#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA7	10347	genome.wustl.edu	37	19	1045035	1045035	+	Nonsense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr19:1045035C>G	ENST00000263094.6	+	12	1481	c.1250C>G	c.(1249-1251)tCa>tGa	p.S417*	ABCA7_ENST00000435683.2_Nonsense_Mutation_p.S279*|ABCA7_ENST00000433129.1_Nonsense_Mutation_p.S417*	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	417					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCGGCACCCTCAGAGGCAGCC	0.662																																						dbGAP											0													44.0	47.0	46.0					19																	1045035		2203	4296	6499	-	-	-	SO:0001587	stop_gained	0			AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.1250C>G	19.37:g.1045035C>G	ENSP00000263094:p.Ser417*		Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Nonsense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_GroES-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.S417*	ENST00000263094.6	37	c.1250	CCDS12055.1	19	.	.	.	.	.	.	.	.	.	.	C	37	6.342936	0.97489	.	.	ENSG00000064687	ENST00000263094;ENST00000433129	.	.	.	4.76	4.76	0.60689	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	15.2425	0.73482	0.0:1.0:0.0:0.0	.	.	.	.	X	417	.	ENSP00000263094:S417X	S	+	2	0	ABCA7	996035	0.002000	0.14202	0.009000	0.14445	0.762000	0.43233	1.674000	0.37544	2.177000	0.69029	0.462000	0.41574	TCA	ABCA7	-	NULL	ENSG00000064687		0.662	ABCA7-001	KNOWN	basic|CCDS	protein_coding	ABCA7	HGNC	protein_coding	OTTHUMT00000394993.1	46	0.00	0	C	NM_019112		1045035	1045035	+1	no_errors	ENST00000263094	ensembl	human	known	69_37n	nonsense	8	55.56	10	SNP	0.003	G
ACOT1	641371	genome.wustl.edu	37	14	74004171	74004171	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr14:74004171G>A	ENST00000311148.4	+	1	354	c.46G>A	c.(46-48)Gac>Aac	p.D16N	HEATR4_ENST00000560393.1_Intron|ACOT1_ENST00000557556.1_Missense_Mutation_p.D16N|HEATR4_ENST00000553558.1_Intron|HEATR4_ENST00000334988.2_Intron	NM_001037161.1	NP_001032238.1	Q86TX2	ACOT1_HUMAN	acyl-CoA thioesterase 1	16					acyl-CoA metabolic process (GO:0006637)|long-chain fatty acid metabolic process (GO:0001676)|very long-chain fatty acid metabolic process (GO:0000038)	cytosol (GO:0005829)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|palmitoyl-CoA hydrolase activity (GO:0016290)			endometrium(1)|large_intestine(1)|lung(2)	4				OV - Ovarian serous cystadenocarcinoma(108;1.37e-45)|BRCA - Breast invasive adenocarcinoma(234;0.0033)		CTGCTGCTGGGACGAACCGGT	0.701																																						dbGAP											0													10.0	9.0	9.0					14																	74004171		1965	3364	5329	-	-	-	SO:0001583	missense	0			DQ082754	CCDS32117.1	14q24.3	2013-09-20			ENSG00000184227	ENSG00000184227		"""Acyl CoA thioesterases"""	33128	protein-coding gene	gene with protein product		614313				16103133, 16940157	Standard	NM_001037161		Approved	ACH2, CTE-1, LACH2		Q86TX2	OTTHUMG00000171607	ENST00000311148.4:c.46G>A	14.37:g.74004171G>A	ENSP00000311224:p.Asp16Asn		A1L173|Q3I5F9	Missense_Mutation	SNP	pfam_BAAT_C,pfam_Thio_Ohase/aa_AcTrfase,pfam_Dienelactn_hydro,pirsf_Acyl-CoA_thioEstase_long-chain	p.D16N	ENST00000311148.4	37	c.46	CCDS32117.1	14	.	.	.	.	.	.	.	.	.	.	-	16.84	3.234574	0.58886	.	.	ENSG00000184227	ENST00000311148;ENST00000557556	T;T	0.79454	-1.27;-1.27	3.65	3.65	0.41850	Acyl-CoA thioester hydrolase/bile acid-CoA amino acid N-acetyltransferase (1);	0.118962	0.56097	D	0.000040	D	0.87819	0.6273	M	0.84773	2.715	0.47949	D	0.999554	D;D	0.55605	0.972;0.972	D;D	0.65233	0.933;0.933	D	0.89561	0.3806	10	0.51188	T	0.08	-35.5755	15.5744	0.76365	0.0:0.0:1.0:0.0	.	16;16	E9KL42;Q86TX2	.;ACOT1_HUMAN	N	16	ENSP00000311224:D16N;ENSP00000451764:D16N	ENSP00000311224:D16N	D	+	1	0	ACOT1	73073924	1.000000	0.71417	1.000000	0.80357	0.060000	0.15804	5.934000	0.70138	1.875000	0.54330	0.184000	0.17185	GAC	ACOT1	-	pfam_Thio_Ohase/aa_AcTrfase,pirsf_Acyl-CoA_thioEstase_long-chain	ENSG00000184227		0.701	ACOT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACOT1	HGNC	protein_coding	OTTHUMT00000414432.1	50	0.00	0	G	NM_001037161		74004171	74004171	+1	no_errors	ENST00000311148	ensembl	human	known	69_37n	missense	19	24.00	6	SNP	1.000	A
ACSF2	80221	genome.wustl.edu	37	17	48538641	48538641	+	Silent	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr17:48538641C>T	ENST00000300441.4	+	3	467	c.363C>T	c.(361-363)ctC>ctT	p.L121L	ACSF2_ENST00000427954.2_Silent_p.L146L|ACSF2_ENST00000504392.1_Intron|ACSF2_ENST00000541920.1_Intron|ACSF2_ENST00000502667.1_Silent_p.L121L	NM_025149.4	NP_079425.3	Q96CM8	ACSF2_HUMAN	acyl-CoA synthetase family member 2	121					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ligase activity (GO:0016874)			endometrium(7)|kidney(3)|large_intestine(1)|lung(1)|stomach(1)	13	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			GCATTGGCCTCTGCAAAGGTG	0.607																																						dbGAP											0													53.0	47.0	49.0					17																	48538641		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK024573, BC012053	CCDS11567.1, CCDS74103.1, CCDS74104.1, CCDS74105.1	17q21.33	2007-10-17			ENSG00000167107	ENSG00000167107		"""Acyl-CoA synthetase family"""	26101	protein-coding gene	gene with protein product		610465				17762044	Standard	NM_001288968		Approved	FLJ20920, ACSMW	uc002iqu.2	Q96CM8	OTTHUMG00000162128	ENST00000300441.4:c.363C>T	17.37:g.48538641C>T			B4DFQ6|B4DHT5|B4DUF5|Q9H7G2	Silent	SNP	pfam_AMP-dep_Synth/Lig	p.L121	ENST00000300441.4	37	c.363	CCDS11567.1	17																																																																																			ACSF2	-	pfam_AMP-dep_Synth/Lig	ENSG00000167107		0.607	ACSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSF2	HGNC	protein_coding	OTTHUMT00000367423.3	66	0.00	0	C	NM_025149		48538641	48538641	+1	no_errors	ENST00000300441	ensembl	human	known	69_37n	silent	31	47.46	28	SNP	0.135	T
ADAMTS20	80070	genome.wustl.edu	37	12	43896138	43896138	+	Missense_Mutation	SNP	C	C	T	rs267603467		TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr12:43896138C>T	ENST00000389420.3	-	4	683	c.684G>A	c.(682-684)atG>atA	p.M228I	ADAMTS20_ENST00000553158.1_Missense_Mutation_p.M228I	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	228					extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.M228I(2)		breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		CTCTTTCTTTCATTACATTAA	0.318																																						dbGAP											2	Substitution - Missense(2)	skin(2)											154.0	164.0	161.0					12																	43896138		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.684G>A	12.37:g.43896138C>T	ENSP00000374071:p.Met228Ile		A6NNC9|J3QT00	Missense_Mutation	SNP	pfam_Pept_M12B_GON-ADAMTSs,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS,pfscan_Pept_M12B_GON-ADAMTSs,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B	p.M228I	ENST00000389420.3	37	c.684	CCDS31778.2	12	.	.	.	.	.	.	.	.	.	.	C	6.201	0.405325	0.11754	.	.	ENSG00000173157	ENST00000389420;ENST00000553158;ENST00000389417	T;T	0.60040	0.39;0.22	4.52	1.54	0.23209	.	0.855601	0.09880	N	0.743747	T	0.36386	0.0965	N	0.14661	0.345	0.09310	N	1	B	0.15719	0.014	B	0.08055	0.003	T	0.21381	-1.0247	10	0.37606	T	0.19	.	6.0294	0.19671	0.1403:0.6373:0.0:0.2224	.	228	P59510	ATS20_HUMAN	I	228	ENSP00000374071:M228I;ENSP00000448341:M228I	ENSP00000374068:M228I	M	-	3	0	ADAMTS20	42182405	0.001000	0.12720	0.001000	0.08648	0.021000	0.10359	0.050000	0.14120	0.536000	0.28733	0.655000	0.94253	ATG	ADAMTS20	-	NULL	ENSG00000173157		0.318	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS20	HGNC	protein_coding	OTTHUMT00000403643.1	143	0.00	0	C	NM_025003		43896138	43896138	-1	no_errors	ENST00000389420	ensembl	human	known	69_37n	missense	83	35.66	46	SNP	0.001	T
ADCY2	108	genome.wustl.edu	37	5	7709482	7709482	+	Silent	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr5:7709482C>T	ENST00000338316.4	+	10	1649	c.1560C>T	c.(1558-1560)aaC>aaT	p.N520N	ADCY2_ENST00000537121.1_Silent_p.N340N|RP11-711G10.1_ENST00000514105.2_RNA	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	520					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						CCACAGAGAACGGCAAGATCA	0.587																																						dbGAP											0													106.0	77.0	87.0					5																	7709482		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.1560C>T	5.37:g.7709482C>T			B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Silent	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.N520	ENST00000338316.4	37	c.1560	CCDS3872.2	5																																																																																			ADCY2	-	pfam_Adenylate_cyclase-like	ENSG00000078295		0.587	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY2	HGNC	protein_coding	OTTHUMT00000206930.2	65	0.00	0	C	NM_020546		7709482	7709482	+1	no_errors	ENST00000338316	ensembl	human	known	69_37n	silent	77	25.24	26	SNP	0.962	T
ETNPPL	64850	genome.wustl.edu	37	4	109669230	109669230	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr4:109669230C>G	ENST00000296486.3	-	9	1167	c.1013G>C	c.(1012-1014)aGa>aCa	p.R338T	ETNPPL_ENST00000510706.1_Missense_Mutation_p.R298T|ETNPPL_ENST00000411864.2_Missense_Mutation_p.R332T|ETNPPL_ENST00000512646.1_Missense_Mutation_p.R280T	NM_001146590.1|NM_031279.3	NP_001140062.1|NP_112569.2	Q8TBG4	AT2L1_HUMAN	ethanolamine-phosphate phospho-lyase	338						mitochondrion (GO:0005739)	ethanolamine-phosphate phospho-lyase activity (GO:0050459)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)										ATTCCCTACTCTCTTGGCATT	0.348																																						dbGAP											0													162.0	157.0	159.0					4																	109669230		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ298293	CCDS3682.1, CCDS54792.1, CCDS54793.1	4q25	2013-06-12	2013-06-12	2013-06-12	ENSG00000164089	ENSG00000164089	4.2.3.2		14404	protein-coding gene	gene with protein product		614682	"""alanine-glyoxylate aminotransferase 2-like 1"""	AGXT2L1		7592550, 22241472	Standard	NM_031279		Approved		uc003hzc.3	Q8TBG4	OTTHUMG00000161036	ENST00000296486.3:c.1013G>C	4.37:g.109669230C>G	ENSP00000296486:p.Arg338Thr		B7Z1Y0|E9PBY0|Q9H174	Missense_Mutation	SNP	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase_major_dom	p.R338T	ENST00000296486.3	37	c.1013	CCDS3682.1	4	.	.	.	.	.	.	.	.	.	.	C	1.418	-0.573675	0.03882	.	.	ENSG00000164089	ENST00000296486;ENST00000411864;ENST00000512646;ENST00000510706	D;D;D;D	0.86097	-2.07;-2.07;-2.07;-2.07	5.54	2.87	0.33458	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.325774	0.35378	N	0.003260	T	0.73953	0.3653	L	0.28014	0.82	0.25892	N	0.983465	B;B;B	0.17465	0.011;0.009;0.022	B;B;B	0.18263	0.021;0.012;0.021	T	0.58781	-0.7576	9	.	.	.	-15.0867	10.6737	0.45772	0.0:0.7925:0.0:0.2075	.	280;332;338	E9PBY0;Q8TBG4-2;Q8TBG4	.;.;AT2L1_HUMAN	T	338;332;280;298	ENSP00000296486:R338T;ENSP00000392269:R332T;ENSP00000427065:R280T;ENSP00000423240:R298T	.	R	-	2	0	AGXT2L1	109888679	0.012000	0.17670	0.846000	0.33378	0.062000	0.15995	2.087000	0.41653	0.832000	0.34804	-0.150000	0.13652	AGA	AGXT2L1	-	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase_major_dom	ENSG00000164089		0.348	ETNPPL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGXT2L1	HGNC	protein_coding	OTTHUMT00000363508.1	218	0.00	0	C	NM_031279		109669230	109669230	-1	no_errors	ENST00000296486	ensembl	human	known	69_37n	missense	141	15.57	26	SNP	0.329	G
AK9	221264	genome.wustl.edu	37	6	109814642	109814642	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr6:109814642C>G	ENST00000424296.2	-	41	5742	c.5666G>C	c.(5665-5667)aGa>aCa	p.R1889T	RP5-919F19.5_ENST00000423747.2_RNA	NM_001145128.2	NP_001138600.2	Q5TCS8	KAD9_HUMAN	adenylate kinase 9	1889					ADP phosphorylation (GO:0006757)|AMP phosphorylation (GO:0006756)|CDP phosphorylation (GO:0061508)|CMP phosphorylation (GO:0061566)|dADP phosphorylation (GO:0006174)|dAMP phosphorylation (GO:0061565)|dCDP phosphorylation (GO:0061570)|dCMP phosphorylation (GO:0061567)|dGDP phosphorylation (GO:0006186)|GDP phosphorylation (GO:0061568)|TDP phosphorylation (GO:0061571)|UDP phosphorylation (GO:0061569)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside phosphate kinase activity (GO:0050145)										GTCAATGGCTCTGAACTGAGG	0.378																																						dbGAP											0													206.0	203.0	204.0					6																	109814642		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK131244, BC146443, BC087860	CCDS5077.1, CCDS55048.1	6q21	2013-04-29	2013-04-29	2013-04-29			2.7.4.3		33814	protein-coding gene	gene with protein product		615358	"""chromosome 6 open reading frame 224"", ""adenylate kinase domain containing 2"", ""chromosome 6 open reading frame 199"", ""adenylate kinase domain containing 1"""	C6orf224, AKD2, C6orf199, AKD1		23416111	Standard	NM_145025		Approved	FLJ42177, FLJ25791, dJ70A9.1, MGC26954		Q5TCS8		ENST00000424296.2:c.5666G>C	6.37:g.109814642C>G	ENSP00000410186:p.Arg1889Thr		A6NL75|B2RDJ0|B6ZDM7|Q3MIS4|Q5I0W8|Q6ZNF1|Q6ZVR7|Q8N7C6|Q8WW00|Q96NF4	Missense_Mutation	SNP	pfam_Adenylate_kin,pfam_YHS,smart_AAA+_ATPase	p.R1889T	ENST00000424296.2	37	c.5666	CCDS55048.1	6	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	17.39|17.39|17.39	3.377825|3.377825|3.377825	0.61735|0.61735|0.61735	.|.|.	.|.|.	ENSG00000155085|ENSG00000155085|ENSG00000155085	ENST00000470564|ENST00000490722|ENST00000424296	.|.|T	.|.|0.70045	.|.|-0.45	5.58|5.58|5.58	5.58|5.58|5.58	0.84498|0.84498|0.84498	.|.|.	.|.|0.157801	.|.|0.52532	.|.|D	.|.|0.000065	T|T|T	0.78207|0.78207|0.78207	0.4247|0.4247|0.4247	M|M|M	0.71581|0.71581|0.71581	2.175|2.175|2.175	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|.|D;D	.|.|0.89917	.|.|0.999;1.0	.|.|D;D	.|.|0.74348	.|.|0.983;0.963	T|T|T	0.76553|0.76553|0.76553	-0.2917|-0.2917|-0.2917	5|5|9	.|.|.	.|.|.	.|.|.	.|.|.	19.5676|19.5676|19.5676	0.95401|0.95401|0.95401	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	.|.|274;1889	.|.|B7ZL24;Q5TCS8	.|.|.;AKD1_HUMAN	Q|H|T	727|289|1889	.|.|ENSP00000410186:R1889T	.|.|.	E|Q|R	-|-|-	1|3|2	0|2|0	AKD1|AKD1|AKD1	109921335|109921335|109921335	0.961000|0.961000|0.961000	0.32948|0.32948|0.32948	0.998000|0.998000|0.998000	0.56505|0.56505|0.56505	0.992000|0.992000|0.992000	0.81027|0.81027|0.81027	3.258000|3.258000|3.258000	0.51507|0.51507|0.51507	2.623000|2.623000|2.623000	0.88846|0.88846|0.88846	0.591000|0.591000|0.591000	0.81541|0.81541|0.81541	GAG|CAG|AGA	AKD1	-	NULL	ENSG00000155085		0.378	AK9-202	KNOWN	basic|appris_principal|CCDS	protein_coding	AKD1	HGNC	protein_coding		154	0.00	0	C	NM_001145128		109814642	109814642	-1	no_errors	ENST00000424296	ensembl	human	known	69_37n	missense	86	23.89	27	SNP	0.995	G
AMZ2P1	201283	genome.wustl.edu	37	17	62969020	62969020	+	RNA	SNP	G	G	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr17:62969020G>T	ENST00000430983.1	-	0	1315					NR_026903.1				archaelysin family metallopeptidase 2 pseudogene 1																		ATTCTTCACTGATAATTCTGG	0.358																																						dbGAP											0																																										-	-	-			0			AK056627		17q24.1	2012-10-16	2010-04-08		ENSG00000214174	ENSG00000214174			26491	pseudogene	pseudogene							Standard	NR_026903		Approved	FLJ32065	uc002jfb.3		OTTHUMG00000132075		17.37:g.62969020G>T				RNA	SNP	-	NULL	ENST00000430983.1	37	NULL		17																																																																																			AMZ2P1	-	-	ENSG00000214174		0.358	AMZ2P1-002	KNOWN	basic	processed_transcript	AMZ2P1	HGNC	pseudogene	OTTHUMT00000255102.1	48	0.00	0	G	NM_153032		62969020	62969020	-1	no_errors	ENST00000397713	ensembl	human	known	69_37n	rna	35	30.00	15	SNP	1.000	T
ANKRD28	23243	genome.wustl.edu	37	3	15727589	15727589	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr3:15727589C>T	ENST00000399451.2	-	20	2366	c.1999G>A	c.(1999-2001)Gac>Aac	p.D667N	ANKRD28_ENST00000383777.1_Missense_Mutation_p.D700N|ANKRD28_ENST00000497037.1_5'UTR	NM_001195098.1|NM_001195099.1|NM_015199.3	NP_001182027.1|NP_001182028.1|NP_056014.2	O15084	ANR28_HUMAN	ankyrin repeat domain 28	667						nucleus (GO:0005634)				breast(2)|endometrium(1)|large_intestine(2)|prostate(1)	6						TAAACACAGTCTGTGTGCCCG	0.448																																						dbGAP											0													115.0	104.0	107.0					3																	15727589		2013	4178	6191	-	-	-	SO:0001583	missense	0			AY367056	CCDS46769.1, CCDS74908.1	3p25.1	2013-01-10			ENSG00000206560	ENSG00000206560		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	29024	protein-coding gene	gene with protein product	"""phosphatase interactor targeting K protein"", ""protein phosphatase 6 ankyrin repeat subunit A"", ""protein phosphatase 1, regulatory subunit 65"""	611122				9205841	Standard	NM_015199		Approved	KIAA0379, PITK, PP6-ARS-A, PPP1R65	uc003caj.1	O15084	OTTHUMG00000155379	ENST00000399451.2:c.1999G>A	3.37:g.15727589C>T	ENSP00000382379:p.Asp667Asn		B4DES5|Q1WWL4|Q29RW6|Q3B857|Q6ULS0|Q6ZT57	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.D700N	ENST00000399451.2	37	c.2098	CCDS46769.1	3	.	.	.	.	.	.	.	.	.	.	C	24.7	4.562159	0.86335	.	.	ENSG00000206560	ENST00000399451;ENST00000383777;ENST00000412318	T;T;T	0.67171	-0.25;-0.25;-0.25	5.54	5.54	0.83059	Ankyrin repeat-containing domain (4);	0.044152	0.85682	D	0.000000	T	0.65417	0.2689	L	0.47190	1.495	0.80722	D	1	B;B;B	0.31859	0.343;0.232;0.047	B;B;B	0.36418	0.133;0.224;0.21	T	0.61628	-0.7024	10	0.32370	T	0.25	.	19.4692	0.94956	0.0:1.0:0.0:0.0	.	700;697;667	O15084-1;O15084-4;O15084	.;.;ANR28_HUMAN	N	667;700;667	ENSP00000382379:D667N;ENSP00000373287:D700N;ENSP00000397341:D667N	ENSP00000373287:D700N	D	-	1	0	ANKRD28	15702593	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	7.776000	0.85560	2.596000	0.87737	0.591000	0.81541	GAC	ANKRD28	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000206560		0.448	ANKRD28-003	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	ANKRD28	HGNC	protein_coding	OTTHUMT00000339758.1	167	0.00	0	C	NM_015199		15727589	15727589	-1	no_errors	ENST00000383777	ensembl	human	known	69_37n	missense	89	49.43	87	SNP	1.000	T
APC2	10297	genome.wustl.edu	37	19	1465771	1465771	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr19:1465771G>A	ENST00000535453.1	+	14	4184	c.2471G>A	c.(2470-2472)cGa>cAa	p.R824Q	C19orf25_ENST00000588427.1_Intron|APC2_ENST00000238483.4_Missense_Mutation_p.R550Q|APC2_ENST00000233607.2_Missense_Mutation_p.R824Q			P02655	APOC2_HUMAN	adenomatosis polyposis coli 2	0					cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|chylomicron remnant clearance (GO:0034382)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle clearance (GO:0034384)|lipid catabolic process (GO:0016042)|lipoprotein metabolic process (GO:0042157)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of lipid metabolic process (GO:0045833)|negative regulation of receptor-mediated endocytosis (GO:0048261)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipid catabolic process (GO:0060697)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)|very-low-density lipoprotein particle remodeling (GO:0034372)	chylomicron (GO:0042627)|early endosome (GO:0005769)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate-density lipoprotein particle (GO:0034363)|low-density lipoprotein particle (GO:0034362)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	lipase inhibitor activity (GO:0055102)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|kidney(4)|large_intestine(2)|lung(5)|pancreas(1)|skin(2)	18		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCACCCGCCGAGGCGGCAAG	0.741																																						dbGAP											0													9.0	10.0	9.0					19																	1465771		2146	4235	6381	-	-	-	SO:0001583	missense	0				CCDS12068.1	19p13.3	2013-02-14			ENSG00000115266	ENSG00000115266		"""Armadillo repeat containing"""	24036	protein-coding gene	gene with protein product	"""adenomatous polyposis coli like"""	612034				9823329, 10021369	Standard	XM_005259475		Approved	APCL	uc002lsr.1	O95996		ENST00000535453.1:c.2471G>A	19.37:g.1465771G>A	ENSP00000442954:p.Arg824Gln		C0JYY4|Q9BS39|Q9UDE3|Q9UNK3	Missense_Mutation	SNP	pfam_APC_basic_dom,pfam_APC_Cys-rich_rpt,pfam_Armadillo,pfam_SAMP,superfamily_ARM-type_fold,superfamily_Prefoldin,smart_Armadillo	p.R824Q	ENST00000535453.1	37	c.2471	CCDS12068.1	19	.	.	.	.	.	.	.	.	.	.	G	1.641	-0.516414	0.04200	.	.	ENSG00000115266	ENST00000233607;ENST00000238483;ENST00000535453	D;D;D	0.92495	-3.05;-2.7;-3.05	3.24	0.561	0.17285	.	1.146790	0.06395	N	0.717653	D	0.83367	0.5239	N	0.24115	0.695	0.32478	N	0.541894	B;B	0.17465	0.022;0.013	B;B	0.06405	0.002;0.001	T	0.72603	-0.4243	10	0.23302	T	0.38	-6.48	3.5245	0.07755	0.1847:0.0:0.5832:0.2321	.	823;824	O95996-3;O95996	.;APC2_HUMAN	Q	824;550;824	ENSP00000233607:R824Q;ENSP00000238483:R550Q;ENSP00000442954:R824Q	ENSP00000233607:R824Q	R	+	2	0	APC2	1416771	0.653000	0.27358	0.004000	0.12327	0.022000	0.10575	1.797000	0.38804	0.029000	0.15352	0.313000	0.20887	CGA	APC2	-	NULL	ENSG00000115266		0.741	APC2-004	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	APC2	HGNC	protein_coding	OTTHUMT00000449539.2	16	0.00	0	G	NM_005883		1465771	1465771	+1	no_errors	ENST00000233607	ensembl	human	known	69_37n	missense	5	44.44	4	SNP	0.024	A
APBA3	9546	genome.wustl.edu	37	19	3759707	3759707	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr19:3759707C>T	ENST00000316757.3	-	2	756	c.556G>A	c.(556-558)Gag>Aag	p.E186K	MRPL54_ENST00000330133.4_5'Flank	NM_004886.3	NP_004877.1	O96018	APBA3_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 3	186					in utero embryonic development (GO:0001701)|negative regulation of catalytic activity (GO:0043086)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	perinuclear region of cytoplasm (GO:0048471)	beta-amyloid binding (GO:0001540)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)			endometrium(1)|large_intestine(1)|skin(1)	3		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00467)|STAD - Stomach adenocarcinoma(1328;0.18)		GCGGGTGGCTCTTCAGGTGTG	0.652																																						dbGAP											0													26.0	31.0	29.0					19																	3759707		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB021638	CCDS12110.1	19p13.3	2008-07-18	2008-07-18			ENSG00000011132			580	protein-coding gene	gene with protein product	"""X11-like 2"""	604262				10049767	Standard	NM_004886		Approved	X11L2, mint3	uc002lyp.1	O96018		ENST00000316757.3:c.556G>A	19.37:g.3759707C>T	ENSP00000315136:p.Glu186Lys		O60483|Q9UPZ2	Missense_Mutation	SNP	pfam_PTyr_interaction_dom,pfam_PDZ,superfamily_PDZ,smart_PTyr_interaction_dom,smart_PDZ,pfscan_PDZ,pfscan_PTyr_interaction_dom	p.E186K	ENST00000316757.3	37	c.556	CCDS12110.1	19	.	.	.	.	.	.	.	.	.	.	C	9.320	1.057787	0.19907	.	.	ENSG00000011132	ENST00000316757	T	0.07216	3.21	4.69	3.66	0.41972	.	0.367513	0.22908	N	0.054176	T	0.05868	0.0153	N	0.20986	0.625	0.09310	N	1	B	0.17038	0.02	B	0.17979	0.02	T	0.31943	-0.9925	10	0.42905	T	0.14	.	7.233	0.26053	0.0:0.7957:0.0:0.2043	.	186	O96018	APBA3_HUMAN	K	186	ENSP00000315136:E186K	ENSP00000315136:E186K	E	-	1	0	APBA3	3710707	0.001000	0.12720	0.005000	0.12908	0.476000	0.33039	1.192000	0.32150	0.981000	0.38548	0.561000	0.74099	GAG	APBA3	-	NULL	ENSG00000011132		0.652	APBA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APBA3	HGNC	protein_coding	OTTHUMT00000453634.2	10	0.00	0	C			3759707	3759707	-1	no_errors	ENST00000316757	ensembl	human	known	69_37n	missense	10	41.18	7	SNP	0.059	T
APOL6	80830	genome.wustl.edu	37	22	36054859	36054859	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr22:36054859C>G	ENST00000409652.4	+	3	524	c.248C>G	c.(247-249)tCt>tGt	p.S83C		NM_030641.3	NP_085144.1	Q9BWW8	APOL6_HUMAN	apolipoprotein L, 6	83					lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)			haematopoietic_and_lymphoid_tissue(1)|lung(4)	5						GTGGCCACCTCTACTGCTGTC	0.527																																						dbGAP											0													108.0	100.0	103.0					22																	36054859		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY014879	CCDS13919.1	22q12.3	2013-01-24			ENSG00000221963	ENSG00000221963		"""Apolipoproteins"""	14870	protein-coding gene	gene with protein product		607256				11374903, 15671246	Standard	NM_030641		Approved	APOL-VI, APOLVI	uc003aoe.3	Q9BWW8	OTTHUMG00000150615	ENST00000409652.4:c.248C>G	22.37:g.36054859C>G	ENSP00000386280:p.Ser83Cys		Q5R3S1|Q658J1|Q8IXX6|Q9UGG1	Missense_Mutation	SNP	pfam_ApoL	p.S83C	ENST00000409652.4	37	c.248	CCDS13919.1	22	.	.	.	.	.	.	.	.	.	.	C	15.92	2.976346	0.53720	.	.	ENSG00000221963	ENST00000409652	T	0.11385	2.78	4.14	4.14	0.48551	.	0.000000	0.64402	D	0.000001	T	0.29684	0.0741	M	0.92555	3.32	0.22827	N	0.998685	P	0.47034	0.889	P	0.48454	0.578	T	0.34775	-0.9815	10	0.72032	D	0.01	-0.729	13.7704	0.63021	0.0:1.0:0.0:0.0	.	83	Q9BWW8	APOL6_HUMAN	C	83	ENSP00000386280:S83C	ENSP00000386280:S83C	S	+	2	0	APOL6	34384805	0.575000	0.26692	0.059000	0.19551	0.004000	0.04260	2.661000	0.46758	2.316000	0.78162	0.655000	0.94253	TCT	APOL6	-	pfam_ApoL	ENSG00000221963		0.527	APOL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOL6	HGNC	protein_coding	OTTHUMT00000319081.2	139	0.00	0	C	NM_030641		36054859	36054859	+1	no_errors	ENST00000409652	ensembl	human	known	69_37n	missense	63	13.70	10	SNP	0.365	G
ATP9A	10079	genome.wustl.edu	37	20	50286620	50286620	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr20:50286620G>C	ENST00000338821.5	-	13	1473	c.1209C>G	c.(1207-1209)ttC>ttG	p.F403L	ATP9A_ENST00000402822.1_Missense_Mutation_p.F282L|ATP9A_ENST00000311637.5_Missense_Mutation_p.F267L	NM_006045.1	NP_006036.1	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	403					phospholipid translocation (GO:0045332)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(10)|lung(18)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						GGAGCCGTTTGAAAATCATCT	0.448																																						dbGAP											0													127.0	116.0	120.0					20																	50286620		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014511	CCDS33489.1	20q13.2	2010-04-20	2007-09-19		ENSG00000054793	ENSG00000054793		"""ATPases / P-type"""	13540	protein-coding gene	gene with protein product		609126	"""ATPase, Class II, type 9A"""			9734811, 11015572	Standard	NM_006045		Approved	KIAA0611, ATPIIA	uc002xwg.1	O75110	OTTHUMG00000032751	ENST00000338821.5:c.1209C>G	20.37:g.50286620G>C	ENSP00000342481:p.Phe403Leu		E1P5Y3|E1P5Y4|Q5TFW5|Q5TFW6|Q5TFW9|Q6ZMF3|Q9NQK6|Q9NQK7	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.F403L	ENST00000338821.5	37	c.1209	CCDS33489.1	20	.	.	.	.	.	.	.	.	.	.	G	12.67	2.007344	0.35415	.	.	ENSG00000054793	ENST00000311637;ENST00000338821;ENST00000402822	T;T;T	0.71341	-0.56;-0.56;-0.56	5.07	3.08	0.35506	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	T	0.76969	0.4062	L	0.53671	1.685	0.80722	D	1	P;B	0.52577	0.954;0.041	D;B	0.63597	0.916;0.074	T	0.74682	-0.3583	10	0.33141	T	0.24	-35.885	12.0515	0.53509	0.1497:0.0:0.8503:0.0	.	282;403	O75110-2;O75110	.;ATP9A_HUMAN	L	267;403;282	ENSP00000309086:F267L;ENSP00000342481:F403L;ENSP00000385875:F282L	ENSP00000309086:F267L	F	-	3	2	ATP9A	49720027	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	4.222000	0.58580	1.258000	0.44101	0.561000	0.74099	TTC	ATP9A	-	pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	ENSG00000054793		0.448	ATP9A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP9A	HGNC	protein_coding	OTTHUMT00000106494.1	113	0.00	0	G	NM_006045		50286620	50286620	-1	no_errors	ENST00000338821	ensembl	human	known	69_37n	missense	192	15.35	35	SNP	1.000	C
ATR	545	genome.wustl.edu	37	3	142266743	142266743	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr3:142266743C>T	ENST00000350721.4	-	16	3302	c.3181G>A	c.(3181-3183)Gaa>Aaa	p.E1061K	ATR_ENST00000383101.3_Missense_Mutation_p.E997K	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	1061					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.E1061*(1)		NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						AGTTCAATTTCTGTTTCATTC	0.313								Other conserved DNA damage response genes																														dbGAP											1	Substitution - Nonsense(1)	large_intestine(1)											71.0	74.0	73.0					3																	142266743		2203	4300	6503	-	-	-	SO:0001583	missense	0			U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.3181G>A	3.37:g.142266743C>T	ENSP00000343741:p.Glu1061Lys		Q59HB2|Q7KYL3|Q93051|Q9BXK4	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PIK-rel_kinase_FAT,pfam_UME,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_UME,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_HEAT_type_2,pfscan_PI3/4_kinase_cat_dom	p.E1061K	ENST00000350721.4	37	c.3181	CCDS3124.1	3	.	.	.	.	.	.	.	.	.	.	C	18.10	3.548156	0.65311	.	.	ENSG00000175054	ENST00000350721;ENST00000383101	T;T	0.64618	-0.11;-0.11	5.89	5.89	0.94794	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.62368	0.2422	N	0.24115	0.695	0.80722	D	1	D	0.57899	0.981	P	0.55391	0.775	T	0.54132	-0.8339	10	0.12766	T	0.61	-23.3274	20.2566	0.98424	0.0:1.0:0.0:0.0	.	1061	Q13535	ATR_HUMAN	K	1061;997	ENSP00000343741:E1061K;ENSP00000372581:E997K	ENSP00000343741:E1061K	E	-	1	0	ATR	143749433	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.999000	0.70665	2.793000	0.96121	0.561000	0.74099	GAA	ATR	-	superfamily_ARM-type_fold	ENSG00000175054		0.313	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATR	HGNC	protein_coding	OTTHUMT00000353995.2	106	0.00	0	C	NM_001184		142266743	142266743	-1	no_errors	ENST00000350721	ensembl	human	known	69_37n	missense	88	16.04	17	SNP	1.000	T
BCAS4	55653	genome.wustl.edu	37	20	49493134	49493134	+	3'UTR	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr20:49493134C>T	ENST00000358791.5	+	0	798				BCAS4_ENST00000262591.5_Missense_Mutation_p.R156W|BCAS4_ENST00000371608.2_Missense_Mutation_p.R201W|BCAS4_ENST00000609336.1_3'UTR	NM_017843.3	NP_060313.3	Q8TDM0	BCAS4_HUMAN	breast carcinoma amplified sequence 4							cytoplasm (GO:0005737)		p.R201W(1)		large_intestine(2)|lung(2)|pancreas(1)|upper_aerodigestive_tract(1)	6						CACCTGCCCTCGGCCTTTGTG	0.547																																						dbGAP											1	Substitution - Missense(1)	ovary(1)											63.0	65.0	64.0					20																	49493134		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			AK000502	CCDS13432.2, CCDS33487.1	20q13	2008-07-03			ENSG00000124243	ENSG00000124243			14367	protein-coding gene	gene with protein product		607471				12378525	Standard	NM_001010974		Approved	FLJ20495, CNOL	uc002xvq.3	Q8TDM0	OTTHUMG00000032735	ENST00000358791.5:c.*62C>T	20.37:g.49493134C>T			Q5TD52|Q5TD53|Q5TD54|Q5U5K7|Q5XKE8|Q8IXI7|Q8NEZ6|Q8TDL9|Q9NX13|Q9Y511	Missense_Mutation	SNP	NULL	p.R201W	ENST00000358791.5	37	c.601	CCDS33487.1	20	.	.	.	.	.	.	.	.	.	.	C	12.44	1.939856	0.34189	.	.	ENSG00000124243	ENST00000262591;ENST00000371608	T;T	0.56103	0.48;0.56	3.19	-5.05	0.02955	.	.	.	.	.	T	0.29256	0.0728	N	0.22421	0.69	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.20940	-1.0260	9	0.72032	D	0.01	.	1.1729	0.01829	0.4422:0.2493:0.1316:0.1768	.	201	Q8TDM0-3	.	W	156;201	ENSP00000262591:R156W;ENSP00000360669:R201W	ENSP00000262591:R156W	R	+	1	2	BCAS4	48926541	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	-1.520000	0.02241	-1.140000	0.02877	0.491000	0.48974	CGG	BCAS4	-	NULL	ENSG00000124243		0.547	BCAS4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCAS4	HGNC	protein_coding	OTTHUMT00000079700.1	35	0.00	0	C	NM_017843		49493134	49493134	+1	no_errors	ENST00000371608	ensembl	human	known	69_37n	missense	57	12.31	8	SNP	0.000	T
BSDC1	55108	genome.wustl.edu	37	1	32843862	32843862	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr1:32843862G>A	ENST00000455895.2	-	7	584	c.551C>T	c.(550-552)tCa>tTa	p.S184L	BSDC1_ENST00000449308.1_Missense_Mutation_p.S184L|BSDC1_ENST00000419121.2_Missense_Mutation_p.S128L|BSDC1_ENST00000341071.7_Missense_Mutation_p.S201L|BSDC1_ENST00000413080.1_Intron|BSDC1_ENST00000526031.1_Missense_Mutation_p.S89L|BSDC1_ENST00000446293.2_Missense_Mutation_p.S201L	NM_001143888.1|NM_018045.6	NP_001137360.1|NP_060515.3	Q9NW68	BSDC1_HUMAN	BSD domain containing 1	184	BSD. {ECO:0000255|PROSITE- ProRule:PRU00036}.									breast(1)|central_nervous_system(2)|kidney(1)|lung(6)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	17		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				CCAGAATTCTGAATGGGAAAC	0.522																																						dbGAP											0													62.0	63.0	63.0					1																	32843862		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX641056	CCDS363.2, CCDS44101.1, CCDS44102.1, CCDS44103.1, CCDS72752.1	1p35.1	2008-02-05			ENSG00000160058	ENSG00000160058			25501	protein-coding gene	gene with protein product						12477932	Standard	XM_005270985		Approved	FLJ10276, RP4-811H24.7	uc010ohg.2	Q9NW68	OTTHUMG00000007588	ENST00000455895.2:c.551C>T	1.37:g.32843862G>A	ENSP00000412173:p.Ser184Leu		B4DMS7|B4DTI7|B4DTP7|B4E2X8|Q49AT8|Q68DY6|Q6IAA3|Q6MZK1|Q6UXS1|Q9HAL9	Missense_Mutation	SNP	pfam_BSD,smart_BSD,pfscan_BSD	p.S201L	ENST00000455895.2	37	c.602	CCDS363.2	1	.	.	.	.	.	.	.	.	.	.	G	17.33	3.361156	0.61403	.	.	ENSG00000160058	ENST00000455895;ENST00000341071;ENST00000526031;ENST00000419121;ENST00000446293;ENST00000449308;ENST00000527163;ENST00000530485	T;T;T;T;T;T;T;T	0.51574	0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7	5.85	5.85	0.93711	BSD (3);	0.117211	0.64402	D	0.000010	T	0.40932	0.1137	L	0.41027	1.25	0.53688	D	0.999979	B;B;B;B;B	0.14012	0.002;0.0;0.002;0.009;0.0	B;B;B;B;B	0.17433	0.005;0.004;0.018;0.012;0.007	T	0.11036	-1.0604	10	0.32370	T	0.25	-6.7497	14.7001	0.69150	0.0711:0.0:0.9289:0.0	.	89;128;201;201;184	Q9NW68-9;Q9NW68-8;Q9NW68-7;Q9NW68-3;Q9NW68	.;.;.;.;BSDC1_HUMAN	L	184;201;89;128;201;184;118;145	ENSP00000412173:S184L;ENSP00000344816:S201L;ENSP00000432382:S89L;ENSP00000405752:S128L;ENSP00000397759:S201L;ENSP00000391762:S184L;ENSP00000432524:S118L;ENSP00000435888:S145L	ENSP00000344816:S201L	S	-	2	0	BSDC1	32616449	1.000000	0.71417	0.985000	0.45067	0.994000	0.84299	5.762000	0.68809	2.941000	0.99782	0.655000	0.94253	TCA	BSDC1	-	pfam_BSD,smart_BSD,pfscan_BSD	ENSG00000160058		0.522	BSDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BSDC1	HGNC	protein_coding	OTTHUMT00000020056.3	76	0.00	0	G	NM_018045		32843862	32843862	-1	no_errors	ENST00000341071	ensembl	human	known	69_37n	missense	42	41.89	31	SNP	0.988	A
CDIP1	29965	genome.wustl.edu	37	16	4563801	4563801	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr16:4563801G>C	ENST00000399599.3	-	3	685	c.137C>G	c.(136-138)cCt>cGt	p.P46R	CDIP1_ENST00000563507.1_Missense_Mutation_p.P46R|CDIP1_ENST00000563332.2_Missense_Mutation_p.P46R|CDIP1_ENST00000567695.1_Missense_Mutation_p.P46R|CDIP1_ENST00000562334.1_Intron|CDIP1_ENST00000564828.1_Missense_Mutation_p.P11R			Q9H305	CDIP1_HUMAN	cell death-inducing p53 target 1	46	Pro-rich.				apoptotic process (GO:0006915)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	nucleus (GO:0005634)											AATGTCCGCAGGGGGCAGTGG	0.642																																						dbGAP											0													33.0	38.0	36.0					16																	4563801		2019	4167	6186	-	-	-	SO:0001583	missense	0			AF131218	CCDS42114.1, CCDS58419.1, CCDS58420.1	16p13.3	2012-11-14	2012-11-14	2012-11-14	ENSG00000089486	ENSG00000089486			13234	protein-coding gene	gene with protein product	"""cell death involved p53-target"", ""lipopolysaccharide-induced TNF factor-like"""	610503	"""chromosome 16 open reading frame 5"""	C16orf5		10570909, 17599062	Standard	NM_013399		Approved	CDIP, LITAFL	uc002cww.3	Q9H305	OTTHUMG00000177172	ENST00000399599.3:c.137C>G	16.37:g.4563801G>C	ENSP00000382508:p.Pro46Arg		A8K7M1|B4DFU1|B4DY75|D3DUD6|Q96ID8|Q9H0Q4|Q9P112	Missense_Mutation	SNP	pfam_LITAF,smart_LITAF	p.P46R	ENST00000399599.3	37	c.137	CCDS42114.1	16	.	.	.	.	.	.	.	.	.	.	G	26.0	4.699347	0.88830	.	.	ENSG00000089486	ENST00000399599	D	0.88586	-2.4	5.48	5.48	0.80851	.	0.051086	0.85682	D	0.000000	D	0.91005	0.7171	L	0.32530	0.975	0.80722	D	1	D;D	0.76494	0.969;0.999	B;D	0.80764	0.326;0.994	D	0.89660	0.3876	10	0.32370	T	0.25	-2.5624	16.8426	0.85973	0.0:0.0:1.0:0.0	.	46;46	B4DFU1;Q9H305	.;LITFL_HUMAN	R	46	ENSP00000382508:P46R	ENSP00000382508:P46R	P	-	2	0	C16orf5	4503802	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	3.601000	0.54059	2.569000	0.86673	0.655000	0.94253	CCT	C16orf5	-	NULL	ENSG00000089486		0.642	CDIP1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C16orf5	HGNC	protein_coding	OTTHUMT00000435718.2	39	0.00	0	G	NM_013399		4563801	4563801	-1	no_errors	ENST00000399599	ensembl	human	known	69_37n	missense	24	40.00	16	SNP	1.000	C
C1orf127	148345	genome.wustl.edu	37	1	11008331	11008331	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr1:11008331C>G	ENST00000377008.4	-	11	1806	c.1360G>C	c.(1360-1362)Gag>Cag	p.E454Q	C1orf127_ENST00000377004.4_Missense_Mutation_p.E621Q			Q8N9H9	CA127_HUMAN	chromosome 1 open reading frame 127	454										NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(5)	32	Ovarian(185;0.249)	Lung NSC(185;0.000226)|all_lung(284;0.000302)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.71e-07)|COAD - Colon adenocarcinoma(227;7.79e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000305)|Kidney(185;0.000785)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|READ - Rectum adenocarcinoma(331;0.0509)		CTCTCCACCTCCGTTCCAGAG	0.652																																						dbGAP											0													58.0	67.0	64.0					1																	11008331		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK094437	CCDS53267.1	1p36.22	2008-02-05			ENSG00000175262	ENSG00000175262			26730	protein-coding gene	gene with protein product						14702039	Standard	NM_001170754		Approved	FLJ37118	uc010oao.2	Q8N9H9	OTTHUMG00000002032	ENST00000377008.4:c.1360G>C	1.37:g.11008331C>G	ENSP00000366207:p.Glu454Gln		A0AVG8|A6NKM7|Q5VXJ2	Missense_Mutation	SNP	superfamily_DNA-bd_dom_put	p.E621Q	ENST00000377008.4	37	c.1861		1	.	.	.	.	.	.	.	.	.	.	C	15.06	2.720415	0.48728	.	.	ENSG00000175262	ENST00000377004;ENST00000377008	T;T	0.34072	1.38;1.38	3.89	2.96	0.34315	.	0.701650	0.12114	N	0.498264	T	0.33265	0.0857	N	0.19112	0.55	0.09310	N	1	D;D;D	0.65815	0.995;0.995;0.995	P;P;P	0.61003	0.882;0.882;0.882	T	0.13202	-1.0518	10	0.13108	T	0.6	-3.0012	6.4552	0.21926	0.0:0.8701:0.0:0.1299	.	472;446;454	B7ZLG7;Q8N9H9-2;Q8N9H9	.;.;CA127_HUMAN	Q	621;454	ENSP00000366203:E621Q;ENSP00000366207:E454Q	ENSP00000366203:E621Q	E	-	1	0	C1orf127	10930918	0.002000	0.14202	0.003000	0.11579	0.043000	0.13939	0.848000	0.27710	2.119000	0.64992	0.491000	0.48974	GAG	C1orf127	-	NULL	ENSG00000175262		0.652	C1orf127-202	KNOWN	basic	protein_coding	C1orf127	HGNC	protein_coding		34	0.00	0	C	NM_173507		11008331	11008331	-1	no_errors	ENST00000377004	ensembl	human	known	69_37n	missense	16	38.46	10	SNP	0.002	G
C1orf127	148345	genome.wustl.edu	37	1	11008427	11008427	+	Missense_Mutation	SNP	G	G	T	rs143447356		TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr1:11008427G>T	ENST00000377008.4	-	11	1710	c.1264C>A	c.(1264-1266)Cag>Aag	p.Q422K	C1orf127_ENST00000377004.4_Missense_Mutation_p.Q589K			Q8N9H9	CA127_HUMAN	chromosome 1 open reading frame 127	422										NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(5)	32	Ovarian(185;0.249)	Lung NSC(185;0.000226)|all_lung(284;0.000302)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.71e-07)|COAD - Colon adenocarcinoma(227;7.79e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000305)|Kidney(185;0.000785)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|READ - Rectum adenocarcinoma(331;0.0509)		GCCAATGGCTGGAACTCCTCA	0.647																																						dbGAP											0													26.0	32.0	30.0					1																	11008427		2199	4290	6489	-	-	-	SO:0001583	missense	0			AK094437	CCDS53267.1	1p36.22	2008-02-05			ENSG00000175262	ENSG00000175262			26730	protein-coding gene	gene with protein product						14702039	Standard	NM_001170754		Approved	FLJ37118	uc010oao.2	Q8N9H9	OTTHUMG00000002032	ENST00000377008.4:c.1264C>A	1.37:g.11008427G>T	ENSP00000366207:p.Gln422Lys		A0AVG8|A6NKM7|Q5VXJ2	Missense_Mutation	SNP	superfamily_DNA-bd_dom_put	p.Q589K	ENST00000377008.4	37	c.1765		1	.	.	.	.	.	.	.	.	.	.	G	13.61	2.289594	0.40494	.	.	ENSG00000175262	ENST00000377004;ENST00000377008	T;T	0.28895	1.59;1.59	4.96	2.03	0.26663	.	1.402300	0.04720	N	0.419174	T	0.19846	0.0477	N	0.19112	0.55	0.09310	N	1	P;P;P	0.42584	0.784;0.642;0.784	B;B;B	0.40009	0.316;0.199;0.316	T	0.15350	-1.0440	10	0.18276	T	0.48	-0.4121	5.2807	0.15674	0.1854:0.1679:0.6466:0.0	.	440;414;422	B7ZLG7;Q8N9H9-2;Q8N9H9	.;.;CA127_HUMAN	K	589;422	ENSP00000366203:Q589K;ENSP00000366207:Q422K	ENSP00000366203:Q589K	Q	-	1	0	C1orf127	10931014	0.001000	0.12720	0.001000	0.08648	0.002000	0.02628	0.141000	0.16076	0.220000	0.20860	-0.339000	0.08088	CAG	C1orf127	-	NULL	ENSG00000175262		0.647	C1orf127-202	KNOWN	basic	protein_coding	C1orf127	HGNC	protein_coding		29	0.00	0	G	NM_173507		11008427	11008427	-1	no_errors	ENST00000377004	ensembl	human	known	69_37n	missense	11	47.62	10	SNP	0.005	T
C3orf30	152405	genome.wustl.edu	37	3	118865557	118865557	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr3:118865557G>T	ENST00000295622.1	+	1	561	c.521G>T	c.(520-522)gGt>gTt	p.G174V	RP11-484M3.5_ENST00000490594.1_5'Flank|IGSF11_ENST00000354673.2_5'Flank|IGSF11_ENST00000441144.2_5'Flank|IGSF11_ENST00000425327.2_5'Flank	NM_152539.2	NP_689752.2	Q96M34	CC030_HUMAN	chromosome 3 open reading frame 30	174										NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(20)|ovary(2)|prostate(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(114;0.222)		GACCAGAGAGGTTCCAGACAG	0.527																																						dbGAP											0													68.0	71.0	70.0					3																	118865557		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK057421	CCDS2984.1	3q13.32	2011-08-09			ENSG00000163424	ENSG00000163424			26553	protein-coding gene	gene with protein product							Standard	NM_152539		Approved	FLJ32859	uc003ecb.1	Q96M34	OTTHUMG00000159349	ENST00000295622.1:c.521G>T	3.37:g.118865557G>T	ENSP00000295622:p.Gly174Val		A1L4B7	Missense_Mutation	SNP	superfamily_cAMP_dep_PK_reg_su_I/II_a/b	p.G174V	ENST00000295622.1	37	c.521	CCDS2984.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	3.134|3.134	-0.177777|-0.177777	0.06380|0.06380	.|.	.|.	ENSG00000163424|ENSG00000163424	ENST00000295622;ENST00000470341|ENST00000460150	T|T	0.24538|0.26660	1.85|1.72	1.16|1.16	-1.41|-1.41	0.08941|0.08941	.|.	4.716990|.	0.00447|.	N|.	0.000082|.	T|T	0.17492|0.17492	0.0420|0.0420	L|L	0.36672|0.36672	1.1|1.1	0.09310|0.09310	N|N	1|1	B;B|.	0.23591|.	0.04;0.088|.	B;B|.	0.22601|.	0.005;0.04|.	T|T	0.31503|0.31503	-0.9941|-0.9941	10|7	0.27785|0.25751	T|T	0.31|0.34	.|.	4.1671|4.1671	0.10312|0.10312	0.2175:0.373:0.4095:0.0|0.2175:0.373:0.4095:0.0	.|.	174;174|.	E9PFE5;Q96M34|.	.;CC030_HUMAN|.	V|S	174|137	ENSP00000295622:G174V|ENSP00000418207:R137S	ENSP00000295622:G174V|ENSP00000418207:R137S	G|R	+|+	2|3	0|2	C3orf30|C3orf30	120348247|120348247	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.005000|0.005000	0.04900|0.04900	-0.043000|-0.043000	0.12043|0.12043	-0.494000|-0.494000	0.06669|0.06669	-0.688000|-0.688000	0.03733|0.03733	GGT|AGG	C3orf30	-	NULL	ENSG00000163424		0.527	C3orf30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf30	HGNC	protein_coding	OTTHUMT00000354838.1	39	0.00	0	G	NM_152539		118865557	118865557	+1	no_errors	ENST00000295622	ensembl	human	known	69_37n	missense	24	25.00	8	SNP	0.000	T
C9orf50	375759	genome.wustl.edu	37	9	132382053	132382053	+	Silent	SNP	G	G	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr9:132382053G>T	ENST00000372478.4	-	2	766	c.565C>A	c.(565-567)Cgg>Agg	p.R189R	NTMT1_ENST00000372486.1_Intron	NM_199350.3	NP_955382.3	Q5SZB4	CI050_HUMAN	chromosome 9 open reading frame 50	189								p.R189W(1)		central_nervous_system(1)|endometrium(4)|large_intestine(2)|ovary(1)|skin(1)|urinary_tract(1)	10		Ovarian(14;0.00556)				TTGGGACACCGCGGAGACCCT	0.607																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											181.0	172.0	175.0					9																	132382053		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK093122	CCDS35159.1	9q34.2	2012-03-15			ENSG00000179058	ENSG00000179058			23677	protein-coding gene	gene with protein product							Standard	NM_199350		Approved	FLJ35803	uc004byc.4	Q5SZB4	OTTHUMG00000020786	ENST00000372478.4:c.565C>A	9.37:g.132382053G>T			Q2M1I2|Q8NA65	Silent	SNP	NULL	p.R189	ENST00000372478.4	37	c.565	CCDS35159.1	9																																																																																			C9orf50	-	NULL	ENSG00000179058		0.607	C9orf50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf50	HGNC	protein_coding	OTTHUMT00000054593.1	164	0.00	0	G	NM_199350		132382053	132382053	-1	no_errors	ENST00000372478	ensembl	human	known	69_37n	silent	93	36.30	53	SNP	0.003	T
STKLD1	169436	genome.wustl.edu	37	9	136270506	136270506	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr9:136270506C>A	ENST00000371957.3	+	18	2111	c.2004C>A	c.(2002-2004)agC>agA	p.S668R	C9orf96_ENST00000371955.1_Missense_Mutation_p.S201R	NM_153710.3	NP_714921.4	Q8NE28	STKL1_HUMAN		668							ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|stomach(2)	25				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		CAGGTGGAAGCCCCCAGCTGG	0.572																																						dbGAP											0													37.0	36.0	37.0					9																	136270506		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000371957.3:c.2004C>A	9.37:g.136270506C>A	ENSP00000361025:p.Ser668Arg		Q5T8U8|Q6ZMP6|Q6ZMQ5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S668R	ENST00000371957.3	37	c.2004	CCDS35169.1	9	.	.	.	.	.	.	.	.	.	.	C	9.890	1.203894	0.22121	.	.	ENSG00000198870	ENST00000371957;ENST00000371955	T;T	0.72835	-0.69;0.52	2.74	-0.963	0.10330	.	6.548850	0.00766	N	0.001160	T	0.44519	0.1297	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.26326	-1.0106	10	0.12103	T	0.63	3.1799	1.0251	0.01526	0.1987:0.38:0.2591:0.1623	.	668	Q8NE28	SGK71_HUMAN	R	668;201	ENSP00000361025:S668R;ENSP00000361023:S201R	ENSP00000361023:S201R	S	+	3	2	C9orf96	135260327	0.003000	0.15002	0.000000	0.03702	0.085000	0.17905	0.607000	0.24209	0.010000	0.14839	0.462000	0.41574	AGC	C9orf96	-	NULL	ENSG00000198870		0.572	C9orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf96	HGNC	protein_coding	OTTHUMT00000054855.1	35	0.00	0	C			136270506	136270506	+1	no_errors	ENST00000371957	ensembl	human	known	69_37n	missense	14	39.13	9	SNP	0.000	A
CACNA1D	776	genome.wustl.edu	37	3	53531432	53531432	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr3:53531432C>G	ENST00000350061.5	+	2	832	c.321C>G	c.(319-321)ttC>ttG	p.F107L	CACNA1D_ENST00000288139.4_Missense_Mutation_p.F107L|CACNA1D_ENST00000422281.2_Missense_Mutation_p.F107L	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	107					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GCGCCCTTTTCTGTTTATCAC	0.468																																						dbGAP											0													100.0	115.0	110.0					3																	53531432		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.321C>G	3.37:g.53531432C>G	ENSP00000288133:p.Phe107Leu		B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su,prints_LVDCC_a1dsu	p.F107L	ENST00000350061.5	37	c.321	CCDS46848.1	3	.	.	.	.	.	.	.	.	.	.	C	17.15	3.314972	0.60524	.	.	ENSG00000157388	ENST00000350061;ENST00000288139;ENST00000422281	T;T;T	0.67171	-0.25;-0.25;-0.25	5.69	5.69	0.88448	.	0.000000	0.64402	D	0.000003	T	0.72162	0.3426	L	0.39566	1.225	0.80722	D	1	D;B;D	0.64830	0.99;0.134;0.994	D;B;D	0.68765	0.913;0.034;0.96	T	0.65705	-0.6103	10	0.18276	T	0.48	.	14.0314	0.64617	0.0:0.9279:0.0:0.0721	.	107;107;107	B0FYA3;Q01668;Q01668-2	.;CAC1D_HUMAN;.	L	107	ENSP00000288133:F107L;ENSP00000288139:F107L;ENSP00000409174:F107L	ENSP00000288139:F107L	F	+	3	2	CACNA1D	53506472	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.094000	0.57721	2.689000	0.91719	0.561000	0.74099	TTC	CACNA1D	-	NULL	ENSG00000157388		0.468	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1D	HGNC	protein_coding	OTTHUMT00000350557.1	123	0.00	0	C	NM_000720		53531432	53531432	+1	no_errors	ENST00000288139	ensembl	human	known	69_37n	missense	51	57.14	68	SNP	1.000	G
CACNA1H	8912	genome.wustl.edu	37	16	1256238	1256238	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr16:1256238A>G	ENST00000348261.5	+	12	2986	c.2738A>G	c.(2737-2739)gAc>gGc	p.D913G	CACNA1H_ENST00000565831.1_Missense_Mutation_p.D913G|RP11-616M22.3_ENST00000564700.1_RNA|CACNA1H_ENST00000358590.4_Missense_Mutation_p.D913G	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	913					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	AAGACCATGGACAACGTGGCT	0.637																																						dbGAP											0													31.0	37.0	35.0					16																	1256238		2136	4225	6361	-	-	-	SO:0001583	missense	0			AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.2738A>G	16.37:g.1256238A>G	ENSP00000334198:p.Asp913Gly		B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_PKD_2	p.D913G	ENST00000348261.5	37	c.2738	CCDS45375.1	16	.	.	.	.	.	.	.	.	.	.	A	25.6	4.653278	0.88056	.	.	ENSG00000196557	ENST00000348261;ENST00000358590	D;D	0.97404	-4.37;-4.37	3.96	3.96	0.45880	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.96466	0.8847	N	0.25031	0.7	0.47407	D	0.999413	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.96766	0.9565	10	0.72032	D	0.01	.	12.1802	0.54208	1.0:0.0:0.0:0.0	.	913;913	O95180-2;O95180	.;CAC1H_HUMAN	G	913	ENSP00000334198:D913G;ENSP00000351401:D913G	ENSP00000334198:D913G	D	+	2	0	CACNA1H	1196239	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	8.666000	0.91149	1.667000	0.50832	0.459000	0.35465	GAC	CACNA1H	-	pfam_Ion_trans_dom	ENSG00000196557		0.637	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	CACNA1H	HGNC	protein_coding	OTTHUMT00000421601.1	71	0.00	0	A	NM_001005407		1256238	1256238	+1	no_errors	ENST00000348261	ensembl	human	known	69_37n	missense	73	15.12	13	SNP	1.000	G
CALHM2	51063	genome.wustl.edu	37	10	105207136	105207136	+	Frame_Shift_Del	DEL	G	G	-			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr10:105207136delG	ENST00000260743.5	-	4	1268	c.745delC	c.(745-747)cgcfs	p.R249fs	RP11-225H22.7_ENST00000608063.1_RNA|CALHM2_ENST00000494180.1_5'Flank|CALHM2_ENST00000369788.3_Frame_Shift_Del_p.R249fs	NM_015916.4	NP_057000.2	Q9HA72	CAHM2_HUMAN	calcium homeostasis modulator 2	249					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(5)|skin(1)	11						CCAAAGAAGCGGCGCACATTG	0.612																																						dbGAP											0													82.0	73.0	76.0					10																	105207136		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			BC000039	CCDS7549.1	10q24.33	2008-07-02	2008-07-02	2008-07-02	ENSG00000138172	ENSG00000138172			23493	protein-coding gene	gene with protein product		612235	"""family with sequence similarity 26, member B"""	FAM26B		18585350	Standard	NM_015916		Approved		uc001kxa.3	Q9HA72	OTTHUMG00000018990	ENST00000260743.5:c.745delC	10.37:g.105207136delG	ENSP00000260743:p.Arg249fs		D3DR94|O95893|Q6ZUV9	Frame_Shift_Del	DEL	NULL	p.R249fs	ENST00000260743.5	37	c.745	CCDS7549.1	10																																																																																			CALHM2	-	NULL	ENSG00000138172		0.612	CALHM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CALHM2	HGNC	protein_coding	OTTHUMT00000050159.1	64	0.00	0	G	NM_015916		105207136	105207136	-1	no_errors	ENST00000260743	ensembl	human	known	69_37n	frame_shift_del	20	45.95	17	DEL	0.999	-
CCDC155	147872	genome.wustl.edu	37	19	49902741	49902741	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr19:49902741G>C	ENST00000447857.3	+	9	980	c.775G>C	c.(775-777)Gag>Cag	p.E259Q		NM_144688.4	NP_653289.3	Q8N6L0	KASH5_HUMAN	coiled-coil domain containing 155	259						chromosome, telomeric region (GO:0000781)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(10)|ovary(1)|stomach(1)	22						TCTGGTGGCTGAGATGGAGAC	0.597																																						dbGAP											0													63.0	72.0	69.0					19																	49902741		2137	4255	6392	-	-	-	SO:0001583	missense	0				CCDS46140.1	19q13.33	2014-01-21			ENSG00000161609	ENSG00000161609			26520	protein-coding gene	gene with protein product							Standard	NM_144688		Approved	FLJ32658, KASH5	uc002pnm.2	Q8N6L0	OTTHUMG00000183170	ENST00000447857.3:c.775G>C	19.37:g.49902741G>C	ENSP00000404220:p.Glu259Gln		Q96MC3	Missense_Mutation	SNP	NULL	p.E259Q	ENST00000447857.3	37	c.775	CCDS46140.1	19	.	.	.	.	.	.	.	.	.	.	G	15.73	2.918735	0.52546	.	.	ENSG00000161609	ENST00000447857	T	0.37584	1.19	5.37	3.15	0.36227	.	0.149823	0.43919	D	0.000501	T	0.52306	0.1726	M	0.76574	2.34	0.27044	N	0.963946	D;D;D	0.76494	0.974;0.974;0.999	P;P;D	0.69479	0.758;0.758;0.964	T	0.39542	-0.9609	10	0.30078	T	0.28	-12.222	8.4378	0.32797	0.1913:0.0:0.8087:0.0	.	259;259;339	C9JGW3;Q8N6L0;Q6ZRK4	.;CC155_HUMAN;.	Q	259	ENSP00000404220:E259Q	ENSP00000404220:E259Q	E	+	1	0	CCDC155	54594553	0.359000	0.24955	0.894000	0.35097	0.980000	0.70556	0.414000	0.21164	1.364000	0.46038	0.555000	0.69702	GAG	CCDC155	-	NULL	ENSG00000161609		0.597	CCDC155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC155	HGNC	protein_coding	OTTHUMT00000465436.2	145	0.00	0	G	NM_144688		49902741	49902741	+1	no_errors	ENST00000447857	ensembl	human	known	69_37n	missense	98	27.74	38	SNP	0.853	C
CD58	965	genome.wustl.edu	37	1	117078619	117078619	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr1:117078619G>A	ENST00000369489.5	-	3	662	c.596C>T	c.(595-597)tCa>tTa	p.S199L	CD58_ENST00000369487.3_Missense_Mutation_p.S199L|CD58_ENST00000457047.2_Missense_Mutation_p.S199L	NM_001779.2	NP_001770.1	P19256	LFA3_HUMAN	CD58 molecule	199					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular response to interferon-gamma (GO:0071346)|cellular response to tumor necrosis factor (GO:0071356)|heterotypic cell-cell adhesion (GO:0034113)|leukocyte migration (GO:0050900)|positive regulation of interleukin-8 secretion (GO:2000484)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(3)|urinary_tract(1)	9	Lung SC(450;0.225)	all_cancers(81;0.000363)|all_lung(203;0.000118)|all_epithelial(167;0.000149)|Lung NSC(69;0.000577)		Lung(183;0.0086)|LUSC - Lung squamous cell carcinoma(189;0.0528)|Colorectal(144;0.0775)|all cancers(265;0.109)|Epithelial(280;0.118)|COAD - Colon adenocarcinoma(174;0.121)		CAAAATGATTGATGATGTTGT	0.353																																						dbGAP											0													140.0	136.0	138.0					1																	117078619		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC005930	CCDS888.1, CCDS44199.1	1p13	2008-02-05	2006-03-28		ENSG00000116815	ENSG00000116815		"""CD molecules"""	1688	protein-coding gene	gene with protein product		153420	"""CD58 antigen, (lymphocyte function-associated antigen 3)"""	LFA3		9510189	Standard	NM_001144822		Approved		uc001egm.3	P19256	OTTHUMG00000022749	ENST00000369489.5:c.596C>T	1.37:g.117078619G>A	ENSP00000358501:p.Ser199Leu		A8K7G5|Q5U053|Q6IB65|Q96KI9	Missense_Mutation	SNP	NULL	p.S199L	ENST00000369489.5	37	c.596	CCDS888.1	1	.	.	.	.	.	.	.	.	.	.	G	9.182	1.023861	0.19433	.	.	ENSG00000116815	ENST00000369489;ENST00000457047;ENST00000369487	T;T;T	0.49720	0.77;0.77;0.77	3.59	1.62	0.23740	.	1.265650	0.05833	N	0.617909	T	0.43233	0.1238	L	0.54323	1.7	0.09310	N	1	B;D;B	0.71674	0.062;0.998;0.062	B;D;B	0.64321	0.043;0.924;0.043	T	0.16424	-1.0403	10	0.49607	T	0.09	-5.5002	6.2809	0.21007	0.0:0.2067:0.5798:0.2135	.	199;199;199	P19256-3;B1AMW1;P19256	.;.;LFA3_HUMAN	L	199	ENSP00000358501:S199L;ENSP00000409080:S199L;ENSP00000358499:S199L	ENSP00000358499:S199L	S	-	2	0	CD58	116880142	0.001000	0.12720	0.001000	0.08648	0.001000	0.01503	0.177000	0.16801	0.460000	0.27045	-0.182000	0.12963	TCA	CD58	-	NULL	ENSG00000116815		0.353	CD58-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD58	HGNC	protein_coding	OTTHUMT00000059036.1	172	0.00	0	G	NM_001779		117078619	117078619	-1	no_errors	ENST00000369489	ensembl	human	known	69_37n	missense	71	29.70	30	SNP	0.001	A
CEACAM16	388551	genome.wustl.edu	37	19	45209092	45209092	+	Silent	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr19:45209092C>T	ENST00000405314.2	+	4	991	c.894C>T	c.(892-894)acC>acT	p.T298T	CEACAM16_ENST00000587331.1_Silent_p.T298T|CTB-171A8.1_ENST00000590796.1_RNA			Q2WEN9	CEA16_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 16	298	Ig-like C2-type 2.				sensory perception of sound (GO:0007605)	extracellular region (GO:0005576)|stereocilium bundle tip (GO:0032426)				endometrium(3)|large_intestine(2)|lung(3)|ovary(1)	9	Lung NSC(12;0.000698)|all_lung(12;0.002)	Prostate(69;0.0376)|Ovarian(192;0.231)				CGAAGAACACCAAGACCCTGC	0.597																																						dbGAP											0													151.0	164.0	160.0					19																	45209092		2125	4235	6360	-	-	-	SO:0001819	synonymous_variant	0				CCDS54278.1	19q13.31	2014-01-27			ENSG00000213892	ENSG00000213892		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31948	protein-coding gene	gene with protein product		614591				21368133	Standard	NM_001039213		Approved	DFNA4B	uc010xxd.2	Q2WEN9	OTTHUMG00000151519	ENST00000405314.2:c.894C>T	19.37:g.45209092C>T			A7LI12	Silent	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.T298	ENST00000405314.2	37	c.894	CCDS54278.1	19																																																																																			CEACAM16	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000213892		0.597	CEACAM16-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	CEACAM16	HGNC	protein_coding		97	0.00	0	C	XM_371177		45209092	45209092	+1	no_errors	ENST00000405314	ensembl	human	known	69_37n	silent	87	22.81	26	SNP	1.000	T
CELSR2	1952	genome.wustl.edu	37	1	109793212	109793212	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr1:109793212C>T	ENST00000271332.3	+	1	572	c.511C>T	c.(511-513)Cgg>Tgg	p.R171W		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	171					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		GGGTGGGCGTCGGAAAAGGAA	0.632																																					NSCLC(158;1285 2011 34800 34852 42084)	dbGAP											0													51.0	66.0	61.0					1																	109793212		2203	4300	6503	-	-	-	SO:0001583	missense	0			D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.511C>T	1.37:g.109793212C>T	ENSP00000271332:p.Arg171Trp		Q5T2Y7|Q92566	Missense_Mutation	SNP	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EGF-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.R171W	ENST00000271332.3	37	c.511	CCDS796.1	1	.	.	.	.	.	.	.	.	.	.	N	11.64	1.698653	0.30142	.	.	ENSG00000143126	ENST00000271332	T	0.69561	-0.41	4.72	2.42	0.29668	.	.	.	.	.	T	0.39306	0.1073	L	0.43923	1.385	0.41759	D	0.989703	B	0.19073	0.033	B	0.06405	0.002	T	0.40961	-0.9535	9	0.45353	T	0.12	.	9.3981	0.38415	0.5327:0.4673:0.0:0.0	.	171	Q9HCU4	CELR2_HUMAN	W	171	ENSP00000271332:R171W	ENSP00000271332:R171W	R	+	1	2	CELSR2	109594735	0.977000	0.34250	1.000000	0.80357	0.961000	0.63080	0.419000	0.21247	1.002000	0.39104	0.555000	0.69702	CGG	CELSR2	-	NULL	ENSG00000143126		0.632	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR2	HGNC	protein_coding	OTTHUMT00000033200.1	63	0.00	0	C	NM_001408		109793212	109793212	+1	no_errors	ENST00000271332	ensembl	human	known	69_37n	missense	25	50.00	25	SNP	0.997	T
CERS3	204219	genome.wustl.edu	37	15	100996101	100996101	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr15:100996101C>T	ENST00000394113.1	-	13	1686	c.996G>A	c.(994-996)atG>atA	p.M332I	CERS3_ENST00000538112.2_Missense_Mutation_p.M332I|CERS3_ENST00000284382.4_Missense_Mutation_p.M332I|CERS3_ENST00000560944.1_Intron			Q8IU89	CERS3_HUMAN	ceramide synthase 3	332					ceramide biosynthetic process (GO:0046513)|keratinocyte differentiation (GO:0030216)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										CCCTTACCTTCATGAATATAC	0.393																																						dbGAP											0													102.0	95.0	97.0					15																	100996101		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS10384.1	15q26.3	2012-11-19	2011-07-08	2011-07-08	ENSG00000154227	ENSG00000154227		"""Homeoboxes / CERS class"""	23752	protein-coding gene	gene with protein product		615276	"""LAG1 longevity assurance homolog 3 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 3"""	LASS3			Standard	NM_178842		Approved	MGC27091	uc002bwb.3	Q8IU89	OTTHUMG00000172568	ENST00000394113.1:c.996G>A	15.37:g.100996101C>T	ENSP00000377672:p.Met332Ile		Q8NE64|Q8NEN6	Missense_Mutation	SNP	pirsf_Longevity_assurance_LAG1_LAC1,pfam_TLC-dom,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,smart_TLC-dom,pfscan_TLC-dom,pfscan_Homeodomain	p.M332I	ENST00000394113.1	37	c.996	CCDS10384.1	15	.	.	.	.	.	.	.	.	.	.	C	10.81	1.456108	0.26161	.	.	ENSG00000154227	ENST00000284382;ENST00000394113;ENST00000538112	T;T	0.06371	3.31;3.31	5.56	-1.89	0.07689	.	1.964930	0.01719	N	0.028193	T	0.06416	0.0165	L	0.40543	1.245	0.09310	N	1	B	0.12630	0.006	B	0.09377	0.004	T	0.38351	-0.9665	10	0.33940	T	0.23	0.4243	5.1533	0.15021	0.0:0.3278:0.1579:0.5143	.	332	Q8IU89	CERS3_HUMAN	I	332;343;332	ENSP00000284382:M332I;ENSP00000437640:M332I	ENSP00000284382:M332I	M	-	3	0	CERS3	98813624	0.000000	0.05858	0.003000	0.11579	0.904000	0.53231	-1.103000	0.03329	-0.189000	0.10482	-0.140000	0.14226	ATG	CERS3	-	pirsf_Longevity_assurance_LAG1_LAC1	ENSG00000154227		0.393	CERS3-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	CERS3	HGNC	protein_coding	OTTHUMT00000313594.4	91	0.00	0	C	NM_178842		100996101	100996101	-1	no_errors	ENST00000284382	ensembl	human	known	69_37n	missense	51	30.67	23	SNP	0.003	T
CGN	57530	genome.wustl.edu	37	1	151509297	151509297	+	Missense_Mutation	SNP	G	G	A	rs199924639		TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr1:151509297G>A	ENST00000271636.7	+	20	3531	c.3398G>A	c.(3397-3399)cGt>cAt	p.R1133H		NM_020770.2	NP_065821.1	Q9P2M7	CING_HUMAN	cingulin	1127					transforming growth factor beta receptor signaling pathway (GO:0007179)	cell junction (GO:0030054)|myosin complex (GO:0016459)|tight junction (GO:0005923)	actin binding (GO:0003779)|motor activity (GO:0003774)			NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			AAGGCCCAGCGTGAGGTGGAG	0.577																																						dbGAP											0													140.0	142.0	142.0					1																	151509297		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037740	CCDS999.1	1q21	2008-02-05			ENSG00000143375	ENSG00000143375			17429	protein-coding gene	gene with protein product		609473				11042084, 12529927	Standard	NM_020770		Approved	KIAA1319	uc009wmw.3	Q9P2M7	OTTHUMG00000012497	ENST00000271636.7:c.3398G>A	1.37:g.151509297G>A	ENSP00000271636:p.Arg1133His		A6H8L3|A7MD22|Q5T386|Q9NR25	Missense_Mutation	SNP	pfam_Myosin_tail	p.R1133H	ENST00000271636.7	37	c.3398	CCDS999.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.314743	0.95655	.	.	ENSG00000143375	ENST00000271636	T	0.78924	-1.22	5.41	5.41	0.78517	Myosin tail (1);	0.099543	0.64402	D	0.000002	T	0.79125	0.4393	L	0.39326	1.205	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74827	-0.3532	10	0.22706	T	0.39	-10.7925	17.7652	0.88475	0.0:0.0:1.0:0.0	.	1127	Q9P2M7	CING_HUMAN	H	1133	ENSP00000271636:R1133H	ENSP00000271636:R1133H	R	+	2	0	CGN	149775921	1.000000	0.71417	0.984000	0.44739	0.989000	0.77384	9.654000	0.98509	2.541000	0.85698	0.655000	0.94253	CGT	CGN	-	pfam_Myosin_tail	ENSG00000143375		0.577	CGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CGN	HGNC	protein_coding	OTTHUMT00000034900.3	163	0.00	0	G	NM_020770		151509297	151509297	+1	no_errors	ENST00000271636	ensembl	human	known	69_37n	missense	88	60.96	139	SNP	0.999	A
CHD3	1107	genome.wustl.edu	37	17	7796626	7796626	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr17:7796626C>G	ENST00000330494.7	+	5	682	c.532C>G	c.(532-534)Cct>Gct	p.P178A	CHD3_ENST00000358181.4_Missense_Mutation_p.P178A|CHD3_ENST00000380358.4_Missense_Mutation_p.P237A	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	178					centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				TAAGAAGAATCCTAAGATCCC	0.488																																						dbGAP											0													53.0	49.0	50.0					17																	7796626		2203	4300	6503	-	-	-	SO:0001583	missense	0			U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.532C>G	17.37:g.7796626C>G	ENSP00000332628:p.Pro178Ala		D3DTQ9|E9PG89|Q9Y4I0	Missense_Mutation	SNP	pfam_CHD_C2,pfam_SNF2_N,pfam_DUF1086,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.P178A	ENST00000330494.7	37	c.532	CCDS32554.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.64|15.64	2.894709|2.894709	0.52121|0.52121	.|.	.|.	ENSG00000170004|ENSG00000170004	ENST00000380358;ENST00000358181;ENST00000330494|ENST00000452447	T;D;D|.	0.96334|.	-0.18;-3.98;-3.98|.	4.65|4.65	4.65|4.65	0.58169|0.58169	High mobility group, HMG1/HMG2 (1);CHD, N-terminal (1);|.	0.000000|.	0.45867|.	D|.	0.000324|.	T|T	0.82102|0.82102	0.4964|0.4964	M|M	0.85373|0.85373	2.75|2.75	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	0.999;0.999;1.0|.	D;D;D|.	0.87578|.	0.996;0.998;0.998|.	D|D	0.84544|0.84544	0.0640|0.0640	10|5	0.87932|.	D|.	0|.	-10.2461|-10.2461	17.7258|17.7258	0.88365|0.88365	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	178;178;237|.	Q12873-2;Q12873;E9PG89|.	.;CHD3_HUMAN;.|.	A|C	237;178;178|52	ENSP00000369716:P237A;ENSP00000350907:P178A;ENSP00000332628:P178A|.	ENSP00000332628:P178A|.	P|S	+|+	1|2	0|0	CHD3|CHD3	7737351|7737351	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.311000|7.311000	0.78958|0.78958	2.411000|2.411000	0.81874|0.81874	0.561000|0.561000	0.74099|0.74099	CCT|TCC	CHD3	-	pfam_CHD_N,superfamily_HMG_superfamily	ENSG00000170004		0.488	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD3	HGNC	protein_coding	OTTHUMT00000318050.1	49	0.00	0	C	NM_001005273		7796626	7796626	+1	no_errors	ENST00000330494	ensembl	human	known	69_37n	missense	60	32.58	29	SNP	1.000	G
CIRBP	1153	genome.wustl.edu	37	19	1272306	1272306	+	Intron	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr19:1272306C>G	ENST00000588030.1	+	7	762				CIRBP_ENST00000587896.1_Missense_Mutation_p.S253C|CIRBP_ENST00000587323.1_Missense_Mutation_p.S253C|CIRBP_ENST00000588230.1_Missense_Mutation_p.S253C|CIRBP_ENST00000589686.1_Intron|CIRBP-AS1_ENST00000585832.1_RNA|CIRBP_ENST00000444172.2_Missense_Mutation_p.S200C|CIRBP_ENST00000320936.5_Intron|CIRBP_ENST00000586472.1_Intron|CIRBP-AS1_ENST00000600215.1_RNA|CIRBP_ENST00000585630.1_Intron|CIRBP_ENST00000588090.1_Intron|CIRBP_ENST00000589235.1_Intron|CIRBP_ENST00000586773.1_Intron|CIRBP_ENST00000589710.1_Missense_Mutation_p.S253C|CIRBP_ENST00000413636.2_Missense_Mutation_p.S219C|CIRBP_ENST00000589660.1_Intron|C19orf24_ENST00000409293.4_5'Flank|CIRBP_ENST00000591935.1_Intron			Q14011	CIRBP_HUMAN	cold inducible RNA binding protein						mRNA stabilization (GO:0048255)|positive regulation of translation (GO:0045727)|response to cold (GO:0009409)|response to UV (GO:0009411)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|small ribosomal subunit rRNA binding (GO:0070181)|translation repressor activity (GO:0030371)			endometrium(1)|large_intestine(1)|lung(3)	5		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000332)|all_lung(49;0.000498)|Breast(49;0.0014)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGCCAGCCTCCCTCGGCTGT	0.652																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			D78134	CCDS12059.1, CCDS74244.1, CCDS74245.1	19p13.3	2013-02-12	2001-11-28		ENSG00000099622	ENSG00000099622		"""RNA binding motif (RRM) containing"""	1982	protein-coding gene	gene with protein product	"""Cold-inducible RNA-binding protein"", ""glycine-rich RNA binding protein"""	602649	"""cold inducible RNA-binding protein"""			9434172, 9151692	Standard	NM_001280		Approved	CIRP	uc002lrr.4	Q14011		ENST00000588030.1:c.503-120C>G	19.37:g.1272306C>G			B3KT17|B4E2X2	Missense_Mutation	SNP	NULL	p.S200C	ENST00000588030.1	37	c.599	CCDS12059.1	19	.	.	.	.	.	.	.	.	.	.	C	11.88	1.771038	0.31320	.	.	ENSG00000099622	ENST00000413636;ENST00000444172	T	0.70164	-0.46	2.85	1.65	0.23941	.	.	.	.	.	T	0.50616	0.1626	.	.	.	0.09310	N	1	B;B	0.30824	0.296;0.296	B;B	0.32465	0.146;0.146	T	0.37641	-0.9697	7	.	.	.	.	9.1588	0.37009	0.0:0.7776:0.2224:0.0	.	219;253	B4E2X2;D6W5Y5	.;.	C	219;200	ENSP00000412831:S219C	.	S	+	2	0	CIRBP	1223306	0.001000	0.12720	0.185000	0.23176	0.151000	0.21798	0.330000	0.19715	1.319000	0.45190	0.491000	0.48974	TCC	CIRBP	-	NULL	ENSG00000099622		0.652	CIRBP-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CIRBP	HGNC	protein_coding	OTTHUMT00000449969.1	36	0.00	0	C	NM_001280		1272306	1272306	+1	no_errors	ENST00000444172	ensembl	human	known	69_37n	missense	34	24.44	11	SNP	0.128	G
CNTN1	1272	genome.wustl.edu	37	12	41419117	41419117	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr12:41419117G>C	ENST00000551295.2	+	21	2806	c.2689G>C	c.(2689-2691)Gag>Cag	p.E897Q	CNTN1_ENST00000347616.1_Missense_Mutation_p.E897Q|CNTN1_ENST00000348761.2_Missense_Mutation_p.E886Q|CNTN1_ENST00000550305.1_3'UTR	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	897	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				TGACATGATTGAGGCTTTCAC	0.448																																						dbGAP											0													156.0	166.0	162.0					12																	41419117		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.2689G>C	12.37:g.41419117G>C	ENSP00000447006:p.Glu897Gln		A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.E897Q	ENST00000551295.2	37	c.2689	CCDS8737.1	12	.	.	.	.	.	.	.	.	.	.	G	8.880	0.951512	0.18431	.	.	ENSG00000018236	ENST00000551295;ENST00000347616;ENST00000348761	T;T;T	0.54479	0.57;0.57;0.57	5.15	5.15	0.70609	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.650417	0.16413	N	0.215514	T	0.39462	0.1079	L	0.27053	0.805	0.80722	D	1	B;B	0.13145	0.007;0.004	B;B	0.15870	0.014;0.006	T	0.13072	-1.0523	10	0.23302	T	0.38	.	12.8489	0.57846	0.076:0.0:0.924:0.0	.	886;897	Q12860-2;Q12860	.;CNTN1_HUMAN	Q	897;897;886	ENSP00000447006:E897Q;ENSP00000325660:E897Q;ENSP00000261160:E886Q	ENSP00000325660:E897Q	E	+	1	0	CNTN1	39705384	1.000000	0.71417	1.000000	0.80357	0.175000	0.22909	2.996000	0.49449	2.780000	0.95670	0.655000	0.94253	GAG	CNTN1	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000018236		0.448	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN1	HGNC	protein_coding	OTTHUMT00000403692.2	48	0.00	0	G	NM_001843		41419117	41419117	+1	no_errors	ENST00000347616	ensembl	human	known	69_37n	missense	27	41.30	19	SNP	0.957	C
COL7A1	1294	genome.wustl.edu	37	3	48609475	48609475	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr3:48609475C>T	ENST00000328333.8	-	91	7134	c.7027G>A	c.(7027-7029)Gaa>Aaa	p.E2343K	COL7A1_ENST00000454817.1_Missense_Mutation_p.E2311K	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	2343	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CGGCCAGCTTCACCCTGCACA	0.657																																						dbGAP											0													33.0	31.0	31.0					3																	48609475		2203	4300	6503	-	-	-	SO:0001583	missense	0			L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.7027G>A	3.37:g.48609475C>T	ENSP00000332371:p.Glu2343Lys		Q14054|Q16507	Missense_Mutation	SNP	pfam_Collagen,pfam_Fibronectin_type3,pfam_VWF_A,pfam_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,superfamily_Prot_inh_Kunz-m,smart_VWF_A,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.E2343K	ENST00000328333.8	37	c.7027	CCDS2773.1	3	.	.	.	.	.	.	.	.	.	.	C	13.50	2.254978	0.39896	.	.	ENSG00000114270	ENST00000328333;ENST00000454817	D;D	0.94184	-3.37;-3.37	5.7	5.7	0.88788	.	0.000000	0.44285	D	0.000462	D	0.92652	0.7665	M	0.66297	2.02	0.44454	D	0.997386	P	0.40578	0.722	B	0.42625	0.393	D	0.90581	0.4529	10	0.12766	T	0.61	.	18.0276	0.89273	0.0:1.0:0.0:0.0	.	2343	Q02388	CO7A1_HUMAN	K	2343;2311	ENSP00000332371:E2343K;ENSP00000412569:E2311K	ENSP00000332371:E2343K	E	-	1	0	COL7A1	48584479	0.975000	0.34042	0.998000	0.56505	0.135000	0.20990	2.983000	0.49345	2.688000	0.91661	0.655000	0.94253	GAA	COL7A1	-	pfam_Collagen	ENSG00000114270		0.657	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL7A1	HGNC	protein_coding	OTTHUMT00000257519.1	57	0.00	0	C	NM_000094		48609475	48609475	-1	no_errors	ENST00000328333	ensembl	human	known	69_37n	missense	8	63.64	14	SNP	1.000	T
COL9A3	1299	genome.wustl.edu	37	20	61458148	61458148	+	Silent	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr20:61458148G>A	ENST00000343916.3	+	15	771	c.768G>A	c.(766-768)ggG>ggA	p.G256G		NM_001853.3	NP_001844.3	Q14050	CO9A3_HUMAN	collagen, type IX, alpha 3	256	Triple-helical region 3 (COL3).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female gonad development (GO:0008585)|male gonad development (GO:0008584)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(1)|endometrium(3)|large_intestine(1)|lung(18)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	28	Breast(26;5.68e-08)					GGCCGCCTGGGATCCCAGGAG	0.667																																						dbGAP											0													35.0	35.0	35.0					20																	61458148		2200	4297	6497	-	-	-	SO:0001819	synonymous_variant	0			AK075240	CCDS13505.1	20q13.3	2013-01-16			ENSG00000092758	ENSG00000092758		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2219	protein-coding gene	gene with protein product	"""collagen type IX proteoglycan"""	120270				8586434, 1429648	Standard	NM_001853		Approved	IDD, MED, EDM3, FLJ90759, DJ885L7.4.1	uc002ydm.3	Q14050	OTTHUMG00000032938	ENST00000343916.3:c.768G>A	20.37:g.61458148G>A			Q13681|Q9H4G9|Q9UPE2	Silent	SNP	pfam_Collagen	p.G256	ENST00000343916.3	37	c.768	CCDS13505.1	20																																																																																			COL9A3	-	NULL	ENSG00000092758		0.667	COL9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL9A3	HGNC	protein_coding	OTTHUMT00000080071.2	36	0.00	0	G	NM_001853		61458148	61458148	+1	no_errors	ENST00000343916	ensembl	human	known	69_37n	silent	28	25.64	10	SNP	0.876	A
CRTC3	64784	genome.wustl.edu	37	15	91136895	91136895	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr15:91136895C>T	ENST00000268184.6	+	3	263	c.259C>T	c.(259-261)Cgg>Tgg	p.R87W	CTD-3065B20.2_ENST00000558389.1_RNA|CRTC3_ENST00000560098.1_Intron|CRTC3_ENST00000420329.2_Missense_Mutation_p.R87W|CRTC3_ENST00000558619.1_3'UTR			Q6UUV7	CRTC3_HUMAN	CREB regulated transcription coactivator 3	87	Required for interaction with HTLV-1 TAX.				energy homeostasis (GO:0097009)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of lipid catabolic process (GO:0050995)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cAMP response element binding protein binding (GO:0008140)		CRTC3/MAML2(26)	breast(1)|endometrium(4)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	20	Melanoma(11;0.00551)|Lung NSC(78;0.0931)|all_lung(78;0.163)		BRCA - Breast invasive adenocarcinoma(143;0.0745)			TGATAATGTTCGGGGAACCCG	0.547			T	MAML2	salivary gland mucoepidermoid																																	dbGAP		Dom	yes		15	15q26.1	64784	CREB regulated transcription coactivator 3		E	0													73.0	75.0	74.0					15																	91136895		2198	4298	6496	-	-	-	SO:0001583	missense	0				CCDS32331.1, CCDS45348.1	15q26.1	2005-11-24				ENSG00000140577			26148	protein-coding gene	gene with protein product		608986				14536081, 14506290	Standard	NM_022769		Approved	FLJ21868	uc002bpp.4	Q6UUV7		ENST00000268184.6:c.259C>T	15.37:g.91136895C>T	ENSP00000268184:p.Arg87Trp		Q6DK61|Q6DK62|Q8NF38|Q9H6U2	Missense_Mutation	SNP	NULL	p.R87W	ENST00000268184.6	37	c.259	CCDS32331.1	15	.	.	.	.	.	.	.	.	.	.	C	25.1	4.605009	0.87157	.	.	ENSG00000140577	ENST00000437186;ENST00000268184;ENST00000420329	T;T	0.19669	2.13;2.15	5.67	4.75	0.60458	.	0.000000	0.85682	D	0.000000	T	0.42607	0.1210	L	0.58810	1.83	0.58432	D	0.999992	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.36939	-0.9727	10	0.87932	D	0	-24.8101	13.8376	0.63419	0.1632:0.8368:0.0:0.0	.	87;87	Q6UUV7;Q6UUV7-3	CRTC3_HUMAN;.	W	51;87;87	ENSP00000268184:R87W;ENSP00000416573:R87W	ENSP00000268184:R87W	R	+	1	2	CRTC3	88937899	0.890000	0.30428	0.323000	0.25347	0.341000	0.28922	2.368000	0.44222	1.496000	0.48567	0.655000	0.94253	CGG	CRTC3	-	NULL	ENSG00000140577		0.547	CRTC3-001	KNOWN	NAGNAG_splice_site|non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CRTC3	HGNC	protein_coding	OTTHUMT00000417716.2	91	0.00	0	C	NM_022769		91136895	91136895	+1	no_errors	ENST00000268184	ensembl	human	known	69_37n	missense	30	35.29	18	SNP	0.765	T
CSNK1A1	1452	genome.wustl.edu	37	5	148885086	148885086	+	Silent	SNP	G	G	C			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr5:148885086G>C	ENST00000377843.2	-	9	1409	c.930C>G	c.(928-930)gcC>gcG	p.A310A	CSNK1A1_ENST00000606299.1_Silent_p.A70A|CSNK1A1_ENST00000606719.1_Silent_p.A107A|CSNK1A1_ENST00000504676.1_Silent_p.A221A|CSNK1A1_ENST00000261798.5_Silent_p.A310A|CSNK1A1_ENST00000515435.1_Silent_p.A249A|CSNK1A1_ENST00000515768.1_Silent_p.A338A	NM_001025105.1|NM_001892.4	NP_001020276.1|NP_001883.4	P48729	KC1A_HUMAN	casein kinase 1, alpha 1	310					cell surface receptor signaling pathway (GO:0007166)|mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear speck (GO:0016607)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(4)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.0407)		CACTGGAAGAGGCTGCCTGCT	0.448																																					Colon(5;64 69 1309 10383)	dbGAP											0													120.0	124.0	122.0					5																	148885086		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF119911	CCDS47303.1, CCDS47304.1, CCDS64291.1	5q32	2013-01-17			ENSG00000113712	ENSG00000113712			2451	protein-coding gene	gene with protein product	"""clock regulator kinase"""	600505				8050587	Standard	NM_001025105		Approved	CK1, CK1a, CK1alpha, CKIa, CKIalpha	uc003lqw.2	P48729	OTTHUMG00000163463	ENST00000377843.2:c.930C>G	5.37:g.148885086G>C			D3DQG0|D3DQG1|Q4JJA0|Q5U046|Q5U047|Q6FGA2|Q71TU5|Q96HD2|Q9UDK3	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom	p.P141R	ENST00000377843.2	37	c.422	CCDS47303.1	5	.	.	.	.	.	.	.	.	.	.	G	6.031	0.374163	0.11409	.	.	ENSG00000113712	ENST00000503350	.	.	.	5.4	2.57	0.30868	.	.	.	.	.	T	0.56277	0.1974	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49504	-0.8933	4	.	.	.	.	8.1336	0.31041	0.1379:0.0:0.7344:0.1278	.	.	.	.	R	141	.	.	P	-	2	0	CSNK1A1	148865279	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.427000	0.59888	0.637000	0.30526	-0.236000	0.12185	CCT	CSNK1A1	-	NULL	ENSG00000113712		0.448	CSNK1A1-201	KNOWN	basic|CCDS	protein_coding	CSNK1A1	HGNC	protein_coding		202	0.00	0	G	NM_001892		148885086	148885086	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000503350	ensembl	human	putative	69_37n	missense	153	34.75	82	SNP	1.000	C
CTNNA3	29119	genome.wustl.edu	37	10	67862936	67862936	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr10:67862936C>G	ENST00000433211.2	-	14	2130	c.1956G>C	c.(1954-1956)caG>caC	p.Q652H	CTNNA3_ENST00000373744.4_Missense_Mutation_p.Q652H|RP11-210G22.1_ENST00000608793.1_RNA	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						TCCCTTCGGTCTGAATGCTGG	0.488																																						dbGAP											0													229.0	171.0	191.0					10																	67862936		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.1956G>C	10.37:g.67862936C>G	ENSP00000389714:p.Gln652His			Missense_Mutation	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.Q652H	ENST00000433211.2	37	c.1956	CCDS7269.1	10	.	.	.	.	.	.	.	.	.	.	C	11.43	1.637754	0.29157	.	.	ENSG00000183230	ENST00000433211;ENST00000373744	T;T	0.38077	1.16;1.16	5.47	3.63	0.41609	.	0.000000	0.52532	D	0.000061	T	0.38558	0.1045	N	0.17248	0.465	0.80722	D	1	D	0.62365	0.991	D	0.75484	0.986	T	0.12319	-1.0552	10	0.34782	T	0.22	-10.0215	8.6925	0.34275	0.0:0.8241:0.0:0.1759	.	652	Q9UI47	CTNA3_HUMAN	H	652	ENSP00000389714:Q652H;ENSP00000362849:Q652H	ENSP00000362849:Q652H	Q	-	3	2	CTNNA3	67532942	0.980000	0.34600	0.990000	0.47175	0.074000	0.17049	-0.072000	0.11486	0.789000	0.33779	-0.126000	0.14955	CAG	CTNNA3	-	pfam_Vinculin/catenin	ENSG00000183230		0.488	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNA3	HGNC	protein_coding	OTTHUMT00000048282.2	110	0.00	0	C	NM_013266		67862936	67862936	-1	no_errors	ENST00000373744	ensembl	human	known	69_37n	missense	56	40.43	38	SNP	1.000	G
DAP	1611	genome.wustl.edu	37	5	10681199	10681199	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr5:10681199C>G	ENST00000230895.6	-	4	481	c.278G>C	c.(277-279)aGa>aCa	p.R93T	DAP_ENST00000432074.2_Missense_Mutation_p.E79Q	NM_004394.2	NP_004385.1	P51397	DAP1_HUMAN	death-associated protein	93					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|autophagy (GO:0006914)|cellular response to amino acid starvation (GO:0034198)|negative regulation of autophagy (GO:0010507)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription, DNA-templated (GO:0045892)		death domain binding (GO:0070513)			endometrium(1)|large_intestine(1)|lung(1)	3		Ovarian(839;1.34e-05)|Breast(839;0.0634)|Lung NSC(810;0.0804)				GTGCTGGGTTCTTGGGGAAGG	0.607																																						dbGAP											0													101.0	82.0	88.0					5																	10681199		2203	4300	6503	-	-	-	SO:0001583	missense	0			X76105	CCDS3880.1	5p15.2	2008-07-18			ENSG00000112977	ENSG00000112977			2672	protein-coding gene	gene with protein product		600954				8530096, 7828849	Standard	NM_004394		Approved		uc003jez.4	P51397	OTTHUMG00000131041	ENST00000230895.6:c.278G>C	5.37:g.10681199C>G	ENSP00000230895:p.Arg93Thr		Q6FGC3|Q9BUC9	Missense_Mutation	SNP	NULL	p.R93T	ENST00000230895.6	37	c.278	CCDS3880.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.14|13.14	2.149244|2.149244	0.37923|0.37923	.|.	.|.	ENSG00000112977|ENSG00000112977	ENST00000432074|ENST00000230895	.|T	.|0.31769	.|1.48	4.93|4.93	3.04|3.04	0.35103|0.35103	.|.	1.224630|.	0.06497|.	N|.	0.735741|.	T|T	0.19927|0.19927	0.0479|0.0479	L|L	0.34521|0.34521	1.04|1.04	0.09310|0.09310	N|N	1|1	B|B	0.20780|0.02656	0.048|0.0	B|B	0.16289|0.01281	0.015|0.0	T|T	0.07158|0.07158	-1.0787|-1.0787	9|9	0.66056|0.38643	D|T	0.02|0.18	-18.1306|-18.1306	3.7324|3.7324	0.08498|0.08498	0.0:0.5502:0.2089:0.2409|0.0:0.5502:0.2089:0.2409	.|.	79|93	B4DQ75|P51397	.|DAP1_HUMAN	Q|T	79|93	.|ENSP00000230895:R93T	ENSP00000394163:E79Q|ENSP00000230895:R93T	E|R	-|-	1|2	0|0	DAP|DAP	10734199|10734199	0.002000|0.002000	0.14202|0.14202	0.012000|0.012000	0.15200|0.15200	0.206000|0.206000	0.24218|0.24218	1.317000|1.317000	0.33631|0.33631	2.294000|2.294000	0.77228|0.77228	0.655000|0.655000	0.94253|0.94253	GAA|AGA	DAP	-	NULL	ENSG00000112977		0.607	DAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAP	HGNC	protein_coding	OTTHUMT00000253687.1	161	0.00	0	C	NM_004394		10681199	10681199	-1	no_errors	ENST00000230895	ensembl	human	known	69_37n	missense	74	55.36	93	SNP	0.001	G
DCAF12L2	340578	genome.wustl.edu	37	X	125298870	125298870	+	Silent	SNP	A	A	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chrX:125298870A>T	ENST00000360028.2	-	1	1064	c.1038T>A	c.(1036-1038)tcT>tcA	p.S346S	DCAF12L2_ENST00000538699.1_Silent_p.S346S			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	346										NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						CACCCTCTCGAGAGCACAGGG	0.627																																						dbGAP											0													48.0	52.0	51.0					X																	125298870		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.1038T>A	X.37:g.125298870A>T			B2RN42	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S346	ENST00000360028.2	37	c.1038	CCDS43991.1	X																																																																																			DCAF12L2	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000198354		0.627	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF12L2	HGNC	protein_coding	OTTHUMT00000058181.1	21	0.00	0	A	NM_001013628		125298870	125298870	-1	no_errors	ENST00000360028	ensembl	human	known	69_37n	silent	6	40.00	4	SNP	0.471	T
DCST2	127579	genome.wustl.edu	37	1	154991075	154991075	+	Nonsense_Mutation	SNP	G	G	C			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr1:154991075G>C	ENST00000368424.3	-	15	2325	c.2267C>G	c.(2266-2268)tCa>tGa	p.S756*		NM_144622.2	NP_653223.2	Q5T1A1	DCST2_HUMAN	DC-STAMP domain containing 2	756	Pro-rich.					integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(13)|ovary(3)|prostate(1)|skin(1)	38	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GAGAGGGACTGAGGGTTCTGA	0.522																																						dbGAP											0													106.0	118.0	114.0					1																	154991075		1982	4170	6152	-	-	-	SO:0001587	stop_gained	0			AK057496	CCDS1082.2	1q22	2008-02-05		2005-08-09	ENSG00000163354	ENSG00000163354			26562	protein-coding gene	gene with protein product							Standard	NM_144622		Approved	FLJ32934	uc001fgm.3	Q5T1A1	OTTHUMG00000037371	ENST00000368424.3:c.2267C>G	1.37:g.154991075G>C	ENSP00000357409:p.Ser756*		Q2M2R2|Q8N810|Q96M03	Nonsense_Mutation	SNP	pfam_DC_STAMP-like	p.S756*	ENST00000368424.3	37	c.2267	CCDS1082.2	1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.487193	0.84854	.	.	ENSG00000163354	ENST00000368424	.	.	.	1.45	1.45	0.22620	.	.	.	.	.	.	.	.	.	.	.	0.51012	D	0.999903	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	6.3084	0.21151	0.0:0.0:1.0:0.0	.	.	.	.	X	756	.	ENSP00000357409:S756X	S	-	2	0	DCST2	153257699	0.256000	0.24012	0.640000	0.29408	0.715000	0.41141	0.462000	0.21956	1.093000	0.41377	0.462000	0.41574	TCA	DCST2	-	NULL	ENSG00000163354		0.522	DCST2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DCST2	HGNC	protein_coding	OTTHUMT00000090953.3	87	0.00	0	G	NM_144622		154991075	154991075	-1	no_errors	ENST00000368424	ensembl	human	known	69_37n	nonsense	174	14.22	29	SNP	0.767	C
DCUN1D5	84259	genome.wustl.edu	37	11	102935019	102935019	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr11:102935019C>T	ENST00000260247.5	-	7	985	c.643G>A	c.(643-645)Gat>Aat	p.D215N	DCUN1D5_ENST00000531543.1_Missense_Mutation_p.D130N	NM_032299.3	NP_115675.1	Q9BTE7	DCNL5_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 5	215	DCUN1. {ECO:0000255|PROSITE- ProRule:PRU00574}.									NS(1)|central_nervous_system(1)|endometrium(2)	4		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.00032)|Epithelial(105;0.0689)|all cancers(92;0.186)		CCATCTTCATCATAGTTACTA	0.308																																						dbGAP											0													138.0	129.0	132.0					11																	102935019		2202	4295	6497	-	-	-	SO:0001583	missense	0				CCDS8325.1	11q22.3	2013-06-10	2013-06-10		ENSG00000137692	ENSG00000137692			28409	protein-coding gene	gene with protein product			"""DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae)"""			15988528	Standard	NM_032299		Approved	MGC2714, FLJ32431	uc001phm.3	Q9BTE7	OTTHUMG00000165822	ENST00000260247.5:c.643G>A	11.37:g.102935019C>T	ENSP00000260247:p.Asp215Asn		Q3ZTT2	Missense_Mutation	SNP	pfam_PONY_dom	p.D215N	ENST00000260247.5	37	c.643	CCDS8325.1	11	.	.	.	.	.	.	.	.	.	.	C	35	5.540184	0.96474	.	.	ENSG00000137692	ENST00000260247;ENST00000531543	.	.	.	5.77	5.77	0.91146	Domain of unknown function DUF298 (2);	0.000000	0.85682	D	0.000000	D	0.85635	0.5742	M	0.88105	2.93	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86988	0.2108	9	0.62326	D	0.03	-12.5475	19.9826	0.97334	0.0:1.0:0.0:0.0	.	215	Q9BTE7	DCNL5_HUMAN	N	215;130	.	ENSP00000260247:D215N	D	-	1	0	DCUN1D5	102440229	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	7.818000	0.86416	2.734000	0.93682	0.650000	0.86243	GAT	DCUN1D5	-	pfam_PONY_dom	ENSG00000137692		0.308	DCUN1D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCUN1D5	HGNC	protein_coding	OTTHUMT00000386382.2	159	0.62	1	C	NM_032299		102935019	102935019	-1	no_errors	ENST00000260247	ensembl	human	known	69_37n	missense	95	21.49	26	SNP	1.000	T
DDX31	64794	genome.wustl.edu	37	9	135513749	135513749	+	Intron	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr9:135513749C>T	ENST00000372159.3	-	14	1907				DDX31_ENST00000372153.1_Intron|DDX31_ENST00000438527.3_Intron|DDX31_ENST00000310532.2_Splice_Site_p.*586*	NM_022779.7	NP_073616.6	Q9H8H2	DDX31_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 31							nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(1)	27				OV - Ovarian serous cystadenocarcinoma(145;2.67e-06)|Epithelial(140;7.61e-05)		GTGAGTTCTTCACTGTAAGTA	0.408																																						dbGAP											0													131.0	119.0	123.0					9																	135513749		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF427339	CCDS6951.1, CCDS6952.1	9q34.2	2012-04-17	2003-06-13		ENSG00000125485	ENSG00000125485		"""DEAD-boxes"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16715	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 25"""		"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31"""				Standard	NM_022779		Approved	FLJ13633, FLJ23349, FLJ14578, PPP1R25	uc004cbq.1	Q9H8H2	OTTHUMG00000020843	ENST00000372159.3:c.1755+3641G>A	9.37:g.135513749C>T			Q5K6N2|Q5K6N3|Q5K6N4|Q5VZJ4|Q5VZJ9|Q96E91|Q96NY2|Q96SX5|Q9H5K6	Silent	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd,pfscan_RNA_helicase_DEAD_Q_motif	p.*586	ENST00000372159.3	37	c.1757	CCDS6951.1	9																																																																																			DDX31	-	NULL	ENSG00000125485		0.408	DDX31-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DDX31	HGNC	protein_coding	OTTHUMT00000054794.1	104	0.00	0	C	NM_138620		135513749	135513749	-1	no_errors	ENST00000310532	ensembl	human	known	69_37n	silent	60	34.78	32	SNP	0.000	T
DDX59	83479	genome.wustl.edu	37	1	200635322	200635322	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr1:200635322C>G	ENST00000331314.6	-	2	760	c.547G>C	c.(547-549)Gaa>Caa	p.E183Q	DDX59_ENST00000447706.2_Missense_Mutation_p.E183Q|DDX59_ENST00000367348.3_Missense_Mutation_p.E183Q	NM_001031725.4	NP_001026895.2	Q5T1V6	DDX59_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 59	183						cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|liver(1)|lung(9)|ovary(3)	21						TTAAGATTTTCAATCTGGTCT	0.428																																						dbGAP											0													95.0	98.0	97.0					1																	200635322		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC041801	CCDS30964.1	1q32.1	2010-07-14			ENSG00000118197	ENSG00000118197		"""Zinc fingers, HIT-type"", ""DEAD-boxes"""	25360	protein-coding gene	gene with protein product		615464					Standard	NM_001031725		Approved	DKFZP564B1023, ZNHIT5	uc009wzk.3	Q5T1V6	OTTHUMG00000035725	ENST00000331314.6:c.547G>C	1.37:g.200635322C>G	ENSP00000330460:p.Glu183Gln		Q6PJL2|Q8IVW3|Q9H0W3	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Znf_HIT,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.E183Q	ENST00000331314.6	37	c.547	CCDS30964.1	1	.	.	.	.	.	.	.	.	.	.	C	12.40	1.926544	0.34002	.	.	ENSG00000118197	ENST00000447706;ENST00000367348;ENST00000331314	T;T;T	0.30714	1.53;1.52;1.89	5.33	4.36	0.52297	.	0.210880	0.49305	D	0.000152	T	0.25938	0.0632	L	0.42487	1.325	0.28110	N	0.931057	B;B	0.21688	0.058;0.059	B;B	0.27170	0.077;0.045	T	0.09357	-1.0678	10	0.39692	T	0.17	-36.82	9.0843	0.36572	0.0:0.7741:0.1488:0.0771	.	183;183	B7Z5N6;Q5T1V6	.;DDX59_HUMAN	Q	183	ENSP00000394367:E183Q;ENSP00000356317:E183Q;ENSP00000330460:E183Q	ENSP00000330460:E183Q	E	-	1	0	DDX59	198901945	0.145000	0.22656	0.117000	0.21633	0.992000	0.81027	0.724000	0.25954	2.498000	0.84270	0.650000	0.86243	GAA	DDX59	-	NULL	ENSG00000118197		0.428	DDX59-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX59	HGNC	protein_coding	OTTHUMT00000086883.2	75	0.00	0	C	NM_001031725.4		200635322	200635322	-1	no_errors	ENST00000331314	ensembl	human	known	69_37n	missense	86	44.52	69	SNP	0.482	G
DEGS2	123099	genome.wustl.edu	37	14	100625894	100625894	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr14:100625894C>G	ENST00000553834.1	-	1	38	c.31G>C	c.(31-33)Gag>Cag	p.E11Q	DEGS2_ENST00000305631.5_Missense_Mutation_p.E11Q					delta(4)-desaturase, sphingolipid 2											breast(1)|lung(6)|skin(1)	8		Melanoma(154;0.212)				TAGACCCACTCGAAGTCGCTG	0.766																																						dbGAP											0													8.0	8.0	8.0					14																	100625894		1691	3073	4764	-	-	-	SO:0001583	missense	0				CCDS9956.1	14q32.2	2013-09-02	2011-12-09	2004-12-14	ENSG00000168350	ENSG00000168350		"""Fatty acid desaturases"""	20113	protein-coding gene	gene with protein product	"""sphingolipid delta(4)-desaturase 2"", ""dihydroceramide desaturase 2"""	610862	"""chromosome 14 open reading frame 66"", ""degenerative spermatocyte homolog 2, lipid desaturase (Drosophila)"""	C14orf66			Standard	NM_206918		Approved	DES2, FADS8	uc001ygx.2	Q6QHC5	OTTHUMG00000171537	ENST00000553834.1:c.31G>C	14.37:g.100625894C>G	ENSP00000450637:p.Glu11Gln			Missense_Mutation	SNP	pfam_Fatty_acid_desaturase-1,pfam_Sphingolipid_d4-desaturase_N,pirsf_Sphingolipid_d4-desaturase	p.E11Q	ENST00000553834.1	37	c.31		14	.	.	.	.	.	.	.	.	.	.	.	29.7	5.029182	0.93518	.	.	ENSG00000168350	ENST00000305631;ENST00000553834	T;T	0.46451	0.87;0.87	4.72	4.72	0.59763	Sphingolipid delta4-desaturase, N-terminal (1);	0.181221	0.47852	D	0.000217	T	0.65913	0.2737	M	0.81239	2.535	0.44668	D	0.997654	D	0.89917	1.0	D	0.91635	0.999	T	0.66670	-0.5865	10	0.33141	T	0.24	-2.4015	16.6721	0.85270	0.0:1.0:0.0:0.0	.	11	Q6QHC5	DEGS2_HUMAN	Q	11	ENSP00000307126:E11Q;ENSP00000450637:E11Q	ENSP00000307126:E11Q	E	-	1	0	DEGS2	99695647	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	6.536000	0.73842	2.172000	0.68678	0.484000	0.47621	GAG	DEGS2	-	pfam_Sphingolipid_d4-desaturase_N,pirsf_Sphingolipid_d4-desaturase	ENSG00000168350		0.766	DEGS2-002	PUTATIVE	basic|exp_conf	protein_coding	DEGS2	HGNC	protein_coding	OTTHUMT00000414004.1	20	0.00	0	C	NM_206918		100625894	100625894	-1	no_errors	ENST00000305631	ensembl	human	known	69_37n	missense	8	38.46	5	SNP	1.000	G
DEPDC5	9681	genome.wustl.edu	37	22	32180825	32180825	+	Silent	SNP	G	G	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr22:32180825G>T	ENST00000382112.3	+	9	658	c.588G>T	c.(586-588)gtG>gtT	p.V196V	DEPDC5_ENST00000382111.2_Silent_p.V196V|DEPDC5_ENST00000266091.3_Silent_p.V196V|DEPDC5_ENST00000382105.2_Silent_p.V196V|DEPDC5_ENST00000400248.2_Silent_p.V196V|DEPDC5_ENST00000400249.2_Silent_p.V196V|DEPDC5_ENST00000400242.3_Silent_p.V196V|DEPDC5_ENST00000400246.1_Silent_p.V196V|DEPDC5_ENST00000536766.1_Silent_p.V168V|DEPDC5_ENST00000535622.1_Silent_p.V196V	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	196					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						AGAAAGCTGTGAATGGTTTCC	0.313																																						dbGAP											0													227.0	202.0	210.0					22																	32180825		1823	4081	5904	-	-	-	SO:0001819	synonymous_variant	0			AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.588G>T	22.37:g.32180825G>T			A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Silent	SNP	pfam_DUF3608,pfam_DEP_dom,smart_DEP_dom,pfscan_DEP_dom	p.V196	ENST00000382112.3	37	c.588	CCDS46692.1	22																																																																																			DEPDC5	-	pfam_DUF3608	ENSG00000100150		0.313	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DEPDC5	HGNC	protein_coding	OTTHUMT00000129087.1	272	0.37	1	G	NM_014662		32180825	32180825	+1	no_errors	ENST00000266091	ensembl	human	known	69_37n	silent	109	43.81	85	SNP	1.000	T
DLG4	1742	genome.wustl.edu	37	17	7100285	7100285	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr17:7100285G>A	ENST00000399506.2	-	9	1065	c.874C>T	c.(874-876)Cgg>Tgg	p.R292W	DLG4_ENST00000302955.6_Missense_Mutation_p.R289W|DLG4_ENST00000399510.2_Missense_Mutation_p.R335W			P78352	DLG4_HUMAN	discs, large homolog 4 (Drosophila)	292					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|axon guidance (GO:0007411)|dendritic spine morphogenesis (GO:0060997)|establishment of protein localization (GO:0045184)|learning (GO:0007612)|locomotory exploration behavior (GO:0035641)|negative regulation of receptor internalization (GO:0002091)|nervous system development (GO:0007399)|neuromuscular process controlling balance (GO:0050885)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synaptic transmission (GO:0050806)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|receptor localization to synapse (GO:0097120)|regulation of grooming behavior (GO:2000821)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|signal transduction (GO:0007165)|social behavior (GO:0035176)|synaptic transmission (GO:0007268)|synaptic vesicle maturation (GO:0016188)|vocalization behavior (GO:0071625)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|juxtaparanode region of axon (GO:0044224)|neuron projection terminus (GO:0044306)|neuron spine (GO:0044309)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	acetylcholine receptor binding (GO:0033130)|beta-1 adrenergic receptor binding (GO:0031697)|D1 dopamine receptor binding (GO:0031748)|ionotropic glutamate receptor binding (GO:0035255)|P2Y1 nucleotide receptor binding (GO:0031812)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein phosphatase binding (GO:0019903)|scaffold protein binding (GO:0097110)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)	18					Guanidine(DB00536)	GAGTAGCGCCGAGGGGAAGTG	0.617																																						dbGAP											0													28.0	32.0	31.0					17																	7100285		2103	4235	6338	-	-	-	SO:0001583	missense	0			U83192	CCDS45599.1, CCDS45600.1	17p13.1	2008-12-15	2001-12-04		ENSG00000132535	ENSG00000132535			2903	protein-coding gene	gene with protein product		602887				9286702	Standard	NM_001128827		Approved	PSD-95, PSD95, SAP90, SAP-90	uc010cly.3	P78352	OTTHUMG00000134327	ENST00000399506.2:c.874C>T	17.37:g.7100285G>A	ENSP00000382425:p.Arg292Trp		B7Z1S1|G5E939|Q92941|Q9UKK8	Missense_Mutation	SNP	pfam_Guanylate_kin,pfam_PDZ,pfam_PDZ_assoc,pfam_MAGUK_PEST_N,pfam_SH3_domain,pfam_SH3_2,pfam_L27_1,superfamily_SH3_domain,superfamily_PDZ,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pirsf_M-assoc_guanylate_kinase,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin	p.R335W	ENST00000399506.2	37	c.1003		17	.	.	.	.	.	.	.	.	.	.	G	19.57	3.852142	0.71719	.	.	ENSG00000132535	ENST00000399506;ENST00000302955;ENST00000399510;ENST00000293813;ENST00000380912;ENST00000539674	T;T;T	0.14516	2.52;2.52;2.5	5.18	4.2	0.49525	PDZ/DHR/GLGF (1);PDZ-associated domain of NMDA receptors (1);	.	.	.	.	T	0.27027	0.0662	L	0.44542	1.39	0.51233	D	0.999912	D;D;D;D	0.71674	0.996;0.989;0.994;0.998	D;P;D;D	0.68621	0.959;0.879;0.924;0.947	T	0.00822	-1.1552	9	0.38643	T	0.18	.	13.4461	0.61142	0.0:0.1587:0.8413:0.0	.	332;292;289;335	B9EGL1;P78352;G5E939;P78352-2	.;DLG4_HUMAN;.;.	W	292;289;335;335;232;335	ENSP00000382425:R292W;ENSP00000307471:R289W;ENSP00000382428:R335W	ENSP00000293813:R335W	R	-	1	2	DLG4	7041009	0.990000	0.36364	1.000000	0.80357	0.999000	0.98932	0.897000	0.28390	1.141000	0.42275	0.655000	0.94253	CGG	DLG4	-	pfam_PDZ_assoc,superfamily_PDZ,pirsf_M-assoc_guanylate_kinase	ENSG00000132535		0.617	DLG4-002	KNOWN	non_canonical_TEC|not_organism_supported|basic|appris_candidate_longest	protein_coding	DLG4	HGNC	protein_coding	OTTHUMT00000259419.2	50	0.00	0	G	NM_001365		7100285	7100285	-1	no_errors	ENST00000293813	ensembl	human	known	69_37n	missense	10	56.52	13	SNP	1.000	A
DNAH2	146754	genome.wustl.edu	37	17	7736442	7736442	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr17:7736442G>C	ENST00000572933.1	+	85	14492	c.13032G>C	c.(13030-13032)aaG>aaC	p.K4344N	DNAH2_ENST00000389173.2_Missense_Mutation_p.K4344N			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	4344					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				GGGACCGGAAGAACTCCTGCT	0.612																																						dbGAP											0													57.0	60.0	59.0					17																	7736442		2203	4300	6503	-	-	-	SO:0001583	missense	0			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.13032G>C	17.37:g.7736442G>C	ENSP00000458355:p.Lys4344Asn		A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA_core,smart_AAA+_ATPase	p.K4344N	ENST00000572933.1	37	c.13032	CCDS32551.1	17	.	.	.	.	.	.	.	.	.	.	G	19.47	3.832840	0.71258	.	.	ENSG00000183914	ENST00000389173	T	0.09350	2.99	3.88	3.88	0.44766	Dynein heavy chain (1);	0.120029	0.53938	D	0.000058	T	0.26702	0.0653	M	0.75447	2.3	0.80722	D	1	P	0.43662	0.814	P	0.53035	0.716	T	0.03384	-1.1042	10	0.59425	D	0.04	.	15.1111	0.72359	0.0:0.0:1.0:0.0	.	4344	Q9P225	DYH2_HUMAN	N	4344	ENSP00000373825:K4344N	ENSP00000373825:K4344N	K	+	3	2	DNAH2	7677167	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.332000	0.59279	2.182000	0.69389	0.471000	0.43371	AAG	DNAH2	-	pfam_Dynein_heavy	ENSG00000183914		0.612	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH2	HGNC	protein_coding	OTTHUMT00000440241.1	70	0.00	0	G	NM_020877		7736442	7736442	+1	no_errors	ENST00000389173	ensembl	human	known	69_37n	missense	39	40.00	26	SNP	1.000	C
DNAH5	1767	genome.wustl.edu	37	5	13769169	13769169	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr5:13769169G>A	ENST00000265104.4	-	58	9901	c.9797C>T	c.(9796-9798)gCc>gTc	p.A3266V	DNAH5_ENST00000504001.3_5'UTR	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3266	Stalk. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					AATGGCCTGGGCCCTGTCCTT	0.448									Kartagener syndrome																													dbGAP											0													312.0	303.0	306.0					5																	13769169		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.9797C>T	5.37:g.13769169G>A	ENSP00000265104:p.Ala3266Val		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.A3266V	ENST00000265104.4	37	c.9797	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	G	32	5.155731	0.94686	.	.	ENSG00000039139	ENST00000265104	T	0.67523	-0.27	5.76	5.76	0.90799	Dynein heavy chain, coiled coil stalk (1);	0.000000	0.85682	D	0.000000	T	0.79341	0.4429	M	0.76574	2.34	0.80722	D	1	P	0.51351	0.944	P	0.58266	0.836	T	0.72912	-0.4148	10	0.19590	T	0.45	.	20.3242	0.98691	0.0:0.0:1.0:0.0	.	3266	Q8TE73	DYH5_HUMAN	V	3266	ENSP00000265104:A3266V	ENSP00000265104:A3266V	A	-	2	0	DNAH5	13822169	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.632000	0.98428	2.882000	0.98803	0.655000	0.94253	GCC	DNAH5	-	NULL	ENSG00000039139		0.448	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	199	0.00	0	G	NM_001369		13769169	13769169	-1	no_errors	ENST00000265104	ensembl	human	known	69_37n	missense	145	46.57	129	SNP	1.000	A
DNASE1L3	1776	genome.wustl.edu	37	3	58190568	58190568	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr3:58190568C>G	ENST00000394549.2	-	4	677	c.361G>C	c.(361-363)Gac>Cac	p.D121H	DNASE1L3_ENST00000318316.3_Missense_Mutation_p.D121H|DNASE1L3_ENST00000483681.1_Missense_Mutation_p.D121H|DNASE1L3_ENST00000486455.1_Missense_Mutation_p.D91H	NM_004944.3	NP_004935.1	Q13609	DNSL3_HUMAN	deoxyribonuclease I-like 3	121					apoptotic DNA fragmentation (GO:0006309)|developmental programmed cell death (GO:0010623)|DNA metabolic process (GO:0006259)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)|deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)			breast(2)|large_intestine(4)|lung(6)	12				BRCA - Breast invasive adenocarcinoma(55;0.00021)|KIRC - Kidney renal clear cell carcinoma(284;0.0445)|Kidney(284;0.0556)|OV - Ovarian serous cystadenocarcinoma(275;0.202)		TCCTGATAGTCATGGTAGTGA	0.488																																					Esophageal Squamous(96;1069 1424 4841 43466 52325)	dbGAP											0													128.0	115.0	119.0					3																	58190568		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF047354	CCDS2886.1, CCDS58836.1	3p14.3	2008-05-15			ENSG00000163687	ENSG00000163687			2959	protein-coding gene	gene with protein product	"""DNase gamma"""	602244				9205125, 9714828, 14646506	Standard	NM_004944		Approved	DNAS1L3, LSD	uc003djo.2	Q13609	OTTHUMG00000159153	ENST00000394549.2:c.361G>C	3.37:g.58190568C>G	ENSP00000378053:p.Asp121His		B2R8B1|B7Z707|O75803	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_DNase_I_euk,pirsf_DNase_I_euk,prints_DNase_I_euk	p.D121H	ENST00000394549.2	37	c.361	CCDS2886.1	3	.	.	.	.	.	.	.	.	.	.	C	14.88	2.666176	0.47677	.	.	ENSG00000163687	ENST00000486455;ENST00000450710;ENST00000318316;ENST00000483681;ENST00000394549;ENST00000461914	T;T;T;T;T	0.53857	0.6;0.6;0.6;0.6;0.6	5.81	5.81	0.92471	Endonuclease/exonuclease/phosphatase (2);	0.000000	0.85682	D	0.000000	T	0.81758	0.4890	H	0.94620	3.56	0.58432	D	0.999994	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.86073	0.1539	10	0.87932	D	0	.	20.0628	0.97684	0.0:1.0:0.0:0.0	.	91;121;121	B7Z707;E9PES0;Q13609	.;.;DNSL3_HUMAN	H	91;121;121;121;121;121	ENSP00000419052:D91H;ENSP00000316193:D121H;ENSP00000417047:D121H;ENSP00000378053:D121H;ENSP00000418113:D121H	ENSP00000316193:D121H	D	-	1	0	DNASE1L3	58165608	1.000000	0.71417	0.999000	0.59377	0.041000	0.13682	7.349000	0.79376	2.745000	0.94114	0.655000	0.94253	GAC	DNASE1L3	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_DNase_I_euk,pirsf_DNase_I_euk,prints_DNase_I_euk	ENSG00000163687		0.488	DNASE1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNASE1L3	HGNC	protein_coding	OTTHUMT00000353533.1	126	0.00	0	C	NM_004944		58190568	58190568	-1	no_errors	ENST00000318316	ensembl	human	known	69_37n	missense	44	42.11	32	SNP	0.983	G
DSP	1832	genome.wustl.edu	37	6	7580958	7580958	+	Missense_Mutation	SNP	A	A	C	rs2076299|rs397516939	byFrequency	TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr6:7580958A>C	ENST00000379802.3	+	23	4876	c.4535A>C	c.(4534-4536)tAt>tCt	p.Y1512S	DSP_ENST00000418664.2_Intron	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	1512	Central fibrous rod domain.		Y -> C (in dbSNP:rs2076299). {ECO:0000269|PubMed:19863551, ECO:0000269|PubMed:20031617}.		adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		AGGGTCCAGTATGACCTGCAG	0.428																																						dbGAP											0													121.0	117.0	118.0					6																	7580958		2203	4300	6503	-	-	-	SO:0001583	missense	0			J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.4535A>C	6.37:g.7580958A>C	ENSP00000369129:p.Tyr1512Ser		B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Missense_Mutation	SNP	pfam_Plectin_repeat,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.Y1512S	ENST00000379802.3	37	c.4535	CCDS4501.1	6	.	.	.	.	.	.	.	.	.	.	A	3.633	-0.075217	0.07184	.	.	ENSG00000096696	ENST00000379802	T	0.69435	-0.4	5.74	1.8	0.24995	.	0.497515	0.18746	N	0.132315	T	0.18882	0.0453	N	0.14661	0.345	0.09310	P	0.9999999999893495	B	0.19583	0.037	B	0.18263	0.021	T	0.07366	-1.0776	9	0.08837	T	0.75	.	5.5709	0.17196	0.4336:0.0:0.0811:0.4854	.	1512	P15924	DESP_HUMAN	S	1512	ENSP00000369129:Y1512S	ENSP00000369129:Y1512S	Y	+	2	0	DSP	7525957	0.062000	0.20869	0.380000	0.26093	0.546000	0.35178	0.826000	0.27407	0.431000	0.26258	0.533000	0.62120	TAT	DSP	-	NULL	ENSG00000096696		0.428	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSP	HGNC	protein_coding	OTTHUMT00000039786.2	61	0.00	0	A	NM_004415		7580958	7580958	+1	no_errors	ENST00000379802	ensembl	human	known	69_37n	missense	59	14.49	10	SNP	0.998	C
DTX3	196403	genome.wustl.edu	37	12	58002372	58002372	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr12:58002372G>A	ENST00000548198.1	+	4	2324	c.820G>A	c.(820-822)Gag>Aag	p.E274K	DTX3_ENST00000337737.3_Missense_Mutation_p.E274K|ARHGEF25_ENST00000333972.7_5'Flank|DTX3_ENST00000548804.1_Missense_Mutation_p.E274K|ARHGEF25_ENST00000286494.4_5'Flank|DTX3_ENST00000551632.1_Missense_Mutation_p.E277K			Q8N9I9	DTX3_HUMAN	deltex 3, E3 ubiquitin ligase	274					Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(6)|urinary_tract(1)	12	Melanoma(17;0.122)					GGACTGCCCTGAGGGCAACAA	0.602																																						dbGAP											0													73.0	77.0	76.0					12																	58002372		2121	4237	6358	-	-	-	SO:0001583	missense	0			AK094385	CCDS41800.1, CCDS66410.1	12q13.2	2014-01-28	2014-01-28			ENSG00000178498		"""RING-type (C3HC4) zinc fingers"""	24457	protein-coding gene	gene with protein product		613142	"""deltex 3 homolog (Drosophila)"", ""deltex homolog 3 (Drosophila)"""			12670957	Standard	XM_005268697		Approved	FLJ34766, RNF154	uc001sow.1	Q8N9I9		ENST00000548198.1:c.820G>A	12.37:g.58002372G>A	ENSP00000447873:p.Glu274Lys		Q53ZZ2|Q8NAU6|Q8NDS8	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.E277K	ENST00000548198.1	37	c.829	CCDS41800.1	12	.	.	.	.	.	.	.	.	.	.	G	18.36	3.607097	0.66558	.	.	ENSG00000178498	ENST00000548804;ENST00000337737;ENST00000548198;ENST00000551632;ENST00000550300	T;T;T;T;T	0.18174	2.23;2.23;2.23;2.23;2.23	4.17	4.17	0.49024	.	0.000000	0.85682	D	0.000000	T	0.12561	0.0305	N	0.25957	0.775	0.80722	D	1	B	0.27823	0.19	B	0.23419	0.046	T	0.11446	-1.0587	10	0.21014	T	0.42	-13.9713	15.6291	0.76888	0.0:0.0:1.0:0.0	.	274	Q8N9I9	DTX3_HUMAN	K	274;274;274;277;62	ENSP00000449294:E274K;ENSP00000338050:E274K;ENSP00000447873:E274K;ENSP00000448696:E277K;ENSP00000446996:E62K	ENSP00000338050:E274K	E	+	1	0	DTX3	56288639	1.000000	0.71417	0.970000	0.41538	0.999000	0.98932	9.504000	0.97986	2.049000	0.60858	0.591000	0.81541	GAG	DTX3	-	NULL	ENSG00000178498		0.602	DTX3-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	DTX3	HGNC	protein_coding	OTTHUMT00000407848.1	50	0.00	0	G	NM_178502		58002372	58002372	+1	no_errors	ENST00000551632	ensembl	human	known	69_37n	missense	31	27.91	12	SNP	1.000	A
DUOX1	53905	genome.wustl.edu	37	15	45454016	45454016	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr15:45454016C>G	ENST00000321429.4	+	31	4344	c.3937C>G	c.(3937-3939)Ctg>Gtg	p.L1313V	CTD-2651B20.1_ENST00000558039.1_lincRNA|DUOX1_ENST00000389037.3_Missense_Mutation_p.L1313V|DUOX1_ENST00000561166.1_Missense_Mutation_p.L959V	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1	1313	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		TTGCCTGGCTCTGGGGACCAC	0.662																																						dbGAP											0													99.0	86.0	90.0					15																	45454016		2198	4298	6496	-	-	-	SO:0001583	missense	0			AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9		ENST00000321429.4:c.3937C>G	15.37:g.45454016C>G	ENSP00000317997:p.Leu1313Val		A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_EF-hand,superfamily_Haem_peroxidase,superfamily_Riboflavin_synthase-like_b-brl,smart_EF_hand_Ca-bd,prints_Haem_peroxidase_animal_subgr,prints_Recoverin,pfscan_EF_HAND_2,pfscan_Haem_peroxidase_animal	p.L1313V	ENST00000321429.4	37	c.3937	CCDS32221.1	15	.	.	.	.	.	.	.	.	.	.	C	16.93	3.256812	0.59321	.	.	ENSG00000137857	ENST00000431588;ENST00000321429;ENST00000389037	D;D	0.92545	-3.06;-3.06	4.11	3.18	0.36537	Riboflavin synthase-like beta-barrel (1);FAD-binding 8 (1);Ferredoxin reductase-type FAD-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.87148	0.6105	N	0.16166	0.38	0.58432	D	0.999995	D	0.54207	0.965	P	0.57057	0.812	T	0.81818	-0.0758	10	0.17369	T	0.5	-13.9625	6.1758	0.20442	0.0:0.7727:0.0:0.2273	.	1313	Q9NRD9	DUOX1_HUMAN	V	1313	ENSP00000317997:L1313V;ENSP00000373689:L1313V	ENSP00000317997:L1313V	L	+	1	2	DUOX1	43241308	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.495000	0.45337	1.061000	0.40601	0.555000	0.69702	CTG	DUOX1	-	pfam_FAD-bd_8,superfamily_Riboflavin_synthase-like_b-brl	ENSG00000137857		0.662	DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DUOX1	HGNC	protein_coding	OTTHUMT00000416251.1	80	0.00	0	C	NM_017434		45454016	45454016	+1	no_errors	ENST00000321429	ensembl	human	known	69_37n	missense	29	44.23	23	SNP	1.000	G
SPAG5	10615	genome.wustl.edu	37	17	26912942	26912942	+	Silent	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr17:26912942G>A	ENST00000321765.5	-	7	2012	c.1680C>T	c.(1678-1680)ctC>ctT	p.L560L		NM_006461.3	NP_006452.3	Q96R06	SPAG5_HUMAN	sperm associated antigen 5	560	Interaction with KNSTRN.				chromosome segregation (GO:0007059)|mitotic sister chromatid segregation (GO:0000070)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|microtubule plus-end (GO:0035371)|mitotic spindle (GO:0072686)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43	Lung NSC(42;0.00431)					TTTCTGCTTTGAGGCTCTGGA	0.478																																						dbGAP											0													212.0	190.0	198.0					17																	26912942		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF063308	CCDS32594.1	17q11.2	2008-07-18			ENSG00000076382	ENSG00000076382			13452	protein-coding gene	gene with protein product	"""mitotic spindle coiled-coil related protein"", ""astrin"", ""mitotic spindle associated protein p126"""	615562				11549262	Standard	NM_006461		Approved	DEEPEST, MAP126, hMAP126	uc002hbq.3	Q96R06	OTTHUMG00000166586	ENST00000321765.5:c.1680C>T	17.37:g.26912942G>A			O95213|Q9BWE8|Q9NT17|Q9UFE6	Missense_Mutation	SNP	NULL	p.S100L	ENST00000321765.5	37	c.299	CCDS32594.1	17																																																																																			RP11-192H23.4	-	NULL	ENSG00000258472		0.478	SPAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000258472	Clone_based_vega_gene	protein_coding	OTTHUMT00000390564.2	145	0.00	0	G	NM_006461		26912942	26912942	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000584206	ensembl	human	novel	69_37n	missense	70	41.18	49	SNP	0.996	A
ABHD17B	51104	genome.wustl.edu	37	9	74489592	74489592	+	Silent	SNP	C	C	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr9:74489592C>A	ENST00000333421.6	-	2	516	c.405G>T	c.(403-405)ggG>ggT	p.G135G	ABHD17B_ENST00000377041.2_Silent_p.G135G	NM_001025780.1	NP_001020951.1	Q5VST6	AB17B_HUMAN	abhydrolase domain containing 17B	135						extracellular region (GO:0005576)|membrane (GO:0016020)	hydrolase activity (GO:0016787)										CTGTGGGTTTCCCGGAACTGG	0.393																																						dbGAP											0													73.0	70.0	71.0					9																	74489592		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF151825	CCDS35042.1, CCDS35043.1	9q21.2	2013-03-15	2013-03-15	2013-03-15	ENSG00000107362	ENSG00000107362		"""Abhydrolase domain containing"""	24278	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 77"", ""family with sequence similarity 108, member B1"""	C9orf77, FAM108B1		10810093	Standard	XM_006717134		Approved	CGI-67	uc004ail.3	Q5VST6	OTTHUMG00000020001	ENST00000333421.6:c.405G>T	9.37:g.74489592C>A			A8KAJ5|Q5VST7|Q86YB6|Q8IY03|Q9Y377	Silent	SNP	pfam_Peptidase_S9,pfam_Dienelactn_hydro	p.G135	ENST00000333421.6	37	c.405	CCDS35043.1	9																																																																																			FAM108B1	-	pfam_Dienelactn_hydro	ENSG00000107362		0.393	ABHD17B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM108B1	HGNC	protein_coding	OTTHUMT00000052625.1	54	0.00	0	C	NM_016014		74489592	74489592	-1	no_errors	ENST00000377041	ensembl	human	known	69_37n	silent	26	45.83	22	SNP	0.997	A
FAM114A1	92689	genome.wustl.edu	37	4	38907253	38907253	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr4:38907253G>A	ENST00000358869.2	+	5	723	c.547G>A	c.(547-549)Gaa>Aaa	p.E183K	FAM114A1_ENST00000515037.1_5'UTR	NM_138389.2	NP_612398.2	Q8IWE2	NXP20_HUMAN	family with sequence similarity 114, member A1	183						cytoplasm (GO:0005737)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	20						CGGAGTCCCTGAAAGTGAGTG	0.453																																						dbGAP											0													76.0	77.0	77.0					4																	38907253		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3447.1	4p14	2006-09-21			ENSG00000197712	ENSG00000197712			25087	protein-coding gene	gene with protein product							Standard	NM_138389		Approved	Noxp20	uc003gtn.3	Q8IWE2	OTTHUMG00000128583	ENST00000358869.2:c.547G>A	4.37:g.38907253G>A	ENSP00000351740:p.Glu183Lys		A8K9W6|Q6MZV4|Q9BVL6	Missense_Mutation	SNP	pfam_DUF719	p.E183K	ENST00000358869.2	37	c.547	CCDS3447.1	4	.	.	.	.	.	.	.	.	.	.	G	11.16	1.557008	0.27827	.	.	ENSG00000197712	ENST00000358869	T	0.41400	1.0	5.17	2.51	0.30379	.	1.632790	0.02893	N	0.134422	T	0.29061	0.0722	N	0.12182	0.205	0.09310	N	1	B	0.10296	0.003	B	0.13407	0.009	T	0.22103	-1.0226	10	0.30854	T	0.27	2.1637	8.8538	0.35217	0.2113:0.5789:0.2098:0.0	.	183	Q8IWE2	NXP20_HUMAN	K	183	ENSP00000351740:E183K	ENSP00000351740:E183K	E	+	1	0	FAM114A1	38583648	0.001000	0.12720	0.010000	0.14722	0.034000	0.12701	0.652000	0.24888	0.290000	0.22444	-0.126000	0.14955	GAA	FAM114A1	-	pfam_DUF719	ENSG00000197712		0.453	FAM114A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM114A1	HGNC	protein_coding	OTTHUMT00000250436.1	67	0.00	0	G	NM_138389		38907253	38907253	+1	no_errors	ENST00000358869	ensembl	human	known	69_37n	missense	40	35.48	22	SNP	0.000	A
FAM124B	79843	genome.wustl.edu	37	2	225244906	225244906	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr2:225244906A>C	ENST00000409685.3	-	2	1017	c.752T>G	c.(751-753)cTt>cGt	p.L251R	FAM124B_ENST00000389874.3_3'UTR	NM_001122779.1	NP_001116251.1	Q9H5Z6	F124B_HUMAN	family with sequence similarity 124B	251										endometrium(2)|large_intestine(2)|lung(7)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	16		Renal(207;0.0112)|all_lung(227;0.0126)|Lung NSC(271;0.0161)|all_hematologic(139;0.138)		Epithelial(121;4.4e-10)|all cancers(144;2.02e-07)|Lung(261;0.00766)|LUSC - Lung squamous cell carcinoma(224;0.00825)		CTTAACACCAAGTTCTGGATT	0.488																																						dbGAP											0													40.0	42.0	41.0					2																	225244906		692	1591	2283	-	-	-	SO:0001583	missense	0			AK075126	CCDS2461.1, CCDS46527.1	2q36.2	2008-02-05			ENSG00000124019	ENSG00000124019			26224	protein-coding gene	gene with protein product						12477932	Standard	NM_001122779		Approved	FLJ22746	uc002vnx.3	Q9H5Z6	OTTHUMG00000133168	ENST00000409685.3:c.752T>G	2.37:g.225244906A>C	ENSP00000386895:p.Leu251Arg		A6NNC7|Q8NBZ4|Q8TAV7	Missense_Mutation	SNP	NULL	p.L251R	ENST00000409685.3	37	c.752	CCDS46527.1	2	.	.	.	.	.	.	.	.	.	.	A	11.61	1.688818	0.29962	.	.	ENSG00000124019	ENST00000409685	T	0.32515	1.45	5.71	-4.69	0.03299	.	.	.	.	.	T	0.20210	0.0486	L	0.51422	1.61	0.09310	N	0.999999	B	0.11235	0.004	B	0.14023	0.01	T	0.33650	-0.9860	9	0.28530	T	0.3	0.0214	3.0639	0.06209	0.3695:0.1238:0.386:0.1207	.	251	Q9H5Z6	F124B_HUMAN	R	251	ENSP00000386895:L251R	ENSP00000386895:L251R	L	-	2	0	FAM124B	224953150	0.000000	0.05858	0.004000	0.12327	0.007000	0.05969	-0.492000	0.06467	-0.412000	0.07519	-0.256000	0.11100	CTT	FAM124B	-	NULL	ENSG00000124019		0.488	FAM124B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM124B	HGNC	protein_coding	OTTHUMT00000330873.1	32	0.00	0	A	NM_024785		225244906	225244906	-1	no_errors	ENST00000409685	ensembl	human	known	69_37n	missense	30	23.08	9	SNP	0.000	C
FAM208B	54906	genome.wustl.edu	37	10	5788925	5788925	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr10:5788925C>G	ENST00000328090.5	+	15	4166	c.3541C>G	c.(3541-3543)Cag>Gag	p.Q1181E	RP11-336A10.2_ENST00000411512.2_RNA	NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	1181																	GAGATGCACTCAGGATTTCCT	0.453																																						dbGAP											0													104.0	105.0	105.0					10																	5788925		1974	4164	6138	-	-	-	SO:0001583	missense	0			BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.3541C>G	10.37:g.5788925C>G	ENSP00000328426:p.Gln1181Glu		Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Missense_Mutation	SNP	pfam_DUF3715,pfam_DUF3699	p.Q1181E	ENST00000328090.5	37	c.3541	CCDS41485.1	10	.	.	.	.	.	.	.	.	.	.	C	3.435	-0.115263	0.06881	.	.	ENSG00000108021	ENST00000328090;ENST00000442808	T	0.04654	3.58	5.67	2.57	0.30868	.	0.364462	0.23727	N	0.045174	T	0.05456	0.0144	L	0.52573	1.65	0.09310	N	1	B	0.12013	0.005	B	0.10450	0.005	T	0.31166	-0.9953	10	0.35671	T	0.21	.	8.6604	0.34088	0.163:0.5214:0.3155:0.0	.	1181	Q5VWN6	F208B_HUMAN	E	1181;376	ENSP00000328426:Q1181E	ENSP00000328426:Q1181E	Q	+	1	0	C10orf18	5828931	0.674000	0.27549	0.436000	0.26797	0.003000	0.03518	0.927000	0.28818	0.705000	0.31890	0.591000	0.81541	CAG	FAM208B	-	NULL	ENSG00000108021		0.453	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM208B	HGNC	protein_coding	OTTHUMT00000046571.2	52	0.00	0	C	NM_017782		5788925	5788925	+1	no_errors	ENST00000328090	ensembl	human	known	69_37n	missense	36	27.45	14	SNP	0.258	G
BRINP2	57795	genome.wustl.edu	37	1	177250316	177250316	+	Missense_Mutation	SNP	G	G	T	rs369281014		TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr1:177250316G>T	ENST00000361539.4	+	8	2316	c.2004G>T	c.(2002-2004)atG>atT	p.M668I	BRINP2_ENST00000478325.1_3'UTR	NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2	668					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)											CCCTGGAGATGACTGATCCCT	0.463																																						dbGAP											0													72.0	69.0	70.0					1																	177250316		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.2004G>T	1.37:g.177250316G>T	ENSP00000354481:p.Met668Ile		O95560|Q6ZWC1|Q7LCZ9|Q8N360	Missense_Mutation	SNP	pfam_MACPF,smart_MACPF	p.M668I	ENST00000361539.4	37	c.2004	CCDS1320.1	1	.	.	.	.	.	.	.	.	.	.	G	11.86	1.764171	0.31228	.	.	ENSG00000198797	ENST00000536589;ENST00000361539	T	0.13196	2.61	5.15	5.15	0.70609	.	0.110090	0.64402	D	0.000006	T	0.10294	0.0252	N	0.22421	0.69	0.41837	D	0.990104	B;B	0.09022	0.002;0.0	B;B	0.08055	0.003;0.0	T	0.09997	-1.0649	10	0.41790	T	0.15	-24.9251	12.3079	0.54912	0.0:0.0:0.8305:0.1695	.	563;668	Q9C0B6-2;Q9C0B6	.;FAM5B_HUMAN	I	421;668	ENSP00000354481:M668I	ENSP00000354481:M668I	M	+	3	0	FAM5B	175516939	0.981000	0.34729	1.000000	0.80357	0.965000	0.64279	1.789000	0.38724	2.386000	0.81285	0.305000	0.20034	ATG	FAM5B	-	NULL	ENSG00000198797		0.463	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM5B	HGNC	protein_coding	OTTHUMT00000084599.1	35	0.00	0	G	NM_021165		177250316	177250316	+1	no_errors	ENST00000361539	ensembl	human	known	69_37n	missense	36	26.00	13	SNP	0.990	T
SPATA31D1	389763	genome.wustl.edu	37	9	84605770	84605770	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr9:84605770G>A	ENST00000344803.2	+	4	432	c.385G>A	c.(385-387)Gtc>Atc	p.V129I		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	129					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CCCAGACCCCGTCTGTCGGGT	0.547																																						dbGAP											0													106.0	99.0	101.0					9																	84605770		1977	4154	6131	-	-	-	SO:0001583	missense	0				CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.385G>A	9.37:g.84605770G>A	ENSP00000341988:p.Val129Ile			Missense_Mutation	SNP	NULL	p.V129I	ENST00000344803.2	37	c.385	CCDS47986.1	9	.	.	.	.	.	.	.	.	.	.	G	5.683	0.310604	0.10733	.	.	ENSG00000214929	ENST00000344803	T	0.04970	3.52	2.88	-1.18	0.09617	.	2.153780	0.02194	N	0.061633	T	0.03520	0.0101	N	0.22421	0.69	0.09310	N	1	B	0.31413	0.322	B	0.17722	0.019	T	0.32455	-0.9906	10	0.22706	T	0.39	1.9552	0.1121	0.00057	0.2419:0.232:0.256:0.2701	.	129	Q6ZQQ2	F75D1_HUMAN	I	129	ENSP00000341988:V129I	ENSP00000341988:V129I	V	+	1	0	FAM75D1	83795590	0.002000	0.14202	0.168000	0.22838	0.004000	0.04260	-0.689000	0.05144	-0.179000	0.10654	-0.160000	0.13428	GTC	FAM75D1	-	NULL	ENSG00000214929		0.547	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM75D1	HGNC	protein_coding	OTTHUMT00000402325.1	286	0.00	0	G	NM_001001670		84605770	84605770	+1	no_errors	ENST00000344803	ensembl	human	known	69_37n	missense	217	18.05	48	SNP	0.223	A
FASN	2194	genome.wustl.edu	37	17	80038680	80038680	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr17:80038680C>G	ENST00000306749.2	-	39	6932	c.6714G>C	c.(6712-6714)caG>caC	p.Q2238H	FASN_ENST00000579758.1_Intron	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	2238	Thioesterase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	GCTCCGAGCTCTGCACGGAGT	0.672																																					Colon(59;314 1043 11189 28578 32273)	dbGAP											0													34.0	38.0	36.0					17																	80038680		2195	4294	6489	-	-	-	SO:0001583	missense	0			U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.6714G>C	17.37:g.80038680C>G	ENSP00000304592:p.Gln2238His		Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	pfam_Acyl_transferase,pfam_Ketoacyl_synth_N,pfam_Thioesterase,pfam_PKS_KR,pfam_DH_sc/Rdtase_SDR,pfam_Ketoacyl_synth_C,pfam_ADH_C,pfam_Acyl_carrier_prot-like,pfam_Methyltransf_12,pfam_Methyltransf_11,superfamily_Thiolase-like,superfamily_Acyl_Trfase/lysoPLipase,superfamily_GroES-like,superfamily_Acyl_carrier_prot-like,superfamily_Malonyl_transacylase_ACP-bd,smart_PKS_Beta-ketoAc_synthase_dom,smart_PKS_acyl_transferase,smart_PKS_dehydratase,smart_PKS_ER,smart_PKS/FAS_KR,smart_PKS_PP-bd,pfscan_Acyl_carrier_prot-like	p.Q2238H	ENST00000306749.2	37	c.6714	CCDS11801.1	17	.	.	.	.	.	.	.	.	.	.	C	12.53	1.964445	0.34659	.	.	ENSG00000169710	ENST00000306749	T	0.26957	1.7	4.8	3.8	0.43715	.	0.145094	0.46758	D	0.000273	T	0.14270	0.0345	N	0.08118	0	0.47621	D	0.999475	P	0.52463	0.953	P	0.44447	0.45	T	0.01702	-1.1292	10	0.59425	D	0.04	-23.4172	9.0976	0.36649	0.0:0.8308:0.0:0.1692	.	2238	P49327	FAS_HUMAN	H	2238	ENSP00000304592:Q2238H	ENSP00000304592:Q2238H	Q	-	3	2	FASN	77631969	1.000000	0.71417	0.994000	0.49952	0.150000	0.21749	1.761000	0.38440	2.500000	0.84329	0.591000	0.81541	CAG	FASN	-	NULL	ENSG00000169710		0.672	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FASN	HGNC	protein_coding	OTTHUMT00000442369.1	51	0.00	0	C	NM_004104		80038680	80038680	-1	no_errors	ENST00000306749	ensembl	human	known	69_37n	missense	18	33.33	9	SNP	1.000	G
FAT3	120114	genome.wustl.edu	37	11	92568091	92568091	+	Silent	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr11:92568091G>A	ENST00000298047.6	+	14	9944	c.9927G>A	c.(9925-9927)ctG>ctA	p.L3309L	FAT3_ENST00000409404.2_Silent_p.L3309L|FAT3_ENST00000525166.1_Silent_p.L3159L			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	3309	Cadherin 30. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GGTTTTACCTGGTAGTGGAAG	0.453										TCGA Ovarian(4;0.039)																												dbGAP											0													35.0	35.0	35.0					11																	92568091		1873	4107	5980	-	-	-	SO:0001819	synonymous_variant	0			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.9927G>A	11.37:g.92568091G>A			B5MDB0|Q96AU6	Silent	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_Laminin_G,smart_EGF-like_Ca-bd,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.L3309	ENST00000298047.6	37	c.9927		11																																																																																			FAT3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000165323		0.453	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		46	0.00	0	G	NM_001008781		92568091	92568091	+1	no_errors	ENST00000298047	ensembl	human	known	69_37n	silent	18	41.94	13	SNP	0.996	A
FBN1	2200	genome.wustl.edu	37	15	48787352	48787352	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr15:48787352G>A	ENST00000316623.5	-	22	3100	c.2645C>T	c.(2644-2646)gCg>gTg	p.A882V		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	882	TB 4.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		GCTTCCCCACGCAGCACCGAG	0.527																																						dbGAP											0			GRCh37	CM042039	FBN1	M							63.0	53.0	57.0					15																	48787352		2197	4296	6493	-	-	-	SO:0001583	missense	0			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.2645C>T	15.37:g.48787352G>A	ENSP00000325527:p.Ala882Val		B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_EGF-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt,smart_EGF-like,smart_EGF-like_Ca-bd,pirsf_Fibrillin,pfscan_EG-like_dom	p.A882V	ENST00000316623.5	37	c.2645	CCDS32232.1	15	.	.	.	.	.	.	.	.	.	.	G	27.6	4.850446	0.91277	.	.	ENSG00000166147	ENST00000316623	D	0.95980	-3.87	5.72	5.72	0.89469	Matrix fibril-associated (3);TGF-beta binding (1);	0.000000	0.85682	D	0.000000	D	0.98210	0.9408	M	0.90082	3.085	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.98732	1.0713	10	0.72032	D	0.01	.	19.4766	0.94991	0.0:0.0:1.0:0.0	.	882	P35555	FBN1_HUMAN	V	882	ENSP00000325527:A882V	ENSP00000325527:A882V	A	-	2	0	FBN1	46574644	1.000000	0.71417	1.000000	0.80357	0.397000	0.30659	9.869000	0.99810	2.690000	0.91761	0.555000	0.69702	GCG	FBN1	-	pfam_TB_dom,superfamily_TB_dom,pirsf_Fibrillin	ENSG00000166147		0.527	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN1	HGNC	protein_coding	OTTHUMT00000417355.1	78	0.00	0	G			48787352	48787352	-1	no_errors	ENST00000316623	ensembl	human	known	69_37n	missense	35	37.50	21	SNP	1.000	A
FBXL5	26234	genome.wustl.edu	37	4	15638232	15638232	+	Silent	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr4:15638232G>A	ENST00000341285.3	-	5	775	c.651C>T	c.(649-651)ttC>ttT	p.F217F	FBXL5_ENST00000412094.2_Silent_p.F200F|FBXL5_ENST00000382358.4_Silent_p.F91F	NM_001193534.1|NM_001193535.1|NM_012161.3	NP_001180463.1|NP_001180464.1|NP_036293.1	Q9UKA1	FBXL5_HUMAN	F-box and leucine-rich repeat protein 5	217	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				iron ion homeostasis (GO:0055072)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	perinuclear region of cytoplasm (GO:0048471)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	iron ion binding (GO:0005506)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(2)|large_intestine(3)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	13						TAAGATAGCTGAAAATTGACA	0.398																																						dbGAP											0													117.0	100.0	106.0					4																	15638232		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF174591	CCDS3415.1, CCDS54745.1	4p15.33	2011-06-09			ENSG00000118564	ENSG00000118564		"""F-boxes / Leucine-rich repeats"""	13602	protein-coding gene	gene with protein product		605655				10531035	Standard	NM_012161		Approved	FBL4, FBL5, FLR1	uc003goc.2	Q9UKA1	OTTHUMG00000097097	ENST00000341285.3:c.651C>T	4.37:g.15638232G>A			A8MSK4|B4DIB5|Q4W5A8|Q8NHP3|Q9NXN2|Q9P0I0|Q9P0X5|Q9UJT7|Q9UKC8	Nonsense_Mutation	SNP	pfam_F-box_dom_cyclin-like,pfam_Leu-rich_rpt,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_F-box_dom_cyclin-like	p.Q138*	ENST00000341285.3	37	c.412	CCDS3415.1	4	.	.	.	.	.	.	.	.	.	.	G	9.772	1.172977	0.21704	.	.	ENSG00000118564	ENST00000513163	.	.	.	5.28	5.28	0.74379	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-15.2485	9.9226	0.41472	0.1525:0.0:0.8475:0.0	.	.	.	.	X	138	.	.	Q	-	1	0	FBXL5	15247330	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.977000	0.63792	2.625000	0.88918	0.591000	0.81541	CAG	FBXL5	-	pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like	ENSG00000118564		0.398	FBXL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL5	HGNC	protein_coding	OTTHUMT00000214235.2	100	0.00	0	G			15638232	15638232	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000513163	ensembl	human	novel	69_37n	nonsense	74	35.09	40	SNP	1.000	A
FCGR3A	2214	genome.wustl.edu	37	1	161518251	161518251	+	Silent	SNP	G	G	C			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr1:161518251G>C	ENST00000436743.1	-	4	433	c.279C>G	c.(277-279)ctC>ctG	p.L93L	RP11-25K21.6_ENST00000537821.2_RNA|FCGR3A_ENST00000443193.1_Silent_p.L128L|FCGR3A_ENST00000540048.1_Silent_p.L93L|FCGR3A_ENST00000367969.3_Silent_p.L129L|FCGR3A_ENST00000476031.1_5'UTR	NM_001127593.1|NM_001127595.1|NM_001127596.1	NP_001121065.1|NP_001121067.1|NP_001121068.1	P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor (CD16a)	93	Ig-like C2-type 1.				Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	TGAGGGTGGAGAGGTTTGTCT	0.517																																						dbGAP											0													176.0	168.0	171.0					1																	161518251		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC036723	CCDS1232.1, CCDS44266.1	1q23	2014-09-17	2005-02-02		ENSG00000203747	ENSG00000203747		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3619	protein-coding gene	gene with protein product		146740	"""Fc fragment of IgG, low affinity IIIa, receptor for (CD16)"""	FCGR3, FCG3		2139735	Standard	NM_001127592		Approved	CD16, CD16a	uc001gar.3	P08637	OTTHUMG00000034466	ENST00000436743.1:c.279C>G	1.37:g.161518251G>C			A2N6W9|Q53FJ0|Q53FL6|Q5EBR4|Q65ZM6|Q6PIJ0	Missense_Mutation	SNP	smart_Ig_sub,pfscan_Ig-like	p.S110C	ENST00000436743.1	37	c.329	CCDS44266.1	1	.	.	.	.	.	.	.	.	.	.	G	9.257	1.042178	0.19748	.	.	ENSG00000203747	ENST00000426740	.	.	.	4.43	1.19	0.21007	.	.	.	.	.	T	0.15262	0.0368	.	.	.	0.19300	N	0.999975	.	.	.	.	.	.	T	0.23976	-1.0173	4	.	.	.	.	7.4461	0.27211	0.0:0.3494:0.4708:0.1798	.	.	.	.	C	110	.	.	S	-	2	0	FCGR3A	159784875	0.019000	0.18553	0.414000	0.26521	0.454000	0.32378	0.325000	0.19628	0.568000	0.29311	0.591000	0.81541	TCT	FCGR3A	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000203747		0.517	FCGR3A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGR3A	HGNC	protein_coding	OTTHUMT00000102169.2	256	0.00	0	G	NM_000569		161518251	161518251	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000426740	ensembl	human	known	69_37n	missense	422	11.46	55	SNP	0.255	C
FOXP2	93986	genome.wustl.edu	37	7	114066652	114066652	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr7:114066652C>A	ENST00000393494.2	+	2	365	c.86C>A	c.(85-87)gCt>gAt	p.A29D	FOXP2_ENST00000393500.3_5'UTR|FOXP2_ENST00000378237.3_Missense_Mutation_p.A29D|FOXP2_ENST00000408937.3_Missense_Mutation_p.A29D|FOXP2_ENST00000459666.1_3'UTR|FOXP2_ENST00000393489.3_5'UTR|FOXP2_ENST00000390668.3_Missense_Mutation_p.A28D|FOXP2_ENST00000350908.4_Missense_Mutation_p.A29D|FOXP2_ENST00000462331.1_Missense_Mutation_p.A29D|FOXP2_ENST00000403559.4_Missense_Mutation_p.A29D|FOXP2_ENST00000393498.2_Missense_Mutation_p.A29D|FOXP2_ENST00000360232.4_Missense_Mutation_p.A29D			O15409	FOXP2_HUMAN	forkhead box P2	29				A -> V (in Ref. 2; AAM60762). {ECO:0000305}.	camera-type eye development (GO:0043010)|caudate nucleus development (GO:0021757)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|growth (GO:0040007)|lung alveolus development (GO:0048286)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of mesenchymal cell proliferation (GO:0002053)|post-embryonic development (GO:0009791)|putamen development (GO:0021758)|righting reflex (GO:0060013)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|vocal learning (GO:0042297)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(7)|kidney(4)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	52						CAATTAGATGCTGGCAGCAGA	0.428																																						dbGAP											0													117.0	104.0	108.0					7																	114066652		2203	4300	6503	-	-	-	SO:0001583	missense	0			U80741	CCDS5760.1, CCDS5761.1, CCDS43635.1, CCDS5761.2, CCDS55154.1	7q31	2008-07-18			ENSG00000128573	ENSG00000128573		"""Forkhead boxes"""	13875	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 10"", ""forkhead/winged-helix transcription factor"", ""speech and language disorder 1"", ""CAG repeat protein 44"""	605317		TNRC10, SPCH1		11586359, 9225980	Standard	NM_014491		Approved	CAGH44	uc003vgz.3	O15409	OTTHUMG00000023131	ENST00000393494.2:c.86C>A	7.37:g.114066652C>A	ENSP00000377132:p.Ala29Asp		A0AUV6|A4D0U8|A6NNW4|B4DLD9|Q6ZND1|Q75MJ3|Q8IZE0|Q8N0W2|Q8N6B7|Q8N6B8|Q8NFQ1|Q8NFQ2|Q8NFQ3|Q8NFQ4|Q8TD74	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.A29D	ENST00000393494.2	37	c.86	CCDS5760.1	7	.	.	.	.	.	.	.	.	.	.	C	19.33	3.806941	0.70797	.	.	ENSG00000128573	ENST00000324462;ENST00000393494;ENST00000462331;ENST00000408937;ENST00000403559;ENST00000350908;ENST00000393498;ENST00000378237;ENST00000360232;ENST00000452963;ENST00000393495;ENST00000390668	T;T;D;T;T;T;T;T	0.90261	1.29;0.66;-2.64;1.57;1.29;1.29;1.29;0.12	5.27	5.27	0.74061	.	0.000000	0.64402	D	0.000001	D	0.92750	0.7695	L	0.29908	0.895	0.80722	D	1	D;D;D;D;D;D;D	0.76494	0.988;0.998;0.999;0.999;0.988;0.999;0.999	D;D;D;D;D;D;D	0.85130	0.942;0.981;0.991;0.991;0.942;0.997;0.991	D	0.93630	0.6955	10	0.72032	D	0.01	.	19.2355	0.93856	0.0:1.0:0.0:0.0	.	29;29;29;28;29;29;29	B7ZLK5;B4DLD9;O15409-6;Q8N6B5;O15409;O15409-4;O15409-5	.;.;.;.;FOXP2_HUMAN;.;.	D	29;29;29;29;29;29;29;29;29;29;29;28	ENSP00000377132:A29D;ENSP00000418100:A29D;ENSP00000386200:A29D;ENSP00000385069:A29D;ENSP00000265436:A29D;ENSP00000367482:A29D;ENSP00000353367:A29D;ENSP00000375084:A28D	ENSP00000319424:A29D	A	+	2	0	FOXP2	113853888	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.681000	0.68175	2.622000	0.88805	0.591000	0.81541	GCT	FOXP2	-	NULL	ENSG00000128573		0.428	FOXP2-014	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	FOXP2	HGNC	protein_coding	OTTHUMT00000317366.1	62	0.00	0	C	NM_014491		114066652	114066652	+1	no_errors	ENST00000408937	ensembl	human	known	69_37n	missense	30	36.17	17	SNP	1.000	A
GCC2	9648	genome.wustl.edu	37	2	109102990	109102990	+	Silent	SNP	A	A	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr2:109102990A>G	ENST00000309863.6	+	16	4530	c.3816A>G	c.(3814-3816)tcA>tcG	p.S1272S		NM_181453.3	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain containing 2	1272					Golgi ribbon formation (GO:0090161)|late endosome to Golgi transport (GO:0034499)|microtubule anchoring (GO:0034453)|microtubule organizing center organization (GO:0031023)|protein localization to Golgi apparatus (GO:0034067)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|recycling endosome to Golgi transport (GO:0071955)|regulation of protein exit from endoplasmic reticulum (GO:0070861)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	identical protein binding (GO:0042802)			breast(8)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	54						AAATAACATCAGAGAAGCACA	0.423																																						dbGAP											0													117.0	117.0	117.0					2																	109102990		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC020645	CCDS33268.1	2q12.3	2008-02-05	2004-03-05		ENSG00000135968	ENSG00000135968			23218	protein-coding gene	gene with protein product		612711	"""GRIP and coiled-coil domain-containing 2"""			12446665	Standard	NM_181453		Approved	GCC185, KIAA0336	uc002tec.3	Q8IWJ2	OTTHUMG00000153214	ENST00000309863.6:c.3816A>G	2.37:g.109102990A>G			A6H8X8|O15045|Q4ZG46|Q8TDH3|Q9H2G8	Silent	SNP	pfam_GRIP,superfamily_GRIP,superfamily_tRNA-bd_arm,smart_GRIP,pfscan_GRIP	p.S1272	ENST00000309863.6	37	c.3816	CCDS33268.1	2																																																																																			GCC2	-	NULL	ENSG00000135968		0.423	GCC2-014	KNOWN	basic|appris_principal|CCDS	protein_coding	GCC2	HGNC	protein_coding	OTTHUMT00000358516.3	96	0.00	0	A	NM_014635		109102990	109102990	+1	no_errors	ENST00000309863	ensembl	human	known	69_37n	silent	36	41.94	26	SNP	0.574	G
GNL3L	54552	genome.wustl.edu	37	X	54586952	54586952	+	Splice_Site	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chrX:54586952G>A	ENST00000336470.4	+	16	1805		c.e16-1		GNL3L_ENST00000360845.2_Splice_Site	NM_019067.5	NP_061940.1	Q9NVN8	GNL3L_HUMAN	guanine nucleotide binding protein-like 3 (nucleolar)-like						GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	30						TCCATTTGCAGATAAAATCGC	0.507																																						dbGAP											0													222.0	183.0	196.0					X																	54586952		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK001475	CCDS14360.1	Xp11.22	2010-03-17			ENSG00000130119	ENSG00000130119			25553	protein-coding gene	gene with protein product		300873				12477932	Standard	NM_019067		Approved	FLJ10613	uc004dth.2	Q9NVN8	OTTHUMG00000021629	ENST00000336470.4:c.1667-1G>A	X.37:g.54586952G>A				Splice_Site	SNP	-	e15-1	ENST00000336470.4	37	c.1667-1	CCDS14360.1	X	.	.	.	.	.	.	.	.	.	.	G	18.04	3.533943	0.64972	.	.	ENSG00000130119	ENST00000336470;ENST00000360845	.	.	.	4.44	4.44	0.53790	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.0835	0.53684	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GNL3L	54603677	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	3.937000	0.56575	2.139000	0.66308	0.506000	0.49869	.	GNL3L	-	-	ENSG00000130119		0.507	GNL3L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GNL3L	HGNC	protein_coding	OTTHUMT00000056805.1	221	0.00	0	G	NM_019067	Intron	54586952	54586952	+1	no_errors	ENST00000336470	ensembl	human	known	69_37n	splice_site	141	24.06	45	SNP	1.000	A
GPR113	165082	genome.wustl.edu	37	2	26534505	26534505	+	Silent	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr2:26534505G>A	ENST00000311519.1	-	11	2090	c.2091C>T	c.(2089-2091)ttC>ttT	p.F697F	GPR113_ENST00000459892.1_5'UTR|GPR113_ENST00000541401.1_Silent_p.F300F|GPR113_ENST00000421160.2_Silent_p.F628F|GPR113_ENST00000333478.6_Silent_p.F498F	NM_001145168.1	NP_001138640.1	Q8IZF5	GP113_HUMAN	G protein-coupled receptor 113	697					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTCCCTGGCTGAAGGCCCGGT	0.572																																						dbGAP											0													55.0	54.0	54.0					2																	26534505		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB083619	CCDS33159.2, CCDS46238.1, CCDS46239.1	2p24.1	2014-08-08			ENSG00000173567	ENSG00000173567		"""-"", ""GPCR / Class B : Orphans"""	18989	protein-coding gene	gene with protein product						12435584	Standard	NM_153835		Approved	hGPCR37, PGR23	uc002rhe.4	Q8IZF5	OTTHUMG00000150225	ENST00000311519.1:c.2091C>T	2.37:g.26534505G>A			B4DF15|E9PEV1|Q53TA5|Q6UXT7|Q6UXX3|Q86SL7|Q8IXD8|Q8TDT3	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.F498	ENST00000311519.1	37	c.1494	CCDS46239.1	2																																																																																			GPR113	-	NULL	ENSG00000173567		0.572	GPR113-004	PUTATIVE	basic|CCDS	protein_coding	GPR113	HGNC	protein_coding	OTTHUMT00000316892.1	82	0.00	0	G	NM_153835		26534505	26534505	-1	no_errors	ENST00000333478	ensembl	human	known	69_37n	silent	30	16.67	6	SNP	0.000	A
GPT	2875	genome.wustl.edu	37	8	145730656	145730656	+	Missense_Mutation	SNP	G	G	A	rs529679428		TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr8:145730656G>A	ENST00000528431.1	+	6	680	c.523G>A	c.(523-525)Gag>Aag	p.E175K	GPT_ENST00000394955.2_Missense_Mutation_p.E175K			P24298	ALAT1_HUMAN	glutamic-pyruvate transaminase (alanine aminotransferase)	175					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-alanine catabolic process (GO:0042853)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	L-alanine:2-oxoglutarate aminotransferase activity (GO:0004021)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(1)|lung(2)|ovary(1)	5	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)		L-Alanine(DB00160)|Phenelzine(DB00780)	GGTGGCCGGCGAGGGCCACAC	0.687													.|||	1	0.000199681	0.0	0.0	5008	,	,		10661	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													20.0	17.0	18.0					8																	145730656		2174	4270	6444	-	-	-	SO:0001583	missense	0				CCDS6430.1	8q24.3	2013-09-19			ENSG00000167701	ENSG00000167701	2.6.1.2		4552	protein-coding gene	gene with protein product		138200					Standard	NM_005309		Approved	ALT1, GPT1	uc003zdh.4	P24298	OTTHUMG00000165176	ENST00000528431.1:c.523G>A	8.37:g.145730656G>A	ENSP00000433586:p.Glu175Lys		B0YJ18|D3DWM7|P78398|Q93076	Missense_Mutation	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom,prints_ACC_synthase	p.E175K	ENST00000528431.1	37	c.523	CCDS6430.1	8	.	.	.	.	.	.	.	.	.	.	G	8.683	0.905524	0.17760	.	.	ENSG00000167701	ENST00000528431;ENST00000394955	T;T	0.22539	1.95;1.95	5.01	2.77	0.32553	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.112655	0.64402	D	0.000018	T	0.19565	0.0470	L	0.56769	1.78	0.29485	N	0.856025	B;B	0.32862	0.387;0.208	B;B	0.37508	0.252;0.075	T	0.09378	-1.0677	10	0.16420	T	0.52	-22.1723	7.2771	0.26290	0.1025:0.3266:0.5709:0.0	.	175;175	B4DPT5;P24298	.;ALAT1_HUMAN	K	175	ENSP00000433586:E175K;ENSP00000378408:E175K	ENSP00000378408:E175K	E	+	1	0	GPT	145701464	0.975000	0.34042	0.062000	0.19696	0.260000	0.26232	1.695000	0.37763	1.054000	0.40438	0.555000	0.69702	GAG	GPT	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom	ENSG00000167701		0.687	GPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPT	HGNC	protein_coding	OTTHUMT00000382471.1	20	0.00	0	G			145730656	145730656	+1	no_errors	ENST00000394955	ensembl	human	known	69_37n	missense	14	33.33	7	SNP	0.335	A
HELQ	113510	genome.wustl.edu	37	4	84361040	84361040	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr4:84361040T>C	ENST00000295488.3	-	8	1946	c.1784A>G	c.(1783-1785)gAa>gGa	p.E595G	HELQ_ENST00000510985.1_Missense_Mutation_p.E528G	NM_133636.2	NP_598375	Q8TDG4	HELQ_HUMAN	helicase, POLQ-like	595	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				double-strand break repair via homologous recombination (GO:0000724)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(10)|lung(17)|ovary(2)|skin(2)	38						GCATATCATTTCTGCTACATT	0.294								Other identified genes with known or suspected DNA repair function																														dbGAP											0													47.0	50.0	49.0					4																	84361040		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF436845	CCDS3603.1, CCDS75158.1	4q21.23	2009-02-26			ENSG00000163312	ENSG00000163312			18536	protein-coding gene	gene with protein product		606769				11751861	Standard	XM_005262711		Approved	Hel308	uc003hom.3	Q8TDG4	OTTHUMG00000130423	ENST00000295488.3:c.1784A>G	4.37:g.84361040T>C	ENSP00000295488:p.Glu595Gly		Q05DF9|Q502W9|Q659B8|Q6ZQX4|Q6ZTS4|Q96EX7	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_DNA_repair_Rad51/TF_NusA_a-hlx,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E595G	ENST00000295488.3	37	c.1784	CCDS3603.1	4	.	.	.	.	.	.	.	.	.	.	T	11.19	1.565692	0.27915	.	.	ENSG00000163312	ENST00000295488;ENST00000510985	T;T	0.72615	-0.67;0.93	5.68	4.5	0.54988	Helicase, C-terminal (2);	0.267324	0.41712	D	0.000837	T	0.52008	0.1708	N	0.20610	0.595	0.36399	D	0.863027	B;B	0.09022	0.001;0.002	B;B	0.08055	0.001;0.003	T	0.51004	-0.8760	10	0.27785	T	0.31	.	8.3547	0.32323	0.0:0.0715:0.1415:0.7869	.	528;595	E3W980;Q8TDG4	.;HELQ_HUMAN	G	595;528	ENSP00000295488:E595G;ENSP00000424539:E528G	ENSP00000295488:E595G	E	-	2	0	HELQ	84580064	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.721000	0.47260	0.985000	0.38656	0.533000	0.62120	GAA	HELQ	-	smart_Helicase_C,pfscan_Helicase_C	ENSG00000163312		0.294	HELQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HELQ	HGNC	protein_coding	OTTHUMT00000252810.1	57	0.00	0	T	NM_133636		84361040	84361040	-1	no_errors	ENST00000295488	ensembl	human	known	69_37n	missense	49	19.67	12	SNP	1.000	C
HEMK1	51409	genome.wustl.edu	37	3	50608618	50608618	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr3:50608618C>T	ENST00000232854.4	+	2	635	c.83C>T	c.(82-84)tCa>tTa	p.S28L	HEMK1_ENST00000434410.1_Missense_Mutation_p.S28L|C3orf18_ENST00000449241.1_5'Flank|HEMK1_ENST00000455834.1_Missense_Mutation_p.S28L	NM_016173.3	NP_057257.1	Q9Y5R4	HEMK1_HUMAN	HemK methyltransferase family member 1	28					DNA methylation (GO:0006306)	mitochondrion (GO:0005739)	DNA binding (GO:0003677)|N-methyltransferase activity (GO:0008170)|protein methyltransferase activity (GO:0008276)			lung(3)	3				BRCA - Breast invasive adenocarcinoma(193;0.000283)|KIRC - Kidney renal clear cell carcinoma(197;0.0179)|Kidney(197;0.0212)		GCCTTCAGCTCATGGCAACCC	0.617																																						dbGAP											0													50.0	58.0	55.0					3																	50608618		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF172244	CCDS2830.1	3p21	2008-02-05			ENSG00000114735	ENSG00000114735			24923	protein-coding gene	gene with protein product						10690633	Standard	XM_005265218		Approved	MTQ1	uc003dav.3	Q9Y5R4	OTTHUMG00000156849	ENST00000232854.4:c.83C>T	3.37:g.50608618C>T	ENSP00000232854:p.Ser28Leu			Missense_Mutation	SNP	pfam_Small_mtfrase_dom,pfam_RNA_methylase_dom,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_RNA_MeTrfase_RsmD,pfam_Methyltransf_11,prints_D21N6_MeTrfase,tigrfam_Release_fac_Glu-N5_MeTfrase,tigrfam_Modification_methylase_HemK	p.S28L	ENST00000232854.4	37	c.83	CCDS2830.1	3	.	.	.	.	.	.	.	.	.	.	C	15.07	2.724998	0.48833	.	.	ENSG00000114735	ENST00000434410;ENST00000232854;ENST00000455834	T;T;T	0.17854	2.25;2.25;2.25	5.06	3.22	0.36961	.	0.638299	0.14973	N	0.287722	T	0.10337	0.0253	N	0.16478	0.41	0.27094	N	0.96277	B	0.02656	0.0	B	0.04013	0.001	T	0.21552	-1.0242	10	0.38643	T	0.18	-3.512	8.4621	0.32934	0.0:0.7589:0.1556:0.0856	.	28	Q9Y5R4	HEMK1_HUMAN	L	28	ENSP00000404843:S28L;ENSP00000232854:S28L;ENSP00000404334:S28L	ENSP00000232854:S28L	S	+	2	0	HEMK1	50583622	0.049000	0.20398	0.972000	0.41901	0.835000	0.47333	1.356000	0.34079	0.767000	0.33267	0.655000	0.94253	TCA	HEMK1	-	NULL	ENSG00000114735		0.617	HEMK1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HEMK1	HGNC	protein_coding	OTTHUMT00000346231.1	53	0.00	0	C	NM_016173		50608618	50608618	+1	no_errors	ENST00000232854	ensembl	human	known	69_37n	missense	20	42.86	15	SNP	0.905	T
HIRIP3	8479	genome.wustl.edu	37	16	30004965	30004965	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr16:30004965C>T	ENST00000279392.3	-	5	2234	c.1404G>A	c.(1402-1404)atG>atA	p.M468I	INO80E_ENST00000304516.7_5'Flank|INO80E_ENST00000567705.1_5'Flank|INO80E_ENST00000567254.1_5'Flank|INO80E_ENST00000563197.1_5'Flank|HIRIP3_ENST00000566471.1_5'Flank|HIRIP3_ENST00000564026.1_Missense_Mutation_p.E156K	NM_003609.4	NP_003600.2	Q9BW71	HIRP3_HUMAN	HIRA interacting protein 3	468					chromatin assembly or disassembly (GO:0006333)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(9)	17						CCTCACCCTTCATGCCTAGCG	0.617																																						dbGAP											0													45.0	49.0	48.0					16																	30004965		2197	4300	6497	-	-	-	SO:0001583	missense	0			AJ223351	CCDS10664.1, CCDS58449.1	16p12.1	2008-02-05	2001-11-29		ENSG00000149929	ENSG00000149929			4917	protein-coding gene	gene with protein product		603365	"""HIRA-interacting protein 3"""			9710638	Standard	NM_003609		Approved		uc002dve.3	Q9BW71	OTTHUMG00000132118	ENST00000279392.3:c.1404G>A	16.37:g.30004965C>T	ENSP00000279392:p.Met468Ile		H3BSR3|O75707|O75708	Missense_Mutation	SNP	pfam_Histone_chaperone_domain_CHZ	p.M468I	ENST00000279392.3	37	c.1404	CCDS10664.1	16	.	.	.	.	.	.	.	.	.	.	C	14.50	2.553816	0.45487	.	.	ENSG00000149929	ENST00000279392;ENST00000352552	T	0.31510	1.49	5.55	4.4	0.53042	.	0.138298	0.49916	D	0.000134	T	0.26666	0.0652	L	0.56769	1.78	0.22317	N	0.999203	P	0.44090	0.826	B	0.39152	0.292	T	0.32107	-0.9919	10	0.49607	T	0.09	-24.1352	7.1988	0.25868	0.1735:0.7292:0.0:0.0973	.	468	Q9BW71	HIRP3_HUMAN	I	468;155	ENSP00000279392:M468I	ENSP00000279392:M468I	M	-	3	0	HIRIP3	29912466	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	1.203000	0.32284	2.610000	0.88304	0.655000	0.94253	ATG	HIRIP3	-	NULL	ENSG00000149929		0.617	HIRIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIRIP3	HGNC	protein_coding	OTTHUMT00000255160.2	65	0.00	0	C	NM_003609		30004965	30004965	-1	no_errors	ENST00000279392	ensembl	human	known	69_37n	missense	50	45.05	41	SNP	1.000	T
HOXB9	3219	genome.wustl.edu	37	17	46703217	46703217	+	Frame_Shift_Del	DEL	C	C	-			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr17:46703217delC	ENST00000311177.5	-	1	622	c.415delG	c.(415-417)gaafs	p.E139fs	HOXB9_ENST00000550387.1_Intron|HOXB-AS4_ENST00000480386.1_RNA|HOXB7_ENST00000567101.2_Intron	NM_024017.4	NP_076922.1	P17482	HXB9_HUMAN	homeobox B9	139					anterior/posterior pattern specification (GO:0009952)|canonical Wnt signaling pathway (GO:0060070)|cell chemotaxis (GO:0060326)|embryonic skeletal system development (GO:0048706)|mammary gland development (GO:0030879)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(2)|endometrium(1)|large_intestine(1)|liver(1)|lung(6)|prostate(1)	12						GCCGAAGTTTCCAAACTGTAC	0.647																																						dbGAP											0													31.0	35.0	34.0					17																	46703217		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS11534.1	17q21.32	2011-06-20	2005-12-22		ENSG00000170689	ENSG00000170689		"""Homeoboxes / ANTP class : HOXL subclass"""	5120	protein-coding gene	gene with protein product		142964	"""homeo box B9"""	HOX2E, HOX2		1973146, 1358459	Standard	NM_024017		Approved		uc002inx.3	P17482	OTTHUMG00000159907	ENST00000311177.5:c.415delG	17.37:g.46703217delC	ENSP00000309439:p.Glu139fs		B2RDB7|Q9H1I1	Frame_Shift_Del	DEL	pfam_Hox9_activation_N,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pirsf_Homeobox_Hox9,pfscan_Homeodomain,prints_Homeobox_metazoa	p.E139fs	ENST00000311177.5	37	c.415	CCDS11534.1	17																																																																																			HOXB9	-	pfam_Hox9_activation_N,pirsf_Homeobox_Hox9	ENSG00000170689		0.647	HOXB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXB9	HGNC	protein_coding	OTTHUMT00000358101.2	70	0.00	0	C			46703217	46703217	-1	no_errors	ENST00000311177	ensembl	human	known	69_37n	frame_shift_del	32	20.00	8	DEL	1.000	-
IDH3B	3420	genome.wustl.edu	37	20	2640352	2640352	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr20:2640352G>C	ENST00000380843.4	-	10	1033	c.1003C>G	c.(1003-1005)Cat>Gat	p.H335D	IDH3B_ENST00000488299.1_5'UTR|SNORD57_ENST00000448188.1_RNA|IDH3B_ENST00000380851.5_Missense_Mutation_p.H335D	NM_006899.3	NP_008830.2	O43837	IDH3B_HUMAN	isocitrate dehydrogenase 3 (NAD+) beta	335					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|isocitrate metabolic process (GO:0006102)|NADH metabolic process (GO:0006734)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|isocitrate dehydrogenase (NAD+) activity (GO:0004449)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)			breast(1)|endometrium(3)|kidney(2)|lung(7)|prostate(1)	14						TACTTAAGATGCCGCAGCATG	0.597																																						dbGAP											0													146.0	144.0	145.0					20																	2640352		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13031.1, CCDS13032.1, CCDS74696.1	20p13	2013-02-14			ENSG00000101365	ENSG00000101365	1.1.1.41		5385	protein-coding gene	gene with protein product		604526				10575215	Standard	NM_006899		Approved	RP46	uc002wgp.4	O43837	OTTHUMG00000031699	ENST00000380843.4:c.1003C>G	20.37:g.2640352G>C	ENSP00000370223:p.His335Asp		B2RDR1|D3DVX2|D3DVX3|O95106|Q5JXS8|Q9NQ06|Q9NQ07|Q9NUZ0|Q9UEX0|Q9UG99	Missense_Mutation	SNP	pfam_IsoPropMal-DH-like_dom,tigrfam_Isocitrate_DH_NAD	p.H335D	ENST00000380843.4	37	c.1003	CCDS13032.1	20	.	.	.	.	.	.	.	.	.	.	G	13.91	2.378052	0.42105	.	.	ENSG00000101365	ENST00000380851;ENST00000380843;ENST00000435594	T;T	0.71103	-0.54;-0.54	5.02	3.02	0.34903	Isopropylmalate dehydrogenase-like domain (2);	0.146863	0.64402	D	0.000009	D	0.86347	0.5911	M	0.93328	3.405	0.80722	D	1	D;D;D	0.69078	0.997;0.99;0.992	D;D;D	0.74674	0.979;0.972;0.984	D	0.88122	0.2832	10	0.87932	D	0	-8.424	11.8386	0.52340	0.0:0.0:0.6823:0.3177	.	183;335;335	O43837-3;O43837-2;O43837	.;.;IDH3B_HUMAN	D	335;335;183	ENSP00000370232:H335D;ENSP00000370223:H335D	ENSP00000370223:H335D	H	-	1	0	IDH3B	2588352	1.000000	0.71417	0.983000	0.44433	0.010000	0.07245	8.963000	0.93385	0.664000	0.31047	-0.188000	0.12872	CAT	IDH3B	-	pfam_IsoPropMal-DH-like_dom,tigrfam_Isocitrate_DH_NAD	ENSG00000101365		0.597	IDH3B-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IDH3B	HGNC	protein_coding	OTTHUMT00000077613.1	96	0.00	0	G			2640352	2640352	-1	no_errors	ENST00000380843	ensembl	human	known	69_37n	missense	94	11.21	12	SNP	0.998	C
IFNA17	3451	genome.wustl.edu	37	9	21228028	21228028	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr9:21228028G>T	ENST00000413767.2	-	1	193	c.145C>A	c.(145-147)Cct>Act	p.P49T		NM_021268.2	NP_067091.1	P01571	IFN17_HUMAN	interferon, alpha 17	49					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			breast(1)|endometrium(2)|lung(4)|ovary(1)|skin(1)	9				Lung(24;2.13e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.116)		CAGGAGAAAGGAGAGATTCTT	0.507																																						dbGAP											0													98.0	100.0	100.0					9																	21228028		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6500.1	9p22	2010-12-10			ENSG00000234829	ENSG00000234829		"""Interferons"""	5422	protein-coding gene	gene with protein product		147583				1385305	Standard	NM_021268		Approved	LEIF2C1, IFN-alphaI	uc003zos.1	P01571	OTTHUMG00000019667	ENST00000413767.2:c.145C>A	9.37:g.21228028G>T	ENSP00000411940:p.Pro49Thr		Q14639|Q4KMT4|Q5VZ53|Q7M4Q4	Missense_Mutation	SNP	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	p.P49T	ENST00000413767.2	37	c.145	CCDS6500.1	9	.	.	.	.	.	.	.	.	.	.	g	5.685	0.311030	0.10733	.	.	ENSG00000234829	ENST00000413767	T	0.03553	3.89	2.87	-5.74	0.02391	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.348813	0.29846	N	0.011045	T	0.03915	0.0110	L	0.56340	1.77	0.09310	N	1	B	0.29508	0.246	B	0.31751	0.135	T	0.07849	-1.0751	10	0.48119	T	0.1	.	9.4961	0.38989	0.1913:0.62:0.1887:0.0	.	49	P01571	IFN17_HUMAN	T	49	ENSP00000411940:P49T	ENSP00000411940:P49T	P	-	1	0	IFNA17	21218028	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.157000	0.10085	-2.207000	0.00740	-0.717000	0.03617	CCT	IFNA17	-	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core	ENSG00000234829		0.507	IFNA17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNA17	HGNC	protein_coding	OTTHUMT00000051896.1	110	0.00	0	G	NM_021268		21228028	21228028	-1	no_errors	ENST00000413767	ensembl	human	known	69_37n	missense	106	15.08	19	SNP	0.000	T
IFNA2	3440	genome.wustl.edu	37	9	21384861	21384861	+	Silent	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr9:21384861C>T	ENST00000380206.2	-	1	535	c.468G>A	c.(466-468)aaG>aaA	p.K156K		NM_000605.3	NP_000596.2	P01563	IFNA2_HUMAN	interferon, alpha 2	156					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of gene expression (GO:0010629)|negative regulation of interleukin-13 secretion (GO:2000666)|negative regulation of interleukin-5 secretion (GO:2000663)|negative regulation of T cell differentiation (GO:0045581)|negative regulation of T-helper 2 cell cytokine production (GO:2000552)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral entry into host cell (GO:0046597)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	type I interferon receptor binding (GO:0005132)			breast(2)|large_intestine(4)|lung(6)|upper_aerodigestive_tract(1)	13				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.0173)		GGCTGTATTTCTTCTCTTTCA	0.438																																						dbGAP											0													215.0	216.0	215.0					9																	21384861		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS6506.1	9p22	2010-08-24			ENSG00000188379	ENSG00000188379		"""Interferons"""	5423	protein-coding gene	gene with protein product	"""alpha-2a interferon"", ""interferon alpha 2b"", ""interferon alpha A"""	147562				1385305	Standard	NM_000605		Approved	IFNA, IFN-alphaA	uc003zpb.3	P01563	OTTHUMG00000019674	ENST00000380206.2:c.468G>A	9.37:g.21384861C>T			H2DF54|H2DF55|P01564|Q14606|Q6DJX8|Q96KI6	Silent	SNP	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	p.K156	ENST00000380206.2	37	c.468	CCDS6506.1	9																																																																																			IFNA2	-	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	ENSG00000188379		0.438	IFNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNA2	HGNC	protein_coding	OTTHUMT00000051903.1	163	0.00	0	C	NM_000605		21384861	21384861	-1	no_errors	ENST00000380206	ensembl	human	known	69_37n	silent	119	30.41	52	SNP	0.011	T
ITGAM	3684	genome.wustl.edu	37	16	31336602	31336602	+	Silent	SNP	G	G	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr16:31336602G>T	ENST00000287497.8	+	20	2457	c.2382G>T	c.(2380-2382)gtG>gtT	p.V794V	ITGAM_ENST00000544665.3_Silent_p.V795V			P11215	ITAM_HUMAN	integrin, alpha M (complement component 3 receptor 3 subunit)	794					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular extravasation (GO:0045123)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|microglia development (GO:0014005)|neutrophil chemotaxis (GO:0030593)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)			endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(1)|prostate(4)|skin(1)	56						GCCTCGTGGTGGGTGGGCCCC	0.607																																						dbGAP											0													53.0	55.0	55.0					16																	31336602		2040	4201	6241	-	-	-	SO:0001819	synonymous_variant	0			J03925	CCDS45470.1, CCDS54004.1	16p11.2	2010-03-23	2006-02-10			ENSG00000169896		"""CD molecules"", ""Complement system"", ""Integrins"""	6149	protein-coding gene	gene with protein product		120980	"""integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide)"""	CR3A, CD11B			Standard	NM_001145808		Approved	MAC-1, CD11b	uc002ebr.3	P11215		ENST00000287497.8:c.2382G>T	16.37:g.31336602G>T			Q4VAK0|Q4VAK1|Q4VAK2	Silent	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.V795	ENST00000287497.8	37	c.2385	CCDS45470.1	16																																																																																			ITGAM	-	pfam_Integrin_alpha-2	ENSG00000169896		0.607	ITGAM-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGAM	HGNC	protein_coding	OTTHUMT00000432816.1	96	0.00	0	G	NM_000632		31336602	31336602	+1	no_errors	ENST00000544665	ensembl	human	known	69_37n	silent	58	36.96	34	SNP	1.000	T
KCMF1	56888	genome.wustl.edu	37	2	85280380	85280380	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr2:85280380G>A	ENST00000409785.4	+	7	1353	c.994G>A	c.(994-996)Gag>Aag	p.E332K		NM_020122.4	NP_064507.3	Q9P0J7	KCMF1_HUMAN	potassium channel modulatory factor 1	332							ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			ovary(3)	3						AGTGCGTGAAGAGAGCTCATC	0.493																																						dbGAP											0													59.0	64.0	63.0					2																	85280380		1966	4163	6129	-	-	-	SO:0001583	missense	0			AF155652	CCDS46350.1	2p11.2	2010-11-23			ENSG00000176407	ENSG00000176407		"""Zinc fingers, ZZ-type"""	20589	protein-coding gene	gene with protein product		614719					Standard	NM_020122		Approved	DEBT91, PCMF, DKFZP434L1021, ZZZ1	uc002sox.4	Q9P0J7	OTTHUMG00000153004	ENST00000409785.4:c.994G>A	2.37:g.85280380G>A	ENSP00000386738:p.Glu332Lys		Q4ZG04|Q53SC7|Q9BWK2|Q9H8P5|Q9UFE8	Missense_Mutation	SNP	pfam_Znf_ZZ,pfam_Di19_RING_finger_144,smart_Znf_ZZ,smart_Znf_C2H2-like,pfscan_Znf_ZZ,pfscan_Znf_C2H2	p.E332K	ENST00000409785.4	37	c.994	CCDS46350.1	2	.	.	.	.	.	.	.	.	.	.	G	19.99	3.928778	0.73327	.	.	ENSG00000176407	ENST00000409785	T	0.43688	0.94	5.96	5.96	0.96718	.	0.111618	0.64402	D	0.000003	T	0.36441	0.0967	L	0.47716	1.5	0.54753	D	0.999982	B	0.25667	0.131	B	0.17433	0.018	T	0.16778	-1.0391	10	0.10636	T	0.68	-5.3008	17.8952	0.88886	0.0:0.0:1.0:0.0	.	332	Q9P0J7	KCMF1_HUMAN	K	332	ENSP00000386738:E332K	ENSP00000386738:E332K	E	+	1	0	KCMF1	85133891	1.000000	0.71417	0.999000	0.59377	0.971000	0.66376	6.378000	0.73150	2.819000	0.97034	0.585000	0.79938	GAG	KCMF1	-	NULL	ENSG00000176407		0.493	KCMF1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	KCMF1	HGNC	protein_coding	OTTHUMT00000328942.4	39	0.00	0	G	NM_020122		85280380	85280380	+1	no_errors	ENST00000409785	ensembl	human	known	69_37n	missense	31	26.19	11	SNP	1.000	A
KIAA1107	23285	genome.wustl.edu	37	1	92649701	92649701	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr1:92649701G>C	ENST00000370378.4	+	9	3977	c.3879G>C	c.(3877-3879)caG>caC	p.Q1293H	KIAA1107_ENST00000409154.4_Missense_Mutation_p.Q1348H	NM_015237.2	NP_056052.2	Q9UPP5	K1107_HUMAN	KIAA1107	1348										breast(4)|central_nervous_system(1)|endometrium(3)|kidney(2)|prostate(1)|skin(3)	14						TAATCAATCAGACACTACTTT	0.388																																						dbGAP											0													107.0	83.0	90.0					1																	92649701		692	1591	2283	-	-	-	SO:0001583	missense	0			AB029030	CCDS44172.1	1p22.1	2008-02-05			ENSG00000069712	ENSG00000069712			29192	protein-coding gene	gene with protein product						10470851	Standard	NM_015237		Approved		uc010otd.2	Q9UPP5	OTTHUMG00000010292	ENST00000370378.4:c.3879G>C	1.37:g.92649701G>C	ENSP00000359404:p.Gln1293His		O14767|Q8N3X7	Missense_Mutation	SNP	NULL	p.Q1348H	ENST00000370378.4	37	c.4044	CCDS44172.1	1	.	.	.	.	.	.	.	.	.	.	G	15.18	2.756038	0.49362	.	.	ENSG00000069712	ENST00000409154;ENST00000370378	T;T	0.08984	3.03;3.04	5.58	4.67	0.58626	.	0.054786	0.85682	D	0.000000	T	0.16727	0.0402	M	0.63843	1.955	0.50632	D	0.999886	D	0.89917	1.0	D	0.76575	0.988	T	0.00855	-1.1539	10	0.87932	D	0	.	14.2219	0.65833	0.0717:0.0:0.9283:0.0	.	1293	E9PEZ5	.	H	1348;1293	ENSP00000386957:Q1348H;ENSP00000359404:Q1293H	ENSP00000359404:Q1293H	Q	+	3	2	KIAA1107	92422289	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.476000	0.60216	1.366000	0.46076	0.563000	0.77884	CAG	KIAA1107	-	NULL	ENSG00000069712		0.388	KIAA1107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1107	HGNC	protein_coding	OTTHUMT00000028375.3	54	0.00	0	G	XM_034086		92649701	92649701	+1	no_errors	ENST00000409154	ensembl	human	known	69_37n	missense	25	37.50	15	SNP	1.000	C
KRT79	338785	genome.wustl.edu	37	12	53225306	53225306	+	Silent	SNP	G	G	C			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr12:53225306G>C	ENST00000330553.5	-	2	616	c.582C>G	c.(580-582)ctC>ctG	p.L194L		NM_175834.2	NP_787028.1	Q5XKE5	K2C79_HUMAN	keratin 79	194	Linker 1.|Rod.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	enzyme binding (GO:0019899)|structural molecule activity (GO:0005198)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						AGGCCTCAAAGAGGGGCTCCA	0.607																																						dbGAP											0													101.0	94.0	96.0					12																	53225306		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ564105	CCDS8839.1	12q13.13	2014-02-12	2007-07-03		ENSG00000185640	ENSG00000185640		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28930	protein-coding gene	gene with protein product	"""keratin 6-like"""	611160				11683385	Standard	NM_175834		Approved	K6L, KRT6L	uc001sbb.3	Q5XKE5	OTTHUMG00000169878	ENST00000330553.5:c.582C>G	12.37:g.53225306G>C			Q6P465|Q7Z793	Silent	SNP	pfam_F,superfamily_STAT_TF_coiled-coil,prints_Keratin_II	p.L194	ENST00000330553.5	37	c.582	CCDS8839.1	12																																																																																			KRT79	-	pfam_F,superfamily_STAT_TF_coiled-coil	ENSG00000185640		0.607	KRT79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT79	HGNC	protein_coding	OTTHUMT00000406376.1	105	0.00	0	G	NM_175834		53225306	53225306	-1	no_errors	ENST00000330553	ensembl	human	known	69_37n	silent	48	40.74	33	SNP	1.000	C
KTN1	3895	genome.wustl.edu	37	14	56107112	56107112	+	Silent	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr14:56107112C>T	ENST00000395314.3	+	15	2003	c.1935C>T	c.(1933-1935)ttC>ttT	p.F645F	KTN1_ENST00000438792.2_Silent_p.F645F|KTN1_ENST00000395311.1_Silent_p.F645F|KTN1_ENST00000395308.1_Silent_p.F645F|KTN1_ENST00000395309.3_Silent_p.F645F|KTN1_ENST00000416613.1_Silent_p.F645F|KTN1_ENST00000413890.2_Silent_p.F645F	NM_001079521.1	NP_001072989.1	Q86UP2	KTN1_HUMAN	kinectin 1 (kinesin receptor)	645					microtubule-based movement (GO:0007018)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|large_intestine(8)|lung(1)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	19						ATATGAATTTCTTATTAAAAG	0.303			T	RET	papillary thryoid																																	dbGAP		Dom	yes		14	14q22.1	3895	kinectin 1 (kinesin receptor)		E	0													56.0	60.0	58.0					14																	56107112		2194	4287	6481	-	-	-	SO:0001819	synonymous_variant	0				CCDS41957.1, CCDS41958.1, CCDS41959.1	14q22.1	2008-05-02			ENSG00000126777	ENSG00000126777			6467	protein-coding gene	gene with protein product		600381				9605849	Standard	NM_001079521		Approved	KIAA0004, CG1	uc001xcc.3	Q86UP2	OTTHUMG00000140312	ENST00000395314.3:c.1935C>T	14.37:g.56107112C>T			B4DZ88|Q13999|Q14707|Q15387|Q17RZ5|Q5GGW3|Q86W57	Silent	SNP	NULL	p.F645	ENST00000395314.3	37	c.1935	CCDS41957.1	14																																																																																			KTN1	-	NULL	ENSG00000126777		0.303	KTN1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KTN1	HGNC	protein_coding	OTTHUMT00000276912.2	125	0.00	0	C			56107112	56107112	+1	no_errors	ENST00000395309	ensembl	human	known	69_37n	silent	84	31.15	38	SNP	0.999	T
LAMA3	3909	genome.wustl.edu	37	18	21417017	21417017	+	Silent	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr18:21417017C>T	ENST00000313654.9	+	25	3298	c.3057C>T	c.(3055-3057)gaC>gaT	p.D1019D	LAMA3_ENST00000399516.3_Silent_p.D1019D	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	1019	Domain IV 1 (domain IV B).				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					CAGATGCAGACATTCAGCTCA	0.438																																						dbGAP											0													100.0	105.0	103.0					18																	21417017		2101	4240	6341	-	-	-	SO:0001819	synonymous_variant	0			L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.3057C>T	18.37:g.21417017C>T			B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Silent	SNP	pfam_EGF_laminin,pfam_Laminin_G,pfam_Laminin_I,pfam_Laminin_N,pfam_Laminin_II,pfam_Laminin_B_type_IV,superfamily_ConA-like_lec_gl,superfamily_Growth_fac_rcpt,superfamily_Galactose-bd-like,superfamily_STAT_TF_coiled-coil,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.D1019	ENST00000313654.9	37	c.3057	CCDS42419.1	18																																																																																			LAMA3	-	NULL	ENSG00000053747		0.438	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA3	HGNC	protein_coding	OTTHUMT00000254824.3	156	0.00	0	C	NM_000227, NM_198129		21417017	21417017	+1	no_errors	ENST00000313654	ensembl	human	known	69_37n	silent	75	62.50	125	SNP	0.037	T
LETM2	137994	genome.wustl.edu	37	8	38258464	38258464	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr8:38258464C>T	ENST00000379957.4	+	6	1004	c.877C>T	c.(877-879)Cag>Tag	p.Q293*	LETM2_ENST00000527710.1_Nonsense_Mutation_p.Q79*|RP11-350N15.3_ENST00000533301.1_RNA|LETM2_ENST00000528827.1_3'UTR|LETM2_ENST00000297720.5_Nonsense_Mutation_p.Q198*|LETM2_ENST00000523983.2_Nonsense_Mutation_p.Q246*|LETM2_ENST00000524874.1_Nonsense_Mutation_p.Q245*	NM_001199659.1	NP_001186588.1	Q2VYF4	LETM2_HUMAN	leucine zipper-EF-hand containing transmembrane protein 2	293	LETM1.					integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				NS(1)|large_intestine(1)|lung(3)|prostate(2)	7	all_cancers(2;6.77e-47)|all_epithelial(2;1.01e-50)|all_lung(3;1.25e-23)|Lung NSC(2;2.76e-23)|Colorectal(12;0.000442)|Esophageal squamous(3;0.00202)	all_lung(54;0.0657)|Hepatocellular(245;0.152)|Lung NSC(58;0.175)	Epithelial(3;1.17e-42)|all cancers(3;5.44e-38)|BRCA - Breast invasive adenocarcinoma(5;5.44e-27)|LUSC - Lung squamous cell carcinoma(2;7.12e-25)|Lung(2;4.49e-22)|COAD - Colon adenocarcinoma(9;0.114)			AGATCGCCCTCAGCTGGTTGC	0.498																																						dbGAP											0													118.0	110.0	113.0					8																	38258464		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK058138	CCDS6106.1, CCDS56534.1, CCDS69466.1, CCDS75731.1	8p12	2013-01-11						"""EF-hand domain containing"""	14648	protein-coding gene	gene with protein product						11549311	Standard	NM_001286821		Approved	FLJ25409	uc003xlm.2	Q2VYF4		ENST00000379957.4:c.877C>T	8.37:g.38258464C>T	ENSP00000369291:p.Gln293*		A6NMG3|Q8NCR2|Q96LL1	Nonsense_Mutation	SNP	pfam_LETM1	p.Q293*	ENST00000379957.4	37	c.877		8	.	.	.	.	.	.	.	.	.	.	C	39	7.828024	0.98513	.	.	ENSG00000165046	ENST00000297720;ENST00000524874;ENST00000379957;ENST00000523983;ENST00000527710	.	.	.	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-14.3136	20.5792	0.99380	0.0:1.0:0.0:0.0	.	.	.	.	X	198;245;293;246;79	.	ENSP00000297720:Q198X	Q	+	1	0	LETM2	38377621	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	7.487000	0.81328	2.873000	0.98535	0.561000	0.74099	CAG	LETM2	-	pfam_LETM1	ENSG00000165046		0.498	LETM2-013	KNOWN	basic|appris_candidate_longest	protein_coding	LETM2	HGNC	protein_coding	OTTHUMT00000381816.1	83	0.00	0	C	NM_144652		38258464	38258464	+1	no_errors	ENST00000379957	ensembl	human	known	69_37n	nonsense	86	27.12	32	SNP	1.000	T
LGI2	55203	genome.wustl.edu	37	4	25005818	25005818	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr4:25005818C>G	ENST00000382114.4	-	8	1078	c.893G>C	c.(892-894)gGt>gCt	p.G298A		NM_018176.3	NP_060646.2	Q8N0V4	LGI2_HUMAN	leucine-rich repeat LGI family, member 2	298						extracellular region (GO:0005576)				breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(15)|prostate(1)|skin(3)|stomach(2)	33		Breast(46;0.173)				GTGAGAGCCACCGAAGAGCTG	0.478																																						dbGAP											0													175.0	177.0	176.0					4																	25005818		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ487516	CCDS3431.1	4p15.31	2008-07-28			ENSG00000153012	ENSG00000153012			18710	protein-coding gene	gene with protein product		608301				12023020, 16014869	Standard	NM_018176		Approved	KIAA1916, FLJ10675	uc003grf.2	Q8N0V4	OTTHUMG00000097749	ENST00000382114.4:c.893G>C	4.37:g.25005818C>G	ENSP00000371548:p.Gly298Ala		Q3MIN2|Q8NDW6|Q96PX2|Q9NVK4	Missense_Mutation	SNP	pfam_EPTP,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,pfscan_EAR	p.G298A	ENST00000382114.4	37	c.893	CCDS3431.1	4	.	.	.	.	.	.	.	.	.	.	C	21.5	4.163112	0.78226	.	.	ENSG00000153012	ENST00000382114	T	0.21543	2.0	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.46347	0.1388	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.14476	-1.0471	10	0.42905	T	0.14	-31.5205	19.8769	0.96880	0.0:1.0:0.0:0.0	.	298	Q8N0V4	LGI2_HUMAN	A	298	ENSP00000371548:G298A	ENSP00000371548:G298A	G	-	2	0	LGI2	24614916	1.000000	0.71417	0.992000	0.48379	0.984000	0.73092	7.776000	0.85560	2.767000	0.95098	0.557000	0.71058	GGT	LGI2	-	pfam_EPTP	ENSG00000153012		0.478	LGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGI2	HGNC	protein_coding	OTTHUMT00000214978.1	52	0.00	0	C			25005818	25005818	-1	no_errors	ENST00000382114	ensembl	human	known	69_37n	missense	36	29.41	15	SNP	1.000	G
LLPH	84298	genome.wustl.edu	37	12	66522788	66522788	+	Silent	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr12:66522788G>A	ENST00000266604.2	-	2	169	c.99C>T	c.(97-99)ctC>ctT	p.L33L	TMBIM4_ENST00000539652.1_3'UTR|RP11-745O10.2_ENST00000510317.2_RNA|LLPH_ENST00000446587.2_Silent_p.L33L|TMBIM4_ENST00000556010.1_3'UTR	NM_032338.3	NP_115714.1	Q9BRT6	LLPH_HUMAN	LLP homolog, long-term synaptic facilitation (Aplysia)	33	Lys-rich.						poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(1)|skin(1)	5						CGTCTAGTTTGAGAATACTTT	0.408																																						dbGAP											0													104.0	98.0	100.0					12																	66522788		2203	4297	6500	-	-	-	SO:0001819	synonymous_variant	0			AK057947	CCDS8974.1	12q14.3	2014-05-09	2008-10-02	2008-10-02	ENSG00000139233	ENSG00000139233			28229	protein-coding gene	gene with protein product	"""human LAPS18-like protein"""		"""chromosome 12 open reading frame 31"""	C12orf31		12477932	Standard	NM_032338		Approved	MGC14817, hLLP	uc010ssw.2	Q9BRT6	OTTHUMG00000168959	ENST00000266604.2:c.99C>T	12.37:g.66522788G>A			Q3B766	Silent	SNP	pfam_LAPS18-like	p.L33	ENST00000266604.2	37	c.99	CCDS8974.1	12																																																																																			LLPH	-	pfam_LAPS18-like	ENSG00000139233		0.408	LLPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LLPH	HGNC	protein_coding	OTTHUMT00000401752.1	176	0.00	0	G	NM_032338		66522788	66522788	-1	no_errors	ENST00000266604	ensembl	human	known	69_37n	silent	117	29.94	50	SNP	0.998	A
LHX5	64211	genome.wustl.edu	37	12	113906151	113906151	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr12:113906151G>T	ENST00000261731.3	-	3	1029	c.456C>A	c.(454-456)gaC>gaA	p.D152E		NM_022363.2	NP_071758.1	Q9H2C1	LHX5_HUMAN	LIM homeobox 5	152					cell proliferation in forebrain (GO:0021846)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellar Purkinje cell-granule cell precursor cell signaling involved in regulation of granule cell precursor cell proliferation (GO:0021937)|forebrain neuron differentiation (GO:0021879)|hippocampus development (GO:0021766)|positive regulation of transcription, DNA-templated (GO:0045893)|spinal cord association neuron differentiation (GO:0021527)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	10						TCTCTTTGGGGTCGTCCTGCA	0.662																																						dbGAP											0													110.0	89.0	96.0					12																	113906151		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF291181	CCDS9171.1	12q24.13	2014-01-15			ENSG00000089116	ENSG00000089116		"""Homeoboxes / LIM class"""	14216	protein-coding gene	gene with protein product		605992					Standard	NM_022363		Approved		uc001tvj.1	Q9H2C1	OTTHUMG00000169552	ENST00000261731.3:c.456C>A	12.37:g.113906151G>T	ENSP00000261731:p.Asp152Glu		Q32MA4	Missense_Mutation	SNP	pfam_Znf_LIM,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_LIM,smart_Homeodomain,pfscan_Znf_LIM,pfscan_Homeodomain	p.D152E	ENST00000261731.3	37	c.456	CCDS9171.1	12	.	.	.	.	.	.	.	.	.	.	G	14.88	2.667428	0.47677	.	.	ENSG00000089116	ENST00000261731	D	0.91124	-2.79	4.85	3.03	0.35002	.	0.104207	0.40222	N	0.001143	T	0.81083	0.4749	N	0.25647	0.755	0.48830	D	0.999715	B	0.06786	0.001	B	0.08055	0.003	T	0.68315	-0.5441	10	0.20046	T	0.44	.	6.9003	0.24279	0.1551:0.1425:0.7024:0.0	.	152	Q9H2C1	LHX5_HUMAN	E	152	ENSP00000261731:D152E	ENSP00000261731:D152E	D	-	3	2	LHX5	112390534	1.000000	0.71417	0.998000	0.56505	0.957000	0.61999	2.260000	0.43267	0.466000	0.27193	-0.327000	0.08410	GAC	LHX5	-	NULL	ENSG00000089116		0.662	LHX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LHX5	HGNC	protein_coding	OTTHUMT00000404788.3	141	0.00	0	G	NM_022363		113906151	113906151	-1	no_errors	ENST00000261731	ensembl	human	known	69_37n	missense	72	37.93	44	SNP	1.000	T
LRCH3	84859	genome.wustl.edu	37	3	197574833	197574833	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr3:197574833G>T	ENST00000425562.2	+	12	1471	c.1471G>T	c.(1471-1473)Gag>Tag	p.E491*	LRCH3_ENST00000441090.2_Nonsense_Mutation_p.E337*|LRCH3_ENST00000334859.4_Nonsense_Mutation_p.E491*|LRCH3_ENST00000414675.2_Nonsense_Mutation_p.E463*|LRCH3_ENST00000536618.1_Nonsense_Mutation_p.E86*|LRCH3_ENST00000438796.2_Nonsense_Mutation_p.E491*			Q96II8	LRCH3_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 3	491						cytoplasm (GO:0005737)|extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;4.82e-24)|all cancers(36;3.61e-22)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.119)		CCTGCAGTATGAGGAGGAGAA	0.507																																						dbGAP											0													115.0	106.0	109.0					3																	197574833		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AL137527	CCDS3330.1	3q29	2006-04-12			ENSG00000186001	ENSG00000186001			28637	protein-coding gene	gene with protein product						12477932	Standard	NM_032773		Approved	MGC4126	uc003fyj.1	Q96II8	OTTHUMG00000155378	ENST00000425562.2:c.1471G>T	3.37:g.197574833G>T	ENSP00000393579:p.Glu491*		B4E0T7|Q96FP9|Q9NT52	Nonsense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_CH-domain,superfamily_CH-domain,smart_Leu-rich_rpt_typical-subtyp,smart_CH-domain,pfscan_CH-domain	p.E491*	ENST00000425562.2	37	c.1471		3	.	.	.	.	.	.	.	.	.	.	G	40	8.068032	0.98638	.	.	ENSG00000186001	ENST00000438796;ENST00000441090;ENST00000414675;ENST00000334859;ENST00000425562;ENST00000536618;ENST00000452660	.	.	.	5.49	5.49	0.81192	.	0.179734	0.48767	D	0.000178	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-13.61	17.2024	0.86909	0.0:0.0:1.0:0.0	.	.	.	.	X	491;337;463;491;491;86;2	.	ENSP00000334375:E491X	E	+	1	0	LRCH3	199059230	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.524000	0.60552	2.588000	0.87417	0.644000	0.83932	GAG	LRCH3	-	NULL	ENSG00000186001		0.507	LRCH3-006	KNOWN	basic	protein_coding	LRCH3	HGNC	protein_coding	OTTHUMT00000339965.1	85	0.00	0	G	NM_032773		197574833	197574833	+1	no_errors	ENST00000438796	ensembl	human	known	69_37n	nonsense	32	54.29	38	SNP	1.000	T
LRRC27	80313	genome.wustl.edu	37	10	134161507	134161507	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr10:134161507G>C	ENST00000368614.3	+	6	678	c.573G>C	c.(571-573)gaG>gaC	p.E191D	LRRC27_ENST00000368612.1_Missense_Mutation_p.E129D|LRRC27_ENST00000368615.3_Missense_Mutation_p.E191D|LRRC27_ENST00000432555.2_Missense_Mutation_p.E64D|LRRC27_ENST00000368613.4_Missense_Mutation_p.E191D|LRRC27_ENST00000344079.5_Missense_Mutation_p.E191D|LRRC27_ENST00000356571.4_3'UTR|LRRC27_ENST00000392638.2_Missense_Mutation_p.E191D|LRRC27_ENST00000368610.3_Missense_Mutation_p.E129D	NM_030626.2	NP_085129.1	Q9C0I9	LRC27_HUMAN	leucine rich repeat containing 27	191										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)	18		all_cancers(35;6.28e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;9.12e-05)|Epithelial(32;0.000116)|all cancers(32;0.000145)|BRCA - Breast invasive adenocarcinoma(275;0.218)		CGGTTAGAGAGATGACCCTCC	0.567																																						dbGAP											0													107.0	115.0	112.0					10																	134161507		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB051461	CCDS31316.1, CCDS44496.1	10q26.3	2013-09-20			ENSG00000148814	ENSG00000148814			29346	protein-coding gene	gene with protein product						11214970	Standard	NM_030626		Approved	KIAA1674	uc010quw.1	Q9C0I9	OTTHUMG00000019284	ENST00000368614.3:c.573G>C	10.37:g.134161507G>C	ENSP00000357603:p.Glu191Asp		A6NE72|A6NJB4|A6NKD3|D3DRH0|Q5SZH6|Q5SZH8|Q5SZH9|Q86XT5|Q8N7C8|Q8NA21	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.E191D	ENST00000368614.3	37	c.573	CCDS31316.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.349|8.349	0.830475|0.830475	0.16749|0.16749	.|.	.|.	ENSG00000148814|ENSG00000148814	ENST00000368615;ENST00000392638;ENST00000344079;ENST00000368614;ENST00000368613;ENST00000368612;ENST00000368610;ENST00000432555|ENST00000450442	T;T;T;T;T;T;T;T|.	0.45276|.	2.58;2.5;2.5;2.51;2.51;4.27;4.27;0.9|.	2.7|2.7	1.78|1.78	0.24846|0.24846	.|.	1.920320|.	0.03046|.	N|.	0.153901|.	T|T	0.23210|0.23210	0.0561|0.0561	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	1|1	B;B;B;B;B|.	0.34161|.	0.095;0.439;0.066;0.016;0.372|.	B;B;B;B;B|.	0.29716|.	0.037;0.106;0.023;0.005;0.074|.	T|T	0.21381|0.21381	-1.0247|-1.0247	10|5	0.26408|.	T|.	0.33|.	-4.4257|-4.4257	5.5866|5.5866	0.17277|0.17277	0.1563:0.0:0.8437:0.0|0.1563:0.0:0.8437:0.0	.|.	191;64;129;191;191|.	Q9C0I9-4;B4DW88;Q9C0I9-2;Q9C0I9;Q9C0I9-3|.	.;.;.;LRC27_HUMAN;.|.	D|T	191;191;191;191;191;129;129;64|143	ENSP00000357604:E191D;ENSP00000376413:E191D;ENSP00000342641:E191D;ENSP00000357603:E191D;ENSP00000357602:E191D;ENSP00000357601:E129D;ENSP00000357599:E129D;ENSP00000407949:E64D|.	ENSP00000342641:E191D|.	E|R	+|+	3|2	2|0	LRRC27|LRRC27	134011497|134011497	0.001000|0.001000	0.12720|0.12720	0.001000|0.001000	0.08648|0.08648	0.000000|0.000000	0.00434|0.00434	1.033000|1.033000	0.30191|0.30191	0.706000|0.706000	0.31912|0.31912	-0.140000|-0.140000	0.14226|0.14226	GAG|AGA	LRRC27	-	NULL	ENSG00000148814		0.567	LRRC27-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRRC27	HGNC	protein_coding	OTTHUMT00000051058.2	35	0.00	0	G	XM_290462		134161507	134161507	+1	no_errors	ENST00000368613	ensembl	human	known	69_37n	missense	6	40.00	4	SNP	0.001	C
LY6K	54742	genome.wustl.edu	37	8	143784680	143784680	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr8:143784680C>T	ENST00000292430.6	+	3	806	c.389C>T	c.(388-390)tCa>tTa	p.S130L	LY6K_ENST00000561179.1_Missense_Mutation_p.S188L|CTD-2292P10.4_ENST00000520572.1_RNA|LY6K_ENST00000519387.1_3'UTR|LY6K_ENST00000522591.1_3'UTR|LY6K_ENST00000519390.1_3'UTR			Q17RY6	LY6K_HUMAN	lymphocyte antigen 6 complex, locus K	130	UPAR/Ly6.					anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(2)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(4)	10	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					CCTATCAACTCATCAGTGTTC	0.542																																						dbGAP											0													105.0	102.0	103.0					8																	143784680		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK092545	CCDS6385.1, CCDS6385.2, CCDS59114.1	8q24.3	2009-08-06				ENSG00000160886			24225	protein-coding gene	gene with protein product	"""cancer/testis antigen 97"""	615093				12516096	Standard	NM_017527		Approved	HSJ001348, FLJ35226, CT97	uc011ljv.2	Q17RY6		ENST00000292430.6:c.389C>T	8.37:g.143784680C>T	ENSP00000292430:p.Ser130Leu		G3V116|O15227|Q9BVD7	Missense_Mutation	SNP	NULL	p.S188L	ENST00000292430.6	37	c.563	CCDS6385.2	8	.	.	.	.	.	.	.	.	.	.	C	6.231	0.410667	0.11812	.	.	ENSG00000160886	ENST00000292430	.	.	.	2.08	-4.16	0.03869	.	.	.	.	.	T	0.09730	0.0239	N	0.08118	0	0.09310	N	1	B	0.30406	0.278	B	0.19391	0.025	T	0.15235	-1.0444	8	0.30854	T	0.27	.	0.2884	0.00255	0.2644:0.1837:0.2961:0.2557	.	130	Q17RY6	LY6K_HUMAN	L	188	.	ENSP00000292430:S188L	S	+	2	0	LY6K	143781682	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.349000	0.07731	-1.633000	0.01539	-1.749000	0.00680	TCA	LY6K	-	NULL	ENSG00000160886		0.542	LY6K-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	LY6K	HGNC	protein_coding	OTTHUMT00000379893.2	175	0.00	0	C	NM_017527		143784680	143784680	+1	no_errors	ENST00000561179	ensembl	human	known	69_37n	missense	168	24.32	54	SNP	0.000	T
MAPT	4137	genome.wustl.edu	37	17	44067416	44067416	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr17:44067416C>G	ENST00000571987.1	+	7	1355	c.1355C>G	c.(1354-1356)tCt>tGt	p.S452C	MAPT_ENST00000334239.8_Intron|MAPT_ENST00000351559.5_Intron|MAPT_ENST00000262410.5_Missense_Mutation_p.S452C|MAPT_ENST00000431008.3_Intron|MAPT_ENST00000570299.1_Intron|MAPT_ENST00000340799.5_Intron|MAPT_ENST00000420682.2_Intron|MAPT_ENST00000347967.5_Intron|MAPT_ENST00000576518.1_Intron|MAPT_ENST00000344290.5_Missense_Mutation_p.S452C|MAPT_ENST00000535772.1_Intron|MAPT_ENST00000446361.3_Intron|MAPT_ENST00000415613.2_Missense_Mutation_p.S452C|MAPT_ENST00000574436.1_Intron			P10636	TAU_HUMAN	microtubule-associated protein tau	452					adult walking behavior (GO:0007628)|apoptotic process (GO:0006915)|axon cargo transport (GO:0008088)|axon extension (GO:0048675)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|generation of neurons (GO:0048699)|microtubule cytoskeleton organization (GO:0000226)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of microtubule polymerization (GO:0031116)|regulation of autophagy (GO:0010506)|regulation of microtubule polymerization (GO:0031113)|regulation of microtubule-based movement (GO:0060632)	axon (GO:0030424)|axoneme (GO:0005930)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|growth cone (GO:0030426)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nuclear periphery (GO:0034399)|plasma membrane (GO:0005886)|tubulin complex (GO:0045298)	apolipoprotein binding (GO:0034185)|enzyme binding (GO:0019899)|lipoprotein particle binding (GO:0071813)|microtubule binding (GO:0008017)|SH3 domain binding (GO:0017124)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		Melanoma(429;0.216)			Docetaxel(DB01248)|Paclitaxel(DB01229)	ACTGGCAGTTCTGGAGCAAAG	0.493																																						dbGAP											0													97.0	98.0	98.0					17																	44067416		2203	4300	6503	-	-	-	SO:0001583	missense	0			J03778	CCDS11499.1, CCDS11500.1, CCDS11501.1, CCDS11502.1, CCDS45715.1, CCDS45716.1, CCDS56033.1	17q21	2014-09-17			ENSG00000186868	ENSG00000186868			6893	protein-coding gene	gene with protein product	"""G protein beta1/gamma2 subunit-interacting factor 1"", ""microtubule-associated protein tau, isoform 4"", ""protein phosphatase 1, regulatory subunit 103"""	157140		DDPAC, MAPTL		7936241, 3131773	Standard	NM_001123067		Approved	MTBT1, tau, PPND, FTDP-17, TAU, MSTD, MTBT2, FLJ31424, MGC138549, PPP1R103	uc010dau.3	P10636	OTTHUMG00000168833	ENST00000571987.1:c.1355C>G	17.37:g.44067416C>G	ENSP00000458742:p.Ser452Cys		P18518|Q14799|Q15549|Q15550|Q15551|Q1RMF6|Q53YB1|Q5CZI7|Q5XWF0|Q6QT54|Q9UDJ3|Q9UMH0|Q9UQ96	Missense_Mutation	SNP	pfam_Tau/MAP_tubulin-bd_rpt,prints_Tau_protein	p.S452C	ENST00000571987.1	37	c.1355	CCDS11501.1	17	.	.	.	.	.	.	.	.	.	.	C	18.33	3.599558	0.66332	.	.	ENSG00000186868	ENST00000344290;ENST00000262410;ENST00000415613	T;T;T	0.32753	1.44;1.44;1.44	5.17	3.14	0.36123	.	0.376195	0.19799	N	0.105798	T	0.41166	0.1147	L	0.50333	1.59	0.80722	D	1	D;D	0.71674	0.998;0.997	P;P	0.61592	0.891;0.781	T	0.21724	-1.0237	10	0.72032	D	0.01	1.0E-4	6.7506	0.23485	0.0:0.7261:0.1792:0.0947	.	452;452	P10636-9;P10636	.;TAU_HUMAN	C	452	ENSP00000340820:S452C;ENSP00000262410:S452C;ENSP00000410838:S452C	ENSP00000262410:S452C	S	+	2	0	MAPT	41423253	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	2.034000	0.41145	0.725000	0.32318	0.491000	0.48974	TCT	MAPT	-	NULL	ENSG00000186868		0.493	MAPT-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	MAPT	HGNC	protein_coding	OTTHUMT00000440133.1	116	0.00	0	C	NM_016835		44067416	44067416	+1	no_errors	ENST00000344290	ensembl	human	known	69_37n	missense	48	31.51	23	SNP	1.000	G
MKL2	57496	genome.wustl.edu	37	16	14339391	14339391	+	Silent	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr16:14339391C>T	ENST00000341243.5	+	9	1053	c.1053C>T	c.(1051-1053)ctC>ctT	p.L351L	MKL2_ENST00000571589.1_Silent_p.L362L|MKL2_ENST00000574045.1_Silent_p.L362L|MKL2_ENST00000318282.5_Silent_p.L362L			Q9ULH7	MKL2_HUMAN	MKL/myocardin-like 2	351					blood vessel morphogenesis (GO:0048514)|cardiac muscle tissue development (GO:0048738)|embryonic organ development (GO:0048568)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|muscle organ development (GO:0007517)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(6)|liver(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						GAAGGCCACTCAATGACAAAA	0.333																																						dbGAP											0													96.0	93.0	94.0					16																	14339391		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AB033069	CCDS32391.1	16p13.12	2012-11-29			ENSG00000186260	ENSG00000186260			29819	protein-coding gene	gene with protein product		609463				10574462	Standard	NM_014048		Approved	MRTF-B, FLJ31823	uc002dcg.3	Q9ULH7	OTTHUMG00000177379	ENST00000341243.5:c.1053C>T	16.37:g.14339391C>T			A6ND53|B4DGT8|Q68CT1|Q6UB16|Q86WW2|Q8N226	Silent	SNP	pfam_RPEL_repeat,pfam_SAP_DNA-bd,smart_RPEL_repeat,smart_SAP_DNA-bd,pfscan_RPEL_repeat,pfscan_SAP_DNA-bd	p.L351	ENST00000341243.5	37	c.1053		16																																																																																			MKL2	-	NULL	ENSG00000186260		0.333	MKL2-202	KNOWN	basic	protein_coding	MKL2	HGNC	protein_coding		69	0.00	0	C	NM_014048		14339391	14339391	+1	no_errors	ENST00000341243	ensembl	human	known	69_37n	silent	61	48.74	58	SNP	0.862	T
MOSPD2	158747	genome.wustl.edu	37	X	14915213	14915213	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chrX:14915213C>G	ENST00000380492.3	+	5	418	c.330C>G	c.(328-330)atC>atG	p.I110M	MOSPD2_ENST00000495110.1_3'UTR|MOSPD2_ENST00000482354.1_Missense_Mutation_p.I110M	NM_001177475.1|NM_152581.3	NP_001170946.1|NP_689794.1	Q8NHP6	MSPD2_HUMAN	motile sperm domain containing 2	110	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.					integral component of membrane (GO:0016021)|membrane (GO:0016020)	structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	Hepatocellular(33;0.183)					AAGTCTGGATCAGGGTGAAGT	0.328																																						dbGAP											0													86.0	82.0	84.0					X																	14915213		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL834345	CCDS14162.1	Xp22.31	2006-03-16			ENSG00000130150	ENSG00000130150			28381	protein-coding gene	gene with protein product						15533722	Standard	NM_152581		Approved	MGC26706	uc004cwi.3	Q8NHP6	OTTHUMG00000021170	ENST00000380492.3:c.330C>G	X.37:g.14915213C>G	ENSP00000369860:p.Ile110Met		Q8N3H2|Q8NA83	Missense_Mutation	SNP	pfam_CRAL-TRIO_dom,pfam_Major_sperm,superfamily_CRAL-TRIO_dom,superfamily_PapD-like,superfamily_CRAL/TRIO_N_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_Major_sperm	p.I110M	ENST00000380492.3	37	c.330	CCDS14162.1	X	.	.	.	.	.	.	.	.	.	.	C	16.42	3.117461	0.56505	.	.	ENSG00000130150	ENST00000380492	T	0.75821	-0.97	5.23	3.45	0.39498	Cellular retinaldehyde-binding/triple function, C-terminal (5);	0.093239	0.85682	D	0.000000	T	0.69655	0.3135	N	0.25485	0.75	0.40044	D	0.97568	P	0.51537	0.946	P	0.52386	0.697	T	0.67452	-0.5667	10	0.38643	T	0.18	.	11.5252	0.50576	0.0:0.8483:0.0:0.1517	.	110	Q8NHP6	MSPD2_HUMAN	M	110	ENSP00000369860:I110M	ENSP00000369860:I110M	I	+	3	3	MOSPD2	14825134	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	2.239000	0.43079	0.512000	0.28257	0.529000	0.55759	ATC	MOSPD2	-	pfam_CRAL-TRIO_dom,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	ENSG00000130150		0.328	MOSPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOSPD2	HGNC	protein_coding	OTTHUMT00000055837.1	99	0.00	0	C	NM_152581		14915213	14915213	+1	no_errors	ENST00000380492	ensembl	human	known	69_37n	missense	80	26.61	29	SNP	1.000	G
MPO	4353	genome.wustl.edu	37	17	56356465	56356465	+	Silent	SNP	G	G	C			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr17:56356465G>C	ENST00000225275.3	-	6	965	c.789C>G	c.(787-789)ctC>ctG	p.L263L	MPO_ENST00000340482.3_Silent_p.L295L|MPO_ENST00000578493.1_5'Flank	NM_000250.1	NP_000241.1	P05164	PERM_HUMAN	myeloperoxidase	263					aging (GO:0007568)|defense response (GO:0006952)|defense response to fungus (GO:0050832)|hydrogen peroxide catabolic process (GO:0042744)|hypochlorous acid biosynthetic process (GO:0002149)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of apoptotic process (GO:0043066)|negative regulation of growth of symbiont in host (GO:0044130)|oxidation-reduction process (GO:0055114)|removal of superoxide radicals (GO:0019430)|respiratory burst involved in defense response (GO:0002679)|response to food (GO:0032094)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|response to yeast (GO:0001878)	azurophil granule (GO:0042582)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|secretory granule (GO:0030141)	chromatin binding (GO:0003682)|heme binding (GO:0020037)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(13)|ovary(2)|pancreas(1)|skin(4)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	46					Aminosalicylic Acid(DB00233)|Bivalirudin(DB00006)|Calcipotriol(DB02300)|Carboplatin(DB00958)|Cefaclor(DB00833)|Cefdinir(DB00535)|Cisplatin(DB00515)|Cysteamine(DB00847)|Dapsone(DB00250)|Enoxaparin(DB01225)|Human Serum Albumin(DB00062)|L-Carnitine(DB00583)|Melatonin(DB01065)|Mesalazine(DB00244)|Nabumetone(DB00461)|Octreotide(DB00104)|Oxaliplatin(DB00526)|Propylthiouracil(DB00550)|Ticlopidine(DB00208)|Tolmetin(DB00500)	GGGTGAAGTCGAGGTCGTGGT	0.642																																						dbGAP											0													51.0	51.0	51.0					17																	56356465		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS11604.1	17q21.3-q23	2014-09-17				ENSG00000005381	1.11.1.7		7218	protein-coding gene	gene with protein product		606989					Standard	NM_000250		Approved		uc002ivu.1	P05164		ENST00000225275.3:c.789C>G	17.37:g.56356465G>C			A1L4B8|Q14862|Q4PJH5|Q9UCL7	Silent	SNP	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.L295	ENST00000225275.3	37	c.885	CCDS11604.1	17																																																																																			MPO	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	ENSG00000005381		0.642	MPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPO	HGNC	protein_coding	OTTHUMT00000443971.1	76	0.00	0	G			56356465	56356465	-1	no_errors	ENST00000340482	ensembl	human	known	69_37n	silent	35	33.96	18	SNP	0.222	C
MSH5	4439	genome.wustl.edu	37	6	31730243	31730243	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr6:31730243C>T	ENST00000375755.3	+	25	2726	c.2440C>T	c.(2440-2442)Cct>Tct	p.P814S	SAPCD1-AS1_ENST00000419679.1_RNA|MSH5_ENST00000375742.3_Missense_Mutation_p.P831S|MSH5_ENST00000375740.3_Missense_Mutation_p.P802S|MSH5-SAPCD1_ENST00000491552.1_3'UTR|MSH5_ENST00000375703.3_Missense_Mutation_p.P815S|SAPCD1_ENST00000415669.2_5'Flank|MSH5_ENST00000431848.2_Missense_Mutation_p.P513S|MSH5_ENST00000534153.4_Missense_Mutation_p.P831S|MSH5_ENST00000395853.1_Missense_Mutation_p.P488S|MSH5-SAPCD1_ENST00000493662.2_Missense_Mutation_p.P831S|SAPCD1_ENST00000425424.1_5'Flank|MSH5_ENST00000375750.3_Missense_Mutation_p.P814S	NM_002441.4	NP_002432.1	O43196	MSH5_HUMAN	mutS homolog 5	814					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)			breast(1)|ovary(2)|skin(2)	5						TTTGGAAGATCCTAACCTGGA	0.478								Direct reversal of damage;Mismatch excision repair (MMR)																														dbGAP											0													116.0	120.0	119.0					6																	31730243		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF070071	CCDS4720.1, CCDS34409.1, CCDS34410.1, CCDS34409.2	6p21.3	2013-09-12	2013-09-12		ENSG00000204410	ENSG00000204410			7328	protein-coding gene	gene with protein product		603382	"""mutS (E. coli) homolog 5"", ""mutS homolog 5 (E. coli)"""			9740671, 9787078, 17977839	Standard	NM_002441		Approved		uc011hbg.2	O43196	OTTHUMG00000167551	ENST00000375755.3:c.2440C>T	6.37:g.31730243C>T	ENSP00000364908:p.Pro814Ser		B0V033|B0V034|O60586|Q5BLU9|Q5SSR1|Q8IW44|Q9BQC7	Missense_Mutation	SNP	pfam_DNA_mismatch_repair_MutS_C,pfam_DNA_mismatch_repair_MutS_core,pfam_DNA_mismatch_repair_MutS_clamp,superfamily_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_C	p.P831S	ENST00000375755.3	37	c.2491	CCDS4720.1	6	.	.	.	.	.	.	.	.	.	.	C	16.15	3.040808	0.55003	.	.	ENSG00000204410;ENSG00000204410;ENSG00000204410;ENSG00000204410;ENSG00000204410;ENSG00000204410;ENSG00000204410;ENSG00000204410;ENSG00000204410;ENSG00000255152	ENST00000375755;ENST00000375742;ENST00000375750;ENST00000534153;ENST00000375703;ENST00000375740;ENST00000431848;ENST00000395853;ENST00000429846;ENST00000491552	D;D;D;D;D;D;D;D;T	0.87256	-1.87;-1.86;-1.87;-1.86;-1.87;-2.23;-1.7;-1.69;1.04	5.81	4.94	0.65067	.	0.390235	0.30076	N	0.010475	T	0.79100	0.4389	L	0.32530	0.975	0.39728	D	0.971571	B;D;P;B;D	0.62365	0.172;0.962;0.73;0.39;0.991	B;P;B;B;P	0.54629	0.041;0.667;0.085;0.257;0.757	T	0.76950	-0.2769	9	0.13108	T	0.6	-10.865	12.7075	0.57070	0.0:0.9203:0.0:0.0797	.	469;802;814;815;831	Q59EC5;O43196-4;O43196;O43196-2;O43196-3	.;.;MSH5_HUMAN;.;.	S	814;831;814;831;815;802;513;488;136;170	ENSP00000364908:P814S;ENSP00000364894:P831S;ENSP00000364903:P814S;ENSP00000431693:P831S;ENSP00000364855:P815S;ENSP00000364892:P802S;ENSP00000416784:P513S;ENSP00000379194:P488S;ENSP00000406849:P136S	ENSP00000364855:P815S	P	+	1	0	MSH5;MSH5-C6orf26	31838222	0.588000	0.26799	0.992000	0.48379	0.971000	0.66376	1.768000	0.38511	1.463000	0.47967	-0.140000	0.14226	CCT	MSH5	-	NULL	ENSG00000204410		0.478	MSH5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MSH5	HGNC	protein_coding	OTTHUMT00000076243.4	116	0.00	0	C			31730243	31730243	+1	no_errors	ENST00000375742	ensembl	human	known	69_37n	missense	70	15.66	13	SNP	0.997	T
MTOR	2475	genome.wustl.edu	37	1	11270881	11270881	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr1:11270881C>G	ENST00000361445.4	-	24	3720	c.3644G>C	c.(3643-3645)aGa>aCa	p.R1215T		NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	1215					cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	CTTGACAATTCTGCAGATGAG	0.398																																						dbGAP											0													102.0	91.0	95.0					1																	11270881		2203	4300	6503	-	-	-	SO:0001583	missense	0			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.3644G>C	1.37:g.11270881C>G	ENSP00000354558:p.Arg1215Thr		Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_DUF3385_TOR,pfam_FKBP_rapamycin-assoc_FKBP12-bd,pfam_FATC,superfamily_ARM-type_fold,superfamily_Kinase-like_dom,superfamily_FKBP_rapamycin-assoc_FKBP12-bd,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.R1215T	ENST00000361445.4	37	c.3644	CCDS127.1	1	.	.	.	.	.	.	.	.	.	.	C	19.49	3.837247	0.71373	.	.	ENSG00000198793	ENST00000361445;ENST00000539766	T	0.67171	-0.25	5.95	5.95	0.96441	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.81941	0.4929	M	0.78637	2.42	0.80722	D	1	D	0.54601	0.967	P	0.60789	0.879	T	0.82796	-0.0280	10	0.87932	D	0	-8.7117	20.3728	0.98895	0.0:1.0:0.0:0.0	.	1215	P42345	MTOR_HUMAN	T	1215	ENSP00000354558:R1215T	ENSP00000354558:R1215T	R	-	2	0	MTOR	11193468	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.448000	0.80631	2.826000	0.97356	0.579000	0.79373	AGA	MTOR	-	superfamily_ARM-type_fold	ENSG00000198793		0.398	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTOR	HGNC	protein_coding	OTTHUMT00000005558.1	76	0.00	0	C	NM_004958		11270881	11270881	-1	no_errors	ENST00000361445	ensembl	human	known	69_37n	missense	43	21.82	12	SNP	1.000	G
MYH2	4620	genome.wustl.edu	37	17	10447097	10447097	+	Silent	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr17:10447097G>A	ENST00000245503.5	-	8	1056	c.672C>T	c.(670-672)atC>atT	p.I224I	MYH2_ENST00000532183.2_Silent_p.I224I|MYH2_ENST00000397183.2_Silent_p.I224I|CTC-297N7.11_ENST00000587182.2_RNA	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	224	Myosin motor.				Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						GGTTGGCACTGATGATTTGAT	0.522																																						dbGAP											0													82.0	79.0	80.0					17																	10447097		2202	4281	6483	-	-	-	SO:0001819	synonymous_variant	0				CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.672C>T	17.37:g.10447097G>A			A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_Ribosomal_L29,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.I224	ENST00000245503.5	37	c.672	CCDS11156.1	17																																																																																			MYH2	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000125414		0.522	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH2	HGNC	protein_coding	OTTHUMT00000252726.3	129	0.00	0	G	NM_017534		10447097	10447097	-1	no_errors	ENST00000245503	ensembl	human	known	69_37n	silent	49	50.00	49	SNP	1.000	A
MYO9A	4649	genome.wustl.edu	37	15	72180453	72180453	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr15:72180453G>A	ENST00000356056.5	-	27	5619	c.5147C>T	c.(5146-5148)tCa>tTa	p.S1716L	MYO9A_ENST00000563542.1_5'Flank|MYO9A_ENST00000444904.1_Missense_Mutation_p.S1697L|MYO9A_ENST00000564571.1_Missense_Mutation_p.S1716L|MYO9A_ENST00000424560.1_Missense_Mutation_p.S1787L	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	1716	Tail.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						AAATCGCTGTGATGTCTGTAA	0.333																																						dbGAP											0													104.0	96.0	98.0					15																	72180453		2199	4297	6496	-	-	-	SO:0001583	missense	0			AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.5147C>T	15.37:g.72180453G>A	ENSP00000348349:p.Ser1716Leu		B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_RhoGAP_dom,pfam_Ras-assoc,pfam_IQ_motif_EF-hand-BS,superfamily_Rho_GTPase_activation_prot,smart_Ras-assoc,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_IQ_motif_EF-hand-BS,pfscan_Ras-assoc,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom,prints_Myosin_head_motor_dom	p.S1787L	ENST00000356056.5	37	c.5360	CCDS10239.1	15	.	.	.	.	.	.	.	.	.	.	G	11.95	1.792686	0.31685	.	.	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000444904	D;D;D	0.83506	-1.73;-1.7;-1.72	5.67	3.57	0.40892	.	.	.	.	.	T	0.64327	0.2588	N	0.08118	0	0.23909	N	0.996499	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.50947	-0.8767	9	0.23891	T	0.37	.	7.0923	0.25291	0.3184:0.0:0.6816:0.0	.	1787;1716	B2RTY4-4;B2RTY4	.;MYO9A_HUMAN	L	1716;1787;1697	ENSP00000348349:S1716L;ENSP00000399162:S1787L;ENSP00000398250:S1697L	ENSP00000348349:S1716L	S	-	2	0	MYO9A	69967507	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	2.068000	0.41471	1.397000	0.46682	0.484000	0.47621	TCA	MYO9A	-	NULL	ENSG00000066933		0.333	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO9A	HGNC	protein_coding	OTTHUMT00000257308.1	122	0.00	0	G	NM_006901		72180453	72180453	-1	no_errors	ENST00000424560	ensembl	human	known	69_37n	missense	73	33.64	37	SNP	0.947	A
NEB	4703	genome.wustl.edu	37	2	152541307	152541307	+	Silent	SNP	A	A	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr2:152541307A>G	ENST00000172853.10	-	28	2967	c.2820T>C	c.(2818-2820)taT>taC	p.Y940Y	NEB_ENST00000409198.1_Silent_p.Y940Y|NEB_ENST00000397345.3_Silent_p.Y940Y|NEB_ENST00000603639.1_Silent_p.Y940Y|NEB_ENST00000604864.1_Silent_p.Y940Y|NEB_ENST00000427231.2_Silent_p.Y940Y			P20929	NEBU_HUMAN	nebulin	940					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TCTGCAGCGCATATGCCTTCT	0.448																																						dbGAP											0													77.0	72.0	74.0					2																	152541307		1918	4144	6062	-	-	-	SO:0001819	synonymous_variant	0			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.2820T>C	2.37:g.152541307A>G			F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom_bac,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,prints_Nebulin,pfscan_Nebulin_35r-motif,pfscan_SH3_domain	p.Y940	ENST00000172853.10	37	c.2820		2																																																																																			NEB	-	pfam_Nebulin_35r-motif,smart_Nebulin_35r-motif,pfscan_Nebulin_35r-motif	ENSG00000183091		0.448	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding		89	0.00	0	A	NM_004543		152541307	152541307	-1	no_errors	ENST00000397345	ensembl	human	known	69_37n	silent	55	21.43	15	SNP	0.993	G
NHSL1	57224	genome.wustl.edu	37	6	138754770	138754770	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr6:138754770G>C	ENST00000427025.2	-	5	1352	c.724C>G	c.(724-726)Cct>Gct	p.P242A	NHSL1_ENST00000343505.5_Missense_Mutation_p.P238A|MIR3145_ENST00000580727.1_RNA	NM_020464.1	NP_065197.1	Q5SYE7	NHSL1_HUMAN	NHS-like 1	242										breast(2)|endometrium(4)|kidney(1)	7						TAGTGATCAGGGGTGTACACT	0.498																																						dbGAP											0													43.0	38.0	39.0					6																	138754770		692	1591	2283	-	-	-	SO:0001583	missense	0			AB037778	CCDS47487.1, CCDS55063.1	6q23.3	2009-02-18	2004-10-07	2004-10-07	ENSG00000135540	ENSG00000135540			21021	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 63"""	C6orf63			Standard	NM_001144060		Approved	bA43P8.1, KIAA1357	uc011edp.2	Q5SYE7	OTTHUMG00000016321	ENST00000427025.2:c.724C>G	6.37:g.138754770G>C	ENSP00000394546:p.Pro242Ala		Q3ZCS5|Q5SYE8|Q9P2J0	Missense_Mutation	SNP	NULL	p.P242A	ENST00000427025.2	37	c.724	CCDS55063.1	6	.	.	.	.	.	.	.	.	.	.	G	12.79	2.044522	0.36085	.	.	ENSG00000135540	ENST00000427025;ENST00000343505;ENST00000342260	T;T	0.41065	1.01;1.69	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.55940	0.1952	M	0.66939	2.045	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.50389	-0.8834	10	0.31617	T	0.26	-0.5394	18.85	0.92224	0.0:0.0:1.0:0.0	.	238;242	E2QRJ1;Q5SYE7	.;NHSL1_HUMAN	A	242;238;180	ENSP00000394546:P242A;ENSP00000344672:P238A	ENSP00000344582:P180A	P	-	1	0	NHSL1	138796463	1.000000	0.71417	0.986000	0.45419	0.016000	0.09150	6.163000	0.71880	2.452000	0.82932	0.655000	0.94253	CCT	NHSL1	-	NULL	ENSG00000135540		0.498	NHSL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	NHSL1	HGNC	protein_coding	OTTHUMT00000043700.2	57	0.00	0	G	XM_050421		138754770	138754770	-1	no_errors	ENST00000427025	ensembl	human	known	69_37n	missense	28	41.67	20	SNP	1.000	C
NRAS	4893	genome.wustl.edu	37	1	115251203	115251203	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr1:115251203C>T	ENST00000369535.4	-	5	776	c.523G>A	c.(523-525)Gat>Aat	p.D175N		NM_002524.4	NP_002515.1	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog	175	Hypervariable region.				actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of skeletal muscle tissue development (GO:0048642)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|small GTPase mediated signal transduction (GO:0007264)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein complex binding (GO:0032403)			NS(134)|adrenal_gland(9)|autonomic_ganglia(9)|biliary_tract(6)|bone(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(11)|eye(3)|haematopoietic_and_lymphoid_tissue(1115)|kidney(3)|large_intestine(105)|liver(10)|lung(42)|meninges(2)|ovary(7)|pancreas(5)|prostate(8)|skin(1144)|soft_tissue(37)|stomach(5)|testis(8)|thyroid(359)|upper_aerodigestive_tract(28)|urinary_tract(13)	3085	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		GTCCCATCATCACTGCTGTTG	0.363		50	Mis		"""melanoma, MM, AML, thyroid"""				Noonan syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)																												dbGAP		Dom	yes		1	1p13.2	4893	neuroblastoma RAS viral (v-ras) oncogene homolog		"""L, E"""	0													322.0	275.0	291.0					1																	115251203		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	BC005219	CCDS877.1	1p13.2	2014-09-17			ENSG00000213281	ENSG00000213281			7989	protein-coding gene	gene with protein product		164790					Standard	NM_002524		Approved	N-ras	uc009wgu.3	P01111	OTTHUMG00000012059	ENST00000369535.4:c.523G>A	1.37:g.115251203C>T	ENSP00000358548:p.Asp175Asn		Q14971|Q15104|Q15282	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_ProtSyn_GTP-bd,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.D175N	ENST00000369535.4	37	c.523	CCDS877.1	1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.215966	0.79352	.	.	ENSG00000213281	ENST00000369535	T	0.67171	-0.25	5.86	5.86	0.93980	.	0.292311	0.21532	U	0.073031	T	0.38904	0.1058	N	0.14661	0.345	0.52099	D	0.999946	B	0.02656	0.0	B	0.04013	0.001	T	0.22068	-1.0227	10	0.21540	T	0.41	.	20.5632	0.99335	0.0:1.0:0.0:0.0	.	175	P01111	RASN_HUMAN	N	175	ENSP00000358548:D175N	ENSP00000358548:D175N	D	-	1	0	NRAS	115052726	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.958000	0.70330	2.937000	0.99478	0.650000	0.86243	GAT	NRAS	-	NULL	ENSG00000213281		0.363	NRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRAS	HGNC	protein_coding	OTTHUMT00000033395.2	330	0.00	0	C	NM_002524		115251203	115251203	-1	no_errors	ENST00000369535	ensembl	human	known	69_37n	missense	205	30.51	90	SNP	1.000	T
NUCB1	4924	genome.wustl.edu	37	19	49424449	49424449	+	Silent	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr19:49424449G>A	ENST00000405315.4	+	11	1375	c.1041G>A	c.(1039-1041)ctG>ctA	p.L347L	NUCB1_ENST00000263273.5_Silent_p.L347L|NUCB1_ENST00000485798.1_3'UTR|NUCB1-AS1_ENST00000416432.1_RNA|NUCB1_ENST00000407032.1_Silent_p.L347L	NM_006184.5	NP_006175.2	Q02818	NUCB1_HUMAN	nucleobindin 1	347						endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)	p.L347L(1)		cervix(1)|endometrium(4)|large_intestine(4)|lung(8)	17		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000171)|all cancers(93;0.000333)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0244)		AGGAAGAGCTGAGGCGCTTTG	0.662																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											34.0	33.0	34.0					19																	49424449		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC002356	CCDS12740.1	19q13.33	2013-01-10			ENSG00000104805	ENSG00000104805		"""EF-hand domain containing"""	8043	protein-coding gene	gene with protein product		601323				8661046	Standard	NM_006184		Approved	NUC, Calnuc	uc002plb.4	Q02818	OTTHUMG00000152514	ENST00000405315.4:c.1041G>A	19.37:g.49424449G>A			B2RD64|Q15838|Q7Z4J7|Q9BUR1	Silent	SNP	pfscan_EF_HAND_2	p.L347	ENST00000405315.4	37	c.1041	CCDS12740.1	19																																																																																			NUCB1	-	NULL	ENSG00000104805		0.662	NUCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUCB1	HGNC	protein_coding	OTTHUMT00000326545.2	24	0.00	0	G	NM_006184		49424449	49424449	+1	no_errors	ENST00000263273	ensembl	human	known	69_37n	silent	12	31.58	6	SNP	0.991	A
TENM1	10178	genome.wustl.edu	37	X	123539030	123539030	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chrX:123539030C>T	ENST00000371130.3	-	26	5284	c.5221G>A	c.(5221-5223)Gag>Aag	p.E1741K	STAG2_ENST00000469481.1_Intron|TENM1_ENST00000422452.2_Missense_Mutation_p.E1748K	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	1741					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										ATGTGGGGCTCTGAGCTGAGG	0.547																																						dbGAP											0													101.0	84.0	90.0					X																	123539030		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.5221G>A	X.37:g.123539030C>T	ENSP00000360171:p.Glu1741Lys		B2RTR5|Q5JZ17	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EGF-like,pfscan_EG-like_dom,tigrfam_YD	p.E1748K	ENST00000371130.3	37	c.5242	CCDS14609.1	X	.	.	.	.	.	.	.	.	.	.	C	21.9	4.220063	0.79464	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.86030	-2.06;-2.03	5.8	5.8	0.92144	.	0.050848	0.85682	D	0.000000	D	0.86310	0.5902	M	0.78637	2.42	0.80722	D	1	B;B;B	0.27853	0.191;0.009;0.01	B;B;B	0.26770	0.073;0.006;0.008	D	0.83562	0.0107	10	0.38643	T	0.18	.	19.0246	0.92927	0.0:1.0:0.0:0.0	.	1747;1748;1741	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	K	1741;1748	ENSP00000360171:E1741K;ENSP00000403954:E1748K	ENSP00000360171:E1741K	E	-	1	0	ODZ1	123366711	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.451000	0.80668	2.442000	0.82660	0.600000	0.82982	GAG	ODZ1	-	NULL	ENSG00000009694		0.547	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ1	HGNC	protein_coding	OTTHUMT00000058985.1	110	0.90	1	C	NM_014253		123539030	123539030	-1	no_errors	ENST00000422452	ensembl	human	known	69_37n	missense	37	50.00	38	SNP	1.000	T
OR10A6	390093	genome.wustl.edu	37	11	7949551	7949551	+	Missense_Mutation	SNP	C	C	G	rs149192400		TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr11:7949551C>G	ENST00000309838.2	-	1	658	c.659G>C	c.(658-660)cGa>cCa	p.R220P		NM_001004461.1	NP_001004461.1	Q8NH74	O10A6_HUMAN	olfactory receptor, family 10, subfamily A, member 6	220						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	22				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		AAACAGAACTCGAATGTAAGA	0.438																																						dbGAP											0													90.0	79.0	83.0					11																	7949551		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB065515	CCDS31420.1	11p15.4	2012-08-09			ENSG00000175393	ENSG00000175393		"""GPCR / Class A : Olfactory receptors"""	15132	protein-coding gene	gene with protein product							Standard	NM_001004461		Approved		uc010rbh.2	Q8NH74	OTTHUMG00000165671	ENST00000309838.2:c.659G>C	11.37:g.7949551C>G	ENSP00000312470:p.Arg220Pro		Q6IF59	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.R220P	ENST00000309838.2	37	c.659	CCDS31420.1	11	.	.	.	.	.	.	.	.	.	.	C	8.245	0.807728	0.16467	.	.	ENSG00000175393	ENST00000309838	T	0.00123	8.7	4.43	1.52	0.23074	GPCR, rhodopsin-like superfamily (1);	0.503989	0.14983	N	0.287139	T	0.00271	0.0008	M	0.74258	2.255	0.09310	N	1	D	0.55605	0.972	P	0.55871	0.786	T	0.44034	-0.9354	10	0.39692	T	0.17	.	3.1486	0.06480	0.1888:0.5067:0.0:0.3045	.	220	Q8NH74	O10A6_HUMAN	P	220	ENSP00000312470:R220P	ENSP00000312470:R220P	R	-	2	0	OR10A6	7906127	0.000000	0.05858	0.018000	0.16275	0.026000	0.11368	-0.744000	0.04839	0.603000	0.29913	0.655000	0.94253	CGA	OR10A6	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000175393		0.438	OR10A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10A6	HGNC	protein_coding	OTTHUMT00000385703.1	75	0.00	0	C	NM_001004461		7949551	7949551	-1	no_errors	ENST00000309838	ensembl	human	known	69_37n	missense	32	50.00	32	SNP	0.000	G
OR9G1	390174	genome.wustl.edu	37	11	56468331	56468331	+	Silent	SNP	A	A	C			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr11:56468331A>C	ENST00000312153.1	+	1	468	c.468A>C	c.(466-468)tcA>tcC	p.S156S		NM_001005213.1	NP_001005213.1	Q8NH87	OR9G1_HUMAN	olfactory receptor, family 9, subfamily G, member 1	156						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|lung(25)|stomach(2)|upper_aerodigestive_tract(1)	31						TTAACTCTTCAATCATCACCA	0.463																																						dbGAP											0													188.0	178.0	181.0					11																	56468331		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AB065500	CCDS31536.1	11q11	2012-08-09			ENSG00000174914	ENSG00000174914		"""GPCR / Class A : Olfactory receptors"""	15319	protein-coding gene	gene with protein product				OR9G5			Standard	NM_001005213		Approved			Q8NH87	OTTHUMG00000167112	ENST00000312153.1:c.468A>C	11.37:g.56468331A>C			Q6IEU9|Q8NGQ0	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S156	ENST00000312153.1	37	c.468	CCDS31536.1	11																																																																																			OR9G1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000174914		0.463	OR9G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR9G1	HGNC	protein_coding	OTTHUMT00000393253.1	230	0.00	0	A	NM_001005213		56468331	56468331	+1	no_errors	ENST00000312153	ensembl	human	known	69_37n	silent	144	14.79	25	SNP	0.000	C
PCDHA3	56145	genome.wustl.edu	37	5	140180926	140180926	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr5:140180926C>G	ENST00000522353.2	+	1	144	c.144C>G	c.(142-144)atC>atG	p.I48M	PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000532566.2_Missense_Mutation_p.I48M|PCDHA2_ENST00000520672.2_Intron	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3	48	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGGCCGCATCGCGCAGGACC	0.647																																						dbGAP											0													53.0	62.0	59.0					5																	140180926		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.144C>G	5.37:g.140180926C>G	ENSP00000429808:p.Ile48Met		O75286	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.I48M	ENST00000522353.2	37	c.144	CCDS54915.1	5	.	.	.	.	.	.	.	.	.	.	c	14.33	2.502844	0.44558	.	.	ENSG00000255408	ENST00000522353;ENST00000532566	T;T	0.35973	1.28;1.28	4.48	2.51	0.30379	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.000000	0.39615	U	0.001304	T	0.61627	0.2362	H	0.94698	3.57	0.26918	N	0.966746	D;D	0.89917	1.0;0.998	D;D	0.73380	0.98;0.98	T	0.56300	-0.8002	10	0.87932	D	0	.	2.6565	0.05014	0.1356:0.4097:0.2973:0.1574	.	48;48	Q9Y5H8-2;Q9Y5H8	.;PCDA3_HUMAN	M	48	ENSP00000429808:I48M;ENSP00000434086:I48M	ENSP00000429808:I48M	I	+	3	3	PCDHA3	140161110	0.619000	0.27059	1.000000	0.80357	0.993000	0.82548	-0.234000	0.09028	0.995000	0.38917	0.586000	0.80456	ATC	PCDHA3	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000255408		0.647	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA3	HGNC	protein_coding	OTTHUMT00000372848.2	70	0.00	0	C	NM_018906		140180926	140180926	+1	no_errors	ENST00000522353	ensembl	human	known	69_37n	missense	46	39.47	30	SNP	0.993	G
PCNXL2	80003	genome.wustl.edu	37	1	233161098	233161098	+	Nonsense_Mutation	SNP	C	C	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr1:233161098C>A	ENST00000258229.9	-	26	4633	c.4399G>T	c.(4399-4401)Gag>Tag	p.E1467*	PCNXL2_ENST00000344698.2_Nonsense_Mutation_p.E119*	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	1467						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				CTGTCCTCCTCGTCGCCCTCC	0.567											OREG0014326	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													78.0	87.0	84.0					1																	233161098		2186	4276	6462	-	-	-	SO:0001587	stop_gained	0			AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.4399G>T	1.37:g.233161098C>A	ENSP00000258229:p.Glu1467*	2363	O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Nonsense_Mutation	SNP	pfam_Pecanex,superfamily_Pept_cys/ser_Trypsin-like	p.E1467*	ENST00000258229.9	37	c.4399	CCDS44335.1	1	.	.	.	.	.	.	.	.	.	.	C	48	14.330836	0.99790	.	.	ENSG00000135749	ENST00000344698;ENST00000258229	.	.	.	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.3473	0.98799	0.0:1.0:0.0:0.0	.	.	.	.	X	119;1467	.	ENSP00000258229:E1467X	E	-	1	0	PCNXL2	231227721	1.000000	0.71417	0.971000	0.41717	0.797000	0.45037	7.439000	0.80444	2.884000	0.98904	0.655000	0.94253	GAG	PCNXL2	-	NULL	ENSG00000135749		0.567	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNXL2	HGNC	protein_coding	OTTHUMT00000092480.3	127	0.00	0	C	NM_014801		233161098	233161098	-1	no_errors	ENST00000258229	ensembl	human	known	69_37n	nonsense	106	33.12	53	SNP	1.000	A
PFKP	5214	genome.wustl.edu	37	10	3149487	3149487	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr10:3149487G>A	ENST00000381125.4	+	8	932	c.856G>A	c.(856-858)Gag>Aag	p.E286K	PFKP_ENST00000381075.2_Missense_Mutation_p.E278K	NM_002627.4	NP_002618.1	Q01813	PFKAP_HUMAN	phosphofructokinase, platelet	286	N-terminal catalytic PFK domain 1.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 6-phosphate metabolic process (GO:0006002)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein complex binding (GO:0032403)			breast(2)|central_nervous_system(4)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(1;0.000975)|all cancers(11;0.00351)|Epithelial(11;0.142)		CATCACCTCTGAGAAAATCAA	0.458																																						dbGAP											0													67.0	67.0	67.0					10																	3149487		2200	4300	6500	-	-	-	SO:0001583	missense	0			AK092597	CCDS7059.1, CCDS55698.1	10p15.3-p15.2	2006-08-25			ENSG00000067057	ENSG00000067057	2.7.1.11		8878	protein-coding gene	gene with protein product	"""Phosphofructokinase, platelet type"""	171840					Standard	NM_002627		Approved	PFK-C, PFKF	uc001igp.3	Q01813	OTTHUMG00000017556	ENST00000381125.4:c.856G>A	10.37:g.3149487G>A	ENSP00000370517:p.Glu286Lys		B3KS15|Q5VSR7|Q5VSR8	Missense_Mutation	SNP	pfam_Phosphofructokinase_dom,superfamily_Phosphofructokinase_dom,pirsf_6-phosphofructokinase_euk,prints_Phosphofructokinase,tigrfam_6-phosphofructokinase_euk	p.E286K	ENST00000381125.4	37	c.856	CCDS7059.1	10	.	.	.	.	.	.	.	.	.	.	G	13.82	2.351063	0.41599	.	.	ENSG00000067057	ENST00000381125;ENST00000397834;ENST00000381075;ENST00000415005	T;T;T	0.77229	-1.08;-1.08;-1.08	4.89	3.97	0.46021	Phosphofructokinase domain (2);	0.385827	0.32055	N	0.006652	T	0.75177	0.3814	M	0.64630	1.985	0.80722	D	1	B;P	0.38455	0.051;0.632	B;B	0.36030	0.026;0.216	T	0.77991	-0.2379	10	0.66056	D	0.02	.	15.4072	0.74887	0.0:0.1398:0.8602:0.0	.	278;286	Q5VSR7;Q01813	.;K6PP_HUMAN	K	286;275;278;70	ENSP00000370517:E286K;ENSP00000370465:E278K;ENSP00000408858:E70K	ENSP00000370465:E278K	E	+	1	0	PFKP	3139487	1.000000	0.71417	0.512000	0.27736	0.036000	0.12997	4.591000	0.61019	1.164000	0.42652	0.655000	0.94253	GAG	PFKP	-	pfam_Phosphofructokinase_dom,superfamily_Phosphofructokinase_dom,pirsf_6-phosphofructokinase_euk,tigrfam_6-phosphofructokinase_euk	ENSG00000067057		0.458	PFKP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PFKP	HGNC	protein_coding	OTTHUMT00000046454.1	105	0.00	0	G	NM_002627		3149487	3149487	+1	no_errors	ENST00000381125	ensembl	human	known	69_37n	missense	42	28.81	17	SNP	0.995	A
PDE6C	5146	genome.wustl.edu	37	10	95415556	95415556	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr10:95415556G>C	ENST00000371447.3	+	16	2113	c.1975G>C	c.(1975-1977)Gaa>Caa	p.E659Q		NM_006204.3	NP_006195.3	P51160	PDE6C_HUMAN	phosphodiesterase 6C, cGMP-specific, cone, alpha prime	659					phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|visual perception (GO:0007601)	plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.123)			Caffeine(DB00201)	GCGGCAGTTTGAAACAGTTAT	0.348																																						dbGAP											0													161.0	161.0	161.0					10																	95415556		2203	4300	6503	-	-	-	SO:0001583	missense	0			U31973	CCDS7429.1	10q24	2013-01-23			ENSG00000095464	ENSG00000095464	3.1.4.17	"""Phosphodiesterases"""	8787	protein-coding gene	gene with protein product		600827					Standard	NM_006204		Approved	PDEA2, ACHM5, COD4	uc001kiu.4	P51160	OTTHUMG00000018775	ENST00000371447.3:c.1975G>C	10.37:g.95415556G>C	ENSP00000360502:p.Glu659Gln		A6NCR6|Q5VY29	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.E659Q	ENST00000371447.3	37	c.1975	CCDS7429.1	10	.	.	.	.	.	.	.	.	.	.	G	23.4	4.417576	0.83449	.	.	ENSG00000095464	ENST00000371447	T	0.81163	-1.46	5.41	5.41	0.78517	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.041854	0.85682	D	0.000000	D	0.82939	0.5146	L	0.37897	1.145	0.58432	D	0.999999	D	0.53462	0.96	P	0.54965	0.765	D	0.83606	0.0131	10	0.56958	D	0.05	.	18.9907	0.92791	0.0:0.0:1.0:0.0	.	659	P51160	PDE6C_HUMAN	Q	659	ENSP00000360502:E659Q	ENSP00000360502:E659Q	E	+	1	0	PDE6C	95405546	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.228000	0.78079	2.826000	0.97356	0.561000	0.74099	GAA	PDE6C	-	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom	ENSG00000095464		0.348	PDE6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE6C	HGNC	protein_coding	OTTHUMT00000049437.1	123	0.00	0	G	NM_006204		95415556	95415556	+1	no_errors	ENST00000371447	ensembl	human	known	69_37n	missense	85	15.00	15	SNP	1.000	C
PGLYRP3	114771	genome.wustl.edu	37	1	153283097	153283097	+	Silent	SNP	G	G	C			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr1:153283097G>C	ENST00000290722.1	-	1	97	c.45C>G	c.(43-45)ctC>ctG	p.L15L		NM_052891.1	NP_443123.1	Q96LB9	PGRP3_HUMAN	peptidoglycan recognition protein 3	15					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(1)|liver(1)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	28	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CCCAAGCCTGGAGACCCAGAA	0.502																																						dbGAP											0													156.0	157.0	157.0					1																	153283097		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY035376	CCDS1035.1	1q21	2008-02-05			ENSG00000159527	ENSG00000159527			30014	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein I alpha precursor"""	608197				11461926	Standard	NM_052891		Approved	PGRPIA, PGLYRPIalpha, PGRP-Ialpha	uc001fbn.1	Q96LB9	OTTHUMG00000014044	ENST00000290722.1:c.45C>G	1.37:g.153283097G>C			A1A4U8|Q5SY65	Silent	SNP	pfam_Amidase_domain,superfamily_Amidase_domain,smart_PGRP_domain_met/bac,smart_Amidase_domain	p.L15	ENST00000290722.1	37	c.45	CCDS1035.1	1																																																																																			PGLYRP3	-	NULL	ENSG00000159527		0.502	PGLYRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGLYRP3	HGNC	protein_coding	OTTHUMT00000039488.1	84	0.00	0	G	NM_052891		153283097	153283097	-1	no_errors	ENST00000290722	ensembl	human	known	69_37n	silent	98	10.09	11	SNP	0.000	C
PGM5	5239	genome.wustl.edu	37	9	71002421	71002421	+	Missense_Mutation	SNP	G	G	A	rs566016535		TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr9:71002421G>A	ENST00000396396.1	+	4	843	c.614G>A	c.(613-615)cGg>cAg	p.R205Q	PGM5_ENST00000396392.1_Missense_Mutation_p.R205Q|PGM5_ENST00000604870.2_3'UTR	NM_021965.3	NP_068800.2	Q15124	PGM5_HUMAN	phosphoglucomutase 5	205					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)	cell-cell adherens junction (GO:0005913)|costamere (GO:0043034)|cytoplasmic side of plasma membrane (GO:0009898)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|sarcolemma (GO:0042383)|spot adherens junction (GO:0005914)|stress fiber (GO:0001725)|Z disc (GO:0030018)	intramolecular transferase activity, phosphotransferases (GO:0016868)|magnesium ion binding (GO:0000287)|structural molecule activity (GO:0005198)			endometrium(5)|kidney(1)|large_intestine(5)|liver(2)|lung(15)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	34						AACCTCCTTCGGACCATCTTT	0.433													N|||	1	0.000199681	0.0	0.0	5008	,	,		20495	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													143.0	137.0	139.0					9																	71002421		2203	4299	6502	-	-	-	SO:0001583	missense	0			L40933	CCDS6622.2	9q13	2008-02-05			ENSG00000154330	ENSG00000154330			8908	protein-coding gene	gene with protein product	"""phosphoglucomutase-related protein"""	600981				8586438, 8631316	Standard	NM_021965		Approved	PGMRP	uc004agr.3	Q15124	OTTHUMG00000019966	ENST00000396396.1:c.614G>A	9.37:g.71002421G>A	ENSP00000379678:p.Arg205Gln		B1AM46|B4DLQ6|Q5VYV3|Q8N527|Q9UDH4	Missense_Mutation	SNP	pfam_A-D-PHexomutase_a/b/a-I,pfam_A-D-PHexomutase_a/b/a-III,pfam_A-D-PHexomutase_a/b/a-II,superfamily_A-D-PHexomutase_a/b/a-I/II/III,prints_Alpha-D-phosphohexomutase_SF	p.R205Q	ENST00000396396.1	37	c.614	CCDS6622.2	9	.	.	.	.	.	.	.	.	.	.	.	9.330	1.060387	0.19987	.	.	ENSG00000154330	ENST00000396396;ENST00000396392;ENST00000377314;ENST00000431583	T;T;T	0.63580	-0.05;-0.05;-0.03	5.16	4.26	0.50523	Alpha-D-phosphohexomutase, alpha/beta/alpha I/II/III (2);Alpha-D-phosphohexomutase, alpha/beta/alpha domain II (1);	0.000000	0.85682	U	0.000000	T	0.50463	0.1617	L	0.31526	0.94	0.53005	D	0.999968	D	0.59767	0.986	B	0.42916	0.402	T	0.46596	-0.9180	10	0.27785	T	0.31	.	14.5988	0.68424	0.0:0.1474:0.8526:0.0	.	205	Q15124	PGM5_HUMAN	Q	205;205;156;122	ENSP00000379678:R205Q;ENSP00000379674:R205Q;ENSP00000394864:R122Q	ENSP00000366531:R156Q	R	+	2	0	PGM5	70192241	1.000000	0.71417	0.694000	0.30210	0.054000	0.15201	6.537000	0.73847	1.150000	0.42419	-0.312000	0.09012	CGG	PGM5	-	pfam_A-D-PHexomutase_a/b/a-II,superfamily_A-D-PHexomutase_a/b/a-I/II/III	ENSG00000154330		0.433	PGM5-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PGM5	HGNC	protein_coding	OTTHUMT00000052548.2	168	0.00	0	G	NM_021965		71002421	71002421	+1	no_errors	ENST00000396396	ensembl	human	known	69_37n	missense	92	28.68	37	SNP	0.995	A
PHF6	84295	genome.wustl.edu	37	X	133547523	133547523	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chrX:133547523G>A	ENST00000332070.3	+	6	623	c.421G>A	c.(421-423)Gat>Aat	p.D141N	PHF6_ENST00000370803.3_Missense_Mutation_p.D141N|PHF6_ENST00000370799.1_Missense_Mutation_p.D142N|PHF6_ENST00000416404.2_Missense_Mutation_p.D107N|PHF6_ENST00000394292.1_Missense_Mutation_p.D142N|PHF6_ENST00000370800.4_Missense_Mutation_p.D142N	NM_032458.2	NP_115834.1	Q8IWS0	PHF6_HUMAN	PHD finger protein 6	141					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone binding (GO:0042393)|histone deacetylase binding (GO:0042826)|phosphoprotein binding (GO:0051219)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|scaffold protein binding (GO:0097110)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(88)|kidney(2)|large_intestine(1)|liver(1)|lung(6)|ovary(1)|skin(1)|urinary_tract(1)	103	Acute lymphoblastic leukemia(192;0.000127)					TTAAGCAGCTGATTTAGAAGA	0.323			"""F, N, Splice, Mis"""		ETP ALL																																Colon(100;666 1493 6344 21231 35807)	dbGAP		Rec	yes		X	Xq26.3	84295	PHD finger protein 6		L	0													67.0	66.0	67.0					X																	133547523		2201	4294	6495	-	-	-	SO:0001583	missense	0			AB058726	CCDS14639.1, CCDS14640.1	Xq26	2014-09-17			ENSG00000156531	ENSG00000156531		"""Zinc fingers, PHD-type"""	18145	protein-coding gene	gene with protein product	"""centromere protein 31"""	300414	"""Borjeson-Forssman-Lehmann syndrome"""	BFLS, BORJ		12415272, 15466013	Standard	NM_032335		Approved	KIAA1823, MGC14797, CENP-31	uc004exk.3	Q8IWS0	OTTHUMG00000022453	ENST00000332070.3:c.421G>A	X.37:g.133547523G>A	ENSP00000329097:p.Asp141Asn		A8K230|B4E0G4|D3DTG3|E9PC97|Q5JRC7|Q5JRC8|Q96JK3|Q9BRU0	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD,smart_Znf_PHD	p.D142N	ENST00000332070.3	37	c.424	CCDS14639.1	X	.	.	.	.	.	.	.	.	.	.	G	17.22	3.332902	0.60853	.	.	ENSG00000156531	ENST00000370803;ENST00000332070;ENST00000394292;ENST00000370799;ENST00000416404;ENST00000370800	D;D;D;D;D;D	0.90732	-2.72;-2.72;-2.12;-2.72;-1.71;-2.17	5.5	5.5	0.81552	.	0.180655	0.64402	D	0.000016	D	0.86356	0.5913	N	0.19112	0.55	0.58432	D	0.999998	P;B;B;B;P	0.44139	0.608;0.118;0.244;0.244;0.827	B;B;B;B;P	0.46026	0.143;0.031;0.05;0.05;0.501	D	0.84330	0.0521	10	0.18276	T	0.48	-16.8043	17.5634	0.87913	0.0:0.0:1.0:0.0	.	107;141;141;142;142	B4E0G4;A8K230;Q8IWS0;E9PC97;Q8IWS0-2	.;.;PHF6_HUMAN;.;.	N	141;141;142;142;107;142	ENSP00000359839:D141N;ENSP00000329097:D141N;ENSP00000377831:D142N;ENSP00000359835:D142N;ENSP00000394480:D107N;ENSP00000359836:D142N	ENSP00000329097:D141N	D	+	1	0	PHF6	133375189	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.177000	0.89688	2.450000	0.82876	0.594000	0.82650	GAT	PHF6	-	NULL	ENSG00000156531		0.323	PHF6-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	PHF6	HGNC	protein_coding	OTTHUMT00000058367.1	96	0.00	0	G	NM_032458		133547523	133547523	+1	no_errors	ENST00000394292	ensembl	human	known	69_37n	missense	36	45.45	30	SNP	1.000	A
PIGR	5284	genome.wustl.edu	37	1	207106470	207106470	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr1:207106470C>G	ENST00000356495.4	-	7	1930	c.1747G>C	c.(1747-1749)Gat>Cat	p.D583H	PIGR_ENST00000487208.1_5'Flank	NM_002644.3	NP_002635.2	P01833	PIGR_HUMAN	polymeric immunoglobulin receptor	583					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc receptor signaling pathway (GO:0038093)|immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor (GO:0002415)|receptor clustering (GO:0043113)|retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	polymeric immunoglobulin receptor activity (GO:0001792)			central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						ACCTTCTCATCAGGAGCAGCG	0.532																																						dbGAP											0													71.0	70.0	70.0					1																	207106470		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1474.1	1q31-q41	2013-01-11			ENSG00000162896	ENSG00000162896		"""Immunoglobulin superfamily / V-set domain containing"""	8968	protein-coding gene	gene with protein product		173880					Standard	NM_002644		Approved		uc001hez.3	P01833	OTTHUMG00000036581	ENST00000356495.4:c.1747G>C	1.37:g.207106470C>G	ENSP00000348888:p.Asp583His		Q68D81|Q8IZY7	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.D583H	ENST00000356495.4	37	c.1747	CCDS1474.1	1	.	.	.	.	.	.	.	.	.	.	C	9.507	1.104780	0.20632	.	.	ENSG00000162896	ENST00000356495	T	0.16457	2.34	4.11	-0.278	0.12894	.	2.930680	0.00888	N	0.002206	T	0.10680	0.0261	N	0.14661	0.345	0.09310	N	1	P	0.37594	0.601	B	0.36244	0.22	T	0.14364	-1.0475	10	0.45353	T	0.12	-20.2953	4.3575	0.11185	0.0:0.5432:0.179:0.2778	.	583	P01833	PIGR_HUMAN	H	583	ENSP00000348888:D583H	ENSP00000348888:D583H	D	-	1	0	PIGR	205173093	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	0.012000	0.13287	-0.022000	0.13986	0.555000	0.69702	GAT	PIGR	-	NULL	ENSG00000162896		0.532	PIGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIGR	HGNC	protein_coding	OTTHUMT00000088975.1	131	0.00	0	C	NM_002644		207106470	207106470	-1	no_errors	ENST00000356495	ensembl	human	known	69_37n	missense	77	41.22	54	SNP	0.000	G
PIK3CA	5290	genome.wustl.edu	37	3	178936082	178936082	+	Missense_Mutation	SNP	G	G	A	rs121913273		TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr3:178936082G>A	ENST00000263967.3	+	10	1781	c.1624G>A	c.(1624-1626)Gaa>Aaa	p.E542K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	542	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> K (in CLOVE, KERSEB, CRC and BC; also found in glioblastoma multiforme and endometrial carcinoma; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N- terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|E -> Q (found in an endometrial carcinoma sample; unknown pathological significance). {ECO:0000269|PubMed:16322209}.|E -> V (in BC; unknown pathological significance). {ECO:0000269|PubMed:16353168}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E542K(545)|p.E542Q(10)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TCCTCTCTCTGAAATCACTGA	0.333	E542K(BT483_BREAST)|E542K(CAL51_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(VMCUB1_URINARY_TRACT)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	555	Substitution - Missense(555)	breast(176)|large_intestine(166)|urinary_tract(45)|endometrium(37)|skin(19)|lung(18)|stomach(16)|ovary(16)|thyroid(14)|upper_aerodigestive_tract(9)|central_nervous_system(7)|cervix(6)|liver(6)|oesophagus(5)|penis(4)|kidney(3)|soft_tissue(2)|haematopoietic_and_lymphoid_tissue(2)|prostate(2)|biliary_tract(1)|pituitary(1)											56.0	56.0	56.0					3																	178936082		1809	4069	5878	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1624G>A	3.37:g.178936082G>A	ENSP00000263967:p.Glu542Lys		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E542K	ENST00000263967.3	37	c.1624	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	34	5.360420	0.95877	.	.	ENSG00000121879	ENST00000263967	T	0.62105	0.05	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69287	0.3094	L	0.41356	1.27	0.80722	D	1	D	0.65815	0.995	D	0.63192	0.912	T	0.60296	-0.7291	10	0.09843	T	0.71	-23.9623	20.0024	0.97423	0.0:0.0:1.0:0.0	.	542	P42336	PK3CA_HUMAN	K	542	ENSP00000263967:E542K	ENSP00000263967:E542K	E	+	1	0	PIK3CA	180418776	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAA	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.333	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	92	0.00	0	G			178936082	178936082	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	49	45.56	41	SNP	1.000	A
PIK3CA	5290	genome.wustl.edu	37	3	178947827	178947827	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr3:178947827G>T	ENST00000263967.3	+	19	2859	c.2702G>T	c.(2701-2703)tGt>tTt	p.C901F		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	901	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.C901F(7)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	ACACGTTCATGTGCTGGATAC	0.388		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	7	Substitution - Missense(7)	endometrium(4)|large_intestine(2)|stomach(1)											220.0	207.0	211.0					3																	178947827		1906	4131	6037	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.2702G>T	3.37:g.178947827G>T	ENSP00000263967:p.Cys901Phe		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.C901F	ENST00000263967.3	37	c.2702	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	24.2	4.506649	0.85282	.	.	ENSG00000121879	ENST00000263967	T	0.76060	-0.99	5.61	5.61	0.85477	Protein kinase-like domain (1);Phosphatidylinositol 3/4-kinase, conserved site (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.090376	0.85682	D	0.000000	D	0.90051	0.6893	M	0.92412	3.305	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91894	0.5526	10	0.87932	D	0	-11.1303	19.6363	0.95735	0.0:0.0:1.0:0.0	.	901	P42336	PK3CA_HUMAN	F	901	ENSP00000263967:C901F	ENSP00000263967:C901F	C	+	2	0	PIK3CA	180430521	1.000000	0.71417	0.987000	0.45799	0.949000	0.60115	9.367000	0.97148	2.648000	0.89879	0.585000	0.79938	TGT	PIK3CA	-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.388	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	128	0.00	0	G			178947827	178947827	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	92	13.21	14	SNP	1.000	T
PIK3CG	5294	genome.wustl.edu	37	7	106509345	106509345	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr7:106509345G>A	ENST00000359195.3	+	2	1649	c.1339G>A	c.(1339-1341)Gca>Aca	p.A447T	PIK3CG_ENST00000496166.1_Missense_Mutation_p.A447T|PIK3CG_ENST00000440650.2_Missense_Mutation_p.A447T	NM_001282427.1|NM_002649.2	NP_001269356.1|NP_002640.2	P48736	PK3CG_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma	447	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.				adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cytokine production (GO:0001816)|dendritic cell chemotaxis (GO:0002407)|endocytosis (GO:0006897)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte apoptotic process (GO:0097284)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|natural killer cell chemotaxis (GO:0035747)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of triglyceride catabolic process (GO:0010897)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion mediated by integrin (GO:0033628)|respiratory burst involved in defense response (GO:0002679)|secretory granule localization (GO:0032252)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell proliferation (GO:0042098)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|ephrin receptor binding (GO:0046875)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(9)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(16)|liver(4)|lung(59)|ovary(4)|pancreas(4)|prostate(3)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	132						CAAGGCCTCTGCAGAGTCCCC	0.512																																						dbGAP											0													64.0	68.0	67.0					7																	106509345		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5739.1	7q22	2012-07-13	2012-07-13		ENSG00000105851	ENSG00000105851	2.7.1.153		8978	protein-coding gene	gene with protein product		601232	"""phosphoinositide-3-kinase, catalytic, gamma polypeptide"""				Standard	XM_005250443		Approved		uc003vdw.3	P48736	OTTHUMG00000157641	ENST00000359195.3:c.1339G>A	7.37:g.106509345G>A	ENSP00000352121:p.Ala447Thr		A4D0Q6|Q8IV23|Q9BZC8	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_C2_dom,pfam_PI3K_Ras-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.A447T	ENST00000359195.3	37	c.1339	CCDS5739.1	7	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.787929	0.00628	.	.	ENSG00000105851	ENST00000440650;ENST00000496166;ENST00000359195	T;T;T	0.77358	-1.09;-1.09;-1.09	4.97	4.02	0.46733	C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (2);	0.553031	0.20906	N	0.083556	T	0.59770	0.2218	N	0.22421	0.69	0.09310	N	1	B	0.12013	0.005	B	0.08055	0.003	T	0.36187	-0.9758	10	0.17832	T	0.49	-8.3855	7.8738	0.29582	0.0:0.2485:0.5443:0.2072	.	447	P48736	PK3CG_HUMAN	T	447	ENSP00000392258:A447T;ENSP00000419260:A447T;ENSP00000352121:A447T	ENSP00000352121:A447T	A	+	1	0	PIK3CG	106296581	0.538000	0.26394	0.178000	0.23040	0.111000	0.19643	3.766000	0.55280	2.482000	0.83794	0.655000	0.94253	GCA	PIK3CG	-	pfam_PI3K_C2_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_C2_dom	ENSG00000105851		0.512	PIK3CG-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PIK3CG	HGNC	protein_coding	OTTHUMT00000349294.1	50	0.00	0	G			106509345	106509345	+1	no_errors	ENST00000359195	ensembl	human	known	69_37n	missense	27	46.00	23	SNP	0.027	A
PKDREJ	10343	genome.wustl.edu	37	22	46656331	46656331	+	Silent	SNP	A	A	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr22:46656331A>T	ENST00000253255.5	-	1	2888	c.2889T>A	c.(2887-2889)gcT>gcA	p.A963A		NM_006071.1	NP_006062.1	Q9NTG1	PKDRE_HUMAN	polycystin (PKD) family receptor for egg jelly	963					acrosome reaction (GO:0007340)|calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|neuropeptide signaling pathway (GO:0007218)|regulation of acrosome reaction (GO:0060046)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			NS(2)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(4)|kidney(5)|large_intestine(21)|lung(16)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	73		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		TGAGATTAAAAGCTGCAAAGG	0.483																																						dbGAP											0													144.0	149.0	147.0					22																	46656331		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF116458	CCDS14073.1	22q13.31	2013-07-31	2013-07-31		ENSG00000130943	ENSG00000130943			9015	protein-coding gene	gene with protein product		604670	"""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-like"", ""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like"", ""polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin)"""			9949214, 10591208	Standard	NM_006071		Approved		uc003bhh.3	Q9NTG1	OTTHUMG00000150493	ENST00000253255.5:c.2889T>A	22.37:g.46656331A>T			B1AJY3|O95850	Silent	SNP	pfam_PKD1_2_channel,pfam_PKD/REJ-like,pfam_LipOase_LH2,pfam_Ion_trans_dom,superfamily_Lipase_LipOase,smart_GPS_dom,smart_LipOase_LH2,pfscan_LipOase_LH2,pfscan_REJ-like,prints_PKD_2	p.A963	ENST00000253255.5	37	c.2889	CCDS14073.1	22																																																																																			PKDREJ	-	NULL	ENSG00000130943		0.483	PKDREJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKDREJ	HGNC	protein_coding	OTTHUMT00000318466.1	52	0.00	0	A	NM_006071		46656331	46656331	-1	no_errors	ENST00000253255	ensembl	human	known	69_37n	silent	18	50.00	19	SNP	0.001	T
PLEKHF2	79666	genome.wustl.edu	37	8	96166542	96166542	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr8:96166542C>G	ENST00000315367.3	+	2	511	c.270C>G	c.(268-270)atC>atG	p.I90M	PLEKHF2_ENST00000519516.1_Missense_Mutation_p.I90M	NM_024613.3	NP_078889.1	Q9H8W4	PKHF2_HUMAN	pleckstrin homology domain containing, family F (with FYVE domain) member 2	90	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|membrane (GO:0016020)|transport vesicle (GO:0030133)	metal ion binding (GO:0046872)			breast(1)|large_intestine(1)|lung(1)|ovary(2)	5	Breast(36;3.18e-05)					TTGATTCCATCAAAGATGAGG	0.348																																						dbGAP											0													85.0	91.0	89.0					8																	96166542		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF434819	CCDS6267.1	8q22.1	2013-01-10				ENSG00000175895		"""Zinc fingers, FYVE domain containing"", ""Pleckstrin homology (PH) domain containing"""	20757	protein-coding gene	gene with protein product		615208					Standard	NM_024613		Approved	ZFYVE18, PHAFIN2, FLJ13187	uc003yhn.2	Q9H8W4		ENST00000315367.3:c.270C>G	8.37:g.96166542C>G	ENSP00000322373:p.Ile90Met			Missense_Mutation	SNP	pfam_Znf_FYVE,pfam_Pleckstrin_homology,superfamily_Znf_FYVE_PHD,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel	p.I90M	ENST00000315367.3	37	c.270	CCDS6267.1	8	.	.	.	.	.	.	.	.	.	.	C	11.78	1.740171	0.30865	.	.	ENSG00000175895	ENST00000315367;ENST00000519516	T;T	0.47869	0.83;0.83	6.06	4.22	0.49857	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.049867	0.85682	D	0.000000	T	0.48607	0.1509	M	0.72894	2.215	0.52099	D	0.999943	B	0.28258	0.205	B	0.35971	0.215	T	0.52283	-0.8596	10	0.54805	T	0.06	-13.0038	7.8453	0.29422	0.1319:0.7354:0.0:0.1328	.	90	Q9H8W4	PKHF2_HUMAN	M	90	ENSP00000322373:I90M;ENSP00000427792:I90M	ENSP00000322373:I90M	I	+	3	3	PLEKHF2	96235718	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.212000	0.32394	1.576000	0.49790	-0.157000	0.13467	ATC	PLEKHF2	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000175895		0.348	PLEKHF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHF2	HGNC	protein_coding	OTTHUMT00000379666.1	50	0.00	0	C	NM_024613		96166542	96166542	+1	no_errors	ENST00000315367	ensembl	human	known	69_37n	missense	50	18.03	11	SNP	1.000	G
PLXNA4	91584	genome.wustl.edu	37	7	132192988	132192988	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr7:132192988C>G	ENST00000359827.3	-	2	1427	c.465G>C	c.(463-465)aaG>aaC	p.K155N	PLXNA4_ENST00000321063.4_Missense_Mutation_p.K155N|PLXNA4_ENST00000378539.5_Missense_Mutation_p.K155N|PLXNA4_ENST00000423507.2_Missense_Mutation_p.K155N			Q9HCM2	PLXA4_HUMAN	plexin A4	155	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						AGTGCTCCTTCTTATGATAAG	0.542																																						dbGAP											0													86.0	76.0	79.0					7																	132192988		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.465G>C	7.37:g.132192988C>G	ENSP00000352882:p.Lys155Asn		A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semaphorin/CD100_Ag,pfam_IPT_TIG_rcpt,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.K155N	ENST00000359827.3	37	c.465	CCDS43646.1	7	.	.	.	.	.	.	.	.	.	.	C	9.266	1.044496	0.19748	.	.	ENSG00000221866	ENST00000321063;ENST00000359827;ENST00000423507;ENST00000378539	T;T;T;T	0.11385	2.78;2.78;2.78;2.78	5.39	4.51	0.55191	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.64402	U	0.000003	T	0.12987	0.0315	M	0.66939	2.045	0.53005	D	0.999968	B;B;B	0.18968	0.005;0.032;0.021	B;B;B	0.22880	0.007;0.042;0.012	T	0.05273	-1.0895	10	0.18710	T	0.47	.	10.6271	0.45514	0.0:0.7952:0.1324:0.0723	.	155;155;155	Q9HCM2-2;A4D1N6;Q9HCM2	.;.;PLXA4_HUMAN	N	155	ENSP00000323194:K155N;ENSP00000352882:K155N;ENSP00000392772:K155N;ENSP00000367800:K155N	ENSP00000323194:K155N	K	-	3	2	PLXNA4	131843528	1.000000	0.71417	1.000000	0.80357	0.694000	0.40290	2.635000	0.46537	1.281000	0.44480	0.462000	0.41574	AAG	PLXNA4	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000221866		0.542	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA4	HGNC	protein_coding	OTTHUMT00000338422.2	67	0.00	0	C	NM_181775		132192988	132192988	-1	no_errors	ENST00000321063	ensembl	human	known	69_37n	missense	34	33.33	17	SNP	1.000	G
POLN	353497	genome.wustl.edu	37	4	2210055	2210055	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr4:2210055C>G	ENST00000511885.2	-	5	726	c.373G>C	c.(373-375)Gag>Cag	p.E125Q	POLN_ENST00000515357.1_5'UTR|POLN_ENST00000382865.1_Missense_Mutation_p.E125Q			Q7Z5Q5	DPOLN_HUMAN	polymerase (DNA directed) nu	125					double-strand break repair via homologous recombination (GO:0000724)|interstrand cross-link repair (GO:0036297)|translesion synthesis (GO:0019985)	nucleus (GO:0005634)	cyclin binding (GO:0030332)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)			kidney(6)|large_intestine(5)|liver(1)|lung(8)|ovary(2)|skin(4)|urinary_tract(2)	28			OV - Ovarian serous cystadenocarcinoma(23;0.0955)			ACTGAAGCCTCTTGATTATAC	0.353								DNA polymerases (catalytic subunits)																														dbGAP											0													79.0	83.0	82.0					4																	2210055		2194	4298	6492	-	-	-	SO:0001583	missense	0			AF044578	CCDS3360.1	4p16.3	2012-05-18			ENSG00000130997	ENSG00000130997		"""DNA polymerases"""	18870	protein-coding gene	gene with protein product		610887				12794064	Standard	NM_181808		Approved		uc003ger.2	Q7Z5Q5	OTTHUMG00000090081	ENST00000511885.2:c.373G>C	4.37:g.2210055C>G	ENSP00000435506:p.Glu125Gln		A2A336|B4E158|Q4TTW4|Q6ZNF4	Missense_Mutation	SNP	pfam_DNA-dir_DNA_pol_A_palm_dom,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_A_palm_dom,prints_DNA_polymerase_A	p.E125Q	ENST00000511885.2	37	c.373	CCDS3360.1	4	.	.	.	.	.	.	.	.	.	.	c	10.26	1.300087	0.23650	.	.	ENSG00000130997	ENST00000511885;ENST00000382865	T;T	0.51325	0.71;0.71	5.27	0.974	0.19715	.	1.459160	0.03971	N	0.291615	T	0.29288	0.0729	N	0.17082	0.46	0.09310	N	1	B;B	0.18863	0.031;0.024	B;B	0.15870	0.014;0.008	T	0.13335	-1.0513	10	0.19590	T	0.45	-5.8173	4.0237	0.09677	0.0:0.3656:0.3924:0.242	.	125;125	E7ERY2;Q7Z5Q5	.;DPOLN_HUMAN	Q	125	ENSP00000435506:E125Q;ENSP00000372316:E125Q	ENSP00000372316:E125Q	E	-	1	0	POLN	2179853	0.000000	0.05858	0.250000	0.24296	0.629000	0.37895	-0.006000	0.12833	0.231000	0.21079	-0.217000	0.12591	GAG	POLN	-	NULL	ENSG00000130997		0.353	POLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLN	HGNC	protein_coding	OTTHUMT00000205684.2	106	0.00	0	C	NM_181808		2210055	2210055	-1	no_errors	ENST00000382865	ensembl	human	known	69_37n	missense	44	32.31	21	SNP	0.139	G
POLR2A	5430	genome.wustl.edu	37	17	7404270	7404270	+	Silent	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr17:7404270G>A	ENST00000322644.6	+	12	2292	c.1893G>A	c.(1891-1893)gaG>gaA	p.E631E		NM_000937.4	NP_000928	P24928	RPB1_HUMAN	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	631					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA-directed RNA polymerase activity (GO:0003968)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(17)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	50		Prostate(122;0.173)				tggtggtggagaatggggagc	0.557																																						dbGAP											0													217.0	178.0	191.0					17																	7404270		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0					17p13.1	2013-01-21	2002-08-29		ENSG00000181222	ENSG00000181222	2.7.7.6	"""RNA polymerase subunits"""	9187	protein-coding gene	gene with protein product	"""DNA-directed RNA polymerase II largest subunit, RNA polymerase II 220 kd subunit"", ""RNA polymerase II subunit B1"""	180660	"""polymerase (RNA) II (DNA directed) polypeptide A (220kD)"""	POLR2			Standard	NM_000937		Approved	POLRA, RPB1	uc002ghf.4	P24928	OTTHUMG00000177594	ENST00000322644.6:c.1893G>A	17.37:g.7404270G>A			A6NN93|B9EH88|Q6NX41	Silent	SNP	pfam_RNA_pol_Rpb1_1,pfam_RNA_pol_Rpb1_5,pfam_RNA_pol_Rpb1_6,pfam_RNA_pol_asu,pfam_RNA_pol_Rpb1_7,pfam_RNA_pol_Rpb1_3,pfam_RNA_pol_Rpb1_4,pfam_RNA_pol_II_repeat_euk,smart_RNA_pol_N	p.E631	ENST00000322644.6	37	c.1893	CCDS32548.1	17																																																																																			POLR2A	-	pfam_RNA_pol_Rpb1_3	ENSG00000181222		0.557	POLR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR2A	HGNC	protein_coding	OTTHUMT00000437967.1	260	0.00	0	G	NM_000937		7404270	7404270	+1	no_errors	ENST00000322644	ensembl	human	known	69_37n	silent	239	33.24	119	SNP	1.000	A
POM121C	100101267	genome.wustl.edu	37	7	75070302	75070302	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr7:75070302C>G	ENST00000257665.5	-	3	882	c.883G>C	c.(883-885)Gag>Cag	p.E295Q	POM121C_ENST00000453279.2_Missense_Mutation_p.E53Q			A8CG34	P121C_HUMAN	POM121 transmembrane nucleoporin C	295	Pore side. {ECO:0000255}.|Required for targeting to the nucleus and nuclear pore complex.				mRNA transport (GO:0051028)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|nuclear pore (GO:0005643)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	14						TTCTTCTTCTCTTTGAGGGCA	0.448																																						dbGAP											0													133.0	146.0	141.0					7																	75070302		2203	4297	6500	-	-	-	SO:0001583	missense	0				CCDS47617.1	7q11.23	2012-03-13	2012-03-13		ENSG00000135213	ENSG00000272391			34005	protein-coding gene	gene with protein product		615754	"""POM121 membrane glycoprotein C"""			17900573	Standard	NM_001099415		Approved		uc003udk.4	A8CG34	OTTHUMG00000156238	ENST00000257665.5:c.883G>C	7.37:g.75070302C>G	ENSP00000257665:p.Glu295Gln		O75115|Q9Y2N3|Q9Y4S7	Missense_Mutation	SNP	NULL	p.E295Q	ENST00000257665.5	37	c.883		7	.	.	.	.	.	.	.	.	.	.	C	13.36	2.214817	0.39102	.	.	ENSG00000135213	ENST00000257665;ENST00000453279	T;T	0.17213	2.29;2.29	4.27	3.37	0.38596	.	0.350989	0.20468	N	0.091760	T	0.34395	0.0896	M	0.73372	2.23	0.42068	D	0.991196	D	0.65815	0.995	P	0.59703	0.862	T	0.09357	-1.0678	10	0.54805	T	0.06	.	11.3341	0.49494	0.0:0.8154:0.1846:0.0	.	295	A8CG34	P121C_HUMAN	Q	295;53	ENSP00000257665:E295Q;ENSP00000414208:E53Q	ENSP00000257665:E295Q	E	-	1	0	POM121C	74908238	1.000000	0.71417	0.995000	0.50966	0.151000	0.21798	3.984000	0.56923	0.903000	0.36546	0.505000	0.49811	GAG	POM121C	-	NULL	ENSG00000135213		0.448	POM121C-003	KNOWN	basic|appris_candidate_longest	protein_coding	POM121C	HGNC	protein_coding	OTTHUMT00000343919.2	314	0.00	0	C	NM_001099415		75070302	75070302	-1	no_errors	ENST00000257665	ensembl	human	known	69_37n	missense	226	36.59	131	SNP	1.000	G
PPEF2	5470	genome.wustl.edu	37	4	76805791	76805791	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr4:76805791G>T	ENST00000286719.7	-	8	1058	c.702C>A	c.(700-702)ttC>ttA	p.F234L		NM_006239.2	NP_006230.2	O14830	PPE2_HUMAN	protein phosphatase, EF-hand calcium binding domain 2	234	Catalytic.				detection of stimulus involved in sensory perception (GO:0050906)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|protein dephosphorylation (GO:0006470)|regulation of JUN kinase activity (GO:0043506)|regulation of MAP kinase activity (GO:0043405)|visual perception (GO:0007601)	cilium (GO:0005929)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|Hsp70 protein binding (GO:0030544)|Hsp90 protein binding (GO:0051879)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	50			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			TGTTAAGATGGAACTCTTTGG	0.398																																					NSCLC(105;1359 1603 15961 44567 47947)	dbGAP											0													183.0	183.0	183.0					4																	76805791		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF023456	CCDS34013.1	4q21.1	2013-01-10			ENSG00000156194	ENSG00000156194		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9244	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, beta isozyme"""	602256				9326663, 12051765	Standard	NM_006239		Approved	PPP7CB	uc003hix.3	O14830	OTTHUMG00000160915	ENST00000286719.7:c.702C>A	4.37:g.76805791G>T	ENSP00000286719:p.Phe234Leu		O14831	Missense_Mutation	SNP	pirsf_Ser/Thr-Pase_EF-hand_contain,pfam_Metallo_PEstase_dom,pfam_PPP_dom,smart_Ser/Thr-sp_prot-phosphatase,smart_EF_hand_Ca-bd,prints_Ser/Thr-sp_prot-phosphatase,pfscan_EF_HAND_2	p.F234L	ENST00000286719.7	37	c.702	CCDS34013.1	4	.	.	.	.	.	.	.	.	.	.	G	8.877	0.950687	0.18431	.	.	ENSG00000156194	ENST00000286719;ENST00000337500	T	0.05513	3.43	4.84	2.1	0.27182	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (1);Metallophosphoesterase domain (1);	0.109437	0.64402	D	0.000009	T	0.06096	0.0158	L	0.55017	1.72	0.37236	D	0.905914	B;P	0.35551	0.034;0.509	B;B	0.38712	0.03;0.28	T	0.21008	-1.0258	10	0.05959	T	0.93	-11.0663	7.2206	0.25985	0.3631:0.0:0.6369:0.0	.	234;234	O14830-2;O14830	.;PPE2_HUMAN	L	234	ENSP00000286719:F234L	ENSP00000286719:F234L	F	-	3	2	PPEF2	77024815	0.979000	0.34478	1.000000	0.80357	0.994000	0.84299	0.130000	0.15850	0.629000	0.30376	0.655000	0.94253	TTC	PPEF2	-	pirsf_Ser/Thr-Pase_EF-hand_contain,pfam_Metallo_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase	ENSG00000156194		0.398	PPEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPEF2	HGNC	protein_coding	OTTHUMT00000362929.1	98	0.00	0	G	NM_006239		76805791	76805791	-1	no_errors	ENST00000286719	ensembl	human	known	69_37n	missense	59	24.36	19	SNP	0.999	T
PPFIA2	8499	genome.wustl.edu	37	12	82147853	82147853	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr12:82147853G>A	ENST00000549396.1	-	3	308	c.148C>T	c.(148-150)Cgg>Tgg	p.R50W	PPFIA2_ENST00000550584.2_Missense_Mutation_p.R50W|PPFIA2_ENST00000548586.1_Missense_Mutation_p.R50W|PPFIA2_ENST00000552948.1_Missense_Mutation_p.R50W|PPFIA2_ENST00000333447.7_Missense_Mutation_p.R50W|PPFIA2_ENST00000549325.1_Missense_Mutation_p.R50W	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	50					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						TGGGTCTCCCGAAGGGTGTCT	0.527																																						dbGAP											0													62.0	65.0	64.0					12																	82147853		1934	4143	6077	-	-	-	SO:0001583	missense	0			AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.148C>T	12.37:g.82147853G>A	ENSP00000450337:p.Arg50Trp		B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.R50W	ENST00000549396.1	37	c.148	CCDS55857.1	12	.	.	.	.	.	.	.	.	.	.	G	22.1	4.248717	0.80024	.	.	ENSG00000139220	ENST00000549396;ENST00000549325;ENST00000541501;ENST00000333447;ENST00000548586;ENST00000552948;ENST00000551442;ENST00000547623	T;T;T;T;T;T;T	0.50813	1.06;1.06;1.06;1.06;1.06;1.06;0.73	5.95	5.04	0.67666	.	0.075220	0.52532	D	0.000079	T	0.64594	0.2612	M	0.81497	2.545	0.80722	D	1	D	0.69078	0.997	P	0.53490	0.727	T	0.72330	-0.4326	10	0.87932	D	0	.	17.0605	0.86546	0.0:0.127:0.873:0.0	.	50	O75334	LIPA2_HUMAN	W	50;50;61;50;50;50;50;50	ENSP00000450337:R50W;ENSP00000450298:R50W;ENSP00000327416:R50W;ENSP00000449338:R50W;ENSP00000447868:R50W;ENSP00000449469:R50W;ENSP00000447918:R50W	ENSP00000327416:R50W	R	-	1	2	PPFIA2	80671984	1.000000	0.71417	0.993000	0.49108	0.998000	0.95712	5.198000	0.65147	1.475000	0.48197	0.650000	0.86243	CGG	PPFIA2	-	NULL	ENSG00000139220		0.527	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPFIA2	HGNC	protein_coding	OTTHUMT00000408030.1	95	0.00	0	G			82147853	82147853	-1	no_errors	ENST00000549396	ensembl	human	known	69_37n	missense	36	37.93	22	SNP	1.000	A
PPP4R4	57718	genome.wustl.edu	37	14	94718190	94718190	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr14:94718190C>G	ENST00000304338.3	+	16	1976	c.1822C>G	c.(1822-1824)Cta>Gta	p.L608V		NM_058237.1	NP_478144.1	Q6NUP7	PP4R4_HUMAN	protein phosphatase 4, regulatory subunit 4	608					negative regulation of phosphoprotein phosphatase activity (GO:0032515)|regulation of protein serine/threonine phosphatase activity (GO:0080163)	cytoplasm (GO:0005737)|protein serine/threonine phosphatase complex (GO:0008287)	protein phosphatase regulator activity (GO:0019888)			NS(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(15)|lung(10)|skin(7)|upper_aerodigestive_tract(2)	40						ATATTTCTTTCTACCTGCTAT	0.294																																						dbGAP											0													42.0	45.0	44.0					14																	94718190		2202	4281	6483	-	-	-	SO:0001583	missense	0			AB046842, BC068491	CCDS9921.1, CCDS9922.1	14q32.2	2014-07-18	2008-09-16	2008-09-16	ENSG00000119698	ENSG00000119698		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	23788	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 14"""		"""KIAA1622"""	KIAA1622		18715871	Standard	NM_020958		Approved	PP4R4, CFAP14	uc001ycs.1	Q6NUP7		ENST00000304338.3:c.1822C>G	14.37:g.94718190C>G	ENSP00000305924:p.Leu608Val		Q9BUF8|Q9HCF0	Missense_Mutation	SNP	superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.L608V	ENST00000304338.3	37	c.1822	CCDS9921.1	14	.	.	.	.	.	.	.	.	.	.	C	6.763	0.509698	0.12883	.	.	ENSG00000119698	ENST00000304338	T	0.31247	1.5	5.72	1.83	0.25207	Armadillo-like helical (1);Armadillo-type fold (1);	0.211578	0.41194	D	0.000925	T	0.25044	0.0608	L	0.57536	1.79	0.80722	D	1	B	0.34103	0.437	B	0.30105	0.111	T	0.04178	-1.0971	10	0.24483	T	0.36	-9.9365	10.1321	0.42685	0.0:0.605:0.0:0.395	.	608	Q6NUP7	PP4R4_HUMAN	V	608	ENSP00000305924:L608V	ENSP00000305924:L608V	L	+	1	2	PPP4R4	93787943	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	1.031000	0.30165	0.349000	0.23975	0.462000	0.41574	CTA	PPP4R4	-	superfamily_ARM-type_fold	ENSG00000119698		0.294	PPP4R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP4R4	HGNC	protein_coding	OTTHUMT00000413056.1	71	0.00	0	C	NM_058237		94718190	94718190	+1	no_errors	ENST00000304338	ensembl	human	known	69_37n	missense	25	33.33	13	SNP	0.993	G
PRCC	5546	genome.wustl.edu	37	1	156737729	156737729	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr1:156737729C>G	ENST00000271526.4	+	1	438	c.166C>G	c.(166-168)Cag>Gag	p.Q56E	PRCC_ENST00000353233.3_Missense_Mutation_p.Q56E|PRCC_ENST00000491853.1_Intron|HDGF_ENST00000465180.1_5'Flank	NM_005973.4	NP_005964.3	Q92733	PRCC_HUMAN	papillary renal cell carcinoma (translocation-associated)	56	Mediates interaction with MAD2L2.				mitotic cell cycle checkpoint (GO:0007093)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)			PRCC/TFE3(25)	breast(1)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(1)|liver(1)|lung(5)|upper_aerodigestive_tract(1)	15	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TCCGCCCCCTCAGATGCTGGC	0.697			T	TFE3	papillary renal																																	dbGAP		Dom	yes		1	1q21.1	5546	papillary renal cell carcinoma (translocation-associated)		E	0													9.0	9.0	9.0					1																	156737729		2190	4278	6468	-	-	-	SO:0001583	missense	0			X99720	CCDS1157.1	1q21.1	2008-02-05			ENSG00000143294	ENSG00000143294			9343	protein-coding gene	gene with protein product		179755				8872474	Standard	NM_005973		Approved	RCCP1	uc001fqa.3	Q92733	OTTHUMG00000041294	ENST00000271526.4:c.166C>G	1.37:g.156737729C>G	ENSP00000271526:p.Gln56Glu		A8K1F7|O00665|O00724|Q5SZ06	Missense_Mutation	SNP	pfam_PRCC_C	p.Q56E	ENST00000271526.4	37	c.166	CCDS1157.1	1	.	.	.	.	.	.	.	.	.	.	C	14.10	2.434229	0.43224	.	.	ENSG00000143294	ENST00000271526;ENST00000353233	T;T	0.36157	1.27;1.27	5.55	4.64	0.57946	.	0.201259	0.35067	N	0.003469	T	0.18341	0.0440	L	0.36672	1.1	0.34961	D	0.752212	P;P	0.40332	0.713;0.713	P;P	0.48654	0.585;0.585	T	0.03761	-1.1006	10	0.07813	T	0.8	-5.3506	11.2803	0.49190	0.0:0.9165:0.0:0.0835	.	56;56	A6NG79;Q92733	.;PRCC_HUMAN	E	56	ENSP00000271526:Q56E;ENSP00000339300:Q56E	ENSP00000271526:Q56E	Q	+	1	0	PRCC	155004353	0.997000	0.39634	1.000000	0.80357	0.996000	0.88848	3.501000	0.53325	1.582000	0.49881	0.655000	0.94253	CAG	PRCC	-	NULL	ENSG00000143294		0.697	PRCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRCC	HGNC	protein_coding	OTTHUMT00000098941.2	13	0.00	0	C	NM_005973		156737729	156737729	+1	no_errors	ENST00000271526	ensembl	human	known	69_37n	missense	10	28.57	4	SNP	1.000	G
PRDM11	56981	genome.wustl.edu	37	11	45203410	45203410	+	Silent	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr11:45203410C>T	ENST00000530656.1	+	2	195	c.195C>T	c.(193-195)ctC>ctT	p.L65L	PRDM11_ENST00000424263.2_Silent_p.L31L|PRDM11_ENST00000263765.4_Silent_p.L65L			Q9NQV5	PRD11_HUMAN	PR domain containing 11	65				KTEVCSPLRD -> NPS (in Ref. 1; AAF87244). {ECO:0000305}.			methyltransferase activity (GO:0008168)			endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	26						GCTCACCACTCCGAGACCAGG	0.612																																					NSCLC(118;1511 1736 6472 36603 43224)	dbGAP											0													66.0	55.0	59.0					11																	45203410		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF275818	CCDS58130.1, CCDS73277.1	11p11	2008-07-21			ENSG00000019485	ENSG00000019485			13996	protein-coding gene	gene with protein product	"""PR-domain containing protein 11"""						Standard	NM_001256695		Approved	PFM8	uc031qab.1	Q9NQV5	OTTHUMG00000166478	ENST00000530656.1:c.195C>T	11.37:g.45203410C>T			Q8N9F1	Silent	SNP	pfscan_SET_dom	p.L65	ENST00000530656.1	37	c.195		11																																																																																			PRDM11	-	NULL	ENSG00000019485		0.612	PRDM11-001	KNOWN	basic|appris_candidate_longest	protein_coding	PRDM11	HGNC	protein_coding	OTTHUMT00000389928.1	45	0.00	0	C	NM_020229		45203410	45203410	+1	no_errors	ENST00000263765	ensembl	human	known	69_37n	silent	22	40.54	15	SNP	0.546	T
PRICKLE2	166336	genome.wustl.edu	37	3	64133158	64133158	+	Silent	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr3:64133158G>A	ENST00000295902.6	-	7	1593	c.1008C>T	c.(1006-1008)cgC>cgT	p.R336R	PRICKLE2_ENST00000564377.1_Silent_p.R392R	NM_198859.3	NP_942559.1	Q7Z3G6	PRIC2_HUMAN	prickle homolog 2 (Drosophila)	336					establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|neuron projection development (GO:0031175)	apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(9)|liver(1)|lung(10)|ovary(4)|prostate(2)|skin(2)|stomach(1)	32		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)		TTTTGGCACTGCGCCGGGACT	0.587																																						dbGAP											0													98.0	111.0	107.0					3																	64133158		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK127839	CCDS2902.1	3p14.3	2006-09-12	2006-09-12		ENSG00000163637	ENSG00000163637			20340	protein-coding gene	gene with protein product		608501	"""prickle-like 2 (Drosophila)"""			12525887	Standard	NM_198859		Approved	DKFZp686D143	uc003dmf.3	Q7Z3G6	OTTHUMG00000158789	ENST00000295902.6:c.1008C>T	3.37:g.64133158G>A			Q0VF44	Silent	SNP	pfam_PET_domain,pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.R336	ENST00000295902.6	37	c.1008	CCDS2902.1	3																																																																																			PRICKLE2	-	NULL	ENSG00000163637		0.587	PRICKLE2-001	KNOWN	basic|CCDS	protein_coding	PRICKLE2	HGNC	protein_coding	OTTHUMT00000352219.1	133	0.00	0	G	NM_198859		64133158	64133158	-1	no_errors	ENST00000295902	ensembl	human	known	69_37n	silent	45	55.00	55	SNP	1.000	A
PRKG1	5592	genome.wustl.edu	37	10	53227489	53227489	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr10:53227489A>T	ENST00000401604.2	+	3	634	c.440A>T	c.(439-441)aAg>aTg	p.K147M	PRKG1_ENST00000373985.1_Missense_Mutation_p.K135M|PRKG1_ENST00000373980.4_Missense_Mutation_p.K162M			Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I	147	cGMP-binding, high affinity.				actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|dendrite development (GO:0016358)|forebrain development (GO:0030900)|negative regulation of platelet aggregation (GO:0090331)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|regulation of GTPase activity (GO:0043087)|relaxation of vascular smooth muscle (GO:0060087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	53		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		TTAGATGGTAAGGTTGAAGTT	0.388																																						dbGAP											0													137.0	125.0	129.0					10																	53227489		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS7244.1	10q11.2	2009-07-10			ENSG00000185532	ENSG00000185532	2.7.11.1		9414	protein-coding gene	gene with protein product		176894		PRKGR1B, PRKG1B		2792381, 1544322	Standard	NM_001098512		Approved	PGK, PKG	uc001jjo.3	Q13976	OTTHUMG00000018248	ENST00000401604.2:c.440A>T	10.37:g.53227489A>T	ENSP00000384200:p.Lys147Met		A5YM56|B3KSF3|E2PU10|P14619|Q5JP05|Q5JSJ6|Q6P5T7	Missense_Mutation	SNP	pirsf_cGMP-dependent_protein_kinase,pfam_Prot_kinase_cat_dom,pfam_cNMP-bd_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,prints_cGMP_dep_kinase,prints_cAMP/cGMP_kin,pfscan_cNMP-bd_dom,pfscan_Prot_kinase_cat_dom	p.K162M	ENST00000401604.2	37	c.485	CCDS44399.1	10	.	.	.	.	.	.	.	.	.	.	A	15.14	2.744299	0.49151	.	.	ENSG00000185532	ENST00000401604;ENST00000373985;ENST00000373980;ENST00000373976	D;D;D;D	0.93659	-3.26;-3.26;-3.26;-3.26	5.9	5.9	0.94986	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.182061	0.46442	D	0.000289	D	0.92606	0.7651	L	0.61036	1.89	0.54753	D	0.999988	B;B;B	0.28605	0.217;0.008;0.023	B;B;B	0.34931	0.192;0.021;0.058	D	0.90978	0.4825	10	0.49607	T	0.09	-12.283	14.2838	0.66232	1.0:0.0:0.0:0.0	.	147;162;147	B4DT93;Q13976-2;Q13976	.;.;KGP1_HUMAN	M	147;135;162;20	ENSP00000384200:K147M;ENSP00000363097:K135M;ENSP00000363092:K162M;ENSP00000363087:K20M	ENSP00000363087:K20M	K	+	2	0	PRKG1	52897495	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	5.984000	0.70548	2.248000	0.74166	0.460000	0.39030	AAG	PRKG1	-	pirsf_cGMP-dependent_protein_kinase,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	ENSG00000185532		0.388	PRKG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKG1	HGNC	protein_coding		156	0.00	0	A			53227489	53227489	+1	no_errors	ENST00000373980	ensembl	human	known	69_37n	missense	72	32.71	35	SNP	1.000	T
PSAP	5660	genome.wustl.edu	37	10	73579279	73579279	+	Silent	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr10:73579279C>T	ENST00000394936.3	-	11	1440	c.1293G>A	c.(1291-1293)gaG>gaA	p.E431E	PSAP_ENST00000394934.1_Silent_p.E433E			P07602	SAP_HUMAN	prosaposin	431	Saposin B-type 4. {ECO:0000255|PROSITE- ProRule:PRU00415}.				blood coagulation (GO:0007596)|cellular response to organic substance (GO:0071310)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|glycosphingolipid metabolic process (GO:0006687)|lipid transport (GO:0006869)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catalytic activity (GO:0043085)|prostate gland growth (GO:0060736)|regulation of lipid metabolic process (GO:0019216)|regulation of MAPK cascade (GO:0043408)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|lipid binding (GO:0008289)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	13						CAGCCAGGATCTCCTGCTTGG	0.577																																						dbGAP											0													108.0	101.0	104.0					10																	73579279		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC004275	CCDS7311.1	10q21-q22	2014-01-30	2008-07-31		ENSG00000197746	ENSG00000197746		"""Endogenous ligands"""	9498	protein-coding gene	gene with protein product	"""variant Gaucher disease and variant metachromatic leukodystrophy"""	176801	"""sphingolipid activator protein-1"""	SAP1, GLBA		2717620	Standard	NM_001042465		Approved		uc001jsm.3	P07602	OTTHUMG00000018429	ENST00000394936.3:c.1293G>A	10.37:g.73579279C>T			P07292|P15793|P78538|P78541|P78546|P78547|P78558|Q53Y86|Q6IBQ6|Q92739|Q92740|Q92741|Q92742	Silent	SNP	pirsf_Saposin_chordata,pfam_SapB_1,pfam_SapB_2,pfam_SapA,superfamily_Saposin-like,smart_SapA,smart_SaposinB,prints_Saposin,pfscan_SapA,pfscan_SaposinB	p.E431	ENST00000394936.3	37	c.1293	CCDS7311.1	10																																																																																			PSAP	-	pirsf_Saposin_chordata,pfam_SapB_1,superfamily_Saposin-like,smart_SaposinB,pfscan_SaposinB	ENSG00000197746		0.577	PSAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PSAP	HGNC	protein_coding	OTTHUMT00000048553.1	128	0.00	0	C	NM_002778		73579279	73579279	-1	no_errors	ENST00000373120	ensembl	human	known	69_37n	silent	60	34.78	32	SNP	0.998	T
PTCHD1	139411	genome.wustl.edu	37	X	23397794	23397794	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chrX:23397794G>C	ENST00000379361.4	+	2	1298	c.438G>C	c.(436-438)aaG>aaC	p.K146N		NM_173495.2	NP_775766.2	Q96NR3	PTHD1_HUMAN	patched domain containing 1	146					cognition (GO:0050890)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(4)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(4)|skin(2)|urinary_tract(2)	42						ATAATGATAAGACTTGCATCG	0.453																																						dbGAP											0													85.0	76.0	80.0					X																	23397794		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK054858	CCDS35215.2	Xp22.13	2008-02-05			ENSG00000165186	ENSG00000165186			26392	protein-coding gene	gene with protein product		300828					Standard	NM_173495		Approved	FLJ30296	uc004dal.4	Q96NR3	OTTHUMG00000021251	ENST00000379361.4:c.438G>C	X.37:g.23397794G>C	ENSP00000368666:p.Lys146Asn		B4DQH0|Q0IJ60|Q6P6B8	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD	p.K146N	ENST00000379361.4	37	c.438	CCDS35215.2	X	.	.	.	.	.	.	.	.	.	.	G	11.30	1.598822	0.28445	.	.	ENSG00000165186	ENST00000379361	D	0.85339	-1.97	5.06	5.06	0.68205	.	0.053492	0.85682	D	0.000000	T	0.76183	0.3952	N	0.20986	0.625	0.40600	D	0.981571	P;B	0.37500	0.597;0.101	B;B	0.35813	0.211;0.028	T	0.74833	-0.3530	10	0.17369	T	0.5	.	17.8115	0.88617	0.0:0.0:1.0:0.0	.	41;146	Q96NR3-3;Q96NR3	.;PTHD1_HUMAN	N	146	ENSP00000368666:K146N	ENSP00000368666:K146N	K	+	3	2	PTCHD1	23307715	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.809000	0.55606	2.483000	0.83821	0.600000	0.82982	AAG	PTCHD1	-	pfam_Patched	ENSG00000165186		0.453	PTCHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD1	HGNC	protein_coding	OTTHUMT00000056047.2	64	0.00	0	G	NM_173495		23397794	23397794	+1	no_errors	ENST00000379361	ensembl	human	known	69_37n	missense	71	20.22	18	SNP	1.000	C
PTGER3	5733	genome.wustl.edu	37	1	71512883	71512883	+	Silent	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr1:71512883C>T	ENST00000306666.5	-	1	588	c.378G>A	c.(376-378)tcG>tcA	p.S126S	PTGER3_ENST00000370931.3_Silent_p.S126S|PTGER3_ENST00000370924.4_Silent_p.S126S|PTGER3_ENST00000354608.5_Silent_p.S126S|ZRANB2-AS1_ENST00000450461.1_RNA|PTGER3_ENST00000356595.4_Silent_p.S126S|PTGER3_ENST00000414819.1_Silent_p.S126S|PTGER3_ENST00000370932.2_Silent_p.S126S|PTGER3_ENST00000460330.1_Silent_p.S126S|PTGER3_ENST00000351052.5_Silent_p.S126S	NM_198719.1	NP_942012.1	P43115	PE2R3_HUMAN	prostaglandin E receptor 3 (subtype EP3)	126					cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of fever generation (GO:0031622)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|prostaglandin E receptor activity (GO:0004957)			endometrium(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25					Bimatoprost(DB00905)|Dinoprostone(DB00917)|Misoprostol(DB00929)	AGAGCCGCCCCGACGGGTCGA	0.652																																						dbGAP											0													25.0	25.0	25.0					1																	71512883		2196	4295	6491	-	-	-	SO:0001819	synonymous_variant	0			X83863	CCDS652.1, CCDS655.1, CCDS656.1, CCDS657.1, CCDS658.1	1p31.2	2012-08-08			ENSG00000050628	ENSG00000050628		"""GPCR / Class A : Prostanoid receptors"""	9595	protein-coding gene	gene with protein product		176806				7759114, 9073510	Standard	NM_001126044		Approved	EP3	uc001dfo.3	P43115	OTTHUMG00000009399	ENST00000306666.5:c.378G>A	1.37:g.71512883C>T			B0AZN4|B1AK19|B5BUP5|O00326|Q12943|Q12944|Q12945|Q16546|Q5CZ59|Q5CZ61|Q5CZ62|Q5CZ63|Q5CZ64	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfam_7TM_GPCR_serpentine_rcpt_Srbc,pfscan_GPCR_Rhodpsn_supfam,prints_Prostglndn_EP3_rcpt,prints_Prostanoid_rcpt,prints_EP3_rcpt_2,prints_Prostglndn_DP_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Thbox_rcpt	p.S126	ENST00000306666.5	37	c.378	CCDS657.1	1																																																																																			PTGER3	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfam_7TM_GPCR_serpentine_rcpt_Srbc,pfscan_GPCR_Rhodpsn_supfam,prints_Prostglndn_EP3_rcpt	ENSG00000050628		0.652	PTGER3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTGER3	HGNC	protein_coding	OTTHUMT00000026076.1	27	0.00	0	C	NM_000957		71512883	71512883	-1	no_errors	ENST00000354608	ensembl	human	known	69_37n	silent	13	45.83	11	SNP	0.933	T
RAVER2	55225	genome.wustl.edu	37	1	65243506	65243506	+	Silent	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr1:65243506C>T	ENST00000294428.3	+	3	595	c.517C>T	c.(517-519)Ctg>Ttg	p.L173L	RAVER2_ENST00000430964.2_5'Flank|RAVER2_ENST00000371072.4_Silent_p.L173L			Q9HCJ3	RAVR2_HUMAN	ribonucleoprotein, PTB-binding 2	173	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	24						GAGATGTTTTCTGGTCTATAG	0.393																																						dbGAP											0													231.0	209.0	216.0					1																	65243506		1880	4106	5986	-	-	-	SO:0001819	synonymous_variant	0			AB046799	CCDS41345.1	1p31.3	2013-02-12			ENSG00000162437	ENSG00000162437		"""RNA binding motif (RRM) containing"""	25577	protein-coding gene	gene with protein product		609953				16051233	Standard	NM_018211		Approved	KIAA1579, FLJ10770	uc001dbs.2	Q9HCJ3	OTTHUMG00000009102	ENST00000294428.3:c.517C>T	1.37:g.65243506C>T			Q6P141|Q9NPV7	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.L173	ENST00000294428.3	37	c.517		1																																																																																			RAVER2	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000162437		0.393	RAVER2-201	KNOWN	basic	protein_coding	RAVER2	HGNC	protein_coding		139	0.00	0	C	NM_018211		65243506	65243506	+1	no_errors	ENST00000294428	ensembl	human	known	69_37n	silent	72	35.14	39	SNP	0.984	T
PTPRC	5788	genome.wustl.edu	37	1	198691597	198691597	+	Nonsense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr1:198691597C>G	ENST00000367376.2	+	15	1877	c.1706C>G	c.(1705-1707)tCa>tGa	p.S569*	PTPRC_ENST00000442510.2_Nonsense_Mutation_p.S571*|PTPRC_ENST00000348564.6_Nonsense_Mutation_p.S410*|PTPRC_ENST00000594404.1_Nonsense_Mutation_p.S408*|PTPRC_ENST00000352140.3_Nonsense_Mutation_p.S521*	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	569	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						TTACATCATTCAACATCTTGT	0.249																																						dbGAP											0													57.0	62.0	60.0					1																	198691597		2193	4278	6471	-	-	-	SO:0001587	stop_gained	0			Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.1706C>G	1.37:g.198691597C>G	ENSP00000356346:p.Ser569*		A8K7W6|Q16614|Q9H0Y6	Nonsense_Mutation	SNP	pirsf_Leukocyte_common_ag,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Leukocyte_common_ag,pfam_PTP_recept_N,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.S571*	ENST00000367376.2	37	c.1712		1	.	.	.	.	.	.	.	.	.	.	C	36	5.699250	0.96802	.	.	ENSG00000081237	ENST00000367376;ENST00000367366;ENST00000352140;ENST00000535566;ENST00000530727;ENST00000442510;ENST00000367367;ENST00000348564	.	.	.	4.14	3.22	0.36961	.	1.842730	0.03138	N	0.166123	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	7.1432	0.25568	0.0:0.8806:0.0:0.1194	.	.	.	.	X	571;505;521;521;455;569;503;408	.	ENSP00000306782:S408X	S	+	2	0	PTPRC	196958220	0.331000	0.24713	0.993000	0.49108	0.544000	0.35116	0.435000	0.21510	2.314000	0.78098	0.644000	0.83932	TCA	PTPRC	-	pirsf_Leukocyte_common_ag,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000081237		0.249	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	PTPRC	HGNC	protein_coding		74	0.00	0	C			198691597	198691597	+1	no_errors	ENST00000367376	ensembl	human	known	69_37n	nonsense	68	20.00	17	SNP	0.982	G
RFXANK	8625	genome.wustl.edu	37	19	19312527	19312527	+	Silent	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr19:19312527G>A	ENST00000303088.4	+	10	1256	c.782G>A	c.(781-783)tGa>tAa	p.*261*	RFXANK_ENST00000353145.1_Silent_p.*238*|NR2C2AP_ENST00000544883.1_3'UTR|RFXANK_ENST00000392324.4_Silent_p.*238*|NR2C2AP_ENST00000331552.7_3'UTR|RFXANK_ENST00000456252.3_Silent_p.*239*|RFXANK_ENST00000407360.3_Silent_p.*261*|NR2C2AP_ENST00000420605.3_Intron	NM_003721.2	NP_003712.1	O14593	RFXK_HUMAN	regulatory factor X-associated ankyrin-containing protein	0					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Ras protein signal transduction (GO:0007265)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)			NS(1)|breast(1)|endometrium(1)|lung(8)|ovary(2)|prostate(1)	14			Epithelial(12;0.00228)			GACCCTGAGTGAAGGCCGCCT	0.582																																						dbGAP											0													73.0	68.0	70.0					19																	19312527		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF094760	CCDS12395.1, CCDS12396.1, CCDS62611.1	19p12	2014-09-17			ENSG00000064490	ENSG00000064490		"""Ankyrin repeat domain containing"""	9987	protein-coding gene	gene with protein product	"""ankyrin repeat-containing regulatory factor X-associated protein"", ""regulatory factor X subunit B"", ""RFX-Bdelta4"", ""DNA-binding protein RFXANK"""	603200				9806546, 10072068	Standard	NM_003721		Approved	BLS, RFX-B, ANKRA1, F14150_1, MGC138628	uc002nls.3	O14593	OTTHUMG00000169224	ENST00000303088.4:c.782G>A	19.37:g.19312527G>A			O95839|Q24JQ1|Q6FGA8	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pirsf_DNA-bd_RFXANK,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.*261	ENST00000303088.4	37	c.782	CCDS12395.1	19																																																																																			RFXANK	-	NULL	ENSG00000064490		0.582	RFXANK-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	RFXANK	HGNC	protein_coding	OTTHUMT00000402923.2	56	0.00	0	G	NM_003721		19312527	19312527	+1	no_errors	ENST00000303088	ensembl	human	known	69_37n	silent	21	27.59	8	SNP	0.998	A
RIOK1	83732	genome.wustl.edu	37	6	7405582	7405582	+	Silent	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr6:7405582C>G	ENST00000379834.2	+	12	1704	c.1197C>G	c.(1195-1197)ctC>ctG	p.L399L		NM_031480.2|NM_153005.1	NP_113668.2|NP_694550.1	Q9BRS2	RIOK1_HUMAN	RIO kinase 1	399	Protein kinase.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	19	Ovarian(93;0.0418)					ATGCTTATCTCTCAAAGGTAA	0.428																																						dbGAP											0													69.0	57.0	61.0					6																	7405582		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC006104	CCDS4500.1	6p24.3	2012-12-10	2012-12-10		ENSG00000124784	ENSG00000124784			18656	protein-coding gene	gene with protein product			"""RIO kinase 1 (yeast)"""				Standard	NM_031480		Approved	AD034, FLJ30006, bA288G3.1, RRP10	uc003mxn.3	Q9BRS2	OTTHUMG00000014207	ENST00000379834.2:c.1197C>G	6.37:g.7405582C>G			B2RB28|Q8NDC8|Q96NV9	Silent	SNP	pfam_RIO-like_kinase,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_RIO_kinase,pirsf_Ser/Thr_kinase_Rio1	p.L399	ENST00000379834.2	37	c.1197	CCDS4500.1	6																																																																																			RIOK1	-	pirsf_Ser/Thr_kinase_Rio1	ENSG00000124784		0.428	RIOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIOK1	HGNC	protein_coding	OTTHUMT00000039780.2	89	0.00	0	C	NM_031480		7405582	7405582	+1	no_errors	ENST00000379834	ensembl	human	known	69_37n	silent	36	26.53	13	SNP	0.389	G
RTEL1	51750	genome.wustl.edu	37	20	62293270	62293270	+	Silent	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr20:62293270C>T	ENST00000360203.5	+	4	694	c.369C>T	c.(367-369)atC>atT	p.I123I	RTEL1_ENST00000318100.4_Silent_p.I123I|RTEL1_ENST00000508582.2_Silent_p.I123I|RTEL1_ENST00000370018.3_Silent_p.I123I|RTEL1-TNFRSF6B_ENST00000482936.1_Silent_p.I123I					regulator of telomere elongation helicase 1											NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			CACAGGTCATCAACGAGCTTC	0.552																																						dbGAP											0													150.0	115.0	127.0					20																	62293270		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB029011	CCDS13530.2, CCDS13531.1, CCDS13530.3, CCDS63331.1, CCDS74751.1	20q13.3	2012-06-27	2004-10-29	2004-10-29	ENSG00000258366	ENSG00000258366			15888	protein-coding gene	gene with protein product		608833	"""chromosome 20 open reading frame 41"""	C20orf41		10655513, 15210109	Standard	NM_016434		Approved	bK3184A7.3, NHL, DKFZP434C013, KIAA1088, RTEL	uc011abd.2	Q9NZ71	OTTHUMG00000032992	ENST00000360203.5:c.369C>T	20.37:g.62293270C>T				Silent	SNP	pfam_DEAD_2,smart_Helicase-like_DEXD_c2,smart_ATP-dep_Helicase_C,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3,tigrfam_DNA_helicase_DNA-repair_Rad3	p.I123	ENST00000360203.5	37	c.369		20																																																																																			RTEL1	-	pfam_DEAD_2,smart_Helicase-like_DEXD_c2,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3	ENSG00000258366		0.552	RTEL1-011	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	RTEL1	HGNC	protein_coding	OTTHUMT00000289781.1	141	0.00	0	C	NM_032957		62293270	62293270	+1	no_errors	ENST00000318100	ensembl	human	known	69_37n	silent	173	19.82	43	SNP	0.053	T
RTN4	57142	genome.wustl.edu	37	2	55253275	55253275	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr2:55253275C>T	ENST00000337526.6	-	3	2203	c.1960G>A	c.(1960-1962)Gaa>Aaa	p.E654K	RTN4_ENST00000404909.1_Missense_Mutation_p.E448K|RTN4_ENST00000354474.6_Missense_Mutation_p.E422K|RTN4_ENST00000357732.4_Intron|RTN4_ENST00000357376.3_Missense_Mutation_p.E448K|RTN4_ENST00000402434.2_Intron|RTN4_ENST00000394611.2_Missense_Mutation_p.E448K|RTN4_ENST00000317610.7_Intron|RTN4_ENST00000405240.1_Missense_Mutation_p.E448K	NM_020532.4	NP_065393.1	Q9NQC3	RTN4_HUMAN	reticulon 4	654					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonal fasciculation (GO:0007413)|cardiac epithelial to mesenchymal transition (GO:0060317)|cerebral cortex radial glia guided migration (GO:0021801)|endoplasmic reticulum tubular network organization (GO:0071786)|negative regulation of axon extension (GO:0030517)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell growth (GO:0030308)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of apoptotic process (GO:0042981)|regulation of axonogenesis (GO:0050770)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of cell migration (GO:0030334)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(1)|skin(1)|stomach(1)	36						GGGGGGTTTTCAGGCTCATGT	0.398																																						dbGAP											0													26.0	29.0	28.0					2																	55253275		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF087901	CCDS1851.1, CCDS1852.1, CCDS42683.1, CCDS42684.1, CCDS42685.1	2p14-p13	2008-05-23			ENSG00000115310	ENSG00000115310			14085	protein-coding gene	gene with protein product		604475				10667797, 10773680	Standard	NM_020532		Approved	NSP-CL, KIAA0886, NOGO, ASY	uc002rye.3	Q9NQC3	OTTHUMG00000129337	ENST00000337526.6:c.1960G>A	2.37:g.55253275C>T	ENSP00000337838:p.Glu654Lys		O94962|Q7L7Q5|Q7L7Q6|Q7L7Q8|Q8IUA4|Q96B16|Q9BXG5|Q9H212|Q9H3I3|Q9UQ42|Q9Y293|Q9Y2Y7|Q9Y5U6	Missense_Mutation	SNP	pfam_Reticulon,pfscan_Reticulon	p.E654K	ENST00000337526.6	37	c.1960	CCDS42684.1	2	.	.	.	.	.	.	.	.	.	.	C	20.2	3.956161	0.73902	.	.	ENSG00000115310	ENST00000405240;ENST00000357376;ENST00000337526;ENST00000394611;ENST00000404909;ENST00000354474	T;T;T;T;T;T	0.27557	1.68;1.68;1.66;1.68;1.68;1.74	5.53	5.53	0.82687	.	0.538204	0.19870	N	0.104220	T	0.58892	0.2154	M	0.75264	2.295	0.47621	D	0.999473	D	0.69078	0.997	D	0.75020	0.985	T	0.61372	-0.7076	10	0.87932	D	0	-16.1473	19.4428	0.94827	0.0:1.0:0.0:0.0	.	654	Q9NQC3	RTN4_HUMAN	K	448;448;654;448;448;422	ENSP00000384471:E448K;ENSP00000349944:E448K;ENSP00000337838:E654K;ENSP00000378109:E448K;ENSP00000385650:E448K;ENSP00000346465:E422K	ENSP00000337838:E654K	E	-	1	0	RTN4	55106779	1.000000	0.71417	0.998000	0.56505	0.894000	0.52154	3.697000	0.54764	2.588000	0.87417	0.655000	0.94253	GAA	RTN4	-	NULL	ENSG00000115310		0.398	RTN4-001	KNOWN	basic|CCDS	protein_coding	RTN4	HGNC	protein_coding	OTTHUMT00000251484.1	18	0.00	0	C			55253275	55253275	-1	no_errors	ENST00000337526	ensembl	human	known	69_37n	missense	6	50.00	6	SNP	1.000	T
S1PR3	1903	genome.wustl.edu	37	9	91616635	91616635	+	Silent	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr9:91616635C>T	ENST00000375846.3	+	1	5215	c.520C>T	c.(520-522)Ctg>Ttg	p.L174L	S1PR3_ENST00000358157.2_Silent_p.L174L			Q99500	S1PR3_HUMAN	sphingosine-1-phosphate receptor 3	174					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|anatomical structure morphogenesis (GO:0009653)|cytokine production (GO:0001816)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of establishment of endothelial barrier (GO:1903141)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of interleukin-1 beta production (GO:0032651)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|integrin binding (GO:0005178)|lipid binding (GO:0008289)|sphingosine-1-phosphate receptor activity (GO:0038036)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|skin(1)	34						CCTGCCCATTCTGGGCTGGAA	0.567											OREG0019291	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													168.0	122.0	138.0					9																	91616635		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF022139	CCDS6680.1	9q22.1-q22.2	2012-08-08	2008-04-30	2008-04-30	ENSG00000213694	ENSG00000213694		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	3167	protein-coding gene	gene with protein product	"""sphingosine-1-phosphate receptor 3"""	601965	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 3"""	EDG3		8878560, 9409733	Standard	NM_005226		Approved	EDG-3	uc004aqe.4	Q99500	OTTHUMG00000020173	ENST00000375846.3:c.520C>T	9.37:g.91616635C>T		1283	Q5SQD8|Q7Z5I2	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_EDG3_rcpt,prints_S1P_rcpt,prints_7TM_GPCR_Rhodpsn,prints_EDG1_rcpt,prints_Cnbnoid_rcpt	p.L174	ENST00000375846.3	37	c.520	CCDS6680.1	9																																																																																			S1PR3	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000213694		0.567	S1PR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	S1PR3	HGNC	protein_coding	OTTHUMT00000052979.2	120	0.00	0	C	NM_005226		91616635	91616635	+1	no_errors	ENST00000358157	ensembl	human	known	69_37n	silent	80	39.85	53	SNP	1.000	T
SCAF1	58506	genome.wustl.edu	37	19	50161137	50161137	+	Silent	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr19:50161137C>T	ENST00000360565.3	+	10	3862	c.3738C>T	c.(3736-3738)gcC>gcT	p.A1246A	IRF3_ENST00000599680.1_5'Flank	NM_021228.2	NP_067051.2	Q9H7N4	SFR19_HUMAN	SR-related CTD-associated factor 1	1246	Necessary for interaction with the CTD domain of POLR2A.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	20		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.196)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00113)|GBM - Glioblastoma multiforme(134;0.0204)		TGAGGAAGGCCGTCCACAAGG	0.607																																						dbGAP											0													86.0	56.0	66.0					19																	50161137		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK024444	CCDS33074.1	19q13.3-q13.4	2011-01-10			ENSG00000126461	ENSG00000126461			30403	protein-coding gene	gene with protein product						11461075	Standard	NM_021228		Approved	SR-A1, FLJ00034	uc002poq.3	Q9H7N4		ENST00000360565.3:c.3738C>T	19.37:g.50161137C>T			Q7Z5V7|Q8WVA1|Q9NR59	Silent	SNP	NULL	p.A1246	ENST00000360565.3	37	c.3738	CCDS33074.1	19																																																																																			SCAF1	-	NULL	ENSG00000126461		0.607	SCAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAF1	HGNC	protein_coding	OTTHUMT00000465764.1	51	0.00	0	C	NM_021228		50161137	50161137	+1	no_errors	ENST00000360565	ensembl	human	known	69_37n	silent	39	54.44	49	SNP	0.621	T
SCN5A	6331	genome.wustl.edu	37	3	38645493	38645494	+	Missense_Mutation	DNP	TG	TG	AA			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	T|G	T|G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr3:38645493_38645494TG>AA	ENST00000333535.4	-	12	1748_1749	c.1599_1600CA>TT	c.(1597-1602)cgCAgg>cgTTgg	p.R534W	SCN5A_ENST00000414099.2_Missense_Mutation_p.R534W|SCN5A_ENST00000443581.1_Missense_Mutation_p.R534W|SCN5A_ENST00000450102.2_Missense_Mutation_p.R534W|SCN5A_ENST00000451551.2_Missense_Mutation_p.R534W|SCN5A_ENST00000413689.1_Missense_Mutation_p.R534W|SCN5A_ENST00000455624.2_Missense_Mutation_p.R534W|SCN5A_ENST00000449557.2_Missense_Mutation_p.R534W|SCN5A_ENST00000425664.1_Missense_Mutation_p.R534W|SCN5A_ENST00000423572.2_Missense_Mutation_p.R534W			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	534					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	AGGTCTCGCCTGCGAAAGGTGA	0.579																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.1599_1600delinsAA	3.37:g.38645493_38645494delinsAA	ENSP00000328968:p.Arg534Trp		A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation|Silent	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,prints_Na_channel_a5su,prints_Na_channel_asu	p.R534W|p.R533	ENST00000333535.4	37	c.1600|c.1599	CCDS46796.1	3																																																																																			SCN5A	-	pfam_DUF3451	ENSG00000183873		0.579	SCN5A-014	KNOWN	basic|CCDS	protein_coding	SCN5A	HGNC	protein_coding	OTTHUMT00000377958.1	69|68	0.00	0	T|G	NM_198056		38645493|38645494	38645493|38645494	-1	no_errors	ENST00000333535	ensembl	human	known	69_37n	missense|silent	42|43	28.33|29.51	17|18	SNP	0.341|0.328	A
SDK1	221935	genome.wustl.edu	37	7	4213862	4213862	+	Silent	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr7:4213862G>A	ENST00000404826.2	+	33	4948	c.4809G>A	c.(4807-4809)agG>agA	p.R1603R	SDK1_ENST00000389531.3_Silent_p.R1603R	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1603	Fibronectin type-III 10. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		AGCCTCCGAGGGACGAAAGCC	0.572																																						dbGAP											0													211.0	201.0	204.0					7																	4213862		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.4809G>A	7.37:g.4213862G>A			Q8TEN9|Q8TEP5|Q96N44	Silent	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.R1603	ENST00000404826.2	37	c.4809	CCDS34590.1	7																																																																																			SDK1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000146555		0.572	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK1	HGNC	protein_coding	OTTHUMT00000323702.1	54	0.00	0	G	NM_152744		4213862	4213862	+1	no_errors	ENST00000404826	ensembl	human	known	69_37n	silent	28	26.32	10	SNP	0.975	A
SENP8	123228	genome.wustl.edu	37	15	72432133	72432133	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr15:72432133G>A	ENST00000542035.2	+	2	502	c.169G>A	c.(169-171)Gaa>Aaa	p.E57K	SENP8_ENST00000544171.1_Missense_Mutation_p.E57K|SENP8_ENST00000544411.1_Missense_Mutation_p.E57K|RP11-2I17.4_ENST00000568984.1_RNA|SENP8_ENST00000340912.4_Missense_Mutation_p.E57K	NM_001166340.1	NP_001159812.1	Q96LD8	SENP8_HUMAN	SUMO/sentrin specific peptidase family member 8	57	Protease.						cysteine-type peptidase activity (GO:0008234)			breast(1)|kidney(2)|lung(1)|ovary(1)|skin(1)	6						CATCAGCCCTGAAGTCACCCA	0.468																																						dbGAP											0													157.0	135.0	143.0					15																	72432133		2199	4297	6496	-	-	-	SO:0001583	missense	0			BC031411	CCDS10240.1	15q22.33	2005-08-17	2005-08-17	2004-01-30	ENSG00000166192	ENSG00000166192			22992	protein-coding gene	gene with protein product	"""NEDD8-specific protease 1"", ""sentrin/SUMO-specific protease SENP8"", ""deneddylase 1"""	608659	"""protease, cysteine, 2 (NEDD8 specific)"", ""SUMO/sentrin specific protease family member 8"""	PRSC2		12730221, 12759362	Standard	NM_145204		Approved	NEDP1, DEN1, HsT17512	uc021spt.1	Q96LD8	OTTHUMG00000133441	ENST00000542035.2:c.169G>A	15.37:g.72432133G>A	ENSP00000446057:p.Glu57Lys		Q96QA4	Missense_Mutation	SNP	pfam_Peptidase_C48,pfscan_Peptidase_C48	p.E57K	ENST00000542035.2	37	c.169	CCDS10240.1	15	.	.	.	.	.	.	.	.	.	.	G	19.93	3.918262	0.73098	.	.	ENSG00000166192	ENST00000542035;ENST00000544411;ENST00000340912;ENST00000544171	T;T;T;T	0.28069	1.63;1.63;1.63;1.63	5.62	4.7	0.59300	.	0.000000	0.85682	D	0.000000	T	0.54143	0.1840	M	0.66439	2.03	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.55823	-0.8080	10	0.44086	T	0.13	-14.58	16.8899	0.86084	0.0:0.1283:0.8717:0.0	.	57	Q96LD8	SENP8_HUMAN	K	57	ENSP00000446057:E57K;ENSP00000441753:E57K;ENSP00000340505:E57K;ENSP00000439415:E57K	ENSP00000340505:E57K	E	+	1	0	SENP8	70219187	1.000000	0.71417	0.936000	0.37596	0.296000	0.27459	9.695000	0.98691	1.502000	0.48669	-0.176000	0.13171	GAA	SENP8	-	pfam_Peptidase_C48,pfscan_Peptidase_C48	ENSG00000166192		0.468	SENP8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SENP8	HGNC	protein_coding	OTTHUMT00000420036.1	39	0.00	0	G	NM_145204		72432133	72432133	+1	no_errors	ENST00000340912	ensembl	human	known	69_37n	missense	33	37.74	20	SNP	1.000	A
SEMA7A	8482	genome.wustl.edu	37	15	74704309	74704309	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr15:74704309G>A	ENST00000261918.4	-	11	1887	c.1339C>T	c.(1339-1341)Cac>Tac	p.H447Y	SEMA7A_ENST00000543145.2_Missense_Mutation_p.H433Y|SEMA7A_ENST00000542748.1_Missense_Mutation_p.H282Y	NM_003612.3	NP_003603.1	O75326	SEM7A_HUMAN	semaphorin 7A, GPI membrane anchor (John Milton Hagen blood group)	447	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon extension (GO:0048675)|axon guidance (GO:0007411)|immune response (GO:0006955)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|olfactory lobe development (GO:0021988)|osteoblast differentiation (GO:0001649)|positive regulation of axon extension (GO:0045773)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of protein phosphorylation (GO:0001934)|regulation of inflammatory response (GO:0050727)	anchored component of membrane (GO:0031225)|external side of plasma membrane (GO:0009897)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(3)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(3)|lung(12)|upper_aerodigestive_tract(1)	30						GCGAAGCTGTGCTCCTGCTCC	0.642																																						dbGAP											0													121.0	82.0	95.0					15																	74704309		2197	4296	6493	-	-	-	SO:0001583	missense	0			AF069493	CCDS10262.1, CCDS53958.1, CCDS53959.1	15q22.3-q23	2014-07-18	2006-02-23		ENSG00000138623	ENSG00000138623		"""Semaphorins"", ""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10741	protein-coding gene	gene with protein product	"""John Milton Hagen blood group"", ""H-Sema K1"""	607961	"""sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A"", ""sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A (JMH blood group)"""	SEMAL		9721204	Standard	NM_003612		Approved	H-Sema-L, CD108	uc002axv.3	O75326	OTTHUMG00000139000	ENST00000261918.4:c.1339C>T	15.37:g.74704309G>A	ENSP00000261918:p.His447Tyr		B4DDP7|F5H1S0|Q1XE81|Q1XE82|Q1XE83|Q1XE84|Q3MIY5	Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,pfscan_Semaphorin/CD100_Ag,pfscan_Ig-like	p.H447Y	ENST00000261918.4	37	c.1339	CCDS10262.1	15	.	.	.	.	.	.	.	.	.	.	G	5.245	0.230621	0.09969	.	.	ENSG00000138623	ENST00000261918;ENST00000543145;ENST00000542748	T;T;T	0.11063	2.81;2.81;2.81	4.2	4.2	0.49525	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.585375	0.14124	N	0.339829	T	0.10252	0.0251	L	0.34521	1.04	0.09310	N	1	B;B	0.27380	0.147;0.177	B;B	0.22152	0.022;0.038	T	0.16660	-1.0395	10	0.66056	D	0.02	-12.7531	13.612	0.62086	0.0:0.0:1.0:0.0	.	433;447	F5H1S0;O75326	.;SEM7A_HUMAN	Y	447;433;282	ENSP00000261918:H447Y;ENSP00000438966:H433Y;ENSP00000441493:H282Y	ENSP00000261918:H447Y	H	-	1	0	SEMA7A	72491362	0.032000	0.19561	0.003000	0.11579	0.008000	0.06430	2.506000	0.45433	2.051000	0.60960	0.491000	0.48974	CAC	SEMA7A	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000138623		0.642	SEMA7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA7A	HGNC	protein_coding	OTTHUMT00000272904.3	54	0.00	0	G	NM_003612		74704309	74704309	-1	no_errors	ENST00000261918	ensembl	human	known	69_37n	missense	19	24.00	6	SNP	0.006	A
SERPINC1	462	genome.wustl.edu	37	1	173884020	173884020	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr1:173884020A>G	ENST00000367698.3	-	2	197	c.79T>C	c.(79-81)Tgg>Cgg	p.W27R	SERPINC1_ENST00000494024.1_5'UTR	NM_000488.3	NP_000479.1	P01008	ANT3_HUMAN	serpin peptidase inhibitor, clade C (antithrombin), member 1	27					blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of inflammatory response (GO:0050728)|regulation of blood coagulation, intrinsic pathway (GO:2000266)|regulation of proteolysis (GO:0030162)|response to nutrient (GO:0007584)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(15)|ovary(1)	25					Ardeparin(DB00407)|Dalteparin(DB06779)|Enoxaparin(DB01225)|Fondaparinux sodium(DB00569)|Heparin(DB01109)|Nadroparin(DB08813)|Sulodexide(DB06271)|Tinzaparin(DB06822)	ACGCAGTCCCAGAAGCCAATG	0.557											OREG0013990	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													62.0	63.0	63.0					1																	173884020		2203	4300	6503	-	-	-	SO:0001583	missense	0			X68793	CCDS1313.1	1q25.1	2014-02-18	2005-08-18		ENSG00000117601	ENSG00000117601		"""Serine (or cysteine) peptidase inhibitors"""	775	protein-coding gene	gene with protein product	"""antithrombin III"", ""signal peptide antithrombin part 1"", ""coding sequence signal peptide antithrombin part 1"", ""antithrombin (aa 375-432)"""	107300	"""serine (or cysteine) proteinase inhibitor, clade C (antithrombin), member 1"""	AT3		3979120, 24172014	Standard	NM_000488		Approved	ATIII, MGC22579	uc001gjt.3	P01008	OTTHUMG00000037276	ENST00000367698.3:c.79T>C	1.37:g.173884020A>G	ENSP00000356671:p.Trp27Arg	1911	B2R6P0|P78439|P78447|Q13815|Q5TC78|Q7KZ43|Q7KZ97|Q9UC78	Missense_Mutation	SNP	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	p.W27R	ENST00000367698.3	37	c.79	CCDS1313.1	1	.	.	.	.	.	.	.	.	.	.	A	19.35	3.810575	0.70797	.	.	ENSG00000117601	ENST00000367698;ENST00000351522	D	0.84660	-1.88	5.53	5.53	0.82687	.	0.511543	0.21891	N	0.067586	D	0.83746	0.5321	M	0.71581	2.175	0.27909	N	0.938684	P	0.52170	0.951	P	0.53224	0.721	T	0.80612	-0.1305	10	0.66056	D	0.02	.	10.0747	0.42353	0.9255:0.0:0.0745:0.0	.	27	P01008	ANT3_HUMAN	R	27	ENSP00000356671:W27R	ENSP00000307953:W27R	W	-	1	0	SERPINC1	172150643	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	3.885000	0.56182	2.109000	0.64355	0.459000	0.35465	TGG	SERPINC1	-	NULL	ENSG00000117601		0.557	SERPINC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINC1	HGNC	protein_coding	OTTHUMT00000090734.1	86	0.00	0	A	NM_000488		173884020	173884020	-1	no_errors	ENST00000367698	ensembl	human	known	69_37n	missense	73	10.98	9	SNP	1.000	G
SGK2	10110	genome.wustl.edu	37	20	42204933	42204933	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr20:42204933G>A	ENST00000341458.4	+	10	1162	c.943G>A	c.(943-945)Gga>Aga	p.G315R	SGK2_ENST00000373077.1_Missense_Mutation_p.G254R|SGK2_ENST00000426287.1_Missense_Mutation_p.G281R|SGK2_ENST00000373092.3_Missense_Mutation_p.G255R|SGK2_ENST00000423407.3_Missense_Mutation_p.G255R|SGK2_ENST00000373100.1_Missense_Mutation_p.G255R	NM_016276.3	NP_057360.2	Q9HBY8	SGK2_HUMAN	serum/glucocorticoid regulated kinase 2	315	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|ion transmembrane transport (GO:0034220)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|response to oxidative stress (GO:0006979)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|sodium channel regulator activity (GO:0017080)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(11)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			ACAGATCCCCGGAGGCCGGAC	0.592																																						dbGAP											0													75.0	80.0	78.0					20																	42204933		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF169034	CCDS13320.1, CCDS13321.1	20q13.2	2008-07-04			ENSG00000101049	ENSG00000101049			13900	protein-coding gene	gene with protein product		607589				10548550	Standard	NM_016276		Approved		uc002xkv.3	Q9HBY8	OTTHUMG00000033054	ENST00000341458.4:c.943G>A	20.37:g.42204933G>A	ENSP00000340608:p.Gly315Arg		Q52PK5|Q5H8Y6|Q5H8Z1|Q5TZR3|Q9UKG6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_cat_dom	p.G315R	ENST00000341458.4	37	c.943	CCDS13320.1	20	.	.	.	.	.	.	.	.	.	.	G	3.087	-0.187722	0.06299	.	.	ENSG00000101049	ENST00000373100;ENST00000373092;ENST00000373077;ENST00000423407;ENST00000341458;ENST00000426287	T;T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93;0.93	4.61	3.66	0.41972	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.214288	0.49305	D	0.000153	T	0.14399	0.0348	N	0.01417	-0.88	0.48395	D	0.999647	B;B;B	0.21225	0.024;0.053;0.027	B;B;B	0.24155	0.021;0.051;0.013	T	0.21999	-1.0229	10	0.02654	T	1	.	12.1734	0.54172	0.0864:0.0:0.9136:0.0	.	281;315;255	Q9HBY8-3;Q9HBY8;Q9HBY8-2	.;SGK2_HUMAN;.	R	255;255;254;255;315;281	ENSP00000362192:G255R;ENSP00000362184:G255R;ENSP00000362168:G254R;ENSP00000392795:G255R;ENSP00000340608:G315R;ENSP00000412214:G281R	ENSP00000340608:G315R	G	+	1	0	SGK2	41638347	0.985000	0.35326	0.211000	0.23655	0.383000	0.30230	1.985000	0.40668	1.257000	0.44085	0.650000	0.86243	GGA	SGK2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000101049		0.592	SGK2-002	KNOWN	basic|CCDS	protein_coding	SGK2	HGNC	protein_coding	OTTHUMT00000080383.1	86	0.00	0	G			42204933	42204933	+1	no_errors	ENST00000341458	ensembl	human	known	69_37n	missense	57	27.85	22	SNP	0.933	A
SLC12A5	57468	genome.wustl.edu	37	20	44684870	44684870	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr20:44684870G>A	ENST00000454036.2	+	22	2987	c.2938G>A	c.(2938-2940)Gaa>Aaa	p.E980K	SLC12A5_ENST00000243964.3_Missense_Mutation_p.E957K	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	980					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	GAACGTCCCAGAAGAGACGGC	0.572																																						dbGAP											0													76.0	74.0	75.0					20																	44684870		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.2938G>A	20.37:g.44684870G>A	ENSP00000387694:p.Glu980Lys		A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Missense_Mutation	SNP	pfam_AA-permease_dom,prints_KCL_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.E980K	ENST00000454036.2	37	c.2938	CCDS46610.1	20	.	.	.	.	.	.	.	.	.	.	G	17.37	3.373647	0.61624	.	.	ENSG00000124140	ENST00000454036;ENST00000243964	T;T	0.45276	0.9;0.9	4.8	4.8	0.61643	.	0.309004	0.33217	N	0.005146	T	0.37461	0.1004	L	0.44542	1.39	0.80722	D	1	B;B	0.15719	0.014;0.014	B;B	0.12156	0.003;0.007	T	0.12268	-1.0554	10	0.27785	T	0.31	.	17.033	0.86466	0.0:0.0:1.0:0.0	.	980;957	Q9H2X9;Q9H2X9-2	S12A5_HUMAN;.	K	980;957	ENSP00000387694:E980K;ENSP00000243964:E957K	ENSP00000243964:E957K	E	+	1	0	SLC12A5	44118277	1.000000	0.71417	1.000000	0.80357	0.762000	0.43233	5.930000	0.70104	2.503000	0.84419	0.561000	0.74099	GAA	SLC12A5	-	tigrfam_Na/K/Cl_cotransptS	ENSG00000124140		0.572	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	SLC12A5	HGNC	protein_coding	OTTHUMT00000471538.1	84	0.00	0	G			44684870	44684870	+1	no_errors	ENST00000454036	ensembl	human	known	69_37n	missense	92	14.81	16	SNP	1.000	A
SLC15A5	729025	genome.wustl.edu	37	12	16430536	16430536	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr12:16430536A>C	ENST00000344941.3	-	1	83	c.84T>G	c.(82-84)atT>atG	p.I28M		NM_001170798.1	NP_001164269.1	A6NIM6	S15A5_HUMAN	solute carrier family 15, member 5	28					peptide transport (GO:0015833)|protein transport (GO:0015031)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			breast(2)|lung(1)	3						ACAAATCGCCAATATGTCTTA	0.418																																						dbGAP											0													135.0	112.0	119.0					12																	16430536		692	1591	2283	-	-	-	SO:0001583	missense	0					12p12.3	2013-07-18			ENSG00000188991	ENSG00000188991		"""Solute carriers"""	33455	protein-coding gene	gene with protein product						21044875	Standard	NM_001170798		Approved		uc021qvs.1	A6NIM6	OTTHUMG00000168793	ENST00000344941.3:c.84T>G	12.37:g.16430536A>C	ENSP00000340402:p.Ile28Met			Missense_Mutation	SNP	pfam_Oligopeptide_transporter,superfamily_MFS_dom_general_subst_transpt	p.I28M	ENST00000344941.3	37	c.84		12	.	.	.	.	.	.	.	.	.	.	A	0.366	-0.936609	0.02340	.	.	ENSG00000188991	ENST00000344941	T	0.03663	3.85	4.93	-3.95	0.04118	.	.	.	.	.	T	0.02807	0.0084	L	0.32530	0.975	0.09310	N	1	.	.	.	.	.	.	T	0.44112	-0.9349	7	0.35671	T	0.21	.	1.4237	0.02318	0.3118:0.26:0.2999:0.1282	.	.	.	.	M	28	ENSP00000340402:I28M	ENSP00000340402:I28M	I	-	3	3	SLC15A5	16321803	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.313000	0.08103	-0.565000	0.06061	0.533000	0.62120	ATT	SLC15A5	-	NULL	ENSG00000188991		0.418	SLC15A5-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	SLC15A5	HGNC	protein_coding	OTTHUMT00000401119.2	98	0.00	0	A	XM_001129090		16430536	16430536	-1	no_errors	ENST00000344941	ensembl	human	novel	69_37n	missense	52	30.67	23	SNP	0.000	C
SLC25A38	54977	genome.wustl.edu	37	3	39425264	39425264	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr3:39425264G>A	ENST00000273158.4	+	1	426	c.49G>A	c.(49-51)Gac>Aac	p.D17N		NM_017875.2	NP_060345.2			solute carrier family 25, member 38											breast(1)|endometrium(1)|large_intestine(1)|lung(6)|skin(1)|stomach(1)	11				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		AGATGTCGGAGACACGGTGGA	0.652																																						dbGAP											0													52.0	48.0	49.0					3																	39425264		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC013194	CCDS2685.1	3p22.1	2013-05-22			ENSG00000144659	ENSG00000144659		"""Solute carriers"""	26054	protein-coding gene	gene with protein product		610819				16949250	Standard	NM_017875		Approved	FLJ20551	uc003cjo.2	Q96DW6	OTTHUMG00000131289	ENST00000273158.4:c.49G>A	3.37:g.39425264G>A	ENSP00000273158:p.Asp17Asn			Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	p.D17N	ENST00000273158.4	37	c.49	CCDS2685.1	3	.	.	.	.	.	.	.	.	.	.	g	20.7	4.033304	0.75504	.	.	ENSG00000144659	ENST00000273158	T	0.80123	-1.34	4.25	4.25	0.50352	.	1.082450	0.07049	N	0.831521	T	0.70622	0.3245	N	0.19112	0.55	0.30083	N	0.809	B	0.02656	0.0	B	0.01281	0.0	T	0.59810	-0.7384	10	0.36615	T	0.2	-22.8885	12.0051	0.53255	0.0:0.0:1.0:0.0	.	17	Q96DW6	S2538_HUMAN	N	17	ENSP00000273158:D17N	ENSP00000273158:D17N	D	+	1	0	SLC25A38	39400268	1.000000	0.71417	0.945000	0.38365	0.935000	0.57460	4.326000	0.59241	2.189000	0.69895	0.655000	0.94253	GAC	SLC25A38	-	NULL	ENSG00000144659		0.652	SLC25A38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A38	HGNC	protein_coding	OTTHUMT00000254057.3	83	0.00	0	G	NM_017875		39425264	39425264	+1	no_errors	ENST00000273158	ensembl	human	known	69_37n	missense	20	58.33	28	SNP	0.991	A
SLC28A3	64078	genome.wustl.edu	37	9	86900304	86900304	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr9:86900304C>G	ENST00000376238.4	-	14	1652	c.1603G>C	c.(1603-1605)Gaa>Caa	p.E535Q	RP11-380F14.2_ENST00000419815.1_RNA|SLC28A3_ENST00000537648.1_Missense_Mutation_p.E466Q	NM_001199633.1|NM_022127.2	NP_001186562.1|NP_071410.1	Q9HAS3	S28A3_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 3	535					pyrimidine nucleoside transport (GO:0015864)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|purine-specific nucleoside:sodium symporter activity (GO:0015390)|pyrimidine- and adenine-specific:sodium symporter activity (GO:0015389)			endometrium(2)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31					Adenosine(DB00640)|Cladribine(DB00242)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Mercaptopurine(DB01033)|Ribavirin(DB00811)	GGTCCACCTTCTTTCCTCAAG	0.388																																					Ovarian(106;425 1539 34835 42413 43572)	dbGAP											0													91.0	92.0	92.0					9																	86900304		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF305210	CCDS6670.1	9q21.33	2013-07-17	2013-07-17		ENSG00000197506	ENSG00000197506		"""Solute carriers"""	16484	protein-coding gene	gene with protein product		608269	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 3"""			11032837	Standard	NM_001199633		Approved	CNT3	uc010mpz.3	Q9HAS3	OTTHUMG00000020117	ENST00000376238.4:c.1603G>C	9.37:g.86900304C>G	ENSP00000365413:p.Glu535Gln		A8K9Y4|B1AML0|B2RA51|B4E2S8|F5GYE3	Missense_Mutation	SNP	pfam_Nucleos_tra2_C,pfam_Nuclsd_transpt2,pfam_Nucleoside_recog_Gate,tigrfam_C_nuclsd_transpt_met_bac	p.E535Q	ENST00000376238.4	37	c.1603	CCDS6670.1	9	.	.	.	.	.	.	.	.	.	.	C	11.71	1.718827	0.30503	.	.	ENSG00000197506	ENST00000376238;ENST00000537648	T;T	0.01947	4.74;4.54	5.74	0.695	0.18070	Na dependent nucleoside transporter, C-terminal (1);	0.664350	0.16124	N	0.228497	T	0.01695	0.0054	N	0.20401	0.57	0.24208	N	0.99549	B	0.19073	0.033	B	0.26614	0.071	T	0.48833	-0.9000	10	0.22109	T	0.4	-0.7856	7.3136	0.26488	0.0:0.3356:0.4522:0.2122	.	535	Q9HAS3	S28A3_HUMAN	Q	535;466	ENSP00000365413:E535Q;ENSP00000446438:E466Q	ENSP00000365413:E535Q	E	-	1	0	SLC28A3	86090124	0.000000	0.05858	0.814000	0.32528	0.839000	0.47603	-0.136000	0.10405	0.279000	0.22186	0.561000	0.74099	GAA	SLC28A3	-	pfam_Nucleos_tra2_C,tigrfam_C_nuclsd_transpt_met_bac	ENSG00000197506		0.388	SLC28A3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC28A3	HGNC	protein_coding	OTTHUMT00000052874.1	126	0.00	0	C	NM_022127		86900304	86900304	-1	no_errors	ENST00000376238	ensembl	human	known	69_37n	missense	59	39.18	38	SNP	0.933	G
TRAPPC4	51399	genome.wustl.edu	37	11	118895783	118895783	+	IGR	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr11:118895783C>G	ENST00000533632.1	+	0	1759				TRAPPC4_ENST00000533058.1_3'UTR|SLC37A4_ENST00000357590.5_Missense_Mutation_p.G398A|SLC37A4_ENST00000330775.7_Missense_Mutation_p.G397A|SLC37A4_ENST00000525102.1_5'UTR|SLC37A4_ENST00000538950.1_Missense_Mutation_p.G303A|SLC37A4_ENST00000545985.1_Missense_Mutation_p.G376A	NM_016146.4	NP_057230.1	Q9Y296	TPPC4_HUMAN	trafficking protein particle complex 4						dendrite development (GO:0016358)|ER to Golgi vesicle-mediated transport (GO:0006888)|extracellular matrix organization (GO:0030198)	cis-Golgi network (GO:0005801)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi stack (GO:0005795)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)|TRAPP complex (GO:0030008)				NS(1)|endometrium(1)|large_intestine(2)|lung(1)	5	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_neural(223;0.224)|all_hematologic(192;0.243)		BRCA - Breast invasive adenocarcinoma(274;7.58e-05)		CAGAAAGCCGCCCACTGTCAG	0.582																																						dbGAP											0													55.0	57.0	57.0					11																	118895783		1990	4161	6151	-	-	-	SO:0001628	intergenic_variant	0			AF078862	CCDS8407.1	11q23.3	2011-10-10				ENSG00000196655		"""Trafficking protein particle complex"""	19943	protein-coding gene	gene with protein product		610971				10810093	Standard	NM_016146		Approved	TRS23, SBDN, PTD009	uc010ryo.2	Q9Y296			11.37:g.118895783C>G			A8K3A5|B4DME1	RNA	SNP	-	NULL	ENST00000533632.1	37	NULL	CCDS8407.1	11																																																																																			SLC37A4	-	-	ENSG00000137700		0.582	TRAPPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC37A4	HGNC	protein_coding	OTTHUMT00000389332.1	47	0.00	0	C	NM_016146		118895783	118895783	-1	no_errors	ENST00000330775	ensembl	human	known	69_37n	rna	11	38.89	7	SNP	1.000	G
SLU7	10569	genome.wustl.edu	37	5	159842203	159842203	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr5:159842203C>T	ENST00000297151.4	-	2	486	c.99G>A	c.(97-99)tgG>tgA	p.W33*		NM_006425.4	NP_006416.3	O95391	SLU7_HUMAN	SLU7 splicing factor homolog (S. cerevisiae)	33					alternative mRNA splicing, via spliceosome (GO:0000380)|cellular response to heat (GO:0034605)|intracellular protein transport (GO:0006886)|mRNA 3'-splice site recognition (GO:0000389)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)	pre-mRNA 3'-splice site binding (GO:0030628)|second spliceosomal transesterification activity (GO:0000386)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(4)|lung(6)|ovary(1)	20	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TCTTCTTTCTCCAGTCCTCTC	0.428																																						dbGAP											0													172.0	173.0	173.0					5																	159842203		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF101074	CCDS4352.1	5q33.3	2010-04-13			ENSG00000164609	ENSG00000164609			16939	protein-coding gene	gene with protein product	zinc knuckle motif containing	605974				10197984, 15728250	Standard	NM_006425		Approved	9G8	uc003lyg.3	O95391	OTTHUMG00000130324	ENST00000297151.4:c.99G>A	5.37:g.159842203C>T	ENSP00000297151:p.Trp33*		D3DQK2|Q3LUJ0|Q3LUJ1|Q6RXQ5|Q96FM9	Nonsense_Mutation	SNP	pfam_Slu7,superfamily_Znf_CCHC	p.W33*	ENST00000297151.4	37	c.99	CCDS4352.1	5	.	.	.	.	.	.	.	.	.	.	C	41	8.643813	0.98897	.	.	ENSG00000164609	ENST00000297151;ENST00000521826;ENST00000519349;ENST00000520664	.	.	.	5.95	5.08	0.68730	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.8641	14.8883	0.70587	0.0:0.9316:0.0:0.0684	.	.	.	.	X	33	.	ENSP00000297151:W33X	W	-	3	0	SLU7	159774781	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.399000	0.79935	1.521000	0.48983	0.650000	0.86243	TGG	SLU7	-	NULL	ENSG00000164609		0.428	SLU7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLU7	HGNC	protein_coding	OTTHUMT00000252673.1	213	0.00	0	C	NM_006425		159842203	159842203	-1	no_errors	ENST00000297151	ensembl	human	known	69_37n	nonsense	164	49.85	163	SNP	1.000	T
SP110	3431	genome.wustl.edu	37	2	231077589	231077589	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr2:231077589C>T	ENST00000358662.4	-	4	548	c.470G>A	c.(469-471)aGt>aAt	p.S157N	SP110_ENST00000540870.1_Missense_Mutation_p.S163N|SP110_ENST00000258381.6_Missense_Mutation_p.S157N|SP110_ENST00000392048.3_Missense_Mutation_p.S157N|SP110_ENST00000258382.5_Missense_Mutation_p.S157N|SP110_ENST00000486146.2_5'UTR|SP110_ENST00000338556.3_De_novo_Start_OutOfFrame	NM_004509.3	NP_004500	Q9HB58	SP110_HUMAN	SP110 nuclear body protein	157					regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(4)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Renal(207;0.0112)|all_lung(227;0.0223)|Lung NSC(271;0.0983)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.169)		Epithelial(121;2.61e-12)|all cancers(144;6.39e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.0097)		TCCAGGCTCACTGACTCTTGG	0.607																																						dbGAP											0													145.0	141.0	143.0					2																	231077589		2203	4300	6503	-	-	-	SO:0001583	missense	0			L22343	CCDS2474.1, CCDS2475.1, CCDS2476.1, CCDS54435.1	2q37.1	2014-09-17	2001-12-19	2001-12-20	ENSG00000135899	ENSG00000135899			5401	protein-coding gene	gene with protein product		604457	"""interferon-induced protein 41, 30kD"""	IFI41, IFI75		7693701, 10388521	Standard	NM_080424		Approved		uc002vqg.3	Q9HB58	OTTHUMG00000133204	ENST00000358662.4:c.470G>A	2.37:g.231077589C>T	ENSP00000351488:p.Ser157Asn		B4DVI4|F5H1M1|Q14976|Q14977|Q53TG2|Q8WUZ6|Q9HCT8	Missense_Mutation	SNP	pfam_Sp100,pfam_SAND_dom,superfamily_SAND_dom-like,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_SAND_dom,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_SAND_dom	p.S157N	ENST00000358662.4	37	c.470	CCDS2474.1	2	.	.	.	.	.	.	.	.	.	.	C	3.858	-0.030377	0.07543	.	.	ENSG00000135899	ENST00000258381;ENST00000358662;ENST00000392048;ENST00000258382;ENST00000540870;ENST00000409815;ENST00000455674	T;T;T;T;T;T;T	0.09255	3.0;3.0;3.0;3.0;3.0;3.0;3.0	4.11	0.166	0.14999	.	0.688041	0.12701	N	0.446335	T	0.06917	0.0176	L	0.34521	1.04	0.09310	N	0.999996	B;B;B;B	0.15473	0.009;0.009;0.006;0.013	B;B;B;B	0.16289	0.015;0.015;0.002;0.011	T	0.38779	-0.9645	10	0.27785	T	0.31	.	3.9065	0.09185	0.0:0.5114:0.1796:0.309	.	157;163;157;157	G5E9C0;F5H1M1;Q9HB58;Q9HB58-6	.;.;SP110_HUMAN;.	N	157;157;157;157;163;157;111	ENSP00000258381:S157N;ENSP00000351488:S157N;ENSP00000375902:S157N;ENSP00000258382:S157N;ENSP00000439558:S163N;ENSP00000387172:S157N;ENSP00000393992:S111N	ENSP00000258381:S157N	S	-	2	0	SP110	230785833	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-1.042000	0.03539	0.013000	0.14918	0.650000	0.86243	AGT	SP110	-	NULL	ENSG00000135899		0.607	SP110-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	SP110	HGNC	protein_coding	OTTHUMT00000332414.1	165	0.00	0	C	NM_080424		231077589	231077589	-1	no_errors	ENST00000258381	ensembl	human	known	69_37n	missense	151	11.70	20	SNP	0.000	T
SPAG5	10615	genome.wustl.edu	37	17	26918847	26918847	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr17:26918847C>G	ENST00000321765.5	-	4	1638	c.1306G>C	c.(1306-1308)Gat>Cat	p.D436H		NM_006461.3	NP_006452.3	Q96R06	SPAG5_HUMAN	sperm associated antigen 5	436					chromosome segregation (GO:0007059)|mitotic sister chromatid segregation (GO:0000070)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|microtubule plus-end (GO:0035371)|mitotic spindle (GO:0072686)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43	Lung NSC(42;0.00431)					AGCAGGTTATCTTCCAAGTCA	0.557																																						dbGAP											0													63.0	67.0	66.0					17																	26918847		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF063308	CCDS32594.1	17q11.2	2008-07-18			ENSG00000076382	ENSG00000076382			13452	protein-coding gene	gene with protein product	"""mitotic spindle coiled-coil related protein"", ""astrin"", ""mitotic spindle associated protein p126"""	615562				11549262	Standard	NM_006461		Approved	DEEPEST, MAP126, hMAP126	uc002hbq.3	Q96R06	OTTHUMG00000166586	ENST00000321765.5:c.1306G>C	17.37:g.26918847C>G	ENSP00000323300:p.Asp436His		O95213|Q9BWE8|Q9NT17|Q9UFE6	Missense_Mutation	SNP	NULL	p.D436H	ENST00000321765.5	37	c.1306	CCDS32594.1	17	.	.	.	.	.	.	.	.	.	.	C	18.49	3.635366	0.67130	.	.	ENSG00000076382	ENST00000321765	.	.	.	5.73	4.76	0.60689	.	0.289706	0.32655	N	0.005804	T	0.53254	0.1785	L	0.32530	0.975	0.31314	N	0.686794	D	0.76494	0.999	D	0.63877	0.919	T	0.60722	-0.7207	9	0.87932	D	0	-2.7113	10.5706	0.45198	0.0:0.9116:0.0:0.0884	.	436	Q96R06	SPAG5_HUMAN	H	436	.	ENSP00000323300:D436H	D	-	1	0	SPAG5	23942974	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.201000	0.58439	1.420000	0.47138	0.655000	0.94253	GAT	SPAG5	-	NULL	ENSG00000076382		0.557	SPAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG5	HGNC	protein_coding	OTTHUMT00000390564.2	104	0.00	0	C	NM_006461		26918847	26918847	-1	no_errors	ENST00000321765	ensembl	human	known	69_37n	missense	24	50.00	24	SNP	1.000	G
SPATA21	374955	genome.wustl.edu	37	1	16736350	16736350	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr1:16736350C>G	ENST00000335496.1	-	6	815	c.333G>C	c.(331-333)caG>caC	p.Q111H	SPATA21_ENST00000466212.1_5'UTR|SPATA21_ENST00000540400.1_Missense_Mutation_p.Q88H	NM_198546.1	NP_940948.1	Q7Z572	SPT21_HUMAN	spermatogenesis associated 21	111							calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|lung(8)|ovary(2)|pancreas(3)|stomach(1)|urinary_tract(2)	19		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.15e-05)|BRCA - Breast invasive adenocarcinoma(304;4.2e-05)|Kidney(64;0.000183)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.0122)|READ - Rectum adenocarcinoma(331;0.0651)		TGGGCGACTTCTGGGCTGTCT	0.677																																						dbGAP											0													33.0	40.0	37.0					1																	16736350		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS172.1	1p36.13	2013-01-10			ENSG00000187144	ENSG00000187144		"""EF-hand domain containing"""	28026	protein-coding gene	gene with protein product							Standard	NM_198546		Approved	spergen-2, spergen2	uc001ayn.3	Q7Z572	OTTHUMG00000002312	ENST00000335496.1:c.333G>C	1.37:g.16736350C>G	ENSP00000335612:p.Gln111His		B9EK40|F5GXP5	Missense_Mutation	SNP	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.Q111H	ENST00000335496.1	37	c.333	CCDS172.1	1	.	.	.	.	.	.	.	.	.	.	C	11.30	1.598669	0.28445	.	.	ENSG00000187144	ENST00000335496;ENST00000540400	T;T	0.64618	-0.11;-0.11	4.07	2.07	0.26955	.	0.337753	0.21498	N	0.073569	T	0.43366	0.1244	N	0.19112	0.55	0.09310	N	1	P;P	0.43094	0.799;0.697	B;B	0.38020	0.263;0.135	T	0.33727	-0.9857	10	0.66056	D	0.02	-3.2249	10.2191	0.43186	0.0:0.6052:0.3948:0.0	.	88;111	F5GXP5;Q7Z572	.;SPT21_HUMAN	H	111;88	ENSP00000335612:Q111H;ENSP00000440046:Q88H	ENSP00000335612:Q111H	Q	-	3	2	SPATA21	16608937	0.668000	0.27493	0.037000	0.18230	0.020000	0.10135	0.833000	0.27504	0.434000	0.26340	-0.556000	0.04195	CAG	SPATA21	-	NULL	ENSG00000187144		0.677	SPATA21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPATA21	HGNC	protein_coding	OTTHUMT00000006677.2	46	0.00	0	C	NM_198546		16736350	16736350	-1	no_errors	ENST00000335496	ensembl	human	known	69_37n	missense	26	31.58	12	SNP	0.075	G
ST18	9705	genome.wustl.edu	37	8	53038649	53038649	+	Silent	SNP	A	A	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr8:53038649A>T	ENST00000276480.7	-	23	3401	c.2718T>A	c.(2716-2718)tcT>tcA	p.S906S		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	906					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				TGAGTTCTTCAGAAACCTTGC	0.448																																						dbGAP											0													203.0	162.0	176.0					8																	53038649		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.2718T>A	8.37:g.53038649A>T			Q17RY1	Silent	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.S906	ENST00000276480.7	37	c.2718	CCDS6149.1	8																																																																																			ST18	-	NULL	ENSG00000147488		0.448	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST18	HGNC	protein_coding	OTTHUMT00000377867.1	196	0.51	1	A			53038649	53038649	-1	no_errors	ENST00000276480	ensembl	human	known	69_37n	silent	192	11.82	26	SNP	0.496	T
STAC3	246329	genome.wustl.edu	37	12	57637603	57637603	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr12:57637603C>G	ENST00000332782.2	-	12	1288	c.1087G>C	c.(1087-1089)Gaa>Caa	p.E363Q	STAC3_ENST00000546246.2_Missense_Mutation_p.E177Q|STAC3_ENST00000554578.1_Missense_Mutation_p.E324Q	NM_145064.1	NP_659501.1	Q96MF2	STAC3_HUMAN	SH3 and cysteine rich domain 3	363	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.				intracellular signal transduction (GO:0035556)|neuromuscular synaptic transmission (GO:0007274)|skeletal muscle contraction (GO:0003009)|skeletal muscle fiber development (GO:0048741)		identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(10)|ovary(2)|skin(1)	18						GCCTAAATTTCCTCTAGAAAG	0.617											OREG0021942	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													29.0	31.0	30.0					12																	57637603		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK057013	CCDS8936.1, CCDS66405.1, CCDS66406.1	12q13.3	2014-08-12			ENSG00000185482	ENSG00000185482			28423	protein-coding gene	gene with protein product		615521				12477932	Standard	NM_001286257		Approved	MGC2793	uc009zpl.2	Q96MF2	OTTHUMG00000171271	ENST00000332782.2:c.1087G>C	12.37:g.57637603C>G	ENSP00000329200:p.Glu363Gln	1024	B4DUK9|Q96HU5	Missense_Mutation	SNP	pfam_SH3_2,pfam_SH3_domain,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_SH3_domain,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_SH3_domain,pfscan_SH3_domain,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_SH3_domain,prints_p67phox	p.E363Q	ENST00000332782.2	37	c.1087	CCDS8936.1	12	.	.	.	.	.	.	.	.	.	.	C	26.5	4.748060	0.89663	.	.	ENSG00000185482	ENST00000554578;ENST00000332782;ENST00000546246	T;T;T	0.11495	2.77;2.77;2.77	4.65	4.65	0.58169	Src homology-3 domain (1);Variant SH3 (1);	0.000000	0.85682	D	0.000000	T	0.29321	0.0730	L	0.58101	1.795	0.80722	D	1	D	0.69078	0.997	D	0.79108	0.992	T	0.00571	-1.1665	10	0.41790	T	0.15	-0.4813	16.8234	0.85924	0.0:1.0:0.0:0.0	.	363	Q96MF2	STAC3_HUMAN	Q	324;363;177	ENSP00000452068:E324Q;ENSP00000329200:E363Q;ENSP00000441515:E177Q	ENSP00000329200:E363Q	E	-	1	0	STAC3	55923870	1.000000	0.71417	1.000000	0.80357	0.690000	0.40134	5.626000	0.67777	2.582000	0.87167	0.655000	0.94253	GAA	STAC3	-	pfam_SH3_2,smart_SH3_domain	ENSG00000185482		0.617	STAC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAC3	HGNC	protein_coding	OTTHUMT00000412724.2	46	0.00	0	C	NM_145064		57637603	57637603	-1	no_errors	ENST00000332782	ensembl	human	known	69_37n	missense	27	30.00	12	SNP	1.000	G
STK4	6789	genome.wustl.edu	37	20	43615911	43615911	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr20:43615911G>A	ENST00000372806.3	+	5	594	c.499G>A	c.(499-501)Gat>Aat	p.D167N	STK4_ENST00000396731.4_Missense_Mutation_p.D167N|STK4_ENST00000499879.2_Intron|STK4_ENST00000372801.1_Missense_Mutation_p.D167N	NM_006282.2	NP_006273.1	Q13043	STK4_HUMAN	serine/threonine kinase 4	167	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell differentiation involved in embryonic placenta development (GO:0060706)|cell morphogenesis (GO:0000902)|central nervous system development (GO:0007417)|endocardium development (GO:0003157)|hepatocyte apoptotic process (GO:0097284)|hippo signaling (GO:0035329)|intracellular signal transduction (GO:0035556)|keratinocyte differentiation (GO:0030216)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of organ growth (GO:0046621)|neural tube formation (GO:0001841)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|primitive hemopoiesis (GO:0060215)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(2)|lung(5)|ovary(1)|prostate(1)|skin(2)	20		Myeloproliferative disorder(115;0.0122)				AAAACTTGCAGATTTTGGGGT	0.323																																					GBM(187;1039 2137 11798 21916 33213)	dbGAP											0													72.0	71.0	71.0					20																	43615911		2203	4296	6499	-	-	-	SO:0001583	missense	0				CCDS13341.1	20q11.2-q13.2	2014-09-17			ENSG00000101109	ENSG00000101109			11408	protein-coding gene	gene with protein product	"""mammalian sterile 20-like 1"", ""yeast Ste20-like"", ""kinase responsive to stress 2"""	604965				8816758, 9545236, 11517310	Standard	NM_006282		Approved	MST1, KRS2, YSK3	uc002xnb.3	Q13043	OTTHUMG00000033059	ENST00000372806.3:c.499G>A	20.37:g.43615911G>A	ENSP00000361892:p.Asp167Asn		B2RCR8|Q15802|Q4G156|Q5H982|Q6PD60|Q9BR32|Q9NTZ4	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_SARAH_domain,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_SARAH,pfscan_Prot_kinase_cat_dom	p.D167N	ENST00000372806.3	37	c.499	CCDS13341.1	20	.	.	.	.	.	.	.	.	.	.	G	35	5.476202	0.96291	.	.	ENSG00000101109	ENST00000372806;ENST00000396731;ENST00000372801	D;D;D	0.92965	-3.14;-3.14;-3.14	5.63	5.63	0.86233	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.97626	0.9222	H	0.96175	3.78	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98452	1.0592	10	0.87932	D	0	.	19.677	0.95939	0.0:0.0:1.0:0.0	.	167;167;167	Q13043-2;A0PJ51;Q13043	.;.;STK4_HUMAN	N	167	ENSP00000361892:D167N;ENSP00000379957:D167N;ENSP00000361887:D167N	ENSP00000361887:D167N	D	+	1	0	STK4	43049325	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.414000	0.97362	2.655000	0.90218	0.462000	0.41574	GAT	STK4	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000101109		0.323	STK4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	STK4	HGNC	protein_coding	OTTHUMT00000080401.4	85	0.00	0	G	NM_006282		43615911	43615911	+1	no_errors	ENST00000372806	ensembl	human	known	69_37n	missense	64	43.86	50	SNP	1.000	A
SUPT5H	6829	genome.wustl.edu	37	19	39955656	39955656	+	Silent	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr19:39955656C>G	ENST00000599117.1	+	12	1210	c.843C>G	c.(841-843)ctC>ctG	p.L281L	SUPT5H_ENST00000402194.2_Silent_p.L277L|SUPT5H_ENST00000359191.6_Silent_p.L277L|SUPT5H_ENST00000598725.1_Silent_p.L281L|SUPT5H_ENST00000432763.2_Silent_p.L281L			O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog (S. cerevisiae)	281	KOW 1.				7-methylguanosine mRNA capping (GO:0006370)|cell cycle (GO:0007049)|chromatin remodeling (GO:0006338)|DNA-templated transcription, elongation (GO:0006354)|gene expression (GO:0010467)|negative regulation of DNA-templated transcription, elongation (GO:0032785)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to organic substance (GO:0010033)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	DSIF complex (GO:0032044)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(13)|lung(12)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	51	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			GGGTCCGCCTCAAGCGGGGCA	0.577																																						dbGAP											0													79.0	73.0	75.0					19																	39955656		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U56402	CCDS12536.1, CCDS46072.1	19q13	2008-07-22	2001-11-28			ENSG00000196235			11469	protein-coding gene	gene with protein product		602102	"""suppressor of Ty (S.cerevisiae) 5 homolog"""			8975720	Standard	NM_003169		Approved	SPT5H, SPT5, FLJ34157	uc002olp.4	O00267		ENST00000599117.1:c.843C>G	19.37:g.39955656C>G			O43279|Q59G52|Q99639	Silent	SNP	pfam_TF_Spt5_NGN-domain,pfam_KOW,pfam_Spt5_N,superfamily_Translation_prot_SH3-like,smart_Transcrpt_antiterm_NusG_N,smart_KOW,pirsf_TF_Spt5	p.L281	ENST00000599117.1	37	c.843	CCDS12536.1	19																																																																																			SUPT5H	-	smart_KOW,pirsf_TF_Spt5	ENSG00000196235		0.577	SUPT5H-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SUPT5H	HGNC	protein_coding	OTTHUMT00000464918.1	37	0.00	0	C	NM_003169		39955656	39955656	+1	no_errors	ENST00000359191	ensembl	human	known	69_37n	silent	21	36.36	12	SNP	1.000	G
SVEP1	79987	genome.wustl.edu	37	9	113265399	113265399	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr9:113265399C>T	ENST00000401783.2	-	6	1738	c.1402G>A	c.(1402-1404)Gaa>Aaa	p.E468K	SVEP1_ENST00000302728.8_Missense_Mutation_p.E468K|SVEP1_ENST00000467821.1_5'UTR|SVEP1_ENST00000374469.1_Missense_Mutation_p.E445K|SVEP1_ENST00000374461.1_Missense_Mutation_p.E445K	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	468	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						CTGTACCCTTCATCACAGGCA	0.473																																						dbGAP											0													164.0	163.0	163.0					9																	113265399		1979	4156	6135	-	-	-	SO:0001583	missense	0			AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.1402G>A	9.37:g.113265399C>T	ENSP00000384917:p.Glu468Lys		Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_EGF-like_dom,pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_Hyalin,pfam_VWF_A,pfam_Pentaxin,pfam_EGF_extracell,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Complement_control_module,superfamily_Growth_fac_rcpt,smart_VWF_A,smart_Sushi_SCR_CCP,smart_EGF-like_Ca-bd,smart_EGF-like,smart_Pentaxin,pfscan_EG-like_dom,pfscan_Hyalin,pfscan_Sushi_SCR_CCP,pfscan_VWF_A,prints_Pentaxin	p.E468K	ENST00000401783.2	37	c.1402	CCDS48004.1	9	.	.	.	.	.	.	.	.	.	.	C	17.94	3.510695	0.64522	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000302728;ENST00000374461	T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23	5.52	5.52	0.82312	Complement control module (2);Sushi/SCR/CCP (3);	0.325513	0.33110	N	0.005264	T	0.62196	0.2408	L	0.45422	1.42	0.41696	D	0.989376	B;B;B	0.28128	0.201;0.201;0.167	B;B;B	0.31442	0.089;0.13;0.079	T	0.57412	-0.7816	10	0.18276	T	0.48	.	19.4562	0.94892	0.0:1.0:0.0:0.0	.	468;468;468	E9PBN8;Q4LDE5;Q4LDE5-2	.;SVEP1_HUMAN;.	K	468;445;468;445	ENSP00000384917:E468K;ENSP00000363593:E445K;ENSP00000304118:E468K;ENSP00000363585:E445K	ENSP00000304118:E468K	E	-	1	0	SVEP1	112305220	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	5.557000	0.67313	2.585000	0.87301	0.655000	0.94253	GAA	SVEP1	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000165124		0.473	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SVEP1	HGNC	protein_coding		172	0.00	0	C			113265399	113265399	-1	no_errors	ENST00000401783	ensembl	human	known	69_37n	missense	88	32.82	43	SNP	1.000	T
SYNJ1	8867	genome.wustl.edu	37	21	34012090	34012090	+	Splice_Site	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr21:34012090C>G	ENST00000322229.7	-	29	3588		c.e29-1		SYNJ1_ENST00000382499.2_Splice_Site|SYNJ1_ENST00000382491.3_Splice_Site|SYNJ1_ENST00000357345.3_Splice_Site|SYNJ1_ENST00000433931.2_Splice_Site			O43426	SYNJ1_HUMAN	synaptojanin 1						cell death (GO:0008219)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of synaptic vesicle uncoating (GO:1903390)|regulation of synaptic vesicle membrane organization (GO:1901632)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)	cytosol (GO:0005829)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|lung(11)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	57						GAGGAATCGTCTACAGATAGG	0.438																																						dbGAP											0													74.0	63.0	67.0					21																	34012090		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF009040	CCDS33539.1, CCDS33540.1, CCDS33539.2, CCDS33540.2, CCDS54483.1	21q22.2	2008-06-23			ENSG00000159082	ENSG00000159082			11503	protein-coding gene	gene with protein product		604297				9428629, 10773674	Standard	NM_203446		Approved	INPP5G	uc002yqh.2	O43426	OTTHUMG00000064926	ENST00000322229.7:c.3589-1G>C	21.37:g.34012090C>G			O43425|O94984|Q4KMR1	Splice_Site	SNP	-	e30-1	ENST00000322229.7	37	c.3706-1	CCDS54484.1	21	.	.	.	.	.	.	.	.	.	.	C	15.48	2.847507	0.51164	.	.	ENSG00000159082	ENST00000382491;ENST00000357345;ENST00000438952;ENST00000382499;ENST00000433931;ENST00000322229;ENST00000418301;ENST00000416083	.	.	.	5.27	5.27	0.74061	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2861	0.94072	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SYNJ1	32933961	1.000000	0.71417	0.325000	0.25375	0.046000	0.14306	5.739000	0.68622	2.653000	0.90120	0.650000	0.86243	.	SYNJ1	-	-	ENSG00000159082		0.438	SYNJ1-201	KNOWN	basic|CCDS	protein_coding	SYNJ1	HGNC	protein_coding		93	0.00	0	C		Intron	34012090	34012090	-1	no_errors	ENST00000433931	ensembl	human	known	69_37n	splice_site	46	43.21	35	SNP	0.996	G
SYT12	91683	genome.wustl.edu	37	11	66807366	66807366	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr11:66807366G>C	ENST00000393946.2	+	7	1475	c.313G>C	c.(313-315)Gag>Cag	p.E105Q	SYT12_ENST00000525457.1_Missense_Mutation_p.E105Q|SYT12_ENST00000527043.1_Missense_Mutation_p.E105Q|SYT12_ENST00000526281.1_3'UTR			Q8IV01	SYT12_HUMAN	synaptotagmin XII	105						cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|synapse (GO:0045202)				NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|urinary_tract(1)	20						GGACACCTTTGAGAGCATCAG	0.637																																					Ovarian(65;2862 3307)	dbGAP											0													79.0	82.0	81.0					11																	66807366		2200	4295	6495	-	-	-	SO:0001583	missense	0			AK024280	CCDS8154.1	11q13.2	2014-07-02			ENSG00000173227	ENSG00000173227		"""Synaptotagmins"""	18381	protein-coding gene	gene with protein product		606436				8987811	Standard	NM_177963		Approved	SRG1	uc001oju.3	Q8IV01	OTTHUMG00000167101	ENST00000393946.2:c.313G>C	11.37:g.66807366G>C	ENSP00000377520:p.Glu105Gln			Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.E105Q	ENST00000393946.2	37	c.313	CCDS8154.1	11	.	.	.	.	.	.	.	.	.	.	G	11.75	1.732042	0.30684	.	.	ENSG00000173227	ENST00000393946;ENST00000525457;ENST00000527043	T;T;T	0.13089	2.62;2.62;2.62	5.1	4.19	0.49359	.	0.174679	0.49916	N	0.000129	T	0.09555	0.0235	N	0.24115	0.695	0.49213	D	0.999766	B	0.27498	0.18	B	0.27076	0.076	T	0.17653	-1.0362	10	0.14656	T	0.56	.	13.5025	0.61465	0.0:0.1574:0.8426:0.0	.	105	Q8IV01	SYT12_HUMAN	Q	105	ENSP00000377520:E105Q;ENSP00000431400:E105Q;ENSP00000435316:E105Q	ENSP00000377520:E105Q	E	+	1	0	SYT12	66563942	1.000000	0.71417	0.963000	0.40424	0.206000	0.24218	7.756000	0.85195	1.374000	0.46228	0.462000	0.41574	GAG	SYT12	-	NULL	ENSG00000173227		0.637	SYT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT12	HGNC	protein_coding	OTTHUMT00000393129.1	37	0.00	0	G	NM_177963		66807366	66807366	+1	no_errors	ENST00000393946	ensembl	human	known	69_37n	missense	23	34.29	12	SNP	1.000	C
TBC1D2B	23102	genome.wustl.edu	37	15	78305373	78305373	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr15:78305373C>T	ENST00000300584.3	-	9	2061	c.2062G>A	c.(2062-2064)Gag>Aag	p.E688K	TBC1D2B_ENST00000409931.3_Missense_Mutation_p.E688K	NM_015079.5|NM_144572.1	NP_055894.6|NP_653173.1	Q9UPU7	TBD2B_HUMAN	TBC1 domain family, member 2B	688	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			breast(3)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(2)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	26						TGGCCAGGCTCAGTGTTGTCC	0.557																																						dbGAP											0													123.0	94.0	104.0					15																	78305373		2196	4293	6489	-	-	-	SO:0001583	missense	0			AB028978	CCDS32301.2, CCDS45314.1	15q24.3-q25.1	2005-11-29			ENSG00000167202	ENSG00000167202			29183	protein-coding gene	gene with protein product						10470851	Standard	NM_015079		Approved	KIAA1055	uc002bcy.4	Q9UPU7	OTTHUMG00000152885	ENST00000300584.3:c.2062G>A	15.37:g.78305373C>T	ENSP00000300584:p.Glu688Lys		A7MD42|Q8N1F9|Q9NXM0	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,superfamily_Prefoldin,smart_Pleckstrin_homology,smart_Rab-GTPase-TBC_dom,pfscan_Pleckstrin_homology,pfscan_Rab-GTPase-TBC_dom	p.E688K	ENST00000300584.3	37	c.2062	CCDS45314.1	15	.	.	.	.	.	.	.	.	.	.	C	0.056	-1.236968	0.01493	.	.	ENSG00000167202	ENST00000409931;ENST00000300584	T;T	0.11495	2.77;2.77	5.47	2.4	0.29515	Rab-GAP/TBC domain (4);	0.512337	0.21670	N	0.070899	T	0.06826	0.0174	L	0.33485	1.01	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.002;0.002	T	0.44065	-0.9352	10	0.08381	T	0.77	.	7.9854	0.30210	0.0:0.7176:0.1298:0.1526	.	688;140;688	Q9UPU7-2;Q9UPU7-3;Q9UPU7	.;.;TBD2B_HUMAN	K	688	ENSP00000387165:E688K;ENSP00000300584:E688K	ENSP00000300584:E688K	E	-	1	0	TBC1D2B	76092428	0.000000	0.05858	0.015000	0.15790	0.043000	0.13939	-0.664000	0.05292	0.295000	0.22570	0.655000	0.94253	GAG	TBC1D2B	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000167202		0.557	TBC1D2B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBC1D2B	HGNC	protein_coding	OTTHUMT00000328369.3	117	0.00	0	C	NM_015079		78305373	78305373	-1	no_errors	ENST00000300584	ensembl	human	known	69_37n	missense	69	39.47	45	SNP	0.050	T
TDRD9	122402	genome.wustl.edu	37	14	104506621	104506621	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr14:104506621G>A	ENST00000409874.4	+	33	3853	c.3805G>A	c.(3805-3807)Gac>Aac	p.D1269N	TDRD9_ENST00000339063.5_Intron	NM_153046.2	NP_694591.2	Q8NDG6	TDRD9_HUMAN	tudor domain containing 9	1269					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|piP-body (GO:0071547)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0768)				GCCCGAGCACGACATGGAGCT	0.512																																						dbGAP											0													166.0	137.0	146.0					14																	104506621		692	1591	2283	-	-	-	SO:0001583	missense	0			AK093483	CCDS9987.2	14q32.33	2013-01-23	2004-04-01	2004-04-02	ENSG00000156414	ENSG00000156414		"""Tudor domain containing"""	20122	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 75"""	C14orf75			Standard	NM_153046		Approved	DKFZp434N0820, FLJ36164, NET54	uc001yom.4	Q8NDG6	OTTHUMG00000152876	ENST00000409874.4:c.3805G>A	14.37:g.104506621G>A	ENSP00000387303:p.Asp1269Asn		A1A4S7|Q6ZU54|Q8N7T3|Q8N827|Q8N9V5|Q96AS9	Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_Tudor,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,smart_Tudor,pfscan_Tudor,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.D1269N	ENST00000409874.4	37	c.3805	CCDS9987.2	14	.	.	.	.	.	.	.	.	.	.	G	16.34	3.094399	0.56075	.	.	ENSG00000156414	ENST00000409874	T	0.09723	2.95	5.24	4.35	0.52113	.	.	.	.	.	T	0.32346	0.0826	M	0.79926	2.475	0.80722	D	1	D	0.76494	0.999	D	0.65573	0.936	T	0.12344	-1.0551	9	0.87932	D	0	.	12.7892	0.57523	0.0811:0.0:0.9189:0.0	.	1269	Q8NDG6	TDRD9_HUMAN	N	1269	ENSP00000387303:D1269N	ENSP00000387303:D1269N	D	+	1	0	TDRD9	103576374	1.000000	0.71417	0.778000	0.31720	0.001000	0.01503	7.713000	0.84693	1.214000	0.43395	-0.145000	0.13849	GAC	TDRD9	-	NULL	ENSG00000156414		0.512	TDRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TDRD9	HGNC	protein_coding	OTTHUMT00000328325.3	109	0.00	0	G	NM_153046		104506621	104506621	+1	no_errors	ENST00000409874	ensembl	human	known	69_37n	missense	76	34.48	40	SNP	0.998	A
TET1	80312	genome.wustl.edu	37	10	70450589	70450589	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr10:70450589C>G	ENST00000373644.4	+	12	5638	c.5429C>G	c.(5428-5430)cCt>cGt	p.P1810R		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	1810					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						ACCGTGCAACCTGAAGTAAAA	0.383																																						dbGAP											0													81.0	83.0	82.0					10																	70450589		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.5429C>G	10.37:g.70450589C>G	ENSP00000362748:p.Pro1810Arg		Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	pfam_Znf_CXXC,pfscan_Znf_CXXC	p.P1810R	ENST00000373644.4	37	c.5429	CCDS7281.1	10	.	.	.	.	.	.	.	.	.	.	C	10.27	1.303270	0.23736	.	.	ENSG00000138336	ENST00000373644	T	0.08720	3.06	4.62	1.57	0.23409	Methylcytosine dioxygenase TET, double-stranded beta helix fold domain (1);	3.748830	0.00649	N	0.000554	T	0.19846	0.0477	M	0.74647	2.275	0.23997	N	0.996229	P	0.45634	0.863	P	0.50136	0.632	T	0.06679	-1.0813	10	0.62326	D	0.03	.	4.0867	0.09950	0.1608:0.5931:0.1553:0.0908	.	1810	Q8NFU7	TET1_HUMAN	R	1810	ENSP00000362748:P1810R	ENSP00000362748:P1810R	P	+	2	0	TET1	70120595	0.981000	0.34729	0.504000	0.27639	0.464000	0.32679	0.263000	0.18478	0.023000	0.15187	0.655000	0.94253	CCT	TET1	-	NULL	ENSG00000138336		0.383	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TET1	HGNC	protein_coding	OTTHUMT00000048354.1	70	0.00	0	C	NM_030625		70450589	70450589	+1	no_errors	ENST00000373644	ensembl	human	known	69_37n	missense	41	21.15	11	SNP	0.984	G
TNFRSF11B	4982	genome.wustl.edu	37	8	119941001	119941001	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr8:119941001C>T	ENST00000297350.4	-	3	946	c.568G>A	c.(568-570)Gaa>Aaa	p.E190K		NM_002546.3	NP_002537.3	O00300	TR11B_HUMAN	tumor necrosis factor receptor superfamily, member 11b	190					apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|negative regulation of bone resorption (GO:0045779)|negative regulation of odontogenesis of dentin-containing tooth (GO:0042489)|response to arsenic-containing substance (GO:0046685)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to magnesium ion (GO:0032026)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|receptor activity (GO:0004872)			breast(1)|central_nervous_system(3)|endometrium(4)|large_intestine(6)|lung(7)|prostate(3)|skin(1)	25	all_cancers(13;3.71e-26)|Lung NSC(37;1.69e-07)|Ovarian(258;0.018)|all_neural(195;0.0592)|Hepatocellular(40;0.234)		STAD - Stomach adenocarcinoma(47;0.00193)			TGAGTTGATTCACTGTTTCCG	0.393																																						dbGAP											0													252.0	235.0	241.0					8																	119941001		2203	4300	6503	-	-	-	SO:0001583	missense	0			U94332	CCDS6326.1	8q24	2008-07-31	2008-07-31		ENSG00000164761	ENSG00000164761		"""Tumor necrosis factor receptor superfamily"""	11909	protein-coding gene	gene with protein product		602643	"""osteoprotegerin"""	OPG		9108485	Standard	NM_002546		Approved	OCIF, TR1	uc003yon.4	O00300	OTTHUMG00000164969	ENST00000297350.4:c.568G>A	8.37:g.119941001C>T	ENSP00000297350:p.Glu190Lys		B2R9A8|O60236|Q53FX6|Q9UHP4	Missense_Mutation	SNP	pirsf_TNFR_11B,pfam_TNFR/NGFR_Cys_rich_reg,pfam_Death,superfamily_DEATH-like,smart_TNFR/NGFR_Cys_rich_reg,smart_Death,prints_TNFR_11B,prints_TNFR_11,pfscan_TNFR/NGFR_Cys_rich_reg	p.E190K	ENST00000297350.4	37	c.568	CCDS6326.1	8	.	.	.	.	.	.	.	.	.	.	C	8.459	0.854892	0.17106	.	.	ENSG00000164761	ENST00000297350	T	0.61859	0.07	5.73	5.73	0.89815	.	0.757041	0.12902	N	0.429755	T	0.51941	0.1704	L	0.40543	1.245	0.30753	N	0.744953	B	0.27559	0.181	B	0.19148	0.024	T	0.49542	-0.8929	9	.	.	.	-13.842	19.9084	0.97016	0.0:1.0:0.0:0.0	.	190	O00300	TR11B_HUMAN	K	190	ENSP00000297350:E190K	.	E	-	1	0	TNFRSF11B	120010182	0.105000	0.21958	0.906000	0.35671	0.466000	0.32739	1.814000	0.38972	2.711000	0.92665	0.650000	0.86243	GAA	TNFRSF11B	-	pirsf_TNFR_11B	ENSG00000164761		0.393	TNFRSF11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF11B	HGNC	protein_coding	OTTHUMT00000381220.1	142	0.00	0	C			119941001	119941001	-1	no_errors	ENST00000297350	ensembl	human	known	69_37n	missense	180	37.93	110	SNP	0.844	T
TG	7038	genome.wustl.edu	37	8	133913623	133913623	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr8:133913623G>C	ENST00000220616.4	+	16	3499	c.3459G>C	c.(3457-3459)aaG>aaC	p.K1153N	TG_ENST00000377869.1_Missense_Mutation_p.K1153N	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1153	Thyroglobulin type-1 10. {ECO:0000255|PROSITE-ProRule:PRU00500}.				hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		ATGTGCTCAAGAGTGGAGTCC	0.607																																						dbGAP											0													81.0	77.0	79.0					8																	133913623		2203	4300	6503	-	-	-	SO:0001583	missense	0			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.3459G>C	8.37:g.133913623G>C	ENSP00000220616:p.Lys1153Asn		O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	pfam_Thyroglobulin_1,pfam_CarbesteraseB,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pirsf_Thyroglobulin,pfscan_Thyroglobulin_1	p.K1153N	ENST00000220616.4	37	c.3459	CCDS34944.1	8	.	.	.	.	.	.	.	.	.	.	G	10.53	1.375633	0.24857	.	.	ENSG00000042832	ENST00000377869;ENST00000220616	T;T	0.63913	-0.07;-0.07	5.12	4.24	0.50183	Thyroglobulin type-1 (2);	2.021940	0.02453	N	0.085819	T	0.61236	0.2331	L	0.58428	1.81	0.09310	N	1	P	0.43231	0.801	B	0.37650	0.255	T	0.51988	-0.8635	10	0.72032	D	0.01	.	7.7196	0.28725	0.1884:0.0:0.8116:0.0	.	1153	P01266	THYG_HUMAN	N	1153	ENSP00000367100:K1153N;ENSP00000220616:K1153N	ENSP00000220616:K1153N	K	+	3	2	TG	133982805	0.019000	0.18553	0.255000	0.24374	0.376000	0.30014	1.895000	0.39778	1.154000	0.42482	0.655000	0.94253	AAG	TG	-	superfamily_Thyroglobulin_1,pirsf_Thyroglobulin,pfscan_Thyroglobulin_1	ENSG00000042832		0.607	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TG	HGNC	protein_coding	OTTHUMT00000379606.1	64	0.00	0	G	NM_003235		133913623	133913623	+1	no_errors	ENST00000220616	ensembl	human	known	69_37n	missense	44	24.14	14	SNP	0.020	C
TP53	7157	genome.wustl.edu	37	17	7578460	7578460	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr17:7578460A>C	ENST00000269305.4	-	5	659	c.470T>G	c.(469-471)gTc>gGc	p.V157G	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.V157G|TP53_ENST00000359597.4_Missense_Mutation_p.V157G|TP53_ENST00000455263.2_Missense_Mutation_p.V157G|TP53_ENST00000445888.2_Missense_Mutation_p.V157G|TP53_ENST00000420246.2_Missense_Mutation_p.V157G	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	157	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation).|V -> D (in sporadic cancers; somatic mutation).|V -> F (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|V -> G (in sporadic cancers; somatic mutation).|V -> I (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:9419979}.|V -> L (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V157D(8)|p.0?(8)|p.V157G(7)|p.R156_I162delRVRAMAI(2)|p.T155fs*23(2)|p.V157del(2)|p.V157fs*9(2)|p.P153fs*22(2)|p.V157fs*22(2)|p.V157_C176del20(1)|p.R156_A161delRVRAMA(1)|p.P151_V173del23(1)|p.R156_V157del(1)|p.V157A(1)|p.R156_R158delRVR(1)|p.R156fs*12(1)|p.R156fs*18(1)|p.R156_A161del(1)|p.V157_M160delVRAM(1)|p.D148fs*23(1)|p.V157_R158delVR(1)|p.S149fs*72(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.R156fs*20(1)|p.V157_I162delVRAMAI(1)|p.V157fs*21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CATGGCGCGGACGCGGGTGCC	0.617		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	53	Substitution - Missense(16)|Deletion - In frame(14)|Deletion - Frameshift(14)|Whole gene deletion(8)|Complex - frameshift(1)	lung(8)|stomach(6)|oesophagus(6)|breast(5)|ovary(5)|upper_aerodigestive_tract(4)|central_nervous_system(4)|bone(4)|large_intestine(3)|haematopoietic_and_lymphoid_tissue(3)|pancreas(2)|biliary_tract(1)|prostate(1)|liver(1)											51.0	52.0	51.0					17																	7578460		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.470T>G	17.37:g.7578460A>C	ENSP00000269305:p.Val157Gly		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.V157G	ENST00000269305.4	37	c.470	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	17.25	3.342925	0.61073	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99825	-6.97;-6.97;-6.97;-6.97;-6.97;-6.97;-6.97;-6.97;-6.97	5.47	5.47	0.80525	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.216722	0.39210	N	0.001429	D	0.99816	0.9919	M	0.86420	2.815	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.996;0.99;0.988;0.998;0.999;1.0	D	0.96765	0.9564	10	0.87932	D	0	-16.7152	13.8032	0.63214	1.0:0.0:0.0:0.0	.	118;157;157;64;157;157;157	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	G	157;157;157;157;157;157;146;64;25;64;25;157	ENSP00000410739:V157G;ENSP00000352610:V157G;ENSP00000269305:V157G;ENSP00000398846:V157G;ENSP00000391127:V157G;ENSP00000391478:V157G;ENSP00000425104:V25G;ENSP00000423862:V64G;ENSP00000424104:V157G	ENSP00000269305:V157G	V	-	2	0	TP53	7519185	1.000000	0.71417	0.032000	0.17829	0.165000	0.22458	9.287000	0.95975	2.208000	0.71279	0.460000	0.39030	GTC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.617	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	65	0.00	0	A	NM_000546		7578460	7578460	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	13	63.16	24	SNP	0.906	C
UBE2D2	7322	genome.wustl.edu	37	5	138980017	138980017	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr5:138980017G>A	ENST00000398733.3	+	2	711	c.85G>A	c.(85-87)Gat>Aat	p.D29N	UBE2D2_ENST00000511725.1_5'UTR|UBE2D2_ENST00000505548.1_5'UTR|UBE2D2_ENST00000253815.2_5'UTR	NM_003339.2	NP_003330.1	P62837	UB2D2_HUMAN	ubiquitin-conjugating enzyme E2D 2	29					cellular protein modification process (GO:0006464)|cellular response to hypoxia (GO:0071456)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|protein K48-linked ubiquitination (GO:0070936)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|protein complex (GO:0043234)|ubiquitin ligase complex (GO:0000151)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(1)|lung(3)|skin(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TGTTGGAGATGATAGTAAGTA	0.363																																						dbGAP											0													91.0	91.0	91.0					5																	138980017		1894	4149	6043	-	-	-	SO:0001583	missense	0			L40146	CCDS43369.1, CCDS47275.1	5q31.2	2013-10-18	2011-05-19		ENSG00000131508	ENSG00000131508		"""Ubiquitin-conjugating enzymes E2"""	12475	protein-coding gene	gene with protein product		602962	"""ubiquitin-conjugating enzyme E2D 2 (homologous to yeast UBC4/5)"", ""ubiquitin-conjugating enzyme E2D 2 (UBC4/5 homolog, yeast)"""			8530467	Standard	NM_181838		Approved	UbcH5B, UBC4	uc003ler.3	P62837	OTTHUMG00000163282	ENST00000398733.3:c.85G>A	5.37:g.138980017G>A	ENSP00000381717:p.Asp29Asn		D3DQC9|P51669|Q3MN78|Q96RP6	Missense_Mutation	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.D29N	ENST00000398733.3	37	c.85	CCDS43369.1	5	.	.	.	.	.	.	.	.	.	.	G	20.2	3.949026	0.73787	.	.	ENSG00000131508	ENST00000398733;ENST00000398734	T;T	0.71341	-0.56;-0.56	5.01	5.01	0.66863	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.85682	D	0.000000	T	0.55465	0.1922	N	0.10945	0.07	0.80722	D	1	B	0.16396	0.017	B	0.26094	0.066	T	0.53208	-0.8471	10	0.39692	T	0.17	.	16.066	0.80870	0.0:0.0:1.0:0.0	.	29	P62837	UB2D2_HUMAN	N	29	ENSP00000381717:D29N;ENSP00000381718:D29N	ENSP00000381717:D29N	D	+	1	0	UBE2D2	138960201	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.121000	0.89582	2.330000	0.79161	0.563000	0.77884	GAT	UBE2D2	-	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	ENSG00000131508		0.363	UBE2D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2D2	HGNC	protein_coding	OTTHUMT00000372454.3	133	0.00	0	G	NM_181838		138980017	138980017	+1	no_errors	ENST00000398733	ensembl	human	known	69_37n	missense	75	40.00	50	SNP	1.000	A
UBE2V2	7336	genome.wustl.edu	37	8	48962528	48962528	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr8:48962528C>G	ENST00000523111.2	+	3	336	c.281C>G	c.(280-282)tCc>tGc	p.S94C	UBE2V2_ENST00000517630.1_Missense_Mutation_p.S54C|UBE2V2_ENST00000520809.1_Missense_Mutation_p.S54C|UBE2V2_ENST00000521346.1_Missense_Mutation_p.S54C	NM_003350.2	NP_003341.1	Q15819	UB2V2_HUMAN	ubiquitin-conjugating enzyme E2 variant 2	94					cell proliferation (GO:0008283)|DNA double-strand break processing (GO:0000729)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of DNA repair (GO:0045739)|positive regulation of neuron projection development (GO:0010976)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of synapse assembly (GO:0051965)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of DNA repair (GO:0006282)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|UBC13-MMS2 complex (GO:0031372)	acid-amino acid ligase activity (GO:0016881)			large_intestine(1)|lung(2)	3		all_cancers(86;0.026)|all_epithelial(80;0.000748)|Lung NSC(129;0.00171)|all_lung(136;0.00196)				ATAAATAATTCCAGTGGGATG	0.289								Rad6 pathway																														dbGAP											0													41.0	39.0	40.0					8																	48962528		1824	4091	5915	-	-	-	SO:0001583	missense	0			X98091	CCDS43738.1	8q11.21	2008-02-05			ENSG00000169139	ENSG00000169139		"""Ubiquitin-conjugating enzymes E2"""	12495	protein-coding gene	gene with protein product		603001				9418904, 9199207	Standard	NM_003350		Approved	UEV-2, DDVit-1, EDPF-1, MMS2	uc003xqm.3	Q15819	OTTHUMG00000164206	ENST00000523111.2:c.281C>G	8.37:g.48962528C>G	ENSP00000428209:p.Ser94Cys			Missense_Mutation	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.S94C	ENST00000523111.2	37	c.281	CCDS43738.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.1|24.1	4.495657|4.495657	0.85069|0.85069	.|.	.|.	ENSG00000169139|ENSG00000169139	ENST00000523432|ENST00000523111;ENST00000521346;ENST00000517630;ENST00000520809;ENST00000520595;ENST00000521628	.|T;T;T;T	.|0.11169	.|2.8;2.8;2.8;2.8	5.0|5.0	5.0|5.0	0.66597|0.66597	.|Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.23094|0.23094	0.0558|0.0558	M|M	0.87617|0.87617	2.895|2.895	0.80722|0.80722	D|D	1|1	.|B	.|0.09022	.|0.002	.|B	.|0.14578	.|0.011	T|T	0.10753|0.10753	-1.0616|-1.0616	5|10	.|0.87932	.|D	.|0	-1.742|-1.742	18.6561|18.6561	0.91455|0.91455	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|94	.|Q15819	.|UB2V2_HUMAN	A|C	58|94;54;54;54;7;7	.|ENSP00000428209:S94C;ENSP00000428818:S54C;ENSP00000429886:S54C;ENSP00000429419:S54C	.|ENSP00000429886:S54C	P|S	+|+	1|2	0|0	UBE2V2|UBE2V2	49125081|49125081	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.870000|0.870000	0.49936|0.49936	7.268000|7.268000	0.78473|0.78473	2.482000|2.482000	0.83794|0.83794	0.462000|0.462000	0.41574|0.41574	CCA|TCC	UBE2V2	-	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	ENSG00000169139		0.289	UBE2V2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2V2	HGNC	protein_coding	OTTHUMT00000377808.3	67	0.00	0	C	NM_003350		48962528	48962528	+1	no_errors	ENST00000523111	ensembl	human	known	69_37n	missense	49	31.94	23	SNP	1.000	G
UBE4B	10277	genome.wustl.edu	37	1	10166258	10166258	+	Silent	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr1:10166258C>G	ENST00000343090.6	+	7	888	c.813C>G	c.(811-813)ctC>ctG	p.L271L	UBE4B_ENST00000253251.8_Intron|UBE4B_ENST00000377157.3_Intron	NM_001105562.2	NP_001099032.1			ubiquitination factor E4B											NS(3)|breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(14)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	48		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		AATTTAGCCTCTATGAAAGTA	0.448																																						dbGAP											0													56.0	54.0	55.0					1																	10166258		1844	4087	5931	-	-	-	SO:0001819	synonymous_variant	0			AF091093	CCDS110.1, CCDS41245.1	1p36.1	2013-01-28	2011-05-19		ENSG00000130939	ENSG00000130939		"""U-box domain containing"""	12500	protein-coding gene	gene with protein product		613565	"""ubiquitination factor E4B (homologous to yeast UFD2)"", ""ubiquitination factor E4B (UFD2 homolog, yeast)"""			9734811, 10089879	Standard	NM_006048		Approved	UBOX3, E4, UFD2, KIAA0684	uc001aqs.4	O95155	OTTHUMG00000001797	ENST00000343090.6:c.813C>G	1.37:g.10166258C>G				Silent	SNP	pfam_Ub_conjug_fac_E4_core,pfam_Ubox_domain,smart_Ubox_domain	p.L271	ENST00000343090.6	37	c.813	CCDS41245.1	1																																																																																			UBE4B	-	NULL	ENSG00000130939		0.448	UBE4B-001	KNOWN	basic|CCDS	protein_coding	UBE4B	HGNC	protein_coding	OTTHUMT00000005016.1	62	0.00	0	C	NM_006048		10166258	10166258	+1	no_errors	ENST00000343090	ensembl	human	known	69_37n	silent	23	25.81	8	SNP	1.000	G
URB1	9875	genome.wustl.edu	37	21	33709732	33709732	+	Silent	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr21:33709732G>A	ENST00000382751.3	-	27	4717	c.4602C>T	c.(4600-4602)ggC>ggT	p.G1534G	URB1_ENST00000492603.1_5'Flank	NM_014825.2	NP_055640.2	O60287	NPA1P_HUMAN	URB1 ribosome biogenesis 1 homolog (S. cerevisiae)	1534						nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(3)|skin(1)|stomach(1)	19						TGAGAGTGGCGCCATAGGCCC	0.617																																						dbGAP											0													38.0	42.0	41.0					21																	33709732		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AB011111	CCDS46645.1	21q22.11	2006-11-28	2006-11-28	2006-11-28	ENSG00000142207	ENSG00000142207			17344	protein-coding gene	gene with protein product	nucleolar preribosomal-associated protein 1	608865	"""chromosome 21 open reading frame 108"""	C21orf108		9628581	Standard	NM_014825		Approved	KIAA0539, NPA1	uc002ypn.2	O60287	OTTHUMG00000064919	ENST00000382751.3:c.4602C>T	21.37:g.33709732G>A			D3DSE5|Q96NX1|Q9NYQ1	Silent	SNP	pfam_Npa1_N,superfamily_ARM-type_fold	p.G1534	ENST00000382751.3	37	c.4602	CCDS46645.1	21																																																																																			URB1	-	NULL	ENSG00000142207		0.617	URB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	URB1	HGNC	protein_coding	OTTHUMT00000139400.2	40	0.00	0	G			33709732	33709732	-1	no_errors	ENST00000382751	ensembl	human	known	69_37n	silent	28	34.88	15	SNP	0.025	A
USP49	25862	genome.wustl.edu	37	6	41774547	41774547	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr6:41774547C>G	ENST00000394253.3	-	3	504	c.175G>C	c.(175-177)Gag>Cag	p.E59Q	USP49_ENST00000373009.3_Missense_Mutation_p.E59Q|USP49_ENST00000373006.1_Missense_Mutation_p.E59Q|USP49_ENST00000373010.1_Missense_Mutation_p.E59Q|USP49_ENST00000297229.2_Missense_Mutation_p.E59Q			Q70CQ1	UBP49_HUMAN	ubiquitin specific peptidase 49	59					histone H2B conserved C-terminal lysine deubiquitination (GO:0035616)|mRNA splicing, via spliceosome (GO:0000398)|protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|histone binding (GO:0042393)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(2)|skin(2)	23	Ovarian(28;0.0919)|Colorectal(47;0.121)		STAD - Stomach adenocarcinoma(11;0.000204)|Epithelial(12;0.000309)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			CCCGTCTCCTCAAAGTGTTTC	0.587																																						dbGAP											0													113.0	115.0	114.0					6																	41774547		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ586139	CCDS4861.1, CCDS69111.1	6p12.1	2008-02-05	2005-08-08		ENSG00000164663	ENSG00000164663		"""Ubiquitin-specific peptidases"""	20078	protein-coding gene	gene with protein product			"""ubiquitin specific protease 49"""			14715245	Standard	NM_018561		Approved	MGC20741	uc003ori.3	Q70CQ1	OTTHUMG00000014688	ENST00000394253.3:c.175G>C	6.37:g.41774547C>G	ENSP00000377797:p.Glu59Gln		Q5T3D9|Q5T3E0|Q96CK4	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_Znf_UBP,smart_Znf_UBP,pfscan_Znf_UBP,pfscan_Peptidase_C19	p.E59Q	ENST00000394253.3	37	c.175		6	.	.	.	.	.	.	.	.	.	.	C	0.811	-0.752130	0.03041	.	.	ENSG00000164663	ENST00000394253;ENST00000373010;ENST00000373009;ENST00000373006;ENST00000297229	T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91	5.05	2.19	0.27852	.	0.168605	0.52532	D	0.000066	T	0.04588	0.0125	N	0.03294	-0.36	0.26705	N	0.971093	B	0.09022	0.002	B	0.13407	0.009	T	0.44483	-0.9325	10	0.02654	T	1	-0.944	9.6437	0.39855	0.0:0.5191:0.4061:0.0747	.	59	Q70CQ1-2	.	Q	59	ENSP00000377797:E59Q;ENSP00000362101:E59Q;ENSP00000362100:E59Q;ENSP00000362097:E59Q;ENSP00000297229:E59Q	ENSP00000297229:E59Q	E	-	1	0	USP49	41882525	0.999000	0.42202	0.062000	0.19696	0.980000	0.70556	2.037000	0.41174	0.266000	0.21894	0.655000	0.94253	GAG	USP49	-	pfam_Znf_UBP,smart_Znf_UBP,pfscan_Znf_UBP	ENSG00000164663		0.587	USP49-007	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	USP49	HGNC	protein_coding	OTTHUMT00000316513.3	64	0.00	0	C	NM_018561		41774547	41774547	-1	no_errors	ENST00000373009	ensembl	human	known	69_37n	missense	34	12.82	5	SNP	0.996	G
UVSSA	57654	genome.wustl.edu	37	4	1348587	1348587	+	Silent	SNP	C	C	G	rs529580289		TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr4:1348587C>G	ENST00000389851.4	+	6	1446	c.999C>G	c.(997-999)ctC>ctG	p.L333L	UVSSA_ENST00000507531.1_Silent_p.L333L|UVSSA_ENST00000511216.1_Silent_p.L333L|AC078852.1_ENST00000504748.1_RNA	NM_020894.2	NP_065945.2	Q2YD98	UVSSA_HUMAN	UV-stimulated scaffold protein A	333					protein ubiquitination (GO:0016567)|response to UV (GO:0009411)|transcription-coupled nucleotide-excision repair (GO:0006283)	chromosome (GO:0005694)	RNA polymerase II core binding (GO:0000993)										GCGACACACTCAAGCTCATCC	0.622																																						dbGAP											0													88.0	71.0	76.0					4																	1348587		2200	4300	6500	-	-	-	SO:0001819	synonymous_variant	0			BC021930	CCDS33938.1	4p16.3	2012-04-27	2012-04-27	2012-04-27		ENSG00000163945			29304	protein-coding gene	gene with protein product		614632	"""KIAA1530"""	KIAA1530		10819331, 22466610, 22466611, 22466612	Standard	NM_020894		Approved		uc003gde.4	Q2YD98		ENST00000389851.4:c.999C>G	4.37:g.1348587C>G			A8K9E6|B2RU11|Q8WTX4|Q9P1Z8	Silent	SNP	pfam_DUF2043,superfamily_ENTH_VHS	p.L333	ENST00000389851.4	37	c.999	CCDS33938.1	4																																																																																			UVSSA	-	NULL	ENSG00000163945		0.622	UVSSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UVSSA	HGNC	protein_coding	OTTHUMT00000359480.1	49	0.00	0	C	NM_020894		1348587	1348587	+1	no_errors	ENST00000389851	ensembl	human	known	69_37n	silent	32	36.00	18	SNP	0.998	G
VAV2	7410	genome.wustl.edu	37	9	136661557	136661557	+	Silent	SNP	G	G	C			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr9:136661557G>C	ENST00000371850.3	-	11	1057	c.1026C>G	c.(1024-1026)ctC>ctG	p.L342L	VAV2_ENST00000406606.3_Silent_p.L337L|VAV2_ENST00000371851.1_Silent_p.L337L	NM_001134398.1	NP_001127870.1	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor	342	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(3)|endometrium(1)|kidney(3)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(1)	35				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		TCACCTTCAAGAGCAGGTGGT	0.602																																						dbGAP											0													76.0	63.0	68.0					9																	136661557		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS6979.1, CCDS48053.1	9q34.1	2013-02-14	2007-07-25		ENSG00000160293	ENSG00000160293		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12658	protein-coding gene	gene with protein product		600428	"""vav 2 oncogene"""			7762982	Standard	NM_003371		Approved		uc004ces.3	P52735	OTTHUMG00000020882	ENST00000371850.3:c.1026C>G	9.37:g.136661557G>C			A2RUM4|A8MQ12|B6ZDF5|Q5SYV3|Q5SYV4|Q5SYV5|Q6N012|Q6PIJ9|Q6Q317	Silent	SNP	pfam_DH-domain,pfam_SH3_2,pfam_CAMSAP_CH,pfam_SH3_domain,pfam_SH2,pfam_CH-domain,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_CH-domain,superfamily_SH3_domain,smart_CH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_SH3_domain,smart_SH2,pfscan_CH-domain,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain,prints_SH2,prints_SH3_domain	p.L342	ENST00000371850.3	37	c.1026	CCDS48053.1	9																																																																																			VAV2	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000160293		0.602	VAV2-001	KNOWN	basic|CCDS	protein_coding	VAV2	HGNC	protein_coding	OTTHUMT00000054939.1	60	0.00	0	G			136661557	136661557	-1	no_errors	ENST00000371850	ensembl	human	known	69_37n	silent	44	25.42	15	SNP	1.000	C
VKORC1	79001	genome.wustl.edu	37	16	31105925	31105925	+	Silent	SNP	G	G	C			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr16:31105925G>C	ENST00000394975.2	-	1	353	c.126C>G	c.(124-126)ctC>ctG	p.L42L	VKORC1_ENST00000498155.1_Intron|RP11-196G11.1_ENST00000529564.1_Silent_p.L42L|VKORC1_ENST00000394971.3_5'Flank|VKORC1_ENST00000319788.7_Silent_p.L42L|VKORC1_ENST00000300851.6_Silent_p.L42L|VKORC1_ENST00000354895.4_Silent_p.L42L	NM_024006.4	NP_076869.1	Q9BQB6	VKOR1_HUMAN	vitamin K epoxide reductase complex, subunit 1	42					blood coagulation (GO:0007596)|bone development (GO:0060348)|cellular protein metabolic process (GO:0044267)|drug metabolic process (GO:0017144)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)|vitamin K metabolic process (GO:0042373)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	quinone binding (GO:0048038)|vitamin-K-epoxide reductase (warfarin-sensitive) activity (GO:0047057)			lung(3)|urinary_tract(1)	4					Acenocoumarol(DB01418)|Dicoumarol(DB00266)|Menadione(DB00170)|Phenindione(DB00498)|Phenprocoumon(DB00946)|Warfarin(DB00682)	CCACGTCGCAGAGCGCGCGGT	0.711																																						dbGAP											0													12.0	13.0	13.0					16																	31105925		2186	4273	6459	-	-	-	SO:0001819	synonymous_variant	0				CCDS10703.1, CCDS10704.1	16p11.2	2008-02-05	2004-07-23		ENSG00000167397	ENSG00000167397			23663	protein-coding gene	gene with protein product		608547	"""vitamin K dependent clotting factors deficiency 2"""	VKCFD2			Standard	NM_024006		Approved		uc002eas.3	Q9BQB6	OTTHUMG00000047408	ENST00000394975.2:c.126C>G	16.37:g.31105925G>C			A6NIQ6|B2R4Z6|Q6UX90|Q7Z2R4	Silent	SNP	pfam_VKOR,smart_VKOR	p.L42	ENST00000394975.2	37	c.126	CCDS10703.1	16																																																																																			VKORC1	-	pfam_VKOR,smart_VKOR	ENSG00000167397		0.711	VKORC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VKORC1	HGNC	protein_coding	OTTHUMT00000108582.1	10	0.00	0	G	NM_024006		31105925	31105925	-1	no_errors	ENST00000394975	ensembl	human	known	69_37n	silent	4	60.00	6	SNP	1.000	C
WDR11	55717	genome.wustl.edu	37	10	122622406	122622406	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr10:122622406A>G	ENST00000263461.6	+	5	932	c.686A>G	c.(685-687)aAa>aGa	p.K229R		NM_018117.11	NP_060587.8	Q8WWQ0	PHIP_HUMAN	WD repeat domain 11	0					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(9)|prostate(2)|skin(2)|stomach(5)	38						AATAAAGTAAAAATTTTAATC	0.383																																						dbGAP											0													61.0	70.0	67.0					10																	122622406		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF320223	CCDS7619.1	10q26	2013-01-21	2010-01-06	2010-01-06	ENSG00000120008	ENSG00000120008		"""WD repeat domain containing"""	13831	protein-coding gene	gene with protein product		606417	"""bromodomain and WD repeat domain containing 2"""	BRWD2		10718198, 11536051	Standard	NM_018117		Approved	KIAA1351, FLJ10506, WDR15, HH14, DR11	uc021pzt.1	Q9BZH6	OTTHUMG00000019171	ENST00000263461.6:c.686A>G	10.37:g.122622406A>G	ENSP00000263461:p.Lys229Arg		A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	p.K229R	ENST00000263461.6	37	c.686	CCDS7619.1	10	.	.	.	.	.	.	.	.	.	.	A	17.30	3.353913	0.61293	.	.	ENSG00000120008	ENST00000263461	D	0.91180	-2.8	6.17	6.17	0.99709	WD40 repeat-like-containing domain (1);	0.083495	0.85682	D	0.000000	T	0.81269	0.4787	N	0.20401	0.57	0.58432	D	0.999999	P	0.39665	0.682	B	0.31390	0.129	T	0.81125	-0.1075	10	0.09843	T	0.71	-19.353	16.8222	0.85835	1.0:0.0:0.0:0.0	.	229	Q9BZH6	WDR11_HUMAN	R	229	ENSP00000263461:K229R	ENSP00000263461:K229R	K	+	2	0	WDR11	122612396	1.000000	0.71417	0.987000	0.45799	0.964000	0.63967	9.163000	0.94750	2.371000	0.80710	0.533000	0.62120	AAA	WDR11	-	superfamily_WD40_repeat_dom	ENSG00000120008		0.383	WDR11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	WDR11	HGNC	protein_coding	OTTHUMT00000050707.2	74	0.00	0	A			122622406	122622406	+1	no_errors	ENST00000263461	ensembl	human	known	69_37n	missense	33	45.90	28	SNP	1.000	G
WDR35	57539	genome.wustl.edu	37	2	20113974	20113974	+	Silent	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr2:20113974G>A	ENST00000345530.3	-	27	3334	c.3219C>T	c.(3217-3219)ctC>ctT	p.L1073L	WDR35_ENST00000281405.4_Silent_p.L1062L|WDR35_ENST00000416055.2_Intron	NM_001006657.1	NP_001006658.1	Q9P2L0	WDR35_HUMAN	WD repeat domain 35	1073					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)				breast(1)|endometrium(5)|kidney(8)|large_intestine(8)|lung(16)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CGCATGCGCAGAGTGCTAGCA	0.423																																						dbGAP											0													76.0	77.0	77.0					2																	20113974		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB037757	CCDS1695.1, CCDS33152.1	2p24.3	2014-02-21			ENSG00000118965	ENSG00000118965		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	29250	protein-coding gene	gene with protein product		613602				10718198	Standard	NM_001006657		Approved	MGC33196, KIAA1336, IFT121, IFTA1	uc002rdi.3	Q9P2L0	OTTHUMG00000090737	ENST00000345530.3:c.3219C>T	2.37:g.20113974G>A			B3KVI5|Q4ZG01|Q8NE11	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pirsf_WD_repeat_p35,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L1073	ENST00000345530.3	37	c.3219	CCDS33152.1	2																																																																																			WDR35	-	pirsf_WD_repeat_p35	ENSG00000118965		0.423	WDR35-001	KNOWN	basic|CCDS	protein_coding	WDR35	HGNC	protein_coding	OTTHUMT00000207472.2	107	0.00	0	G	NM_020779		20113974	20113974	-1	no_errors	ENST00000345530	ensembl	human	known	69_37n	silent	61	22.78	18	SNP	0.996	A
ZBTB22	9278	genome.wustl.edu	37	6	33283626	33283626	+	Silent	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr6:33283626G>A	ENST00000431845.2	-	2	1219	c.1068C>T	c.(1066-1068)ctC>ctT	p.L356L	TAPBP_ENST00000475304.1_5'Flank|TAPBP_ENST00000489157.1_5'Flank|ZBTB22_ENST00000418724.1_Silent_p.L356L|TAPBP_ENST00000456592.2_5'Flank|TAPBP_ENST00000434618.2_5'Flank|TAPBP_ENST00000426633.2_5'Flank	NM_005453.4	NP_005444.4	O15209	ZBT22_HUMAN	zinc finger and BTB domain containing 22	356					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(3)	21						CACTTATGCTGAGGGTAGCCT	0.562																																						dbGAP											0													104.0	92.0	96.0					6																	33283626		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z97183	CCDS4775.1	6p21.3	2013-01-09	2006-04-12	2006-04-12	ENSG00000236104	ENSG00000236104		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13085	protein-coding gene	gene with protein product		611439	"""zinc finger protein 297"""	ZNF297			Standard	NM_005453		Approved	BING1, ZNF297A, fruitless, fru, ZBTB22A	uc010juu.3	O15209	OTTHUMG00000031110	ENST00000431845.2:c.1068C>T	6.37:g.33283626G>A			B0V007|Q5HYV4|Q5STL0|Q5STR7|Q8WV82	Silent	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.L356	ENST00000431845.2	37	c.1068	CCDS4775.1	6																																																																																			ZBTB22	-	NULL	ENSG00000236104		0.562	ZBTB22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB22	HGNC	protein_coding	OTTHUMT00000076183.2	45	0.00	0	G			33283626	33283626	-1	no_errors	ENST00000418724	ensembl	human	known	69_37n	silent	26	25.71	9	SNP	0.972	A
ZC2HC1A	51101	genome.wustl.edu	37	8	79629583	79629583	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr8:79629583C>G	ENST00000263849.4	+	9	935	c.833C>G	c.(832-834)tCt>tGt	p.S278C	IL7_ENST00000519833.1_5'Flank	NM_016010.2	NP_057094.2	Q96GY0	ZC21A_HUMAN	zinc finger, C2HC-type containing 1A	278							metal ion binding (GO:0046872)										GACTGTGCATCTTCCCTTAAT	0.388																																						dbGAP											0													140.0	133.0	135.0					8																	79629583		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6223.1	8q21.11	2013-01-10	2012-02-03	2012-02-03	ENSG00000104427	ENSG00000104427		"""Zinc fingers, C2HC-type containing"""	24277	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 70"", ""family with sequence similarity 164, member A"""	C8orf70, FAM164A		10810093	Standard	NM_016010		Approved	CGI-62	uc003ybd.3	Q96GY0	OTTHUMG00000164619	ENST00000263849.4:c.833C>G	8.37:g.79629583C>G	ENSP00000263849:p.Ser278Cys		Q9Y372	Missense_Mutation	SNP	NULL	p.S278C	ENST00000263849.4	37	c.833	CCDS6223.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.87|13.87	2.366279|2.366279	0.41902|0.41902	.|.	.|.	ENSG00000104427|ENSG00000104427	ENST00000519307|ENST00000263849	.|T	.|0.48836	.|0.8	4.61|4.61	4.61|4.61	0.57282|0.57282	.|.	.|0.393945	.|0.25078	.|N	.|0.033318	T|T	0.53270|0.53270	0.1786|0.1786	L|L	0.44542|0.44542	1.39|1.39	0.80722|0.80722	D|D	1|1	.|D	.|0.69078	.|0.997	.|P	.|0.57283	.|0.817	T|T	0.47898|0.47898	-0.9081|-0.9081	5|9	.|.	.|.	.|.	-16.8982|-16.8982	13.0185|13.0185	0.58773|0.58773	0.1613:0.8387:0.0:0.0|0.1613:0.8387:0.0:0.0	.|.	.|278	.|Q96GY0	.|F164A_HUMAN	M|C	149|278	.|ENSP00000263849:S278C	.|.	I|S	+|+	3|2	3|0	FAM164A|FAM164A	79792138|79792138	0.998000|0.998000	0.40836|0.40836	0.844000|0.844000	0.33320|0.33320	0.220000|0.220000	0.24768|0.24768	2.421000|2.421000	0.44688|0.44688	2.548000|2.548000	0.85928|0.85928	0.591000|0.591000	0.81541|0.81541	ATC|TCT	ZC2HC1A	-	NULL	ENSG00000104427		0.388	ZC2HC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC2HC1A	HGNC	protein_coding	OTTHUMT00000379423.2	111	0.00	0	C	NM_016010		79629583	79629583	+1	no_errors	ENST00000263849	ensembl	human	known	69_37n	missense	126	30.39	55	SNP	0.964	G
ZDHHC5	25921	genome.wustl.edu	37	11	57457520	57457520	+	Silent	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr11:57457520C>T	ENST00000287169.3	+	5	1764	c.402C>T	c.(400-402)tgC>tgT	p.C134C	ZDHHC5_ENST00000527985.1_Silent_p.C81C	NM_015457.2	NP_056272.2	Q9C0B5	ZDHC5_HUMAN	zinc finger, DHHC-type containing 5	134					protein palmitoylation (GO:0018345)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(3)|large_intestine(3)|lung(5)|skin(1)	18						ATCATCACTGCCCCTGGGTGA	0.458																																						dbGAP											0													141.0	141.0	141.0					11																	57457520		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AB051535	CCDS7965.1	11q13.1	2008-05-02			ENSG00000156599	ENSG00000156599		"""Zinc fingers, DHHC-type"""	18472	protein-coding gene	gene with protein product		614586				11214970	Standard	NM_015457		Approved	KIAA1748, ZNF375	uc001nkx.1	Q9C0B5	OTTHUMG00000167198	ENST00000287169.3:c.402C>T	11.37:g.57457520C>T			Q2TGF0|Q6ZMF0|Q8TAK8|Q9H923|Q9UFI7	Silent	SNP	pfam_Znf_DHHC_palmitoyltrfase,superfamily_Plexin-like_fold,pfscan_Znf_DHHC_palmitoyltrfase	p.C134	ENST00000287169.3	37	c.402	CCDS7965.1	11																																																																																			ZDHHC5	-	pfam_Znf_DHHC_palmitoyltrfase,superfamily_Plexin-like_fold,pfscan_Znf_DHHC_palmitoyltrfase	ENSG00000156599		0.458	ZDHHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC5	HGNC	protein_coding	OTTHUMT00000393694.1	84	0.00	0	C	NM_015457		57457520	57457520	+1	no_errors	ENST00000287169	ensembl	human	known	69_37n	silent	37	33.93	19	SNP	1.000	T
ZMIZ2	83637	genome.wustl.edu	37	7	44802875	44802875	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr7:44802875G>T	ENST00000309315.4	+	13	1846	c.1723G>T	c.(1723-1725)Ggc>Tgc	p.G575C	ZMIZ2_ENST00000413916.1_Missense_Mutation_p.G517C|ZMIZ2_ENST00000433667.1_Missense_Mutation_p.G543C|ZMIZ2_ENST00000441627.1_Missense_Mutation_p.G575C|ZMIZ2_ENST00000265346.7_Missense_Mutation_p.G549C	NM_031449.3	NP_113637.3	Q8NF64	ZMIZ2_HUMAN	zinc finger, MIZ-type containing 2	575					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						CTTCAGCAGCGGCACCATCCC	0.587																																					NSCLC(20;604 852 1948 16908 50522)	dbGAP											0													99.0	112.0	108.0					7																	44802875		2157	4282	6439	-	-	-	SO:0001583	missense	0			AK090415	CCDS43576.1, CCDS43577.1, CCDS75591.1	7p13	2009-11-06			ENSG00000122515	ENSG00000122515		"""Zinc fingers, MIZ-type"""	22229	protein-coding gene	gene with protein product		611196					Standard	XM_005249866		Approved	KIAA1886, hZIMP7, ZIMP7, DKFZp761I2123, NET27	uc003tlr.3	Q8NF64	OTTHUMG00000155817	ENST00000309315.4:c.1723G>T	7.37:g.44802875G>T	ENSP00000311778:p.Gly575Cys		A4D2K7|D3DVL1|O94790|Q0VGB4|Q659A8|Q6JKL5|Q8WTX8|Q96Q01|Q9BQH7	Missense_Mutation	SNP	pfam_Znf_MIZ,pfscan_Znf_MIZ	p.G575C	ENST00000309315.4	37	c.1723	CCDS43576.1	7	.	.	.	.	.	.	.	.	.	.	G	18.36	3.607117	0.66558	.	.	ENSG00000122515	ENST00000413916;ENST00000309315;ENST00000441627;ENST00000433667;ENST00000265346;ENST00000414051	T;T;T;T;T	0.35236	1.32;1.33;1.33;1.32;1.34	4.82	4.82	0.62117	.	0.090924	0.45867	D	0.000340	T	0.37404	0.1002	L	0.46157	1.445	0.80722	D	1	B;B;B	0.15473	0.013;0.008;0.013	B;B;B	0.24541	0.054;0.03;0.054	T	0.26950	-1.0088	10	0.66056	D	0.02	-13.7882	17.7538	0.88442	0.0:0.0:1.0:0.0	.	549;575;517	Q8NF64-2;Q8NF64;Q8NF64-3	.;ZMIZ2_HUMAN;.	C	517;575;575;543;549;578	ENSP00000409648:G517C;ENSP00000311778:G575C;ENSP00000414723:G575C;ENSP00000396601:G543C;ENSP00000265346:G549C	ENSP00000265346:G549C	G	+	1	0	ZMIZ2	44769400	1.000000	0.71417	0.989000	0.46669	0.981000	0.71138	9.129000	0.94430	2.521000	0.84997	0.555000	0.69702	GGC	ZMIZ2	-	NULL	ENSG00000122515		0.587	ZMIZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMIZ2	HGNC	protein_coding	OTTHUMT00000341790.1	57	0.00	0	G	NM_031449		44802875	44802875	+1	no_errors	ENST00000309315	ensembl	human	known	69_37n	missense	49	12.50	7	SNP	1.000	T
ZNF169	169841	genome.wustl.edu	37	9	97062379	97062379	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr9:97062379G>C	ENST00000395395.2	+	5	629	c.539G>C	c.(538-540)aGa>aCa	p.R180T	ZNF169_ENST00000340911.4_3'UTR	NM_194320.2	NP_919301.2	Q14929	ZN169_HUMAN	zinc finger protein 169	180					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	24		Acute lymphoblastic leukemia(62;0.136)				GAAGGGAACAGAGAAGGAGGA	0.507																																						dbGAP											0													49.0	48.0	49.0					9																	97062379		2203	4300	6503	-	-	-	SO:0001583	missense	0			U28322	CCDS6709.2	9q22.32	2014-07-30			ENSG00000175787	ENSG00000175787		"""Zinc fingers, C2H2-type"", ""-"""	12957	protein-coding gene	gene with protein product		603404				9186526, 9071574	Standard	NM_001301275		Approved	MGC51961	uc004aum.1	Q14929	OTTHUMG00000020264	ENST00000395395.2:c.539G>C	9.37:g.97062379G>C	ENSP00000378792:p.Arg180Thr		A2AGP5|A8K127|Q6PI28	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R180T	ENST00000395395.2	37	c.539	CCDS6709.2	9	.	.	.	.	.	.	.	.	.	.	G	0.354	-0.943324	0.02322	.	.	ENSG00000175787	ENST00000395395	T	0.06768	3.26	2.59	0.607	0.17564	.	.	.	.	.	T	0.03434	0.0099	N	0.03608	-0.345	0.09310	N	1	B	0.21688	0.059	B	0.19148	0.024	T	0.47995	-0.9073	9	0.20046	T	0.44	.	8.6958	0.34296	0.0:0.1633:0.6721:0.1646	.	180	Q14929	ZN169_HUMAN	T	180	ENSP00000378792:R180T	ENSP00000378792:R180T	R	+	2	0	ZNF169	96102200	0.006000	0.16342	0.000000	0.03702	0.002000	0.02628	0.918000	0.28678	-0.114000	0.11936	-1.631000	0.00782	AGA	ZNF169	-	NULL	ENSG00000175787		0.507	ZNF169-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF169	HGNC	protein_coding	OTTHUMT00000253714.1	44	0.00	0	G	NM_194320		97062379	97062379	+1	no_errors	ENST00000395395	ensembl	human	known	69_37n	missense	20	31.03	9	SNP	0.000	C
ZNF235	9310	genome.wustl.edu	37	19	44791480	44791480	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr19:44791480C>G	ENST00000291182.4	-	5	2210	c.2108G>C	c.(2107-2109)aGa>aCa	p.R703T	ZNF235_ENST00000589799.1_Intron|ZNF235_ENST00000589248.1_Intron	NM_004234.4	NP_004225.3	Q14590	ZN235_HUMAN	zinc finger protein 235	703					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29		Prostate(69;0.0352)|all_neural(266;0.116)				AGTGTGGACTCTCTGGTGTGT	0.522																																						dbGAP											0													144.0	127.0	133.0					19																	44791480		2203	4300	6503	-	-	-	SO:0001583	missense	0			X78929	CCDS33048.1	19q13.2	2013-01-08	2002-11-04	2002-11-08	ENSG00000159917	ENSG00000159917		"""Zinc fingers, C2H2-type"", ""-"""	12866	protein-coding gene	gene with protein product		604749	"""zinc finger protein homologous to Zfp93 in mouse"""	ZNF270, ZFP93		7865130, 9570955	Standard	NM_004234		Approved	HZF6, ANF270	uc002oza.4	Q14590		ENST00000291182.4:c.2108G>C	19.37:g.44791480C>G	ENSP00000291182:p.Arg703Thr		B4DTQ7|O14898|O14899|Q17RR8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R703T	ENST00000291182.4	37	c.2108	CCDS33048.1	19	.	.	.	.	.	.	.	.	.	.	C	17.78	3.474080	0.63737	.	.	ENSG00000159917	ENST00000391957;ENST00000291182	T	0.25414	1.8	4.97	3.87	0.44632	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.44902	D	0.000404	T	0.51568	0.1682	M	0.81179	2.53	0.33765	D	0.622344	D;D	0.89917	1.0;1.0	D;D	0.72075	0.943;0.976	T	0.67643	-0.5618	10	0.66056	D	0.02	-39.1471	14.6117	0.68519	0.0:0.7823:0.2177:0.0	.	699;703	Q14590-2;Q14590	.;ZN235_HUMAN	T	703	ENSP00000291182:R703T	ENSP00000291182:R703T	R	-	2	0	ZNF235	49483320	0.000000	0.05858	1.000000	0.80357	0.984000	0.73092	0.304000	0.19228	2.473000	0.83533	0.313000	0.20887	AGA	ZNF235	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000159917		0.522	ZNF235-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF235	HGNC	protein_coding	OTTHUMT00000460732.1	146	0.00	0	C			44791480	44791480	-1	no_errors	ENST00000291182	ensembl	human	known	69_37n	missense	133	24.86	44	SNP	1.000	G
ZNF252P	286101	genome.wustl.edu	37	8	146202132	146202132	+	RNA	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr8:146202132C>G	ENST00000426361.2	-	0	2052					NR_023392.1				zinc finger protein 252, pseudogene											endometrium(1)	1						GGTGTGCACTCTGGCTGAAGG	0.473																																						dbGAP											0																																										-	-	-			0			BC019922		8q24.3	2012-10-05	2012-04-19	2012-04-19	ENSG00000196922	ENSG00000196922			13046	pseudogene	pseudogene			"""zinc finger protein 252"""	ZNF252			Standard	NR_023392		Approved		uc011llo.2		OTTHUMG00000165201		8.37:g.146202132C>G				RNA	SNP	-	NULL	ENST00000426361.2	37	NULL		8	.	.	.	.	.	.	.	.	.	.	C	5.761	0.324745	0.10900	.	.	ENSG00000196922	ENST00000544285;ENST00000355436	.	.	.	3.06	-1.62	0.08372	.	.	.	.	.	T	0.23330	0.0564	.	.	.	.	.	.	.	.	.	.	.	.	T	0.35301	-0.9794	4	0.18276	T	0.48	.	4.4492	0.11612	0.0:0.3656:0.3226:0.3118	.	.	.	.	H	362;572	.	ENSP00000347611:Q572H	Q	-	3	2	ZNF252	146172936	0.000000	0.05858	0.014000	0.15608	0.977000	0.68977	-1.900000	0.01599	0.021000	0.15133	-0.357000	0.07601	CAG	ZNF252P	-	-	ENSG00000196922		0.473	ZNF252P-008	KNOWN	basic|exp_conf	processed_transcript	ZNF252P	HGNC	pseudogene	OTTHUMT00000451422.1	21	0.00	0	C	NR_023392		146202132	146202132	-1	no_errors	ENST00000426361	ensembl	human	known	69_37n	rna	58	17.14	12	SNP	0.000	G
ZNF396	252884	genome.wustl.edu	37	18	32949307	32949307	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr18:32949307G>C	ENST00000589332.1	-	4	1011	c.880C>G	c.(880-882)Ctg>Gtg	p.L294V	ZNF396_ENST00000306346.1_Missense_Mutation_p.L294V			Q96N95	ZN396_HUMAN	zinc finger protein 396	294					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)	7						TGCTGAATCAGAATTGCGCTT	0.448																																						dbGAP											0													102.0	99.0	100.0					18																	32949307		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055775	CCDS11913.1	18p12	2013-01-09			ENSG00000186496	ENSG00000186496		"""-"", ""Zinc fingers, C2H2-type"""	18824	protein-coding gene	gene with protein product		609600					Standard	NM_145756		Approved	ZSCAN14, FLJ31213	uc010xcf.1	Q96N95	OTTHUMG00000132562	ENST00000589332.1:c.880C>G	18.37:g.32949307G>C	ENSP00000466500:p.Leu294Val		A1L3V0|Q8NF98|Q8TD80	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.L294V	ENST00000589332.1	37	c.880		18	.	.	.	.	.	.	.	.	.	.	G	14.24	2.475602	0.43942	.	.	ENSG00000186496	ENST00000306346;ENST00000399057	T	0.53423	0.62	3.96	3.96	0.45880	.	0.000000	0.30428	U	0.009659	T	0.68677	0.3027	M	0.86502	2.82	0.80722	D	1	D	0.63880	0.993	P	0.61397	0.888	T	0.76310	-0.3006	10	0.87932	D	0	.	13.8752	0.63648	0.0:0.0:1.0:0.0	.	294	Q96N95-3	.	V	294	ENSP00000302310:L294V	ENSP00000302310:L294V	L	-	1	2	ZNF396	31203305	0.998000	0.40836	0.899000	0.35326	0.310000	0.27922	2.782000	0.47758	2.199000	0.70637	0.650000	0.86243	CTG	ZNF396	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000186496		0.448	ZNF396-002	KNOWN	basic|appris_principal	protein_coding	ZNF396	HGNC	protein_coding	OTTHUMT00000255766.1	89	0.00	0	G	NM_145756		32949307	32949307	-1	no_errors	ENST00000589332	ensembl	human	known	69_37n	missense	14	65.85	27	SNP	0.977	C
ZNF432	9668	genome.wustl.edu	37	19	52537854	52537854	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr19:52537854C>G	ENST00000594154.1	-	5	1290	c.1078G>C	c.(1078-1080)Gtc>Ctc	p.V360L	ZNF432_ENST00000221315.5_Missense_Mutation_p.V360L			O94892	ZN432_HUMAN	zinc finger protein 432	360					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	29		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.0054)|OV - Ovarian serous cystadenocarcinoma(262;0.0182)		TGTATGATGACATAGTGTTTT	0.423																																						dbGAP											0													124.0	116.0	119.0					19																	52537854		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018341	CCDS12848.1	19q13.41	2013-01-08				ENSG00000256087		"""Zinc fingers, C2H2-type"", ""-"""	20810	protein-coding gene	gene with protein product						9872452	Standard	NM_014650		Approved	KIAA0798	uc002pyk.3	O94892		ENST00000594154.1:c.1078G>C	19.37:g.52537854C>G	ENSP00000470488:p.Val360Leu			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V360L	ENST00000594154.1	37	c.1078	CCDS12848.1	19	.	.	.	.	.	.	.	.	.	.	C	0.060	-1.225640	0.01530	.	.	ENSG00000256087	ENST00000221315	T	0.06933	3.24	2.9	1.71	0.24356	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01222	0.0040	N	0.00032	-2.585	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.41324	-0.9515	9	0.02654	T	1	.	8.9026	0.35503	0.0:0.5217:0.4783:0.0	.	360	O94892	ZN432_HUMAN	L	360	ENSP00000221315:V360L	ENSP00000221315:V360L	V	-	1	0	ZNF432	57229666	0.047000	0.20315	0.994000	0.49952	0.937000	0.57800	0.547000	0.23299	1.635000	0.50512	0.591000	0.81541	GTC	ZNF432	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000256087		0.423	ZNF432-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF432	HGNC	protein_coding	OTTHUMT00000462410.1	74	0.00	0	C	NM_014650		52537854	52537854	-1	no_errors	ENST00000221315	ensembl	human	known	69_37n	missense	98	23.44	30	SNP	0.019	G
ZNF462	58499	genome.wustl.edu	37	9	109773294	109773294	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr9:109773294G>A	ENST00000277225.5	+	13	7793	c.7504G>A	c.(7504-7506)Gag>Aag	p.E2502K	ZNF462_ENST00000457913.1_Missense_Mutation_p.E2562K|ZNF462_ENST00000542028.1_Missense_Mutation_p.E459K|RP11-508N12.2_ENST00000439901.1_RNA|ZNF462_ENST00000441147.2_Missense_Mutation_p.E1408K			Q96JM2	ZN462_HUMAN	zinc finger protein 462	2502					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						GGAGAATGCAGAGGCCAAAAA	0.448																																						dbGAP											0													70.0	66.0	68.0					9																	109773294		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.7504G>A	9.37:g.109773294G>A	ENSP00000277225:p.Glu2502Lys		Q5T0T4|Q8N408	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E2562K	ENST00000277225.5	37	c.7684	CCDS35096.1	9	.	.	.	.	.	.	.	.	.	.	G	33	5.214329	0.95104	.	.	ENSG00000148143	ENST00000277225;ENST00000457913;ENST00000374686;ENST00000441147;ENST00000542028	T;T;T;T;T	0.18016	3.18;3.74;3.84;3.84;2.24	5.75	5.75	0.90469	.	0.123296	0.56097	D	0.000039	T	0.41696	0.1170	L	0.57536	1.79	0.52501	D	0.999952	D;D	0.63880	0.99;0.993	D;D	0.72982	0.979;0.971	T	0.09618	-1.0666	10	0.72032	D	0.01	.	19.9598	0.97242	0.0:0.0:1.0:0.0	.	2562;2502	Q96JM2-3;Q96JM2	.;ZN462_HUMAN	K	2502;2562;1445;1408;459	ENSP00000277225:E2502K;ENSP00000414570:E2562K;ENSP00000363818:E1445K;ENSP00000397306:E1408K;ENSP00000439771:E459K	ENSP00000277225:E2502K	E	+	1	0	ZNF462	108813115	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.417000	0.73337	2.716000	0.92895	0.655000	0.94253	GAG	ZNF462	-	NULL	ENSG00000148143		0.448	ZNF462-001	KNOWN	basic|CCDS	protein_coding	ZNF462	HGNC	protein_coding	OTTHUMT00000053532.2	57	0.00	0	G	NM_021224		109773294	109773294	+1	no_errors	ENST00000457913	ensembl	human	known	69_37n	missense	35	28.57	14	SNP	1.000	A
ZNF536	9745	genome.wustl.edu	37	19	31039733	31039733	+	Silent	SNP	C	C	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr19:31039733C>T	ENST00000355537.3	+	4	3354	c.3207C>T	c.(3205-3207)atC>atT	p.I1069I		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	1069					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					CCAATATGATCAGCTCTCTAG	0.567																																						dbGAP											0													60.0	63.0	62.0					19																	31039733		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.3207C>T	19.37:g.31039733C>T			A2RU18	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.I1069	ENST00000355537.3	37	c.3207	CCDS32984.1	19																																																																																			ZNF536	-	NULL	ENSG00000198597		0.567	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	HGNC	protein_coding	OTTHUMT00000459667.2	52	0.00	0	C	NM_014717		31039733	31039733	+1	no_errors	ENST00000355537	ensembl	human	known	69_37n	silent	25	53.70	29	SNP	0.000	T
ZNF572	137209	genome.wustl.edu	37	8	125988660	125988660	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr8:125988660A>T	ENST00000319286.5	+	3	304	c.150A>T	c.(148-150)aaA>aaT	p.K50N		NM_152412.2	NP_689625.2	Q7Z3I7	ZN572_HUMAN	zinc finger protein 572	50					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)	31	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			TTAAAGAGAAACCTTCAGAAT	0.343										HNSCC(60;0.17)																												dbGAP											0													64.0	66.0	65.0					8																	125988660		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX537876	CCDS6354.1	8q24.13	2013-09-20			ENSG00000180938	ENSG00000180938		"""Zinc fingers, C2H2-type"""	26758	protein-coding gene	gene with protein product							Standard	NM_152412		Approved	FLJ38002	uc003yrr.3	Q7Z3I7	OTTHUMG00000164988	ENST00000319286.5:c.150A>T	8.37:g.125988660A>T	ENSP00000319305:p.Lys50Asn		A1L4F1|Q8N1Q0	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K50N	ENST00000319286.5	37	c.150	CCDS6354.1	8	.	.	.	.	.	.	.	.	.	.	A	0.951	-0.706517	0.03230	.	.	ENSG00000180938	ENST00000319286	T	0.08546	3.08	4.73	-0.854	0.10705	.	0.618193	0.13478	N	0.384944	T	0.02888	0.0086	N	0.08118	0	0.09310	N	1	B	0.14012	0.009	B	0.11329	0.006	T	0.44802	-0.9304	10	0.15066	T	0.55	-2.2344	1.7776	0.03025	0.5637:0.1387:0.1633:0.1343	.	50	Q7Z3I7	ZN572_HUMAN	N	50	ENSP00000319305:K50N	ENSP00000319305:K50N	K	+	3	2	ZNF572	126057841	0.000000	0.05858	0.002000	0.10522	0.061000	0.15899	0.121000	0.15667	-0.020000	0.14032	0.459000	0.35465	AAA	ZNF572	-	NULL	ENSG00000180938		0.343	ZNF572-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF572	HGNC	protein_coding	OTTHUMT00000381359.1	39	0.00	0	A	NM_152412		125988660	125988660	+1	no_errors	ENST00000319286	ensembl	human	known	69_37n	missense	33	19.51	8	SNP	0.000	T
ZNF629	23361	genome.wustl.edu	37	16	30793337	30793337	+	Nonsense_Mutation	SNP	G	G	C			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr16:30793337G>C	ENST00000262525.4	-	3	2519	c.2312C>G	c.(2311-2313)tCa>tGa	p.S771*	RP11-2C24.6_ENST00000575562.1_RNA	NM_001080417.1	NP_001073886.1	Q9UEG4	ZN629_HUMAN	zinc finger protein 629	771					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(3)|urinary_tract(1)	22			Colorectal(24;0.198)			CCTGCAATCTGAGCAGCGGTA	0.657																																						dbGAP											0													67.0	79.0	75.0					16																	30793337		1900	4104	6004	-	-	-	SO:0001587	stop_gained	0			AB002324	CCDS45463.1	16p11.2	2013-01-08				ENSG00000102870		"""Zinc fingers, C2H2-type"""	29008	protein-coding gene	gene with protein product			"""zinc finger protein 65"""	ZNF65		9205841	Standard	NM_001080417		Approved	KIAA0326	uc002dzs.1	Q9UEG4		ENST00000262525.4:c.2312C>G	16.37:g.30793337G>C	ENSP00000262525:p.Ser771*		Q15938	Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S771*	ENST00000262525.4	37	c.2312	CCDS45463.1	16	.	.	.	.	.	.	.	.	.	.	G	37	6.242715	0.97408	.	.	ENSG00000102870	ENST00000262525	.	.	.	5.65	5.65	0.86999	.	0.000000	0.37261	N	0.002173	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-13.0864	17.225	0.86967	0.0:0.0:1.0:0.0	.	.	.	.	X	771	.	ENSP00000262525:S771X	S	-	2	0	ZNF629	30700838	0.031000	0.19500	0.999000	0.59377	0.777000	0.43975	1.968000	0.40500	2.677000	0.91161	0.561000	0.74099	TCA	ZNF629	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000102870		0.657	ZNF629-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF629	HGNC	protein_coding	OTTHUMT00000434291.1	38	0.00	0	G	NM_015309		30793337	30793337	-1	no_errors	ENST00000262525	ensembl	human	known	69_37n	nonsense	34	37.50	21	SNP	0.978	C
ZNF876P	642280	genome.wustl.edu	37	4	247396	247396	+	RNA	SNP	G	G	C			TCGA-E2-A1IN-01A-11D-A13L-09	TCGA-E2-A1IN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e85559f-098e-4b0f-8034-4798789e710b	8dd6fca4-007f-45de-a569-bfb899254977	g.chr4:247396G>C	ENST00000356347.3	+	0	220					NR_027481.1		Q49A33	Z876P_HUMAN	zinc finger protein 876, pseudogene						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										GCAGGGCATAGAAGATTCATT	0.343																																						dbGAP											0																																										-	-	-			0			BC028359		4p16.3	2011-04-20	2010-08-03	2009-07-22	ENSG00000198155	ENSG00000198155			32472	pseudogene	pseudogene							Standard	NR_027481		Approved		uc010iba.4	Q49A33	OTTHUMG00000159874		4.37:g.247396G>C				RNA	SNP	-	NULL	ENST00000356347.3	37	NULL		4																																																																																			ZNF876P	-	-	ENSG00000198155		0.343	ZNF876P-001	KNOWN	basic	processed_transcript	ZNF876P	HGNC	pseudogene	OTTHUMT00000357870.2	18	0.00	0	G	NR_027481		247396	247396	+1	no_errors	ENST00000356347	ensembl	human	known	69_37n	rna	15	48.28	14	SNP	0.010	C
