.662000	0.27439	1.000000	0.80357	0.117000	0.20001	0.559000	0.23485	2.424000	0.82194	0.655000	0.94253	CGC	MASP2	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000009724		0.657	MASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MASP2	HGNC	protein_coding	OTTHUMT00000006072.1	54	0.00	0	G	NM_006610		11107016	11107016	-1	no_errors	ENST00000400897	ensembl	human	known	69_37n	missense	45	16.36	9	SNP	1.000	A
MDM2	4193	genome.wustl.edu	37	12	69202261	69202261	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr12:69202261G>C	ENST00000462284.1	+	1	306	c.4G>C	c.(4-6)Gtg>Ctg	p.V2L	MDM2_ENST00000393410.1_5'Flank|MDM2_ENST00000478070.1_5'Flank|MDM2_ENST00000517852.1_5'Flank|MDM2_ENST00000428863.2_5'UTR|MDM2_ENST00000356290.4_5'UTR|MDM2_ENST00000258149.5_5'UTR|MDM2_ENST00000393412.3_5'UTR|MDM2_ENST00000540827.1_5'UTR|MDM2_ENST00000258148.7_Missense_Mutation_p.V2L|MDM2_ENST00000350057.5_5'Flank|MDM2_ENST00000544561.1_5'Flank|MDM2_ENST00000348801.2_5'Flank|MDM2_ENST00000360430.2_5'Flank|MDM2_ENST00000545204.1_5'Flank|MDM2_ENST00000393413.3_5'Flank|MDM2_ENST00000299252.4_5'Flank	NM_002392.4	NP_002383.2	Q00987	MDM2_HUMAN	MDM2 proto-oncogene, E3 ubiquitin protein ligase	0	Necessary for interaction with USP2.				cellular response to acid chemical (GO:0071229)|cellular response to alkaloid (GO:0071312)|cellular response to antibiotic (GO:0071236)|cellular response to estrogen stimulus (GO:0071391)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to UV-C (GO:0071494)|cellular response to vitamin B1 (GO:0071301)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment of protein localization (GO:0045184)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of protein processing (GO:0010955)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-lysine modification (GO:0018205)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein export from nucleus (GO:0046827)|protein complex assembly (GO:0006461)|protein destabilization (GO:0031648)|protein localization to nucleus (GO:0034504)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of protein catabolic process (GO:0042176)|response to antibiotic (GO:0046677)|response to carbohydrate (GO:0009743)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ether (GO:0045472)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to morphine (GO:0043278)|synaptic transmission (GO:0007268)|traversing start control point of mitotic cell cycle (GO:0007089)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|p53 binding (GO:0002039)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(8)|prostate(1)|urinary_tract(1)	19	all_cancers(1;8.46e-121)|all_epithelial(5;3.21e-36)|Lung NSC(4;2.16e-33)|all_lung(4;3.03e-31)|Glioma(1;1.9e-09)|Breast(13;1.59e-06)|all_neural(1;1.03e-05)|Melanoma(1;0.0171)|Renal(347;0.0684)		all cancers(2;8.67e-65)|GBM - Glioblastoma multiforme(2;8.89e-62)|BRCA - Breast invasive adenocarcinoma(5;2.43e-08)|Lung(24;1.5e-05)|LUAD - Lung adenocarcinoma(15;8.5e-05)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)			ACCCCGGATGGTGAGGAGCAG	0.662			A		"""sarcoma, glioma, colorectal, other"""																																	dbGAP		Dom	yes		12	12q15	4193	Mdm2 p53 binding protein homolog		"""M, O, E, L"""	0													39.0	48.0	45.0					12																	69202261		1923	4128	6051	-	-	-	SO:0001583	missense	0				CCDS8986.2, CCDS61189.1	12q13-q14	2014-06-26	2014-06-26		ENSG00000135679	ENSG00000135679			6973	protein-coding gene	gene with protein product		164785	"""mouse double minute 2, human homolog of; p53-binding protein"", ""Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse)"", ""Mdm2 p53 binding protein homolog (mouse)"""			1614537, 16905769	Standard	NM_002392		Approved	HDM2, MGC5370	uc001sui.4	Q00987	OTTHUMG00000142827	ENST00000462284.1:c.4G>C	12.37:g.69202261G>C	ENSP00000417281:p.Val2Leu		A6NL51|A8K2S6|Q13226|Q13297|Q13298|Q13299|Q13300|Q13301|Q53XW0|Q71TW9|Q8WYJ1|Q8WYJ2|Q9UGI3|Q9UMT8	Missense_Mutation	SNP	pfam_SWIB_MDM2_domain,pfam_Znf_RanBP2,superfamily_SWIB_MDM2_domain,pirsf_p53_neg-reg_MDM_2/4,pfscan_Znf_RanBP2,pfscan_Znf_RING	p.V2L	ENST00000462284.1	37	c.4	CCDS8986.2	12	.	.	.	.	.	.	.	.	.	.	G	17.54	3.416054	0.62511	.	.	ENSG00000135679	ENST00000462284;ENST00000311420;ENST00000258148	T;T	0.44881	1.51;0.91	3.51	3.51	0.40186	.	229.394000	0.02394	U	0.079943	T	0.35038	0.0918	.	.	.	0.50313	D	0.999869	P;P	0.36282	0.546;0.546	B;B	0.34138	0.176;0.176	T	0.24012	-1.0172	8	.	.	.	-20.3698	10.8466	0.46746	0.0:0.0:1.0:0.0	.	2;2	G3XA89;Q00987-11	.;.	L	2	ENSP00000417281:V2L;ENSP00000258148:V2L	.	V	+	1	0	MDM2	67488528	0.398000	0.25279	0.038000	0.18304	0.558000	0.35554	2.329000	0.43876	2.244000	0.73946	0.462000	0.41574	GTG	MDM2	-	NULL	ENSG00000135679		0.662	MDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MDM2	HGNC	protein_coding	OTTHUMT00000286419.1	81	0.00	0	G	NM_006880		69202261	69202261	+1	no_errors	ENST00000462284	ensembl	human	known	69_37n	missense	9	88.16	67	SNP	0.064	C
MIR521-1	574494	genome.wustl.edu	37	19	54254529	54254529	+	RNA	SNP	C	C	G			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr19:54254529C>G	ENST00000384902.1	+	0	87				RNU6-751P_ENST00000516382.1_RNA|MIR519A1_ENST00000385257.1_RNA|MIR527_ENST00000385244.1_RNA|MIR522_ENST00000385071.1_RNA	NR_030216.1				microRNA 521-1																		AAATGGTTCCCTTTAGAGTGT	0.418																																						dbGAP											0													106.0	98.0	100.0					19																	54254529		1568	3582	5150	-	-	-			0					19q13.42	2011-09-12		2008-12-18	ENSG00000207634	ENSG00000207634		"""ncRNAs / Micro RNAs"""	32126	non-coding RNA	RNA, micro				MIRN521-1			Standard	NR_030216		Approved	hsa-mir-521-1	uc021vas.1				19.37:g.54254529C>G				RNA	SNP	-	NULL	ENST00000384902.1	37	NULL		19																																																																																			MIR522	-	-	ENSG00000207806		0.418	MIR521-1-201	KNOWN	basic	miRNA	MIR522	HGNC	miRNA		430	0.00	0	C	NR_030216		54254529	54254529	+1	no_errors	ENST00000385071	ensembl	human	known	69_37n	rna	224	41.97	162	SNP	0.203	G
MYCBP2	23077	genome.wustl.edu	37	13	77644815	77644815	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr13:77644815A>G	ENST00000544440.2	-	69	11758	c.11741T>C	c.(11740-11742)aTg>aCg	p.M3914T	MYCBP2_ENST00000357337.6_Missense_Mutation_p.M3914T|MYCBP2_ENST00000407578.2_Missense_Mutation_p.M3952T					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		GATTCCAACCATATGTTCTTT	0.318																																						dbGAP											0													229.0	212.0	218.0					13																	77644815		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.11741T>C	13.37:g.77644815A>G	ENSP00000444596:p.Met3914Thr			Missense_Mutation	SNP	pfam_PHR,pfam_Reg_chr_condens,pfam_Filamin/ABP280_repeat-like,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_Galactose-bd-like,superfamily_Ig_E-set,superfamily_ARM-type_fold,smart_Znf_RING,prints_Reg_chr_condens,pfscan_Filamin/ABP280_repeat-like,pfscan_Znf_RING,pfscan_Reg_chr_condens	p.M3952T	ENST00000544440.2	37	c.11855		13	.	.	.	.	.	.	.	.	.	.	A	16.23	3.063907	0.55432	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.32753	1.44;1.44;1.44	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.48607	0.1509	M	0.68593	2.085	0.80722	D	1	P	0.40431	0.717	P	0.52189	0.692	T	0.49560	-0.8927	10	0.87932	D	0	.	15.1695	0.72858	1.0:0.0:0.0:0.0	.	3914	O75592	MYCB2_HUMAN	T	3914;3952;3914	ENSP00000349892:M3914T;ENSP00000384288:M3952T;ENSP00000444596:M3914T	ENSP00000349892:M3914T	M	-	2	0	MYCBP2	76542816	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.915000	0.92740	2.172000	0.68678	0.533000	0.62120	ATG	MYCBP2	-	superfamily_ARM-type_fold	ENSG00000005810		0.318	MYCBP2-001	KNOWN	basic	protein_coding	MYCBP2	HGNC	protein_coding	OTTHUMT00000045326.1	306	0.00	0	A	NM_015057		77644815	77644815	-1	no_errors	ENST00000407578	ensembl	human	known	69_37n	missense	34	89.21	281	SNP	1.000	G
NACA	4666	genome.wustl.edu	37	12	57110900	57110900	+	Missense_Mutation	SNP	G	G	T	rs570866733		TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	671469b6-2cc7-4236-95d3-3e3f73e08ea3	g.chr12:57110900G>T	ENST00000454682.1	-	3	4695	c.4414C>A	c.(4414-4416)Cct>Act	p.P1472T	NACA_ENST00000552540.1_Intron|NACA_ENST00000548563.1_Intron|NACA_ENST00000546392.1_Intron|NACA_ENST00000551793.1_Intron|NACA_ENST00000393891.4_Intron|NACA_ENST00000550952.1_Intron|NACA_ENST00000356769.3_Intron	NM_001113203.2	NP_001106674.2	E9PAV3	NACAM_HUMAN	nascent polypeptide-associated complex alpha subunit	1472	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	10						GGGGAAGGAGGAGTCACTGCT	0.627			T	BCL6	NHL								g|||	1	0.000199681	0.0	0.0	5008	,	,		9153	0.0		0.0	False		,,,				2504	0.001					dbGAP		Dom	yes		12	12q23-q24.1	4666	nascent-polypeptide-associated complex alpha polypeptide		L	0																																										-	-	-	SO:0001583	missense	0			X80909	CCDS31837.1, CCDS44925.1, CCDS44925.2	12q23-q24.1	2008-09-05	2007-04-20		ENSG00000196531	ENSG00000196531			7629	protein-coding gene	gene with protein product		601234	"""nascent-polypeptide-associated complex alpha polypeptide"""			8047162	Standard	NM_001113202		Approved	NACA1	uc001sma.2	E9PAV3		ENST00000454682.1:c.4414C>A	12.37:g.57110900G>T	ENSP00000403817:p.Pro1472Thr			Missense_Mutation	SNP	pfam_Nas_poly-pep-assoc_cplx,superfamily_UBA-like,pfscan_Nas_poly-pep-assoc_cplx	p.P1472T	ENST00000454682.1	37	c.4414		12	.	.	.	.	.	.	.	.	.	.	G	3.743	-0.053168	0.07362	.	.	ENSG00000196531	ENST00000454682	T	0.51574	0.7	3.14	-0.26	0.12967	.	.	.	.	.	T	0.23806	0.0576	.	.	.	0.09310	N	1	B	0.18741	0.03	B	0.10450	0.005	T	0.17837	-1.0356	7	.	.	.	.	0.1839	0.00126	0.2618:0.1763:0.2926:0.2693	.	1472	E9PAV3	.	T	1472	ENSP00000403817:P1472T	.	P	-	1	0	NACA	55397167	0.000000	0.05858	0.000000	0.03702	0.226000	0.24999	-1.282000	0.02799	-0.030000	0.13804	0.184000	0.17185	CCT	NACA	-	NULL	ENSG00000196531		0.627	NACA-201	KNOWN	basic	protein_coding	NACA	HGNC	protein_coding		51	0.00	0	G	NM_005594		57110900	57110900	-1	no_errors	ENST00000454682	ensembl	human	known	69_37n	missense	23	14.81	4	SNP	0.000	T
NACA	4666	genome.wustl.edu	37	12	57110900	57110900	+	Missense_Mutation	SNP	G	G	T	rs570866733		TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr12:57110900G>T	ENST00000454682.1	-	3	4695	c.4414C>A	c.(4414-4416)Cct>Act	p.P1472T	NACA_ENST00000552540.1_Intron|NACA_ENST00000548563.1_Intron|NACA_ENST00000546392.1_Intron|NACA_ENST00000551793.1_Intron|NACA_ENST00000393891.4_Intron|NACA_ENST00000550952.1_Intron|NACA_ENST00000356769.3_Intron	NM_001113203.2	NP_001106674.2	E9PAV3	NACAM_HUMAN	nascent polypeptide-associated complex alpha subunit	1472	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	10						GGGGAAGGAGGAGTCACTGCT	0.627			T	BCL6	NHL								g|||	1	0.000199681	0.0	0.0	5008	,	,		9153	0.0		0.0	False		,,,				2504	0.001					dbGAP		Dom	yes		12	12q23-q24.1	4666	nascent-polypeptide-associated complex alpha polypeptide		L	0																																										-	-	-	SO:0001583	missense	0			X80909	CCDS31837.1, CCDS44925.1, CCDS44925.2	12q23-q24.1	2008-09-05	2007-04-20		ENSG00000196531	ENSG00000196531			7629	protein-coding gene	gene with protein product		601234	"""nascent-polypeptide-associated complex alpha polypeptide"""			8047162	Standard	NM_001113202		Approved	NACA1	uc001sma.2	E9PAV3		ENST00000454682.1:c.4414C>A	12.37:g.57110900G>T	ENSP00000403817:p.Pro1472Thr			Missense_Mutation	SNP	pfam_Nas_poly-pep-assoc_cplx,superfamily_UBA-like,pfscan_Nas_poly-pep-assoc_cplx	p.P1472T	ENST00000454682.1	37	c.4414		12	.	.	.	.	.	.	.	.	.	.	G	3.743	-0.053168	0.07362	.	.	ENSG00000196531	ENST00000454682	T	0.51574	0.7	3.14	-0.26	0.12967	.	.	.	.	.	T	0.23806	0.0576	.	.	.	0.09310	N	1	B	0.18741	0.03	B	0.10450	0.005	T	0.17837	-1.0356	7	.	.	.	.	0.1839	0.00126	0.2618:0.1763:0.2926:0.2693	.	1472	E9PAV3	.	T	1472	ENSP00000403817:P1472T	.	P	-	1	0	NACA	55397167	0.000000	0.05858	0.000000	0.03702	0.226000	0.24999	-1.282000	0.02799	-0.030000	0.13804	0.184000	0.17185	CCT	NACA	-	NULL	ENSG00000196531		0.627	NACA-201	KNOWN	basic	protein_coding	NACA	HGNC	protein_coding		56	0.00	0	G	NM_005594		57110900	57110900	-1	no_errors	ENST00000454682	ensembl	human	known	69_37n	missense	23	14.81	4	SNP	0.000	T
NOMO3	408050	genome.wustl.edu	37	16	16349580	16349580	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr16:16349580G>A	ENST00000399336.4	+	10	1139	c.967G>A	c.(967-969)Gtg>Atg	p.V323M	NOMO3_ENST00000538468.1_Missense_Mutation_p.V156M|NOMO3_ENST00000263012.6_Missense_Mutation_p.V323M	NM_001004067.3	NP_001004067.1	P69849	NOMO3_HUMAN	NODAL modulator 3	323						integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	8				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)		TTTCTAGCCCGTGTTCCACGT	0.547																																						dbGAP											0													88.0	103.0	98.0					16																	16349580		2025	4294	6319	-	-	-	SO:0001583	missense	0			AK125530	CCDS42123.1	16p13	2004-11-24				ENSG00000103226			25242	protein-coding gene	gene with protein product		609159				15257293	Standard	NM_001004067		Approved		uc002deq.3	P69849	OTTHUMG00000170525	ENST00000399336.4:c.967G>A	16.37:g.16349580G>A	ENSP00000382274:p.Val323Met			Missense_Mutation	SNP	pfam_DUF2012,superfamily_CarboxyPept-like_regulatory,superfamily_Carb-bd-like_fold,superfamily_Collagen-bd_Cna_B-typ_dom	p.V323M	ENST00000399336.4	37	c.967	CCDS42123.1	16	.	.	.	.	.	.	.	.	.	.	.	13.79	2.343461	0.41498	.	.	ENSG00000103226	ENST00000263012;ENST00000399336;ENST00000538468	T;T;T	0.04083	3.72;3.73;3.71	3.38	2.41	0.29592	.	0.220831	0.37857	N	0.001914	T	0.06050	0.0157	L	0.60455	1.87	0.58432	D	0.999993	P;P;P	0.47409	0.769;0.882;0.895	B;B;B	0.39876	0.312;0.092;0.289	T	0.36114	-0.9761	10	0.48119	T	0.1	-9.6229	9.7854	0.40673	0.1054:0.0:0.8946:0.0	.	156;323;323	F5H826;P69849;Q5JPE7-2	.;NOMO3_HUMAN;.	M	323;323;156	ENSP00000263012:V323M;ENSP00000382274:V323M;ENSP00000443768:V156M	ENSP00000263012:V323M	V	+	1	0	NOMO3	16257081	0.991000	0.36638	0.912000	0.35992	0.827000	0.46813	2.122000	0.41987	0.560000	0.29169	-0.463000	0.05309	GTG	NOMO3	-	superfamily_CarboxyPept-like_regulatory	ENSG00000103226		0.547	NOMO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOMO3	HGNC	protein_coding	OTTHUMT00000409528.13	423	0.00	0	G	NM_001004067		16349580	16349580	+1	no_errors	ENST00000399336	ensembl	human	known	69_37n	missense	227	40.42	154	SNP	0.997	A
OR10H2	26538	genome.wustl.edu	37	19	15838966	15838966	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr19:15838966C>T	ENST00000305899.3	+	1	133	c.113C>T	c.(112-114)aCg>aTg	p.T38M		NM_013939.2	NP_039227.1	O60403	O10H2_HUMAN	olfactory receptor, family 10, subfamily H, member 2	38						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(1)	27	all_hematologic(1;0.0517)|Acute lymphoblastic leukemia(2;0.074)					TACCTGTTCACGCTGCTGGGC	0.582																																						dbGAP											0													239.0	199.0	213.0					19																	15838966		2203	4300	6503	-	-	-	SO:0001583	missense	0			AC004597	CCDS12333.1	19p13.1	2012-08-09				ENSG00000171942		"""GPCR / Class A : Olfactory receptors"""	8173	protein-coding gene	gene with protein product							Standard	NM_013939		Approved		uc002nbm.2	O60403		ENST00000305899.3:c.113C>T	19.37:g.15838966C>T	ENSP00000306095:p.Thr38Met		Q6IFQ1|Q96R58	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.T38M	ENST00000305899.3	37	c.113	CCDS12333.1	19	.	.	.	.	.	.	.	.	.	.	.	15.99	2.995658	0.54147	.	.	ENSG00000171942	ENST00000305899	T	0.01455	4.87	2.88	2.88	0.33553	.	0.000000	0.50627	D	0.000103	T	0.07007	0.0178	M	0.91140	3.18	0.32794	N	0.500764	D	0.61080	0.989	P	0.48738	0.588	T	0.16335	-1.0406	10	0.72032	D	0.01	.	11.2362	0.48942	0.0:1.0:0.0:0.0	.	38	O60403	O10H2_HUMAN	M	38	ENSP00000306095:T38M	ENSP00000306095:T38M	T	+	2	0	OR10H2	15699966	0.011000	0.17503	0.989000	0.46669	0.994000	0.84299	1.756000	0.38390	1.446000	0.47643	0.537000	0.68136	ACG	OR10H2	-	pfam_7TM_GPCR_olfarory/Srsx,prints_7TM_GPCR_Rhodpsn	ENSG00000171942		0.582	OR10H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10H2	HGNC	protein_coding	OTTHUMT00000460917.1	345	0.00	0	C			15838966	15838966	+1	no_errors	ENST00000305899	ensembl	human	known	69_37n	missense	170	46.37	147	SNP	0.994	T
PANX2	56666	genome.wustl.edu	37	22	50617594	50617595	+	Frame_Shift_Ins	INS	-	-	CC	rs376326556		TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-10A-01D-A12B-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	671469b6-2cc7-4236-95d3-3e3f73e08ea3	g.chr22:50617594_50617595insCC	ENST00000395842.2	+	3	1922_1923	c.1922_1923insCC	c.(1921-1926)ggccccfs	p.GP641fs	PANX2_ENST00000159647.5_Intron	NM_052839.3	NP_443071.2	Q96RD6	PANX2_HUMAN	pannexin 2	641					ion transport (GO:0006811)|protein hexamerization (GO:0034214)|response to ischemia (GO:0002931)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gap junction hemi-channel activity (GO:0055077)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(1)|skin(1)	7		all_cancers(38;1.14e-10)|all_epithelial(38;2.12e-09)|all_lung(38;7.01e-05)|Breast(42;0.000523)|Lung NSC(38;0.0018)|Ovarian(80;0.0365)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.105)		GAGGACGGGGGCCCCCGCCTGC	0.678																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS14085.2, CCDS54544.1	22q13.33	2011-12-05			ENSG00000073150	ENSG00000073150		"""Ion channels / Pannexins"""	8600	protein-coding gene	gene with protein product		608421				14702039, 14597722	Standard	NM_052839		Approved	hPANX2, PX2	uc003bjn.4	Q96RD6	OTTHUMG00000044649	ENST00000395842.2:c.1925_1926dupCC	22.37:g.50617597_50617598dupCC	ENSP00000379183:p.Gly641fs		B7Z684|Q96RD5|Q9UGX8	Frame_Shift_Ins	INS	pfam_Innexin,pfscan_Innexin	p.R643fs	ENST00000395842.2	37	c.1922_1923	CCDS14085.2	22																																																																																			PANX2	-	NULL	ENSG00000073150		0.678	PANX2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PANX2	HGNC	protein_coding	OTTHUMT00000075010.3	29	0.00	0	-	NM_052839		50617594	50617595	+1	no_errors	ENST00000395842	ensembl	human	known	69_37n	frame_shift_ins	4	33.33	2	INS	0.106:0.002	CC
PANX2	56666	genome.wustl.edu	37	22	50617594	50617595	+	Frame_Shift_Ins	INS	-	-	CC	rs376326556		TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr22:50617594_50617595insCC	ENST00000395842.2	+	3	1922_1923	c.1922_1923insCC	c.(1921-1926)ggccccfs	p.GP641fs	PANX2_ENST00000159647.5_Intron	NM_052839.3	NP_443071.2	Q96RD6	PANX2_HUMAN	pannexin 2	641					ion transport (GO:0006811)|protein hexamerization (GO:0034214)|response to ischemia (GO:0002931)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gap junction hemi-channel activity (GO:0055077)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(1)|skin(1)	7		all_cancers(38;1.14e-10)|all_epithelial(38;2.12e-09)|all_lung(38;7.01e-05)|Breast(42;0.000523)|Lung NSC(38;0.0018)|Ovarian(80;0.0365)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.105)		GAGGACGGGGGCCCCCGCCTGC	0.678																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS14085.2, CCDS54544.1	22q13.33	2011-12-05			ENSG00000073150	ENSG00000073150		"""Ion channels / Pannexins"""	8600	protein-coding gene	gene with protein product		608421				14702039, 14597722	Standard	NM_052839		Approved	hPANX2, PX2	uc003bjn.4	Q96RD6	OTTHUMG00000044649	ENST00000395842.2:c.1925_1926dupCC	22.37:g.50617597_50617598dupCC	ENSP00000379183:p.Gly641fs		B7Z684|Q96RD5|Q9UGX8	Frame_Shift_Ins	INS	pfam_Innexin,pfscan_Innexin	p.R643fs	ENST00000395842.2	37	c.1922_1923	CCDS14085.2	22																																																																																			PANX2	-	NULL	ENSG00000073150		0.678	PANX2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PANX2	HGNC	protein_coding	OTTHUMT00000075010.3	14	0.00	0	-	NM_052839		50617594	50617595	+1	no_errors	ENST00000395842	ensembl	human	known	69_37n	frame_shift_ins	4	33.33	2	INS	0.106:0.002	CC
PCDHGA5	56110	genome.wustl.edu	37	5	140746002	140746002	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr5:140746002G>C	ENST00000518069.1	+	1	2105	c.2105G>C	c.(2104-2106)tGc>tCc	p.C702S	PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018918.2|NM_032054.1	NP_061741.1|NP_114443.1	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5	702					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|upper_aerodigestive_tract(3)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAGTCTCCTGCGTCTTCCTG	0.597																																						dbGAP											0													191.0	207.0	202.0					5																	140746002		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152512	CCDS54925.1, CCDS75333.1	5q31	2010-01-26				ENSG00000253485		"""Cadherins / Protocadherins : Clustered"""	8703	other	protocadherin	"""cadherin ME3"""	606292				10380929	Standard	NM_018918		Approved	CDH-GAMMA-A5, ME3, PCDH-GAMMA-A5		Q9Y5G8		ENST00000518069.1:c.2105G>C	5.37:g.140746002G>C	ENSP00000429834:p.Cys702Ser		Q2M3F5|Q9Y5D2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.C702S	ENST00000518069.1	37	c.2105	CCDS54925.1	5	.	.	.	.	.	.	.	.	.	.	.	9.293	1.051115	0.19827	.	.	ENSG00000253485	ENST00000518069	T	0.13196	2.61	4.93	4.93	0.64822	.	.	.	.	.	T	0.22704	0.0548	M	0.62016	1.91	0.25112	N	0.9907	P;B	0.38800	0.648;0.062	B;B	0.44224	0.444;0.178	T	0.07252	-1.0782	9	0.66056	D	0.02	.	13.142	0.59440	0.0:0.0:0.8398:0.1602	.	702;702	Q9Y5G8-2;Q9Y5G8	.;PCDG5_HUMAN	S	702	ENSP00000429834:C702S	ENSP00000429834:C702S	C	+	2	0	PCDHGA5	140726186	0.000000	0.05858	0.968000	0.41197	0.020000	0.10135	0.358000	0.20216	2.445000	0.82738	0.563000	0.77884	TGC	PCDHGA5	-	NULL	ENSG00000253485		0.597	PCDHGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA5	HGNC	protein_coding	OTTHUMT00000374742.1	43	0.00	0	G	NM_018918		140746002	140746002	+1	no_errors	ENST00000518069	ensembl	human	known	69_37n	missense	7	81.08	30	SNP	0.933	C
PEG3	5178	genome.wustl.edu	37	19	57326308	57326308	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr19:57326308A>C	ENST00000326441.9	-	10	3865	c.3502T>G	c.(3502-3504)Tgt>Ggt	p.C1168G	ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000391708.3_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.C1168G|PEG3_ENST00000598410.1_Missense_Mutation_p.C1044G|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000593695.1_Missense_Mutation_p.C1042G|ZIM2_ENST00000601070.1_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	1168					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		GATTCCCCACACTTTGGACAT	0.428																																						dbGAP											0													149.0	143.0	145.0					19																	57326308		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.3502T>G	19.37:g.57326308A>C	ENSP00000326581:p.Cys1168Gly		A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.C1168G	ENST00000326441.9	37	c.3502	CCDS12948.1	19	.	.	.	.	.	.	.	.	.	.	A	19.31	3.803091	0.70682	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	D;D	0.99974	-10.2;-10.2	3.84	3.84	0.44239	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.49916	D	0.000138	D	0.99972	0.9991	M	0.89601	3.045	.	.	.	D;D;D	0.89917	1.0;0.984;0.999	D;D;D	0.91635	0.999;0.934;0.976	D	0.94808	0.7976	9	0.87932	D	0	-26.5579	11.2477	0.49006	1.0:0.0:0.0:0.0	.	1044;1168;1103	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	G	1168	ENSP00000326581:C1168G;ENSP00000403051:C1168G	ENSP00000326581:C1168G	C	-	1	0	ZIM2	62018120	0.996000	0.38824	0.936000	0.37596	0.998000	0.95712	4.443000	0.59994	1.975000	0.57531	0.533000	0.62120	TGT	PEG3	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198300		0.428	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG3	HGNC	protein_coding	OTTHUMT00000416099.2	165	0.00	0	A			57326308	57326308	-1	no_errors	ENST00000326441	ensembl	human	known	69_37n	missense	81	52.07	88	SNP	0.996	C
PHEX	5251	genome.wustl.edu	37	X	22208620	22208620	+	Splice_Site	SNP	G	G	A			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chrX:22208620G>A	ENST00000379374.4	+	15	2210		c.e15+1		PHEX_ENST00000537599.1_Splice_Site|PHEX_ENST00000535894.1_Splice_Site|PHEX_ENST00000418858.3_Splice_Site	NM_000444.4	NP_000435.3	P78562	PHEX_HUMAN	phosphate regulating endopeptidase homolog, X-linked						bone mineralization (GO:0030282)|cell-cell signaling (GO:0007267)|cellular protein modification process (GO:0006464)|organophosphate metabolic process (GO:0019637)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|cervix(2)|endometrium(2)|large_intestine(12)|liver(1)|lung(19)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	42						AACCAGATCCGTGAGTACGGG	0.418																																						dbGAP											0			GRCh37	CS992468	PHEX	S							155.0	131.0	139.0					X																	22208620		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U82970	CCDS14204.1	Xp22.2-p22.1	2008-07-31	2008-07-31		ENSG00000102174	ENSG00000102174			8918	protein-coding gene	gene with protein product		300550	"""phosphate regulating gene with homologies to endopeptidases on the X chromosome (hypophosphatemia, vitamin D resistant rickets)"""	HYP, HPDR		7550339, 9070861	Standard	NM_000444		Approved	PEX, HPDR1, HYP1, XLH	uc004dah.3	P78562	OTTHUMG00000021241	ENST00000379374.4:c.1645+1G>A	X.37:g.22208620G>A			O00678|Q13646|Q2M325|Q93032|Q99827	Splice_Site	SNP	-	e15+1	ENST00000379374.4	37	c.1645+1	CCDS14204.1	X	.	.	.	.	.	.	.	.	.	.	g	17.80	3.477187	0.63849	.	.	ENSG00000102174	ENST00000379374;ENST00000537599;ENST00000535894;ENST00000418858	.	.	.	5.03	5.03	0.67393	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.1518	0.65389	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PHEX	22118541	1.000000	0.71417	1.000000	0.80357	0.695000	0.40330	7.148000	0.77389	2.312000	0.78011	0.540000	0.68198	.	PHEX	-	-	ENSG00000102174		0.418	PHEX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHEX	HGNC	protein_coding	OTTHUMT00000056035.1	372	0.00	0	G	NM_000444	Intron	22208620	22208620	+1	no_errors	ENST00000379374	ensembl	human	known	69_37n	splice_site	208	45.69	175	SNP	0.999	A
PLCE1	51196	genome.wustl.edu	37	10	96030357	96030357	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr10:96030357A>C	ENST00000371380.3	+	17	4739	c.4504A>C	c.(4504-4506)Aag>Cag	p.K1502Q	PLCE1_ENST00000371375.1_Missense_Mutation_p.K1194Q|PLCE1_ENST00000371385.3_Missense_Mutation_p.K1194Q|PLCE1_ENST00000260766.3_Missense_Mutation_p.K1502Q			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	1502	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				AGAAATTTTCAAGGTGAGCTC	0.413																																						dbGAP											0													117.0	109.0	112.0					10																	96030357		1915	4129	6044	-	-	-	SO:0001583	missense	0				CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.4504A>C	10.37:g.96030357A>C	ENSP00000360431:p.Lys1502Gln		A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_Ras-assoc,pfam_RasGRF_CDC25,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_Ras_GEF_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_RasGRF_CDC25,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,smart_Ras-assoc,pfscan_C2_membr_targeting,pfscan_Ras-assoc,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,pfscan_RasGRF_CDC25,prints_Pinositol_PLipase_C	p.K1502Q	ENST00000371380.3	37	c.4504	CCDS41552.1	10	.	.	.	.	.	.	.	.	.	.	A	22.8	4.342396	0.81911	.	.	ENSG00000138193	ENST00000260766;ENST00000371380;ENST00000371385;ENST00000371375	T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16	5.3	5.3	0.74995	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.000000	0.85682	D	0.000000	T	0.64193	0.2576	N	0.17674	0.51	0.51012	D	0.999903	D;D;P	0.64830	0.994;0.992;0.608	D;P;P	0.66497	0.944;0.907;0.887	T	0.62048	-0.6936	10	0.25106	T	0.35	.	15.1917	0.73049	1.0:0.0:0.0:0.0	.	1486;1194;1502	B7ZM61;Q9P212-2;Q9P212	.;.;PLCE1_HUMAN	Q	1502;1502;1194;1194	ENSP00000260766:K1502Q;ENSP00000360431:K1502Q;ENSP00000360438:K1194Q;ENSP00000360426:K1194Q	ENSP00000260766:K1502Q	K	+	1	0	PLCE1	96020347	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	9.202000	0.95026	2.132000	0.65825	0.455000	0.32223	AAG	PLCE1	-	pfam_PLipase_C_PInositol-sp_X_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_PInositol-sp_X_dom	ENSG00000138193		0.413	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCE1	HGNC	protein_coding	OTTHUMT00000049469.3	212	0.00	0	A	NM_016341		96030357	96030357	+1	no_errors	ENST00000371380	ensembl	human	known	69_37n	missense	124	44.89	101	SNP	1.000	C
POU2F1	5451	genome.wustl.edu	37	1	167367365	167367365	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr1:167367365T>G	ENST00000541643.3	+	12	1357	c.1195T>G	c.(1195-1197)Ttg>Gtg	p.L399V	POU2F1_ENST00000367866.2_Missense_Mutation_p.L422V|POU2F1_ENST00000420254.3_Missense_Mutation_p.L399V|POU2F1_ENST00000367865.1_3'UTR|POU2F1_ENST00000429375.2_Missense_Mutation_p.L359V|POU2F1_ENST00000367862.5_Missense_Mutation_p.L411V			P14859	PO2F1_HUMAN	POU class 2 homeobox 1	399					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	30						GAAGAGTTTCTTGGAGGTCAG	0.438																																						dbGAP											0													136.0	134.0	135.0					1																	167367365		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC001664	CCDS1259.1, CCDS1259.2, CCDS55655.1, CCDS55656.1	1q24.2	2011-06-20	2007-07-13		ENSG00000143190	ENSG00000143190		"""Homeoboxes / POU class"""	9212	protein-coding gene	gene with protein product		164175	"""POU domain class 2, transcription factor 1"""	OTF1		1887216	Standard	NM_002697		Approved	OCT1	uc001gee.3	P14859	OTTHUMG00000034436	ENST00000541643.3:c.1195T>G	1.37:g.167367365T>G	ENSP00000441285:p.Leu399Val		B1AL91|B1AL93|B4E029|J3KP77|Q5TBT7|Q6PK46|Q8NEU9|Q9BPV1	Missense_Mutation	SNP	pfam_POU_specific,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeodomain,pfscan_Homeodomain,pfscan_POU_specific,prints_POU,prints_TF_octamer	p.L422V	ENST00000541643.3	37	c.1264		1	.	.	.	.	.	.	.	.	.	.	T	17.69	3.451498	0.63290	.	.	ENSG00000143190	ENST00000367866;ENST00000429375;ENST00000367865;ENST00000420254;ENST00000541643;ENST00000367862;ENST00000443275	D;D;D;D;D;D;D	0.96265	-3.96;-3.96;-3.96;-3.96;-3.96;-3.96;-3.96	6.0	-6.55	0.01854	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.277852	0.36167	N	0.002748	D	0.88373	0.6419	M	0.68317	2.08	0.51012	D	0.999901	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.11329	0.0;0.006;0.0;0.0;0.0	T	0.67158	-0.5741	10	0.59425	D	0.04	.	5.6129	0.17416	0.1207:0.5127:0.2306:0.1359	.	359;399;411;397;399	B4E029;P14859-4;P14859-2;P14859-3;P14859	.;.;.;.;PO2F1_HUMAN	V	422;359;397;399;399;411;307	ENSP00000356840:L422V;ENSP00000401217:L359V;ENSP00000356839:L397V;ENSP00000414660:L399V;ENSP00000441285:L399V;ENSP00000356836:L411V;ENSP00000415993:L307V	ENSP00000356836:L411V	L	+	1	2	POU2F1	165633989	0.994000	0.37717	0.872000	0.34217	0.998000	0.95712	0.396000	0.20867	-1.107000	0.03004	0.533000	0.62120	TTG	POU2F1	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000143190		0.438	POU2F1-203	KNOWN	basic|appris_candidate	protein_coding	POU2F1	HGNC	protein_coding		446	0.00	0	T	NM_002697		167367365	167367365	+1	no_errors	ENST00000367866	ensembl	human	known	69_37n	missense	439	28.62	176	SNP	0.977	G
PPM1B	5495	genome.wustl.edu	37	2	44457678	44457678	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr2:44457678G>C	ENST00000282412.4	+	6	1673	c.1261G>C	c.(1261-1263)Gct>Cct	p.A421P	PPM1B_ENST00000378540.4_Intron|PPM1B_ENST00000345249.4_Missense_Mutation_p.A134P|PPM1B_ENST00000409432.3_3'UTR|PPM1B_ENST00000378551.2_Intron	NM_002706.4	NP_002697.1	O75688	PPM1B_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1B	421					cytokine-mediated signaling pathway (GO:0019221)|N-terminal protein myristoylation (GO:0006499)|negative regulation of defense response to virus (GO:0050687)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)	cytosol (GO:0005829)|membrane (GO:0016020)	magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)			kidney(4)|large_intestine(3)|lung(7)|skin(2)	16		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				TTACAGGCTAGCTAAAGTAGA	0.473																																						dbGAP											0													74.0	74.0	74.0					2																	44457678		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ005801	CCDS1816.1, CCDS1817.1, CCDS1818.1, CCDS46271.1	2p22.1	2012-04-17	2010-03-05		ENSG00000138032	ENSG00000138032	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9276	protein-coding gene	gene with protein product	"""protein phosphatase 2C, beta isoform"""	603770	"""protein phosphatase 1B (formerly 2C), magnesium-dependent, beta isoform"""			9684878	Standard	NM_002706		Approved	PPC2BETAX, PP2CB, PP2CBETA	uc002rtt.3	O75688	OTTHUMG00000128757	ENST00000282412.4:c.1261G>C	2.37:g.44457678G>C	ENSP00000282412:p.Ala421Pro		Q461Q2|Q4J6C1|Q4J6C2|Q658R4|Q96ER6|Q9HAY8	Missense_Mutation	SNP	pfam_PP2C-like,pfam_PP2C_C,superfamily_PP2C-like,superfamily_PP2C_C,smart_PP2C-like	p.A421P	ENST00000282412.4	37	c.1261	CCDS1817.1	2	.	.	.	.	.	.	.	.	.	.	G	16.50	3.139936	0.56936	.	.	ENSG00000138032	ENST00000282412;ENST00000345249	T	0.26518	1.73	5.19	5.19	0.71726	.	0.169932	0.40818	N	0.001001	T	0.20901	0.0503	N	0.19112	0.55	0.80722	D	1	D	0.55385	0.971	B	0.42882	0.401	T	0.01940	-1.1243	10	0.33141	T	0.24	-10.4968	19.0653	0.93108	0.0:0.0:1.0:0.0	.	421	O75688	PPM1B_HUMAN	P	421;134	ENSP00000282412:A421P	ENSP00000282412:A421P	A	+	1	0	PPM1B	44311182	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.103000	0.77014	2.572000	0.86782	0.591000	0.81541	GCT	PPM1B	-	NULL	ENSG00000138032		0.473	PPM1B-001	KNOWN	basic|CCDS	protein_coding	PPM1B	HGNC	protein_coding	OTTHUMT00000250672.1	154	0.00	0	G	NM_002706		44457678	44457678	+1	no_errors	ENST00000282412	ensembl	human	known	69_37n	missense	151	29.31	68	SNP	1.000	C
PRICKLE3	4007	genome.wustl.edu	37	X	49040158	49040158	+	Intron	SNP	G	G	T			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	671469b6-2cc7-4236-95d3-3e3f73e08ea3	g.chrX:49040158G>T	ENST00000376317.3	-	3	407				PRICKLE3_ENST00000376310.3_Intron|PRICKLE3_ENST00000538114.1_Missense_Mutation_p.A114D|PRICKLE3_ENST00000540849.1_Intron|PRICKLE3_ENST00000536904.1_Missense_Mutation_p.A46D	NM_006150.3	NP_006141.2	O43900	PRIC3_HUMAN	prickle homolog 3 (Drosophila)								zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|skin(2)	22						CCACTGGACAGCAAGAGTGGA	0.597																																						dbGAP											0													29.0	25.0	27.0					X																	49040158		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			BC016856	CCDS14320.1	Xp11.23	2008-02-05	2007-09-18	2007-09-18	ENSG00000012211	ENSG00000012211			6645	protein-coding gene	gene with protein product		300111	"""LIM domain only 6"""	LMO6		9344658	Standard	XM_005272605		Approved		uc004dmy.1	O43900	OTTHUMG00000024134	ENST00000376317.3:c.312+28C>A	X.37:g.49040158G>T			B7Z8F2|O76007|Q53XR5	Missense_Mutation	SNP	pfam_Znf_LIM,pfam_PET_domain,smart_Znf_LIM,pfscan_Znf_LIM	p.A46D	ENST00000376317.3	37	c.137	CCDS14320.1	X	.	.	.	.	.	.	.	.	.	.	G	11.93	1.786891	0.31593	.	.	ENSG00000012211	ENST00000536904;ENST00000538114;ENST00000417014	T;T	0.68765	-0.35;-0.32	3.5	-1.48	0.08745	.	.	.	.	.	T	0.52370	0.1730	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45527	-0.9255	8	0.72032	D	0.01	.	7.8005	0.29172	0.7845:0.0:0.2155:0.0	.	46	B7Z8F2	.	D	46;114;114	ENSP00000441385:A46D;ENSP00000441743:A114D	ENSP00000401337:A114D	A	-	2	0	PRICKLE3	48927102	0.000000	0.05858	0.002000	0.10522	0.269000	0.26545	-0.371000	0.07513	-0.398000	0.07679	0.468000	0.43344	GCT	PRICKLE3	-	NULL	ENSG00000012211		0.597	PRICKLE3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRICKLE3	HGNC	protein_coding	OTTHUMT00000060811.1	31	0.00	0	G	NM_006150		49040158	49040158	-1	no_errors	ENST00000536904	ensembl	human	known	69_37n	missense	23	14.81	4	SNP	0.001	T
PRICKLE3	4007	genome.wustl.edu	37	X	49040158	49040158	+	Intron	SNP	G	G	T			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chrX:49040158G>T	ENST00000376317.3	-	3	407				PRICKLE3_ENST00000376310.3_Intron|PRICKLE3_ENST00000538114.1_Missense_Mutation_p.A114D|PRICKLE3_ENST00000540849.1_Intron|PRICKLE3_ENST00000536904.1_Missense_Mutation_p.A46D	NM_006150.3	NP_006141.2	O43900	PRIC3_HUMAN	prickle homolog 3 (Drosophila)								zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|skin(2)	22						CCACTGGACAGCAAGAGTGGA	0.597																																						dbGAP											0													29.0	25.0	27.0					X																	49040158		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			BC016856	CCDS14320.1	Xp11.23	2008-02-05	2007-09-18	2007-09-18	ENSG00000012211	ENSG00000012211			6645	protein-coding gene	gene with protein product		300111	"""LIM domain only 6"""	LMO6		9344658	Standard	XM_005272605		Approved		uc004dmy.1	O43900	OTTHUMG00000024134	ENST00000376317.3:c.312+28C>A	X.37:g.49040158G>T			B7Z8F2|O76007|Q53XR5	Missense_Mutation	SNP	pfam_Znf_LIM,pfam_PET_domain,smart_Znf_LIM,pfscan_Znf_LIM	p.A46D	ENST00000376317.3	37	c.137	CCDS14320.1	X	.	.	.	.	.	.	.	.	.	.	G	11.93	1.786891	0.31593	.	.	ENSG00000012211	ENST00000536904;ENST00000538114;ENST00000417014	T;T	0.68765	-0.35;-0.32	3.5	-1.48	0.08745	.	.	.	.	.	T	0.52370	0.1730	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45527	-0.9255	8	0.72032	D	0.01	.	7.8005	0.29172	0.7845:0.0:0.2155:0.0	.	46	B7Z8F2	.	D	46;114;114	ENSP00000441385:A46D;ENSP00000441743:A114D	ENSP00000401337:A114D	A	-	2	0	PRICKLE3	48927102	0.000000	0.05858	0.002000	0.10522	0.269000	0.26545	-0.371000	0.07513	-0.398000	0.07679	0.468000	0.43344	GCT	PRICKLE3	-	NULL	ENSG00000012211		0.597	PRICKLE3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRICKLE3	HGNC	protein_coding	OTTHUMT00000060811.1	32	0.00	0	G	NM_006150		49040158	49040158	-1	no_errors	ENST00000536904	ensembl	human	known	69_37n	missense	23	14.81	4	SNP	0.001	T
PTPN7	5778	genome.wustl.edu	37	1	202119541	202119541	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr1:202119541C>G	ENST00000308986.5	-	9	1017	c.887G>C	c.(886-888)gGc>gCc	p.G296A	PTPN7_ENST00000367279.4_Missense_Mutation_p.G335A|PTPN7_ENST00000544762.1_Missense_Mutation_p.G72A|PTPN7_ENST00000309017.3_Missense_Mutation_p.G401A|PTPN7_ENST00000543735.1_Missense_Mutation_p.G125A|PTPN7_ENST00000492977.1_5'UTR			P35236	PTN7_HUMAN	protein tyrosine phosphatase, non-receptor type 7	296	Substrate binding.|Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)|soft_tissue(1)|urinary_tract(1)	13						GCCCGTCCGGCCAATCCCTGC	0.572																																						dbGAP											0													43.0	36.0	38.0					1																	202119541		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC001746	CCDS1422.1, CCDS1423.1, CCDS1423.2	1q32.1	2011-06-09			ENSG00000143851	ENSG00000143851		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9659	protein-coding gene	gene with protein product		176889				1510684	Standard	NM_002832		Approved	HEPTP, LC-PTP	uc010ppx.2	P35236	OTTHUMG00000035931	ENST00000308986.5:c.887G>C	1.37:g.202119541C>G	ENSP00000311133:p.Gly296Ala		B3KXE1|Q53XK4|Q5SXQ0|Q5SXQ1|Q9BV05	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_KIM-con,prints_Tyr_Pase_rcpt/non-rcpt	p.G401A	ENST00000308986.5	37	c.1202		1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.829175	0.90955	.	.	ENSG00000143851	ENST00000367279;ENST00000309017;ENST00000308986;ENST00000544762;ENST00000543735;ENST00000477554	T;T;T;T;T;T	0.28895	1.59;1.59;1.59;1.59;1.59;1.59	5.43	5.43	0.79202	Protein-tyrosine phosphatase, receptor/non-receptor type (4);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.64402	D	0.000018	T	0.72614	0.3482	H	0.98238	4.18	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.83944	0.0313	10	0.87932	D	0	.	18.8448	0.92202	0.0:1.0:0.0:0.0	.	370;244;248;296;335	B4DZD9;B4DVF0;Q8NFX3;P35236;P35236-2	.;.;.;PTN7_HUMAN;.	A	335;401;296;72;125;377	ENSP00000356248:G335A;ENSP00000309116:G401A;ENSP00000311133:G296A;ENSP00000438272:G72A;ENSP00000444624:G125A;ENSP00000418416:G377A	ENSP00000311133:G296A	G	-	2	0	PTPN7	200386164	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	7.168000	0.77570	2.532000	0.85374	0.563000	0.77884	GGC	PTPN7	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	ENSG00000143851		0.572	PTPN7-201	KNOWN	basic|appris_principal	protein_coding	PTPN7	HGNC	protein_coding		101	0.00	0	C	NM_002832		202119541	202119541	-1	no_errors	ENST00000309017	ensembl	human	known	69_37n	missense	53	51.38	56	SNP	1.000	G
PTPRE	5791	genome.wustl.edu	37	10	129875909	129875909	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr10:129875909G>A	ENST00000254667.3	+	19	2033	c.1754G>A	c.(1753-1755)cGa>cAa	p.R585Q	PTPRE_ENST00000306042.5_Missense_Mutation_p.R527Q|PTPRE_ENST00000419012.2_Missense_Mutation_p.R585Q	NM_006504.4	NP_006495.1	P23469	PTPRE_HUMAN	protein tyrosine phosphatase, receptor type, E	585	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				negative regulation of insulin receptor signaling pathway (GO:0046627)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of mast cell activation (GO:0033003)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	22		all_epithelial(44;1.66e-05)|all_lung(145;0.00456)|Lung NSC(174;0.0066)|all_neural(114;0.0936)|Colorectal(57;0.141)|Breast(234;0.166)|Melanoma(40;0.203)			Alendronate(DB00630)	GAGCAGGTCCGAGTAGTGCGC	0.672																																					Colon(52;977 1184 20575 41685)	dbGAP											0													46.0	42.0	44.0					10																	129875909		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF406557	CCDS7657.1, CCDS7658.1	10q26	2011-06-09			ENSG00000132334	ENSG00000132334		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9669	protein-coding gene	gene with protein product		600926				8595895	Standard	NM_130435		Approved	PTPE	uc001lkb.3	P23469	OTTHUMG00000019254	ENST00000254667.3:c.1754G>A	10.37:g.129875909G>A	ENSP00000254667:p.Arg585Gln		Q13345|Q5VWH3|Q5VWH4|Q96KQ6	Missense_Mutation	SNP	pirsf_Tyr_Pase_rcpt_a/e-type,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.R585Q	ENST00000254667.3	37	c.1754	CCDS7657.1	10	.	.	.	.	.	.	.	.	.	.	G	16.99	3.273627	0.59649	.	.	ENSG00000132334	ENST00000254667;ENST00000439034;ENST00000419012;ENST00000306042	T;T;T	0.14766	2.48;2.48;2.48	4.44	4.44	0.53790	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.071938	0.52532	D	0.000074	T	0.28764	0.0713	M	0.82323	2.585	0.80722	D	1	B;D;D;D	0.55385	0.341;0.971;0.963;0.971	B;P;B;P	0.47430	0.024;0.547;0.411;0.547	T	0.33033	-0.9884	10	0.62326	D	0.03	.	17.2389	0.87007	0.0:0.0:1.0:0.0	.	563;585;527;585	F5H0X4;Q5VWH4;P23469-2;P23469	.;.;.;PTPRE_HUMAN	Q	585;563;585;527	ENSP00000254667:R585Q;ENSP00000402337:R585Q;ENSP00000303350:R527Q	ENSP00000254667:R585Q	R	+	2	0	PTPRE	129765899	1.000000	0.71417	0.393000	0.26258	0.722000	0.41435	7.569000	0.82380	2.315000	0.78130	0.561000	0.74099	CGA	PTPRE	-	pirsf_Tyr_Pase_rcpt_a/e-type,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000132334		0.672	PTPRE-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PTPRE	HGNC	protein_coding	OTTHUMT00000050990.1	38	0.00	0	G			129875909	129875909	+1	no_errors	ENST00000254667	ensembl	human	known	69_37n	missense	2	92.00	23	SNP	0.937	A
RBM24	221662	genome.wustl.edu	37	6	17283067	17283067	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr6:17283067G>C	ENST00000379052.5	+	2	436	c.200G>C	c.(199-201)aGg>aCg	p.R67T	RBM24_ENST00000425446.2_Missense_Mutation_p.R9T|RBM24_ENST00000318204.5_Missense_Mutation_p.R22T	NM_001143942.1	NP_001137414.1	Q9BX46	RBM24_HUMAN	RNA binding motif protein 24	67	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cell differentiation (GO:0030154)|regulation of mRNA stability (GO:0043488)|regulation of myotube differentiation (GO:0010830)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)			endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(1)	13	Breast(50;0.0615)|Ovarian(93;0.0733)	all_hematologic(90;0.062)	all cancers(50;0.131)|Epithelial(50;0.15)			GCTGCCGAAAGGGCCTGCAAG	0.478																																						dbGAP											0													110.0	95.0	100.0					6																	17283067		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC040928	CCDS4538.1, CCDS47378.1, CCDS47379.1	6p22.3	2013-02-12	2004-04-23	2004-04-23	ENSG00000112183	ENSG00000112183		"""RNA binding motif (RRM) containing"""	21539	protein-coding gene	gene with protein product			"""RNA-binding region (RNP1, RRM) containing 6"""	RNPC6			Standard	NM_153020		Approved	FLJ30829, dJ259A10.1	uc003nbz.4	Q9BX46	OTTHUMG00000014306	ENST00000379052.5:c.200G>C	6.37:g.17283067G>C	ENSP00000368341:p.Arg67Thr		E9PAY4|Q6QDA4|Q8N9D3|Q96NI3	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R67T	ENST00000379052.5	37	c.200	CCDS47378.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.7|21.7	4.193212|4.193212	0.78902|0.78902	.|.	.|.	ENSG00000112183|ENSG00000112183	ENST00000503965|ENST00000379052;ENST00000509686;ENST00000425446;ENST00000318204	.|T;T;T;T	.|0.37584	.|2.3;3.05;1.19;3.31	4.83|4.83	4.83|4.83	0.62350|0.62350	.|Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	.|0.054305	.|0.64402	.|D	.|0.000002	T|T	0.38983|0.38983	0.1061|0.1061	L|L	0.41027|0.41027	1.25|1.25	0.80722|0.80722	D|D	1|1	.|P;B;B	.|0.52692	.|0.955;0.036;0.036	.|P;B;B	.|0.57846	.|0.828;0.145;0.145	T|T	0.30119|0.30119	-0.9989|-0.9989	5|10	.|0.59425	.|D	.|0.04	-16.3068|-16.3068	17.9271|17.9271	0.88987|0.88987	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|22;67;67	.|Q9BX46-2;Q9BX46;A8KAI7	.|.;RBM24_HUMAN;.	R|T	32|67;26;9;22	.|ENSP00000368341:R67T;ENSP00000426222:R26T;ENSP00000396898:R9T;ENSP00000319551:R22T	.|ENSP00000319551:R22T	G|R	+|+	1|2	0|0	RBM24|RBM24	17391046|17391046	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.998000|0.998000	0.95712|0.95712	9.602000|9.602000	0.98312|0.98312	2.227000|2.227000	0.72691|0.72691	0.655000|0.655000	0.94253|0.94253	GGG|AGG	RBM24	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000112183		0.478	RBM24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM24	HGNC	protein_coding	OTTHUMT00000039946.2	211	0.00	0	G	NM_153020		17283067	17283067	+1	no_errors	ENST00000379052	ensembl	human	known	69_37n	missense	130	42.98	98	SNP	1.000	C
RNF130	55819	genome.wustl.edu	37	5	179440193	179440193	+	Silent	SNP	C	C	A	rs371226485		TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr5:179440193C>A	ENST00000261947.4	-	3	959	c.561G>T	c.(559-561)ccG>ccT	p.P187P	RNF130_ENST00000521389.1_Silent_p.P187P|RNF130_ENST00000522208.2_Silent_p.P187P|MIR340_ENST00000362125.1_RNA	NM_001280801.1	NP_001267730.1			ring finger protein 130											breast(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	17	all_cancers(89;5.49e-05)|all_epithelial(37;1.94e-05)|Renal(175;0.000159)|Lung NSC(126;0.00118)|all_lung(126;0.00212)	all_cancers(40;0.0294)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGAAGTTCTTCGGTGGCATTC	0.383																																					GBM(24;432 554 38471 39699 51728)	dbGAP											0													116.0	104.0	108.0					5																	179440193		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF155650	CCDS4451.1, CCDS64340.1	5q35.3	2013-01-09			ENSG00000113269	ENSG00000113269		"""RING-type (C3HC4) zinc fingers"""	18280	protein-coding gene	gene with protein product						10806348	Standard	NM_018434		Approved	GP, G1RZFP, GOLIATH	uc003mll.1	Q86XS8	OTTHUMG00000130909	ENST00000261947.4:c.561G>T	5.37:g.179440193C>A				Silent	SNP	pfam_Protease-assoc_domain,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.P187	ENST00000261947.4	37	c.561		5																																																																																			RNF130	-	NULL	ENSG00000113269		0.383	RNF130-003	PUTATIVE	basic|exp_conf	protein_coding	RNF130	HGNC	protein_coding	OTTHUMT00000374205.1	176	0.00	0	C	NM_018434		179440193	179440193	-1	no_errors	ENST00000521389	ensembl	human	known	69_37n	silent	18	83.76	98	SNP	0.086	A
C19orf67	646457	genome.wustl.edu	37	19	14199331	14199331	+	5'Flank	SNP	C	C	T			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr19:14199331C>T	ENST00000548523.1	-	0	0				C19orf67_ENST00000547589.1_5'Flank|SAMD1_ENST00000533683.2_Silent_p.L399L|SAMD1_ENST00000541938.1_5'Flank	NM_001277378.1	NP_001264307.1	A6NJJ6	CS067_HUMAN	chromosome 19 open reading frame 67											central_nervous_system(1)	1						GGCGGATGGACAGGCCGGTGA	0.567																																						dbGAP											0													58.0	64.0	62.0					19																	14199331		2049	4170	6219	-	-	-	SO:0001631	upstream_gene_variant	0				CCDS59360.1	19p13.12	2008-07-02			ENSG00000188032	ENSG00000188032			34354	protein-coding gene	gene with protein product							Standard	NM_001277378		Approved		uc031rjr.1	A6NJJ6			19.37:g.14199331C>T	Exception_encountered			Silent	SNP	pfam_SAM_type1,pfam_Pointed_dom,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.L399	ENST00000548523.1	37	c.1197	CCDS59360.1	19																																																																																			SAMD1	-	pfam_SAM_type1,pfam_Pointed_dom,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	ENSG00000141858		0.567	C19orf67-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	SAMD1	HGNC	protein_coding	OTTHUMT00000403368.1	89	0.00	0	C	XM_929382		14199331	14199331	-1	no_errors	ENST00000533683	ensembl	human	novel	69_37n	silent	61	45.05	50	SNP	1.000	T
SCFD2	152579	genome.wustl.edu	37	4	53752015	53752015	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr4:53752015T>A	ENST00000401642.3	-	8	1994	c.1861A>T	c.(1861-1863)Agt>Tgt	p.S621C	SCFD2_ENST00000388940.4_Missense_Mutation_p.S576C	NM_152540.3	NP_689753.2	Q8WU76	SCFD2_HUMAN	sec1 family domain containing 2	621					protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)					breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	30			GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)			GGGTAGTCACTAGGATGAGGC	0.507																																						dbGAP											0													88.0	73.0	78.0					4																	53752015		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY299407	CCDS33984.1	4q12	2004-01-15			ENSG00000184178	ENSG00000184178			30676	protein-coding gene	gene with protein product						12477932	Standard	NM_152540		Approved	STXBP1L1, FLJ39514	uc003gzu.3	Q8WU76	OTTHUMG00000160588	ENST00000401642.3:c.1861A>T	4.37:g.53752015T>A	ENSP00000384182:p.Ser621Cys		Q8N5F3|Q8N8H0|Q96ED3	Missense_Mutation	SNP	pfam_Sec1-like,superfamily_Sec1-like	p.S621C	ENST00000401642.3	37	c.1861	CCDS33984.1	4	.	.	.	.	.	.	.	.	.	.	T	12.69	2.014252	0.35511	.	.	ENSG00000184178	ENST00000401642;ENST00000388940	T;T	0.80480	-1.38;-1.38	5.07	3.9	0.45041	.	0.221335	0.40302	N	0.001128	T	0.81550	0.4846	L	0.51422	1.61	0.38597	D	0.950563	D;D	0.63046	0.99;0.992	P;P	0.60345	0.799;0.873	T	0.82688	-0.0333	10	0.66056	D	0.02	.	4.6973	0.12809	0.0:0.2678:0.0:0.7322	.	576;621	Q8WU76-2;Q8WU76	.;SCFD2_HUMAN	C	621;576	ENSP00000384182:S621C;ENSP00000373592:S576C	ENSP00000373592:S576C	S	-	1	0	SCFD2	53446772	1.000000	0.71417	1.000000	0.80357	0.037000	0.13140	1.033000	0.30191	1.922000	0.55676	0.459000	0.35465	AGT	SCFD2	-	pfam_Sec1-like,superfamily_Sec1-like	ENSG00000184178		0.507	SCFD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCFD2	HGNC	protein_coding	OTTHUMT00000361311.3	120	0.00	0	T	NM_152540		53752015	53752015	-1	no_errors	ENST00000401642	ensembl	human	known	69_37n	missense	75	50.66	77	SNP	1.000	A
SERPINB3	6317	genome.wustl.edu	37	18	61325830	61325830	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr18:61325830G>C	ENST00000283752.5	-	5	529	c.386C>G	c.(385-387)aCc>aGc	p.T129S	SERPINB3_ENST00000332821.8_Missense_Mutation_p.T129S|SERPINB11_ENST00000489748.1_RNA	NM_006919.2	NP_008850.1	P29508	SPB3_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 3	129					negative regulation of catalytic activity (GO:0043086)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of peptidase activity (GO:0010466)|negative regulation of proteolysis (GO:0045861)|regulation of proteolysis (GO:0030162)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)|virus receptor activity (GO:0001618)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	36						TTCCACACTGGTCTGGTAAAA	0.358																																						dbGAP											0													83.0	78.0	80.0					18																	61325830		2203	4297	6500	-	-	-	SO:0001583	missense	0			U19568	CCDS11987.1	18q21.3	2014-02-18	2005-08-18		ENSG00000057149	ENSG00000057149		"""Serine (or cysteine) peptidase inhibitors"""	10569	protein-coding gene	gene with protein product		600517	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 3"""	SCC, SCCA1		7724531, 24172014	Standard	NM_006919		Approved	T4-A, HsT1196	uc002lji.3	P29508	OTTHUMG00000060403	ENST00000283752.5:c.386C>G	18.37:g.61325830G>C	ENSP00000283752:p.Thr129Ser		A6NDM2|B2RBT5|B3W5Y6|Q53H28|Q53YB5|Q86VF3|Q86W04|Q8IWL4|Q8IXI3|Q96J21|Q9BYF8	Missense_Mutation	SNP	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	p.T129S	ENST00000283752.5	37	c.386	CCDS11987.1	18	.	.	.	.	.	.	.	.	.	.	G	12.74	2.028206	0.35797	.	.	ENSG00000057149	ENST00000283752;ENST00000332821	D;D	0.83506	-1.73;-1.73	2.97	2.97	0.34412	Serpin domain (3);	0.653207	0.12555	N	0.458723	T	0.69269	0.3092	N	0.04768	-0.165	0.27381	N	0.955422	B;B;B	0.15473	0.013;0.009;0.009	B;B;B	0.23275	0.02;0.045;0.029	T	0.65170	-0.6233	10	0.66056	D	0.02	.	14.1145	0.65144	0.0:0.0:1.0:0.0	.	129;129;129	P29508-2;P29508;Q5K684	.;SPB3_HUMAN;.	S	129	ENSP00000283752:T129S;ENSP00000329498:T129S	ENSP00000283752:T129S	T	-	2	0	SERPINB3	59476810	0.269000	0.24143	0.008000	0.14137	0.009000	0.06853	3.102000	0.50291	1.984000	0.57885	0.455000	0.32223	ACC	SERPINB3	-	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	ENSG00000057149		0.358	SERPINB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB3	HGNC	protein_coding	OTTHUMT00000133791.1	660	0.00	0	G	NM_006919		61325830	61325830	-1	no_errors	ENST00000283752	ensembl	human	known	69_37n	missense	303	47.94	279	SNP	0.792	C
SLC29A3	55315	genome.wustl.edu	37	10	73111428	73111428	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr10:73111428T>C	ENST00000373189.5	+	4	545	c.493T>C	c.(493-495)Ttt>Ctt	p.F165L		NM_001174098.1|NM_018344.5	NP_001167569.1|NP_060814.4	Q9BZD2	S29A3_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 3	165					transmembrane transport (GO:0055085)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	nucleoside transmembrane transporter activity (GO:0005337)			endometrium(3)|kidney(2)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	15						CCGTGGCTTTTTTGCGGTCAC	0.562																																					Esophageal Squamous(200;1319 2142 18949 31248 39672)	dbGAP											0													204.0	150.0	168.0					10																	73111428		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF326987	CCDS7310.1	10q22.2	2013-07-17	2013-07-17		ENSG00000198246	ENSG00000198246		"""Solute carriers"""	23096	protein-coding gene	gene with protein product		612373	"""solute carrier family 29 (nucleoside transporters), member 3"""			11396612	Standard	NM_018344		Approved	ENT3, FLJ11160	uc001jrr.4	Q9BZD2	OTTHUMG00000018424	ENST00000373189.5:c.493T>C	10.37:g.73111428T>C	ENSP00000362285:p.Phe165Leu		B2RB50|B4E2Z9|B7ZA37|Q0VAM9|Q5T465|Q7RTT8|Q8IVZ0|Q9BWI2|Q9NUS9	Missense_Mutation	SNP	pfam_Eqnu_transpt,prints_Eqnu_transpt	p.F165L	ENST00000373189.5	37	c.493	CCDS7310.1	10	.	.	.	.	.	.	.	.	.	.	T	16.05	3.011754	0.54468	.	.	ENSG00000198246	ENST00000373189	T	0.61392	0.11	5.83	5.83	0.93111	.	0.052395	0.85682	D	0.000000	T	0.70500	0.3231	M	0.83852	2.665	0.46149	D	0.998899	P	0.38078	0.617	P	0.46975	0.533	T	0.79393	-0.1822	9	0.87932	D	0	-27.4983	14.7594	0.69593	0.0:0.0:0.0:1.0	.	165	Q9BZD2	S29A3_HUMAN	L	165	ENSP00000362285:F165L	ENSP00000362285:F165L	F	+	1	0	SLC29A3	72781434	1.000000	0.71417	0.992000	0.48379	0.140000	0.21249	7.685000	0.84117	2.231000	0.72958	0.454000	0.30748	TTT	SLC29A3	-	NULL	ENSG00000198246		0.562	SLC29A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC29A3	HGNC	protein_coding	OTTHUMT00000048544.1	153	0.00	0	T	NM_018344		73111428	73111428	+1	no_errors	ENST00000373189	ensembl	human	known	69_37n	missense	87	43.14	66	SNP	1.000	C
SLC4A5	57835	genome.wustl.edu	37	2	74474219	74474219	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr2:74474219T>A	ENST00000377634.4	-	19	2402	c.2003A>T	c.(2002-2004)gAc>gTc	p.D668V	RP11-287D1.3_ENST00000451608.2_3'UTR|SLC4A5_ENST00000377632.1_Missense_Mutation_p.D668V|SLC4A5_ENST00000394019.2_Missense_Mutation_p.D668V|SLC4A5_ENST00000346834.4_Missense_Mutation_p.D668V|SLC4A5_ENST00000357822.5_Missense_Mutation_p.D668V|SLC4A5_ENST00000359484.4_Missense_Mutation_p.D604V|SLC4A5_ENST00000483195.1_5'UTR|SLC4A5_ENST00000358683.4_Missense_Mutation_p.D604V|SLC4A5_ENST00000423644.1_Missense_Mutation_p.D668V					solute carrier family 4 (sodium bicarbonate cotransporter), member 5											breast(5)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(13)|ovary(5)|pancreas(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						TGGCTTGAAGTCCATATTGAT	0.522																																						dbGAP											0													267.0	250.0	256.0					2																	74474219		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF243499	CCDS1936.1, CCDS1937.1	2p13.1	2013-07-19	2013-07-19		ENSG00000188687	ENSG00000188687		"""Solute carriers"""	18168	protein-coding gene	gene with protein product		606757	"""solute carrier family 4, sodium bicarbonate cotransporter, member 5"""			10978526, 11087115	Standard	NM_133478		Approved	NBC4	uc002sko.1	Q9BY07	OTTHUMG00000090263	ENST00000377634.4:c.2003A>T	2.37:g.74474219T>A	ENSP00000366861:p.Asp668Val			Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Na/HCO3_transpt,tigrfam_HCO3_transpt_euk	p.D668V	ENST00000377634.4	37	c.2003	CCDS1936.1	2	.	.	.	.	.	.	.	.	.	.	T	13.62	2.291416	0.40494	.	.	ENSG00000188687	ENST00000394019;ENST00000451608;ENST00000346834;ENST00000359484;ENST00000423644;ENST00000358683;ENST00000357822;ENST00000377632;ENST00000377634;ENST00000425249	T;T;T;T;T;T;T;T;T	0.78924	-1.22;-1.22;-1.22;-1.22;-1.22;-1.22;-1.22;-1.22;-1.22	5.17	1.16	0.20824	Bicarbonate transporter, C-terminal (1);	0.251267	0.45126	D	0.000397	T	0.79741	0.4498	M	0.74389	2.26	0.58432	D	0.999999	B;D;P;P;P	0.57257	0.377;0.979;0.567;0.605;0.566	B;P;B;P;B	0.56088	0.211;0.791;0.255;0.673;0.405	T	0.74466	-0.3656	10	0.23891	T	0.37	.	6.4657	0.21980	0.0:0.0817:0.2959:0.6224	.	668;668;604;668;668	Q9BY07-4;E7EQT3;Q9BY07-7;Q9BY07;Q9BY07-3	.;.;.;S4A5_HUMAN;.	V	668;668;668;604;668;604;668;668;668;668	ENSP00000377587:D668V;ENSP00000251768:D668V;ENSP00000352461:D604V;ENSP00000395804:D668V;ENSP00000351513:D604V;ENSP00000350475:D668V;ENSP00000366859:D668V;ENSP00000366861:D668V;ENSP00000405678:D668V	ENSP00000251768:D668V	D	-	2	0	SLC4A5	74327727	1.000000	0.71417	1.000000	0.80357	0.621000	0.37620	3.341000	0.52151	0.409000	0.25649	0.533000	0.62120	GAC	SLC4A5	-	pfam_HCO3_transpt_C,tigrfam_HCO3_transpt_euk	ENSG00000188687		0.522	SLC4A5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC4A5	HGNC	protein_coding	OTTHUMT00000206583.3	248	0.00	0	T			74474219	74474219	-1	no_errors	ENST00000357822	ensembl	human	known	69_37n	missense	242	26.49	89	SNP	0.999	A
SLC5A5	6528	genome.wustl.edu	37	19	17985316	17985316	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr19:17985316G>T	ENST00000222248.3	+	3	784	c.437G>T	c.(436-438)gGc>gTc	p.G146V		NM_000453.2	NP_000444.1	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium/iodide cotransporter), member 5	146					cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|iodide transport (GO:0015705)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	iodide transmembrane transporter activity (GO:0015111)|sodium:iodide symporter activity (GO:0008507)			NS(2)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						CTGTACACCGGCATCGTAATC	0.597																																					Melanoma(65;1008 1708 7910 46650)	dbGAP											0													116.0	116.0	116.0					19																	17985316		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12368.1	19p13.11	2013-07-19	2013-07-19		ENSG00000105641	ENSG00000105641		"""Solute carriers"""	11040	protein-coding gene	gene with protein product		601843	"""solute carrier family 5 (sodium iodide symporter), member 5"""			9231811	Standard	NM_000453		Approved	NIS	uc002nhr.4	Q92911		ENST00000222248.3:c.437G>T	19.37:g.17985316G>T	ENSP00000222248:p.Gly146Val		O43702|Q2M335|Q9NYB6	Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.G146V	ENST00000222248.3	37	c.437	CCDS12368.1	19	.	.	.	.	.	.	.	.	.	.	G	18.54	3.646848	0.67358	.	.	ENSG00000105641	ENST00000222248	D	0.87256	-2.23	4.43	2.18	0.27775	.	0.122257	0.53938	D	0.000048	D	0.94571	0.8251	H	0.96720	3.87	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.92630	0.6115	10	0.66056	D	0.02	.	7.5502	0.27793	0.096:0.1678:0.7362:0.0	.	146	Q92911	SC5A5_HUMAN	V	146	ENSP00000222248:G146V	ENSP00000222248:G146V	G	+	2	0	SLC5A5	17846316	1.000000	0.71417	0.764000	0.31436	0.700000	0.40528	9.327000	0.96396	0.395000	0.25257	0.491000	0.48974	GGC	SLC5A5	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	ENSG00000105641		0.597	SLC5A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A5	HGNC	protein_coding	OTTHUMT00000466690.1	189	0.53	1	G			17985316	17985316	+1	no_errors	ENST00000222248	ensembl	human	known	69_37n	missense	110	43.94	87	SNP	0.999	T
RPL13A	23521	genome.wustl.edu	37	19	49993282	49993282	+	Intron	SNP	C	C	T			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr19:49993282C>T	ENST00000391857.4	+	2	164				SNORD33_ENST00000362761.1_RNA|SNORD32A_ENST00000364805.1_RNA|SNORD35A_ENST00000363389.1_RNA|CTD-3148I10.15_ENST00000595815.1_RNA|SNORD34_ENST00000365633.1_RNA|RPL13A_ENST00000477613.2_Intron	NM_001270491.1|NM_012423.3	NP_001257420.1|NP_036555.1	P40429	RL13A_HUMAN	ribosomal protein L13a						cellular protein metabolic process (GO:0044267)|cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|negative regulation of formation of translation preinitiation complex (GO:1901194)|negative regulation of translation (GO:0017148)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|focal adhesion (GO:0005925)|GAIT complex (GO:0097452)|large ribosomal subunit (GO:0015934)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			cervix(1)|endometrium(1)	2		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00154)|GBM - Glioblastoma multiforme(486;0.0246)		ATGAGATCAACCCCATGCACC	0.527																																						dbGAP											0													64.0	63.0	63.0					19																	49993282		876	1991	2867	-	-	-	SO:0001627	intron_variant	0			X56932	CCDS12768.1, CCDS74421.1	19q13.3	2011-04-06			ENSG00000142541	ENSG00000142541		"""L ribosomal proteins"""	10304	protein-coding gene	gene with protein product			"""tissue specific transplantation antigen 1"""	TSTA1			Standard	NM_012423		Approved	L13A	uc031rlt.1	P40429	OTTHUMG00000134289	ENST00000391857.4:c.88+103C>T	19.37:g.49993282C>T			A8K505	RNA	SNP	-	NULL	ENST00000391857.4	37	NULL	CCDS12768.1	19																																																																																			SNORD32A	-	-	ENSG00000201675		0.527	RPL13A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNORD32A	HGNC	protein_coding	OTTHUMT00000258989.1	13	0.00	0	C			49993282	49993282	+1	no_errors	ENST00000364805	ensembl	human	known	69_37n	rna	7	46.67	7	SNP	0.998	T
SNX10	29887	genome.wustl.edu	37	7	26412173	26412173	+	Missense_Mutation	SNP	C	C	G	rs374115762		TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr7:26412173C>G	ENST00000338523.4	+	7	774	c.587C>G	c.(586-588)aCa>aGa	p.T196R	SNX10_ENST00000462993.1_3'UTR|SNX10_ENST00000409367.1_Missense_Mutation_p.T156R|SNX10_ENST00000409838.1_Missense_Mutation_p.T112R|SNX10_ENST00000396376.1_Missense_Mutation_p.T196R|AC004540.4_ENST00000451368.1_RNA|AC004540.4_ENST00000451264.1_RNA|SNX10_ENST00000446848.2_Missense_Mutation_p.T222R	NM_001199835.1|NM_013322.2	NP_001186764.1|NP_037454.2	Q9Y5X0	SNX10_HUMAN	sorting nexin 10	196					cilium assembly (GO:0042384)|endosome organization (GO:0007032)|intracellular protein transport (GO:0006886)|osteoclast differentiation (GO:0030316)|protein localization to centrosome (GO:0071539)|protein localization to cilium (GO:0061512)	cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extrinsic component of endosome membrane (GO:0031313)|nucleus (GO:0005634)	1-phosphatidylinositol binding (GO:0005545)|ATPase binding (GO:0051117)			endometrium(1)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	6						AAAGTAAATACAGCTCCGCAG	0.363																																						dbGAP											0													133.0	142.0	139.0					7																	26412173		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF121860	CCDS5399.1, CCDS56470.1	7p15.2	2008-05-22			ENSG00000086300	ENSG00000086300		"""Sorting nexins"""	14974	protein-coding gene	gene with protein product		614780				17012226	Standard	NM_013322		Approved		uc010kuu.3	Q9Y5X0	OTTHUMG00000023650	ENST00000338523.4:c.587C>G	7.37:g.26412173C>G	ENSP00000343709:p.Thr196Arg		E9PFH5|Q8IYT5	Missense_Mutation	SNP	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.T222R	ENST00000338523.4	37	c.665	CCDS5399.1	7	.	.	.	.	.	.	.	.	.	.	C	6.638	0.486190	0.12641	.	.	ENSG00000086300	ENST00000338523;ENST00000446848;ENST00000396376;ENST00000409367;ENST00000409838	T;T;T;T;T	0.63913	0.52;0.47;0.52;-0.07;0.92	5.33	5.33	0.75918	.	0.785780	0.12272	N	0.483728	T	0.45816	0.1361	N	0.22421	0.69	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.14023	0.001;0.01	T	0.23583	-1.0184	10	0.17369	T	0.5	.	9.282	0.37733	0.1439:0.7812:0.0:0.0749	.	222;196	B4DJM0;Q9Y5X0	.;SNX10_HUMAN	R	196;222;196;156;112	ENSP00000343709:T196R;ENSP00000395474:T222R;ENSP00000379661:T196R;ENSP00000387274:T156R;ENSP00000386540:T112R	ENSP00000343709:T196R	T	+	2	0	SNX10	26378698	0.666000	0.27475	0.009000	0.14445	0.590000	0.36582	2.674000	0.46867	2.470000	0.83445	0.650000	0.86243	ACA	SNX10	-	NULL	ENSG00000086300		0.363	SNX10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX10	HGNC	protein_coding	OTTHUMT00000214120.1	331	0.00	0	C			26412173	26412173	+1	no_errors	ENST00000446848	ensembl	human	known	69_37n	missense	172	61.52	275	SNP	0.020	G
SPAST	6683	genome.wustl.edu	37	2	32379525	32379525	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr2:32379525A>G	ENST00000315285.3	+	17	1936	c.1811A>G	c.(1810-1812)tAc>tGc	p.Y604C	SPAST_ENST00000345662.1_Missense_Mutation_p.Y572C	NM_014946.3	NP_055761.2			spastin											breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(8)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					TTAGAAGCGTACATACGTTGG	0.348																																						dbGAP											0													95.0	94.0	94.0					2																	32379525		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ246001	CCDS1778.1, CCDS1779.1	2p24-p21	2014-09-17	2005-03-15	2005-03-17	ENSG00000021574	ENSG00000021574		"""ATPases / AAA-type"""	11233	protein-coding gene	gene with protein product		604277	"""spastic paraplegia 4 (autosomal dominant; spastin)"""	SPG4		10493830, 10610178	Standard	NM_014946		Approved	FSP2, ADPSP, KIAA1083	uc002roc.3	Q9UBP0	OTTHUMG00000128455	ENST00000315285.3:c.1811A>G	2.37:g.32379525A>G	ENSP00000320885:p.Tyr604Cys			Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_MIT,pfam_DNA_helicase_Holl-junc_RuvB_N,smart_MIT,smart_AAA+_ATPase,pirsf_Spastin	p.Y604C	ENST00000315285.3	37	c.1811	CCDS1778.1	2	.	.	.	.	.	.	.	.	.	.	A	16.46	3.130844	0.56828	.	.	ENSG00000021574	ENST00000345662;ENST00000315285	D;D	0.99089	-5.41;-5.41	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	D	0.99594	0.9853	H	0.97983	4.12	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.97707	1.0188	10	0.87932	D	0	-2.1388	16.0308	0.80577	1.0:0.0:0.0:0.0	.	572;604	E5KRP6;Q9UBP0	.;SPAST_HUMAN	C	572;604	ENSP00000340817:Y572C;ENSP00000320885:Y604C	ENSP00000320885:Y604C	Y	+	2	0	SPAST	32233029	1.000000	0.71417	1.000000	0.80357	0.696000	0.40369	7.336000	0.79245	2.315000	0.78130	0.533000	0.62120	TAC	SPAST	-	pirsf_Spastin	ENSG00000021574		0.348	SPAST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAST	HGNC	protein_coding	OTTHUMT00000250253.1	244	0.00	0	A	NM_199436		32379525	32379525	+1	no_errors	ENST00000315285	ensembl	human	known	69_37n	missense	268	33.99	138	SNP	1.000	G
STAT4	6775	genome.wustl.edu	37	2	191900935	191900935	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr2:191900935C>T	ENST00000392320.2	-	17	1839	c.1525G>A	c.(1525-1527)Ggt>Agt	p.G509S	STAT4_ENST00000470708.1_5'UTR|STAT4_ENST00000358470.4_Missense_Mutation_p.G509S	NM_003151.3	NP_003142.1	Q14765	STAT4_HUMAN	signal transducer and activator of transcription 4	509					cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|JAK-STAT cascade (GO:0007259)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(4)|endometrium(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.0864)|all cancers(119;0.204)			GAGTTAAGACCACGACCAACG	0.448																																						dbGAP											0													121.0	106.0	111.0					2																	191900935		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2310.1	2q32.2-q32.3	2013-02-14			ENSG00000138378	ENSG00000138378		"""SH2 domain containing"""	11365	protein-coding gene	gene with protein product		600558				8007943, 8700208	Standard	NM_003151		Approved		uc002usn.2	Q14765	OTTHUMG00000132700	ENST00000392320.2:c.1525G>A	2.37:g.191900935C>T	ENSP00000376134:p.Gly509Ser		Q96NZ6	Missense_Mutation	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,pfscan_SH2	p.G509S	ENST00000392320.2	37	c.1525	CCDS2310.1	2	.	.	.	.	.	.	.	.	.	.	C	36	5.864216	0.97043	.	.	ENSG00000138378	ENST00000358470;ENST00000392320	D;D	0.90444	-2.67;-2.67	5.83	5.83	0.93111	STAT transcription factor, DNA-binding (1);p53-like transcription factor, DNA-binding (1);EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.94324	0.8176	L	0.49699	1.58	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.94317	0.7550	10	0.87932	D	0	-15.2788	20.1195	0.97955	0.0:1.0:0.0:0.0	.	418;509;509	Q53S87;B4DV04;Q14765	.;.;STAT4_HUMAN	S	509	ENSP00000351255:G509S;ENSP00000376134:G509S	ENSP00000351255:G509S	G	-	1	0	STAT4	191609180	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	7.818000	0.86416	2.759000	0.94783	0.650000	0.86243	GGT	STAT4	-	pfam_STAT_TF_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000138378		0.448	STAT4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	STAT4	HGNC	protein_coding	OTTHUMT00000335586.1	274	0.00	0	C	NM_003151		191900935	191900935	-1	no_errors	ENST00000358470	ensembl	human	known	69_37n	missense	137	51.76	147	SNP	1.000	T
SYMPK	8189	genome.wustl.edu	37	19	46319242	46319242	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr19:46319242G>C	ENST00000245934.7	-	26	3798	c.3554C>G	c.(3553-3555)tCt>tGt	p.S1185C	RSPH6A_ENST00000597055.1_5'Flank|RSPH6A_ENST00000221538.3_5'Flank|SYMPK_ENST00000598155.1_5'UTR	NM_004819.2	NP_004810.2	Q92797	SYMPK_HUMAN	symplekin	1185					cell adhesion (GO:0007155)|mRNA polyadenylation (GO:0006378)|positive regulation of protein dephosphorylation (GO:0035307)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(25)|ovary(1)|urinary_tract(1)	45		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		GGCTTCCTCAGACGGGGGCGG	0.687																																						dbGAP											0													8.0	10.0	9.0					19																	46319242		2138	4179	6317	-	-	-	SO:0001583	missense	0			U49240	CCDS12676.2	19q13.3	2008-02-05			ENSG00000125755	ENSG00000125755			22935	protein-coding gene	gene with protein product		602388				9330635	Standard	NM_004819		Approved	SYM, SPK	uc002pdn.3	Q92797	OTTHUMG00000150151	ENST00000245934.7:c.3554C>G	19.37:g.46319242G>C	ENSP00000245934:p.Ser1185Cys		O00521|O00689|O00733|Q59GT5|Q8N2U5	Missense_Mutation	SNP	pfam_DUF3453,pfam_Symplekin_C,superfamily_ARM-type_fold	p.S1185C	ENST00000245934.7	37	c.3554	CCDS12676.2	19	.	.	.	.	.	.	.	.	.	.	G	9.010	0.982210	0.18889	.	.	ENSG00000125755	ENST00000245934	.	.	.	4.72	4.72	0.59763	.	0.624874	0.14009	N	0.347582	T	0.26846	0.0657	N	0.08118	0	0.09310	N	1	B	0.22480	0.07	B	0.25140	0.058	T	0.20207	-1.0282	9	0.54805	T	0.06	.	13.099	0.59210	0.0:0.0:1.0:0.0	.	1185	Q92797	SYMPK_HUMAN	C	1185	.	ENSP00000245934:S1185C	S	-	2	0	SYMPK	51011082	0.070000	0.21116	0.005000	0.12908	0.130000	0.20726	2.955000	0.49121	2.472000	0.83506	0.472000	0.43445	TCT	SYMPK	-	NULL	ENSG00000125755		0.687	SYMPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYMPK	HGNC	protein_coding	OTTHUMT00000316581.1	9	0.00	0	G	NM_004819		46319242	46319242	-1	no_errors	ENST00000245934	ensembl	human	known	69_37n	missense	2	77.78	7	SNP	0.007	C
TBC1D23	55773	genome.wustl.edu	37	3	100015073	100015073	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr3:100015073C>G	ENST00000394144.4	+	8	837	c.830C>G	c.(829-831)tCt>tGt	p.S277C	TBC1D23_ENST00000486274.1_3'UTR|TBC1D23_ENST00000344949.5_Missense_Mutation_p.S277C|TBC1D23_ENST00000475134.1_Missense_Mutation_p.S140C	NM_001199198.2	NP_001186127.1	Q9NUY8	TBC23_HUMAN	TBC1 domain family, member 23	277					positive regulation of interleukin-6 production (GO:0032755)|regulation of inflammatory response (GO:0050727)|regulation of tumor necrosis factor production (GO:0032680)		Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(1)|large_intestine(7)|liver(1)|lung(10)|ovary(1)|prostate(2)|skin(2)	25						GACCTTTTCTCTCTGGCTCAG	0.318																																						dbGAP											0													87.0	98.0	94.0					3																	100015073		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK001908	CCDS2936.1, CCDS56265.1	3q12.2	2013-07-10			ENSG00000036054	ENSG00000036054			25622	protein-coding gene	gene with protein product						22312129	Standard	NM_001199198		Approved	FLJ11046	uc003dtt.4	Q9NUY8	OTTHUMG00000159067	ENST00000394144.4:c.830C>G	3.37:g.100015073C>G	ENSP00000377700:p.Ser277Cys		B9A6M5|Q8TCN8|Q8WUB7|Q96D90|Q9NV75	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_Rhodanese-like_dom,superfamily_Rab-GTPase-TBC_dom,superfamily_Rhodanese-like_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom,pfscan_Rhodanese-like_dom	p.S277C	ENST00000394144.4	37	c.830	CCDS56265.1	3	.	.	.	.	.	.	.	.	.	.	C	27.1	4.800688	0.90538	.	.	ENSG00000036054	ENST00000344949;ENST00000394144;ENST00000475134	T;T;T	0.24723	1.84;1.84;1.84	5.61	5.61	0.85477	Rab-GAP/TBC domain (1);	0.049820	0.85682	D	0.000000	T	0.45357	0.1338	M	0.73217	2.22	0.80722	D	1	P;D	0.53885	0.938;0.963	P;P	0.53593	0.541;0.73	T	0.27331	-1.0077	9	.	.	.	.	19.6376	0.95740	0.0:1.0:0.0:0.0	.	277;277	Q9NUY8;Q9NUY8-2	TBC23_HUMAN;.	C	277;277;140	ENSP00000340693:S277C;ENSP00000377700:S277C;ENSP00000418059:S140C	.	S	+	2	0	TBC1D23	101497763	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.187000	0.77730	2.643000	0.89663	0.467000	0.42956	TCT	TBC1D23	-	superfamily_Rab-GTPase-TBC_dom	ENSG00000036054		0.318	TBC1D23-002	KNOWN	basic|CCDS	protein_coding	TBC1D23	HGNC	protein_coding	OTTHUMT00000353150.1	263	0.00	0	C	NM_018309		100015073	100015073	+1	no_errors	ENST00000394144	ensembl	human	known	69_37n	missense	167	43.62	130	SNP	1.000	G
TDRD5	163589	genome.wustl.edu	37	1	179609514	179609514	+	Splice_Site	SNP	G	G	A			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr1:179609514G>A	ENST00000367614.1	+	11	2093	c.1734G>A	c.(1732-1734)aaG>aaA	p.K578K	TDRD5_ENST00000444136.1_Splice_Site_p.K578K|TDRD5_ENST00000294848.8_Splice_Site_p.K578K	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	578	Tudor. {ECO:0000255|PROSITE- ProRule:PRU00211}.				DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)				NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						TCTATTGCAGGTGCTGCTACA	0.388																																						dbGAP											0													183.0	159.0	167.0					1																	179609514		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.1734-1G>A	1.37:g.179609514G>A			A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Silent	SNP	pfam_Tudor,smart_Tudor,pfscan_Tudor	p.K578	ENST00000367614.1	37	c.1734	CCDS1332.1	1																																																																																			TDRD5	-	pfam_Tudor,smart_Tudor,pfscan_Tudor	ENSG00000162782		0.388	TDRD5-002	KNOWN	basic|CCDS	protein_coding	TDRD5	HGNC	protein_coding	OTTHUMT00000085295.1	447	0.22	1	G	NM_173533	Silent	179609514	179609514	+1	no_errors	ENST00000444136	ensembl	human	known	69_37n	silent	227	48.76	216	SNP	0.999	A
TMEM18	129787	genome.wustl.edu	37	2	675561	675561	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr2:675561A>T	ENST00000281017.3	-	2	220	c.127T>A	c.(127-129)Tgc>Agc	p.C43S	AC092159.2_ENST00000445418.1_RNA|TMEM18_ENST00000355654.2_Missense_Mutation_p.C30S|TMEM18_ENST00000405941.3_Missense_Mutation_p.C46S	NM_152834.2	NP_690047.2	Q96B42	TMM18_HUMAN	transmembrane protein 18	43					cell migration (GO:0016477)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	DNA binding (GO:0003677)			endometrium(1)|large_intestine(1)|lung(7)|ovary(1)	10	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;5.27e-05)|all_epithelial(98;2.11e-06)|Ovarian(717;0.0253)		all cancers(51;1.95e-21)|Epithelial(75;9.47e-21)|OV - Ovarian serous cystadenocarcinoma(76;8.15e-18)|GBM - Glioblastoma multiforme(21;0.0285)		GAGGACAAGCAGGTGAGGAGC	0.542																																						dbGAP											0													142.0	123.0	129.0					2																	675561		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL137269	CCDS33141.1	2p25.3	2008-02-05			ENSG00000151353	ENSG00000151353			25257	protein-coding gene	gene with protein product		613220				12477932	Standard	NM_152834		Approved	DKFZp434C1714	uc002qwl.3	Q96B42	OTTHUMG00000151381	ENST00000281017.3:c.127T>A	2.37:g.675561A>T	ENSP00000281017:p.Cys43Ser		D6W4X9|Q8N5H2|Q9NTH3	Missense_Mutation	SNP	NULL	p.C43S	ENST00000281017.3	37	c.127	CCDS33141.1	2	.	.	.	.	.	.	.	.	.	.	A	9.904	1.207753	0.22205	.	.	ENSG00000151353	ENST00000281017;ENST00000355654;ENST00000405941	.	.	.	5.05	5.05	0.67936	.	0.372591	0.28192	N	0.016243	T	0.40522	0.1120	M	0.68317	2.08	0.09310	N	0.999999	P	0.39311	0.667	B	0.35727	0.209	T	0.49725	-0.8909	9	0.72032	D	0.01	-4.6097	11.1059	0.48203	1.0:0.0:0.0:0.0	.	43	Q96B42	TMM18_HUMAN	S	43;30;46	.	ENSP00000281017:C43S	C	-	1	0	TMEM18	665561	0.036000	0.19791	0.443000	0.26883	0.022000	0.10575	2.358000	0.44134	2.103000	0.63969	0.482000	0.46254	TGC	TMEM18	-	NULL	ENSG00000151353		0.542	TMEM18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM18	HGNC	protein_coding	OTTHUMT00000322427.1	185	0.00	0	A	NM_152834		675561	675561	-1	no_errors	ENST00000281017	ensembl	human	known	69_37n	missense	157	31.93	76	SNP	0.141	T
TMEM51	55092	genome.wustl.edu	37	1	15541910	15541910	+	Missense_Mutation	SNP	C	C	A	rs72874051	byFrequency	TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr1:15541910C>A	ENST00000428417.1	+	2	773	c.327C>A	c.(325-327)caC>caA	p.H109Q	TMEM51_ENST00000400796.3_Missense_Mutation_p.H109Q|TMEM51_ENST00000376014.3_Missense_Mutation_p.H109Q|TMEM51_ENST00000376008.2_Missense_Mutation_p.H109Q|TMEM51_ENST00000434578.2_Missense_Mutation_p.H109Q	NM_001136217.1	NP_001129689.1	Q9NW97	TMM51_HUMAN	transmembrane protein 51	109						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(3)|large_intestine(2)|lung(5)|prostate(2)	14		Renal(390;0.00145)|Breast(348;0.00186)|Colorectal(325;0.00215)|all_lung(284;0.00459)|Lung NSC(340;0.0104)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;2.07e-06)|COAD - Colon adenocarcinoma(227;7.14e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000175)|KIRC - Kidney renal clear cell carcinoma(229;0.00141)|STAD - Stomach adenocarcinoma(313;0.00644)|READ - Rectum adenocarcinoma(331;0.0751)		CTGGGCCTCACGCCCAGGAGG	0.627																																						dbGAP											0													25.0	22.0	23.0					1																	15541910		2201	4298	6499	-	-	-	SO:0001583	missense	0			AK098467	CCDS154.1	1p36.21	2008-02-05	2005-05-22	2005-05-22	ENSG00000171729	ENSG00000171729			25488	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 72"""	C1orf72		12477932	Standard	NM_018022		Approved	FLJ10199	uc001avx.3	Q9NW97	OTTHUMG00000002046	ENST00000428417.1:c.327C>A	1.37:g.15541910C>A	ENSP00000394899:p.His109Gln		A8K819	Missense_Mutation	SNP	NULL	p.H109Q	ENST00000428417.1	37	c.327	CCDS154.1	1	.	.	.	.	.	.	.	.	.	.	C	0.750	-0.773121	0.02951	.	.	ENSG00000171729	ENST00000428417;ENST00000376014;ENST00000451326;ENST00000434578;ENST00000400796;ENST00000376008;ENST00000303840	T;T;T;T;T;T	0.27890	1.64;1.64;1.64;1.64;1.64;1.64	5.25	-10.5	0.00291	.	1.366400	0.03980	N	0.293048	T	0.07773	0.0195	N	0.01705	-0.755	0.09310	N	1	B;B	0.09022	0.002;0.0	B;B	0.06405	0.002;0.001	T	0.15206	-1.0445	10	0.17832	T	0.49	-11.4259	2.5634	0.04778	0.1591:0.132:0.2317:0.4771	.	109;109	Q9BSA0;Q9NW97	.;TMM51_HUMAN	Q	109	ENSP00000394899:H109Q;ENSP00000365182:H109Q;ENSP00000412298:H109Q;ENSP00000409665:H109Q;ENSP00000383600:H109Q;ENSP00000365176:H109Q	ENSP00000303666:H109Q	H	+	3	2	TMEM51	15414497	0.000000	0.05858	0.000000	0.03702	0.089000	0.18198	-2.254000	0.01183	-1.935000	0.01049	-1.202000	0.01658	CAC	TMEM51	-	NULL	ENSG00000171729		0.627	TMEM51-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM51	HGNC	protein_coding	OTTHUMT00000005699.3	14	0.00	0	C	NM_018022		15541910	15541910	+1	no_errors	ENST00000303840	ensembl	human	known	69_37n	missense	7	66.67	14	SNP	0.000	A
TP53	7157	genome.wustl.edu	37	17	7578265	7578265	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr17:7578265A>G	ENST00000269305.4	-	6	773	c.584T>C	c.(583-585)aTc>aCc	p.I195T	TP53_ENST00000445888.2_Missense_Mutation_p.I195T|TP53_ENST00000359597.4_Missense_Mutation_p.I195T|TP53_ENST00000413465.2_Missense_Mutation_p.I195T|TP53_ENST00000455263.2_Missense_Mutation_p.I195T|TP53_ENST00000574684.1_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.I195T	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	195	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		I -> F (in sporadic cancers; somatic mutation).|I -> L (in a sporadic cancer; somatic mutation).|I -> N (in sporadic cancers; somatic mutation).|I -> S (in sporadic cancers; somatic mutation).|I -> T (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:9450901}.|I -> V (in a sporadic cancer; somatic mutation).|I -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.I195T(69)|p.I195N(12)|p.I195S(10)|p.0?(8)|p.I195fs*14(5)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.I102S(2)|p.I102T(2)|p.I63T(2)|p.I63S(2)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.I102fs*14(1)|p.I195fs*12(1)|p.I195fs*50(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I63fs*14(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCCACTCGGATAAGATGCTG	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	134	Substitution - Missense(99)|Whole gene deletion(8)|Insertion - Frameshift(7)|Deletion - In frame(6)|Complex - deletion inframe(6)|Unknown(5)|Deletion - Frameshift(2)|Complex - frameshift(1)	ovary(37)|breast(21)|large_intestine(18)|lung(10)|central_nervous_system(8)|biliary_tract(6)|haematopoietic_and_lymphoid_tissue(5)|skin(5)|stomach(4)|oesophagus(4)|bone(4)|endometrium(3)|urinary_tract(3)|upper_aerodigestive_tract(2)|liver(2)|pancreas(2)											100.0	89.0	93.0					17																	7578265		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.584T>C	17.37:g.7578265A>G	ENSP00000269305:p.Ile195Thr		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.I195T	ENST00000269305.4	37	c.584	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	13.73	2.324656	0.41197	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99823	-6.95;-6.95;-6.95;-6.95;-6.95;-6.95;-6.95;-6.95	5.41	3.21	0.36854	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.103171	0.64402	N	0.000004	D	0.99785	0.9910	M	0.90019	3.08	0.52099	D	0.999943	D;D;D;D;D;D;D	0.89917	1.0;0.999;0.991;0.989;0.998;0.997;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.995;0.953;0.979;0.995;0.993;0.996	D	0.98429	1.0581	10	0.87932	D	0	-18.4587	8.2743	0.31864	0.8356:0.0:0.1644:0.0	.	156;195;195;102;195;195;195	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	T	195;195;195;195;195;195;184;102;63;102;63	ENSP00000410739:I195T;ENSP00000352610:I195T;ENSP00000269305:I195T;ENSP00000398846:I195T;ENSP00000391127:I195T;ENSP00000391478:I195T;ENSP00000425104:I63T;ENSP00000423862:I102T	ENSP00000269305:I195T	I	-	2	0	TP53	7518990	1.000000	0.71417	0.946000	0.38457	0.026000	0.11368	9.287000	0.95975	0.456000	0.26937	-0.256000	0.11100	ATC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	295	0.00	0	A	NM_000546		7578265	7578265	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	34	81.01	145	SNP	1.000	G
TRIM43	129868	genome.wustl.edu	37	2	96259815	96259815	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr2:96259815G>C	ENST00000272395.2	+	2	180	c.44G>C	c.(43-45)tGc>tCc	p.C15S		NM_001164464.1|NM_138800.1	NP_001157936.1|NP_620155.1	Q96BQ3	TRI43_HUMAN	tripartite motif containing 43	15						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|large_intestine(3)|lung(7)|ovary(1)	12						GAACTCACCTGCGTCATCTGT	0.488																																						dbGAP											0													142.0	140.0	140.0					2																	96259815		2201	4298	6499	-	-	-	SO:0001583	missense	0			BK000505	CCDS2015.1	2q11	2014-02-17	2011-01-25		ENSG00000144015	ENSG00000144015		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19015	protein-coding gene	gene with protein product			"""tripartite motif-containing 43"""				Standard	NM_138800		Approved	TRIM43A	uc002suv.3	Q96BQ3	OTTHUMG00000130401	ENST00000272395.2:c.44G>C	2.37:g.96259815G>C	ENSP00000272395:p.Cys15Ser		Q53TJ7	Missense_Mutation	SNP	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING	p.C15S	ENST00000272395.2	37	c.44	CCDS2015.1	2	.	.	.	.	.	.	.	.	.	.	.	12.68	2.010464	0.35511	.	.	ENSG00000144015	ENST00000272395	T	0.73575	-0.76	1.46	1.46	0.22682	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	.	.	.	.	D	0.90092	0.6905	H	0.98276	4.19	0.09310	N	1	D	0.89917	1.0	D	0.85130	0.997	T	0.78373	-0.2229	9	0.87932	D	0	-29.4671	8.8794	0.35365	0.0:0.0:1.0:0.0	.	15	Q96BQ3	TRI43_HUMAN	S	15	ENSP00000272395:C15S	ENSP00000272395:C15S	C	+	2	0	TRIM43	95623542	0.852000	0.29690	0.002000	0.10522	0.004000	0.04260	3.900000	0.56295	1.120000	0.41904	0.386000	0.25728	TGC	TRIM43	-	smart_Znf_RING,pfscan_Znf_RING	ENSG00000144015		0.488	TRIM43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM43	HGNC	protein_coding	OTTHUMT00000252784.1	370	0.00	0	G	NM_138800		96259815	96259815	+1	no_errors	ENST00000272395	ensembl	human	known	69_37n	missense	190	43.32	146	SNP	0.061	C
TTN	7273	genome.wustl.edu	37	2	179585241	179585241	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr2:179585241T>G	ENST00000591111.1	-	78	22521	c.22297A>C	c.(22297-22299)Atc>Ctc	p.I7433L	TTN_ENST00000342992.6_Missense_Mutation_p.I6506L|RP11-171I2.1_ENST00000590024.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.I7750L|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin	12992	Ig-like 56.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTGAAGTGATTTTAAATTTC	0.383																																						dbGAP											0													93.0	85.0	87.0					2																	179585241		1829	4071	5900	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.22297A>C	2.37:g.179585241T>G	ENSP00000465570:p.Ile7433Leu		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.I6506L	ENST00000591111.1	37	c.19516		2	.	.	.	.	.	.	.	.	.	.	T	11.71	1.719436	0.30503	.	.	ENSG00000155657	ENST00000342992	T	0.67865	-0.29	5.76	-0.654	0.11443	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.53706	0.1813	L	0.37750	1.13	0.80722	D	1	B	0.09022	0.002	B	0.19946	0.027	T	0.50432	-0.8829	9	0.87932	D	0	.	9.7659	0.40561	0.0:0.5516:0.0:0.4484	.	7433	Q8WZ42	TITIN_HUMAN	L	6506	ENSP00000343764:I6506L	ENSP00000343764:I6506L	I	-	1	0	TTN	179293486	0.950000	0.32346	0.983000	0.44433	0.997000	0.91878	0.115000	0.15540	0.091000	0.17302	0.528000	0.53228	ATC	TTN	-	pfam_Ig_I-set,pfam_Ig_V-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000155657		0.383	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	314	0.00	0	T	NM_133378		179585241	179585241	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	190	42.30	140	SNP	0.978	G
TTN	7273	genome.wustl.edu	37	2	179592849	179592849	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr2:179592849A>C	ENST00000591111.1	-	65	18975	c.18751T>G	c.(18751-18753)Tta>Gta	p.L6251V	TTN_ENST00000342992.6_Missense_Mutation_p.L5324V|RP11-171I2.1_ENST00000590024.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.L6568V|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin	13027	Ig-like 43.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCACAGTTAAGATGCCACTG	0.363																																						dbGAP											0													51.0	50.0	50.0					2																	179592849		1929	4148	6077	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.18751T>G	2.37:g.179592849A>C	ENSP00000465570:p.Leu6251Val		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.L5324V	ENST00000591111.1	37	c.15970		2	.	.	.	.	.	.	.	.	.	.	A	7.531	0.658757	0.14645	.	.	ENSG00000155657	ENST00000342992	T	0.59224	0.28	5.77	2.1	0.27182	Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.62950	0.2470	M	0.63843	1.955	0.80722	D	1	D	0.57899	0.981	P	0.54210	0.745	T	0.62599	-0.6820	9	0.87932	D	0	.	9.3913	0.38374	0.6361:0.0:0.3639:0.0	.	6251	Q8WZ42	TITIN_HUMAN	V	5324	ENSP00000343764:L5324V	ENSP00000343764:L5324V	L	-	1	2	TTN	179301094	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	1.726000	0.38085	0.184000	0.20083	0.477000	0.44152	TTA	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,pfscan_Ig-like	ENSG00000155657		0.363	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	145	0.00	0	A	NM_133378		179592849	179592849	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	77	48.32	72	SNP	0.999	C
UGGT2	55757	genome.wustl.edu	37	13	96547535	96547535	+	Silent	SNP	A	A	G			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr13:96547535A>G	ENST00000376747.3	-	23	2728	c.2658T>C	c.(2656-2658)gaT>gaC	p.D886D		NM_020121.3	NP_064506.3	Q9NYU1	UGGG2_HUMAN	UDP-glucose glycoprotein glucosyltransferase 2	886					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-glucosylation (GO:0097359)	endoplasmic reticulum lumen (GO:0005788)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(17)|lung(20)|ovary(3)|pancreas(1)|prostate(4)|urinary_tract(2)	60						CTGCATAAAAATCTTCATCTA	0.259																																						dbGAP											0													43.0	43.0	43.0					13																	96547535		2194	4280	6474	-	-	-	SO:0001819	synonymous_variant	0			AF227906	CCDS9480.1	13q32.1	2009-07-23	2009-07-23	2009-07-23	ENSG00000102595	ENSG00000102595			15664	protein-coding gene	gene with protein product	"""UDP-glucose:glycoprotein glucosyltransferase 2"""	605898	"""UDP-glucose ceramide glucosyltransferase-like 2"""	UGCGL2		10694380	Standard	NM_020121		Approved	FLJ11485, HUGT2, FLJ10873, MGC150689, MGC87276, MGC117360	uc001vmt.3	Q9NYU1	OTTHUMG00000017230	ENST00000376747.3:c.2658T>C	13.37:g.96547535A>G			A6NKL4|Q08AD0|Q5JQR8|Q8N5K0|Q9UFC4	Silent	SNP	pfam_UDP-g_GGtrans,pfam_Glyco_trans_8	p.D886	ENST00000376747.3	37	c.2658	CCDS9480.1	13																																																																																			UGGT2	-	NULL	ENSG00000102595		0.259	UGGT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGGT2	HGNC	protein_coding	OTTHUMT00000045507.1	269	0.00	0	A	NM_020121		96547535	96547535	-1	no_errors	ENST00000376747	ensembl	human	known	69_37n	silent	27	93.59	394	SNP	0.989	G
VANGL2	57216	genome.wustl.edu	37	1	160388826	160388826	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr1:160388826C>T	ENST00000368061.2	+	4	701	c.227C>T	c.(226-228)aCg>aTg	p.T76M		NM_020335.2	NP_065068.1	Q9ULK5	VANG2_HUMAN	VANGL planar cell polarity protein 2	76					anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|cell migration involved in kidney development (GO:0035787)|cochlea morphogenesis (GO:0090103)|convergent extension involved in axis elongation (GO:0060028)|convergent extension involved in neural plate elongation (GO:0022007)|digestive tract morphogenesis (GO:0048546)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity involved in neural tube closure (GO:0090177)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|glomerulus development (GO:0032835)|hair follicle development (GO:0001942)|heart looping (GO:0001947)|inner ear receptor stereocilium organization (GO:0060122)|kidney morphogenesis (GO:0060993)|lateral sprouting involved in lung morphogenesis (GO:0060490)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|neural tube closure (GO:0001843)|nonmotile primary cilium assembly (GO:0035058)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in axis elongation (GO:0003402)|planar cell polarity pathway involved in heart morphogenesis (GO:0061346)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|positive regulation of JUN kinase activity (GO:0043507)|post-anal tail morphogenesis (GO:0036342)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of Wnt signaling pathway (GO:0030111)|Rho protein signal transduction (GO:0007266)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell pole (GO:0060187)|cell-cell junction (GO:0005911)|ER to Golgi transport vesicle (GO:0030134)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)				biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(1)	37	all_cancers(52;1.08e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			ACAGTAGTAACGGGCACCTCA	0.562																																						dbGAP											0													110.0	107.0	108.0					1																	160388826		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033041	CCDS30915.1	1q22-q23	2013-03-05	2013-03-05		ENSG00000162738	ENSG00000162738			15511	protein-coding gene	gene with protein product	"""vang, van gogh-like 2"", ""loop-tail-associated protein"", ""strabismus"""	600533	"""vang (van gogh, Drosophila)-like 2, vang, van gogh-like 2 (Drosophila)"", ""vang-like 2 (van gogh, Drosophila)"""			11431695	Standard	NM_020335		Approved	KIAA1215, LTAP, LPP1, STBM, STB1, STBM1, MGC119403, MGC119404	uc001fwc.2	Q9ULK5	OTTHUMG00000033122	ENST00000368061.2:c.227C>T	1.37:g.160388826C>T	ENSP00000357040:p.Thr76Met		D3DVE9|Q5T212	Missense_Mutation	SNP	pfam_Strabismus,pirsf_Strabismus	p.T76M	ENST00000368061.2	37	c.227	CCDS30915.1	1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.068763	0.76301	.	.	ENSG00000162738	ENST00000368061	D	0.85258	-1.96	4.55	4.55	0.56014	.	0.059350	0.64402	D	0.000003	D	0.92782	0.7705	M	0.89785	3.06	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.94281	0.7520	10	0.87932	D	0	-17.7802	16.2429	0.82424	0.0:1.0:0.0:0.0	.	76	Q9ULK5	VANG2_HUMAN	M	76	ENSP00000357040:T76M	ENSP00000357040:T76M	T	+	2	0	VANGL2	158655450	1.000000	0.71417	0.420000	0.26596	0.961000	0.63080	7.385000	0.79763	2.232000	0.73038	0.563000	0.77884	ACG	VANGL2	-	pfam_Strabismus,pirsf_Strabismus	ENSG00000162738		0.562	VANGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VANGL2	HGNC	protein_coding	OTTHUMT00000080677.1	72	0.00	0	C	NM_020335		160388826	160388826	+1	no_errors	ENST00000368061	ensembl	human	known	69_37n	missense	64	28.89	26	SNP	0.996	T
ZNF100	163227	genome.wustl.edu	37	19	21909523	21909523	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr19:21909523G>C	ENST00000358296.6	-	5	1789	c.1591C>G	c.(1591-1593)Caa>Gaa	p.Q531E	ZNF100_ENST00000305570.6_Missense_Mutation_p.Q467E	NM_173531.3	NP_775802.2	Q8IYN0	ZN100_HUMAN	zinc finger protein 100	531					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(11)|skin(1)|upper_aerodigestive_tract(1)	21						GAGTTATTTTGTTTAATAAGG	0.343																																						dbGAP											0													65.0	72.0	70.0					19																	21909523		2107	4245	6352	-	-	-	SO:0001583	missense	0			BC035579	CCDS42538.1	19p13.1	2013-01-08	2003-12-19		ENSG00000197020	ENSG00000197020		"""Zinc fingers, C2H2-type"", ""-"""	12880	protein-coding gene	gene with protein product		603982	"""zinc finger protein 100 (Y1)"""			12477932	Standard	NM_173531		Approved		uc002nqi.3	Q8IYN0		ENST00000358296.6:c.1591C>G	19.37:g.21909523G>C	ENSP00000351042:p.Gln531Glu		Q7M4M0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q531E	ENST00000358296.6	37	c.1591	CCDS42538.1	19	.	.	.	.	.	.	.	.	.	.	.	1.137	-0.650736	0.03506	.	.	ENSG00000197020	ENST00000358296	T	0.04502	3.61	0.867	0.867	0.19085	.	.	.	.	.	T	0.03011	0.0089	N	0.11560	0.145	0.20873	N	0.999836	B;B	0.24882	0.011;0.113	B;B	0.20184	0.012;0.028	T	0.43327	-0.9398	9	0.87932	D	0	.	8.5421	0.33399	0.0:0.0:1.0:0.0	.	531;585	Q8IYN0;Q4G131	ZN100_HUMAN;.	E	531	ENSP00000351042:Q531E	ENSP00000351042:Q531E	Q	-	1	0	ZNF100	21701363	1.000000	0.71417	0.289000	0.24876	0.285000	0.27093	4.831000	0.62752	0.284000	0.22305	0.289000	0.19496	CAA	ZNF100	-	NULL	ENSG00000197020		0.343	ZNF100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF100	HGNC	protein_coding	OTTHUMT00000464087.1	223	0.00	0	G	NM_173531		21909523	21909523	-1	no_errors	ENST00000358296	ensembl	human	known	69_37n	missense	97	42.26	71	SNP	0.933	C
ZNF181	339318	genome.wustl.edu	37	19	35232115	35232115	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A158-01A-11D-A12B-09	TCGA-E2-A158-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5517dcca-46e7-4d0c-ba4f-193343f590d6	7d23b5bb-cacb-4c49-a6f0-b1293bccd644	g.chr19:35232115G>T	ENST00000492450.1	+	4	918	c.829G>T	c.(829-831)Ggc>Tgc	p.G277C	ZNF181_ENST00000459757.2_Missense_Mutation_p.G276C|ZNF181_ENST00000392232.3_Missense_Mutation_p.G321C			Q2M3W8	ZN181_HUMAN	zinc finger protein 181	277					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(6)|kidney(2)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|skin(1)	22	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)			TTTTAGCCATGGCTCATCCCT	0.438																																						dbGAP											0													91.0	95.0	94.0					19																	35232115		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC104759, H54888	CCDS32990.2, CCDS46043.1	19q13.13	2013-01-08	2006-04-27		ENSG00000197841	ENSG00000197841		"""Zinc fingers, C2H2-type"", ""-"""	12971	protein-coding gene	gene with protein product		606741	"""zinc finger protein 181 (HHZ181)"""				Standard	NM_001029997		Approved	HHZ181, MGC44316	uc002nvu.3	Q2M3W8	OTTHUMG00000157508	ENST00000492450.1:c.829G>T	19.37:g.35232115G>T	ENSP00000420727:p.Gly277Cys		B7ZKX3|Q49A75	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,smart_Znf_BED_prd,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G277C	ENST00000492450.1	37	c.829	CCDS32990.2	19	.	.	.	.	.	.	.	.	.	.	G	12.25	1.882065	0.33255	.	.	ENSG00000197841	ENST00000392232;ENST00000425140;ENST00000492450;ENST00000459757	T;T;T	0.07800	3.16;3.16;3.16	2.71	1.66	0.24008	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.11239	0.0274	N	0.13235	0.315	0.09310	N	1	D;D	0.89917	0.994;1.0	P;D	0.85130	0.667;0.997	T	0.25363	-1.0134	9	0.42905	T	0.14	.	4.9324	0.13923	0.2897:0.0:0.7103:0.0	.	276;277	B7ZKX3;Q2M3W8	.;ZN181_HUMAN	C	321;276;277;276	ENSP00000376065:G321C;ENSP00000420727:G277C;ENSP00000419435:G276C	ENSP00000376065:G321C	G	+	1	0	ZNF181	39923955	0.000000	0.05858	1.000000	0.80357	0.994000	0.84299	0.354000	0.20146	0.696000	0.31696	0.491000	0.48974	GGC	ZNF181	-	pfam_Znf_C2H2,smart_Znf_BED_prd,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197841		0.438	ZNF181-002	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	ZNF181	HGNC	protein_coding	OTTHUMT00000349005.3	265	0.00	0	G	NM_001029997		35232115	35232115	+1	no_errors	ENST00000492450	ensembl	human	known	69_37n	missense	145	44.44	116	SNP	0.206	T
