#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABHD13	84945	genome.wustl.edu	37	13	108882272	108882272	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1L9-01A-11D-A13L-09	TCGA-E2-A1L9-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a50cd2b2-913d-41bf-94ad-45464547b348	893c62e3-94ee-49f2-a0e1-64eed978c722	g.chr13:108882272C>T	ENST00000375898.3	+	2	1007	c.706C>T	c.(706-708)Cgt>Tgt	p.R236C		NM_032859.2	NP_116248.2	Q7L211	ABHDD_HUMAN	abhydrolase domain containing 13	236						integral component of membrane (GO:0016021)|membrane (GO:0016020)	hydrolase activity (GO:0016787)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					CTTTCCGATGCGTTACCTTCC	0.373																																					Pancreas(22;506 789 38166 45896 51596)	dbGAP											0													110.0	112.0	111.0					13																	108882272		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK027812	CCDS32007.1	13q33.2	2007-04-03	2006-03-10	2006-03-10	ENSG00000139826	ENSG00000139826		"""Abhydrolase domain containing"""	20293	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 6"""	C13orf6			Standard	NM_032859		Approved	bA153I24.2, FLJ14906, BEM46L1	uc001vqq.3	Q7L211	OTTHUMG00000017330	ENST00000375898.3:c.706C>T	13.37:g.108882272C>T	ENSP00000365063:p.Arg236Cys		B3KWE7|Q8NBW1|Q96JX9	Missense_Mutation	SNP	pfam_AB_hydrolase_1,pfam_AXE1	p.R236C	ENST00000375898.3	37	c.706	CCDS32007.1	13	.	.	.	.	.	.	.	.	.	.	C	11.69	1.712621	0.30413	.	.	ENSG00000139826	ENST00000375898	T	0.42513	0.97	6.02	5.17	0.71159	.	0.000000	0.85682	D	0.000000	T	0.46367	0.1389	M	0.66506	2.035	0.80722	D	1	D	0.57257	0.979	P	0.48598	0.583	T	0.49390	-0.8945	10	0.72032	D	0.01	-16.1385	8.489	0.33089	0.2298:0.6945:0.0:0.0758	.	236	Q7L211	ABHDD_HUMAN	C	236	ENSP00000365063:R236C	ENSP00000365063:R236C	R	+	1	0	ABHD13	107680273	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.086000	0.50159	2.857000	0.98124	0.650000	0.86243	CGT	ABHD13	-	NULL	ENSG00000139826		0.373	ABHD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD13	HGNC	protein_coding	OTTHUMT00000045743.1	94	0.00	0	C	NM_032859		108882272	108882272	+1	no_errors	ENST00000375898	ensembl	human	known	69_37n	missense	76	22.45	22	SNP	1.000	T
ASXL2	55252	genome.wustl.edu	37	2	25982469	25982469	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1L9-01A-11D-A13L-09	TCGA-E2-A1L9-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a50cd2b2-913d-41bf-94ad-45464547b348	893c62e3-94ee-49f2-a0e1-64eed978c722	g.chr2:25982469G>A	ENST00000435504.4	-	9	1114	c.821C>T	c.(820-822)cCg>cTg	p.P274L	ASXL2_ENST00000336112.4_Missense_Mutation_p.P246L|ASXL2_ENST00000272341.4_Missense_Mutation_p.P14L|ASXL2_ENST00000404843.1_Missense_Mutation_p.P14L			Q76L83	ASXL2_HUMAN	additional sex combs like transcriptional regulator 2	274					adult heart development (GO:0007512)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone H3-K27 trimethylation (GO:1902466)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(3)	33	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AATGGAGTCCGGTGTCTCAAC	0.428																																						dbGAP											0													206.0	194.0	198.0					2																	25982469		1953	4160	6113	-	-	-	SO:0001583	missense	0					2p24.1	2014-06-17	2014-06-17		ENSG00000143970	ENSG00000143970			23805	protein-coding gene	gene with protein product		612991	"""additional sex combs like 2 (Drosophila)"""			12888926	Standard	NM_018263		Approved	ASXH2, FLJ10898, KIAA1685	uc002rgs.2	Q76L83	OTTHUMG00000152176	ENST00000435504.4:c.821C>T	2.37:g.25982469G>A	ENSP00000391447:p.Pro274Leu		Q53TC9|Q5H9U4|Q76L81|Q86XM1|Q9C0H8|Q9NV67	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD	p.P274L	ENST00000435504.4	37	c.821		2	.	.	.	.	.	.	.	.	.	.	G	24.2	4.500192	0.85176	.	.	ENSG00000143970	ENST00000435504;ENST00000336112;ENST00000404843;ENST00000272341	T;T;T;T	0.58506	0.33;0.33;0.93;0.93	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.77046	0.4073	M	0.74467	2.265	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	T	0.79215	-0.1895	10	0.87932	D	0	-13.7189	18.133	0.89608	0.0:0.0:1.0:0.0	.	14;274	Q76L83-2;Q76L83	.;ASXL2_HUMAN	L	274;246;14;14	ENSP00000391447:P274L;ENSP00000337250:P246L;ENSP00000383920:P14L;ENSP00000272341:P14L	ENSP00000272341:P14L	P	-	2	0	ASXL2	25835973	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	9.676000	0.98643	2.613000	0.88420	0.650000	0.86243	CCG	ASXL2	-	NULL	ENSG00000143970		0.428	ASXL2-001	KNOWN	basic|appris_principal	protein_coding	ASXL2	HGNC	protein_coding	OTTHUMT00000325593.3	151	0.00	0	G	NM_018263		25982469	25982469	-1	no_errors	ENST00000435504	ensembl	human	known	69_37n	missense	137	14.37	23	SNP	1.000	A
BRCA1	672	genome.wustl.edu	37	17	41244468	41244468	+	Missense_Mutation	SNP	C	C	A	rs80357386		TCGA-E2-A1L9-01A-11D-A13L-09	TCGA-E2-A1L9-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a50cd2b2-913d-41bf-94ad-45464547b348	893c62e3-94ee-49f2-a0e1-64eed978c722	g.chr17:41244468C>A	ENST00000357654.3	-	10	3198	c.3080G>T	c.(3079-3081)aGc>aTc	p.S1027I	BRCA1_ENST00000491747.2_Intron|BRCA1_ENST00000468300.1_Intron|BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000352993.3_Intron|BRCA1_ENST00000471181.2_Missense_Mutation_p.S1027I|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000493795.1_Missense_Mutation_p.S980I|BRCA1_ENST00000309486.4_Missense_Mutation_p.S731I|BRCA1_ENST00000354071.3_Missense_Mutation_p.S1027I|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000346315.3_Missense_Mutation_p.S1027I|BRCA1_ENST00000351666.3_Intron	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	1027					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		GTTATTACGGCTAATTGTGCT	0.353			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																												dbGAP	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	0													131.0	126.0	127.0					17																	41244468		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database		U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.3080G>T	17.37:g.41244468C>A	ENSP00000350283:p.Ser1027Ile		O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Missense_Mutation	SNP	pirsf_BRCA1,pfam_BRCT_dom,pfam_Znf_C3HC4_RING-type,superfamily_BRCT_dom,smart_Znf_RING,smart_BRCT_dom,pfscan_BRCT_dom,pfscan_Znf_RING	p.S1027I	ENST00000357654.3	37	c.3080	CCDS11453.1	17	.	.	.	.	.	.	.	.	.	.	C	16.16	3.045505	0.55110	.	.	ENSG00000012048	ENST00000357654;ENST00000412061;ENST00000354071;ENST00000346315;ENST00000309486;ENST00000471181;ENST00000493795	T;T;T;T;T;T	0.79033	-1.23;-1.23;-1.23;-1.23;-1.23;-1.23	5.23	5.23	0.72850	.	0.000000	0.64402	D	0.000005	D	0.89626	0.6769	M	0.93150	3.385	0.29640	N	0.844796	D;D;P;P;D;P	0.89917	1.0;1.0;0.782;0.866;0.989;0.929	D;D;B;P;P;P	0.71870	0.975;0.975;0.411;0.688;0.844;0.771	D	0.87116	0.2188	10	0.72032	D	0.01	.	10.8703	0.46879	0.0:0.9073:0.0:0.0927	.	1027;986;1027;1027;1027;1027	E7EMP0;E7ERL4;Q5YLB2;E9PFC7;P38398;P38398-2	.;.;.;.;BRCA1_HUMAN;.	I	1027;1027;1027;1027;731;1027;980	ENSP00000350283:S1027I;ENSP00000326002:S1027I;ENSP00000246907:S1027I;ENSP00000310938:S731I;ENSP00000418960:S1027I;ENSP00000418775:S980I	ENSP00000310938:S731I	S	-	2	0	BRCA1	38497994	0.732000	0.28121	0.970000	0.41538	0.741000	0.42261	1.344000	0.33941	2.720000	0.93068	0.557000	0.71058	AGC	BRCA1	-	pirsf_BRCA1	ENSG00000012048		0.353	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA1	HGNC	protein_coding	OTTHUMT00000348798.2	121	0.00	0	C	NM_007294		41244468	41244468	-1	no_errors	ENST00000471181	ensembl	human	known	69_37n	missense	70	21.35	19	SNP	0.912	A
CCDC175	729665	genome.wustl.edu	37	14	60011911	60011911	+	Missense_Mutation	SNP	G	G	T	rs576464899		TCGA-E2-A1L9-01A-11D-A13L-09	TCGA-E2-A1L9-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a50cd2b2-913d-41bf-94ad-45464547b348	893c62e3-94ee-49f2-a0e1-64eed978c722	g.chr14:60011911G>T	ENST00000537690.2	-	9	1197	c.1142C>A	c.(1141-1143)gCt>gAt	p.A381D	CCDC175_ENST00000281581.4_Missense_Mutation_p.A381D	NM_001164399.1	NP_001157871.1	P0C221	CC175_HUMAN	coiled-coil domain containing 175	381																	TTGCAAAAAAGCTTTTTCTTC	0.373																																						dbGAP											0													169.0	148.0	154.0					14																	60011911		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS53898.1	14q23.1	2012-09-24	2012-09-24	2012-09-24	ENSG00000151838	ENSG00000151838			19847	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 38"""	C14orf38			Standard	NM_001164399		Approved		uc021rtw.1	P0C221		ENST00000537690.2:c.1142C>A	14.37:g.60011911G>T	ENSP00000453940:p.Ala381Asp		G3V5J7	Missense_Mutation	SNP	superfamily_Prefoldin	p.A381D	ENST00000537690.2	37	c.1142	CCDS53898.1	14	.	.	.	.	.	.	.	.	.	.	G	9.044	0.990411	0.18966	.	.	ENSG00000151838	ENST00000555041	.	.	.	4.19	0.5	0.16919	.	2.288870	0.01495	N	0.017277	T	0.21761	0.0524	N	0.14661	0.345	0.09310	N	1	.	.	.	.	.	.	T	0.12760	-1.0535	7	0.39692	T	0.17	0.6431	2.488	0.04603	0.5659:0.0:0.2308:0.2033	.	.	.	.	D	381	.	ENSP00000281581:A381D	A	-	2	0	C14orf38	59081664	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.705000	0.25675	0.063000	0.16370	-0.312000	0.09012	GCT	C14orf38	-	NULL	ENSG00000151838		0.373	CCDC175-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf38	HGNC	protein_coding	OTTHUMT00000471273.1	120	0.83	1	G	NM_001164399		60011911	60011911	-1	no_errors	ENST00000281581	ensembl	human	known	69_37n	missense	101	15.13	18	SNP	0.000	T
CBFB	865	genome.wustl.edu	37	16	67070543	67070543	+	Splice_Site	SNP	C	C	G			TCGA-E2-A1L9-01A-11D-A13L-09	TCGA-E2-A1L9-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a50cd2b2-913d-41bf-94ad-45464547b348	893c62e3-94ee-49f2-a0e1-64eed978c722	g.chr16:67070543C>G	ENST00000290858.6	+	3	428	c.167C>G	c.(166-168)gCt>gGt	p.A56G	CBFB_ENST00000561924.2_5'UTR|CBFB_ENST00000412916.2_Splice_Site_p.A56G	NM_001755.2|NM_022845.2	NP_001746.1|NP_074036.1	Q13951	PEBB_HUMAN	core-binding factor, beta subunit	56					cell maturation (GO:0048469)|definitive hemopoiesis (GO:0060216)|lymphocyte differentiation (GO:0030098)|myeloid cell differentiation (GO:0030099)|osteoblast differentiation (GO:0001649)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(3)|large_intestine(1)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00189)|Epithelial(162;0.00755)|all cancers(182;0.066)		TTCTAAAAGGCTTTTGTGGCC	0.423			T	MYH11	AML																																	dbGAP		Dom	yes		16	16q22	865	"""core-binding factor, beta subunit"""		L	0													82.0	83.0	83.0					16																	67070543		2200	4300	6500	-	-	-	SO:0001630	splice_region_variant	0			BC018509	CCDS10827.1, CCDS45508.1	16q22.1	2008-02-05			ENSG00000067955	ENSG00000067955			1539	protein-coding gene	gene with protein product		121360				8351518, 7587111	Standard	NM_001755		Approved	PEBP2B	uc002erb.3	Q13951	OTTHUMG00000137520	ENST00000290858.6:c.166-1C>G	16.37:g.67070543C>G			A8K347|Q13124|Q9HCT2	Missense_Mutation	SNP	pfam_CBF_beta,superfamily_CBF_beta	p.A56G	ENST00000290858.6	37	c.167	CCDS10827.1	16	.	.	.	.	.	.	.	.	.	.	C	24.5	4.543854	0.86022	.	.	ENSG00000067955	ENST00000290858;ENST00000412916	.	.	.	5.05	5.05	0.67936	.	0.051264	0.85682	D	0.000000	T	0.79034	0.4378	M	0.73217	2.22	0.80722	D	1	P;P	0.48589	0.892;0.912	D;D	0.72338	0.974;0.977	T	0.80819	-0.1212	9	0.72032	D	0.01	-5.8675	17.3257	0.87246	0.0:1.0:0.0:0.0	.	56;56	Q13951-2;Q13951	.;PEBB_HUMAN	G	56	.	ENSP00000290858:A56G	A	+	2	0	CBFB	65628044	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.257000	0.78362	2.498000	0.84270	0.561000	0.74099	GCT	CBFB	-	pfam_CBF_beta,superfamily_CBF_beta	ENSG00000067955		0.423	CBFB-001	KNOWN	basic|CCDS	protein_coding	CBFB	HGNC	protein_coding	OTTHUMT00000268843.2	98	0.00	0	C	NM_001755	Missense_Mutation	67070543	67070543	+1	no_errors	ENST00000290858	ensembl	human	known	69_37n	missense	42	61.40	70	SNP	1.000	G
CBX2	84733	genome.wustl.edu	37	17	77755934	77755934	+	Intron	SNP	G	G	A			TCGA-E2-A1L9-01A-11D-A13L-09	TCGA-E2-A1L9-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a50cd2b2-913d-41bf-94ad-45464547b348	893c62e3-94ee-49f2-a0e1-64eed978c722	g.chr17:77755934G>A	ENST00000310942.4	+	4	392				CBX2_ENST00000269399.5_Missense_Mutation_p.A208T	NM_005189.2	NP_005180.1	Q14781	CBX2_HUMAN	chromobox homolog 2						cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|development of primary sexual characteristics (GO:0045137)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|upper_aerodigestive_tract(1)	16			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			GGAACAGGAAGCATGCGTACA	0.587																																						dbGAP											0													29.0	32.0	31.0					17																	77755934		2198	4281	6479	-	-	-	SO:0001627	intron_variant	0			BC004252, BG354579	CCDS11764.1, CCDS32757.1	17q25.3	2010-07-06	2010-06-24		ENSG00000173894	ENSG00000173894			1552	protein-coding gene	gene with protein product	"""Pc class homolog (Drosophila)"""	602770	"""chromobox homolog 2 (Drosophila Pc class)"", ""cell division cycle associated 6"""	CDCA6		7782071, 2477932	Standard	NM_005189		Approved	MGC10561	uc002jxc.3	Q14781		ENST00000310942.4:c.288+334G>A	17.37:g.77755934G>A			Q0VDA5|Q9BTB1	Missense_Mutation	SNP	pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,pfscan_Chromo_domain/shadow,prints_Chromo_dom_subgr	p.A208T	ENST00000310942.4	37	c.622	CCDS32757.1	17	.	.	.	.	.	.	.	.	.	.	G	6.825	0.521459	0.13005	.	.	ENSG00000173894	ENST00000269399	.	.	.	3.05	0.925	0.19424	.	.	.	.	.	T	0.18964	0.0455	.	.	.	0.09310	N	1	B	0.22909	0.077	B	0.20767	0.031	T	0.24941	-1.0146	6	.	.	.	.	4.2287	0.10592	0.1332:0.0:0.642:0.2247	.	208	Q14781-2	.	T	208	.	.	A	+	1	0	CBX2	75370529	0.009000	0.17119	0.001000	0.08648	0.005000	0.04900	-0.005000	0.12855	0.104000	0.17725	-0.268000	0.10319	GCA	CBX2	-	NULL	ENSG00000173894		0.587	CBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBX2	HGNC	protein_coding	OTTHUMT00000437040.1	18	0.00	0	G	NM_032647		77755934	77755934	+1	no_errors	ENST00000269399	ensembl	human	known	69_37n	missense	10	33.33	5	SNP	0.001	A
CD1C	911	genome.wustl.edu	37	1	158261046	158261046	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A1L9-01A-11D-A13L-09	TCGA-E2-A1L9-10A-01D-A188-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a50cd2b2-913d-41bf-94ad-45464547b348	893c62e3-94ee-49f2-a0e1-64eed978c722	g.chr1:158261046T>C	ENST00000368170.3	+	2	463	c.184T>C	c.(184-186)Tca>Cca	p.S62P		NM_001765.2	NP_001756.2	P29017	CD1C_HUMAN	CD1c molecule	62					antigen processing and presentation (GO:0019882)|T cell activation involved in immune response (GO:0002286)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	endogenous lipid antigen binding (GO:0030883)|exogenous lipid antigen binding (GO:0030884)|glycolipid binding (GO:0051861)|lipopeptide binding (GO:0071723)			NS(1)|endometrium(3)|large_intestine(4)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	39	all_hematologic(112;0.0378)					GGACAGTGAATCAGGCACAAT	0.473																																						dbGAP											0													119.0	106.0	111.0					1																	158261046		2203	4300	6503	-	-	-	SO:0001583	missense	0			M28827	CCDS1175.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158481	ENSG00000158481		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1636	protein-coding gene	gene with protein product		188340	"""CD1C antigen, c polypeptide"", ""CD1c antigen"""	CD1		2447586	Standard	NM_001765		Approved		uc001fru.3	P29017	OTTHUMG00000017514	ENST00000368170.3:c.184T>C	1.37:g.158261046T>C	ENSP00000357152:p.Ser62Pro		Q5TDJ7|Q6IAS4|Q9UMM0|Q9UN96	Missense_Mutation	SNP	pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like	p.S62P	ENST00000368170.3	37	c.184	CCDS1175.1	1	.	.	.	.	.	.	.	.	.	.	-	9.667	1.145668	0.21288	.	.	ENSG00000158481	ENST00000368169;ENST00000368170	T	0.16597	2.33	3.08	-2.29	0.06805	MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	0.345019	0.16668	N	0.204485	T	0.06280	0.0162	M	0.79926	2.475	0.09310	N	1	B	0.19935	0.04	B	0.15052	0.012	T	0.28073	-1.0055	10	0.59425	D	0.04	.	2.2886	0.04133	0.3887:0.2432:0.0:0.3681	.	62	P29017	CD1C_HUMAN	P	62	ENSP00000357152:S62P	ENSP00000357151:S62P	S	+	1	0	CD1C	156527670	0.000000	0.05858	0.000000	0.03702	0.099000	0.18886	-1.466000	0.02355	-0.491000	0.06697	-0.256000	0.11100	TCA	CD1C	-	superfamily_MHC_I/II-like_Ag-recog	ENSG00000158481		0.473	CD1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD1C	HGNC	protein_coding	OTTHUMT00000046351.2	79	0.00	0	T	NM_001765		158261046	158261046	+1	no_errors	ENST00000368170	ensembl	human	known	69_37n	missense	84	23.42	26	SNP	0.000	C
CXorf36	79742	genome.wustl.edu	37	X	45011033	45011033	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1L9-01A-11D-A13L-09	TCGA-E2-A1L9-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a50cd2b2-913d-41bf-94ad-45464547b348	893c62e3-94ee-49f2-a0e1-64eed978c722	g.chrX:45011033C>T	ENST00000398000.2	-	5	1240	c.1166G>A	c.(1165-1167)tGt>tAt	p.C389Y	CXorf36_ENST00000477281.1_5'UTR	NM_176819.3	NP_789789.2	Q9H7Y0	DIA1R_HUMAN	chromosome X open reading frame 36	389						extracellular region (GO:0005576)				endometrium(1)|large_intestine(2)|lung(4)	7						GCTGTCCCCACACTGAACAAG	0.582																																						dbGAP											0													57.0	51.0	53.0					X																	45011033		1568	3582	5150	-	-	-	SO:0001583	missense	0			AF289581	CCDS14266.1, CCDS48096.1	Xp11.3-p11.23	2012-08-03			ENSG00000147113	ENSG00000147113			25866	protein-coding gene	gene with protein product						11944989, 21283809	Standard	NM_176819		Approved	FLJ14103, DIA1R	uc004dgg.2	Q9H7Y0	OTTHUMG00000021403	ENST00000398000.2:c.1166G>A	X.37:g.45011033C>T	ENSP00000381086:p.Cys389Tyr		A8MUU5|B2RPN7|Q6UWJ5	Missense_Mutation	SNP	NULL	p.C389Y	ENST00000398000.2	37	c.1166	CCDS48096.1	X	.	.	.	.	.	.	.	.	.	.	C	14.01	2.407878	0.42715	.	.	ENSG00000147113	ENST00000398000	T	0.59772	0.24	5.17	5.17	0.71159	.	0.000000	0.64402	D	0.000003	T	0.76716	0.4026	M	0.79475	2.455	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.80450	-0.1377	10	0.87932	D	0	.	16.0126	0.80413	0.0:1.0:0.0:0.0	.	389	Q9H7Y0	CX036_HUMAN	Y	389	ENSP00000381086:C389Y	ENSP00000381086:C389Y	C	-	2	0	CXorf36	44895977	1.000000	0.71417	0.078000	0.20375	0.036000	0.12997	5.360000	0.66086	2.145000	0.66743	0.594000	0.82650	TGT	CXorf36	-	NULL	ENSG00000147113		0.582	CXorf36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf36	HGNC	protein_coding	OTTHUMT00000056333.2	102	0.00	0	C	NM_024689		45011033	45011033	-1	no_errors	ENST00000398000	ensembl	human	known	69_37n	missense	42	35.38	23	SNP	0.966	T
DSPP	1834	genome.wustl.edu	37	4	88534248	88534248	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A1L9-01A-11D-A13L-09	TCGA-E2-A1L9-10A-01D-A188-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a50cd2b2-913d-41bf-94ad-45464547b348	893c62e3-94ee-49f2-a0e1-64eed978c722	g.chr4:88534248T>A	ENST00000282478.7	+	3	943	c.910T>A	c.(910-912)Tat>Aat	p.Y304N	DSPP_ENST00000399271.1_Missense_Mutation_p.Y304N|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	304					biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		TAGTAAAGAATATTATGACCC	0.423																																						dbGAP											0													74.0	78.0	76.0					4																	88534248		1913	4109	6022	-	-	-	SO:0001583	missense	0			AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.910T>A	4.37:g.88534248T>A	ENSP00000282478:p.Tyr304Asn		A8MUI0|O95815	Missense_Mutation	SNP	NULL	p.Y304N	ENST00000282478.7	37	c.910	CCDS43248.1	4	.	.	.	.	.	.	.	.	.	.	T	8.073	0.770592	0.15983	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.86627	-2.15;-2.15	4.54	1.9	0.25705	.	.	.	.	.	T	0.71978	0.3404	N	0.08118	0	0.20563	N	0.999882	B	0.02656	0.0	B	0.08055	0.003	T	0.59941	-0.7359	9	0.46703	T	0.11	-0.0337	6.1961	0.20550	0.1656:0.0:0.6832:0.1513	.	304	Q9NZW4	DSPP_HUMAN	N	304	ENSP00000382213:Y304N;ENSP00000282478:Y304N	ENSP00000282478:Y304N	Y	+	1	0	DSPP	88753272	0.940000	0.31905	0.328000	0.25416	0.022000	0.10575	1.261000	0.32980	0.189000	0.20188	-0.254000	0.11334	TAT	DSPP	-	NULL	ENSG00000152591		0.423	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DSPP	HGNC	protein_coding	OTTHUMT00000363616.3	61	0.00	0	T	NM_014208		88534248	88534248	+1	no_errors	ENST00000282478	ensembl	human	known	69_37n	missense	33	26.67	12	SNP	0.769	A
E2F7	144455	genome.wustl.edu	37	12	77439990	77439990	+	Silent	SNP	C	C	T			TCGA-E2-A1L9-01A-11D-A13L-09	TCGA-E2-A1L9-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a50cd2b2-913d-41bf-94ad-45464547b348	893c62e3-94ee-49f2-a0e1-64eed978c722	g.chr12:77439990C>T	ENST00000322886.7	-	5	892	c.657G>A	c.(655-657)ctG>ctA	p.L219L	E2F7_ENST00000416496.2_Silent_p.L219L	NM_203394.2	NP_976328.2	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	219					chorionic trophoblast cell differentiation (GO:0060718)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|hepatocyte differentiation (GO:0070365)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokinesis (GO:0032466)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(15)|lung(14)|ovary(3)|upper_aerodigestive_tract(2)	42						GGAGGTTCCTCAGGGTTTTTG	0.488																																						dbGAP											0													138.0	131.0	133.0					12																	77439990		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC016658	CCDS9016.1	12q21.1	2008-02-05				ENSG00000165891			23820	protein-coding gene	gene with protein product		612046				12893818	Standard	NM_203394		Approved		uc001sym.4	Q96AV8	OTTHUMG00000169969	ENST00000322886.7:c.657G>A	12.37:g.77439990C>T			A6NC74|B2RMR7|B3KTZ5|B3KUP8|B5MED9	Silent	SNP	pfam_E2F_TDP	p.L219	ENST00000322886.7	37	c.657	CCDS9016.1	12																																																																																			E2F7	-	NULL	ENSG00000165891		0.488	E2F7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	E2F7	HGNC	protein_coding	OTTHUMT00000406716.1	131	0.00	0	C	XM_084871		77439990	77439990	-1	no_errors	ENST00000322886	ensembl	human	known	69_37n	silent	63	44.74	51	SNP	0.120	T
ELP6	54859	genome.wustl.edu	37	3	47545880	47545880	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A1L9-01A-11D-A13L-09	TCGA-E2-A1L9-10A-01D-A188-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a50cd2b2-913d-41bf-94ad-45464547b348	893c62e3-94ee-49f2-a0e1-64eed978c722	g.chr3:47545880T>C	ENST00000296149.4	-	4	433	c.263A>G	c.(262-264)aAg>aGg	p.K88R	ELP6_ENST00000446787.1_Missense_Mutation_p.K15R|ELP6_ENST00000439305.1_Missense_Mutation_p.K15R	NM_001031703.2	NP_001026873.2	Q0PNE2	ELP6_HUMAN	elongator acetyltransferase complex subunit 6	88					chromatin organization (GO:0006325)|positive regulation of cell migration (GO:0030335)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Elongator holoenzyme complex (GO:0033588)											CACTGCAGACTTGAGTCCCTC	0.572																																						dbGAP											0													66.0	71.0	69.0					3																	47545880		2032	4180	6212	-	-	-	SO:0001583	missense	0			AK000218	CCDS43082.1	3p21.31	2012-08-14	2012-08-08	2012-08-08	ENSG00000163832	ENSG00000163832		"""Elongator acetyltransferase complex subunits"""	25976	protein-coding gene	gene with protein product		615020	"""transmembrane protein 103"", ""chromosome 3 open reading frame 75"""	TMEM103, C3orf75		22854966	Standard	XM_005265241		Approved	FLJ20211	uc003crk.3	Q0PNE2	OTTHUMG00000133521	ENST00000296149.4:c.263A>G	3.37:g.47545880T>C	ENSP00000296149:p.Lys88Arg		Q9BW57|Q9NXJ3	Missense_Mutation	SNP	pfam_UPF0405	p.K88R	ENST00000296149.4	37	c.263	CCDS43082.1	3	.	.	.	.	.	.	.	.	.	.	T	11.22	1.573280	0.28092	.	.	ENSG00000163832	ENST00000296149;ENST00000450051;ENST00000446787;ENST00000439305;ENST00000412761;ENST00000444760;ENST00000425291;ENST00000449409;ENST00000414236	.	.	.	6.06	3.68	0.42216	.	0.183930	0.64402	N	0.000020	T	0.46639	0.1403	L	0.47716	1.5	0.40016	D	0.975346	B;B;B	0.23650	0.032;0.089;0.067	B;B;B	0.26969	0.042;0.075;0.058	T	0.29792	-1.0000	9	0.25751	T	0.34	0.4962	7.44	0.27176	0.0:0.2386:0.0:0.7614	.	64;88;88	B4DP60;C9JAS1;Q0PNE2	.;.;CC075_HUMAN	R	88;64;15;15;15;15;15;15;15	.	ENSP00000296149:K88R	K	-	2	0	C3orf75	47520884	1.000000	0.71417	0.997000	0.53966	0.059000	0.15707	1.640000	0.37186	0.535000	0.28714	0.533000	0.62120	AAG	ELP6	-	pfam_UPF0405	ENSG00000163832		0.572	ELP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELP6	HGNC	protein_coding	OTTHUMT00000257493.1	52	0.00	0	T	NM_017713		47545880	47545880	-1	no_errors	ENST00000296149	ensembl	human	known	69_37n	missense	19	29.63	8	SNP	1.000	C
GATA3	2625	genome.wustl.edu	37	10	8115705	8115706	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-E2-A1L9-01A-11D-A13L-09	TCGA-E2-A1L9-10A-01D-A188-09	AA	AA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a50cd2b2-913d-41bf-94ad-45464547b348	893c62e3-94ee-49f2-a0e1-64eed978c722	g.chr10:8115705_8115706delAA	ENST00000346208.3	+	6	1506_1507	c.1051_1052delAA	c.(1051-1053)aacfs	p.N351fs	GATA3_ENST00000379328.3_Frame_Shift_Del_p.N352fs|GATA3_ENST00000461472.1_3'UTR			P23771	GATA3_HUMAN	GATA binding protein 3	351					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.?(3)		NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						TGTTTAGATTAACAGACCCCTG	0.416			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																															dbGAP		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	3	Unknown(3)	breast(3)																																								-	-	-	SO:0001589	frameshift_variant	0			X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.1051_1052delAA	10.37:g.8115705_8115706delAA	ENSP00000341619:p.Asn351fs		Q5VWG7|Q5VWG8|Q96J16	Frame_Shift_Del	DEL	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	p.N352fs	ENST00000346208.3	37	c.1054_1055	CCDS7083.1	10																																																																																			GATA3	-	smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA	ENSG00000107485		0.416	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA3	HGNC	protein_coding	OTTHUMT00000046719.1	39	0.00	0	AA	NM_001002295		8115705	8115706	+1	no_errors	ENST00000379328	ensembl	human	known	69_37n	frame_shift_del	28	24.32	9	DEL	1.000:1.000	-
GRM8	2918	genome.wustl.edu	37	7	126173165	126173165	+	Silent	SNP	G	G	T			TCGA-E2-A1L9-01A-11D-A13L-09	TCGA-E2-A1L9-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a50cd2b2-913d-41bf-94ad-45464547b348	893c62e3-94ee-49f2-a0e1-64eed978c722	g.chr7:126173165G>T	ENST00000339582.2	-	9	3079	c.2271C>A	c.(2269-2271)atC>atA	p.I757I	GRM8_ENST00000444921.2_Silent_p.I757I|GRM8_ENST00000358373.3_Silent_p.I757I|GRM8_ENST00000480995.1_5'UTR			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	757					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				CCATCAAGAGGATACTGTATC	0.443										HNSCC(24;0.065)																												dbGAP											0													130.0	112.0	118.0					7																	126173165		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.2271C>A	7.37:g.126173165G>T			A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_8,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_4	p.I757	ENST00000339582.2	37	c.2271	CCDS5794.1	7																																																																																			GRM8	-	pfam_GPCR_3_C,pfscan_GPCR_3_C,prints_GPCR_3	ENSG00000179603		0.443	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRM8	HGNC	protein_coding	OTTHUMT00000059209.4	124	0.00	0	G			126173165	126173165	-1	no_errors	ENST00000339582	ensembl	human	known	69_37n	silent	93	33.57	47	SNP	1.000	T
IFNA21	3452	genome.wustl.edu	37	9	21166507	21166507	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A1L9-01A-11D-A13L-09	TCGA-E2-A1L9-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a50cd2b2-913d-41bf-94ad-45464547b348	893c62e3-94ee-49f2-a0e1-64eed978c722	g.chr9:21166507C>A	ENST00000380225.1	-	1	152	c.105G>T	c.(103-105)agG>agT	p.R35S		NM_002175.2	NP_002166.2	P01568	IFN21_HUMAN	interferon, alpha 21	35					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|cytokine receptor binding (GO:0005126)|type I interferon receptor binding (GO:0005132)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|skin(3)	14				GBM - Glioblastoma multiforme(5;1.93e-187)|Lung(24;2.12e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		TCAAGGCCCTCCTATTACCCA	0.522																																						dbGAP											0													63.0	67.0	66.0					9																	21166507		2202	4281	6483	-	-	-	SO:0001583	missense	0				CCDS6497.1	9p22	2010-12-10			ENSG00000137080	ENSG00000137080		"""Interferons"""	5424	protein-coding gene	gene with protein product	"""leukocyte interferon protein"""	147584				1385305	Standard	NM_002175		Approved	IFN-alphaI	uc003zom.2	P01568	OTTHUMG00000019653	ENST00000380225.1:c.105G>T	9.37:g.21166507C>A	ENSP00000369574:p.Arg35Ser		Q14608|Q5VWD1|Q7M4Q4	Missense_Mutation	SNP	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	p.R35S	ENST00000380225.1	37	c.105	CCDS6497.1	9	.	.	.	.	.	.	.	.	.	.	N	14.70	2.613408	0.46631	.	.	ENSG00000137080	ENST00000380225	T	0.03635	3.86	4.02	-1.43	0.08884	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	1.348330	0.04465	N	0.375094	T	0.14313	0.0346	M	0.84082	2.675	0.09310	N	1	P	0.36392	0.551	P	0.51453	0.67	T	0.36601	-0.9741	10	0.72032	D	0.01	.	5.894	0.18929	0.0:0.33:0.4748:0.1952	.	35	P01568	IFN21_HUMAN	S	35	ENSP00000369574:R35S	ENSP00000369574:R35S	R	-	3	2	IFNA21	21156507	0.000000	0.05858	0.000000	0.03702	0.056000	0.15407	0.335000	0.19806	-0.549000	0.06191	-0.178000	0.13098	AGG	IFNA21	-	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core	ENSG00000137080		0.522	IFNA21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNA21	HGNC	protein_coding	OTTHUMT00000051882.1	134	0.00	0	C	NM_002175		21166507	21166507	-1	no_errors	ENST00000380225	ensembl	human	known	69_37n	missense	108	15.62	20	SNP	0.000	A
KMT2C	58508	genome.wustl.edu	37	7	151932951	151932952	+	Frame_Shift_Ins	INS	-	-	GG			TCGA-E2-A1L9-01A-11D-A13L-09	TCGA-E2-A1L9-10A-01D-A188-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a50cd2b2-913d-41bf-94ad-45464547b348	893c62e3-94ee-49f2-a0e1-64eed978c722	g.chr7:151932951_151932952insGG	ENST00000262189.6	-	16	2937_2938	c.2719_2720insCC	c.(2719-2721)cgafs	p.R907fs	KMT2C_ENST00000355193.2_Frame_Shift_Ins_p.R907fs	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	907					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TGACCTGCCTCGGCCACCTCGC	0.485																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.2718_2719dupCC	7.37:g.151932952_151932953dupGG	ENSP00000262189:p.Arg907fs		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Frame_Shift_Ins	INS	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.R907fs	ENST00000262189.6	37	c.2720_2719	CCDS5931.1	7																																																																																			MLL3	-	NULL	ENSG00000055609		0.485	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL3	HGNC	protein_coding	OTTHUMT00000318887.3	78	0.00	0	-			151932951	151932952	-1	no_errors	ENST00000355193	ensembl	human	known	69_37n	frame_shift_ins	82	17.17	17	INS	1.000:0.998	GG
KMT2C	58508	genome.wustl.edu	37	7	152012230	152012230	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E2-A1L9-01A-11D-A13L-09	TCGA-E2-A1L9-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a50cd2b2-913d-41bf-94ad-45464547b348	893c62e3-94ee-49f2-a0e1-64eed978c722	g.chr7:152012230G>A	ENST00000262189.6	-	4	801	c.583C>T	c.(583-585)Cag>Tag	p.Q195*	KMT2C_ENST00000355193.2_Nonsense_Mutation_p.Q195*	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	195					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TACTTTCTCTGTCCTCTTTGT	0.338																																						dbGAP											0													218.0	186.0	197.0					7																	152012230		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.583C>T	7.37:g.152012230G>A	ENSP00000262189:p.Gln195*		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Nonsense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.Q195*	ENST00000262189.6	37	c.583	CCDS5931.1	7	.	.	.	.	.	.	.	.	.	.	G	37	6.249618	0.97412	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	.	.	.	5.78	5.78	0.91487	.	0.000000	0.42821	D	0.000647	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	.	20.0137	0.97470	0.0:0.0:1.0:0.0	.	.	.	.	X	195	.	ENSP00000262189:Q195X	Q	-	1	0	MLL3	151643163	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.980000	0.56895	2.734000	0.93682	0.563000	0.77884	CAG	MLL3	-	NULL	ENSG00000055609		0.338	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL3	HGNC	protein_coding	OTTHUMT00000318887.3	186	0.00	0	G			152012230	152012230	-1	no_errors	ENST00000355193	ensembl	human	known	69_37n	nonsense	134	16.25	26	SNP	1.000	A
SEMA3G	56920	genome.wustl.edu	37	3	52469820	52469820	+	Silent	SNP	G	G	A			TCGA-E2-A1L9-01A-11D-A13L-09	TCGA-E2-A1L9-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a50cd2b2-913d-41bf-94ad-45464547b348	893c62e3-94ee-49f2-a0e1-64eed978c722	g.chr3:52469820G>A	ENST00000231721.2	-	16	2147	c.2148C>T	c.(2146-2148)ttC>ttT	p.F716F		NM_020163.1	NP_064548.1	Q9NS98	SEM3G_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G	716					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	receptor activity (GO:0004872)			kidney(1)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)	18				BRCA - Breast invasive adenocarcinoma(193;1.69e-05)|Kidney(197;0.00173)|KIRC - Kidney renal clear cell carcinoma(197;0.00196)|OV - Ovarian serous cystadenocarcinoma(275;0.0333)		GCAGGTTGGCGAAGCCAATGA	0.677																																						dbGAP											0													64.0	71.0	69.0					3																	52469820		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2856.1	3p21.1	2013-01-11			ENSG00000010319	ENSG00000010319		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30400	protein-coding gene	gene with protein product						11214971	Standard	XM_005265327		Approved	FLJ00014, sem2	uc003dea.1	Q9NS98	OTTHUMG00000158570	ENST00000231721.2:c.2148C>T	3.37:g.52469820G>A			Q7L9D9|Q9H7Q3	Silent	SNP	pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,pfscan_Semaphorin/CD100_Ag,pfscan_Ig-like	p.F716	ENST00000231721.2	37	c.2148	CCDS2856.1	3																																																																																			SEMA3G	-	NULL	ENSG00000010319		0.677	SEMA3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3G	HGNC	protein_coding	OTTHUMT00000351354.1	72	0.00	0	G	NM_020163		52469820	52469820	-1	no_errors	ENST00000231721	ensembl	human	known	69_37n	silent	33	28.26	13	SNP	0.001	A
SLC1A6	6511	genome.wustl.edu	37	19	15079170	15079170	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1L9-01A-11D-A13L-09	TCGA-E2-A1L9-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a50cd2b2-913d-41bf-94ad-45464547b348	893c62e3-94ee-49f2-a0e1-64eed978c722	g.chr19:15079170G>A	ENST00000221742.3	-	3	500	c.493C>T	c.(493-495)Cgg>Tgg	p.R165W	SLC1A6_ENST00000544886.2_Missense_Mutation_p.R165W|SLC1A6_ENST00000430939.2_Intron|SLC1A6_ENST00000598504.1_Missense_Mutation_p.R165W|SLC1A6_ENST00000600144.1_Missense_Mutation_p.R165W	NM_005071.1	NP_005062.1	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6	165					aspartate transport (GO:0015810)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(8)|liver(1)|lung(12)|ovary(3)|pancreas(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42						CGGCCCTCCCGGTGCAGCCCC	0.542																																						dbGAP											0													75.0	56.0	62.0					19																	15079170		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12321.1, CCDS62578.1	19p13.12	2013-07-15			ENSG00000105143	ENSG00000105143		"""Solute carriers"""	10944	protein-coding gene	gene with protein product		600637				7791878	Standard	NM_005071		Approved	EAAT4	uc002naa.2	P48664	OTTHUMG00000183351	ENST00000221742.3:c.493C>T	19.37:g.15079170G>A	ENSP00000221742:p.Arg165Trp		Q8N753	Missense_Mutation	SNP	pfam_Na-dicarboxylate_symporter,prints_Na-dicarboxylate_symporter	p.R165W	ENST00000221742.3	37	c.493	CCDS12321.1	19	.	.	.	.	.	.	.	.	.	.	g	12.62	1.993425	0.35131	.	.	ENSG00000105143	ENST00000221742;ENST00000544886;ENST00000542610	T;T	0.59638	0.25;0.25	4.3	3.25	0.37280	.	0.732205	0.13270	N	0.400584	T	0.57666	0.2069	M	0.74647	2.275	0.31886	N	0.617805	B;B;B	0.29590	0.105;0.25;0.167	B;B;B	0.28139	0.051;0.086;0.053	T	0.65348	-0.6190	10	0.72032	D	0.01	-2.333	11.2796	0.49186	0.0:0.0:0.8164:0.1836	.	165;166;165	Q8N753;Q59GB0;P48664	.;.;EAA4_HUMAN	W	165;165;166	ENSP00000221742:R165W;ENSP00000446175:R165W	ENSP00000221742:R165W	R	-	1	2	SLC1A6	14940170	0.987000	0.35691	0.940000	0.37924	0.923000	0.55619	3.037000	0.49775	1.009000	0.39289	0.457000	0.33378	CGG	SLC1A6	-	pfam_Na-dicarboxylate_symporter	ENSG00000105143		0.542	SLC1A6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC1A6	HGNC	protein_coding	OTTHUMT00000466283.1	65	0.00	0	G	NM_005071		15079170	15079170	-1	no_errors	ENST00000221742	ensembl	human	known	69_37n	missense	59	28.05	23	SNP	0.761	A
SLC25A13	10165	genome.wustl.edu	37	7	95761189	95761189	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1L9-01A-11D-A13L-09	TCGA-E2-A1L9-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a50cd2b2-913d-41bf-94ad-45464547b348	893c62e3-94ee-49f2-a0e1-64eed978c722	g.chr7:95761189G>A	ENST00000265631.5	-	15	1593	c.1457C>T	c.(1456-1458)gCc>gTc	p.A486V	SLC25A13_ENST00000542654.1_Missense_Mutation_p.A378V|SLC25A13_ENST00000416240.2_Missense_Mutation_p.A487V			Q9UJS0	CMC2_HUMAN	solute carrier family 25 (aspartate/glutamate carrier), member 13	486					aspartate transport (GO:0015810)|ATP biosynthetic process (GO:0006754)|carbohydrate metabolic process (GO:0005975)|cellular respiration (GO:0045333)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|L-glutamate transport (GO:0015813)|malate-aspartate shuttle (GO:0043490)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|transporter activity (GO:0005215)			breast(4)|central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(8)|liver(2)|lung(14)|prostate(1)|skin(4)	42	all_cancers(62;7.75e-08)|all_epithelial(64;1.16e-07)		STAD - Stomach adenocarcinoma(171;0.194)		L-Aspartic Acid(DB00128)	GCATGCTTTGGCACCCTGCAC	0.458																																						dbGAP											0													81.0	76.0	77.0					7																	95761189		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF118838	CCDS5645.1, CCDS55130.1	7q21.3	2013-05-22	2012-03-29		ENSG00000004864	ENSG00000004864		"""Solute carriers"", ""EF-hand domain containing"""	10983	protein-coding gene	gene with protein product	"""mitochondrial aspartate glutamate carrier 2"""	603859	"""solute carrier family 25, member 13 (citrin)"""	CTLN2		10369257	Standard	NM_014251		Approved	CITRIN, ARALAR2	uc003uog.4	Q9UJS0	OTTHUMG00000023074	ENST00000265631.5:c.1457C>T	7.37:g.95761189G>A	ENSP00000265631:p.Ala486Val		O14566|O14575|Q546F9|Q9NZW1|Q9UNI7	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,prints_Mit_carrier,pfscan_EF_HAND_2,pfscan_Mitochondrial_sb/sol_carrier	p.A487V	ENST00000265631.5	37	c.1460	CCDS5645.1	7	.	.	.	.	.	.	.	.	.	.	G	32	5.119120	0.94385	.	.	ENSG00000004864	ENST00000265631;ENST00000416240;ENST00000542654	T;T;T	0.77489	-1.1;-1.1;-1.1	4.65	4.65	0.58169	Mitochondrial carrier domain (2);	0.063440	0.64402	D	0.000009	D	0.85656	0.5747	M	0.62266	1.93	0.80722	D	1	D;D;D	0.63046	0.981;0.992;0.992	P;D;D	0.65233	0.89;0.933;0.933	D	0.85907	0.1438	10	0.49607	T	0.09	-14.156	18.1095	0.89530	0.0:0.0:1.0:0.0	.	378;487;486	F5GX33;Q546F9;Q9UJS0	.;.;CMC2_HUMAN	V	486;487;378	ENSP00000265631:A486V;ENSP00000400101:A487V;ENSP00000440484:A378V	ENSP00000265631:A486V	A	-	2	0	SLC25A13	95599125	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.657000	0.98554	2.599000	0.87857	0.655000	0.94253	GCC	SLC25A13	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,prints_Mit_carrier,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000004864		0.458	SLC25A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A13	HGNC	protein_coding	OTTHUMT00000059395.2	49	0.00	0	G	NM_014251		95761189	95761189	-1	no_errors	ENST00000416240	ensembl	human	known	69_37n	missense	30	18.92	7	SNP	1.000	A
SLC40A1	30061	genome.wustl.edu	37	2	190428522	190428522	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A1L9-01A-11D-A13L-09	TCGA-E2-A1L9-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a50cd2b2-913d-41bf-94ad-45464547b348	893c62e3-94ee-49f2-a0e1-64eed978c722	g.chr2:190428522G>T	ENST00000261024.2	-	7	1616	c.1190C>A	c.(1189-1191)cCc>cAc	p.P397H		NM_014585.5	NP_055400.1	Q9NP59	S40A1_HUMAN	solute carrier family 40 (iron-regulated transporter), member 1	397					anatomical structure morphogenesis (GO:0009653)|cellular iron ion homeostasis (GO:0006879)|endothelium development (GO:0003158)|iron ion transmembrane transport (GO:0034755)|lymphocyte homeostasis (GO:0002260)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of apoptotic process (GO:0043066)|regulation of transcription from RNA polymerase II promoter in response to iron (GO:0034395)|spleen trabecula formation (GO:0060345)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	iron ion transmembrane transporter activity (GO:0005381)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(117;0.000917)|Epithelial(96;0.014)|all cancers(119;0.0491)			CAAGTCCAGGGGGCTTCCAGG	0.438																																						dbGAP											0													78.0	75.0	76.0					2																	190428522		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF215636	CCDS2299.1	2q32	2014-09-17	2003-06-04	2003-06-05	ENSG00000138449	ENSG00000138449		"""Solute carriers"""	10909	protein-coding gene	gene with protein product	"""ferroportin 1"""	604653	"""solute carrier family 11 (proton-coupled divalent metal ion transporters), member 3"""	SLC11A3		10828623	Standard	NM_014585		Approved	MTP1, IREG1, FPN1, HFE4	uc002uqp.4	Q9NP59	OTTHUMG00000132662	ENST00000261024.2:c.1190C>A	2.37:g.190428522G>T	ENSP00000261024:p.Pro397His		Q6FI62|Q7Z4F8|Q8IVB2|Q9NRL0	Missense_Mutation	SNP	pfam_Ferroportin-1,superfamily_MFS_dom_general_subst_transpt	p.P397H	ENST00000261024.2	37	c.1190	CCDS2299.1	2	.	.	.	.	.	.	.	.	.	.	G	25.1	4.602907	0.87157	.	.	ENSG00000138449	ENST00000261024;ENST00000544056	D	0.81739	-1.53	6.02	6.02	0.97574	Major facilitator superfamily domain, general substrate transporter (1);	0.142231	0.64402	D	0.000003	D	0.90338	0.6977	M	0.76838	2.35	0.58432	D	0.999999	D	0.76494	0.999	D	0.74348	0.983	D	0.89891	0.4037	10	0.62326	D	0.03	-28.3705	20.5373	0.99239	0.0:0.0:1.0:0.0	.	397	Q9NP59	S40A1_HUMAN	H	397;132	ENSP00000261024:P397H	ENSP00000261024:P397H	P	-	2	0	SLC40A1	190136767	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.992000	0.88273	2.857000	0.98124	0.650000	0.86243	CCC	SLC40A1	-	pfam_Ferroportin-1,superfamily_MFS_dom_general_subst_transpt	ENSG00000138449		0.438	SLC40A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC40A1	HGNC	protein_coding	OTTHUMT00000255916.2	58	0.00	0	G			190428522	190428522	-1	no_errors	ENST00000261024	ensembl	human	known	69_37n	missense	48	27.27	18	SNP	1.000	T
SYNCRIP	10492	genome.wustl.edu	37	6	86332254	86332254	+	Silent	SNP	T	T	C			TCGA-E2-A1L9-01A-11D-A13L-09	TCGA-E2-A1L9-10A-01D-A188-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a50cd2b2-913d-41bf-94ad-45464547b348	893c62e3-94ee-49f2-a0e1-64eed978c722	g.chr6:86332254T>C	ENST00000369622.3	-	8	1454	c.954A>G	c.(952-954)ggA>ggG	p.G318G	SYNCRIP_ENST00000355238.6_Silent_p.G318G	NM_001159675.1|NM_006372.4	NP_001153147.1|NP_006363.4	O60506	HNRPQ_HUMAN	synaptotagmin binding, cytoplasmic RNA interacting protein	318	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular response to interferon-gamma (GO:0071346)|CRD-mediated mRNA stabilization (GO:0070934)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of translation (GO:0017148)|osteoblast differentiation (GO:0001649)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|CRD-mediated mRNA stability complex (GO:0070937)|endoplasmic reticulum (GO:0005783)|GAIT complex (GO:0097452)|histone pre-mRNA 3'end processing complex (GO:0071204)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(10)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	33		all_cancers(76;0.000137)|Acute lymphoblastic leukemia(125;3.66e-08)|Prostate(29;8.2e-07)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0297)		BRCA - Breast invasive adenocarcinoma(108;0.0389)		ATTCAACAGTTCCAACATTCC	0.413																																						dbGAP											0													245.0	241.0	242.0					6																	86332254		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF037448	CCDS5005.1, CCDS55041.1, CCDS75491.1	6q14-q15	2013-05-23			ENSG00000135316	ENSG00000135316		"""RNA binding motif (RRM) containing"""	16918	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein Q"""					9847309, 11352648	Standard	NM_006372		Approved	NSAP1, GRY-RBP, dJ3J17.2, HNRPQ1, hnRNP-Q, HNRNPQ	uc003pla.2	O60506	OTTHUMG00000015141	ENST00000369622.3:c.954A>G	6.37:g.86332254T>C			E1P501|E1P502|Q53H05|Q5TCG2|Q5TCG3|Q8IW78|Q8N599|Q96LC1|Q96LC2|Q9Y583	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP_R/Q_splicing_fac	p.G318	ENST00000369622.3	37	c.954	CCDS5005.1	6																																																																																			SYNCRIP	-	smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP_R/Q_splicing_fac	ENSG00000135316		0.413	SYNCRIP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNCRIP	HGNC	protein_coding	OTTHUMT00000041396.1	220	0.45	1	T	NM_006372		86332254	86332254	-1	no_errors	ENST00000369622	ensembl	human	known	69_37n	silent	145	26.40	52	SNP	1.000	C
SYT9	143425	genome.wustl.edu	37	11	7439351	7439351	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A1L9-01A-11D-A13L-09	TCGA-E2-A1L9-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a50cd2b2-913d-41bf-94ad-45464547b348	893c62e3-94ee-49f2-a0e1-64eed978c722	g.chr11:7439351C>A	ENST00000318881.6	+	5	1566	c.1329C>A	c.(1327-1329)gaC>gaA	p.D443E		NM_175733.3	NP_783860.1	Q86SS6	SYT9_HUMAN	synaptotagmin IX	443	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|secretory granule membrane (GO:0030667)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			NS(1)|endometrium(2)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	38				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)		CAGTCATGGACTATGACCGGT	0.507																																						dbGAP											0													143.0	124.0	130.0					11																	7439351		2201	4296	6497	-	-	-	SO:0001583	missense	0			AK055003	CCDS7778.1	11p15.4	2013-01-21			ENSG00000170743	ENSG00000170743		"""Synaptotagmins"""	19265	protein-coding gene	gene with protein product		613528				11543631	Standard	NM_175733		Approved		uc001mfe.3	Q86SS6	OTTHUMG00000165499	ENST00000318881.6:c.1329C>A	11.37:g.7439351C>A	ENSP00000324419:p.Asp443Glu			Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting,prints_Synaptotagmin,prints_C2_dom	p.D443E	ENST00000318881.6	37	c.1329	CCDS7778.1	11	.	.	.	.	.	.	.	.	.	.	C	19.78	3.890763	0.72524	.	.	ENSG00000170743	ENST00000318881	T	0.80480	-1.38	5.85	1.86	0.25419	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.64402	D	0.000008	D	0.89255	0.6663	M	0.91038	3.17	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.86820	0.2004	10	0.54805	T	0.06	.	7.189	0.25814	0.0:0.5555:0.0:0.4445	.	443	Q86SS6	SYT9_HUMAN	E	443	ENSP00000324419:D443E	ENSP00000324419:D443E	D	+	3	2	SYT9	7395927	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	0.663000	0.25053	0.355000	0.24131	0.655000	0.94253	GAC	SYT9	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	ENSG00000170743		0.507	SYT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT9	HGNC	protein_coding	OTTHUMT00000384483.1	77	0.00	0	C	NM_175733		7439351	7439351	+1	no_errors	ENST00000318881	ensembl	human	known	69_37n	missense	66	28.26	26	SNP	0.998	A
XAB2	56949	genome.wustl.edu	37	19	7691056	7691056	+	Missense_Mutation	SNP	C	C	T	rs191550276	byFrequency	TCGA-E2-A1L9-01A-11D-A13L-09	TCGA-E2-A1L9-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a50cd2b2-913d-41bf-94ad-45464547b348	893c62e3-94ee-49f2-a0e1-64eed978c722	g.chr19:7691056C>T	ENST00000358368.4	-	5	660	c.623G>A	c.(622-624)cGt>cAt	p.R208H	XAB2_ENST00000534844.1_Missense_Mutation_p.R205H	NM_020196.2	NP_064581.2	Q9HCS7	SYF1_HUMAN	XPA binding protein 2	208					blastocyst development (GO:0001824)|DNA repair (GO:0006281)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|transcription, DNA-templated (GO:0006351)|transcription-coupled nucleotide-excision repair (GO:0006283)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	26						AGACACGAAACGCTCGTCGTT	0.632								Direct reversal of damage;Nucleotide excision repair (NER)					C|||	2	0.000399361	0.0	0.0014	5008	,	,		15336	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													84.0	90.0	88.0					19																	7691056		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB026111	CCDS32892.1	19p13.3	2013-08-21				ENSG00000076924			14089	protein-coding gene	gene with protein product	"""SYF1 homolog, RNA splicing factor (S. cerevisiae)"", ""SYF1 pre-mRNA-splicing factor"""	610850				10944529	Standard	NM_020196		Approved	HCNP, HCRN, SYF1, NTC90	uc002mgx.3	Q9HCS7		ENST00000358368.4:c.623G>A	19.37:g.7691056C>T	ENSP00000351137:p.Arg208His		Q8TET6|Q96HB0|Q96IW0|Q9NRG6|Q9ULP3	Missense_Mutation	SNP	smart_HAT,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R208H	ENST00000358368.4	37	c.623	CCDS32892.1	19	2	9.157509157509158E-4	0	0.0	1	0.0027624309392265192	1	0.0017482517482517483	0	0.0	C	9.145	1.014698	0.19355	.	.	ENSG00000076924	ENST00000358368;ENST00000534844	T;T	0.72394	-0.65;-0.65	4.84	3.8	0.43715	.	0.222293	0.37955	N	0.001867	T	0.56277	0.1974	L	0.29908	0.895	0.30465	N	0.773852	B	0.06786	0.001	B	0.06405	0.002	T	0.54497	-0.8285	10	0.36615	T	0.2	-25.5248	10.2415	0.43314	0.0:0.9057:0.0:0.0943	.	208	Q9HCS7	SYF1_HUMAN	H	208;205	ENSP00000351137:R208H;ENSP00000438225:R205H	ENSP00000351137:R208H	R	-	2	0	XAB2	7597056	0.993000	0.37304	0.991000	0.47740	0.021000	0.10359	0.630000	0.24553	1.033000	0.39918	0.455000	0.32223	CGT	XAB2	-	NULL	ENSG00000076924		0.632	XAB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	XAB2	HGNC	protein_coding	OTTHUMT00000461021.1	43	0.00	0	C	NM_020196		7691056	7691056	-1	no_errors	ENST00000358368	ensembl	human	known	69_37n	missense	33	21.43	9	SNP	0.999	T
