#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACER1	125981	genome.wustl.edu	37	19	6333478	6333478	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr19:6333478A>T	ENST00000301452.4	-	1	162	c.85T>A	c.(85-87)Tac>Aac	p.Y29N		NM_133492.2	NP_597999.1	Q8TDN7	ACER1_HUMAN	alkaline ceramidase 1	29					cell differentiation (GO:0030154)|cellular response to calcium ion (GO:0071277)|ceramide catabolic process (GO:0046514)|epidermis development (GO:0008544)|keratinocyte differentiation (GO:0030216)|regulation of lipid metabolic process (GO:0019216)|response to alkaline pH (GO:0010446)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ceramidase activity (GO:0017040)|dihydroceramidase activity (GO:0071633)			NS(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(4)|pancreas(1)	15						ACCGTGTTGTAGAACTCGGCC	0.572																																						dbGAP											0													71.0	44.0	53.0					19																	6333478		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF347024	CCDS12161.1	19p13.3	2013-01-25	2008-12-19	2008-12-19	ENSG00000167769	ENSG00000167769	3.5.1.23	"""Alkaline ceramidase"""	18356	protein-coding gene	gene with protein product		613491	"""N-acylsphingosine amidohydrolase (alkaline ceramidase) 3"""	ASAH3		12783875	Standard	NM_133492		Approved		uc002mel.2	Q8TDN7		ENST00000301452.4:c.85T>A	19.37:g.6333478A>T	ENSP00000301452:p.Tyr29Asn			Missense_Mutation	SNP	pfam_Ceramidase	p.Y29N	ENST00000301452.4	37	c.85	CCDS12161.1	19	.	.	.	.	.	.	.	.	.	.	A	15.04	2.715578	0.48622	.	.	ENSG00000167769	ENST00000301452	T	0.46063	0.88	4.86	4.86	0.63082	.	0.187041	0.47852	D	0.000206	T	0.57021	0.2025	L	0.53780	1.695	0.53688	D	0.999974	D	0.89917	1.0	D	0.75484	0.986	T	0.60052	-0.7338	10	0.87932	D	0	-27.7984	10.7747	0.46342	1.0:0.0:0.0:0.0	.	29	Q8TDN7	ACER1_HUMAN	N	29	ENSP00000301452:Y29N	ENSP00000301452:Y29N	Y	-	1	0	ACER1	6284478	1.000000	0.71417	1.000000	0.80357	0.141000	0.21300	5.428000	0.66489	2.032000	0.59987	0.533000	0.62120	TAC	ACER1	-	pfam_Ceramidase	ENSG00000167769		0.572	ACER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACER1	HGNC	protein_coding	OTTHUMT00000452982.1	12	0.00	0	A	NM_133492		6333478	6333478	-1	no_errors	ENST00000301452	ensembl	human	known	69_37n	missense	14	44.00	11	SNP	1.000	T
AHCYL1	10768	genome.wustl.edu	37	1	110559298	110559298	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr1:110559298G>T	ENST00000369799.5	+	9	1276	c.909G>T	c.(907-909)agG>agT	p.R303S	AHCYL1_ENST00000393614.4_Missense_Mutation_p.R256S|AHCYL1_ENST00000359172.3_Missense_Mutation_p.R256S	NM_001242673.1|NM_001242674.1|NM_006621.5	NP_001229602.1|NP_001229603.1|NP_006612.2	O43865	SAHH2_HUMAN	adenosylhomocysteinase-like 1	303	NAD binding. {ECO:0000250}.				mRNA polyadenylation (GO:0006378)|one-carbon metabolic process (GO:0006730)|positive regulation of sodium ion transport (GO:0010765)|protein export from nucleus (GO:0006611)|regulation of anion transport (GO:0044070)|regulation of ion transmembrane transporter activity (GO:0032412)|regulation of mRNA 3'-end processing (GO:0031440)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	adenosylhomocysteinase activity (GO:0004013)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)	18		all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0259)|Colorectal(144;0.123)|all cancers(265;0.134)|Epithelial(280;0.141)|LUSC - Lung squamous cell carcinoma(189;0.143)		GCCTGAAGAGGACCACAGATG	0.448																																						dbGAP											0													389.0	365.0	373.0					1																	110559298		2203	4300	6503	-	-	-	SO:0001583	missense	0			U82761	CCDS818.1, CCDS55620.1	1p13	2014-06-12	2009-06-12		ENSG00000168710	ENSG00000168710			344	protein-coding gene	gene with protein product	"""inositol 1,4,5-trisphosphate receptor-binding protein"", ""protein phosphatase 1, regulatory subunit 78"""	607826	"""S-adenosylhomocysteine hydrolase-like 1"""			11904675, 16754674, 12525476	Standard	NM_006621		Approved	XPVKONA, IRBIT, PPP1R78	uc001dyx.3	O43865	OTTHUMG00000011652	ENST00000369799.5:c.909G>T	1.37:g.110559298G>T	ENSP00000358814:p.Arg303Ser		B4E168|Q2TAJ6|Q502W8|Q5VSM0|Q6P171|Q96PK4|Q9UG84	Missense_Mutation	SNP	pfam_Adenosylhomocysteinase,pfam_Ado_hCys_hydrolase_NAD-bd,pfam_D-isomer_2_OHA_DH_NAD-bd,pfam_IlvN,pirsf_Adenosylhomocysteinase,tigrfam_Adenosylhomocysteinase	p.R303S	ENST00000369799.5	37	c.909	CCDS818.1	1	.	.	.	.	.	.	.	.	.	.	G	14.58	2.578616	0.46006	.	.	ENSG00000168710	ENST00000369799;ENST00000359172;ENST00000393614	T;T;T	0.80653	-1.4;-1.37;-1.37	5.85	5.85	0.93711	S-adenosyl-L-homocysteine hydrolase, NAD binding (1);	0.000000	0.85682	D	0.000000	D	0.82870	0.5131	M	0.88704	2.975	0.80722	D	1	P	0.39847	0.691	P	0.46659	0.523	D	0.86152	0.1588	10	0.87932	D	0	-14.5722	10.5224	0.44927	0.1428:0.0:0.8572:0.0	.	303	O43865	SAHH2_HUMAN	S	303;256;256	ENSP00000358814:R303S;ENSP00000352092:R256S;ENSP00000377238:R256S	ENSP00000352092:R256S	R	+	3	2	AHCYL1	110360821	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.919000	0.56439	2.753000	0.94483	0.655000	0.94253	AGG	AHCYL1	-	pfam_Adenosylhomocysteinase,pfam_Ado_hCys_hydrolase_NAD-bd,pirsf_Adenosylhomocysteinase,tigrfam_Adenosylhomocysteinase	ENSG00000168710		0.448	AHCYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AHCYL1	HGNC	protein_coding	OTTHUMT00000032243.1	262	0.00	0	G			110559298	110559298	+1	no_errors	ENST00000369799	ensembl	human	known	69_37n	missense	255	16.67	51	SNP	1.000	T
AKAP6	9472	genome.wustl.edu	37	14	33015163	33015164	+	Nonsense_Mutation	DNP	CC	CC	GA			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr14:33015163_33015164CC>GA	ENST00000280979.4	+	4	1474_1475	c.1304_1305CC>GA	c.(1303-1305)tCC>tGA	p.S435*	AKAP6_ENST00000557272.1_Nonsense_Mutation_p.S435*|AKAP6_ENST00000557354.1_Nonsense_Mutation_p.S435*	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	435					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		CCTGACAGATCCAAACTTTGCC	0.475																																					Melanoma(49;821 1200 7288 13647 42351)	dbGAP											0																																										-	-	-	SO:0001587	stop_gained	0			AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	Exception_encountered	14.37:g.33015163_33015164delinsGA	ENSP00000280979:p.Ser435*		A7E242|A7E2D4|O15028	Missense_Mutation|Silent	SNP	smart_Spectrin/alpha-actinin	p.S435C|p.S435	ENST00000280979.4	37	c.1304|c.1305	CCDS9644.1	14																																																																																			AKAP6	-	NULL	ENSG00000151320		0.475	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP6	HGNC	protein_coding	OTTHUMT00000276617.2	37	0.00	0	C	NM_004274		33015163|33015164	33015163|33015164	+1	no_errors	ENST00000280979	ensembl	human	known	69_37n	missense|silent	56	13.85	9	SNP	1.000|0.970	G|A
AKR1D1	6718	genome.wustl.edu	37	7	137776547	137776547	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr7:137776547C>T	ENST00000242375.3	+	3	337	c.295C>T	c.(295-297)Cgc>Tgc	p.R99C	RN7SKP223_ENST00000410582.1_RNA|AKR1D1_ENST00000468877.2_Intron|AKR1D1_ENST00000411726.2_Missense_Mutation_p.R99C|AKR1D1_ENST00000432161.1_Missense_Mutation_p.R99C	NM_005989.3	NP_005980.1	P51857	AK1D1_HUMAN	aldo-keto reductase family 1, member D1	99					androgen metabolic process (GO:0008209)|bile acid biosynthetic process (GO:0006699)|bile acid catabolic process (GO:0030573)|bile acid metabolic process (GO:0008206)|C21-steroid hormone metabolic process (GO:0008207)|cholesterol catabolic process (GO:0006707)|digestion (GO:0007586)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	delta4-3-oxosteroid 5beta-reductase activity (GO:0047787)|steroid binding (GO:0005496)			endometrium(1)|kidney(2)|large_intestine(1)|lung(14)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	23					Azelaic Acid(DB00548)|Finasteride(DB01216)	AGAGATGGTCCGCCCAACCCT	0.463																																						dbGAP											0													95.0	92.0	93.0					7																	137776547		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z28339	CCDS5846.1, CCDS55169.1, CCDS55170.1	7q32-q33	2012-12-04	2012-12-04		ENSG00000122787	ENSG00000122787	1.3.99.6	"""Aldo-keto reductases"""	388	protein-coding gene	gene with protein product	"""delta 4-3-ketosteroid-5-beta-reductase"""	604741	"""aldo-keto reductase family 1, member D1 (delta 4-3-ketosteroid-5-beta-reductase)"""	SRD5B1		7508385, 10343119	Standard	NM_005989		Approved		uc003vtz.3	P51857	OTTHUMG00000155787	ENST00000242375.3:c.295C>T	7.37:g.137776547C>T	ENSP00000242375:p.Arg99Cys		A1L4P6|A8K060|B4DPN3|B4DPN8	Missense_Mutation	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_Aldo/keto_reductase_subgr	p.R99C	ENST00000242375.3	37	c.295	CCDS5846.1	7	.	.	.	.	.	.	.	.	.	.	C	17.05	3.289644	0.59976	.	.	ENSG00000122787	ENST00000432161;ENST00000411726;ENST00000242375;ENST00000438242	T;T;T;T	0.54479	1.7;1.7;1.7;0.57	5.4	3.56	0.40772	NADP-dependent oxidoreductase domain (3);	0.358654	0.27227	N	0.020331	T	0.69178	0.3082	M	0.85859	2.78	0.19945	N	0.999943	D;D;D	0.71674	0.997;0.998;0.998	P;P;D	0.63033	0.906;0.846;0.91	T	0.61907	-0.6966	10	0.87932	D	0	.	8.1685	0.31241	0.1576:0.7598:0.0:0.0826	.	99;99;99	B4DPN8;B4DPN3;P51857	.;.;AK1D1_HUMAN	C	99;99;99;43	ENSP00000389197:R99C;ENSP00000402374:R99C;ENSP00000242375:R99C;ENSP00000397042:R43C	ENSP00000242375:R99C	R	+	1	0	AKR1D1	137427087	1.000000	0.71417	0.016000	0.15963	0.887000	0.51463	3.340000	0.52143	0.808000	0.34231	0.655000	0.94253	CGC	AKR1D1	-	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom	ENSG00000122787		0.463	AKR1D1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AKR1D1	HGNC	protein_coding	OTTHUMT00000341637.1	64	0.00	0	C	NM_005989		137776547	137776547	+1	no_errors	ENST00000242375	ensembl	human	known	69_37n	missense	108	12.20	15	SNP	0.006	T
ALG9	79796	genome.wustl.edu	37	11	111680367	111680367	+	Splice_Site	SNP	C	C	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr11:111680367C>G	ENST00000531154.1	-	14	1692	c.1220G>C	c.(1219-1221)aGa>aCa	p.R407T	ALG9_ENST00000398006.2_Splice_Site_p.R400T|ALG9_ENST00000527228.1_5'UTR|ALG9_ENST00000524880.1_3'UTR	NM_024740.2	NP_079016.2	Q9H6U8	ALG9_HUMAN	ALG9, alpha-1,2-mannosyltransferase	571					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	dol-P-Man:Man(6)GlcNAc(2)-PP-Dol alpha-1,2-mannosyltransferase activity (GO:0052926)|dol-P-Man:Man(8)GlcNAc(2)-PP-Dol alpha-1,2-mannosyltransferase activity (GO:0052918)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.81e-07)|BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|all cancers(92;1.3e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0587)		AGCCACATACCTAGAAGCATC	0.418																																						dbGAP											0													154.0	145.0	147.0					11																	111680367		1858	4087	5945	-	-	-	SO:0001630	splice_region_variant	0				CCDS41714.1, CCDS53709.1, CCDS73379.1, CCDS73380.1	11q23	2013-02-26	2013-02-26	2004-08-26	ENSG00000086848	ENSG00000086848	2.4.1.259, 2.4.1.261	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	15672	protein-coding gene	gene with protein product	"""dolichyl-P-Man:Man(6)GlcNAc(2)-PP-dolichol alpha-1,2-mannosyltransferase"", ""dolichyl-P-Man:Man(8)GlcNAc(2)-PP-dolichol alpha-1,2-mannosyltransferase"", ""dol-P-Man dependent alpha-1,2-mannosyltransferase"""	606941	"""disrupted in bipolar affective disorder 1"", ""asparagine-linked glycosylation 9 homolog (yeast, alpha 1,2 mannosyltransferase)"", ""asparagine-linked glycosylation 9, alpha- 1,2-mannosyltransferase homolog (S. cerevisiae, alpha- 1,2-mannosyltransferase)"", ""asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae)"""	DIBD1		12030331, 15148656	Standard	NM_024740		Approved		uc021qql.1	Q9H6U8	OTTHUMG00000166819	ENST00000531154.1:c.1220+1G>C	11.37:g.111680367C>G			Q6ZMD5|Q7Z4R4|Q96GS7|Q96PB9|Q9H068	Missense_Mutation	SNP	pfam_GPI_mannosylTrfase	p.R407T	ENST00000531154.1	37	c.1220	CCDS41714.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.89|15.89	2.966363|2.966363	0.53507|0.53507	.|.	.|.	ENSG00000086848|ENSG00000086848	ENST00000532425|ENST00000531154;ENST00000398006;ENST00000428306	.|T;T	.|0.73469	.|-0.75;-0.75	5.96|5.96	5.96|5.96	0.96718|0.96718	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.82240|0.82240	0.4994|0.4994	M|M	0.78637|0.78637	2.42|2.42	0.80722|0.80722	D|D	1|1	.|P;P;P	.|0.52842	.|0.956;0.928;0.882	.|P;P;P	.|0.50896	.|0.63;0.653;0.451	T|T	0.82157|0.82157	-0.0596|-0.0596	5|9	.|.	.|.	.|.	-13.3223|-13.3223	19.1935|19.1935	0.93677|0.93677	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|400;578;571	.|B4DQI3;Q9H6U8-3;Q9H6U8	.|.;.;ALG9_HUMAN	H|T	156|407;400;804	.|ENSP00000435517:R407T;ENSP00000381090:R400T	.|.	D|R	-|-	1|2	0|0	ALG9|ALG9	111185577|111185577	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.907000|0.907000	0.53573|0.53573	3.678000|3.678000	0.54627|0.54627	2.832000|2.832000	0.97577|0.97577	0.655000|0.655000	0.94253|0.94253	GAT|AGA	ALG9	-	NULL	ENSG00000086848		0.418	ALG9-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALG9	HGNC	protein_coding	OTTHUMT00000391485.1	90	0.00	0	C	NM_024740	Missense_Mutation	111680367	111680367	-1	no_errors	ENST00000531154	ensembl	human	known	69_37n	missense	104	17.46	22	SNP	1.000	G
ALPK2	115701	genome.wustl.edu	37	18	56247679	56247679	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr18:56247679T>G	ENST00000361673.3	-	4	542	c.329A>C	c.(328-330)aAc>aCc	p.N110T	ALPK2_ENST00000587399.1_5'Flank	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	110	Ig-like 1.					nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						CAATTGTGGGTTCTCTGATGA	0.433																																						dbGAP											0													215.0	195.0	202.0					18																	56247679		1963	4156	6119	-	-	-	SO:0001583	missense	0			AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.329A>C	18.37:g.56247679T>G	ENSP00000354991:p.Asn110Thr		Q6ZUX0|Q8NAT5|Q96L95	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase,pfscan_Ig-like	p.N110T	ENST00000361673.3	37	c.329	CCDS11966.2	18	.	.	.	.	.	.	.	.	.	.	T	18.96	3.733198	0.69189	.	.	ENSG00000198796	ENST00000361673	T	0.45668	0.89	5.28	2.73	0.32206	Immunoglobulin-like (1);	.	.	.	.	T	0.28896	0.0717	L	0.44542	1.39	0.09310	N	1	P	0.40083	0.702	B	0.32149	0.141	T	0.08249	-1.0731	9	0.38643	T	0.18	-0.0126	6.9221	0.24393	0.1496:0.0:0.1567:0.6937	.	110	Q86TB3	ALPK2_HUMAN	T	110	ENSP00000354991:N110T	ENSP00000354991:N110T	N	-	2	0	ALPK2	54398659	0.023000	0.18921	0.009000	0.14445	0.580000	0.36256	2.238000	0.43070	0.267000	0.21916	0.383000	0.25322	AAC	ALPK2	-	pfscan_Ig-like	ENSG00000198796		0.433	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK2	HGNC	protein_coding	OTTHUMT00000256126.1	115	0.00	0	T	NM_052947		56247679	56247679	-1	no_errors	ENST00000361673	ensembl	human	known	69_37n	missense	90	28.57	36	SNP	0.071	G
AMDHD1	144193	genome.wustl.edu	37	12	96359545	96359548	+	Frame_Shift_Del	DEL	TTGC	TTGC	-			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	TTGC	TTGC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr12:96359545_96359548delTTGC	ENST00000266736.2	+	7	1126_1129	c.1020_1023delTTGC	c.(1018-1023)tattgcfs	p.YC340fs		NM_152435.2	NP_689648.2	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1	340					cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	imidazolonepropionase activity (GO:0050480)|metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|skin(1)	22						CCAATGCATATTGCTTTTCAATGG	0.333																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB075878	CCDS9057.1	12q23.1	2006-02-02				ENSG00000139344			28577	protein-coding gene	gene with protein product							Standard	NM_152435		Approved	MGC35366	uc001tel.2	Q96NU7	OTTHUMG00000170353	ENST00000266736.2:c.1020_1023delTTGC	12.37:g.96359545_96359548delTTGC	ENSP00000266736:p.Tyr340fs		A8K463|Q68CI8	Frame_Shift_Del	DEL	pfam_Amidohydro_1,pfam_Amidohydro_3,superfamily_Metal-dep_hydrolase_composite,tigrfam_HutI	p.C341fs	ENST00000266736.2	37	c.1020_1023	CCDS9057.1	12																																																																																			AMDHD1	-	pfam_Amidohydro_1,pfam_Amidohydro_3,superfamily_Metal-dep_hydrolase_composite,tigrfam_HutI	ENSG00000139344		0.333	AMDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMDHD1	HGNC	protein_coding	OTTHUMT00000408640.1	95	0.00	0	TTGC	NM_152435		96359545	96359548	+1	no_errors	ENST00000266736	ensembl	human	known	69_37n	frame_shift_del	116	12.12	16	DEL	1.000:1.000:1.000:0.998	-
ATP13A4	84239	genome.wustl.edu	37	3	193156267	193156267	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr3:193156267A>C	ENST00000342695.4	-	23	2991	c.2669T>G	c.(2668-2670)aTc>aGc	p.I890S	ATP13A4_ENST00000392443.3_Missense_Mutation_p.I871S	NM_032279.2	NP_115655.2	Q4VNC1	AT134_HUMAN	ATPase type 13A4	890						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(27)|ovary(2)|prostate(3)|skin(11)|upper_aerodigestive_tract(2)	71	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		TACTTACTTGATAAGGTGAGG	0.443																																						dbGAP											0													136.0	115.0	122.0					3																	193156267		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095277	CCDS3304.2	3q29	2010-04-20			ENSG00000127249	ENSG00000127249		"""ATPases / P-type"""	25422	protein-coding gene	gene with protein product		609556				14702039, 12975309	Standard	XM_005247829		Approved	DKFZp761I1011, FLJ37958	uc003ftd.3	Q4VNC1	OTTHUMG00000074067	ENST00000342695.4:c.2669T>G	3.37:g.193156267A>C	ENSP00000339182:p.Ile890Ser		B7WPC7|Q6UY23|Q8N1Q9|Q9H043	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,prints_ATPase_P-typ_cation-exchng_asu,tigrfam_ATPase_P-typ_unknown-pump-sp,tigrfam_ATPase_P-typ_ion-transptr	p.I890S	ENST00000342695.4	37	c.2669	CCDS3304.2	3	.	.	.	.	.	.	.	.	.	.	A	26.1	4.702978	0.88924	.	.	ENSG00000127249	ENST00000392443;ENST00000342695	T;T	0.61274	0.12;0.12	5.87	5.87	0.94306	HAD-like domain (2);	0.000000	0.85682	D	0.000000	T	0.80265	0.4591	M	0.90814	3.15	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	D	0.84423	0.0572	10	0.87932	D	0	.	15.3992	0.74823	1.0:0.0:0.0:0.0	.	890	Q4VNC1	AT134_HUMAN	S	871;890	ENSP00000376238:I871S;ENSP00000339182:I890S	ENSP00000339182:I890S	I	-	2	0	ATP13A4	194638961	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	8.862000	0.92283	2.371000	0.80710	0.533000	0.62120	ATC	ATP13A4	-	superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_unknown-pump-sp,tigrfam_ATPase_P-typ_ion-transptr	ENSG00000127249		0.443	ATP13A4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A4	HGNC	protein_coding	OTTHUMT00000157244.4	62	0.00	0	A	NM_032279		193156267	193156267	-1	no_errors	ENST00000342695	ensembl	human	known	69_37n	missense	47	20.34	12	SNP	1.000	C
AVPI1	60370	genome.wustl.edu	37	10	99437633	99437633	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr10:99437633C>G	ENST00000370626.3	-	3	1004	c.437G>C	c.(436-438)aGa>aCa	p.R146T		NM_021732.2	NP_068378.2	Q5T686	AVPI1_HUMAN	arginine vasopressin-induced 1	146					activation of MAPK activity (GO:0000187)|cell cycle (GO:0007049)					breast(1)|endometrium(1)|large_intestine(2)|skin(1)	5		Colorectal(252;0.162)		Epithelial(162;8.37e-11)|all cancers(201;7.94e-09)		GGATCAGTGTCTGATCTGGTG	0.552																																						dbGAP											0													111.0	87.0	95.0					10																	99437633		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF131791	CCDS7470.1	10q24.2	2004-04-05			ENSG00000119986	ENSG00000119986			30898	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_021732		Approved	VIP32, PP5395, VIT32	uc001koi.2	Q5T686	OTTHUMG00000018864	ENST00000370626.3:c.437G>C	10.37:g.99437633C>G	ENSP00000359660:p.Arg146Thr		Q53G32|Q9H2R9|Q9HBN9	Missense_Mutation	SNP	NULL	p.R146T	ENST00000370626.3	37	c.437	CCDS7470.1	10	.	.	.	.	.	.	.	.	.	.	C	18.20	3.571366	0.65765	.	.	ENSG00000119986	ENST00000370626	T	0.55760	0.5	5.24	5.24	0.73138	.	.	.	.	.	T	0.61627	0.2362	L	0.29908	0.895	0.32859	D	0.507725	D	0.76494	0.999	D	0.80764	0.994	T	0.67906	-0.5549	9	0.66056	D	0.02	-0.6648	14.5152	0.67814	0.0:1.0:0.0:0.0	.	146	Q5T686	AVPI1_HUMAN	T	146	ENSP00000359660:R146T	ENSP00000359660:R146T	R	-	2	0	AVPI1	99427623	1.000000	0.71417	1.000000	0.80357	0.367000	0.29736	3.783000	0.55409	2.884000	0.98904	0.655000	0.94253	AGA	AVPI1	-	NULL	ENSG00000119986		0.552	AVPI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AVPI1	HGNC	protein_coding	OTTHUMT00000049736.1	63	0.00	0	C	NM_021732		99437633	99437633	-1	no_errors	ENST00000370626	ensembl	human	known	69_37n	missense	93	13.89	15	SNP	1.000	G
BBS9	27241	genome.wustl.edu	37	7	33573686	33573686	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr7:33573686C>G	ENST00000242067.6	+	21	2940	c.2419C>G	c.(2419-2421)Caa>Gaa	p.Q807E	BBS9_ENST00000355070.2_Missense_Mutation_p.Q802E|BBS9_ENST00000350941.3_Missense_Mutation_p.Q767E|BBS9_ENST00000354265.4_Missense_Mutation_p.Q772E|BBS9_ENST00000396127.2_Missense_Mutation_p.Q772E	NM_198428.2	NP_940820.1	Q3SYG4	PTHB1_HUMAN	Bardet-Biedl syndrome 9	807					cilium assembly (GO:0042384)|fat cell differentiation (GO:0045444)|protein transport (GO:0015031)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)			BBS9/PKD1L1(2)	NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	50			GBM - Glioblastoma multiforme(11;0.0894)			AGACACAAGCCAACTGAAGAA	0.512									Bardet-Biedl syndrome																													dbGAP											0													155.0	122.0	133.0					7																	33573686		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome		CCDS5441.1, CCDS34618.1, CCDS43566.1, CCDS47572.1	7p14	2014-06-17			ENSG00000122507	ENSG00000122507			30000	protein-coding gene	gene with protein product	"""parathyroid hormone responsive B1 gene"""	607968				16380913, 10221542	Standard	XM_005249701		Approved	B1, PTHB1	uc003tdn.1	Q3SYG4	OTTHUMG00000128659	ENST00000242067.6:c.2419C>G	7.37:g.33573686C>G	ENSP00000242067:p.Gln807Glu		E9PDC9|P78514|Q7KYS6|Q7KYS7|Q8N570|Q99844|Q99854|Q9Y699|Q9Y6A0	Missense_Mutation	SNP	NULL	p.Q807E	ENST00000242067.6	37	c.2419	CCDS43566.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.27|13.27	2.186122|2.186122	0.38609|0.38609	.|.	.|.	ENSG00000122507|ENSG00000122507	ENST00000434373|ENST00000242067;ENST00000350941;ENST00000396127;ENST00000355070;ENST00000354265;ENST00000396132	.|T;T;T;T;T	.|0.12255	.|2.7;2.7;2.7;2.7;2.7	5.93|5.93	4.1|4.1	0.47936|0.47936	.|.	.|0.163326	.|0.38720	.|N	.|0.001594	T|T	0.07279|0.07279	0.0184|0.0184	N|N	0.08118|0.08118	0|0	0.27364|0.27364	N|N	0.955891|0.955891	.|B;B;B;B;B	.|0.10296	.|0.003;0.001;0.001;0.001;0.002	.|B;B;B;B;B	.|0.13407	.|0.007;0.007;0.007;0.009;0.007	T|T	0.21586|0.21586	-1.0241|-1.0241	5|10	.|0.66056	.|D	.|0.02	-8.3237|-8.3237	8.3895|8.3895	0.32520|0.32520	0.4088:0.518:0.0:0.0732|0.4088:0.518:0.0:0.0732	.|.	.|807;767;802;772;807	.|Q3SYG4-3;Q3SYG4-2;E9PDC9;Q3SYG4-4;Q3SYG4	.|.;.;.;.;PTHB1_HUMAN	R|E	373|807;767;772;802;772;807	.|ENSP00000242067:Q807E;ENSP00000313122:Q767E;ENSP00000379433:Q772E;ENSP00000347182:Q802E;ENSP00000346214:Q772E	.|ENSP00000242067:Q807E	P|Q	+|+	2|1	0|0	BBS9|BBS9	33540211|33540211	0.997000|0.997000	0.39634|0.39634	0.815000|0.815000	0.32552|0.32552	0.970000|0.970000	0.65996|0.65996	2.810000|2.810000	0.47979|0.47979	0.822000|0.822000	0.34565|0.34565	0.655000|0.655000	0.94253|0.94253	CCA|CAA	BBS9	-	NULL	ENSG00000122507		0.512	BBS9-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BBS9	HGNC	protein_coding	OTTHUMT00000329064.1	51	0.00	0	C			33573686	33573686	+1	no_errors	ENST00000242067	ensembl	human	known	69_37n	missense	58	21.62	16	SNP	0.146	G
C11orf63	79864	genome.wustl.edu	37	11	122774895	122774895	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr11:122774895G>A	ENST00000531316.1	+	2	699	c.607G>A	c.(607-609)Ggt>Agt	p.G203S	C11orf63_ENST00000307257.6_Missense_Mutation_p.G203S|C11orf63_ENST00000227349.2_Missense_Mutation_p.G203S			Q6NUN7	CK063_HUMAN	chromosome 11 open reading frame 63	203					axoneme assembly (GO:0035082)|brain development (GO:0007420)|cerebrospinal fluid secretion (GO:0033326)|ciliary basal body organization (GO:0032053)					breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(13)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	47		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)		CTATGAGCATGGTGCCCGTCG	0.507																																						dbGAP											0													84.0	79.0	80.0					11																	122774895		2202	4299	6501	-	-	-	SO:0001583	missense	0			BC068507	CCDS8438.1, CCDS8439.1	11q24.1	2012-05-25			ENSG00000109944	ENSG00000109944			26288	protein-coding gene	gene with protein product						12477932	Standard	NM_024806		Approved	FLJ23554	uc001pym.4	Q6NUN7	OTTHUMG00000166027	ENST00000531316.1:c.607G>A	11.37:g.122774895G>A	ENSP00000431669:p.Gly203Ser		A8K6G0|Q96GB5|Q9H5D6	Missense_Mutation	SNP	NULL	p.G203S	ENST00000531316.1	37	c.607	CCDS8438.1	11	.	.	.	.	.	.	.	.	.	.	G	6.242	0.412829	0.11812	.	.	ENSG00000109944	ENST00000307257;ENST00000227349;ENST00000531316	T;T	0.43294	0.95;0.95	5.83	-2.46	0.06461	.	1.037240	0.07555	N	0.916093	T	0.20700	0.0498	N	0.17674	0.51	0.09310	N	1	B;B	0.20052	0.041;0.041	B;B	0.19946	0.027;0.027	T	0.29882	-0.9997	10	0.02654	T	1	0.5217	6.3397	0.21316	0.4036:0.4025:0.1939:0.0	.	203;203	Q6NUN7;Q6NUN7-2	CK063_HUMAN;.	S	203	ENSP00000227349:G203S;ENSP00000431669:G203S	ENSP00000227349:G203S	G	+	1	0	C11orf63	122280105	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	0.027000	0.13621	-0.480000	0.06803	-0.175000	0.13238	GGT	C11orf63	-	NULL	ENSG00000109944		0.507	C11orf63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf63	HGNC	protein_coding	OTTHUMT00000387511.1	20	0.00	0	G	NM_024806		122774895	122774895	+1	no_errors	ENST00000227349	ensembl	human	known	69_37n	missense	19	38.71	12	SNP	0.000	A
C6orf123	26238	genome.wustl.edu	37	6	168191674	168191674	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr6:168191674G>C	ENST00000366822.2	-	2	337	c.83C>G	c.(82-84)cCt>cGt	p.P28R						chromosome 6 open reading frame 123																		cCTTCCATAAGGGAAGTCTGA	0.493																																						dbGAP											0													79.0	79.0	79.0					6																	168191674		692	1591	2283	-	-	-	SO:0001583	missense	0					6q27	2008-02-05			ENSG00000146521	ENSG00000146521			21235	protein-coding gene	gene with protein product						10382971	Standard	NR_026773		Approved	HGC6.2, dJ431P23.4	uc003sic.3	Q9Y6Z2	OTTHUMG00000016030	ENST00000366822.2:c.83C>G	6.37:g.168191674G>C	ENSP00000355787:p.Pro28Arg			Missense_Mutation	SNP	NULL	p.P28R	ENST00000366822.2	37	c.83		6	.	.	.	.	.	.	.	.	.	.	G	0.579	-0.837921	0.02692	.	.	ENSG00000146521	ENST00000366822	.	.	.	1.12	0.204	0.15199	.	.	.	.	.	T	0.18341	0.0440	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.31166	-0.9953	5	0.87932	D	0	.	3.4413	0.07465	0.2835:0.0:0.7165:0.0	.	.	.	.	R	28	.	ENSP00000355787:P28R	P	-	2	0	C6orf123	167934523	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	0.037000	0.13840	0.035000	0.15519	0.484000	0.47621	CCT	C6orf123	-	NULL	ENSG00000146521		0.493	C6orf123-002	PUTATIVE	basic|appris_principal	protein_coding	C6orf123	HGNC	protein_coding	OTTHUMT00000043147.3	26	0.00	0	G	NM_014356		168191674	168191674	-1	no_errors	ENST00000495520	ensembl	human	known	69_37n	missense	29	32.56	14	SNP	0.001	C
CACNA1F	778	genome.wustl.edu	37	X	49063555	49063555	+	Silent	SNP	G	G	C			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chrX:49063555G>C	ENST00000376265.2	-	44	5236	c.5175C>G	c.(5173-5175)ctC>ctG	p.L1725L	CACNA1F_ENST00000376251.1_Silent_p.L1660L|CACNA1F_ENST00000323022.5_Silent_p.L1714L	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	1725					axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	TGGTGAAAATGAGAGCCCCAG	0.557																																						dbGAP											0													116.0	80.0	92.0					X																	49063555		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.5175C>G	X.37:g.49063555G>C			A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.L1725	ENST00000376265.2	37	c.5175	CCDS35253.1	X																																																																																			CACNA1F	-	NULL	ENSG00000102001		0.557	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1F	HGNC	protein_coding	OTTHUMT00000358157.1	74	0.00	0	G	NM_005183		49063555	49063555	-1	no_errors	ENST00000376265	ensembl	human	known	69_37n	silent	152	20.83	40	SNP	0.951	C
CARS2	79587	genome.wustl.edu	37	13	111293891	111293893	+	In_Frame_Del	DEL	GCT	GCT	-	rs542366222		TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	GCT	GCT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr13:111293891_111293893delGCT	ENST00000257347.4	-	15	1749_1751	c.1686_1688delAGC	c.(1684-1689)tcagcg>tcg	p.A563del	CARS2_ENST00000535398.1_5'Flank	NM_024537.2	NP_078813.1	Q9HA77	SYCM_HUMAN	cysteinyl-tRNA synthetase 2, mitochondrial (putative)	563					cysteinyl-tRNA aminoacylation (GO:0006423)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|cysteine-tRNA ligase activity (GO:0004817)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|prostate(4)|skin(1)	13	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.163)		L-Cysteine(DB00151)	TCCTCAGCCCGCTGATTTTTGGT	0.522																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			BC007220	CCDS9514.1	13q34	2011-07-01	2007-02-22		ENSG00000134905	ENSG00000134905	6.1.1.16	"""Aminoacyl tRNA synthetases / Class I"""	25695	protein-coding gene	gene with protein product	"""cysteine tRNA ligase 2, mitochondrial (putative)"""	612800				15779907	Standard	NM_024537		Approved	FLJ12118	uc001vrd.2	Q9HA77	OTTHUMG00000017347	ENST00000257347.4:c.1686_1688delAGC	13.37:g.111293891_111293893delGCT	ENSP00000257347:p.Ala563del		Q8NI84|Q96IV4	In_Frame_Del	DEL	pfam_Cys-tRNA/MSH_ligase,pfam_Methionyl/Leucyl_tRNA_Synth,pfam_aa-tRNA-synth_Ia,superfamily_tRNAsynth_1a_anticodon-bd,prints_Cys-tRNA/MSH_ligase,tigrfam_Cys-tRNA-synt	p.A563in_frame_del	ENST00000257347.4	37	c.1688_1686	CCDS9514.1	13																																																																																			CARS2	-	NULL	ENSG00000134905		0.522	CARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARS2	HGNC	protein_coding	OTTHUMT00000045772.3	71	0.00	0	GCT	NM_024537		111293891	111293893	-1	no_errors	ENST00000257347	ensembl	human	known	69_37n	in_frame_del	116	12.69	17	DEL	0.000:0.000:0.000	-
CCDC125	202243	genome.wustl.edu	37	5	68595848	68595848	+	Silent	SNP	T	T	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr5:68595848T>G	ENST00000396496.2	-	8	914	c.807A>C	c.(805-807)tcA>tcC	p.S269S	CCDC125_ENST00000460090.1_5'UTR|CCDC125_ENST00000511257.1_Silent_p.S144S|CCDC125_ENST00000396499.1_Silent_p.S269S|CCDC125_ENST00000383374.2_Silent_p.S268S			Q86Z20	CC125_HUMAN	coiled-coil domain containing 125	269						cytoplasm (GO:0005737)				breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(7)|urinary_tract(1)	19		Lung NSC(167;7.26e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.2e-56)|Epithelial(20;2.31e-52)|all cancers(19;5.85e-48)|Lung(70;0.0183)		CCTCAAGACCTGAAGCCTCTG	0.458																																						dbGAP											0													245.0	221.0	229.0					5																	68595848		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB024691	CCDS4000.1, CCDS75255.1	5q13.2	2008-02-05			ENSG00000183323	ENSG00000183323			28924	protein-coding gene	gene with protein product		613781					Standard	XM_005248461		Approved	KENAE	uc003jvv.1	Q86Z20	OTTHUMG00000131259	ENST00000396496.2:c.807A>C	5.37:g.68595848T>G			Q86Z19	Silent	SNP	NULL	p.S269	ENST00000396496.2	37	c.807	CCDS4000.1	5																																																																																			CCDC125	-	NULL	ENSG00000183323		0.458	CCDC125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC125	HGNC	protein_coding	OTTHUMT00000254027.4	116	0.00	0	T	NM_176816		68595848	68595848	-1	no_errors	ENST00000396496	ensembl	human	known	69_37n	silent	95	30.71	43	SNP	1.000	G
CD84	8832	genome.wustl.edu	37	1	160523827	160523827	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr1:160523827G>T	ENST00000311224.4	-	3	564	c.498C>A	c.(496-498)taC>taA	p.Y166*	RP11-528G1.2_ENST00000446952.1_RNA|CD84_ENST00000368047.3_5'UTR|CD84_ENST00000368048.3_Nonsense_Mutation_p.Y166*|CD84_ENST00000534968.1_Nonsense_Mutation_p.Y52*|CD84_ENST00000368054.3_Nonsense_Mutation_p.Y166*|CD84_ENST00000368051.3_Nonsense_Mutation_p.Y166*	NM_001184879.1	NP_001171808.1	Q9UIB8	SLAF5_HUMAN	CD84 molecule	166	Ig-like C2-type.				blood coagulation (GO:0007596)|defense response (GO:0006952)|homophilic cell adhesion (GO:0007156)|leukocyte migration (GO:0050900)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(1)	24	all_cancers(52;3.62e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			GACTCCAATTGTATGTCACAT	0.448																																						dbGAP											0													184.0	165.0	171.0					1																	160523827		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF054816	CCDS1206.1, CCDS53395.1, CCDS53396.1, CCDS53397.1	1q24	2013-01-11	2006-03-31		ENSG00000066294	ENSG00000066294		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1704	protein-coding gene	gene with protein product		604513	"""CD84 antigen (leukocyte antigen)"", ""CD84 molecule """			9310491	Standard	NM_003874		Approved	SLAMF5, hCD84, mCD84	uc001fwh.4	Q9UIB8	OTTHUMG00000022788	ENST00000311224.4:c.498C>A	1.37:g.160523827G>T	ENSP00000312367:p.Tyr166*		B2R8T1|B7Z3R8|O15430|O95266|O95660|Q5H9R1|Q6FHA8|Q8WLP1|Q8WWI8|Q9UF04|Q9UIB6|Q9UIB7|Q9UIT7	Nonsense_Mutation	SNP	smart_Ig_sub,pfscan_Ig-like	p.Y166*	ENST00000311224.4	37	c.498	CCDS53396.1	1	.	.	.	.	.	.	.	.	.	.	G	10.71	1.427140	0.25726	.	.	ENSG00000066294	ENST00000534968;ENST00000368054;ENST00000368048;ENST00000311224;ENST00000368051;ENST00000360056;ENST00000368047	.	.	.	5.25	1.25	0.21368	.	0.450143	0.24810	N	0.035410	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.609	7.0448	0.25040	0.3787:0.0:0.6213:0.0	.	.	.	.	X	52;166;166;166;166;166;166	.	ENSP00000312367:Y166X	Y	-	3	2	CD84	158790451	0.000000	0.05858	0.033000	0.17914	0.214000	0.24535	-1.227000	0.02950	0.361000	0.24292	0.563000	0.77884	TAC	CD84	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000066294		0.448	CD84-003	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	CD84	HGNC	protein_coding	OTTHUMT00000059092.1	84	0.00	0	G	NM_003874		160523827	160523827	-1	no_errors	ENST00000311224	ensembl	human	known	69_37n	nonsense	107	39.20	69	SNP	0.014	T
CDH8	1006	genome.wustl.edu	37	16	61689466	61689466	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr16:61689466A>T	ENST00000577390.1	-	11	2768	c.1814T>A	c.(1813-1815)gTc>gAc	p.V605D	CDH8_ENST00000299345.6_Missense_Mutation_p.V605D|CDH8_ENST00000577730.1_Missense_Mutation_p.V605D	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	605	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		GCAAGACTGGACGACACCGTC	0.448																																						dbGAP											0													154.0	127.0	136.0					16																	61689466		2203	4300	6503	-	-	-	SO:0001583	missense	0			L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.1814T>A	16.37:g.61689466A>T	ENSP00000462701:p.Val605Asp		B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.V605D	ENST00000577390.1	37	c.1814	CCDS10802.1	16	.	.	.	.	.	.	.	.	.	.	A	22.5	4.301952	0.81136	.	.	ENSG00000150394	ENST00000299345	T	0.56611	0.45	5.52	5.52	0.82312	Cadherin (1);	0.000000	0.85682	D	0.000000	T	0.63283	0.2498	M	0.70595	2.14	0.80722	D	1	P	0.49783	0.928	P	0.50791	0.65	T	0.68712	-0.5336	10	0.87932	D	0	.	14.82	0.70065	1.0:0.0:0.0:0.0	.	605	P55286	CADH8_HUMAN	D	605	ENSP00000299345:V605D	ENSP00000299345:V605D	V	-	2	0	CDH8	60246967	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.127000	0.77210	2.101000	0.63845	0.459000	0.35465	GTC	CDH8	-	pfscan_Cadherin	ENSG00000150394		0.448	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH8	HGNC	protein_coding	OTTHUMT00000268754.3	61	0.00	0	A	NM_001796		61689466	61689466	-1	no_errors	ENST00000577390	ensembl	human	known	69_37n	missense	62	13.89	10	SNP	1.000	T
CKAP4	10970	genome.wustl.edu	37	12	106633464	106633464	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr12:106633464C>G	ENST00000378026.4	-	2	1283	c.1147G>C	c.(1147-1149)Gat>Cat	p.D383H	CKAP4_ENST00000552828.1_5'Flank	NM_006825.3	NP_006816.2	Q07065	CKAP4_HUMAN	cytoskeleton-associated protein 4	383						cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|pancreas(1)|urinary_tract(1)	20						CCGTGGGAATCGGACTTCAGC	0.627																																						dbGAP											0													42.0	45.0	44.0					12																	106633464		2203	4300	6503	-	-	-	SO:0001583	missense	0			X69910	CCDS9103.1	12q23.3	2006-06-23				ENSG00000136026			16991	protein-coding gene	gene with protein product						8314870	Standard	NM_006825		Approved	P63, CLIMP-63, ERGIC-63	uc001tlk.3	Q07065		ENST00000378026.4:c.1147G>C	12.37:g.106633464C>G	ENSP00000367265:p.Asp383His		Q504S5|Q53ES6	Missense_Mutation	SNP	superfamily_Tscrpt_elong_fac_GreA/B_N,superfamily_STAT_TF_coiled-coil	p.D383H	ENST00000378026.4	37	c.1147	CCDS9103.1	12	.	.	.	.	.	.	.	.	.	.	C	10.74	1.434388	0.25813	.	.	ENSG00000136026	ENST00000378026	T	0.78246	-1.16	5.82	1.4	0.22301	.	2.361080	0.01151	N	0.006406	T	0.75946	0.3919	L	0.44542	1.39	0.09310	N	1	P	0.47191	0.891	P	0.45998	0.5	T	0.61357	-0.7079	10	0.46703	T	0.11	-2.4413	7.5985	0.28063	0.0:0.5468:0.1252:0.328	.	383	Q07065	CKAP4_HUMAN	H	383	ENSP00000367265:D383H	ENSP00000367265:D383H	D	-	1	0	CKAP4	105157594	0.000000	0.05858	0.000000	0.03702	0.407000	0.30961	-0.125000	0.10579	0.358000	0.24211	0.563000	0.77884	GAT	CKAP4	-	superfamily_Tscrpt_elong_fac_GreA/B_N	ENSG00000136026		0.627	CKAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CKAP4	HGNC	protein_coding	OTTHUMT00000407196.1	8	0.00	0	C			106633464	106633464	-1	no_errors	ENST00000378026	ensembl	human	known	69_37n	missense	7	46.15	6	SNP	0.001	G
CNTN4	152330	genome.wustl.edu	37	3	3080621	3080621	+	Silent	SNP	C	C	A	rs151025792	byFrequency	TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr3:3080621C>A	ENST00000397461.1	+	18	2481	c.2097C>A	c.(2095-2097)ccC>ccA	p.P699P	CNTN4_ENST00000427331.1_Silent_p.P699P|CNTN4-AS1_ENST00000442749.2_RNA|CNTN4_ENST00000358480.3_Silent_p.P480P|CNTN4_ENST00000448906.2_Silent_p.P371P|CNTN4_ENST00000397459.2_Silent_p.P371P|CNTN4_ENST00000418658.1_Silent_p.P699P	NM_001206955.1	NP_001193884.1	Q8IWV2	CNTN4_HUMAN	contactin 4	699					axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|brain development (GO:0007420)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|neuron cell-cell adhesion (GO:0007158)|neuron projection development (GO:0031175)|regulation of synaptic plasticity (GO:0048167)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(19)|ovary(2)|pancreas(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		GTGCAGTCCCCGAAGTCACAC	0.498																																						dbGAP											0													102.0	95.0	97.0					3																	3080621		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AW665944	CCDS2558.1, CCDS43041.1	3p26.3	2013-02-11			ENSG00000144619	ENSG00000144619		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2174	protein-coding gene	gene with protein product		607280				8586965, 12202991	Standard	NM_175607		Approved	BIG-2	uc003bpc.3	Q8IWV2	OTTHUMG00000119031	ENST00000397461.1:c.2097C>A	3.37:g.3080621C>A			B2RAX3|Q8IX14|Q8TC35	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.P699	ENST00000397461.1	37	c.2097	CCDS43041.1	3																																																																																			CNTN4	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000144619		0.498	CNTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN4	HGNC	protein_coding	OTTHUMT00000239236.2	50	0.00	0	C			3080621	3080621	+1	no_errors	ENST00000397461	ensembl	human	known	69_37n	silent	68	23.60	21	SNP	0.355	A
COLQ	8292	genome.wustl.edu	37	3	15515753	15515753	+	Silent	SNP	C	C	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr3:15515753C>G	ENST00000383788.5	-	9	707	c.582G>C	c.(580-582)ctG>ctC	p.L194L	COLQ_ENST00000435459.2_Silent_p.L184L|COLQ_ENST00000603808.1_Silent_p.L194L|COLQ_ENST00000383787.2_Silent_p.L185L|COLQ_ENST00000383781.4_Silent_p.L184L|COLQ_ENST00000383785.2_Silent_p.L194L|COLQ_ENST00000383786.5_Silent_p.L160L	NM_005677.3	NP_005668.2	Q9Y215	COLQ_HUMAN	collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase	194	Collagen-like 1.				acetylcholine catabolic process in synaptic cleft (GO:0001507)|asymmetric protein localization (GO:0008105)	basal lamina (GO:0005605)|cell junction (GO:0030054)|collagen trimer (GO:0005581)|extracellular space (GO:0005615)|synapse (GO:0045202)				endometrium(2)|large_intestine(4)|lung(10)|skin(3)	19						CTTTGGGACCCAGGTCACCCT	0.453																																						dbGAP											0													146.0	154.0	151.0					3																	15515753		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF057036	CCDS33709.1, CCDS43057.1, CCDS46768.1	3p	2008-07-18			ENSG00000206561	ENSG00000206561			2226	protein-coding gene	gene with protein product	"""single strand of homotrimeric collagen-like tail subunit of asymmetric acetylcholinesterase"", ""collagenic tail of endplate acetylcholinesterase"", ""AChE Q subunit"", ""acetylcholinesterase-associated collagen"""	603033				9689136	Standard	NM_005677		Approved	EAD	uc003bzx.3	Q9Y215	OTTHUMG00000156233	ENST00000383788.5:c.582G>C	3.37:g.15515753C>G			B3KY09|Q6DK18|Q6YH18|Q6YH19|Q6YH20|Q6YH21|Q9NP18|Q9NP19|Q9NP20|Q9NP21|Q9NP22|Q9NP23|Q9NP24|Q9UP88	Silent	SNP	pfam_Collagen,tigrfam_Myxo_disulph_rpt	p.L194	ENST00000383788.5	37	c.582	CCDS33709.1	3																																																																																			COLQ	-	NULL	ENSG00000206561		0.453	COLQ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COLQ	HGNC	protein_coding	OTTHUMT00000343575.1	113	0.00	0	C	NM_005677		15515753	15515753	-1	no_errors	ENST00000383788	ensembl	human	known	69_37n	silent	77	37.40	46	SNP	0.985	G
CPD	1362	genome.wustl.edu	37	17	28766018	28766018	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr17:28766018G>C	ENST00000225719.4	+	9	2229	c.2153G>C	c.(2152-2154)aGa>aCa	p.R718T	CPD_ENST00000543464.2_Missense_Mutation_p.R471T	NM_001304.4	NP_001295.2	O75976	CBPD_HUMAN	carboxypeptidase D	718	Carboxypeptidase-like 2.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metallocarboxypeptidase activity (GO:0004181)|serine-type carboxypeptidase activity (GO:0004185)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(13)|skin(5)|stomach(1)|urinary_tract(1)	36						TTTCAAGGTAGACCTTGCAAG	0.318																																						dbGAP											0													84.0	89.0	88.0					17																	28766018		2203	4300	6503	-	-	-	SO:0001583	missense	0			U65090	CCDS11257.1, CCDS56025.1	17q11.2	2012-02-10			ENSG00000108582	ENSG00000108582	3.4.17.22		2301	protein-coding gene	gene with protein product	"""metallocarboxypeptidase D"""	603102				9628828, 9355738	Standard	NM_001304		Approved	GP180	uc002hfb.2	O75976	OTTHUMG00000132797	ENST00000225719.4:c.2153G>C	17.37:g.28766018G>C	ENSP00000225719:p.Arg718Thr		B7Z7T9|B7ZAU4|F5GZH6|O15377|Q86SH9|Q86XE6	Missense_Mutation	SNP	pfam_Peptidase_M14,superfamily_CarboxyPept-like_regulatory,smart_Peptidase_M14,prints_Peptidase_M14	p.R718T	ENST00000225719.4	37	c.2153	CCDS11257.1	17	.	.	.	.	.	.	.	.	.	.	G	6.037	0.375234	0.11409	.	.	ENSG00000108582	ENST00000225719;ENST00000543464	T;T	0.19532	2.14;3.25	5.37	2.13	0.27403	Peptidase M14, carboxypeptidase A (2);	0.376195	0.33023	N	0.005378	T	0.07593	0.0191	N	0.10837	0.055	0.26397	N	0.976486	B;B	0.14012	0.006;0.009	B;B	0.14023	0.009;0.01	T	0.33059	-0.9883	10	0.09084	T	0.74	.	3.7644	0.08616	0.1519:0.131:0.5823:0.1348	.	471;718	F5GZH6;O75976	.;CBPD_HUMAN	T	718;471	ENSP00000225719:R718T;ENSP00000444443:R471T	ENSP00000225719:R718T	R	+	2	0	CPD	25790144	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.123000	0.41996	1.260000	0.44134	0.585000	0.79938	AGA	CPD	-	pfam_Peptidase_M14,smart_Peptidase_M14	ENSG00000108582		0.318	CPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPD	HGNC	protein_coding	OTTHUMT00000256214.3	47	0.00	0	G	NM_001304		28766018	28766018	+1	no_errors	ENST00000225719	ensembl	human	known	69_37n	missense	58	19.44	14	SNP	1.000	C
CRIPAK	285464	genome.wustl.edu	37	4	1388613	1388613	+	Frame_Shift_Del	DEL	C	C	-	rs558358960		TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr4:1388613delC	ENST00000324803.4	+	1	3274	c.314delC	c.(313-315)gccfs	p.A105fs		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	105					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			ATGTGGAGTGCCCGCCTGCTC	0.667																																						dbGAP											0													203.0	150.0	168.0					4																	1388613		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.314delC	4.37:g.1388613delC	ENSP00000323978:p.Ala105fs		Q8NB03	Frame_Shift_Del	DEL	smart_Post-SET_dom	p.R106fs	ENST00000324803.4	37	c.314	CCDS3349.1	4																																																																																			CRIPAK	-	smart_Post-SET_dom	ENSG00000179979		0.667	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRIPAK	HGNC	protein_coding	OTTHUMT00000241607.2	25	0.00	0	C	NM_175918		1388613	1388613	+1	no_errors	ENST00000324803	ensembl	human	known	69_37n	frame_shift_del	21	21.43	6	DEL	0.007	-
CST7	8530	genome.wustl.edu	37	20	24937952	24937952	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr20:24937952G>C	ENST00000480798.1	+	2	376	c.100G>C	c.(100-102)Gtg>Ctg	p.V34L	CST7_ENST00000376835.2_Missense_Mutation_p.V56L	NM_003650.3	NP_003641.3	O76096	CYTF_HUMAN	cystatin F (leukocystatin)	34					immune response (GO:0006955)|negative regulation of endopeptidase activity (GO:0010951)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|endopeptidase inhibitor activity (GO:0004866)			large_intestine(1)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	5						TAACTCACGTGTGAAGCCAGG	0.468																																						dbGAP											0													262.0	254.0	257.0					20																	24937952		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF036342	CCDS13165.1, CCDS13165.2	20p11.21	2008-04-15			ENSG00000077984	ENSG00000077984			2479	protein-coding gene	gene with protein product		603253				9733783, 9632704	Standard	NM_003650		Approved		uc002wtx.2	O76096	OTTHUMG00000032108	ENST00000480798.1:c.100G>C	20.37:g.24937952G>C	ENSP00000420384:p.Val34Leu		Q6FH95|Q7Z4J8|Q9UED4	Missense_Mutation	SNP	pfam_Prot_inh_cystat,smart_Prot_inh_cystat	p.V56L	ENST00000480798.1	37	c.166	CCDS13165.2	20	.	.	.	.	.	.	.	.	.	.	g	1.703	-0.501068	0.04261	.	.	ENSG00000077984	ENST00000480798;ENST00000376835	T;T	0.09163	3.06;3.01	3.98	-0.445	0.12242	Proteinase inhibitor I25, cystatin (1);	0.977830	0.08395	N	0.952367	T	0.06416	0.0165	L	0.32530	0.975	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45220	-0.9276	10	0.20519	T	0.43	-1.4094	0.5074	0.00590	0.2052:0.1655:0.2907:0.3386	.	34	O76096	CYTF_HUMAN	L	34;56	ENSP00000420384:V34L;ENSP00000366031:V56L	ENSP00000366031:V56L	V	+	1	0	CST7	24885952	0.000000	0.05858	0.003000	0.11579	0.055000	0.15305	0.378000	0.20569	0.077000	0.16863	0.506000	0.49869	GTG	CST7	-	smart_Prot_inh_cystat	ENSG00000077984		0.468	CST7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CST7	HGNC	protein_coding	OTTHUMT00000078381.2	79	0.00	0	G	NM_003650		24937952	24937952	+1	no_errors	ENST00000376835	ensembl	human	known	69_37n	missense	95	12.04	13	SNP	0.000	C
DDX11	1663	genome.wustl.edu	37	12	31244703	31244703	+	Silent	SNP	C	C	T	rs374684190		TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr12:31244703C>T	ENST00000407793.2	+	10	1391	c.1140C>T	c.(1138-1140)gcC>gcT	p.A380A	DDX11_ENST00000545668.1_Silent_p.A380A|DDX11_ENST00000251758.5_3'UTR|DDX11_ENST00000228264.6_Silent_p.A354A|DDX11_ENST00000542838.1_Silent_p.A380A|DDX11_ENST00000350437.4_Silent_p.A380A	NM_030653.3|NM_152438.1	NP_085911.2|NP_689651.1	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11	380	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.A380A(9)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(11)|large_intestine(5)|lung(23)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	57	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					CTCGGCAGGCCGCGGGCATCC	0.677										Multiple Myeloma(12;0.14)																												dbGAP											9	Substitution - coding silent(9)	kidney(9)											37.0	36.0	36.0					12																	31244703		2202	4298	6500	-	-	-	SO:0001819	synonymous_variant	0			U75969	CCDS8721.1, CCDS41767.1, CCDS44856.1, CCDS58224.1	12p11.21	2012-02-23	2012-02-23		ENSG00000013573	ENSG00000013573		"""DEAD-boxes"""	2736	protein-coding gene	gene with protein product	"""CHL1-like helicase homolog (S. cerevisiae)"""	601150	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (S.cerevisiae CHL1-like helicase)"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11"""				Standard	NM_030653		Approved	CHLR1, KRG2, CHL1, ChlR1, WABS	uc001rjv.2	Q96FC9	OTTHUMG00000168435	ENST00000407793.2:c.1140C>T	12.37:g.31244703C>T			Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Silent	SNP	pfam_DEAD_2,smart_Helicase-like_DEXD_c2,smart_ATP-dep_Helicase_C,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3,tigrfam_DNA_helicase_DNA-repair_Rad3	p.A380	ENST00000407793.2	37	c.1140	CCDS44856.1	12																																																																																			DDX11	-	pfam_DEAD_2,smart_Helicase-like_DEXD_c2,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3,tigrfam_DNA_helicase_DNA-repair_Rad3	ENSG00000013573		0.677	DDX11-202	KNOWN	basic|CCDS	protein_coding	DDX11	HGNC	protein_coding	OTTHUMT00000399728.1	25	0.00	0	C	NM_030653		31244703	31244703	+1	no_errors	ENST00000407793	ensembl	human	known	69_37n	silent	18	33.33	9	SNP	0.617	T
DDX18	8886	genome.wustl.edu	37	2	118582195	118582195	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr2:118582195G>C	ENST00000263239.2	+	8	1245	c.1117G>C	c.(1117-1119)Gac>Cac	p.D373H		NM_006773.3	NP_006764.3	Q9NVP1	DDX18_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 18	373	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(4)|large_intestine(3)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						AAAAGTTGAAGACCTGGCAAG	0.393																																						dbGAP											0													114.0	114.0	114.0					2																	118582195		2203	4300	6503	-	-	-	SO:0001583	missense	0			X98743	CCDS2120.1	2q21.2	2008-02-05	2003-06-13		ENSG00000088205	ENSG00000088205		"""DEAD-boxes"""	2741	protein-coding gene	gene with protein product		606355	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 18 (Myc-regulated)"""			8861962	Standard	NM_006773		Approved	MrDb	uc002tlh.1	Q9NVP1	OTTHUMG00000058521	ENST00000263239.2:c.1117G>C	2.37:g.118582195G>C	ENSP00000263239:p.Asp373His		Q6GTZ9|Q6IAU4|Q92732|Q9BQB7	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.D373H	ENST00000263239.2	37	c.1117	CCDS2120.1	2	.	.	.	.	.	.	.	.	.	.	G	18.93	3.726783	0.69074	.	.	ENSG00000088205	ENST00000263239;ENST00000539346;ENST00000415038	T;T	0.15952	2.38;2.38	4.68	4.68	0.58851	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.26231	0.0640	L	0.59912	1.85	0.80722	D	1	B	0.23937	0.094	B	0.34536	0.185	T	0.11743	-1.0575	10	0.87932	D	0	-13.9772	18.2033	0.89846	0.0:0.0:1.0:0.0	.	373	Q9NVP1	DDX18_HUMAN	H	373;112;56	ENSP00000263239:D373H;ENSP00000415604:D56H	ENSP00000263239:D373H	D	+	1	0	DDX18	118298665	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.006000	0.93592	2.614000	0.88457	0.558000	0.71614	GAC	DDX18	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000088205		0.393	DDX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX18	HGNC	protein_coding	OTTHUMT00000129632.3	102	0.00	0	G	NM_006773		118582195	118582195	+1	no_errors	ENST00000263239	ensembl	human	known	69_37n	missense	109	12.10	15	SNP	1.000	C
DENND1C	79958	genome.wustl.edu	37	19	6468312	6468312	+	Frame_Shift_Del	DEL	C	C	-			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr19:6468312delC	ENST00000381480.2	-	22	1836	c.1724delG	c.(1723-1725)ggcfs	p.G575fs	DENND1C_ENST00000543576.1_Frame_Shift_Del_p.G531fs	NM_024898.2	NP_079174.2	Q8IV53	DEN1C_HUMAN	DENN/MADD domain containing 1C	575					positive regulation of Rab GTPase activity (GO:0032851)	cytoplasmic vesicle (GO:0031410)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			endometrium(3)|kidney(3)|large_intestine(1)|lung(3)	10						TCTCAGGCTGCCTGCGCTCTT	0.577																																						dbGAP											0													46.0	49.0	48.0					19																	6468312		2051	4200	6251	-	-	-	SO:0001589	frameshift_variant	0			AL713770	CCDS45938.1	19p13.3	2014-02-06	2005-08-17	2005-08-17	ENSG00000205744	ENSG00000205744		"""DENN/MADD domain containing"""	26225	protein-coding gene	gene with protein product		613634	"""family with sequence similarity 31, member C"""	FAM31C		12477932	Standard	XM_005259646		Approved	FLJ22757	uc002mfe.3	Q8IV53	OTTHUMG00000180853	ENST00000381480.2:c.1724delG	19.37:g.6468312delC	ENSP00000370889:p.Gly575fs		B4E051|D3PFD4|Q8NDB1|Q9H5Z2	Frame_Shift_Del	DEL	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.G575fs	ENST00000381480.2	37	c.1724	CCDS45938.1	19																																																																																			DENND1C	-	NULL	ENSG00000205744		0.577	DENND1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND1C	HGNC	protein_coding	OTTHUMT00000453332.2	36	0.00	0	C	NM_024898		6468312	6468312	-1	no_errors	ENST00000381480	ensembl	human	known	69_37n	frame_shift_del	50	10.71	6	DEL	0.015	-
DNAH11	8701	genome.wustl.edu	37	7	21639618	21639618	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr7:21639618C>G	ENST00000409508.3	+	15	2912	c.2881C>G	c.(2881-2883)Cta>Gta	p.L961V	DNAH11_ENST00000328843.6_Missense_Mutation_p.L961V	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	961	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						TAAACCTTCCCTAGACAGAGA	0.408									Kartagener syndrome																													dbGAP											0													68.0	65.0	66.0					7																	21639618		1845	4096	5941	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.2881C>G	7.37:g.21639618C>G	ENSP00000475939:p.Leu961Val		Q9UJ82	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.L961V	ENST00000409508.3	37	c.2881		7	.	.	.	.	.	.	.	.	.	.	C	15.31	2.794532	0.50102	.	.	ENSG00000105877	ENST00000328843	T	0.26067	1.76	5.72	1.78	0.24846	.	0.167707	0.38548	N	0.001660	T	0.21881	0.0527	.	.	.	0.39831	D	0.972977	P	0.48294	0.908	B	0.44224	0.444	T	0.03619	-1.1019	9	0.51188	T	0.08	.	4.7892	0.13239	0.2378:0.1426:0.0:0.6196	.	961	Q96DT5	DYH11_HUMAN	V	961	ENSP00000330671:L961V	ENSP00000330671:L961V	L	+	1	2	DNAH11	21606143	0.033000	0.19621	0.989000	0.46669	0.970000	0.65996	0.237000	0.17985	0.503000	0.28060	-0.302000	0.09304	CTA	DNAH11	-	NULL	ENSG00000105877		0.408	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DNAH11	HGNC	protein_coding	OTTHUMT00000326582.6	62	0.00	0	C	NM_003777		21639618	21639618	+1	no_errors	ENST00000328843	ensembl	human	known	69_37n	missense	50	19.35	12	SNP	0.575	G
DOPEY1	23033	genome.wustl.edu	37	6	83841993	83841993	+	Silent	SNP	T	T	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr6:83841993T>G	ENST00000349129.2	+	18	2975	c.2715T>G	c.(2713-2715)ccT>ccG	p.P905P	DOPEY1_ENST00000369739.3_Silent_p.P896P|DOPEY1_ENST00000237163.5_Silent_p.P886P	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	905					protein transport (GO:0015031)					breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		ACTTAGTTCCTTCTTCTAGCA	0.438																																						dbGAP											0													130.0	127.0	128.0					6																	83841993		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.2715T>G	6.37:g.83841993T>G			Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Silent	SNP	pfam_Dopey_N,superfamily_ARM-type_fold	p.P905	ENST00000349129.2	37	c.2715	CCDS4996.1	6																																																																																			DOPEY1	-	superfamily_ARM-type_fold	ENSG00000083097		0.438	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DOPEY1	HGNC	protein_coding	OTTHUMT00000043785.2	50	0.00	0	T	NM_015018		83841993	83841993	+1	no_errors	ENST00000349129	ensembl	human	known	69_37n	silent	49	32.88	24	SNP	1.000	G
DSCAM	1826	genome.wustl.edu	37	21	41459120	41459120	+	Silent	SNP	A	A	C			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr21:41459120A>C	ENST00000400454.1	-	22	4422	c.3945T>G	c.(3943-3945)ccT>ccG	p.P1315P		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	1315	Ig-like C2-type 10.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				ATTTGACTGCAGGAGAAGGGT	0.478																																					Melanoma(134;970 1778 1785 21664 32388)	dbGAP											0													141.0	138.0	139.0					21																	41459120		1973	4163	6136	-	-	-	SO:0001819	synonymous_variant	0			AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.3945T>G	21.37:g.41459120A>C			O60468	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub2,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.P1315	ENST00000400454.1	37	c.3945	CCDS42929.1	21																																																																																			DSCAM	-	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000171587		0.478	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAM	HGNC	protein_coding	OTTHUMT00000195029.1	50	0.00	0	A	NM_001389		41459120	41459120	-1	no_errors	ENST00000400454	ensembl	human	known	69_37n	silent	89	13.59	14	SNP	0.997	C
DUSP27	92235	genome.wustl.edu	37	1	167095074	167095074	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr1:167095074G>C	ENST00000361200.2	+	6	872	c.706G>C	c.(706-708)Gtg>Ctg	p.V236L	DUSP27_ENST00000443333.1_Missense_Mutation_p.V236L|DUSP27_ENST00000271385.5_Missense_Mutation_p.V236L			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	236	Tyrosine-protein phosphatase.				protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						AGCAGTGCTGGTGGTCGCCTA	0.517																																						dbGAP											0													92.0	77.0	82.0					1																	167095074		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.706G>C	1.37:g.167095074G>C	ENSP00000354483:p.Val236Leu		A0AUM4|Q9C074	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP,prints_Atypical_DUSP_famA	p.V236L	ENST00000361200.2	37	c.706	CCDS30932.1	1	.	.	.	.	.	.	.	.	.	.	G	32	5.152246	0.94645	.	.	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	T;T;T	0.65549	-0.16;-0.16;-0.16	5.55	5.55	0.83447	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.137679	0.48767	D	0.000169	T	0.79387	0.4437	M	0.82193	2.58	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.81959	-0.0694	10	0.87932	D	0	-35.4802	19.509	0.95133	0.0:0.0:1.0:0.0	.	236	Q5VZP5	DUS27_HUMAN	L	236	ENSP00000354483:V236L;ENSP00000271385:V236L;ENSP00000404874:V236L	ENSP00000271385:V236L	V	+	1	0	DUSP27	165361698	1.000000	0.71417	1.000000	0.80357	0.765000	0.43378	7.994000	0.88315	2.593000	0.87608	0.643000	0.83706	GTG	DUSP27	-	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	ENSG00000198842		0.517	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP27	HGNC	protein_coding	OTTHUMT00000083244.1	35	0.00	0	G	NM_001080426		167095074	167095074	+1	no_errors	ENST00000271385	ensembl	human	known	69_37n	missense	45	13.46	7	SNP	1.000	C
DYNC1H1	1778	genome.wustl.edu	37	14	102496209	102496209	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr14:102496209G>T	ENST00000360184.4	+	50	9860	c.9696G>T	c.(9694-9696)aaG>aaT	p.K3232N		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	3232	Stalk. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						TGGAGGTGAAGAATGCAGCAG	0.468																																						dbGAP											0													93.0	104.0	100.0					14																	102496209		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.9696G>T	14.37:g.102496209G>T	ENSP00000348965:p.Lys3232Asn		B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like,smart_AAA+_ATPase	p.K3232N	ENST00000360184.4	37	c.9696	CCDS9966.1	14	.	.	.	.	.	.	.	.	.	.	G	21.6	4.166224	0.78339	.	.	ENSG00000197102	ENST00000360184	T	0.80304	-1.36	5.54	2.64	0.31445	Dynein heavy chain, coiled coil stalk (1);	0.000000	0.85682	D	0.000000	D	0.88930	0.6571	M	0.87097	2.86	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.87992	0.2750	10	0.66056	D	0.02	.	8.7971	0.34885	0.3769:0.0:0.6231:0.0	.	3232	Q14204	DYHC1_HUMAN	N	3232	ENSP00000348965:K3232N	ENSP00000348965:K3232N	K	+	3	2	DYNC1H1	101565962	1.000000	0.71417	0.996000	0.52242	0.981000	0.71138	2.957000	0.49137	0.663000	0.31027	0.585000	0.79938	AAG	DYNC1H1	-	NULL	ENSG00000197102		0.468	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	HGNC	protein_coding	OTTHUMT00000414574.1	40	0.00	0	G	NM_001376		102496209	102496209	+1	no_errors	ENST00000360184	ensembl	human	known	69_37n	missense	38	11.36	5	SNP	1.000	T
DYNC2H1	79659	genome.wustl.edu	37	11	103106473	103106473	+	Missense_Mutation	SNP	C	C	A	rs567626676		TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr11:103106473C>A	ENST00000375735.2	+	62	9784	c.9640C>A	c.(9640-9642)Ctt>Att	p.L3214I	DYNC2H1_ENST00000334267.7_Intron|DYNC2H1_ENST00000398093.3_Missense_Mutation_p.L3214I	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	3214					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		TATTACATATCTTTCTGCTGC	0.398													C|||	1	0.000199681	0.0	0.0	5008	,	,		14999	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													83.0	79.0	80.0					11																	103106473		1845	4101	5946	-	-	-	SO:0001583	missense	0			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.9640C>A	11.37:g.103106473C>A	ENSP00000364887:p.Leu3214Ile		O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.L3214I	ENST00000375735.2	37	c.9640	CCDS53701.1	11	.	.	.	.	.	.	.	.	.	.	C	19.58	3.855003	0.71719	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.74209	-0.82;-0.82	5.59	5.59	0.84812	Dynein heavy chain, coiled coil stalk (1);	0.000000	0.85682	D	0.000000	T	0.79741	0.4498	M	0.71581	2.175	0.49915	D	0.999832	P;P	0.52061	0.828;0.95	P;P	0.50934	0.654;0.652	T	0.81081	-0.1094	10	0.52906	T	0.07	.	14.4869	0.67624	0.1469:0.8531:0.0:0.0	.	3214;3214	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	I	3214	ENSP00000364887:L3214I;ENSP00000381167:L3214I	ENSP00000364887:L3214I	L	+	1	0	DYNC2H1	102611683	1.000000	0.71417	0.999000	0.59377	0.932000	0.56968	4.230000	0.58632	2.643000	0.89663	0.579000	0.79373	CTT	DYNC2H1	-	NULL	ENSG00000187240		0.398	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC2H1	HGNC	protein_coding	OTTHUMT00000387196.1	75	0.00	0	C	XM_370652		103106473	103106473	+1	no_errors	ENST00000398093	ensembl	human	known	69_37n	missense	80	11.11	10	SNP	1.000	A
EI24	9538	genome.wustl.edu	37	11	125447449	125447449	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr11:125447449T>C	ENST00000278903.6	+	5	541	c.299T>C	c.(298-300)gTa>gCa	p.V100A	RNU6-1156P_ENST00000410365.1_RNA|STT3A-AS1_ENST00000532714.1_RNA|EI24_ENST00000530985.1_3'UTR|STT3A-AS1_ENST00000530526.1_RNA|EI24_ENST00000343678.4_Missense_Mutation_p.V100A	NM_004879.3	NP_004870.3	O14681	EI24_HUMAN	etoposide induced 2.4	100					apoptotic process (GO:0006915)|autophagy (GO:0006914)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of cell growth (GO:0030308)|neuromuscular process controlling balance (GO:0050885)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|response to drug (GO:0042493)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				large_intestine(1)|lung(9)|ovary(1)	11	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.64e-07)|OV - Ovarian serous cystadenocarcinoma(99;0.0975)		CTTCAGTCGGTAACAGCCCGA	0.418																																						dbGAP											0													312.0	262.0	278.0					11																	125447449		1909	4132	6041	-	-	-	SO:0001583	missense	0			AF010313	CCDS73410.1	11q24.2	2012-11-19	2012-11-16		ENSG00000149547	ENSG00000149547			13276	protein-coding gene	gene with protein product	"""ectopic P-granules autophagy protein 4 homolog (C. elegans)"""	605170	"""etoposide induced 2.4 mRNA"""			10594026, 9305847	Standard	NM_001290135		Approved	PIG8, TP53I8, EPG4	uc001qcb.3	O14681	OTTHUMG00000165851	ENST00000278903.6:c.299T>C	11.37:g.125447449T>C	ENSP00000278903:p.Val100Ala		A8K7D6|B4DKL6|Q9BUQ1	Missense_Mutation	SNP	NULL	p.V100A	ENST00000278903.6	37	c.299		11	.	.	.	.	.	.	.	.	.	.	T	16.31	3.087375	0.55968	.	.	ENSG00000149547	ENST00000278903;ENST00000343678;ENST00000524723;ENST00000527842;ENST00000527520;ENST00000527131	.	.	.	5.61	5.61	0.85477	.	0.056596	0.64402	D	0.000001	T	0.47655	0.1457	L	0.42245	1.32	0.46011	D	0.998815	B;B;B;B	0.06786	0.0;0.0;0.001;0.0	B;B;B;B	0.08055	0.001;0.002;0.003;0.001	T	0.40327	-0.9569	9	0.28530	T	0.3	.	10.6699	0.45751	0.0:0.0752:0.0:0.9248	.	86;100;100;100	B4DKL6;E9PM05;A6NES3;O14681	.;.;.;EI24_HUMAN	A	100;100;143;100;86;100	.	ENSP00000278903:V100A	V	+	2	0	EI24	124952659	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	4.458000	0.60095	2.147000	0.66899	0.533000	0.62120	GTA	EI24	-	NULL	ENSG00000149547		0.418	EI24-201	KNOWN	basic|appris_principal	protein_coding	EI24	HGNC	protein_coding		161	0.00	0	T	NM_004879		125447449	125447449	+1	no_errors	ENST00000278903	ensembl	human	known	69_37n	missense	217	17.18	45	SNP	1.000	C
EIF3E	3646	genome.wustl.edu	37	8	109228677	109228677	+	Silent	SNP	A	A	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr8:109228677A>G	ENST00000220849.5	-	9	977	c.915T>C	c.(913-915)ttT>ttC	p.F305F	EIF3E_ENST00000519517.1_5'UTR|EIF3E_ENST00000519030.1_Silent_p.F212F	NM_001568.2	NP_001559.1			eukaryotic translation initiation factor 3, subunit E										EIF3E/RSPO2(6)	NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(57;6.84e-10)			GAGCCCCATCAAAGTCAAAGT	0.299																																					GBM(15;360 410 8460 34179 52246)	dbGAP											0													72.0	75.0	74.0					8																	109228677		2202	4298	6500	-	-	-	SO:0001819	synonymous_variant	0			U94175	CCDS6308.1	8q22-q23	2010-03-10	2007-07-27	2007-07-27	ENSG00000104408	ENSG00000104408			3277	protein-coding gene	gene with protein product		602210	"""eukaryotic translation initiation factor 3, subunit 6 48kDa"""	INT6, EIF3S6		9403073, 9295280	Standard	NM_001568		Approved	eIF3-p48, eIF3e	uc003ymu.3	P60228	OTTHUMG00000164858	ENST00000220849.5:c.915T>C	8.37:g.109228677A>G				Silent	SNP	pfam_eIF3_su6_N,pfam_PCI_dom,smart_PCI_dom,pirsf_Transl_init_fac_3_su6_euk	p.F305	ENST00000220849.5	37	c.915	CCDS6308.1	8																																																																																			EIF3E	-	pfam_PCI_dom,pirsf_Transl_init_fac_3_su6_euk	ENSG00000104408		0.299	EIF3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF3E	HGNC	protein_coding	OTTHUMT00000380612.2	81	0.00	0	A	NM_001568		109228677	109228677	-1	no_errors	ENST00000220849	ensembl	human	known	69_37n	silent	141	11.88	19	SNP	1.000	G
PLIN5	440503	genome.wustl.edu	37	19	4534066	4534066	+	Silent	SNP	A	A	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr19:4534066A>G	ENST00000381848.3	-	2	101	c.21T>C	c.(19-21)gcT>gcC	p.A7A	CTB-50L17.14_ENST00000586020.1_Missense_Mutation_p.L25P|PLIN5_ENST00000592610.1_Silent_p.A7A|PLIN5_ENST00000586133.1_Silent_p.A7A	NM_001013706.2	NP_001013728.2	Q00G26	PLIN5_HUMAN	perilipin 5	7	Essential for lipid droplet targeting. {ECO:0000250}.|Interaction with LIPE. {ECO:0000250}.				lipid particle organization (GO:0034389)|lipid storage (GO:0019915)|mitochondrion localization (GO:0051646)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of lipase activity (GO:0060192)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of triglyceride catabolic process (GO:0010897)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of lipase activity (GO:0060193)|positive regulation of lipid storage (GO:0010884)|positive regulation of sequestering of triglyceride (GO:0010890)|positive regulation of triglyceride biosynthetic process (GO:0010867)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lipid particle (GO:0005811)|mitochondrion (GO:0005739)				endometrium(4)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	10						TGGGGATCTGAGCCGCCTCTT	0.587																																						dbGAP											0													38.0	41.0	40.0					19																	4534066		2016	4165	6181	-	-	-	SO:0001819	synonymous_variant	0			DQ839131	CCDS42473.1	19p13.3	2009-08-12			ENSG00000214456	ENSG00000214456		"""Perilipins"""	33196	protein-coding gene	gene with protein product	"""lipid storage droplet protein 5"""	613248				17234449, 19638644	Standard	NM_001013706		Approved	LSDP5, LSDA5, OXPAT, MLDP	uc002mas.3	Q00G26		ENST00000381848.3:c.21T>C	19.37:g.4534066A>G			A2RRC1|Q6ZS68	Missense_Mutation	SNP	NULL	p.L25P	ENST00000381848.3	37	c.74	CCDS42473.1	19																																																																																			CTB-50L17.14	-	NULL	ENSG00000267385		0.587	PLIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000267385	Clone_based_vega_gene	protein_coding	OTTHUMT00000458647.1	29	0.00	0	A	NM_001013706		4534066	4534066	-1	no_errors	ENST00000586020	ensembl	human	known	69_37n	missense	44	15.38	8	SNP	0.012	G
EP400NL	347918	genome.wustl.edu	37	12	132589046	132589046	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr12:132589046G>C	ENST00000376625.4	+	1	507	c.481G>C	c.(481-483)Gat>Cat	p.D161H	EP400NL_ENST00000389560.2_Missense_Mutation_p.D92H|EP400NL_ENST00000361109.5_Intron|EP400NL_ENST00000443539.2_Intron|EP400NL_ENST00000392352.1_Intron			Q6ZTU2	E400N_HUMAN	EP400 N-terminal like	161										endometrium(1)|lung(1)|prostate(2)|urinary_tract(1)	5						GGACTTCGTGGATGCCAGCGT	0.667																																						dbGAP											0													52.0	76.0	69.0					12																	132589046		640	1586	2226	-	-	-	SO:0001583	missense	0			AK091234		12q24.33	2013-02-15			ENSG00000185684	ENSG00000185684			26602	protein-coding gene	gene with protein product						12477932	Standard	NR_003290		Approved	FLJ33915	uc009zyq.3	Q6ZTU2	OTTHUMG00000168251	ENST00000376625.4:c.481G>C	12.37:g.132589046G>C	ENSP00000365812:p.Asp161His		A6NLB7|A8K0Z5|B3KQY2|Q6NXP1|Q8N253|Q8N7S7|Q9UFJ3	Missense_Mutation	SNP	NULL	p.D161H	ENST00000376625.4	37	c.481		12	.	.	.	.	.	.	.	.	.	.	G	12.30	1.896340	0.33442	.	.	ENSG00000185684	ENST00000454179;ENST00000389560;ENST00000539205;ENST00000376625	.	.	.	2.99	2.99	0.34606	.	.	.	.	.	T	0.78792	0.4339	.	.	.	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.82920	-0.0218	7	0.87932	D	0	.	14.2371	0.65934	0.0:0.0:1.0:0.0	.	161;161	Q6ZTU2-6;Q6ZTU2	.;E400N_HUMAN	H	92;92;92;161	.	ENSP00000328997:D93H	D	+	1	0	EP400NL	131154999	1.000000	0.71417	0.979000	0.43373	0.021000	0.10359	8.749000	0.91619	1.360000	0.45960	0.313000	0.20887	GAT	EP400NL	-	NULL	ENSG00000185684		0.667	EP400NL-202	KNOWN	basic|appris_candidate_longest	protein_coding	EP400NL	HGNC	protein_coding		40	0.00	0	G	NM_182613		132589046	132589046	+1	no_errors	ENST00000376625	ensembl	human	known	69_37n	missense	43	24.56	14	SNP	1.000	C
EPX	8288	genome.wustl.edu	37	17	56276953	56276953	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr17:56276953G>C	ENST00000225371.5	+	9	1445	c.1335G>C	c.(1333-1335)agG>agC	p.R445S		NM_000502.4	NP_000493.1	P11678	PERE_HUMAN	eosinophil peroxidase	445					defense response to nematode (GO:0002215)|eosinophil migration (GO:0072677)|hydrogen peroxide catabolic process (GO:0042744)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-5 production (GO:0032714)|positive regulation of interleukin-4 production (GO:0032753)	extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(2)|endometrium(9)|kidney(1)|large_intestine(9)|liver(2)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	48					Melatonin(DB01065)	CCCGGGCCAGGAGAACCCTGG	0.602																																						dbGAP											0													89.0	81.0	84.0					17																	56276953		2203	4300	6503	-	-	-	SO:0001583	missense	0			M26515	CCDS11602.1	17q23.1	2006-09-25				ENSG00000121053	1.11.1.7		3423	protein-coding gene	gene with protein product		131399				2550461, 2541222	Standard	NM_000502		Approved	EPO, EPP, EPX-PEN	uc002ivq.3	P11678		ENST00000225371.5:c.1335G>C	17.37:g.56276953G>C	ENSP00000225371:p.Arg445Ser		Q4TVP3	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.R445S	ENST00000225371.5	37	c.1335	CCDS11602.1	17	.	.	.	.	.	.	.	.	.	.	G	11.99	1.802683	0.31869	.	.	ENSG00000121053	ENST00000225371	T	0.68903	-0.36	5.81	-1.01	0.10169	.	1.097390	0.06569	N	0.748254	T	0.57755	0.2075	L	0.53671	1.685	0.09310	N	1	B	0.25609	0.13	B	0.30495	0.116	T	0.48514	-0.9029	10	0.38643	T	0.18	-1.9094	2.4627	0.04545	0.2946:0.1269:0.4502:0.1284	.	445	P11678	PERE_HUMAN	S	445	ENSP00000225371:R445S	ENSP00000225371:R445S	R	+	3	2	EPX	53631952	0.000000	0.05858	0.184000	0.23157	0.978000	0.69477	-0.583000	0.05807	-0.013000	0.14199	0.655000	0.94253	AGG	EPX	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal	ENSG00000121053		0.602	EPX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPX	HGNC	protein_coding	OTTHUMT00000443367.1	41	0.00	0	G	NM_000502		56276953	56276953	+1	no_errors	ENST00000225371	ensembl	human	known	69_37n	missense	76	18.28	17	SNP	0.001	C
ETV1	2115	genome.wustl.edu	37	7	13949273	13949273	+	Silent	SNP	G	G	T			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr7:13949273G>T	ENST00000430479.1	-	11	1591	c.924C>A	c.(922-924)gtC>gtA	p.V308V	ETV1_ENST00000403527.1_Silent_p.V268V|ETV1_ENST00000242066.5_Silent_p.V290V|ETV1_ENST00000399357.3_Silent_p.V205V|ETV1_ENST00000476720.2_5'Flank|ETV1_ENST00000420159.2_Silent_p.V250V|ETV1_ENST00000403685.1_Silent_p.V290V|ETV1_ENST00000405358.4_Silent_p.V322V|ETV1_ENST00000405192.2_Silent_p.V285V|ETV1_ENST00000405218.2_Silent_p.V308V|ETV1_ENST00000343495.5_Silent_p.V290V	NM_004956.4	NP_004947.2	P50549	ETV1_HUMAN	ets variant 1	308					axon guidance (GO:0007411)|cell differentiation (GO:0030154)|mechanosensory behavior (GO:0007638)|muscle organ development (GO:0007517)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V308V(1)|p.V268V(1)	TMPRSS2/ETV1(34)|ACSL3_ENST00000357430/ETV1(2)|EWSR1/ETV1(7)|KLK2/ETV1(3)|SLC45A3/ETV1(3)|HNRNPA2B1/ETV1(8)	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31						ATTTTTCTGGGACAACACAGG	0.388			T	"""EWSR1, TMPRSS2, SLC45A3, C15orf21, HNRNPA2B1. ACSL3"""	"""Ewing sarcoma, prostate"""																																	dbGAP		Dom	yes		7	7p22	2115	ets variant gene 1		"""M, E"""	2	Substitution - coding silent(2)	lung(2)											111.0	109.0	110.0					7																	13949273		1820	4073	5893	-	-	-	SO:0001819	synonymous_variant	0				CCDS55083.1, CCDS55084.1, CCDS55085.1, CCDS55086.1, CCDS55087.1, CCDS55088.1	7p22	2008-09-12	2008-09-12		ENSG00000006468	ENSG00000006468			3490	protein-coding gene	gene with protein product		600541	"""ets variant gene 1"""			1340465	Standard	NM_004956		Approved	ER81	uc003ssw.4	P50549	OTTHUMG00000152403	ENST00000430479.1:c.924C>A	7.37:g.13949273G>T			A4D118|B2R768|B7Z2I4|B7Z618|B7Z9P2|C9JT37|E9PHB1|F5GXR2|O75849|Q4KMQ6|Q59GA7|Q6AI30|Q9UQ71|Q9Y636	Silent	SNP	pfam_ETS_PEA3_N,pfam_Ets,smart_Ets,pfscan_Ets,prints_Ets	p.V308	ENST00000430479.1	37	c.924	CCDS55088.1	7																																																																																			ETV1	-	pfam_ETS_PEA3_N	ENSG00000006468		0.388	ETV1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	ETV1	HGNC	protein_coding	OTTHUMT00000326111.1	62	0.00	0	G	NM_004956		13949273	13949273	-1	no_errors	ENST00000405218	ensembl	human	known	69_37n	silent	52	18.75	12	SNP	0.983	T
FAM49B	51571	genome.wustl.edu	37	8	130867881	130867881	+	Silent	SNP	G	G	A			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr8:130867881G>A	ENST00000519824.2	-	6	687	c.414C>T	c.(412-414)ttC>ttT	p.F138F	FAM49B_ENST00000518879.1_5'UTR|FAM49B_ENST00000522941.1_5'UTR|FAM49B_ENST00000519110.1_Silent_p.F138F|FAM49B_ENST00000517654.1_Silent_p.F138F|FAM49B_ENST00000519540.1_Silent_p.F138F|FAM49B_ENST00000522250.1_5'UTR|FAM49B_ENST00000522746.1_Silent_p.F138F|FAM49B_ENST00000523509.1_Silent_p.F138F|FAM49B_ENST00000401979.2_Silent_p.F138F	NM_016623.4	NP_057707.3	Q9NUQ9	FA49B_HUMAN	family with sequence similarity 49, member B	138						cilium (GO:0005929)|extracellular vesicular exosome (GO:0070062)				kidney(1)|large_intestine(6)|lung(4)|prostate(1)	12	Ovarian(5;0.000567)|Esophageal squamous(12;0.00693)|Acute lymphoblastic leukemia(118;0.155)		LUAD - Lung adenocarcinoma(14;0.0989)			ACCGGAGTGTGAAATGAAGAA	0.438																																						dbGAP											0													83.0	86.0	85.0					8																	130867881		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF208851	CCDS6361.1	8q24	2004-08-20				ENSG00000153310			25216	protein-coding gene	gene with protein product							Standard	NM_001256763		Approved	BM-009	uc003ysu.4	Q9NUQ9		ENST00000519824.2:c.414C>T	8.37:g.130867881G>A			Q96AZ5|Q9NW21|Q9NZE7	Silent	SNP	pfam_DUF1394	p.F138	ENST00000519824.2	37	c.414	CCDS6361.1	8																																																																																			FAM49B	-	pfam_DUF1394	ENSG00000153310		0.438	FAM49B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM49B	HGNC	protein_coding	OTTHUMT00000380390.2	44	0.00	0	G	NM_016623		130867881	130867881	-1	no_errors	ENST00000401979	ensembl	human	known	69_37n	silent	74	25.25	25	SNP	1.000	A
FANCD2	2177	genome.wustl.edu	37	3	10128882	10128882	+	Missense_Mutation	SNP	C	C	G	rs587778332		TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr3:10128882C>G	ENST00000419585.1	+	34	3561	c.3400C>G	c.(3400-3402)Ctc>Gtc	p.L1134V	FANCD2_ENST00000383806.1_Missense_Mutation_p.L1134V|FANCD2OS_ENST00000436517.1_5'UTR|FANCD2_ENST00000383807.1_Missense_Mutation_p.L1134V|FANCD2OS_ENST00000524279.1_Intron|FANCD2_ENST00000287647.3_Missense_Mutation_p.L1134V			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	1134					DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		TGCTCTTTATCTCATCAGACT	0.363			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													dbGAP	yes	Rec		Fanconi anaemia D2	3	3p26	2177	"""Fanconi anemia, complementation group D2"""		L	0													182.0	179.0	180.0					3																	10128882		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.3400C>G	3.37:g.10128882C>G	ENSP00000398754:p.Leu1134Val		Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.L1134V	ENST00000419585.1	37	c.3400	CCDS33696.1	3	.	.	.	.	.	.	.	.	.	.	C	22.9	4.351528	0.82132	.	.	ENSG00000144554	ENST00000287647;ENST00000383807;ENST00000383806;ENST00000419585	T;T;T;T	0.60672	0.17;0.17;0.17;0.17	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.77651	0.4162	M	0.82923	2.615	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.80122	-0.1514	10	0.62326	D	0.03	.	15.0629	0.71970	0.0:1.0:0.0:0.0	.	1134;1134	Q9BXW9-2;Q9BXW9	.;FACD2_HUMAN	V	1134	ENSP00000287647:L1134V;ENSP00000373318:L1134V;ENSP00000373317:L1134V;ENSP00000398754:L1134V	ENSP00000287647:L1134V	L	+	1	0	FANCD2	10103882	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.875000	0.69660	2.619000	0.88677	0.650000	0.86243	CTC	FANCD2	-	NULL	ENSG00000144554		0.363	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCD2	HGNC	protein_coding	OTTHUMT00000339873.1	92	0.00	0	C			10128882	10128882	+1	no_errors	ENST00000287647	ensembl	human	known	69_37n	missense	128	21.47	35	SNP	1.000	G
FGD2	221472	genome.wustl.edu	37	6	36995284	36995285	+	Frame_Shift_Ins	INS	-	-	C	rs61753293		TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr6:36995284_36995285insC	ENST00000274963.8	+	15	1856_1857	c.1685_1686insC	c.(1684-1689)ggccccfs	p.GP562fs		NM_173558.3	NP_775829.2	Q7Z6J4	FGD2_HUMAN	FYVE, RhoGEF and PH domain containing 2	562	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	25						GGCAAGAGCGGCCCCCGGGGCT	0.644																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK097230	CCDS4829.1	6p21.2	2013-01-10	2004-08-24		ENSG00000146192	ENSG00000146192		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3664	protein-coding gene	gene with protein product		605091	"""FGD1 family, member 2"""			10458911	Standard	NM_173558		Approved	ZFYVE4	uc010jwp.1	Q7Z6J4	OTTHUMG00000014616	ENST00000274963.8:c.1690dupC	6.37:g.36995289_36995289dupC	ENSP00000274963:p.Gly562fs		Q5T8I1|Q6P6A8|Q6ZNL5|Q8IZ32|Q8N868|Q9H7M2	Frame_Shift_Ins	INS	pfam_DH-domain,pfam_Znf_FYVE,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_Znf_FYVE_PHD,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.R564fs	ENST00000274963.8	37	c.1685_1686	CCDS4829.1	6																																																																																			FGD2	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000146192		0.644	FGD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD2	HGNC	protein_coding	OTTHUMT00000040398.2	32	0.00	0	-	NM_173558		36995284	36995285	+1	no_errors	ENST00000274963	ensembl	human	known	69_37n	frame_shift_ins	29	29.27	12	INS	0.734:0.736	C
FOXRED1	55572	genome.wustl.edu	37	11	126147394	126147394	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr11:126147394C>G	ENST00000263578.5	+	11	1345	c.1271C>G	c.(1270-1272)cCc>cGc	p.P424R	FOXRED1_ENST00000534011.1_3'UTR|FOXRED1_ENST00000532125.1_Missense_Mutation_p.P410R|FOXRED1_ENST00000442061.2_Missense_Mutation_p.P254R	NM_017547.3	NP_060017.1	Q96CU9	FXRD1_HUMAN	FAD-dependent oxidoreductase domain containing 1	424						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	oxidoreductase activity (GO:0016491)			breast(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(1)	15	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0739)|all_lung(97;0.0798)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0729)		GTGGTGGGCCCCCACCCGCTA	0.592																																						dbGAP											0													77.0	78.0	77.0					11																	126147394		2201	4298	6499	-	-	-	SO:0001583	missense	0				CCDS8471.1	11q24.2	2006-02-03			ENSG00000110074	ENSG00000110074			26927	protein-coding gene	gene with protein product		613622				10497265	Standard	NM_017547		Approved	H17	uc001qdi.3	Q96CU9	OTTHUMG00000165827	ENST00000263578.5:c.1271C>G	11.37:g.126147394C>G	ENSP00000263578:p.Pro424Arg		B3KN84|B4DHU2|Q71MG0|Q9BU39|Q9UKY9	Missense_Mutation	SNP	pfam_FAD-dep_OxRdtase	p.P424R	ENST00000263578.5	37	c.1271	CCDS8471.1	11	.	.	.	.	.	.	.	.	.	.	C	10.44	1.350936	0.24512	.	.	ENSG00000110074	ENST00000263578;ENST00000442061;ENST00000532125	T;T;T	0.80214	-1.35;-1.35;-1.35	5.37	4.4	0.53042	FAD dependent oxidoreductase (1);	0.411963	0.27826	N	0.017684	T	0.78065	0.4225	L	0.28014	0.82	0.36746	D	0.882516	B;D;B	0.67145	0.169;0.996;0.203	B;D;B	0.67231	0.118;0.95;0.135	T	0.76080	-0.3090	10	0.22706	T	0.39	-16.8256	5.8903	0.18909	0.1601:0.6877:0.0:0.1522	.	410;291;424	Q96CU9-3;B4DI59;Q96CU9	.;.;FXRD1_HUMAN	R	424;254;410	ENSP00000263578:P424R;ENSP00000404371:P254R;ENSP00000434178:P410R	ENSP00000263578:P424R	P	+	2	0	FOXRED1	125652604	0.001000	0.12720	1.000000	0.80357	0.933000	0.57130	1.400000	0.34577	2.511000	0.84671	0.467000	0.42956	CCC	FOXRED1	-	pfam_FAD-dep_OxRdtase	ENSG00000110074		0.592	FOXRED1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXRED1	HGNC	protein_coding	OTTHUMT00000386434.1	37	0.00	0	C	NM_017547		126147394	126147394	+1	no_errors	ENST00000263578	ensembl	human	known	69_37n	missense	32	33.33	16	SNP	0.977	G
FREM1	158326	genome.wustl.edu	37	9	14859447	14859447	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr9:14859447A>G	ENST00000380880.3	-	4	1148	c.365T>C	c.(364-366)aTc>aCc	p.I122T	FREM1_ENST00000380881.4_Missense_Mutation_p.I122T|FREM1_ENST00000422223.2_Missense_Mutation_p.I122T			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	122					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		GACCCACAGGATAAAAGTTTC	0.413																																						dbGAP											0													114.0	112.0	113.0					9																	14859447		1860	4092	5952	-	-	-	SO:0001583	missense	0			AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.365T>C	9.37:g.14859447A>G	ENSP00000370262:p.Ile122Thr		B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_Calx_beta,superfamily_C-type_lectin_fold,superfamily_Cadherin-like,smart_C-type_lectin,pfscan_C-type_lectin	p.I122T	ENST00000380880.3	37	c.365	CCDS47952.1	9	.	.	.	.	.	.	.	.	.	.	A	11.05	1.524394	0.27299	.	.	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380880	T;T;T	0.10099	2.91;2.91;2.91	5.95	2.28	0.28536	.	0.791613	0.12804	N	0.437767	T	0.07818	0.0196	L	0.41824	1.3	0.20638	N	0.99988	B	0.11235	0.004	B	0.08055	0.003	T	0.44345	-0.9334	10	0.16896	T	0.51	-0.1674	4.6059	0.12378	0.6062:0.0:0.2597:0.1341	.	122	Q5H8C1	FREM1_HUMAN	T	122	ENSP00000370263:I122T;ENSP00000412940:I122T;ENSP00000370262:I122T	ENSP00000370257:I122T	I	-	2	0	FREM1	14849447	0.150000	0.22732	0.733000	0.30861	0.957000	0.61999	0.402000	0.20965	0.141000	0.18875	-0.256000	0.11100	ATC	FREM1	-	NULL	ENSG00000164946		0.413	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FREM1	HGNC	protein_coding	OTTHUMT00000339474.2	32	0.00	0	A	NM_144966		14859447	14859447	-1	no_errors	ENST00000380881	ensembl	human	known	69_37n	missense	36	18.18	8	SNP	0.682	G
GBP4	115361	genome.wustl.edu	37	1	89656943	89656943	+	Splice_Site	SNP	C	C	T			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr1:89656943C>T	ENST00000355754.6	-	6	1014		c.e6+1			NM_052941.4	NP_443173.2	Q96PP9	GBP4_HUMAN	guanylate binding protein 4							cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.?(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(19)|skin(1)|stomach(2)|urinary_tract(1)	33				all cancers(265;0.00723)|Epithelial(280;0.0291)		AAAAGACTCACGCTTTCCAGT	0.403																																						dbGAP											1	Unknown(1)	lung(1)											118.0	125.0	123.0					1																	89656943		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF288814	CCDS721.1	1p22.2	2008-02-05			ENSG00000162654	ENSG00000162654			20480	protein-coding gene	gene with protein product		612466				16689661	Standard	NM_052941		Approved	Mpa2	uc001dnb.3	Q96PP9	OTTHUMG00000010663	ENST00000355754.6:c.916+1G>A	1.37:g.89656943C>T			B2R630|Q05D63|Q6NSL0|Q86T99	Splice_Site	SNP	-	e6+1	ENST00000355754.6	37	c.916+1	CCDS721.1	1	.	.	.	.	.	.	.	.	.	.	C	5.630	0.300967	0.10678	.	.	ENSG00000162654	ENST00000355754	.	.	.	5.28	2.43	0.29744	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.4865	0.38933	0.0:0.7665:0.0:0.2335	.	.	.	.	.	-1	.	.	.	-	.	.	GBP4	89429531	0.951000	0.32395	0.464000	0.27143	0.025000	0.11179	2.041000	0.41213	0.482000	0.27582	-0.123000	0.14984	.	GBP4	-	-	ENSG00000162654		0.403	GBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP4	HGNC	protein_coding	OTTHUMT00000029409.1	58	0.00	0	C	NM_052941	Intron	89656943	89656943	-1	no_errors	ENST00000355754	ensembl	human	known	69_37n	splice_site	74	16.85	15	SNP	0.840	T
GGA1	26088	genome.wustl.edu	37	22	38016265	38016265	+	Silent	SNP	G	G	A	rs556098927		TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr22:38016265G>A	ENST00000343632.4	+	5	710	c.324G>A	c.(322-324)tcG>tcA	p.S108S	GGA1_ENST00000381756.5_Silent_p.S125S|GGA1_ENST00000325180.8_Silent_p.S108S|GGA1_ENST00000406772.1_Silent_p.S35S|GGA1_ENST00000337437.4_Silent_p.S75S	NM_001172687.1|NM_013365.4	NP_001166158.1|NP_037497.1	Q9UJY5	GGA1_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 1	108	VHS. {ECO:0000255|PROSITE- ProRule:PRU00218}.				intracellular protein transport (GO:0006886)|positive regulation of protein catabolic process (GO:0045732)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|urinary_tract(1)	10	Melanoma(58;0.0574)					CTCGGACATCGGAGAAGGTGA	0.562																																						dbGAP											0													125.0	118.0	120.0					22																	38016265		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF190862	CCDS13951.1, CCDS33643.1, CCDS54526.1	22q13.31	2010-02-12	2010-02-12		ENSG00000100083	ENSG00000100083			17842	protein-coding gene	gene with protein product		606004				10747088, 10747089, 16407204	Standard	NM_013365		Approved		uc003atc.3	Q9UJY5	OTTHUMG00000030985	ENST00000343632.4:c.324G>A	22.37:g.38016265G>A			A8K3D3|B0QYR7|Q5TG07|Q86YA9|Q8NCS6|Q9BW94|Q9UG00|Q9UGW0|Q9UGW1	Silent	SNP	pfam_VHS,pfam_GAT,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_Coatomer/clathrin_app_Ig-like,superfamily_ENTH_VHS,smart_VHS_subgr,smart_Clathrin_a/b/g-adaptin_app_Ig,pfscan_Clathrin_g-adaptin_app,pfscan_GAT,pfscan_VHS	p.S108	ENST00000343632.4	37	c.324	CCDS13951.1	22																																																																																			GGA1	-	pfam_VHS,superfamily_ENTH_VHS,smart_VHS_subgr,pfscan_VHS	ENSG00000100083		0.562	GGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GGA1	HGNC	protein_coding	OTTHUMT00000075873.3	27	0.00	0	G	NM_013365		38016265	38016265	+1	no_errors	ENST00000343632	ensembl	human	known	69_37n	silent	27	54.24	32	SNP	0.224	A
GPATCH3	63906	genome.wustl.edu	37	1	27226625	27226625	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr1:27226625G>C	ENST00000361720.5	-	1	332	c.309C>G	c.(307-309)tgC>tgG	p.C103W		NM_022078.2	NP_071361.2	Q96I76	GPTC3_HUMAN	G patch domain containing 3	103							nucleic acid binding (GO:0003676)			endometrium(2)|large_intestine(1)|lung(11)|skin(1)	15		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.97e-51)|OV - Ovarian serous cystadenocarcinoma(117;9.55e-30)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|STAD - Stomach adenocarcinoma(196;0.000595)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|READ - Rectum adenocarcinoma(331;0.0419)		AGATGACGCAGCAGCAGGTGC	0.622																																						dbGAP											0													70.0	73.0	72.0					1																	27226625		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC007767	CCDS290.1	1p35.3-p35.1	2013-01-28		2006-12-13	ENSG00000198746	ENSG00000198746		"""G patch domain containing"""	25720	protein-coding gene	gene with protein product				GPATC3			Standard	NM_022078		Approved	FLJ12455	uc001bne.3	Q96I76	OTTHUMG00000004229	ENST00000361720.5:c.309C>G	1.37:g.27226625G>C	ENSP00000354645:p.Cys103Trp		Q5JYH2|Q8NDJ2|Q9H9Z3	Missense_Mutation	SNP	pfam_G_patch_dom,smart_G_patch_dom,pfscan_G_patch_dom	p.C103W	ENST00000361720.5	37	c.309	CCDS290.1	1	.	.	.	.	.	.	.	.	.	.	G	16.35	3.099174	0.56183	.	.	ENSG00000198746	ENST00000361720;ENST00000536641	T	0.45668	0.89	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.65512	0.2698	M	0.74467	2.265	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.67565	-0.5638	10	0.87932	D	0	-26.6937	16.26	0.82535	0.0:0.0:1.0:0.0	.	103	Q96I76	GPTC3_HUMAN	W	103	ENSP00000354645:C103W	ENSP00000354645:C103W	C	-	3	2	GPATCH3	27099212	1.000000	0.71417	1.000000	0.80357	0.342000	0.28953	1.392000	0.34486	2.854000	0.98071	0.655000	0.94253	TGC	GPATCH3	-	NULL	ENSG00000198746		0.622	GPATCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPATCH3	HGNC	protein_coding	OTTHUMT00000012181.1	24	0.00	0	G	NM_022078		27226625	27226625	-1	no_errors	ENST00000361720	ensembl	human	known	69_37n	missense	16	20.00	4	SNP	1.000	C
GPR111	222611	genome.wustl.edu	37	6	47646792	47646792	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr6:47646792G>A	ENST00000296862.1	+	4	393	c.393G>A	c.(391-393)atG>atA	p.M131I	GPR111_ENST00000507065.1_Missense_Mutation_p.M63I|GPR111_ENST00000398742.2_Missense_Mutation_p.M63I			Q8IZF7	GP111_HUMAN	G protein-coupled receptor 111	131					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(2)|lung(15)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29						AGGGAAATATGGGGTTTTCAT	0.448																																						dbGAP											0													124.0	122.0	123.0					6																	47646792		1981	4182	6163	-	-	-	SO:0001583	missense	0			AB065684		6p12.3	2014-08-08			ENSG00000164393	ENSG00000164393		"""-"", ""GPCR / Class B : Orphans"""	18991	protein-coding gene	gene with protein product						12435584	Standard	NM_153839		Approved	hGPCR35, PGR20	uc003oyy.3	Q8IZF7	OTTHUMG00000046168	ENST00000296862.1:c.393G>A	6.37:g.47646792G>A	ENSP00000296862:p.Met131Ile		Q2PNZ1|Q86SL6|Q8NGU5|Q8TDT5	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_GPCR_2-like	p.M131I	ENST00000296862.1	37	c.393		6	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.262202	0.00262	.	.	ENSG00000164393	ENST00000507065;ENST00000296862;ENST00000398742	T;T;T	0.28069	2.41;2.3;1.63	4.69	1.93	0.25924	.	0.125811	0.36665	N	0.002474	T	0.03434	0.0099	N	0.19112	0.55	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.04013	0.001;0.001	T	0.41342	-0.9514	10	0.02654	T	1	.	3.045	0.06151	0.2533:0.0:0.541:0.2056	.	63;131	Q8IZF7-2;Q8IZF7	.;GP111_HUMAN	I	63;131;63	ENSP00000422934:M63I;ENSP00000296862:M131I;ENSP00000381727:M63I	ENSP00000296862:M131I	M	+	3	0	GPR111	47754751	0.342000	0.24809	0.331000	0.25455	0.031000	0.12232	0.782000	0.26788	0.709000	0.31976	-0.182000	0.12963	ATG	GPR111	-	NULL	ENSG00000164393		0.448	GPR111-001	KNOWN	basic	protein_coding	GPR111	HGNC	protein_coding	OTTHUMT00000106423.2	70	0.00	0	G	NM_153839		47646792	47646792	+1	no_errors	ENST00000296862	ensembl	human	known	69_37n	missense	85	19.81	21	SNP	0.321	A
GRAMD3	65983	genome.wustl.edu	37	5	125759303	125759303	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr5:125759303C>G	ENST00000285689.3	+	1	466	c.5C>G	c.(4-6)aCt>aGt	p.T2S	GRAMD3_ENST00000514932.1_3'UTR|GRAMD3_ENST00000543198.1_Missense_Mutation_p.T2S|GRAMD3_ENST00000542322.1_5'UTR|GRAMD3_ENST00000515200.1_Missense_Mutation_p.T2S|GRAMD3_ENST00000513040.1_Intron|GRAMD3_ENST00000544396.1_5'UTR	NM_023927.2	NP_076416.2	Q96HH9	GRAM3_HUMAN	GRAM domain containing 3	2						cytoplasmic microtubule (GO:0005881)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		Prostate(80;0.0928)	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0401)|OV - Ovarian serous cystadenocarcinoma(64;0.0604)|all cancers(49;0.108)		GCCCCGATGACTGAACTACAG	0.617																																						dbGAP											0													62.0	59.0	60.0					5																	125759303		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC008590	CCDS4136.1, CCDS54891.1, CCDS54892.1, CCDS54893.1, CCDS54894.1	5q23.2	2014-02-12	2005-11-03		ENSG00000155324	ENSG00000155324			24911	protein-coding gene	gene with protein product	"""HCV NS3 transactivated protein 2"""					12477932	Standard	NM_023927		Approved	NS3TP2, FLJ21313	uc011cwt.2	Q96HH9	OTTHUMG00000128943	ENST00000285689.3:c.5C>G	5.37:g.125759303C>G	ENSP00000285689:p.Thr2Ser		B7Z1F2|B7Z3R1|B7Z6D8|B7Z8T2|D3DSZ3|Q9H753	Missense_Mutation	SNP	pfam_GRAM,smart_GRAM	p.T2S	ENST00000285689.3	37	c.5	CCDS4136.1	5	.	.	.	.	.	.	.	.	.	.	C	13.10	2.136537	0.37728	.	.	ENSG00000155324	ENST00000285689;ENST00000515200;ENST00000543198	T;T;T	0.41758	1.37;1.03;0.99	5.62	5.62	0.85841	.	0.957880	0.08616	N	0.919245	T	0.41880	0.1178	L	0.51422	1.61	0.80722	D	1	P	0.39424	0.673	B	0.35813	0.211	T	0.26155	-1.0111	10	0.27082	T	0.32	.	16.5958	0.84796	0.0:1.0:0.0:0.0	.	2	Q96HH9	GRAM3_HUMAN	S	2	ENSP00000285689:T2S;ENSP00000426143:T2S;ENSP00000442902:T2S	ENSP00000285689:T2S	T	+	2	0	GRAMD3	125787202	0.995000	0.38212	0.953000	0.39169	0.005000	0.04900	3.996000	0.57009	2.659000	0.90383	0.655000	0.94253	ACT	GRAMD3	-	NULL	ENSG00000155324		0.617	GRAMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRAMD3	HGNC	protein_coding	OTTHUMT00000250922.2	38	0.00	0	C	NM_023927		125759303	125759303	+1	no_errors	ENST00000285689	ensembl	human	known	69_37n	missense	27	15.62	5	SNP	0.990	G
HDX	139324	genome.wustl.edu	37	X	83724316	83724316	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chrX:83724316G>C	ENST00000297977.5	-	3	526	c.415C>G	c.(415-417)Cag>Gag	p.Q139E	HDX_ENST00000373177.2_Missense_Mutation_p.Q139E|HDX_ENST00000506585.2_Missense_Mutation_p.Q81E	NM_001177479.1|NM_144657.4	NP_001170950.1|NP_653258.2	Q7Z353	HDX_HUMAN	highly divergent homeobox	139						nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(6)|kidney(2)|large_intestine(12)|liver(1)|lung(19)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						GCTGTTTTCTGAATAGGGATT	0.378																																					Pancreas(53;231 1169 36156 43751 51139)	dbGAP											0													196.0	169.0	178.0					X																	83724316		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX538112	CCDS35342.1, CCDS55456.1	Xq21.1	2012-03-09	2007-07-13	2007-07-13	ENSG00000165259	ENSG00000165259		"""Homeoboxes / POU class"""	26411	protein-coding gene	gene with protein product			"""chromosome X open reading frame 43"""	CXorf43			Standard	NM_144657		Approved	FLJ30678	uc004eek.2	Q7Z353	OTTHUMG00000021926	ENST00000297977.5:c.415C>G	X.37:g.83724316G>C	ENSP00000297977:p.Gln139Glu		A8K1Y5|B7ZL18|Q5JZB4|Q96NK7	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.Q139E	ENST00000297977.5	37	c.415	CCDS35342.1	X	.	.	.	.	.	.	.	.	.	.	G	10.37	1.331966	0.24167	.	.	ENSG00000165259	ENST00000297977;ENST00000373177;ENST00000506585;ENST00000449553	T;T;T;T	0.46063	1.75;1.53;1.75;0.88	4.9	4.9	0.64082	.	0.295269	0.32970	N	0.005421	T	0.40423	0.1116	L	0.55481	1.735	0.32739	N	0.507909	B	0.25609	0.13	B	0.19148	0.024	T	0.49995	-0.8879	10	0.34782	T	0.22	-21.366	17.4912	0.87704	0.0:0.0:1.0:0.0	.	139	Q7Z353	HDX_HUMAN	E	139;81;139;81	ENSP00000297977:Q139E;ENSP00000362272:Q81E;ENSP00000423670:Q139E;ENSP00000387790:Q81E	ENSP00000297977:Q139E	Q	-	1	0	HDX	83610972	1.000000	0.71417	0.994000	0.49952	0.877000	0.50540	4.557000	0.60782	2.402000	0.81655	0.513000	0.50165	CAG	HDX	-	NULL	ENSG00000165259		0.378	HDX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HDX	HGNC	protein_coding	OTTHUMT00000057379.2	145	0.00	0	G	NM_144657		83724316	83724316	-1	no_errors	ENST00000297977	ensembl	human	known	69_37n	missense	143	11.38	19	SNP	0.997	C
HEXA	3073	genome.wustl.edu	37	15	72641433	72641433	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr15:72641433C>T	ENST00000268097.5	-	8	1476	c.973G>A	c.(973-975)Gat>Aat	p.D325N	HEXA_ENST00000566304.1_Missense_Mutation_p.D336N|HEXA_ENST00000567159.1_Missense_Mutation_p.D325N|RP11-106M3.2_ENST00000379915.4_RNA|HEXA_ENST00000429918.2_Missense_Mutation_p.D152N|HEXA_ENST00000457859.2_Missense_Mutation_p.D133N|RP11-106M3.3_ENST00000570175.1_RNA	NM_000520.4	NP_000511.2	P06865	HEXA_HUMAN	hexosaminidase A (alpha polypeptide)	325					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	beta-N-acetylhexosaminidase activity (GO:0004563)|protein heterodimerization activity (GO:0046982)			breast(2)|cervix(1)|endometrium(3)|kidney(3)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	24						CAGGTGAAATCAACCTCATCT	0.458																																						dbGAP											0													77.0	73.0	75.0					15																	72641433		2199	4297	6496	-	-	-	SO:0001583	missense	0			M13520	CCDS10243.1	15q24.1	2012-10-02			ENSG00000213614	ENSG00000213614	3.2.1.52		4878	protein-coding gene	gene with protein product	"""Tay Sachs disease"", ""GM2 gangliosidosis"""	606869				2952641, 3013851	Standard	NM_000520		Approved		uc002aun.4	P06865	OTTHUMG00000133445	ENST00000268097.5:c.973G>A	15.37:g.72641433C>T	ENSP00000268097:p.Asp325Asn		B4DKE7|E7ENH7|Q53HS8|Q6AI32	Missense_Mutation	SNP	pfam_Glyco_hydro_20_cat-core,pfam_Glyco_hydro_20b,superfamily_Glycoside_hydrolase_SF,prints_Beta_hexosaminidase_sua/sub	p.D325N	ENST00000268097.5	37	c.973	CCDS10243.1	15	.	.	.	.	.	.	.	.	.	.	C	15.28	2.785755	0.49997	.	.	ENSG00000213614	ENST00000268097;ENST00000457859;ENST00000429918	D;D;D	0.95137	-3.62;-3.62;-3.62	5.46	5.46	0.80206	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycoside hydrolase, family 20, catalytic core (1);Glycoside hydrolase, family 20 (1);	0.178875	0.48767	D	0.000163	D	0.89989	0.6875	N	0.16567	0.415	0.45946	D	0.998774	B;B;B;B;B	0.16802	0.009;0.008;0.009;0.001;0.019	B;B;B;B;B	0.29440	0.038;0.102;0.038;0.007;0.038	D	0.85310	0.1078	10	0.13470	T	0.59	-24.0473	19.3096	0.94182	0.0:1.0:0.0:0.0	.	152;336;152;205;325	E9PGL4;B4DVA7;B4DVL8;Q9BVJ8;P06865	.;.;.;.;HEXA_HUMAN	N	325;133;152	ENSP00000268097:D325N;ENSP00000398026:D133N;ENSP00000416187:D152N	ENSP00000268097:D325N	D	-	1	0	HEXA	70428487	0.982000	0.34865	1.000000	0.80357	0.999000	0.98932	2.591000	0.46163	2.571000	0.86741	0.655000	0.94253	GAT	HEXA	-	pfam_Glyco_hydro_20_cat-core,superfamily_Glycoside_hydrolase_SF,prints_Beta_hexosaminidase_sua/sub	ENSG00000213614		0.458	HEXA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEXA	HGNC	protein_coding	OTTHUMT00000257317.2	41	0.00	0	C	NM_000520		72641433	72641433	-1	no_errors	ENST00000268097	ensembl	human	known	69_37n	missense	59	11.94	8	SNP	0.999	T
IFNG	3458	genome.wustl.edu	37	12	68549246	68549246	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr12:68549246G>A	ENST00000229135.3	-	4	519	c.388C>T	c.(388-390)Cgc>Tgc	p.R130C	IFNG-AS1_ENST00000536914.1_RNA	NM_000619.2	NP_000610.2	P01579	IFNG_HUMAN	interferon, gamma	130					adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|apoptotic process (GO:0006915)|CD8-positive, alpha-beta T cell differentiation involved in immune response (GO:0002302)|cell cycle arrest (GO:0007050)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|cellular response to interleukin-18 (GO:0071351)|cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endoplasmic reticulum unfolded protein response (GO:0030968)|extrinsic apoptotic signaling pathway (GO:0097191)|humoral immune response (GO:0006959)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003340)|negative regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072308)|negative regulation of myelination (GO:0031642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neutrophil apoptotic process (GO:0001781)|neutrophil chemotaxis (GO:0030593)|positive regulation of calcidiol 1-monooxygenase activity (GO:0060559)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of fructose 1,6-bisphosphate 1-phosphatase activity (GO:0060550)|positive regulation of fructose 1,6-bisphosphate metabolic process (GO:0060552)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-23 production (GO:0032747)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor (ligand) superfamily member 11 production (GO:2000309)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of vitamin D biosynthetic process (GO:0060557)|protein import into nucleus, translocation (GO:0000060)|regulation of insulin secretion (GO:0050796)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of the force of heart contraction (GO:0002026)|response to drug (GO:0042493)|response to virus (GO:0009615)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|interferon-gamma receptor binding (GO:0005133)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)	12			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000829)	Glucosamine(DB01296)|Olsalazine(DB01250)	ATTGCTTTGCGTTGGACATTC	0.428																																						dbGAP											0													114.0	97.0	103.0					12																	68549246		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8980.1	12q14	2007-10-17			ENSG00000111537	ENSG00000111537		"""Interferons"""	5438	protein-coding gene	gene with protein product		147570					Standard	NM_000619		Approved		uc001stw.1	P01579	OTTHUMG00000169113	ENST00000229135.3:c.388C>T	12.37:g.68549246G>A	ENSP00000229135:p.Arg130Cys		B5BU88|Q53ZV4	Missense_Mutation	SNP	pfam_Interferon_gamma,superfamily_4_helix_cytokine-like_core,pirsf_Interferon_gamma	p.R130C	ENST00000229135.3	37	c.388	CCDS8980.1	12	.	.	.	.	.	.	.	.	.	.	G	13.25	2.182034	0.38511	.	.	ENSG00000111537	ENST00000229135	T	0.55234	0.53	4.82	3.89	0.44902	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.123594	0.56097	D	0.000033	T	0.72961	0.3526	M	0.86343	2.81	0.52099	D	0.999946	D	0.89917	1.0	D	0.79108	0.992	T	0.76119	-0.3076	9	.	.	.	-6.9043	10.6574	0.45684	0.0:0.0:0.8077:0.1923	.	130	P01579	IFNG_HUMAN	C	130	ENSP00000229135:R130C	.	R	-	1	0	IFNG	66835513	1.000000	0.71417	0.988000	0.46212	0.009000	0.06853	3.301000	0.51842	1.267000	0.44247	0.655000	0.94253	CGC	IFNG	-	pfam_Interferon_gamma,superfamily_4_helix_cytokine-like_core,pirsf_Interferon_gamma	ENSG00000111537		0.428	IFNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNG	HGNC	protein_coding	OTTHUMT00000402301.1	59	0.00	0	G			68549246	68549246	-1	no_errors	ENST00000229135	ensembl	human	known	69_37n	missense	36	29.41	15	SNP	0.999	A
IKBIP	121457	genome.wustl.edu	37	12	99007970	99007970	+	Missense_Mutation	SNP	G	G	A	rs543615821		TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr12:99007970G>A	ENST00000342502.2	-	3	857	c.446C>T	c.(445-447)aCg>aTg	p.T149M	IKBIP_ENST00000420861.1_Missense_Mutation_p.T43M|IKBIP_ENST00000393042.3_3'UTR	NM_201612.2	NP_963906.1	Q70UQ0	IKIP_HUMAN	IKBKB interacting protein	149					response to X-ray (GO:0010165)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|kidney(1)|large_intestine(1)|lung(1)|prostate(2)	6						TTGAGAAAGCGTCGTCAGACT	0.363																																						dbGAP											0													128.0	116.0	120.0					12																	99007970		2202	4300	6502	-	-	-	SO:0001583	missense	0			AJ539425	CCDS9067.1, CCDS9068.1, CCDS41822.1	12q23.1	2010-02-17			ENSG00000166130	ENSG00000166130			26430	protein-coding gene	gene with protein product	"""I kappa B kinase interacting protein"""	609861				15389287	Standard	NM_153687		Approved	FLJ31051, IKIP	uc001tfx.4	Q70UQ0	OTTHUMG00000170213	ENST00000342502.2:c.446C>T	12.37:g.99007970G>A	ENSP00000343471:p.Thr149Met		Q6ZWH4|Q70UP9|Q86V91|Q96ND2	Missense_Mutation	SNP	NULL	p.T149M	ENST00000342502.2	37	c.446	CCDS9067.1	12	.	.	.	.	.	.	.	.	.	.	G	1.922	-0.448004	0.04572	.	.	ENSG00000166130	ENST00000342502;ENST00000420861	T;T	0.50001	0.81;0.76	5.76	0.584	0.17422	.	.	.	.	.	T	0.31389	0.0795	L	0.34521	1.04	0.09310	N	1	B	0.18610	0.029	B	0.10450	0.005	T	0.24440	-1.0160	9	0.51188	T	0.08	.	3.3739	0.07230	0.1969:0.3268:0.3764:0.0999	.	149	Q70UQ0	IKIP_HUMAN	M	149;43	ENSP00000343471:T149M;ENSP00000398023:T43M	ENSP00000343471:T149M	T	-	2	0	IKBIP	97532101	0.005000	0.15991	0.005000	0.12908	0.007000	0.05969	0.138000	0.16016	0.082000	0.17018	-0.137000	0.14449	ACG	IKBIP	-	NULL	ENSG00000166130		0.363	IKBIP-003	KNOWN	basic|CCDS	protein_coding	IKBIP	HGNC	protein_coding	OTTHUMT00000408003.2	55	0.00	0	G	NM_153687		99007970	99007970	-1	no_errors	ENST00000342502	ensembl	human	known	69_37n	missense	65	10.96	8	SNP	0.001	A
INADL	10207	genome.wustl.edu	37	1	62503648	62503649	+	Splice_Site	DNP	GA	GA	TC			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G|A	G|A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr1:62503648_62503649GA>TC	ENST00000371158.2	+	30	4073_4074	c.3959_3960GA>TC	c.(3958-3960)aGA>aTC	p.R1320I	INADL_ENST00000316485.6_Splice_Site_p.R1320I|INADL_ENST00000545929.1_5'UTR|INADL_ENST00000543708.1_Splice_Site_p.R104I	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	1320	PDZ 7. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						ACACTTCACAGAAACGAGGATG	0.396																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0			AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	Exception_encountered	1.37:g.62503648_62503649delinsTC			O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Splice_Site|Missense_Mutation	SNP	-|pfam_PDZ,pfam_L27_2,superfamily_PDZ,smart_L27,smart_PDZ,pfscan_L27,pfscan_PDZ	e29-1|p.R1320S	ENST00000371158.2	37	c.3960-1|c.3960	CCDS617.2	1																																																																																			INADL	-	-|superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000132849		0.396	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INADL	HGNC	protein_coding	OTTHUMT00000023639.2	79|77	0.00	0	G|A	NM_170605	Missense_Mutation	62503648|62503649	62503648|62503649	+1	no_errors	ENST00000371158	ensembl	human	known	69_37n	splice_site|missense	64|65	23.81|24.42	20|21	SNP	1.000	T|C
INTS6	26512	genome.wustl.edu	37	13	51948545	51948545	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr13:51948545C>G	ENST00000311234.4	-	15	2375	c.1903G>C	c.(1903-1905)Gtg>Ctg	p.V635L	INTS6_ENST00000398119.2_Missense_Mutation_p.V622L|INTS6_ENST00000490542.1_Missense_Mutation_p.V319L|INTS6_ENST00000497989.1_Missense_Mutation_p.V457L|INTS6_ENST00000463928.1_Intron|INTS6_ENST00000425000.1_Missense_Mutation_p.V203L	NM_012141.2	NP_036273.1	Q9UL03	INT6_HUMAN	integrator complex subunit 6	635					signal transduction (GO:0007165)|snRNA processing (GO:0016180)	actin cytoskeleton (GO:0015629)|integrator complex (GO:0032039)|nucleus (GO:0005634)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Breast(56;0.000286)|Lung NSC(96;0.00145)|Prostate(109;0.00403)|Hepatocellular(98;0.065)|Myeloproliferative disorder(33;0.163)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;7.7e-08)		GGTCCAGCCACAAATTCATCT	0.383																																						dbGAP											0													110.0	113.0	112.0					13																	51948545		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF097645	CCDS9428.1, CCDS41890.1, CCDS45048.1	13q14.3	2010-08-20	2006-03-15	2006-03-15	ENSG00000102786	ENSG00000102786		"""DEAD-boxes"""	14879	protein-coding gene	gene with protein product		604331	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26"""	DDX26		10467397, 16239144	Standard	XM_005266340		Approved	DICE1, HDB, Notchl2, DBI-1, DDX26A, INT6	uc001vfk.3	Q9UL03	OTTHUMG00000016945	ENST00000311234.4:c.1903G>C	13.37:g.51948545C>G	ENSP00000310260:p.Val635Leu		Q0P664|Q6PJP4|Q9UFK0|Q9Y5M9	Missense_Mutation	SNP	pfam_VWF_A,pfscan_VWF_A	p.V635L	ENST00000311234.4	37	c.1903	CCDS9428.1	13	.	.	.	.	.	.	.	.	.	.	C	19.01	3.743365	0.69418	.	.	ENSG00000102786	ENST00000311234;ENST00000398119;ENST00000497989;ENST00000425000;ENST00000490542	T;T;T;T;T	0.34472	1.36;1.36;1.36;1.36;1.36	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.38321	0.1036	M	0.67397	2.05	0.80722	D	1	B	0.21309	0.054	B	0.24848	0.056	T	0.31223	-0.9951	10	0.08837	T	0.75	-10.3181	18.0335	0.89292	0.0:1.0:0.0:0.0	.	635	Q9UL03	INT6_HUMAN	L	635;622;457;203;319	ENSP00000310260:V635L;ENSP00000381187:V622L;ENSP00000419871:V457L;ENSP00000406915:V203L;ENSP00000419984:V319L	ENSP00000310260:V635L	V	-	1	0	INTS6	50846546	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.027000	0.70881	2.555000	0.86185	0.591000	0.81541	GTG	INTS6	-	NULL	ENSG00000102786		0.383	INTS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS6	HGNC	protein_coding	OTTHUMT00000045023.1	100	0.00	0	C	NM_012141		51948545	51948545	-1	no_errors	ENST00000311234	ensembl	human	known	69_37n	missense	100	12.28	14	SNP	1.000	G
ITIH5	80760	genome.wustl.edu	37	10	7658059	7658059	+	Silent	SNP	A	A	T			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr10:7658059A>T	ENST00000256861.6	-	7	903	c.825T>A	c.(823-825)gtT>gtA	p.V275V	ITIH5_ENST00000434980.1_5'UTR|ITIH5_ENST00000298441.6_Silent_p.V61V|ITIH5_ENST00000397145.2_Silent_p.V275V|ITIH5_ENST00000397146.2_Silent_p.V275V|ITIH5_ENST00000446830.2_Silent_p.V57V	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	275					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						AGCCATTTAGAACCTGGTGGA	0.423																																						dbGAP											0													126.0	121.0	122.0					10																	7658059		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0					10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.825T>A	10.37:g.7658059A>T			Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Missense_Mutation	SNP	NULL	p.S53T	ENST00000256861.6	37	c.157		10																																																																																			ITIH5	-	NULL	ENSG00000123243		0.423	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	ITIH5	HGNC	protein_coding	OTTHUMT00000046688.1	56	0.00	0	A	NM_030569		7658059	7658059	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000461751	ensembl	human	known	69_37n	missense	105	13.93	17	SNP	0.989	T
ITLN2	142683	genome.wustl.edu	37	1	160922453	160922453	+	Silent	SNP	A	A	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr1:160922453A>G	ENST00000368029.3	-	3	207	c.150T>C	c.(148-150)ccT>ccC	p.P50P	RP11-544M22.1_ENST00000356006.3_RNA|ITLN2_ENST00000494442.1_5'Flank	NM_080878.2	NP_543154.1	Q8WWU7	ITLN2_HUMAN	intelectin 2	50	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.					extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			endometrium(4)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(1)	19	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			TGCAGCTTCTAGGCAGGGAAG	0.453																																						dbGAP											0													115.0	110.0	112.0					1																	160922453		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY065973	CCDS1212.1	1q22-q23.5	2013-02-06			ENSG00000158764	ENSG00000158764		"""Fibrinogen C domain containing"""	20599	protein-coding gene	gene with protein product		609874				11181563	Standard	NM_080878		Approved	HL-2	uc001fxd.3	Q8WWU7	OTTHUMG00000028605	ENST00000368029.3:c.150T>C	1.37:g.160922453A>G			Q17RR2|Q5VYI0	Silent	SNP	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C	p.P50	ENST00000368029.3	37	c.150	CCDS1212.1	1																																																																																			ITLN2	-	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C	ENSG00000158764		0.453	ITLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITLN2	HGNC	protein_coding	OTTHUMT00000071465.1	86	0.00	0	A	NM_080878		160922453	160922453	-1	no_errors	ENST00000368029	ensembl	human	known	69_37n	silent	128	17.95	28	SNP	0.028	G
KDELR2	11014	genome.wustl.edu	37	7	6509386	6509386	+	Splice_Site	SNP	C	C	G	rs56210712		TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr7:6509386C>G	ENST00000258739.4	-	3	377		c.e3-1		DAGLB_ENST00000436575.1_Intron|KDELR2_ENST00000490996.1_Splice_Site|KDELR2_ENST00000463747.1_Intron	NM_006854.3	NP_006845.1	P33947	ERD22_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2						intracellular protein transport (GO:0006886)|protein retention in ER lumen (GO:0006621)|vesicle-mediated transport (GO:0016192)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	KDEL sequence binding (GO:0005046)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(5)|ovary(1)	10		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)		GGTAGATAACCTACAAATAAA	0.423																																						dbGAP											0													62.0	59.0	60.0					7																	6509386		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			X63745	CCDS5351.1, CCDS43550.1	7p	2008-05-02			ENSG00000136240	ENSG00000136240			6305	protein-coding gene	gene with protein product		609024				1316805, 1325562	Standard	NM_006854		Approved	ELP-1, ERD2.2	uc003sqe.4	P33947	OTTHUMG00000023103	ENST00000258739.4:c.193-1G>C	7.37:g.6509386C>G			A4D2P4|Q6IPC5|Q96E30	Splice_Site	SNP	-	e3-1	ENST00000258739.4	37	c.193-1	CCDS5351.1	7	.	.	.	.	.	.	.	.	.	.	C	16.13	3.037046	0.54896	.	.	ENSG00000136240	ENST00000258739;ENST00000490996	.	.	.	5.49	5.49	0.81192	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7303	0.96180	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KDELR2	6475911	1.000000	0.71417	0.994000	0.49952	0.498000	0.33706	7.730000	0.84881	2.724000	0.93272	0.557000	0.71058	.	KDELR2	-	-	ENSG00000136240		0.423	KDELR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDELR2	HGNC	protein_coding	OTTHUMT00000059424.2	37	0.00	0	C		Intron	6509386	6509386	-1	no_errors	ENST00000258739	ensembl	human	known	69_37n	splice_site	32	21.95	9	SNP	1.000	G
KLHDC3	116138	genome.wustl.edu	37	6	42986864	42986864	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr6:42986864G>C	ENST00000326974.4	+	9	1159	c.964G>C	c.(964-966)Gac>Cac	p.D322H	RRP36_ENST00000244496.5_5'Flank|KLHDC3_ENST00000244670.8_Missense_Mutation_p.D188H|KLHDC3_ENST00000332245.8_Missense_Mutation_p.D263H	NM_057161.3	NP_476502.1	Q9BQ90	KLDC3_HUMAN	kelch domain containing 3	322					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|reciprocal meiotic recombination (GO:0007131)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)	chromatin binding (GO:0003682)			cervix(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	9			Colorectal(64;0.00237)|all cancers(41;0.0034)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0539)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			AGATGAATTTGACCTTATAGA	0.423																																						dbGAP											0													141.0	143.0	142.0					6																	42986864		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB055925	CCDS4880.1	6p21.1	2003-06-12			ENSG00000124702	ENSG00000124702			20704	protein-coding gene	gene with protein product		611248				12444059, 12606021	Standard	NM_057161		Approved	PEAS, hPeas, dJ20C7.3	uc003otl.3	Q9BQ90	OTTHUMG00000014714	ENST00000326974.4:c.964G>C	6.37:g.42986864G>C	ENSP00000313995:p.Asp322His		A8K2W9	Missense_Mutation	SNP	pfam_Kelch_2,pfam_Kelch_1	p.D322H	ENST00000326974.4	37	c.964	CCDS4880.1	6	.	.	.	.	.	.	.	.	.	.	G	14.06	2.423683	0.43020	.	.	ENSG00000124702	ENST00000326974;ENST00000432243;ENST00000244670;ENST00000394096;ENST00000426116;ENST00000332245	T;T;T	0.16457	3.14;2.34;3.14	5.48	5.48	0.80851	.	0.468933	0.24975	N	0.034116	T	0.12305	0.0299	L	0.46157	1.445	0.43390	D	0.995502	P;P;P;P	0.44380	0.555;0.779;0.834;0.61	B;B;B;B	0.43018	0.151;0.317;0.405;0.076	T	0.00992	-1.1488	10	0.59425	D	0.04	-7.2625	14.5482	0.68047	0.0:0.0:0.8536:0.1463	.	322;263;188;322	E7ENU0;E7ERR0;F8W6A4;Q9BQ90	.;.;.;KLDC3_HUMAN	H	322;322;188;322;295;263	ENSP00000313995:D322H;ENSP00000244670:D188H;ENSP00000331562:D263H	ENSP00000244670:D188H	D	+	1	0	KLHDC3	43094842	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	4.642000	0.61383	2.740000	0.93945	0.313000	0.20887	GAC	KLHDC3	-	NULL	ENSG00000124702		0.423	KLHDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHDC3	HGNC	protein_coding	OTTHUMT00000040570.1	115	0.00	0	G	NM_057161		42986864	42986864	+1	no_errors	ENST00000326974	ensembl	human	known	69_37n	missense	186	11.00	23	SNP	1.000	C
CEP162	22832	genome.wustl.edu	37	6	84862461	84862461	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr6:84862461T>G	ENST00000403245.3	-	23	3546	c.3432A>C	c.(3430-3432)aaA>aaC	p.K1144N	KIAA1009_ENST00000257766.4_Missense_Mutation_p.K1068N|KIAA1009_ENST00000461137.1_5'UTR	NM_014895.2	NP_055710.2														breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	43		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)		BRCA - Breast invasive adenocarcinoma(397;0.089)		TAGCATTTCCTTTACTTGAGT	0.408																																						dbGAP											0													91.0	89.0	90.0					6																	84862461		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000403245.3:c.3432A>C	6.37:g.84862461T>G	ENSP00000385215:p.Lys1144Asn			Missense_Mutation	SNP	NULL	p.K1144N	ENST00000403245.3	37	c.3432	CCDS34494.2	6	.	.	.	.	.	.	.	.	.	.	T	13.03	2.116807	0.37339	.	.	ENSG00000135315	ENST00000257766;ENST00000403245	T;T	0.19669	2.13;2.13	5.52	4.34	0.51931	.	0.152009	0.46758	D	0.000264	T	0.20170	0.0485	M	0.74881	2.28	0.32630	N	0.522174	D	0.56746	0.977	P	0.51016	0.656	T	0.07731	-1.0757	10	0.39692	T	0.17	-14.0933	11.5706	0.50832	0.1335:0.0:0.0:0.8665	.	1144	Q5TB80	QN1_HUMAN	N	1068;1144	ENSP00000257766:K1068N;ENSP00000385215:K1144N	ENSP00000257766:K1068N	K	-	3	2	KIAA1009	84919180	0.998000	0.40836	0.901000	0.35422	0.126000	0.20510	1.905000	0.39878	0.993000	0.38866	0.455000	0.32223	AAA	KIAA1009	-	NULL	ENSG00000135315		0.408	KIAA1009-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIAA1009	HGNC	protein_coding	OTTHUMT00000317315.1	78	0.00	0	T			84862461	84862461	-1	no_errors	ENST00000403245	ensembl	human	known	69_37n	missense	84	25.00	28	SNP	1.000	G
KLHL29	114818	genome.wustl.edu	37	2	23916383	23916383	+	Silent	SNP	C	C	A	rs61729937	byFrequency	TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr2:23916383C>A	ENST00000486442.1	+	8	2244	c.1527C>A	c.(1525-1527)ccC>ccA	p.P509P		NM_052920.1	NP_443152.1	Q96CT2	KLH29_HUMAN	kelch-like family member 29	509										breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|lung(1)|ovary(3)	10						AGAAGGACCCCGCGACACGCA	0.617													C|||	11	0.00219649	0.0008	0.0043	5008	,	,		18474	0.0		0.004	False		,,,				2504	0.0031					dbGAP											0													43.0	40.0	41.0					2																	23916383		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS54335.1	2p23.3	2013-09-27	2013-02-22	2007-01-09	ENSG00000119771	ENSG00000119771		"""Kelch-like"", ""BTB/POZ domain containing"""	29404	protein-coding gene	gene with protein product			"""kelch repeat and BTB (POZ) domain containing 9"", ""kelch-like 29 (Drosophila)"""	KBTBD9		11572484	Standard	NM_052920		Approved	KIAA1921	uc010ykg.2	Q96CT2	OTTHUMG00000151899	ENST00000486442.1:c.1527C>A	2.37:g.23916383C>A			Q8N388|Q96BF0|Q96PW7	Missense_Mutation	SNP	pfam_BACK,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.P349Q	ENST00000486442.1	37	c.1046	CCDS54335.1	2	9	0.004120879120879121	2	0.0040650406504065045	3	0.008287292817679558	0	0.0	4	0.005277044854881266	C	12.06	1.823665	0.32237	.	.	ENSG00000119771	ENST00000288548	T	0.67865	-0.29	5.24	-10.5	0.00291	.	0.157235	0.56097	D	0.000024	T	0.30823	0.0777	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46693	-0.9173	7	0.13470	T	0.59	.	3.2573	0.06836	0.1439:0.3854:0.1448:0.3259	rs61729937	.	.	.	Q	349	ENSP00000288548:P349Q	ENSP00000288548:P349Q	P	+	2	0	KLHL29	23769888	0.000000	0.05858	0.014000	0.15608	0.852000	0.48524	-3.753000	0.00375	-1.639000	0.01527	-0.440000	0.05779	CCG	KLHL29	-	pfam_BACK,smart_BACK,pirsf_Kelch-like_gigaxonin	ENSG00000119771		0.617	KLHL29-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	KLHL29	HGNC	protein_coding	OTTHUMT00000324315.3	8	0.00	0	C	NM_052920		23916383	23916383	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000288548	ensembl	human	putative	69_37n	missense	5	64.29	9	SNP	0.001	A
KLK13	26085	genome.wustl.edu	37	19	51561881	51561881	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr19:51561881C>T	ENST00000595793.1	-	4	601	c.559G>A	c.(559-561)Gag>Aag	p.E187K	KLK13_ENST00000595547.1_Missense_Mutation_p.E114K|KLK13_ENST00000335422.3_Missense_Mutation_p.E35K	NM_015596.1	NP_056411.1	Q9UKR3	KLK13_HUMAN	kallikrein-related peptidase 13	187	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				protein processing (GO:0016485)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|secretory granule (GO:0030141)	hydrolase activity (GO:0016787)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|skin(1)	16		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00224)|GBM - Glioblastoma multiforme(134;0.00432)		CGACACTCCTCATCTGAGCGA	0.502																																						dbGAP											0													227.0	205.0	213.0					19																	51561881		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12822.1	19q13.33	2008-02-05	2006-10-27			ENSG00000167759		"""Kallikreins"""	6361	protein-coding gene	gene with protein product		605505	"""kallikrein 13"""			16800724, 16800723	Standard	NM_015596		Approved	KLK-L4	uc002pvn.3	Q9UKR3		ENST00000595793.1:c.559G>A	19.37:g.51561881C>T	ENSP00000470555:p.Glu187Lys		A7UNK6|Q86VI8|Q9Y433	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.E187K	ENST00000595793.1	37	c.559	CCDS12822.1	19	.	.	.	.	.	.	.	.	.	.	C	3.935	-0.015434	0.07681	.	.	ENSG00000167759	ENST00000156476;ENST00000335422	D	0.89343	-2.5	4.8	2.67	0.31697	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.285685	0.24886	N	0.034810	T	0.81173	0.4767	L	0.33245	0.995	0.80722	D	1	B;P;B	0.35527	0.321;0.507;0.291	B;B;B	0.37304	0.137;0.246;0.066	T	0.74064	-0.3785	10	0.32370	T	0.25	.	6.9259	0.24414	0.0:0.7201:0.0:0.2799	.	35;114;187	Q86VI8;Q86VI7;Q9UKR3	.;.;KLK13_HUMAN	K	187;35	ENSP00000334079:E35K	ENSP00000156476:E187K	E	-	1	0	KLK13	56253693	0.000000	0.05858	0.998000	0.56505	0.101000	0.19017	0.891000	0.28309	0.751000	0.32900	-0.136000	0.14681	GAG	KLK13	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000167759		0.502	KLK13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLK13	HGNC	protein_coding	OTTHUMT00000464298.2	85	0.00	0	C	NM_015596		51561881	51561881	-1	no_errors	ENST00000156476	ensembl	human	known	69_37n	missense	87	13.00	13	SNP	0.995	T
LRRC18	474354	genome.wustl.edu	37	10	50122049	50122049	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr10:50122049T>A	ENST00000374160.3	-	1	228	c.152A>T	c.(151-153)gAc>gTc	p.D51V	LRRC18_ENST00000298124.3_Missense_Mutation_p.D51V|RP11-523O18.7_ENST00000430438.1_RNA|WDFY4_ENST00000325239.5_Intron|WDFY4_ENST00000413659.2_Intron	NM_001006939.3	NP_001006940.3	Q8N456	LRC18_HUMAN	leucine rich repeat containing 18	51						cytoplasm (GO:0005737)				NS(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	18						CTCGTCCATGTCACTAAGGCG	0.502																																						dbGAP											0													99.0	87.0	91.0					10																	50122049		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY358137	CCDS31197.1	10q11.23	2011-02-10			ENSG00000165383	ENSG00000165383			23199	protein-coding gene	gene with protein product							Standard	NM_001006939		Approved	UNQ933, MGC34773, UNQ9338, VKGE9338	uc001jhd.3	Q8N456	OTTHUMG00000018182	ENST00000374160.3:c.152A>T	10.37:g.50122049T>A	ENSP00000363275:p.Asp51Val		Q6UY02	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.D51V	ENST00000374160.3	37	c.152	CCDS31197.1	10	.	.	.	.	.	.	.	.	.	.	T	14.61	2.585552	0.46110	.	.	ENSG00000165383	ENST00000374160;ENST00000298124	T;T	0.52526	0.66;0.66	5.91	5.91	0.95273	.	0.334452	0.34386	N	0.004020	T	0.49932	0.1586	N	0.25094	0.71	0.80722	D	1	D	0.55172	0.97	P	0.57101	0.813	T	0.44097	-0.9350	9	.	.	.	.	16.3469	0.83138	0.0:0.0:0.0:1.0	.	51	Q8N456	LRC18_HUMAN	V	51	ENSP00000363275:D51V;ENSP00000298124:D51V	.	D	-	2	0	LRRC18	49792055	0.993000	0.37304	0.809000	0.32408	0.257000	0.26127	4.056000	0.57448	2.263000	0.75096	0.528000	0.53228	GAC	LRRC18	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000165383		0.502	LRRC18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRRC18	HGNC	protein_coding	OTTHUMT00000047964.1	52	0.00	0	T	NM_001006939		50122049	50122049	-1	no_errors	ENST00000374160	ensembl	human	known	69_37n	missense	47	14.55	8	SNP	1.000	A
LYST	1130	genome.wustl.edu	37	1	235907399	235907399	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr1:235907399C>G	ENST00000389794.3	-	30	8205	c.8031G>C	c.(8029-8031)aaG>aaC	p.K2677N	LYST_ENST00000389793.2_Missense_Mutation_p.K2677N			Q99698	LYST_HUMAN	lysosomal trafficking regulator	2677					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			AAACTGAGGTCTTGCTTTGAG	0.299																																						dbGAP											0													65.0	72.0	70.0					1																	235907399		2201	4297	6498	-	-	-	SO:0001583	missense	0			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.8031G>C	1.37:g.235907399C>G	ENSP00000374444:p.Lys2677Asn		O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.K2677N	ENST00000389794.3	37	c.8031	CCDS31062.1	1	.	.	.	.	.	.	.	.	.	.	C	10.57	1.387810	0.25031	.	.	ENSG00000143669	ENST00000389794;ENST00000389793	T;T	0.62364	0.03;0.03	5.64	4.51	0.55191	.	1.407560	0.03818	N	0.267115	T	0.60183	0.2249	L	0.51422	1.61	0.80722	D	1	B	0.21688	0.059	B	0.21917	0.037	T	0.53648	-0.8409	10	0.48119	T	0.1	.	8.7327	0.34510	0.0:0.8292:0.0:0.1708	.	2677	Q99698	LYST_HUMAN	N	2677	ENSP00000374444:K2677N;ENSP00000374443:K2677N	ENSP00000374443:K2677N	K	-	3	2	LYST	233974022	1.000000	0.71417	0.938000	0.37757	0.404000	0.30871	2.171000	0.42453	2.820000	0.97059	0.650000	0.86243	AAG	LYST	-	superfamily_ARM-type_fold	ENSG00000143669		0.299	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYST	HGNC	protein_coding	OTTHUMT00000097533.5	71	0.00	0	C			235907399	235907399	-1	no_errors	ENST00000389793	ensembl	human	known	69_37n	missense	88	13.73	14	SNP	0.926	G
MAGEA12	4111	genome.wustl.edu	37	X	151900530	151900530	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chrX:151900530C>G	ENST00000357916.4	-	2	426	c.271G>C	c.(271-273)Gaa>Caa	p.E91Q	CSAG4_ENST00000361201.4_RNA|CSAG1_ENST00000370291.2_5'Flank|CSAG1_ENST00000370287.3_5'Flank|MAGEA12_ENST00000393869.3_Missense_Mutation_p.E91Q|MAGEA12_ENST00000393900.3_Missense_Mutation_p.E91Q|CSAG1_ENST00000452779.2_5'Flank	NM_005367.5	NP_005358.2	P43365	MAGAC_HUMAN	melanoma antigen family A, 12	91										breast(5)|large_intestine(5)|liver(1)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Acute lymphoblastic leukemia(192;6.56e-05)					CCTTCCTGTTCTTCGTTGCTG	0.537																																						dbGAP											0													132.0	111.0	118.0					X																	151900530		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS76048.1	Xq28	2009-03-13			ENSG00000213401	ENSG00000213401			6799	protein-coding gene	gene with protein product	"""cancer/testis antigen family 1, member 12"""	300177		MAGE12		8575766	Standard	NM_001166386		Approved	CT1.12	uc004fgc.3	P43365	OTTHUMG00000022650	ENST00000357916.4:c.271G>C	X.37:g.151900530C>G	ENSP00000350592:p.Glu91Gln		Q9NSD3	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.E91Q	ENST00000357916.4	37	c.271	CCDS14710.1	X	.	.	.	.	.	.	.	.	.	.	C	11.23	1.577383	0.28180	.	.	ENSG00000213401	ENST00000357916;ENST00000393869;ENST00000393900	T;T;T	0.04917	3.53;3.53;3.53	0.801	0.801	0.18679	Melanoma associated antigen, MAGE, N-terminal (1);	1.618090	0.02975	N	0.144891	T	0.20495	0.0493	M	0.73372	2.23	0.09310	N	1	P	0.52692	0.955	P	0.61070	0.883	T	0.15150	-1.0447	9	0.33940	T	0.23	.	.	.	.	.	91	P43365	MAGAC_HUMAN	Q	91	ENSP00000350592:E91Q;ENSP00000377447:E91Q;ENSP00000377478:E91Q	ENSP00000350592:E91Q	E	-	1	0	MAGEA12	151651186	0.005000	0.15991	0.016000	0.15963	0.018000	0.09664	-0.102000	0.10956	0.646000	0.30693	0.179000	0.17066	GAA	MAGEA12	-	pfam_Melanoma_ass_antigen_N	ENSG00000213401		0.537	MAGEA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEA12	HGNC	protein_coding	OTTHUMT00000058764.1	99	0.00	0	C	NM_005367		151900530	151900530	-1	no_errors	ENST00000357916	ensembl	human	known	69_37n	missense	75	20.21	19	SNP	0.016	G
MAST4	375449	genome.wustl.edu	37	5	66432390	66432390	+	Splice_Site	SNP	G	G	A			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr5:66432390G>A	ENST00000403625.2	+	19	2687		c.e19-1		MAST4_ENST00000404260.3_Splice_Site|MAST4_ENST00000405643.1_Splice_Site|MAST4_ENST00000261569.7_Splice_Site|MAST4_ENST00000403666.1_Splice_Site	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4							cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		CTTCCTTCTAGATGAGATCAA	0.488																																						dbGAP											0													53.0	51.0	52.0					5																	66432390		1904	4120	6024	-	-	-	SO:0001630	splice_region_variant	0			AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.2393-1G>A	5.37:g.66432390G>A			A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Splice_Site	SNP	-	e19-1	ENST00000403625.2	37	c.2402-1	CCDS54861.1	5	.	.	.	.	.	.	.	.	.	.	G	33	5.242409	0.95272	.	.	ENSG00000069020	ENST00000404260;ENST00000403625;ENST00000403666;ENST00000405643;ENST00000380908;ENST00000261569;ENST00000432399	.	.	.	6.17	6.17	0.99709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MAST4	66468146	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.756000	0.98918	2.941000	0.99782	0.655000	0.94253	.	MAST4	-	-	ENSG00000069020		0.488	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	MAST4	HGNC	protein_coding	OTTHUMT00000326324.2	66	0.00	0	G		Intron	66432390	66432390	+1	no_errors	ENST00000404260	ensembl	human	known	69_37n	splice_site	47	14.29	8	SNP	1.000	A
MBD3L3	653657	genome.wustl.edu	37	19	7056372	7056372	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr19:7056372G>C	ENST00000333843.4	-	2	622	c.588C>G	c.(586-588)gaC>gaG	p.D196E		NM_001164425.1	NP_001157897.1	A6NE82	MB3L3_HUMAN	methyl-CpG binding domain protein 3-like 3	196					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					central_nervous_system(1)|lung(5)|stomach(1)	7						TGGCCAGCCTGTCTGCCTGCA	0.562																																						dbGAP											0													1.0	1.0	1.0					19																	7056372		385	1060	1445	-	-	-	SO:0001583	missense	0				CCDS45944.1	19p13.2	2014-04-01			ENSG00000182315	ENSG00000182315			37205	protein-coding gene	gene with protein product							Standard	NM_001164425		Approved		uc021uns.1	A6NE82	OTTHUMG00000181976	ENST00000333843.4:c.588C>G	19.37:g.7056372G>C	ENSP00000333183:p.Asp196Glu			Missense_Mutation	SNP	NULL	p.D196E	ENST00000333843.4	37	c.588	CCDS45944.1	19	.	.	.	.	.	.	.	.	.	.	.	13.45	2.240247	0.39598	.	.	ENSG00000182315	ENST00000333843	.	.	.	0.607	0.607	0.17564	.	0.000000	0.35525	N	0.003153	T	0.56934	0.2019	M	0.65975	2.015	0.33049	D	0.532522	.	.	.	.	.	.	T	0.67007	-0.5779	6	0.51188	T	0.08	-5.8879	.	.	.	.	.	.	.	E	196	.	ENSP00000333183:D196E	D	-	3	2	MBD3L3	7007372	0.906000	0.30813	0.278000	0.24718	0.366000	0.29705	1.152000	0.31663	0.592000	0.29728	0.175000	0.17021	GAC	MBD3L3	-	NULL	ENSG00000182315		0.562	MBD3L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD3L3	HGNC	protein_coding	OTTHUMT00000458500.1	25	0.00	0	G	NM_001164425		7056372	7056372	-1	no_errors	ENST00000333843	ensembl	human	known	69_37n	missense	22	21.43	6	SNP	0.473	C
MEA1	4201	genome.wustl.edu	37	6	42980860	42980860	+	Missense_Mutation	SNP	C	C	G	rs374988758		TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr6:42980860C>G	ENST00000244711.3	-	2	450	c.296G>C	c.(295-297)cGa>cCa	p.R99P	KLHDC3_ENST00000326974.4_5'Flank|KLHDC3_ENST00000244670.8_5'Flank	NM_014623.2	NP_055438.1	Q16626	MEA1_HUMAN	male-enhanced antigen 1	99					cell differentiation (GO:0030154)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)				central_nervous_system(1)|large_intestine(3)|lung(1)|skin(1)	6			Colorectal(64;0.00237)|all cancers(41;0.00411)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0664)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			TACCTGGATTCGATCCTGGAT	0.577																																						dbGAP											0													143.0	124.0	130.0					6																	42980860		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4879.1	6p21.3-p21.1	2008-08-15	2005-06-02	2005-06-02	ENSG00000124733	ENSG00000124733			6986	protein-coding gene	gene with protein product		143170	"""male-enhanced antigen"""	MEA		2813404, 12444059	Standard	NM_014623		Approved		uc003otk.3	Q16626	OTTHUMG00000014717	ENST00000244711.3:c.296G>C	6.37:g.42980860C>G	ENSP00000244711:p.Arg99Pro		Q5TC36|Q9BV01	Missense_Mutation	SNP	pfam_MEA1	p.R99P	ENST00000244711.3	37	c.296	CCDS4879.1	6	.	.	.	.	.	.	.	.	.	.	C	24.0	4.486688	0.84854	.	.	ENSG00000124733	ENST00000244711	T	0.56611	0.45	5.81	3.97	0.46021	.	0.058268	0.64402	D	0.000003	T	0.46718	0.1407	L	0.34521	1.04	0.49213	D	0.999764	D	0.71674	0.998	D	0.67382	0.951	T	0.43925	-0.9361	10	0.34782	T	0.22	-8.5261	12.0483	0.53493	0.0:0.8549:0.0:0.1451	.	99	Q16626	MEA1_HUMAN	P	99	ENSP00000244711:R99P	ENSP00000244711:R99P	R	-	2	0	MEA1	43088838	1.000000	0.71417	0.999000	0.59377	0.901000	0.52897	4.315000	0.59172	1.394000	0.46624	0.591000	0.81541	CGA	MEA1	-	pfam_MEA1	ENSG00000124733		0.577	MEA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEA1	HGNC	protein_coding	OTTHUMT00000040574.2	60	0.00	0	C			42980860	42980860	-1	no_errors	ENST00000244711	ensembl	human	known	69_37n	missense	60	37.50	36	SNP	0.997	G
KMT2E	55904	genome.wustl.edu	37	7	104752795	104752795	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr7:104752795A>G	ENST00000311117.3	+	27	5137	c.4592A>G	c.(4591-4593)tAc>tGc	p.Y1531C	SRPK2_ENST00000493638.1_Intron|KMT2E_ENST00000257745.4_Missense_Mutation_p.Y1531C|KMT2E_ENST00000334877.4_Missense_Mutation_p.Y1489C|KMT2E_ENST00000334914.7_Missense_Mutation_p.Y586C	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	1531	Pro-rich. {ECO:0000255}.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										TCAGCAACATACAGTCAGTTT	0.483																																						dbGAP											0													159.0	170.0	166.0					7																	104752795		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.4592A>G	7.37:g.104752795A>G	ENSP00000312379:p.Tyr1531Cys		B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Missense_Mutation	SNP	pfam_SET_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_SET_dom,pfscan_SET_dom,pfscan_Znf_PHD-finger	p.Y1531C	ENST00000311117.3	37	c.4592	CCDS34723.1	7	.	.	.	.	.	.	.	.	.	.	A	11.87	1.767872	0.31320	.	.	ENSG00000005483	ENST00000311117;ENST00000334877;ENST00000351043;ENST00000257745;ENST00000334914	D;D;D;T	0.94232	-3.38;-3.34;-3.38;0.37	3.49	2.29	0.28610	.	0.176615	0.27143	N	0.020732	D	0.91553	0.7332	L	0.27053	0.805	0.80722	D	1	D;D	0.76494	0.999;0.964	P;P	0.60345	0.873;0.65	D	0.88363	0.2989	10	0.40728	T	0.16	.	9.0413	0.36319	0.8348:0.0:0.0:0.1652	.	1451;1531	F8W6H1;Q8IZD2	.;MLL5_HUMAN	C	1531;1489;1451;1531;586	ENSP00000312379:Y1531C;ENSP00000335599:Y1489C;ENSP00000257745:Y1531C;ENSP00000333986:Y586C	ENSP00000257745:Y1531C	Y	+	2	0	MLL5	104540031	0.996000	0.38824	0.928000	0.36995	0.328000	0.28507	2.596000	0.46205	0.341000	0.23771	0.254000	0.18369	TAC	MLL5	-	NULL	ENSG00000005483		0.483	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLL5	HGNC	protein_coding	OTTHUMT00000348697.1	129	0.00	0	A			104752795	104752795	+1	no_errors	ENST00000257745	ensembl	human	known	69_37n	missense	125	14.97	22	SNP	0.990	G
MYH11	4629	genome.wustl.edu	37	16	15797866	15797866	+	Silent	SNP	T	T	C			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr16:15797866T>C	ENST00000300036.5	-	41	6010	c.5901A>G	c.(5899-5901)ggA>ggG	p.G1967G	NDE1_ENST00000396354.1_Intron|NDE1_ENST00000396355.1_Intron|MYH11_ENST00000452625.2_3'UTR|NDE1_ENST00000342673.5_Intron|MYH11_ENST00000576790.2_3'UTR|MYH11_ENST00000396324.3_Silent_p.G1974G|MYH11_ENST00000573908.1_5'UTR	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	1967	C-terminal.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						TGGCCTTGGTTCCATTGAAGT	0.433			T	CBFB	AML																																	dbGAP		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	0													236.0	231.0	233.0					16																	15797866		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.5901A>G	16.37:g.15797866T>C			D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.G1974	ENST00000300036.5	37	c.5922	CCDS10565.1	16	.	.	.	.	.	.	.	.	.	.	T	9.550	1.115681	0.20795	.	.	ENSG00000133392	ENST00000396320	.	.	.	5.43	3.05	0.35203	.	.	.	.	.	T	0.59418	0.2192	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52442	-0.8575	4	.	.	.	.	10.1194	0.42612	0.0:0.0:0.3249:0.6751	.	.	.	.	G	1987	.	.	E	-	2	0	MYH11	15705367	1.000000	0.71417	0.999000	0.59377	0.947000	0.59692	2.071000	0.41500	0.307000	0.22880	0.459000	0.35465	GAA	MYH11	-	NULL	ENSG00000133392		0.433	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH11	HGNC	protein_coding	OTTHUMT00000252192.2	113	0.00	0	T	NM_001040113		15797866	15797866	-1	no_errors	ENST00000396324	ensembl	human	known	69_37n	silent	142	14.46	24	SNP	1.000	C
MYO18B	84700	genome.wustl.edu	37	22	26272182	26272182	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr22:26272182C>G	ENST00000407587.2	+	24	4279	c.4110C>G	c.(4108-4110)atC>atG	p.I1370M	MYO18B_ENST00000335473.7_Missense_Mutation_p.I1369M|MYO18B_ENST00000536101.1_Missense_Mutation_p.I1369M			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1369						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						CACAGTGCATCCAGAAGAATG	0.562																																						dbGAP											0													42.0	46.0	45.0					22																	26272182		2082	4207	6289	-	-	-	SO:0001583	missense	0			AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.4110C>G	22.37:g.26272182C>G	ENSP00000386096:p.Ile1370Met		B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,superfamily_tRNA-bd_arm,superfamily_Ribosomal_zn-bd_dom,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.I1369M	ENST00000407587.2	37	c.4107		22	.	.	.	.	.	.	.	.	.	.	C	16.82	3.229476	0.58777	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	T;T;T	0.79554	-1.28;-1.28;-1.28	5.05	1.8	0.24995	.	0.254626	0.34268	N	0.004110	D	0.87087	0.6090	M	0.85859	2.78	0.32120	N	0.58808	D;D;D;D	0.76494	0.997;0.997;0.999;0.998	D;D;D;D	0.72075	0.965;0.944;0.976;0.975	D	0.84711	0.0734	10	0.87932	D	0	.	4.1594	0.10277	0.1608:0.5743:0.0:0.2649	.	882;1369;1370;1369	Q8IUG5-2;Q8IUG5;F5GXR6;F5GYU7	.;MY18B_HUMAN;.;.	M	1369;1369;1370	ENSP00000441229:I1369M;ENSP00000334563:I1369M;ENSP00000386096:I1370M	ENSP00000334563:I1369M	I	+	3	3	MYO18B	24602182	0.992000	0.36948	0.997000	0.53966	0.948000	0.59901	0.182000	0.16900	0.253000	0.21552	0.650000	0.86243	ATC	MYO18B	-	NULL	ENSG00000133454		0.562	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	MYO18B	HGNC	protein_coding	OTTHUMT00000400691.1	26	0.00	0	C	NM_032608		26272182	26272182	+1	no_errors	ENST00000335473	ensembl	human	known	69_37n	missense	27	35.71	15	SNP	1.000	G
MYOM2	9172	genome.wustl.edu	37	8	2041867	2041867	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr8:2041867A>T	ENST00000262113.4	+	17	2215	c.2074A>T	c.(2074-2076)Atg>Ttg	p.M692L	MYOM2_ENST00000523438.1_Missense_Mutation_p.M117L	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	692	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		TGCTGTGGGGATGAGTGAAAA	0.522																																						dbGAP											0													187.0	151.0	163.0					8																	2041867		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.2074A>T	8.37:g.2041867A>T	ENSP00000262113:p.Met692Leu		Q7Z3Y2	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.M692L	ENST00000262113.4	37	c.2074	CCDS5957.1	8	.	.	.	.	.	.	.	.	.	.	A	0.007	-1.966882	0.00461	.	.	ENSG00000036448	ENST00000262113;ENST00000523438	T;T	0.51574	0.7;0.7	5.44	1.79	0.24919	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.666605	0.15228	N	0.273573	T	0.09730	0.0239	N	0.00224	-1.81	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.35475	-0.9787	10	0.02654	T	1	.	4.7116	0.12875	0.5613:0.0:0.2986:0.1401	.	692	P54296	MYOM2_HUMAN	L	692;117	ENSP00000262113:M692L;ENSP00000428396:M117L	ENSP00000262113:M692L	M	+	1	0	MYOM2	2029274	0.004000	0.15560	0.000000	0.03702	0.008000	0.06430	0.705000	0.25675	0.073000	0.16731	-0.290000	0.09829	ATG	MYOM2	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000036448		0.522	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOM2	HGNC	protein_coding	OTTHUMT00000251249.1	47	0.00	0	A	NM_003970		2041867	2041867	+1	no_errors	ENST00000262113	ensembl	human	known	69_37n	missense	40	29.82	17	SNP	0.000	T
MYOM3	127294	genome.wustl.edu	37	1	24407909	24407909	+	Missense_Mutation	SNP	C	C	T	rs200529083		TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr1:24407909C>T	ENST00000374434.3	-	19	2480	c.2318G>A	c.(2317-2319)cGt>cAt	p.R773H	RP11-293P20.2_ENST00000439239.2_RNA|MYOM3_ENST00000475306.1_5'Flank|MYOM3_ENST00000329601.7_Missense_Mutation_p.R773H|RP11-293P20.4_ENST00000429191.1_RNA|MYOM3_ENST00000330966.7_Missense_Mutation_p.R774H	NM_152372.3	NP_689585.3	Q5VTT5	MYOM3_HUMAN	myomesin 3	773	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.					M band (GO:0031430)	protein homodimerization activity (GO:0042803)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(3)|lung(40)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	68		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)		AGCCCGGGCACGGAACTCATA	0.572													C|||	1	0.000199681	0.0	0.0	5008	,	,		18710	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													36.0	39.0	38.0					1																	24407909		1984	4159	6143	-	-	-	SO:0001583	missense	0			AK093280	CCDS41281.1	1p36	2013-02-11	2012-10-17		ENSG00000142661	ENSG00000142661		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	26679	protein-coding gene	gene with protein product			"""myomesin family, member 3"""			18177667	Standard	NM_152372		Approved	FLJ35961	uc001bin.4	Q5VTT5	OTTHUMG00000002969	ENST00000374434.3:c.2318G>A	1.37:g.24407909C>T	ENSP00000363557:p.Arg773His		A6NF75|Q5VTT6|Q6AWC0|Q6AWC1|Q6NXF9|Q6ZRG7|Q7Z3G9|Q8NA11|Q96C54	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.R774H	ENST00000374434.3	37	c.2321	CCDS41281.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	16.49	3.138460	0.56936	.	.	ENSG00000142661	ENST00000374434;ENST00000330966;ENST00000329601	T;T;T	0.60920	0.15;0.15;0.15	5.02	4.1	0.47936	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.056938	0.64402	D	0.000001	T	0.63010	0.2475	M	0.88241	2.94	0.43476	D	0.995695	B;B	0.27416	0.005;0.178	B;B	0.25291	0.019;0.059	T	0.69950	-0.5006	10	0.72032	D	0.01	.	12.8007	0.57584	0.0:0.9207:0.0:0.0793	.	773;773	Q5VTT5-2;Q5VTT5	.;MYOM3_HUMAN	H	773;774;773	ENSP00000363557:R773H;ENSP00000332670:R774H;ENSP00000328415:R773H	ENSP00000328415:R773H	R	-	2	0	MYOM3	24280496	0.995000	0.38212	0.996000	0.52242	0.729000	0.41735	3.239000	0.51360	2.338000	0.79540	0.609000	0.83330	CGT	MYOM3	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000142661		0.572	MYOM3-001	NOVEL	basic|appris_candidate|CCDS	protein_coding	MYOM3	HGNC	protein_coding	OTTHUMT00000008272.2	12	0.00	0	C	NM_152372		24407909	24407909	-1	no_errors	ENST00000330966	ensembl	human	known	69_37n	missense	12	25.00	4	SNP	1.000	T
NFAT5	10725	genome.wustl.edu	37	16	69681063	69681063	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr16:69681063C>T	ENST00000354436.2	+	3	650	c.332C>T	c.(331-333)gCc>gTc	p.A111V	NFAT5_ENST00000393742.2_Missense_Mutation_p.A35V|NFAT5_ENST00000349945.1_Missense_Mutation_p.A35V|NFAT5_ENST00000567239.1_Missense_Mutation_p.A129V|NFAT5_ENST00000432919.1_Missense_Mutation_p.A129V|NFAT5_ENST00000566899.1_Missense_Mutation_p.A35V	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive	111					cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						TGCTCCTCAGCCGTGGGGGTA	0.517																																						dbGAP											0													151.0	142.0	145.0					16																	69681063		2198	4300	6498	-	-	-	SO:0001583	missense	0			AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.332C>T	16.37:g.69681063C>T	ENSP00000346420:p.Ala111Val		A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	Missense_Mutation	SNP	pfam_RHD,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT_TIG_rcpt,pfscan_RHD,prints_NFAT	p.A129V	ENST00000354436.2	37	c.386	CCDS10881.1	16	.	.	.	.	.	.	.	.	.	.	C	17.71	3.456592	0.63401	.	.	ENSG00000102908	ENST00000432919;ENST00000426654;ENST00000349945;ENST00000354436;ENST00000393742	T;T;T;T	0.24908	1.83;1.83;1.83;1.83	5.67	5.67	0.87782	.	0.182252	0.49305	D	0.000147	T	0.17109	0.0411	N	0.12182	0.205	0.58432	D	0.999991	P;P;P	0.34864	0.473;0.473;0.473	B;B;B	0.26416	0.069;0.069;0.069	T	0.07328	-1.0778	10	0.87932	D	0	-1.7183	19.7714	0.96367	0.0:1.0:0.0:0.0	.	129;111;129	A2RRB4;O94916;E9PHR7	.;NFAT5_HUMAN;.	V	129;129;35;111;35	ENSP00000396538:A129V;ENSP00000338806:A35V;ENSP00000346420:A111V;ENSP00000377343:A35V	ENSP00000338806:A35V	A	+	2	0	NFAT5	68238564	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.658000	0.37376	2.666000	0.90696	0.655000	0.94253	GCC	NFAT5	-	NULL	ENSG00000102908		0.517	NFAT5-001	KNOWN	basic|CCDS	protein_coding	NFAT5	HGNC	protein_coding	OTTHUMT00000268952.2	74	0.00	0	C	NM_138714		69681063	69681063	+1	no_errors	ENST00000432919	ensembl	human	known	69_37n	missense	68	15.00	12	SNP	1.000	T
NFKB1	4790	genome.wustl.edu	37	4	103459076	103459076	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr4:103459076C>G	ENST00000505458.1	+	5	495	c.218C>G	c.(217-219)tCt>tGt	p.S73C	NFKB1_ENST00000226574.4_Missense_Mutation_p.S74C|NFKB1_ENST00000394820.4_Missense_Mutation_p.S73C			P19838	NFKB1_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 1	73	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				apoptotic process (GO:0006915)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|cellular response to nicotine (GO:0071316)|cellular response to peptide hormone stimulus (GO:0071375)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|membrane protein intracellular domain proteolysis (GO:0031293)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of calcidiol 1-monooxygenase activity (GO:0010956)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of cytokine production (GO:0001818)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-12 biosynthetic process (GO:0045083)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|response to copper ion (GO:0046688)|response to oxidative stress (GO:0006979)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|I-kappaB/NF-kappaB complex (GO:0033256)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleic acid binding transcription factor activity (GO:0001071)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			biliary_tract(1)|breast(4)|endometrium(2)|large_intestine(6)|lung(7)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	27		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.59e-08)	Acetylsalicylic acid(DB00945)|Pranlukast(DB01411)|Thalidomide(DB01041)|Triflusal(DB08814)	CCTGGTGCCTCTAGTGAAAAG	0.408																																						dbGAP											0													156.0	148.0	151.0					4																	103459076		2203	4300	6503	-	-	-	SO:0001583	missense	0			M58603	CCDS3657.1, CCDS54783.1	4q24	2013-01-10	2008-07-28		ENSG00000109320	ENSG00000109320		"""Ankyrin repeat domain containing"""	7794	protein-coding gene	gene with protein product		164011				1992489	Standard	NM_003998		Approved	KBF1, p105, NFKB-p50, p50, NF-kappaB, NFkappaB, NF-kB1	uc011cep.2	P19838	OTTHUMG00000161080	ENST00000505458.1:c.218C>G	4.37:g.103459076C>G	ENSP00000424790:p.Ser73Cys		A8K5Y5|B3KVE8|Q68D84|Q86V43|Q8N4X7|Q9NZC0	Missense_Mutation	SNP	pfam_RHD,pfam_Ankyrin_rpt,pfam_Death,superfamily_p53-like_TF_DNA-bd,superfamily_Ankyrin_rpt-contain_dom,superfamily_Ig_E-set,superfamily_DEATH-like,smart_IPT_TIG_rcpt,smart_Ankyrin_rpt,smart_Death,prints_NF_Rel_dor,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_RHD	p.S74C	ENST00000505458.1	37	c.221	CCDS54783.1	4	.	.	.	.	.	.	.	.	.	.	C	22.0	4.225061	0.79576	.	.	ENSG00000109320	ENST00000226574;ENST00000394820;ENST00000507079;ENST00000505458;ENST00000509165	T;T;T;T;T	0.49139	0.79;0.79;0.79;0.79;0.79	5.24	5.24	0.73138	Rel homology (3);p53-like transcription factor, DNA-binding (1);	0.147687	0.46145	D	0.000313	T	0.72011	0.3408	M	0.83774	2.66	0.58432	D	0.999997	D;D	0.89917	1.0;0.997	D;D	0.76071	0.987;0.95	T	0.76870	-0.2799	10	0.87932	D	0	.	17.633	0.88114	0.0:1.0:0.0:0.0	.	73;74	P19838;P19838-2	NFKB1_HUMAN;.	C	74;73;82;73;74	ENSP00000226574:S74C;ENSP00000378297:S73C;ENSP00000426147:S82C;ENSP00000424790:S73C;ENSP00000423877:S74C	ENSP00000226574:S74C	S	+	2	0	NFKB1	103678104	1.000000	0.71417	0.987000	0.45799	0.715000	0.41141	6.847000	0.75404	2.456000	0.83038	0.655000	0.94253	TCT	NFKB1	-	pfam_RHD,superfamily_p53-like_TF_DNA-bd,pfscan_RHD	ENSG00000109320		0.408	NFKB1-003	KNOWN	alternative_5_UTR|non_canonical_polymorphism|basic|appris_candidate|CCDS	protein_coding	NFKB1	HGNC	protein_coding	OTTHUMT00000363411.1	92	0.00	0	C			103459076	103459076	+1	no_errors	ENST00000226574	ensembl	human	known	69_37n	missense	58	18.31	13	SNP	1.000	G
NIF3L1	60491	genome.wustl.edu	37	2	201764124	201764124	+	Silent	SNP	C	C	T	rs564959592		TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr2:201764124C>T	ENST00000409020.1	+	6	1176	c.882C>T	c.(880-882)gtC>gtT	p.V294V	NIF3L1_ENST00000416651.1_Silent_p.V294V|NIF3L1_ENST00000359683.4_Silent_p.V267V|NIF3L1_ENST00000409357.1_Silent_p.V294V|NIF3L1_ENST00000409588.1_Missense_Mutation_p.S248L|RNU6-762P_ENST00000517107.1_RNA			Q9GZT8	GTPC1_HUMAN	NIF3 NGG1 interacting factor 3-like 1 (S. cerevisiae)	294					7,8-dihydroneopterin 3'-triphosphate biosynthetic process (GO:0035998)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTP cyclohydrolase I activity (GO:0003934)|metal ion binding (GO:0046872)|transcription factor binding (GO:0008134)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|skin(1)|urinary_tract(2)	13						AAGTCAAAGTCGTGGCCCTGT	0.423													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18695	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													134.0	133.0	134.0					2																	201764124		2033	4212	6245	-	-	-	SO:0001819	synonymous_variant	0			AB038949	CCDS42797.1, CCDS46485.1, CCDS46486.1	2q33	2011-11-10	2011-11-10		ENSG00000196290	ENSG00000196290			13390	protein-coding gene	gene with protein product		605778	"""NIF3 (Ngg1 interacting factor 3, S.pombe homolog)-like 1"", ""NIF3 NGG1 interacting factor 3-like 1 (S. pombe)"""	ALS2CR1		11124544, 11161814, 12522100	Standard	NM_001136039		Approved	CALS-7, MDS015	uc002uwm.2	Q9GZT8	OTTHUMG00000154588	ENST00000409020.1:c.882C>T	2.37:g.201764124C>T			Q53TX4|Q6X735|Q9H2D2|Q9HC18	Missense_Mutation	SNP	pfam_Interacting_NIF3,superfamily_Interacting_NIF3,pirsf_UCP037490_NIF3_euk	p.S248L	ENST00000409020.1	37	c.743	CCDS46485.1	2	.	.	.	.	.	.	.	.	.	.	C	8.129	0.782690	0.16189	.	.	ENSG00000196290	ENST00000409588;ENST00000436412	.	.	.	5.0	-9.99	0.00435	.	.	.	.	.	T	0.33904	0.0879	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.07829	-1.0752	7	0.29301	T	0.29	-2.0068	5.4122	0.16354	0.0836:0.4282:0.3494:0.1388	.	248	Q6X735	.	L	248;53	.	ENSP00000387021:S248L	S	+	2	0	NIF3L1	201472369	0.000000	0.05858	0.005000	0.12908	0.407000	0.30961	-3.294000	0.00523	-3.155000	0.00229	-1.327000	0.01280	TCG	NIF3L1	-	pirsf_UCP037490_NIF3_euk	ENSG00000196290		0.423	NIF3L1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	NIF3L1	HGNC	protein_coding	OTTHUMT00000336201.1	133	0.00	0	C	NM_021824		201764124	201764124	+1	no_errors	ENST00000409588	ensembl	human	novel	69_37n	missense	247	10.83	30	SNP	0.001	T
NPSR1	387129	genome.wustl.edu	37	7	34873914	34873914	+	Intron	SNP	G	G	C			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr7:34873914G>C	ENST00000360581.1	+	6	808				NPSR1_ENST00000359791.1_Intron|NPSR1_ENST00000531252.1_Intron|NPSR1_ENST00000381539.3_Intron|NPSR1_ENST00000381542.1_Intron	NM_207172.1	NP_997055.1	Q6W5P4	NPSR1_HUMAN	neuropeptide S receptor 1							cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|vasopressin receptor activity (GO:0005000)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(7)	31					Halothane(DB01159)	CTTGCACTCGGGGAGGTGGGA	0.478																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AY255536	CCDS5443.1, CCDS5444.1, CCDS75579.1, CCDS75580.1, CCDS75581.1	7p14.3	2012-08-08	2006-05-10	2006-05-10	ENSG00000187258	ENSG00000187258		"""GPCR / Class A : Neuropeptide receptors : S"""	23631	protein-coding gene	gene with protein product		608595	"""G protein-coupled receptor 154"""	GPR154		12679517, 15073379	Standard	NM_207173		Approved	PGR14, GPRA	uc003tei.1	Q6W5P4	OTTHUMG00000099383	ENST00000360581.1:c.681-82G>C	7.37:g.34873914G>C			A2RTZ4|Q2XP58|Q56H76|Q56H77|Q56H78|Q6JSL4|Q6JSL5|Q6JSL6|Q6JSL7|Q6JSL8|Q6W5P3|Q6ZMB8	RNA	SNP	-	NULL	ENST00000360581.1	37	NULL	CCDS5444.1	7																																																																																			NPSR1-AS1	-	-	ENSG00000197085		0.478	NPSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPSR1-AS1	HGNC	protein_coding	OTTHUMT00000216837.1	34	0.00	0	G	NM_207173		34873914	34873914	-1	no_errors	ENST00000436945	ensembl	human	known	69_37n	rna	27	15.62	5	SNP	0.002	C
NR2F1	7025	genome.wustl.edu	37	5	92923685	92923685	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr5:92923685G>A	ENST00000327111.3	+	2	2213	c.526G>A	c.(526-528)Ggg>Agg	p.G176R	NR2F1-AS1_ENST00000513055.1_RNA	NM_005654.4	NP_005645.1	P10589	COT1_HUMAN	nuclear receptor subfamily 2, group F, member 1	176					cerebral cortex regionalization (GO:0021796)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of neuron projection development (GO:0010977)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|retinoic acid-responsive element binding (GO:0044323)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(4)|large_intestine(6)|lung(2)|ovary(3)|prostate(1)|skin(1)|urinary_tract(2)	21		all_cancers(142;1.62e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0416)|all cancers(79;9.57e-18)		ACTCACCAACGGGGACCCCCT	0.607																																						dbGAP											0													72.0	72.0	72.0					5																	92923685		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC004154	CCDS4068.1	5q14	2013-01-16			ENSG00000175745	ENSG00000175745		"""Nuclear hormone receptors"""	7975	protein-coding gene	gene with protein product		132890		ERBAL3, TFCOUP1		8530078	Standard	NM_005654		Approved	EAR-3, COUP-TFI, TCFCOUP1, SVP44	uc003kkj.3	P10589	OTTHUMG00000119079	ENST00000327111.3:c.526G>A	5.37:g.92923685G>A	ENSP00000325819:p.Gly176Arg			Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_COUP_TF,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Retinoid-X_rcpt/HNF4,pfscan_Znf_hrmn_rcpt	p.G176R	ENST00000327111.3	37	c.526	CCDS4068.1	5	.	.	.	.	.	.	.	.	.	.	G	25.2	4.612429	0.87258	.	.	ENSG00000175745	ENST00000327111	T	0.51574	0.7	4.9	4.9	0.64082	Nuclear hormone receptor, ligand-binding (2);	0.000000	0.85682	D	0.000000	T	0.55737	0.1939	M	0.84683	2.71	0.80722	D	1	P	0.46277	0.875	B	0.40285	0.325	T	0.66320	-0.5953	10	0.48119	T	0.1	.	18.2484	0.89995	0.0:0.0:1.0:0.0	.	176	P10589	COT1_HUMAN	R	176	ENSP00000325819:G176R	ENSP00000325819:G176R	G	+	1	0	NR2F1	92949441	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.575000	0.98187	2.536000	0.85505	0.561000	0.74099	GGG	NR2F1	-	superfamily_Nucl_hormone_rcpt_ligand-bd	ENSG00000175745		0.607	NR2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR2F1	HGNC	protein_coding	OTTHUMT00000239293.2	18	0.00	0	G	NM_005654		92923685	92923685	+1	no_errors	ENST00000327111	ensembl	human	known	69_37n	missense	14	41.67	10	SNP	1.000	A
NSUN5	55695	genome.wustl.edu	37	7	72718027	72718027	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr7:72718027G>C	ENST00000252594.6	-	8	956	c.941C>G	c.(940-942)cCg>cGg	p.P314R	NSUN5_ENST00000438747.2_Missense_Mutation_p.P314R|NSUN5_ENST00000310326.8_Missense_Mutation_p.P314R|NSUN5_ENST00000428206.1_Missense_Mutation_p.P276R			Q96P11	NSUN5_HUMAN	NOP2/Sun domain family, member 5	314					rRNA processing (GO:0006364)	nucleolus (GO:0005730)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|large_intestine(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	8		Lung NSC(55;0.163)				CTGTCTGCTCGGCATACCTAA	0.597																																						dbGAP											0													36.0	40.0	38.0					7																	72718027		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF420249	CCDS5546.1, CCDS5547.1, CCDS55118.1, CCDS55119.1	7q11.23	2010-04-08	2009-11-23	2005-01-14	ENSG00000130305	ENSG00000130305		"""NOP2/Sun domain containing"""	16385	protein-coding gene	gene with protein product	"""NOP2/Sun domain family, member 5A"""	615732	"""Williams Beuren syndrome chromosome region 20A"", ""NOL1/NOP2/Sun domain family, member 5"""	WBSCR20, WBSCR20A		11978965, 12073013	Standard	NM_148956		Approved	NOL1R, p120, (NOL1), FLJ10267, NSUN5A, Ynl022cL	uc011kev.2	Q96P11	OTTHUMG00000129869	ENST00000252594.6:c.941C>G	7.37:g.72718027G>C	ENSP00000252594:p.Pro314Arg		B3KX04|B4DP79|G3V0G9|Q6ZUI8|Q96HT9|Q9NW70	Missense_Mutation	SNP	pfam_Fmu/NOL1/Nop2p,prints_RCMT	p.P314R	ENST00000252594.6	37	c.941	CCDS5547.1	7	.	.	.	.	.	.	.	.	.	.	.	10.29	1.308316	0.23821	.	.	ENSG00000130305	ENST00000428206;ENST00000252594;ENST00000438747;ENST00000310326	T;T;T;T	0.21543	2.0;2.0;2.0;2.0	4.28	-2.82	0.05787	Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (1);	0.846295	0.10435	N	0.674998	T	0.13243	0.0321	N	0.16368	0.405	0.09310	N	1	B;B;B;B	0.29085	0.232;0.163;0.062;0.09	B;B;B;B	0.37780	0.258;0.132;0.258;0.168	T	0.41610	-0.9499	10	0.66056	D	0.02	.	5.0423	0.14465	0.4805:0.0:0.3801:0.1394	.	314;276;314;314	B4DP79;G3V0G9;Q96P11;Q96P11-2	.;.;NSUN5_HUMAN;.	R	276;314;314;314	ENSP00000393081:P276R;ENSP00000252594:P314R;ENSP00000388464:P314R;ENSP00000309126:P314R	ENSP00000252594:P314R	P	-	2	0	NSUN5	72355963	0.000000	0.05858	0.000000	0.03702	0.196000	0.23810	0.396000	0.20867	-0.357000	0.08175	-1.378000	0.01179	CCG	NSUN5	-	pfam_Fmu/NOL1/Nop2p	ENSG00000130305		0.597	NSUN5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	NSUN5	HGNC	protein_coding	OTTHUMT00000252113.1	17	0.00	0	G	NM_148956		72718027	72718027	-1	no_errors	ENST00000438747	ensembl	human	known	69_37n	missense	11	38.89	7	SNP	0.000	C
OGFR	11054	genome.wustl.edu	37	20	61444633	61444633	+	Missense_Mutation	SNP	G	G	A	rs75570150		TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr20:61444633G>A	ENST00000290291.6	+	7	1691	c.1666G>A	c.(1666-1668)Gag>Aag	p.E556K	OGFR_ENST00000370461.1_Missense_Mutation_p.E504K	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	556	7 X 20 AA approximate tandem repeats of [ST]-P-S-E-T-P-G-P-[SR]-P-A-G-P-[AT]- [GR]-D-E-P-A-[EK].				opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)	p.E556K(1)		endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					CGAGCCAGCCGAGAGCCCATC	0.756																																						dbGAP											1	Substitution - Missense(1)	skin(1)											6.0	11.0	9.0					20																	61444633		1936	3778	5714	-	-	-	SO:0001583	missense	0			AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.1666G>A	20.37:g.61444633G>A	ENSP00000290291:p.Glu556Lys		O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Missense_Mutation	SNP	pfam_OGF_rcpt,pfam_OGF_rcpt_rpt	p.E556K	ENST00000290291.6	37	c.1666	CCDS13504.1	20	.	.	.	.	.	.	.	.	.	.	A	2.693	-0.272793	0.05716	.	.	ENSG00000060491	ENST00000290291;ENST00000357163;ENST00000370469;ENST00000370461	T;T	0.52983	0.64;0.64	0.773	-1.55	0.08558	.	.	.	.	.	T	0.25195	0.0612	N	0.14661	0.345	0.09310	N	1	B;B;B	0.09022	0.002;0.002;0.002	B;B;B	0.04013	0.0;0.001;0.0	T	0.12785	-1.0534	9	0.34782	T	0.22	.	5.1465	0.14987	0.4456:0.0:0.5544:0.0	.	556;539;556	B3KMQ6;Q05BV5;Q9NZT2	.;.;OGFR_HUMAN	K	556;536;391;504	ENSP00000290291:E556K;ENSP00000359491:E504K	ENSP00000290291:E556K	E	+	1	0	OGFR	60915078	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.269000	0.00532	-0.808000	0.04387	-1.125000	0.01998	GAG	OGFR	-	pfam_OGF_rcpt_rpt	ENSG00000060491		0.756	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OGFR	HGNC	protein_coding	OTTHUMT00000080067.1	10	0.00	0	G			61444633	61444633	+1	no_errors	ENST00000290291	ensembl	human	known	69_37n	missense	8	38.46	5	SNP	0.040	A
OR10G4	390264	genome.wustl.edu	37	11	123886801	123886801	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr11:123886801C>T	ENST00000320891.4	+	1	520	c.520C>T	c.(520-522)Cag>Tag	p.Q174*		NM_001004462.1	NP_001004462.1	Q8NGN3	O10G4_HUMAN	olfactory receptor, family 10, subfamily G, member 4	174						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)|skin(4)|stomach(6)|upper_aerodigestive_tract(1)	48		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		CAACCAGATCCAGCACTACTT	0.562																																						dbGAP											0													174.0	153.0	160.0					11																	123886801		2201	4286	6487	-	-	-	SO:0001587	stop_gained	0			AB065757	CCDS31702.1	11q24.1	2012-08-09			ENSG00000254737	ENSG00000254737		"""GPCR / Class A : Olfactory receptors"""	14809	protein-coding gene	gene with protein product							Standard	NM_001004462		Approved		uc010sac.2	Q8NGN3	OTTHUMG00000165966	ENST00000320891.4:c.520C>T	11.37:g.123886801C>T	ENSP00000325076:p.Gln174*		Q6IEW0	Nonsense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.Q174*	ENST00000320891.4	37	c.520	CCDS31702.1	11	.	.	.	.	.	.	.	.	.	.	c	10.29	1.309768	0.23821	.	.	ENSG00000254737	ENST00000320891	.	.	.	3.33	2.3	0.28687	.	0.330848	0.21981	N	0.066319	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	5.5873	0.17281	0.32:0.4099:0.27:0.0	.	.	.	.	X	174	.	ENSP00000325076:Q174X	Q	+	1	0	OR10G4	123392011	0.000000	0.05858	0.992000	0.48379	0.305000	0.27757	-0.492000	0.06467	1.878000	0.54408	0.580000	0.79431	CAG	OR10G4	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000254737		0.562	OR10G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10G4	HGNC	protein_coding	OTTHUMT00000387268.1	118	0.00	0	C	NM_001004462		123886801	123886801	+1	no_errors	ENST00000320891	ensembl	human	known	69_37n	nonsense	160	11.11	20	SNP	0.003	T
OR2L8	391190	genome.wustl.edu	37	1	248113016	248113016	+	Missense_Mutation	SNP	C	C	A	rs547684252	byFrequency	TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr1:248113016C>A	ENST00000357191.3	+	1	857	c.857C>A	c.(856-858)cCc>cAc	p.P286H	OR2L13_ENST00000366478.2_Intron	NM_001001963.1	NP_001001963.1	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L, member 8 (gene/pseudogene)	286						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(3)|large_intestine(3)|lung(30)|ovary(1)|prostate(1)|skin(3)	42	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			ATGCTCAACCCCATCATCTAT	0.493																																						dbGAP											0													78.0	63.0	68.0					1																	248113016		2203	4298	6501	-	-	-	SO:0001583	missense	0			BK004459	CCDS31101.1	1q44	2013-10-10	2013-10-10		ENSG00000196936	ENSG00000196936		"""GPCR / Class A : Olfactory receptors"""	15014	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily L, member 8"""				Standard	NM_001001963		Approved		uc001idt.1	Q8NGY9	OTTHUMG00000040196	ENST00000357191.3:c.857C>A	1.37:g.248113016C>A	ENSP00000349719:p.Pro286His		Q6IF03	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.P286H	ENST00000357191.3	37	c.857	CCDS31101.1	1	.	.	.	.	.	.	.	.	.	.	.	16.06	3.015509	0.54468	.	.	ENSG00000196936	ENST00000357191	T	0.64260	-0.09	1.8	1.8	0.24995	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	D	0.82742	0.5103	H	0.96142	3.775	0.42527	D	0.993023	D	0.89917	1.0	D	0.70016	0.967	D	0.86063	0.1533	9	0.87932	D	0	.	10.6261	0.45508	0.0:1.0:0.0:0.0	.	286	Q8NGY9	OR2L8_HUMAN	H	286	ENSP00000349719:P286H	ENSP00000349719:P286H	P	+	2	0	OR2L8	246179639	0.997000	0.39634	0.738000	0.30950	0.850000	0.48378	5.744000	0.68664	1.010000	0.39314	0.485000	0.47835	CCC	OR2L8	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	ENSG00000196936		0.493	OR2L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L8	HGNC	protein_coding	OTTHUMT00000096853.2	56	0.00	0	C			248113016	248113016	+1	no_errors	ENST00000357191	ensembl	human	known	69_37n	missense	55	37.50	33	SNP	0.998	A
OR5K1	26339	genome.wustl.edu	37	3	98189042	98189042	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr3:98189042G>C	ENST00000332650.5	+	1	719	c.622G>C	c.(622-624)Gtc>Ctc	p.V208L		NM_001004736.2	NP_001004736.2	Q8NHB7	OR5K1_HUMAN	olfactory receptor, family 5, subfamily K, member 1	208						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(4)|lung(21)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TTCAGTTCAAGTCTTTACCAT	0.348																																						dbGAP											0													169.0	171.0	170.0					3																	98189042		2203	4296	6499	-	-	-	SO:0001583	missense	0			X64984	CCDS43115.1	3q11.2	2013-09-23			ENSG00000232382	ENSG00000232382		"""GPCR / Class A : Olfactory receptors"""	8349	protein-coding gene	gene with protein product						1370859	Standard	NM_001004736		Approved	HTPCRX10, HSHTPCRX10	uc003dsm.3	Q8NHB7	OTTHUMG00000160048	ENST00000332650.5:c.622G>C	3.37:g.98189042G>C	ENSP00000373193:p.Val208Leu		B9EGY5|Q6IF46	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.V208L	ENST00000332650.5	37	c.622	CCDS43115.1	3	.	.	.	.	.	.	.	.	.	.	G	11.39	1.625048	0.28889	.	.	ENSG00000232382	ENST00000332650	T	0.34472	1.36	4.75	3.87	0.44632	GPCR, rhodopsin-like superfamily (1);	0.189322	0.25517	N	0.030122	T	0.21347	0.0514	N	0.12920	0.275	0.20563	N	0.999887	B	0.21147	0.052	B	0.26969	0.075	T	0.19877	-1.0292	10	0.16896	T	0.51	-6.68	11.1089	0.48221	0.092:0.0:0.908:0.0	.	208	Q8NHB7	OR5K1_HUMAN	L	208	ENSP00000373193:V208L	ENSP00000373193:V208L	V	+	1	0	OR5K1	99671732	0.000000	0.05858	0.999000	0.59377	0.963000	0.63663	-0.587000	0.05780	1.176000	0.42840	0.563000	0.77884	GTC	OR5K1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000232382		0.348	OR5K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5K1	HGNC	protein_coding	OTTHUMT00000359019.1	122	0.00	0	G			98189042	98189042	+1	no_errors	ENST00000332650	ensembl	human	known	69_37n	missense	162	20.20	41	SNP	0.890	C
PAAF1	80227	genome.wustl.edu	37	11	73627677	73627680	+	Frame_Shift_Del	DEL	ATTT	ATTT	-			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	ATTT	ATTT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr11:73627677_73627680delATTT	ENST00000310571.3	+	9	960_963	c.907_910delATTT	c.(907-912)atttatfs	p.IY303fs	PAAF1_ENST00000544552.1_Frame_Shift_Del_p.IY286fs|PAAF1_ENST00000535604.1_Frame_Shift_Del_p.IY188fs|PAAF1_ENST00000536003.1_Frame_Shift_Del_p.IY286fs|PAAF1_ENST00000376384.5_Frame_Shift_Del_p.IY286fs|PAAF1_ENST00000544909.1_Frame_Shift_Del_p.IY304fs|PAAF1_ENST00000541951.1_Frame_Shift_Del_p.IY188fs	NM_025155.2	NP_079431.1	Q9BRP4	PAAF1_HUMAN	proteasomal ATPase-associated factor 1	303					viral process (GO:0016032)	proteasome complex (GO:0000502)				breast(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Breast(11;7.42e-05)					AGATGGAAACATTTATCAGCTGGA	0.422																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC006142	CCDS8226.1, CCDS58157.1, CCDS58158.1	11q13.4	2013-05-21	2007-08-16	2007-08-16	ENSG00000175575	ENSG00000175575		"""WD repeat domain containing"""	25687	protein-coding gene	gene with protein product			"""WD repeat domain 71"""	WDR71		15831487, 17317272, 17289585	Standard	NM_001267803		Approved	FLJ11848, Rpn14	uc001ouk.2	Q9BRP4	OTTHUMG00000168062	ENST00000310571.3:c.907_910delATTT	11.37:g.73627677_73627680delATTT	ENSP00000311665:p.Ile303fs		A6NDR5|B4DPB0|B7ZAS9|Q4G165|Q53HS9|Q7Z500|Q8TBU6|Q9HAB6	Frame_Shift_Del	DEL	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.Y304fs	ENST00000310571.3	37	c.907_910	CCDS8226.1	11																																																																																			PAAF1	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000175575		0.422	PAAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAAF1	HGNC	protein_coding	OTTHUMT00000397885.1	77	0.00	0	ATTT	NM_025155		73627677	73627680	+1	no_errors	ENST00000310571	ensembl	human	known	69_37n	frame_shift_del	86	17.31	18	DEL	1.000:1.000:1.000:1.000	-
PACSIN2	11252	genome.wustl.edu	37	22	43275089	43275089	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr22:43275089C>G	ENST00000263246.3	-	8	1194	c.993G>C	c.(991-993)caG>caC	p.Q331H	PACSIN2_ENST00000407585.1_Missense_Mutation_p.Q331H|PACSIN2_ENST00000402229.1_Missense_Mutation_p.Q331H|PACSIN2_ENST00000403744.3_Missense_Mutation_p.Q331H|PACSIN2_ENST00000337959.4_Missense_Mutation_p.Q331H	NM_001184970.1	NP_001171899.1	Q9UNF0	PACN2_HUMAN	protein kinase C and casein kinase substrate in neurons 2	331					actin cytoskeleton organization (GO:0030036)|caveola assembly (GO:0070836)|caveolin-mediated endocytosis (GO:0072584)|cell projection morphogenesis (GO:0048858)|membrane tubulation (GO:0097320)|negative regulation of endocytosis (GO:0045806)|protein localization to endosome (GO:0036010)	caveola (GO:0005901)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|recycling endosome membrane (GO:0055038)	identical protein binding (GO:0042802)|phosphatidic acid binding (GO:0070300)|transporter activity (GO:0005215)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)	19		Glioma(61;0.222)				GGTCGCCTGTCTGGTTGATGC	0.617																																						dbGAP											0													70.0	75.0	74.0					22																	43275089		2077	4195	6272	-	-	-	SO:0001583	missense	0			AF128536	CCDS43023.1, CCDS54536.1	22q13.2-q13.33	2009-05-08			ENSG00000100266	ENSG00000100266			8571	protein-coding gene	gene with protein product	"""syndapin II"""	604960				10431838, 11082044	Standard	NM_007229		Approved	SDPII	uc003bdg.4	Q9UNF0	OTTHUMG00000150701	ENST00000263246.3:c.993G>C	22.37:g.43275089C>G	ENSP00000263246:p.Gln331His		O95921|Q96HV9|Q9H0D3|Q9NPN1|Q9Y4V2	Missense_Mutation	SNP	pfam_FCH,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_FCH,smart_SH3_domain,pfscan_FCH,pfscan_SH3_domain,prints_SH3_domain	p.Q331H	ENST00000263246.3	37	c.993	CCDS43023.1	22	.	.	.	.	.	.	.	.	.	.	C	13.87	2.366947	0.41902	.	.	ENSG00000100266	ENST00000263246;ENST00000337959;ENST00000407585;ENST00000403744;ENST00000402229	T;T;T;T;T	0.22336	1.96;1.96;1.96;1.96;1.96	5.07	2.19	0.27852	Src homology-3 domain (1);	0.272188	0.42682	N	0.000665	T	0.14874	0.0359	L	0.34521	1.04	0.45690	D	0.998603	B;B	0.12013	0.005;0.001	B;B	0.12837	0.008;0.002	T	0.07751	-1.0756	10	0.30078	T	0.28	-27.7688	10.4145	0.44314	0.0:0.8022:0.0:0.1978	.	331;331	Q6FIA3;Q9UNF0	.;PACN2_HUMAN	H	331	ENSP00000263246:Q331H;ENSP00000338379:Q331H;ENSP00000385952:Q331H;ENSP00000385372:Q331H;ENSP00000385040:Q331H	ENSP00000263246:Q331H	Q	-	3	2	PACSIN2	41605033	0.996000	0.38824	0.987000	0.45799	0.982000	0.71751	0.518000	0.22847	0.452000	0.26830	0.558000	0.71614	CAG	PACSIN2	-	superfamily_SH3_domain	ENSG00000100266		0.617	PACSIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PACSIN2	HGNC	protein_coding	OTTHUMT00000319665.1	39	0.00	0	C	NM_007229		43275089	43275089	-1	no_errors	ENST00000263246	ensembl	human	known	69_37n	missense	40	31.03	18	SNP	1.000	G
PCDH10	57575	genome.wustl.edu	37	4	134073838	134073838	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr4:134073838C>G	ENST00000264360.5	+	1	3369	c.2543C>G	c.(2542-2544)aCt>aGt	p.T848S		NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	848					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		AGTACGGACACTGAGCACAAC	0.557																																						dbGAP											0													89.0	82.0	84.0					4																	134073838		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.2543C>G	4.37:g.134073838C>G	ENSP00000264360:p.Thr848Ser		Q4W5F6|Q96SF0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T848S	ENST00000264360.5	37	c.2543	CCDS34063.1	4	.	.	.	.	.	.	.	.	.	.	C	12.78	2.041840	0.35989	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.51574	0.7	5.13	5.13	0.70059	.	0.305616	0.23616	N	0.046283	T	0.28034	0.0691	N	0.05383	-0.06	0.41780	D	0.989815	B;B	0.20368	0.044;0.006	B;B	0.15870	0.014;0.005	T	0.14587	-1.0467	10	0.07813	T	0.8	.	18.2039	0.89848	0.0:1.0:0.0:0.0	.	848;848	Q9P2E7;Q96SF0	PCD10_HUMAN;.	S	848	ENSP00000264360:T848S	ENSP00000264360:T848S	T	+	2	0	PCDH10	134293288	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	4.603000	0.61105	2.387000	0.81309	0.650000	0.86243	ACT	PCDH10	-	NULL	ENSG00000138650		0.557	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PCDH10	HGNC	protein_coding	OTTHUMT00000364457.2	50	0.00	0	C	NM_032961		134073838	134073838	+1	no_errors	ENST00000264360	ensembl	human	known	69_37n	missense	51	15.00	9	SNP	1.000	G
PCMT1	5110	genome.wustl.edu	37	6	150070927	150070927	+	5'UTR	SNP	G	G	A			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr6:150070927G>A	ENST00000367380.5	+	0	97				PCMT1_ENST00000367378.1_Missense_Mutation_p.D22N|PCMT1_ENST00000367384.2_Missense_Mutation_p.D22N|PCMT1_ENST00000464889.1_Missense_Mutation_p.D22N|NUP43_ENST00000463048.3_5'Flank|PCMT1_ENST00000544496.1_5'UTR	NM_001252049.1|NM_001252050.1|NM_001252051.1|NM_001252052.1|NM_005389.2	NP_001238978.1|NP_001238979.1|NP_001238980.1|NP_001238981.1|NP_005380.2	P22061	PIMT_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase						protein methylation (GO:0006479)|protein repair (GO:0030091)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			kidney(1)|large_intestine(2)|lung(4)|ovary(1)	8		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.221)	OV - Ovarian serous cystadenocarcinoma(155;5.63e-13)|GBM - Glioblastoma multiforme(68;0.207)		ctacagcggggacgcgagcgg	0.706																																						dbGAP											0													37.0	61.0	54.0					6																	150070927		692	1591	2283	-	-	-	SO:0001623	5_prime_UTR_variant	0				CCDS5219.1, CCDS5219.2, CCDS59041.1, CCDS75533.1, CCDS75534.1	6q22.3-q24	2008-02-05			ENSG00000120265	ENSG00000120265	2.1.1.77		8728	protein-coding gene	gene with protein product		176851				1478665, 10343128	Standard	NM_005389		Approved		uc003qne.3	P22061	OTTHUMG00000015794	ENST00000367380.5:c.-111G>A	6.37:g.150070927G>A			A8K109|J3KP72|Q14661|Q16556|Q5VYC1|Q5VYC2|Q93061|Q96II9|Q99625|Q9BQV7|Q9BQV8|Q9NP03	Missense_Mutation	SNP	pfam_PCMT,tigrfam_PCMT	p.D22N	ENST00000367380.5	37	c.64		6	.	.	.	.	.	.	.	.	.	.	G	23.0	4.356729	0.82243	.	.	ENSG00000120265	ENST00000367384;ENST00000367378;ENST00000464889	T;T;T	0.52526	0.66;0.66;0.66	5.24	4.35	0.52113	.	.	.	.	.	T	0.24122	0.0584	L	0.44542	1.39	0.80722	D	1	B;B;B	0.33238	0.403;0.403;0.275	B;B;B	0.27796	0.083;0.083;0.083	T	0.11227	-1.0596	9	0.54805	T	0.06	.	13.3944	0.60843	0.0:0.0:0.8426:0.1574	.	22;22;22	F8WAX2;F8WAV5;F8WDT3	.;.;.	N	22	ENSP00000356354:D22N;ENSP00000356348:D22N;ENSP00000420813:D22N	ENSP00000356348:D22N	D	+	1	0	PCMT1	150112620	1.000000	0.71417	0.877000	0.34402	0.991000	0.79684	5.703000	0.68340	1.151000	0.42436	0.591000	0.81541	GAC	PCMT1	-	NULL	ENSG00000120265		0.706	PCMT1-201	KNOWN	basic|appris_principal	protein_coding	PCMT1	HGNC	protein_coding		17	0.00	0	G			150070927	150070927	+1	no_errors	ENST00000367384	ensembl	human	known	69_37n	missense	22	18.52	5	SNP	1.000	A
PCSK5	5125	genome.wustl.edu	37	9	78799667	78799667	+	Missense_Mutation	SNP	G	G	C	rs555029666		TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr9:78799667G>C	ENST00000545128.1	+	17	2814	c.2276G>C	c.(2275-2277)gGg>gCg	p.G759A	PCSK5_ENST00000376752.4_Missense_Mutation_p.G759A	NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	759	CRM (Cys-rich motif).				anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						TGTAGGGATGGGTTAAGGTAA	0.328																																						dbGAP											0													72.0	70.0	71.0					9																	78799667		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.2276G>C	9.37:g.78799667G>C	ENSP00000446280:p.Gly759Ala		F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	pfam_Peptidase_S8/S53,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53,superfamily_Galactose-bd-like,superfamily_Growth_fac_rcpt,superfamily_Prot_inh_propept,smart_Furin_repeat,smart_EGF-like,prints_Peptidase_S8_subtilisin-rel	p.G759A	ENST00000545128.1	37	c.2276	CCDS55320.1	9	.	.	.	.	.	.	.	.	.	.	G	24.3	4.518632	0.85495	.	.	ENSG00000099139	ENST00000545128;ENST00000376754;ENST00000376752;ENST00000424854	T;T;T	0.72505	-0.66;1.04;-0.62	5.58	5.58	0.84498	Growth factor, receptor (2);	0.000000	0.85682	D	0.000000	D	0.84488	0.5483	M	0.75777	2.31	0.80722	D	1	D;D	0.69078	0.995;0.997	D;D	0.75484	0.943;0.986	D	0.84408	0.0564	10	0.51188	T	0.08	-21.846	19.5751	0.95439	0.0:0.0:1.0:0.0	.	759;759	Q92824;Q92824-2	PCSK5_HUMAN;.	A	759;462;759;432	ENSP00000446280:G759A;ENSP00000365943:G759A;ENSP00000411654:G432A	ENSP00000365943:G759A	G	+	2	0	PCSK5	77989487	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	8.863000	0.92288	2.642000	0.89623	0.561000	0.74099	GGG	PCSK5	-	superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_EGF-like	ENSG00000099139		0.328	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK5	HGNC	protein_coding		44	0.00	0	G			78799667	78799667	+1	no_errors	ENST00000545128	ensembl	human	known	69_37n	missense	60	11.76	8	SNP	1.000	C
PHKA1	5255	genome.wustl.edu	37	X	71855080	71855080	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chrX:71855080G>A	ENST00000373542.4	-	16	1798	c.1639C>T	c.(1639-1641)Ctc>Ttc	p.L547F	PHKA1_ENST00000339490.3_Missense_Mutation_p.L547F|PHKA1_ENST00000373545.3_Missense_Mutation_p.L547F|PHKA1_ENST00000541944.1_Missense_Mutation_p.L547F|PHKA1_ENST00000373539.3_Missense_Mutation_p.L547F	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	547					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					AGGTAGGAGAGGTCTGTTCTA	0.473																																						dbGAP											0													117.0	92.0	101.0					X																	71855080		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.1639C>T	X.37:g.71855080G>A	ENSP00000362643:p.Leu547Phe		B7ZL05|B7ZL07|Q2M3D7	Missense_Mutation	SNP	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	p.L547F	ENST00000373542.4	37	c.1639	CCDS14421.1	X	.	.	.	.	.	.	.	.	.	.	G	18.70	3.681145	0.68042	.	.	ENSG00000067177	ENST00000373545;ENST00000373542;ENST00000541944;ENST00000339490;ENST00000373539	D;D;D;D;D	0.95001	-3.53;-3.58;-3.5;-3.53;-3.56	4.47	4.47	0.54385	Glycoside hydrolase 15-related (1);	0.069042	0.64402	D	0.000018	D	0.96046	0.8712	M	0.83774	2.66	0.58432	D	0.999998	P;P;P	0.50272	0.664;0.648;0.933	B;P;P	0.53102	0.307;0.596;0.718	D	0.96169	0.9121	10	0.54805	T	0.06	-14.2466	13.9669	0.64213	0.0:0.0:1.0:0.0	.	547;547;547	B7ZL07;P46020-2;P46020	.;.;KPB1_HUMAN	F	547	ENSP00000362646:L547F;ENSP00000362643:L547F;ENSP00000441251:L547F;ENSP00000342469:L547F;ENSP00000362640:L547F	ENSP00000342469:L547F	L	-	1	0	PHKA1	71771805	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	3.088000	0.50175	1.956000	0.56807	0.415000	0.27848	CTC	PHKA1	-	pfam_Glyco_hydro_15	ENSG00000067177		0.473	PHKA1-001	KNOWN	basic|CCDS	protein_coding	PHKA1	HGNC	protein_coding	OTTHUMT00000058896.1	69	0.00	0	G			71855080	71855080	-1	no_errors	ENST00000373539	ensembl	human	known	69_37n	missense	69	18.82	16	SNP	1.000	A
PLAT	5327	genome.wustl.edu	37	8	42045512	42045512	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr8:42045512G>T	ENST00000220809.4	-	5	532	c.276C>A	c.(274-276)ttC>ttA	p.F92L	PLAT_ENST00000524009.1_Missense_Mutation_p.F92L|PLAT_ENST00000270189.6_Missense_Mutation_p.F92L|PLAT_ENST00000429710.2_Intron|PLAT_ENST00000519510.1_Missense_Mutation_p.F92L|PLAT_ENST00000352041.3_Missense_Mutation_p.F46L|PLAT_ENST00000429089.2_Missense_Mutation_p.F92L	NM_000930.3	NP_000921.1	P00750	TPA_HUMAN	plasminogen activator, tissue	92	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.				blood coagulation (GO:0007596)|cellular protein modification process (GO:0006464)|fibrinolysis (GO:0042730)|negative regulation of proteolysis (GO:0045861)|plasminogen activation (GO:0031639)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of ovulation (GO:0060279)|proteolysis (GO:0006508)|regulation of synaptic plasticity (GO:0048167)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|smooth muscle cell migration (GO:0014909)|synaptic transmission, glutamatergic (GO:0035249)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|secretory granule (GO:0030141)|synapse (GO:0045202)	serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(10)|skin(1)|soft_tissue(1)|urinary_tract(1)	27	all_cancers(6;3.84e-26)|all_epithelial(6;9.61e-28)|all_lung(13;7.2e-13)|Lung NSC(13;1.18e-11)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000378)|Lung NSC(58;0.00145)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00135)|Colorectal(10;0.00165)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)		Aminocaproic Acid(DB00513)|Ibuprofen(DB01050)|Iloprost(DB01088)|Urokinase(DB00013)	TGCCCCCGTTGAAACACCTTG	0.542																																						dbGAP											0													76.0	71.0	73.0					8																	42045512		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6126.1, CCDS6127.1	8p11.21	2012-10-02			ENSG00000104368	ENSG00000104368			9051	protein-coding gene	gene with protein product		173370					Standard	NM_033011		Approved		uc003xos.2	P00750	OTTHUMG00000164072	ENST00000220809.4:c.276C>A	8.37:g.42045512G>T	ENSP00000220809:p.Phe92Leu		A8K022|B2R8E8|Q15103|Q503B0|Q6PJA5|Q7Z7N2|Q86YK8|Q9BU99|Q9BZW1	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_Kringle,pfam_Fibronectin_type1,pfam_EGF-like_dom,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_Fibronectin_type1,smart_Kringle,smart_Peptidase_S1_S6,pfscan_EG-like_dom,pfscan_Fibronectin_type1,pfscan_Kringle,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.F92L	ENST00000220809.4	37	c.276	CCDS6126.1	8	.	.	.	.	.	.	.	.	.	.	G	0.276	-0.989526	0.02162	.	.	ENSG00000104368	ENST00000270189;ENST00000429089;ENST00000220809;ENST00000352041;ENST00000519510;ENST00000524009;ENST00000520523;ENST00000521694	D;D;D;D;D;D;D;D	0.91464	-2.85;-2.85;-2.85;-2.85;-2.85;-2.85;-2.85;-2.85	5.73	3.96	0.45880	EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.104845	0.64402	N	0.000002	T	0.79058	0.4382	N	0.02192	-0.645	0.37157	D	0.902402	B;B;B;B	0.34349	0.002;0.45;0.001;0.004	B;B;B;B	0.42163	0.012;0.378;0.001;0.013	T	0.75139	-0.3423	10	0.08179	T	0.78	.	12.6768	0.56899	0.1343:0.0:0.8657:0.0	.	92;92;46;92	B4DN26;B4DV92;P00750-3;P00750	.;.;.;TPA_HUMAN	L	92;92;92;46;92;92;92;92	ENSP00000270189:F92L;ENSP00000392045:F92L;ENSP00000220809:F92L;ENSP00000270188:F46L;ENSP00000428886:F92L;ENSP00000429401:F92L;ENSP00000428797:F92L;ENSP00000429801:F92L	ENSP00000220809:F92L	F	-	3	2	PLAT	42164669	1.000000	0.71417	0.716000	0.30569	0.003000	0.03518	1.590000	0.36654	0.782000	0.33613	-0.137000	0.14449	TTC	PLAT	-	pfam_EGF-like_dom,pfscan_EG-like_dom	ENSG00000104368		0.542	PLAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLAT	HGNC	protein_coding	OTTHUMT00000377100.1	37	0.00	0	G	NM_000930		42045512	42045512	-1	no_errors	ENST00000220809	ensembl	human	known	69_37n	missense	27	15.62	5	SNP	1.000	T
PLCD3	113026	genome.wustl.edu	37	17	43195728	43195728	+	Missense_Mutation	SNP	A	A	T	rs375623406		TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr17:43195728A>T	ENST00000322765.5	-	6	1158	c.1045T>A	c.(1045-1047)Tct>Act	p.S349T	PLCD3_ENST00000540511.1_5'UTR	NM_133373.3	NP_588614.1	Q8N3E9	PLCD3_HUMAN	phospholipase C, delta 3	349	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				angiogenesis (GO:0001525)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|labyrinthine layer blood vessel development (GO:0060716)|lipid catabolic process (GO:0016042)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			breast(2)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)|stomach(2)|urinary_tract(2)	17						TGGGAGGAAGAGATGAAGTAG	0.577																																						dbGAP											0													144.0	167.0	159.0					17																	43195728		2063	4204	6267	-	-	-	SO:0001583	missense	0			AC002117	CCDS74077.1	17q21	2012-04-20			ENSG00000161714	ENSG00000161714	3.1.4.11		9061	protein-coding gene	gene with protein product		608795				10702670, 9056492	Standard	NM_133373		Approved		uc002iib.3	Q8N3E9	OTTHUMG00000168029	ENST00000322765.5:c.1045T>A	17.37:g.43195728A>T	ENSP00000313731:p.Ser349Thr		Q8TEC1|Q8TF37|Q96FL6	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,prints_Pinositol_PLipase_C,pfscan_C2_membr_targeting,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y	p.S349T	ENST00000322765.5	37	c.1045		17	.	.	.	.	.	.	.	.	.	.	A	25.8	4.674358	0.88445	.	.	ENSG00000161714	ENST00000322765	T	0.66638	-0.22	4.35	3.26	0.37387	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.000000	0.85682	D	0.000000	T	0.75722	0.3888	.	.	.	0.39091	D	0.961095	D	0.61080	0.989	P	0.59643	0.861	T	0.77973	-0.2386	9	0.72032	D	0.01	.	9.337	0.38056	0.9109:0.0:0.0891:0.0	.	349	Q8N3E9	PLCD3_HUMAN	T	349	ENSP00000313731:S349T	ENSP00000313731:S349T	S	-	1	0	PLCD3	40551254	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.095000	0.71439	0.794000	0.33899	0.368000	0.22195	TCT	PLCD3	-	pfam_PLipase_C_PInositol-sp_X_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_PInositol-sp_X_dom,prints_Pinositol_PLipase_C,pfscan_PLipase_C_PInositol-sp_X_dom	ENSG00000161714		0.577	PLCD3-201	KNOWN	basic|appris_principal	protein_coding	PLCD3	HGNC	protein_coding		70	0.00	0	A	NM_133373		43195728	43195728	-1	no_errors	ENST00000322765	ensembl	human	known	69_37n	missense	68	33.33	34	SNP	1.000	T
POGLUT1	56983	genome.wustl.edu	37	3	119209519	119209519	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr3:119209519C>G	ENST00000295588.4	+	9	1003	c.919C>G	c.(919-921)Cca>Gca	p.P307A		NM_152305.2	NP_689518.1	Q8NBL1	PGLT1_HUMAN	protein O-glucosyltransferase 1	307					cardiovascular system development (GO:0072358)|Notch signaling pathway (GO:0007219)|protein O-linked glycosylation (GO:0006493)|regulation of Notch signaling pathway (GO:0008593)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	glucosyltransferase activity (GO:0046527)|protein xylosyltransferase activity (GO:0030158)|UDP-glucosyltransferase activity (GO:0035251)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|prostate(1)	16						ACAGCTGAAGCCATGGGTTCA	0.448																																						dbGAP											0													150.0	140.0	143.0					3																	119209519		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC030614	CCDS2988.1	3q13.33	2010-09-29	2010-09-29	2010-09-29	ENSG00000163389	ENSG00000163389			22954	protein-coding gene	gene with protein product	"""KDELC family like 1"""	615618	"""chromosome 3 open reading frame 9"", ""KTEL (Lys-Tyr-Glu-Leu) containing 1"""	C3orf9, KTELC1		16524674	Standard	NM_152305		Approved	MDS010, MGC32995, 9630046K23Rik, MDSRP, hCLP46, KDELCL1, Rumi	uc003ecm.3	Q8NBL1	OTTHUMG00000159379	ENST00000295588.4:c.919C>G	3.37:g.119209519C>G	ENSP00000295588:p.Pro307Ala		B2RD13|Q53GJ4|Q8N2T1	Missense_Mutation	SNP	pfam_LipoPS_modifying,smart_LipoPS_modifying	p.P307A	ENST00000295588.4	37	c.919	CCDS2988.1	3	.	.	.	.	.	.	.	.	.	.	C	24.1	4.491426	0.84962	.	.	ENSG00000163389	ENST00000295588	T	0.33438	1.41	6.16	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.55752	0.1940	M	0.82056	2.57	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.56098	-0.8035	10	0.54805	T	0.06	-12.3948	11.9748	0.53085	0.0:0.9188:0.0:0.0812	.	307	Q8NBL1	PGLT1_HUMAN	A	307	ENSP00000295588:P307A	ENSP00000295588:P307A	P	+	1	0	POGLUT1	120692209	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.126000	0.77201	2.937000	0.99478	0.650000	0.86243	CCA	POGLUT1	-	pfam_LipoPS_modifying,smart_LipoPS_modifying	ENSG00000163389		0.448	POGLUT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POGLUT1	HGNC	protein_coding	OTTHUMT00000355034.2	97	0.00	0	C	NM_152305		119209519	119209519	+1	no_errors	ENST00000295588	ensembl	human	known	69_37n	missense	106	14.52	18	SNP	1.000	G
POP1	10940	genome.wustl.edu	37	8	99158821	99158821	+	Silent	SNP	T	T	A			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr8:99158821T>A	ENST00000401707.2	+	12	1701	c.1620T>A	c.(1618-1620)ctT>ctA	p.L540L	POP1_ENST00000349693.3_Silent_p.L540L	NM_001145860.1|NM_001145861.1	NP_001139332.1|NP_001139333.1	Q99575	POP1_HUMAN	processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)	540					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA 5'-leader removal (GO:0001682)|tRNA catabolic process (GO:0016078)	extracellular space (GO:0005615)|nucleolar ribonuclease P complex (GO:0005655)|ribonuclease MRP complex (GO:0000172)	poly(A) RNA binding (GO:0044822)|ribonuclease MRP activity (GO:0000171)|ribonuclease P activity (GO:0004526)			autonomic_ganglia(1)|breast(3)|endometrium(4)|large_intestine(9)|lung(15)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.145)			GACAGCTGCTTCTGGAGGGTG	0.398																																						dbGAP											0													186.0	176.0	179.0					8																	99158821		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D31765	CCDS6277.1	8q22.2	2012-05-21			ENSG00000104356	ENSG00000104356			30129	protein-coding gene	gene with protein product	"""processing of precursors 1"""	602486				10199568, 8918471	Standard	NM_015029		Approved		uc011lgv.2	Q99575	OTTHUMG00000164635	ENST00000401707.2:c.1620T>A	8.37:g.99158821T>A			A8K5W9|Q15037	Silent	SNP	pfam_RNase_P/MRP_POP1,pfam_POPLD	p.L540	ENST00000401707.2	37	c.1620	CCDS6277.1	8																																																																																			POP1	-	NULL	ENSG00000104356		0.398	POP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POP1	HGNC	protein_coding	OTTHUMT00000379470.1	101	0.00	0	T	NM_015029		99158821	99158821	+1	no_errors	ENST00000349693	ensembl	human	known	69_37n	silent	199	13.10	30	SNP	0.966	A
PRICKLE2	166336	genome.wustl.edu	37	3	64142909	64142909	+	Frame_Shift_Del	DEL	G	G	-			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr3:64142909delG	ENST00000295902.6	-	5	1114	c.529delC	c.(529-531)caafs	p.Q177fs	PRICKLE2_ENST00000564377.1_Frame_Shift_Del_p.Q233fs	NM_198859.3	NP_942559.1	Q7Z3G6	PRIC2_HUMAN	prickle homolog 2 (Drosophila)	177	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|neuron projection development (GO:0031175)	apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(9)|liver(1)|lung(10)|ovary(4)|prostate(2)|skin(2)|stomach(1)	32		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)		TTCCCATCTTGGTAAAAGTAG	0.562																																						dbGAP											0													81.0	69.0	73.0					3																	64142909		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AK127839	CCDS2902.1	3p14.3	2006-09-12	2006-09-12		ENSG00000163637	ENSG00000163637			20340	protein-coding gene	gene with protein product		608501	"""prickle-like 2 (Drosophila)"""			12525887	Standard	NM_198859		Approved	DKFZp686D143	uc003dmf.3	Q7Z3G6	OTTHUMG00000158789	ENST00000295902.6:c.529delC	3.37:g.64142909delG	ENSP00000295902:p.Gln177fs		Q0VF44	Frame_Shift_Del	DEL	pfam_PET_domain,pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.Q177fs	ENST00000295902.6	37	c.529	CCDS2902.1	3																																																																																			PRICKLE2	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	ENSG00000163637		0.562	PRICKLE2-001	KNOWN	basic|CCDS	protein_coding	PRICKLE2	HGNC	protein_coding	OTTHUMT00000352219.1	22	0.00	0	G	NM_198859		64142909	64142909	-1	no_errors	ENST00000295902	ensembl	human	known	69_37n	frame_shift_del	27	12.12	4	DEL	1.000	-
PSENEN	55851	genome.wustl.edu	37	19	36237374	36237374	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr19:36237374G>A	ENST00000587708.2	+	3	799	c.116G>A	c.(115-117)cGa>cAa	p.R39Q	PSENEN_ENST00000222266.2_Missense_Mutation_p.R39Q|U2AF1L4_ENST00000292879.5_5'Flank|AC002398.11_ENST00000585365.1_RNA|U2AF1L4_ENST00000588100.1_5'Flank|U2AF1L4_ENST00000378975.3_5'Flank|U2AF1L4_ENST00000412391.2_5'Flank|AD000671.6_ENST00000589807.1_5'Flank|AC002398.11_ENST00000591091.1_RNA|LIN37_ENST00000301159.9_5'Flank|AC002398.9_ENST00000591613.2_Missense_Mutation_p.R39Q|PSENEN_ENST00000591949.1_Missense_Mutation_p.R39Q			Q9NZ42	PEN2_HUMAN	presenilin enhancer gamma secretase subunit	39					amyloid precursor protein catabolic process (GO:0042987)|apoptotic signaling pathway (GO:0097190)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|protein processing (GO:0016485)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.R39Q(1)		central_nervous_system(1)|kidney(1)|liver(1)|lung(2)|ovary(2)|prostate(1)	8	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TGGTTCTTCCGAGAGGCCTTC	0.512																																						dbGAP											1	Substitution - Missense(1)	liver(1)											137.0	134.0	135.0					19																	36237374		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF220053	CCDS12474.1	19q13.12	2014-09-17	2013-09-12			ENSG00000205155			30100	protein-coding gene	gene with protein product		607632	"""presenilin enhancer 2 homolog (C. elegans)"""			12110170, 12660785	Standard	NM_172341		Approved	PEN2	uc002obi.1	Q9NZ42		ENST00000587708.2:c.116G>A	19.37:g.36237374G>A	ENSP00000468411:p.Arg39Gln		B2R5L9	Missense_Mutation	SNP	pfam_Gamma_Secretase_Asp_P_PEN2	p.R39Q	ENST00000587708.2	37	c.116	CCDS12474.1	19	.	.	.	.	.	.	.	.	.	.	G	15.67	2.903513	0.52333	.	.	ENSG00000205155	ENST00000222266	T	0.78595	-1.19	5.29	4.23	0.50019	.	0.285984	0.30134	N	0.010339	T	0.69079	0.3071	L	0.48986	1.54	0.33614	D	0.603954	B	0.24576	0.106	B	0.13407	0.009	T	0.72527	-0.4266	10	0.37606	T	0.19	-1.3183	9.6666	0.39988	0.1625:0.0:0.8375:0.0	.	39	Q9NZ42	PEN2_HUMAN	Q	39	ENSP00000222266:R39Q	ENSP00000222266:R39Q	R	+	2	0	PSENEN	40929214	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.672000	0.54583	1.432000	0.47375	0.655000	0.94253	CGA	PSENEN	-	pfam_Gamma_Secretase_Asp_P_PEN2	ENSG00000205155		0.512	PSENEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSENEN	HGNC	protein_coding	OTTHUMT00000459101.2	120	0.00	0	G	NM_172341		36237374	36237374	+1	no_errors	ENST00000222266	ensembl	human	known	69_37n	missense	116	17.73	25	SNP	0.996	A
PRODH2	58510	genome.wustl.edu	37	19	36297349	36297349	+	Silent	SNP	A	A	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr19:36297349A>G	ENST00000301175.3	-	8	1229	c.1212T>C	c.(1210-1212)taT>taC	p.Y404Y		NM_021232.1	NP_067055.1	Q9UF12	PROD2_HUMAN	proline dehydrogenase (oxidase) 2	404					proline catabolic process to glutamate (GO:0010133)	mitochondrial inner membrane (GO:0005743)	proline dehydrogenase activity (GO:0004657)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TGGTGGCCTCATAGTCAGGCT	0.587																																						dbGAP											0													91.0	82.0	85.0					19																	36297349		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U80018	CCDS12478.1	19q13.1	2014-07-11				ENSG00000250799			17325	protein-coding gene	gene with protein product							Standard	NM_021232		Approved	HSPOX1	uc002obx.1	Q9UF12		ENST00000301175.3:c.1212T>C	19.37:g.36297349A>G				Silent	SNP	pfam_Proline_DH	p.Y404	ENST00000301175.3	37	c.1212	CCDS12478.1	19																																																																																			PRODH2	-	pfam_Proline_DH	ENSG00000250799		0.587	PRODH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRODH2	HGNC	protein_coding	OTTHUMT00000452552.2	23	0.00	0	A	NM_021232		36297349	36297349	-1	no_errors	ENST00000301175	ensembl	human	known	69_37n	silent	26	18.75	6	SNP	0.462	G
PTPN23	25930	genome.wustl.edu	37	3	47452898	47452898	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr3:47452898C>G	ENST00000265562.4	+	20	3687	c.3610C>G	c.(3610-3612)Cat>Gat	p.H1204D	PTPN23_ENST00000431726.1_Missense_Mutation_p.H1078D	NM_015466.2	NP_056281.1	Q9H3S7	PTN23_HUMAN	protein tyrosine phosphatase, non-receptor type 23	1204	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cilium morphogenesis (GO:0060271)|negative regulation of epithelial cell migration (GO:0010633)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of adherens junction organization (GO:1903393)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of homophilic cell adhesion (GO:1903387)|protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|central_nervous_system(1)|large_intestine(5)|lung(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.000271)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TGCGCAGGAACATGATGCCCG	0.617																																						dbGAP											0													79.0	66.0	70.0					3																	47452898		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB025194	CCDS2754.1	3p21.3	2011-06-09			ENSG00000076201	ENSG00000076201		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	14406	protein-coding gene	gene with protein product		606584				11095967	Standard	NM_015466		Approved	DKFZP564F0923, KIAA1471, HD-PTP	uc003crf.1	Q9H3S7	OTTHUMG00000133520	ENST00000265562.4:c.3610C>G	3.37:g.47452898C>G	ENSP00000265562:p.His1204Asp		A8K0D7|Q7KZF8|Q8N6Z5|Q9BSR5|Q9P257|Q9UG03|Q9UMZ4	Missense_Mutation	SNP	pfam_BRO1_dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_BRO1_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.H1204D	ENST00000265562.4	37	c.3610	CCDS2754.1	3	.	.	.	.	.	.	.	.	.	.	C	10.41	1.341928	0.24339	.	.	ENSG00000076201	ENST00000265562	T	0.02498	4.27	4.51	4.51	0.55191	Protein-tyrosine phosphatase, receptor/non-receptor type (1);	0.932468	0.08988	N	0.864782	T	0.03095	0.0091	N	0.20986	0.625	0.26577	N	0.973448	B;B	0.14012	0.009;0.009	B;B	0.12156	0.007;0.004	T	0.28839	-1.0031	10	0.66056	D	0.02	-0.6714	9.9528	0.41649	0.3198:0.6802:0.0:0.0	.	1078;1204	B4DST5;Q9H3S7	.;PTN23_HUMAN	D	1204	ENSP00000265562:H1204D	ENSP00000265562:H1204D	H	+	1	0	PTPN23	47427902	0.997000	0.39634	0.071000	0.20095	0.309000	0.27889	5.008000	0.63991	2.317000	0.78254	0.563000	0.77884	CAT	PTPN23	-	smart_Tyr_Pase_rcpt/non-rcpt	ENSG00000076201		0.617	PTPN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN23	HGNC	protein_coding	OTTHUMT00000257492.2	15	0.00	0	C	NM_015466		47452898	47452898	+1	no_errors	ENST00000265562	ensembl	human	known	69_37n	missense	16	30.43	7	SNP	0.844	G
RAB11FIP1	80223	genome.wustl.edu	37	8	37730075	37730075	+	Missense_Mutation	SNP	C	C	G	rs549065236	byFrequency	TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr8:37730075C>G	ENST00000330843.4	-	4	2257	c.2245G>C	c.(2245-2247)Gac>Cac	p.D749H	RAB11FIP1_ENST00000524118.1_Intron|RAB11FIP1_ENST00000522727.1_Intron|RAB11FIP1_ENST00000523182.1_5'UTR|RAB11FIP1_ENST00000287263.4_Intron	NM_001002814.2	NP_001002814.2	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 (class I)	749					protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(4)|endometrium(3)|large_intestine(6)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	49		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)			AAGTCTCTGTCTCCTCCTGCT	0.582																																						dbGAP											0													91.0	84.0	87.0					8																	37730075		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK092296	CCDS34881.1, CCDS34882.1	8p11.22	2005-10-04			ENSG00000156675	ENSG00000156675			30265	protein-coding gene	gene with protein product		608737				11786538, 11495908	Standard	NM_001002814		Approved	RCP, FLJ22622, FLJ22524, Rab11-FIP1	uc003xkm.2	Q6WKZ4	OTTHUMG00000164026	ENST00000330843.4:c.2245G>C	8.37:g.37730075C>G	ENSP00000331342:p.Asp749His		J3KNP0|Q307T1|Q6AZK4|Q6WKZ2|Q6WKZ6|Q86YV4|Q8TDL1|Q9H642	Missense_Mutation	SNP	pfam_Rab-bd_FIP-RBD,pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.D749H	ENST00000330843.4	37	c.2245	CCDS34882.1	8	.	.	.	.	.	.	.	.	.	.	C	8.230	0.804364	0.16467	.	.	ENSG00000156675	ENST00000330843	T	0.11821	2.74	4.29	-3.21	0.05140	.	1.199300	0.06300	N	0.700791	T	0.07548	0.0190	N	0.14661	0.345	0.09310	N	0.999999	B;B	0.18166	0.026;0.002	B;B	0.17979	0.02;0.002	T	0.39143	-0.9628	10	0.45353	T	0.12	.	5.751	0.18146	0.0:0.4921:0.1709:0.337	.	78;749	Q67C35;Q6WKZ4	.;RFIP1_HUMAN	H	749	ENSP00000331342:D749H	ENSP00000331342:D749H	D	-	1	0	RAB11FIP1	37849233	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-2.184000	0.01254	-1.064000	0.03172	-0.373000	0.07131	GAC	RAB11FIP1	-	NULL	ENSG00000156675		0.582	RAB11FIP1-002	KNOWN	basic|CCDS	protein_coding	RAB11FIP1	HGNC	protein_coding	OTTHUMT00000376816.1	53	0.00	0	C	NM_025151		37730075	37730075	-1	no_errors	ENST00000330843	ensembl	human	known	69_37n	missense	51	15.00	9	SNP	0.000	G
RANBP3L	202151	genome.wustl.edu	37	5	36268305	36268305	+	Intron	SNP	A	A	T			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr5:36268305A>T	ENST00000296604.3	-	4	754				RANBP3L_ENST00000502994.1_Missense_Mutation_p.H111Q|RANBP3L_ENST00000515759.1_Intron	NM_145000.3	NP_659437.3	Q86VV4	RNB3L_HUMAN	RAN binding protein 3-like						intracellular transport (GO:0046907)					endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|urinary_tract(1)	16	all_lung(31;4.52e-05)		Epithelial(62;0.0543)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.149)|Colorectal(62;0.202)			CTGGCCCAGAATGGGGGAAGG	0.383																																						dbGAP											0													124.0	122.0	122.0					5																	36268305		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			BC047660	CCDS3918.1, CCDS54843.1	5p13.2	2008-02-05			ENSG00000164188	ENSG00000164188			26353	protein-coding gene	gene with protein product						12477932	Standard	NM_145000		Approved	FLJ25422	uc011cow.2	Q86VV4	OTTHUMG00000131110	ENST00000296604.3:c.268+1186T>A	5.37:g.36268305A>T			B7Z866|E9PGP9|Q96LK2	Missense_Mutation	SNP	pfam_Ran_bind_dom,smart_Ran_bind_dom,pfscan_Ran_bind_dom	p.H111Q	ENST00000296604.3	37	c.333	CCDS3918.1	5	.	.	.	.	.	.	.	.	.	.	A	8.953	0.968632	0.18659	.	.	ENSG00000164188	ENST00000502994	T	0.21031	2.03	4.31	0.508	0.16972	.	.	.	.	.	T	0.08980	0.0222	N	0.08118	0	0.26860	N	0.96798	B	0.16802	0.019	B	0.14023	0.01	T	0.28713	-1.0035	9	0.46703	T	0.11	.	2.8975	0.05694	0.6138:0.0:0.1988:0.1875	.	111	E9PGP9	.	Q	111	ENSP00000421853:H111Q	ENSP00000421853:H111Q	H	-	3	2	RANBP3L	36304062	0.155000	0.22806	0.223000	0.23860	0.620000	0.37586	0.229000	0.17833	0.004000	0.14682	0.528000	0.53228	CAT	RANBP3L	-	NULL	ENSG00000164188		0.383	RANBP3L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RANBP3L	HGNC	protein_coding	OTTHUMT00000253773.2	76	0.00	0	A	NM_145000		36268305	36268305	-1	no_errors	ENST00000502994	ensembl	human	novel	69_37n	missense	75	12.79	11	SNP	0.348	T
RB1CC1	9821	genome.wustl.edu	37	8	53586778	53586778	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr8:53586778C>T	ENST00000025008.5	-	7	1152	c.629G>A	c.(628-630)aGa>aAa	p.R210K	RB1CC1_ENST00000435644.2_Missense_Mutation_p.R210K|RB1CC1_ENST00000539297.1_Missense_Mutation_p.R210K|RB1CC1_ENST00000521611.1_Intron	NM_014781.4	NP_055596.3	Q8TDY2	RBCC1_HUMAN	RB1-inducible coiled-coil 1	210					autophagic vacuole assembly (GO:0000045)|cell cycle (GO:0007049)|heart development (GO:0007507)|JNK cascade (GO:0007254)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell size (GO:0045793)|positive regulation of protein phosphorylation (GO:0001934)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)				NS(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(19)|ovary(8)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	60		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				GTAACTATGTCTGGTTAGGCA	0.398																																					GBM(180;1701 2102 13475 42023 52570)	dbGAP											0													165.0	157.0	160.0					8																	53586778		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB059622	CCDS34892.1, CCDS47856.1	8q11	2014-06-13				ENSG00000023287			15574	protein-coding gene	gene with protein product	"""200 kDa FAK family kinase-interacting protein"", ""phosphatase 1, regulatory subunit 131"""	606837				11850849, 7724523, 18443221	Standard	NM_014781		Approved	KIAA0203, Cc1, DRAGOU14, FIP200, ATG17, PPP1R131	uc003xre.4	Q8TDY2		ENST00000025008.5:c.629G>A	8.37:g.53586778C>T	ENSP00000025008:p.Arg210Lys		Q86YR4|Q8WVU9|Q92601	Missense_Mutation	SNP	pfam_Autophagy-rel_p11	p.R210K	ENST00000025008.5	37	c.629	CCDS34892.1	8	.	.	.	.	.	.	.	.	.	.	C	21.4	4.146917	0.77888	.	.	ENSG00000023287	ENST00000025008;ENST00000435644;ENST00000539297	T;T;T	0.14640	2.49;2.49;2.49	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.25975	0.0633	L	0.57536	1.79	0.58432	D	0.999992	D;P	0.54601	0.967;0.944	P;B	0.50405	0.64;0.437	T	0.00370	-1.1783	10	0.41790	T	0.15	-19.1747	19.4471	0.94852	0.0:1.0:0.0:0.0	.	210;210	Q8TDY2-2;Q8TDY2	.;RBCC1_HUMAN	K	210	ENSP00000025008:R210K;ENSP00000396067:R210K;ENSP00000445960:R210K	ENSP00000025008:R210K	R	-	2	0	RB1CC1	53749331	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.664000	0.68045	2.663000	0.90544	0.467000	0.42956	AGA	RB1CC1	-	NULL	ENSG00000023287		0.398	RB1CC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RB1CC1	HGNC	protein_coding	OTTHUMT00000378011.1	76	0.00	0	C	NM_014781		53586778	53586778	-1	no_errors	ENST00000025008	ensembl	human	known	69_37n	missense	162	10.50	19	SNP	1.000	T
RBM12	10137	genome.wustl.edu	37	20	34240553	34240553	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr20:34240553C>T	ENST00000374114.3	-	3	2955	c.2692G>A	c.(2692-2694)Ggt>Agt	p.G898S	CPNE1_ENST00000317677.5_Intron|RBM12_ENST00000359646.1_Missense_Mutation_p.G898S|CPNE1_ENST00000397442.1_Intron|RBM12_ENST00000374104.3_Missense_Mutation_p.G898S|RP1-309K20.6_ENST00000541176.2_Intron|CPNE1_ENST00000397446.1_Intron|CPNE1_ENST00000397443.1_Intron|CPNE1_ENST00000317619.3_Intron|CPNE1_ENST00000397445.1_Intron|CPNE1_ENST00000352393.4_Intron	NM_001198838.1|NM_001198840.1|NM_006047.5	NP_001185767.1|NP_001185769.1|NP_006038.2	Q9NTZ6	RBM12_HUMAN	RNA binding motif protein 12	898	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.					nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(7)|kidney(1)|large_intestine(3)|lung(14)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			ATGGCTTCACCTGTGGGCATA	0.393																																						dbGAP											0													95.0	93.0	94.0					20																	34240553		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ289772	CCDS13261.1	20q11.21	2013-02-12			ENSG00000244462	ENSG00000244462		"""RNA binding motif (RRM) containing"""	9898	protein-coding gene	gene with protein product		607179				11435693	Standard	NM_006047		Approved	HRIHFB2091, KIAA0765, SWAN	uc021wcq.1	Q9NTZ6	OTTHUMG00000032350	ENST00000374114.3:c.2692G>A	20.37:g.34240553C>T	ENSP00000363228:p.Gly898Ser		B3KRU2|E1P5R6|O94865|Q8N3B1|Q9H196	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.G898S	ENST00000374114.3	37	c.2692	CCDS13261.1	20	.	.	.	.	.	.	.	.	.	.	C	17.81	3.479618	0.63849	.	.	ENSG00000244462	ENST00000374114;ENST00000359646;ENST00000374104;ENST00000349942	T;T;T	0.10668	2.85;2.85;2.85	5.27	5.27	0.74061	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.48352	0.1495	H	0.95260	3.645	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.63897	-0.6533	10	0.87932	D	0	-4.5896	19.078	0.93171	0.0:1.0:0.0:0.0	.	898	Q9NTZ6	RBM12_HUMAN	S	898;898;898;697	ENSP00000363228:G898S;ENSP00000352668:G898S;ENSP00000363217:G898S	ENSP00000339879:G697S	G	-	1	0	RBM12	33703967	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.320000	0.79064	2.740000	0.93945	0.650000	0.86243	GGT	RBM12	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000244462		0.393	RBM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM12	HGNC	protein_coding	OTTHUMT00000078894.1	59	0.00	0	C	NM_006047		34240553	34240553	-1	no_errors	ENST00000359646	ensembl	human	known	69_37n	missense	70	21.35	19	SNP	1.000	T
RIMS4	140730	genome.wustl.edu	37	20	43386365	43386365	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr20:43386365C>G	ENST00000372851.3	-	4	463	c.397G>C	c.(397-399)Gac>Cac	p.D133H	RIMS4_ENST00000541604.2_Missense_Mutation_p.D134H	NM_001205317.1|NM_182970.3	NP_001192246.1|NP_892015.1	Q9H426	RIMS4_HUMAN	regulating synaptic membrane exocytosis 4	133	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|neurotransmitter transport (GO:0006836)|regulation of membrane potential (GO:0042391)	cell junction (GO:0030054)|presynaptic active zone (GO:0048786)|synaptic membrane (GO:0097060)				central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(5)|urinary_tract(1)	29		Myeloproliferative disorder(115;0.0122)				TGGATAATGTCCACCTCCAAC	0.592																																						dbGAP											0													134.0	108.0	117.0					20																	43386365		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13338.1, CCDS56191.1	20q13.12	2005-02-03	2003-06-18	2003-06-20	ENSG00000101098	ENSG00000101098			16183	protein-coding gene	gene with protein product		611601	"""chromosome 20 open reading frame 190"""	C20orf190		12620390	Standard	NM_182970		Approved	dJ781B1.3	uc010ggu.3	Q9H426	OTTHUMG00000032546	ENST00000372851.3:c.397G>C	20.37:g.43386365C>G	ENSP00000361942:p.Asp133His		A4FU94|E1P613|Q3MI44|Q5JWT7	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.D134H	ENST00000372851.3	37	c.400	CCDS13338.1	20	.	.	.	.	.	.	.	.	.	.	C	20.9	4.068286	0.76301	.	.	ENSG00000101098	ENST00000372851;ENST00000541604	T;T	0.68624	-0.34;-0.34	5.76	5.76	0.90799	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.048443	0.85682	D	0.000000	T	0.58438	0.2122	N	0.02842	-0.48	0.80722	D	1	P;P	0.42409	0.779;0.779	P;P	0.50314	0.637;0.637	T	0.70044	-0.4980	10	0.87932	D	0	.	19.9738	0.97296	0.0:1.0:0.0:0.0	.	134;133	E1P613;Q9H426	.;RIMS4_HUMAN	H	133;134	ENSP00000361942:D133H;ENSP00000439287:D134H	ENSP00000361942:D133H	D	-	1	0	RIMS4	42819779	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.818000	0.86416	2.732000	0.93576	0.655000	0.94253	GAC	RIMS4	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	ENSG00000101098		0.592	RIMS4-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	RIMS4	HGNC	protein_coding	OTTHUMT00000101027.2	26	0.00	0	C	NM_182970		43386365	43386365	-1	no_errors	ENST00000541604	ensembl	human	known	69_37n	missense	38	13.64	6	SNP	1.000	G
ROCK2	9475	genome.wustl.edu	37	2	11338833	11338833	+	Frame_Shift_Del	DEL	T	T	-			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr2:11338833delT	ENST00000315872.6	-	24	3426	c.2978delA	c.(2977-2979)aatfs	p.N994fs	ROCK2_ENST00000401753.1_Frame_Shift_Del_p.N751fs	NM_004850.3	NP_004841.2	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein kinase 2	994	RHOA binding. {ECO:0000250}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|neural tube closure (GO:0001843)|positive regulation of centrosome duplication (GO:0010825)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of circadian rhythm (GO:0042752)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|rhythmic process (GO:0048511)|smooth muscle contraction (GO:0006939)	centrosome (GO:0005813)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole centrosome (GO:0031616)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(10)|prostate(1)|skin(4)|stomach(3)|urinary_tract(2)	43	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		CAATTTGTTATTTAATTCTTC	0.279																																						dbGAP											0													61.0	56.0	57.0					2																	11338833		1803	4065	5868	-	-	-	SO:0001589	frameshift_variant	0			D87931	CCDS42654.1	2p24	2013-01-10			ENSG00000134318	ENSG00000134318	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10252	protein-coding gene	gene with protein product		604002				9933571	Standard	NM_004850		Approved		uc002rbd.1	O75116	OTTHUMG00000149916	ENST00000315872.6:c.2978delA	2.37:g.11338833delT	ENSP00000317985:p.Asn994fs		Q53QZ0|Q53SJ7|Q9UQN5	Frame_Shift_Del	DEL	pfam_Prot_kinase_cat_dom,pfam_Rho-bd,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pleckstrin_homology,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_tRNA-bd_arm,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,pirsf_Rho-assoc_coiled-coil_kinase,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.N993fs	ENST00000315872.6	37	c.2978	CCDS42654.1	2																																																																																			ROCK2	-	pfam_Rho-bd,pirsf_Rho-assoc_coiled-coil_kinase	ENSG00000134318		0.279	ROCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROCK2	HGNC	protein_coding	OTTHUMT00000313886.3	82	0.00	0	T			11338833	11338833	-1	no_errors	ENST00000315872	ensembl	human	known	69_37n	frame_shift_del	119	11.85	16	DEL	1.000	-
ROR2	4920	genome.wustl.edu	37	9	94487258	94487258	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr9:94487258G>C	ENST00000375708.3	-	9	1716	c.1518C>G	c.(1516-1518)atC>atG	p.I506M	ROR2_ENST00000550066.1_5'UTR|ROR2_ENST00000375715.1_Missense_Mutation_p.I366M	NM_004560.3	NP_004551.2	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	506	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|embryonic genitalia morphogenesis (GO:0030538)|inner ear morphogenesis (GO:0042472)|JNK cascade (GO:0007254)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	clathrin-coated endocytic vesicle membrane (GO:0030669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						TCAGCGTTTTGATGGCCACAG	0.632																																						dbGAP											0													104.0	121.0	116.0					9																	94487258		2203	4300	6503	-	-	-	SO:0001583	missense	0			M97639	CCDS6691.1	9q22	2013-01-11			ENSG00000169071	ENSG00000169071		"""Immunoglobulin superfamily / I-set domain containing"""	10257	protein-coding gene	gene with protein product		602337		NTRKR2, BDB, BDB1		1334494, 10700182	Standard	NM_004560		Approved		uc004arj.2	Q01974	OTTHUMG00000020211	ENST00000375708.3:c.1518C>G	9.37:g.94487258G>C	ENSP00000364860:p.Ile506Met		Q59GF5|Q5SPI5|Q9HAY7|Q9HB61	Missense_Mutation	SNP	pirsf_Tyr_kinase_rcpt_ROR,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Kringle,pfam_Frizzled_dom,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Kinase-like_dom,superfamily_Kringle-like,superfamily_Frizzled_dom,smart_Ig_sub,smart_Ig_sub2,smart_Kringle,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Frizzled_dom,pfscan_Kringle,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.I506M	ENST00000375708.3	37	c.1518	CCDS6691.1	9	.	.	.	.	.	.	.	.	.	.	G	13.96	2.391581	0.42410	.	.	ENSG00000169071	ENST00000375715;ENST00000375708	D;D	0.85339	-1.97;-1.97	4.47	3.57	0.40892	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.42821	D	0.000658	D	0.89908	0.6851	M	0.71296	2.17	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.81914	0.995;0.987	D	0.89771	0.3954	10	0.87932	D	0	.	9.1878	0.37180	0.2215:0.0:0.7785:0.0	.	506;366	Q01974;B1APY4	ROR2_HUMAN;.	M	366;506	ENSP00000364867:I366M;ENSP00000364860:I506M	ENSP00000364860:I506M	I	-	3	3	ROR2	93527079	1.000000	0.71417	1.000000	0.80357	0.827000	0.46813	1.817000	0.39002	2.478000	0.83669	0.491000	0.48974	ATC	ROR2	-	pirsf_Tyr_kinase_rcpt_ROR,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000169071		0.632	ROR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROR2	HGNC	protein_coding	OTTHUMT00000053040.1	13	0.00	0	G			94487258	94487258	-1	no_errors	ENST00000375708	ensembl	human	known	69_37n	missense	22	18.52	5	SNP	1.000	C
SACS	26278	genome.wustl.edu	37	13	23912087	23912087	+	Silent	SNP	G	G	C			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr13:23912087G>C	ENST00000382292.3	-	9	6201	c.5928C>G	c.(5926-5928)acC>acG	p.T1976T	SACS_ENST00000402364.1_Silent_p.T1226T|SACS_ENST00000382298.3_Silent_p.T1976T			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	1976					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		AGAAGACTTTGGTCAGTTCTT	0.378																																						dbGAP											0													60.0	62.0	61.0					13																	23912087		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.5928C>G	13.37:g.23912087G>C			O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Silent	SNP	pfam_HEPN,pfam_Ubiquitin,superfamily_ATPase-like_ATP-bd,superfamily_DnaJ_N,smart_HEPN,pfscan_HEPN,pfscan_DnaJ_N,pfscan_Ubiquitin_supergroup	p.T1976	ENST00000382292.3	37	c.5928	CCDS9300.2	13																																																																																			SACS	-	NULL	ENSG00000151835		0.378	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SACS	HGNC	protein_coding	OTTHUMT00000044148.3	37	0.00	0	G	NM_014363		23912087	23912087	-1	no_errors	ENST00000382292	ensembl	human	known	69_37n	silent	31	16.22	6	SNP	0.149	C
SAFB2	9667	genome.wustl.edu	37	19	5604645	5604645	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr19:5604645T>C	ENST00000252542.4	-	11	1772	c.1508A>G	c.(1507-1509)gAa>gGa	p.E503G	SAFB2_ENST00000591310.1_5'UTR	NM_014649.2	NP_055464.1	Q14151	SAFB2_HUMAN	scaffold attachment factor B2	503	Lys-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(4)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				UCEC - Uterine corpus endometrioid carcinoma (162;0.000228)		CGATAATTTTTCCTTCTTCAC	0.423																																					Ovarian(127;888 1728 23957 44128 52668)	dbGAP											0													99.0	92.0	94.0					19																	5604645		2203	4300	6503	-	-	-	SO:0001583	missense	0			D50928	CCDS32879.1	19p13.3	2013-02-12				ENSG00000130254		"""RNA binding motif (RRM) containing"""	21605	protein-coding gene	gene with protein product		608066				12660241	Standard	NM_014649		Approved	KIAA0138	uc002mcd.3	Q14151		ENST00000252542.4:c.1508A>G	19.37:g.5604645T>C	ENSP00000252542:p.Glu503Gly		B4DKG3|Q8TB13	Missense_Mutation	SNP	pfam_RRM_dom,pfam_SAP_DNA-bd,smart_SAP_DNA-bd,smart_RRM_dom,pfscan_SAP_DNA-bd,pfscan_RRM_dom	p.E503G	ENST00000252542.4	37	c.1508	CCDS32879.1	19	.	.	.	.	.	.	.	.	.	.	T	22.6	4.307655	0.81247	.	.	ENSG00000130254	ENST00000434962;ENST00000415313;ENST00000394625;ENST00000252542	T	0.23950	1.88	4.81	4.81	0.61882	.	0.000000	0.64402	D	0.000018	T	0.32823	0.0842	L	0.52573	1.65	0.52501	D	0.999956	P	0.43885	0.82	P	0.47645	0.553	T	0.05022	-1.0911	10	0.45353	T	0.12	-30.7841	14.5316	0.67929	0.0:0.0:0.0:1.0	.	503	Q14151	SAFB2_HUMAN	G	399;254;503;503	ENSP00000252542:E503G	ENSP00000252542:E503G	E	-	2	0	SAFB2	5555645	1.000000	0.71417	0.983000	0.44433	0.848000	0.48234	5.646000	0.67916	2.026000	0.59711	0.454000	0.30748	GAA	SAFB2	-	NULL	ENSG00000130254		0.423	SAFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAFB2	HGNC	protein_coding	OTTHUMT00000451016.1	88	0.00	0	T	NM_014649		5604645	5604645	-1	no_errors	ENST00000252542	ensembl	human	known	69_37n	missense	97	12.61	14	SNP	0.997	C
SCN11A	11280	genome.wustl.edu	37	3	38951681	38951681	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr3:38951681T>A	ENST00000302328.3	-	8	1175	c.977A>T	c.(976-978)tAt>tTt	p.Y326F	AC116038.1_ENST00000401122.1_RNA|SCN11A_ENST00000450244.1_Missense_Mutation_p.Y326F|SCN11A_ENST00000456224.3_Missense_Mutation_p.Y326F|SCN11A_ENST00000444237.2_Missense_Mutation_p.Y326F	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	326					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CTTACATTCATATTGTATGGA	0.383																																						dbGAP											0													106.0	99.0	101.0					3																	38951681		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.977A>T	3.37:g.38951681T>A	ENSP00000307599:p.Tyr326Phe		A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.Y326F	ENST00000302328.3	37	c.977	CCDS33737.1	3	.	.	.	.	.	.	.	.	.	.	T	10.28	1.307312	0.23821	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224;ENST00000444237	D;D;D;D	0.96685	-4.09;-4.09;-4.05;-3.98	4.97	-5.6	0.02497	Ion transport (1);	0.402910	0.27807	N	0.017775	D	0.90421	0.7001	L	0.37630	1.12	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.78934	-0.2008	10	0.48119	T	0.1	.	8.9894	0.36014	0.2121:0.0:0.0888:0.699	.	326	Q9UI33	SCNBA_HUMAN	F	326	ENSP00000307599:Y326F;ENSP00000400945:Y326F;ENSP00000416757:Y326F;ENSP00000408028:Y326F	ENSP00000307599:Y326F	Y	-	2	0	SCN11A	38926685	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.674000	0.05233	-0.887000	0.03961	-0.646000	0.03943	TAT	SCN11A	-	pfam_Ion_trans_dom	ENSG00000168356		0.383	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN11A	HGNC	protein_coding	OTTHUMT00000109746.4	59	0.00	0	T	NM_014139		38951681	38951681	-1	no_errors	ENST00000302328	ensembl	human	known	69_37n	missense	64	11.11	8	SNP	0.000	A
SERPINI2	5276	genome.wustl.edu	37	3	167184946	167184946	+	Silent	SNP	A	A	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr3:167184946A>G	ENST00000476257.1	-	4	673	c.375T>C	c.(373-375)caT>caC	p.H125H	SERPINI2_ENST00000465031.1_5'Flank|SERPINI2_ENST00000471111.1_Silent_p.H125H|SERPINI2_ENST00000264677.4_Silent_p.H125H|SERPINI2_ENST00000461846.1_Silent_p.H125H			O75830	SPI2_HUMAN	serpin peptidase inhibitor, clade I (pancpin), member 2	125					cellular component movement (GO:0006928)|negative regulation of endopeptidase activity (GO:0010951)|regulation of cell adhesion (GO:0030155)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(20)|prostate(1)|skin(5)|urinary_tract(1)	41						CCTTGTTGCCATGGAGATACT	0.378																																						dbGAP											0													115.0	115.0	115.0					3																	167184946		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AB006423	CCDS3200.1, CCDS75047.1	3q26.1	2014-02-18	2005-08-18		ENSG00000114204	ENSG00000114204		"""Serine (or cysteine) peptidase inhibitors"""	8945	protein-coding gene	gene with protein product		605587	"""serine (or cysteine) proteinase inhibitor, clade I (neuroserpin), member 2"", ""serine (or cysteine) proteinase inhibitor, clade I (pancpin), member 2"""	PI14		9624529, 24172014	Standard	NM_006217		Approved	PANCPIN, TSA2004, MEPI, pancpin	uc003fes.2	O75830	OTTHUMG00000158231	ENST00000476257.1:c.375T>C	3.37:g.167184946A>G				Silent	SNP	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	p.H125	ENST00000476257.1	37	c.375	CCDS3200.1	3																																																																																			SERPINI2	-	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	ENSG00000114204		0.378	SERPINI2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SERPINI2	HGNC	protein_coding	OTTHUMT00000350450.1	100	0.00	0	A	NM_006217		167184946	167184946	-1	no_errors	ENST00000264677	ensembl	human	known	69_37n	silent	165	11.29	21	SNP	1.000	G
SF3B3	23450	genome.wustl.edu	37	16	70595601	70595601	+	Silent	SNP	G	G	A			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr16:70595601G>A	ENST00000302516.5	+	17	2413	c.2202G>A	c.(2200-2202)ctG>ctA	p.L734L		NM_012426.4	NP_036558.3	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3, 130kDa	734					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein complex assembly (GO:0006461)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleic acid binding (GO:0003676)			breast(2)|endometrium(8)|kidney(2)|large_intestine(8)|liver(3)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	53		Ovarian(137;0.0694)				TCACCCCACTGTCTTACGAGA	0.507																																						dbGAP											0													157.0	134.0	142.0					16																	70595601		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			AJ001443	CCDS10894.1	16q22	2008-08-01	2002-08-29		ENSG00000189091	ENSG00000189091			10770	protein-coding gene	gene with protein product		605592	"""splicing factor 3b, subunit 3, 130kD"""			10490618	Standard	NM_012426		Approved	SAP130, SF3b130, RSE1, KIAA0017	uc002ezf.3	Q15393	OTTHUMG00000137582	ENST00000302516.5:c.2202G>A	16.37:g.70595601G>A			Q6NTI8|Q96GC0|Q9BPY2|Q9UFX7|Q9UJ29	Silent	SNP	pfam_Cleavage/polyA-sp_fac_asu_C,superfamily_WD40_repeat_dom	p.L734	ENST00000302516.5	37	c.2202	CCDS10894.1	16																																																																																			SF3B3	-	superfamily_WD40_repeat_dom	ENSG00000189091		0.507	SF3B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3B3	HGNC	protein_coding	OTTHUMT00000268972.1	37	0.00	0	G	NM_012426		70595601	70595601	+1	no_errors	ENST00000302516	ensembl	human	known	69_37n	silent	46	20.69	12	SNP	1.000	A
SGIP1	84251	genome.wustl.edu	37	1	67206389	67206390	+	Nonsense_Mutation	DNP	GA	GA	TT			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G|A	G|A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr1:67206389_67206390GA>TT	ENST00000371037.4	+	23	2360_2361	c.2283_2284GA>TT	c.(2281-2286)caGAag>caTTag	p.761_762QK>H*	SGIP1_ENST00000371036.3_Nonsense_Mutation_p.563_564QK>H*|SGIP1_ENST00000435165.2_Nonsense_Mutation_p.266_267QK>H*|SGIP1_ENST00000237247.6_Nonsense_Mutation_p.792_793QK>H*|SGIP1_ENST00000371039.1_Nonsense_Mutation_p.564_565QK>H*|SGIP1_ENST00000371035.3_Nonsense_Mutation_p.551_552QK>H*	NM_032291.2	NP_115667.2	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting protein 1	761	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.|Necessary and sufficient to mediate interaction with CANX. {ECO:0000250}.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of feeding behavior (GO:2000253)|positive regulation of receptor-mediated endocytosis (GO:0048260)|response to dietary excess (GO:0002021)	AP-2 adaptor complex (GO:0030122)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phospholipid binding (GO:0005543)|SH3 domain binding (GO:0017124)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(43)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	71						ATATCTCTCAGAAGTCAGAAAA	0.312																																						dbGAP											0																																										-	-	-	SO:0001587	stop_gained	0			AL136561	CCDS30744.1	1p31.3	2008-02-05			ENSG00000118473	ENSG00000118473			25412	protein-coding gene	gene with protein product		611540				11230166	Standard	NM_032291		Approved	DKFZp761D221	uc001dcr.3	Q9BQI5	OTTHUMG00000009161	Exception_encountered	1.37:g.67206389_67206390delinsTT	ENSP00000360076:p.Q761_K762delinsH*		A6NL81|A6NLD1|Q4LE32|Q5VYE2|Q5VYE3|Q5VYE4|Q68D76|Q6MZY6|Q8IWC2	Missense_Mutation|Nonsense_Mutation	SNP	pfam_Muniscin_C-term_mu_dom,pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C	p.Q792H|p.K793*	ENST00000371037.4	37	c.2376|c.2377	CCDS30744.1	1																																																																																			SGIP1	-	pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C	ENSG00000118473		0.312	SGIP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SGIP1	HGNC	protein_coding	OTTHUMT00000025395.4	40|38	0.00	0	G|A	NM_032291		67206389|67206390	67206389|67206390	+1	no_errors	ENST00000237247	ensembl	human	known	69_37n	missense|nonsense	55|56	14.06|13.85	9	SNP	1.000	T
SLC12A1	6557	genome.wustl.edu	37	15	48551430	48551430	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr15:48551430G>A	ENST00000558405.1	+	16	2090	c.2076G>A	c.(2074-2076)atG>atA	p.M692I	SLC12A1_ENST00000396577.3_Missense_Mutation_p.M692I|SLC12A1_ENST00000380993.3_Missense_Mutation_p.M692I			Q13621	S12A1_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 1	692					cell death (GO:0008219)|chemical homeostasis (GO:0048878)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|kidney development (GO:0001822)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:potassium:chloride symporter activity (GO:0008511)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|prostate(2)|skin(1)	59		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Potassium Chloride(DB00761)|Quinethazone(DB01325)|Torasemide(DB00214)|Trichlormethiazide(DB01021)	GGGGACCCATGACAAGACCTG	0.493																																						dbGAP											0													184.0	161.0	169.0					15																	48551430		2198	4297	6495	-	-	-	SO:0001583	missense	0				CCDS10129.2, CCDS53940.1	15q15-q21	2013-07-18	2013-07-18		ENSG00000074803	ENSG00000074803		"""Solute carriers"""	10910	protein-coding gene	gene with protein product		600839				8640224	Standard	NM_000338		Approved	NKCC2	uc010bem.3	Q13621	OTTHUMG00000131495	ENST00000558405.1:c.2076G>A	15.37:g.48551430G>A	ENSP00000453409:p.Met692Ile		A8JYA2|E9PDW4	Missense_Mutation	SNP	pfam_AA-permease_dom,pfam_AA_permease_N,prints_Na/K/Cl_cotranspt2,prints_Na/K/Cl_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.M692I	ENST00000558405.1	37	c.2076	CCDS10129.2	15	.	.	.	.	.	.	.	.	.	.	G	14.81	2.647759	0.47258	.	.	ENSG00000074803	ENST00000428362;ENST00000380993;ENST00000396577;ENST00000546071	D;D	0.84442	-1.85;-1.85	5.48	4.56	0.56223	.	0.082057	0.85682	D	0.000000	T	0.79076	0.4385	L	0.38838	1.175	0.40474	D	0.980373	B;B	0.28439	0.212;0.138	B;B	0.22601	0.03;0.04	T	0.78448	-0.2200	10	0.62326	D	0.03	.	14.6755	0.68975	0.0703:0.0:0.9297:0.0	.	692;692	E9PDW4;Q13621	.;S12A1_HUMAN	I	505;692;692;86	ENSP00000370381:M692I;ENSP00000379822:M692I	ENSP00000370381:M692I	M	+	3	0	SLC12A1	46338722	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.942000	0.49018	1.445000	0.47624	0.555000	0.69702	ATG	SLC12A1	-	tigrfam_Na/K/Cl_cotransptS	ENSG00000074803		0.493	SLC12A1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC12A1	HGNC	protein_coding	OTTHUMT00000417131.1	95	0.00	0	G			48551430	48551430	+1	no_errors	ENST00000380993	ensembl	human	known	69_37n	missense	97	24.81	32	SNP	1.000	A
SLC18B1	116843	genome.wustl.edu	37	6	133100532	133100532	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr6:133100532C>G	ENST00000275227.4	-	7	766	c.670G>C	c.(670-672)Ggt>Cgt	p.G224R	SLC18B1_ENST00000538764.1_Missense_Mutation_p.G98R|SLC18B1_ENST00000367918.1_Intron	NM_052831.2	NP_439896.1	Q6NT16	S18B1_HUMAN	solute carrier family 18, subfamily B, member 1	224					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)											GAGTGTTCACCTGGATCAGAC	0.368																																						dbGAP											0													127.0	125.0	126.0					6																	133100532		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK124442	CCDS5163.1	6q22.3-q23.3	2013-05-22	2012-03-09	2012-03-09	ENSG00000146409	ENSG00000146409		"""Solute carriers"""	21573	protein-coding gene	gene with protein product		613361	"""chromosome 6 open reading frame 192"""	C6orf192		19697161	Standard	XM_006715328		Approved	dJ55C23.6	uc003qdw.1	Q6NT16	OTTHUMG00000015595	ENST00000275227.4:c.670G>C	6.37:g.133100532C>G	ENSP00000275227:p.Gly224Arg		A8K1K3|B3KW77|Q6ISF2	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.G224R	ENST00000275227.4	37	c.670	CCDS5163.1	6	.	.	.	.	.	.	.	.	.	.	C	11.31	1.600715	0.28534	.	.	ENSG00000146409	ENST00000275227;ENST00000538764	T;T	0.58060	0.36;0.36	5.07	-1.54	0.08584	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.374011	0.33572	N	0.004779	T	0.31136	0.0787	L	0.56769	1.78	0.09310	N	1	P;B	0.50369	0.934;0.016	P;B	0.49637	0.617;0.024	T	0.48547	-0.9026	10	0.17832	T	0.49	-1.1948	9.7773	0.40628	0.0:0.3371:0.0:0.6629	.	98;224	B7Z1S5;Q6NT16	.;CF192_HUMAN	R	224;98	ENSP00000275227:G224R;ENSP00000444098:G98R	ENSP00000275227:G224R	G	-	1	0	C6orf192	133142225	0.124000	0.22315	0.000000	0.03702	0.441000	0.31987	0.453000	0.21811	-0.271000	0.09272	0.561000	0.74099	GGT	SLC18B1	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000146409		0.368	SLC18B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC18B1	HGNC	protein_coding	OTTHUMT00000042273.1	61	0.00	0	C	NM_052831		133100532	133100532	-1	no_errors	ENST00000275227	ensembl	human	known	69_37n	missense	44	15.38	8	SNP	0.002	G
SLC22A10	387775	genome.wustl.edu	37	11	63069806	63069806	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr11:63069806C>G	ENST00000332793.6	+	7	1078	c.1076C>G	c.(1075-1077)gCa>gGa	p.A359G	SLC22A10_ENST00000544661.1_Missense_Mutation_p.A204G|SLC22A10_ENST00000526800.1_Intron|SLC22A10_ENST00000535888.1_Intron|SLC22A10_ENST00000525620.1_Intron	NM_001039752.3	NP_001034841.3	Q63ZE4	S22AA_HUMAN	solute carrier family 22, member 10	359						integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28					Conjugated Estrogens(DB00286)|Probenecid(DB01032)|Salicylic acid(DB00936)	CACAGATTTGCAAACACAATA	0.423																																						dbGAP											0													126.0	115.0	118.0					11																	63069806		1898	4113	6011	-	-	-	SO:0001583	missense	0			AP003420	CCDS41661.1	11q12.3	2013-05-22	2008-01-11		ENSG00000184999	ENSG00000184999		"""Solute carriers"""	18057	protein-coding gene	gene with protein product		607580	"""solute carrier family 22 (organic anion/cation transporter), member 10"""			11327718	Standard	NM_001039752		Approved	OAT5, hOAT5	uc009yor.3	Q63ZE4	OTTHUMG00000165197	ENST00000332793.6:c.1076C>G	11.37:g.63069806C>G	ENSP00000327569:p.Ala359Gly		Q68CJ0	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.A359G	ENST00000332793.6	37	c.1076	CCDS41661.1	11	.	.	.	.	.	.	.	.	.	.	C	13.08	2.131486	0.37630	.	.	ENSG00000184999	ENST00000544661;ENST00000332793	T;T	0.58940	0.3;0.3	3.62	1.65	0.23941	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.155965	0.43416	U	0.000580	T	0.42154	0.1190	L	0.52011	1.625	0.09310	N	1	P;B	0.35793	0.521;0.02	B;B	0.33568	0.166;0.029	T	0.18366	-1.0339	10	0.25106	T	0.35	.	4.2724	0.10792	0.0:0.6214:0.24:0.1386	.	199;359	E9PJB1;Q63ZE4	.;S22AA_HUMAN	G	204;359	ENSP00000445667:A204G;ENSP00000327569:A359G	ENSP00000327569:A359G	A	+	2	0	SLC22A10	62826382	0.005000	0.15991	0.079000	0.20413	0.039000	0.13416	0.383000	0.20651	0.224000	0.20940	0.579000	0.79373	GCA	SLC22A10	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000184999		0.423	SLC22A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A10	HGNC	protein_coding	OTTHUMT00000382622.3	76	0.00	0	C	NM_001039752		63069806	63069806	+1	no_errors	ENST00000332793	ensembl	human	known	69_37n	missense	109	12.10	15	SNP	0.012	G
SLC27A2	11001	genome.wustl.edu	37	15	50515175	50515175	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr15:50515175G>A	ENST00000267842.5	+	5	1218	c.986G>A	c.(985-987)cGt>cAt	p.R329H	SLC27A2_ENST00000380902.4_Missense_Mutation_p.R276H|Y_RNA_ENST00000363735.1_RNA|SLC27A2_ENST00000544960.1_Missense_Mutation_p.R94H	NM_003645.3	NP_003636.2	O14975	S27A2_HUMAN	solute carrier family 27 (fatty acid transporter), member 2	329					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid alpha-oxidation (GO:0001561)|fatty acid beta-oxidation (GO:0006635)|long-chain fatty acid import (GO:0044539)|long-chain fatty acid metabolic process (GO:0001676)|methyl-branched fatty acid metabolic process (GO:0097089)|small molecule metabolic process (GO:0044281)|very long-chain fatty acid catabolic process (GO:0042760)	endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of peroxisomal membrane (GO:0005779)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|fatty acid transporter activity (GO:0015245)|long-chain fatty acid-CoA ligase activity (GO:0004467)|phytanate-CoA ligase activity (GO:0050197)|pristanate-CoA ligase activity (GO:0070251)|receptor binding (GO:0005102)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			NS(1)|breast(2)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_lung(180;0.00177)		all cancers(107;1.16e-06)|GBM - Glioblastoma multiforme(94;0.000113)		CCAAATGACCGTGATCATAAA	0.408																																						dbGAP											0													126.0	121.0	123.0					15																	50515175		2196	4295	6491	-	-	-	SO:0001583	missense	0			D88308	CCDS10133.1, CCDS53943.1	15q21.2	2013-05-22			ENSG00000140284	ENSG00000140284		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10996	protein-coding gene	gene with protein product		603247		FACVL1		9730624	Standard	NM_003645		Approved	FATP2, hFACVL1, VLACS, VLCS, HsT17226, ACSVL1	uc001zxw.3	O14975	OTTHUMG00000131643	ENST00000267842.5:c.986G>A	15.37:g.50515175G>A	ENSP00000267842:p.Arg329His		A8K2J7|Q53FY6|Q6PF09	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.R329H	ENST00000267842.5	37	c.986	CCDS10133.1	15	.	.	.	.	.	.	.	.	.	.	G	15.56	2.869847	0.51588	.	.	ENSG00000140284	ENST00000380902;ENST00000267842;ENST00000544960	T;T;T	0.49720	0.77;0.77;0.77	5.93	5.02	0.67125	AMP-dependent synthetase/ligase (1);	0.274243	0.35495	N	0.003171	T	0.68906	0.3052	M	0.87180	2.865	0.39953	D	0.974563	P;D	0.89917	0.895;1.0	B;D	0.74674	0.427;0.984	T	0.74472	-0.3654	10	0.72032	D	0.01	.	8.498	0.33141	0.0809:0.1544:0.7647:0.0	.	276;329	Q6PF09;O14975	.;S27A2_HUMAN	H	276;329;94	ENSP00000370289:R276H;ENSP00000267842:R329H;ENSP00000444549:R94H	ENSP00000267842:R329H	R	+	2	0	SLC27A2	48302467	0.012000	0.17670	1.000000	0.80357	0.289000	0.27227	0.833000	0.27504	1.518000	0.48934	0.655000	0.94253	CGT	SLC27A2	-	pfam_AMP-dep_Synth/Lig	ENSG00000140284		0.408	SLC27A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC27A2	HGNC	protein_coding	OTTHUMT00000254539.2	89	0.00	0	G	NM_003645		50515175	50515175	+1	no_errors	ENST00000267842	ensembl	human	known	69_37n	missense	85	18.27	19	SNP	0.988	A
SLC4A2	6522	genome.wustl.edu	37	7	150773264	150773264	+	Silent	SNP	G	G	A			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr7:150773264G>A	ENST00000485713.1	+	22	4676	c.3636G>A	c.(3634-3636)gaG>gaA	p.E1212E	SLC4A2_ENST00000392826.2_Silent_p.E1203E|SLC4A2_ENST00000413384.2_Silent_p.E1212E|RP11-148K1.12_ENST00000485974.1_RNA|SLC4A2_ENST00000310317.5_Silent_p.E1130E|FASTK_ENST00000489884.1_5'Flank|SLC4A2_ENST00000461735.1_Silent_p.E1198E	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2	1212	Membrane (anion exchange).				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CCGACCGAGAGATGAAATGTG	0.622																																						dbGAP											0													123.0	124.0	123.0					7																	150773264		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889		"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2		8434259	Standard	NM_003040		Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000485713.1:c.3636G>A	7.37:g.150773264G>A			B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	Silent	SNP	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Anion_exchange,prints_Anion_exchange_2,tigrfam_HCO3_transpt_euk	p.E1212	ENST00000485713.1	37	c.3636	CCDS5917.1	7																																																																																			SLC4A2	-	tigrfam_HCO3_transpt_euk	ENSG00000164889		0.622	SLC4A2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SLC4A2	HGNC	protein_coding	OTTHUMT00000351039.1	25	0.00	0	G	NM_003040		150773264	150773264	+1	no_errors	ENST00000413384	ensembl	human	known	69_37n	silent	38	15.56	7	SNP	1.000	A
SLC4A5	57835	genome.wustl.edu	37	2	74466568	74466568	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr2:74466568T>G	ENST00000377634.4	-	21	2612	c.2213A>C	c.(2212-2214)aAg>aCg	p.K738T	SLC4A5_ENST00000394019.2_Missense_Mutation_p.K738T|RP11-287D1.3_ENST00000451608.2_3'UTR|SLC4A5_ENST00000377632.1_Missense_Mutation_p.K738T|SLC4A5_ENST00000423644.1_Missense_Mutation_p.K738T|SLC4A5_ENST00000346834.4_Missense_Mutation_p.K738T|SLC4A5_ENST00000357822.5_Missense_Mutation_p.K738T|SLC4A5_ENST00000359484.4_Missense_Mutation_p.K674T|SLC4A5_ENST00000358683.4_Missense_Mutation_p.K674T|SLC4A5_ENST00000483195.1_5'UTR					solute carrier family 4 (sodium bicarbonate cotransporter), member 5											breast(5)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(13)|ovary(5)|pancreas(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						TGGGATAAACTTGCAGGAATT	0.517																																						dbGAP											0													76.0	76.0	76.0					2																	74466568		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF243499	CCDS1936.1, CCDS1937.1	2p13.1	2013-07-19	2013-07-19		ENSG00000188687	ENSG00000188687		"""Solute carriers"""	18168	protein-coding gene	gene with protein product		606757	"""solute carrier family 4, sodium bicarbonate cotransporter, member 5"""			10978526, 11087115	Standard	NM_133478		Approved	NBC4	uc002sko.1	Q9BY07	OTTHUMG00000090263	ENST00000377634.4:c.2213A>C	2.37:g.74466568T>G	ENSP00000366861:p.Lys738Thr			Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Na/HCO3_transpt,tigrfam_HCO3_transpt_euk	p.K738T	ENST00000377634.4	37	c.2213	CCDS1936.1	2	.	.	.	.	.	.	.	.	.	.	T	12.87	2.066144	0.36470	.	.	ENSG00000188687	ENST00000394019;ENST00000451608;ENST00000346834;ENST00000359484;ENST00000423644;ENST00000358683;ENST00000357822;ENST00000377632;ENST00000377634;ENST00000425249	T;T;T;T;T;T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24;-1.24;-1.24;-1.24;-1.24;-1.24	5.33	4.16	0.48862	Bicarbonate transporter, C-terminal (1);	0.118142	0.53938	D	0.000044	T	0.76513	0.3998	L	0.47716	1.5	0.32549	N	0.532632	B;P;B;P;B	0.46512	0.061;0.879;0.115;0.466;0.047	B;P;B;P;B	0.52031	0.053;0.688;0.187;0.513;0.172	T	0.76460	-0.2951	10	0.18710	T	0.47	.	10.6215	0.45483	0.0:0.0:0.1614:0.8386	.	738;738;674;738;738	Q9BY07-4;E7EQT3;Q9BY07-7;Q9BY07;Q9BY07-3	.;.;.;S4A5_HUMAN;.	T	738;738;738;674;738;674;738;738;738;738	ENSP00000377587:K738T;ENSP00000251768:K738T;ENSP00000352461:K674T;ENSP00000395804:K738T;ENSP00000351513:K674T;ENSP00000350475:K738T;ENSP00000366859:K738T;ENSP00000366861:K738T;ENSP00000405678:K738T	ENSP00000251768:K738T	K	-	2	0	SLC4A5	74320076	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	3.267000	0.51577	1.020000	0.39573	0.459000	0.35465	AAG	SLC4A5	-	pfam_HCO3_transpt_C,tigrfam_HCO3_transpt_euk	ENSG00000188687		0.517	SLC4A5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC4A5	HGNC	protein_coding	OTTHUMT00000206583.3	29	0.00	0	T			74466568	74466568	-1	no_errors	ENST00000357822	ensembl	human	known	69_37n	missense	33	13.16	5	SNP	1.000	G
SLC5A12	159963	genome.wustl.edu	37	11	26702758	26702758	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr11:26702758C>A	ENST00000396005.3	-	12	1628	c.1319G>T	c.(1318-1320)gGa>gTa	p.G440V		NM_178498.3	NP_848593.2	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12	440					sodium ion transport (GO:0006814)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)	35						AAGAAGACCTCCTAGTGCACC	0.448																																						dbGAP											0													50.0	47.0	48.0					11																	26702758		1871	4095	5966	-	-	-	SO:0001583	missense	0			BC049207	CCDS7860.2	11p14.2	2013-07-19	2013-07-19		ENSG00000148942	ENSG00000148942		"""Solute carriers"""	28750	protein-coding gene	gene with protein product		612455	"""solute carrier family 5 (sodium/glucose cotransporter), member 12"""			12477932	Standard	NM_178498		Approved	MGC52019, SMCT2	uc001mra.2	Q1EHB4	OTTHUMG00000150706	ENST00000396005.3:c.1319G>T	11.37:g.26702758C>A	ENSP00000379326:p.Gly440Val		Q86UC7	Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.G440V	ENST00000396005.3	37	c.1319	CCDS7860.2	11	.	.	.	.	.	.	.	.	.	.	C	19.65	3.866404	0.72065	.	.	ENSG00000148942	ENST00000396005	D	0.87029	-2.2	5.52	4.6	0.57074	.	0.085540	0.45606	U	0.000347	T	0.67618	0.2912	N	0.01152	-0.98	0.80722	D	1	B	0.09022	0.002	B	0.15052	0.012	T	0.63157	-0.6700	10	0.11794	T	0.64	.	15.2807	0.73781	0.0:0.8588:0.1412:0.0	.	440	Q1EHB4	SC5AC_HUMAN	V	440	ENSP00000379326:G440V	ENSP00000379326:G440V	G	-	2	0	SLC5A12	26659334	0.966000	0.33281	0.866000	0.34008	0.964000	0.63967	4.264000	0.58859	1.311000	0.45024	0.655000	0.94253	GGA	SLC5A12	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	ENSG00000148942		0.448	SLC5A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A12	HGNC	protein_coding	OTTHUMT00000319681.1	41	0.00	0	C	NM_178498		26702758	26702758	-1	no_errors	ENST00000396005	ensembl	human	known	69_37n	missense	40	14.89	7	SNP	0.992	A
SLC6A19	340024	genome.wustl.edu	37	5	1210685	1210685	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr5:1210685A>G	ENST00000304460.10	+	3	526	c.470A>G	c.(469-471)gAg>gGg	p.E157G		NM_001003841.2	NP_001003841.1	Q695T7	S6A19_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 19	157					amino acid transport (GO:0006865)|ion transport (GO:0006811)|response to nutrient (GO:0007584)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|neutral amino acid transmembrane transporter activity (GO:0015175)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(25)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			CCGCTCAACGAGAACCAGACA	0.542																																						dbGAP											0													69.0	65.0	67.0					5																	1210685		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK096054	CCDS34130.1	5p15	2013-07-19			ENSG00000174358	ENSG00000174358		"""Solute carriers"""	27960	protein-coding gene	gene with protein product	"""Hartnup disease"""	608893					Standard	NM_001003841		Approved		uc003jbw.4	Q695T7	OTTHUMG00000161636	ENST00000304460.10:c.470A>G	5.37:g.1210685A>G	ENSP00000305302:p.Glu157Gly		A8K446	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_orphan	p.E157G	ENST00000304460.10	37	c.470	CCDS34130.1	5	.	.	.	.	.	.	.	.	.	.	a	1.541	-0.541757	0.04053	.	.	ENSG00000174358	ENST00000304460	T	0.74209	-0.82	4.28	-3.37	0.04898	.	2.851500	0.01657	N	0.024873	T	0.55768	0.1941	N	0.16656	0.425	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.35500	-0.9786	10	0.23302	T	0.38	.	5.4148	0.16368	0.3415:0.4876:0.0713:0.0996	.	157	Q695T7	S6A19_HUMAN	G	157	ENSP00000305302:E157G	ENSP00000305302:E157G	E	+	2	0	SLC6A19	1263685	0.000000	0.05858	0.001000	0.08648	0.138000	0.21146	-3.265000	0.00534	-0.863000	0.04084	0.387000	0.25754	GAG	SLC6A19	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport	ENSG00000174358		0.542	SLC6A19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A19	HGNC	protein_coding	OTTHUMT00000365557.1	14	0.00	0	A	XM_291120		1210685	1210685	+1	no_errors	ENST00000304460	ensembl	human	known	69_37n	missense	27	20.59	7	SNP	0.000	G
SLC7A14	57709	genome.wustl.edu	37	3	170201192	170201192	+	Silent	SNP	C	C	T			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr3:170201192C>T	ENST00000231706.5	-	6	1341	c.1026G>A	c.(1024-1026)tcG>tcA	p.S342S	CLDN11_ENST00000486975.1_Intron|CLDN11_ENST00000451576.1_Intron	NM_020949.2	NP_066000.2	Q8TBB6	S7A14_HUMAN	solute carrier family 7, member 14	342					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)	amino acid transmembrane transporter activity (GO:0015171)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(23)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(4)	53	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			GTCCTGCAACCGACCCAATGG	0.527											OREG0015917	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													107.0	96.0	100.0					3																	170201192		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC022968	CCDS33892.1	3q26.2	2014-06-13	2013-07-19		ENSG00000013293	ENSG00000013293		"""Solute carriers"""	29326	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 142"""	615720					Standard	NM_020949		Approved	KIAA1613, PPP1R142	uc003fgz.2	Q8TBB6	OTTHUMG00000158941	ENST00000231706.5:c.1026G>A	3.37:g.170201192C>T		1883	B3KV33|Q9HCF9	Silent	SNP	pfam_AA-permease_dom	p.S342	ENST00000231706.5	37	c.1026	CCDS33892.1	3																																																																																			SLC7A14	-	pfam_AA-permease_dom	ENSG00000013293		0.527	SLC7A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A14	HGNC	protein_coding	OTTHUMT00000352598.2	29	0.00	0	C	NM_020949		170201192	170201192	-1	no_errors	ENST00000231706	ensembl	human	known	69_37n	silent	38	13.64	6	SNP	0.000	T
SLC9A6	10479	genome.wustl.edu	37	X	135077034	135077034	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chrX:135077034C>A	ENST00000370698.3	+	2	450	c.415C>A	c.(415-417)Cca>Aca	p.P139T	SLC9A6_ENST00000370701.1_Missense_Mutation_p.P87T|SLC9A6_ENST00000370695.4_Missense_Mutation_p.P139T	NM_006359.2	NP_006350.1	Q92581	SL9A6_HUMAN	solute carrier family 9, subfamily A (NHE6, cation proton antiporter 6), member 6	139					axon extension (GO:0048675)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|dendrite extension (GO:0097484)|dendritic spine development (GO:0060996)|ion transport (GO:0006811)|neuron projection morphogenesis (GO:0048812)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon terminus (GO:0043679)|axonal spine (GO:0044308)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|synapse (GO:0045202)	sodium:proton antiporter activity (GO:0015385)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(18)|ovary(2)|upper_aerodigestive_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					GCAGTCAAGTCCAACTACCTT	0.383																																						dbGAP											0													202.0	167.0	179.0					X																	135077034		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF030409	CCDS14654.1, CCDS44003.1, CCDS55504.1	Xq26.3	2013-05-22	2012-03-22		ENSG00000198689	ENSG00000198689		"""Solute carriers"""	11079	protein-coding gene	gene with protein product		300231	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 6"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 6"""			9507001	Standard	NM_001042537		Approved	NHE6, KIAA0267	uc004ezk.3	Q92581	OTTHUMG00000022498	ENST00000370698.3:c.415C>A	X.37:g.135077034C>A	ENSP00000359732:p.Pro139Thr		A6NIQ9|A8K160|B4DU30|B7ZAE0|Q3ZCW7|Q5JPP8|Q5JPP9|Q86VS0	Missense_Mutation	SNP	pfam_Cation/H_exchanger,prints_Na/H_exchanger_6,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.P139T	ENST00000370698.3	37	c.415	CCDS14654.1	X	.	.	.	.	.	.	.	.	.	.	C	17.28	3.349168	0.61183	.	.	ENSG00000198689	ENST00000370701;ENST00000370698;ENST00000370695	T;T;T	0.58797	0.34;0.34;0.31	5.07	5.07	0.68467	Cation/H+ exchanger (1);	0.000000	0.85682	D	0.000000	T	0.64338	0.2589	M	0.72894	2.215	0.80722	D	1	P;B;P	0.36837	0.571;0.317;0.571	B;B;B	0.42163	0.378;0.193;0.378	T	0.69709	-0.5072	10	0.72032	D	0.01	.	16.6983	0.85342	0.0:1.0:0.0:0.0	.	87;139;139	B4DU30;Q92581-2;Q92581	.;.;SL9A6_HUMAN	T	87;139;139	ENSP00000359735:P87T;ENSP00000359732:P139T;ENSP00000359729:P139T	ENSP00000359729:P139T	P	+	1	0	SLC9A6	134904700	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.583000	0.67484	2.234000	0.73211	0.544000	0.68410	CCA	SLC9A6	-	pfam_Cation/H_exchanger,prints_Na/H_exchanger_6	ENSG00000198689		0.383	SLC9A6-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	SLC9A6	HGNC	protein_coding	OTTHUMT00000058450.1	90	0.00	0	C	NM_006359		135077034	135077034	+1	no_errors	ENST00000370695	ensembl	human	known	69_37n	missense	99	16.10	19	SNP	1.000	A
SLITRK3	22865	genome.wustl.edu	37	3	164905805	164905805	+	Silent	SNP	C	C	G	rs145516007	byFrequency	TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr3:164905805C>G	ENST00000475390.1	-	2	3257	c.2814G>C	c.(2812-2814)tcG>tcC	p.S938S	SLITRK3_ENST00000241274.3_Silent_p.S938S			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	938					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.S938S(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						CCTTTCCAGCCGAGAAGAGAA	0.502										HNSCC(40;0.11)																												dbGAP											1	Substitution - coding silent(1)	kidney(1)											175.0	174.0	174.0					3																	164905805		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.2814G>C	3.37:g.164905805C>G			Q1RMY6	Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.S938	ENST00000475390.1	37	c.2814	CCDS3197.1	3																																																																																			SLITRK3	-	NULL	ENSG00000121871		0.502	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLITRK3	HGNC	protein_coding	OTTHUMT00000350126.1	71	0.00	0	C	NM_014926		164905805	164905805	-1	no_errors	ENST00000241274	ensembl	human	known	69_37n	silent	82	18.00	18	SNP	0.984	G
SNX6	58533	genome.wustl.edu	37	14	35032351	35032351	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr14:35032351C>A	ENST00000362031.4	-	14	1264	c.1234G>T	c.(1234-1236)Gca>Tca	p.A412S	SNX6_ENST00000355110.5_Missense_Mutation_p.A288S|RP11-671J11.4_ENST00000554608.1_RNA|RP11-671J11.4_ENST00000555361.1_RNA|SNX6_ENST00000396534.3_Missense_Mutation_p.A284S|SNX6_ENST00000396526.3_Missense_Mutation_p.A284S	NM_152233.2	NP_689419.2	Q9UNH7	SNX6_HUMAN	sorting nexin 6	400					intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|intracellular (GO:0005622)|nucleus (GO:0005634)	phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)			endometrium(4)|lung(1)|ovary(1)	6	Breast(36;0.0473)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00199)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.0245)		TTTAACACTGCCAGGCAGTTC	0.343																																						dbGAP											0													75.0	72.0	73.0					14																	35032351		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF121856	CCDS9648.1, CCDS41942.1	14q13	2010-08-05			ENSG00000129515	ENSG00000129515		"""Sorting nexins"""	14970	protein-coding gene	gene with protein product		606098				11279102	Standard	XM_006720224		Approved		uc001wsf.1	Q9UNH7	OTTHUMG00000140213	ENST00000362031.4:c.1234G>T	14.37:g.35032351C>A	ENSP00000355217:p.Ala412Ser		C0H5W9|Q9Y449	Missense_Mutation	SNP	pfam_Phox,pfam_Vps5_C,pfam_BAR_dom,superfamily_Phox,pirsf_Snx5_Snx6,pfscan_Phox	p.A412S	ENST00000362031.4	37	c.1234	CCDS41942.1	14	.	.	.	.	.	.	.	.	.	.	C	11.31	1.600690	0.28534	.	.	ENSG00000129515	ENST00000396526;ENST00000396534;ENST00000362031;ENST00000355110	T;T;T;T	0.59083	0.29;0.29;0.29;0.29	4.37	4.37	0.52481	.	0.110135	0.64402	D	0.000010	T	0.38957	0.1060	N	0.16478	0.41	0.46725	D	0.999175	P;P	0.34587	0.458;0.458	B;B	0.31547	0.132;0.132	T	0.30179	-0.9987	10	0.09084	T	0.74	-5.2883	17.7917	0.88554	0.0:1.0:0.0:0.0	.	288;400	B4DJS7;Q9UNH7	.;SNX6_HUMAN	S	284;284;412;288	ENSP00000379779:A284S;ENSP00000379785:A284S;ENSP00000355217:A412S;ENSP00000347230:A288S	ENSP00000347230:A288S	A	-	1	0	SNX6	34102102	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.601000	0.61090	2.360000	0.80028	0.462000	0.41574	GCA	SNX6	-	pfam_BAR_dom,pirsf_Snx5_Snx6	ENSG00000129515		0.343	SNX6-002	KNOWN	downstream_ATG|basic|appris_principal|CCDS	protein_coding	SNX6	HGNC	protein_coding	OTTHUMT00000276642.3	65	0.00	0	C			35032351	35032351	-1	no_errors	ENST00000362031	ensembl	human	known	69_37n	missense	87	19.44	21	SNP	1.000	A
SPHKAP	80309	genome.wustl.edu	37	2	228846465	228846465	+	Missense_Mutation	SNP	T	T	A	rs571822525		TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr2:228846465T>A	ENST00000392056.3	-	12	5117	c.5071A>T	c.(5071-5073)Agt>Tgt	p.S1691C	SPHKAP_ENST00000344657.5_Missense_Mutation_p.S1662C	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1691						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TCAAAGAGACTCAGTCTCCCA	0.458																																						dbGAP											0													106.0	94.0	98.0					2																	228846465		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.5071A>T	2.37:g.228846465T>A	ENSP00000375909:p.Ser1691Cys		Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	pfam_AKAP_110_C	p.S1691C	ENST00000392056.3	37	c.5071	CCDS46537.1	2	.	.	.	.	.	.	.	.	.	.	T	24.7	4.555999	0.86231	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.06768	3.26;3.26	5.85	5.85	0.93711	A-kinase anchor 110kDa, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.31136	0.0787	M	0.77103	2.36	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.02668	-1.1126	10	0.87932	D	0	.	15.4167	0.74974	0.0:0.0:0.0:1.0	.	1691;1662	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	C	1691;1662	ENSP00000375909:S1691C;ENSP00000339886:S1662C	ENSP00000339886:S1662C	S	-	1	0	SPHKAP	228554709	1.000000	0.71417	0.968000	0.41197	0.992000	0.81027	4.697000	0.61782	2.238000	0.73509	0.533000	0.62120	AGT	SPHKAP	-	pfam_AKAP_110_C	ENSG00000153820		0.458	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHKAP	HGNC	protein_coding	OTTHUMT00000331750.1	26	0.00	0	T	NM_030623		228846465	228846465	-1	no_errors	ENST00000392056	ensembl	human	known	69_37n	missense	42	14.29	7	SNP	1.000	A
SPINK5	11005	genome.wustl.edu	37	5	147469120	147469120	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr5:147469120G>C	ENST00000256084.7	+	7	580	c.538G>C	c.(538-540)Gat>Cat	p.D180H	SPINK5_ENST00000398454.1_Missense_Mutation_p.D180H|SPINK5_ENST00000359874.3_Missense_Mutation_p.D180H	NM_006846.3	NP_006837.2	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5	180	Kazal-like 3. {ECO:0000255|PROSITE- ProRule:PRU00798}.				anagen (GO:0042640)|epidermal cell differentiation (GO:0009913)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|hair cell differentiation (GO:0035315)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of immune response (GO:0050777)|negative regulation of proteolysis (GO:0045861)|negative regulation of serine-type peptidase activity (GO:1902572)|regulation of cell adhesion (GO:0030155)|regulation of T cell differentiation (GO:0045580)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(8)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAGGGAAAATGATCCTGTTCT	0.453																																						dbGAP											0													268.0	252.0	257.0					5																	147469120		2062	4200	6262	-	-	-	SO:0001583	missense	0			AJ228139	CCDS43382.1, CCDS47300.1, CCDS47301.1	5q31-q32	2014-09-17	2005-08-17		ENSG00000133710	ENSG00000133710		"""Serine peptidase inhibitors, Kazal type"""	15464	protein-coding gene	gene with protein product	"""lymphoepithelial Kazal-type-related inhibitor"""	605010	"""serine protease inhibitor, Kazal type 5"""			10419450	Standard	NM_001127698		Approved	VAKTI, LEKTI, LETKI, NETS, NS, FLJ21544, FLJ97536, FLJ97596, FLJ99794, DKFZp686K19184	uc003loy.2	Q9NQ38	OTTHUMG00000134305	ENST00000256084.7:c.538G>C	5.37:g.147469120G>C	ENSP00000256084:p.Asp180His		A8MYE8|B7WPB7|D6REN5|O75770|Q3LX95|Q3LX96|Q3LX97|Q96PP2|Q96PP3	Missense_Mutation	SNP	pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,smart_Prot_inh_Kazal	p.D180H	ENST00000256084.7	37	c.538	CCDS43382.1	5	.	.	.	.	.	.	.	.	.	.	G	19.26	3.793452	0.70452	.	.	ENSG00000133710	ENST00000398454;ENST00000359874;ENST00000508733;ENST00000256084	T;T;T;T	0.04970	3.52;3.52;3.52;3.52	5.84	4.95	0.65309	Proteinase inhibitor I1, Kazal (1);Protease inhibitor, Kazal-type (1);	0.116055	0.38548	N	0.001643	T	0.20981	0.0505	M	0.64170	1.965	0.26001	N	0.982117	D;D;D;D	0.89917	1.0;0.987;1.0;1.0	D;D;D;D	0.97110	0.997;0.969;1.0;0.998	T	0.02371	-1.1169	10	0.52906	T	0.07	-28.9554	12.5066	0.55986	0.0:0.0:0.8332:0.1668	.	161;180;180;180	B4DWS3;Q9NQ38-3;Q9NQ38;Q9NQ38-2	.;.;ISK5_HUMAN;.	H	180;180;161;180	ENSP00000381472:D180H;ENSP00000352936:D180H;ENSP00000421519:D161H;ENSP00000256084:D180H	ENSP00000256084:D180H	D	+	1	0	SPINK5	147449313	0.989000	0.36119	0.999000	0.59377	0.989000	0.77384	1.844000	0.39269	1.571000	0.49722	0.650000	0.86243	GAT	SPINK5	-	pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,smart_Prot_inh_Kazal	ENSG00000133710		0.453	SPINK5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SPINK5	HGNC	protein_coding	OTTHUMT00000259215.2	119	0.00	0	G	NM_001127698		147469120	147469120	+1	no_errors	ENST00000359874	ensembl	human	known	69_37n	missense	126	17.65	27	SNP	1.000	C
STXBP2	6813	genome.wustl.edu	37	19	7707892	7707892	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr19:7707892G>C	ENST00000221283.5	+	12	1015	c.984G>C	c.(982-984)caG>caC	p.Q328H	STXBP2_ENST00000441779.2_Missense_Mutation_p.Q339H|STXBP2_ENST00000602355.1_5'Flank|STXBP2_ENST00000414284.2_Missense_Mutation_p.Q325H	NM_006949.2	NP_008880.2	Q15833	STXB2_HUMAN	syntaxin binding protein 2	328					leukocyte mediated cytotoxicity (GO:0001909)|neutrophil degranulation (GO:0043312)|protein transport (GO:0015031)|regulation of mast cell degranulation (GO:0043304)|vesicle docking involved in exocytosis (GO:0006904)	azurophil granule (GO:0042582)|cytolytic granule (GO:0044194)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin-3 binding (GO:0030348)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	23						ACCTATCCCAGATCCTGAAAA	0.612																																						dbGAP											0													121.0	125.0	124.0					19																	7707892		2203	4300	6503	-	-	-	SO:0001583	missense	0			U63533	CCDS12181.1, CCDS45948.1, CCDS62522.1	19p13.3-p13.2	2014-09-17				ENSG00000076944			11445	protein-coding gene	gene with protein product		601717				8921365	Standard	NM_001127396		Approved	UNC18B, Hunc18b	uc010xjr.3	Q15833		ENST00000221283.5:c.984G>C	19.37:g.7707892G>C	ENSP00000221283:p.Gln328His		B4E175|E7EQD5|Q9BU65	Missense_Mutation	SNP	pfam_Sec1-like,superfamily_Sec1-like	p.Q339H	ENST00000221283.5	37	c.1017	CCDS12181.1	19	.	.	.	.	.	.	.	.	.	.	G	8.221	0.802552	0.16397	.	.	ENSG00000076944	ENST00000221283;ENST00000414284;ENST00000441779;ENST00000543902	T;T;T	0.80214	-1.35;-1.35;-1.35	4.69	-0.389	0.12455	.	0.132265	0.52532	N	0.000061	T	0.71542	0.3352	L	0.52364	1.645	0.38481	D	0.947721	B;B;B;B	0.06786	0.001;0.0;0.001;0.001	B;B;B;B	0.17433	0.018;0.003;0.006;0.01	T	0.63189	-0.6693	10	0.41790	T	0.15	-4.5634	9.4898	0.38953	0.0:0.3293:0.5803:0.0904	.	339;294;325;328	E7EQD5;B4DY46;Q15833-2;Q15833	.;.;.;STXB2_HUMAN	H	328;325;339;328	ENSP00000221283:Q328H;ENSP00000409471:Q325H;ENSP00000413606:Q339H	ENSP00000221283:Q328H	Q	+	3	2	STXBP2	7613892	1.000000	0.71417	0.999000	0.59377	0.165000	0.22458	2.166000	0.42406	0.084000	0.17077	-0.565000	0.04167	CAG	STXBP2	-	pfam_Sec1-like,superfamily_Sec1-like	ENSG00000076944		0.612	STXBP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STXBP2	HGNC	protein_coding	OTTHUMT00000460963.1	37	0.00	0	G	NM_006949		7707892	7707892	+1	no_errors	ENST00000441779	ensembl	human	known	69_37n	missense	28	24.32	9	SNP	1.000	C
TAL1	6886	genome.wustl.edu	37	1	47685653	47685653	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr1:47685653G>C	ENST00000294339.3	-	4	1311	c.735C>G	c.(733-735)gaC>gaG	p.D245E	TAL1_ENST00000371883.3_Missense_Mutation_p.D247E|TAL1_ENST00000459729.1_5'UTR|TAL1_ENST00000371884.2_Missense_Mutation_p.D245E	NM_003189.2	NP_003180.1	P17542	TAL1_HUMAN	T-cell acute lymphocytic leukemia 1	245					angiogenesis (GO:0001525)|astrocyte fate commitment (GO:0060018)|basophil differentiation (GO:0030221)|cell fate commitment (GO:0045165)|definitive hemopoiesis (GO:0060216)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|erythrocyte maturation (GO:0043249)|hemangioblast cell differentiation (GO:0060217)|hematopoietic stem cell differentiation (GO:0060218)|hemopoiesis (GO:0030097)|locomotory behavior (GO:0007626)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|platelet formation (GO:0030220)|positive regulation of cell division (GO:0051781)|positive regulation of chromatin assembly or disassembly (GO:0045799)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell proliferation (GO:0042127)|regulation of mast cell differentiation (GO:0060375)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spinal cord association neuron differentiation (GO:0021527)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|E-box binding (GO:0070888)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			haematopoietic_and_lymphoid_tissue(1)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	15						CCTCCTCCTGGTCATTGAGCA	0.637			T	"""TRD@, SIL"""	lymphoblastic leukemia/biphasic																																	dbGAP		Dom	yes		1	1p32	6886	T-cell acute lymphocytic leukemia 1 (SCL)		L	0													32.0	31.0	31.0					1																	47685653		2203	4300	6503	-	-	-	SO:0001583	missense	0			M29038	CCDS547.1	1p32	2013-05-21	2001-12-04		ENSG00000162367	ENSG00000162367		"""Basic helix-loop-helix proteins"""	11556	protein-coding gene	gene with protein product		187040		TCL5		2740341	Standard	NM_001287347		Approved	SCL, bHLHa17	uc009vyq.2	P17542	OTTHUMG00000007847	ENST00000294339.3:c.735C>G	1.37:g.47685653G>C	ENSP00000294339:p.Asp245Glu		D3DQ24	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.D247E	ENST00000294339.3	37	c.741	CCDS547.1	1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.136281	0.77662	.	.	ENSG00000162367	ENST00000371884;ENST00000371883;ENST00000294339	D;D;D	0.87334	-2.24;-2.24;-2.24	5.53	4.62	0.57501	Helix-loop-helix DNA-binding (2);	0.000000	0.85682	D	0.000000	D	0.83737	0.5319	L	0.32530	0.975	0.58432	D	0.999996	P	0.41188	0.741	B	0.43360	0.417	D	0.85003	0.0901	10	0.66056	D	0.02	.	14.4575	0.67425	0.071:0.0:0.929:0.0	.	245	P17542	TAL1_HUMAN	E	245;247;245	ENSP00000360951:D245E;ENSP00000360950:D247E;ENSP00000294339:D245E	ENSP00000294339:D245E	D	-	3	2	TAL1	47458240	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.502000	0.53332	1.340000	0.45581	0.579000	0.79373	GAC	TAL1	-	superfamily_HLH_DNA-bd,smart_HLH_DNA-bd	ENSG00000162367		0.637	TAL1-002	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	TAL1	HGNC	protein_coding	OTTHUMT00000021640.1	14	0.00	0	G	NM_003189		47685653	47685653	-1	no_errors	ENST00000371883	ensembl	human	known	69_37n	missense	4	44.44	4	SNP	1.000	C
TERF2	7014	genome.wustl.edu	37	16	69401045	69401045	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr16:69401045C>G	ENST00000254942.3	-	7	1021	c.1005G>C	c.(1003-1005)aaG>aaC	p.K335N	TERF2_ENST00000603068.1_Missense_Mutation_p.K293N|TERF2_ENST00000569611.2_5'Flank	NM_005652.3	NP_005643.2	Q15554	TERF2_HUMAN	telomeric repeat binding factor 2	335					age-dependent telomere shortening (GO:0001309)|cell cycle (GO:0007049)|cellular senescence (GO:0090398)|in utero embryonic development (GO:0001701)|negative regulation of telomere maintenance (GO:0032205)|negative regulation of telomere maintenance via semi-conservative replication (GO:0032214)|positive regulation of telomere maintenance (GO:0032206)|protection from non-homologous end joining at telomere (GO:0031848)|protein localization to chromosome, telomeric region (GO:0070198)|telomere capping (GO:0016233)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)|telomere maintenance via telomere shortening (GO:0010834)|telomeric loop formation (GO:0031627)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|male germ cell nucleus (GO:0001673)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|double-stranded telomeric DNA binding (GO:0003691)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|telomeric DNA binding (GO:0042162)			NS(2)|breast(1)|large_intestine(3)|lung(1)	7		Ovarian(137;0.101)				CAGACAGAGTCTTGAAAGCTG	0.488																																					Ovarian(13;63 524 30420 31710 34037)	dbGAP											0													62.0	63.0	63.0					16																	69401045		2198	4300	6498	-	-	-	SO:0001583	missense	0				CCDS10879.1, CCDS10879.2	16q22.1	2008-02-05			ENSG00000132604	ENSG00000132604			11729	protein-coding gene	gene with protein product		602027		TRBF2		9326950, 10226653	Standard	NM_005652		Approved	TRF2	uc002exd.4	Q15554	OTTHUMG00000137566	ENST00000254942.3:c.1005G>C	16.37:g.69401045C>G	ENSP00000254942:p.Lys335Asn			Missense_Mutation	SNP	pfam_Telomere_rpt-bd_fac_dimer_dom,pfam_SANT/Myb,superfamily_Telomere_rpt-bd_fac_dimer_dom,superfamily_Homeodomain-like,smart_SANT/Myb,pirsf_Telomere_repeat-bd-1/2,pfscan_Myb-like_dom	p.K293N	ENST00000254942.3	37	c.879		16	.	.	.	.	.	.	.	.	.	.	C	18.54	3.646607	0.67358	.	.	ENSG00000132604	ENST00000254942	.	.	.	6.17	4.22	0.49857	.	0.161207	0.56097	D	0.000034	T	0.67353	0.2884	L	0.58101	1.795	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.65800	-0.6080	9	0.37606	T	0.19	-29.0012	7.8327	0.29353	0.0:0.8177:0.0:0.1823	.	293	Q15554	TERF2_HUMAN	N	293	.	ENSP00000254942:K293N	K	-	3	2	TERF2	67958546	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	0.896000	0.28377	1.598000	0.50083	0.655000	0.94253	AAG	TERF2	-	pirsf_Telomere_repeat-bd-1/2	ENSG00000132604		0.488	TERF2-001	KNOWN	basic	protein_coding	TERF2	HGNC	protein_coding	OTTHUMT00000268944.2	38	0.00	0	C			69401045	69401045	-1	no_errors	ENST00000254942	ensembl	human	known	69_37n	missense	50	15.25	9	SNP	1.000	G
TIMM8A	1678	genome.wustl.edu	37	X	100601591	100601591	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chrX:100601591C>T	ENST00000372902.3	-	2	721	c.190G>A	c.(190-192)Gtg>Atg	p.V64M	TIMM8A_ENST00000480575.1_5'Flank	NM_004085.3	NP_004076.1	O60220	TIM8A_HUMAN	translocase of inner mitochondrial membrane 8 homolog A (yeast)	64					cellular protein metabolic process (GO:0044267)|chaperone-mediated protein transport (GO:0072321)|nervous system development (GO:0007399)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)			endometrium(1)|lung(1)	2						ACGCAGTTCACAAAACAGGCC	0.483																																						dbGAP											0													134.0	131.0	132.0					X																	100601591		2203	4300	6503	-	-	-	SO:0001583	missense	0			U66035	CCDS14481.1	Xq22	2008-02-05	2001-11-28		ENSG00000126953	ENSG00000126953			11817	protein-coding gene	gene with protein product		300356	"""translocase of inner mitochondrial membrane 8 (yeast) homolog A"""	DFN1		10552927, 8841189	Standard	NM_004085		Approved	DDP, MTS	uc004ehd.2	O60220	OTTHUMG00000022028	ENST00000372902.3:c.190G>A	X.37:g.100601591C>T	ENSP00000361993:p.Val64Met		B2R5A6|Q6IRW6	Missense_Mutation	SNP	pfam_Tim8/9/10/13_Znf-like,superfamily_Tim8/9/10/13_Znf-like	p.V64M	ENST00000372902.3	37	c.190	CCDS14481.1	X	.	.	.	.	.	.	.	.	.	.	C	22.3	4.269970	0.80469	.	.	ENSG00000126953	ENST00000372902	T	0.63096	-0.02	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.79191	0.4404	.	.	.	0.58432	D	0.999999	D	0.67145	0.996	D	0.67382	0.951	T	0.81064	-0.1102	9	0.52906	T	0.07	.	17.7039	0.88303	0.0:1.0:0.0:0.0	.	64	O60220	TIM8A_HUMAN	M	64	ENSP00000361993:V64M	ENSP00000361993:V64M	V	-	1	0	TIMM8A	100488247	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.670000	0.83925	2.210000	0.71456	0.600000	0.82982	GTG	TIMM8A	-	pfam_Tim8/9/10/13_Znf-like,superfamily_Tim8/9/10/13_Znf-like	ENSG00000126953		0.483	TIMM8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIMM8A	HGNC	protein_coding	OTTHUMT00000057554.1	65	0.00	0	C	NM_004085		100601591	100601591	-1	no_errors	ENST00000372902	ensembl	human	known	69_37n	missense	56	22.22	16	SNP	1.000	T
TLN1	7094	genome.wustl.edu	37	9	35707382	35707382	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr9:35707382G>A	ENST00000314888.9	-	36	5089	c.4736C>T	c.(4735-4737)cCt>cTt	p.P1579L	TLN1_ENST00000540444.1_Missense_Mutation_p.P1579L|TLN1_ENST00000464379.1_Intron	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	1579	Interaction with SYNM.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GGAGAACTCAGGGTTGGACGC	0.592																																						dbGAP											0													74.0	68.0	70.0					9																	35707382		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.4736C>T	9.37:g.35707382G>A	ENSP00000316029:p.Pro1579Leu		A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	pfam_Talin_cent,pfam_Vinculin-bd_dom,pfam_ILWEQ,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ,pfscan_FERM_domain,pfscan_ILWEQ	p.P1579L	ENST00000314888.9	37	c.4736	CCDS35009.1	9	.	.	.	.	.	.	.	.	.	.	G	23.2	4.391712	0.83011	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	T;T	0.75050	-0.74;-0.9	5.69	4.79	0.61399	.	0.000000	0.85682	D	0.000000	D	0.87732	0.6251	M	0.90252	3.1	0.80722	D	1	D	0.76494	0.999	D	0.68943	0.961	D	0.89592	0.3828	10	0.52906	T	0.07	-6.4277	14.844	0.70246	0.0693:0.0:0.9307:0.0	.	1579	Q9Y490	TLN1_HUMAN	L	1579	ENSP00000316029:P1579L;ENSP00000442981:P1579L	ENSP00000316029:P1579L	P	-	2	0	TLN1	35697382	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.661000	0.74422	1.412000	0.46977	0.561000	0.74099	CCT	TLN1	-	NULL	ENSG00000137076		0.592	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN1	HGNC	protein_coding	OTTHUMT00000052353.2	18	0.00	0	G	NM_006289		35707382	35707382	-1	no_errors	ENST00000314888	ensembl	human	known	69_37n	missense	19	24.00	6	SNP	1.000	A
TMEM63C	57156	genome.wustl.edu	37	14	77697973	77697973	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr14:77697973C>G	ENST00000298351.4	+	7	537	c.393C>G	c.(391-393)atC>atG	p.I131M		NM_020431.2	NP_065164.2	Q9P1W3	CSC1_HUMAN	transmembrane protein 63C	131					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)	integral component of membrane (GO:0016021)	calcium activated cation channel activity (GO:0005227)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(1)	23			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0342)		ACGCACGCATCTACATCGTGT	0.522																																						dbGAP											0													145.0	144.0	145.0					14																	77697973		1976	3699	5675	-	-	-	SO:0001583	missense	0				CCDS45141.1	14q24.3	2014-05-30	2005-07-25	2005-07-25	ENSG00000165548	ENSG00000165548			23787	protein-coding gene	gene with protein product	"""calcium permeable stress-gated cation channel 1 homolog (Arabidopsis)"""		"""chromosome 14 open reading frame 171"""	C14orf171		24503647	Standard	NM_020431		Approved	DKFZp434P0111, CSC1, hsCSC1	uc001xtf.2	Q9P1W3	OTTHUMG00000171557	ENST00000298351.4:c.393C>G	14.37:g.77697973C>G	ENSP00000298351:p.Ile131Met		B2RN22|B3KWJ5|Q86TS3|Q86TS4|Q9NSQ4|Q9P1W1	Missense_Mutation	SNP	pfam_DUF221	p.I131M	ENST00000298351.4	37	c.393	CCDS45141.1	14	.	.	.	.	.	.	.	.	.	.	C	9.262	1.043394	0.19748	.	.	ENSG00000165548	ENST00000554766;ENST00000298351	T;T	0.43294	0.95;0.95	5.08	3.23	0.37069	.	0.094770	0.64402	D	0.000001	T	0.39145	0.1067	M	0.62723	1.935	0.31318	N	0.686352	B	0.14438	0.01	B	0.23018	0.043	T	0.42649	-0.9439	10	0.46703	T	0.11	-27.9863	9.1027	0.36678	0.0:0.8256:0.0:0.1744	.	131	Q9P1W3	TM63C_HUMAN	M	131	ENSP00000451842:I131M;ENSP00000298351:I131M	ENSP00000298351:I131M	I	+	3	3	TMEM63C	76767726	0.999000	0.42202	0.998000	0.56505	0.395000	0.30598	0.590000	0.23954	0.625000	0.30304	0.655000	0.94253	ATC	TMEM63C	-	NULL	ENSG00000165548		0.522	TMEM63C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM63C	HGNC	protein_coding	OTTHUMT00000414193.1	96	0.00	0	C			77697973	77697973	+1	no_errors	ENST00000298351	ensembl	human	known	69_37n	missense	126	11.27	16	SNP	1.000	G
TP53	7157	genome.wustl.edu	37	17	7578535	7578535	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr17:7578535T>G	ENST00000269305.4	-	5	584	c.395A>C	c.(394-396)aAg>aCg	p.K132T	TP53_ENST00000359597.4_Missense_Mutation_p.K132T|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.K132T|TP53_ENST00000455263.2_Missense_Mutation_p.K132T|TP53_ENST00000420246.2_Missense_Mutation_p.K132T|TP53_ENST00000445888.2_Missense_Mutation_p.K132T	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	132	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		K -> E (in LFS; germline mutation and in sporadic cancers; somatic mutation).|K -> L (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|K -> M (in sporadic cancers; somatic mutation).|K -> N (in sporadic cancers; somatic mutation).|K -> Q (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1694291}.|K -> R (in sporadic cancers; somatic mutation).|K -> T (in sporadic cancers; somatic mutation).|K -> W (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|KM -> NL (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.K132R(42)|p.K132M(10)|p.0?(8)|p.K132T(7)|p.Y126_K132delYSPALNK(6)|p.N131del(3)|p.K39R(3)|p.N131fs*27(2)|p.V73fs*9(1)|p.S127fs*36(1)|p.A129_K132delALNK(1)|p.Y126fs*11(1)|p.K132W(1)|p.K132_A138delKMFCQLA(1)|p.S127_Q136del10(1)|p.L130_M133delLNKM(1)|p.K39T(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCAAAACATCTTGTTGAGGGC	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	90	Substitution - Missense(64)|Deletion - In frame(13)|Whole gene deletion(8)|Deletion - Frameshift(5)	lung(15)|ovary(12)|large_intestine(11)|central_nervous_system(8)|oesophagus(7)|breast(5)|bone(5)|upper_aerodigestive_tract(4)|biliary_tract(4)|urinary_tract(4)|haematopoietic_and_lymphoid_tissue(3)|adrenal_gland(2)|kidney(2)|prostate(2)|liver(2)|stomach(1)|endometrium(1)|skin(1)|pancreas(1)											46.0	47.0	47.0					17																	7578535		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.395A>C	17.37:g.7578535T>G	ENSP00000269305:p.Lys132Thr		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.K132T	ENST00000269305.4	37	c.395	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	19.63	3.863814	0.71949	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000514944;ENST00000508793	D;D;D;D;D;D;D;D	0.99859	-7.23;-7.23;-7.23;-7.23;-7.23;-7.23;-7.23;-7.23	5.48	4.41	0.53225	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99799	0.9914	M	0.81497	2.545	0.80722	D	1	D;D;P;D;D;D;D	0.89917	1.0;0.999;0.814;1.0;1.0;0.998;1.0	D;D;P;D;D;D;D	0.97110	0.998;0.996;0.716;0.994;0.998;0.992;1.0	D	0.97421	1.0009	10	0.87932	D	0	-14.0777	9.8103	0.40820	0.0:0.082:0.0:0.918	.	93;132;132;39;132;132;132	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	T	132;132;132;132;132;132;121;39;39;132	ENSP00000410739:K132T;ENSP00000352610:K132T;ENSP00000269305:K132T;ENSP00000398846:K132T;ENSP00000391127:K132T;ENSP00000391478:K132T;ENSP00000423862:K39T;ENSP00000424104:K132T	ENSP00000269305:K132T	K	-	2	0	TP53	7519260	1.000000	0.71417	0.999000	0.59377	0.772000	0.43724	7.993000	0.88291	1.020000	0.39573	-0.256000	0.11100	AAG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	32	0.00	0	T	NM_000546		7578535	7578535	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	34	22.73	10	SNP	1.000	G
TRAFD1	10906	genome.wustl.edu	37	12	112587555	112587555	+	Splice_Site	SNP	G	G	T			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr12:112587555G>T	ENST00000257604.5	+	9	1776	c.1159G>T	c.(1159-1161)Gac>Tac	p.D387Y	TRAFD1_ENST00000412615.2_Splice_Site_p.D387Y|Y_RNA_ENST00000363265.1_RNA	NM_001143906.1	NP_001137378.1	O14545	TRAD1_HUMAN	TRAF-type zinc finger domain containing 1	387					negative regulation of innate immune response (GO:0045824)|response to cytokine (GO:0034097)		metal ion binding (GO:0046872)			kidney(5)|large_intestine(3)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	17						TCTTGTTTAGGACCAGTGTGA	0.517																																						dbGAP											0													93.0	84.0	87.0					12																	112587555		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB007447	CCDS9160.1	12q24.13	2013-01-25			ENSG00000135148	ENSG00000135148			24808	protein-coding gene	gene with protein product		613197				12477932	Standard	NM_006700		Approved	FLN29	uc001ttp.3	O14545	OTTHUMG00000169640	ENST00000257604.5:c.1159-1G>T	12.37:g.112587555G>T			A8K5L6|B4DI89	Missense_Mutation	SNP	superfamily_TRAF-like	p.D387Y	ENST00000257604.5	37	c.1159	CCDS9160.1	12	.	.	.	.	.	.	.	.	.	.	G	24.7	4.554927	0.86231	.	.	ENSG00000135148	ENST00000412615;ENST00000257604	T;T	0.39592	1.07;1.07	5.73	5.73	0.89815	.	0.561206	0.19750	N	0.106924	T	0.67116	0.2859	M	0.77103	2.36	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.66236	-0.5974	9	.	.	.	-22.9469	17.6863	0.88257	0.0:0.0:1.0:0.0	.	387	O14545	TRAD1_HUMAN	Y	387	ENSP00000396526:D387Y;ENSP00000257604:D387Y	.	D	+	1	0	TRAFD1	111071938	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.190000	0.58365	2.721000	0.93114	0.655000	0.94253	GAC	TRAFD1	-	superfamily_TRAF-like	ENSG00000135148		0.517	TRAFD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAFD1	HGNC	protein_coding	OTTHUMT00000405214.1	44	0.00	0	G	NM_006700	Missense_Mutation	112587555	112587555	+1	no_errors	ENST00000257604	ensembl	human	known	69_37n	missense	47	21.67	13	SNP	1.000	T
TTBK1	84630	genome.wustl.edu	37	6	43223320	43223320	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr6:43223320C>A	ENST00000259750.4	+	8	756	c.673C>A	c.(673-675)Ctc>Atc	p.L225I	TTBK1_ENST00000304139.5_Missense_Mutation_p.L174I	NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	225	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			CCTGTGGTCCCTCTTCTACAT	0.632																																						dbGAP											0													38.0	37.0	37.0					6																	43223320		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.673C>A	6.37:g.43223320C>A	ENSP00000259750:p.Leu225Ile		A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L225I	ENST00000259750.4	37	c.673	CCDS34455.1	6	.	.	.	.	.	.	.	.	.	.	C	20.5	4.003027	0.74932	.	.	ENSG00000146216	ENST00000393984;ENST00000259750;ENST00000304139	T	0.28666	1.6	4.85	4.85	0.62838	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000002	T	0.46521	0.1397	M	0.69185	2.1	0.45129	D	0.998145	D	0.76494	0.999	D	0.72625	0.978	T	0.50816	-0.8783	10	0.72032	D	0.01	.	16.7621	0.85515	0.0:1.0:0.0:0.0	.	225	Q5TCY1	TTBK1_HUMAN	I	174;225;174	ENSP00000259750:L225I	ENSP00000259750:L225I	L	+	1	0	TTBK1	43331298	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.747000	0.47475	2.250000	0.74265	0.563000	0.77884	CTC	TTBK1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000146216		0.632	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTBK1	HGNC	protein_coding	OTTHUMT00000040584.3	22	0.00	0	C			43223320	43223320	+1	no_errors	ENST00000259750	ensembl	human	known	69_37n	missense	53	18.46	12	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179477137	179477137	+	Silent	SNP	G	G	C			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr2:179477137G>C	ENST00000591111.1	-	216	45416	c.45192C>G	c.(45190-45192)gtC>gtG	p.V15064V	TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000359218.5_Silent_p.V7765V|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000460472.2_Silent_p.V7640V|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342992.6_Silent_p.V14137V|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342175.6_Silent_p.V7832V|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Silent_p.V16705V|TTN-AS1_ENST00000589487.1_RNA			Q8WZ42	TITIN_HUMAN	titin	15064	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGTGTCCTTGACAGTGGTAT	0.498																																						dbGAP											0													103.0	94.0	97.0					2																	179477137		1969	4143	6112	-	-	-	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.45192C>G	2.37:g.179477137G>C			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.V14137	ENST00000591111.1	37	c.42411		2																																																																																			TTN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.498	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	81	0.00	0	G	NM_133378		179477137	179477137	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	silent	67	18.29	15	SNP	0.957	C
TWSG1	57045	genome.wustl.edu	37	18	9396385	9396385	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr18:9396385G>C	ENST00000262120.5	+	4	522	c.331G>C	c.(331-333)Gat>Cat	p.D111H	TWSG1_ENST00000581641.1_Missense_Mutation_p.D111H	NM_020648.5	NP_065699.1	Q9GZX9	TWSG1_HUMAN	twisted gastrulation BMP signaling modulator 1	111					BMP signaling pathway (GO:0030509)|camera-type eye development (GO:0043010)|cell differentiation (GO:0030154)|forebrain development (GO:0030900)|hemopoiesis (GO:0030097)|mesoderm formation (GO:0001707)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of osteoblast differentiation (GO:0045668)|ossification (GO:0001503)|positive regulation of BMP signaling pathway (GO:0030513)|salivary gland morphogenesis (GO:0007435)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|pancreas(2)	10						CACAGAAGGAGATACTCAGTT	0.438																																						dbGAP											0													121.0	115.0	117.0					18																	9396385		2203	4300	6503	-	-	-	SO:0001583	missense	0			AA486291	CCDS11844.1	18p11.3	2013-10-03	2013-10-03		ENSG00000128791	ENSG00000128791			12429	protein-coding gene	gene with protein product		605049	"""twisted gastrulation homolog 1 (Drosophila)"""			11260715	Standard	NM_020648		Approved	TSG	uc002knz.3	Q9GZX9	OTTHUMG00000131597	ENST00000262120.5:c.331G>C	18.37:g.9396385G>C	ENSP00000262120:p.Asp111His		B2RE08|D3DUH9|Q8NBI7|Q96K46	Missense_Mutation	SNP	pfam_Tsg	p.D111H	ENST00000262120.5	37	c.331	CCDS11844.1	18	.	.	.	.	.	.	.	.	.	.	G	19.26	3.793509	0.70452	.	.	ENSG00000128791	ENST00000262120	.	.	.	5.33	5.33	0.75918	.	0.090906	0.64402	D	0.000001	T	0.71056	0.3295	M	0.79011	2.435	0.80722	D	1	B	0.18310	0.027	B	0.24006	0.05	T	0.71024	-0.4712	9	0.87932	D	0	-42.4513	17.994	0.89177	0.0:0.0:1.0:0.0	.	111	Q9GZX9	TWSG1_HUMAN	H	111	.	ENSP00000262120:D111H	D	+	1	0	TWSG1	9386385	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	9.652000	0.98499	2.506000	0.84524	0.561000	0.74099	GAT	TWSG1	-	pfam_Tsg	ENSG00000128791		0.438	TWSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TWSG1	HGNC	protein_coding	OTTHUMT00000254480.2	57	0.00	0	G			9396385	9396385	+1	no_errors	ENST00000262120	ensembl	human	known	69_37n	missense	67	10.67	8	SNP	1.000	C
UBR5	51366	genome.wustl.edu	37	8	103282400	103282400	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr8:103282400C>A	ENST00000520539.1	-	50	7703	c.7097G>T	c.(7096-7098)aGa>aTa	p.R2366I	UBR5_ENST00000518205.1_Missense_Mutation_p.R95I|UBR5_ENST00000220959.4_Missense_Mutation_p.R2366I|UBR5_ENST00000521922.1_Missense_Mutation_p.R2360I	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	2366	Arg/Asp-rich (mixed charge).				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)			NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			GGAAAGCTGTCTTCTAAAGTC	0.418																																					Ovarian(131;96 1741 5634 7352 27489)	dbGAP											0													111.0	106.0	108.0					8																	103282400		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.7097G>T	8.37:g.103282400C>A	ENSP00000429084:p.Arg2366Ile		B2RP24|J3KMW7|O94970|Q9NPL3	Missense_Mutation	SNP	pfam_HECT,pfam_E3_UbLigase_EDD_UBA,pfam_PABP_HYD,pfam_Znf_N-recognin,superfamily_HECT,superfamily_PABP_HYD,superfamily_Reg_csome_cond/b-lactamase_inh,smart_Znf_N-recognin_met,smart_PABP_HYD,smart_HECT,pfscan_HECT,pfscan_Znf_N-recognin	p.R2366I	ENST00000520539.1	37	c.7097	CCDS34933.1	8	.	.	.	.	.	.	.	.	.	.	C	28.4	4.915585	0.92178	.	.	ENSG00000104517	ENST00000520539;ENST00000220959;ENST00000518205;ENST00000521922	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	5.32	5.32	0.75619	Polyadenylate-binding protein/Hyperplastic disc protein (1);HECT (1);	0.000000	0.85682	D	0.000000	T	0.46229	0.1382	L	0.48642	1.525	0.80722	D	1	D;D	0.57571	0.974;0.98	B;P	0.46275	0.424;0.51	T	0.50162	-0.8860	10	0.72032	D	0.01	.	19.3665	0.94464	0.0:1.0:0.0:0.0	.	2360;2366	E7EMW7;O95071	.;UBR5_HUMAN	I	2366;2366;95;2360	ENSP00000429084:R2366I;ENSP00000220959:R2366I;ENSP00000428693:R95I;ENSP00000427819:R2360I	ENSP00000220959:R2366I	R	-	2	0	UBR5	103351576	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.361000	0.79497	2.625000	0.88918	0.655000	0.94253	AGA	UBR5	-	superfamily_HECT,superfamily_PABP_HYD	ENSG00000104517		0.418	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	UBR5	HGNC	protein_coding	OTTHUMT00000380075.2	40	0.00	0	C	NM_015902		103282400	103282400	-1	no_errors	ENST00000520539	ensembl	human	known	69_37n	missense	63	11.27	8	SNP	1.000	A
UCP2	7351	genome.wustl.edu	37	11	73687912	73687912	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr11:73687912T>A	ENST00000310473.3	-	5	1330	c.488A>T	c.(487-489)tAc>tTc	p.Y163F	UCP2_ENST00000542615.1_5'Flank|UCP2_ENST00000536983.1_Missense_Mutation_p.Y163F	NM_003355.2	NP_003346.2	P55851	UCP2_HUMAN	uncoupling protein 2 (mitochondrial, proton carrier)	163					aging (GO:0007568)|cellular metabolic process (GO:0044237)|cellular response to amino acid starvation (GO:0034198)|cellular response to glucose stimulus (GO:0071333)|cellular response to insulin stimulus (GO:0032869)|female pregnancy (GO:0007565)|liver regeneration (GO:0097421)|mitochondrial transport (GO:0006839)|negative regulation of apoptotic process (GO:0043066)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|positive regulation of cell death (GO:0010942)|proton transport (GO:0015992)|regulation of mitochondrial membrane potential (GO:0051881)|respiratory electron transport chain (GO:0022904)|response to fatty acid (GO:0070542)|response to hypoxia (GO:0001666)|response to superoxide (GO:0000303)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				large_intestine(1)|lung(3)|prostate(1)	5	Breast(11;0.000112)					AATGGTCTTGTAGGCATTGAC	0.587																																					Colon(191;388 2040 43557 45622 48925)	dbGAP											0													135.0	127.0	130.0					11																	73687912		2200	4293	6493	-	-	-	SO:0001583	missense	0			U76367	CCDS8228.1	11q13	2014-02-12						"""Solute carriers"""	12518	protein-coding gene	gene with protein product		601693	"""body mass index QTL 4"", ""body mass index quantitative trait 4"""	BMIQ4		9196039, 11381268	Standard	NM_003355		Approved	SLC25A8	uc001oup.1	P55851		ENST00000310473.3:c.488A>T	11.37:g.73687912T>A	ENSP00000312029:p.Tyr163Phe		Q4PJH8|Q53HM3	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_uncoupling	p.Y163F	ENST00000310473.3	37	c.488	CCDS8228.1	11	.	.	.	.	.	.	.	.	.	.	T	26.9	4.783050	0.90282	.	.	ENSG00000175567	ENST00000310473;ENST00000536983;ENST00000544615;ENST00000545212	T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05	5.92	5.92	0.95590	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	T	0.75034	0.3795	N	0.12422	0.21	0.80722	D	1	P;B	0.42248	0.774;0.429	P;P	0.55824	0.508;0.785	T	0.74328	-0.3701	10	0.27082	T	0.32	-3.1262	15.1874	0.73016	0.0:0.0:0.0:1.0	.	163;163	F5GX45;P55851	.;UCP2_HUMAN	F	163;163;136;47	ENSP00000312029:Y163F;ENSP00000441147:Y163F;ENSP00000439951:Y136F;ENSP00000439706:Y47F	ENSP00000312029:Y163F	Y	-	2	0	UCP2	73365560	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	7.997000	0.88414	2.270000	0.75569	0.459000	0.35465	TAC	UCP2	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000175567		0.587	UCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UCP2	HGNC	protein_coding	OTTHUMT00000398108.1	44	0.00	0	T	NM_003355		73687912	73687912	-1	no_errors	ENST00000310473	ensembl	human	known	69_37n	missense	28	36.36	16	SNP	1.000	A
UGT1A5	54579	genome.wustl.edu	37	2	234622270	234622270	+	Silent	SNP	C	C	A			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr2:234622270C>A	ENST00000373414.3	+	1	633	c.633C>A	c.(631-633)gtC>gtA	p.V211V	UGT1A1_ENST00000608381.1_Silent_p.V211V|UGT1A1_ENST00000373450.4_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A6_ENST00000406651.1_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A6_ENST00000480628.1_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A6_ENST00000305139.6_Intron			P35504	UD15_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A5	211						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			cervix(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	22		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;4.51e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000523)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.00645)		TGCAAAGGGTCAAGAACATGC	0.473																																						dbGAP											0													199.0	190.0	193.0					2																	234622270		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			M84129	CCDS33404.1	2q37	2010-03-05	2005-07-20		ENSG00000240224	ENSG00000240224		"""UDP glucuronosyltransferases"""	12537	other	complex locus constituent		606430	"""UDP glycosyltransferase 1 family, polypeptide A5"""			9295054, 1339448	Standard	NM_019078		Approved	UGT1E		P35504	OTTHUMG00000059120	ENST00000373414.3:c.633C>A	2.37:g.234622270C>A			B8K294	Silent	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.V211	ENST00000373414.3	37	c.633	CCDS33404.1	2																																																																																			UGT1A5	-	pfam_UDP_glucos_trans	ENSG00000240224		0.473	UGT1A5-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	UGT1A5	HGNC	protein_coding	OTTHUMT00000130985.1	145	0.00	0	C	NM_019078		234622270	234622270	+1	no_errors	ENST00000373414	ensembl	human	known	69_37n	silent	166	14.43	28	SNP	0.978	A
ULK4	54986	genome.wustl.edu	37	3	41757046	41757046	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr3:41757046A>C	ENST00000301831.4	-	24	2932	c.2470T>G	c.(2470-2472)Tcc>Gcc	p.S824A		NM_017886.2	NP_060356.2	Q96C45	ULK4_HUMAN	unc-51 like kinase 4	824					cilium morphogenesis (GO:0060271)|epithelial cilium movement (GO:0003351)|microtubule cytoskeleton organization (GO:0000226)|regulation of JNK cascade (GO:0046328)|regulation of MAPK cascade (GO:0043408)|regulation of neuron migration (GO:2001222)|regulation of neuron projection development (GO:0010975)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein kinase C signaling (GO:0090036)|ventricular system development (GO:0021591)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|large_intestine(6)|lung(7)|prostate(5)|skin(1)	22				KIRC - Kidney renal clear cell carcinoma(284;0.214)		TTAGCCAAGGAGTTAAGAATG	0.463																																						dbGAP											0													81.0	79.0	80.0					3																	41757046		1960	4167	6127	-	-	-	SO:0001583	missense	0			AK000581	CCDS43071.1	3p22.1	2013-07-02	2013-07-02		ENSG00000168038	ENSG00000168038			15784	protein-coding gene	gene with protein product			"""unc-51-like kinase 4 (C. elegans)"""			12477932	Standard	NM_017886		Approved	FLJ20574, REC01035, FAM7C1	uc003ckv.4	Q96C45	OTTHUMG00000156210	ENST00000301831.4:c.2470T>G	3.37:g.41757046A>C	ENSP00000301831:p.Ser824Ala		A6NF15|Q8IW79|Q9NWV6|Q9UF96	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S824A	ENST00000301831.4	37	c.2470	CCDS43071.1	3	.	.	.	.	.	.	.	.	.	.	A	0.021	-1.418888	0.01136	.	.	ENSG00000168038	ENST00000301831	T	0.62105	0.05	5.5	3.71	0.42584	Armadillo-type fold (1);	0.471646	0.20608	N	0.089024	T	0.26122	0.0637	N	0.00926	-1.1	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.27971	-1.0058	10	0.02654	T	1	.	9.9176	0.41444	0.2493:0.6844:0.0:0.0662	.	824	Q96C45	ULK4_HUMAN	A	824	ENSP00000301831:S824A	ENSP00000301831:S824A	S	-	1	0	ULK4	41732050	0.992000	0.36948	0.628000	0.29241	0.417000	0.31264	3.097000	0.50251	0.685000	0.31468	-0.895000	0.02911	TCC	ULK4	-	superfamily_ARM-type_fold	ENSG00000168038		0.463	ULK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ULK4	HGNC	protein_coding	OTTHUMT00000343490.1	45	0.00	0	A	XM_929989		41757046	41757046	-1	no_errors	ENST00000301831	ensembl	human	known	69_37n	missense	31	18.42	7	SNP	0.740	C
USP24	23358	genome.wustl.edu	37	1	55555340	55555340	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr1:55555340C>T	ENST00000294383.6	-	55	6627	c.6628G>A	c.(6628-6630)Gtt>Att	p.V2210I	USP24_ENST00000407756.1_Missense_Mutation_p.V2050I	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	2210					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						AAATATTCAACTAACCACTGA	0.328																																						dbGAP											0													54.0	47.0	49.0					1																	55555340		1830	4076	5906	-	-	-	SO:0001583	missense	0			AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.6628G>A	1.37:g.55555340C>T	ENSP00000294383:p.Val2210Ile		Q6ZSY2|Q8N2Y4|Q9NXD1	Missense_Mutation	SNP	pfam_Peptidase_C19,superfamily_UBA-like,superfamily_ARM-type_fold,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Peptidase_C19	p.V2210I	ENST00000294383.6	37	c.6628	CCDS44154.2	1	.	.	.	.	.	.	.	.	.	.	C	17.68	3.448648	0.63178	.	.	ENSG00000162402	ENST00000294383;ENST00000407756	T;T	0.02197	4.4;4.41	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.02767	0.0083	L	0.38531	1.155	0.53005	D	0.999964	B	0.23591	0.088	B	0.24701	0.055	T	0.55811	-0.8082	10	0.33940	T	0.23	.	12.5291	0.56104	0.0:0.9246:0.0:0.0754	.	2050	B7WPF4	.	I	2210;2050	ENSP00000294383:V2210I;ENSP00000385700:V2050I	ENSP00000294383:V2210I	V	-	1	0	USP24	55327928	0.997000	0.39634	0.996000	0.52242	0.996000	0.88848	3.469000	0.53093	2.771000	0.95319	0.563000	0.77884	GTT	USP24	-	superfamily_ARM-type_fold	ENSG00000162402		0.328	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	USP24	HGNC	protein_coding	OTTHUMT00000022275.2	62	0.00	0	C			55555340	55555340	-1	no_errors	ENST00000294383	ensembl	human	known	69_37n	missense	57	12.31	8	SNP	0.999	T
CFAP44	55779	genome.wustl.edu	37	3	113119482	113119482	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr3:113119482G>T	ENST00000295868.2	-	12	1546	c.1384C>A	c.(1384-1386)Cca>Aca	p.P462T	WDR52_ENST00000393845.2_Missense_Mutation_p.P462T	NM_018338.3	NP_060808.2														breast(2)|central_nervous_system(3)|endometrium(3)|kidney(5)|large_intestine(7)|lung(26)|prostate(1)|urinary_tract(2)	49						AGGCATTCTGGGTCCTGGGTC	0.398																																						dbGAP											0													51.0	55.0	54.0					3																	113119482		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000295868.2:c.1384C>A	3.37:g.113119482G>T	ENSP00000295868:p.Pro462Thr			Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P462T	ENST00000295868.2	37	c.1384	CCDS2972.1	3	.	.	.	.	.	.	.	.	.	.	G	21.2	4.117671	0.77323	.	.	ENSG00000206530	ENST00000393845;ENST00000295868	T;T	0.68181	-0.31;0.62	5.98	4.17	0.49024	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	.	.	.	.	T	0.80449	0.4625	M	0.81239	2.535	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.80108	-0.1520	9	0.48119	T	0.1	.	11.2541	0.49043	0.0685:0.1274:0.8041:0.0	.	462	Q96MT7	WDR52_HUMAN	T	462	ENSP00000377428:P462T;ENSP00000295868:P462T	ENSP00000295868:P462T	P	-	1	0	WDR52	114602172	1.000000	0.71417	0.999000	0.59377	0.974000	0.67602	8.618000	0.90932	0.833000	0.34828	0.650000	0.86243	CCA	WDR52	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000206530		0.398	WDR52-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR52	HGNC	protein_coding	OTTHUMT00000354128.3	35	0.00	0	G			113119482	113119482	-1	no_errors	ENST00000393845	ensembl	human	known	69_37n	missense	36	36.84	21	SNP	1.000	T
XRCC2	7516	genome.wustl.edu	37	7	152346029	152346029	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr7:152346029C>T	ENST00000359321.1	-	3	626	c.541G>A	c.(541-543)Gag>Aag	p.E181K	XRCC2_ENST00000495707.1_5'UTR	NM_005431.1	NP_005422.1	O43543	XRCC2_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 2	181					centrosome organization (GO:0051297)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|in utero embryonic development (GO:0001701)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of neurogenesis (GO:0050769)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|strand invasion (GO:0042148)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Rad51B-Rad51C-Rad51D-XRCC2 complex (GO:0033063)|replication fork (GO:0005657)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)			NS(1)|breast(1)|large_intestine(5)|liver(1)|lung(1)|prostate(2)	11		all_hematologic(28;0.0592)|Prostate(32;0.081)	OV - Ovarian serous cystadenocarcinoma(82;0.0423)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0429)		ACAAGCTTCTCTAAGCACTGA	0.443								Homologous recombination																														dbGAP											0													108.0	111.0	110.0					7																	152346029		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y08837	CCDS5933.1	7q36	2006-05-04			ENSG00000196584	ENSG00000196584			12829	protein-coding gene	gene with protein product	"""RAD51-like"""	600375				7607692, 10422536	Standard	NM_005431		Approved		uc003wld.3	O43543	OTTHUMG00000151470	ENST00000359321.1:c.541G>A	7.37:g.152346029C>T	ENSP00000352271:p.Glu181Lys		B2R925	Missense_Mutation	SNP	pfam_DNA_recomb/repair_Rad51_C,pfscan_DNA_recomb_RecA/RadB_ATP-bd	p.E181K	ENST00000359321.1	37	c.541	CCDS5933.1	7	.	.	.	.	.	.	.	.	.	.	C	7.391	0.630733	0.14322	.	.	ENSG00000196584	ENST00000359321	T	0.61510	0.1	5.06	1.15	0.20763	DNA recombination/repair protein RecA/RadB, ATP-binding domain (1);DNA recombination and repair protein Rad51, C-terminal (1);	0.460401	0.24608	N	0.037072	T	0.30759	0.0775	N	0.17278	0.47	0.36808	D	0.885727	B	0.02656	0.0	B	0.10450	0.005	T	0.17899	-1.0354	10	0.07175	T	0.84	-6.1495	5.2328	0.15432	0.0:0.4915:0.277:0.2316	.	181	O43543	XRCC2_HUMAN	K	181	ENSP00000352271:E181K	ENSP00000352271:E181K	E	-	1	0	XRCC2	151976962	0.995000	0.38212	0.247000	0.24249	0.349000	0.29174	1.191000	0.32138	-0.061000	0.13110	0.467000	0.42956	GAG	XRCC2	-	pfam_DNA_recomb/repair_Rad51_C,pfscan_DNA_recomb_RecA/RadB_ATP-bd	ENSG00000196584		0.443	XRCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRCC2	HGNC	protein_coding	OTTHUMT00000322783.1	36	0.00	0	C	NM_005431		152346029	152346029	-1	no_errors	ENST00000359321	ensembl	human	known	69_37n	missense	41	14.58	7	SNP	0.984	T
XRRA1	143570	genome.wustl.edu	37	11	74574068	74574068	+	Splice_Site	SNP	T	T	C	rs369939343		TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr11:74574068T>C	ENST00000340360.6	-	11	1311		c.e11-2		XRRA1_ENST00000321448.8_Splice_Site|XRRA1_ENST00000527087.1_Intron	NM_182969.2	NP_892014.1			X-ray radiation resistance associated 1											breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(3)	20						ACACAACCTCTGAAACAGAAG	0.433																																						dbGAP											0													44.0	41.0	42.0					11																	74574068		1905	4129	6034	-	-	-	SO:0001630	splice_region_variant	0			AK074152	CCDS44680.1, CCDS58159.1, CCDS58160.1	11q13.4	2010-03-19			ENSG00000166435	ENSG00000166435			18868	protein-coding gene	gene with protein product		609788				12908878, 17295261	Standard	NM_182969		Approved	FLJ00225	uc009yub.3	Q6P2D8		ENST00000340360.6:c.980-2A>G	11.37:g.74574068T>C				Splice_Site	SNP	-	e9-2	ENST00000340360.6	37	c.980-2	CCDS44680.1	11	.	.	.	.	.	.	.	.	.	.	T	17.45	3.392128	0.62066	.	.	ENSG00000166435	ENST00000340360;ENST00000321448	.	.	.	5.1	5.1	0.69264	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.4433	0.50109	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	XRRA1	74251716	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	3.387000	0.52501	2.270000	0.75569	0.533000	0.62120	.	XRRA1	-	-	ENSG00000166435		0.433	XRRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRRA1	HGNC	protein_coding	OTTHUMT00000384715.1	30	0.00	0	T	NM_182969	Intron	74574068	74574068	-1	no_errors	ENST00000340360	ensembl	human	known	69_37n	splice_site	37	21.28	10	SNP	1.000	C
ZCCHC8	55596	genome.wustl.edu	37	12	122958130	122958130	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr12:122958130C>T	ENST00000336229.4	-	14	2168	c.2038G>A	c.(2038-2040)Gaa>Aaa	p.E680K	ZCCHC8_ENST00000536306.1_Missense_Mutation_p.E442K|ZCCHC8_ENST00000543897.1_Missense_Mutation_p.E442K|ZCCHC8_ENST00000538116.1_Missense_Mutation_p.E291K	NM_017612.3	NP_060082.2	Q6NZY4	ZCHC8_HUMAN	zinc finger, CCHC domain containing 8	680					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(2)|large_intestine(8)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	23	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.25e-05)|Epithelial(86;0.000113)|BRCA - Breast invasive adenocarcinoma(302;0.202)		CCAGTAGATTCTGCCATATTC	0.418																																						dbGAP											0													138.0	130.0	132.0					12																	122958130		1854	4098	5952	-	-	-	SO:0001583	missense	0			BC017704		12q24.31	2014-04-14				ENSG00000033030		"""Zinc fingers, CCHC domain containing"""	25265	protein-coding gene	gene with protein product						12477932	Standard	XM_005253581		Approved	DKFZp434E2220	uc001ucn.3	Q6NZY4		ENST00000336229.4:c.2038G>A	12.37:g.122958130C>T	ENSP00000337313:p.Glu680Lys		Q7L2P6|Q8N2K5|Q96SK7|Q9NSS2|Q9NSS3	Missense_Mutation	SNP	pfam_PSP,pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_CCHC,smart_PSP,pfscan_Znf_CCHC	p.E680K	ENST00000336229.4	37	c.2038		12	.	.	.	.	.	.	.	.	.	.	C	29.5	5.009257	0.93346	.	.	ENSG00000033030	ENST00000536306;ENST00000543897;ENST00000336229;ENST00000538116	T;T;T;T	0.57273	0.62;0.62;0.62;0.41	5.88	5.0	0.66597	.	0.089497	0.85682	D	0.000000	T	0.63604	0.2525	M	0.71581	2.175	0.54753	D	0.999983	D	0.63880	0.993	P	0.53954	0.738	T	0.63734	-0.6570	10	0.31617	T	0.26	-24.6652	14.8837	0.70553	0.0:0.9315:0.0:0.0685	.	680	Q6NZY4	ZCHC8_HUMAN	K	442;442;680;291	ENSP00000441423:E442K;ENSP00000438993:E442K;ENSP00000337313:E680K;ENSP00000440028:E291K	ENSP00000337313:E680K	E	-	1	0	ZCCHC8	121524083	1.000000	0.71417	0.863000	0.33907	0.998000	0.95712	6.949000	0.75971	1.496000	0.48567	0.650000	0.86243	GAA	ZCCHC8	-	NULL	ENSG00000033030		0.418	ZCCHC8-201	KNOWN	basic|appris_principal	protein_coding	ZCCHC8	HGNC	protein_coding		106	0.00	0	C	NM_017612		122958130	122958130	-1	no_errors	ENST00000336229	ensembl	human	known	69_37n	missense	94	18.97	22	SNP	1.000	T
ZDHHC11	79844	genome.wustl.edu	37	5	840342	840342	+	Intron	SNP	A	A	G	rs3822811	byFrequency	TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr5:840342A>G	ENST00000283441.8	-	5	1168				ZDHHC11_ENST00000503758.2_Intron|ZDHHC11_ENST00000424784.2_Intron|ZDHHC11_ENST00000511539.1_Missense_Mutation_p.V138A	NM_024786.2	NP_079062.1	Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(10)|pancreas(1)|prostate(5)|skin(2)|urinary_tract(1)	21			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)			acctggcaccactcctgcagg	0.453													G|||	1365	0.272564	0.0567	0.3516	5008	,	,		30402	0.3105		0.3718	False		,,,				2504	0.3671					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK023215	CCDS3857.1	5p15.2	2011-02-09			ENSG00000188818	ENSG00000188818		"""Zinc fingers, DHHC-type"""	19158	protein-coding gene	gene with protein product							Standard	NM_024786		Approved	ZNF399, FLJ13153	uc011cma.1	Q9H8X9	OTTHUMG00000090319	ENST00000283441.8:c.784+267T>C	5.37:g.840342A>G			Q6UWR9	Missense_Mutation	SNP	NULL	p.V138A	ENST00000283441.8	37	c.413	CCDS3857.1	5	.	.	.	.	.	.	.	.	.	.	a	0.010	-1.763054	0.00651	.	.	ENSG00000188818	ENST00000511539	T	0.54279	0.58	1.63	-3.04	0.05412	.	.	.	.	.	T	0.18800	0.0451	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.20306	-1.0279	8	0.02654	T	1	.	0.7372	0.00967	0.2179:0.1625:0.3929:0.2267	rs3822811;rs58222577	138	Q6UWR9	.	A	138	ENSP00000427067:V138A	ENSP00000427067:V138A	V	-	2	0	ZDHHC11	893342	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.790000	0.00767	-1.616000	0.01572	-1.956000	0.00482	GTG	ZDHHC11	-	NULL	ENSG00000188818		0.453	ZDHHC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC11	HGNC	protein_coding	OTTHUMT00000206681.3	8	0.00	0	A	NM_024786		840342	840342	-1	no_errors	ENST00000511539	ensembl	human	putative	69_37n	missense	4	60.00	6	SNP	0.000	G
ZDHHC17	23390	genome.wustl.edu	37	12	77191265	77191265	+	Missense_Mutation	SNP	C	C	G	rs578131355		TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr12:77191265C>G	ENST00000426126.2	+	2	794	c.145C>G	c.(145-147)Cgg>Ggg	p.R49G	ZDHHC17_ENST00000334822.5_Missense_Mutation_p.R49G|ZDHHC17_ENST00000359019.4_Intron	NM_015336.2	NP_056151.2	Q8IUH5	ZDH17_HUMAN	zinc finger, DHHC-type containing 17	49					lipoprotein transport (GO:0042953)|magnesium ion transport (GO:0015693)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein palmitoylation (GO:0018345)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	identical protein binding (GO:0042802)|magnesium ion transmembrane transporter activity (GO:0015095)|palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|large_intestine(3)|liver(2)|lung(14)	23						ACCTCTTGGACGGAAAACTCA	0.373																																						dbGAP											0													105.0	98.0	100.0					12																	77191265		1837	4100	5937	-	-	-	SO:0001583	missense	0			AB023163	CCDS44946.1	12q21.2	2013-01-10				ENSG00000186908		"""Zinc fingers, DHHC-type"", ""Ankyrin repeat domain containing"""	18412	protein-coding gene	gene with protein product		607799				9700202, 18794299	Standard	NM_015336		Approved	HIP14, HYPH, KIAA0946	uc001syk.1	Q8IUH5	OTTHUMG00000169917	ENST00000426126.2:c.145C>G	12.37:g.77191265C>G	ENSP00000403397:p.Arg49Gly		B4DR39|O75407|Q7Z2I0|Q86W89|Q86YK0|Q9P088|Q9UPZ8	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Znf_DHHC_palmitoyltrfase,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Znf_DHHC_palmitoyltrfase,prints_Ankyrin_rpt	p.R49G	ENST00000426126.2	37	c.145	CCDS44946.1	12	.	.	.	.	.	.	.	.	.	.	C	17.87	3.494891	0.64186	.	.	ENSG00000186908	ENST00000426126;ENST00000334822;ENST00000549682	T;T;T	0.62498	1.34;1.34;0.02	5.26	4.36	0.52297	.	0.000000	0.85682	D	0.000000	T	0.47619	0.1455	N	0.22421	0.69	0.80722	D	1	B	0.22604	0.072	B	0.18871	0.023	T	0.36407	-0.9749	10	0.23302	T	0.38	-12.9072	15.2574	0.73596	0.1412:0.8588:0.0:0.0	.	49	Q8IUH5	ZDH17_HUMAN	G	49;49;26	ENSP00000403397:R49G;ENSP00000334868:R49G;ENSP00000450295:R26G	ENSP00000334868:R49G	R	+	1	2	ZDHHC17	75715396	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.458000	0.60095	1.422000	0.47177	0.555000	0.69702	CGG	ZDHHC17	-	NULL	ENSG00000186908		0.373	ZDHHC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC17	HGNC	protein_coding	OTTHUMT00000406555.1	70	0.00	0	C	NM_015336		77191265	77191265	+1	no_errors	ENST00000334822	ensembl	human	known	69_37n	missense	62	10.14	7	SNP	1.000	G
ZKSCAN4	387032	genome.wustl.edu	37	6	28219418	28219418	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr6:28219418C>A	ENST00000377294.2	-	1	584	c.341G>T	c.(340-342)cGg>cTg	p.R114L	ZKSCAN4_ENST00000423974.2_Intron	NM_019110.3	NP_061983.2	Q969J2	ZKSC4_HUMAN	zinc finger with KRAB and SCAN domains 4	114	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(2)|lung(10)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	18						ATGCTGCTCCCGCACCCAGCT	0.602																																						dbGAP											0													28.0	31.0	30.0					6																	28219418		2202	4277	6479	-	-	-	SO:0001583	missense	0			AK056698	CCDS4647.1	6p21	2013-01-09	2007-02-20	2007-02-20	ENSG00000187626	ENSG00000187626		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13854	protein-coding gene	gene with protein product		611643	"""zinc finger protein 307"", ""zinc finger protein 427"""	ZNF307, ZNF427		12477932	Standard	NM_019110		Approved	p373c6.1, P1P373C6, FLJ32136, ZSCAN36	uc003nks.1	Q969J2	OTTHUMG00000014511	ENST00000377294.2:c.341G>T	6.37:g.28219418C>A	ENSP00000366509:p.Arg114Leu		B2RE32|Q5U7L4	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.R114L	ENST00000377294.2	37	c.341	CCDS4647.1	6	.	.	.	.	.	.	.	.	.	.	C	13.72	2.321898	0.41096	.	.	ENSG00000187626	ENST00000377294;ENST00000356796	T	0.04551	3.6	4.33	3.46	0.39613	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	.	.	.	.	T	0.04724	0.0128	M	0.86268	2.805	0.80722	D	1	P	0.44946	0.846	B	0.43155	0.41	T	0.13575	-1.0504	9	0.45353	T	0.12	.	7.8093	0.29221	0.0:0.7434:0.164:0.0927	.	114	Q969J2	ZKSC4_HUMAN	L	114;62	ENSP00000366509:R114L	ENSP00000349249:R62L	R	-	2	0	ZKSCAN4	28327397	0.000000	0.05858	0.977000	0.42913	0.999000	0.98932	0.249000	0.18216	1.102000	0.41551	0.655000	0.94253	CGG	ZKSCAN4	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN	ENSG00000187626		0.602	ZKSCAN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZKSCAN4	HGNC	protein_coding	OTTHUMT00000040179.1	44	0.00	0	C	NM_019110		28219418	28219418	-1	no_errors	ENST00000377294	ensembl	human	known	69_37n	missense	47	18.97	11	SNP	0.995	A
ZNF180	7733	genome.wustl.edu	37	19	44982147	44982147	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr19:44982147A>G	ENST00000221327.4	-	5	832	c.551T>C	c.(550-552)gTt>gCt	p.V184A	ZNF180_ENST00000592529.1_Missense_Mutation_p.V157A|AC069278.4_ENST00000591684.1_lincRNA|ZNF180_ENST00000585514.1_5'Flank|ZNF180_ENST00000391956.4_Missense_Mutation_p.V159A|ZNF180_ENST00000586637.1_3'UTR	NM_013256.3	NP_037388.2	Q9UJW8	ZN180_HUMAN	zinc finger protein 180	184					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(14)|lung(6)|ovary(2)|urinary_tract(1)	33		Prostate(69;0.0435)				CTCATGAATAACTGCTTTCCT	0.398																																					Esophageal Squamous(180;1353 2003 32862 46574 49854)	dbGAP											0													150.0	144.0	146.0					19																	44982147		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF192913	CCDS12639.1, CCDS62707.1, CCDS62708.1	19q13.2	2013-01-08	2006-08-22			ENSG00000167384		"""Zinc fingers, C2H2-type"", ""-"""	12970	protein-coding gene	gene with protein product		606740	"""zinc finger protein 180 (HHZ168)"""				Standard	NM_001288762		Approved	HHZ168	uc002ozf.4	Q9UJW8		ENST00000221327.4:c.551T>C	19.37:g.44982147A>G	ENSP00000221327:p.Val184Ala		B2RCN6|B3KV56|K7EQX9|Q58F03|Q9P1U2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V184A	ENST00000221327.4	37	c.551	CCDS12639.1	19	.	.	.	.	.	.	.	.	.	.	A	1.093	-0.663555	0.03428	.	.	ENSG00000167384	ENST00000221327;ENST00000391956	T;T	0.07800	3.16;3.2	3.98	1.8	0.24995	.	1.213800	0.06435	N	0.724960	T	0.03827	0.0108	N	0.08118	0	0.09310	N	1	B;B;B	0.11235	0.004;0.002;0.002	B;B;B	0.16289	0.015;0.007;0.007	T	0.46569	-0.9182	10	0.17369	T	0.5	-0.0323	1.1563	0.01797	0.512:0.2012:0.1074:0.1794	.	159;183;184	G5E9B8;Q58F03;Q9UJW8	.;.;ZN180_HUMAN	A	184;159	ENSP00000221327:V184A;ENSP00000375818:V159A	ENSP00000221327:V184A	V	-	2	0	ZNF180	49673987	0.000000	0.05858	0.000000	0.03702	0.876000	0.50452	0.227000	0.17795	0.206000	0.20587	0.533000	0.62120	GTT	ZNF180	-	NULL	ENSG00000167384		0.398	ZNF180-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF180	HGNC	protein_coding	OTTHUMT00000451601.1	81	0.00	0	A	NM_013256		44982147	44982147	-1	no_errors	ENST00000221327	ensembl	human	known	69_37n	missense	74	21.28	20	SNP	0.001	G
ZNF215	7762	genome.wustl.edu	37	11	6977210	6977210	+	Silent	SNP	T	T	C			TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr11:6977210T>C	ENST00000278319.5	+	7	1590	c.1002T>C	c.(1000-1002)tgT>tgC	p.C334C	ZNF215_ENST00000527171.1_3'UTR|ZNF215_ENST00000529903.1_Intron|ZNF215_ENST00000414517.2_Silent_p.C334C	NM_013250.2	NP_037382.2	Q9UL58	ZN215_HUMAN	zinc finger protein 215	334					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(2)|skin(4)	32				Epithelial(150;6.33e-08)|BRCA - Breast invasive adenocarcinoma(625;0.134)		CTCCAAAATGTGATAAGTTTA	0.308																																						dbGAP											0													51.0	58.0	56.0					11																	6977210		2200	4294	6494	-	-	-	SO:0001819	synonymous_variant	0			AF056618	CCDS7775.1	11p15.4	2013-01-09			ENSG00000149054	ENSG00000149054		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13007	protein-coding gene	gene with protein product		605016					Standard	XM_005253130		Approved	ZKSCAN11, ZSCAN43	uc001mey.3	Q9UL58	OTTHUMG00000165507	ENST00000278319.5:c.1002T>C	11.37:g.6977210T>C			Q96C84	Silent	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.C334	ENST00000278319.5	37	c.1002	CCDS7775.1	11																																																																																			ZNF215	-	NULL	ENSG00000149054		0.308	ZNF215-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF215	HGNC	protein_coding	OTTHUMT00000384550.1	28	0.00	0	T			6977210	6977210	+1	no_errors	ENST00000278319	ensembl	human	known	69_37n	silent	29	35.56	16	SNP	0.001	C
ZNF43	7594	genome.wustl.edu	37	19	21990455	21990455	+	Missense_Mutation	SNP	A	A	T	rs371024943		TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr19:21990455A>T	ENST00000354959.4	-	4	2553	c.2384T>A	c.(2383-2385)gTg>gAg	p.V795E	ZNF43_ENST00000595461.1_Missense_Mutation_p.V789E|ZNF43_ENST00000598381.1_Missense_Mutation_p.V789E|ZNF43_ENST00000594012.1_Missense_Mutation_p.V789E	NM_003423.3	NP_003414.2	P17038	ZNF43_HUMAN	zinc finger protein 43	795					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	51		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)		AATCACTGTCACATCTTCAGG	0.303																																						dbGAP											0													51.0	52.0	52.0					19																	21990455		2201	4300	6501	-	-	-	SO:0001583	missense	0			X59244	CCDS12413.2, CCDS59367.1, CCDS74321.1	19p13.1-p12	2013-01-08	2006-05-11		ENSG00000198521	ENSG00000198521		"""Zinc fingers, C2H2-type"", ""-"""	13109	protein-coding gene	gene with protein product		603972	"""zinc finger protein 39-like 1 (KOX 27)"", ""zinc finger protein 43 (HTF6)"""	ZNF39L1		1711675	Standard	NM_001256649		Approved	HTF6, KOX27	uc031rka.1	P17038	OTTHUMG00000128543	ENST00000354959.4:c.2384T>A	19.37:g.21990455A>T	ENSP00000347045:p.Val795Glu		A8K5N8|P28160|Q53XQ2|Q5H9T3|Q96DG1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V795E	ENST00000354959.4	37	c.2384	CCDS12413.2	19	.	.	.	.	.	.	.	.	.	.	A	11.02	1.515451	0.27123	.	.	ENSG00000198521	ENST00000397148;ENST00000354959	T	0.05447	3.44	1.76	0.597	0.17504	.	.	.	.	.	T	0.04092	0.0114	N	0.19112	0.55	0.23598	N	0.997325	B	0.20368	0.044	B	0.08055	0.003	T	0.40403	-0.9565	9	0.87932	D	0	.	4.6496	0.12589	0.7173:0.0:0.0:0.2827	.	795	P17038	ZNF43_HUMAN	E	794;795	ENSP00000347045:V795E	ENSP00000347045:V795E	V	-	2	0	ZNF43	21782295	0.162000	0.22906	0.006000	0.13384	0.213000	0.24496	0.380000	0.20602	-0.054000	0.13266	0.254000	0.18369	GTG	ZNF43	-	NULL	ENSG00000198521		0.303	ZNF43-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF43	HGNC	protein_coding	OTTHUMT00000250380.2	109	0.00	0	A	NM_003423		21990455	21990455	-1	no_errors	ENST00000354959	ensembl	human	known	69_37n	missense	64	28.89	26	SNP	0.595	T
ZNF609	23060	genome.wustl.edu	37	15	64970559	64970559	+	Missense_Mutation	SNP	C	C	G	rs267604285		TCGA-E2-A1LH-01A-11D-A14G-09	TCGA-E2-A1LH-11A-22D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	605f1d27-db45-449a-a68f-4888b8c786a1	4feb8572-68f1-403c-8d3c-198fbe6e9fa4	g.chr15:64970559C>G	ENST00000326648.3	+	5	3775	c.3647C>G	c.(3646-3648)tCc>tGc	p.S1216C		NM_015042.1	NP_055857.1	O15014	ZN609_HUMAN	zinc finger protein 609	1216						nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CCTGTGTCCTCCCCACTTACC	0.597																																						dbGAP											0													147.0	135.0	139.0					15																	64970559		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC014251	CCDS32270.1	15q22.1	2008-05-02				ENSG00000180357		"""Zinc fingers, C2H2-type"""	29003	protein-coding gene	gene with protein product						9205841	Standard	NM_015042		Approved	KIAA0295	uc002ann.3	O15014		ENST00000326648.3:c.3647C>G	15.37:g.64970559C>G	ENSP00000316527:p.Ser1216Cys		Q0D2I2	Missense_Mutation	SNP	pfscan_Znf_C2H2	p.S1216C	ENST00000326648.3	37	c.3647	CCDS32270.1	15	.	.	.	.	.	.	.	.	.	.	C	21.7	4.183461	0.78677	.	.	ENSG00000180357	ENST00000326648	T	0.58060	0.36	5.21	5.21	0.72293	.	0.117810	0.64402	D	0.000006	T	0.71358	0.3330	M	0.64404	1.975	0.58432	D	0.999994	D	0.89917	1.0	D	0.85130	0.997	T	0.72956	-0.4134	10	0.56958	D	0.05	-13.0658	18.7811	0.91933	0.0:1.0:0.0:0.0	.	1216	O15014	ZN609_HUMAN	C	1216	ENSP00000316527:S1216C	ENSP00000316527:S1216C	S	+	2	0	ZNF609	62757612	1.000000	0.71417	0.997000	0.53966	0.956000	0.61745	6.089000	0.71384	2.432000	0.82394	0.650000	0.86243	TCC	ZNF609	-	NULL	ENSG00000180357		0.597	ZNF609-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF609	HGNC	protein_coding	OTTHUMT00000418130.1	46	0.00	0	C	XM_042833		64970559	64970559	+1	no_errors	ENST00000326648	ensembl	human	known	69_37n	missense	56	16.42	11	SNP	1.000	G
