#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAMTS5	11096	genome.wustl.edu	37	21	28305265	28305265	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A1B4-01A-11D-A12Q-09	TCGA-E2-A1B4-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6aa4529-7996-4b66-9632-2559293db35d	45514149-d01b-4bc9-864b-ed556da905c1	g.chr21:28305265G>T	ENST00000284987.5	-	5	1909	c.1788C>A	c.(1786-1788)aaC>aaA	p.N596K	AP001601.2_ENST00000426771.1_RNA	NM_007038.3	NP_008969.2	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 5	596	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	72						TGGGAGCAGGGTTATTACAGT	0.577																																					Esophageal Squamous(53;683 1080 10100 14424 45938)	dbGAP											0													155.0	107.0	124.0					21																	28305265		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF142099	CCDS13579.1	21q21.3	2008-07-31	2008-07-31		ENSG00000154736	ENSG00000154736		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	221	protein-coding gene	gene with protein product	"""aggrecanase-2"""	605007	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)"""			10438522	Standard	NM_007038		Approved	ADMP-2, ADAMTS11	uc002ymg.3	Q9UNA0	OTTHUMG00000078686	ENST00000284987.5:c.1788C>A	21.37:g.28305265G>T	ENSP00000284987:p.Asn596Lys		Q52LV4|Q9UKP2	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Pept_M12B_ADAM-TS5,prints_Peptidase_M12B_ADAM-TS	p.N596K	ENST00000284987.5	37	c.1788	CCDS13579.1	21	.	.	.	.	.	.	.	.	.	.	G	19.74	3.884692	0.72410	.	.	ENSG00000154736	ENST00000284987	T	0.51325	0.71	6.03	1.2	0.21068	.	0.000000	0.85682	D	0.000000	T	0.66713	0.2817	M	0.83012	2.62	0.51482	D	0.999923	D	0.89917	1.0	D	0.87578	0.998	T	0.67284	-0.5709	10	0.62326	D	0.03	.	10.4951	0.44772	0.3136:0.0:0.6864:0.0	.	596	Q9UNA0	ATS5_HUMAN	K	596	ENSP00000284987:N596K	ENSP00000284987:N596K	N	-	3	2	ADAMTS5	27227136	1.000000	0.71417	0.996000	0.52242	0.981000	0.71138	1.125000	0.31332	0.157000	0.19338	0.655000	0.94253	AAC	ADAMTS5	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000154736		0.577	ADAMTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS5	HGNC	protein_coding	OTTHUMT00000171648.1	182	0.00	0	G			28305265	28305265	-1	no_errors	ENST00000284987	ensembl	human	known	69_37n	missense	100	35.06	54	SNP	1.000	T
ATP8B3	148229	genome.wustl.edu	37	19	1802548	1802548	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A1B4-01A-11D-A12Q-09	TCGA-E2-A1B4-10A-01D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6aa4529-7996-4b66-9632-2559293db35d	45514149-d01b-4bc9-864b-ed556da905c1	g.chr19:1802548A>C	ENST00000310127.6	-	11	1239	c.1001T>G	c.(1000-1002)cTc>cGc	p.L334R	ATP8B3_ENST00000539485.1_Missense_Mutation_p.L334R|ATP8B3_ENST00000526092.2_Missense_Mutation_p.L281R|ATP8B3_ENST00000525591.1_Missense_Mutation_p.L281R	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3	334					binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCGGAGGAGGAGGTTGCCAAT	0.562																																						dbGAP											0													131.0	142.0	138.0					19																	1802548		2126	4240	6366	-	-	-	SO:0001583	missense	0			AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.1001T>G	19.37:g.1802548A>C	ENSP00000311336:p.Leu334Arg		Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.L334R	ENST00000310127.6	37	c.1001	CCDS45901.1	19	.	.	.	.	.	.	.	.	.	.	a	19.65	3.867519	0.72065	.	.	ENSG00000130270	ENST00000310127;ENST00000539485;ENST00000525591;ENST00000526092;ENST00000382339	T;T;T;T	0.75154	-0.91;-0.91;-0.91;-0.91	3.72	2.7	0.31948	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.401840	0.24601	U	0.037131	D	0.83519	0.5272	M	0.91140	3.18	0.34669	D	0.723484	D;P;P	0.65815	0.995;0.863;0.947	P;P;P	0.55222	0.751;0.617;0.771	D	0.87179	0.2226	10	0.87932	D	0	.	8.1386	0.31069	0.9001:0.0:0.0999:0.0	.	281;334;281	F5H3R9;O60423;Q7Z485	.;AT8B3_HUMAN;.	R	334;334;281;281;281	ENSP00000311336:L334R;ENSP00000443574:L334R;ENSP00000437115:L281R;ENSP00000445204:L281R	ENSP00000311336:L334R	L	-	2	0	ATP8B3	1753548	1.000000	0.71417	0.972000	0.41901	0.920000	0.55202	8.789000	0.91839	0.509000	0.28195	0.370000	0.22315	CTC	ATP8B3	-	pfam_ATPase_P-typ_ATPase-assoc-dom,tigrfam_ATPase_P-typ_Plipid-transl	ENSG00000130270		0.562	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	ATP8B3	HGNC	protein_coding	OTTHUMT00000388279.1	220	0.00	0	A	NM_138813		1802548	1802548	-1	no_errors	ENST00000539485	ensembl	human	known	69_37n	missense	113	30.91	51	SNP	0.984	C
BMP8B	656	genome.wustl.edu	37	1	40226145	40226145	+	Silent	SNP	A	A	G			TCGA-E2-A1B4-01A-11D-A12Q-09	TCGA-E2-A1B4-10A-01D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6aa4529-7996-4b66-9632-2559293db35d	45514149-d01b-4bc9-864b-ed556da905c1	g.chr1:40226145A>G	ENST00000372827.3	-	7	1530	c.1155T>C	c.(1153-1155)aaT>aaC	p.N385N	PPIE_ENST00000372830.1_Intron|PPIE_ENST00000356511.2_Intron	NM_001720.3	NP_001711.2	P34820	BMP8B_HUMAN	bone morphogenetic protein 8b	385					cartilage development (GO:0051216)|cell differentiation (GO:0030154)|growth (GO:0040007)|ossification (GO:0001503)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)				endometrium(1)|liver(1)|ovary(1)|urinary_tract(1)	4	all_cancers(7;5.56e-14)|all_lung(5;3.88e-17)|all_epithelial(6;3.78e-16)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;1.92e-17)|all cancers(16;4.03e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			GCAGGATGACATTGTTGCTGC	0.627																																						dbGAP											0													144.0	109.0	121.0					1																	40226145		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC023526	CCDS444.1	1p35-p32	2014-01-30	2008-05-22	2003-10-22	ENSG00000116985	ENSG00000116985		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1075	protein-coding gene	gene with protein product	"""osteogenic protein 2"""	602284	"""bone morphogenetic protein 8 (osteogenic protein 2)"""	BMP8		1460021, 9070944	Standard	NM_001720		Approved	OP-2	uc001cdz.1	P34820	OTTHUMG00000009247	ENST00000372827.3:c.1155T>C	1.37:g.40226145A>G			E7EMY8|Q32NE5|Q53ZM7|Q9NUF0	Silent	SNP	pfam_TGF-b_N,pfam_TGF-b_C,smart_TGF-b_C,prints_Inhibin_asu	p.N385	ENST00000372827.3	37	c.1155	CCDS444.1	1																																																																																			BMP8B	-	pfam_TGF-b_C,smart_TGF-b_C	ENSG00000116985		0.627	BMP8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP8B	HGNC	protein_coding	OTTHUMT00000025641.1	78	0.00	0	A	NM_001720		40226145	40226145	-1	no_errors	ENST00000372827	ensembl	human	known	69_37n	silent	38	11.63	5	SNP	0.946	G
CD96	10225	genome.wustl.edu	37	3	111304209	111304209	+	Missense_Mutation	SNP	C	C	A	rs119477056		TCGA-E2-A1B4-01A-11D-A12Q-09	TCGA-E2-A1B4-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6aa4529-7996-4b66-9632-2559293db35d	45514149-d01b-4bc9-864b-ed556da905c1	g.chr3:111304209C>A	ENST00000283285.5	+	6	970	c.839C>A	c.(838-840)aCg>aAg	p.T280K	CD96_ENST00000438817.2_Missense_Mutation_p.T264K|CD96_ENST00000352690.4_Missense_Mutation_p.T264K	NM_198196.2	NP_937839.1	P40200	TACT_HUMAN	CD96 molecule	280	Ig-like C2-type.		T -> M (in CSYN). {ECO:0000269|PubMed:17847009}.		cell adhesion (GO:0007155)|immune response (GO:0006955)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(4)|liver(2)|lung(14)|skin(5)	35						AATAACTCCACGGATGTCTTG	0.408									Opitz Trigonocephaly syndrome																													dbGAP											0			GRCh37	CM074083	CD96	M	rs119477056						116.0	112.0	113.0					3																	111304209		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	C syndrome, Trigonocephaly syndrome	M88282	CCDS2958.1, CCDS2959.1	3p13-q13.2	2013-01-11	2006-03-28		ENSG00000153283	ENSG00000153283		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16892	protein-coding gene	gene with protein product		606037	"""CD96 antigen"""			1313846	Standard	XR_241462		Approved	TACTILE	uc003dxx.3	P40200	OTTHUMG00000159275	ENST00000283285.5:c.839C>A	3.37:g.111304209C>A	ENSP00000283285:p.Thr280Lys		Q5JPB3	Missense_Mutation	SNP	smart_Ig_sub,pfscan_Ig-like	p.T280K	ENST00000283285.5	37	c.839	CCDS2959.1	3	.	.	.	.	.	.	.	.	.	.	C	5.410	0.260817	0.10239	.	.	ENSG00000153283	ENST00000352690;ENST00000283285;ENST00000438817	T;T;T	0.03330	3.97;3.97;3.97	5.02	-5.3	0.02738	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.190820	0.05817	N	0.615066	T	0.02533	0.0077	N	0.19112	0.55	0.09310	N	1	B;B;B;B	0.12630	0.006;0.004;0.006;0.006	B;B;B;B	0.13407	0.009;0.005;0.009;0.009	T	0.47873	-0.9083	10	0.30854	T	0.27	-0.0178	7.276	0.26283	0.1321:0.4919:0.0:0.3759	.	264;264;280;264	E9PEJ1;P40200-2;P40200;Q8WUE2	.;.;TACT_HUMAN;.	K	264;280;264	ENSP00000342040:T264K;ENSP00000283285:T280K;ENSP00000389801:T264K	ENSP00000283285:T280K	T	+	2	0	CD96	112786899	0.003000	0.15002	0.000000	0.03702	0.001000	0.01503	-1.631000	0.02026	-0.791000	0.04486	-1.808000	0.00615	ACG	CD96	-	pfscan_Ig-like	ENSG00000153283		0.408	CD96-001	KNOWN	basic|CCDS	protein_coding	CD96	HGNC	protein_coding	OTTHUMT00000354312.2	278	0.00	0	C			111304209	111304209	+1	no_errors	ENST00000283285	ensembl	human	known	69_37n	missense	192	37.86	117	SNP	0.000	A
DNAH5	1767	genome.wustl.edu	37	5	13902213	13902213	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1B4-01A-11D-A12Q-09	TCGA-E2-A1B4-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6aa4529-7996-4b66-9632-2559293db35d	45514149-d01b-4bc9-864b-ed556da905c1	g.chr5:13902213G>A	ENST00000265104.4	-	13	1783	c.1679C>T	c.(1678-1680)gCa>gTa	p.A560V		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	560	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TTGAATCTTTGCAAATGTAAC	0.294									Kartagener syndrome																													dbGAP											0													51.0	45.0	47.0					5																	13902213		2202	4293	6495	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.1679C>T	5.37:g.13902213G>A	ENSP00000265104:p.Ala560Val		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.A560V	ENST00000265104.4	37	c.1679	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	T	29.0	4.967147	0.92855	.	.	ENSG00000039139	ENST00000265104	T	0.57107	0.42	4.94	4.94	0.65067	Dynein heavy chain, domain-1 (1);	0.052267	0.85682	D	0.000000	T	0.45418	0.1341	L	0.42245	1.32	0.22292	N	0.999225	B	0.06786	0.001	B	0.15484	0.013	T	0.35992	-0.9766	10	0.44086	T	0.13	.	12.2109	0.54379	0.0:0.0:0.1429:0.857	.	560	Q8TE73	DYH5_HUMAN	V	560	ENSP00000265104:A560V	ENSP00000265104:A560V	A	-	2	0	DNAH5	13955213	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	4.526000	0.60566	0.839000	0.34971	-0.256000	0.11100	GCA	DNAH5	-	pfam_Dynein_heavy_dom-1	ENSG00000039139		0.294	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	210	0.00	0	G	NM_001369		13902213	13902213	-1	no_errors	ENST00000265104	ensembl	human	known	69_37n	missense	238	28.01	93	SNP	1.000	A
CDHR2	54825	genome.wustl.edu	37	5	176004515	176004515	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1B4-01A-11D-A12Q-09	TCGA-E2-A1B4-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6aa4529-7996-4b66-9632-2559293db35d	45514149-d01b-4bc9-864b-ed556da905c1	g.chr5:176004515C>T	ENST00000510636.1	+	13	1584	c.1310C>T	c.(1309-1311)gCg>gTg	p.A437V	CDHR2_ENST00000506348.1_Missense_Mutation_p.A437V|CDHR2_ENST00000261944.5_Missense_Mutation_p.A437V	NM_001171976.1	NP_001165447.1	Q9BYE9	CDHR2_HUMAN	cadherin-related family member 2	437	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|liver(1)|lung(23)|ovary(3)|prostate(5)|skin(4)|urinary_tract(1)	56						AGAGTATCCGCGCTGGTGGAC	0.687																																						dbGAP											0													36.0	40.0	38.0					5																	176004515		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB047004	CCDS34297.1	5q35.2	2011-07-01	2010-01-25	2010-01-25		ENSG00000074276		"""Cadherins / Cadherin-related"""	18231	protein-coding gene	gene with protein product	"""protocadherin LKC"""		"""protocadherin 24"""	PCDH24		11082270, 12117771	Standard	NM_001171976		Approved	PC-LKC, FLJ20124, FLJ20383, PCLKC	uc003mem.2	Q9BYE9		ENST00000510636.1:c.1310C>T	5.37:g.176004515C>T	ENSP00000424565:p.Ala437Val		A1L3U4|A6NC80|Q9NXP8	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A437V	ENST00000510636.1	37	c.1310	CCDS34297.1	5	.	.	.	.	.	.	.	.	.	.	c	8.263	0.811695	0.16537	.	.	ENSG00000074276	ENST00000510636;ENST00000261944;ENST00000506348	T;T;T	0.61274	0.12;0.12;0.12	4.11	-4.03	0.04021	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.32585	0.0834	N	0.20483	0.58	0.09310	N	1	B	0.12013	0.005	B	0.06405	0.002	T	0.14364	-1.0475	9	0.28530	T	0.3	-1.204	3.5246	0.07755	0.4103:0.3291:0.179:0.0816	.	437	Q9BYE9	CDHR2_HUMAN	V	437	ENSP00000424565:A437V;ENSP00000261944:A437V;ENSP00000421078:A437V	ENSP00000261944:A437V	A	+	2	0	CDHR2	175937121	0.000000	0.05858	0.000000	0.03702	0.057000	0.15508	-1.199000	0.03032	-0.531000	0.06340	-1.872000	0.00552	GCG	CDHR2	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000074276		0.687	CDHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDHR2	HGNC	protein_coding	OTTHUMT00000372201.1	80	0.00	0	C	NM_017675		176004515	176004515	+1	no_errors	ENST00000261944	ensembl	human	known	69_37n	missense	29	31.82	14	SNP	0.000	T
DOCK3	1795	genome.wustl.edu	37	3	51393602	51393602	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A1B4-01A-11D-A12Q-09	TCGA-E2-A1B4-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6aa4529-7996-4b66-9632-2559293db35d	45514149-d01b-4bc9-864b-ed556da905c1	g.chr3:51393602C>A	ENST00000266037.9	+	42	4355	c.4332C>A	c.(4330-4332)agC>agA	p.S1444R		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1444	DHR-2.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		GAGTCAAGAGCTTCTATCGCG	0.478																																						dbGAP											0													143.0	135.0	138.0					3																	51393602		1958	4164	6122	-	-	-	SO:0001583	missense	0			AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.4332C>A	3.37:g.51393602C>A	ENSP00000266037:p.Ser1444Arg		O15017	Missense_Mutation	SNP	pfam_DOCK,pfam_SH3_2,superfamily_SH3_domain,superfamily_ARM-type_fold,smart_SH3_domain,pfscan_SH3_domain	p.S1444R	ENST00000266037.9	37	c.4332	CCDS46835.1	3	.	.	.	.	.	.	.	.	.	.	C	16.95	3.263663	0.59431	.	.	ENSG00000088538	ENST00000266037;ENST00000402669	T	0.17370	2.28	5.36	2.57	0.30868	.	0.000000	0.85682	D	0.000000	T	0.28466	0.0704	L	0.49455	1.56	0.58432	D	0.999995	D	0.89917	1.0	D	0.97110	1.0	T	0.04693	-1.0933	10	0.19147	T	0.46	.	8.1639	0.31215	0.0:0.6352:0.0:0.3648	.	1444	Q8IZD9	DOCK3_HUMAN	R	1444;240	ENSP00000266037:S1444R	ENSP00000266037:S1444R	S	+	3	2	DOCK3	51368642	0.998000	0.40836	1.000000	0.80357	0.995000	0.86356	0.655000	0.24933	0.755000	0.32990	0.561000	0.74099	AGC	DOCK3	-	pfam_DOCK	ENSG00000088538		0.478	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK3	HGNC	protein_coding	OTTHUMT00000346478.5	222	0.00	0	C	NM_004947		51393602	51393602	+1	no_errors	ENST00000266037	ensembl	human	known	69_37n	missense	127	34.18	67	SNP	1.000	A
DSG1	1828	genome.wustl.edu	37	18	28934692	28934692	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1B4-01A-11D-A12Q-09	TCGA-E2-A1B4-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6aa4529-7996-4b66-9632-2559293db35d	45514149-d01b-4bc9-864b-ed556da905c1	g.chr18:28934692G>C	ENST00000257192.4	+	15	2745	c.2533G>C	c.(2533-2535)Gac>Cac	p.D845H	RP11-534N16.1_ENST00000581856.1_RNA|RP11-534N16.1_ENST00000578477.1_RNA|RP11-534N16.1_ENST00000578119.1_RNA|RP11-534N16.1_ENST00000581452.1_RNA|DSG1_ENST00000462981.2_Missense_Mutation_p.D204H	NM_001942.2	NP_001933.2	Q02413	DSG1_HUMAN	desmoglein 1	845					apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell-cell junction assembly (GO:0007043)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|protein stabilization (GO:0050821)|response to progesterone (GO:0032570)|single organismal cell-cell adhesion (GO:0016337)	apical plasma membrane (GO:0016324)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)|toxic substance binding (GO:0015643)			NS(2)|central_nervous_system(2)|endometrium(5)|kidney(7)|large_intestine(11)|lung(36)|ovary(3)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	76			OV - Ovarian serous cystadenocarcinoma(10;0.00559)			CACCACCTCTGACACTCTGAA	0.537																																						dbGAP											0													216.0	183.0	194.0					18																	28934692		2203	4300	6503	-	-	-	SO:0001583	missense	0			X56654	CCDS11896.1	18q12.1	2014-05-13			ENSG00000134760	ENSG00000134760		"""Cadherins / Major cadherins"""	3048	protein-coding gene	gene with protein product		125670		DSG		1889810	Standard	NM_001942		Approved	CDHF4	uc002kwp.3	Q02413	OTTHUMG00000131983	ENST00000257192.4:c.2533G>C	18.37:g.28934692G>C	ENSP00000257192:p.Asp845His		B7Z845	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,prints_Desmoglein,prints_Cadherin,prints_Desmo_cadherin,pfscan_Cadherin	p.D845H	ENST00000257192.4	37	c.2533	CCDS11896.1	18	.	.	.	.	.	.	.	.	.	.	G	9.514	1.106548	0.20714	.	.	ENSG00000134760	ENST00000257192	T	0.57273	0.41	5.76	5.76	0.90799	.	0.270716	0.32518	N	0.005987	T	0.46814	0.1412	L	0.32530	0.975	0.30529	N	0.76767	P	0.50943	0.94	B	0.43701	0.428	T	0.56890	-0.7904	10	0.87932	D	0	.	15.1026	0.72292	0.0694:0.0:0.9306:0.0	.	845	Q02413	DSG1_HUMAN	H	845	ENSP00000257192:D845H	ENSP00000257192:D845H	D	+	1	0	DSG1	27188690	1.000000	0.71417	1.000000	0.80357	0.632000	0.37999	5.058000	0.64300	2.733000	0.93635	0.467000	0.42956	GAC	DSG1	-	NULL	ENSG00000134760		0.537	DSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSG1	HGNC	protein_coding	OTTHUMT00000254947.1	148	0.00	0	G	NM_001942		28934692	28934692	+1	no_errors	ENST00000257192	ensembl	human	known	69_37n	missense	83	40.29	56	SNP	0.997	C
ELAC2	60528	genome.wustl.edu	37	17	12897055	12897055	+	Silent	SNP	G	G	A			TCGA-E2-A1B4-01A-11D-A12Q-09	TCGA-E2-A1B4-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6aa4529-7996-4b66-9632-2559293db35d	45514149-d01b-4bc9-864b-ed556da905c1	g.chr17:12897055G>A	ENST00000338034.4	-	23	2441	c.2202C>T	c.(2200-2202)ctC>ctT	p.L734L	ELAC2_ENST00000426905.3_Silent_p.L694L|ELAC2_ENST00000395962.2_Silent_p.L715L	NM_018127.6|NM_173717.1	NP_060597.4|NP_776065.1	Q9BQ52	RNZ2_HUMAN	elaC ribonuclease Z 2	734					mitochondrial tRNA 3'-trailer cleavage, endonucleolytic (GO:0072684)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|skin(1)	23						TGGGGCTGAAGAGGGGGACCT	0.587																																						dbGAP											0													173.0	125.0	141.0					17																	12897055		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF304370	CCDS11164.1, CCDS54093.1	17p11.2	2013-05-24	2013-05-24		ENSG00000006744	ENSG00000006744	3.1.26.11		14198	protein-coding gene	gene with protein product	"""tRNase Z (long form)"""	605367	"""elaC (E. coli) homolog 2"", ""elaC homolog 2 (E. coli)"""			10986046, 16636667, 21559454	Standard	NM_018127		Approved	FLJ10530, HPC2	uc010vvr.2	Q9BQ52	OTTHUMG00000058764	ENST00000338034.4:c.2202C>T	17.37:g.12897055G>A			B4DPL9|Q6IA94|Q9HAS8|Q9HAS9|Q9NVT1	Missense_Mutation	SNP	pfam_Beta-lactamas-like	p.S534F	ENST00000338034.4	37	c.1601	CCDS11164.1	17																																																																																			ELAC2	-	NULL	ENSG00000006744		0.587	ELAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELAC2	HGNC	protein_coding	OTTHUMT00000129934.5	148	0.00	0	G			12897055	12897055	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000584650	ensembl	human	novel	69_37n	missense	83	30.00	36	SNP	0.996	A
ENOX1	55068	genome.wustl.edu	37	13	43810874	43810874	+	Splice_Site	SNP	C	C	A			TCGA-E2-A1B4-01A-11D-A12Q-09	TCGA-E2-A1B4-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6aa4529-7996-4b66-9632-2559293db35d	45514149-d01b-4bc9-864b-ed556da905c1	g.chr13:43810874C>A	ENST00000261488.6	-	15	2189	c.1612G>T	c.(1612-1614)Gaa>Taa	p.E538*	ENOX1_ENST00000412891.1_Splice_Site_p.E538*	NM_001242863.1|NM_017993.3	NP_001229792.1|NP_060463.2	Q8TC92	ENOX1_HUMAN	ecto-NOX disulfide-thiol exchanger 1	538					rhythmic process (GO:0048511)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)	nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(3)|large_intestine(7)|lung(18)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(1)	34		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)		ACATTGATTTCCTATAAAGTT	0.338																																						dbGAP											0													89.0	85.0	86.0					13																	43810874		2201	4297	6498	-	-	-	SO:0001630	splice_region_variant	0			EF432052	CCDS9389.1	13q14.11	2013-02-12			ENSG00000120658	ENSG00000120658		"""RNA binding motif (RRM) containing"""	25474	protein-coding gene	gene with protein product		610914				11360993	Standard	NM_001127615		Approved	FLJ10094, PIG38, CNOX, cCNOX	uc001uza.4	Q8TC92	OTTHUMG00000016818	ENST00000261488.6:c.1612-1G>T	13.37:g.43810874C>A			A4GU15|A6NMH9|B7Z5K1|Q2TU81|Q5VT11|Q9NWE0	Nonsense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.E538*	ENST00000261488.6	37	c.1612	CCDS9389.1	13	.	.	.	.	.	.	.	.	.	.	C	40	8.246066	0.98724	.	.	ENSG00000120658	ENST00000261488;ENST00000412891	.	.	.	5.67	5.67	0.87782	.	0.245803	0.41712	D	0.000824	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	-17.9577	17.9536	0.89061	0.0:1.0:0.0:0.0	.	.	.	.	X	538	.	ENSP00000261488:E538X	E	-	1	0	ENOX1	42708874	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	4.770000	0.62309	2.677000	0.91161	0.655000	0.94253	GAA	ENOX1	-	NULL	ENSG00000120658		0.338	ENOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENOX1	HGNC	protein_coding	OTTHUMT00000044717.2	316	0.32	1	C	NM_017993	Nonsense_Mutation	43810874	43810874	-1	no_errors	ENST00000261488	ensembl	human	known	69_37n	nonsense	238	38.56	150	SNP	1.000	A
FCHO1	23149	genome.wustl.edu	37	19	17883272	17883272	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A1B4-01A-11D-A12Q-09	TCGA-E2-A1B4-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6aa4529-7996-4b66-9632-2559293db35d	45514149-d01b-4bc9-864b-ed556da905c1	g.chr19:17883272C>T	ENST00000596536.1	+	10	884	c.601C>T	c.(601-603)Caa>Taa	p.Q201*	FCHO1_ENST00000595033.1_Nonsense_Mutation_p.Q151*|FCHO1_ENST00000252771.7_Nonsense_Mutation_p.Q201*|FCHO1_ENST00000597512.1_Nonsense_Mutation_p.Q208*|FCHO1_ENST00000596951.1_Nonsense_Mutation_p.Q201*|FCHO1_ENST00000594202.1_Nonsense_Mutation_p.Q201*|FCHO1_ENST00000539407.1_Nonsense_Mutation_p.Q201*|FCHO1_ENST00000600676.1_Nonsense_Mutation_p.Q201*|FCHO1_ENST00000389133.4_Nonsense_Mutation_p.Q201*	NM_015122.2	NP_055937.1	O14526	FCHO1_HUMAN	FCH domain only 1	201	Mediates membrane-binding.				clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	AP-2 adaptor complex binding (GO:0035612)			NS(2)|breast(1)|large_intestine(6)|liver(1)|lung(12)	22						TCAGCGCTTCCAAGCCATGGA	0.572																																						dbGAP											0													90.0	76.0	81.0					19																	17883272		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB006628	CCDS32955.1, CCDS59365.1, CCDS59366.1	19p13.12	2008-02-05				ENSG00000130475			29002	protein-coding gene	gene with protein product		613437				12477932	Standard	NM_001161357		Approved	KIAA0290	uc002nhg.3	O14526		ENST00000596536.1:c.601C>T	19.37:g.17883272C>T	ENSP00000470731:p.Gln201*		A6NHE6|A8K5U5|B4E120|Q05C93|Q8IW22	Nonsense_Mutation	SNP	pfam_Muniscin_C-term_mu_dom,pfam_FCH,superfamily_Clathrin_mu_C,smart_FCH,pfscan_FCH	p.Q201*	ENST00000596536.1	37	c.601	CCDS32955.1	19	.	.	.	.	.	.	.	.	.	.	C	38	6.704348	0.97776	.	.	ENSG00000130475	ENST00000252771;ENST00000389133;ENST00000539407	.	.	.	4.05	4.05	0.47172	.	0.121046	0.64402	D	0.000020	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-12.3535	12.0143	0.53305	0.0:1.0:0.0:0.0	.	.	.	.	X	201	.	ENSP00000252771:Q201X	Q	+	1	0	FCHO1	17744272	1.000000	0.71417	0.999000	0.59377	0.890000	0.51754	6.689000	0.74562	2.551000	0.86045	0.561000	0.74099	CAA	FCHO1	-	NULL	ENSG00000130475		0.572	FCHO1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FCHO1	HGNC	protein_coding	OTTHUMT00000466946.2	137	0.00	0	C	NM_015122		17883272	17883272	+1	no_errors	ENST00000252771	ensembl	human	known	69_37n	nonsense	52	44.79	43	SNP	1.000	T
GP1BA	2811	genome.wustl.edu	37	17	4837651	4837651	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1B4-01A-11D-A12Q-09	TCGA-E2-A1B4-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6aa4529-7996-4b66-9632-2559293db35d	45514149-d01b-4bc9-864b-ed556da905c1	g.chr17:4837651G>C	ENST00000329125.5	+	2	1827	c.1752G>C	c.(1750-1752)agG>agC	p.R584S		NM_000173.5	NP_000164.5	P07359	GP1BA_HUMAN	glycoprotein Ib (platelet), alpha polypeptide	584					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|fibrinolysis (GO:0042730)|platelet activation (GO:0030168)|regulation of blood coagulation (GO:0030193)|thrombin receptor signaling pathway (GO:0070493)	anchored component of external side of plasma membrane (GO:0031362)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	thrombin receptor activity (GO:0015057)			central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(5)|stomach(1)|urinary_tract(1)	20						AGCTGCAGAGGGGACGGCAAG	0.622											OREG0024109	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													131.0	148.0	142.0					17																	4837651		2106	4235	6341	-	-	-	SO:0001583	missense	0				CCDS54068.1	17p13.2	2014-09-17			ENSG00000185245	ENSG00000185245		"""CD molecules"""	4439	protein-coding gene	gene with protein product		606672		GP1B		3353370	Standard	NM_000173		Approved	CD42b	uc021tnz.1	P07359	OTTHUMG00000177946	ENST00000329125.5:c.1752G>C	17.37:g.4837651G>C	ENSP00000329380:p.Arg584Ser	621	E7ES66|Q14441|Q16469|Q8N1F3|Q8NG39|Q9HDC7|Q9UEK1|Q9UQS4	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.R584S	ENST00000329125.5	37	c.1752	CCDS54068.1	17	.	.	.	.	.	.	.	.	.	.	G	12.13	1.845983	0.32606	.	.	ENSG00000185245	ENST00000329125;ENST00000438881	T	0.54479	0.57	5.02	-0.56	0.11789	.	0.429254	0.17243	N	0.181442	T	0.35682	0.0940	L	0.32530	0.975	0.20764	N	0.999851	B	0.30482	0.281	B	0.27715	0.082	T	0.16482	-1.0401	10	0.51188	T	0.08	-10.3602	8.0751	0.30712	0.4392:0.0:0.5608:0.0	.	571	A5CKE2	.	S	584;558	ENSP00000329380:R584S	ENSP00000329380:R584S	R	+	3	2	GP1BA	4778392	0.338000	0.24775	0.798000	0.32154	0.433000	0.31745	0.128000	0.15810	-0.309000	0.08779	-0.460000	0.05396	AGG	GP1BA	-	NULL	ENSG00000185245		0.622	GP1BA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GP1BA	HGNC	protein_coding	OTTHUMT00000439889.1	121	0.00	0	G			4837651	4837651	+1	no_errors	ENST00000329125	ensembl	human	known	69_37n	missense	48	37.66	29	SNP	0.281	C
HIP1R	9026	genome.wustl.edu	37	12	123345688	123345688	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A1B4-01A-11D-A12Q-09	TCGA-E2-A1B4-10A-01D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6aa4529-7996-4b66-9632-2559293db35d	45514149-d01b-4bc9-864b-ed556da905c1	g.chr12:123345688T>G	ENST00000253083.4	+	30	3026	c.2901T>G	c.(2899-2901)gaT>gaG	p.D967E		NM_003959.1	NP_003950.1	O75146	HIP1R_HUMAN	huntingtin interacting protein 1 related	967	I/LWEQ. {ECO:0000255|PROSITE- ProRule:PRU00292}.				receptor-mediated endocytosis (GO:0006898)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)	phosphatidylinositol binding (GO:0035091)			breast(1)|endometrium(5)|kidney(6)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	26	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;4.6e-05)|Epithelial(86;0.000119)|BRCA - Breast invasive adenocarcinoma(302;0.2)		ACACCATGGATTTCTCCGGCC	0.637																																						dbGAP											0													59.0	62.0	61.0					12																	123345688		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB013384	CCDS31922.1	12q24	2007-12-07			ENSG00000130787	ENSG00000130787			18415	protein-coding gene	gene with protein product		605613				16415883	Standard	NM_003959		Approved	KIAA0655, HIP3, HIP12, FLJ14000, ILWEQ	uc001udj.1	O75146	OTTHUMG00000168765	ENST00000253083.4:c.2901T>G	12.37:g.123345688T>G	ENSP00000253083:p.Asp967Glu		A6NHQ6|Q6NXG8|Q9UED9	Missense_Mutation	SNP	pfam_ANTH,pfam_ILWEQ,pfam_Epsin_dom_N,superfamily_ENTH_VHS,smart_Epsin-like_N,smart_ILWEQ,pfscan_Epsin-like_N,pfscan_ILWEQ	p.D967E	ENST00000253083.4	37	c.2901	CCDS31922.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.17|18.17	3.563417|3.563417	0.65651|0.65651	.|.	.|.	ENSG00000130787|ENSG00000130787	ENST00000253083|ENST00000535012	T|.	0.47177|.	0.85|.	5.38|5.38	0.619|0.619	0.17630|0.17630	I/LWEQ (4);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.67382|0.67382	0.2887|0.2887	M|M	0.72353|0.72353	2.195|2.195	0.47905|0.47905	D|D	0.999546|0.999546	D|.	0.76494|.	0.999|.	D|.	0.87578|.	0.998|.	T|T	0.64188|0.64188	-0.6466|-0.6466	10|5	0.48119|.	T|.	0.1|.	-40.0676|-40.0676	9.7067|9.7067	0.40220|0.40220	0.0:0.5782:0.0:0.4218|0.0:0.5782:0.0:0.4218	.|.	967|.	O75146|.	HIP1R_HUMAN|.	E|S	967|96	ENSP00000253083:D967E|.	ENSP00000253083:D967E|.	D|I	+|+	3|2	2|0	HIP1R|HIP1R	121911641|121911641	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.503000|0.503000	0.33858|0.33858	2.552000|2.552000	0.45828|0.45828	0.231000|0.231000	0.21079|0.21079	-0.624000|-0.624000	0.04008|0.04008	GAT|ATT	HIP1R	-	pfam_ILWEQ,smart_ILWEQ,pfscan_ILWEQ	ENSG00000130787		0.637	HIP1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIP1R	HGNC	protein_coding	OTTHUMT00000400935.1	43	0.00	0	T	NM_003959		123345688	123345688	+1	no_errors	ENST00000253083	ensembl	human	known	69_37n	missense	16	42.86	12	SNP	1.000	G
KATNB1	10300	genome.wustl.edu	37	16	57786814	57786814	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1B4-01A-11D-A12Q-09	TCGA-E2-A1B4-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6aa4529-7996-4b66-9632-2559293db35d	45514149-d01b-4bc9-864b-ed556da905c1	g.chr16:57786814G>A	ENST00000379661.3	+	10	1221	c.829G>A	c.(829-831)Gac>Aac	p.D277N		NM_005886.2	NP_005877.2			katanin p80 (WD repeat containing) subunit B 1											cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_neural(199;0.223)				CAAGGTGGCCGACCTGGCCAT	0.662																																						dbGAP											0													46.0	45.0	45.0					16																	57786814		2198	4300	6498	-	-	-	SO:0001583	missense	0			AF052432	CCDS10788.1	16q12.2	2013-01-09	2003-03-13		ENSG00000140854	ENSG00000140854		"""WD repeat domain containing"""	6217	protein-coding gene	gene with protein product		602703	"""katanin p80 (WD40-containing) subunit B 1"""			9568719	Standard	XM_006721121		Approved		uc002eml.1	Q9BVA0	OTTHUMG00000133467	ENST00000379661.3:c.829G>A	16.37:g.57786814G>A	ENSP00000368982:p.Asp277Asn			Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.D277N	ENST00000379661.3	37	c.829	CCDS10788.1	16	.	.	.	.	.	.	.	.	.	.	G	36	5.940817	0.97128	.	.	ENSG00000140854	ENST00000379661	D	0.81659	-1.52	5.45	5.45	0.79879	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.90225	0.6944	M	0.81802	2.56	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.91044	0.4873	10	0.66056	D	0.02	-3.219	18.2687	0.90060	0.0:0.0:1.0:0.0	.	277	Q9BVA0	KTNB1_HUMAN	N	277	ENSP00000368982:D277N	ENSP00000368982:D277N	D	+	1	0	KATNB1	56344315	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	9.476000	0.97823	2.563000	0.86464	0.655000	0.94253	GAC	KATNB1	-	superfamily_WD40_repeat_dom	ENSG00000140854		0.662	KATNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KATNB1	HGNC	protein_coding	OTTHUMT00000257343.3	30	0.00	0	G			57786814	57786814	+1	no_errors	ENST00000379661	ensembl	human	known	69_37n	missense	3	66.67	8	SNP	1.000	A
KLHL30	377007	genome.wustl.edu	37	2	239049614	239049614	+	Silent	SNP	C	C	T	rs201039052		TCGA-E2-A1B4-01A-11D-A12Q-09	TCGA-E2-A1B4-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6aa4529-7996-4b66-9632-2559293db35d	45514149-d01b-4bc9-864b-ed556da905c1	g.chr2:239049614C>T	ENST00000409223.1	+	2	326	c.219C>T	c.(217-219)cgC>cgT	p.R73R	KLHL30_ENST00000305959.4_Silent_p.R55R			Q0D2K2	KLH30_HUMAN	kelch-like family member 30	73	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.									lung(4)	4		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		TCTCTGCGCGCGTGGAGCTGC	0.682																																						dbGAP											0													98.0	112.0	107.0					2																	239049614		2164	4255	6419	-	-	-	SO:0001819	synonymous_variant	0				CCDS46555.1, CCDS46555.2	2q37.3	2013-02-22	2013-02-22		ENSG00000168427	ENSG00000168427		"""Kelch-like"", ""BTB/POZ domain containing"""	24770	protein-coding gene	gene with protein product			"""kelch-like 30 (Drosophila)"""				Standard	NM_198582		Approved	FLJ43374	uc002vxr.2	Q0D2K2	OTTHUMG00000152905	ENST00000409223.1:c.219C>T	2.37:g.239049614C>T			Q6ZUS1	Silent	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.R73	ENST00000409223.1	37	c.219	CCDS46555.2	2																																																																																			KLHL30	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	ENSG00000168427		0.682	KLHL30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL30	HGNC	protein_coding	OTTHUMT00000328518.1	27	0.00	0	C	NM_198582		239049614	239049614	+1	no_errors	ENST00000409223	ensembl	human	known	69_37n	silent	9	52.63	10	SNP	0.612	T
KRBA1	84626	genome.wustl.edu	37	7	149427674	149427674	+	Intron	SNP	C	C	T			TCGA-E2-A1B4-01A-11D-A12Q-09	TCGA-E2-A1B4-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6aa4529-7996-4b66-9632-2559293db35d	45514149-d01b-4bc9-864b-ed556da905c1	g.chr7:149427674C>T	ENST00000485033.2	+	13	1963				KRBA1_ENST00000479560.1_Intron|KRBA1_ENST00000319551.8_Intron|KRBA1_ENST00000255992.10_Intron			A5PL33	KRBA1_HUMAN	KRAB-A domain containing 1											breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(17)|ovary(1)|prostate(1)	27	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CCTGGGGTCTCCTGAGGGGGC	0.667																																						dbGAP											0													15.0	17.0	16.0					7																	149427674		1914	4114	6028	-	-	-	SO:0001627	intron_variant	0			AB058765	CCDS75674.1	7q36	2014-02-12	2006-08-15		ENSG00000133619	ENSG00000133619		"""-"""	22228	protein-coding gene	gene with protein product			"""KRAB A domain containing 1"""				Standard	NM_001290187		Approved	KIAA1862	uc003wfz.3	A5PL33	OTTHUMG00000157886	ENST00000485033.2:c.1963+16C>T	7.37:g.149427674C>T			A7E2F5|E7ENE9|Q8N4X0|Q96JG5	Missense_Mutation	SNP	NULL	p.P617S	ENST00000485033.2	37	c.1849		7																																																																																			KRBA1	-	NULL	ENSG00000133619		0.667	KRBA1-004	PUTATIVE	basic	protein_coding	KRBA1	HGNC	protein_coding	OTTHUMT00000349841.3	17	0.00	0	C	NM_032534		149427674	149427674	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000496259	ensembl	human	known	69_37n	missense	7	50.00	7	SNP	0.005	T
MAP3K1	4214	genome.wustl.edu	37	5	56178085	56178085	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A1B4-01A-11D-A12Q-09	TCGA-E2-A1B4-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6aa4529-7996-4b66-9632-2559293db35d	45514149-d01b-4bc9-864b-ed556da905c1	g.chr5:56178085C>T	ENST00000399503.3	+	14	3058	c.3058C>T	c.(3058-3060)Caa>Taa	p.Q1020*		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	1020					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		TGCATCTCCTCAAACACAGCG	0.448																																						dbGAP											0													70.0	69.0	69.0					5																	56178085		1887	4117	6004	-	-	-	SO:0001587	stop_gained	0			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.3058C>T	5.37:g.56178085C>T	ENSP00000382423:p.Gln1020*			Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Prot_kinase_cat_dom	p.Q1020*	ENST00000399503.3	37	c.3058	CCDS43318.1	5	.	.	.	.	.	.	.	.	.	.	C	38	7.094050	0.98059	.	.	ENSG00000095015	ENST00000399503	.	.	.	5.71	5.71	0.89125	.	0.217463	0.41500	D	0.000880	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	.	19.8546	0.96752	0.0:1.0:0.0:0.0	.	.	.	.	X	1020	.	ENSP00000382423:Q1020X	Q	+	1	0	MAP3K1	56213842	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	4.536000	0.60636	2.697000	0.92050	0.655000	0.94253	CAA	MAP3K1	-	NULL	ENSG00000095015		0.448	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	HGNC	protein_coding	OTTHUMT00000132309.2	117	0.00	0	C	XM_042066		56178085	56178085	+1	no_errors	ENST00000399503	ensembl	human	novel	69_37n	nonsense	64	47.54	58	SNP	1.000	T
MAP3K1	4214	genome.wustl.edu	37	5	56178466	56178467	+	Frame_Shift_Ins	INS	-	-	T			TCGA-E2-A1B4-01A-11D-A12Q-09	TCGA-E2-A1B4-10A-01D-A12Q-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6aa4529-7996-4b66-9632-2559293db35d	45514149-d01b-4bc9-864b-ed556da905c1	g.chr5:56178466_56178467insT	ENST00000399503.3	+	14	3439_3440	c.3439_3440insT	c.(3439-3441)gtafs	p.V1147fs		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	1147					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		TGATACAACAGTAACTTTTAAG	0.396																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.3440dupT	5.37:g.56178467_56178467dupT	ENSP00000382423:p.Val1147fs			Frame_Shift_Ins	INS	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Prot_kinase_cat_dom	p.T1148fs	ENST00000399503.3	37	c.3439_3440	CCDS43318.1	5																																																																																			MAP3K1	-	NULL	ENSG00000095015		0.396	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	HGNC	protein_coding	OTTHUMT00000132309.2	158	0.00	0	-	XM_042066		56178466	56178467	+1	no_errors	ENST00000399503	ensembl	human	novel	69_37n	frame_shift_ins	130	29.73	55	INS	1.000:0.998	T
NPHP4	261734	genome.wustl.edu	37	1	5964847	5964847	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1B4-01A-11D-A12Q-09	TCGA-E2-A1B4-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6aa4529-7996-4b66-9632-2559293db35d	45514149-d01b-4bc9-864b-ed556da905c1	g.chr1:5964847C>T	ENST00000378156.4	-	16	2238	c.1973G>A	c.(1972-1974)cGa>cAa	p.R658Q	NPHP4_ENST00000478423.2_5'UTR	NM_015102.3	NP_055917.1	O75161	NPHP4_HUMAN	nephronophthisis 4	658					actin cytoskeleton organization (GO:0030036)|hippo signaling (GO:0035329)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(4)	47	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		TGATGTTCCTCGGCAGTCCTG	0.547																																						dbGAP											0													115.0	117.0	117.0					1																	5964847		2094	4225	6319	-	-	-	SO:0001583	missense	0			AB014573	CCDS44052.1	1p36	2010-03-26			ENSG00000131697	ENSG00000131697			19104	protein-coding gene	gene with protein product	"""nephroretinin"", ""nephrocystin-4"", ""POC10 centriolar protein homolog (Chlamydomonas)"""	607215				11920287, 12205563	Standard	XR_244787		Approved	SLSN4, KIAA0673, POC10	uc001alq.2	O75161	OTTHUMG00000000701	ENST00000378156.4:c.1973G>A	1.37:g.5964847C>T	ENSP00000367398:p.Arg658Gln		Q8IWC0	Missense_Mutation	SNP	NULL	p.R658Q	ENST00000378156.4	37	c.1973	CCDS44052.1	1	.	.	.	.	.	.	.	.	.	.	C	8.122	0.781207	0.16120	.	.	ENSG00000131697	ENST00000378156;ENST00000378160	D	0.86865	-2.18	5.1	-1.94	0.07571	.	1.397130	0.04674	N	0.411192	T	0.64305	0.2586	N	0.02539	-0.55	0.09310	N	1	B	0.18741	0.03	B	0.09377	0.004	T	0.55798	-0.8084	10	0.10636	T	0.68	.	2.8422	0.05533	0.1131:0.4045:0.3466:0.1358	.	658	O75161	NPHP4_HUMAN	Q	658;61	ENSP00000367398:R658Q	ENSP00000367398:R658Q	R	-	2	0	NPHP4	5887434	0.000000	0.05858	0.000000	0.03702	0.910000	0.53928	-0.677000	0.05215	-0.771000	0.04608	0.655000	0.94253	CGA	NPHP4	-	NULL	ENSG00000131697		0.547	NPHP4-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	NPHP4	HGNC	protein_coding	OTTHUMT00000001715.2	108	0.00	0	C			5964847	5964847	-1	no_errors	ENST00000378156	ensembl	human	known	69_37n	missense	47	37.97	30	SNP	0.001	T
OLFML2A	169611	genome.wustl.edu	37	9	127563854	127563854	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A1B4-01A-11D-A12Q-09	TCGA-E2-A1B4-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6aa4529-7996-4b66-9632-2559293db35d	45514149-d01b-4bc9-864b-ed556da905c1	g.chr9:127563854G>T	ENST00000373580.3	+	5	831	c.831G>T	c.(829-831)aaG>aaT	p.K277N	OLFML2A_ENST00000288815.5_Missense_Mutation_p.K63N	NM_182487.2	NP_872293.2	Q68BL7	OLM2A_HUMAN	olfactomedin-like 2A	277					extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)			endometrium(5)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	25						CCACAGCCAAGCCCCGCGCCC	0.632																																						dbGAP											0													45.0	46.0	46.0					9																	127563854		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK092255	CCDS6857.2, CCDS65129.1	9q34.11	2008-02-05			ENSG00000185585	ENSG00000185585			27270	protein-coding gene	gene with protein product		615899				12477932	Standard	NM_001282715		Approved	FLJ00237	uc004bov.3	Q68BL7	OTTHUMG00000020663	ENST00000373580.3:c.831G>T	9.37:g.127563854G>T	ENSP00000362682:p.Lys277Asn		Q5JTM5|Q5JTM6|Q6UXW1|Q7Z5V3	Missense_Mutation	SNP	pfam_Olfac-like,smart_Olfac-like,pfscan_Olfac-like	p.K277N	ENST00000373580.3	37	c.831	CCDS6857.2	9	.	.	.	.	.	.	.	.	.	.	G	17.82	3.482202	0.63962	.	.	ENSG00000185585	ENST00000331715;ENST00000425732;ENST00000373580;ENST00000288815	T;T;D	0.90844	0.84;0.84;-2.74	6.07	4.23	0.50019	.	0.334454	0.34603	N	0.003824	D	0.93210	0.7837	M	0.65498	2.005	0.35662	D	0.812653	D;P;P	0.63046	0.992;0.836;0.921	P;P;P	0.61397	0.888;0.526;0.478	D	0.95633	0.8691	10	0.66056	D	0.02	.	12.2385	0.54528	0.141:0.0:0.859:0.0	.	241;63;277	Q5JTM7;Q68BL7-3;Q68BL7	.;.;OLM2A_HUMAN	N	241;241;277;63	ENSP00000336425:K241N;ENSP00000362682:K277N;ENSP00000288815:K63N	ENSP00000288815:K63N	K	+	3	2	OLFML2A	126603675	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.132000	0.50523	1.583000	0.49898	0.655000	0.94253	AAG	OLFML2A	-	NULL	ENSG00000185585		0.632	OLFML2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	OLFML2A	HGNC	protein_coding	OTTHUMT00000054046.2	64	0.00	0	G	NM_182487		127563854	127563854	+1	no_errors	ENST00000373580	ensembl	human	known	69_37n	missense	34	33.33	17	SNP	1.000	T
PCNXL2	80003	genome.wustl.edu	37	1	233136233	233136233	+	Nonsense_Mutation	SNP	C	C	A	rs369348878		TCGA-E2-A1B4-01A-11D-A12Q-09	TCGA-E2-A1B4-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6aa4529-7996-4b66-9632-2559293db35d	45514149-d01b-4bc9-864b-ed556da905c1	g.chr1:233136233C>A	ENST00000258229.9	-	30	5380	c.5146G>T	c.(5146-5148)Gag>Tag	p.E1716*	PCNXL2_ENST00000344698.2_Nonsense_Mutation_p.E368*	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	1716						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				TGGATGGCCTCGTAGAGGACT	0.612																																						dbGAP											0													59.0	61.0	60.0					1																	233136233		2012	4181	6193	-	-	-	SO:0001587	stop_gained	0			AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.5146G>T	1.37:g.233136233C>A	ENSP00000258229:p.Glu1716*		O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Nonsense_Mutation	SNP	pfam_Pecanex,superfamily_Pept_cys/ser_Trypsin-like	p.E1716*	ENST00000258229.9	37	c.5146	CCDS44335.1	1	.	.	.	.	.	.	.	.	.	.	C	49	16.053237	0.99853	.	.	ENSG00000135749	ENST00000344698;ENST00000258229	.	.	.	5.51	5.51	0.81932	.	0.090587	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.7892	0.96452	0.0:1.0:0.0:0.0	.	.	.	.	X	368;1716	.	ENSP00000258229:E1716X	E	-	1	0	PCNXL2	231202856	1.000000	0.71417	0.994000	0.49952	0.983000	0.72400	7.476000	0.81055	2.753000	0.94483	0.650000	0.86243	GAG	PCNXL2	-	pfam_Pecanex,superfamily_Pept_cys/ser_Trypsin-like	ENSG00000135749		0.612	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNXL2	HGNC	protein_coding	OTTHUMT00000092480.3	143	0.00	0	C	NM_014801		233136233	233136233	-1	no_errors	ENST00000258229	ensembl	human	known	69_37n	nonsense	65	35.64	36	SNP	1.000	A
PIK3CA	5290	genome.wustl.edu	37	3	178936082	178936082	+	Missense_Mutation	SNP	G	G	A	rs121913273		TCGA-E2-A1B4-01A-11D-A12Q-09	TCGA-E2-A1B4-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6aa4529-7996-4b66-9632-2559293db35d	45514149-d01b-4bc9-864b-ed556da905c1	g.chr3:178936082G>A	ENST00000263967.3	+	10	1781	c.1624G>A	c.(1624-1626)Gaa>Aaa	p.E542K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	542	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> K (in CLOVE, KERSEB, CRC and BC; also found in glioblastoma multiforme and endometrial carcinoma; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N- terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|E -> Q (found in an endometrial carcinoma sample; unknown pathological significance). {ECO:0000269|PubMed:16322209}.|E -> V (in BC; unknown pathological significance). {ECO:0000269|PubMed:16353168}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E542K(545)|p.E542Q(10)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TCCTCTCTCTGAAATCACTGA	0.333	E542K(BT483_BREAST)|E542K(CAL51_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(VMCUB1_URINARY_TRACT)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	555	Substitution - Missense(555)	breast(176)|large_intestine(166)|urinary_tract(45)|endometrium(37)|skin(19)|lung(18)|stomach(16)|ovary(16)|thyroid(14)|upper_aerodigestive_tract(9)|central_nervous_system(7)|cervix(6)|liver(6)|oesophagus(5)|penis(4)|kidney(3)|soft_tissue(2)|haematopoietic_and_lymphoid_tissue(2)|prostate(2)|biliary_tract(1)|pituitary(1)											56.0	56.0	56.0					3																	178936082		1809	4069	5878	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1624G>A	3.37:g.178936082G>A	ENSP00000263967:p.Glu542Lys		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E542K	ENST00000263967.3	37	c.1624	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	34	5.360420	0.95877	.	.	ENSG00000121879	ENST00000263967	T	0.62105	0.05	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69287	0.3094	L	0.41356	1.27	0.80722	D	1	D	0.65815	0.995	D	0.63192	0.912	T	0.60296	-0.7291	10	0.09843	T	0.71	-23.9623	20.0024	0.97423	0.0:0.0:1.0:0.0	.	542	P42336	PK3CA_HUMAN	K	542	ENSP00000263967:E542K	ENSP00000263967:E542K	E	+	1	0	PIK3CA	180418776	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAA	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.333	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	221	0.00	0	G			178936082	178936082	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	222	35.28	121	SNP	1.000	A
PNMAL2	57469	genome.wustl.edu	37	19	46998318	46998318	+	Silent	SNP	C	C	T			TCGA-E2-A1B4-01A-11D-A12Q-09	TCGA-E2-A1B4-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6aa4529-7996-4b66-9632-2559293db35d	45514149-d01b-4bc9-864b-ed556da905c1	g.chr19:46998318C>T	ENST00000377655.2	-	1	404	c.405G>A	c.(403-405)acG>acA	p.T135T	AC011484.1_ENST00000377652.3_Silent_p.C143C|PNMAL2_ENST00000594749.1_Intron|PNMAL2_ENST00000599531.1_Silent_p.T135T			Q9ULN7	PNML2_HUMAN	paraneoplastic Ma antigen family-like 2	135										central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(4)	8		Ovarian(192;0.00965)|all_neural(266;0.0459)		OV - Ovarian serous cystadenocarcinoma(262;0.000322)|all cancers(93;0.00233)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)		CCTGGGCCTGCGTCTCCGAAG	0.692																																						dbGAP											0													46.0	48.0	47.0					19																	46998318		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB033009	CCDS59400.1	19q13.32	2014-02-12	2012-02-09		ENSG00000204851	ENSG00000204851		"""Paraneoplastic Ma antigens"""	29206	protein-coding gene	gene with protein product			"""PNMA-like 2"""			10574461	Standard	NM_020709		Approved	KIAA1183	uc002pes.2	Q9ULN7		ENST00000377655.2:c.405G>A	19.37:g.46998318C>T			C9JGD5|M0R374|Q08E79|Q0D2F9|Q6ZVD1	Silent	SNP	NULL	p.T135	ENST00000377655.2	37	c.405		19																																																																																			PNMAL2	-	NULL	ENSG00000204851		0.692	PNMAL2-201	KNOWN	basic	protein_coding	PNMAL2	HGNC	protein_coding		37	0.00	0	C	NM_020709		46998318	46998318	-1	no_errors	ENST00000377655	ensembl	human	known	69_37n	silent	15	34.78	8	SNP	0.001	T
POLR2J	5439	genome.wustl.edu	37	7	102119254	102119256	+	Splice_Site	DEL	CTT	CTT	-	rs141678884		TCGA-E2-A1B4-01A-11D-A12Q-09	TCGA-E2-A1B4-10A-01D-A12Q-09	CTT	CTT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6aa4529-7996-4b66-9632-2559293db35d	45514149-d01b-4bc9-864b-ed556da905c1	g.chr7:102119254_102119256delCTT	ENST00000292614.5	-	1	98_100	c.52_54delAAG	c.(52-54)aagdel	p.K18del	POLR2J_ENST00000393794.3_Splice_Site_p.K18del|AC093668.3_ENST00000607525.1_RNA	NM_006234.4	NP_006225.1	P52435	RPB11_HUMAN	polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa	18					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|LRR domain binding (GO:0030275)	p.?(1)		pancreas(2)	2						GCGTCACTTACTTCTTCTCGCCC	0.685											OREG0018232	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Unknown(1)	pancreas(1)								54,3764		3,48,1858						2.5	1.0			17	108,7482		12,84,3699	no	coding-near-splice	POLR2J	NM_006234.4		15,132,5557	A1A1,A1R,RR		1.4229,1.4144,1.4201				162,11246				-	-	-	SO:0001630	splice_region_variant	0			X98433	CCDS5724.1	7q11.2	2013-01-21	2002-08-29		ENSG00000005075	ENSG00000005075		"""RNA polymerase subunits"""	9197	protein-coding gene	gene with protein product		604150	"""polymerase (RNA) II (DNA directed) polypeptide J (13.3kD)"""				Standard	XM_005250452		Approved	RPB11, hRPB14, RPB11A, RPB11m, POLR2J1	uc003uzp.1	P52435	OTTHUMG00000150387	ENST00000292614.5:c.53+1AAG>-	7.37:g.102119257_102119259delCTT		1364	A5D6V8|O43375	Splice_Site	DEL	-	e2-1	ENST00000292614.5	37	c.53+3_53+1	CCDS5724.1	7																																																																																			POLR2J	-	-	ENSG00000005075		0.685	POLR2J-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR2J	HGNC	protein_coding	OTTHUMT00000317913.1	13	0.00	0	CTT	NM_006234	In_Frame_Del	102119254	102119256	-1	no_errors	ENST00000393794	ensembl	human	known	69_37n	splice_site_del	5	37.50	3	DEL	1.000:1.000:1.000	-
RGS3	5998	genome.wustl.edu	37	9	116346360	116346360	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1B4-01A-11D-A12Q-09	TCGA-E2-A1B4-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6aa4529-7996-4b66-9632-2559293db35d	45514149-d01b-4bc9-864b-ed556da905c1	g.chr9:116346360G>A	ENST00000374140.2	+	21	2877	c.2668G>A	c.(2668-2670)Gag>Aag	p.E890K	RGS3_ENST00000342620.5_Intron|RGS3_ENST00000394646.3_Intron|RGS3_ENST00000343817.5_Missense_Mutation_p.E609K|RGS3_ENST00000350696.5_Missense_Mutation_p.E890K|RGS3_ENST00000462143.1_Missense_Mutation_p.E211K|RGS3_ENST00000374134.3_Missense_Mutation_p.E211K|RP11-168K11.2_ENST00000428429.1_RNA	NM_001282923.1|NM_144488.4	NP_001269852.1|NP_652759.3	P49796	RGS3_HUMAN	regulator of G-protein signaling 3	890					inactivation of MAPK activity (GO:0000188)|positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			cervix(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	48						ggaggtggaggagggggagga	0.642																																						dbGAP											0													97.0	76.0	83.0					9																	116346360		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF006610	CCDS6797.1, CCDS6798.1, CCDS35113.1, CCDS35114.1, CCDS43869.1, CCDS65111.1	9q32	2008-02-05	2007-08-14		ENSG00000138835	ENSG00000138835		"""Regulators of G-protein signaling"""	9999	protein-coding gene	gene with protein product		602189	"""regulator of G-protein signalling 3"""			8602223, 11034339	Standard	NM_001276260		Approved	C2PA, FLJ20370, PDZ-RGS3	uc004bhq.4	P49796	OTTHUMG00000021048	ENST00000374140.2:c.2668G>A	9.37:g.116346360G>A	ENSP00000363255:p.Glu890Lys		A6NHA0|A8K0V1|B3KUB2|Q5VXB8|Q5VXC1|Q5VZ05|Q5VZ06|Q6ZRM5|Q8IUQ1|Q8NC47|Q8NFN4|Q8NFN5|Q8NFN6|Q8TD59|Q8TD68|Q8WV02|Q8WXA0	Missense_Mutation	SNP	pfam_Regulat_G_prot_signal,pfam_C2_Ca-dep,pfam_PDZ,superfamily_Regulat_G_prot_signal_superfam,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_PDZ,smart_C2_Ca-dep,smart_PDZ,smart_Regulat_G_prot_signal,pfscan_C2_membr_targeting,pfscan_PDZ,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.E890K	ENST00000374140.2	37	c.2668	CCDS43869.1	9	.	.	.	.	.	.	.	.	.	.	G	16.76	3.210968	0.58343	.	.	ENSG00000138835	ENST00000374140;ENST00000350696;ENST00000343817;ENST00000462143;ENST00000374134	T;T;T;T;T	0.61980	0.63;0.63;0.16;0.06;0.06	4.92	4.92	0.64577	.	0.369137	0.25349	N	0.031306	T	0.61502	0.2352	N	0.14661	0.345	0.80722	D	1	D;P;D;D;D;D	0.89917	1.0;0.908;0.997;0.998;0.996;0.996	D;P;D;D;P;P	0.79784	0.993;0.492;0.942;0.941;0.874;0.874	T	0.56643	-0.7945	10	0.15952	T	0.53	.	13.6089	0.62063	0.0:0.0:1.0:0.0	.	229;786;211;609;780;890	B4DWF9;P49796-6;Q6ZV17;P49796-4;B3KWG8;P49796	.;.;.;.;.;RGS3_HUMAN	K	890;890;609;211;211	ENSP00000363255:E890K;ENSP00000259406:E890K;ENSP00000340284:E609K;ENSP00000420356:E211K;ENSP00000363249:E211K	ENSP00000340284:E609K	E	+	1	0	RGS3	115386181	0.737000	0.28175	0.168000	0.22838	0.118000	0.20060	0.759000	0.26461	2.260000	0.74910	0.313000	0.20887	GAG	RGS3	-	NULL	ENSG00000138835		0.642	RGS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS3	HGNC	protein_coding	OTTHUMT00000055561.3	161	0.00	0	G	NM_017790		116346360	116346360	+1	no_errors	ENST00000350696	ensembl	human	known	69_37n	missense	50	43.18	38	SNP	0.806	A
SDHB	6390	genome.wustl.edu	37	1	17355201	17355201	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A1B4-01A-11D-A12Q-09	TCGA-E2-A1B4-10A-01D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6aa4529-7996-4b66-9632-2559293db35d	45514149-d01b-4bc9-864b-ed556da905c1	g.chr1:17355201T>C	ENST00000375499.3	-	4	467	c.317A>G	c.(316-318)aAt>aGt	p.N106S		NM_003000.2	NP_002991.2	P21912	SDHB_HUMAN	succinate dehydrogenase complex, subunit B, iron sulfur (Ip)	106	2Fe-2S ferredoxin-type. {ECO:0000255|PROSITE-ProRule:PRU00465}.				aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|3 iron, 4 sulfur cluster binding (GO:0051538)|4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)|ubiquinone binding (GO:0048039)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)	10		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00054)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0049)|COAD - Colon adenocarcinoma(227;1.18e-05)|BRCA - Breast invasive adenocarcinoma(304;2.41e-05)|Kidney(64;0.000188)|KIRC - Kidney renal clear cell carcinoma(64;0.00273)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.19)	Succinic acid(DB00139)	GTTGCCTCCATTGATGTTCAT	0.443			"""Mis, N, F"""			"""paraganglioma, pheochromocytoma"""			Familial Paragangliomas;Cowden syndrome;Carney-Stratakis syndrome																													dbGAP	yes	Rec		Familial paraganglioma	1	1p36.1-p35	6390	"""succinate dehydrogenase complex, subunit B, iron sulfur (Ip)"""		O	0													231.0	191.0	204.0					1																	17355201		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;Carney-Stratakis dyad, Paraganglioma-Gastric Stromal Sarcoma dyad	U17248	CCDS176.1	1p36.1-p35	2014-09-17			ENSG00000117118	ENSG00000117118	1.3.99.1	"""Mitochondrial respiratory chain complex / Complex II"""	10681	protein-coding gene	gene with protein product		185470		SDH1, SDH			Standard	NM_003000		Approved		uc001bae.3	P21912	OTTHUMG00000002289	ENST00000375499.3:c.317A>G	1.37:g.17355201T>C	ENSP00000364649:p.Asn106Ser		B2R545|Q0QEY7|Q9NQ12	Missense_Mutation	SNP	superfamily_Helical_ferredxn,superfamily_2Fe-2S_ferredoxin-type,pfscan_2Fe-2S_ferredoxin-type,tigrfam_Succ_DH/fum_Rdtase_Fe-S	p.N106S	ENST00000375499.3	37	c.317	CCDS176.1	1	.	.	.	.	.	.	.	.	.	.	T	17.36	3.369135	0.61624	.	.	ENSG00000117118	ENST00000375499	D	0.99488	-6.0	6.17	6.17	0.99709	Beta-grasp fold, ferredoxin-type (1);Ferredoxin (2);	0.083887	0.85682	D	0.000000	D	0.99077	0.9683	M	0.93016	3.37	0.46317	D	0.998986	B	0.22983	0.078	B	0.22753	0.041	D	0.97436	1.0018	10	0.72032	D	0.01	-32.5805	12.2132	0.54391	0.0:0.0:0.142:0.858	.	106	P21912	DHSB_HUMAN	S	106	ENSP00000364649:N106S	ENSP00000364649:N106S	N	-	2	0	SDHB	17227788	0.999000	0.42202	0.973000	0.42090	0.990000	0.78478	3.068000	0.50018	2.371000	0.80710	0.533000	0.62120	AAT	SDHB	-	superfamily_2Fe-2S_ferredoxin-type,pfscan_2Fe-2S_ferredoxin-type,tigrfam_Succ_DH/fum_Rdtase_Fe-S	ENSG00000117118		0.443	SDHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDHB	HGNC	protein_coding	OTTHUMT00000006603.1	341	0.00	0	T	NM_003000		17355201	17355201	-1	no_errors	ENST00000375499	ensembl	human	known	69_37n	missense	200	34.53	106	SNP	0.998	C
SLC52A2	79581	genome.wustl.edu	37	8	145584626	145584626	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A1B4-01A-11D-A12Q-09	TCGA-E2-A1B4-10A-01D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6aa4529-7996-4b66-9632-2559293db35d	45514149-d01b-4bc9-864b-ed556da905c1	g.chr8:145584626A>G	ENST00000532887.1	+	5	1872	c.1289A>G	c.(1288-1290)tAt>tGt	p.Y430C	SLC52A2_ENST00000329994.2_Missense_Mutation_p.Y430C|SLC52A2_ENST00000526752.1_Silent_p.L98L|SLC52A2_ENST00000527078.1_Missense_Mutation_p.Y430C|SLC52A2_ENST00000402965.1_Missense_Mutation_p.Y430C|FBXL6_ENST00000331890.5_5'Flank|SLC52A2_ENST00000530047.1_Missense_Mutation_p.Y430C|SLC52A2_ENST00000540505.1_Missense_Mutation_p.Y342C|FBXL6_ENST00000455319.2_5'Flank			Q9HAB3	S52A2_HUMAN	solute carrier family 52 (riboflavin transporter), member 2	430					riboflavin transport (GO:0032218)	integral component of plasma membrane (GO:0005887)	riboflavin transporter activity (GO:0032217)|virus receptor activity (GO:0001618)									Gamma Hydroxybutyric Acid(DB01440)	ACCAGCATCTATCACGTGTTC	0.652																																						dbGAP											0													123.0	116.0	119.0					8																	145584626		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY070774	CCDS6423.1	8q24.3	2013-07-17	2013-07-17	2012-02-29		ENSG00000185803		"""Solute carriers"""	30224	protein-coding gene	gene with protein product		607882	"""G protein-coupled receptor 172A"""	GPR172A		12740431	Standard	NM_024531		Approved	FLJ11856, PAR1, GPCR41, D15Ertd747e, RFVT2, hRFT3	uc003zcd.2	Q9HAB3		ENST00000532887.1:c.1289A>G	8.37:g.145584626A>G	ENSP00000436768:p.Tyr430Cys		A8K6B6|D3DWL8|G1UCY1|Q86UT1	Missense_Mutation	SNP	pfam_Endogenous_retrovirus_rcpt	p.Y430C	ENST00000532887.1	37	c.1289	CCDS6423.1	8	.	.	.	.	.	.	.	.	.	.	A	11.80	1.745520	0.30955	.	.	ENSG00000185803	ENST00000530047;ENST00000527078;ENST00000402965;ENST00000532887;ENST00000329994;ENST00000540505	T;T;T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03;-1.03;-0.82	5.25	4.07	0.47477	.	0.071233	0.64402	D	0.000018	T	0.73521	0.3597	M	0.62723	1.935	0.80722	D	1	P	0.37985	0.613	B	0.37550	0.253	T	0.71672	-0.4522	10	0.48119	T	0.1	.	10.482	0.44700	0.8363:0.1637:0.0:0.0	.	430	Q9HAB3	RFT3_HUMAN	C	430;430;430;430;430;342	ENSP00000435820:Y430C;ENSP00000434728:Y430C;ENSP00000385961:Y430C;ENSP00000436768:Y430C;ENSP00000333638:Y430C;ENSP00000440400:Y342C	ENSP00000333638:Y430C	Y	+	2	0	GPR172A	145555434	0.998000	0.40836	0.907000	0.35723	0.228000	0.25075	4.037000	0.57311	0.831000	0.34780	0.374000	0.22700	TAT	SLC52A2	-	NULL	ENSG00000185803		0.652	SLC52A2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC52A2	HGNC	protein_coding	OTTHUMT00000382405.1	97	0.00	0	A	NM_024531		145584626	145584626	+1	no_errors	ENST00000329994	ensembl	human	known	69_37n	missense	32	44.07	26	SNP	0.999	G
SMARCA2	6595	genome.wustl.edu	37	9	2088587	2088587	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1B4-01A-11D-A12Q-09	TCGA-E2-A1B4-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6aa4529-7996-4b66-9632-2559293db35d	45514149-d01b-4bc9-864b-ed556da905c1	g.chr9:2088587G>A	ENST00000382203.1	+	19	3066	c.2857G>A	c.(2857-2859)Gaa>Aaa	p.E953K	SMARCA2_ENST00000349721.2_Missense_Mutation_p.E953K|SMARCA2_ENST00000357248.2_Missense_Mutation_p.E953K|SMARCA2_ENST00000382194.1_Missense_Mutation_p.E953K			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	953					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		ACTGAAGAAAGAAGTTGAATC	0.378																																						dbGAP											0													109.0	123.0	118.0					9																	2088587		2203	4300	6503	-	-	-	SO:0001583	missense	0			D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.2857G>A	9.37:g.2088587G>A	ENSP00000371638:p.Glu953Lys		B1ALG3|B1ALG4|D3DRH4|D3DRH5	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Bromodomain,pfam_BRK_domain,pfam_HSA,pfam_Helicase_C,pfam_Gln-Leu-Gln_QLQ,superfamily_Bromodomain,superfamily_RNaseH-like_dom,smart_Gln-Leu-Gln_QLQ,smart_HAS_subgr,smart_BRK_domain,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Bromodomain,prints_Bromodomain,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Bromodomain	p.E953K	ENST00000382203.1	37	c.2857	CCDS34977.1	9	.	.	.	.	.	.	.	.	.	.	G	33	5.233111	0.95207	.	.	ENSG00000080503	ENST00000349721;ENST00000357248;ENST00000382203;ENST00000382194	D;D;D;D	0.93307	-3.2;-3.2;-3.2;-3.2	5.43	5.43	0.79202	SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.95755	0.8619	L	0.49455	1.56	0.80722	D	1	D;D;D	0.69078	0.995;0.996;0.997	D;D;D	0.79108	0.951;0.987;0.992	D	0.96098	0.9067	10	0.87932	D	0	-23.7209	19.2492	0.93917	0.0:0.0:1.0:0.0	.	554;953;953	B4DK35;P51531-2;P51531	.;.;SMCA2_HUMAN	K	953	ENSP00000265773:E953K;ENSP00000349788:E953K;ENSP00000371638:E953K;ENSP00000371629:E953K	ENSP00000265773:E953K	E	+	1	0	SMARCA2	2078587	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.813000	0.99286	2.563000	0.86464	0.655000	0.94253	GAA	SMARCA2	-	pfam_SNF2_N	ENSG00000080503		0.378	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	SMARCA2	HGNC	protein_coding	OTTHUMT00000051505.1	173	0.00	0	G	NM_003070		2088587	2088587	+1	no_errors	ENST00000349721	ensembl	human	known	69_37n	missense	48	73.18	131	SNP	1.000	A
EIF4A1	1973	genome.wustl.edu	37	17	7478063	7478063	+	Intron	SNP	G	G	C			TCGA-E2-A1B4-01A-11D-A12Q-09	TCGA-E2-A1B4-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6aa4529-7996-4b66-9632-2559293db35d	45514149-d01b-4bc9-864b-ed556da905c1	g.chr17:7478063G>C	ENST00000293831.8	+	3	221				EIF4A1_ENST00000577269.1_Intron|EIF4A1_ENST00000380512.5_Intron|SNORD10_ENST00000459579.1_RNA|EIF4A1_ENST00000582746.1_Intron|SENP3-EIF4A1_ENST00000579777.1_RNA|SNORA48_ENST00000386847.1_RNA	NM_001416.3	NP_001407.1	P60842	IF4A1_HUMAN	eukaryotic translation initiation factor 4A1						cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			NS(1)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	22						GCATCTGGTTGGTGATGCCCA	0.527																																					Melanoma(120;278 1668 15796 27423 46368)	dbGAP											0													271.0	239.0	249.0					17																	7478063		876	1991	2867	-	-	-	SO:0001627	intron_variant	0			D13748	CCDS11113.1, CCDS58511.1	17p13	2012-02-23	2010-02-10		ENSG00000161960	ENSG00000161960		"""DEAD-boxes"""	3282	protein-coding gene	gene with protein product		602641	"""eukaryotic translation initiation factor 4A, isoform 1"""	EIF4A		8493113, 9790779	Standard	NM_001416		Approved	DDX2A, EIF-4A		P60842	OTTHUMG00000108149	ENST00000293831.8:c.205+67G>C	17.37:g.7478063G>C			B2R6L8|D3DTP9|J3QLC4|P04765|Q5U018|Q61516	RNA	SNP	-	NULL	ENST00000293831.8	37	NULL	CCDS11113.1	17																																																																																			SNORA48	-	-	ENSG00000209582		0.527	EIF4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNORA48	HGNC	protein_coding	OTTHUMT00000226952.6	23	0.00	0	G	NM_001416		7478063	7478063	+1	no_errors	ENST00000386847	ensembl	human	known	69_37n	rna	18	35.71	10	SNP	0.001	C
CTBS	1486	genome.wustl.edu	37	1	85018792	85018792	+	3'UTR	SNP	C	C	T			TCGA-E2-A1B4-01A-11D-A12Q-09	TCGA-E2-A1B4-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6aa4529-7996-4b66-9632-2559293db35d	45514149-d01b-4bc9-864b-ed556da905c1	g.chr1:85018792C>T	ENST00000370630.5	-	0	3096				CTBS_ENST00000477677.1_5'Flank	NM_004388.2	NP_004379.1	Q01459	DIAC_HUMAN	chitobiase, di-N-acetyl-						chitin catabolic process (GO:0006032)|oligosaccharide catabolic process (GO:0009313)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	chitinase activity (GO:0004568)			breast(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)	9				all cancers(265;0.00727)|Epithelial(280;0.0192)|OV - Ovarian serous cystadenocarcinoma(397;0.166)		TAATACATCTCTACAATCTCA	0.239																																						dbGAP											0													5.0	5.0	5.0					1																	85018792		1520	3442	4962	-	-	-	SO:0001624	3_prime_UTR_variant	0			M95767	CCDS698.1	1p22	2010-05-04			ENSG00000117151	ENSG00000117151	3.2.1.-		2496	protein-coding gene	gene with protein product		600873		CTB		1549114, 7606925	Standard	NM_004388		Approved		uc001dka.2	Q01459	OTTHUMG00000009922	ENST00000370630.5:c.*1890G>A	1.37:g.85018792C>T			Q5VX50	RNA	SNP	-	NULL	ENST00000370630.5	37	NULL	CCDS698.1	1																																																																																			SPATA1	-	-	ENSG00000122432		0.239	CTBS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA1	HGNC	protein_coding	OTTHUMT00000027457.2	26	0.00	0	C	NM_004388		85018792	85018792	+1	no_errors	ENST00000460286	ensembl	human	known	69_37n	rna	42	37.31	25	SNP	0.616	T
TMSB15A	11013	genome.wustl.edu	37	X	101769050	101769050	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A1B4-01A-11D-A12Q-09	TCGA-E2-A1B4-10A-01D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6aa4529-7996-4b66-9632-2559293db35d	45514149-d01b-4bc9-864b-ed556da905c1	g.chrX:101769050T>G	ENST00000289373.4	-	3	238	c.103A>C	c.(103-105)Atc>Ctc	p.I35L		NM_021992.2	NP_068832.1	P0CG34	TB15A_HUMAN	thymosin beta 15a	35					actin cytoskeleton organization (GO:0030036)|sequestering of actin monomers (GO:0042989)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				large_intestine(1)|lung(1)	2						TCTTGCTGGATAGCTGGGAAG	0.393																																						dbGAP											0													230.0	208.0	216.0					X																	101769050		2203	4300	6503	-	-	-	SO:0001583	missense	0			D82345	CCDS14498.1	Xq21.33-q22.3	2009-01-12	2009-01-12	2009-01-12	ENSG00000158164	ENSG00000158164			30744	protein-coding gene	gene with protein product		601587	"""thymosin-like 8"""	TMSL8		9039501, 17567946	Standard	NM_021992		Approved	TMSNB	uc004eje.3	P0CG34	OTTHUMG00000022054	ENST00000289373.4:c.103A>C	X.37:g.101769050T>G	ENSP00000289373:p.Ile35Leu		A8K614|Q99406	Missense_Mutation	SNP	pfam_Thymosin_b4,smart_Thymosin_b4,pirsf_Thymosin_b4_chordata	p.I35L	ENST00000289373.4	37	c.103	CCDS14498.1	X	.	.	.	.	.	.	.	.	.	.	T	14.03	2.413439	0.42817	.	.	ENSG00000158164	ENST00000289373	T	0.57907	0.37	2.33	1.16	0.20824	.	0.111999	0.32134	U	0.006535	T	0.35885	0.0947	.	.	.	0.24841	N	0.992464	B	0.10296	0.003	B	0.10450	0.005	T	0.27938	-1.0059	9	0.72032	D	0.01	-7.6033	3.6359	0.08148	0.0:0.2011:0.0:0.7989	.	35	P0CG34	TB15A_HUMAN	L	35	ENSP00000289373:I35L	ENSP00000289373:I35L	I	-	1	0	TMSB15A	101655706	1.000000	0.71417	0.950000	0.38849	0.602000	0.36980	1.326000	0.33735	0.241000	0.21283	0.430000	0.28490	ATC	TMSB15A	-	pfam_Thymosin_b4,smart_Thymosin_b4,pirsf_Thymosin_b4_chordata	ENSG00000158164		0.393	TMSB15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMSB15A	HGNC	protein_coding	OTTHUMT00000057621.1	509	0.00	0	T	NM_021992		101769050	101769050	-1	no_errors	ENST00000289373	ensembl	human	known	69_37n	missense	356	34.92	191	SNP	0.948	G
STAG2	10735	genome.wustl.edu	37	X	123211834	123211834	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A1B4-01A-11D-A12Q-09	TCGA-E2-A1B4-10A-01D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6aa4529-7996-4b66-9632-2559293db35d	45514149-d01b-4bc9-864b-ed556da905c1	g.chrX:123211834A>G	ENST00000371160.1	+	27	2991	c.2701A>G	c.(2701-2703)Aaa>Gaa	p.K901E	STAG2_ENST00000469481.1_Intron|STAG2_ENST00000218089.9_Missense_Mutation_p.K901E|STAG2_ENST00000371157.3_Missense_Mutation_p.K901E|STAG2_ENST00000371144.3_Missense_Mutation_p.K901E|STAG2_ENST00000371145.3_Missense_Mutation_p.K901E|STAG2_ENST00000354548.5_Missense_Mutation_p.K832E	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	901					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						AGATATCATCAAAGAAACAAT	0.308																																						dbGAP											0													93.0	83.0	86.0					X																	123211834		2203	4299	6502	-	-	-	SO:0001583	missense	0			Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.2701A>G	X.37:g.123211834A>G	ENSP00000360202:p.Lys901Glu		B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Missense_Mutation	SNP	pfam_STAG,superfamily_ARM-type_fold	p.K901E	ENST00000371160.1	37	c.2701	CCDS14607.1	X	.	.	.	.	.	.	.	.	.	.	A	25.8	4.671265	0.88348	.	.	ENSG00000101972	ENST00000218089;ENST00000354548;ENST00000371160;ENST00000371157;ENST00000371145;ENST00000371144	T;T;T;T;T;T	0.55413	0.83;0.55;0.52;0.52;0.83;0.52	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.75997	0.3926	M	0.86502	2.82	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.81048	-0.1109	10	0.87932	D	0	-13.7772	14.611	0.68517	1.0:0.0:0.0:0.0	.	901;901	Q8N3U4-2;Q8N3U4	.;STAG2_HUMAN	E	901;832;901;901;901;901	ENSP00000218089:K901E;ENSP00000346555:K832E;ENSP00000360202:K901E;ENSP00000360199:K901E;ENSP00000360187:K901E;ENSP00000360186:K901E	ENSP00000218089:K901E	K	+	1	0	STAG2	123039515	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.339000	0.96797	1.831000	0.53308	0.412000	0.27726	AAA	STAG2	-	NULL	ENSG00000101972		0.308	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	STAG2	HGNC	protein_coding	OTTHUMT00000156159.2	341	0.00	0	A	NM_006603		123211834	123211834	+1	no_errors	ENST00000218089	ensembl	human	known	69_37n	missense	262	34.17	136	SNP	1.000	G
TPTE	7179	genome.wustl.edu	37	21	10921971	10921971	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1B4-01A-11D-A12Q-09	TCGA-E2-A1B4-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6aa4529-7996-4b66-9632-2559293db35d	45514149-d01b-4bc9-864b-ed556da905c1	g.chr21:10921971G>A	ENST00000361285.4	-	18	1381	c.1052C>T	c.(1051-1053)gCc>gTc	p.A351V	TPTE_ENST00000415664.2_5'UTR|TPTE_ENST00000298232.7_Missense_Mutation_p.A333V|TPTE_ENST00000342420.5_Missense_Mutation_p.A313V	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	351	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		AATAAGGAAGGCACAAACCAT	0.338																																						dbGAP											0													140.0	119.0	127.0					21																	10921971		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.1052C>T	21.37:g.10921971G>A	ENSP00000355208:p.Ala351Val		B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_Dual-sp_phosphatase_cat-dom,pfam_Ion_trans_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,pfscan_Tyr/Dual-specificity_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.A351V	ENST00000361285.4	37	c.1052	CCDS13560.2	21	.	.	.	.	.	.	.	.	.	.	.	7.264	0.605745	0.14002	.	.	ENSG00000166157	ENST00000298232;ENST00000361285;ENST00000342420	D;D;D	0.99005	-5.32;-5.32;-5.32	2.26	-0.885	0.10593	Phosphatase tensin type (1);Dual specificity phosphatase, catalytic domain (1);	0.291598	0.36268	N	0.002682	D	0.98551	0.9516	M	0.86864	2.845	0.09310	N	0.999998	P;P;P	0.40578	0.48;0.48;0.722	B;B;P	0.51297	0.32;0.32;0.665	D	0.96995	0.9725	10	0.66056	D	0.02	-2.1423	4.9456	0.13987	0.5375:0.0:0.4625:0.0	.	313;333;351	P56180-3;P56180-2;P56180	.;.;TPTE_HUMAN	V	333;351;313	ENSP00000298232:A333V;ENSP00000355208:A351V;ENSP00000344441:A313V	ENSP00000298232:A333V	A	-	2	0	TPTE	9943842	0.794000	0.28838	0.495000	0.27527	0.026000	0.11368	0.014000	0.13333	-0.064000	0.13043	0.121000	0.15741	GCC	TPTE	-	pfam_Dual-sp_phosphatase_cat-dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Phosphatase_tensin-typ	ENSG00000166157		0.338	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPTE	HGNC	protein_coding	OTTHUMT00000157413.1	375	0.00	0	G			10921971	10921971	-1	no_errors	ENST00000361285	ensembl	human	known	69_37n	missense	338	15.97	65	SNP	0.221	A
USP34	9736	genome.wustl.edu	37	2	61492669	61492669	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A1B4-01A-11D-A12Q-09	TCGA-E2-A1B4-10A-01D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6aa4529-7996-4b66-9632-2559293db35d	45514149-d01b-4bc9-864b-ed556da905c1	g.chr2:61492669A>G	ENST00000398571.2	-	43	5717	c.5641T>C	c.(5641-5643)Tac>Cac	p.Y1881H		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	1881					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			TGAGGCCAGTAATCCCATTTA	0.403																																						dbGAP											0													124.0	115.0	118.0					2																	61492669		1881	4108	5989	-	-	-	SO:0001583	missense	0			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.5641T>C	2.37:g.61492669A>G	ENSP00000381577:p.Tyr1881His		A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	pfam_Peptidase_C19,superfamily_ARM-type_fold,pfscan_Peptidase_C19	p.Y1881H	ENST00000398571.2	37	c.5641	CCDS42686.1	2	.	.	.	.	.	.	.	.	.	.	A	21.5	4.158343	0.78114	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571;ENST00000453734	T;T	0.05786	3.51;3.39	5.28	5.28	0.74379	Armadillo-type fold (1);	0.062845	0.64402	D	0.000003	T	0.13072	0.0317	M	0.73217	2.22	0.51767	D	0.999935	P	0.35542	0.508	B	0.39617	0.305	T	0.01004	-1.1484	10	0.59425	D	0.04	.	15.2057	0.73177	1.0:0.0:0.0:0.0	.	1881	Q70CQ2	UBP34_HUMAN	H	1729;1729;1881;159	ENSP00000381577:Y1881H;ENSP00000410559:Y159H	ENSP00000263989:Y1729H	Y	-	1	0	USP34	61346173	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	9.339000	0.96797	2.002000	0.58637	0.533000	0.62120	TAC	USP34	-	superfamily_ARM-type_fold	ENSG00000115464		0.403	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP34	HGNC	protein_coding	OTTHUMT00000325650.4	190	0.00	0	A			61492669	61492669	-1	no_errors	ENST00000398571	ensembl	human	known	69_37n	missense	129	36.45	74	SNP	1.000	G
XYLT2	64132	genome.wustl.edu	37	17	48433561	48433561	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A1B4-01A-11D-A12Q-09	TCGA-E2-A1B4-10A-01D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6aa4529-7996-4b66-9632-2559293db35d	45514149-d01b-4bc9-864b-ed556da905c1	g.chr17:48433561T>C	ENST00000017003.2	+	7	1470	c.1421T>C	c.(1420-1422)aTt>aCt	p.I474T	XYLT2_ENST00000507602.1_Missense_Mutation_p.I474T	NM_022167.2	NP_071450.2	Q9H1B5	XYLT2_HUMAN	xylosyltransferase II	474					chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			endometrium(2)|kidney(2)|large_intestine(4)|pancreas(1)|prostate(2)|urinary_tract(1)	12	Breast(11;7.18e-19)					TACAAGCACATTGTGGACTGG	0.622																																						dbGAP											0													91.0	81.0	85.0					17																	48433561		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ277442	CCDS11563.1	17q21.33	2013-02-25			ENSG00000015532	ENSG00000015532	2.4.2.26		15517	protein-coding gene	gene with protein product	"""protein xylosyltransferase 2"""	608125				11099377	Standard	NM_022167		Approved	XT-II, PXYLT2	uc002iqo.3	Q9H1B5	OTTHUMG00000162057	ENST00000017003.2:c.1421T>C	17.37:g.48433561T>C	ENSP00000017003:p.Ile474Thr		Q6UY41|Q86V00	Missense_Mutation	SNP	pfam_XylT_met,pfam_Glyco_trans_14	p.I474T	ENST00000017003.2	37	c.1421	CCDS11563.1	17	.	.	.	.	.	.	.	.	.	.	T	20.2	3.953489	0.73902	.	.	ENSG00000015532	ENST00000017003;ENST00000507602	T;T	0.10573	3.36;2.86	4.75	4.75	0.60458	.	0.052013	0.64402	D	0.000001	T	0.37919	0.1021	M	0.86805	2.84	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.43114	-0.9411	10	0.87932	D	0	-22.7302	14.4255	0.67212	0.0:0.0:0.0:1.0	.	474	Q9H1B5	XYLT2_HUMAN	T	474	ENSP00000017003:I474T;ENSP00000426501:I474T	ENSP00000017003:I474T	I	+	2	0	XYLT2	45788560	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	7.868000	0.87116	2.006000	0.58801	0.460000	0.39030	ATT	XYLT2	-	pfam_Glyco_trans_14	ENSG00000015532		0.622	XYLT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XYLT2	HGNC	protein_coding	OTTHUMT00000367046.1	68	0.00	0	T	NM_022167		48433561	48433561	+1	no_errors	ENST00000017003	ensembl	human	known	69_37n	missense	27	41.30	19	SNP	1.000	C
ZNF718	255403	genome.wustl.edu	37	4	155283	155283	+	lincRNA	SNP	C	C	T			TCGA-E2-A1B4-01A-11D-A12Q-09	TCGA-E2-A1B4-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6aa4529-7996-4b66-9632-2559293db35d	45514149-d01b-4bc9-864b-ed556da905c1	g.chr4:155283C>T	ENST00000510175.1	+	0	718							Q3SXZ3	ZN718_HUMAN	zinc finger protein 718						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)						all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0681)|Epithelial(2;0.0838)|all cancers(2;0.135)|LUSC - Lung squamous cell carcinoma(95;0.18)		ATCCTCAACCCTTAATTTACA	0.353																																						dbGAP											0													40.0	46.0	44.0					4																	155283		2079	4234	6313	-	-	-			0			AK096662	CCDS75078.1, CCDS75079.1	4p16.3	2011-05-24			ENSG00000250312	ENSG00000250312		"""Zinc fingers, C2H2-type"""	26889	protein-coding gene	gene with protein product							Standard	XM_005278364		Approved	FLJ90036	uc003fzt.4	Q3SXZ3	OTTHUMG00000159873		4.37:g.155283C>T			Q3SXZ4|Q3SXZ5	RNA	SNP	-	NULL	ENST00000510175.1	37	NULL		4																																																																																			ZNF718	-	-	ENSG00000250312		0.353	ZNF718-002	KNOWN	basic	lincRNA	ZNF718	HGNC	lincRNA	OTTHUMT00000357865.3	132	0.00	0	C	NM_001039127		155283	155283	+1	no_errors	ENST00000400172	ensembl	human	known	69_37n	rna	100	37.50	60	SNP	0.038	T
