#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABL2	27	genome.wustl.edu	37	1	179086512	179086512	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr1:179086512C>G	ENST00000502732.1	-	8	1566	c.1363G>C	c.(1363-1365)Gag>Cag	p.E455Q	ABL2_ENST00000392043.3_Missense_Mutation_p.E434Q|ABL2_ENST00000504405.1_Missense_Mutation_p.E419Q|ABL2_ENST00000512653.1_Missense_Mutation_p.E440Q|ABL2_ENST00000344730.3_Missense_Mutation_p.E440Q|ABL2_ENST00000367623.4_Missense_Mutation_p.E434Q|ABL2_ENST00000511413.1_Missense_Mutation_p.E455Q|ABL2_ENST00000408940.3_Missense_Mutation_p.E419Q|ABL2_ENST00000507173.1_Missense_Mutation_p.E434Q	NM_001168236.1|NM_001168237.1|NM_001168238.1|NM_007314.3	NP_001161708.1|NP_001161709.1|NP_001161710.1|NP_009298.1	P42684	ABL2_HUMAN	ABL proto-oncogene 2, non-receptor tyrosine kinase	455	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|cellular response to retinoic acid (GO:0071300)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phospholipase C activity (GO:0010863)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)			breast(8)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	65					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	GCAAGACTCTCTGGTGCTGTC	0.383			T	ETV6	AML																																	dbGAP		Dom	yes		1	1q24-q25	27	v-abl Abelson murine leukemia viral oncogene homolog 2		L	0													151.0	148.0	149.0					1																	179086512		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14904	CCDS30947.1, CCDS41441.1, CCDS44282.1, CCDS44283.1, CCDS41441.2, CCDS53435.1, CCDS53436.1, CCDS53437.1, CCDS53438.1	1q25.2	2014-06-26	2014-06-26		ENSG00000143322	ENSG00000143322		"""SH2 domain containing"""	77	protein-coding gene	gene with protein product	"""Abelson-related gene"""	164690	"""v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene)"", ""v-abl Abelson murine leukemia viral oncogene homolog 2"", ""c-abl oncogene 2, non-receptor tyrosine kinase"""	ABLL		3787260	Standard	NM_001136001		Approved	ARG	uc001gmi.4	P42684	OTTHUMG00000035199	ENST00000502732.1:c.1363G>C	1.37:g.179086512C>G	ENSP00000427562:p.Glu455Gln		A0M8X0|B7UEF2|B7UEF3|B7UEF4|B7UEF5|Q5T0X6|Q5W0C5|Q6NZY6|Q7Z301	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_F-actin_binding,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,pfam_SH3-like_bac,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_F-actin_binding,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.E455Q	ENST00000502732.1	37	c.1363	CCDS30947.1	1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.973785	0.92919	.	.	ENSG00000143322	ENST00000502732;ENST00000408940;ENST00000344730;ENST00000512653;ENST00000504405;ENST00000367623;ENST00000507173;ENST00000511413;ENST00000392043	D;D;D;D;D;D;D;D;D	0.84370	-1.84;-1.84;-1.84;-1.84;-1.84;-1.84;-1.84;-1.84;-1.84	4.92	4.92	0.64577	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.52532	D	0.000068	D	0.94401	0.8199	M	0.93507	3.425	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D	0.87578	0.998;0.992;0.992;0.997;0.997;0.99;0.997;0.998;0.998;0.998;0.997	D	0.95789	0.8823	10	0.87932	D	0	.	17.4556	0.87606	0.0:1.0:0.0:0.0	.	434;434;455;419;419;434;419;455;440;419;440	P42684-6;P42684-7;P42684-5;P42684-4;P42684-9;P42684-8;P42684-2;P42684;P42684-3;D1MPS6;P42684-10	.;.;.;.;.;.;.;ABL2_HUMAN;.;.;.	Q	455;419;440;440;419;434;434;455;434	ENSP00000427562:E455Q;ENSP00000386152:E419Q;ENSP00000339209:E440Q;ENSP00000423578:E440Q;ENSP00000426831:E419Q;ENSP00000356595:E434Q;ENSP00000423413:E434Q;ENSP00000424697:E455Q;ENSP00000375897:E434Q	ENSP00000339209:E440Q	E	-	1	0	ABL2	177353135	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.772000	0.85439	2.417000	0.82017	0.655000	0.94253	GAG	ABL2	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	ENSG00000143322		0.383	ABL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ABL2	HGNC	protein_coding	OTTHUMT00000085174.3	130	0.00	0	C	NM_005158		179086512	179086512	-1	no_errors	ENST00000502732	ensembl	human	known	69_37n	missense	156	15.68	29	SNP	1.000	G
ABRA	137735	genome.wustl.edu	37	8	107773358	107773358	+	Silent	SNP	G	G	C			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr8:107773358G>C	ENST00000311955.3	-	2	1107	c.1053C>G	c.(1051-1053)ctC>ctG	p.L351L		NM_139166.4	NP_631905.1			actin-binding Rho activating protein											breast(1)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)	27			OV - Ovarian serous cystadenocarcinoma(57;3.83e-09)			TGGCACGCATGAGAATGCCCA	0.468																																						dbGAP											0													184.0	166.0	172.0					8																	107773358		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF503617	CCDS6305.1	8q23.1	2012-02-06			ENSG00000174429	ENSG00000174429			30655	protein-coding gene	gene with protein product	"""striated muscle activator of Rho-dependent signaling"""	609747				11983702	Standard	NM_139166		Approved	STARS	uc003ymm.4	Q8N0Z2	OTTHUMG00000164809	ENST00000311955.3:c.1053C>G	8.37:g.107773358G>C				Silent	SNP	NULL	p.L351	ENST00000311955.3	37	c.1053	CCDS6305.1	8																																																																																			ABRA	-	NULL	ENSG00000174429		0.468	ABRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABRA	HGNC	protein_coding	OTTHUMT00000380416.1	155	0.64	1	G	NM_139166		107773358	107773358	-1	no_errors	ENST00000311955	ensembl	human	known	69_37n	silent	79	28.83	32	SNP	0.596	C
ACAN	176	genome.wustl.edu	37	15	89401865	89401865	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr15:89401865G>A	ENST00000561243.1	+	11	6049	c.6049G>A	c.(6049-6051)Gaa>Aaa	p.E2017K	ACAN_ENST00000352105.7_Missense_Mutation_p.E2017K|ACAN_ENST00000439576.2_Missense_Mutation_p.E2017K|ACAN_ENST00000559004.1_Missense_Mutation_p.E2017K			P16112	PGCA_HUMAN	aggrecan	2027	CS-2.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			TGTAAGTGGAGAATCCTCTGT	0.517																																						dbGAP											0													41.0	42.0	41.0					15																	89401865		1873	4111	5984	-	-	-	SO:0001583	missense	0			M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.6049G>A	15.37:g.89401865G>A	ENSP00000453342:p.Glu2017Lys		Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_Sushi_SCR_CCP,pfam_EGF-like_dom,superfamily_C-type_lectin_fold,superfamily_Complement_control_module,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Link,smart_EGF-like,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like,prints_Link	p.E2017K	ENST00000561243.1	37	c.6049	CCDS53970.1	15	.	.	.	.	.	.	.	.	.	.	G	10.93	1.489198	0.26686	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	T;T	0.02890	4.39;4.12	5.15	5.15	0.70609	.	0.248407	0.21087	N	0.080382	T	0.10680	0.0261	M	0.67953	2.075	0.21527	N	0.999656	D;D	0.60160	0.987;0.987	P;P	0.57776	0.827;0.827	T	0.02950	-1.1090	10	0.54805	T	0.06	-5.3222	14.0782	0.64903	0.0:0.1628:0.8372:0.0	.	2017;2017	E7ENV9;E7EX88	.;.	K	2017;2017;1903	ENSP00000387356:E2017K;ENSP00000341615:E2017K	ENSP00000268134:E1903K	E	+	1	0	ACAN	87202869	0.997000	0.39634	0.026000	0.17262	0.007000	0.05969	5.007000	0.63984	2.380000	0.81148	0.655000	0.94253	GAA	ACAN	-	NULL	ENSG00000157766		0.517	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	ACAN	HGNC	protein_coding	OTTHUMT00000416267.2	22	0.00	0	G	NM_001135		89401865	89401865	+1	no_errors	ENST00000439576	ensembl	human	known	69_37n	missense	27	35.71	15	SNP	0.708	A
ADAMTSL1	92949	genome.wustl.edu	37	9	18639298	18639298	+	Silent	SNP	C	C	G			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr9:18639298C>G	ENST00000380548.4	+	7	1062	c.723C>G	c.(721-723)ctC>ctG	p.L241L	ADAMTSL1_ENST00000276935.6_Silent_p.L241L|ADAMTSL1_ENST00000380566.4_Silent_p.L241L|ADAMTSL1_ENST00000327883.7_Silent_p.L241L	NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	241						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		AAAACAGTCTCAGCTCCACAG	0.448																																						dbGAP											0													76.0	73.0	74.0					9																	18639298		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.723C>G	9.37:g.18639298C>G			A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Silent	SNP	pfam_Thrombospondin_1_rpt,pfam_ADAM_spacer1,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS,pfscan_Thrombospondin_1_rpt	p.L241	ENST00000380548.4	37	c.723	CCDS47954.1	9																																																																																			ADAMTSL1	-	pfam_ADAM_spacer1	ENSG00000178031		0.448	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	ADAMTSL1	HGNC	protein_coding	OTTHUMT00000401206.1	102	0.00	0	C			18639298	18639298	+1	no_errors	ENST00000327883	ensembl	human	known	69_37n	silent	61	14.08	10	SNP	1.000	G
ANXA1	301	genome.wustl.edu	37	9	75773624	75773624	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr9:75773624C>T	ENST00000376911.1	+	2	962	c.80C>T	c.(79-81)tCa>tTa	p.S27L	ANXA1_ENST00000257497.6_Missense_Mutation_p.S27L			P04083	ANXA1_HUMAN	annexin A1	27					alpha-beta T cell differentiation (GO:0046632)|arachidonic acid secretion (GO:0050482)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to hydrogen peroxide (GO:0070301)|endocrine pancreas development (GO:0031018)|estrous cycle phase (GO:0060206)|gliogenesis (GO:0042063)|hepatocyte differentiation (GO:0070365)|inflammatory response (GO:0006954)|insulin secretion (GO:0030073)|keratinocyte differentiation (GO:0030216)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of interleukin-8 secretion (GO:2000483)|neutrophil clearance (GO:0097350)|neutrophil homeostasis (GO:0001780)|peptide cross-linking (GO:0018149)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of neutrophil apoptotic process (GO:0033031)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of vesicle fusion (GO:0031340)|regulation of cell proliferation (GO:0042127)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to interleukin-1 (GO:0070555)|response to peptide hormone (GO:0043434)|response to X-ray (GO:0010165)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cilium (GO:0005929)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|phospholipase A2 inhibitor activity (GO:0019834)|phospholipid binding (GO:0005543)|protein binding, bridging (GO:0030674)|receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|large_intestine(1)|lung(5)	8		all_epithelial(88;2.54e-11)		OV - Ovarian serous cystadenocarcinoma(323;2.82e-06)|GBM - Glioblastoma multiforme(74;0.0325)	Amcinonide(DB00288)|Dexamethasone(DB01234)|Hydrocortisone(DB00741)	ACTGTGAAGTCATCCAAAGGT	0.383																																						dbGAP											0													64.0	64.0	64.0					9																	75773624		2203	4300	6503	-	-	-	SO:0001583	missense	0			X05908	CCDS6645.1	9q21.13	2013-02-25			ENSG00000135046	ENSG00000135046		"""Annexins"", ""Endogenous ligands"""	533	protein-coding gene	gene with protein product		151690		ANX1, LPC1		2936963	Standard	NM_000700		Approved		uc004ajf.1	P04083	OTTHUMG00000020016	ENST00000376911.1:c.80C>T	9.37:g.75773624C>T	ENSP00000366109:p.Ser27Leu			Missense_Mutation	SNP	pfam_Annexin_repeat,superfamily_Annexin,smart_Annexin_repeat,prints_Annexin,prints_AnnexinI	p.S27L	ENST00000376911.1	37	c.80	CCDS6645.1	9	.	.	.	.	.	.	.	.	.	.	C	6.926	0.540569	0.13250	.	.	ENSG00000135046	ENST00000257497;ENST00000456643;ENST00000415424;ENST00000376911	T;T;T;T	0.04862	3.54;3.54;3.54;3.54	5.24	3.39	0.38822	.	1.244550	0.05509	N	0.559792	T	0.06325	0.0163	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.51903	-0.8646	10	0.56958	D	0.05	.	17.9094	0.88929	0.0:0.7461:0.2539:0.0	.	27	P04083	ANXA1_HUMAN	L	27;38;27;27	ENSP00000257497:S27L;ENSP00000412489:S38L;ENSP00000414013:S27L;ENSP00000366109:S27L	ENSP00000257497:S27L	S	+	2	0	ANXA1	74963444	0.339000	0.24784	0.019000	0.16419	0.311000	0.27955	0.826000	0.27407	0.685000	0.31468	0.655000	0.94253	TCA	ANXA1	-	prints_AnnexinI	ENSG00000135046		0.383	ANXA1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA1	HGNC	protein_coding	OTTHUMT00000052665.1	52	0.00	0	C	NM_000700		75773624	75773624	+1	no_errors	ENST00000257497	ensembl	human	known	69_37n	missense	53	13.11	8	SNP	0.017	T
AKNA	80709	genome.wustl.edu	37	9	117108251	117108251	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr9:117108251C>G	ENST00000307564.4	-	18	3714	c.3553G>C	c.(3553-3555)Gag>Cag	p.E1185Q	AKNA_ENST00000374088.3_Missense_Mutation_p.E1185Q|AKNA_ENST00000374075.5_Missense_Mutation_p.E1104Q|AKNA_ENST00000492875.1_5'UTR|AKNA_ENST00000223791.3_Missense_Mutation_p.E645Q|AKNA_ENST00000374079.4_Missense_Mutation_p.E130Q	NM_030767.4	NP_110394.3	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	1185					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(7)|liver(2)|lung(22)|ovary(4)|stomach(2)	51						TTGCTCTTCTCAGAGAACAGT	0.592																																						dbGAP											0													83.0	73.0	76.0					9																	117108251		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK024431	CCDS6805.1	9q32	2008-02-05			ENSG00000106948	ENSG00000106948			24108	protein-coding gene	gene with protein product		605729				11268217, 11853319	Standard	NM_030767		Approved	KIAA1968	uc004bis.3	Q7Z591	OTTHUMG00000020538	ENST00000307564.4:c.3553G>C	9.37:g.117108251C>G	ENSP00000303769:p.Glu1185Gln		Q05BK5|Q5T535|Q5T536|Q5T537|Q64FX6|Q64FX7|Q64FX8|Q64FY2|Q6ZMK0|Q6ZNL2|Q6ZTX0|Q8TET1|Q8TF33|Q96RR9|Q9H7P7	Missense_Mutation	SNP	pfam_TF_AT-hook	p.E1185Q	ENST00000307564.4	37	c.3553	CCDS6805.1	9	.	.	.	.	.	.	.	.	.	.	C	12.65	2.002529	0.35320	.	.	ENSG00000106948	ENST00000307564;ENST00000374079;ENST00000320310;ENST00000374088;ENST00000223791;ENST00000374075	T;T;T;T;T	0.20463	2.56;2.07;2.56;2.34;2.56	4.99	3.11	0.35812	.	0.549737	0.16531	N	0.210346	T	0.37839	0.1018	M	0.69823	2.125	0.20307	N	0.999913	D;D	0.69078	0.994;0.997	P;P	0.62298	0.796;0.9	T	0.13845	-1.0494	10	0.87932	D	0	-6.1918	6.7506	0.23485	0.0:0.7223:0.1804:0.0973	.	1185;1104	Q7Z591;Q7Z591-2	AKNA_HUMAN;.	Q	1185;130;197;1185;645;1104	ENSP00000303769:E1185Q;ENSP00000363192:E130Q;ENSP00000363201:E1185Q;ENSP00000223791:E645Q;ENSP00000363188:E1104Q	ENSP00000223791:E645Q	E	-	1	0	AKNA	116148072	0.995000	0.38212	0.053000	0.19242	0.068000	0.16541	1.325000	0.33724	0.587000	0.29643	0.561000	0.74099	GAG	AKNA	-	NULL	ENSG00000106948		0.592	AKNA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	AKNA	HGNC	protein_coding	OTTHUMT00000053767.2	131	0.00	0	C	NM_030767		117108251	117108251	-1	no_errors	ENST00000307564	ensembl	human	known	69_37n	missense	64	18.99	15	SNP	0.535	G
ARPC1B	10095	genome.wustl.edu	37	7	98991734	98991734	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr7:98991734G>A	ENST00000451682.1	+	11	1381	c.1072G>A	c.(1072-1074)Gat>Aat	p.D358N	PDAP1_ENST00000496335.1_Intron|ARPC1B_ENST00000252725.5_Missense_Mutation_p.D358N			O15143	ARC1B_HUMAN	actin related protein 2/3 complex, subunit 1B, 41kDa	358					Arp2/3 complex-mediated actin nucleation (GO:0034314)|cellular component movement (GO:0006928)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(2)|lung(1)	11	all_cancers(62;3.49e-09)|all_epithelial(64;2.57e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			GAGTATCTGGGATGTGAAGGT	0.617																																						dbGAP											0													96.0	88.0	91.0					7																	98991734		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF006084	CCDS5661.1	7q22.1	2013-03-14	2002-08-29		ENSG00000130429	ENSG00000130429		"""Actin related protein 2/3 complex subunits"", ""WD repeat domain containing"""	704	protein-coding gene	gene with protein product	"""ARP2/3 protein complex subunit p41"", ""actin related protein 2/3 complex, subunit 1A (41 kD)"""	604223	"""actin related protein 2/3 complex, subunit 1B (41 kD)"""			9230079, 9359840	Standard	NM_005720		Approved	ARC41, p40-ARC, p41-ARC	uc003upz.3	O15143	OTTHUMG00000154552	ENST00000451682.1:c.1072G>A	7.37:g.98991734G>A	ENSP00000389631:p.Asp358Asn		Q9BU00	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_ARPC2/3_su1,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D358N	ENST00000451682.1	37	c.1072	CCDS5661.1	7	.	.	.	.	.	.	.	.	.	.	G	24.2	4.500924	0.85176	.	.	ENSG00000130429	ENST00000252725;ENST00000451682	T;T	0.69306	-0.39;-0.39	5.54	5.54	0.83059	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.75679	0.3882	L	0.45422	1.42	0.80722	D	1	D	0.76494	0.999	D	0.64687	0.928	T	0.72887	-0.4156	10	0.35671	T	0.21	-27.9383	19.0937	0.93240	0.0:0.0:1.0:0.0	.	358	O15143	ARC1B_HUMAN	N	358	ENSP00000252725:D358N;ENSP00000389631:D358N	ENSP00000252725:D358N	D	+	1	0	ARPC1B	98829670	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.716000	0.98752	2.603000	0.88011	0.655000	0.94253	GAT	ARPC1B	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_ARPC2/3_su1	ENSG00000130429		0.617	ARPC1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ARPC1B	HGNC	protein_coding	OTTHUMT00000335894.1	121	0.00	0	G	NM_005720		98991734	98991734	+1	no_errors	ENST00000252725	ensembl	human	known	69_37n	missense	83	20.95	22	SNP	1.000	A
B4GALT4	8702	genome.wustl.edu	37	3	118945872	118945872	+	Silent	SNP	G	G	C			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr3:118945872G>C	ENST00000483209.1	-	4	911	c.270C>G	c.(268-270)ctC>ctG	p.L90L	B4GALT4_ENST00000460321.1_5'UTR|B4GALT4_ENST00000471675.1_Silent_p.L43L|B4GALT4-AS1_ENST00000470790.1_RNA|B4GALT4_ENST00000467604.1_Silent_p.L90L|B4GALT4_ENST00000359213.3_Silent_p.L90L|B4GALT4_ENST00000393765.2_Silent_p.L90L			O60513	B4GT4_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4	90					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|membrane lipid metabolic process (GO:0006643)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)|metal ion binding (GO:0046872)|N-acetyllactosamine synthase activity (GO:0003945)			breast(2)|endometrium(1)|large_intestine(1)|lung(6)|skin(2)|stomach(2)	14				GBM - Glioblastoma multiforme(114;0.222)	N-Acetyl-D-glucosamine(DB00141)	GTTTGAAAATGAGCTTGCTCT	0.438																																						dbGAP											0													96.0	96.0	96.0					3																	118945872		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF022367	CCDS2986.1	3q13.3	2013-02-19			ENSG00000121578	ENSG00000121578		"""Beta 4-glycosyltransferases"""	927	protein-coding gene	gene with protein product		604015				9597550	Standard	NM_003778		Approved	beta4Gal-T4	uc003eci.3	O60513	OTTHUMG00000159358	ENST00000483209.1:c.270C>G	3.37:g.118945872G>C			Q68D68|Q9BSW3|Q9C078	Silent	SNP	pfam_Galactosyl_T_2_met,prints_Galactosyl_T_2_met	p.L90	ENST00000483209.1	37	c.270	CCDS2986.1	3																																																																																			B4GALT4	-	pfam_Galactosyl_T_2_met	ENSG00000121578		0.438	B4GALT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALT4	HGNC	protein_coding	OTTHUMT00000354925.2	110	0.00	0	G	NM_003778		118945872	118945872	-1	no_errors	ENST00000359213	ensembl	human	known	69_37n	silent	86	27.12	32	SNP	0.038	C
BACH2	60468	genome.wustl.edu	37	6	90661581	90661581	+	Splice_Site	SNP	C	C	A			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr6:90661581C>A	ENST00000257749.4	-	7	951	c.244G>T	c.(244-246)Gtc>Ttc	p.V82F	BACH2_ENST00000343122.3_Splice_Site_p.V82F|RP3-512E2.2_ENST00000445838.1_RNA|BACH2_ENST00000537989.1_Splice_Site_p.V82F|RP3-512E2.2_ENST00000413986.1_RNA	NM_021813.2	NP_068585.1	Q9BYV9	BACH2_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 2	82	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	45		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)		CTGGCTGTGACCTGCAAAACA	0.507																																						dbGAP											0													39.0	40.0	40.0					6																	90661581		2197	4288	6485	-	-	-	SO:0001630	splice_region_variant	0			AL121787	CCDS5026.1	6q15	2013-01-10			ENSG00000112182	ENSG00000112182		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	14078	protein-coding gene	gene with protein product		605394				10949928, 12829606	Standard	NM_001170794		Approved	BTBD25	uc003pnw.3	Q9BYV9	OTTHUMG00000015216	ENST00000257749.4:c.244-1G>T	6.37:g.90661581C>A			E1P518|Q59H70|Q5T793|Q9NTS5	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_bZIP_1,pfam_bZIP_2,superfamily_BTB/POZ_fold,superfamily_Euk_TF_DNA-bd,smart_BTB/POZ-like,smart_bZIP,pfscan_BTB/POZ-like,pfscan_bZIP	p.V82F	ENST00000257749.4	37	c.244	CCDS5026.1	6	.	.	.	.	.	.	.	.	.	.	C	21.3	4.123942	0.77436	.	.	ENSG00000112182	ENST00000257749;ENST00000537989;ENST00000343122	T;T;T	0.71222	-0.55;-0.55;-0.55	5.78	5.78	0.91487	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.85452	0.5700	M	0.86864	2.845	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.86881	0.2042	10	0.87932	D	0	-0.6341	20.0165	0.97478	0.0:1.0:0.0:0.0	.	82	Q9BYV9	BACH2_HUMAN	F	82	ENSP00000257749:V82F;ENSP00000437473:V82F;ENSP00000345642:V82F	ENSP00000257749:V82F	V	-	1	0	BACH2	90718302	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.487000	0.81328	2.736000	0.93811	0.557000	0.71058	GTC	BACH2	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	ENSG00000112182		0.507	BACH2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	BACH2	HGNC	protein_coding	OTTHUMT00000041522.2	28	0.00	0	C	NM_021813	Missense_Mutation	90661581	90661581	-1	no_errors	ENST00000257749	ensembl	human	known	69_37n	missense	8	46.67	7	SNP	1.000	A
BLOC1S1	2647	genome.wustl.edu	37	12	56112976	56112976	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr12:56112976G>A	ENST00000548925.1	+	3	335	c.320G>A	c.(319-321)gGa>gAa	p.G107E	RDH5_ENST00000547072.1_5'Flank|BLOC1S1_ENST00000549147.1_Missense_Mutation_p.G107E|BLOC1S1_ENST00000547076.1_Missense_Mutation_p.G29E|RP11-644F5.10_ENST00000550412.1_Missense_Mutation_p.G107E|RDH5_ENST00000257895.5_5'Flank|BLOC1S1_ENST00000257899.2_Missense_Mutation_p.G79E|BLOC1S1_ENST00000551926.1_Missense_Mutation_p.G29E|RP11-644F5.10_ENST00000549424.1_Missense_Mutation_p.G29E|RDH5_ENST00000548082.1_5'Flank|BLOC1S1_ENST00000548556.1_Missense_Mutation_p.G29E			P78537	BL1S1_HUMAN	biogenesis of lysosomal organelles complex-1, subunit 1	107					aerobic respiration (GO:0009060)|anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|neuron projection development (GO:0031175)|peptidyl-lysine acetylation (GO:0018394)|platelet dense granule organization (GO:0060155)|post-Golgi vesicle-mediated transport (GO:0006892)	BLOC-1 complex (GO:0031083)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)				breast(1)|endometrium(1)|large_intestine(1)|prostate(1)	4						CAGTGGATCGGAATGGTGGAG	0.582																																					Colon(112;1254 2715 13015)	dbGAP											0													87.0	74.0	78.0					12																	56112976		2203	4300	6503	-	-	-	SO:0001583	missense	0			S82447	CCDS8889.1, CCDS8889.2	12q13-q14	2012-08-01	2008-08-11	2004-05-26		ENSG00000135441		"""Biogenesis of lysosomal organelles complex-1 subunits"""	4200	protein-coding gene	gene with protein product	"""GCN5 (general control of amino-acid synthesis, yeast, homolog)-like 1"", ""BLOC-1 Subunit 1"", ""Biogenesis of Lysosome-related Organelles complex-1 Subunit 1"""	601444	"""GCN5 general control of amino-acid synthesis 5-like 1 (yeast)"""	GCN5L1		8646881, 15102850	Standard	NM_001487		Approved	BLOS1	uc001shi.4	P78537		ENST00000548925.1:c.320G>A	12.37:g.56112976G>A	ENSP00000447537:p.Gly107Glu		A1L4Q9|Q6NZ45	Missense_Mutation	SNP	pfam_GCN5L1	p.G107E	ENST00000548925.1	37	c.320	CCDS8889.2	12	.	.	.	.	.	.	.	.	.	.	G	15.48	2.845205	0.51164	.	.	ENSG00000258311;ENSG00000258311;ENSG00000135441;ENSG00000135441;ENSG00000135441;ENSG00000135441;ENSG00000135441;ENSG00000135441	ENST00000550412;ENST00000549424;ENST00000257899;ENST00000548925;ENST00000549147;ENST00000547076;ENST00000551926;ENST00000548556	.	.	.	5.34	4.44	0.53790	.	0.165410	0.52532	D	0.000077	T	0.56514	0.1990	L	0.46157	1.445	0.36084	D	0.842961	D;D;P	0.63046	0.992;0.977;0.669	P;P;B	0.59948	0.866;0.73;0.355	T	0.58526	-0.7621	9	0.06236	T	0.91	-24.8229	13.3839	0.60785	0.0:0.0:0.8411:0.1589	.	107;107;107	F8VP73;F8W036;P78537	.;.;BL1S1_HUMAN	E	107;29;79;107;107;29;29;29	.	ENSP00000257899:G79E	G	+	2	0	RP11-644F5.10;BLOC1S1	54399243	1.000000	0.71417	0.957000	0.39632	0.979000	0.70002	3.659000	0.54489	1.359000	0.45940	0.655000	0.94253	GGA	BLOC1S1	-	pfam_GCN5L1	ENSG00000135441		0.582	BLOC1S1-001	KNOWN	downstream_ATG|basic|CCDS	protein_coding	BLOC1S1	HGNC	protein_coding	OTTHUMT00000406681.1	59	0.00	0	G	NM_001487		56112976	56112976	+1	no_errors	ENST00000548925	ensembl	human	known	69_37n	missense	46	22.03	13	SNP	0.984	A
BMP2K	55589	genome.wustl.edu	37	4	79792136	79792137	+	In_Frame_Ins	INS	-	-	CAG	rs545604264	byFrequency	TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr4:79792136_79792137insCAG	ENST00000335016.5	+	11	1597_1598	c.1431_1432insCAG	c.(1432-1434)cag>CAGcag	p.478_478Q>QQ	BMP2K_ENST00000502871.1_In_Frame_Ins_p.478_478Q>QQ	NM_198892.1	NP_942595.1	Q9NSY1	BMP2K_HUMAN	BMP2 inducible kinase	478	Gln/His-rich.			Missing (in Ref. 2; CAB70863). {ECO:0000305}.|Q -> R (in Ref. 4; AAH36021). {ECO:0000305}.	regulation of bone mineralization (GO:0030500)	nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatase regulator activity (GO:0019208)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	13						agcaacagcaacagcagcagca	0.505																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			AB015331	CCDS34019.1, CCDS47083.1	4q21.21	2008-05-15			ENSG00000138756	ENSG00000138756			18041	protein-coding gene	gene with protein product							Standard	NM_017593		Approved	DKFZp434K0614, BIKe	uc003hlk.3	Q9NSY1	OTTHUMG00000160900	ENST00000335016.5:c.1456_1458dupCAG	4.37:g.79792143_79792145dupCAG	ENSP00000334836:p.Gln486dup		O94791|Q4W5H2|Q8IYF2|Q8N2G7|Q8NHG9|Q9NTG8	In_Frame_Ins	INS	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.481in_frame_insQ	ENST00000335016.5	37	c.1431_1432	CCDS47083.1	4																																																																																			BMP2K	-	NULL	ENSG00000138756		0.505	BMP2K-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BMP2K	HGNC	protein_coding		30	0.00	0	-	NM_017593		79792136	79792137	+1	no_errors	ENST00000335016	ensembl	human	known	69_37n	in_frame_ins	40	13.04	6	INS	0.956:0.960	CAG
C17orf53	78995	genome.wustl.edu	37	17	42232258	42232258	+	Silent	SNP	G	G	A			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr17:42232258G>A	ENST00000319977.4	+	7	1836	c.1599G>A	c.(1597-1599)gaG>gaA	p.E533E	C17orf53_ENST00000585683.1_Silent_p.E532E|C17orf53_ENST00000245382.6_Silent_p.E457E	NM_001171251.1|NM_024032.3	NP_001164722.1|NP_076937.2	Q8N3J3	CQ053_HUMAN	chromosome 17 open reading frame 53	533										NS(1)|breast(3)|cervix(1)|kidney(3)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	22		Breast(137;0.0364)|Prostate(33;0.0376)		BRCA - Breast invasive adenocarcinoma(366;0.114)		TGCTGCTGGAGACGTGCCAGA	0.612																																						dbGAP											0													80.0	67.0	72.0					17																	42232258		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK021656	CCDS11477.1, CCDS59293.1	17q21.31	2012-10-11			ENSG00000125319	ENSG00000125319			28460	protein-coding gene	gene with protein product							Standard	NM_001171251		Approved	MGC3130	uc002ifi.2	Q8N3J3	OTTHUMG00000181808	ENST00000319977.4:c.1599G>A	17.37:g.42232258G>A			A8K7A9|Q9BWM9|Q9HAI1	Silent	SNP	NULL	p.E533	ENST00000319977.4	37	c.1599	CCDS11477.1	17																																																																																			C17orf53	-	NULL	ENSG00000125319		0.612	C17orf53-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C17orf53	HGNC	protein_coding	OTTHUMT00000457697.1	133	0.00	0	G	NM_024032		42232258	42232258	+1	no_errors	ENST00000319977	ensembl	human	known	69_37n	silent	75	18.48	17	SNP	0.996	A
CBL	867	genome.wustl.edu	37	11	119148506	119148506	+	Silent	SNP	G	G	A			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr11:119148506G>A	ENST00000264033.4	+	7	1423	c.1047G>A	c.(1045-1047)ctG>ctA	p.L349L		NM_005188.3	NP_005179.2	P22681	CBL_HUMAN	Cbl proto-oncogene, E3 ubiquitin protein ligase	349	Cbl-PTB. {ECO:0000255|PROSITE- ProRule:PRU00839}.|SH2-like.|Sufficient for interaction with EPHB1.				cell surface receptor signaling pathway (GO:0007166)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|flotillin complex (GO:0016600)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ephrin receptor binding (GO:0046875)|ligase activity (GO:0016874)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SH3 domain binding (GO:0017124)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(194)|kidney(3)|large_intestine(9)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	251		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.92e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.000784)		ATCCTGATCTGACTGGCTTAT	0.398			"""T, Mis S, O"""	MLL	"""AML, JMML, MDS"""				Noonan syndrome;CBL gene-associated Juvenile Myelomonocytic Leukemia and Developmental Anomalies																													dbGAP		"""Dom, Rec"""	yes		11	11q23.3	867	Cas-Br-M (murine) ecotropic retroviral transforming		L	0													105.0	99.0	101.0					11																	119148506		2199	4295	6494	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CBL-associated JMML	X57110	CCDS8418.1	11q23.3	2014-09-17	2012-02-23		ENSG00000110395	ENSG00000110395		"""RING-type (C3HC4) zinc fingers"""	1541	protein-coding gene	gene with protein product	"""oncogene CBL2"""	165360	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence"""	CBL2		2013228	Standard	NM_005188		Approved	RNF55, c-Cbl	uc001pwe.4	P22681	OTTHUMG00000166170	ENST00000264033.4:c.1047G>A	11.37:g.119148506G>A			A3KMP8	Silent	SNP	pfam_Adaptor_Cbl_N_hlx,pfam_Adaptor_Cbl_SH2-like,pfam_Adaptor_Cbl_EF_hand-like,pfam_Znf_C3HC4_RING-type,pfam_UBA/transl_elong_EF1B_N,superfamily_Adaptor_Cbl_N_hlx,superfamily_UBA-like,smart_Znf_RING,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_RING	p.L349	ENST00000264033.4	37	c.1047	CCDS8418.1	11																																																																																			CBL	-	pfam_Adaptor_Cbl_SH2-like	ENSG00000110395		0.398	CBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBL	HGNC	protein_coding	OTTHUMT00000388219.4	114	0.00	0	G	NM_005188		119148506	119148506	+1	no_errors	ENST00000264033	ensembl	human	known	69_37n	silent	97	13.39	15	SNP	1.000	A
CBL	867	genome.wustl.edu	37	11	119155748	119155748	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr11:119155748G>C	ENST00000264033.4	+	10	1877	c.1501G>C	c.(1501-1503)Gac>Cac	p.D501H		NM_005188.3	NP_005179.2	P22681	CBL_HUMAN	Cbl proto-oncogene, E3 ubiquitin protein ligase	501	Pro-rich.				cell surface receptor signaling pathway (GO:0007166)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|flotillin complex (GO:0016600)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ephrin receptor binding (GO:0046875)|ligase activity (GO:0016874)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SH3 domain binding (GO:0017124)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(194)|kidney(3)|large_intestine(9)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	251		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.92e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.000784)		ACCACGACTTGACCTTCTGCC	0.483			"""T, Mis S, O"""	MLL	"""AML, JMML, MDS"""				Noonan syndrome;CBL gene-associated Juvenile Myelomonocytic Leukemia and Developmental Anomalies		OREG0021401	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP		"""Dom, Rec"""	yes		11	11q23.3	867	Cas-Br-M (murine) ecotropic retroviral transforming		L	0													99.0	91.0	94.0					11																	119155748		2199	4295	6494	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CBL-associated JMML	X57110	CCDS8418.1	11q23.3	2014-09-17	2012-02-23		ENSG00000110395	ENSG00000110395		"""RING-type (C3HC4) zinc fingers"""	1541	protein-coding gene	gene with protein product	"""oncogene CBL2"""	165360	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence"""	CBL2		2013228	Standard	NM_005188		Approved	RNF55, c-Cbl	uc001pwe.4	P22681	OTTHUMG00000166170	ENST00000264033.4:c.1501G>C	11.37:g.119155748G>C	ENSP00000264033:p.Asp501His	1494	A3KMP8	Missense_Mutation	SNP	pfam_Adaptor_Cbl_N_hlx,pfam_Adaptor_Cbl_SH2-like,pfam_Adaptor_Cbl_EF_hand-like,pfam_Znf_C3HC4_RING-type,pfam_UBA/transl_elong_EF1B_N,superfamily_Adaptor_Cbl_N_hlx,superfamily_UBA-like,smart_Znf_RING,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_RING	p.D501H	ENST00000264033.4	37	c.1501	CCDS8418.1	11	.	.	.	.	.	.	.	.	.	.	G	18.36	3.606853	0.66558	.	.	ENSG00000110395	ENST00000264033	D	0.81499	-1.5	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	D	0.89846	0.6833	M	0.75777	2.31	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.90297	0.4327	10	0.87932	D	0	-31.9911	19.0299	0.92952	0.0:0.0:1.0:0.0	.	501	P22681	CBL_HUMAN	H	501	ENSP00000264033:D501H	ENSP00000264033:D501H	D	+	1	0	CBL	118660958	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	8.878000	0.92393	2.827000	0.97445	0.650000	0.86243	GAC	CBL	-	NULL	ENSG00000110395		0.483	CBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBL	HGNC	protein_coding	OTTHUMT00000388219.4	84	0.00	0	G	NM_005188		119155748	119155748	+1	no_errors	ENST00000264033	ensembl	human	known	69_37n	missense	59	24.36	19	SNP	1.000	C
CCDC150	284992	genome.wustl.edu	37	2	197521749	197521749	+	Silent	SNP	C	C	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr2:197521749C>T	ENST00000389175.4	+	4	600	c.465C>T	c.(463-465)ctC>ctT	p.L155L	CCDC150_ENST00000423093.2_Intron|CCDC150_ENST00000472405.2_Silent_p.L52L|CCDC150_ENST00000272831.7_Intron	NM_001080539.1	NP_001074008.1	Q8NCX0	CC150_HUMAN	coiled-coil domain containing 150	155										breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(14)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	33						TGTTGCATCTCGAAGTTATGA	0.478																																						dbGAP											0													74.0	75.0	74.0					2																	197521749		1964	4151	6115	-	-	-	SO:0001819	synonymous_variant	0				CCDS46478.1	2q33.1	2008-04-10			ENSG00000144395	ENSG00000144395			26834	protein-coding gene	gene with protein product							Standard	NM_001080539		Approved	FLJ39660	uc002utp.1	Q8NCX0	OTTHUMG00000154475	ENST00000389175.4:c.465C>T	2.37:g.197521749C>T			Q6P5U6|Q6P663|Q8N8V5	Silent	SNP	NULL	p.L155	ENST00000389175.4	37	c.465	CCDS46478.1	2																																																																																			CCDC150	-	NULL	ENSG00000144395		0.478	CCDC150-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	CCDC150	HGNC	protein_coding	OTTHUMT00000335377.2	115	0.85	1	C	NM_001080539		197521749	197521749	+1	no_errors	ENST00000389175	ensembl	human	known	69_37n	silent	67	18.29	15	SNP	0.562	T
CCDC67	159989	genome.wustl.edu	37	11	93148236	93148236	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr11:93148236G>C	ENST00000298050.3	+	13	1694	c.1594G>C	c.(1594-1596)Gaa>Caa	p.E532Q	CCDC67_ENST00000525646.1_Missense_Mutation_p.E274Q	NM_181645.3	NP_857596.2	Q05D60	DEUP1_HUMAN	coiled-coil domain containing 67	532					cell projection organization (GO:0030030)|de novo centriole assembly (GO:0098535)	cytoplasm (GO:0005737)|deuterosome (GO:0098536)				endometrium(3)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		Acute lymphoblastic leukemia(157;2.35e-05)|all_hematologic(158;0.00824)				TCAAGCCAAAGAAATGACAAG	0.398																																						dbGAP											0													215.0	201.0	206.0					11																	93148236		1933	4130	6063	-	-	-	SO:0001583	missense	0			AK058122	CCDS44707.1	11q21	2014-02-20				ENSG00000165325			26344	protein-coding gene	gene with protein product						24240477	Standard	NM_181645		Approved	FLJ25393	uc001pdq.3	Q05D60		ENST00000298050.3:c.1594G>C	11.37:g.93148236G>C	ENSP00000298050:p.Glu532Gln		Q8NEF1|Q96LL7	Missense_Mutation	SNP	superfamily_MHC_II-assoc_invariant_trimer	p.E532Q	ENST00000298050.3	37	c.1594	CCDS44707.1	11	.	.	.	.	.	.	.	.	.	.	G	13.54	2.268442	0.40095	.	.	ENSG00000165325	ENST00000534747;ENST00000298050;ENST00000525646;ENST00000529909	T;T;T;T	0.19806	2.12;2.12;2.12;2.12	5.73	5.73	0.89815	.	0.390557	0.21935	N	0.066967	T	0.21267	0.0512	L	0.51422	1.61	0.36757	D	0.883088	B;P	0.37864	0.017;0.61	B;B	0.35353	0.009;0.201	T	0.09335	-1.0679	10	0.25106	T	0.35	.	15.7604	0.78076	0.0:0.0:1.0:0.0	.	532;524	Q05D60;Q6ZRU6	CCD67_HUMAN;.	Q	532;532;274;13	ENSP00000432111:E532Q;ENSP00000298050:E532Q;ENSP00000435079:E274Q;ENSP00000433859:E13Q	ENSP00000298050:E532Q	E	+	1	0	CCDC67	92787884	1.000000	0.71417	0.972000	0.41901	0.862000	0.49288	4.405000	0.59741	2.854000	0.98071	0.655000	0.94253	GAA	CCDC67	-	NULL	ENSG00000165325		0.398	CCDC67-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC67	HGNC	protein_coding		271	0.00	0	G	NM_181645		93148236	93148236	+1	no_errors	ENST00000298050	ensembl	human	known	69_37n	missense	235	22.44	68	SNP	0.997	C
CD200R1L	344807	genome.wustl.edu	37	3	112538665	112538665	+	Silent	SNP	G	G	A			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr3:112538665G>A	ENST00000398214.1	-	5	982	c.757C>T	c.(757-759)Ctg>Ttg	p.L253L	CD200R1L_ENST00000448932.1_Silent_p.L232L|CD200R1L_ENST00000488794.1_Silent_p.L232L	NM_001008784.2	NP_001008784.2	Q6Q8B3	MO2R2_HUMAN	CD200 receptor 1-like	253						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|urinary_tract(2)	19						GTGGTGACCAGAATGACCACA	0.388																																						dbGAP											0													77.0	74.0	75.0					3																	112538665		1851	4102	5953	-	-	-	SO:0001819	synonymous_variant	0			AY284976	CCDS43131.1, CCDS56267.1	3q13.2	2014-05-15	2008-10-08		ENSG00000206531	ENSG00000206531		"""Immunoglobulin superfamily / C2-set domain containing"""	24665	protein-coding gene	gene with protein product	"""CD200 receptor 2"""						Standard	NM_001008784		Approved	CD200RLa, CD200R2	uc003dzi.1	Q6Q8B3	OTTHUMG00000159283	ENST00000398214.1:c.757C>T	3.37:g.112538665G>A			Q6WHB7	Silent	SNP	pfam_CD80_C2-set,pfscan_Ig-like	p.L253	ENST00000398214.1	37	c.757	CCDS43131.1	3																																																																																			CD200R1L	-	NULL	ENSG00000206531		0.388	CD200R1L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD200R1L	HGNC	protein_coding	OTTHUMT00000354365.1	85	0.00	0	G	NM_001008784		112538665	112538665	-1	no_errors	ENST00000398214	ensembl	human	known	69_37n	silent	98	17.65	21	SNP	0.511	A
CDHR2	54825	genome.wustl.edu	37	5	176002162	176002162	+	Silent	SNP	C	C	G			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr5:176002162C>G	ENST00000510636.1	+	8	847	c.573C>G	c.(571-573)ctC>ctG	p.L191L	CDHR2_ENST00000261944.5_Silent_p.L191L|CDHR2_ENST00000506348.1_Silent_p.L191L	NM_001171976.1	NP_001165447.1	Q9BYE9	CDHR2_HUMAN	cadherin-related family member 2	191	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|liver(1)|lung(23)|ovary(3)|prostate(5)|skin(4)|urinary_tract(1)	56						ATGGCAGCCTCAGCTACAACA	0.627																																						dbGAP											0													81.0	79.0	79.0					5																	176002162		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB047004	CCDS34297.1	5q35.2	2011-07-01	2010-01-25	2010-01-25		ENSG00000074276		"""Cadherins / Cadherin-related"""	18231	protein-coding gene	gene with protein product	"""protocadherin LKC"""		"""protocadherin 24"""	PCDH24		11082270, 12117771	Standard	NM_001171976		Approved	PC-LKC, FLJ20124, FLJ20383, PCLKC	uc003mem.2	Q9BYE9		ENST00000510636.1:c.573C>G	5.37:g.176002162C>G			A1L3U4|A6NC80|Q9NXP8	Silent	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L191	ENST00000510636.1	37	c.573	CCDS34297.1	5																																																																																			CDHR2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000074276		0.627	CDHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDHR2	HGNC	protein_coding	OTTHUMT00000372201.1	65	0.00	0	C	NM_017675		176002162	176002162	+1	no_errors	ENST00000261944	ensembl	human	known	69_37n	silent	58	18.31	13	SNP	1.000	G
CDK12	51755	genome.wustl.edu	37	17	37667820	37667820	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr17:37667820G>C	ENST00000447079.4	+	8	2738	c.2705G>C	c.(2704-2706)cGa>cCa	p.R902P	CDK12_ENST00000430627.2_Missense_Mutation_p.R902P	NM_015083.1|NM_016507.2	NP_055898.1|NP_057591.2	Q9NYV4	CDK12_HUMAN	cyclin-dependent kinase 12	902	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				mRNA processing (GO:0006397)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|protein autophosphorylation (GO:0046777)|regulation of MAP kinase activity (GO:0043405)|RNA splicing (GO:0008380)	cyclin K-CDK12 complex (GO:0002944)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			NS(4)|breast(3)|endometrium(5)|kidney(4)|large_intestine(11)|lung(23)|ovary(11)|prostate(4)|skin(2)|urinary_tract(3)	70						TTGTGGTACCGACCTCCAGAA	0.388			"""Mis, N, F"""		serous ovarian					TCGA Ovarian(9;0.13)																												dbGAP		Rec	yes		17	17q12	51755	cyclin-dependent kinase 12		E	0													125.0	119.0	121.0					17																	37667820		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF227198	CCDS11337.1, CCDS45666.1	17q12	2011-10-25	2009-12-16	2009-12-16	ENSG00000167258	ENSG00000167258		"""Cyclin-dependent kinases"""	24224	protein-coding gene	gene with protein product	"""CDC2 related protein kinase 7"""	615514	"""Cdc2-related kinase, arginine/serine-rich"""	CRKRS		10048485, 11683387, 19884882	Standard	XM_005257456		Approved	CRK7, CRKR, KIAA0904	uc010cvv.3	Q9NYV4	OTTHUMG00000133214	ENST00000447079.4:c.2705G>C	17.37:g.37667820G>C	ENSP00000398880:p.Arg902Pro		A7E2B2|B4DYX4|B9EIQ6|O94978	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.R902P	ENST00000447079.4	37	c.2705	CCDS11337.1	17	.	.	.	.	.	.	.	.	.	.	G	21.2	4.111971	0.77210	.	.	ENSG00000167258	ENST00000430627;ENST00000447079	T;T	0.51574	0.7;0.7	5.07	5.07	0.68467	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.35805	N	0.002963	T	0.81399	0.4814	H	0.97829	4.085	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.88751	0.3250	10	0.87932	D	0	-6.7445	18.8066	0.92040	0.0:0.0:1.0:0.0	.	901;902;902	E7EUM9;Q9NYV4;Q9NYV4-2	.;CDK12_HUMAN;.	P	902	ENSP00000407720:R902P;ENSP00000398880:R902P	ENSP00000407720:R902P	R	+	2	0	CDK12	34921346	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	9.686000	0.98664	2.521000	0.84997	0.555000	0.69702	CGA	CDK12	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000167258		0.388	CDK12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDK12	HGNC	protein_coding	OTTHUMT00000256941.4	88	0.00	0	G	NM_016507		37667820	37667820	+1	no_errors	ENST00000447079	ensembl	human	known	69_37n	missense	73	27.00	27	SNP	1.000	C
CEP164	22897	genome.wustl.edu	37	11	117267896	117267896	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr11:117267896C>G	ENST00000278935.3	+	27	3515	c.3368C>G	c.(3367-3369)tCc>tGc	p.S1123C	CEP164_ENST00000533706.1_3'UTR	NM_001271933.1|NM_014956.4	NP_001258862.1|NP_055771.4	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	1123					cilium assembly (GO:0042384)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(7)|large_intestine(12)|lung(18)|ovary(3)|prostate(3)	47	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		CAGACACGCTCCATGCGGAGG	0.627																																						dbGAP											0													57.0	53.0	54.0					11																	117267896		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB028975	CCDS31683.1	11q23.3	2014-02-20			ENSG00000110274	ENSG00000110274			29182	protein-coding gene	gene with protein product		614848				10470851, 14654843	Standard	NM_014956		Approved	KIAA1052, NPHP15	uc001prc.3	Q9UPV0	OTTHUMG00000167070	ENST00000278935.3:c.3368C>G	11.37:g.117267896C>G	ENSP00000278935:p.Ser1123Cys		Q6PKH9|Q7Z2X9|Q9NVS0|Q9UFJ6	Missense_Mutation	SNP	superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,pfscan_WW_Rsp5_WWP	p.S1123C	ENST00000278935.3	37	c.3368	CCDS31683.1	11	.	.	.	.	.	.	.	.	.	.	C	17.03	3.285693	0.59867	.	.	ENSG00000110274	ENST00000278935	T	0.38401	1.14	4.87	4.87	0.63330	.	0.000000	0.42682	D	0.000675	T	0.60958	0.2309	M	0.74258	2.255	0.46167	D	0.998904	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.76071	0.987;0.976;0.976	T	0.65915	-0.6052	10	0.87932	D	0	-6.1957	16.5308	0.84357	0.0:1.0:0.0:0.0	.	897;1123;1126	Q9NTH6;Q9UPV0;Q9UPV0-2	.;CE164_HUMAN;.	C	1123	ENSP00000278935:S1123C	ENSP00000278935:S1123C	S	+	2	0	CEP164	116773106	1.000000	0.71417	0.995000	0.50966	0.445000	0.32107	4.946000	0.63576	2.423000	0.82170	0.591000	0.81541	TCC	CEP164	-	NULL	ENSG00000110274		0.627	CEP164-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP164	HGNC	protein_coding	OTTHUMT00000392893.1	68	0.00	0	C	NM_014956		117267896	117267896	+1	no_errors	ENST00000278935	ensembl	human	known	69_37n	missense	42	10.64	5	SNP	1.000	G
CHPT1	56994	genome.wustl.edu	37	12	102117560	102117560	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr12:102117560C>G	ENST00000229266.3	+	7	1235	c.1000C>G	c.(1000-1002)Ctt>Gtt	p.L334V	CHPT1_ENST00000549872.1_Missense_Mutation_p.L334V	NM_020244.2	NP_064629.2	Q8WUD6	CHPT1_HUMAN	choline phosphotransferase 1	334					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|regulation of cell growth (GO:0001558)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	diacylglycerol binding (GO:0019992)|diacylglycerol cholinephosphotransferase activity (GO:0004142)|metal ion binding (GO:0046872)			kidney(2)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	10						GGGGCCAGGTCTTTTGTTTTT	0.279																																						dbGAP											0													80.0	84.0	83.0					12																	102117560		2202	4297	6499	-	-	-	SO:0001583	missense	0				CCDS9086.1	12q	2010-07-08				ENSG00000111666	2.7.8.2		17852	protein-coding gene	gene with protein product	"""phosphatidylcholine synthesizing enzyme"""					10893425	Standard	NM_020244		Approved	CPT1	uc001tin.3	Q8WUD6		ENST00000229266.3:c.1000C>G	12.37:g.102117560C>G	ENSP00000229266:p.Leu334Val		B3KQM2|Q7Z7H0|Q7Z7H1|Q7Z7H2|Q8IWQ4|Q8IWQ5|Q8WYI4|Q9NRQ6|Q9NRQ7|Q9Y6M6	Missense_Mutation	SNP	pfam_CDP-OH_P_trans,pirsf_CHOPT	p.L334V	ENST00000229266.3	37	c.1000	CCDS9086.1	12	.	.	.	.	.	.	.	.	.	.	C	14.67	2.603668	0.46423	.	.	ENSG00000111666	ENST00000229266;ENST00000549872;ENST00000543999	T;T	0.46819	0.87;0.86	5.82	4.93	0.64822	.	0.000000	0.85682	D	0.000000	T	0.64746	0.2626	L	0.56769	1.78	0.80722	D	1	D;D	0.89917	1.0;0.995	D;P	0.91635	0.999;0.844	T	0.62369	-0.6869	10	0.29301	T	0.29	-5.6625	16.7625	0.85516	0.0:0.8613:0.1387:0.0	.	334;334	F8W1B3;Q8WUD6	.;CHPT1_HUMAN	V	334;334;167	ENSP00000229266:L334V;ENSP00000448766:L334V	ENSP00000229266:L334V	L	+	1	0	CHPT1	100641691	1.000000	0.71417	1.000000	0.80357	0.257000	0.26127	5.734000	0.68580	1.457000	0.47850	-0.219000	0.12488	CTT	CHPT1	-	pirsf_CHOPT	ENSG00000111666		0.279	CHPT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHPT1	HGNC	protein_coding	OTTHUMT00000409173.1	152	0.00	0	C	NM_020244		102117560	102117560	+1	no_errors	ENST00000229266	ensembl	human	known	69_37n	missense	154	30.63	68	SNP	1.000	G
CHRDL1	91851	genome.wustl.edu	37	X	110035316	110035316	+	Splice_Site	SNP	G	G	A			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chrX:110035316G>A	ENST00000372045.1	-	2	207	c.76C>T	c.(76-78)Cat>Tat	p.H26Y	CHRDL1_ENST00000434224.1_Splice_Site_p.H32Y|CHRDL1_ENST00000394797.4_Splice_Site_p.H32Y|CHRDL1_ENST00000444321.2_Splice_Site_p.H32Y|CHRDL1_ENST00000218054.4_Splice_Site_p.H32Y|CHRDL1_ENST00000372042.1_Splice_Site_p.H32Y|CHRDL1_ENST00000482160.1_Splice_Site_p.H32Y			Q9BU40	CRDL1_HUMAN	chordin-like 1	26					BMP signaling pathway (GO:0030509)|cell differentiation (GO:0030154)|compound eye development (GO:0048749)|eye development (GO:0001654)|negative regulation of BMP signaling pathway (GO:0030514)|nervous system development (GO:0007399)|ossification (GO:0001503)	extracellular region (GO:0005576)				endometrium(1)|large_intestine(12)|liver(1)|lung(15)|prostate(1)|skin(1)	31						AGACACTTACGTTTTACTTGC	0.348																																						dbGAP											0													91.0	77.0	82.0					X																	110035316		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AL049176	CCDS14553.1, CCDS48148.1, CCDS48149.1, CCDS48150.1, CCDS48148.2	Xq23	2014-01-31			ENSG00000101938	ENSG00000101938			29861	protein-coding gene	gene with protein product		300350	"""megalocornea 1 (X-linked)"""	MGC1		11441185, 11118896, 22284829	Standard	NM_001143981		Approved	NRLN1, CHL	uc004eow.3	Q9BU40	OTTHUMG00000022199	ENST00000372045.1:c.76+1C>T	X.37:g.110035316G>A			B1AKD0|B4DMP3|D3DUY6|E9PGS5|Q539E4|Q9Y3H7	Missense_Mutation	SNP	pfam_VWF_C,smart_VWF_C,pfscan_VWF_C	p.H32Y	ENST00000372045.1	37	c.94		X	.	.	.	.	.	.	.	.	.	.	G	2.967	-0.213392	0.06140	.	.	ENSG00000101938	ENST00000372045;ENST00000434224;ENST00000218054;ENST00000394797;ENST00000372042;ENST00000482160;ENST00000444321	T;T;T;T;T;T;T	0.29397	2.29;1.57;2.29;2.29;2.55;1.57;2.29	5.06	3.26	0.37387	.	0.365142	0.31797	N	0.007044	T	0.12860	0.0312	L	0.27053	0.805	0.80722	D	1	P;B;B;B;B;B;B	0.43938	0.822;0.001;0.001;0.0;0.001;0.001;0.143	B;B;B;B;B;B;B	0.18871	0.022;0.0;0.001;0.0;0.0;0.001;0.023	T	0.11743	-1.0575	9	.	.	.	-1.091	7.0867	0.25261	0.093:0.0:0.7368:0.1701	.	32;32;26;11;26;32;32	B4DMP3;E9PGS5;Q9BU40-2;Q59FB2;Q9BU40;D3DUY6;D3YTA8	.;.;.;.;CRDL1_HUMAN;.;.	Y	26;32;32;32;32;32;32	ENSP00000361115:H26Y;ENSP00000389627:H32Y;ENSP00000218054:H32Y;ENSP00000378276:H32Y;ENSP00000361112:H32Y;ENSP00000418443:H32Y;ENSP00000399739:H32Y	.	H	-	1	0	CHRDL1	109921972	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.664000	0.46783	0.576000	0.29452	0.506000	0.49869	CAT	CHRDL1	-	NULL	ENSG00000101938		0.348	CHRDL1-001	KNOWN	basic	protein_coding	CHRDL1	HGNC	protein_coding	OTTHUMT00000057912.1	134	0.00	0	G	NM_145234	Missense_Mutation	110035316	110035316	-1	no_errors	ENST00000372042	ensembl	human	known	69_37n	missense	55	38.89	35	SNP	1.000	A
FNTB	2342	genome.wustl.edu	37	14	65482433	65482433	+	Splice_Site	SNP	G	G	C	rs368832309		TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr14:65482433G>C	ENST00000246166.2	+	4	607	c.373G>C	c.(373-375)Gat>Cat	p.D125H	FNTB_ENST00000542227.1_Splice_Site_p.D79H|FNTB_ENST00000555742.1_3'UTR|CHURC1-FNTB_ENST00000549987.1_Splice_Site_p.D160H|MAX_ENST00000341653.2_Intron|FNTB_ENST00000447296.2_Splice_Site_p.D159H|AL139022.1_ENST00000577601.1_RNA	NM_002028.3	NP_002019.1	P49356	FNTB_HUMAN	farnesyltransferase, CAAX box, beta	125					negative regulation of cell proliferation (GO:0008285)|phototransduction, visible light (GO:0007603)|positive regulation of cell cycle (GO:0045787)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|protein farnesylation (GO:0018343)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to cytokine (GO:0034097)|response to inorganic substance (GO:0010035)|response to organic cyclic compound (GO:0014070)|rhodopsin mediated signaling pathway (GO:0016056)|wound healing (GO:0042060)	cytosol (GO:0005829)|microtubule associated complex (GO:0005875)|protein farnesyltransferase complex (GO:0005965)	farnesyltranstransferase activity (GO:0004311)|protein farnesyltransferase activity (GO:0004660)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14				all cancers(60;0.00115)|OV - Ovarian serous cystadenocarcinoma(108;0.00412)|BRCA - Breast invasive adenocarcinoma(234;0.011)		AGTGGCTACAGAGTGAGTCTG	0.453																																						dbGAP											0													100.0	90.0	94.0					14																	65482433		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS9769.1	14q23.3	2011-09-28			ENSG00000257365	ENSG00000257365			3785	protein-coding gene	gene with protein product		134636				8276393	Standard	NM_002028		Approved	FPTB		P49356	OTTHUMG00000142811	ENST00000246166.2:c.374+1G>C	14.37:g.65482433G>C			B2RDX6|B4E1A0	Missense_Mutation	SNP	pfam_Prenyltrans,pfam_Transcrpt_activator_Churchill,superfamily_Terpenoid_cyclase/PrenylTrfase	p.D159H	ENST00000246166.2	37	c.475	CCDS9769.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.6|23.6	4.431849|4.431849	0.83776|0.83776	.|.	.|.	ENSG00000125954;ENSG00000125954;ENSG00000125954;ENSG00000257365|ENSG00000257365	ENST00000542227;ENST00000549987;ENST00000447296;ENST00000246166|ENST00000555372	T;T;T;T|.	0.44881|.	0.91;0.91;0.91;0.91|.	5.82|5.82	5.82|5.82	0.92795|0.92795	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);|.	0.043821|.	0.85682|.	D|.	0.000000|.	T|T	0.76069|0.76069	0.3936|0.3936	M|M	0.69523|0.69523	2.12|2.12	0.80722|0.80722	D|D	1|1	D;D;D;B|.	0.76494|.	0.999;0.992;0.997;0.434|.	D;P;P;B|.	0.68765|.	0.96;0.765;0.852;0.154|.	T|T	0.73852|0.73852	-0.3852|-0.3852	10|5	0.44086|.	T|.	0.13|.	-13.168|-13.168	18.8715|18.8715	0.92317|0.92317	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	128;79;159;125|.	Q86TX8;B4E1A0;B4DL54;P49356|.	.;.;.;FNTB_HUMAN|.	H|Q	79;160;159;125|125	ENSP00000443140:D79H;ENSP00000447121:D160H;ENSP00000406393:D159H;ENSP00000246166:D125H|.	ENSP00000246166:D125H|.	D|E	+|+	1|1	0|0	FNTB;AL139022.1|AL139022.1	64552186|64552186	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.894000|0.894000	0.52154|0.52154	8.350000|8.350000	0.90069|0.90069	2.760000|2.760000	0.94817|0.94817	0.655000|0.655000	0.94253|0.94253	GAT|GAA	CHURC1-FNTB	-	superfamily_Terpenoid_cyclase/PrenylTrfase	ENSG00000125954		0.453	FNTB-001	KNOWN	basic|CCDS	protein_coding	CHURC1-FNTB	HGNC	protein_coding	OTTHUMT00000286392.1	93	0.00	0	G	NM_002028	Missense_Mutation	65482433	65482433	+1	no_errors	ENST00000447296	ensembl	human	known	69_37n	missense	101	27.34	38	SNP	1.000	C
CILP2	148113	genome.wustl.edu	37	19	19654870	19654870	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr19:19654870C>T	ENST00000291495.5	+	8	1601	c.1516C>T	c.(1516-1518)Cag>Tag	p.Q506*	CILP2_ENST00000586018.1_Nonsense_Mutation_p.Q512*	NM_153221.2	NP_694953.2	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	506						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	32						CACCGCCTACCAGGGCGACTT	0.667																																						dbGAP											0													25.0	28.0	27.0					19																	19654870		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF542080	CCDS12405.1	19p13.11	2013-01-14				ENSG00000160161		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24213	protein-coding gene	gene with protein product		612419				12477932	Standard	NM_153221		Approved	MGC45771	uc002nmv.4	Q8IUL8		ENST00000291495.5:c.1516C>T	19.37:g.19654870C>T	ENSP00000291495:p.Gln506*		Q6NV88|Q8N4A6|Q8WV21	Nonsense_Mutation	SNP	pfam_Thrombospondin_1_rpt,pfam_Ig_I-set,superfamily_Thrombospondin_1_rpt,superfamily_CarboxyPept-like_regulatory,superfamily_Carb-bd-like_fold,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like	p.Q506*	ENST00000291495.5	37	c.1516	CCDS12405.1	19	.	.	.	.	.	.	.	.	.	.	C	20.6	4.012606	0.75161	.	.	ENSG00000160161	ENST00000291495	.	.	.	3.94	3.94	0.45596	.	0.066001	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-24.3182	9.0604	0.36431	0.2199:0.7801:0.0:0.0	.	.	.	.	X	506	.	ENSP00000291495:Q506X	Q	+	1	0	CILP2	19515870	1.000000	0.71417	1.000000	0.80357	0.332000	0.28634	1.691000	0.37721	1.764000	0.52075	0.423000	0.28283	CAG	CILP2	-	superfamily_Carb-bd-like_fold	ENSG00000160161		0.667	CILP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	CILP2	HGNC	protein_coding	OTTHUMT00000459738.3	29	0.00	0	C	NM_153221		19654870	19654870	+1	no_errors	ENST00000291495	ensembl	human	known	69_37n	nonsense	28	24.32	9	SNP	1.000	T
CNGB1	1258	genome.wustl.edu	37	16	57921825	57921825	+	Silent	SNP	G	G	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr16:57921825G>T	ENST00000251102.8	-	32	3456	c.3396C>A	c.(3394-3396)ctC>ctA	p.L1132L	CNGB1_ENST00000564448.1_Silent_p.L1126L	NM_001297.4	NP_001288.3	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1	1132					cation transport (GO:0006812)|cytosolic calcium ion homeostasis (GO:0051480)|detection of light stimulus involved in visual perception (GO:0050908)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|protein heterotetramerization (GO:0051290)|regulation of membrane potential (GO:0042391)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina homeostasis (GO:0001895)|rhodopsin mediated signaling pathway (GO:0016056)|sensory perception of smell (GO:0007608)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|intracellular cyclic nucleotide activated cation channel complex (GO:0017071)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)|transmembrane transporter complex (GO:1902495)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(7)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(11)|liver(1)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	54						GCCGGGCCCGGAGGTGAGCAA	0.612																																					Colon(156;1293 1853 16336 28962 38659)	dbGAP											0													91.0	96.0	95.0					16																	57921825		1921	4114	6035	-	-	-	SO:0001819	synonymous_variant	0			AF042498	CCDS42169.1, CCDS45495.1, CCDS67042.1	16q13	2013-02-14			ENSG00000070729	ENSG00000070729		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2151	protein-coding gene	gene with protein product	"""glutamic acid-rich protein"""	600724		CNCG2, CNCG3L		8766832, 7590744, 16382102	Standard	NM_001297		Approved	RCNC2, RCNCb, GARP, GAR1, CNGB1B, RP45	uc002emt.2	Q14028	OTTHUMG00000154810	ENST00000251102.8:c.3396C>A	16.37:g.57921825G>T			H3BN09|O43636|Q13059|Q14029|Q9UMG2	Silent	SNP	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.L1132	ENST00000251102.8	37	c.3396	CCDS42169.1	16																																																																																			CNGB1	-	NULL	ENSG00000070729		0.612	CNGB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNGB1	HGNC	protein_coding	OTTHUMT00000337167.2	59	0.00	0	G	NM_001297		57921825	57921825	-1	no_errors	ENST00000251102	ensembl	human	known	69_37n	silent	26	27.78	10	SNP	0.006	T
COL4A2	1284	genome.wustl.edu	37	13	111117840	111117840	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr13:111117840G>T	ENST00000360467.5	+	25	2171	c.1865G>T	c.(1864-1866)gGa>gTa	p.G622V	COL4A2-AS2_ENST00000458403.2_RNA	NM_001846.2	NP_001837.2	P08572	CO4A2_HUMAN	collagen, type IV, alpha 2	622	Triple-helical region.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of angiogenesis (GO:0016525)|transcription, DNA-templated (GO:0006351)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	extracellular matrix structural constituent (GO:0005201)			NS(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|liver(2)|lung(48)|ovary(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	80	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			GGCCCCCCAGGACTGGGCCTT	0.637																																						dbGAP											0													35.0	39.0	38.0					13																	111117840		1820	4079	5899	-	-	-	SO:0001583	missense	0			AK025912	CCDS41907.1	13q34	2013-09-05			ENSG00000134871	ENSG00000134871		"""Collagens"""	2203	protein-coding gene	gene with protein product	"""canstatin"", ""collagen type IV alpha 2"""	120090				2439508, 3025878	Standard	NM_001846		Approved	FLJ22259, DKFZp686I14213	uc001vqx.3	P08572	OTTHUMG00000017344	ENST00000360467.5:c.1865G>T	13.37:g.111117840G>T	ENSP00000353654:p.Gly622Val		Q14052|Q548C3|Q5VZA9|Q66K23	Missense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.G622V	ENST00000360467.5	37	c.1865	CCDS41907.1	13	.	.	.	.	.	.	.	.	.	.	G	11.26	1.587718	0.28268	.	.	ENSG00000134871	ENST00000360467;ENST00000257309	D	0.99637	-6.29	4.65	4.65	0.58169	.	0.000000	0.49305	D	0.000145	D	0.99579	0.9848	M	0.81239	2.535	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98034	1.0378	10	0.62326	D	0.03	.	17.1381	0.86745	0.0:0.0:1.0:0.0	.	622	P08572	CO4A2_HUMAN	V	622	ENSP00000353654:G622V	ENSP00000257309:G622V	G	+	2	0	COL4A2	109915841	1.000000	0.71417	0.088000	0.20740	0.013000	0.08279	3.630000	0.54273	2.136000	0.66102	0.462000	0.41574	GGA	COL4A2	-	NULL	ENSG00000134871		0.637	COL4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A2	HGNC	protein_coding	OTTHUMT00000045761.2	30	0.00	0	G	NM_001846		111117840	111117840	+1	no_errors	ENST00000360467	ensembl	human	known	69_37n	missense	46	19.30	11	SNP	0.981	T
COLEC12	81035	genome.wustl.edu	37	18	331727	331727	+	Silent	SNP	G	G	A			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr18:331727G>A	ENST00000400256.3	-	8	2211	c.2004C>T	c.(2002-2004)ctC>ctT	p.L668L		NM_130386.2	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12	668	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	46		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)				CTGAGTCTGTGAGGCCGATCC	0.473																																						dbGAP											0													154.0	130.0	138.0					18																	331727		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB038518	CCDS32782.1	18p11.32	2013-09-19			ENSG00000158270	ENSG00000158270		"""Collectins"""	16016	protein-coding gene	gene with protein product		607621				11162630	Standard	NM_130386		Approved	SRCL, CL-P1, SCARA4	uc002kkm.3	Q5KU26	OTTHUMG00000178145	ENST00000400256.3:c.2004C>T	18.37:g.331727G>A			Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Silent	SNP	pfam_C-type_lectin,pfam_Collagen,superfamily_C-type_lectin_fold,smart_C-type_lectin,prints_AntifreezeII,pfscan_C-type_lectin	p.L668	ENST00000400256.3	37	c.2004	CCDS32782.1	18																																																																																			COLEC12	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,prints_AntifreezeII,pfscan_C-type_lectin	ENSG00000158270		0.473	COLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COLEC12	HGNC	protein_coding	OTTHUMT00000440746.1	192	0.52	1	G			331727	331727	-1	no_errors	ENST00000400256	ensembl	human	known	69_37n	silent	117	31.98	55	SNP	0.983	A
CRYGA	1418	genome.wustl.edu	37	2	209025769	209025769	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr2:209025769C>T	ENST00000304502.4	-	3	303	c.284G>A	c.(283-285)aGa>aAa	p.R95K		NM_014617.3	NP_055432.2	P11844	CRGA_HUMAN	crystallin, gamma A	95	Beta/gamma crystallin 'Greek key' 3. {ECO:0000255|PROSITE-ProRule:PRU00028}.				lens development in camera-type eye (GO:0002088)|visual perception (GO:0007601)		structural constituent of eye lens (GO:0005212)			endometrium(1)|kidney(3)|large_intestine(1)|lung(7)	12				Epithelial(149;0.067)|LUSC - Lung squamous cell carcinoma(261;0.0708)|Lung(261;0.135)		GTAGTCATCTCTCTCGTACAG	0.483																																						dbGAP											0													79.0	72.0	74.0					2																	209025769		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33367.1	2q34	2013-02-14			ENSG00000168582	ENSG00000168582			2408	protein-coding gene	gene with protein product	"""gamma crystallin 5"""	123660		CRYG1			Standard	NM_014617		Approved	CRYG5, CRY-g-A		P11844	OTTHUMG00000154796	ENST00000304502.4:c.284G>A	2.37:g.209025769C>T	ENSP00000302105:p.Arg95Lys		Q53ST5	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.R95K	ENST00000304502.4	37	c.284	CCDS33367.1	2	.	.	.	.	.	.	.	.	.	.	C	7.760	0.705218	0.15172	.	.	ENSG00000168582	ENST00000304502	T	0.74632	-0.86	4.69	4.69	0.59074	Beta/gamma crystallin (5);Gamma-crystallin-related (1);	0.108358	0.56097	D	0.000023	T	0.64249	0.2581	L	0.45744	1.44	0.39121	D	0.961652	B	0.10296	0.003	B	0.14023	0.01	T	0.59899	-0.7367	10	0.25106	T	0.35	.	8.9539	0.35805	0.0:0.9003:0.0:0.0997	.	95	P11844	CRGA_HUMAN	K	95	ENSP00000302105:R95K	ENSP00000302105:R95K	R	-	2	0	CRYGA	208734014	0.416000	0.25424	0.979000	0.43373	0.023000	0.10783	1.215000	0.32431	2.573000	0.86826	0.650000	0.86243	AGA	CRYGA	-	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	ENSG00000168582		0.483	CRYGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRYGA	HGNC	protein_coding	OTTHUMT00000337096.1	55	0.00	0	C	NM_014617		209025769	209025769	-1	no_errors	ENST00000304502	ensembl	human	known	69_37n	missense	42	23.64	13	SNP	0.963	T
CTAGE5	4253	genome.wustl.edu	37	14	39796100	39796100	+	Nonsense_Mutation	SNP	C	C	T	rs545600752	byFrequency	TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr14:39796100C>T	ENST00000280083.3	+	20	2019	c.1705C>T	c.(1705-1707)Cag>Tag	p.Q569*	CTAGE5_ENST00000553352.1_Nonsense_Mutation_p.Q540*|CTAGE5_ENST00000396165.4_Nonsense_Mutation_p.Q540*|CTAGE5_ENST00000557038.1_Nonsense_Mutation_p.Q489*|RP11-407N17.3_ENST00000603904.1_Nonsense_Mutation_p.Q540*|CTAGE5_ENST00000396158.2_Nonsense_Mutation_p.Q574*|CTAGE5_ENST00000348007.3_Nonsense_Mutation_p.Q526*|CTAGE5_ENST00000341502.5_Nonsense_Mutation_p.Q569*|CTAGE5_ENST00000341749.3_Nonsense_Mutation_p.Q557*|RP11-407N17.3_ENST00000553728.1_Nonsense_Mutation_p.Q1104*|CTAGE5_ENST00000556148.1_Nonsense_Mutation_p.Q494*			O15320	CTGE5_HUMAN	CTAGE family, member 5	569	Pro-rich.				positive regulation of catalytic activity (GO:0043085)	membrane (GO:0016020)	enzyme activator activity (GO:0008047)		CTAGE5/SIP1(2)	breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0475)		TCTGGACCATCAGATTACCAA	0.423																																						dbGAP											0													111.0	105.0	107.0					14																	39796100		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U94780	CCDS9673.1, CCDS9674.1, CCDS9675.1, CCDS9676.1, CCDS58316.1, CCDS58317.1	14q21.1	2009-09-11	2004-08-24	2004-08-26	ENSG00000150527	ENSG00000150527			7057	protein-coding gene	gene with protein product		602132	"""meningioma expressed antigen 6 (coiled-coil proline-rich)"""	MGEA, MGEA6		9356211, 11149944	Standard	NM_203355		Approved	MEA6, cTAGE-5A, cTAGE-5B, cTAGE-5C, cTAGE-5D, MGEA11	uc001wvi.4	O15320	OTTHUMG00000140258	ENST00000280083.3:c.1705C>T	14.37:g.39796100C>T	ENSP00000280083:p.Gln569*		B3KRA6|B4DQS6|D3DSA6|G3XAC5|O00169|Q6MZN2|Q6P2R8|Q86TF6|Q8IX92|Q8IX93	Nonsense_Mutation	SNP	NULL	p.Q574*	ENST00000280083.3	37	c.1720	CCDS9674.1	14	.	.	.	.	.	.	.	.	.	.	C	42	9.808910	0.99270	.	.	ENSG00000258941;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527	ENST00000553728;ENST00000341749;ENST00000557038;ENST00000382245;ENST00000396165;ENST00000341502;ENST00000396158;ENST00000280083;ENST00000556148;ENST00000348007;ENST00000553352	.	.	.	5.63	4.72	0.59763	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.9863	0.41843	0.133:0.6725:0.1944:0.0	.	.	.	.	X	1104;557;489;531;540;569;574;569;494;526;540	.	.	Q	+	1	0	CTAGE5;RP11-407N17.3	38865851	0.990000	0.36364	0.786000	0.31890	0.902000	0.53008	2.653000	0.46691	1.477000	0.48234	0.655000	0.94253	CAG	CTAGE5	-	NULL	ENSG00000150527		0.423	CTAGE5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	CTAGE5	HGNC	protein_coding	OTTHUMT00000276771.2	279	0.00	0	C	NM_005930		39796100	39796100	+1	no_errors	ENST00000396158	ensembl	human	known	69_37n	nonsense	294	16.71	59	SNP	0.906	T
CYLC2	1539	genome.wustl.edu	37	9	105767684	105767684	+	Silent	SNP	G	G	C			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr9:105767684G>C	ENST00000374798.3	+	5	841	c.771G>C	c.(769-771)tcG>tcC	p.S257S	CYLC2_ENST00000487798.1_Silent_p.S257S	NM_001340.3	NP_001331.1	Q14093	CYLC2_HUMAN	cylicin, basic protein of sperm head cytoskeleton 2	257	31 X 3 AA repeats of K-K-X.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)	41		all_hematologic(171;0.125)				GTGATGAATCGAAGGATGCCA	0.383																																						dbGAP											0													122.0	115.0	117.0					9																	105767684		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z46788	CCDS35085.1	9q31.2	2008-07-21			ENSG00000155833	ENSG00000155833			2583	protein-coding gene	gene with protein product		604035				7737358	Standard	NM_001340		Approved		uc004bbs.2	Q14093	OTTHUMG00000020396	ENST00000374798.3:c.771G>C	9.37:g.105767684G>C			B2R8F4|Q5VVJ9	Silent	SNP	NULL	p.S257	ENST00000374798.3	37	c.771	CCDS35085.1	9																																																																																			CYLC2	-	NULL	ENSG00000155833		0.383	CYLC2-001	KNOWN	alternative_3_UTR|NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	CYLC2	HGNC	protein_coding	OTTHUMT00000053463.3	101	0.00	0	G	NM_001340		105767684	105767684	+1	no_errors	ENST00000374798	ensembl	human	putative	69_37n	silent	117	13.33	18	SNP	0.000	C
DEFB132	400830	genome.wustl.edu	37	20	239786	239786	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr20:239786G>T	ENST00000382376.3	+	2	170	c.127G>T	c.(127-129)Gag>Tag	p.E43*		NM_207469.2	NP_997352.1	Q7Z7B7	DB132_HUMAN	defensin, beta 132	43					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				breast(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	4						CCACTGGGGGGAGACAGCATT	0.527																																						dbGAP											0													153.0	119.0	130.0					20																	239786		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF525932	CCDS12993.1	20p13	2009-12-04	2008-10-23		ENSG00000186458	ENSG00000186458		"""Defensins, beta"""	33806	protein-coding gene	gene with protein product						18416833	Standard	NM_207469		Approved	RP5-1103G7.6, DEFB32	uc002wdb.3	Q7Z7B7	OTTHUMG00000043061	ENST00000382376.3:c.127G>T	20.37:g.239786G>T	ENSP00000371813:p.Glu43*		B2RP72|Q4QY40	Nonsense_Mutation	SNP	NULL	p.E43*	ENST00000382376.3	37	c.127	CCDS12993.1	20	.	.	.	.	.	.	.	.	.	.	G	14.61	2.587972	0.46110	.	.	ENSG00000186458	ENST00000382376	.	.	.	3.05	3.05	0.35203	.	0.000000	0.36167	N	0.002753	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	9.8406	0.40996	0.0:0.0:1.0:0.0	.	.	.	.	X	43	.	ENSP00000371813:E43X	E	+	1	0	DEFB132	187786	0.318000	0.24598	0.016000	0.15963	0.002000	0.02628	3.040000	0.49799	2.020000	0.59435	0.655000	0.94253	GAG	DEFB132	-	NULL	ENSG00000186458		0.527	DEFB132-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB132	HGNC	protein_coding	OTTHUMT00000101365.1	116	0.00	0	G	NM_207469		239786	239786	+1	no_errors	ENST00000382376	ensembl	human	known	69_37n	nonsense	57	32.94	28	SNP	0.017	T
DENND5B	160518	genome.wustl.edu	37	12	31632879	31632879	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr12:31632879C>T	ENST00000389082.5	-	3	812	c.548G>A	c.(547-549)aGa>aAa	p.R183K	DENND5B_ENST00000306833.6_Missense_Mutation_p.R218K|DENND5B_ENST00000545147.1_Intron|DENND5B_ENST00000354285.4_Missense_Mutation_p.R205K|DENND5B_ENST00000536562.1_Missense_Mutation_p.R218K	NM_144973.3	NP_659410.3	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	183					positive regulation of Rab GTPase activity (GO:0032851)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						CAGGGTGTCTCTGCTAATATC	0.418																																						dbGAP											0													150.0	140.0	143.0					12																	31632879		1923	4137	6060	-	-	-	SO:0001583	missense	0			AF086301	CCDS44857.1	12p11.21	2012-10-03			ENSG00000170456	ENSG00000170456		"""DENN/MADD domain containing"""	28338	protein-coding gene	gene with protein product						12477932	Standard	NM_144973		Approved	MGC24039	uc001rki.1	Q6ZUT9	OTTHUMG00000169034	ENST00000389082.5:c.548G>A	12.37:g.31632879C>T	ENSP00000373734:p.Arg183Lys		B5ME75|Q59FW8|Q68CZ7|Q6NUJ0|Q7Z3F9|Q8N973|Q8WUC8	Missense_Mutation	SNP	pfam_DENN_dom,pfam_Run,pfam_uDENN_dom,pfam_dDENN_dom,pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,smart_Run,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom,pfscan_LipOase_LH2,pfscan_Run	p.R218K	ENST00000389082.5	37	c.653	CCDS44857.1	12	.	.	.	.	.	.	.	.	.	.	C	9.703	1.155060	0.21371	.	.	ENSG00000170456	ENST00000389082;ENST00000306833;ENST00000536562;ENST00000354285;ENST00000546299	T;T;T;T;T	0.06768	3.74;3.84;3.84;3.26;3.27	4.65	4.65	0.58169	.	0.000000	0.85682	D	0.000000	T	0.04770	0.0129	N	0.16903	0.455	0.54753	D	0.99998	B;B;B;B;B	0.16603	0.001;0.001;0.018;0.0;0.001	B;B;B;B;B	0.19148	0.003;0.003;0.024;0.002;0.003	T	0.21143	-1.0254	10	0.06099	T	0.92	-23.2708	11.24	0.48964	0.0:0.9165:0.0:0.0835	.	218;105;205;183;218	Q6ZUT9-2;Q6ZUT9-3;Q6ZUT9-4;Q6ZUT9;G3V1S3	.;.;.;DEN5B_HUMAN;.	K	183;218;218;205;135	ENSP00000373734:R183K;ENSP00000306482:R218K;ENSP00000444889:R218K;ENSP00000346238:R205K;ENSP00000442938:R135K	ENSP00000306482:R218K	R	-	2	0	DENND5B	31524146	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.452000	0.80683	2.413000	0.81919	0.655000	0.94253	AGA	DENND5B	-	NULL	ENSG00000170456		0.418	DENND5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND5B	HGNC	protein_coding	OTTHUMT00000402040.1	160	0.00	0	C	NM_144973		31632879	31632879	-1	no_errors	ENST00000306833	ensembl	human	known	69_37n	missense	104	21.80	29	SNP	1.000	T
DGCR6	8214	genome.wustl.edu	37	22	18893927	18893927	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr22:18893927G>A	ENST00000331444.6	+	1	192	c.40G>A	c.(40-42)Ggt>Agt	p.G14S	DGCR6_ENST00000413981.1_Intron|DGCR6_ENST00000608842.1_Missense_Mutation_p.G14S	NM_005675.4	NP_005666.2	Q14129	DGCR6_HUMAN	DiGeorge syndrome critical region gene 6	14					cell adhesion (GO:0007155)|organ morphogenesis (GO:0009887)	nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)				central_nervous_system(1)|cervix(1)|upper_aerodigestive_tract(1)	3						GGTGGCGGACGGTGCCCGGCA	0.741																																						dbGAP											0													13.0	14.0	13.0					22																	18893927		2186	4269	6455	-	-	-	SO:0001583	missense	0			X96484	CCDS13753.1	22q11.21	2008-06-12			ENSG00000183628	ENSG00000183628			2846	protein-coding gene	gene with protein product		601279				8733130	Standard	NM_005675		Approved		uc002zoh.4	Q14129	OTTHUMG00000150162	ENST00000331444.6:c.40G>A	22.37:g.18893927G>A	ENSP00000331681:p.Gly14Ser		B2RCH5|D3DX15|G5E9J8|Q9BY28	Missense_Mutation	SNP	pfam_DGCR6	p.G14S	ENST00000331444.6	37	c.40	CCDS13753.1	22	.	.	.	.	.	.	.	.	.	.	g	15.77	2.930590	0.52866	.	.	ENSG00000183628	ENST00000331444	T	0.27104	1.69	3.29	2.23	0.28157	.	0.365626	0.28077	N	0.016700	T	0.07234	0.0183	N	0.02802	-0.49	0.19775	N	0.999951	B	0.20780	0.048	B	0.14023	0.01	T	0.36065	-0.9763	10	0.06494	T	0.89	-25.1715	4.5888	0.12297	0.1295:0.2461:0.6244:0.0	.	14	Q14129	DGCR6_HUMAN	S	14	ENSP00000331681:G14S	ENSP00000331681:G14S	G	+	1	0	DGCR6	17273927	0.774000	0.28592	0.108000	0.21378	0.828000	0.46876	1.640000	0.37186	0.933000	0.37291	0.423000	0.28283	GGT	DGCR6	-	pfam_DGCR6	ENSG00000183628		0.741	DGCR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGCR6	HGNC	protein_coding	OTTHUMT00000316631.2	12	0.00	0	G	NM_005675		18893927	18893927	+1	no_errors	ENST00000331444	ensembl	human	known	69_37n	missense	24	27.27	9	SNP	0.592	A
DNAH14	127602	genome.wustl.edu	37	1	225334860	225334860	+	Intron	SNP	G	G	C			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr1:225334860G>C	ENST00000445597.2	+	18	3537				DNAH14_ENST00000439375.2_Missense_Mutation_p.D1600H|DNAH14_ENST00000430092.1_Missense_Mutation_p.D1600H			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14						microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						GAGTTGTTTTGATGAATTCAA	0.318																																						dbGAP											0													231.0	193.0	205.0					1																	225334860		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.3537+2530G>C	1.37:g.225334860G>C			A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,superfamily_Tautomerase,smart_AAA+_ATPase	p.D1600H	ENST00000445597.2	37	c.4798		1	.	.	.	.	.	.	.	.	.	.	G	11.68	1.711273	0.30322	.	.	ENSG00000185842	ENST00000430092;ENST00000439375;ENST00000328556	T;T;T	0.75154	-0.91;-0.91;-0.91	5.4	0.35	0.16037	.	0.224147	0.25052	U	0.033501	T	0.66416	0.2787	N	0.08118	0	0.52099	D	0.999942	D	0.76494	0.999	P	0.61003	0.882	T	0.66878	-0.5812	10	0.87932	D	0	.	10.0101	0.41981	0.3359:0.0:0.6641:0.0	.	1600	Q0VDD8-4	.	H	1600;1600;695	ENSP00000414402:D1600H;ENSP00000392061:D1600H;ENSP00000332424:D695H	ENSP00000332424:D695H	D	+	1	0	DNAH14	223401483	1.000000	0.71417	0.003000	0.11579	0.277000	0.26821	4.313000	0.59160	-0.181000	0.10619	-0.908000	0.02827	GAT	DNAH14	-	smart_AAA+_ATPase	ENSG00000185842		0.318	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	DNAH14	HGNC	protein_coding	OTTHUMT00000331217.3	164	0.00	0	G	XM_059166		225334860	225334860	+1	no_errors	ENST00000430092	ensembl	human	known	69_37n	missense	187	19.74	46	SNP	0.677	C
DNAH5	1767	genome.wustl.edu	37	5	13762836	13762836	+	Missense_Mutation	SNP	G	G	C	rs564215697		TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr5:13762836G>C	ENST00000265104.4	-	60	10380	c.10276C>G	c.(10276-10278)Ctg>Gtg	p.L3426V	DNAH5_ENST00000504001.3_5'Flank	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3426	Stalk. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CTTACCTTCAGAGGCAGTACT	0.502									Kartagener syndrome				G|||	1	0.000199681	0.0	0.0	5008	,	,		18838	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													54.0	55.0	55.0					5																	13762836		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.10276C>G	5.37:g.13762836G>C	ENSP00000265104:p.Leu3426Val		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.L3426V	ENST00000265104.4	37	c.10276	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	G	16.24	3.067866	0.55539	.	.	ENSG00000039139	ENST00000265104	T	0.74106	-0.81	5.31	4.32	0.51571	Dynein heavy chain, coiled coil stalk (1);	0.000000	0.64402	D	0.000001	D	0.87450	0.6180	H	0.95365	3.66	0.58432	D	0.999997	D	0.69078	0.997	D	0.75020	0.985	D	0.87435	0.2391	10	0.46703	T	0.11	.	6.3375	0.21304	0.2219:0.0:0.7781:0.0	.	3426	Q8TE73	DYH5_HUMAN	V	3426	ENSP00000265104:L3426V	ENSP00000265104:L3426V	L	-	1	2	DNAH5	13815836	1.000000	0.71417	1.000000	0.80357	0.442000	0.32017	3.438000	0.52871	2.490000	0.84030	0.305000	0.20034	CTG	DNAH5	-	NULL	ENSG00000039139		0.502	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	40	0.00	0	G	NM_001369		13762836	13762836	-1	no_errors	ENST00000265104	ensembl	human	known	69_37n	missense	57	17.39	12	SNP	1.000	C
DSCAML1	57453	genome.wustl.edu	37	11	117651335	117651335	+	Silent	SNP	G	G	A			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr11:117651335G>A	ENST00000321322.6	-	2	418	c.417C>T	c.(415-417)aaC>aaT	p.N139N	DSCAML1_ENST00000527706.1_Intron	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	79	Ig-like C2-type 2.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		GCAGCGTCCCGTTGGCGTGGA	0.657																																						dbGAP											0													142.0	144.0	143.0					11																	117651335		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0				CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.417C>T	11.37:g.117651335G>A			Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.N139	ENST00000321322.6	37	c.417	CCDS8384.1	11																																																																																			DSCAML1	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000177103		0.657	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAML1	HGNC	protein_coding	OTTHUMT00000392907.2	152	0.00	0	G	NM_020693		117651335	117651335	-1	no_errors	ENST00000321322	ensembl	human	known	69_37n	silent	48	58.62	68	SNP	0.999	A
EDAR	10913	genome.wustl.edu	37	2	109546677	109546677	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr2:109546677G>A	ENST00000258443.2	-	3	503	c.73C>T	c.(73-75)Cga>Tga	p.R25*	EDAR_ENST00000376651.1_Nonsense_Mutation_p.R25*|EDAR_ENST00000409271.1_Nonsense_Mutation_p.R25*	NM_022336.3	NP_071731.1	Q9UNE0	EDAR_HUMAN	ectodysplasin A receptor	25					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|epidermis development (GO:0008544)|hair follicle development (GO:0001942)|odontogenesis of dentin-containing tooth (GO:0042475)|pigmentation (GO:0043473)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|salivary gland cavitation (GO:0060662)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	16						TATTCCGCTCGGGCTGAGCAC	0.587																																						dbGAP											0													78.0	71.0	74.0					2																	109546677		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF130988	CCDS2081.1	2q13	2013-05-22	2004-08-09		ENSG00000135960	ENSG00000135960		"""Tumor necrosis factor receptor superfamily"""	2895	protein-coding gene	gene with protein product		604095	"""ectodysplasin 1, anhidrotic receptor"""	ED3, DL		10431241, 9375732	Standard	NM_022336		Approved	ED5, EDA3, Edar, ED1R, EDA1R	uc002teq.4	Q9UNE0	OTTHUMG00000130982	ENST00000258443.2:c.73C>T	2.37:g.109546677G>A	ENSP00000258443:p.Arg25*		B2R9H2|B4DLC5|D3DX74|E9PC98|Q52LL5|Q9UND9	Nonsense_Mutation	SNP	pfam_Death,superfamily_DEATH-like	p.R25*	ENST00000258443.2	37	c.73	CCDS2081.1	2	.	.	.	.	.	.	.	.	.	.	G	32	5.131372	0.94473	.	.	ENSG00000135960	ENST00000409271;ENST00000258443;ENST00000376651	.	.	.	5.41	-1.74	0.08056	.	0.613559	0.18213	N	0.148114	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	-1.9769	7.9504	0.30012	0.0:0.1425:0.5042:0.3533	.	.	.	.	X	25	.	ENSP00000258443:R25X	R	-	1	2	EDAR	108913109	0.001000	0.12720	0.004000	0.12327	0.198000	0.23893	0.615000	0.24329	-0.201000	0.10284	-1.097000	0.02148	CGA	EDAR	-	NULL	ENSG00000135960		0.587	EDAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDAR	HGNC	protein_coding	OTTHUMT00000253595.1	52	0.00	0	G			109546677	109546677	-1	no_errors	ENST00000376651	ensembl	human	known	69_37n	nonsense	27	55.74	34	SNP	0.008	A
MICU2	221154	genome.wustl.edu	37	13	22070300	22070300	+	Splice_Site	SNP	C	C	G			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr13:22070300C>G	ENST00000382374.4	-	10	999		c.e10-1		MICU2_ENST00000479790.1_Splice_Site	NM_152726.2	NP_689939.1	Q8IYU8	MICU2_HUMAN	mitochondrial calcium uptake 2						mitochondrial calcium ion transport (GO:0006851)|negative regulation of mitochondrial calcium ion concentration (GO:0051562)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)	calcium channel complex (GO:0034704)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|uniplex complex (GO:1990246)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)										AACTAATGCTCTAATAAAGTA	0.313																																						dbGAP											0													64.0	65.0	65.0					13																	22070300		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK091907	CCDS9297.1	13q12.11	2013-03-13	2013-03-13	2013-03-13	ENSG00000165487	ENSG00000165487		"""EF-hand domain containing"""	31830	protein-coding gene	gene with protein product		610632	"""EF hand domain family A1"", ""EF-hand domain family, member A1"""	EFHA1		23409044	Standard	NM_152726		Approved		uc001uof.3	Q8IYU8	OTTHUMG00000067414	ENST00000382374.4:c.934-1G>C	13.37:g.22070300C>G			Q8N0T6|Q8NAX8	Splice_Site	SNP	-	e10-1	ENST00000382374.4	37	c.934-1	CCDS9297.1	13	.	.	.	.	.	.	.	.	.	.	C	15.91	2.972448	0.53614	.	.	ENSG00000165487	ENST00000382374	.	.	.	5.61	4.72	0.59763	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9887	0.80183	0.0:0.8654:0.1346:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	EFHA1	20968300	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	7.225000	0.78051	2.653000	0.90120	0.655000	0.94253	.	EFHA1	-	-	ENSG00000165487		0.313	MICU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFHA1	HGNC	protein_coding	OTTHUMT00000144355.1	68	0.00	0	C	NM_152726	Intron	22070300	22070300	-1	no_errors	ENST00000382374	ensembl	human	known	69_37n	splice_site	160	12.02	22	SNP	1.000	G
ENPP6	133121	genome.wustl.edu	37	4	185038159	185038159	+	Silent	SNP	G	G	A			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr4:185038159G>A	ENST00000296741.2	-	5	846	c.705C>T	c.(703-705)gtC>gtT	p.V235V		NM_153343.3	NP_699174.1	Q6UWR7	ENPP6_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 6	235					choline metabolic process (GO:0019695)|lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	glycerophosphocholine cholinephosphodiesterase activity (GO:0047390)|glycerophosphodiester phosphodiesterase activity (GO:0008889)|phosphoric diester hydrolase activity (GO:0008081)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|skin(2)	15		all_lung(41;7.99e-12)|Lung NSC(41;1.46e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;4.98e-27)|Epithelial(43;3.15e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.09e-12)|Colorectal(24;3.78e-05)|STAD - Stomach adenocarcinoma(60;4.5e-05)|COAD - Colon adenocarcinoma(29;0.000154)|GBM - Glioblastoma multiforme(59;0.000167)|BRCA - Breast invasive adenocarcinoma(30;0.000378)|LUSC - Lung squamous cell carcinoma(40;0.0151)		AGAAAATAATGACGTTCAGGC	0.507																																						dbGAP											0													88.0	77.0	81.0					4																	185038159		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK057370	CCDS3834.1	4q35.1	2008-02-05			ENSG00000164303	ENSG00000164303			23409	protein-coding gene	gene with protein product							Standard	NM_153343		Approved	MGC33971	uc003iwc.3	Q6UWR7	OTTHUMG00000160617	ENST00000296741.2:c.705C>T	4.37:g.185038159G>A			Q4W5Q1|Q96M57	Silent	SNP	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.V235	ENST00000296741.2	37	c.705	CCDS3834.1	4																																																																																			ENPP6	-	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	ENSG00000164303		0.507	ENPP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP6	HGNC	protein_coding	OTTHUMT00000361428.1	104	0.95	1	G	NM_153343		185038159	185038159	-1	no_errors	ENST00000296741	ensembl	human	known	69_37n	silent	49	25.76	17	SNP	0.955	A
ERAP2	64167	genome.wustl.edu	37	5	96215756	96215756	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr5:96215756C>G	ENST00000437043.3	+	2	1078	c.367C>G	c.(367-369)Cag>Gag	p.Q123E	ERAP2_ENST00000379904.4_Missense_Mutation_p.Q123E|CTD-2260A17.2_ENST00000501338.1_Intron|ERAP2_ENST00000510309.1_Missense_Mutation_p.Q123E	NM_001130140.1|NM_022350.3	NP_001123612.1|NP_071745.1	Q6P179	ERAP2_HUMAN	endoplasmic reticulum aminopeptidase 2	123					antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|regulation of blood pressure (GO:0008217)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24		all_cancers(142;0.000311)|all_epithelial(76;1.54e-06)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0596)|Ovarian(225;0.105)		COAD - Colon adenocarcinoma(37;0.0703)		TGCCACCCTTCAGTCAGAGGA	0.423																																						dbGAP											0													73.0	66.0	68.0					5																	96215756		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF191545	CCDS4086.1	5q15	2007-11-21			ENSG00000164308	ENSG00000164308			29499	protein-coding gene	gene with protein product	"""leukocyte-derived arginine aminopeptidase"""	609497				12799365, 15908954	Standard	NM_022350		Approved	L-RAP, LRAP	uc003kmt.3	Q6P179	OTTHUMG00000128718	ENST00000437043.3:c.367C>G	5.37:g.96215756C>G	ENSP00000400376:p.Gln123Glu		Q7Z5K1|Q8TD32|Q8WVJ4|Q9HBX2	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.Q123E	ENST00000437043.3	37	c.367	CCDS4086.1	5	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.757298	0.00657	.	.	ENSG00000164308	ENST00000437043;ENST00000510373;ENST00000513084;ENST00000379904;ENST00000510309	T;T;T;T;T	0.02446	4.29;4.29;4.29;5.11;4.29	3.46	0.679	0.17975	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	1.540240	0.03652	N	0.241132	T	0.02380	0.0073	N	0.16790	0.44	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.45906	-0.9229	10	0.25751	T	0.34	.	5.5764	0.17225	0.0:0.6294:0.0:0.3706	.	123;123	Q6P179-3;Q6P179	.;ERAP2_HUMAN	E	123	ENSP00000400376:Q123E;ENSP00000421175:Q123E;ENSP00000421849:Q123E;ENSP00000369235:Q123E;ENSP00000425758:Q123E	ENSP00000369235:Q123E	Q	+	1	0	ERAP2	96241512	0.003000	0.15002	0.032000	0.17829	0.784000	0.44337	0.447000	0.21710	0.126000	0.18424	0.467000	0.42956	CAG	ERAP2	-	pfam_Peptidase_M1_N	ENSG00000164308		0.423	ERAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERAP2	HGNC	protein_coding	OTTHUMT00000250623.2	68	0.00	0	C	NM_022350		96215756	96215756	+1	no_errors	ENST00000437043	ensembl	human	known	69_37n	missense	78	12.36	11	SNP	0.004	G
ERGIC3	51614	genome.wustl.edu	37	20	34130641	34130641	+	Silent	SNP	A	A	G			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr20:34130641A>G	ENST00000348547.2	+	4	395	c.318A>G	c.(316-318)caA>caG	p.Q106Q	ERGIC3_ENST00000357394.4_Silent_p.Q106Q|ERGIC3_ENST00000279052.6_Silent_p.Q106Q|ERGIC3_ENST00000447986.1_Silent_p.Q106Q	NM_015966.2	NP_057050.1	Q9Y282	ERGI3_HUMAN	ERGIC and golgi 3	106					vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)	16	Lung NSC(9;0.00489)|all_lung(11;0.00729)		BRCA - Breast invasive adenocarcinoma(18;0.0127)			TGTTCAAGCAACGACTAGATA	0.537																																						dbGAP											0													142.0	109.0	120.0					20																	34130641		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF077030	CCDS13257.1, CCDS13258.1	20q11.22	2013-09-19	2006-01-19	2006-01-19	ENSG00000125991	ENSG00000125991			15927	protein-coding gene	gene with protein product			"""serologically defined breast cancer antigen 84"", ""chromosome 20 open reading frame 47"""	SDBCAG84, C20orf47		10810093	Standard	NM_015966		Approved	CGI-54, PRO0989, NY-BR-84, Erv46	uc002xcs.3	Q9Y282	OTTHUMG00000032346	ENST00000348547.2:c.318A>G	20.37:g.34130641A>G			Q5JWS3|Q6ZWP7|Q9H276|Q9P1L3	Missense_Mutation	SNP	pfam_DUF1692	p.N105S	ENST00000348547.2	37	c.314	CCDS13257.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.556|9.556	1.117145|1.117145	0.20795|0.20795	.|.	.|.	ENSG00000125991|ENSG00000125991	ENST00000416206|ENST00000413587	.|.	.|.	.|.	5.25|5.25	-2.81|-2.81	0.05805|0.05805	.|.	.|.	.|.	.|.	.|.	T|T	0.65407|0.65407	0.2688|0.2688	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.64947|0.64947	-0.6287|-0.6287	4|4	.|.	.|.	.|.	-21.2255|-21.2255	14.7849|14.7849	0.69796|0.69796	0.3943:0.0:0.6057:0.0|0.3943:0.0:0.6057:0.0	.|.	.|.	.|.	.|.	S|A	105|108	.|.	.|.	N|T	+|+	2|1	0|0	ERGIC3|ERGIC3	33594055|33594055	1.000000|1.000000	0.71417|0.71417	0.912000|0.912000	0.35992|0.35992	0.906000|0.906000	0.53458|0.53458	0.750000|0.750000	0.26334|0.26334	-0.425000|-0.425000	0.07371|0.07371	0.254000|0.254000	0.18369|0.18369	AAC|ACG	ERGIC3	-	NULL	ENSG00000125991		0.537	ERGIC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERGIC3	HGNC	protein_coding	OTTHUMT00000078880.2	164	0.00	0	A	NM_015966		34130641	34130641	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000416206	ensembl	human	novel	69_37n	missense	67	24.72	22	SNP	0.996	G
FAM129B	64855	genome.wustl.edu	37	9	130286102	130286102	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr9:130286102C>T	ENST00000373312.3	-	5	658	c.445G>A	c.(445-447)Gcc>Acc	p.A149T	FAM129B_ENST00000468379.1_Intron|FAM129B_ENST00000373314.3_Missense_Mutation_p.A136T	NM_022833.2	NP_073744.2	Q96TA1	NIBL1_HUMAN	family with sequence similarity 129, member B	149	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				negative regulation of apoptotic process (GO:0043066)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						AGGATGGGGGCACTGCCCGAC	0.577											OREG0019507	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													119.0	106.0	110.0					9																	130286102		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF151783	CCDS35144.1, CCDS35145.1	9q34.13	2010-02-01	2006-11-23	2006-11-23	ENSG00000136830	ENSG00000136830			25282	protein-coding gene	gene with protein product		614045	"""chromosome 9 open reading frame 88"""	C9orf88		14702039, 19362540	Standard	XM_005252135		Approved	DKFZP434H0820, FLJ13518, FLJ22151, FLJ22298, bA356B19.6, MINERVA	uc004brh.3	Q96TA1	OTTHUMG00000020705	ENST00000373312.3:c.445G>A	9.37:g.130286102C>T	ENSP00000362409:p.Ala149Thr	1579	Q4LE55|Q5VVW6|Q5VVW7|Q9BUS2|Q9NT35	Missense_Mutation	SNP	pfscan_Pleckstrin_homology	p.A149T	ENST00000373312.3	37	c.445	CCDS35145.1	9	.	.	.	.	.	.	.	.	.	.	C	6.028	0.373589	0.11409	.	.	ENSG00000136830	ENST00000373314;ENST00000373312	T;T	0.16597	2.33;2.33	5.42	-1.09	0.09904	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.632610	0.15869	N	0.240616	T	0.07863	0.0197	L	0.29908	0.895	0.20074	N	0.999932	B;B	0.06786	0.001;0.001	B;B	0.09377	0.004;0.004	T	0.42344	-0.9457	10	0.02654	T	1	-14.9876	5.0352	0.14430	0.1335:0.4521:0.0:0.4144	.	136;149	Q96TA1-2;Q96TA1	.;NIBL1_HUMAN	T	136;149	ENSP00000362411:A136T;ENSP00000362409:A149T	ENSP00000362409:A149T	A	-	1	0	FAM129B	129325923	0.000000	0.05858	0.010000	0.14722	0.382000	0.30200	-3.651000	0.00403	-0.547000	0.06207	-0.314000	0.08810	GCC	FAM129B	-	pfscan_Pleckstrin_homology	ENSG00000136830		0.577	FAM129B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM129B	HGNC	protein_coding	OTTHUMT00000054196.1	93	0.00	0	C	NM_022833		130286102	130286102	-1	no_errors	ENST00000373312	ensembl	human	known	69_37n	missense	67	22.09	19	SNP	0.004	T
FBXO18	84893	genome.wustl.edu	37	10	5948419	5948419	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr10:5948419C>G	ENST00000362091.4	+	3	692	c.577C>G	c.(577-579)Cct>Gct	p.P193A	FBXO18_ENST00000379999.5_Missense_Mutation_p.P244A|FBXO18_ENST00000470089.1_3'UTR|FBXO18_ENST00000397269.3_5'UTR	NM_001258453.1|NM_178150.2	NP_001245382.1|NP_835363.1	Q8NFZ0	FBX18_HUMAN	F-box protein, helicase, 18	193					DNA catabolic process, endonucleolytic (GO:0000737)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of protein phosphorylation (GO:0001934)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)			NS(2)|breast(2)|kidney(2)|large_intestine(16)|lung(9)|ovary(2)|prostate(3)|skin(3)|stomach(1)	40						TGATCCCATTCCTGACTCATA	0.577																																						dbGAP											0													77.0	61.0	66.0					10																	5948419		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095343	CCDS7072.1, CCDS7073.1, CCDS73064.1	10p15.1	2004-08-24	2004-06-15		ENSG00000134452	ENSG00000134452		"""F-boxes /  ""other"""""	13620	protein-coding gene	gene with protein product		607222	"""F-box only protein 18"""			10531037, 11956208	Standard	NM_032807		Approved	FBH1, FLJ14590, Fbx18	uc001iit.4	Q8NFZ0	OTTHUMG00000017609	ENST00000362091.4:c.577C>G	10.37:g.5948419C>G	ENSP00000355415:p.Pro193Ala		Q5JVB0|Q5JVB1|Q7Z4Q6|Q7Z4R0|Q8N1P5|Q8N586|Q96E82|Q96K67|Q96SW7|Q9UFB2	Missense_Mutation	SNP	pfam_UvrD-like_ATP-bd,pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like	p.P244A	ENST00000362091.4	37	c.730	CCDS7072.1	10	.	.	.	.	.	.	.	.	.	.	C	14.80	2.644461	0.47258	.	.	ENSG00000134452	ENST00000362091;ENST00000379999	.	.	.	5.76	4.86	0.63082	.	0.000000	0.85682	D	0.000000	T	0.77082	0.4078	M	0.68952	2.095	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.998	T	0.79899	-0.1608	9	0.87932	D	0	-8.653	14.4239	0.67202	0.0:0.9289:0.0:0.071	.	244;193;119	Q8NFZ0-2;Q8NFZ0;Q2TAK1	.;FBX18_HUMAN;.	A	193;244	.	ENSP00000355415:P193A	P	+	1	0	FBXO18	5988425	1.000000	0.71417	0.388000	0.26195	0.000000	0.00434	4.845000	0.62853	1.440000	0.47531	-0.136000	0.14681	CCT	FBXO18	-	NULL	ENSG00000134452		0.577	FBXO18-009	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO18	HGNC	protein_coding	OTTHUMT00000046596.1	39	0.00	0	C	NM_032807		5948419	5948419	+1	no_errors	ENST00000379999	ensembl	human	known	69_37n	missense	17	48.48	16	SNP	0.998	G
FAM178A	55719	genome.wustl.edu	37	10	102676827	102676827	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr10:102676827G>C	ENST00000238961.4	+	3	1227	c.685G>C	c.(685-687)Gaa>Caa	p.E229Q	FAM178A_ENST00000370271.3_Missense_Mutation_p.E229Q|FAM178A_ENST00000370269.3_Missense_Mutation_p.E229Q	NM_018121.3	NP_060591.3	Q8IX21	F178A_HUMAN	family with sequence similarity 178, member A	229						chromatin (GO:0000785)|extracellular space (GO:0005615)|nucleus (GO:0005634)											CCACCCGGAAGAAAGCCCACT	0.493																																						dbGAP											0													53.0	55.0	54.0					10																	102676827		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF460991	CCDS7500.1, CCDS44470.1, CCDS65918.1	10q24.31	2008-07-18	2008-07-18	2008-07-18	ENSG00000119906	ENSG00000119906			17814	protein-coding gene	gene with protein product		610348	"""chromosome 10 open reading frame 6"""	C10orf6		12459258	Standard	NM_018121		Approved	FLJ10512, FLJ25012	uc001krs.3	Q8IX21	OTTHUMG00000018919	ENST00000238961.4:c.685G>C	10.37:g.102676827G>C	ENSP00000238961:p.Glu229Gln		A8K950|B1AL17|Q5W0L8|Q6GMU6|Q9NPE8	Missense_Mutation	SNP	NULL	p.E229Q	ENST00000238961.4	37	c.685	CCDS7500.1	10	.	.	.	.	.	.	.	.	.	.	G	14.46	2.541044	0.45280	.	.	ENSG00000119906	ENST00000370271;ENST00000238961;ENST00000370269	T;T;T	0.52754	0.65;1.29;1.28	5.8	4.89	0.63831	.	0.000000	0.53938	D	0.000043	T	0.52948	0.1766	N	0.24115	0.695	0.31847	N	0.622713	D;D;D	0.71674	0.994;0.998;0.998	P;D;D	0.80764	0.889;0.947;0.994	T	0.59747	-0.7396	10	0.72032	D	0.01	-20.3289	12.2296	0.54480	0.0808:0.0:0.9192:0.0	.	229;229;229	Q8IX21;B1AL17;B1AL16	F178A_HUMAN;.;.	Q	229	ENSP00000359294:E229Q;ENSP00000238961:E229Q;ENSP00000359292:E229Q	ENSP00000238961:E229Q	E	+	1	0	FAM178A	102666817	0.954000	0.32549	1.000000	0.80357	0.477000	0.33069	0.763000	0.26517	2.745000	0.94114	0.650000	0.86243	GAA	FAM178A	-	NULL	ENSG00000119906		0.493	FAM178A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM178A	HGNC	protein_coding	OTTHUMT00000049897.3	71	0.00	0	G			102676827	102676827	+1	no_errors	ENST00000370269	ensembl	human	known	69_37n	missense	22	31.25	10	SNP	1.000	C
FIZ1	84922	genome.wustl.edu	37	19	56109162	56109162	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr19:56109162G>A	ENST00000221665.3	-	2	159	c.70C>T	c.(70-72)Cac>Tac	p.H24Y	FIZ1_ENST00000592585.1_Missense_Mutation_p.H24Y|ZNF524_ENST00000301073.3_5'Flank	NM_032836.2	NP_116225.2	Q96SL8	FIZ1_HUMAN	FLT3-interacting zinc finger 1	24					positive regulation of protein phosphorylation (GO:0001934)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|receptor tyrosine kinase binding (GO:0030971)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)	11			BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		TCACTGCAGTGAAACGGGACC	0.687																																						dbGAP											0													26.0	26.0	26.0					19																	56109162		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK027674	CCDS12928.1	19q13.42	2013-01-08				ENSG00000179943		"""Zinc fingers, C2H2-type"""	25917	protein-coding gene	gene with protein product		609133				12566383	Standard	NM_032836		Approved	FLJ14768, ZNF798	uc002qli.4	Q96SL8		ENST00000221665.3:c.70C>T	19.37:g.56109162G>A	ENSP00000221665:p.His24Tyr		A2RU72|Q6ZMJ7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H24Y	ENST00000221665.3	37	c.70	CCDS12928.1	19	.	.	.	.	.	.	.	.	.	.	G	14.38	2.519369	0.44866	.	.	ENSG00000179943	ENST00000221665	T	0.08546	3.08	3.57	3.57	0.40892	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08403	0.0209	N	0.19112	0.55	0.28486	N	0.91471	P	0.49185	0.92	B	0.44085	0.44	T	0.12734	-1.0536	9	0.87932	D	0	-24.1657	14.463	0.67465	0.0:0.0:1.0:0.0	.	24	Q96SL8	FIZ1_HUMAN	Y	24	ENSP00000221665:H24Y	ENSP00000221665:H24Y	H	-	1	0	FIZ1	60800974	1.000000	0.71417	0.998000	0.56505	0.913000	0.54294	1.990000	0.40717	2.017000	0.59298	0.462000	0.41574	CAC	FIZ1	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000179943		0.687	FIZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FIZ1	HGNC	protein_coding	OTTHUMT00000453350.1	32	0.00	0	G	NM_032836		56109162	56109162	-1	no_errors	ENST00000221665	ensembl	human	known	69_37n	missense	27	22.86	8	SNP	1.000	A
FLG	2312	genome.wustl.edu	37	1	152276492	152276492	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr1:152276492C>T	ENST00000368799.1	-	3	10905	c.10870G>A	c.(10870-10872)Gag>Aag	p.E3624K	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3624	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCATGTCTCTCTCCTGCACTT	0.547									Ichthyosis																													dbGAP											0													272.0	219.0	237.0					1																	152276492		2201	4296	6497	-	-	-	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.10870G>A	1.37:g.152276492C>T	ENSP00000357789:p.Glu3624Lys		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.E3624K	ENST00000368799.1	37	c.10870	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	C	12.49	1.953398	0.34471	.	.	ENSG00000143631	ENST00000368799	T	0.01685	4.69	4.48	-0.0295	0.13917	.	.	.	.	.	T	0.00608	0.0020	L	0.51422	1.61	0.09310	N	1	P	0.36222	0.544	B	0.41723	0.365	T	0.38929	-0.9638	9	0.07030	T	0.85	.	2.9468	0.05848	0.1739:0.3874:0.3393:0.0994	.	3624	P20930	FILA_HUMAN	K	3624	ENSP00000357789:E3624K	ENSP00000357789:E3624K	E	-	1	0	FLG	150543116	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.069000	0.11542	0.209000	0.20645	0.502000	0.49764	GAG	FLG	-	pfam_Filaggrin	ENSG00000143631		0.547	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	521	0.00	0	C	NM_002016		152276492	152276492	-1	no_errors	ENST00000368799	ensembl	human	known	69_37n	missense	478	14.49	81	SNP	0.000	T
GSTK1	373156	genome.wustl.edu	37	7	142962324	142962324	+	Intron	SNP	C	C	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr7:142962324C>T	ENST00000358406.5	+	5	455				GSTK1_ENST00000443571.2_Intron|GSTK1_ENST00000409500.3_Intron|GSTK1_ENST00000479303.1_Missense_Mutation_p.R175C|AC073342.12_ENST00000427392.1_RNA	NM_015917.2	NP_057001.1	Q9Y2Q3	GSTK1_HUMAN	glutathione S-transferase kappa 1						epithelial cell differentiation (GO:0030855)|glutathione metabolic process (GO:0006749)|oxidation-reduction process (GO:0055114)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|peroxisome (GO:0005777)	glutathione peroxidase activity (GO:0004602)|glutathione transferase activity (GO:0004364)|protein disulfide oxidoreductase activity (GO:0015035)|receptor binding (GO:0005102)			lung(4)	4	Melanoma(164;0.059)				Glutathione(DB00143)	CTCCCCGCACCGCCTTCCTGC	0.602																																						dbGAP											0													45.0	39.0	41.0					7																	142962324		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0				CCDS5877.1, CCDS47730.1, CCDS47731.1, CCDS47732.1	7q34	2012-06-21			ENSG00000197448	ENSG00000197448	2.5.1.18	"""Glutathione S-transferases / Mitochondrial (kappa)"""	16906	protein-coding gene	gene with protein product		602321				12720545, 14742434	Standard	NM_015917		Approved	GST13	uc003wcj.3	Q9Y2Q3	OTTHUMG00000152637	ENST00000358406.5:c.385-30C>T	7.37:g.142962324C>T			B4DIH1|B4DSY2|Q6P4H0|Q7Z520|Q9P1S4	Missense_Mutation	SNP	pfam_DSBA-like_thioredoxin_dom,superfamily_Thioredoxin-like_fold	p.R175C	ENST00000358406.5	37	c.523	CCDS5877.1	7	.	.	.	.	.	.	.	.	.	.	C	9.506	1.104454	0.20632	.	.	ENSG00000197448	ENST00000479303	.	.	.	4.76	-0.766	0.11020	.	2.509600	0.01831	N	0.034667	T	0.25494	0.0620	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.08868	-1.0701	7	.	.	.	2.7496	4.4375	0.11557	0.0:0.4098:0.1609:0.4293	.	175	Q9Y2Q3-2	.	C	175	.	.	R	+	1	0	GSTK1	142672446	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.786000	0.04623	-0.019000	0.14055	-0.355000	0.07637	CGC	GSTK1	-	NULL	ENSG00000197448		0.602	GSTK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSTK1	HGNC	protein_coding	OTTHUMT00000327091.1	84	0.00	0	C	NM_015917		142962324	142962324	+1	no_errors	ENST00000479303	ensembl	human	known	69_37n	missense	50	21.88	14	SNP	0.000	T
GTF3A	2971	genome.wustl.edu	37	13	28001286	28001286	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr13:28001286C>G	ENST00000381140.4	+	2	453	c.259C>G	c.(259-261)Ctg>Gtg	p.L87V	GTF3A_ENST00000470606.1_3'UTR	NM_002097.2	NP_002088	Q92664	TF3A_HUMAN	general transcription factor IIIA	87					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)			breast(1)|lung(1)	2		Lung SC(185;0.0156)	Colorectal(13;0.00042)|READ - Rectum adenocarcinoma(15;0.105)	all cancers(112;0.11)|OV - Ovarian serous cystadenocarcinoma(117;0.158)		GGACTACCATCTGAGCCGCCA	0.453																																						dbGAP											0													71.0	64.0	66.0					13																	28001286		1568	3582	5150	-	-	-	SO:0001583	missense	0				CCDS45019.1	13q12.3-q13.1	2013-01-08			ENSG00000122034	ENSG00000122034		"""General transcription factors"", ""Zinc fingers, C2H2-type"""	4662	protein-coding gene	gene with protein product		600860				7789179	Standard	NM_002097		Approved	TFIIIA, AP2	uc001ure.2	Q92664	OTTHUMG00000016632	ENST00000381140.4:c.259C>G	13.37:g.28001286C>G	ENSP00000370532:p.Leu87Val		B7ZBK5|Q12963|Q13097	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L87V	ENST00000381140.4	37	c.259	CCDS45019.1	13	.	.	.	.	.	.	.	.	.	.	C	22.9	4.345077	0.82022	.	.	ENSG00000122034	ENST00000381140	T	0.52983	0.64	5.2	5.2	0.72013	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.145183	0.47093	D	0.000252	T	0.67748	0.2926	M	0.83852	2.665	0.36767	D	0.883617	D	0.56968	0.978	P	0.57425	0.82	T	0.75102	-0.3436	9	0.72032	D	0.01	-18.1704	17.2681	0.87093	0.0:1.0:0.0:0.0	.	87	Q92664	TF3A_HUMAN	V	87	ENSP00000370532:L87V	ENSP00000370532:L87V	L	+	1	2	GTF3A	26899286	1.000000	0.71417	0.998000	0.56505	0.842000	0.47809	4.804000	0.62554	2.576000	0.86940	0.655000	0.94253	CTG	GTF3A	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000122034		0.453	GTF3A-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	GTF3A	HGNC	protein_coding	OTTHUMT00000044281.2	167	0.60	1	C	NM_002097		28001286	28001286	+1	no_errors	ENST00000419181	ensembl	human	known	69_37n	missense	282	11.60	37	SNP	1.000	G
HIST1H2AJ	8331	genome.wustl.edu	37	6	27782245	27782245	+	Nonsense_Mutation	SNP	C	C	A			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr6:27782245C>A	ENST00000333151.3	-	1	362	c.274G>T	c.(274-276)Gag>Tag	p.E92*	HIST1H2BM_ENST00000359465.4_5'Flank	NM_021066.2	NP_066544.1	Q99878	H2A1J_HUMAN	histone cluster 1, H2aj	92						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(2)	11						TTGAGCTCCTCATCGTTGCGG	0.617																																						dbGAP											0													64.0	67.0	66.0					6																	27782245		2203	4292	6495	-	-	-	SO:0001587	stop_gained	0			Z83736	CCDS4628.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000182611	ENSG00000276368		"""Histones / Replication-dependent"""	4727	protein-coding gene	gene with protein product		602791	"""H2A histone family, member E"", ""histone 1, H2aj"""	H2AFE		9439656, 12408966	Standard	NM_021066		Approved	H2A/E	uc003njn.1	Q99878	OTTHUMG00000014486	ENST00000333151.3:c.274G>T	6.37:g.27782245C>A	ENSP00000328484:p.Glu92*		A2RUU6|Q5JXQ5	Nonsense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.E92*	ENST00000333151.3	37	c.274	CCDS4628.1	6	.	.	.	.	.	.	.	.	.	.	.	33	5.247263	0.95305	.	.	ENSG00000182611	ENST00000333151	.	.	.	4.15	4.15	0.48705	.	0.000000	0.32533	U	0.005973	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	16.6779	0.85284	0.0:1.0:0.0:0.0	.	.	.	.	X	92	.	ENSP00000328484:E92X	E	-	1	0	HIST1H2AJ	27890224	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.629000	0.67798	2.582000	0.87167	0.655000	0.94253	GAG	HIST1H2AJ	-	superfamily_Histone-fold,smart_Histone_H2A	ENSG00000182611		0.617	HIST1H2AJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2AJ	HGNC	protein_coding	OTTHUMT00000040154.1	144	0.00	0	C	NM_021066		27782245	27782245	-1	no_errors	ENST00000333151	ensembl	human	known	69_37n	nonsense	134	18.79	31	SNP	1.000	A
HM13	81502	genome.wustl.edu	37	20	30135465	30135465	+	Intron	SNP	C	C	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr20:30135465C>T	ENST00000340852.5	+	5	578				HM13_ENST00000398174.3_Intron|HM13_ENST00000492709.1_Intron|HM13_ENST00000376127.3_Intron|HM13_ENST00000335574.5_Intron	NM_030789.2	NP_110416.1	Q8TCT9	HM13_HUMAN	histocompatibility (minor) 13						membrane protein proteolysis (GO:0033619)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	aspartic endopeptidase activity, intramembrane cleaving (GO:0042500)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	12	all_cancers(5;3.44e-05)|Lung NSC(7;4.38e-06)|all_lung(7;7.65e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		all cancers(5;0.000479)|Colorectal(19;0.00202)|COAD - Colon adenocarcinoma(19;0.0264)			TCAAAATAGTCCGATGCCACG	0.398																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AL110115	CCDS13182.1, CCDS13183.1, CCDS42861.1	20q11.21	2012-02-21			ENSG00000101294	ENSG00000101294			16435	protein-coding gene	gene with protein product	"""signal peptide peptidase beta"", ""presenilin-like protein 3"", ""intramembrane protease"", ""signal peptide peptidase like 1"""	607106				12077416, 14704149	Standard	NM_030789		Approved	H13, dJ324O17.1, SPP, PSL3, IMP1, IMPAS, PSENL3, SPPL1	uc002wwc.3	Q8TCT9	OTTHUMG00000032175	ENST00000340852.5:c.455-1367C>T	20.37:g.30135465C>T			B2RAY5|E1P5L3|Q15K36|Q540H8|Q5JWP2|Q5JWP3|Q5JWP4|Q5JWP5|Q7Z4F2|Q86Y35|Q95H87|Q9H110|Q9H111	RNA	SNP	-	NULL	ENST00000340852.5	37	NULL	CCDS13182.1	20																																																																																			HM13	-	-	ENSG00000101294		0.398	HM13-011	KNOWN	basic|appris_principal|CCDS	protein_coding	HM13	HGNC	protein_coding	OTTHUMT00000078527.2	33	0.00	0	C	NM_178580		30135465	30135465	+1	no_errors	ENST00000479096	ensembl	human	known	69_37n	rna	20	23.08	6	SNP	0.168	T
INPP4A	3631	genome.wustl.edu	37	2	99189336	99189336	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr2:99189336G>C	ENST00000523221.1	+	22	2592	c.2592G>C	c.(2590-2592)caG>caC	p.Q864H	INPP4A_ENST00000409540.3_Missense_Mutation_p.Q825H|INPP4A_ENST00000409016.4_Missense_Mutation_p.Q825H|INPP4A_ENST00000545415.1_Missense_Mutation_p.Q825H|INPP4A_ENST00000409851.3_Missense_Mutation_p.Q859H|INPP4A_ENST00000074304.5_Missense_Mutation_p.Q864H|INPP4A_ENST00000409463.1_Missense_Mutation_p.Q193H			Q96PE3	INP4A_HUMAN	inositol polyphosphate-4-phosphatase, type I, 107kDa	864					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(1)|endometrium(9)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(4)|upper_aerodigestive_tract(4)	43						TTCTGGGTCAGAACGTGCATG	0.577																																						dbGAP											0													41.0	43.0	42.0					2																	99189336		1991	4169	6160	-	-	-	SO:0001583	missense	0			U26398	CCDS46369.1, CCDS46370.1, CCDS46371.1, CCDS46372.1	2q11.2	2008-05-27	2002-08-29		ENSG00000040933	ENSG00000040933			6074	protein-coding gene	gene with protein product		600916	"""inositol polyphosphate-4-phosphatase, type I, 107kD"""	INPP4		7608176, 9295334	Standard	NM_004027		Approved		uc002syy.3	Q96PE3	OTTHUMG00000153106	ENST00000523221.1:c.2592G>C	2.37:g.99189336G>C	ENSP00000427722:p.Gln864His		O15326|Q13187|Q53TD8|Q8TC02	Missense_Mutation	SNP	superfamily_C2_Ca/lipid-bd_dom_CaLB	p.Q864H	ENST00000523221.1	37	c.2592	CCDS46369.1	2	.	.	.	.	.	.	.	.	.	.	G	17.40	3.379452	0.61845	.	.	ENSG00000040933	ENST00000409016;ENST00000409851;ENST00000409463;ENST00000074304;ENST00000545415;ENST00000409540;ENST00000523221	T;T;T;T;T;T;T	0.44083	1.89;2.24;0.93;2.24;1.89;1.89;2.24	4.91	4.02	0.46733	.	0.129251	0.53938	D	0.000052	T	0.50752	0.1634	L	0.43923	1.385	0.58432	D	0.999999	D;D;B;D;D	0.76494	0.998;0.998;0.251;0.999;0.999	D;D;B;D;D	0.85130	0.984;0.996;0.159;0.997;0.997	T	0.51364	-0.8715	10	0.62326	D	0.03	-9.7297	5.9748	0.19373	0.2943:0.0:0.7057:0.0	.	825;825;193;864;859	Q96PE3-2;Q96PE3-4;B8ZZB2;Q96PE3;Q96PE3-3	.;.;.;INP4A_HUMAN;.	H	825;859;193;864;825;825;864	ENSP00000386704:Q825H;ENSP00000386777:Q859H;ENSP00000386329:Q193H;ENSP00000074304:Q864H;ENSP00000442149:Q825H;ENSP00000387294:Q825H;ENSP00000427722:Q864H	ENSP00000074304:Q864H	Q	+	3	2	INPP4A	98555768	1.000000	0.71417	0.999000	0.59377	0.865000	0.49528	3.724000	0.54962	1.281000	0.44480	0.462000	0.41574	CAG	INPP4A	-	NULL	ENSG00000040933		0.577	INPP4A-009	KNOWN	basic|CCDS	protein_coding	INPP4A	HGNC	protein_coding	OTTHUMT00000376095.1	107	0.00	0	G	NM_001566		99189336	99189336	+1	no_errors	ENST00000074304	ensembl	human	known	69_37n	missense	60	22.08	17	SNP	1.000	C
KCNN3	3782	genome.wustl.edu	37	1	154842199	154842200	+	In_Frame_Ins	INS	-	-	GCT	rs56352724|rs3831942|rs367921715|rs58327065		TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr1:154842199_154842200insGCT	ENST00000271915.4	-	1	556_557	c.241_242insAGC	c.(241-243)cca>cAGCca	p.80_81insQ	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	80	Gln-rich.		Missing.		potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)	p.Q80_P81insQQ(2)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	GGGATGCGGTGgctgctgctgc	0.698																																						dbGAP											2	Insertion - In frame(2)	prostate(2)																																								-	-	-	SO:0001652	inframe_insertion	0			AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.239_241dupAGC	1.37:g.154842206_154842208dupGCT	ENSP00000271915:p.Gln80_Gln80dup		B1ANX0|O43517|Q86VF9|Q8WXG7	In_Frame_Ins	INS	pfam_K_chnl_Ca-activ_SK,pfam_CaM-bd_dom,pfam_Ion_trans_2,superfamily_CaM-bd_dom,prints_K_chnl_Ca-activ_SK	p.81in_frame_insQ	ENST00000271915.4	37	c.242_241	CCDS30880.1	1																																																																																			KCNN3	-	NULL	ENSG00000143603		0.698	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	KCNN3	HGNC	protein_coding	OTTHUMT00000090688.3	60	0.00	0	-	NM_002249		154842199	154842200	-1	no_errors	ENST00000271915	ensembl	human	known	69_37n	in_frame_ins	82	22.64	24	INS	0.748:0.982	GCT
JMJD4	65094	genome.wustl.edu	37	1	227921783	227921783	+	Intron	SNP	G	G	C			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr1:227921783G>C	ENST00000366758.3	-	3	566				JMJD4_ENST00000485807.1_5'UTR|SNAP47_ENST00000366759.4_5'Flank|SNAP47_ENST00000366760.1_Intron|SNAP47_ENST00000480897.1_3'UTR|JMJD4_ENST00000438896.2_Intron|SNAP47_ENST00000315781.5_5'Flank	NM_023007.2	NP_075383.2	Q9H9V9	JMJD4_HUMAN	jumonji domain containing 4											endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)	9		Prostate(94;0.0885)				GGCACGAGGAGACTAGGGCAG	0.627																																						dbGAP											0													59.0	48.0	52.0					1																	227921783		2202	4299	6501	-	-	-	SO:0001627	intron_variant	0			AK022579	CCDS1561.1, CCDS59203.1	1q42.13	2008-02-05			ENSG00000081692	ENSG00000081692			25724	protein-coding gene	gene with protein product						12477932	Standard	NM_023007		Approved	FLJ12517	uc001hrb.3	Q9H9V9	OTTHUMG00000037698	ENST00000366758.3:c.567-50C>G	1.37:g.227921783G>C			Q5TBZ1|Q5TBZ6|Q9H970	RNA	SNP	-	NULL	ENST00000366758.3	37	NULL	CCDS1561.1	1																																																																																			JMJD4	-	-	ENSG00000081692		0.627	JMJD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	JMJD4	HGNC	protein_coding	OTTHUMT00000091970.1	55	0.00	0	G	NM_023007		227921783	227921783	-1	no_errors	ENST00000465251	ensembl	human	known	69_37n	rna	43	20.37	11	SNP	0.000	C
KCTD19	146212	genome.wustl.edu	37	16	67338408	67338408	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr16:67338408C>T	ENST00000304372.5	-	3	422	c.367G>A	c.(367-369)Gag>Aag	p.E123K	KCTD19_ENST00000562860.1_Intron	NM_001100915.1	NP_001094385.1	Q17RG1	KCD19_HUMAN	potassium channel tetramerization domain containing 19	123					protein homooligomerization (GO:0051260)					endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)	23		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0311)|Epithelial(162;0.0906)		GATGCTCTCTCAGCAACAGGT	0.448																																						dbGAP											0													173.0	172.0	172.0					16																	67338408		1998	4174	6172	-	-	-	SO:0001583	missense	0			AK097481	CCDS42179.1	16q22.1	2013-06-20	2013-06-20			ENSG00000168676			24753	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 19"""				Standard	NM_001100915		Approved	FLJ40162	uc002esu.2	Q17RG1		ENST00000304372.5:c.367G>A	16.37:g.67338408C>T	ENSP00000305702:p.Glu123Lys		B4DZ49|Q8N804	Missense_Mutation	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold	p.E123K	ENST00000304372.5	37	c.367	CCDS42179.1	16	.	.	.	.	.	.	.	.	.	.	C	19.77	3.888595	0.72524	.	.	ENSG00000168676	ENST00000304372	T	0.69435	-0.4	5.98	5.98	0.97165	.	0.000000	0.64402	D	0.000002	T	0.72301	0.3443	N	0.24115	0.695	0.35729	D	0.8178	D	0.69078	0.997	D	0.75020	0.985	T	0.77925	-0.2405	10	0.56958	D	0.05	-6.2211	17.1626	0.86807	0.0:1.0:0.0:0.0	.	123	Q17RG1	KCD19_HUMAN	K	123	ENSP00000305702:E123K	ENSP00000305702:E123K	E	-	1	0	KCTD19	65895909	0.997000	0.39634	1.000000	0.80357	0.851000	0.48451	3.519000	0.53458	2.838000	0.97847	0.655000	0.94253	GAG	KCTD19	-	NULL	ENSG00000168676		0.448	KCTD19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD19	HGNC	protein_coding	OTTHUMT00000422061.1	202	0.00	0	C	XM_085367		67338408	67338408	-1	no_errors	ENST00000304372	ensembl	human	known	69_37n	missense	68	33.33	34	SNP	1.000	T
KDELC1	79070	genome.wustl.edu	37	13	103446142	103446142	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr13:103446142C>T	ENST00000376004.4	-	3	739	c.403G>A	c.(403-405)Gag>Aag	p.E135K	KDELC1_ENST00000460338.1_5'UTR	NM_024089.2	NP_076994.2	Q6UW63	KDEL1_HUMAN	KDEL (Lys-Asp-Glu-Leu) containing 1	135						endoplasmic reticulum lumen (GO:0005788)				central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(1)	19	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					TCACAGTTCTCATGGTAAACC	0.428																																						dbGAP											0													87.0	84.0	85.0					13																	103446142		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC001297	CCDS9504.1	13q33	2010-11-18			ENSG00000134901	ENSG00000134901			19350	protein-coding gene	gene with protein product		611613					Standard	NM_024089		Approved	MGC5302, EP58	uc001vpq.4	Q6UW63	OTTHUMG00000017307	ENST00000376004.4:c.403G>A	13.37:g.103446142C>T	ENSP00000365172:p.Glu135Lys		Q53HL3|Q9BVD2	Missense_Mutation	SNP	pfam_LipoPS_modifying,pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,smart_LipoPS_modifying,pfscan_Filamin/ABP280_repeat-like	p.E135K	ENST00000376004.4	37	c.403	CCDS9504.1	13	.	.	.	.	.	.	.	.	.	.	C	35	5.532759	0.96446	.	.	ENSG00000134901	ENST00000376004	T	0.23348	1.91	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.52869	0.1761	M	0.83953	2.67	0.80722	D	1	D	0.61080	0.989	P	0.58077	0.832	T	0.58183	-0.7681	10	0.87932	D	0	.	19.8418	0.96692	0.0:1.0:0.0:0.0	.	135	Q6UW63	KDEL1_HUMAN	K	135	ENSP00000365172:E135K	ENSP00000365172:E135K	E	-	1	0	KDELC1	102244143	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	7.752000	0.85141	2.685000	0.91497	0.561000	0.74099	GAG	KDELC1	-	NULL	ENSG00000134901		0.428	KDELC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDELC1	HGNC	protein_coding	OTTHUMT00000045699.1	126	0.00	0	C			103446142	103446142	-1	no_errors	ENST00000376004	ensembl	human	known	69_37n	missense	151	14.69	26	SNP	1.000	T
KIF3A	11127	genome.wustl.edu	37	5	132034940	132034940	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr5:132034940C>G	ENST00000378746.4	-	16	2192	c.1974G>C	c.(1972-1974)gaG>gaC	p.E658D	KIF3A_ENST00000403231.1_Missense_Mutation_p.E685D|KIF3A_ENST00000378735.1_Missense_Mutation_p.E661D|AC004237.1_ENST00000431165.1_RNA|KIF3A_ENST00000487055.1_5'Flank	NM_007054.5	NP_008985.3	Q9Y496	KIF3A_HUMAN	kinesin family member 3A	658					anterior/posterior pattern specification (GO:0009952)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|dorsal/ventral neural tube patterning (GO:0021904)|epidermal stem cell homeostasis (GO:0036334)|epidermis development (GO:0008544)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|inner ear receptor stereocilium organization (GO:0060122)|kidney development (GO:0001822)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|organelle organization (GO:0006996)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of receptor-mediated endocytosis (GO:0048260)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|neuron projection (GO:0043005)|photoreceptor connecting cilium (GO:0032391)|primary cilium (GO:0072372)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|spectrin binding (GO:0030507)			endometrium(1)|kidney(4)|large_intestine(8)|lung(3)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	25		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GACGCAGACTCTCCTCAGTAT	0.448																																						dbGAP											0													197.0	169.0	178.0					5																	132034940		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF041853	CCDS34235.1, CCDS75295.1, CCDS75296.1	5q31	2012-08-01			ENSG00000131437	ENSG00000131437		"""Kinesins"""	6319	protein-coding gene	gene with protein product	"""kinesin family protein 3A"""	604683				1054846	Standard	XM_005271868		Approved	FLA10, KLP-20	uc003kxo.3	Q9Y496	OTTHUMG00000059725	ENST00000378746.4:c.1974G>C	5.37:g.132034940C>G	ENSP00000368020:p.Glu658Asp		A8MSW9|Q59EN1|Q86XE9|Q9Y6V4	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E661D	ENST00000378746.4	37	c.1983	CCDS34235.1	5	.	.	.	.	.	.	.	.	.	.	C	12.41	1.928583	0.34002	.	.	ENSG00000131437	ENST00000378746;ENST00000378735;ENST00000541316;ENST00000450441;ENST00000403231	T;T;T;T	0.10860	2.83;2.83;2.83;2.83	6.0	1.37	0.22104	.	0.000000	0.85682	D	0.000000	T	0.11922	0.0290	N	0.20483	0.58	0.54753	D	0.999988	P;P;P;P	0.52842	0.956;0.956;0.956;0.956	P;P;P;P	0.62184	0.899;0.899;0.899;0.899	T	0.24440	-1.0160	10	0.13108	T	0.6	.	8.1475	0.31121	0.0:0.4968:0.0:0.5032	.	685;685;658;684	E9PES4;B4DHG8;Q9Y496;Q2UVF2	.;.;KIF3A_HUMAN;.	D	658;661;685;144;685	ENSP00000368020:E658D;ENSP00000368009:E661D;ENSP00000405619:E144D;ENSP00000385808:E685D	ENSP00000368009:E661D	E	-	3	2	KIF3A	132062839	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	1.388000	0.34442	0.345000	0.23873	0.650000	0.86243	GAG	KIF3A	-	NULL	ENSG00000131437		0.448	KIF3A-001	KNOWN	basic|CCDS	protein_coding	KIF3A	HGNC	protein_coding	OTTHUMT00000132788.3	133	0.75	1	C	NM_007054		132034940	132034940	-1	no_errors	ENST00000378735	ensembl	human	known	69_37n	missense	175	23.81	55	SNP	1.000	G
KIF4A	24137	genome.wustl.edu	37	X	69606486	69606486	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chrX:69606486G>T	ENST00000374403.3	+	19	2135	c.2053G>T	c.(2053-2055)Gag>Tag	p.E685*	KIF4A_ENST00000374388.3_Nonsense_Mutation_p.E685*	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	685	Interaction with PRC1.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						GAGGCAATATGAGCTGCTGAA	0.373																																						dbGAP											0													78.0	70.0	73.0					X																	69606486		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.2053G>T	X.37:g.69606486G>T	ENSP00000363524:p.Glu685*		B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Nonsense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E685*	ENST00000374403.3	37	c.2053	CCDS14401.1	X	.	.	.	.	.	.	.	.	.	.	G	39	7.837486	0.98516	.	.	ENSG00000090889	ENST00000374388;ENST00000374403	.	.	.	3.74	3.74	0.42951	.	0.000000	0.53938	D	0.000044	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	13.6772	0.62460	0.0:0.0:1.0:0.0	.	.	.	.	X	685	.	ENSP00000363509:E685X	E	+	1	0	KIF4A	69523211	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.717000	0.91425	1.842000	0.53543	0.468000	0.43344	GAG	KIF4A	-	NULL	ENSG00000090889		0.373	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF4A	HGNC	protein_coding	OTTHUMT00000057068.1	101	0.00	0	G	NM_012310		69606486	69606486	+1	no_errors	ENST00000374403	ensembl	human	known	69_37n	nonsense	51	25.00	17	SNP	1.000	T
KRTAP10-8	386681	genome.wustl.edu	37	21	46032257	46032257	+	Silent	SNP	C	C	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr21:46032257C>T	ENST00000334662.2	+	1	262	c.240C>T	c.(238-240)agC>agT	p.S80S	TSPEAR_ENST00000323084.4_Intron	NM_198695.2	NP_941968.2	P60410	KR108_HUMAN	keratin associated protein 10-8	80	19 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|skin(1)	17						CCCCAGTGAGCTGTGAGCCCA	0.672																																						dbGAP											0													54.0	58.0	57.0					21																	46032257		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB076355	CCDS13713.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000187766	ENSG00000187766		"""Keratin associated proteins"""	20525	protein-coding gene	gene with protein product			"""keratin associated protein 18-8"""	KRTAP18-8			Standard	NM_198695		Approved	KRTAP18.8, KAP10.8	uc002zfo.1	P60410	OTTHUMG00000057632	ENST00000334662.2:c.240C>T	21.37:g.46032257C>T			A0JNW4	Silent	SNP	pfam_PMG	p.S80	ENST00000334662.2	37	c.240	CCDS13713.1	21																																																																																			KRTAP10-8	-	pfam_PMG	ENSG00000187766		0.672	KRTAP10-8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-8	HGNC	protein_coding	OTTHUMT00000128035.1	99	0.00	0	C	NM_198695		46032257	46032257	+1	no_errors	ENST00000334662	ensembl	human	known	69_37n	silent	11	81.67	49	SNP	0.987	T
LAMC2	3918	genome.wustl.edu	37	1	183187608	183187608	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr1:183187608G>C	ENST00000264144.4	+	4	553	c.488G>C	c.(487-489)gGa>gCa	p.G163A	LAMC2_ENST00000493293.1_Missense_Mutation_p.G163A	NM_005562.2	NP_005553.2	Q13753	LAMC2_HUMAN	laminin, gamma 2	163	Laminin EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00460}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	cell cortex (GO:0005938)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-2 complex (GO:0005607)|laminin-5 complex (GO:0005610)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	heparin binding (GO:0008201)			breast(2)|endometrium(6)|kidney(8)|large_intestine(11)|lung(18)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55						GCTGTCACTGGAGAACGCTGT	0.542																																						dbGAP											0													38.0	36.0	37.0					1																	183187608		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z15008	CCDS1352.1, CCDS44285.1	1q25-q31	2013-03-01	2002-08-29		ENSG00000058085	ENSG00000058085		"""Laminins"""	6493	protein-coding gene	gene with protein product		150292	"""laminin, gamma 2 (nicein (100kD), kalinin (105kD), BM600 (100kD), Herlitz junctional epidermolysis bullosa))"""	EBR2, LAMB2T, LAMNB2, EBR2A		1383240	Standard	NM_005562		Approved	nicein-100kDa, kalinin-105kDa, BM600-100kDa	uc001gqa.2	Q13753	OTTHUMG00000035520	ENST00000264144.4:c.488G>C	1.37:g.183187608G>C	ENSP00000264144:p.Gly163Ala		Q02536|Q02537|Q13752|Q14941|Q14DF7|Q2M1N2|Q5VYE8	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_B_type_IV,superfamily_Growth_fac_rcpt,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin	p.G163A	ENST00000264144.4	37	c.488	CCDS1352.1	1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.285697	0.80803	.	.	ENSG00000058085	ENST00000493293;ENST00000537180;ENST00000264144	D;D	0.91843	-2.92;-2.92	5.26	5.26	0.73747	EGF-like, laminin (4);Growth factor, receptor (1);	0.000000	0.64402	D	0.000005	D	0.97483	0.9176	H	0.96633	3.855	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.98763	1.0725	10	0.87932	D	0	.	16.0124	0.80411	0.0:0.0:1.0:0.0	.	163;163	Q13753;Q13753-2	LAMC2_HUMAN;.	A	163	ENSP00000432063:G163A;ENSP00000264144:G163A	ENSP00000264144:G163A	G	+	2	0	LAMC2	181454231	1.000000	0.71417	0.963000	0.40424	0.991000	0.79684	5.796000	0.69080	2.440000	0.82611	0.655000	0.94253	GGA	LAMC2	-	pfam_EGF_laminin,superfamily_Growth_fac_rcpt,smart_EGF_laminin,smart_EGF-like,pfscan_EGF_laminin	ENSG00000058085		0.542	LAMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC2	HGNC	protein_coding	OTTHUMT00000086258.1	39	0.00	0	G	NM_005562		183187608	183187608	+1	no_errors	ENST00000264144	ensembl	human	known	69_37n	missense	32	20.00	8	SNP	1.000	C
LAMC3	10319	genome.wustl.edu	37	9	133924412	133924412	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr9:133924412G>A	ENST00000361069.4	+	9	1658	c.1525G>A	c.(1525-1527)Gaa>Aaa	p.E509K	LAMC3_ENST00000480883.1_Intron	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	509	Laminin IV type A. {ECO:0000255|PROSITE- ProRule:PRU00458}.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		TCTAGGAGCCGAAGGCTGGTG	0.667																																						dbGAP											0													20.0	22.0	21.0					9																	133924412		2091	4083	6174	-	-	-	SO:0001583	missense	0			AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.1525G>A	9.37:g.133924412G>A	ENSP00000354360:p.Glu509Lys		B1APX9|B1APY0|Q59H72	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,pfam_Laminin_B_type_IV,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.E509K	ENST00000361069.4	37	c.1525	CCDS6938.1	9	.	.	.	.	.	.	.	.	.	.	G	12.94	2.087390	0.36855	.	.	ENSG00000050555	ENST00000361069;ENST00000355048	T	0.29397	1.57	4.78	2.95	0.34219	Laminin B type IV (1);	0.566112	0.20245	N	0.096213	T	0.24084	0.0583	L	0.51422	1.61	0.09310	N	1	B	0.28783	0.222	B	0.23419	0.046	T	0.13045	-1.0524	10	0.32370	T	0.25	.	7.8284	0.29328	0.1887:0.0:0.8113:0.0	.	509	Q9Y6N6	LAMC3_HUMAN	K	509	ENSP00000354360:E509K	ENSP00000347156:E509K	E	+	1	0	LAMC3	132914233	0.000000	0.05858	0.001000	0.08648	0.884000	0.51177	0.409000	0.21082	0.758000	0.33059	-0.232000	0.12228	GAA	LAMC3	-	pfscan_Laminin_B_type_IV	ENSG00000050555		0.667	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC3	HGNC	protein_coding	OTTHUMT00000054717.3	34	0.00	0	G	NM_006059		133924412	133924412	+1	no_errors	ENST00000361069	ensembl	human	known	69_37n	missense	28	20.00	7	SNP	0.002	A
LCMT2	9836	genome.wustl.edu	37	15	43622033	43622033	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr15:43622033C>T	ENST00000305641.5	-	1	770	c.655G>A	c.(655-657)Gag>Aag	p.E219K	LCMT2_ENST00000544735.1_Intron|ADAL_ENST00000428046.3_5'Flank|LCMT2_ENST00000567039.1_Intron|ADAL_ENST00000422466.2_5'Flank|ADAL_ENST00000389651.4_5'Flank	NM_014793.4	NP_055608.2	O60294	TYW4_HUMAN	leucine carboxyl methyltransferase 2	219					tRNA processing (GO:0008033)		methyltransferase activity (GO:0008168)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(2)|liver(1)|lung(9)|skin(1)|urinary_tract(1)	20		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.1e-07)	L-Leucine(DB00149)	CTCATCTGCTCATAGACCACG	0.607																																						dbGAP											0													46.0	39.0	41.0					15																	43622033		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF265443	CCDS10094.1	15q15.3	2007-01-26			ENSG00000168806	ENSG00000168806			17558	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 4"""	611246				9628581, 17150819	Standard	NM_014793		Approved	KIAA0547, MGC9534, TYW4, PPM2	uc001zrg.3	O60294	OTTHUMG00000130705	ENST00000305641.5:c.655G>A	15.37:g.43622033C>T	ENSP00000307214:p.Glu219Lys		Q4JFT6|Q96B55|Q9NR10	Missense_Mutation	SNP	pfam_LCM_MeTrfase	p.E219K	ENST00000305641.5	37	c.655	CCDS10094.1	15	.	.	.	.	.	.	.	.	.	.	C	24.2	4.501006	0.85176	.	.	ENSG00000168806	ENST00000305641	T	0.26957	1.7	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.59404	0.2191	M	0.92026	3.265	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.67360	-0.5690	10	0.87932	D	0	-2.6391	14.535	0.67953	0.0:1.0:0.0:0.0	.	219	O60294	LCMT2_HUMAN	K	219	ENSP00000307214:E219K	ENSP00000307214:E219K	E	-	1	0	LCMT2	41409325	0.999000	0.42202	0.994000	0.49952	0.978000	0.69477	4.295000	0.59049	2.804000	0.96469	0.655000	0.94253	GAG	LCMT2	-	NULL	ENSG00000168806		0.607	LCMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCMT2	HGNC	protein_coding	OTTHUMT00000253205.1	43	0.00	0	C	NM_014793		43622033	43622033	-1	no_errors	ENST00000305641	ensembl	human	known	69_37n	missense	14	39.13	9	SNP	0.999	T
LMBR1L	55716	genome.wustl.edu	37	12	49500499	49500499	+	Intron	SNP	G	G	C			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr12:49500499G>C	ENST00000267102.8	-	2	500				LMBR1L_ENST00000547382.1_Intron|LMBR1L_ENST00000553204.1_Intron|LMBR1L_ENST00000395141.4_5'Flank	NM_018113.2	NP_060583.2	Q6UX01	LMBRL_HUMAN	limb development membrane protein 1-like						endocytosis (GO:0006897)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						ggagtaggtagacattgttac	0.468																																						dbGAP											0													63.0	54.0	56.0					12																	49500499		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AB033000	CCDS8780.2, CCDS73466.1	12q13.12	2013-08-05	2013-08-05		ENSG00000139636	ENSG00000139636			18268	protein-coding gene	gene with protein product		610007	"""limb region 1 homolog (mouse)-like"""			10574461, 11287427	Standard	XM_005269022		Approved	FLJ10494, KIAA1174	uc001rth.4	Q6UX01	OTTHUMG00000150511	ENST00000267102.8:c.157+244C>G	12.37:g.49500499G>C			Q969J4|Q96BY8|Q96HN8|Q9NT09|Q9NVE1|Q9NVU9|Q9ULP6	Missense_Mutation	SNP	NULL	p.S63C	ENST00000267102.8	37	c.188	CCDS8780.2	12																																																																																			LMBR1L	-	NULL	ENSG00000139636		0.468	LMBR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMBR1L	HGNC	protein_coding	OTTHUMT00000318696.1	54	0.00	0	G	NM_018113		49500499	49500499	-1	no_errors	ENST00000417750	ensembl	human	known	69_37n	missense	33	25.00	11	SNP	0.002	C
LRP4	4038	genome.wustl.edu	37	11	46897025	46897025	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr11:46897025C>G	ENST00000378623.1	-	27	4149	c.3907G>C	c.(3907-3909)Gac>Cac	p.D1303H	LRP4-AS1_ENST00000531719.1_RNA|LRP4-AS1_ENST00000502049.2_RNA	NM_002334.3	NP_002325.2	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein 4	1303					dendrite morphogenesis (GO:0048813)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|limb development (GO:0060173)|negative regulation of axonogenesis (GO:0050771)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of presynaptic membrane organization (GO:1901631)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|proximal/distal pattern formation (GO:0009954)|regulation of protein phosphorylation (GO:0001932)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|synapse organization (GO:0050808)|synaptic growth at neuromuscular junction (GO:0051124)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|synaptic membrane (GO:0097060)	calcium ion binding (GO:0005509)|receptor tyrosine kinase binding (GO:0030971)|scaffold protein binding (GO:0097110)			breast(7)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(24)|ovary(3)|pancreas(2)|prostate(5)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	70				Lung(87;0.159)		TGTGCCCGGTCCACAGCCTGC	0.587																																						dbGAP											0													41.0	38.0	39.0					11																	46897025		2201	4299	6500	-	-	-	SO:0001583	missense	0			AB011540	CCDS31478.1	11p11.2	2013-05-29			ENSG00000134569	ENSG00000134569		"""Low density lipoprotein receptors"""	6696	protein-coding gene	gene with protein product		604270				9693030	Standard	NM_002334		Approved	MEGF7, CLSS, LRP-4, SOST2	uc001ndn.4	O75096	OTTHUMG00000166700	ENST00000378623.1:c.3907G>C	11.37:g.46897025C>G	ENSP00000367888:p.Asp1303His		B2RN39|Q4AC85|Q5KTZ5	Missense_Mutation	SNP	pfam_LDLR_classB_rpt,pfam_LDrepeatLR_classA_rpt,pfam_EGF-like_Ca-bd,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.D1303H	ENST00000378623.1	37	c.3907	CCDS31478.1	11	.	.	.	.	.	.	.	.	.	.	C	15.98	2.992502	0.54041	.	.	ENSG00000134569	ENST00000378623	D	0.90620	-2.7	5.78	5.78	0.91487	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	T	0.80824	0.4697	N	0.04335	-0.225	0.80722	D	1	B	0.15141	0.012	B	0.15870	0.014	T	0.75294	-0.3368	10	0.12430	T	0.62	.	20.005	0.97433	0.0:1.0:0.0:0.0	.	1303	O75096	LRP4_HUMAN	H	1303	ENSP00000367888:D1303H	ENSP00000367888:D1303H	D	-	1	0	LRP4	46853601	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	5.845000	0.69437	2.745000	0.94114	0.555000	0.69702	GAC	LRP4	-	NULL	ENSG00000134569		0.587	LRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP4	HGNC	protein_coding	OTTHUMT00000391133.1	40	0.00	0	C	NM_002334		46897025	46897025	-1	no_errors	ENST00000378623	ensembl	human	known	69_37n	missense	22	26.67	8	SNP	1.000	G
MAP1B	4131	genome.wustl.edu	37	5	71492844	71492844	+	Missense_Mutation	SNP	C	C	G	rs6876207		TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr5:71492844C>G	ENST00000296755.7	+	5	3960	c.3662C>G	c.(3661-3663)tCt>tGt	p.S1221C		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	1221					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		TTCAGCAGATCTGCTTTACGT	0.458																																					Melanoma(17;367 822 11631 31730 47712)	dbGAP											0													76.0	66.0	69.0					5																	71492844		2203	4300	6503	-	-	-	SO:0001583	missense	0			L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.3662C>G	5.37:g.71492844C>G	ENSP00000296755:p.Ser1221Cys		A2BDK5	Missense_Mutation	SNP	pfam_MAP1B_neuraxin	p.S1221C	ENST00000296755.7	37	c.3662	CCDS4012.1	5	.	.	.	.	.	.	.	.	.	.	C	13.28	2.191107	0.38707	.	.	ENSG00000131711	ENST00000296755	T	0.04970	3.52	5.79	5.79	0.91817	.	0.000000	0.64402	D	0.000007	T	0.15176	0.0366	N	0.24115	0.695	0.47511	D	0.999446	D;D	0.76494	0.999;0.999	D;D	0.64042	0.921;0.921	T	0.01545	-1.1328	10	0.87932	D	0	-16.5845	20.032	0.97543	0.0:1.0:0.0:0.0	rs6876207;rs6876207	1095;1221	A2BDK6;P46821	.;MAP1B_HUMAN	C	1221	ENSP00000296755:S1221C	ENSP00000296755:S1221C	S	+	2	0	MAP1B	71528600	1.000000	0.71417	0.960000	0.40013	0.995000	0.86356	2.724000	0.47285	2.743000	0.94032	0.655000	0.94253	TCT	MAP1B	-	NULL	ENSG00000131711		0.458	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1B	HGNC	protein_coding	OTTHUMT00000218561.6	81	0.00	0	C	NM_005909		71492844	71492844	+1	no_errors	ENST00000296755	ensembl	human	known	69_37n	missense	77	17.20	16	SNP	0.991	G
MAP4K4	9448	genome.wustl.edu	37	2	102448266	102448266	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr2:102448266G>A	ENST00000347699.4	+	7	592	c.592G>A	c.(592-594)Gag>Aag	p.E198K	MAP4K4_ENST00000324219.4_Missense_Mutation_p.E198K|MAP4K4_ENST00000413150.2_Missense_Mutation_p.E198K|MAP4K4_ENST00000350878.4_Missense_Mutation_p.E178K|MAP4K4_ENST00000350198.4_Missense_Mutation_p.E198K|MAP4K4_ENST00000302217.5_Intron|MAP4K4_ENST00000456652.1_Intron|MAP4K4_ENST00000425019.1_Missense_Mutation_p.E198K	NM_001242559.1|NM_145687.3	NP_001229488.1|NP_663720.1	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase kinase 4	198	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of JNK cascade (GO:0046328)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						GATGGCTCCTGAGGTCATCGC	0.552											OREG0014845	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													78.0	76.0	77.0					2																	102448266		1971	4186	6157	-	-	-	SO:0001583	missense	0			AF096300	CCDS56130.1, CCDS74546.1	2q11.2-q12	2011-06-09			ENSG00000071054	ENSG00000071054		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6866	protein-coding gene	gene with protein product	"""HPK/GCK-like kinase"", ""hepatocyte progenitor kinase-like/germinal center kinase-like kinase"""	604666				9890973, 9734811, 9135144	Standard	NM_004834		Approved	HGK, NIK, FLH21957	uc002tbf.3	O95819	OTTHUMG00000155394	ENST00000347699.4:c.592G>A	2.37:g.102448266G>A	ENSP00000314363:p.Glu198Lys	1366	O75172|Q9NST7	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_cat_dom	p.E198K	ENST00000347699.4	37	c.592	CCDS56130.1	2	.	.	.	.	.	.	.	.	.	.	G	34	5.407774	0.96051	.	.	ENSG00000071054	ENST00000425019;ENST00000324219;ENST00000350198;ENST00000413150;ENST00000347699;ENST00000417294;ENST00000350878	T;T;T;T;T;T;D	0.81821	-0.17;-0.17;-0.17;-0.17;-0.17;-0.17;-1.54	6.06	6.06	0.98353	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.95475	0.8530	H	0.99867	4.865	0.80722	D	1	D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;0.996;0.998;1.0;0.994;0.994	D;D;D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;0.994;0.996;0.998;0.99;0.99	D	0.97061	0.9771	10	0.87932	D	0	.	20.6243	0.99512	0.0:0.0:1.0:0.0	.	178;198;198;178;198;198;198;198;198;198	B7Z388;B7Z3V5;E7ENQ1;E7ESS2;O95819-4;O95819;E7EN19;G3XAA2;O95819-2;G5E948	.;.;.;.;.;M4K4_HUMAN;.;.;.;.	K	198;198;198;198;198;160;178	ENSP00000392830:E198K;ENSP00000313644:E198K;ENSP00000281111:E198K;ENSP00000389752:E198K;ENSP00000314363:E198K;ENSP00000409720:E160K;ENSP00000343658:E178K	ENSP00000313644:E198K	E	+	1	0	MAP4K4	101814698	1.000000	0.71417	0.973000	0.42090	0.978000	0.69477	9.700000	0.98707	2.879000	0.98667	0.650000	0.86243	GAG	MAP4K4	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000071054		0.552	MAP4K4-001	KNOWN	basic|CCDS	protein_coding	MAP4K4	HGNC	protein_coding	OTTHUMT00000339839.1	170	0.00	0	G	NM_004834		102448266	102448266	+1	no_errors	ENST00000324219	ensembl	human	known	69_37n	missense	131	24.71	43	SNP	1.000	A
MCM3	4172	genome.wustl.edu	37	6	52146918	52146918	+	Silent	SNP	C	C	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr6:52146918C>T	ENST00000229854.7	-	4	532	c.456G>A	c.(454-456)aaG>aaA	p.K152K	MCM3_ENST00000596288.1_Silent_p.K197K|MCM3_ENST00000419835.2_Silent_p.K106K|MCM3_ENST00000476448.1_5'Flank			P25205	MCM3_HUMAN	minichromosome maintenance complex component 3	152					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	alpha DNA polymerase:primase complex (GO:0005658)|centrosome (GO:0005813)|intracellular membrane-bounded organelle (GO:0043231)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(4)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	20	Lung NSC(77;0.0931)					CTATGGTCTTCTTAGTAGCAG	0.483																																						dbGAP											0													161.0	141.0	148.0					6																	52146918		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X62153	CCDS4940.1, CCDS4940.2, CCDS75468.1	6p12	2008-02-05	2007-04-04		ENSG00000112118	ENSG00000112118			6945	protein-coding gene	gene with protein product		602693	"""minichromosome maintenance deficient (S. cerevisiae) 3"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae)"""			1549468	Standard	NM_002388		Approved		uc011dwu.2	P25205	OTTHUMG00000014844	ENST00000229854.7:c.456G>A	6.37:g.52146918C>T			B4DWW4|Q92660|Q9BTR3|Q9NUE7	Silent	SNP	pfam_MCM_DNA-dep_ATPase,pfam_Mg_chelatse_chII,superfamily_NA-bd_OB-fold-like,smart_MCM_DNA-dep_ATPase,smart_AAA+_ATPase,pfscan_MCM_DNA-dep_ATPase,prints_MCM_DNA-dep_ATPase,prints_MCM_3	p.K152	ENST00000229854.7	37	c.456		6																																																																																			MCM3	-	superfamily_NA-bd_OB-fold-like,smart_MCM_DNA-dep_ATPase	ENSG00000112118		0.483	MCM3-006	KNOWN	basic|appris_principal	protein_coding	MCM3	HGNC	protein_coding	OTTHUMT00000470784.1	103	0.96	1	C			52146918	52146918	-1	no_errors	ENST00000229854	ensembl	human	known	69_37n	silent	92	19.30	22	SNP	1.000	T
MIB2	142678	genome.wustl.edu	37	1	1565047	1565047	+	Missense_Mutation	SNP	C	C	G	rs146481628	byFrequency	TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr1:1565047C>G	ENST00000357210.4	+	19	2982	c.2766C>G	c.(2764-2766)atC>atG	p.I922M	MIB2_ENST00000378710.3_Missense_Mutation_p.I886M|MIB2_ENST00000520777.1_Missense_Mutation_p.I975M|MIB2_ENST00000504599.1_Missense_Mutation_p.I878M|MIB2_ENST00000518681.1_Missense_Mutation_p.I914M|MMP23B_ENST00000378675.3_5'Flank|MIB2_ENST00000360522.4_Missense_Mutation_p.I887M|MIB2_ENST00000505820.2_Missense_Mutation_p.I979M|MMP23B_ENST00000356026.5_5'Flank|MIB2_ENST00000355826.5_Missense_Mutation_p.I965M|MIB2_ENST00000378712.1_Missense_Mutation_p.Q739E|MIB2_ENST00000378708.1_Missense_Mutation_p.I828M	NM_080875.2	NP_543151.2	Q96AX9	MIB2_HUMAN	mindbomb E3 ubiquitin protein ligase 2	922					Notch signaling pathway (GO:0007219)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)	early endosome (GO:0005769)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|lung(7)|prostate(4)|upper_aerodigestive_tract(1)	18	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;5.26e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.54e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|BRCA - Breast invasive adenocarcinoma(365;0.00786)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		AGAAGTGCATCAGGTGCCAGG	0.701																																						dbGAP											0													34.0	41.0	39.0					1																	1565047		2095	4212	6307	-	-	-	SO:0001583	missense	0			AK097106	CCDS41224.1, CCDS41224.2, CCDS53261.1, CCDS53262.1, CCDS53263.1, CCDS53264.1	1p36.33	2013-01-10	2012-02-23	2005-04-01	ENSG00000197530	ENSG00000197530		"""Zinc fingers, ZZ-type"", ""Ankyrin repeat domain containing"""	30577	protein-coding gene	gene with protein product		611141	"""zinc finger, ZZ type with ankyrin repeat domain 1"", ""mindbomb homolog 2 (Drosophila)"""	ZZANK1		12761501	Standard	NM_080875		Approved	skeletrophin, ZZZ5, FLJ39787	uc001agg.3	Q96AX9	OTTHUMG00000074647	ENST00000357210.4:c.2766C>G	1.37:g.1565047C>G	ENSP00000349741:p.Ile922Met		A2AGM5|A2AGM6|B3KV93|B3KVF4|B3KXY1|B4DZ57|E9PGU1|E9PHQ1|F8WA73|J3KNZ7|Q7Z437|Q8IY62|Q8N786|Q8N897|Q8N8R2|Q8N911|Q8NB36|Q8NCY1|Q8NG59|Q8NG60|Q8NG61|Q8NI59|Q8WYN1	Missense_Mutation	SNP	pfam_Mib_Herc2,pfam_Ankyrin_rpt,pfam_Znf_ZZ,superfamily_Ankyrin_rpt-contain_dom,smart_Znf_ZZ,smart_Ankyrin_rpt,smart_Znf_RING,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Znf_RING,pfscan_Znf_ZZ,prints_Ankyrin_rpt	p.I979M	ENST00000357210.4	37	c.2937		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	16.04|16.04	3.010225|3.010225	0.54361|0.54361	.|.	.|.	ENSG00000197530|ENSG00000197530	ENST00000520777;ENST00000357210;ENST00000360522;ENST00000378710;ENST00000355826;ENST00000518681;ENST00000505820;ENST00000504599;ENST00000378708|ENST00000378712;ENST00000514234	T;T;T;T;T;T;T;T;T|T	0.78364|0.64085	-1.17;-1.17;-1.17;-1.17;-1.17;-1.17;-1.17;-1.17;-1.17|-0.08	3.25|3.25	3.25|3.25	0.37280|0.37280	Zinc finger, RING-type (2);|.	0.055408|.	0.64402|.	D|.	0.000001|.	T|T	0.56277|0.56277	0.1974|0.1974	M|M	0.61703|0.61703	1.905|1.905	0.48975|0.48975	D|D	0.999734|0.999734	D;D;D;D;D;D|B	0.89917|0.19200	0.993;1.0;0.999;0.999;1.0;0.998|0.034	P;D;D;D;D;D|B	0.91635|0.18871	0.878;0.999;0.972;0.998;0.998;0.973|0.023	T|T	0.53330|0.53330	-0.8454|-0.8454	10|9	0.56958|0.13108	D|T	0.05|0.6	-26.6342|-26.6342	13.9945|13.9945	0.64388|0.64388	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	887;828;914;975;908;922|739	Q96AX9-5;F2Z2L2;E9PHQ1;E9PGU1;Q96AX9-2;Q96AX9|B3KXY1	.;.;.;.;.;MIB2_HUMAN|.	M|E	975;922;887;886;965;914;979;878;828|739;738	ENSP00000428660:I975M;ENSP00000349741:I922M;ENSP00000353713:I887M;ENSP00000367982:I886M;ENSP00000348081:I965M;ENSP00000428264:I914M;ENSP00000426103:I979M;ENSP00000426128:I878M;ENSP00000367980:I828M|ENSP00000367984:Q739E	ENSP00000348081:I965M|ENSP00000367984:Q739E	I|Q	+|+	3|1	3|0	MIB2|MIB2	1554910|1554910	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.927000|0.927000	0.56198|0.56198	5.136000|5.136000	0.64783|0.64783	1.802000|1.802000	0.52723|0.52723	0.450000|0.450000	0.29827|0.29827	ATC|CAG	MIB2	-	smart_Znf_RING,pfscan_Znf_RING	ENSG00000197530		0.701	MIB2-201	KNOWN	basic|appris_candidate	protein_coding	MIB2	HGNC	protein_coding		44	0.00	0	C	NM_080875		1565047	1565047	+1	no_errors	ENST00000505820	ensembl	human	known	69_37n	missense	8	66.67	16	SNP	1.000	G
KMT2C	58508	genome.wustl.edu	37	7	151917645	151917646	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	TG	TG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr7:151917645_151917646delTG	ENST00000262189.6	-	23	3892_3893	c.3674_3675delCA	c.(3673-3675)tcafs	p.S1225fs	KMT2C_ENST00000355193.2_Frame_Shift_Del_p.S1225fs	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	1225					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TTGAATGCTCTGATTGGATGTC	0.356																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.3674_3675delCA	7.37:g.151917645_151917646delTG	ENSP00000262189:p.Ser1225fs		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Frame_Shift_Del	DEL	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.S1225fs	ENST00000262189.6	37	c.3675_3674	CCDS5931.1	7																																																																																			MLL3	-	NULL	ENSG00000055609		0.356	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL3	HGNC	protein_coding	OTTHUMT00000318887.3	209	0.00	0	TG			151917645	151917646	-1	no_errors	ENST00000355193	ensembl	human	known	69_37n	frame_shift_del	140	10.80	19	DEL	1.000:1.000	-
KMT2C	58508	genome.wustl.edu	37	7	151921673	151921673	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr7:151921673C>T	ENST00000262189.6	-	19	3223	c.3005G>A	c.(3004-3006)tGg>tAg	p.W1002*	KMT2C_ENST00000355193.2_Nonsense_Mutation_p.W1002*	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	1002					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										AAGACACCTCCAACCTTTGCT	0.398																																						dbGAP											0													7.0	7.0	7.0					7																	151921673		2115	4123	6238	-	-	-	SO:0001587	stop_gained	0			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.3005G>A	7.37:g.151921673C>T	ENSP00000262189:p.Trp1002*		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Nonsense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.W1002*	ENST00000262189.6	37	c.3005	CCDS5931.1	7	.	.	.	.	.	.	.	.	.	.	C	42	9.390793	0.99156	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	.	.	.	4.84	4.84	0.62591	.	0.000000	0.44097	D	0.000487	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.9358	0.89012	0.0:1.0:0.0:0.0	.	.	.	.	X	1002	.	ENSP00000262189:W1002X	W	-	2	0	MLL3	151552606	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.767000	0.85331	2.236000	0.73375	0.650000	0.86243	TGG	MLL3	-	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_Znf_RING,pfscan_Znf_PHD-finger	ENSG00000055609		0.398	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL3	HGNC	protein_coding	OTTHUMT00000318887.3	72	0.00	0	C			151921673	151921673	-1	no_errors	ENST00000355193	ensembl	human	known	69_37n	nonsense	47	17.54	10	SNP	1.000	T
MOBP	4336	genome.wustl.edu	37	3	39555004	39555004	+	IGR	SNP	C	C	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr3:39555004C>T	ENST00000420739.1	+	0	940				MOBP_ENST00000396228.1_3'UTR|MOBP_ENST00000479860.1_3'UTR|MOBP_ENST00000447324.1_3'UTR|MOBP_ENST00000383754.3_3'UTR|MOBP_ENST00000311042.6_3'UTR|MOBP_ENST00000415443.1_3'UTR			Q13875	MOBP_HUMAN	myelin-associated oligodendrocyte basic protein						intracellular protein transport (GO:0006886)|nervous system development (GO:0007399)	cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)	6				KIRC - Kidney renal clear cell carcinoma(284;0.082)|Kidney(284;0.0998)		TATCTGGCTTCAAATATTATG	0.527																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			D28113	CCDS2687.1, CCDS63598.1, CCDS2688.1	3p21.33	2004-03-02			ENSG00000168314	ENSG00000168314			7189	protein-coding gene	gene with protein product		600948				7989345	Standard	NM_001278322		Approved		uc031ryw.1	Q13875	OTTHUMG00000131347		3.37:g.39555004C>T			A8K2C2|G5E945|Q13874|Q6DHZ6|Q8TBJ1	RNA	SNP	-	NULL	ENST00000420739.1	37	NULL		3																																																																																			MOBP	-	-	ENSG00000168314		0.527	MOBP-001	KNOWN	basic	protein_coding	MOBP	HGNC	protein_coding	OTTHUMT00000343711.1	49	0.00	0	C	NM_006501, NM_182934, NM_182935		39555004	39555004	+1	no_errors	ENST00000479860	ensembl	human	known	69_37n	rna	53	14.52	9	SNP	0.000	T
MYH9	4627	genome.wustl.edu	37	22	36690231	36690231	+	Silent	SNP	C	C	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr22:36690231C>T	ENST00000216181.5	-	28	3974	c.3744G>A	c.(3742-3744)aaG>aaA	p.K1248K		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	1248					actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						CCTCCACTTTCTTGCGCTTGT	0.627			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																													dbGAP		Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	0													108.0	102.0	104.0					22																	36690231		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.3744G>A	22.37:g.36690231C>T			A8K6E4|O60805|Q60FE2|Q86T83	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_Regulat_G_prot_signal_superfam,superfamily_Prefoldin,superfamily_Myosin_S1_N,superfamily_STAT_TF_coiled-coil,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.K1248	ENST00000216181.5	37	c.3744	CCDS13927.1	22																																																																																			MYH9	-	pfam_Myosin_tail,superfamily_STAT_TF_coiled-coil	ENSG00000100345		0.627	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH9	HGNC	protein_coding	OTTHUMT00000259110.3	122	0.00	0	C	NM_002473		36690231	36690231	-1	no_errors	ENST00000216181	ensembl	human	known	69_37n	silent	63	26.74	23	SNP	1.000	T
MYOM2	9172	genome.wustl.edu	37	8	2088660	2088660	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr8:2088660C>T	ENST00000262113.4	+	33	3956	c.3815C>T	c.(3814-3816)tCa>tTa	p.S1272L	MYOM2_ENST00000523438.1_Missense_Mutation_p.S697L	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	1272					muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		GCTAAGATCTCATCCAGTGAG	0.463																																						dbGAP											0													105.0	103.0	104.0					8																	2088660		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.3815C>T	8.37:g.2088660C>T	ENSP00000262113:p.Ser1272Leu		Q7Z3Y2	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.S1272L	ENST00000262113.4	37	c.3815	CCDS5957.1	8	.	.	.	.	.	.	.	.	.	.	C	12.49	1.952987	0.34471	.	.	ENSG00000036448	ENST00000262113;ENST00000523438	T;T	0.34859	1.34;1.34	5.02	5.02	0.67125	Immunoglobulin-like fold (1);	0.330703	0.32068	N	0.006622	T	0.36220	0.0959	L	0.51422	1.61	0.49582	D	0.9998	B	0.21225	0.053	B	0.17722	0.019	T	0.11084	-1.0602	10	0.32370	T	0.25	.	18.3675	0.90397	0.0:1.0:0.0:0.0	.	1272	P54296	MYOM2_HUMAN	L	1272;697	ENSP00000262113:S1272L;ENSP00000428396:S697L	ENSP00000262113:S1272L	S	+	2	0	MYOM2	2076067	0.986000	0.35501	0.010000	0.14722	0.137000	0.21094	5.820000	0.69250	2.338000	0.79540	0.655000	0.94253	TCA	MYOM2	-	NULL	ENSG00000036448		0.463	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOM2	HGNC	protein_coding	OTTHUMT00000251249.1	100	0.98	1	C	NM_003970		2088660	2088660	+1	no_errors	ENST00000262113	ensembl	human	known	69_37n	missense	35	12.50	5	SNP	0.957	T
NDUFS5	4725	genome.wustl.edu	37	1	39494490	39494490	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr1:39494490C>G	ENST00000372969.3	+	2	181	c.94C>G	c.(94-96)Cga>Gga	p.R32G	NDUFS5_ENST00000372967.3_Missense_Mutation_p.R32G	NM_004552.2	NP_004543.1	O43920	NDUS5_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase)	32					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|mitochondrial respiratory chain complex I assembly (GO:0032981)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			endometrium(1)|kidney(1)|large_intestine(2)|upper_aerodigestive_tract(1)	5	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;1.93e-18)			GATGGCTGGTCGATGCCATGC	0.438																																						dbGAP											0													111.0	104.0	106.0					1																	39494490		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF047434	CCDS434.1	1p34.2-p33	2011-07-04	2002-08-29		ENSG00000168653	ENSG00000168653		"""Mitochondrial respiratory chain complex / Complex I"""	7712	protein-coding gene	gene with protein product	"""complex I 51kDa subunit"", ""NADH dehydrogenase [ubiquinone] iron-sulfur protein 5"""	603847	"""NADH dehydrogenase (ubiquinone) Fe-S protein 5 (15kD) (NADH-coenzyme Q reductase)"""			9763677, 9653160	Standard	NM_004552		Approved	CI-15k	uc001ccy.3	O43920	OTTHUMG00000007497	ENST00000372969.3:c.94C>G	1.37:g.39494490C>G	ENSP00000362060:p.Arg32Gly			Missense_Mutation	SNP	pfam_NADH_UbQ_OxRdtase_FeS-su5,pfam_Cyt_c_biogenesis_Cmc1-like	p.R32G	ENST00000372969.3	37	c.94	CCDS434.1	1	.	.	.	.	.	.	.	.	.	.	C	17.79	3.476515	0.63737	.	.	ENSG00000168653	ENST00000372969;ENST00000372967	T;T	0.78246	-1.16;-1.16	5.82	4.85	0.62838	.	0.592704	0.18218	N	0.147986	T	0.81361	0.4806	M	0.83012	2.62	0.35596	D	0.807467	P	0.45902	0.868	P	0.48815	0.591	D	0.86020	0.1506	10	0.62326	D	0.03	-2.5073	6.8225	0.23864	0.1757:0.7384:0.0:0.0859	.	32	O43920	NDUS5_HUMAN	G	32	ENSP00000362060:R32G;ENSP00000362058:R32G	ENSP00000362058:R32G	R	+	1	2	NDUFS5	39267077	0.647000	0.27304	0.993000	0.49108	0.645000	0.38454	1.825000	0.39081	2.767000	0.95098	0.655000	0.94253	CGA	NDUFS5	-	pfam_NADH_UbQ_OxRdtase_FeS-su5,pfam_Cyt_c_biogenesis_Cmc1-like	ENSG00000168653		0.438	NDUFS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFS5	HGNC	protein_coding	OTTHUMT00000019688.1	84	0.00	0	C	NM_004552		39494490	39494490	+1	no_errors	ENST00000372967	ensembl	human	known	69_37n	missense	45	10.00	5	SNP	0.948	G
NIN	51199	genome.wustl.edu	37	14	51239789	51239789	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr14:51239789G>C	ENST00000382041.3	-	8	881	c.691C>G	c.(691-693)Ctt>Gtt	p.L231V	NIN_ENST00000324330.9_Missense_Mutation_p.L231V|NIN_ENST00000245441.5_Missense_Mutation_p.L231V|NIN_ENST00000530997.2_Missense_Mutation_p.L231V|NIN_ENST00000382043.4_Missense_Mutation_p.L231V|NIN_ENST00000453196.1_Missense_Mutation_p.L231V|NIN_ENST00000389868.3_Missense_Mutation_p.L231V	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	231	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					TCAGGATCAAGATTATGGAAT	0.358			T	PDGFRB	MPD																																	dbGAP		Dom	yes		14	14q24	51199	ninein (GSK3B interacting protein)		L	0													96.0	94.0	94.0					14																	51239789		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.691C>G	14.37:g.51239789G>C	ENSP00000371472:p.Leu231Val		A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Missense_Mutation	SNP	superfamily_tRNA-bd_arm,pfscan_EF_HAND_2	p.L231V	ENST00000382041.3	37	c.691	CCDS32079.1	14	.	.	.	.	.	.	.	.	.	.	G	21.4	4.144419	0.77888	.	.	ENSG00000100503	ENST00000245441;ENST00000311149;ENST00000389868;ENST00000382043;ENST00000324292;ENST00000382041;ENST00000324330;ENST00000453196;ENST00000453401	D;T;D;T;D;D;T	0.95788	-3.81;-0.57;-3.81;1.32;-3.81;-3.81;2.92	4.88	4.88	0.63580	EF-hand-like domain (1);	0.130542	0.53938	D	0.000054	D	0.95853	0.8650	L	0.27053	0.805	0.49299	D	0.999779	D;D;D;D;D	0.89917	1.0;1.0;0.999;0.996;0.998	D;D;D;D;D	0.91635	0.999;0.998;0.997;0.912;0.99	D	0.96861	0.9632	10	0.72032	D	0.01	-6.2678	17.3719	0.87381	0.0:0.0:1.0:0.0	.	237;231;231;231;231	Q8N4C6-5;C9J066;Q8N4C6;Q5BKU3;Q8N4C6-7	.;.;NIN_HUMAN;.;.	V	231;231;231;231;237;231;231;231;193	ENSP00000245441:L231V;ENSP00000374518:L231V;ENSP00000371474:L231V;ENSP00000371472:L231V;ENSP00000324210:L231V;ENSP00000412391:L231V;ENSP00000398641:L193V	ENSP00000245441:L231V	L	-	1	0	NIN	50309539	1.000000	0.71417	0.984000	0.44739	0.901000	0.52897	7.920000	0.87521	2.403000	0.81681	0.467000	0.42956	CTT	NIN	-	NULL	ENSG00000100503		0.358	NIN-016	KNOWN	basic|CCDS	protein_coding	NIN	HGNC	protein_coding	OTTHUMT00000395207.2	123	0.00	0	G	NM_182946		51239789	51239789	-1	no_errors	ENST00000245441	ensembl	human	known	69_37n	missense	136	15.00	24	SNP	1.000	C
NPR1	4881	genome.wustl.edu	37	1	153661754	153661754	+	Silent	SNP	C	C	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr1:153661754C>T	ENST00000368680.3	+	17	3127	c.2655C>T	c.(2653-2655)ttC>ttT	p.F885F		NM_000906.3	NP_000897.3	P16066	ANPRA_HUMAN	natriuretic peptide receptor 1	885	Guanylate cyclase. {ECO:0000255|PROSITE- ProRule:PRU00099}.				body fluid secretion (GO:0007589)|cell surface receptor signaling pathway (GO:0007166)|cGMP biosynthetic process (GO:0006182)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|regulation of vascular permeability (GO:0043114)|regulation of vasodilation (GO:0042312)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|G-protein coupled peptide receptor activity (GO:0008528)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(17)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)		Amyl Nitrite(DB01612)|Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Nesiritide(DB04899)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)	TTGTGGGTTTCACAGCGCTGT	0.592																																					Pancreas(141;1349 1870 15144 15830 40702)	dbGAP											0													139.0	122.0	128.0					1																	153661754		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC063304	CCDS1051.1	1q21-q22	2014-03-03	2014-03-03		ENSG00000169418	ENSG00000169418			7943	protein-coding gene	gene with protein product	"""guanylate cyclase A"""	108960	"""atrionatriuretic peptide receptor A"", ""natriuretic peptide receptor A"""	ANPRA, NPRA		1979052	Standard	NM_000906		Approved	GUCY2A, ANPa	uc001fcs.4	P16066	OTTHUMG00000037085	ENST00000368680.3:c.2655C>T	1.37:g.153661754C>T			B0ZBF0|Q5SR08|Q6P4Q3	Silent	SNP	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_A/G_cyclase,superfamily_Kinase-like_dom,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_A/G_cyclase,prints_Ntpep_rcpt,pfscan_Prot_kinase_cat_dom,pfscan_A/G_cyclase	p.F885	ENST00000368680.3	37	c.2655	CCDS1051.1	1																																																																																			NPR1	-	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	ENSG00000169418		0.592	NPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPR1	HGNC	protein_coding	OTTHUMT00000090034.1	111	0.00	0	C	NM_000906		153661754	153661754	+1	no_errors	ENST00000368680	ensembl	human	known	69_37n	silent	71	19.10	17	SNP	1.000	T
NUGGC	389643	genome.wustl.edu	37	8	27887897	27887897	+	Silent	SNP	G	G	A			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr8:27887897G>A	ENST00000413272.2	-	16	2089	c.1947C>T	c.(1945-1947)ctC>ctT	p.L649L	NUGGC_ENST00000341513.6_Silent_p.L649L	NM_001010906.1	NP_001010906.1	Q68CJ6	SLIP_HUMAN	nuclear GTPase, germinal center associated	649					cellular response to DNA damage stimulus (GO:0006974)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)										TCTTCCTTCTGAGGATGTGGT	0.562																																						dbGAP											0													42.0	46.0	45.0					8																	27887897		2006	4157	6163	-	-	-	SO:0001819	synonymous_variant	0			AB075870	CCDS47833.1	8p21.1	2012-06-07	2012-06-07	2012-06-07	ENSG00000189233	ENSG00000189233			33550	protein-coding gene	gene with protein product	"""speckled-like pattern in the germinal center"""		"""chromosome 8 open reading frame 80"""	C8orf80		19734146	Standard	NM_001010906		Approved	HMFN0672, SLIP-GC	uc003xgm.4	Q68CJ6	OTTHUMG00000155970	ENST00000413272.2:c.1947C>T	8.37:g.27887897G>A			Q6ZP73	Silent	SNP	pfam_Dynamin_GTPase	p.L649	ENST00000413272.2	37	c.1947	CCDS47833.1	8																																																																																			NUGGC	-	NULL	ENSG00000189233		0.562	NUGGC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NUGGC	HGNC	protein_coding	OTTHUMT00000342494.1	88	0.00	0	G	NM_001010906		27887897	27887897	-1	no_errors	ENST00000341513	ensembl	human	known	69_37n	silent	7	65.00	13	SNP	0.643	A
OPHN1	4983	genome.wustl.edu	37	X	67431962	67431962	+	Silent	SNP	G	G	C			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chrX:67431962G>C	ENST00000355520.5	-	8	1331	c.690C>G	c.(688-690)ctC>ctG	p.L230L	OPHN1_ENST00000540071.1_Silent_p.L230L	NM_002547.2	NP_002538.1	O60890	OPHN1_HUMAN	oligophrenin 1	230					actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|negative regulation of proteasomal protein catabolic process (GO:1901799)|nervous system development (GO:0007399)|regulation of endocytosis (GO:0030100)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of synaptic transmission, glutamatergic (GO:0051966)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|substrate-dependent cell migration, cell extension (GO:0006930)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|terminal bouton (GO:0043195)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|skin(2)	31						TCTGTAAACTGAGTTGGAGCT	0.438																																						dbGAP											0													102.0	81.0	89.0					X																	67431962		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AJ001189	CCDS14388.1	Xq12	2011-07-04			ENSG00000079482	ENSG00000079482		"""Rho GTPase activating proteins"""	8148	protein-coding gene	gene with protein product		300127	"""mental retardation, X-linked 60"""	MRX60		9195162, 9582072	Standard	NM_002547		Approved	OPN1, ARHGAP41	uc004dww.4	O60890	OTTHUMG00000021744	ENST00000355520.5:c.690C>G	X.37:g.67431962G>C			B9EIP8|Q5JQ81|Q6PCC1|Q8WX47	Silent	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.L230	ENST00000355520.5	37	c.690	CCDS14388.1	X																																																																																			OPHN1	-	NULL	ENSG00000079482		0.438	OPHN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPHN1	HGNC	protein_coding	OTTHUMT00000057011.1	132	0.00	0	G	NM_002547		67431962	67431962	-1	no_errors	ENST00000355520	ensembl	human	known	69_37n	silent	78	25.47	27	SNP	1.000	C
OR2T27	403239	genome.wustl.edu	37	1	248813827	248813827	+	Missense_Mutation	SNP	T	T	C	rs1782241	byFrequency	TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr1:248813827T>C	ENST00000344889.3	-	1	358	c.359A>G	c.(358-360)tAt>tGt	p.Y120C		NM_001001824.1	NP_001001824.1	Q8NH04	O2T27_HUMAN	olfactory receptor, family 2, subfamily T, member 27	120						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|endometrium(2)|large_intestine(4)|lung(20)|skin(3)|stomach(1)	32	all_cancers(71;1.15e-05)|all_epithelial(71;5.29e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.089)|Lung NSC(105;0.0969)|Melanoma(84;0.199)	all_cancers(173;0.237)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GTAGCGATCATAGGACATGAG	0.547																																						dbGAP											0													103.0	42.0	63.0					1																	248813827		2182	4052	6234	-	-	-	SO:0001583	missense	0				CCDS31124.1	1q44	2012-08-09			ENSG00000187701	ENSG00000187701		"""GPCR / Class A : Olfactory receptors"""	31252	protein-coding gene	gene with protein product							Standard	NM_001001824		Approved		uc010pzo.2	Q8NH04	OTTHUMG00000040376	ENST00000344889.3:c.359A>G	1.37:g.248813827T>C	ENSP00000342008:p.Tyr120Cys			Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.Y120C	ENST00000344889.3	37	c.359	CCDS31124.1	1	.	.	.	.	.	.	.	.	.	.	.	5.759	0.324378	0.10900	.	.	ENSG00000187701	ENST00000344889	T	0.01119	5.31	3.3	3.3	0.37823	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36034	N	0.002838	T	0.04272	0.0118	.	.	.	0.43628	P	0.003982000000000041	D	0.58970	0.984	P	0.60473	0.875	T	0.25257	-1.0137	8	0.62326	D	0.03	.	11.0943	0.48134	0.0:0.0:0.0:1.0	rs1782241	120	Q8NH04	O2T27_HUMAN	C	120	ENSP00000342008:Y120C	ENSP00000342008:Y120C	Y	-	2	0	OR2T27	246880450	0.001000	0.12720	0.632000	0.29296	0.318000	0.28184	0.320000	0.19540	1.511000	0.48818	0.163000	0.16589	TAT	OR2T27	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000187701		0.547	OR2T27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T27	HGNC	protein_coding	OTTHUMT00000097124.1	105	0.00	0	T	NM_001001824		248813827	248813827	-1	no_errors	ENST00000344889	ensembl	human	known	69_37n	missense	47	20.00	12	SNP	0.954	C
OR5H6	79295	genome.wustl.edu	37	3	97983636	97983636	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr3:97983636C>T	ENST00000383696.2	+	1	549	c.508C>T	c.(508-510)Ctt>Ttt	p.L170F	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005479.1	NP_001005479.1	Q8NGV6	OR5H6_HUMAN	olfactory receptor, family 5, subfamily H, member 6 (gene/pseudogene)	170						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(2)|endometrium(1)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						AGGTGGCCTTCTTCATGCTTT	0.338																																						dbGAP											0													95.0	92.0	93.0					3																	97983636		2203	4298	6501	-	-	-	SO:0001583	missense	0			BK004374	CCDS33800.1	3q12.1	2013-10-10	2013-10-10		ENSG00000230301	ENSG00000230301		"""GPCR / Class A : Olfactory receptors"""	14767	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily H, member 6"""				Standard	NM_001005479		Approved		uc003dsi.1	Q8NGV6	OTTHUMG00000160078	ENST00000383696.2:c.508C>T	3.37:g.97983636C>T	ENSP00000373196:p.Leu170Phe		Q6IF88	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L170F	ENST00000383696.2	37	c.508	CCDS33800.1	3	.	.	.	.	.	.	.	.	.	.	-	7.144	0.582477	0.13749	.	.	ENSG00000230301	ENST00000383696	T	0.46451	0.87	2.19	-4.38	0.03622	GPCR, rhodopsin-like superfamily (1);	1.562390	0.04160	N	0.322861	T	0.36717	0.0977	M	0.63208	1.945	0.09310	N	1	B	0.23806	0.091	B	0.28991	0.097	T	0.29427	-1.0012	10	0.59425	D	0.04	.	0.9399	0.01353	0.1668:0.3005:0.3097:0.223	.	170	Q8NGV6	OR5H6_HUMAN	F	170	ENSP00000373196:L170F	ENSP00000373196:L170F	L	+	1	0	OR5H6	99466326	0.000000	0.05858	0.000000	0.03702	0.053000	0.15095	-5.785000	0.00098	-1.569000	0.01668	0.194000	0.17425	CTT	OR5H6	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000230301		0.338	OR5H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5H6	HGNC	protein_coding	OTTHUMT00000359111.2	72	0.00	0	C			97983636	97983636	+1	no_errors	ENST00000383696	ensembl	human	known	69_37n	missense	112	22.76	33	SNP	0.000	T
PAMR1	25891	genome.wustl.edu	37	11	35463039	35463039	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr11:35463039G>C	ENST00000378880.2	-	7	1468	c.1023C>G	c.(1021-1023)atC>atG	p.I341M	PAMR1_ENST00000278360.3_Missense_Mutation_p.I358M|PAMR1_ENST00000378878.3_Missense_Mutation_p.I230M|PAMR1_ENST00000532848.1_Missense_Mutation_p.I301M	NM_001001991.1	NP_001001991.1	Q6UXH9	PAMR1_HUMAN	peptidase domain containing associated with muscle regeneration 1	341	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	26						CTTTTATGCAGATGGGCTGTT	0.423																																						dbGAP											0													190.0	184.0	186.0					11																	35463039		2202	4298	6500	-	-	-	SO:0001583	missense	0				CCDS7898.1, CCDS31460.1, CCDS60759.1, CCDS60760.1	11p13	2009-09-30			ENSG00000149090	ENSG00000149090			24554	protein-coding gene	gene with protein product	"""regeneration-associated muscle protease"""					15111323	Standard	NM_001282675		Approved	RAMP, DKFZP586H2123	uc001mwf.3	Q6UXH9	OTTHUMG00000166328	ENST00000378880.2:c.1023C>G	11.37:g.35463039G>C	ENSP00000368158:p.Ile341Met		A8MQ58|B7ZA73|Q5EBL7|Q5JPI4|Q6N062|Q71RE9|Q96JW2|Q9Y432	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_CUB,pfam_Sushi_SCR_CCP,pfam_EGF-like_dom,superfamily_Pept_cys/ser_Trypsin-like,superfamily_CUB,superfamily_Complement_control_module,smart_EGF-like,smart_CUB,smart_EGF-like_Ca-bd,smart_Sushi_SCR_CCP,smart_Peptidase_S1_S6,pfscan_CUB,pfscan_EG-like_dom,pfscan_Sushi_SCR_CCP,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.I358M	ENST00000378880.2	37	c.1074	CCDS31460.1	11	.	.	.	.	.	.	.	.	.	.	G	13.62	2.292476	0.40594	.	.	ENSG00000149090	ENST00000278360;ENST00000378880;ENST00000378878;ENST00000532848;ENST00000527605	T;T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12;-0.12	5.84	-2.09	0.07232	Complement control module (2);Sushi/SCR/CCP (3);	0.492042	0.24647	N	0.036755	T	0.63721	0.2535	M	0.64997	1.995	0.34522	D	0.708259	D;B;P	0.58970	0.984;0.079;0.573	P;B;B	0.60541	0.876;0.084;0.366	T	0.66280	-0.5963	10	0.87932	D	0	.	1.9909	0.03446	0.2732:0.0927:0.4274:0.2067	.	230;341;358	A8MQ58;Q6UXH9;Q6UXH9-2	.;PAMR1_HUMAN;.	M	358;341;230;301;318	ENSP00000278360:I358M;ENSP00000368158:I341M;ENSP00000368156:I230M;ENSP00000433868:I301M;ENSP00000432591:I318M	ENSP00000278360:I358M	I	-	3	3	PAMR1	35419615	1.000000	0.71417	0.795000	0.32087	0.962000	0.63368	0.767000	0.26575	-0.203000	0.10251	0.655000	0.94253	ATC	PAMR1	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000149090		0.423	PAMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAMR1	HGNC	protein_coding	OTTHUMT00000389177.1	164	0.61	1	G	NM_015430		35463039	35463039	-1	no_errors	ENST00000278360	ensembl	human	known	69_37n	missense	101	29.37	42	SNP	0.962	C
PBRM1	55193	genome.wustl.edu	37	3	52584826	52584826	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr3:52584826C>T	ENST00000296302.7	-	28	4618	c.4617G>A	c.(4615-4617)atG>atA	p.M1539I	PBRM1_ENST00000409767.1_Missense_Mutation_p.M1447I|RNU6-856P_ENST00000516959.1_RNA|SMIM4_ENST00000476842.1_Intron|PBRM1_ENST00000337303.4_Missense_Mutation_p.M1432I|PBRM1_ENST00000409057.1_Missense_Mutation_p.M1484I|PBRM1_ENST00000356770.4_Missense_Mutation_p.M1452I|PBRM1_ENST00000394830.3_Missense_Mutation_p.M1432I|PBRM1_ENST00000410007.1_Missense_Mutation_p.M1459I|PBRM1_ENST00000409114.3_Missense_Mutation_p.M1502I			Q86U86	PB1_HUMAN	polybromo 1	1539	Pro-rich.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		CTCCTTGGTTCATCACACCTA	0.448			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																	dbGAP		Rec	yes		3	3p21	55193	polybromo 1		E	0													71.0	67.0	69.0					3																	52584826		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.4617G>A	3.37:g.52584826C>T	ENSP00000296302:p.Met1539Ile		A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Missense_Mutation	SNP	pfam_Bromodomain,pfam_BAH_dom,pfam_HMG_superfamily,superfamily_Bromodomain,superfamily_HMG_superfamily,smart_Bromodomain,smart_BAH_dom,smart_HMG_superfamily,pfscan_BAH_dom,pfscan_HMG_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.M1539I	ENST00000296302.7	37	c.4617		3	.	.	.	.	.	.	.	.	.	.	C	15.85	2.953447	0.53293	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767	T;T;T;T;T;T;T;T	0.34667	1.36;1.36;1.4;1.41;1.35;1.36;1.8;1.41	5.93	5.06	0.68205	.	0.147188	0.64402	D	0.000007	T	0.15176	0.0366	N	0.08118	0	0.26127	N	0.980461	B;B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B	0.04013	0.001;0.001;0.001;0.001;0.0;0.0;0.0;0.001	T	0.28106	-1.0054	10	0.02654	T	1	-13.0557	8.5952	0.33712	0.0:0.8222:0.0:0.1778	.	1459;1432;1484;1502;1447;1539;1452;1432	Q86U86-9;Q86U86-4;Q86U86-2;Q86U86-8;Q86U86-7;Q86U86;Q86U86-3;Q86U86-5	.;.;.;.;.;PB1_HUMAN;.;.	I	1452;1432;1539;1432;1484;1459;1502;1447	ENSP00000349213:M1452I;ENSP00000378307:M1432I;ENSP00000296302:M1539I;ENSP00000338302:M1432I;ENSP00000386593:M1484I;ENSP00000386529:M1459I;ENSP00000386643:M1502I;ENSP00000386601:M1447I	ENSP00000296302:M1539I	M	-	3	0	PBRM1	52559866	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.972000	0.40540	1.518000	0.48934	0.655000	0.94253	ATG	PBRM1	-	NULL	ENSG00000163939		0.448	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	PBRM1	HGNC	protein_coding	OTTHUMT00000327232.1	73	0.00	0	C	NM_018165		52584826	52584826	-1	no_errors	ENST00000296302	ensembl	human	known	69_37n	missense	59	20.27	15	SNP	1.000	T
PCDH10	57575	genome.wustl.edu	37	4	134072178	134072178	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr4:134072178C>T	ENST00000264360.5	+	1	1709	c.883C>T	c.(883-885)Ccc>Tcc	p.P295S	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	295	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		CCACATTTCGCCCCGGGCGCG	0.622																																						dbGAP											0													43.0	46.0	45.0					4																	134072178		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.883C>T	4.37:g.134072178C>T	ENSP00000264360:p.Pro295Ser		Q4W5F6|Q96SF0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P295S	ENST00000264360.5	37	c.883	CCDS34063.1	4	.	.	.	.	.	.	.	.	.	.	C	0.024	-1.390099	0.01185	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.36878	1.23	4.33	3.46	0.39613	Cadherin (4);Cadherin-like (1);	0.000000	0.44902	D	0.000414	T	0.24005	0.0581	N	0.26162	0.8	0.47905	D	0.999541	B;B	0.10296	0.003;0.001	B;B	0.13407	0.008;0.009	T	0.04509	-1.0946	10	0.12103	T	0.63	.	13.2875	0.60251	0.0:0.6249:0.3751:0.0	.	295;295	Q9P2E7;Q96SF0	PCD10_HUMAN;.	S	295	ENSP00000264360:P295S	ENSP00000264360:P295S	P	+	1	0	PCDH10	134291628	0.277000	0.24220	1.000000	0.80357	0.286000	0.27126	1.791000	0.38744	0.970000	0.38263	0.511000	0.50034	CCC	PCDH10	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000138650		0.622	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PCDH10	HGNC	protein_coding	OTTHUMT00000364457.2	39	0.00	0	C	NM_032961		134072178	134072178	+1	no_errors	ENST00000264360	ensembl	human	known	69_37n	missense	16	40.74	11	SNP	0.993	T
PCNXL3	399909	genome.wustl.edu	37	11	65389721	65389721	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr11:65389721G>T	ENST00000355703.3	+	11	2780	c.2241G>T	c.(2239-2241)caG>caT	p.Q747H		NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)	747						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						CCCAGGAGCAGACACTGATGG	0.642																																						dbGAP											0													19.0	23.0	22.0					11																	65389721		2040	4187	6227	-	-	-	SO:0001583	missense	0			BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539	ENST00000355703.3:c.2241G>T	11.37:g.65389721G>T	ENSP00000347931:p.Gln747His		Q6MZN8	Missense_Mutation	SNP	pfam_Pecanex	p.Q747H	ENST00000355703.3	37	c.2241	CCDS44650.1	11	.	.	.	.	.	.	.	.	.	.	G	17.01	3.278187	0.59758	.	.	ENSG00000197136	ENST00000355703	T	0.26660	1.72	4.32	4.32	0.51571	.	.	.	.	.	T	0.22704	0.0548	L	0.35854	1.095	0.32686	N	0.514882	D	0.54772	0.968	P	0.44518	0.452	T	0.12553	-1.0543	9	0.16896	T	0.51	.	14.3325	0.66566	0.0:0.0:1.0:0.0	.	747	Q9H6A9	PCX3_HUMAN	H	747	ENSP00000347931:Q747H	ENSP00000347931:Q747H	Q	+	3	2	PCNXL3	65146297	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	3.727000	0.54984	1.976000	0.57569	0.561000	0.74099	CAG	PCNXL3	-	NULL	ENSG00000197136		0.642	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNXL3	HGNC	protein_coding	OTTHUMT00000390321.1	37	0.00	0	G	NM_032223		65389721	65389721	+1	no_errors	ENST00000355703	ensembl	human	known	69_37n	missense	19	29.63	8	SNP	1.000	T
PLD6	201164	genome.wustl.edu	37	17	17106133	17106133	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr17:17106133C>T	ENST00000321560.3	-	2	735	c.707G>A	c.(706-708)aGa>aAa	p.R236K	RP11-45M22.4_ENST00000427497.3_3'UTR	NM_178836.3	NP_849158.2	Q8N2A8	PLD6_HUMAN	phospholipase D family, member 6	236					DNA methylation involved in gamete generation (GO:0043046)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|meiotic nuclear division (GO:0007126)|mitochondrial fusion (GO:0008053)|P granule organization (GO:0030719)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|piRNA metabolic process (GO:0034587)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)	cardiolipin hydrolase activity (GO:0035755)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)			endometrium(1)|lung(1)	2						TGAAAGCAATCTCCCTCCAGC	0.547																																						dbGAP											0													79.0	66.0	71.0					17																	17106133		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK090899	CCDS11182.1	17p11.2	2008-08-14			ENSG00000179598	ENSG00000179598			30447	protein-coding gene	gene with protein product		614960				12477932	Standard	NM_178836		Approved		uc002gqz.3	Q8N2A8	OTTHUMG00000059278	ENST00000321560.3:c.707G>A	17.37:g.17106133C>T	ENSP00000317177:p.Arg236Lys		Q8N5Y1	Missense_Mutation	SNP	smart_PLipase_D/transphosphatidylase,pfscan_PLipase_D/transphosphatidylase	p.R236K	ENST00000321560.3	37	c.707	CCDS11182.1	17	.	.	.	.	.	.	.	.	.	.	C	5.618	0.298674	0.10622	.	.	ENSG00000179598	ENST00000321560	T	0.35048	1.33	3.49	-4.08	0.03963	.	.	.	.	.	T	0.13243	0.0321	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32929	-0.9888	9	0.09590	T	0.72	.	5.6595	0.17660	0.0:0.3841:0.1417:0.4742	.	236	Q8N2A8	PLD6_HUMAN	K	236	ENSP00000317177:R236K	ENSP00000317177:R236K	R	-	2	0	PLD6	17046858	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-3.723000	0.00383	-1.012000	0.03387	-2.053000	0.00404	AGA	PLD6	-	NULL	ENSG00000179598		0.547	PLD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLD6	HGNC	protein_coding	OTTHUMT00000131600.2	94	0.00	0	C	NM_178836		17106133	17106133	-1	no_errors	ENST00000321560	ensembl	human	known	69_37n	missense	41	22.64	12	SNP	0.000	T
PLIN2	123	genome.wustl.edu	37	9	19116288	19116288	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr9:19116288C>G	ENST00000276914.2	-	8	1451	c.1272G>C	c.(1270-1272)aaG>aaC	p.K424N	PLIN2_ENST00000411567.1_Missense_Mutation_p.K343N	NM_001122.3	NP_001113.2	Q99541	PLIN2_HUMAN	perilipin 2	424					cellular lipid metabolic process (GO:0044255)|lipid storage (GO:0019915)|long-chain fatty acid transport (GO:0015909)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|lipid particle (GO:0005811)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	19						CCTGGCTGCTCTTGTCCATCT	0.493																																						dbGAP											0													87.0	83.0	85.0					9																	19116288		2203	4300	6503	-	-	-	SO:0001583	missense	0			X97324	CCDS6490.1	9p22.1	2009-08-12	2009-08-12	2009-08-12	ENSG00000147872	ENSG00000147872		"""Perilipins"""	248	protein-coding gene	gene with protein product	"""adipophilin"""	103195	"""adipose differentiation-related protein"""	ADFP		9003395, 19638644	Standard	NM_001122		Approved	ADRP	uc003zno.3	Q99541	OTTHUMG00000019624	ENST00000276914.2:c.1272G>C	9.37:g.19116288C>G	ENSP00000276914:p.Lys424Asn		Q9BSC3	Missense_Mutation	SNP	pfam_Perilipin,pirsf_Perilipin	p.K424N	ENST00000276914.2	37	c.1272	CCDS6490.1	9	.	.	.	.	.	.	.	.	.	.	C	8.524	0.869391	0.17322	.	.	ENSG00000147872	ENST00000411567;ENST00000276914	T;T	0.05139	3.49;3.92	4.67	0.111	0.14619	.	3.261290	0.00780	N	0.001275	T	0.03434	0.0099	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.37103	-0.9720	10	0.26408	T	0.33	.	1.4006	0.02270	0.1496:0.3477:0.131:0.3717	.	424	Q99541	PLIN2_HUMAN	N	343;424	ENSP00000415270:K343N;ENSP00000276914:K424N	ENSP00000276914:K424N	K	-	3	2	PLIN2	19106288	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.806000	0.04525	0.139000	0.18822	-0.133000	0.14855	AAG	PLIN2	-	pirsf_Perilipin	ENSG00000147872		0.493	PLIN2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	PLIN2	HGNC	protein_coding	OTTHUMT00000051835.1	88	0.00	0	C	NM_001122		19116288	19116288	-1	no_errors	ENST00000276914	ensembl	human	known	69_37n	missense	69	13.75	11	SNP	0.000	G
PMS1	5378	genome.wustl.edu	37	2	190728571	190728571	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr2:190728571G>C	ENST00000441310.2	+	10	2192	c.1959G>C	c.(1957-1959)aaG>aaC	p.K653N	PMS1_ENST00000418224.3_Missense_Mutation_p.K477N|PMS1_ENST00000421722.1_3'UTR|PMS1_ENST00000432292.3_Missense_Mutation_p.K477N|PMS1_ENST00000409823.3_Missense_Mutation_p.K614N|PMS1_ENST00000447232.2_Intron	NM_000534.4	NP_000525.1	P54277	PMS1_HUMAN	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)	653					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)	MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|mismatched DNA binding (GO:0030983)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)			GCAGAAAAAAGATAAAACCCA	0.388			"""Mis, N"""			"""colorectal, endometrial, ovarian"""		Direct reversal of damage;Mismatch excision repair (MMR)																														dbGAP	yes	Rec		Hereditary non-polyposis colorectal cancer	2	2q31-q33	5378	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)		E	0													114.0	124.0	121.0					2																	190728571		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2302.1, CCDS46473.1, CCDS46474.1, CCDS74615.1	2q31-q33	2014-09-17	2001-11-28		ENSG00000064933	ENSG00000064933			9121	protein-coding gene	gene with protein product		600258	"""postmeiotic segregation increased (S. cerevisiae) 1"""	PMSL1		8072530	Standard	NM_000534		Approved		uc002urh.4	P54277	OTTHUMG00000132664	ENST00000441310.2:c.1959G>C	2.37:g.190728571G>C	ENSP00000406490:p.Lys653Asn		D3DPI1|Q4VAL4|Q5FBZ3|Q5FBZ6|Q5FBZ8	Missense_Mutation	SNP	pfam_DNA_mismatch_repair_C,pfam_HMG_superfamily,pfam_ATPase-like_ATP-bd,superfamily_ATPase-like_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily,tigrfam_DNA_mismatch_repair_N	p.K653N	ENST00000441310.2	37	c.1959	CCDS2302.1	2	.	.	.	.	.	.	.	.	.	.	G	14.65	2.599420	0.46318	.	.	ENSG00000064933	ENST00000392338;ENST00000441310;ENST00000418224;ENST00000409823;ENST00000432292;ENST00000424307;ENST00000452382	T;T;T;T;D;T	0.88975	2.01;2.01;2.01;2.01;-2.45;1.84	5.31	3.36	0.38483	.	0.532316	0.22483	N	0.059465	D	0.82861	0.5129	L	0.51422	1.61	0.24601	N	0.993777	B;P;B;B	0.35433	0.418;0.501;0.361;0.418	B;B;B;B	0.32393	0.145;0.107;0.109;0.145	T	0.73353	-0.4009	10	0.33940	T	0.23	-4.0845	9.011	0.36142	0.1943:0.0:0.8057:0.0	.	653;614;614;653	Q4VAL4;Q5FBZ9;Q5FBZ3;P54277	.;.;.;PMS1_HUMAN	N	477;653;477;614;477;592;41	ENSP00000406490:K653N;ENSP00000404492:K477N;ENSP00000387125:K614N;ENSP00000398378:K477N;ENSP00000389938:K592N;ENSP00000396232:K41N	ENSP00000376149:K477N	K	+	3	2	PMS1	190436816	0.964000	0.33143	0.989000	0.46669	0.930000	0.56654	1.450000	0.35134	1.465000	0.48006	0.650000	0.86243	AAG	PMS1	-	NULL	ENSG00000064933		0.388	PMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMS1	HGNC	protein_coding	OTTHUMT00000255918.2	86	0.00	0	G			190728571	190728571	+1	no_errors	ENST00000441310	ensembl	human	known	69_37n	missense	75	29.25	31	SNP	0.877	C
PTH2	113091	genome.wustl.edu	37	19	49926531	49926533	+	In_Frame_Del	DEL	CAG	CAG	-	rs200733272|rs371950649	byFrequency	TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	CAG	CAG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr19:49926531_49926533delCAG	ENST00000270631.1	-	1	165_167	c.64_66delCTG	c.(64-66)ctgdel	p.L22del	CTD-3148I10.1_ENST00000576655.1_5'Flank	NM_178449.3	NP_848544.1	Q96A98	TIP39_HUMAN	parathyroid hormone 2	22					neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)		p.L22V(2)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(262;0.0015)|GBM - Glioblastoma multiforme(486;0.044)|Lung(386;0.0785)|LUSC - Lung squamous cell carcinoma(496;0.0836)		AGGGCACCACcagcagcagcagc	0.69																																						dbGAP											2	Substitution - Missense(2)	endometrium(2)																																								-	-	-	SO:0001651	inframe_deletion	0			AY037555	CCDS12763.1	19q13.33	2013-02-28				ENSG00000142538		"""Endogenous ligands"""	30828	protein-coding gene	gene with protein product	"""tuberoinfundibular 39 residues"""	608386				11861531	Standard	NM_178449		Approved	TIP39	uc002pnn.1	Q96A98		ENST00000270631.1:c.64_66delCTG	19.37:g.49926540_49926542delCAG	ENSP00000270631:p.Leu22del		Q96DJ4	In_Frame_Del	DEL	NULL	p.L22in_frame_del	ENST00000270631.1	37	c.66_64	CCDS12763.1	19																																																																																			PTH2	-	NULL	ENSG00000142538		0.690	PTH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTH2	HGNC	protein_coding	OTTHUMT00000465366.1	18	0.00	0	CAG	NM_178449		49926531	49926533	-1	no_errors	ENST00000270631	ensembl	human	known	69_37n	in_frame_del	18	18.18	4	DEL	0.016:0.132:0.132	-
PTPRD	5789	genome.wustl.edu	37	9	8518119	8518119	+	Silent	SNP	G	G	A			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr9:8518119G>A	ENST00000381196.4	-	18	1815	c.1272C>T	c.(1270-1272)gtC>gtT	p.V424V	PTPRD_ENST00000397606.3_Silent_p.V414V|PTPRD_ENST00000397611.3_Silent_p.V421V|PTPRD_ENST00000537002.1_Silent_p.V421V|PTPRD_ENST00000360074.4_Silent_p.V411V|PTPRD_ENST00000358503.5_Silent_p.V411V|PTPRD_ENST00000355233.5_Silent_p.V424V|PTPRD_ENST00000486161.1_Silent_p.V424V|PTPRD_ENST00000540109.1_Silent_p.V424V|PTPRD_ENST00000356435.5_Silent_p.V424V|PTPRD_ENST00000397617.3_Silent_p.V414V	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	424	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		TTCGTGCCTGGACATCCCTCG	0.502										TSP Lung(15;0.13)																												dbGAP											0													189.0	177.0	181.0					9																	8518119		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.1272C>T	9.37:g.8518119G>A			B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like,prints_Tyr_Pase_rcpt/non-rcpt	p.V424	ENST00000381196.4	37	c.1272	CCDS43786.1	9																																																																																			PTPRD	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000153707		0.502	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRD	HGNC	protein_coding	OTTHUMT00000055395.3	256	0.39	1	G			8518119	8518119	-1	no_errors	ENST00000356435	ensembl	human	known	69_37n	silent	139	26.84	51	SNP	0.989	A
PUM1	9698	genome.wustl.edu	37	1	31478856	31478856	+	Silent	SNP	G	G	A			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr1:31478856G>A	ENST00000257075.5	-	5	657	c.564C>T	c.(562-564)atC>atT	p.I188I	PUM1_ENST00000373741.4_Silent_p.I224I|PUM1_ENST00000426105.2_Silent_p.I188I|PUM1_ENST00000373742.2_Intron|PUM1_ENST00000373747.3_Silent_p.I188I|PUM1_ENST00000423018.2_Intron|PUM1_ENST00000424085.2_Intron|PUM1_ENST00000440538.2_Silent_p.I188I	NM_014676.2	NP_055491.1	Q14671	PUM1_HUMAN	pumilio RNA-binding family member 1	188					membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(17)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		TCTGCACCATGATTGGCTGGG	0.468																																						dbGAP											0													101.0	96.0	97.0					1																	31478856		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF315592	CCDS338.1, CCDS44099.1	1p35.2	2013-09-02	2013-09-02		ENSG00000134644	ENSG00000134644			14957	protein-coding gene	gene with protein product		607204	"""pumilio (Drosophila) homolog 1"", ""pumilio homolog 1 (Drosophila)"""				Standard	NM_001020658		Approved	PUMH1, KIAA0099	uc001bsh.1	Q14671	OTTHUMG00000003795	ENST00000257075.5:c.564C>T	1.37:g.31478856G>A			A8K6W4|B4DG92|D3DPN3|E9PCJ0|Q53HH5|Q5VXY7|Q9HAN1	Missense_Mutation	SNP	pfam_Pumilio_RNA-bd_rpt,superfamily_ARM-type_fold,smart_Pumilio_RNA-bd_rpt,pfscan_Pumilio_RNA-bd_rpt	p.H205Y	ENST00000257075.5	37	c.613	CCDS338.1	1	.	.	.	.	.	.	.	.	.	.	G	7.147	0.583082	0.13749	.	.	ENSG00000134644	ENST00000525843	.	.	.	5.8	5.8	0.92144	.	.	.	.	.	T	0.61813	0.2377	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59495	-0.7444	4	.	.	.	-8.0224	10.1394	0.42725	0.152:0.0:0.848:0.0	.	.	.	.	Y	205	.	.	H	-	1	0	PUM1	31251443	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.786000	0.47790	2.751000	0.94390	0.650000	0.86243	CAT	PUM1	-	NULL	ENSG00000134644		0.468	PUM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PUM1	HGNC	protein_coding	OTTHUMT00000010671.1	54	0.00	0	G			31478856	31478856	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000525843	ensembl	human	putative	69_37n	missense	24	34.21	13	SNP	1.000	A
GBA2	57704	genome.wustl.edu	37	9	35749738	35749738	+	5'Flank	SNP	G	G	C			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr9:35749738G>C	ENST00000378103.3	-	0	0				GBA2_ENST00000378094.4_5'Flank|RGP1_ENST00000378078.4_5'UTR|RGP1_ENST00000456972.2_Missense_Mutation_p.D36H|GBA2_ENST00000545786.1_De_novo_Start_OutOfFrame	NM_020944.2	NP_065995.1	Q9HCG7	GBA2_HUMAN	glucosidase, beta (bile acid) 2						bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|central nervous system neuron development (GO:0021954)|glucosylceramide catabolic process (GO:0006680)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-glucosidase activity (GO:0008422)|glucosylceramidase activity (GO:0004348)			NS(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(4)|skin(3)	21	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TTCTAGATCTGATTCCGGAGC	0.607																																						dbGAP											0													41.0	42.0	42.0					9																	35749738		2005	4169	6174	-	-	-	SO:0001631	upstream_gene_variant	0			AJ309567	CCDS6589.1	9p13.2	2013-09-11			ENSG00000070610	ENSG00000070610			18986	protein-coding gene	gene with protein product	"""bile acid beta-glucosidase"", ""non-lysosomal glucosylceramidase"""	609471	"""spastic paraplegia 46 (autosomal recessive)"""	SPG46		11489889, 23332916, 23332917	Standard	NM_020944		Approved	KIAA1605, AD035, DKFZp762K054	uc003zxw.3	Q9HCG7	OTTHUMG00000021024		9.37:g.35749738G>C	Exception_encountered		D3DRP2|Q5TCV6|Q96A51|Q96LY1|Q96SJ2|Q9H2L8	Missense_Mutation	SNP	pfam_Rgp1	p.D36H	ENST00000378103.3	37	c.106	CCDS6589.1	9	.	.	.	.	.	.	.	.	.	.	G	19.72	3.880786	0.72294	.	.	ENSG00000107185	ENST00000456972	.	.	.	5.43	3.44	0.39384	.	.	.	.	.	T	0.38772	0.1053	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.30707	-0.9969	5	0.52906	T	0.07	.	5.6985	0.17869	0.0961:0.0:0.6569:0.247	.	.	.	.	H	36	.	ENSP00000409466:D36H	D	+	1	0	RGP1	35739738	0.020000	0.18652	0.048000	0.18961	0.887000	0.51463	0.609000	0.24238	1.260000	0.44134	0.591000	0.81541	GAT	RGP1	-	NULL	ENSG00000107185		0.607	GBA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RGP1	HGNC	protein_coding	OTTHUMT00000055456.1	129	0.00	0	G	NM_020944		35749738	35749738	+1	no_errors	ENST00000456972	ensembl	human	known	69_37n	missense	82	21.90	23	SNP	0.002	C
GBA2	57704	genome.wustl.edu	37	9	35751661	35751661	+	5'Flank	SNP	G	G	A			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr9:35751661G>A	ENST00000378103.3	-	0	0				GBA2_ENST00000378094.4_5'Flank|MSMP_ENST00000414286.1_5'Flank|RGP1_ENST00000378078.4_Silent_p.G224G|RGP1_ENST00000456972.2_Silent_p.G264G|GBA2_ENST00000545786.1_5'Flank	NM_020944.2	NP_065995.1	Q9HCG7	GBA2_HUMAN	glucosidase, beta (bile acid) 2						bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|central nervous system neuron development (GO:0021954)|glucosylceramide catabolic process (GO:0006680)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-glucosidase activity (GO:0008422)|glucosylceramidase activity (GO:0004348)			NS(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(4)|skin(3)	21	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GGAAAGTTGGGACGTTTGGCA	0.488																																						dbGAP											0													115.0	114.0	114.0					9																	35751661		1964	4158	6122	-	-	-	SO:0001631	upstream_gene_variant	0			AJ309567	CCDS6589.1	9p13.2	2013-09-11			ENSG00000070610	ENSG00000070610			18986	protein-coding gene	gene with protein product	"""bile acid beta-glucosidase"", ""non-lysosomal glucosylceramidase"""	609471	"""spastic paraplegia 46 (autosomal recessive)"""	SPG46		11489889, 23332916, 23332917	Standard	NM_020944		Approved	KIAA1605, AD035, DKFZp762K054	uc003zxw.3	Q9HCG7	OTTHUMG00000021024		9.37:g.35751661G>A	Exception_encountered		D3DRP2|Q5TCV6|Q96A51|Q96LY1|Q96SJ2|Q9H2L8	Silent	SNP	pfam_Rgp1	p.G264	ENST00000378103.3	37	c.792	CCDS6589.1	9																																																																																			RGP1	-	pfam_Rgp1	ENSG00000107185		0.488	GBA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RGP1	HGNC	protein_coding	OTTHUMT00000055456.1	160	0.62	1	G	NM_020944		35751661	35751661	+1	no_errors	ENST00000456972	ensembl	human	known	69_37n	silent	91	23.53	28	SNP	0.994	A
RGS22	26166	genome.wustl.edu	37	8	101083735	101083735	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr8:101083735C>A	ENST00000360863.6	-	6	650	c.456G>T	c.(454-456)tgG>tgT	p.W152C	RGS22_ENST00000523287.1_Intron|RGS22_ENST00000523437.1_Missense_Mutation_p.W152C	NM_015668.3	NP_056483.3	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	152					positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.W152C(2)	RGS22/SYCP1(2)	breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(33)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	68			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			CGGACTTGCTCCATCTTACTT	0.383																																						dbGAP											2	Substitution - Missense(2)	lung(2)											135.0	118.0	123.0					8																	101083735		1841	4102	5943	-	-	-	SO:0001583	missense	0			AY009106	CCDS43758.1, CCDS69521.1, CCDS75775.1	8q22.2	2014-01-21	2007-08-14		ENSG00000132554	ENSG00000132554		"""Regulators of G-protein signaling"""	24499	protein-coding gene	gene with protein product		615650	"""regulator of G-protein signalling 22"""				Standard	XM_005250856		Approved	DKFZP434I092, PRTD-NY2, CT145	uc003yjb.1	Q8NE09	OTTHUMG00000164802	ENST00000360863.6:c.456G>T	8.37:g.101083735C>A	ENSP00000354109:p.Trp152Cys		A8K944|Q569L2|Q86Y71|Q9BYZ4|Q9UFN6	Missense_Mutation	SNP	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal	p.W152C	ENST00000360863.6	37	c.456	CCDS43758.1	8	.	.	.	.	.	.	.	.	.	.	C	18.04	3.533609	0.64972	.	.	ENSG00000132554	ENST00000360863;ENST00000427793;ENST00000523437;ENST00000520117;ENST00000519092;ENST00000519408	T;T	0.62105	0.05;0.05	5.06	5.06	0.68205	.	0.236285	0.30584	N	0.009320	T	0.78578	0.4305	M	0.65975	2.015	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.79918	-0.1600	10	0.59425	D	0.04	.	18.7853	0.91952	0.0:1.0:0.0:0.0	.	152;152	A8K944;Q8NE09	.;RGS22_HUMAN	C	152;152;152;71;56;56	ENSP00000354109:W152C;ENSP00000428212:W152C	ENSP00000354109:W152C	W	-	3	0	RGS22	101152911	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	4.997000	0.63921	2.529000	0.85273	0.484000	0.47621	TGG	RGS22	-	NULL	ENSG00000132554		0.383	RGS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RGS22	HGNC	protein_coding	OTTHUMT00000380365.1	140	0.00	0	C	NM_015668		101083735	101083735	-1	no_errors	ENST00000360863	ensembl	human	known	69_37n	missense	120	24.53	39	SNP	1.000	A
RHBDF2	79651	genome.wustl.edu	37	17	74473024	74473024	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr17:74473024G>A	ENST00000313080.4	-	9	1363	c.1090C>T	c.(1090-1092)Cgg>Tgg	p.R364W	RHBDF2_ENST00000592378.1_5'Flank|RHBDF2_ENST00000389760.4_Missense_Mutation_p.R335W|RHBDF2_ENST00000591885.1_Missense_Mutation_p.R335W	NM_024599.5	NP_078875.4	Q6PJF5	RHDF2_HUMAN	rhomboid 5 homolog 2 (Drosophila)	364					negative regulation of protein secretion (GO:0050709)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(4)|skin(1)	27						CGCTTCTTCCGATCAAAGGCA	0.662																																						dbGAP											0													41.0	52.0	48.0					17																	74473024		2202	4299	6501	-	-	-	SO:0001583	missense	0			BC016034	CCDS32743.1, CCDS32744.1	17q25.3	2014-09-17	2006-02-22	2006-02-22		ENSG00000129667			20788	protein-coding gene	gene with protein product		614404	"""rhomboid, veinlet-like 6 (Drosophila)"", ""tylosis with oesophageal cancer"""	RHBDL6, TOC		12838346, 22265016	Standard	NM_024599		Approved	FLJ22341, RHBDL5, TOCG	uc002jrq.2	Q6PJF5		ENST00000313080.4:c.1090C>T	17.37:g.74473024G>A	ENSP00000322775:p.Arg364Trp		A6NEM3|A8K801|Q5U607|Q5YGQ8|Q9H6E9	Missense_Mutation	SNP	pfam_Rhomboid_SP,pfam_Peptidase_S54_rhomboid_dom	p.R364W	ENST00000313080.4	37	c.1090	CCDS32743.1	17	.	.	.	.	.	.	.	.	.	.	G	24.9	4.580564	0.86645	.	.	ENSG00000129667	ENST00000313080;ENST00000389760;ENST00000389762	T;T	0.57752	0.38;0.38	5.39	5.39	0.77823	.	0.178340	0.45867	D	0.000322	T	0.73118	0.3546	M	0.71036	2.16	0.46701	D	0.999163	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.76071	0.976;0.987;0.929;0.968	T	0.75651	-0.3244	10	0.72032	D	0.01	-43.6996	19.1574	0.93517	0.0:0.0:1.0:0.0	.	335;310;364;335	B7Z8H4;Q6ZWP8;Q6PJF5;Q6PJF5-2	.;.;RHDF2_HUMAN;.	W	364;335;310	ENSP00000322775:R364W;ENSP00000374410:R335W	ENSP00000322775:R364W	R	-	1	2	RHBDF2	71984619	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.661000	0.54503	2.525000	0.85131	0.655000	0.94253	CGG	RHBDF2	-	NULL	ENSG00000129667		0.662	RHBDF2-001	KNOWN	basic|CCDS	protein_coding	RHBDF2	HGNC	protein_coding	OTTHUMT00000450134.1	37	0.00	0	G	NM_024599		74473024	74473024	-1	no_errors	ENST00000313080	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	1.000	A
RPS14	6208	genome.wustl.edu	37	5	149825182	149825182	+	Silent	SNP	G	G	A			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr5:149825182G>A	ENST00000401695.3	-	4	424	c.378C>T	c.(376-378)atC>atT	p.I126I	RPS14_ENST00000407193.1_Silent_p.I126I|RPS14_ENST00000312037.5_Silent_p.I126I			P62263	RS14_HUMAN	ribosomal protein S14	126					cellular protein metabolic process (GO:0044267)|erythrocyte differentiation (GO:0030218)|gene expression (GO:0010467)|maturation of SSU-rRNA (GO:0030490)|mRNA metabolic process (GO:0016071)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translation (GO:0006417)|ribosomal small subunit assembly (GO:0000028)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)	mRNA 5'-UTR binding (GO:0048027)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)|translation regulator activity (GO:0045182)			central_nervous_system(1)|lung(1)|skin(1)	3		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CAATCCGCCCGATCTTCATAC	0.552																																						dbGAP											0													40.0	43.0	42.0					5																	149825182		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS4307.1	5q31-q33	2012-10-02			ENSG00000164587	ENSG00000164587		"""S ribosomal proteins"""	10387	protein-coding gene	gene with protein product	"""emetine resistance"", ""40S ribosomal protein S14"""	130620				3785212, 1549121	Standard	XM_006714790		Approved	EMTB, S14	uc003lsj.3	P62263	OTTHUMG00000130080	ENST00000401695.3:c.378C>T	5.37:g.149825182G>A			B2R5G5|D3DQG5|P06366|Q5BJI0	Missense_Mutation	SNP	pfam_Ribosomal_S11	p.S68L	ENST00000401695.3	37	c.203	CCDS4307.1	5	.	.	.	.	.	.	.	.	.	.	G	10.65	1.409390	0.25378	.	.	ENSG00000164587	ENST00000519855	.	.	.	5.54	-9.68	0.00528	.	.	.	.	.	T	0.43765	0.1262	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51164	-0.8740	4	.	.	.	.	6.4652	0.21977	0.4898:0.0:0.3318:0.1784	.	.	.	.	L	68	.	.	S	-	2	0	RPS14	149805375	0.010000	0.17322	0.627000	0.29227	0.853000	0.48598	-0.799000	0.04560	-1.910000	0.01083	-0.314000	0.08810	TCG	RPS14	-	pfam_Ribosomal_S11	ENSG00000164587		0.552	RPS14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS14	HGNC	protein_coding	OTTHUMT00000252373.1	37	0.00	0	G	NM_001025071		149825182	149825182	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000519855	ensembl	human	putative	69_37n	missense	26	18.75	6	SNP	0.937	A
RYR1	6261	genome.wustl.edu	37	19	38948694	38948694	+	Silent	SNP	C	C	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr19:38948694C>T	ENST00000359596.3	+	18	1929	c.1929C>T	c.(1927-1929)atC>atT	p.I643I	RYR1_ENST00000355481.4_Silent_p.I643I|RYR1_ENST00000360985.3_Silent_p.I643I			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	643	B30.2/SPRY 1. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CCTGCAGCATCCGCCCCAACA	0.567																																						dbGAP											0													75.0	68.0	70.0					19																	38948694		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.1929C>T	19.37:g.38948694C>T			Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.I643	ENST00000359596.3	37	c.1929	CCDS33011.1	19																																																																																			RYR1	-	pfscan_B30.2/SPRY	ENSG00000196218		0.567	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	HGNC	protein_coding	OTTHUMT00000462137.1	45	0.00	0	C			38948694	38948694	+1	no_errors	ENST00000359596	ensembl	human	known	69_37n	silent	32	27.27	12	SNP	1.000	T
SCN10A	6336	genome.wustl.edu	37	3	38805068	38805068	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr3:38805068C>G	ENST00000449082.2	-	5	618	c.619G>C	c.(619-621)Gat>Cat	p.D207H		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	207					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	CCACGGAGATCTATTGCTGTG	0.463																																						dbGAP											0													134.0	129.0	130.0					3																	38805068		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.619G>C	3.37:g.38805068C>G	ENSP00000390600:p.Asp207His		A6NDQ1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_asu,prints_PKD_2	p.D207H	ENST00000449082.2	37	c.619	CCDS33736.1	3	.	.	.	.	.	.	.	.	.	.	C	17.70	3.455421	0.63401	.	.	ENSG00000185313	ENST00000449082	D	0.98602	-5.02	4.66	4.66	0.58398	Ion transport (1);	0.156470	0.56097	D	0.000040	D	0.98817	0.9601	M	0.90309	3.105	0.35547	D	0.8035	D	0.55605	0.972	P	0.59424	0.857	D	0.99967	1.1893	10	0.87932	D	0	.	13.5472	0.61711	0.0:0.922:0.0:0.078	.	207	Q9Y5Y9	SCNAA_HUMAN	H	207	ENSP00000390600:D207H	ENSP00000390600:D207H	D	-	1	0	SCN10A	38780072	0.419000	0.25449	0.064000	0.19789	0.913000	0.54294	1.318000	0.33643	2.558000	0.86282	0.650000	0.86243	GAT	SCN10A	-	pfam_Ion_trans_dom	ENSG00000185313		0.463	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN10A	HGNC	protein_coding	OTTHUMT00000109745.3	138	0.00	0	C	NM_006514		38805068	38805068	-1	no_errors	ENST00000449082	ensembl	human	known	69_37n	missense	129	22.29	37	SNP	0.997	G
SEC16B	89866	genome.wustl.edu	37	1	177899016	177899016	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr1:177899016G>A	ENST00000308284.6	-	26	3249	c.3160C>T	c.(3160-3162)Cgc>Tgc	p.R1054C	SEC16B_ENST00000495165.1_5'UTR|RP4-798P15.3_ENST00000354921.3_RNA	NM_033127.2	NP_149118.2	Q96JE7	SC16B_HUMAN	SEC16 homolog B (S. cerevisiae)	1054					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|peroxisome fission (GO:0016559)|peroxisome organization (GO:0007031)|positive regulation of gene expression (GO:0010628)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endoplasmic reticulum (GO:0070972)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)				central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)|stomach(1)	35						GTGGGATAGCGACGCTGAGCT	0.517																																						dbGAP											0													99.0	107.0	104.0					1																	177899016		2037	4189	6226	-	-	-	SO:0001583	missense	0			AK090411	CCDS44281.1	1q25.2	2012-10-08	2007-06-20	2007-06-20	ENSG00000120341	ENSG00000120341			30301	protein-coding gene	gene with protein product	"""regucalcin gene promotor region related protein"""	612855	"""leucine zipper transcription regulator 2"""	LZTR2		11572484, 11605020	Standard	NM_033127		Approved	RGPR, PGPR-p117	uc001gli.1	Q96JE7	OTTHUMG00000167206	ENST00000308284.6:c.3160C>T	1.37:g.177899016G>A	ENSP00000308339:p.Arg1054Cys		A3EYF1|Q5HYF6|Q8N7D6|Q96GX6	Missense_Mutation	SNP	NULL	p.R1054C	ENST00000308284.6	37	c.3160	CCDS44281.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.0|22.0	4.228948|4.228948	0.79688|0.79688	.|.	.|.	ENSG00000120341|ENSG00000120341	ENST00000308284;ENST00000414025|ENST00000239472	T|.	0.21191|.	2.02|.	5.2|5.2	5.2|5.2	0.72013|0.72013	.|.	0.000000|.	0.64402|.	D|.	0.000002|.	T|T	0.71099|0.71099	0.3300|0.3300	M|M	0.64997|0.64997	1.995|1.995	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.83275|.	0.996;0.996;0.993|.	T|T	0.71097|0.71097	-0.4691|-0.4691	10|6	0.87932|0.44086	D|T	0|0.13	-16.3404|-16.3404	14.2205|14.2205	0.65823|0.65823	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1055;1054;751|.	B1AM08;Q96JE7;Q96PW0|.	.;SC16B_HUMAN;.|.	C|L	1054;739|769	ENSP00000308339:R1054C|.	ENSP00000308339:R1054C|ENSP00000239472:S769L	R|S	-|-	1|2	0|0	AL359075.1|AL359075.1	176165639|176165639	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.861000|0.861000	0.49209|0.49209	4.519000|4.519000	0.60517|0.60517	2.416000|2.416000	0.81992|0.81992	0.561000|0.561000	0.74099|0.74099	CGC|TCG	SEC16B	-	NULL	ENSG00000120341		0.517	SEC16B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC16B	Clone_based_vega_gene	protein_coding	OTTHUMT00000084773.16	134	0.00	0	G	NM_033127		177899016	177899016	-1	no_errors	ENST00000308284	ensembl	human	known	69_37n	missense	130	23.98	41	SNP	1.000	A
SH3BP5L	80851	genome.wustl.edu	37	1	249106488	249106488	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr1:249106488C>T	ENST00000366472.5	-	7	2022	c.793G>A	c.(793-795)Gag>Aag	p.E265K	SH3BP5L_ENST00000475978.1_5'UTR|SH3BP5L_ENST00000411742.2_Missense_Mutation_p.E233K	NM_030645.1	NP_085148.1	Q7L8J4	3BP5L_HUMAN	SH3-binding domain protein 5-like	265										endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	OV - Ovarian serous cystadenocarcinoma(106;0.00805)			CTGATCTGCTCCAGGTTACGA	0.687																																						dbGAP											0													57.0	57.0	57.0					1																	249106488		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB051507	CCDS31126.1	1q44	2008-02-05			ENSG00000175137	ENSG00000175137			29360	protein-coding gene	gene with protein product							Standard	NM_030645		Approved	KIAA1720	uc001iew.1	Q7L8J4	OTTHUMG00000040389	ENST00000366472.5:c.793G>A	1.37:g.249106488C>T	ENSP00000355428:p.Glu265Lys		B4DQ94|Q96FI5|Q9BQH8|Q9C0E3	Missense_Mutation	SNP	pfam_SH3-bd_5	p.E265K	ENST00000366472.5	37	c.793	CCDS31126.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.327219	0.95708	.	.	ENSG00000175137	ENST00000366472;ENST00000411742	T	0.76448	-1.02	4.42	4.42	0.53409	.	0.000000	0.85682	D	0.000000	D	0.88633	0.6489	M	0.85859	2.78	0.80722	D	1	D;D;D;D	0.76494	0.997;0.997;0.999;0.997	D;D;D;D	0.87578	0.994;0.994;0.998;0.994	D	0.90443	0.4433	10	0.87932	D	0	-30.6986	14.9144	0.70785	0.0:1.0:0.0:0.0	.	233;158;265;123	B4DQ94;B4DSF1;Q7L8J4;Q96MW4	.;.;3BP5L_HUMAN;.	K	265;233	ENSP00000412203:E233K	ENSP00000355428:E265K	E	-	1	0	SH3BP5L	247073111	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.691000	0.74573	2.456000	0.83038	0.467000	0.42956	GAG	SH3BP5L	-	pfam_SH3-bd_5	ENSG00000175137		0.687	SH3BP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3BP5L	HGNC	protein_coding	OTTHUMT00000097140.1	58	0.00	0	C	NM_030645		249106488	249106488	-1	no_errors	ENST00000366472	ensembl	human	known	69_37n	missense	40	13.04	6	SNP	1.000	T
SLC36A2	153201	genome.wustl.edu	37	5	150696504	150696504	+	Silent	SNP	G	G	A			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr5:150696504G>A	ENST00000335244.4	-	10	1455	c.1326C>T	c.(1324-1326)ttC>ttT	p.F442F	SLC36A2_ENST00000450886.1_Silent_p.F166F	NM_181776.2	NP_861441.2	Q495M3	S36A2_HUMAN	solute carrier family 36 (proton/amino acid symporter), member 2	442					amino acid transport (GO:0006865)|ion transport (GO:0006811)|proline transmembrane transport (GO:0035524)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine transmembrane transporter activity (GO:0015187)|hydrogen:amino acid symporter activity (GO:0005280)|L-alanine transmembrane transporter activity (GO:0015180)|L-proline transmembrane transporter activity (GO:0015193)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(14)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	33		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Cycloserine(DB00260)	GGGCGTCCTTGAAGATGGTGA	0.617																																						dbGAP											0													77.0	67.0	71.0					5																	150696504		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY162214	CCDS4315.1	5q33.1	2013-05-22			ENSG00000186335	ENSG00000186335		"""Solute carriers"""	18762	protein-coding gene	gene with protein product		608331				11959859	Standard	NM_181776		Approved	PAT2, tramdorin, TRAMD1	uc003lty.3	Q495M3	OTTHUMG00000130129	ENST00000335244.4:c.1326C>T	5.37:g.150696504G>A			Q495M4|Q495M6|Q6ZWK5|Q7Z6B5	Silent	SNP	pfam_AA_transpt_TM	p.F442	ENST00000335244.4	37	c.1326	CCDS4315.1	5																																																																																			SLC36A2	-	pfam_AA_transpt_TM	ENSG00000186335		0.617	SLC36A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC36A2	HGNC	protein_coding	OTTHUMT00000252437.1	118	0.84	1	G			150696504	150696504	-1	no_errors	ENST00000335244	ensembl	human	known	69_37n	silent	107	21.90	30	SNP	0.965	A
SORD	6652	genome.wustl.edu	37	15	45353269	45353269	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr15:45353269T>A	ENST00000267814.9	+	4	450	c.270T>A	c.(268-270)gaT>gaA	p.D90E	RP11-109D20.1_ENST00000560324.1_RNA|SORD_ENST00000558580.1_Missense_Mutation_p.D69E	NM_003104.5	NP_003095.2	Q00796	DHSO_HUMAN	sorbitol dehydrogenase	90					fructose biosynthetic process (GO:0046370)|glucose metabolic process (GO:0006006)|L-xylitol catabolic process (GO:0051160)|L-xylitol metabolic process (GO:0051164)|sorbitol catabolic process (GO:0006062)|sperm motility (GO:0030317)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|motile cilium (GO:0031514)	carbohydrate binding (GO:0030246)|L-iditol 2-dehydrogenase activity (GO:0003939)|NAD binding (GO:0051287)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(3)|lung(4)	9		all_cancers(109;3.43e-12)|all_epithelial(112;2.33e-10)|Lung NSC(122;6.01e-07)|all_lung(180;4.38e-06)|Melanoma(134;0.0122)		all cancers(107;1.6e-18)|GBM - Glioblastoma multiforme(94;4.95e-07)|COAD - Colon adenocarcinoma(120;0.0704)|Colorectal(133;0.0706)		CTCCAGGTGATCGTGTTGCCA	0.517																																						dbGAP											0													80.0	64.0	70.0					15																	45353269		2198	4298	6496	-	-	-	SO:0001583	missense	0				CCDS10116.1	15q15-q21.1	2012-10-02			ENSG00000140263	ENSG00000140263	1.1.1.14		11184	protein-coding gene	gene with protein product		182500				7782086	Standard	NM_003104		Approved		uc001zul.4	Q00796	OTTHUMG00000131265	ENST00000267814.9:c.270T>A	15.37:g.45353269T>A	ENSP00000267814:p.Asp90Glu		B2R655|B7Z3A6|J3JZZ5|Q16682|Q9UMD6	Missense_Mutation	SNP	pfam_ADH_C,pfam_ADH_GroES-like,superfamily_GroES-like,smart_PKS_ER	p.D90E	ENST00000267814.9	37	c.270	CCDS10116.1	15	.	.	.	.	.	.	.	.	.	.	T	18.57	3.652459	0.67472	.	.	ENSG00000140263	ENST00000267814	T	0.06218	3.33	4.23	0.657	0.17850	GroES-like (1);Alcohol dehydrogenase GroES-like (1);	0.000000	0.85682	D	0.000000	T	0.18383	0.0441	M	0.68593	2.085	0.58432	D	0.999991	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.00148	-1.1989	10	0.87932	D	0	-14.4699	8.9076	0.35532	0.0:0.5765:0.0:0.4235	.	11;90	B4DKI2;Q00796	.;DHSO_HUMAN	E	90	ENSP00000267814:D90E	ENSP00000267814:D90E	D	+	3	2	SORD	43140561	0.257000	0.24022	0.998000	0.56505	0.678000	0.39670	-0.337000	0.07852	-0.122000	0.11766	0.460000	0.39030	GAT	SORD	-	pfam_ADH_GroES-like,superfamily_GroES-like,smart_PKS_ER	ENSG00000140263		0.517	SORD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORD	HGNC	protein_coding	OTTHUMT00000254033.3	109	0.00	0	T			45353269	45353269	+1	no_errors	ENST00000267814	ensembl	human	known	69_37n	missense	89	15.24	16	SNP	1.000	A
SOX14	8403	genome.wustl.edu	37	3	137484310	137484310	+	Silent	SNP	C	C	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr3:137484310C>T	ENST00000306087.1	+	1	732	c.684C>T	c.(682-684)ggC>ggT	p.G228G		NM_004189.3	NP_004180.1	O95416	SOX14_HUMAN	SRY (sex determining region Y)-box 14	228					entrainment of circadian clock (GO:0009649)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|regulation of neuron migration (GO:2001222)|visual perception (GO:0007601)	nuclear transcription factor complex (GO:0044798)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			large_intestine(2)|lung(12)	14						CCAAGACTGGCATAGACCCTT	0.642																																						dbGAP											0													53.0	42.0	45.0					3																	137484310		2195	4281	6476	-	-	-	SO:0001819	synonymous_variant	0			AJ006230	CCDS3094.1	3q22-q23	2008-07-18			ENSG00000168875	ENSG00000168875		"""SRY (sex determining region Y)-boxes"""	11193	protein-coding gene	gene with protein product	"""HMG box transcription factor SOX-14"", ""SRY-box 14"""	604747				9925951	Standard	NM_004189		Approved	SOX28	uc003erm.2	O95416	OTTHUMG00000159757	ENST00000306087.1:c.684C>T	3.37:g.137484310C>T			B2RAC0|Q3KPH7	Silent	SNP	pfam_HMG_superfamily,pfam_TF_SOX,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.G228	ENST00000306087.1	37	c.684	CCDS3094.1	3																																																																																			SOX14	-	NULL	ENSG00000168875		0.642	SOX14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX14	HGNC	protein_coding	OTTHUMT00000357182.1	20	0.00	0	C	NM_004189		137484310	137484310	+1	no_errors	ENST00000306087	ensembl	human	known	69_37n	silent	18	41.94	13	SNP	1.000	T
SPATC1	375686	genome.wustl.edu	37	8	145101812	145101812	+	Silent	SNP	C	C	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr8:145101812C>T	ENST00000377470.3	+	5	1833	c.1731C>T	c.(1729-1731)ctC>ctT	p.L577L	SPATC1_ENST00000447830.2_3'UTR|CTD-3065J16.6_ENST00000528912.1_RNA|CTD-3065J16.6_ENST00000561181.1_RNA	NM_198572.2	NP_940974.2	Q76KD6	SPERI_HUMAN	spermatogenesis and centriole associated 1	577						centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.L577L(1)|p.L486L(1)		NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;3.67e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TCTCCTGCCTCAGCCAGCTGG	0.682																																						dbGAP											2	Substitution - coding silent(2)	lung(2)											49.0	48.0	48.0					8																	145101812		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			BC053547	CCDS6413.2, CCDS47937.1	8q24.3	2005-01-11			ENSG00000186583	ENSG00000186583			30510	protein-coding gene	gene with protein product		610874				15280373	Standard	NM_198572		Approved	MGC61633, SPATA15, SPERIOLIN	uc011lkw.2	Q76KD6	OTTHUMG00000156976	ENST00000377470.3:c.1731C>T	8.37:g.145101812C>T			B4DWW9|Q5U5I8|Q7Z6L7	Silent	SNP	NULL	p.L577	ENST00000377470.3	37	c.1731	CCDS6413.2	8																																																																																			SPATC1	-	NULL	ENSG00000186583		0.682	SPATC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPATC1	HGNC	protein_coding	OTTHUMT00000346926.1	26	0.00	0	C	NM_198572		145101812	145101812	+1	no_errors	ENST00000377470	ensembl	human	known	69_37n	silent	5	44.44	4	SNP	1.000	T
SRGAP2	23380	genome.wustl.edu	37	1	206579816	206579816	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr1:206579816C>G	ENST00000414007.1	+	6	819	c.819C>G	c.(817-819)ttC>ttG	p.F273L	SRGAP2_ENST00000419187.2_5'UTR			O75044	SRGP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 2	413	F-BAR domain.				actin filament severing (GO:0051014)|axon guidance (GO:0007411)|dendritic spine development (GO:0060996)|extension of a leading process involved in cell motility in cerebral cortex radial glia guided migration (GO:0021816)|filopodium assembly (GO:0046847)|lamellipodium assembly involved in ameboidal cell migration (GO:0003363)|negative regulation of neuron migration (GO:2001223)|neuron projection morphogenesis (GO:0048812)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic spine head (GO:0044327)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	protein homodimerization activity (GO:0042803)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			NS(1)|breast(1)|kidney(1)|lung(1)	4	Breast(84;0.137)					CTGACTGCTTCCAGTACAGCA	0.527																																						dbGAP											0													8.0	7.0	7.0					1																	206579816		1691	3710	5401	-	-	-	SO:0001583	missense	0			AB007925	CCDS73017.1	1q32.1	2014-08-13	2004-11-12	2004-11-12	ENSG00000163486	ENSG00000266028		"""Rho GTPase activating proteins"""	19751	protein-coding gene	gene with protein product		606524	"""formin binding protein 2"""	FNBP2		15046868, 11672528	Standard	XM_005277510		Approved	KIAA0456, ARHGAP34, SRGAP2A	uc001hdy.3	O75044	OTTHUMG00000184381	ENST00000414007.1:c.819C>G	1.37:g.206579816C>G	ENSP00000390898:p.Phe273Leu			Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,smart_RhoGAP_dom,smart_SH3_domain,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.P327A	ENST00000414007.1	37	c.979		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.2|20.2	3.943637|3.943637	0.73672|0.73672	.|.	.|.	ENSG00000163486|ENSG00000163486	ENST00000414359;ENST00000414007;ENST00000439126|ENST00000295713	T;T|.	0.48836|.	0.8;2.38|.	5.97|5.97	5.06|5.06	0.68205|0.68205	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.55878|0.55878	0.1948|0.1948	.|.	.|.	.|.	.|.	.|.	.|.	D;B;D|.	0.69078|.	0.997;0.114;0.986|.	D;B;D|.	0.70716|.	0.97;0.222;0.93|.	T|T	0.62704|0.62704	-0.6798|-0.6798	8|3	0.38643|.	T|.	0.18|.	.|.	11.3943|11.3943	0.49832|0.49832	0.0:0.8413:0.0:0.1587|0.0:0.8413:0.0:0.1587	.|.	260;413;412|.	B4DDU0;O75044;B7Z3G4|.	.;FNBP2_HUMAN;.|.	L|A	326;273;27|327	ENSP00000390898:F273L;ENSP00000403036:F27L|.	ENSP00000390898:F273L|.	F|P	+|+	3|1	2|0	SRGAP2|SRGAP2	204646439|204646439	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	0.941000|0.941000	0.29005|0.29005	2.837000|2.837000	0.97791|0.97791	0.655000|0.655000	0.94253|0.94253	TTC|CCA	SRGAP2	-	NULL	ENSG00000163486		0.527	SRGAP2-201	KNOWN	basic	protein_coding	SRGAP2	HGNC	protein_coding		32	0.00	0	C	NM_015326		206579816	206579816	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000295713	ensembl	human	known	69_37n	missense	30	18.92	7	SNP	1.000	G
STAT5B	6777	genome.wustl.edu	37	17	40370196	40370196	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr17:40370196G>C	ENST00000293328.3	-	9	1310	c.1142C>G	c.(1141-1143)tCt>tGt	p.S381C		NM_012448.3	NP_036580.2	P51692	STA5B_HUMAN	signal transducer and activator of transcription 5B	381					2-oxoglutarate metabolic process (GO:0006103)|acute-phase response (GO:0006953)|allantoin metabolic process (GO:0000255)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hormone stimulus (GO:0032870)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|development of secondary female sexual characteristics (GO:0046543)|development of secondary male sexual characteristics (GO:0046544)|fatty acid metabolic process (GO:0006631)|female pregnancy (GO:0007565)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|lipid storage (GO:0019915)|liver development (GO:0001889)|luteinization (GO:0001553)|natural killer cell differentiation (GO:0001779)|negative regulation of apoptotic process (GO:0043066)|negative regulation of erythrocyte differentiation (GO:0045647)|oxaloacetate metabolic process (GO:0006107)|Peyer's patch development (GO:0048541)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of cellular component movement (GO:0051272)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone metabolic process (GO:0042448)|prolactin signaling pathway (GO:0038161)|regulation of cell adhesion (GO:0030155)|regulation of epithelial cell differentiation (GO:0030856)|regulation of multicellular organism growth (GO:0040014)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to lipopolysaccharide (GO:0032496)|succinate metabolic process (GO:0006105)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|taurine metabolic process (GO:0019530)|transcription from RNA polymerase II promoter (GO:0006366)|valine metabolic process (GO:0006573)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|glucocorticoid receptor binding (GO:0035259)|protein dimerization activity (GO:0046983)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_cancers(22;4.15e-07)|all_epithelial(22;2.83e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.135)	Dasatinib(DB01254)	CTTGAGCAGAGACTTGGCCTG	0.547																																						dbGAP											0													118.0	93.0	101.0					17																	40370196		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC065227	CCDS11423.1	17q11.2	2014-09-17			ENSG00000173757	ENSG00000173757		"""SH2 domain containing"""	11367	protein-coding gene	gene with protein product		604260				8631883	Standard	NM_012448		Approved		uc002hzh.3	P51692	OTTHUMG00000150724	ENST00000293328.3:c.1142C>G	17.37:g.40370196G>C	ENSP00000293328:p.Ser381Cys		Q8WWS8	Missense_Mutation	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,smart_SH2,pfscan_SH2	p.S381C	ENST00000293328.3	37	c.1142	CCDS11423.1	17	.	.	.	.	.	.	.	.	.	.	G	22.2	4.256129	0.80246	.	.	ENSG00000173757	ENST00000293328	D	0.87966	-2.32	5.41	5.41	0.78517	STAT transcription factor, DNA-binding, subdomain (1);STAT transcription factor, DNA-binding (1);p53-like transcription factor, DNA-binding (1);	0.152472	0.56097	D	0.000021	D	0.86636	0.5980	L	0.34521	1.04	0.47511	D	0.999445	B;P	0.34615	0.305;0.459	B;B	0.43360	0.417;0.347	D	0.86621	0.1879	10	0.72032	D	0.01	-4.0072	19.3785	0.94521	0.0:0.0:1.0:0.0	.	381;381	Q8WW55;P51692	.;STA5B_HUMAN	C	381	ENSP00000293328:S381C	ENSP00000293328:S381C	S	-	2	0	STAT5B	37623722	1.000000	0.71417	0.988000	0.46212	0.995000	0.86356	9.524000	0.98036	2.815000	0.96918	0.561000	0.74099	TCT	STAT5B	-	pfam_STAT_TF_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000173757		0.547	STAT5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAT5B	HGNC	protein_coding	OTTHUMT00000319797.1	117	0.85	1	G	NM_012448		40370196	40370196	-1	no_errors	ENST00000293328	ensembl	human	known	69_37n	missense	91	18.02	20	SNP	1.000	C
TBC1D3P2	440452	genome.wustl.edu	37	17	60345093	60345093	+	RNA	SNP	G	G	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr17:60345093G>T	ENST00000581291.1	-	0	874									TBC1 domain family, member 3 pseudogene 2											breast(2)|kidney(1)|lung(2)	5						GCCTAAGGACGAACACTGCCC	0.572																																						dbGAP											0																																										-	-	-			0					17q23.2	2009-05-14				ENSG00000188755			27783	pseudogene	pseudogene							Standard	NR_027486		Approved		uc002izq.2				17.37:g.60345093G>T				RNA	SNP	-	NULL	ENST00000581291.1	37	NULL		17																																																																																			TBC1D3P2	-	-	ENSG00000188755		0.572	TBC1D3P2-002	KNOWN	basic	processed_transcript	TBC1D3P2	HGNC	pseudogene	OTTHUMT00000445021.1	172	0.00	0	G	NR_027486		60345093	60345093	-1	no_errors	ENST00000339120	ensembl	human	known	69_37n	rna	117	21.48	32	SNP	0.004	T
TBP	6908	genome.wustl.edu	37	6	170871091	170871091	+	Silent	SNP	G	G	A			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr6:170871091G>A	ENST00000392092.2	+	3	546	c.267G>A	c.(265-267)caG>caA	p.Q89Q	TBP_ENST00000540980.1_Silent_p.Q69Q|TBP_ENST00000230354.6_Silent_p.Q89Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	89	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcagcagcagcagcagcagc	0.617																																						dbGAP											0													20.0	26.0	24.0					6																	170871091		1890	3708	5598	-	-	-	SO:0001819	synonymous_variant	0			M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.267G>A	6.37:g.170871091G>A			B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	pfam_TBP,prints_TBP	p.Q89	ENST00000392092.2	37	c.267	CCDS5315.1	6																																																																																			TBP	-	NULL	ENSG00000112592		0.617	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBP	HGNC	protein_coding	OTTHUMT00000043271.2	48	0.00	0	G	NM_003194		170871091	170871091	+1	no_errors	ENST00000230354	ensembl	human	known	69_37n	silent	60	13.04	9	SNP	0.078	A
TBX20	57057	genome.wustl.edu	37	7	35284610	35284610	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr7:35284610G>T	ENST00000408931.3	-	4	1131	c.605C>A	c.(604-606)tCt>tAt	p.S202Y		NM_001077653.2|NM_001166220.1	NP_001071121.1|NP_001159692.1	Q9UMR3	TBX20_HUMAN	T-box 20	202					aortic valve morphogenesis (GO:0003180)|atrial septum morphogenesis (GO:0060413)|blood circulation (GO:0008015)|cardiac chamber formation (GO:0003207)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|dorsal/ventral pattern formation (GO:0009953)|embryonic heart tube elongation (GO:0036306)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cushion formation (GO:0003272)|endocardial cushion morphogenesis (GO:0003203)|endoderm formation (GO:0001706)|foramen ovale closure (GO:0035922)|heart looping (GO:0001947)|lateral mesoderm formation (GO:0048370)|muscle contraction (GO:0006936)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron migration (GO:0001764)|outflow tract septum morphogenesis (GO:0003148)|patterning of blood vessels (GO:0001569)|pericardium morphogenesis (GO:0003344)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary valve formation (GO:0003193)|pulmonary vein morphogenesis (GO:0060577)|tricuspid valve development (GO:0003175)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(9)|prostate(1)|skin(1)|stomach(1)	18						CTTTTCAAAAGACACCATCTG	0.418																																						dbGAP											0													193.0	153.0	167.0					7																	35284610		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ237589	CCDS43568.1	7p14.3	2014-09-17			ENSG00000164532	ENSG00000164532		"""T-boxes"""	11598	protein-coding gene	gene with protein product		606061				10936053	Standard	NM_001077653		Approved		uc011kas.2	Q9UMR3	OTTHUMG00000099411	ENST00000408931.3:c.605C>A	7.37:g.35284610G>T	ENSP00000386170:p.Ser202Tyr		A4D1Y6|Q000T4|Q0IJ70|Q0VAS1|Q9Y2N5	Missense_Mutation	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.S202Y	ENST00000408931.3	37	c.605	CCDS43568.1	7	.	.	.	.	.	.	.	.	.	.	G	27.0	4.786629	0.90367	.	.	ENSG00000164532	ENST00000408931	D	0.90955	-2.76	5.47	5.47	0.80525	Transcription factor, T-box, conserved site (1);p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.96911	0.8991	H	0.94771	3.58	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97740	1.0208	10	0.87932	D	0	.	19.3343	0.94309	0.0:0.0:1.0:0.0	.	202	Q9UMR3	TBX20_HUMAN	Y	202	ENSP00000386170:S202Y	ENSP00000386170:S202Y	S	-	2	0	TBX20	35251135	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.869000	0.99810	2.567000	0.86603	0.591000	0.81541	TCT	TBX20	-	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	ENSG00000164532		0.418	TBX20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBX20	HGNC	protein_coding	OTTHUMT00000216870.2	253	0.39	1	G	NM_020417		35284610	35284610	-1	no_errors	ENST00000408931	ensembl	human	known	69_37n	missense	133	25.28	45	SNP	1.000	T
TCOF1	6949	genome.wustl.edu	37	5	149775971	149775971	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr5:149775971C>T	ENST00000504761.2	+	24	3908	c.3908C>T	c.(3907-3909)cCc>cTc	p.P1303L	TCOF1_ENST00000323668.7_Missense_Mutation_p.P1226L|TCOF1_ENST00000439160.2_Missense_Mutation_p.P1266L|TCOF1_ENST00000377797.3_Missense_Mutation_p.P1304L|TCOF1_ENST00000445265.2_Missense_Mutation_p.P1227L|TCOF1_ENST00000513346.1_Missense_Mutation_p.P1303L|TCOF1_ENST00000451292.1_Missense_Mutation_p.P1340L			Q13428	TCOF_HUMAN	Treacher Collins-Franceschetti syndrome 1	1303					skeletal system development (GO:0001501)|transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:0042790)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transporter activity (GO:0005215)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	35		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTGGGCCAACCCTGGCCCCTG	0.607																																						dbGAP											0													39.0	42.0	41.0					5																	149775971		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4306.1, CCDS47305.1, CCDS47306.1, CCDS47307.1, CCDS54936.1	5q32	2014-06-18			ENSG00000070814	ENSG00000070814			11654	protein-coding gene	gene with protein product		606847				1765376	Standard	NM_001008657		Approved	treacle, TCS	uc003lry.3	Q13428	OTTHUMG00000130081	ENST00000504761.2:c.3908C>T	5.37:g.149775971C>T	ENSP00000421655:p.Pro1303Leu		A0JLU0|B4E111|Q6SC72|Q7Z5W9|Q96A52|Q99408|Q99860	Missense_Mutation	SNP	pfam_TCS_treacle,smart_LisH_dimerisation,pfscan_LisH_dimerisation,prints_Treacle-like_TCS	p.P1340L	ENST00000504761.2	37	c.4019	CCDS54936.1	5	.	.	.	.	.	.	.	.	.	.	C	12.06	1.823856	0.32237	.	.	ENSG00000070814	ENST00000451292;ENST00000377797;ENST00000445265;ENST00000323668;ENST00000439160;ENST00000427724;ENST00000504761;ENST00000513346	T;T;T;T;T;T;T;T	0.58506	0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33	4.8	2.94	0.34122	.	0.823466	0.10289	N	0.692608	T	0.59609	0.2206	L	0.32530	0.975	0.29062	N	0.883837	P;P;P;D;P	0.62365	0.728;0.728;0.728;0.991;0.728	B;B;B;P;B	0.55667	0.294;0.294;0.294;0.781;0.294	T	0.54132	-0.8339	10	0.72032	D	0.01	-0.4592	10.4753	0.44661	0.3524:0.6476:0.0:0.0	.	1266;1226;1265;1303;1227	Q13428-7;Q13428-2;Q13428-6;Q13428;Q13428-8	.;.;.;TCOF_HUMAN;.	L	1340;1304;1227;1226;1266;1265;1303;1303	ENSP00000400939:P1340L;ENSP00000367028:P1304L;ENSP00000409944:P1227L;ENSP00000325223:P1226L;ENSP00000406888:P1266L;ENSP00000390717:P1265L;ENSP00000421655:P1303L;ENSP00000427484:P1303L	ENSP00000325223:P1226L	P	+	2	0	TCOF1	149756164	0.806000	0.28996	0.671000	0.29857	0.027000	0.11550	1.244000	0.32778	0.652000	0.30806	-0.314000	0.08810	CCC	TCOF1	-	NULL	ENSG00000070814		0.607	TCOF1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	TCOF1	HGNC	protein_coding	OTTHUMT00000380552.1	19	0.00	0	C	NM_001008656		149775971	149775971	+1	no_errors	ENST00000451292	ensembl	human	known	69_37n	missense	21	34.38	11	SNP	0.784	T
THEMIS	387357	genome.wustl.edu	37	6	128221997	128221997	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr6:128221997G>C	ENST00000368248.2	-	1	229	c.81C>G	c.(79-81)atC>atG	p.I27M	THEMIS_ENST00000537166.1_Intron|THEMIS_ENST00000543064.1_Missense_Mutation_p.I27M|THEMIS_ENST00000368250.1_De_novo_Start_InFrame	NM_001010923.2	NP_001010923.1	Q8N1K5	THMS1_HUMAN	thymocyte selection associated	27	CABIT 1.				negative T cell selection (GO:0043383)|positive T cell selection (GO:0043368)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(3)	60						CTTCAAGATAGATGCCTGCCT	0.428																																						dbGAP											0													192.0	186.0	188.0					6																	128221997		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK094863	CCDS34534.1, CCDS55055.1	6q22.33	2012-02-08	2009-06-25	2009-06-25	ENSG00000172673	ENSG00000172673			21569	protein-coding gene	gene with protein product	"""thymocyte expressed molecule involved in selection"""	613607	"""chromosome 6 open reading frame 207"", ""chromosome 6 open reading frame 190"", ""thymocyte selection pathway associated"""	C6orf207, C6orf190, TSEPA		19597499, 19597498, 19597497	Standard	NM_001010923		Approved	bA325O24.4, FLJ40584, bA325O24.3	uc011ebt.2	Q8N1K5	OTTHUMG00000015534	ENST00000368248.2:c.81C>G	6.37:g.128221997G>C	ENSP00000357231:p.Ile27Met		A1L4F0|A8K7N1|B3KT31|B3KW32|B3KY07|F5H1J9|Q5T3C4|Q5T3C5|Q6MZT7	Missense_Mutation	SNP	NULL	p.I27M	ENST00000368248.2	37	c.81	CCDS34534.1	6	.	.	.	.	.	.	.	.	.	.	G	16.49	3.137986	0.56936	.	.	ENSG00000172673	ENST00000543064;ENST00000368248	T;T	0.14144	2.53;2.53	5.65	4.78	0.61160	.	0.312769	0.28203	N	0.016218	T	0.15262	0.0368	L	0.60455	1.87	0.80722	D	1	D;P	0.53151	0.958;0.928	P;P	0.54965	0.748;0.765	T	0.00992	-1.1488	10	0.72032	D	0.01	-2.242	10.2916	0.43599	0.0908:0.0:0.9092:0.0	.	27;27	F5H1J9;Q8N1K5	.;THMS1_HUMAN	M	27	ENSP00000439594:I27M;ENSP00000357231:I27M	ENSP00000357231:I27M	I	-	3	3	THEMIS	128263690	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.005000	0.40864	1.386000	0.46466	0.591000	0.81541	ATC	THEMIS	-	NULL	ENSG00000172673		0.428	THEMIS-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	THEMIS	HGNC	protein_coding		162	0.61	1	G	NM_001010923		128221997	128221997	-1	no_errors	ENST00000543064	ensembl	human	known	69_37n	missense	102	33.97	53	SNP	1.000	C
TMEM247	388946	genome.wustl.edu	37	2	46707888	46707888	+	Frame_Shift_Del	DEL	G	G	-			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr2:46707888delG	ENST00000434431.1	+	2	462	c.462delG	c.(460-462)gagfs	p.E154fs		NM_001145051.2	NP_001138523.1	A6NEH6	TM247_HUMAN	transmembrane protein 247	154						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											TGCAGCAAGAGGCGGCGCCCC	0.682																																						dbGAP											0										59,2867		9,41,1413	15.0	19.0	18.0			1.5	0.0	2	dbSNP_130	19	233,5079		9,215,2432	no	frameshift	LOC388946	NM_001145051.2		18,256,3845	A1A1,A1R,RR		4.3863,2.0164,3.5445			46707888	292,7946	690	1589	2279	-	-	-	SO:0001589	frameshift_variant	0				CCDS56117.1	2p21	2012-04-11			ENSG00000187600	ENSG00000187600			42967	protein-coding gene	gene with protein product							Standard	NM_001145051		Approved		uc010yod.3	A6NEH6	OTTHUMG00000153137	ENST00000434431.1:c.462delG	2.37:g.46707888delG	ENSP00000388684:p.Glu154fs			Frame_Shift_Del	DEL	NULL	p.A155fs	ENST00000434431.1	37	c.462	CCDS56117.1	2																																																																																			TMEM247	-	NULL	ENSG00000187600		0.682	TMEM247-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	TMEM247	HGNC	protein_coding	OTTHUMT00000329726.1	25	0.00	0	G	NM_001145051		46707888	46707888	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000434431	ensembl	human	known	69_37n	frame_shift_del	27	15.62	5	DEL	0.083	-
TNNI2	7136	genome.wustl.edu	37	11	1862416	1862416	+	Silent	SNP	C	C	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr11:1862416C>T	ENST00000381906.1	+	7	501	c.432C>T	c.(430-432)gtC>gtT	p.V144V	TNNI2_ENST00000381905.3_Silent_p.V144V|TNNI2_ENST00000381911.1_Silent_p.V144V|TNNI2_ENST00000252898.7_Silent_p.V144V	NM_001145829.1	NP_001139301.1	P48788	TNNI2_HUMAN	troponin I type 2 (skeletal, fast)	144					muscle filament sliding (GO:0030049)|positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|nucleus (GO:0005634)|troponin complex (GO:0005861)	troponin T binding (GO:0031014)			lung(8)|prostate(1)|urinary_tract(1)	10		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		TGAAGCAGGTCAAGAAGGAGG	0.662																																						dbGAP											0													57.0	48.0	51.0					11																	1862416		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			L21715	CCDS31333.1, CCDS53594.1	11p15.5	2014-09-17	2005-09-12		ENSG00000130598	ENSG00000130598			11946	protein-coding gene	gene with protein product	"""troponin I, fast-twitch skeletal muscle isoform"", ""troponin I fast twitch 2"""	191043	"""troponin I, skeletal, fast"", ""arthrogryposis multiplex congenita, distal, type 2B"""	AMCD2B		9016781, 12592607	Standard	NM_001145829		Approved	FSSV, DA2B	uc010qxe.1	P48788	OTTHUMG00000012253	ENST00000381906.1:c.432C>T	11.37:g.1862416C>T			A6NIV8|A6NJU5	Silent	SNP	pfam_Troponin	p.V144	ENST00000381906.1	37	c.432	CCDS31333.1	11																																																																																			TNNI2	-	pfam_Troponin	ENSG00000130598		0.662	TNNI2-001	KNOWN	basic|CCDS	protein_coding	TNNI2	HGNC	protein_coding	OTTHUMT00000034046.2	35	0.00	0	C	NM_003282		1862416	1862416	+1	no_errors	ENST00000252898	ensembl	human	known	69_37n	silent	24	17.24	5	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7577515	7577517	+	In_Frame_Del	DEL	TGA	TGA	-	rs587781433		TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	TGA	TGA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr17:7577515_7577517delTGA	ENST00000269305.4	-	7	953_955	c.764_766delTCA	c.(763-768)atcaca>aca	p.I255del	TP53_ENST00000420246.2_In_Frame_Del_p.I255del|TP53_ENST00000455263.2_In_Frame_Del_p.I255del|TP53_ENST00000359597.4_In_Frame_Del_p.I255del|TP53_ENST00000413465.2_In_Frame_Del_p.I255del|TP53_ENST00000445888.2_In_Frame_Del_p.I255del|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	255	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		I -> F (in sporadic cancers; somatic mutation).|I -> M (in sporadic cancers; somatic mutation).|I -> N (in sporadic cancers; somatic mutation).|I -> S (in sporadic cancers; somatic mutation).|I -> T (in sporadic cancers; somatic mutation).|I -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.I255S(10)|p.0?(8)|p.I255N(7)|p.I255del(7)|p.I255T(7)|p.T256A(3)|p.T256fs*89(3)|p.T256fs*8(2)|p.T256S(2)|p.I255I(2)|p.I255fs*8(1)|p.?(1)|p.I254fs*7(1)|p.I255M(1)|p.T256fs*90(1)|p.T256P(1)|p.T256del(1)|p.R249_T256delRPILTIIT(1)|p.T256fs*87(1)|p.T256fs*17(1)|p.I254_T256del(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCTTCCAGTGTGATGATGGTGAG	0.586		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	62	Substitution - Missense(31)|Deletion - In frame(10)|Whole gene deletion(8)|Deletion - Frameshift(6)|Insertion - Frameshift(4)|Substitution - coding silent(2)|Unknown(1)	breast(15)|ovary(7)|pancreas(6)|central_nervous_system(5)|bone(5)|upper_aerodigestive_tract(4)|large_intestine(3)|haematopoietic_and_lymphoid_tissue(3)|urinary_tract(3)|oesophagus(3)|lung(3)|thyroid(1)|stomach(1)|liver(1)|endometrium(1)|skin(1)																																								-	-	-	SO:0001651	inframe_deletion	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.764_766delTCA	17.37:g.7577518_7577520delTGA	ENSP00000269305:p.Ile255del		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	In_Frame_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.I255in_frame_del	ENST00000269305.4	37	c.766_764	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.586	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	102	0.95	1	TGA	NM_000546		7577515	7577517	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	in_frame_del	26	60.87	42	DEL	1.000:1.000:1.000	-
TRPM5	29850	genome.wustl.edu	37	11	2432657	2432657	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr11:2432657C>T	ENST00000155858.6	-	18	2715	c.2707G>A	c.(2707-2709)Gag>Aag	p.E903K	TRPM5_ENST00000452833.1_Missense_Mutation_p.E905K|TRPM5_ENST00000528453.1_Missense_Mutation_p.E903K|TRPM5_ENST00000533060.1_Missense_Mutation_p.E903K	NM_014555.3	NP_055370.1			transient receptor potential cation channel, subfamily M, member 5											breast(1)|central_nervous_system(1)|endometrium(4)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(2)|urinary_tract(2)	23		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		AAGATCCACTCCAGGCGGCCG	0.622																																					NSCLC(1;49 61 17205 18850 43201)	dbGAP											0													33.0	37.0	35.0					11																	2432657		2198	4295	6493	-	-	-	SO:0001583	missense	0			AF177473	CCDS31340.1	11p15.5	2011-12-14			ENSG00000070985	ENSG00000070985		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	14323	protein-coding gene	gene with protein product		604600				10607831, 16382100	Standard	NM_014555		Approved	LTRPC5, MTR1	uc001lwm.4	Q9NZQ8	OTTHUMG00000009896	ENST00000155858.6:c.2707G>A	11.37:g.2432657C>T	ENSP00000155858:p.Glu903Lys			Missense_Mutation	SNP	superfamily_Ankyrin_rpt-contain_dom	p.E905K	ENST00000155858.6	37	c.2713	CCDS31340.1	11	.	.	.	.	.	.	.	.	.	.	C	19.63	3.864228	0.71949	.	.	ENSG00000070985	ENST00000533881;ENST00000155858;ENST00000452833;ENST00000533060;ENST00000528453	T;T;T;T;T	0.69806	-0.43;-0.43;-0.43;-0.43;-0.43	3.89	2.96	0.34315	Ion transport (1);	0.061993	0.64402	D	0.000005	T	0.58524	0.2128	L	0.38838	1.175	0.37507	D	0.917019	P;P;P	0.50443	0.935;0.935;0.868	P;P;P	0.49252	0.604;0.604;0.572	T	0.58668	-0.7596	10	0.35671	T	0.21	-22.2791	6.8426	0.23971	0.0:0.7236:0.1798:0.0966	.	903;905;903	E9PRW0;Q9NZQ8-2;Q9NZQ8	.;.;TRPM5_HUMAN	K	897;903;905;903;903	ENSP00000434383:E897K;ENSP00000155858:E903K;ENSP00000387965:E905K;ENSP00000434121:E903K;ENSP00000436809:E903K	ENSP00000155858:E903K	E	-	1	0	TRPM5	2389233	0.998000	0.40836	0.985000	0.45067	0.949000	0.60115	3.696000	0.54757	0.761000	0.33130	0.561000	0.74099	GAG	TRPM5	-	NULL	ENSG00000070985		0.622	TRPM5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TRPM5	HGNC	protein_coding	OTTHUMT00000027378.1	20	0.00	0	C	NM_014555		2432657	2432657	-1	no_errors	ENST00000452833	ensembl	human	known	69_37n	missense	9	30.77	4	SNP	1.000	T
AC002472.1	0	genome.wustl.edu	37	22	21363462	21363462	+	5'Flank	SNP	C	C	T	rs149639922	byFrequency	TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr22:21363462C>T	ENST00000547793.2	-	0	0				THAP7-AS1_ENST00000436079.1_RNA|TUBA3FP_ENST00000422086.1_RNA|THAP7-AS1_ENST00000452284.1_RNA																							ATGGGACACTCGATGTCCAGG	0.532													C|||	6	0.00119808	0.0	0.0	5008	,	,		20891	0.005		0.0	False		,,,				2504	0.001					dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0																															22.37:g.21363462C>T	Exception_encountered			RNA	SNP	-	NULL	ENST00000547793.2	37	NULL		22																																																																																			TUBA3FP	-	-	ENSG00000161149		0.532	AC002472.1-201	NOVEL	basic|appris_principal	protein_coding	TUBA3FP	HGNC	protein_coding		198	0.50	1	C			21363462	21363462	-1	no_errors	ENST00000292748	ensembl	human	known	69_37n	rna	145	24.08	46	SNP	1.000	T
TUT1	64852	genome.wustl.edu	37	11	62343377	62343377	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr11:62343377G>C	ENST00000476907.1	-	9	2505	c.1814C>G	c.(1813-1815)tCt>tGt	p.S605C	TUT1_ENST00000308436.7_Missense_Mutation_p.S643C|MIR3654_ENST00000496634.2_Intron|EEF1G_ENST00000378019.3_5'Flank|EEF1G_ENST00000532986.1_5'Flank|EEF1G_ENST00000329251.4_5'Flank			Q9H6E5	STPAP_HUMAN	terminal uridylyl transferase 1, U6 snRNA-specific	605					mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|snRNA processing (GO:0016180)	intercellular bridge (GO:0045171)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|mRNA 3'-UTR binding (GO:0003730)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)|RNA uridylyltransferase activity (GO:0050265)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						CGGCGTAGCAGAGAGCAGGGA	0.627																																						dbGAP											0													55.0	60.0	58.0					11																	62343377		2202	4299	6501	-	-	-	SO:0001583	missense	0			BC005013	CCDS8021.1, CCDS8021.2	11q12.2	2014-03-05	2006-10-06	2006-10-06	ENSG00000149016	ENSG00000149016	2.7.7.52	"""RNA binding motif (RRM) containing"""	26184	protein-coding gene	gene with protein product	"""RNA uridylyltransferase"", ""U6 TUTase"", ""TUTase 6"""	610641	"""RNA binding motif protein 21"""	RBM21		16790842	Standard	NM_022830		Approved	FLJ22347, FLJ22267, FLJ21850, PAPD2, TUTase	uc001nto.2	Q9H6E5	OTTHUMG00000158564	ENST00000476907.1:c.1814C>G	11.37:g.62343377G>C	ENSP00000419607:p.Ser605Cys		A1A527|A8K995|Q2NL65|Q7L583|Q9H6H7	Missense_Mutation	SNP	pfam_PAP_assoc,pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.S643C	ENST00000476907.1	37	c.1928		11	.	.	.	.	.	.	.	.	.	.	G	14.01	2.408710	0.42715	.	.	ENSG00000149016	ENST00000308436;ENST00000476907	T;T	0.39056	1.1;1.11	5.71	5.71	0.89125	.	0.742417	0.13287	N	0.399283	T	0.30978	0.0782	N	0.19112	0.55	0.27235	N	0.9593	P;B	0.37330	0.59;0.091	B;B	0.35182	0.197;0.039	T	0.28713	-1.0035	10	0.87932	D	0	-8.4384	12.9913	0.58620	0.0:0.1621:0.8379:0.0	.	605;643	Q9H6E5;F5H0R1	STPAP_HUMAN;.	C	643;605	ENSP00000308000:S643C;ENSP00000419607:S605C	ENSP00000308000:S643C	S	-	2	0	TUT1	62099953	0.941000	0.31946	0.928000	0.36995	0.059000	0.15707	3.366000	0.52343	2.696000	0.92011	0.655000	0.94253	TCT	TUT1	-	NULL	ENSG00000149016		0.627	TUT1-001	KNOWN	basic|appris_candidate	protein_coding	TUT1	HGNC	protein_coding	OTTHUMT00000351319.2	61	0.00	0	G	NM_022830		62343377	62343377	-1	no_errors	ENST00000308436	ensembl	human	known	69_37n	missense	38	25.49	13	SNP	0.996	C
U2AF2	11338	genome.wustl.edu	37	19	56171941	56171941	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr19:56171941C>T	ENST00000308924.4	+	4	330	c.290C>T	c.(289-291)cCa>cTa	p.P97L	U2AF2_ENST00000450554.2_Missense_Mutation_p.P97L|CTD-2537I9.12_ENST00000589456.1_RNA|U2AF2_ENST00000590551.1_5'Flank|CTD-2537I9.12_ENST00000585940.1_RNA			P26368	U2AF2_HUMAN	U2 small nuclear RNA auxiliary factor 2	97					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|urinary_tract(2)	21		Colorectal(82;0.00244)|Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		GTGCCACCCCCAGGCTTTGAG	0.632																																						dbGAP											0													77.0	67.0	70.0					19																	56171941		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC008740	CCDS12933.1, CCDS46197.1	19q13.43	2014-09-17	2006-04-11			ENSG00000063244		"""RNA binding motif (RRM) containing"""	23156	protein-coding gene	gene with protein product	"""U2 small nuclear ribonucleoprotein auxiliary factor (65kD)"", ""splicing factor U2AF 65 kD subunit"", ""U2 snRNP auxiliary factor large subunit"""	191318	"""U2 (RNU2) small nuclear RNA auxiliary factor 2"""			1538748	Standard	XM_006722994		Approved	U2AF65	uc002qlu.3	P26368		ENST00000308924.4:c.290C>T	19.37:g.56171941C>T	ENSP00000307863:p.Pro97Leu		Q96HC5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_U2AF_lg	p.P97L	ENST00000308924.4	37	c.290	CCDS12933.1	19	.	.	.	.	.	.	.	.	.	.	c	10.73	1.433389	0.25813	.	.	ENSG00000063244	ENST00000308924;ENST00000450554	T;T	0.12255	2.72;2.7	3.85	3.85	0.44370	.	0.000000	0.85682	U	0.000000	T	0.14184	0.0343	L	0.43923	1.385	0.80722	D	1	B;B	0.11235	0.002;0.004	B;B	0.14578	0.005;0.011	T	0.05451	-1.0884	10	0.49607	T	0.09	-19.2923	15.089	0.72177	0.0:1.0:0.0:0.0	.	97;97	P26368;P26368-2	U2AF2_HUMAN;.	L	97	ENSP00000307863:P97L;ENSP00000388475:P97L	ENSP00000307863:P97L	P	+	2	0	U2AF2	60863753	1.000000	0.71417	0.088000	0.20740	0.049000	0.14656	7.083000	0.76859	2.142000	0.66516	0.472000	0.43445	CCA	U2AF2	-	tigrfam_U2AF_lg	ENSG00000063244		0.632	U2AF2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	U2AF2	HGNC	protein_coding	OTTHUMT00000453599.1	65	0.00	0	C	NM_007279		56171941	56171941	+1	no_errors	ENST00000308924	ensembl	human	known	69_37n	missense	29	29.27	12	SNP	0.994	T
UGGT2	55757	genome.wustl.edu	37	13	96529964	96529964	+	Silent	SNP	C	C	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr13:96529964C>T	ENST00000376747.3	-	28	3445	c.3375G>A	c.(3373-3375)gtG>gtA	p.V1125V		NM_020121.3	NP_064506.3	Q9NYU1	UGGG2_HUMAN	UDP-glucose glycoprotein glucosyltransferase 2	1125					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-glucosylation (GO:0097359)	endoplasmic reticulum lumen (GO:0005788)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(17)|lung(20)|ovary(3)|pancreas(1)|prostate(4)|urinary_tract(2)	60						GATGTGCCATCACTATTGTAT	0.353																																						dbGAP											0													95.0	90.0	91.0					13																	96529964		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF227906	CCDS9480.1	13q32.1	2009-07-23	2009-07-23	2009-07-23	ENSG00000102595	ENSG00000102595			15664	protein-coding gene	gene with protein product	"""UDP-glucose:glycoprotein glucosyltransferase 2"""	605898	"""UDP-glucose ceramide glucosyltransferase-like 2"""	UGCGL2		10694380	Standard	NM_020121		Approved	FLJ11485, HUGT2, FLJ10873, MGC150689, MGC87276, MGC117360	uc001vmt.3	Q9NYU1	OTTHUMG00000017230	ENST00000376747.3:c.3375G>A	13.37:g.96529964C>T			A6NKL4|Q08AD0|Q5JQR8|Q8N5K0|Q9UFC4	Silent	SNP	pfam_UDP-g_GGtrans,pfam_Glyco_trans_8	p.V1125	ENST00000376747.3	37	c.3375	CCDS9480.1	13																																																																																			UGGT2	-	pfam_UDP-g_GGtrans	ENSG00000102595		0.353	UGGT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGGT2	HGNC	protein_coding	OTTHUMT00000045507.1	101	0.00	0	C	NM_020121		96529964	96529964	-1	no_errors	ENST00000376747	ensembl	human	known	69_37n	silent	248	12.06	34	SNP	1.000	T
UNC79	57578	genome.wustl.edu	37	14	94088627	94088627	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr14:94088627C>T	ENST00000393151.2	+	30	5048	c.5048C>T	c.(5047-5049)cCg>cTg	p.P1683L	UNC79_ENST00000553484.1_Missense_Mutation_p.P1705L|UNC79_ENST00000256339.4_Missense_Mutation_p.P1506L|UNC79_ENST00000555664.1_Missense_Mutation_p.P1683L			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	1683					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P1705L(1)|p.P1506L(1)		breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						AGCACAGCTCCGCTTGTACAA	0.532																																						dbGAP											2	Substitution - Missense(2)	ovary(2)											77.0	80.0	79.0					14																	94088627		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.5048C>T	14.37:g.94088627C>T	ENSP00000376858:p.Pro1683Leu		B5MDL6|Q6ZUT7	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.P1705L	ENST00000393151.2	37	c.5114		14	.	.	.	.	.	.	.	.	.	.	C	10.84	1.463154	0.26248	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.32753	1.54;1.44;1.55;1.54	5.3	4.4	0.53042	.	0.051283	0.85682	D	0.000000	T	0.21921	0.0528	L	0.29908	0.895	0.58432	D	0.999998	P	0.39696	0.683	B	0.29598	0.104	T	0.05370	-1.0889	10	0.87932	D	0	-11.3744	16.0821	0.81012	0.0:0.8659:0.1341:0.0	.	1705	C9JQL1	.	L	1506;1683;1705;1683;1705	ENSP00000256339:P1506L;ENSP00000450868:P1683L;ENSP00000451360:P1705L;ENSP00000376858:P1683L	ENSP00000256339:P1506L	P	+	2	0	KIAA1409	93158380	0.998000	0.40836	0.266000	0.24541	0.568000	0.35870	4.329000	0.59260	1.216000	0.43427	0.313000	0.20887	CCG	UNC79	-	superfamily_ARM-type_fold	ENSG00000133958		0.532	UNC79-006	KNOWN	basic	protein_coding	UNC79	HGNC	protein_coding	OTTHUMT00000412766.1	61	0.00	0	C	XM_028395		94088627	94088627	+1	no_errors	ENST00000553484	ensembl	human	known	69_37n	missense	35	41.67	25	SNP	0.997	T
USP13	8975	genome.wustl.edu	37	3	179472637	179472637	+	Nonsense_Mutation	SNP	C	C	A			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr3:179472637C>A	ENST00000263966.3	+	15	2387	c.1916C>A	c.(1915-1917)tCa>tAa	p.S639*	USP13_ENST00000496897.1_Nonsense_Mutation_p.S574*|USP13_ENST00000482333.1_3'UTR	NM_003940.2	NP_003931.2	Q92995	UBP13_HUMAN	ubiquitin specific peptidase 13 (isopeptidase T-3)	639	USP.				autophagy (GO:0006914)|cell proliferation (GO:0008283)|melanocyte differentiation (GO:0030318)|protein K63-linked deubiquitination (GO:0070536)|protein stabilization (GO:0050821)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type endopeptidase activity (GO:0004197)|omega peptidase activity (GO:0008242)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	46	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			CCTGATGACTCAAAAGGTACC	0.522																																						dbGAP											0													114.0	107.0	109.0					3																	179472637		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U75362	CCDS3235.1	3q26.2-q26.3	2008-04-11	2005-08-08		ENSG00000058056	ENSG00000058056		"""Ubiquitin-specific peptidases"""	12611	protein-coding gene	gene with protein product		603591	"""ubiquitin specific protease 13 (isopeptidase T-3)"""			12838346	Standard	NM_003940		Approved	IsoT-3	uc003fkh.3	Q92995	OTTHUMG00000157783	ENST00000263966.3:c.1916C>A	3.37:g.179472637C>A	ENSP00000263966:p.Ser639*		A8K2S3|B4DYF3|D3DNS2|Q96B25	Nonsense_Mutation	SNP	pfam_Peptidase_C19,pfam_UBA/transl_elong_EF1B_N,pfam_Znf_UBP,superfamily_UBA-like,smart_Znf_UBP,smart_UBA/transl_elong_EF1B_N_euk,pirsf_Ubiquitinyl_hydrolase,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_UBP,pfscan_Peptidase_C19	p.S639*	ENST00000263966.3	37	c.1916	CCDS3235.1	3	.	.	.	.	.	.	.	.	.	.	C	44	10.709171	0.99454	.	.	ENSG00000058056	ENST00000263966;ENST00000496897;ENST00000497155	.	.	.	6.06	5.2	0.72013	.	0.195415	0.44902	D	0.000419	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07482	T	0.82	-10.1238	15.2353	0.73427	0.0:0.9331:0.0:0.0668	.	.	.	.	X	639;574;285	.	ENSP00000263966:S639X	S	+	2	0	USP13	180955331	1.000000	0.71417	0.915000	0.36163	0.985000	0.73830	7.176000	0.77643	1.580000	0.49851	0.650000	0.86243	TCA	USP13	-	pfam_Peptidase_C19,pirsf_Ubiquitinyl_hydrolase,pfscan_Peptidase_C19	ENSG00000058056		0.522	USP13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP13	HGNC	protein_coding	OTTHUMT00000349617.1	99	0.00	0	C			179472637	179472637	+1	no_errors	ENST00000263966	ensembl	human	known	69_37n	nonsense	88	12.75	13	SNP	1.000	A
VAV3	10451	genome.wustl.edu	37	1	108299921	108299921	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr1:108299921C>G	ENST00000370056.4	-	11	1322	c.1048G>C	c.(1048-1050)Gag>Cag	p.E350Q	VAV3_ENST00000371846.4_Missense_Mutation_p.E285Q|VAV3_ENST00000343258.4_5'UTR|VAV3_ENST00000527011.1_Missense_Mutation_p.E350Q	NM_006113.4	NP_006104.4	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor	350	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of signal transduction (GO:0009967)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|vesicle fusion (GO:0006906)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|SH3/SH2 adaptor activity (GO:0005070)			NS(2)|breast(5)|endometrium(4)|kidney(2)|large_intestine(14)|lung(20)|ovary(6)|prostate(3)|stomach(1)|urinary_tract(1)	58		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		TTTGCCTTCTCAGTCGGATCA	0.338																																						dbGAP											0													156.0	148.0	151.0					1																	108299921		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF118886	CCDS785.1, CCDS44181.1	1p13.3	2013-02-14	2007-07-25		ENSG00000134215	ENSG00000134215		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12659	protein-coding gene	gene with protein product		605541	"""vav 3 oncogene"""				Standard	NM_001079874		Approved		uc001dvk.1	Q9UKW4	OTTHUMG00000010995	ENST00000370056.4:c.1048G>C	1.37:g.108299921C>G	ENSP00000359073:p.Glu350Gln		B1AMM0|B1APV5|B4E232|B7ZLR1|E9PQ97|O60498|O95230|Q9Y5X8	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_2,pfam_CAMSAP_CH,pfam_SH3_domain,pfam_SH2,pfam_CH-domain,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_CH-domain,superfamily_SH3_domain,smart_CH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_SH3_domain,smart_SH2,pfscan_CH-domain,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain,prints_SH2,prints_SH3_domain,prints_SM22_calponin	p.E350Q	ENST00000370056.4	37	c.1048	CCDS785.1	1	.	.	.	.	.	.	.	.	.	.	c	17.96	3.516896	0.64634	.	.	ENSG00000134215	ENST00000370056;ENST00000527011;ENST00000371846	T;T;T	0.71461	-0.57;-0.57;-0.57	5.83	5.83	0.93111	Dbl homology (DH) domain (5);	0.050338	0.85682	D	0.000000	D	0.83691	0.5309	M	0.80982	2.52	0.54753	D	0.999983	P;D;D;D	0.67145	0.743;0.968;0.996;0.996	P;P;D;D	0.72982	0.604;0.773;0.971;0.979	D	0.84560	0.0649	10	0.72032	D	0.01	.	20.1174	0.97942	0.0:1.0:0.0:0.0	.	350;350;285;350	B7ZLR1;E9PQ97;B4DHL6;Q9UKW4	.;.;.;VAV3_HUMAN	Q	350;350;285	ENSP00000359073:E350Q;ENSP00000432540:E350Q;ENSP00000360912:E285Q	ENSP00000359073:E350Q	E	-	1	0	VAV3	108101444	1.000000	0.71417	0.964000	0.40570	0.059000	0.15707	5.680000	0.68168	2.755000	0.94549	0.639000	0.83563	GAG	VAV3	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000134215		0.338	VAV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAV3	HGNC	protein_coding	OTTHUMT00000030242.2	225	0.44	1	C	NM_006113		108299921	108299921	-1	no_errors	ENST00000370056	ensembl	human	known	69_37n	missense	117	23.03	35	SNP	1.000	G
WTIP	126374	genome.wustl.edu	37	19	34984225	34984225	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr19:34984225G>A	ENST00000590071.2	+	4	1232	c.895G>A	c.(895-897)Gaa>Aaa	p.E299K	WTIP_ENST00000270288.6_Missense_Mutation_p.E523K	NM_001080436.1	NP_001073905.1	A6NIX2	WTIP_HUMAN	Wilms tumor 1 interacting protein	299	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cytoskeleton organization (GO:0007010)|gene silencing by miRNA (GO:0035195)|negative regulation of hippo signaling (GO:0035331)|positive regulation of gene silencing by miRNA (GO:2000637)|regulation of cell morphogenesis (GO:0022604)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasmic mRNA processing body (GO:0000932)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(2)|lung(1)	4	all_lung(56;5.94e-07)|Lung NSC(56;9.35e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			TCTCATCATGGAAATGGTGAG	0.612																																						dbGAP											0													28.0	31.0	30.0					19																	34984225		2065	4216	6281	-	-	-	SO:0001583	missense	0			AK130059	CCDS59375.1	19q13.11	2012-03-16			ENSG00000142279	ENSG00000142279			20964	protein-coding gene	gene with protein product	"""WT1-interacting protein"""	614790				14736876	Standard	NM_001080436		Approved		uc002nvm.3	A6NIX2		ENST00000590071.2:c.895G>A	19.37:g.34984225G>A	ENSP00000466953:p.Glu299Lys			Nonsense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.W114*	ENST00000590071.2	37	c.342	CCDS59375.1	19	.	.	.	.	.	.	.	.	.	.	G	25.5	4.649468	0.87958	.	.	ENSG00000142279	ENST00000270288	D	0.88046	-2.33	5.06	5.06	0.68205	Zinc finger, LIM-type (4);	0.000000	0.85682	D	0.000000	D	0.90601	0.7053	L	0.48174	1.505	0.80722	D	1	D	0.55385	0.971	P	0.62298	0.9	D	0.91486	0.5208	10	0.87932	D	0	.	17.3578	0.87341	0.0:0.0:1.0:0.0	.	523	A6NIX2	WTIP_HUMAN	K	523	ENSP00000270288:E523K	ENSP00000270288:E523K	E	+	1	0	WTIP	39676065	1.000000	0.71417	1.000000	0.80357	0.667000	0.39255	7.254000	0.78329	2.624000	0.88883	0.561000	0.74099	GAA	WTIP	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	ENSG00000142279		0.612	WTIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WTIP	HGNC	protein_coding	OTTHUMT00000459381.3	33	0.00	0	G	XM_059037		34984225	34984225	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000585928	ensembl	human	putative	69_37n	nonsense	17	22.73	5	SNP	1.000	A
XCR1	2829	genome.wustl.edu	37	3	46063195	46063195	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr3:46063195C>T	ENST00000309285.3	-	2	601	c.245G>A	c.(244-246)tGc>tAc	p.C82Y	XCR1_ENST00000542109.1_Missense_Mutation_p.C82Y	NM_001024644.1	NP_001019815.1	P46094	XCR1_HUMAN	chemokine (C motif) receptor 1	82					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|inflammatory response (GO:0006954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|release of sequestered calcium ion into cytosol (GO:0051209)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)			NS(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|prostate(2)	14				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		AGGCAACAAGCAGGCGAACAC	0.552																																						dbGAP											0													111.0	118.0	116.0					3																	46063195		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2736.1	3p21.3-p21.1	2012-11-19	2006-01-13	2002-08-23	ENSG00000173578	ENSG00000173578		"""GPCR / Class A : Chemokine receptors : X-C motif"""	1625	protein-coding gene	gene with protein product		600552	"""chemokine (C motif) XC receptor 1"""	GPR5, CCXCR1		7832990, 10400311	Standard	NM_005283		Approved		uc003cpf.3	P46094	OTTHUMG00000133449	ENST00000309285.3:c.245G>A	3.37:g.46063195C>T	ENSP00000310405:p.Cys82Tyr			Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Chemokine_lymphotactin_XCR1,prints_7TM_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Brdyknn_rcpt	p.C82Y	ENST00000309285.3	37	c.245	CCDS2736.1	3	.	.	.	.	.	.	.	.	.	.	C	10.29	1.309305	0.23821	.	.	ENSG00000173578	ENST00000309285;ENST00000542109	T;T	0.37752	1.18;1.18	5.24	-0.191	0.13252	GPCR, rhodopsin-like superfamily (1);	0.938835	0.09164	N	0.839830	T	0.46092	0.1375	M	0.85945	2.785	0.09310	N	1	P	0.44281	0.831	B	0.43536	0.423	T	0.44892	-0.9298	10	0.87932	D	0	.	10.0834	0.42404	0.3511:0.307:0.3419:0.0	.	82	P46094	XCR1_HUMAN	Y	82	ENSP00000310405:C82Y;ENSP00000438119:C82Y	ENSP00000310405:C82Y	C	-	2	0	XCR1	46038199	0.000000	0.05858	0.012000	0.15200	0.239000	0.25481	0.098000	0.15189	-0.376000	0.07943	-0.182000	0.12963	TGC	XCR1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_Chemokine_rcpt	ENSG00000173578		0.552	XCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XCR1	HGNC	protein_coding	OTTHUMT00000257322.2	253	0.00	0	C			46063195	46063195	-1	no_errors	ENST00000309285	ensembl	human	known	69_37n	missense	152	19.58	37	SNP	0.000	T
XPO4	64328	genome.wustl.edu	37	13	21436902	21436902	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr13:21436902C>T	ENST00000255305.6	-	3	342	c.271G>A	c.(271-273)Gag>Aag	p.E91K	XPO4_ENST00000400602.2_Missense_Mutation_p.E91K|XPO4_ENST00000490513.1_5'UTR			Q9C0E2	XPO4_HUMAN	exportin 4	91					positive regulation of protein export from nucleus (GO:0046827)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(10)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	41		all_cancers(29;5.05e-24)|all_epithelial(30;5.56e-20)|all_lung(29;2.38e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000521)|Epithelial(112;0.000892)|OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Lung(94;0.0189)|LUSC - Lung squamous cell carcinoma(192;0.0548)		CGCAGAGACTCGATGCTACCT	0.438																																						dbGAP											0													195.0	189.0	191.0					13																	21436902		1857	4098	5955	-	-	-	SO:0001583	missense	0			AB051508	CCDS41872.1	13q11	2011-04-13			ENSG00000132953	ENSG00000132953		"""Exportins"""	17796	protein-coding gene	gene with protein product		611449				11214970, 10944119	Standard	NM_022459		Approved	FLJ13046, KIAA1721	uc001unq.4	Q9C0E2	OTTHUMG00000016528	ENST00000255305.6:c.271G>A	13.37:g.21436902C>T	ENSP00000255305:p.Glu91Lys		Q5VUZ5|Q8N3V6|Q9H934	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.E91K	ENST00000255305.6	37	c.271	CCDS41872.1	13	.	.	.	.	.	.	.	.	.	.	C	12.48	1.950383	0.34377	.	.	ENSG00000132953	ENST00000400602;ENST00000255305	T;T	0.68624	-0.34;-0.34	5.38	5.38	0.77491	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.46502	0.1396	N	0.11064	0.09	0.80722	D	1	B	0.21688	0.059	B	0.15052	0.012	T	0.48139	-0.9061	10	0.06236	T	0.91	0.4938	19.1276	0.93391	0.0:1.0:0.0:0.0	.	91	Q9C0E2	XPO4_HUMAN	K	91	ENSP00000383444:E91K;ENSP00000255305:E91K	ENSP00000255305:E91K	E	-	1	0	XPO4	20334902	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	7.440000	0.80464	2.522000	0.85027	0.591000	0.81541	GAG	XPO4	-	superfamily_ARM-type_fold	ENSG00000132953		0.438	XPO4-001	KNOWN	non_canonical_conserved|non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	XPO4	HGNC	protein_coding	OTTHUMT00000044096.1	116	0.00	0	C	NM_022459		21436902	21436902	-1	no_errors	ENST00000255305	ensembl	human	known	69_37n	missense	221	12.65	32	SNP	1.000	T
ZDBF2	57683	genome.wustl.edu	37	2	207169562	207169562	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr2:207169562G>T	ENST00000374423.3	+	5	696	c.310G>T	c.(310-312)Gaa>Taa	p.E104*		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	104							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						GGATGCTACCGAAGAGAGACC	0.458																																						dbGAP											0													84.0	81.0	82.0					2																	207169562		1969	4154	6123	-	-	-	SO:0001587	stop_gained	0			AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.310G>T	2.37:g.207169562G>T	ENSP00000363545:p.Glu104*		Q6ZNP7|Q6ZSN8	Nonsense_Mutation	SNP	pfam_Znf_DBF,smart_Znf_DBF	p.E104*	ENST00000374423.3	37	c.310	CCDS46501.1	2	.	.	.	.	.	.	.	.	.	.	G	29.0	4.966808	0.92855	.	.	ENSG00000204186	ENST00000374423	.	.	.	4.68	2.72	0.32119	.	1.458410	0.04756	N	0.425444	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.1627	0.15070	0.1066:0.0:0.6893:0.204	.	.	.	.	X	104	.	ENSP00000363545:E104X	E	+	1	0	ZDBF2	206877807	0.023000	0.18921	0.002000	0.10522	0.002000	0.02628	0.663000	0.25053	1.110000	0.41699	0.650000	0.86243	GAA	ZDBF2	-	NULL	ENSG00000204186		0.458	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDBF2	HGNC	protein_coding	OTTHUMT00000336458.1	92	0.00	0	G	NM_020923		207169562	207169562	+1	no_errors	ENST00000374423	ensembl	human	known	69_37n	nonsense	53	31.17	24	SNP	0.001	T
ZMYM2	7750	genome.wustl.edu	37	13	20579263	20579263	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr13:20579263G>C	ENST00000382874.2	+	6	1373	c.1183G>C	c.(1183-1185)Gag>Cag	p.E395Q	ZMYM2_ENST00000382883.3_5'Flank|ZMYM2_ENST00000382871.2_Missense_Mutation_p.E395Q|ZMYM2_ENST00000382881.3_Missense_Mutation_p.E308Q|ZMYM2_ENST00000382869.3_Missense_Mutation_p.E395Q	NM_001190964.1	NP_001177893.1	Q9UBW7	ZMYM2_HUMAN	zinc finger, MYM-type 2	395					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|PML body (GO:0016605)	ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)			large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	10		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		GGATTCAAGTGAGTCCTTCCA	0.313																																						dbGAP											0													99.0	97.0	97.0					13																	20579263		1819	4072	5891	-	-	-	SO:0001583	missense	0			AF012126	CCDS45016.1	13q11-q12	2013-01-08	2006-07-13	2006-07-13	ENSG00000121741	ENSG00000121741		"""Zinc fingers, MYM type"""	12989	protein-coding gene	gene with protein product		602221	"""zinc finger protein 198"""	ZNF198		9499416, 9425908	Standard	XM_005266517		Approved	RAMP, FIM, MYM	uc001ums.3	Q9UBW7	OTTHUMG00000016507	ENST00000382874.2:c.1183G>C	13.37:g.20579263G>C	ENSP00000372327:p.Glu395Gln		A6NDG0|A6NI02|O43212|O43434|O60898|Q5W0Q4|Q5W0T3|Q63HP0|Q8NE39|Q9H0V5|Q9H538|Q9UEU2	Missense_Mutation	SNP	pfam_Znf_MYM,pfam_DUF3504,smart_TRASH	p.E395Q	ENST00000382874.2	37	c.1183	CCDS45016.1	13	.	.	.	.	.	.	.	.	.	.	G	17.48	3.398947	0.62177	.	.	ENSG00000121741	ENST00000382869;ENST00000456228;ENST00000382881;ENST00000382874;ENST00000382871	T;T;T;T	0.19394	2.15;2.2;2.15;2.15	5.29	3.57	0.40892	TRASH (1);Zinc finger, MYM-type (1);	0.146783	0.64402	N	0.000010	T	0.34395	0.0896	L	0.42245	1.32	0.80722	D	1	D;D	0.71674	0.998;0.962	D;P	0.72625	0.978;0.576	T	0.01334	-1.1382	10	0.34782	T	0.22	1.055	11.4967	0.50413	0.145:0.0:0.855:0.0	.	395;308	Q9UBW7;Q9UBW7-2	ZMYM2_HUMAN;.	Q	395;395;308;395;395	ENSP00000372322:E395Q;ENSP00000372334:E308Q;ENSP00000372327:E395Q;ENSP00000372324:E395Q	ENSP00000372322:E395Q	E	+	1	0	ZMYM2	19477263	1.000000	0.71417	0.825000	0.32803	0.960000	0.62799	9.356000	0.97091	0.621000	0.30232	0.591000	0.81541	GAG	ZMYM2	-	pfam_Znf_MYM,smart_TRASH	ENSG00000121741		0.313	ZMYM2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYM2	HGNC	protein_coding	OTTHUMT00000044051.2	89	0.00	0	G	NM_003453		20579263	20579263	+1	no_errors	ENST00000382869	ensembl	human	known	69_37n	missense	176	11.50	23	SNP	1.000	C
ZMYND12	84217	genome.wustl.edu	37	1	42914274	42914274	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr1:42914274C>G	ENST00000372565.3	-	3	557	c.288G>C	c.(286-288)caG>caC	p.Q96H	ZMYND12_ENST00000433602.2_Intron	NM_032257.4	NP_115633.3	Q9H0C1	ZMY12_HUMAN	zinc finger, MYND-type containing 12	96						intracellular (GO:0005622)	metal ion binding (GO:0046872)			NS(1)|endometrium(2)|large_intestine(3)|lung(5)|ovary(2)|prostate(2)|skin(2)	17	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				AGAGGTATTTCTGGGCTATGG	0.458																																						dbGAP											0													107.0	96.0	100.0					1																	42914274		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK057384	CCDS467.1	1p34.1	2008-02-05			ENSG00000066185	ENSG00000066185		"""Zinc fingers, MYND-type"""	21192	protein-coding gene	gene with protein product						11230166	Standard	NM_032257		Approved	DKFZp434N2435	uc001chj.3	Q9H0C1	OTTHUMG00000007333	ENST00000372565.3:c.288G>C	1.37:g.42914274C>G	ENSP00000361646:p.Gln96His		Q5VUS6|Q8TC87|Q96M51	Missense_Mutation	SNP	pfam_Znf_MYND,pfscan_Znf_MYND	p.Q96H	ENST00000372565.3	37	c.288	CCDS467.1	1	.	.	.	.	.	.	.	.	.	.	C	17.43	3.388405	0.61956	.	.	ENSG00000066185	ENST00000372565	T	0.63417	-0.04	5.58	4.67	0.58626	Tetratricopeptide-like helical (1);	0.055566	0.64402	D	0.000001	T	0.71567	0.3355	L	0.53671	1.685	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.71623	-0.4537	10	0.51188	T	0.08	-17.4564	8.376	0.32442	0.0:0.8243:0.0:0.1757	.	96	Q9H0C1	ZMY12_HUMAN	H	96	ENSP00000361646:Q96H	ENSP00000361646:Q96H	Q	-	3	2	ZMYND12	42686861	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	2.815000	0.48018	1.356000	0.45884	0.561000	0.74099	CAG	ZMYND12	-	NULL	ENSG00000066185		0.458	ZMYND12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYND12	HGNC	protein_coding	OTTHUMT00000019170.1	81	0.00	0	C	NM_032257		42914274	42914274	-1	no_errors	ENST00000372565	ensembl	human	known	69_37n	missense	42	31.75	20	SNP	1.000	G
ZKSCAN7	55888	genome.wustl.edu	37	3	44611611	44611611	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr3:44611611G>C	ENST00000273320.3	+	6	1438	c.1009G>C	c.(1009-1011)Gat>Cat	p.D337H	RP11-944L7.5_ENST00000419137.1_Intron|ZKSCAN7_ENST00000341840.3_Intron|ZKSCAN7_ENST00000426540.1_Missense_Mutation_p.D337H|RP11-944L7.4_ENST00000457331.1_RNA|ZKSCAN7_ENST00000431636.1_Intron	NM_018651.2	NP_061121.2	Q9P0L1	ZKSC7_HUMAN	zinc finger with KRAB and SCAN domains 7	337					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										ACTAGAAAATGATTTCTTGGA	0.413																																						dbGAP											0													90.0	96.0	94.0					3																	44611611		2203	4300	6503	-	-	-	SO:0001583	missense	0			L32164, AY280798	CCDS2714.1, CCDS2715.1, CCDS74924.1	3p21.32	2013-01-09	2013-01-09	2013-01-09	ENSG00000196345	ENSG00000196345		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12955	protein-coding gene	gene with protein product			"""zinc finger protein 64"", ""zinc finger protein 448"", ""zinc finger protein 167"""	ZNF64, ZNF448, ZNF167		7814019, 1505991	Standard	XM_005265323		Approved	FLJ12738, ZSCAN39	uc003cnj.3	Q9P0L1	OTTHUMG00000133094	ENST00000273320.3:c.1009G>C	3.37:g.44611611G>C	ENSP00000273320:p.Asp337His		A0PJV3|A8K5H0|Q6WL09|Q96FQ2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.D337H	ENST00000273320.3	37	c.1009	CCDS2715.1	3	.	.	.	.	.	.	.	.	.	.	.	10.42	1.345443	0.24426	.	.	ENSG00000196345	ENST00000426540;ENST00000273320;ENST00000447279	T;T;T	0.06218	3.36;3.36;3.33	4.4	2.53	0.30540	.	.	.	.	.	T	0.03608	0.0103	N	0.08118	0	0.09310	N	1	P;B	0.40000	0.698;0.07	B;B	0.40329	0.326;0.111	T	0.42932	-0.9422	9	0.33940	T	0.23	-4.4261	5.8788	0.18844	0.3443:0.0:0.6557:0.0	.	207;337	A7MAY2;Q9P0L1	.;ZN167_HUMAN	H	337;337;186	ENSP00000395524:D337H;ENSP00000273320:D337H;ENSP00000405034:D186H	ENSP00000273320:D337H	D	+	1	0	ZNF167	44586615	0.000000	0.05858	0.006000	0.13384	0.053000	0.15095	-1.165000	0.03132	0.450000	0.26774	0.650000	0.86243	GAT	ZNF167	-	NULL	ENSG00000196345		0.413	ZKSCAN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF167	HGNC	protein_coding	OTTHUMT00000256752.4	81	0.00	0	G	NM_018651		44611611	44611611	+1	no_errors	ENST00000273320	ensembl	human	known	69_37n	missense	88	11.11	11	SNP	0.001	C
ZNF202	7753	genome.wustl.edu	37	11	123601456	123601456	+	Silent	SNP	C	C	T			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr11:123601456C>T	ENST00000529691.1	-	2	360	c.141G>A	c.(139-141)caG>caA	p.Q47Q	ZNF202_ENST00000530393.1_Silent_p.Q47Q|ZNF202_ENST00000336139.4_Silent_p.Q47Q			O95125	ZN202_HUMAN	zinc finger protein 202	47	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.03)		GTCGGAAGTTCTGGTGGGAGG	0.542																																						dbGAP											0													103.0	102.0	102.0					11																	123601456		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			AF027219	CCDS8443.1	11q23.3	2013-01-09				ENSG00000166261		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12994	protein-coding gene	gene with protein product		603430				9790754	Standard	XM_005271659		Approved	ZKSCAN10, ZSCAN42	uc001pzd.1	O95125		ENST00000529691.1:c.141G>A	11.37:g.123601456C>T			B0LPH9|Q4JG21|Q9H1B9|Q9NSM4	Silent	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.Q47	ENST00000529691.1	37	c.141	CCDS8443.1	11																																																																																			ZNF202	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN	ENSG00000166261		0.542	ZNF202-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF202	HGNC	protein_coding	OTTHUMT00000387419.1	87	0.00	0	C	NM_003455		123601456	123601456	-1	no_errors	ENST00000336139	ensembl	human	known	69_37n	silent	70	18.60	16	SNP	1.000	T
ZNF425	155054	genome.wustl.edu	37	7	148802280	148802280	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr7:148802280C>G	ENST00000378061.2	-	4	815	c.683G>C	c.(682-684)aGa>aCa	p.R228T		NM_001001661.2	NP_001001661.1	Q6IV72	ZN425_HUMAN	zinc finger protein 425	228					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(6)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	50	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			GGACTTCCCTCTGGACGAGTT	0.527																																						dbGAP											0													81.0	84.0	83.0					7																	148802280		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056498	CCDS34773.1	7q36.1	2013-01-08			ENSG00000204947	ENSG00000204947		"""Zinc fingers, C2H2-type"", ""-"""	20690	protein-coding gene	gene with protein product							Standard	NM_001001661		Approved		uc003wfj.3	Q6IV72	OTTHUMG00000158971	ENST00000378061.2:c.683G>C	7.37:g.148802280C>G	ENSP00000367300:p.Arg228Thr		B3KPM1|Q08AG3	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.R228T	ENST00000378061.2	37	c.683	CCDS34773.1	7	.	.	.	.	.	.	.	.	.	.	C	8.392	0.839912	0.16891	.	.	ENSG00000204947	ENST00000378061	T	0.07908	3.15	2.62	1.68	0.24146	.	.	.	.	.	T	0.03783	0.0107	N	0.08118	0	0.19300	N	0.999975	B	0.30281	0.275	B	0.20767	0.031	T	0.45731	-0.9241	9	0.22706	T	0.39	.	9.0189	0.36186	0.0:0.7703:0.2296:0.0	.	228	Q6IV72	ZN425_HUMAN	T	228	ENSP00000367300:R228T	ENSP00000367300:R228T	R	-	2	0	ZNF425	148433213	0.000000	0.05858	0.114000	0.21550	0.613000	0.37349	-0.127000	0.10547	0.410000	0.25675	0.655000	0.94253	AGA	ZNF425	-	NULL	ENSG00000204947		0.527	ZNF425-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF425	HGNC	protein_coding	OTTHUMT00000352726.1	82	0.00	0	C	XM_088140		148802280	148802280	-1	no_errors	ENST00000378061	ensembl	human	known	69_37n	missense	65	25.29	22	SNP	0.110	G
ZNF860	344787	genome.wustl.edu	37	3	32032288	32032288	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LG-01A-21D-A14K-09	TCGA-E2-A1LG-11A-42D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7cdbe0e8-f614-4f54-b864-fd6b39e8ef1c	583d989c-fa07-46f5-b463-6ce5a2744927	g.chr3:32032288G>A	ENST00000360311.4	+	2	2266	c.1717G>A	c.(1717-1719)Gag>Aag	p.E573K		NM_001137674.2	NP_001131146.2	A6NHJ4	ZN860_HUMAN	zinc finger protein 860	573					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|lung(4)|ovary(1)	8						TGATTTTGACGAGGCCTTCAG	0.383																																						dbGAP											0													77.0	68.0	71.0					3																	32032288		692	1591	2283	-	-	-	SO:0001583	missense	0			AK294003	CCDS46784.1	3p24.1	2013-01-08			ENSG00000197385	ENSG00000197385		"""Zinc fingers, C2H2-type"", ""-"""	34513	protein-coding gene	gene with protein product							Standard	NM_001137674		Approved		uc011axg.2	A6NHJ4	OTTHUMG00000155838	ENST00000360311.4:c.1717G>A	3.37:g.32032288G>A	ENSP00000373274:p.Glu573Lys		B4DFA4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E573K	ENST00000360311.4	37	c.1717	CCDS46784.1	3	.	.	.	.	.	.	.	.	.	.	G	0.009	-1.801633	0.00611	.	.	ENSG00000197385	ENST00000360311	T	0.10960	2.82	0.314	-0.628	0.11537	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01765	0.0056	N	0.00221	-1.82	0.22424	N	0.999112	B	0.20459	0.045	B	0.09377	0.004	T	0.43621	-0.9380	8	.	.	.	.	3.7669	0.08626	0.6492:0.0:0.3508:0.0	.	573	A6NHJ4	ZN860_HUMAN	K	573	ENSP00000373274:E573K	.	E	+	1	0	ZNF860	32007292	0.971000	0.33674	0.009000	0.14445	0.008000	0.06430	1.845000	0.39279	-0.520000	0.06435	-0.515000	0.04445	GAG	ZNF860	-	pfscan_Znf_C2H2	ENSG00000197385		0.383	ZNF860-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF860	HGNC	protein_coding	OTTHUMT00000341957.1	92	0.00	0	G			32032288	32032288	+1	no_errors	ENST00000360311	ensembl	human	known	69_37n	missense	96	20.00	24	SNP	0.988	A
