#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
BIRC6	57448	genome.wustl.edu	37	2	32774504	32774504	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr2:32774504C>T	ENST00000421745.2	+	65	13234	c.13100C>T	c.(13099-13101)tCc>tTc	p.S4367F		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	4367					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					CTCAGTCAGTCCTGCCTCATC	0.418																																					Pancreas(94;175 1509 16028 18060 45422)	dbGAP											0													135.0	126.0	129.0					2																	32774504		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.13100C>T	2.37:g.32774504C>T	ENSP00000393596:p.Ser4367Phe		Q9ULD1	Missense_Mutation	SNP	pfam_DUF3643,pfam_UBQ-conjugat_E2,pfam_BIR,pfam_UEV_N,superfamily_UBQ-conjugating_enzyme/RWD,superfamily_Galactose-bd-like,superfamily_WD40_repeat_dom,smart_BIR,pfscan_BIR,pfscan_UBQ-conjugat_E2	p.S4367F	ENST00000421745.2	37	c.13100	CCDS33175.2	2	.	.	.	.	.	.	.	.	.	.	C	32	5.168223	0.94768	.	.	ENSG00000115760	ENST00000421745	D	0.90444	-2.67	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	D	0.95990	0.8694	M	0.85197	2.74	0.80722	D	1	D	0.65815	0.995	D	0.75484	0.986	D	0.95936	0.8942	10	0.66056	D	0.02	.	19.7806	0.96414	0.0:1.0:0.0:0.0	.	4367	Q9NR09	BIRC6_HUMAN	F	4367	ENSP00000393596:S4367F	ENSP00000393596:S4367F	S	+	2	0	BIRC6	32628008	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.818000	0.86416	2.669000	0.90835	0.650000	0.86243	TCC	BIRC6	-	NULL	ENSG00000115760		0.418	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIRC6	HGNC	protein_coding	OTTHUMT00000318769.3	54	0.00	0	C	NM_016252		32774504	32774504	+1	no_errors	ENST00000421745	ensembl	human	known	69_37n	missense	63	18.18	14	SNP	1.000	T
ALPP	250	genome.wustl.edu	37	2	233243713	233243713	+	Missense_Mutation	SNP	G	G	A	rs113323105	byFrequency	TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr2:233243713G>A	ENST00000392027.2	+	2	378	c.109G>A	c.(109-111)Gag>Aag	p.E37K	AC068134.8_ENST00000439072.1_RNA|AC068134.8_ENST00000441266.1_RNA	NM_001632.3	NP_001623.3	P05187	PPB1_HUMAN	alkaline phosphatase, placental	37					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|magnesium ion binding (GO:0000287)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|endometrium(1)|kidney(4)|large_intestine(2)|liver(1)|lung(10)|ovary(2)	22		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)		CTGGAACCGCGAGGCAGCCGA	0.632																																						dbGAP											0													66.0	80.0	76.0					2																	233243713		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14169	CCDS2490.1	2q37.1	2010-06-24	2010-06-24		ENSG00000163283	ENSG00000163283	3.1.3.1		439	protein-coding gene	gene with protein product	"""Regan isozyme"""	171800	"""alkaline phosphatase, placental (Regan isozyme)"""			3001717, 3461452	Standard	XM_005246439		Approved		uc002vsq.3	P05187	OTTHUMG00000133255	ENST00000392027.2:c.109G>A	2.37:g.233243713G>A	ENSP00000375881:p.Glu37Lys		P05188|P06861|Q53S78|Q96DB7	Missense_Mutation	SNP	pfam_Alkaline_phosphatase,superfamily_Alkaline_phosphatase_core,smart_Alkaline_phosphatase,prints_Alkaline_phosphatase	p.E37K	ENST00000392027.2	37	c.109	CCDS2490.1	2	.	.	.	.	.	.	.	.	.	.	.	6.941	0.543323	0.13250	.	.	ENSG00000163283	ENST00000392027	T	0.21191	2.02	2.32	-0.812	0.10853	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.518247	0.21905	N	0.067388	T	0.03095	0.0091	N	0.00077	-2.24	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42699	-0.9436	10	0.20519	T	0.43	.	6.4229	0.21754	0.4732:0.2929:0.2338:0.0	.	37	P05187	PPB1_HUMAN	K	37	ENSP00000375881:E37K	ENSP00000375881:E37K	E	+	1	0	ALPP	232951957	0.000000	0.05858	0.014000	0.15608	0.392000	0.30506	-0.669000	0.05262	-1.013000	0.03383	-0.671000	0.03813	GAG	ALPP	-	superfamily_Alkaline_phosphatase_core	ENSG00000163283		0.632	ALPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPP	HGNC	protein_coding	OTTHUMT00000257032.3	136	0.73	1	G	NM_001632		233243713	233243713	+1	no_errors	ENST00000392027	ensembl	human	known	69_37n	missense	90	26.23	32	SNP	0.035	A
BRWD1	54014	genome.wustl.edu	37	21	40597087	40597087	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr21:40597087C>G	ENST00000333229.2	-	28	3572	c.3245G>C	c.(3244-3246)tGg>tCg	p.W1082S	BRWD1_ENST00000342449.3_Missense_Mutation_p.W1082S|BRWD1_ENST00000380800.3_Missense_Mutation_p.W1082S	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1082					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				TGTTCCAAACCACCAAGCATC	0.358																																					Melanoma(170;988 1986 4794 16843 39731)	dbGAP											0													187.0	180.0	182.0					21																	40597087		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.3245G>C	21.37:g.40597087C>G	ENSP00000330753:p.Trp1082Ser		C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_WD40_repeat_dom,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.W1082S	ENST00000333229.2	37	c.3245	CCDS13662.1	21	.	.	.	.	.	.	.	.	.	.	C	23.8	4.459369	0.84317	.	.	ENSG00000185658	ENST00000333229;ENST00000342449;ENST00000380800;ENST00000380783	T;T;T	0.42900	0.96;0.96;0.96	5.18	5.18	0.71444	.	0.000000	0.64402	D	0.000004	T	0.70919	0.3279	M	0.86420	2.815	0.80722	D	1	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.91635	0.999;0.991;0.997	T	0.76735	-0.2850	10	0.87932	D	0	-4.8373	19.0379	0.92986	0.0:1.0:0.0:0.0	.	1082;1082;1082	Q9NSI6-3;Q9NSI6-2;Q9NSI6	.;.;BRWD1_HUMAN	S	1082;1082;1082;86	ENSP00000330753:W1082S;ENSP00000344333:W1082S;ENSP00000370178:W1082S	ENSP00000330753:W1082S	W	-	2	0	BRWD1	39518957	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.371000	0.79600	2.563000	0.86464	0.591000	0.81541	TGG	BRWD1	-	NULL	ENSG00000185658		0.358	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD1	HGNC	protein_coding	OTTHUMT00000141398.3	36	0.00	0	C	NM_033656		40597087	40597087	-1	no_errors	ENST00000333229	ensembl	human	known	69_37n	missense	15	16.67	3	SNP	1.000	G
C14orf159	80017	genome.wustl.edu	37	14	91681803	91681803	+	Nonsense_Mutation	SNP	C	C	G			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr14:91681803C>G	ENST00000523771.1	+	13	2207	c.1604C>G	c.(1603-1605)tCa>tGa	p.S535*	C14orf159_ENST00000522322.1_Nonsense_Mutation_p.S535*|C14orf159_ENST00000520328.1_Nonsense_Mutation_p.S483*|C14orf159_ENST00000412671.2_Nonsense_Mutation_p.S540*|C14orf159_ENST00000518868.1_Nonsense_Mutation_p.S540*|C14orf159_ENST00000256324.10_Nonsense_Mutation_p.S540*|C14orf159_ENST00000521077.2_Nonsense_Mutation_p.S500*|C14orf159_ENST00000428926.2_Nonsense_Mutation_p.S535*|C14orf159_ENST00000525393.2_Nonsense_Mutation_p.S411*|C14orf159_ENST00000523816.1_Nonsense_Mutation_p.S535*			Q7Z3D6	CN159_HUMAN	chromosome 14 open reading frame 159	535						mitochondrion (GO:0005739)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	21		all_cancers(154;0.0191)|all_epithelial(191;0.241)		Epithelial(152;0.141)|OV - Ovarian serous cystadenocarcinoma(161;0.207)		ATCCTGTACTCATGTGCTGTC	0.537																																						dbGAP											0													126.0	111.0	116.0					14																	91681803		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK097294	CCDS32141.1, CCDS41979.1, CCDS45150.1, CCDS66693.1, CCDS73677.1	14q32.11	2012-09-26			ENSG00000133943	ENSG00000133943			20498	protein-coding gene	gene with protein product							Standard	NM_001102367		Approved	FLJ39975	uc001xze.2	Q7Z3D6	OTTHUMG00000164980	ENST00000523771.1:c.1604C>G	14.37:g.91681803C>G	ENSP00000429655:p.Ser535*		B3KUI7|Q86SW3|Q86SX8|Q86SX9|Q86T08|Q86TV5|Q96GW5|Q9H7G0|Q9H8Y9|Q9H9W6	Nonsense_Mutation	SNP	pfam_DUF1445,pirsf_UPF0317_mt	p.S540*	ENST00000523771.1	37	c.1619	CCDS32141.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	37|37	6.118889|6.118889	0.97300|0.97300	.|.	.|.	ENSG00000133943|ENSG00000133943	ENST00000522816|ENST00000520328;ENST00000256324;ENST00000521077;ENST00000518868;ENST00000523816;ENST00000525393;ENST00000428926;ENST00000522322;ENST00000523771;ENST00000412671	.|.	.|.	.|.	5.34|5.34	3.49|3.49	0.39957|0.39957	.|.	.|0.617876	.|0.16119	.|N	.|0.228740	T|.	0.39200|.	0.1069|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.46978|.	-0.9152|.	3|.	.|0.18710	.|T	.|0.47	.|.	9.426|9.426	0.38581|0.38581	0.0:0.8271:0.0:0.1729|0.0:0.8271:0.0:0.1729	.|.	.|.	.|.	.|.	D|X	136|483;540;500;540;535;411;535;535;535;540	.|.	.|ENSP00000256324:S540X	H|S	+|+	1|2	0|0	C14orf159|C14orf159	90751556|90751556	0.000000|0.000000	0.05858|0.05858	0.009000|0.009000	0.14445|0.14445	0.014000|0.014000	0.08584|0.08584	-0.037000|-0.037000	0.12164|0.12164	1.248000|1.248000	0.43934|0.43934	0.655000|0.655000	0.94253|0.94253	CAT|TCA	C14orf159	-	pirsf_UPF0317_mt	ENSG00000133943		0.537	C14orf159-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C14orf159	HGNC	protein_coding	OTTHUMT00000381273.1	89	0.00	0	C	NM_024952		91681803	91681803	+1	no_errors	ENST00000256324	ensembl	human	known	69_37n	nonsense	43	34.85	23	SNP	0.053	G
TRAPPC13	80006	genome.wustl.edu	37	5	64925401	64925401	+	Intron	SNP	T	T	A			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr5:64925401T>A	ENST00000399438.3	+	1	391				TRAPPC13_ENST00000505553.1_Intron|TRAPPC13_ENST00000438419.2_Intron|CTC-534A2.2_ENST00000514404.1_3'UTR|TRAPPC13_ENST00000545191.1_Intron|TRAPPC13_ENST00000231526.4_Intron|CTC-534A2.2_ENST00000510585.2_5'UTR	NM_001093755.1|NM_024941.3	NP_001087224.1|NP_079217.2	A5PLN9	TPC13_HUMAN	trafficking protein particle complex 13																		TAAGAGTAACTGGATTACTGC	0.358																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS47221.1, CCDS47222.1, CCDS47223.1, CCDS58950.1	5q12.3	2013-01-31	2013-01-24	2013-01-24	ENSG00000113597	ENSG00000113597			25828	protein-coding gene	gene with protein product	"""Trs65-related"""		"""chromosome 5 open reading frame 44"""	C5orf44		12477932	Standard	NM_024941		Approved	FLJ13611, FLJ26957, MGC48585	uc010iwu.1	A5PLN9	OTTHUMG00000163649	ENST00000399438.3:c.46+4468T>A	5.37:g.64925401T>A			Q17RZ9|Q49A23|Q4JHG0|Q6MZG4|Q8TCM2|Q9H8I3	RNA	SNP	-	NULL	ENST00000399438.3	37	NULL	CCDS47222.1	5																																																																																			C5orf44	-	-	ENSG00000113597		0.358	TRAPPC13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	C5orf44	HGNC	protein_coding	OTTHUMT00000370113.1	39	0.00	0	T	NM_024941		64925401	64925401	+1	no_errors	ENST00000514404	ensembl	human	putative	69_37n	rna	5	73.68	14	SNP	0.687	A
CALML3	810	genome.wustl.edu	37	10	5567450	5567450	+	Silent	SNP	C	C	T			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr10:5567450C>T	ENST00000315238.1	+	1	527	c.402C>T	c.(400-402)gaC>gaT	p.D134D	CALML3-AS1_ENST00000543008.1_RNA|CALML3-AS1_ENST00000542093.1_RNA|CALML3-AS1_ENST00000545372.1_RNA|RP11-116G8.5_ENST00000442008.2_RNA	NM_005185.2	NP_005176.1	P27482	CALL3_HUMAN	calmodulin-like 3	134	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.					extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			endometrium(3)|lung(2)	5						CGGACGGAGACGGACAGGTGA	0.672																																					Colon(173;2070 2647 27580 52203)	dbGAP											0													63.0	58.0	59.0					10																	5567450		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X13461	CCDS7069.1	10p15.1	2013-01-10			ENSG00000178363	ENSG00000178363		"""EF-hand domain containing"""	1452	protein-coding gene	gene with protein product		114184				8476923	Standard	NM_005185		Approved	CLP	uc001iie.1	P27482	OTTHUMG00000017597	ENST00000315238.1:c.402C>T	10.37:g.5567450C>T			B2R9V6|Q5SQI4	Silent	SNP	pfam_EF-hand,pfam_EF-hand_Ca_insen,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.D134	ENST00000315238.1	37	c.402	CCDS7069.1	10																																																																																			CALML3	-	pfam_EF-hand,pfam_EF-hand_Ca_insen,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	ENSG00000178363		0.672	CALML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALML3	HGNC	protein_coding	OTTHUMT00000046555.1	34	0.00	0	C	NM_005185		5567450	5567450	+1	no_errors	ENST00000315238	ensembl	human	known	69_37n	silent	51	12.07	7	SNP	0.849	T
CACNB2	783	genome.wustl.edu	37	10	18803948	18803948	+	Intron	SNP	C	C	T			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr10:18803948C>T	ENST00000324631.7	+	7	864				CACNB2_ENST00000352115.6_Missense_Mutation_p.A237V|CACNB2_ENST00000377315.4_Intron|CACNB2_ENST00000377329.4_Intron|CACNB2_ENST00000377319.3_Intron|CACNB2_ENST00000396576.2_Intron|CACNB2_ENST00000377328.1_Intron|CACNB2_ENST00000282343.8_Intron|CACNB2_ENST00000377331.2_Missense_Mutation_p.A209V|RP11-499P20.2_ENST00000425669.1_RNA	NM_201593.2|NM_201596.2	NP_963887.2|NP_963890.2	Q08289	CACB2_HUMAN	calcium channel, voltage-dependent, beta 2 subunit						axon guidance (GO:0007411)|calcium ion import (GO:0070509)|neuromuscular junction development (GO:0007528)|positive regulation of calcium ion transport (GO:0051928)|synaptic transmission (GO:0007268)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|voltage-gated calcium channel complex (GO:0005891)	calcium channel activity (GO:0005262)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(12)|prostate(1)|skin(3)|stomach(2)	31					Amlodipine(DB00381)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TGGAAAACTGCAGGCTTGTTT	0.343																																						dbGAP											0													113.0	109.0	110.0					10																	18803948		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			U95019	CCDS7125.1, CCDS7126.1, CCDS7127.1, CCDS7128.1, CCDS7129.1, CCDS41493.1, CCDS41494.1	10p12	2014-09-17			ENSG00000165995	ENSG00000165995		"""Calcium channel subunits"""	1402	protein-coding gene	gene with protein product		600003		MYSB, CACNLB2		9254841, 8494331	Standard	NM_201596		Approved		uc001ipr.2	Q08289	OTTHUMG00000017764	ENST00000324631.7:c.804+650C>T	10.37:g.18803948C>T			A6PVM5|A6PVM7|A6PVM8|O00304|Q5QJ99|Q5QJA0|Q5VVG9|Q5VVH0|Q5VWV6|Q6TME1|Q6TME2|Q6TME3|Q8WX81|Q96NZ3|Q96NZ4|Q96NZ5|Q9BWU2|Q9HD32|Q9Y340|Q9Y341	Missense_Mutation	SNP	pfam_Guanylate_kin,pfam_VDCC_L_bsu,superfamily_SH3_domain,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_SH3_domain,prints_VDCC_L_bsu,prints_VDCC_L_b2su	p.A237V	ENST00000324631.7	37	c.710	CCDS7125.1	10	.	.	.	.	.	.	.	.	.	.	C	11.90	1.777728	0.31502	.	.	ENSG00000165995	ENST00000352115;ENST00000377331	D;D	0.82893	-1.66;-1.66	5.52	4.6	0.57074	.	.	.	.	.	T	0.73690	0.3619	N	0.22421	0.69	0.80722	D	1	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.11329	0.002;0.0;0.006	T	0.70132	-0.4956	9	0.59425	D	0.04	.	13.3446	0.60564	0.0:0.9258:0.0:0.0742	.	183;209;237	Q6TME1;A6PVM7;Q08289-8	.;.;.	V	237;209	ENSP00000344474:A237V;ENSP00000366548:A209V	ENSP00000344474:A237V	A	+	2	0	CACNB2	18843954	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.220000	0.51207	1.450000	0.47717	0.655000	0.94253	GCA	CACNB2	-	superfamily_SH3_domain	ENSG00000165995		0.343	CACNB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CACNB2	HGNC	protein_coding	OTTHUMT00000047072.2	41	0.00	0	C	NM_000724		18803948	18803948	+1	no_errors	ENST00000352115	ensembl	human	known	69_37n	missense	54	10.00	6	SNP	1.000	T
CC2D1A	54862	genome.wustl.edu	37	19	14029770	14029770	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr19:14029770G>A	ENST00000318003.7	+	10	1305	c.1064G>A	c.(1063-1065)cGg>cAg	p.R355Q	CC2D1A_ENST00000589606.1_Missense_Mutation_p.R355Q	NM_017721.4	NP_060191.3	Q6P1N0	C2D1A_HUMAN	coiled-coil and C2 domain containing 1A	355					positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(2)|skin(2)	27			OV - Ovarian serous cystadenocarcinoma(19;3.49e-23)			CTGGAGCAGCGGATGGAGCGG	0.667																																						dbGAP											0													12.0	20.0	17.0					19																	14029770		2031	4190	6221	-	-	-	SO:0001583	missense	0			AF536205	CCDS42512.1	19p13.12	2007-01-08				ENSG00000132024			30237	protein-coding gene	gene with protein product	"""mental retardation, nonsyndromic, autosomal recessive, 3"""	610055				12761501, 16033914	Standard	NM_017721		Approved	FLJ20241, MRT3	uc002mxo.2	Q6P1N0		ENST00000318003.7:c.1064G>A	19.37:g.14029770G>A	ENSP00000313601:p.Arg355Gln		Q7Z435|Q86XV0|Q8NF89|Q9H603|Q9NXI1	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_DM14,smart_C2_Ca-dep	p.R355Q	ENST00000318003.7	37	c.1064	CCDS42512.1	19	.	.	.	.	.	.	.	.	.	.	G	36	5.629757	0.96671	.	.	ENSG00000132024	ENST00000318003;ENST00000397486	T	0.34859	1.34	4.75	4.75	0.60458	Domain of unknown function DM14 (1);	0.000000	0.85682	D	0.000000	T	0.66066	0.2752	M	0.88906	2.99	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.996;0.996;0.999	T	0.70960	-0.4730	10	0.45353	T	0.12	-32.33	16.6765	0.85280	0.0:0.0:1.0:0.0	.	355;355;109	Q6P1N0-2;Q6P1N0;C9J1T8	.;C2D1A_HUMAN;.	Q	355;109	ENSP00000313601:R355Q	ENSP00000313601:R355Q	R	+	2	0	CC2D1A	13890770	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.697000	0.91307	2.472000	0.83506	0.561000	0.74099	CGG	CC2D1A	-	smart_DM14	ENSG00000132024		0.667	CC2D1A-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	CC2D1A	HGNC	protein_coding	OTTHUMT00000457954.1	86	0.00	0	G	NM_017721		14029770	14029770	+1	no_errors	ENST00000318003	ensembl	human	known	69_37n	missense	145	12.65	21	SNP	1.000	A
CC2D1A	54862	genome.wustl.edu	37	19	14030750	14030750	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr19:14030750G>A	ENST00000318003.7	+	12	1583	c.1342G>A	c.(1342-1344)Gag>Aag	p.E448K	CC2D1A_ENST00000589606.1_Missense_Mutation_p.E448K	NM_017721.4	NP_060191.3	Q6P1N0	C2D1A_HUMAN	coiled-coil and C2 domain containing 1A	448					positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(2)|skin(2)	27			OV - Ovarian serous cystadenocarcinoma(19;3.49e-23)			TGAAGAGGATGAGGTGCCTAA	0.602																																						dbGAP											0													50.0	57.0	55.0					19																	14030750		1941	4149	6090	-	-	-	SO:0001583	missense	0			AF536205	CCDS42512.1	19p13.12	2007-01-08				ENSG00000132024			30237	protein-coding gene	gene with protein product	"""mental retardation, nonsyndromic, autosomal recessive, 3"""	610055				12761501, 16033914	Standard	NM_017721		Approved	FLJ20241, MRT3	uc002mxo.2	Q6P1N0		ENST00000318003.7:c.1342G>A	19.37:g.14030750G>A	ENSP00000313601:p.Glu448Lys		Q7Z435|Q86XV0|Q8NF89|Q9H603|Q9NXI1	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_DM14,smart_C2_Ca-dep	p.E448K	ENST00000318003.7	37	c.1342	CCDS42512.1	19	.	.	.	.	.	.	.	.	.	.	G	27.0	4.791654	0.90367	.	.	ENSG00000132024	ENST00000318003;ENST00000397486	T	0.56275	0.47	4.96	4.96	0.65561	.	0.063724	0.64402	D	0.000012	T	0.63390	0.2507	L	0.39898	1.24	0.54753	D	0.999985	D;D;D	0.71674	0.998;0.991;0.993	D;P;P	0.80764	0.994;0.815;0.879	T	0.58267	-0.7666	10	0.23891	T	0.37	-34.4078	16.9777	0.86317	0.0:0.0:1.0:0.0	.	448;448;202	Q6P1N0-2;Q6P1N0;C9J1T8	.;C2D1A_HUMAN;.	K	448;202	ENSP00000313601:E448K	ENSP00000313601:E448K	E	+	1	0	CC2D1A	13891750	1.000000	0.71417	0.937000	0.37676	0.969000	0.65631	5.861000	0.69553	2.296000	0.77279	0.561000	0.74099	GAG	CC2D1A	-	NULL	ENSG00000132024		0.602	CC2D1A-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	CC2D1A	HGNC	protein_coding	OTTHUMT00000457954.1	53	0.00	0	G	NM_017721		14030750	14030750	+1	no_errors	ENST00000318003	ensembl	human	known	69_37n	missense	57	18.57	13	SNP	0.980	A
CCDC169	728591	genome.wustl.edu	37	13	36855373	36855373	+	Intron	SNP	C	C	G			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr13:36855373C>G	ENST00000239859.7	-	4	347				CCDC169_ENST00000379862.2_Intron|CCDC169_ENST00000491049.2_Intron|CCDC169-SOHLH2_ENST00000511166.1_Intron|SOHLH2_ENST00000554962.1_Intron|CCDC169_ENST00000510088.1_Intron|CCDC169_ENST00000239860.6_Intron|CCDC169_ENST00000503173.1_Intron|CCDC169_ENST00000477250.1_5'UTR|CCDC169_ENST00000379864.2_Intron			A6NNP5	CC169_HUMAN	coiled-coil domain containing 169											breast(1)|endometrium(1)	2						actgcaccacccctggactgc	0.403																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS45027.1, CCDS45028.1, CCDS45029.1, CCDS53863.1, CCDS55897.1	13q13.3	2011-08-09	2011-08-09	2011-08-09	ENSG00000242715	ENSG00000242715			34361	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 38"""	C13orf38			Standard	NM_001144981		Approved	RP11-251J8.1, LOC728591		A6NNP5	OTTHUMG00000016731	ENST00000239859.7:c.315+2232G>C	13.37:g.36855373C>G			A6NC13|A6NCT2|B7ZW45|B7ZW49|B9EJF2|Q9H1T4|Q9H1T5	RNA	SNP	-	NULL	ENST00000239859.7	37	NULL	CCDS45028.1	13																																																																																			CCDC169	-	-	ENSG00000242715		0.403	CCDC169-014	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC169	HGNC	protein_coding	OTTHUMT00000368255.1	8	0.00	0	C	NM_001144981		36855373	36855373	-1	no_errors	ENST00000477250	ensembl	human	known	69_37n	rna	3	72.73	8	SNP	0.004	G
CCDC85B	11007	genome.wustl.edu	37	11	65658674	65658674	+	Silent	SNP	C	C	T			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr11:65658674C>T	ENST00000312579.2	+	1	800	c.420C>T	c.(418-420)ctC>ctT	p.L140L	FIBP_ENST00000426652.2_5'Flank|FIBP_ENST00000533045.1_5'Flank|FIBP_ENST00000357519.4_5'Flank|FIBP_ENST00000338369.2_5'Flank	NM_006848.2	NP_006839.2	Q15834	CC85B_HUMAN	coiled-coil domain containing 85B	140					cell differentiation (GO:0030154)|negative regulation of cell growth (GO:0030308)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)									READ - Rectum adenocarcinoma(159;0.166)		TTAAGGAGCTCTGCCTGGCGC	0.746																																						dbGAP											0													3.0	4.0	4.0					11																	65658674		1965	3895	5860	-	-	-	SO:0001819	synonymous_variant	0			BC008796	CCDS8120.1	11q13.1	2010-12-24				ENSG00000175602			24926	protein-coding gene	gene with protein product	"""hepatitis delta antigen interacting protein A"""	605360				8810253, 15644333, 17873903	Standard	NM_006848		Approved	DIPA	uc001ogf.3	Q15834		ENST00000312579.2:c.420C>T	11.37:g.65658674C>T			B2R598|Q96HA0	Silent	SNP	pfam_DUF2216_coiled-coil	p.L140	ENST00000312579.2	37	c.420	CCDS8120.1	11																																																																																			CCDC85B	-	pfam_DUF2216_coiled-coil	ENSG00000175602		0.746	CCDC85B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC85B	HGNC	protein_coding	OTTHUMT00000391196.1	20	0.00	0	C	NM_006848		65658674	65658674	+1	no_errors	ENST00000312579	ensembl	human	known	69_37n	silent	16	30.43	7	SNP	1.000	T
CD247	919	genome.wustl.edu	37	1	167404209	167404210	+	Intron	INS	-	-	T			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr1:167404209_167404210insT	ENST00000362089.5	-	5	409				CD247_ENST00000392122.3_Intron|CD247_ENST00000483825.1_5'UTR			P20963	CD3Z_HUMAN	CD247 molecule						Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	alpha-beta T cell receptor complex (GO:0042105)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(1)|skin(1)	6			LUSC - Lung squamous cell carcinoma(543;0.236)		Muromonab(DB00075)	ctccggagccctcctccagccc	0.688																																					Ovarian(192;1815 2869 36877 43334)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC025703	CCDS1260.1, CCDS1261.1	1q24.2	2014-09-17	2006-03-28	2006-03-09	ENSG00000198821	ENSG00000198821		"""CD molecules"""	1677	protein-coding gene	gene with protein product		186780	"""CD3z antigen, zeta polypeptide (TiT3 complex)"", ""CD247 antigen"""	CD3Z		2974162	Standard	NM_198053		Approved	CD3H, CD3Q	uc001gei.4	P20963	OTTHUMG00000034593	ENST00000362089.5:c.336+425->A	1.37:g.167404210_167404210dupT			B1AK49|Q5VX13|Q8TAX4	RNA	INS	-	NULL	ENST00000362089.5	37	NULL	CCDS1261.1	1																																																																																			CD247	-	-	ENSG00000198821		0.688	CD247-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD247	HGNC	protein_coding	OTTHUMT00000083707.1	47	0.00	0	-	NM_198053		167404209	167404210	-1	no_errors	ENST00000483825	ensembl	human	known	69_37n	rna	41	12.77	6	INS	0.000:0.000	T
APRT	353	genome.wustl.edu	37	16	88872978	88872978	+	IGR	SNP	G	G	T			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr16:88872978G>T	ENST00000378364.3	-	0	947				CDT1_ENST00000301019.4_Missense_Mutation_p.V340L	NM_000485.2	NP_000476.1	P07741	APT_HUMAN	adenine phosphoribosyltransferase						adenine salvage (GO:0006168)|AMP salvage (GO:0044209)|cellular response to insulin stimulus (GO:0032869)|grooming behavior (GO:0007625)|lactation (GO:0007595)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	adenine binding (GO:0002055)|adenine phosphoribosyltransferase activity (GO:0003999)|AMP binding (GO:0016208)			cervix(1)|endometrium(1)|liver(1)	3				BRCA - Breast invasive adenocarcinoma(80;0.0477)	Adenine(DB00173)|Adenosine monophosphate(DB00131)	CGTGGATGAAGTACCCGACAT	0.687																																						dbGAP											0													18.0	20.0	19.0					16																	88872978		2179	4293	6472	-	-	-	SO:0001628	intergenic_variant	0				CCDS32511.1, CCDS45546.1	16q24	2012-10-02				ENSG00000198931	2.4.2.7		626	protein-coding gene	gene with protein product		102600					Standard	NM_000485		Approved		uc002flv.3	P07741			16.37:g.88872978G>T			G5E9J2|Q3KP55|Q68DF9	Missense_Mutation	SNP	pfam_CDT1_Gemini-bd-like	p.V340L	ENST00000378364.3	37	c.1018	CCDS32511.1	16	.	.	.	.	.	.	.	.	.	.	G	20.7	4.028235	0.75390	.	.	ENSG00000167513	ENST00000301019	T	0.33438	1.41	4.97	4.97	0.65823	.	0.000000	0.85682	D	0.000000	T	0.56572	0.1994	M	0.74647	2.275	0.80722	D	1	D	0.76494	0.999	D	0.74023	0.982	T	0.58819	-0.7569	10	0.48119	T	0.1	-36.1615	17.843	0.88720	0.0:0.0:1.0:0.0	.	340	Q9H211	CDT1_HUMAN	L	340	ENSP00000301019:V340L	ENSP00000301019:V340L	V	+	1	0	CDT1	87400479	1.000000	0.71417	0.910000	0.35882	0.067000	0.16453	9.186000	0.94906	2.308000	0.77769	0.462000	0.41574	GTA	CDT1	-	pfam_CDT1_Gemini-bd-like	ENSG00000167513		0.687	APRT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDT1	HGNC	protein_coding	OTTHUMT00000430000.2	36	0.00	0	G	NM_000485		88872978	88872978	+1	no_errors	ENST00000301019	ensembl	human	known	69_37n	missense	31	26.19	11	SNP	1.000	T
CPNE4	131034	genome.wustl.edu	37	3	131268919	131268919	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr3:131268919G>A	ENST00000512055.1	-	18	3300	c.1174C>T	c.(1174-1176)Caa>Taa	p.Q392*	CPNE4_ENST00000512332.1_Nonsense_Mutation_p.Q410*|CPNE4_ENST00000429747.1_Nonsense_Mutation_p.Q392*|CPNE4_ENST00000511604.1_Nonsense_Mutation_p.Q392*|CPNE4_ENST00000502818.1_Nonsense_Mutation_p.Q410*			Q96A23	CPNE4_HUMAN	copine IV	392	VWFA.					extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|liver(1)|lung(16)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	39						ACAACTCCTTGAATTCCTGAG	0.443																																						dbGAP											0													97.0	96.0	97.0					3																	131268919		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			H29499	CCDS3072.1, CCDS75010.1	3q22.1	2014-09-04			ENSG00000196353	ENSG00000196353			2317	protein-coding gene	gene with protein product	"""copine 8"""	604208				9430674, 12670487	Standard	XM_005247107		Approved	COPN4, CPN4	uc003eok.3	Q96A23	OTTHUMG00000159631	ENST00000512055.1:c.1174C>T	3.37:g.131268919G>A	ENSP00000421705:p.Gln392*		D3DNC5|Q8TEX1	Nonsense_Mutation	SNP	pfam_Copine,pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_VWF_A,pfscan_C2_membr_targeting	p.Q410*	ENST00000512055.1	37	c.1228	CCDS3072.1	3	.	.	.	.	.	.	.	.	.	.	G	39	7.621559	0.98393	.	.	ENSG00000196353	ENST00000512055;ENST00000429747;ENST00000512332;ENST00000511604;ENST00000502818	.	.	.	5.33	5.33	0.75918	.	0.049241	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-13.354	19.0186	0.92903	0.0:0.0:1.0:0.0	.	.	.	.	X	392;392;410;392;410	.	ENSP00000411904:Q392X	Q	-	1	0	CPNE4	132751609	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.876000	0.87215	2.507000	0.84556	0.462000	0.41574	CAA	CPNE4	-	pfam_Copine,smart_VWF_A	ENSG00000196353		0.443	CPNE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE4	HGNC	protein_coding	OTTHUMT00000356583.4	46	0.00	0	G	NM_130808		131268919	131268919	-1	no_errors	ENST00000502818	ensembl	human	known	69_37n	nonsense	19	20.83	5	SNP	1.000	A
CRYL1	51084	genome.wustl.edu	37	13	21013828	21013828	+	Frame_Shift_Del	DEL	A	A	-	rs183986286	byFrequency	TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr13:21013828delA	ENST00000298248.7	-	4	404	c.342delT	c.(340-342)gatfs	p.D115fs	CRYL1_ENST00000382812.1_Frame_Shift_Del_p.D93fs|CRYL1_ENST00000480748.1_5'UTR	NM_015974.2	NP_057058.2	Q9Y2S2	CRYL1_HUMAN	crystallin, lambda 1	115					fatty acid metabolic process (GO:0006631)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|L-gulonate 3-dehydrogenase activity (GO:0050104)|NAD+ binding (GO:0070403)|protein homodimerization activity (GO:0042803)			NS(1)|kidney(1)|large_intestine(5)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(29;2.27e-23)|all_epithelial(30;1.69e-19)|all_lung(29;8.29e-18)|Lung SC(185;0.0262)|Ovarian(182;0.0827)|Hepatocellular(188;0.244)		all cancers(112;6.6e-05)|Epithelial(112;0.00178)|OV - Ovarian serous cystadenocarcinoma(117;0.0169)|Lung(94;0.0215)|GBM - Glioblastoma multiforme(144;0.0402)|LUSC - Lung squamous cell carcinoma(192;0.061)		TCACTCGATCATCAATGATGG	0.418																																						dbGAP											0													123.0	121.0	122.0					13																	21013828		1973	4173	6146	-	-	-	SO:0001589	frameshift_variant	0			AF077049	CCDS41871.1	13q11	2008-07-18			ENSG00000165475	ENSG00000165475			18246	protein-coding gene	gene with protein product	"""crystallin, lamda 1"", ""L-gulonate 3-dehydrogenase"", ""lambda-crystallin homolog"""	609877				12527201	Standard	NM_015974		Approved	GDH, lambda-CRY, MGC149525, MGC149526	uc001une.3	Q9Y2S2	OTTHUMG00000016516	ENST00000298248.7:c.342delT	13.37:g.21013828delA	ENSP00000298248:p.Asp115fs		A0PJ43|B3KN92|Q0VDI1|Q7Z4Z9|Q9P0G7	Frame_Shift_Del	DEL	pfam_3-OHacyl-CoA_DH_NAD-bd,pfam_3HC_DH_C,superfamily_6-PGluconate_DH_C-like	p.D114fs	ENST00000298248.7	37	c.342	CCDS41871.1	13																																																																																			CRYL1	-	pfam_3-OHacyl-CoA_DH_NAD-bd	ENSG00000165475		0.418	CRYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRYL1	HGNC	protein_coding	OTTHUMT00000044071.1	24	0.00	0	A	NM_015974		21013828	21013828	-1	no_errors	ENST00000298248	ensembl	human	known	69_37n	frame_shift_del	19	23.08	6	DEL	0.001	-
DAB2	1601	genome.wustl.edu	37	5	39377343	39377343	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr5:39377343T>C	ENST00000320816.6	-	12	2013	c.1546A>G	c.(1546-1548)Aca>Gca	p.T516A	DAB2_ENST00000509337.1_Missense_Mutation_p.T495A|DAB2_ENST00000545653.1_Missense_Mutation_p.T495A|DAB2_ENST00000339788.6_Missense_Mutation_p.T298A	NM_001343.3	NP_001334.2	P98082	DAB2_HUMAN	Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)	516					activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cell morphogenesis involved in differentiation (GO:0000904)|cell proliferation (GO:0008283)|cellular response to transforming growth factor beta stimulus (GO:0071560)|clathrin coat assembly (GO:0048268)|endoderm development (GO:0007492)|excretion (GO:0007588)|in utero embryonic development (GO:0001701)|leading edge cell differentiation (GO:0035026)|membrane organization (GO:0061024)|myeloid cell differentiation (GO:0030099)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein binding (GO:0032091)|negative regulation of protein localization to plasma membrane (GO:1903077)|negative regulation of transcription, DNA-templated (GO:0045892)|pinocytosis (GO:0006907)|positive regulation of cell migration (GO:0030335)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of endocytosis (GO:0045807)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor recycling (GO:0001921)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|clathrin coat of coated pit (GO:0030132)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	cargo receptor activity (GO:0038024)|clathrin adaptor activity (GO:0035615)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein C-terminus binding (GO:0008022)|SMAD binding (GO:0046332)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(9)|lung(19)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	47	all_lung(31;0.000197)		Epithelial(62;0.137)			AAAGATGCTGTGTTCCATGGT	0.463																																						dbGAP											0													100.0	97.0	98.0					5																	39377343		2203	4300	6503	-	-	-	SO:0001583	missense	0			U53446	CCDS34149.1, CCDS58946.1	5p13.1	2013-10-03	2013-03-08		ENSG00000153071	ENSG00000153071			2662	protein-coding gene	gene with protein product		601236	"""disabled (Drosophila) homolog 2 (mitogen-responsive phosphoprotein)"", ""disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)"""			8660969, 9620555	Standard	NM_001343		Approved	DOC-2	uc003jlx.3	P98082	OTTHUMG00000162043	ENST00000320816.6:c.1546A>G	5.37:g.39377343T>C	ENSP00000313391:p.Thr516Ala		A6NES5|Q13598|Q9BTY0|Q9UK04	Missense_Mutation	SNP	pfam_PTyr_interaction_dom,smart_PTyr_interaction_dom,pfscan_PTyr_interaction_dom	p.T516A	ENST00000320816.6	37	c.1546	CCDS34149.1	5	.	.	.	.	.	.	.	.	.	.	T	6.463	0.453493	0.12283	.	.	ENSG00000153071	ENST00000320816;ENST00000339788;ENST00000545653;ENST00000509337	T;T;T;T	0.34472	1.36;1.39;1.36;1.36	5.16	-1.46	0.08800	.	0.630458	0.16010	N	0.233854	T	0.20210	0.0486	L	0.29908	0.895	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.0;0.002	T	0.14282	-1.0478	10	0.29301	T	0.29	-0.0833	5.6448	0.17584	0.0628:0.1918:0.2305:0.5149	.	516;495	P98082;P98082-3	DAB2_HUMAN;.	A	516;298;495;495	ENSP00000313391:T516A;ENSP00000345508:T298A;ENSP00000439919:T495A;ENSP00000426245:T495A	ENSP00000313391:T516A	T	-	1	0	DAB2	39413100	0.004000	0.15560	0.000000	0.03702	0.038000	0.13279	-0.061000	0.11693	-0.375000	0.07955	-1.251000	0.01509	ACA	DAB2	-	NULL	ENSG00000153071		0.463	DAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAB2	HGNC	protein_coding	OTTHUMT00000367014.1	33	0.00	0	T	NM_001343		39377343	39377343	-1	no_errors	ENST00000320816	ensembl	human	known	69_37n	missense	25	28.57	10	SNP	0.000	C
DCAF10	79269	genome.wustl.edu	37	9	37862230	37862230	+	3'UTR	SNP	C	C	G			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr9:37862230C>G	ENST00000377724.3	+	0	2770				DCAF10_ENST00000242323.7_3'UTR|DCAF10_ENST00000483167.1_3'UTR|RP11-613M10.9_ENST00000540557.1_Intron	NM_024345.3	NP_077321.3	Q5QP82	DCA10_HUMAN	DDB1 and CUL4 associated factor 10						protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	12						TTTAACATCTCTAGCATGTAT	0.303																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			BC003520	CCDS6613.2, CCDS75835.1	9p13.2	2013-01-09	2009-07-17	2009-07-17	ENSG00000122741	ENSG00000122741		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	23686	protein-coding gene	gene with protein product			"""WD repeat domain 32"""	WDR32			Standard	NM_001286810		Approved	MGC10765, FLJ23201	uc004aao.3	Q5QP82	OTTHUMG00000019934	ENST00000377724.3:c.*725C>G	9.37:g.37862230C>G			A4VCJ5|Q32NE2|Q8N2Q5|Q96ET5|Q9BTQ5|Q9H5P6	RNA	SNP	-	NULL	ENST00000377724.3	37	NULL	CCDS6613.2	9																																																																																			DCAF10	-	-	ENSG00000122741		0.303	DCAF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF10	HGNC	protein_coding	OTTHUMT00000052485.2	43	0.00	0	C	NM_024345		37862230	37862230	+1	no_errors	ENST00000483167	ensembl	human	known	69_37n	rna	34	15.00	6	SNP	0.000	G
DDR1	780	genome.wustl.edu	37	6	30859162	30859162	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr6:30859162C>T	ENST00000324771.8	+	8	1119	c.571C>T	c.(571-573)Ctc>Ttc	p.L191F	DDR1_ENST00000376569.3_Missense_Mutation_p.L191F|DDR1_ENST00000508472.1_3'UTR|DDR1_ENST00000454612.2_Missense_Mutation_p.L191F|DDR1_ENST00000376575.3_Missense_Mutation_p.L191F|DDR1_ENST00000376567.2_Missense_Mutation_p.L191F|DDR1_ENST00000418800.2_Missense_Mutation_p.L191F|DDR1_ENST00000376568.3_Missense_Mutation_p.L191F|DDR1_ENST00000376570.4_Missense_Mutation_p.L191F|DDR1_ENST00000446312.1_Intron|DDR1_ENST00000452441.1_Missense_Mutation_p.L191F|DDR1_ENST00000361741.4_5'Flank|DDR1_ENST00000513240.1_Missense_Mutation_p.L191F|DDR1_ENST00000508312.1_Missense_Mutation_p.L209F|MIR4640_ENST00000581824.1_RNA			Q08345	DDR1_HUMAN	discoidin domain receptor tyrosine kinase 1	191					branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|ear development (GO:0043583)|embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine autophosphorylation (GO:0038083)|protein autophosphorylation (GO:0046777)|regulation of cell growth (GO:0001558)|regulation of cell-matrix adhesion (GO:0001952)|regulation of extracellular matrix disassembly (GO:0010715)|smooth muscle cell migration (GO:0014909)|smooth muscle cell-matrix adhesion (GO:0061302)|wound healing, spreading of cells (GO:0044319)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|metal ion binding (GO:0046872)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(1)|prostate(1)|skin(1)	29					Imatinib(DB00619)	CCCAGATGGACTCCTGTCTTA	0.577																																						dbGAP											0													71.0	50.0	57.0					6																	30859162		1511	2709	4220	-	-	-	SO:0001583	missense	0			X99031	CCDS4690.1, CCDS34385.1, CCDS47396.1, CCDS56411.1, CCDS75419.1	6p21.33	2010-02-17	2008-01-23		ENSG00000204580	ENSG00000204580	2.7.10.1	"""CD molecules"""	2730	protein-coding gene	gene with protein product		600408	"""discoidin domain receptor family, member 1"""	NTRK4, PTK3A, NEP, CAK, EDDR1		7789998	Standard	NM_001954		Approved	RTK6, CD167	uc003nrv.3	Q08345	OTTHUMG00000031236	ENST00000324771.8:c.571C>T	6.37:g.30859162C>T	ENSP00000318217:p.Leu191Phe		B5A975|B5A976|B7Z2K0|Q14196|Q16562|Q2L6H3|Q4LE50|Q5ST11|Q5ST12|Q6NSK4|Q9UD35|Q9UD36|Q9UD37|Q9UD86|Q9UDL2	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Kinase-like_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Prot_kinase_cat_dom	p.L191F	ENST00000324771.8	37	c.571	CCDS34385.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.3|20.3	3.974061|3.974061	0.74246|0.74246	.|.	.|.	ENSG00000204580|ENSG00000204580	ENST00000460944;ENST00000324771;ENST00000418800;ENST00000454612;ENST00000376569;ENST00000376575;ENST00000376570;ENST00000428153;ENST00000376568;ENST00000452441;ENST00000515219;ENST00000508312;ENST00000421124;ENST00000376567;ENST00000513240|ENST00000424544	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.26223|.	1.75;1.75;1.75;1.75;1.75;1.75;1.75;1.75;1.75;1.75;1.75;1.75;1.75;1.75;1.75|.	4.26|4.26	4.26|4.26	0.50523|0.50523	.|.	0.000000|.	0.64402|.	D|.	0.000006|.	T|T	0.68906|0.68906	0.3052|0.3052	M|M	0.79011|0.79011	2.435|2.435	0.80722|0.80722	D|D	1|1	D;D;P|.	0.67145|.	0.963;0.996;0.641|.	P;D;P|.	0.67725|.	0.827;0.953;0.473|.	T|T	0.70655|0.70655	-0.4812|-0.4812	10|5	0.87932|.	D|.	0|.	.|.	14.5309|14.5309	0.67926|0.67926	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	209;191;191|.	B7Z2K0;Q08345-5;Q08345|.	.;.;DDR1_HUMAN|.	F|I	191;191;191;191;191;191;191;191;191;191;33;209;191;191;191|174	ENSP00000426420:L191F;ENSP00000318217:L191F;ENSP00000407699:L191F;ENSP00000406091:L191F;ENSP00000365753:L191F;ENSP00000365759:L191F;ENSP00000365754:L191F;ENSP00000390593:L191F;ENSP00000365752:L191F;ENSP00000405039:L191F;ENSP00000421152:L33F;ENSP00000422442:L209F;ENSP00000409682:L191F;ENSP00000365751:L191F;ENSP00000427552:L191F|.	ENSP00000318217:L191F|.	L|T	+|+	1|2	0|0	DDR1|DDR1	30967141|30967141	0.813000|0.813000	0.29090|0.29090	1.000000|1.000000	0.80357|0.80357	0.978000|0.978000	0.69477|0.69477	1.325000|1.325000	0.33724|0.33724	2.373000|2.373000	0.80994|0.80994	0.467000|0.467000	0.42956|0.42956	CTC|ACT	DDR1	-	NULL	ENSG00000204580		0.577	DDR1-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	DDR1	HGNC	protein_coding	OTTHUMT00000076494.3	47	0.00	0	C	NM_013994		30859162	30859162	+1	no_errors	ENST00000376575	ensembl	human	known	69_37n	missense	55	15.38	10	SNP	1.000	T
DDX1	1653	genome.wustl.edu	37	2	15761226	15761226	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr2:15761226G>C	ENST00000381341.2	+	19	1822	c.1433G>C	c.(1432-1434)gGt>gCt	p.G478A	DDX1_ENST00000233084.3_Missense_Mutation_p.G478A			Q92499	DDX1_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 1	478	Necessary for interaction with RELA.				ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|multicellular organismal development (GO:0007275)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translational initiation (GO:0006446)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|spliceosomal complex assembly (GO:0000245)|transcription, DNA-templated (GO:0006351)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	cleavage body (GO:0071920)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|tRNA-splicing ligase complex (GO:0072669)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA/RNA helicase activity (GO:0033677)|double-stranded RNA binding (GO:0003725)|exonuclease activity (GO:0004527)|nuclease activity (GO:0004518)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|transcription cofactor activity (GO:0003712)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(13)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	all_epithelial(98;2.96e-07)|Acute lymphoblastic leukemia(84;4.24e-05)|Ovarian(717;0.0694)	GBM - Glioblastoma multiforme(3;0.00969)	Epithelial(75;4.35e-05)|OV - Ovarian serous cystadenocarcinoma(76;0.133)		ACAAGACCTGGTGCTAATAGT	0.338																																						dbGAP											0													93.0	94.0	94.0					2																	15761226		2203	4297	6500	-	-	-	SO:0001583	missense	0			X70649	CCDS1686.1	2p24	2012-02-23	2012-02-23		ENSG00000079785	ENSG00000079785		"""DEAD-boxes"""	2734	protein-coding gene	gene with protein product		601257	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 1"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 1"""			1552844, 19058135	Standard	NM_004939		Approved	DBP-RB	uc002rce.4	Q92499	OTTHUMG00000090593	ENST00000381341.2:c.1433G>C	2.37:g.15761226G>C	ENSP00000370745:p.Gly478Ala		B4DME8|B4DPN6	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_SPRY_rcpt,pfam_Helicase_C,superfamily_ConA-like_lec_gl,smart_Helicase_ATP-bd,smart_SPla/RYanodine_receptor_subgr,smart_Helicase_C,pfscan_B30.2/SPRY,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.G478A	ENST00000381341.2	37	c.1433	CCDS1686.1	2	.	.	.	.	.	.	.	.	.	.	G	18.17	3.564038	0.65651	.	.	ENSG00000079785	ENST00000381341;ENST00000233084;ENST00000543614	D;D	0.97114	-4.25;-4.25	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	D	0.96204	0.8762	M	0.69248	2.105	0.80722	D	1	P	0.38473	0.633	B	0.37692	0.256	D	0.95145	0.8267	10	0.29301	T	0.29	-22.0039	20.0784	0.97758	0.0:0.0:1.0:0.0	.	478	Q92499	DDX1_HUMAN	A	478;478;462	ENSP00000370745:G478A;ENSP00000233084:G478A	ENSP00000233084:G478A	G	+	2	0	DDX1	15678677	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	9.319000	0.96338	2.736000	0.93811	0.655000	0.94253	GGT	DDX1	-	NULL	ENSG00000079785		0.338	DDX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX1	HGNC	protein_coding	OTTHUMT00000207141.2	34	0.00	0	G	NM_004939		15761226	15761226	+1	no_errors	ENST00000233084	ensembl	human	known	69_37n	missense	39	20.41	10	SNP	1.000	C
DDX21	9188	genome.wustl.edu	37	10	70728850	70728850	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr10:70728850G>C	ENST00000354185.4	+	7	1307	c.1209G>C	c.(1207-1209)aaG>aaC	p.K403N	RN7SL373P_ENST00000577512.1_RNA	NM_001256910.1|NM_004728.3	NP_001243839.1|NP_004719.2	Q9NR30	DDX21_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 21	403					ATP catabolic process (GO:0006200)|osteoblast differentiation (GO:0001649)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	20						TTGGTAAAAAGACTCAGAAAA	0.323																																						dbGAP											0													95.0	96.0	96.0					10																	70728850		2203	4300	6503	-	-	-	SO:0001583	missense	0			U41387	CCDS31211.1, CCDS73144.1	10q21	2013-05-13	2012-02-23		ENSG00000165732	ENSG00000165732		"""DEAD-boxes"""	2744	protein-coding gene	gene with protein product		606357	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 21"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 21"""			8614622, 18180292	Standard	NM_004728		Approved	RH-II/GU, GURDB	uc001jov.2	Q9NR30	OTTHUMG00000018366	ENST00000354185.4:c.1209G>C	10.37:g.70728850G>C	ENSP00000346120:p.Lys403Asn		B2RDL0|Q13436|Q5VX41|Q68D35	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_GUCT,pfam_Helicase_C,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.K403N	ENST00000354185.4	37	c.1209	CCDS31211.1	10	.	.	.	.	.	.	.	.	.	.	G	13.38	2.219352	0.39201	.	.	ENSG00000165732	ENST00000354185	T	0.17528	2.27	5.77	5.77	0.91146	DEAD-like helicase (1);	0.123216	0.64402	D	0.000001	T	0.14485	0.0350	L	0.33485	1.01	0.44603	D	0.997579	B	0.11235	0.004	B	0.09377	0.004	T	0.03933	-1.0991	10	0.33141	T	0.24	-48.5248	13.5594	0.61779	0.0711:0.0:0.9289:0.0	.	403	Q9NR30	DDX21_HUMAN	N	403	ENSP00000346120:K403N	ENSP00000346120:K403N	K	+	3	2	DDX21	70398856	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.473000	0.45145	2.885000	0.99019	0.655000	0.94253	AAG	DDX21	-	smart_Helicase_ATP-bd	ENSG00000165732		0.323	DDX21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX21	HGNC	protein_coding	OTTHUMT00000048374.1	49	0.00	0	G	NM_004728		70728850	70728850	+1	no_errors	ENST00000354185	ensembl	human	known	69_37n	missense	20	28.57	8	SNP	1.000	C
DDX60	55601	genome.wustl.edu	37	4	169227774	169227774	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr4:169227774G>C	ENST00000393743.3	-	5	653	c.362C>G	c.(361-363)aCa>aGa	p.T121R		NM_017631.5	NP_060101.3	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	121					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|urinary_tract(4)	63		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		CGAAAATGTTGTTCGAACATC	0.403																																						dbGAP											0													84.0	86.0	86.0					4																	169227774		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001649	CCDS34097.1	4q32.3	2010-02-17			ENSG00000137628	ENSG00000137628			25942	protein-coding gene	gene with protein product		613974				12477932	Standard	NM_017631		Approved	FLJ20035	uc003irp.3	Q8IY21	OTTHUMG00000161350	ENST00000393743.3:c.362C>G	4.37:g.169227774G>C	ENSP00000377344:p.Thr121Arg		Q6PK35|Q9NVE3	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.T121R	ENST00000393743.3	37	c.362	CCDS34097.1	4	.	.	.	.	.	.	.	.	.	.	G	14.71	2.617513	0.46736	.	.	ENSG00000137628	ENST00000393743	T	0.19105	2.17	5.21	5.21	0.72293	.	0.000000	0.64402	D	0.000007	T	0.48132	0.1483	M	0.76328	2.33	0.39245	D	0.963935	D	0.89917	1.0	D	0.72982	0.979	T	0.47636	-0.9102	10	0.44086	T	0.13	.	18.7054	0.91635	0.0:0.0:1.0:0.0	.	121	Q8IY21	DDX60_HUMAN	R	121	ENSP00000377344:T121R	ENSP00000377344:T121R	T	-	2	0	DDX60	169464349	1.000000	0.71417	0.056000	0.19401	0.001000	0.01503	6.134000	0.71689	2.573000	0.86826	0.563000	0.77884	ACA	DDX60	-	NULL	ENSG00000137628		0.403	DDX60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX60	HGNC	protein_coding	OTTHUMT00000364622.1	37	0.00	0	G	NM_017631		169227774	169227774	-1	no_errors	ENST00000393743	ensembl	human	known	69_37n	missense	9	64.00	16	SNP	0.759	C
DEPDC5	9681	genome.wustl.edu	37	22	32289734	32289734	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr22:32289734G>T	ENST00000382112.3	+	38	4243	c.4173G>T	c.(4171-4173)gaG>gaT	p.E1391D	DEPDC5_ENST00000539165.1_Missense_Mutation_p.E217D|DEPDC5_ENST00000382105.2_3'UTR|DEPDC5_ENST00000266091.3_Missense_Mutation_p.E1378D|DEPDC5_ENST00000400249.2_Missense_Mutation_p.E1369D|DEPDC5_ENST00000382111.2_Missense_Mutation_p.E1400D|DEPDC5_ENST00000400248.2_Missense_Mutation_p.E1369D|DEPDC5_ENST00000400246.1_Missense_Mutation_p.E1400D|DEPDC5_ENST00000535622.1_Missense_Mutation_p.E1300D	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	1400					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						TACTCTTCGAGATGGTGAGAA	0.473																																						dbGAP											0													61.0	63.0	62.0					22																	32289734		2043	4190	6233	-	-	-	SO:0001583	missense	0			AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.4173G>T	22.37:g.32289734G>T	ENSP00000371546:p.Glu1391Asp		A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Missense_Mutation	SNP	pfam_DUF3608,pfam_DEP_dom,smart_DEP_dom,pfscan_DEP_dom	p.E1378D	ENST00000382112.3	37	c.4134	CCDS46692.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.74|13.74	2.327031|2.327031	0.41197|0.41197	.|.	.|.	ENSG00000100150|ENSG00000100150	ENST00000433147|ENST00000535622;ENST00000266091;ENST00000400249;ENST00000382109;ENST00000400246;ENST00000382112;ENST00000382111;ENST00000400248;ENST00000539165	.|T;T;T;T;T;T;T	.|0.18016	.|2.24;2.69;2.68;2.34;2.69;2.34;2.68	5.12|5.12	5.12|5.12	0.69794|0.69794	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.22704|0.22704	0.0548|0.0548	N|N	0.16567|0.16567	0.415|0.415	0.58432|0.58432	D|D	0.999994|0.999994	.|D;D;D;D;D;D	.|0.76494	.|0.995;0.998;0.999;0.996;0.994;0.994	.|D;D;D;D;D;D	.|0.81914	.|0.978;0.986;0.995;0.987;0.97;0.97	T|T	0.01545|0.01545	-1.1328|-1.1328	5|10	.|0.02654	.|T	.|1	.|.	17.5688|17.5688	0.87928|0.87928	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1400;1300;786;1378;1391;1369	.|B9EGN9;B4DH93;O75140-7;O75140-4;A8MPX9;O75140	.|.;.;.;.;.;DEPD5_HUMAN	Y|D	776|1300;1378;1369;1300;1400;1391;1400;1369;217	.|ENSP00000440210:E1300D;ENSP00000266091:E1378D;ENSP00000383108:E1369D;ENSP00000383105:E1400D;ENSP00000371546:E1391D;ENSP00000371545:E1400D;ENSP00000383107:E1369D	.|ENSP00000266091:E1378D	D|E	+|+	1|3	0|2	DEPDC5|DEPDC5	30619734|30619734	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.980000|0.980000	0.70556|0.70556	3.728000|3.728000	0.54991|0.54991	2.380000|2.380000	0.81148|0.81148	0.655000|0.655000	0.94253|0.94253	GAT|GAG	DEPDC5	-	NULL	ENSG00000100150		0.473	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DEPDC5	HGNC	protein_coding	OTTHUMT00000129087.1	34	0.00	0	G	NM_014662		32289734	32289734	+1	no_errors	ENST00000266091	ensembl	human	known	69_37n	missense	2	88.89	16	SNP	1.000	T
DGAT2	84649	genome.wustl.edu	37	11	75508201	75508201	+	Splice_Site	SNP	A	A	T			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr11:75508201A>T	ENST00000228027.7	+	6	894		c.e6-1		DGAT2_ENST00000376262.3_Splice_Site	NM_032564.4	NP_115953.2	Q96PD7	DGAT2_HUMAN	diacylglycerol O-acyltransferase 2						acylglycerol acyl-chain remodeling (GO:0036155)|cellular lipid metabolic process (GO:0044255)|cellular response to oleic acid (GO:0071400)|cellular triglyceride homeostasis (GO:0035356)|cholesterol homeostasis (GO:0042632)|diacylglycerol metabolic process (GO:0046339)|fat pad development (GO:0060613)|fatty acid homeostasis (GO:0055089)|glycerol metabolic process (GO:0006071)|glycerophospholipid biosynthetic process (GO:0046474)|lipid storage (GO:0019915)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|low-density lipoprotein particle clearance (GO:0034383)|phospholipid metabolic process (GO:0006644)|regulation of plasma lipoprotein particle levels (GO:0097006)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)	2-acylglycerol O-acyltransferase activity (GO:0003846)|diacylglycerol O-acyltransferase activity (GO:0004144)|protein homodimerization activity (GO:0042803)|retinol O-fatty-acyltransferase activity (GO:0050252)			endometrium(3)|large_intestine(5)|lung(5)|prostate(2)|skin(2)	17	Ovarian(111;0.103)					CCCTCCCCTCAGGTATCTGCC	0.557																																					Melanoma(35;811 1096 8354 24009 39363)	dbGAP											0													137.0	128.0	131.0					11																	75508201		2200	4293	6493	-	-	-	SO:0001630	splice_region_variant	0				CCDS31642.1, CCDS58162.1	11q13.3	2010-06-24	2010-06-24		ENSG00000062282	ENSG00000062282			16940	protein-coding gene	gene with protein product		606983	"""diacylglycerol O-acyltransferase homolog 2 (mouse)"""			11481335, 14970677	Standard	NM_032564		Approved		uc001oxa.3	Q96PD7	OTTHUMG00000165338	ENST00000228027.7:c.635-1A>T	11.37:g.75508201A>T			A6ND76|Q5U810|Q68CL3|Q68DJ0|Q8NDB7|Q96BS0|Q9BYE5	Splice_Site	SNP	-	e6-2	ENST00000228027.7	37	c.635-2	CCDS31642.1	11	.	.	.	.	.	.	.	.	.	.	A	17.27	3.347683	0.61183	.	.	ENSG00000062282	ENST00000524706;ENST00000228027;ENST00000376262;ENST00000525612	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0509	0.71867	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DGAT2	75185849	1.000000	0.71417	0.985000	0.45067	0.516000	0.34256	8.904000	0.92590	2.243000	0.73865	0.533000	0.62120	.	DGAT2	-	-	ENSG00000062282		0.557	DGAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGAT2	HGNC	protein_coding	OTTHUMT00000383506.1	51	0	0	A	NM_032564	Intron	75508201	75508201	+1	no_errors	ENST00000228027	ensembl	human	known	69_37n	splice_site	49	14.04	8	SNP	1.000	T
DNAH17	8632	genome.wustl.edu	37	17	76565585	76565585	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr17:76565585C>G	ENST00000585328.1	-	8	1193	c.1069G>C	c.(1069-1071)Gag>Cag	p.E357Q	DNAH17_ENST00000389840.5_Missense_Mutation_p.E357Q	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	357	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			TTCAGCACCTCTTCCGGGCTC	0.562																																						dbGAP											0													51.0	43.0	46.0					17																	76565585		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.1069G>C	17.37:g.76565585C>G	ENSP00000465516:p.Glu357Gln		O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_HR1_rho-bd	p.E357Q	ENST00000585328.1	37	c.1069		17	.	.	.	.	.	.	.	.	.	.	C	12.52	1.964127	0.34659	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.55930	0.49	4.65	3.67	0.42095	.	0.304241	0.22580	N	0.058231	T	0.60353	0.2262	M	0.72353	2.195	0.26624	N	0.972598	B	0.28552	0.215	B	0.41466	0.358	T	0.58983	-0.7539	10	0.51188	T	0.08	.	12.793	0.57545	0.0:0.8351:0.1649:0.0	.	59	Q9UFH2-4	.	Q	357	ENSP00000374490:E357Q	ENSP00000300671:E357Q	E	-	1	0	DNAH17	74077180	0.986000	0.35501	0.623000	0.29173	0.417000	0.31264	3.195000	0.51013	0.937000	0.37394	0.561000	0.74099	GAG	DNAH17	-	pfam_Dynein_heavy_dom-1	ENSG00000187775		0.562	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	DNAH17	HGNC	protein_coding	OTTHUMT00000318962.2	62	0.00	0	C	NM_173628		76565585	76565585	-1	no_errors	ENST00000389840	ensembl	human	known	69_37n	missense	41	33.87	21	SNP	0.973	G
DNAJB12	54788	genome.wustl.edu	37	10	74096348	74096348	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr10:74096348C>G	ENST00000444643.2	-	7	1272	c.940G>C	c.(940-942)Gag>Cag	p.E314Q	DNAJB12_ENST00000461919.1_Missense_Mutation_p.E109Q|DNAJB12_ENST00000338820.3_Missense_Mutation_p.E348Q|DNAJB12_ENST00000394903.2_Missense_Mutation_p.E348Q			Q9NXW2	DJB12_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 12	314						integral component of membrane (GO:0016021)|membrane (GO:0016020)				endometrium(1)|large_intestine(2)|skin(1)	4						ACATTCCGCTCGACTGTTTTG	0.557																																						dbGAP											0													155.0	143.0	147.0					10																	74096348		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000034	CCDS7316.2	10q22	2011-09-02			ENSG00000148719	ENSG00000148719		"""Heat shock proteins / DNAJ (HSP40)"""	14891	protein-coding gene	gene with protein product		608376				11147971	Standard	NM_001002762		Approved	DJ10, FLJ20027	uc001jta.2	Q9NXW2	OTTHUMG00000018436	ENST00000444643.2:c.940G>C	10.37:g.74096348C>G	ENSP00000403313:p.Glu314Gln		B7Z7I3|Q9H6H0	Missense_Mutation	SNP	pfam_DUF1977_DnaJ-like,pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,prints_Hsp_DnaJ,pfscan_DnaJ_N	p.E348Q	ENST00000444643.2	37	c.1042		10	.	.	.	.	.	.	.	.	.	.	C	27.3	4.818413	0.90790	.	.	ENSG00000148719	ENST00000338820;ENST00000394903;ENST00000444643	T;T;T	0.60299	0.2;0.2;0.2	5.62	5.62	0.85841	Domain of unknown function DUF1977, DnaJ-like (1);	0.000000	0.85682	D	0.000000	D	0.82866	0.5130	M	0.92268	3.29	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.86215	0.1627	10	0.87932	D	0	-17.5843	20.0247	0.97519	0.0:1.0:0.0:0.0	.	314;314	Q9NXW2-2;Q9NXW2	.;DJB12_HUMAN	Q	348;348;314	ENSP00000345575:E348Q;ENSP00000378363:E348Q;ENSP00000403313:E314Q	ENSP00000345575:E348Q	E	-	1	0	DNAJB12	73766354	1.000000	0.71417	0.275000	0.24674	0.763000	0.43281	7.445000	0.80570	2.804000	0.96469	0.655000	0.94253	GAG	DNAJB12	-	pfam_DUF1977_DnaJ-like	ENSG00000148719		0.557	DNAJB12-001	KNOWN	basic|appris_principal	protein_coding	DNAJB12	HGNC	protein_coding	OTTHUMT00000048581.2	73	0.00	0	C			74096348	74096348	-1	no_errors	ENST00000338820	ensembl	human	known	69_37n	missense	32	11.11	4	SNP	0.999	G
ENDOV	284131	genome.wustl.edu	37	17	78389493	78389493	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr17:78389493G>A	ENST00000518137.1	+	2	128	c.100G>A	c.(100-102)Gag>Aag	p.E34K	ENDOV_ENST00000518907.1_Intron|CTD-2047H16.4_ENST00000572151.1_RNA|ENDOV_ENST00000522751.1_5'UTR|CTD-2047H16.4_ENST00000573394.1_RNA|ENDOV_ENST00000517295.2_5'UTR|ENDOV_ENST00000517795.1_Intron|ENDOV_ENST00000523999.1_Missense_Mutation_p.E34K|ENDOV_ENST00000323854.5_Missense_Mutation_p.E34K|ENDOV_ENST00000520367.1_Missense_Mutation_p.E34K|CTD-2047H16.4_ENST00000575034.1_RNA|ENDOV_ENST00000520284.1_5'UTR|ENDOV_ENST00000518644.1_5'UTR|ENDOV_ENST00000518901.1_Intron|ENDOV_ENST00000521847.1_3'UTR	NM_173627.3	NP_775898.2	Q8N8Q3	ENDOV_HUMAN	endonuclease V	34					DNA repair (GO:0006281)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|endoribonuclease activity, producing 5'-phosphomonoesters (GO:0016891)|magnesium ion binding (GO:0000287)|single-stranded RNA binding (GO:0003727)|structure-specific DNA binding (GO:0043566)			endometrium(1)|lung(1)|pancreas(1)|prostate(1)	4						CCGGGACACCGAGGCGTGGCA	0.642								Direct reversal of damage																														dbGAP											0													36.0	43.0	41.0					17																	78389493		2034	4163	6197	-	-	-	SO:0001583	missense	0				CCDS54172.1, CCDS54173.1, CCDS54174.1	17q25.3	2011-05-05			ENSG00000173818	ENSG00000173818			26640	protein-coding gene	gene with protein product						12853604	Standard	NM_001164638		Approved	FLJ35220	uc021ueo.1	Q8N8Q3	OTTHUMG00000164638	ENST00000518137.1:c.100G>A	17.37:g.78389493G>A	ENSP00000429190:p.Glu34Lys		I3L3S4|Q6P2G2|Q86X99|Q8NAK0	Missense_Mutation	SNP	pfam_Endonuclease-V	p.E34K	ENST00000518137.1	37	c.100	CCDS54172.1	17	.	.	.	.	.	.	.	.	.	.	G	20.7	4.028485	0.75390	.	.	ENSG00000173818	ENST00000518137;ENST00000520367;ENST00000523999;ENST00000323854;ENST00000517295	T;T;T;T	0.46451	2.51;1.88;0.87;1.87	4.62	3.57	0.40892	.	0.000000	0.85682	U	0.000000	T	0.59959	0.2232	M	0.71581	2.175	0.80722	D	1	P;P;P;D	0.89917	0.806;0.769;0.87;1.0	B;B;B;D	0.81914	0.232;0.149;0.245;0.995	T	0.58498	-0.7626	10	0.27785	T	0.31	-6.5662	13.696	0.62580	0.0:0.2779:0.7221:0.0	.	34;34;34;34	Q8N8Q3;Q8N8Q3-2;Q8N8Q3-3;E5RFW0	ENDOV_HUMAN;.;.;.	K	34;34;34;34;9	ENSP00000429190:E34K;ENSP00000431036:E34K;ENSP00000427921:E34K;ENSP00000317810:E34K	ENSP00000317810:E34K	E	+	1	0	ENDOV	76004088	1.000000	0.71417	0.998000	0.56505	0.267000	0.26476	5.214000	0.65236	2.087000	0.62958	0.585000	0.79938	GAG	ENDOV	-	NULL	ENSG00000173818		0.642	ENDOV-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENDOV	HGNC	protein_coding	OTTHUMT00000379487.1	62	0.00	0	G	NM_173627		78389493	78389493	+1	no_errors	ENST00000518137	ensembl	human	known	69_37n	missense	35	27.08	13	SNP	0.979	A
PILRB	29990	genome.wustl.edu	37	7	99933775	99933775	+	5'UTR	SNP	G	G	C			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr7:99933775G>C	ENST00000610247.1	+	0	39				STAG3L5P_ENST00000493499.1_RNA|STAG3L5P-PVRIG2P-PILRB_ENST00000310771.4_RNA			Q9UKJ0	PILRB_HUMAN	paired immunoglobin-like type 2 receptor beta						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)				endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	13	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GCCTGGCGTGGATTCCGAGCG	0.632																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AF161081, AJ400845	CCDS43622.1	7q22.1	2014-05-16			ENSG00000121716	ENSG00000121716		"""Immunoglobulin superfamily / V-set domain containing"""	18297	protein-coding gene	gene with protein product		605342				10660620	Standard	NM_178238		Approved	FDFACT1, FDFACT2	uc022ail.1	Q9UKJ0	OTTHUMG00000155363	ENST00000610247.1:c.-2458G>C	7.37:g.99933775G>C			Q69YF9|Q9HBS0	RNA	SNP	-	NULL	ENST00000610247.1	37	NULL	CCDS43622.1	7																																																																																			CTB-161A2.3	-	-	ENSG00000242294		0.632	PILRB-202	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000242294	Clone_based_vega_gene	protein_coding		134	0.00	0	G	NM_178238		99933775	99933775	+1	no_errors	ENST00000414292	ensembl	human	known	69_37n	rna	90	19.64	22	SNP	0.024	C
SNORD112	692215	genome.wustl.edu	37	18	5577341	5577342	+	RNA	DEL	AG	AG	-			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr18:5577341_5577342delAG	ENST00000516763.1	+	0	0									small nucleolar RNA, C/D box 112																		CCAAATCCTAAGAGAGACTTTG	0.386																																						dbGAP											0																																										-	-	-			0					14q32.31	2013-09-05			ENSG00000238527	ENSG00000275662		"""ncRNAs / Small nucleolar RNAs : C/D box containing"""	32777	non-coding RNA	RNA, small nucleolar		613649				12045206	Standard	NR_003080		Approved	14q(0)	uc021ply.1				18.37:g.5577345_5577346delAG				Frame_Shift_Del	DEL	NULL	p.L15fs	ENST00000516763.1	37	c.43_42		18																																																																																			EPB41L3	-	NULL	ENSG00000082397		0.386	SNORD112.34-201	NOVEL	basic	snoRNA	EPB41L3	HGNC	snoRNA		15	0.00	0	AG	NR_003080		5577341	5577342	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000582592	ensembl	human	putative	69_37n	frame_shift_del	2	50.00	2	DEL	0.995:1.000	-
FABP6	2172	genome.wustl.edu	37	5	159661862	159661862	+	Silent	SNP	G	G	A			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr5:159661862G>A	ENST00000402432.3	+	3	407	c.279G>A	c.(277-279)gtG>gtA	p.V93V	FABP6_ENST00000393980.4_Silent_p.V142V|FABP6_ENST00000393982.1_Silent_p.V142V	NM_001445.2	NP_001436.1	P51161	FABP6_HUMAN	fatty acid binding protein 6, ileal	93					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|lipid metabolic process (GO:0006629)|negative regulation of cell proliferation (GO:0008285)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	lipid binding (GO:0008289)|transporter activity (GO:0005215)			breast(1)|kidney(1)|large_intestine(1)|lung(2)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGCTGGTGGTGAATTTCCCCA	0.517																																					Colon(29;562 677 12756 16385 20992)	dbGAP											0													133.0	110.0	118.0					5																	159661862		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U19869	CCDS4349.1, CCDS43393.1	5q23-q35	2013-03-01	2008-08-01		ENSG00000170231	ENSG00000170231		"""Fatty acid binding protein family"""	3561	protein-coding gene	gene with protein product	"""illeal lipid-binding protein"", ""ileal bile acid binding protein"", ""gastrotropin"""	600422				7894165, 7619861	Standard	NM_001130958		Approved	I-15P, ILLBP, I-BAP, ILBP3, I-BABP, ILBP, I-BALB	uc003lxx.1	P51161	OTTHUMG00000130329	ENST00000402432.3:c.279G>A	5.37:g.159661862G>A			Q07DR7|Q8TBI3|Q9UGI7	Silent	SNP	superfamily_Calycin-like,prints_Fatty_acid-bd	p.V142	ENST00000402432.3	37	c.426	CCDS4349.1	5																																																																																			FABP6	-	superfamily_Calycin-like	ENSG00000170231		0.517	FABP6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FABP6	HGNC	protein_coding	OTTHUMT00000320505.2	92	0.00	0	G	NM_001040442		159661862	159661862	+1	no_errors	ENST00000393980	ensembl	human	known	69_37n	silent	52	33.75	27	SNP	0.000	A
FAHD2A	51011	genome.wustl.edu	37	2	96071355	96071355	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr2:96071355C>T	ENST00000233379.4	+	2	202	c.49C>T	c.(49-51)Cag>Tag	p.Q17*	FAHD2A_ENST00000447036.1_Nonsense_Mutation_p.Q17*	NM_016044.2	NP_057128.2	Q96GK7	FAH2A_HUMAN	fumarylacetoacetate hydrolase domain containing 2A	17							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(3)|ovary(1)	8						GCTGCAGGCTCAGAAGTGGCC	0.572																																						dbGAP											0													72.0	72.0	72.0					2																	96071355		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF151863	CCDS2014.1	2q11.2	2008-02-05			ENSG00000115042	ENSG00000115042			24252	protein-coding gene	gene with protein product							Standard	NM_016044		Approved	CGI-105	uc002sur.3	Q96GK7	OTTHUMG00000130397	ENST00000233379.4:c.49C>T	2.37:g.96071355C>T	ENSP00000233379:p.Gln17*		Q9Y3B0	Nonsense_Mutation	SNP	pfam_Fumarylacetoacetase_C,superfamily_Fumarylacetoacetase_C-rel	p.Q17*	ENST00000233379.4	37	c.49	CCDS2014.1	2	.	.	.	.	.	.	.	.	.	.	C	26.8	4.771841	0.90108	.	.	ENSG00000115042	ENST00000445649;ENST00000447036;ENST00000233379;ENST00000418606	.	.	.	3.03	3.03	0.35002	.	0.810667	0.11066	N	0.603423	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	.	9.665	0.39979	0.0:1.0:0.0:0.0	.	.	.	.	X	17	.	ENSP00000233379:Q17X	Q	+	1	0	FAHD2A	95435082	0.924000	0.31332	0.993000	0.49108	0.766000	0.43426	2.471000	0.45127	1.676000	0.50930	0.561000	0.74099	CAG	FAHD2A	-	NULL	ENSG00000115042		0.572	FAHD2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAHD2A	HGNC	protein_coding	OTTHUMT00000252778.1	117	0.00	0	C	NM_016044		96071355	96071355	+1	no_errors	ENST00000233379	ensembl	human	known	69_37n	nonsense	187	12.62	27	SNP	0.962	T
FAM115C	285966	genome.wustl.edu	37	7	143417625	143417625	+	Silent	SNP	G	G	C	rs370129390		TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr7:143417625G>C	ENST00000441159.2	+	3	1539	c.1473G>C	c.(1471-1473)gcG>gcC	p.A491A	FAM115C_ENST00000444908.2_Silent_p.A491A|FAM115C_ENST00000411935.1_Silent_p.A327A|FAM115C_ENST00000411497.2_Silent_p.A210A|FAM115C_ENST00000357344.4_Silent_p.A491A|FAM115C_ENST00000409703.3_Silent_p.A327A|FAM115C_ENST00000425618.2_Silent_p.A210A			A6NFQ2	F115C_HUMAN	family with sequence similarity 115, member C	491					hematopoietic progenitor cell differentiation (GO:0002244)					endometrium(2)|large_intestine(4)|lung(2)|prostate(1)	9						ATGAGGCTGCGGTGCTCTCCC	0.617																																						dbGAP											0													1.0	1.0	1.0					7																	143417625		387	704	1091	-	-	-	SO:0001819	synonymous_variant	0			AY167570	CCDS34769.1, CCDS47735.1, CCDS47735.2	7q35	2010-08-03	2008-06-12	2008-06-12	ENSG00000170379	ENSG00000170379			26878	protein-coding gene	gene with protein product			"""family with sequence similarity 139, member A"""	FAM139A			Standard	NM_173678		Approved	FLJ40722	uc003wdf.3	A6NFQ2	OTTHUMG00000153232	ENST00000441159.2:c.1473G>C	7.37:g.143417625G>C			B4DK02|Q14D25|Q17RQ4|Q8IWQ0|Q8NF84	Missense_Mutation	SNP	NULL	p.G306R	ENST00000441159.2	37	c.916		7	.	.	.	.	.	.	.	.	.	.	N	0.013	-1.615842	0.00828	.	.	ENSG00000170379	ENST00000518791	.	.	.	3.53	-7.07	0.01563	.	.	.	.	.	T	0.25457	0.0619	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.17837	-1.0356	3	.	.	.	-0.9929	5.859	0.18736	0.1832:0.4002:0.3373:0.0792	.	.	.	.	R	306	.	.	G	+	1	0	FAM115C	143048558	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	-7.769000	0.00030	-5.507000	0.00013	-1.434000	0.01081	GGT	FAM115C	-	NULL	ENSG00000170379		0.617	FAM115C-001	KNOWN	basic|appris_principal	protein_coding	FAM115C	HGNC	protein_coding	OTTHUMT00000330287.1	32	0.00	0	G	NM_173678		143417625	143417625	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000518791	ensembl	human	putative	69_37n	missense	1	66.67	2	SNP	0.000	C
SPATA31D5P	347127	genome.wustl.edu	37	9	84534225	84534225	+	RNA	SNP	C	C	T			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr9:84534225C>T	ENST00000527857.1	+	0	4247					NR_026851.1				SPATA31 subfamily D, member 5, pseudogene																		GAATAGAAGTCGAGTTACAAG	0.428																																						dbGAP											0																																										-	-	-			0					9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000240632	ENSG00000240632			38602	pseudogene	pseudogene			"""family with sequence similarity 75, member D5"", ""family with sequence similarity 75, member D5, pseudogene"""	FAM75D5			Standard	NR_026851		Approved	FLJ43950, FAM75D5P	uc011lst.2		OTTHUMG00000020087		9.37:g.84534225C>T				RNA	SNP	-	NULL	ENST00000527857.1	37	NULL		9																																																																																			FAM75D5	-	-	ENSG00000240632		0.428	SPATA31D5P-002	KNOWN	basic	processed_transcript	FAM75D5	HGNC	pseudogene	OTTHUMT00000052810.2	32	0.00	0	C	NR_026851		84534225	84534225	+1	no_errors	ENST00000527857	ensembl	human	known	69_37n	rna	8	63.64	14	SNP	0.000	T
FAT2	2196	genome.wustl.edu	37	5	150946114	150946114	+	Silent	SNP	A	A	G			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr5:150946114A>G	ENST00000261800.5	-	1	2391	c.2379T>C	c.(2377-2379)taT>taC	p.Y793Y		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	793	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGCCCAGGTCATATACTGTTA	0.517																																						dbGAP											0													84.0	80.0	82.0					5																	150946114		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.2379T>C	5.37:g.150946114A>G			O75091|Q9NSR7	Silent	SNP	pfam_Cadherin,pfam_Laminin_G,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl,smart_Cadherin,smart_Laminin_G,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.Y793	ENST00000261800.5	37	c.2379	CCDS4317.1	5																																																																																			FAT2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000086570		0.517	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT2	HGNC	protein_coding	OTTHUMT00000252434.1	72	0.00	0	A	NM_001447		150946114	150946114	-1	no_errors	ENST00000261800	ensembl	human	known	69_37n	silent	7	86.00	43	SNP	1.000	G
FBXW7	55294	genome.wustl.edu	37	4	153249385	153249385	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr4:153249385G>A	ENST00000281708.4	-	9	2622	c.1393C>T	c.(1393-1395)Cgt>Tgt	p.R465C	FBXW7_ENST00000393956.3_Missense_Mutation_p.R289C|FBXW7_ENST00000603841.1_Missense_Mutation_p.R465C|FBXW7_ENST00000296555.5_Missense_Mutation_p.R347C|FBXW7_ENST00000263981.5_Missense_Mutation_p.R385C|FBXW7_ENST00000603548.1_Missense_Mutation_p.R465C	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	465			R -> C (in a acute lymphoblastic leukemia cell line). {ECO:0000269|PubMed:11565033}.|R -> H (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.R465C(71)|p.R226C(11)|p.R385C(11)|p.R347C(3)|p.R465Y(2)|p.?(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				TGCATACAACGCACAGTGGAA	0.413			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																	dbGAP		Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	99	Substitution - Missense(98)|Unknown(1)	haematopoietic_and_lymphoid_tissue(41)|large_intestine(27)|endometrium(20)|stomach(6)|biliary_tract(4)|pancreas(1)											260.0	223.0	235.0					4																	153249385		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1393C>T	4.37:g.153249385G>A	ENSP00000281708:p.Arg465Cys		B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_F-box_dom_cyclin-like,superfamily_WD40_repeat_dom,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_F-box_dom_cyclin-like,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R465C	ENST00000281708.4	37	c.1393	CCDS3777.1	4	.	.	.	.	.	.	.	.	.	.	G	28.3	4.909959	0.92107	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	6.05	6.05	0.98169	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.67287	0.2877	M	0.71206	2.165	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.67130	-0.5748	10	0.87932	D	0	-17.2313	20.6013	0.99457	0.0:0.0:1.0:0.0	.	289;465;347;385	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	C	465;347;385;289	ENSP00000281708:R465C;ENSP00000296555:R347C;ENSP00000263981:R385C;ENSP00000377528:R289C	ENSP00000263981:R385C	R	-	1	0	FBXW7	153468835	1.000000	0.71417	0.959000	0.39883	0.996000	0.88848	9.869000	0.99810	2.878000	0.98634	0.650000	0.86243	CGT	FBXW7	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000109670		0.413	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW7	HGNC	protein_coding	OTTHUMT00000469956.1	65	0.00	0	G			153249385	153249385	-1	no_errors	ENST00000281708	ensembl	human	known	69_37n	missense	8	84.91	45	SNP	1.000	A
FCRL1	115350	genome.wustl.edu	37	1	157771340	157771340	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr1:157771340A>C	ENST00000368176.3	-	6	981	c.914T>G	c.(913-915)cTt>cGt	p.L305R	FCRL1_ENST00000489998.1_Intron|FCRL1_ENST00000358292.3_Intron|FCRL1_ENST00000491942.1_Missense_Mutation_p.L305R	NM_001159398.1|NM_052938.4	NP_001152870.1|NP_443170.1	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1	305						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(24)|ovary(4)|prostate(1)|skin(6)	42	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			TCCTGAGGTAAGATGATTGCT	0.507																																					GBM(54;482 1003 11223 30131 35730)	dbGAP											0													76.0	77.0	77.0					1																	157771340		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC033690	CCDS1170.1, CCDS53382.1, CCDS53383.1	1q21-q22	2013-01-14			ENSG00000163534	ENSG00000163534		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18509	protein-coding gene	gene with protein product		606508				11493702, 11929751	Standard	NM_052938		Approved	FCRH1, IRTA5, IFGP1, CD307a	uc001frg.3	Q96LA6	OTTHUMG00000019398	ENST00000368176.3:c.914T>G	1.37:g.157771340A>C	ENSP00000357158:p.Leu305Arg		B2RE05|Q8N759|Q8NDI0|Q96PJ6	Missense_Mutation	SNP	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L305R	ENST00000368176.3	37	c.914	CCDS1170.1	1	.	.	.	.	.	.	.	.	.	.	A	15.88	2.964683	0.53507	.	.	ENSG00000163534	ENST00000368176;ENST00000491942	T;T	0.42900	0.96;0.97	4.96	4.96	0.65561	.	0.893950	0.09665	N	0.771895	T	0.49423	0.1556	M	0.69823	2.125	0.09310	N	1	D;D	0.89917	0.997;1.0	D;D	0.70227	0.953;0.968	T	0.36792	-0.9733	10	0.35671	T	0.21	.	11.2038	0.48758	1.0:0.0:0.0:0.0	.	305;305	Q96LA6-2;Q96LA6	.;FCRL1_HUMAN	R	305	ENSP00000357158:L305R;ENSP00000418130:L305R	ENSP00000357158:L305R	L	-	2	0	FCRL1	156037964	0.216000	0.23585	0.026000	0.17262	0.006000	0.05464	3.552000	0.53705	2.193000	0.70182	0.533000	0.62120	CTT	FCRL1	-	NULL	ENSG00000163534		0.507	FCRL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL1	HGNC	protein_coding	OTTHUMT00000051401.1	36	0.00	0	A	NM_052938		157771340	157771340	-1	no_errors	ENST00000368176	ensembl	human	known	69_37n	missense	36	26.53	13	SNP	0.055	C
FOCAD	54914	genome.wustl.edu	37	9	20944725	20944725	+	Silent	SNP	G	G	T			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr9:20944725G>T	ENST00000380249.1	+	31	3871	c.3507G>T	c.(3505-3507)ctG>ctT	p.L1169L	FOCAD_ENST00000338382.6_Silent_p.L1169L|FOCAD_ENST00000605086.1_Silent_p.L605L	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin	1169						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)											TCCGGAAGCTGTCTGCGCACG	0.527																																						dbGAP											0													110.0	96.0	101.0					9																	20944725		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.3507G>T	9.37:g.20944725G>T			D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Silent	SNP	pfam_DUF3028,pfam_DUF3730,superfamily_ARM-type_fold	p.L1169	ENST00000380249.1	37	c.3507	CCDS34993.1	9																																																																																			FOCAD	-	superfamily_ARM-type_fold	ENSG00000188352		0.527	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOCAD	HGNC	protein_coding	OTTHUMT00000143442.1	105	0.00	0	G	NM_017794		20944725	20944725	+1	no_errors	ENST00000338382	ensembl	human	known	69_37n	silent	79	17.71	17	SNP	0.979	T
FOXR2	139628	genome.wustl.edu	37	X	55650935	55650935	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chrX:55650935G>C	ENST00000339140.3	+	1	1103	c.791G>C	c.(790-792)aGa>aCa	p.R264T		NM_198451.3	NP_940853.1	Q6PJQ5	FOXR2_HUMAN	forkhead box R2	264					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|liver(1)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	19						GATAATGCAAGACCTCGCTCT	0.522																																						dbGAP											0													95.0	84.0	88.0					X																	55650935		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC012934	CCDS35308.1	Xp11	2006-12-15			ENSG00000189299	ENSG00000189299		"""Forkhead boxes"""	30469	protein-coding gene	gene with protein product						15202009, 15202027	Standard	NM_198451		Approved	MGC21658, FOXN6	uc004duo.3	Q6PJQ5	OTTHUMG00000021661	ENST00000339140.3:c.791G>C	X.37:g.55650935G>C	ENSP00000427329:p.Arg264Thr			Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.R264T	ENST00000339140.3	37	c.791	CCDS35308.1	X	.	.	.	.	.	.	.	.	.	.	G	12.83	2.055957	0.36277	.	.	ENSG00000189299	ENST00000339140	D	0.95342	-3.68	3.42	-1.0	0.10196	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	1.463730	0.04240	N	0.336811	D	0.93910	0.8051	L	0.31207	0.915	0.09310	N	1	D	0.60575	0.988	P	0.60886	0.88	D	0.85562	0.1228	10	0.46703	T	0.11	.	8.2462	0.31691	0.7104:0.0:0.2896:0.0	.	264	Q6PJQ5	FOXR2_HUMAN	T	264	ENSP00000427329:R264T	ENSP00000427329:R264T	R	+	2	0	FOXR2	55667660	0.997000	0.39634	0.000000	0.03702	0.003000	0.03518	1.022000	0.30052	-0.375000	0.07955	-0.208000	0.12717	AGA	FOXR2	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head	ENSG00000189299		0.522	FOXR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXR2	HGNC	protein_coding	OTTHUMT00000056877.2	26	0.00	0	G	NM_198451		55650935	55650935	+1	no_errors	ENST00000339140	ensembl	human	known	69_37n	missense	15	42.31	11	SNP	0.002	C
GEMIN5	25929	genome.wustl.edu	37	5	154316741	154316741	+	Silent	SNP	T	T	G			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr5:154316741T>G	ENST00000285873.7	-	2	246	c.171A>C	c.(169-171)atA>atC	p.I57I		NM_001252156.1|NM_015465.4	NP_001239085.1|NP_056280.2	Q8TEQ6	GEMI5_HUMAN	gem (nuclear organelle) associated protein 5	57					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|protein complex assembly (GO:0006461)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)	poly(A) RNA binding (GO:0044822)|snRNA binding (GO:0017069)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CCAACTCTCCTATGACTTTAA	0.493																																						dbGAP											0													157.0	152.0	154.0					5																	154316741		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK022748	CCDS4330.1	5q34	2013-01-10			ENSG00000082516	ENSG00000082516		"""WD repeat domain containing"""	20043	protein-coding gene	gene with protein product		607005				11714716	Standard	NM_015465		Approved		uc003lvx.3	Q8TEQ6	OTTHUMG00000130189	ENST00000285873.7:c.171A>C	5.37:g.154316741T>G			Q14CV0|Q8WWV4|Q969W4|Q9H9K3|Q9UFI5	Silent	SNP	pfam_WD40_repeat,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.I57	ENST00000285873.7	37	c.171	CCDS4330.1	5																																																																																			GEMIN5	-	pfam_WD40_repeat,smart_WD40_repeat	ENSG00000082516		0.493	GEMIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GEMIN5	HGNC	protein_coding	OTTHUMT00000252507.1	84	0.00	0	T			154316741	154316741	-1	no_errors	ENST00000285873	ensembl	human	known	69_37n	silent	32	37.25	19	SNP	1.000	G
GRIK4	2900	genome.wustl.edu	37	11	120852906	120852906	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr11:120852906G>A	ENST00000527524.2	+	20	2774	c.2487G>A	c.(2485-2487)tgG>tgA	p.W829*	GRIK4_ENST00000438375.2_Nonsense_Mutation_p.W829*	NM_001282470.1	NP_001269399.1	Q16099	GRIK4_HUMAN	glutamate receptor, ionotropic, kainate 4	829					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|response to corticosteroid (GO:0031960)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|nucleus (GO:0005634)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(20)|liver(1)|lung(29)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	69		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)		AGTTTTTATGGACTCTCAGAC	0.428																																						dbGAP											0													210.0	210.0	210.0					11																	120852906		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0			S67803	CCDS8433.1	11q23.3	2012-08-29			ENSG00000149403	ENSG00000149403		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4582	protein-coding gene	gene with protein product		600282		GRIK			Standard	NM_001282470		Approved	GluK4, KA1	uc009zax.1	Q16099	OTTHUMG00000048255	ENST00000527524.2:c.2487G>A	11.37:g.120852906G>A	ENSP00000435648:p.Trp829*		A8K9L1	Nonsense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.W829*	ENST00000527524.2	37	c.2487	CCDS8433.1	11	.	.	.	.	.	.	.	.	.	.	G	42	9.789930	0.99264	.	.	ENSG00000149403	ENST00000527524;ENST00000438375	.	.	.	5.74	4.82	0.62117	.	0.055710	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	.	15.7342	0.77831	0.0:0.0:0.8621:0.1379	.	.	.	.	X	829	.	ENSP00000404063:W829X	W	+	3	0	GRIK4	120358116	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.444000	0.97578	1.396000	0.46663	0.655000	0.94253	TGG	GRIK4	-	prints_NMDA_rcpt	ENSG00000149403		0.428	GRIK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK4	HGNC	protein_coding	OTTHUMT00000109760.4	74	0.00	0	G	NM_014619		120852906	120852906	+1	no_errors	ENST00000527524	ensembl	human	known	69_37n	nonsense	68	19.05	16	SNP	1.000	A
HERC2	8924	genome.wustl.edu	37	15	28436380	28436380	+	Missense_Mutation	SNP	C	C	G	rs541212527		TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr15:28436380C>G	ENST00000261609.7	-	54	8570	c.8462G>C	c.(8461-8463)cGt>cCt	p.R2821P		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		AATCTCCAAACGAATCCAGTG	0.368																																						dbGAP											0													72.0	73.0	73.0					15																	28436380		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.8462G>C	15.37:g.28436380C>G	ENSP00000261609:p.Arg2821Pro			Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_CPH_domain,pfam_Mib_Herc2,pfam_Cyt_B5,pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_HECT,superfamily_Galactose-bd-like,superfamily_Cyt_B5,superfamily_UBA-like,superfamily_CUB,smart_Beta-propeller_rpt_TECPR,smart_Znf_ZZ,smart_HECT,pfscan_HECT,pfscan_Znf_ZZ,pfscan_Reg_chr_condens,pfscan_Cyt_B5,prints_Reg_chr_condens	p.R2821P	ENST00000261609.7	37	c.8462	CCDS10021.1	15	.	.	.	.	.	.	.	.	.	.	C	28.5	4.929082	0.92389	.	.	ENSG00000128731	ENST00000261609	T	0.64438	-0.1	5.34	5.34	0.76211	Anaphase-promoting complex, subunit 10/DOC domain (2);Galactose-binding domain-like (1);	0.118669	0.56097	D	0.000022	T	0.81851	0.4910	M	0.83774	2.66	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.87578	0.972;0.998	D	0.84195	0.0447	10	0.87932	D	0	.	19.395	0.94603	0.0:1.0:0.0:0.0	.	288;2821	A8KAQ8;O95714	.;HERC2_HUMAN	P	2821	ENSP00000261609:R2821P	ENSP00000261609:R2821P	R	-	2	0	HERC2	26109975	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.776000	0.85560	2.653000	0.90120	0.643000	0.83706	CGT	HERC2	-	pfam_APC_su10/DOC_dom,superfamily_Galactose-bd-like	ENSG00000128731		0.368	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC2	HGNC	protein_coding	OTTHUMT00000251358.2	28	0.00	0	C	NM_004667		28436380	28436380	-1	no_errors	ENST00000261609	ensembl	human	known	69_37n	missense	13	18.75	3	SNP	1.000	G
HLX	3142	genome.wustl.edu	37	1	221054585	221054585	+	Silent	SNP	A	A	C	rs377616408		TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr1:221054585A>C	ENST00000366903.6	+	2	2143	c.642A>C	c.(640-642)tcA>tcC	p.S214S	HLX_ENST00000549319.1_5'UTR|HLA-AS1_ENST00000552026.1_RNA	NM_021958.3	NP_068777.1	Q14774	HLX_HUMAN	H2.0-like homeobox	214					cell differentiation (GO:0030154)|embryonic digestive tract morphogenesis (GO:0048557)|enteric nervous system development (GO:0048484)|liver development (GO:0001889)|multicellular organismal development (GO:0007275)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|positive regulation of cell proliferation (GO:0008284)|positive regulation of organ growth (GO:0046622)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(9)|lung(11)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(131;0.00914)		TGCACCTCTCAGGCCTGCAGC	0.572																																						dbGAP											0													111.0	119.0	116.0					1																	221054585		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC033808	CCDS1527.1	1q41	2011-06-20	2007-07-26	2007-07-26	ENSG00000136630	ENSG00000136630		"""Homeoboxes / ANTP class : NKL subclass"""	4978	protein-coding gene	gene with protein product		142995	"""H2.0 (Drosophila)-like homeo box 1"", ""H2.0-like homeobox 1 (Drosophila)"", ""H2.0-like homeobox 1"""	HLX1		1676597, 7806220	Standard	NM_021958		Approved	HB24	uc001hmv.4	Q14774	OTTHUMG00000037352	ENST00000366903.6:c.642A>C	1.37:g.221054585A>C			B2R8A8|Q15988|Q59HE7|Q9NZ75	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_HTH_motif,prints_Homeobox_metazoa	p.S214	ENST00000366903.6	37	c.642	CCDS1527.1	1																																																																																			HLX	-	NULL	ENSG00000136630		0.572	HLX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLX	HGNC	protein_coding	OTTHUMT00000090902.3	67	0.00	0	A	NM_021958		221054585	221054585	+1	no_errors	ENST00000366903	ensembl	human	known	69_37n	silent	56	16.18	11	SNP	0.003	C
IGF2R	3482	genome.wustl.edu	37	6	160484554	160484554	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr6:160484554C>T	ENST00000356956.1	+	27	3926	c.3778C>T	c.(3778-3780)Cgg>Tgg	p.R1260W		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	1260					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)	p.R1260W(1)		breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	TTATTACTTCCGGGTCTGTGG	0.542																																						dbGAP											1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											108.0	102.0	104.0					6																	160484554		2203	4300	6503	-	-	-	SO:0001583	missense	0			J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.3778C>T	6.37:g.160484554C>T	ENSP00000349437:p.Arg1260Trp		Q7Z7G9|Q96PT5	Missense_Mutation	SNP	pfam_CIMR,pfam_FN_type2_col-bd,superfamily_Man6P_isomerase_rcpt-bd_dom,superfamily_Kringle-like,smart_FN_type2_col-bd,pfscan_FN_type2_col-bd	p.R1260W	ENST00000356956.1	37	c.3778	CCDS5273.1	6	.	.	.	.	.	.	.	.	.	.	C	16.95	3.264407	0.59431	.	.	ENSG00000197081	ENST00000356956	T	0.03951	3.75	5.2	5.2	0.72013	Mannose-6-phosphate receptor, binding (1);	0.200877	0.44285	D	0.000468	T	0.15696	0.0378	M	0.85710	2.77	0.47584	D	0.999463	D	0.89917	1.0	D	0.81914	0.995	T	0.00143	-1.1995	10	0.72032	D	0.01	-36.9891	12.1569	0.54083	0.2823:0.7177:0.0:0.0	.	1260	P11717	MPRI_HUMAN	W	1260	ENSP00000349437:R1260W	ENSP00000349437:R1260W	R	+	1	2	IGF2R	160404544	1.000000	0.71417	1.000000	0.80357	0.505000	0.33919	2.128000	0.42045	2.584000	0.87258	0.563000	0.77884	CGG	IGF2R	-	pfam_CIMR,superfamily_Man6P_isomerase_rcpt-bd_dom	ENSG00000197081		0.542	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGF2R	HGNC	protein_coding	OTTHUMT00000042931.1	36	0.00	0	C	NM_000876		160484554	160484554	+1	no_errors	ENST00000356956	ensembl	human	known	69_37n	missense	43	12.24	6	SNP	0.997	T
INF2	64423	genome.wustl.edu	37	14	105173281	105173281	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr14:105173281C>T	ENST00000392634.4	+	7	990	c.878C>T	c.(877-879)tCg>tTg	p.S293L	INF2_ENST00000330634.7_Missense_Mutation_p.S293L	NM_022489.3	NP_071934.3	Q27J81	INF2_HUMAN	inverted formin, FH2 and WH2 domain containing	293	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin cytoskeleton organization (GO:0030036)|cell death (GO:0008219)|regulation of cellular component size (GO:0032535)|regulation of mitochondrial fission (GO:0090140)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00188)|OV - Ovarian serous cystadenocarcinoma(23;0.0191)|Epithelial(46;0.047)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.176)		CAGCTCCTGTCGGTGCTGCAG	0.711																																						dbGAP											0													16.0	21.0	19.0					14																	105173281		2043	4167	6210	-	-	-	SO:0001583	missense	0			AK025709	CCDS9989.2, CCDS45173.1	14q32.33	2009-09-07	2007-11-29	2007-11-29	ENSG00000203485	ENSG00000203485			23791	protein-coding gene	gene with protein product	"""inverted formin 2"""	610982	"""chromosome 14 open reading frame 151"", ""chromosome 14 open reading frame 173"""	C14orf151, C14orf173		16818491	Standard	NM_001031714		Approved	MGC13251	uc001ypb.2	Q27J81	OTTHUMG00000029811	ENST00000392634.4:c.878C>T	14.37:g.105173281C>T	ENSP00000376410:p.Ser293Leu		Q27J83|Q69YL8|Q6P1X7|Q6PK22|Q86TR7|Q9BRM1|Q9H6N1	Missense_Mutation	SNP	pfam_FH2_actin-bd,pfam_Drf_FH3,pfam_Drf_GTPase-bd,pfam_WH2_dom,superfamily_FH2_actin-bd,superfamily_ARM-type_fold,smart_Actin-bd_FH2/DRF_autoreg,pfscan_WH2_dom	p.S293L	ENST00000392634.4	37	c.878	CCDS9989.2	14	.	.	.	.	.	.	.	.	.	.	C	28.5	4.927557	0.92389	.	.	ENSG00000203485	ENST00000330634;ENST00000392634	D;D	0.88124	-2.34;-2.34	4.79	4.79	0.61399	GTPase-binding/formin homology 3 (1);Diaphanous FH3 (1);Armadillo-type fold (1);	.	.	.	.	D	0.93795	0.8016	M	0.86028	2.79	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.67382	0.919;0.951	D	0.94946	0.8095	9	0.87932	D	0	.	17.8172	0.88638	0.0:1.0:0.0:0.0	.	293;293	Q27J81-2;Q27J81	.;INF2_HUMAN	L	293	ENSP00000376406:S293L;ENSP00000376410:S293L	ENSP00000376406:S293L	S	+	2	0	INF2	104244326	1.000000	0.71417	0.905000	0.35620	0.675000	0.39556	7.237000	0.78164	2.193000	0.70182	0.650000	0.86243	TCG	INF2	-	pfam_Drf_FH3,superfamily_ARM-type_fold	ENSG00000203485		0.711	INF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INF2	HGNC	protein_coding	OTTHUMT00000074371.4	19	0.00	0	C	NM_022489		105173281	105173281	+1	no_errors	ENST00000392634	ensembl	human	known	69_37n	missense	7	46.15	6	SNP	1.000	T
IGHA2	3494	genome.wustl.edu	37	14	106053516	106053516	+	RNA	SNP	C	C	T			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr14:106053516C>T	ENST00000390539.2	-	0	780				AL928742.1_ENST00000581377.1_RNA			P01877	IGHA2_HUMAN	immunoglobulin heavy constant alpha 2 (A2m marker)						antibacterial humoral response (GO:0019731)|glomerular filtration (GO:0003094)|immune response (GO:0006955)|positive regulation of respiratory burst (GO:0060267)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|monomeric IgA immunoglobulin complex (GO:0071748)|secretory dimeric IgA immunoglobulin complex (GO:0071752)|secretory IgA immunoglobulin complex (GO:0071751)	antigen binding (GO:0003823)										AGGTACTTCTCGCGGGGCAGC	0.647																																						dbGAP											0													22.0	13.0	16.0					14																	106053516		2076	4115	6191	-	-	-			0			J00221		14q32.33	2012-10-02			ENSG00000211890	ENSG00000211890		"""Immunoglobulins / IGH locus"""	5479	other	immunoglobulin gene		147000					Standard	NG_001019		Approved			P01877	OTTHUMG00000152472		14.37:g.106053516C>T				Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like	p.E261K	ENST00000390539.2	37	c.781		14																																																																																			IGHA2	-	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like	ENSG00000211890		0.647	IGHA2-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	IG_C_gene	IGHA2	HGNC	IG_C_gene	OTTHUMT00000326338.1	53	0.00	0	C	NG_001019		106053516	106053516	-1	no_start_codon	ENST00000390539	ensembl	human	known	69_37n	missense	14	51.72	15	SNP	0.000	T
ITGB2	3689	genome.wustl.edu	37	21	46311893	46311893	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr21:46311893C>T	ENST00000397850.2	-	12	1695	c.1243G>A	c.(1243-1245)Gtc>Atc	p.V415I	ITGB2_ENST00000397857.1_Missense_Mutation_p.V415I|ITGB2_ENST00000397852.1_Missense_Mutation_p.V415I|ITGB2_ENST00000302347.5_Missense_Mutation_p.V415I|ITGB2_ENST00000397854.3_Missense_Mutation_p.V358I|ITGB2_ENST00000355153.4_Missense_Mutation_p.V415I			P05107	ITB2_HUMAN	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	415					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|neutrophil chemotaxis (GO:0030593)|receptor clustering (GO:0043113)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|glycoprotein binding (GO:0001948)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(4)|skin(3)	35				Colorectal(79;0.0669)	Simvastatin(DB00641)	GTGGCCGTGACCTTCACCTGG	0.647																																						dbGAP											0													74.0	55.0	62.0					21																	46311893		2200	4300	6500	-	-	-	SO:0001583	missense	0			AK222505	CCDS13716.1	21q22.3	2014-09-17	2006-03-02		ENSG00000160255	ENSG00000160255		"""CD molecules"", ""Complement system"", ""Integrins"""	6155	protein-coding gene	gene with protein product		600065	"""integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit)"""	CD18, MFI7			Standard	NM_000211		Approved	LFA-1, MAC-1	uc002zgf.3	P05107	OTTHUMG00000090257	ENST00000397850.2:c.1243G>A	21.37:g.46311893C>T	ENSP00000380948:p.Val415Ile		B3KTS8|D3DSM1|Q16418|Q53HS5|Q9UD72	Missense_Mutation	SNP	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,pfam_Integrin_bsu_tail,pfam_Integrin_bsu_cyt,pfam_EGF_extracell,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like,smart_Integrin_bsu_N,prints_Integrin_bsu	p.V415I	ENST00000397850.2	37	c.1243	CCDS13716.1	21	.	.	.	.	.	.	.	.	.	.	C	13.25	2.180385	0.38511	.	.	ENSG00000160255	ENST00000397852;ENST00000397857;ENST00000397854;ENST00000355153;ENST00000397850;ENST00000302347;ENST00000545414	D;D;D;D;D;D	0.93488	-3.23;-3.23;-3.23;-3.23;-3.23;-3.23	5.54	5.54	0.83059	Integrin beta subunit, N-terminal (2);	.	.	.	.	D	0.89483	0.6728	L	0.31207	0.915	0.58432	D	0.99999	B;B	0.29766	0.256;0.057	B;B	0.35353	0.116;0.201	D	0.85990	0.1488	9	0.13470	T	0.59	.	16.9813	0.86328	0.0:1.0:0.0:0.0	.	358;415	A8MYE6;P05107	.;ITB2_HUMAN	I	415;415;358;415;415;415;358	ENSP00000380950:V415I;ENSP00000380955:V415I;ENSP00000380952:V358I;ENSP00000347279:V415I;ENSP00000380948:V415I;ENSP00000303242:V415I	ENSP00000303242:V415I	V	-	1	0	ITGB2	45136321	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	1.544000	0.36158	2.615000	0.88500	0.655000	0.94253	GTC	ITGB2	-	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,smart_Integrin_bsu_N	ENSG00000160255		0.647	ITGB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB2	HGNC	protein_coding	OTTHUMT00000206566.2	37	0.00	0	C	NM_000211		46311893	46311893	-1	no_errors	ENST00000302347	ensembl	human	known	69_37n	missense	26	29.73	11	SNP	1.000	T
KANK1	23189	genome.wustl.edu	37	9	711061	711061	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr9:711061G>A	ENST00000382303.1	+	7	947	c.295G>A	c.(295-297)Gac>Aac	p.D99N	KANK1_ENST00000382297.2_Missense_Mutation_p.D99N|KANK1_ENST00000382293.3_5'UTR|KANK1_ENST00000489369.1_3'UTR	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	99					negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		CAACAGTGATGACAACAAGCA	0.532																																						dbGAP											0													152.0	116.0	128.0					9																	711061		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.295G>A	9.37:g.711061G>A	ENSP00000371740:p.Asp99Asn		A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_KN_motif,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.D99N	ENST00000382303.1	37	c.295	CCDS34976.1	9	.	.	.	.	.	.	.	.	.	.	G	19.92	3.917016	0.73098	.	.	ENSG00000107104	ENST00000382303;ENST00000354485;ENST00000382297	T;T	0.58506	0.33;0.33	6.06	5.16	0.70880	.	0.121556	0.37393	N	0.002114	T	0.70334	0.3212	M	0.66939	2.045	0.80722	D	1	D;D	0.62365	0.991;0.969	P;P	0.58928	0.848;0.621	T	0.72312	-0.4331	10	0.48119	T	0.1	.	15.1122	0.72368	0.0672:0.0:0.9328:0.0	.	99;99	Q5W0W1;Q14678	.;KANK1_HUMAN	N	99	ENSP00000371740:D99N;ENSP00000371734:D99N	ENSP00000346479:D99N	D	+	1	0	KANK1	701061	1.000000	0.71417	0.901000	0.35422	0.924000	0.55760	5.389000	0.66255	1.579000	0.49836	0.655000	0.94253	GAC	KANK1	-	NULL	ENSG00000107104		0.532	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KANK1	HGNC	protein_coding	OTTHUMT00000051484.2	33	0.00	0	G	NM_015158		711061	711061	+1	no_errors	ENST00000382297	ensembl	human	known	69_37n	missense	29	25.64	10	SNP	1.000	A
KBTBD13	390594	genome.wustl.edu	37	15	65370332	65370332	+	Silent	SNP	C	C	T			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr15:65370332C>T	ENST00000432196.2	+	1	1179	c.1179C>T	c.(1177-1179)ctC>ctT	p.L393L	RASL12_ENST00000434605.2_5'Flank	NM_001101362.2	NP_001094832.1	C9JR72	KBTBD_HUMAN	kelch repeat and BTB (POZ) domain containing 13	393					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				lung(1)|prostate(1)|skin(1)	3						AGGGAGCGCTCTTCACGGCCG	0.657																																						dbGAP											0													18.0	19.0	19.0					15																	65370332		2038	4110	6148	-	-	-	SO:0001819	synonymous_variant	0				CCDS45281.1	15q22.31	2014-09-17			ENSG00000234438	ENSG00000234438		"""BTB/POZ domain containing"""	37227	protein-coding gene	gene with protein product	"""nemaline myopathy type 6"""	613727				21109227, 22542517	Standard	NM_001101362		Approved	hCG_1645727, NEM6	uc010uis.2	C9JR72		ENST00000432196.2:c.1179C>T	15.37:g.65370332C>T				Silent	SNP	pfam_Kelch_1,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_Kelch_1,pfscan_BTB/POZ-like	p.L393	ENST00000432196.2	37	c.1179	CCDS45281.1	15																																																																																			KBTBD13	-	NULL	ENSG00000234438		0.657	KBTBD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KBTBD13	HGNC	protein_coding	OTTHUMT00000418468.2	30	0.00	0	C	NM_001101362		65370332	65370332	+1	no_errors	ENST00000432196	ensembl	human	known	69_37n	silent	24	31.43	11	SNP	0.918	T
KLHL36	79786	genome.wustl.edu	37	16	84690686	84690686	+	Silent	SNP	C	C	T			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr16:84690686C>T	ENST00000564996.1	+	3	414	c.273C>T	c.(271-273)ggC>ggT	p.G91G	KLHL36_ENST00000258157.5_Silent_p.G91G	NM_024731.2	NP_079007.2	Q8N4N3	KLH36_HUMAN	kelch-like family member 36	91	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				protein ubiquitination (GO:0016567)					endometrium(3)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13						AGCTGATCGGCGCCTCCTACA	0.612																																						dbGAP											0													88.0	76.0	80.0					16																	84690686		2199	4300	6499	-	-	-	SO:0001819	synonymous_variant	0			AK022605	CCDS10948.1	16q24.1	2013-02-22	2013-02-22	2008-07-07	ENSG00000135686	ENSG00000135686		"""Kelch-like"", ""BTB/POZ domain containing"""	17844	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 44"", ""kelch-like 36 (Drosophila)"""	C16orf44			Standard	NM_024731		Approved	FLJ12543	uc002fig.3	Q8N4N3	OTTHUMG00000137642	ENST00000564996.1:c.273C>T	16.37:g.84690686C>T			Q8N5G6|Q9H9U6	Silent	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.G91	ENST00000564996.1	37	c.273	CCDS10948.1	16																																																																																			KLHL36	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	ENSG00000135686		0.612	KLHL36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL36	HGNC	protein_coding	OTTHUMT00000269084.2	52	0.00	0	C			84690686	84690686	+1	no_errors	ENST00000564996	ensembl	human	known	69_37n	silent	32	30.43	14	SNP	0.995	T
KLHL7	55975	genome.wustl.edu	37	7	23145615	23145615	+	5'UTR	SNP	G	G	A			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr7:23145615G>A	ENST00000339077.5	+	0	213				KLHL7-AS1_ENST00000419813.1_lincRNA|KLHL7_ENST00000322231.7_5'UTR|KLHL7_ENST00000322275.5_5'UTR|KLHL7_ENST00000545771.1_5'Flank|KLHL7_ENST00000479288.1_3'UTR|KLHL7_ENST00000539124.1_5'UTR|KLHL7_ENST00000409689.1_5'Flank|KLHL7_ENST00000542558.1_5'UTR|KLHL7_ENST00000410047.1_5'Flank	NM_001031710.2	NP_001026880.2	Q8IXQ5	KLHL7_HUMAN	kelch-like family member 7						protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						CCGGCCCGGCGAGCCCCGGGC	0.642																																						dbGAP											0													18.0	19.0	19.0					7																	23145615		2194	4292	6486	-	-	-	SO:0001623	5_prime_UTR_variant	0				CCDS5378.1, CCDS34609.1, CCDS5378.2, CCDS55095.1	7p15.3	2013-01-30	2013-01-30		ENSG00000122550	ENSG00000122550		"""Kelch-like"", ""BTB/POZ domain containing"""	15646	protein-coding gene	gene with protein product	"""retinitis pigmentosa 42"""	611119	"""kelch-like 7 (Drosophila)"""			19520207	Standard	NM_001031710		Approved	KLHL6, SBBI26, RP42	uc003svs.4	Q8IXQ5	OTTHUMG00000094813	ENST00000339077.5:c.-31G>A	7.37:g.23145615G>A			A4D144|B7Z5I9|G5E9G3|Q7Z765|Q96MV2|Q9BQF8|Q9UDQ9	RNA	SNP	-	NULL	ENST00000339077.5	37	NULL	CCDS34609.1	7																																																																																			KLHL7	-	-	ENSG00000122550		0.642	KLHL7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL7	HGNC	protein_coding	OTTHUMT00000326860.3	35	0.00	0	G	NM_018846		23145615	23145615	+1	no_errors	ENST00000459661	ensembl	human	known	69_37n	rna	40	13.04	6	SNP	0.094	A
LARP1	23367	genome.wustl.edu	37	5	154169917	154169917	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr5:154169917G>A	ENST00000336314.4	+	2	262	c.238G>A	c.(238-240)Gct>Act	p.A80T		NM_015315.3	NP_056130.2	Q6PKG0	LARP1_HUMAN	La ribonucleoprotein domain family, member 1	157					cell proliferation (GO:0008283)|positive regulation of macroautophagy (GO:0016239)|positive regulation of translation (GO:0045727)|TOR signaling (GO:0031929)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation activator activity (GO:0008494)|translation initiation factor binding (GO:0031369)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GGTGAGGGCAGCTGTTCCTAA	0.522																																						dbGAP											0													93.0	86.0	88.0					5																	154169917		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018274	CCDS4328.1	5q33.2	2014-02-12			ENSG00000155506	ENSG00000155506		"""La ribonucleoprotein domain containing"""	29531	protein-coding gene	gene with protein product		612059				9872452, 10878606	Standard	NM_015315		Approved	LARP, KIAA0731, MGC19556	uc003lvo.4	Q6PKG0	OTTHUMG00000130191	ENST00000336314.4:c.238G>A	5.37:g.154169917G>A	ENSP00000336721:p.Ala80Thr		O94836|Q8N4M2|Q8NB73|Q9UFD7	Missense_Mutation	SNP	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,smart_DM15,pfscan_Lupus_La_RNA-bd	p.A80T	ENST00000336314.4	37	c.238	CCDS4328.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.4|24.4	4.526573|4.526573	0.85706|0.85706	.|.	.|.	ENSG00000155506|ENSG00000155506	ENST00000336314;ENST00000518297|ENST00000517616	T;T|.	0.40476|.	1.88;1.03|.	5.95|5.95	5.95|5.95	0.96441|0.96441	.|.	0.056016|.	0.64402|.	D|.	0.000002|.	T|T	0.57519|0.57519	0.2059|0.2059	N|N	0.24115|0.24115	0.695|0.695	0.49483|0.49483	D|D	0.999798|0.999798	P;P|.	0.48162|.	0.89;0.906|.	B;P|.	0.51701|.	0.393;0.677|.	T|T	0.49273|0.49273	-0.8957|-0.8957	10|5	0.46703|.	T|.	0.11|.	-11.5936|-11.5936	20.3931|20.3931	0.98965|0.98965	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	157;80|.	Q6PKG0;Q6PKG0-3|.	LARP1_HUMAN;.|.	T|N	80;157|81	ENSP00000336721:A80T;ENSP00000428589:A157T|.	ENSP00000336721:A80T|.	A|S	+|+	1|2	0|0	LARP1|LARP1	154150110|154150110	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.988000|0.988000	0.76386|0.76386	8.413000|8.413000	0.90235|0.90235	2.824000|2.824000	0.97209|0.97209	0.655000|0.655000	0.94253|0.94253	GCT|AGC	LARP1	-	NULL	ENSG00000155506		0.522	LARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP1	HGNC	protein_coding	OTTHUMT00000252509.1	89	0.00	0	G	NM_033551		154169917	154169917	+1	no_errors	ENST00000336314	ensembl	human	known	69_37n	missense	34	34.62	18	SNP	1.000	A
LIG3	3980	genome.wustl.edu	37	17	33310218	33310218	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr17:33310218G>A	ENST00000378526.4	+	2	327	c.194G>A	c.(193-195)aGa>aAa	p.R65K	LIG3_ENST00000262327.5_Missense_Mutation_p.R65K|LIG3_ENST00000586407.1_Intron	NM_013975.3	NP_039269.2	P49916	DNLI3_HUMAN	ligase III, DNA, ATP-dependent	65					base-excision repair (GO:0006284)|base-excision repair, DNA ligation (GO:0006288)|DNA biosynthetic process (GO:0071897)|DNA repair (GO:0006281)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitochondrial DNA repair (GO:0043504)|negative regulation of DNA recombination (GO:0045910)|nucleotide-excision repair (GO:0006289)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(8)|lung(9)|ovary(3)|pancreas(2)|prostate(1)|skin(3)|stomach(1)	31		Ovarian(249;0.17)			Bleomycin(DB00290)	AGCCATCTAAGATCACGTGCC	0.512								Other BER factors																														dbGAP											0													137.0	135.0	136.0					17																	33310218		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11284.2, CCDS11285.2	17q11.2-q12	2008-10-29			ENSG00000005156	ENSG00000005156			6600	protein-coding gene	gene with protein product		600940	"""ligase II, DNA, ATP-dependent"""	LIG2		7760816	Standard	NM_002311		Approved		uc002hik.2	P49916	OTTHUMG00000128519	ENST00000378526.4:c.194G>A	17.37:g.33310218G>A	ENSP00000367787:p.Arg65Lys		Q16714|Q6NVK3	Missense_Mutation	SNP	pfam_DNA_ligase_ATP-dep_cent,pfam_DNA_ligase_ATP-dep_N,pfam_Znf_PARP,pfam_DNA_ligase_ATP-dep_C,superfamily_NA-bd_OB-fold-like,superfamily_BRCT_dom,superfamily_DNA_ligase_ATP-dep_N,smart_BRCT_dom,pfscan_BRCT_dom,pfscan_Znf_PARP,pfscan_DNA_ligase_ATP-dep_cent,tigrfam_DNA_ligase_ATP-dep	p.R65K	ENST00000378526.4	37	c.194	CCDS11284.2	17	.	.	.	.	.	.	.	.	.	.	G	10.21	1.287702	0.23478	.	.	ENSG00000005156	ENST00000378526;ENST00000262327	T;T	0.61627	0.23;0.09	4.69	3.72	0.42706	.	0.214644	0.31709	N	0.007182	T	0.38719	0.1051	N	0.19112	0.55	0.25158	N	0.990374	B;B;B;B	0.06786	0.0;0.0;0.0;0.001	B;B;B;B	0.04013	0.001;0.001;0.0;0.001	T	0.21793	-1.0235	10	0.36615	T	0.2	-9.2724	8.655	0.34058	0.1036:0.0:0.8964:0.0	.	65;65;65;65	E5KLB5;P49916;E5KLB6;Q96DF0	.;DNLI3_HUMAN;.;.	K	65	ENSP00000367787:R65K;ENSP00000262327:R65K	ENSP00000262327:R65K	R	+	2	0	LIG3	30334331	0.428000	0.25522	0.989000	0.46669	0.581000	0.36288	1.614000	0.36911	1.202000	0.43218	0.655000	0.94253	AGA	LIG3	-	NULL	ENSG00000005156		0.512	LIG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIG3	HGNC	protein_coding	OTTHUMT00000250330.3	41	0.00	0	G	NM_013975		33310218	33310218	+1	no_errors	ENST00000378526	ensembl	human	known	69_37n	missense	32	15.79	6	SNP	0.995	A
LPHN1	22859	genome.wustl.edu	37	19	14263405	14263405	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr19:14263405C>G	ENST00000340736.6	-	21	3756	c.3459G>C	c.(3457-3459)tgG>tgC	p.W1153C	CTB-55O6.12_ENST00000592086.1_RNA|CTB-55O6.12_ENST00000588658.1_RNA|LPHN1_ENST00000361434.3_Missense_Mutation_p.W1148C|CTB-55O6.12_ENST00000588387.1_RNA	NM_001008701.2	NP_001008701.1	O94910	LPHN1_HUMAN	latrophilin 1	1153					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|heterophilic cell-cell adhesion (GO:0007157)|neuropeptide signaling pathway (GO:0007218)|positive regulation of synapse maturation (GO:0090129)	axon (GO:0030424)|cell junction (GO:0030054)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CAGTGTCATTCCACATCCTCC	0.562																																						dbGAP											0													97.0	84.0	88.0					19																	14263405		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020628	CCDS12307.1, CCDS32928.1	19p13.2	2014-08-08				ENSG00000072071		"""-"", ""GPCR / Class B : Orphans"""	20973	protein-coding gene	gene with protein product						10994649	Standard	NM_014921		Approved	KIAA0821, CIRL1, LEC2	uc010xnn.2	O94910		ENST00000340736.6:c.3459G>C	19.37:g.14263405C>G	ENSP00000340688:p.Trp1153Cys		Q96IE7|Q9BU07|Q9HAR3	Missense_Mutation	SNP	pfam_GPCR_2_latrophilin_rcpt_C,pfam_Olfac-like,pfam_DUF3497,pfam_GPCR_2_secretin-like,pfam_Lectin_gal-bd_dom,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,smart_Olfac-like,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_Lectin_gal-bd_dom,pfscan_Olfac-like,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_latrophilin,prints_GPCR_2_secretin-like	p.W1153C	ENST00000340736.6	37	c.3459	CCDS32928.1	19	.	.	.	.	.	.	.	.	.	.	C	22.6	4.314242	0.81358	.	.	ENSG00000072071	ENST00000340736;ENST00000361434	T;T	0.74002	-0.8;-0.8	5.47	5.47	0.80525	GPCR, family 2, latrophilin, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.84705	0.5531	M	0.64170	1.965	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85977	0.1480	10	0.87932	D	0	.	16.8128	0.85725	0.0:1.0:0.0:0.0	.	1148;1153	O94910-2;O94910	.;LPHN1_HUMAN	C	1153;1148	ENSP00000340688:W1153C;ENSP00000355328:W1148C	ENSP00000340688:W1153C	W	-	3	0	LPHN1	14124405	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.794000	0.85869	2.571000	0.86741	0.561000	0.74099	TGG	LPHN1	-	pfam_GPCR_2_latrophilin_rcpt_C	ENSG00000072071		0.562	LPHN1-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	LPHN1	HGNC	protein_coding	OTTHUMT00000459696.1	69	0.00	0	C	NM_014921		14263405	14263405	-1	no_errors	ENST00000340736	ensembl	human	known	69_37n	missense	86	13.13	13	SNP	1.000	G
LRRC49	54839	genome.wustl.edu	37	15	71302313	71302313	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr15:71302313G>C	ENST00000260382.5	+	13	1835	c.1575G>C	c.(1573-1575)caG>caC	p.Q525H	LRRC49_ENST00000560691.1_Missense_Mutation_p.Q231H|LRRC49_ENST00000436542.2_3'UTR|LRRC49_ENST00000560369.1_Missense_Mutation_p.Q530H|LRRC49_ENST00000443425.2_Missense_Mutation_p.Q481H|LRRC49_ENST00000544974.2_Missense_Mutation_p.Q515H|LRRC49_ENST00000560158.2_Missense_Mutation_p.Q213H	NM_001199017.1|NM_017691.3	NP_001185946.1|NP_060161.2	Q8IUZ0	LRC49_HUMAN	leucine rich repeat containing 49	525						cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(3)|skin(3)	34						TCAGTATGCAGAAAATAAATG	0.303																																						dbGAP											0													64.0	65.0	65.0					15																	71302313		2199	4297	6496	-	-	-	SO:0001583	missense	0				CCDS32282.1, CCDS55971.1, CCDS58376.1, CCDS61694.1	15q23	2005-08-09				ENSG00000137821			25965	protein-coding gene	gene with protein product						12477932	Standard	NM_001199017		Approved	FLJ20156	uc010ukf.2	Q8IUZ0		ENST00000260382.5:c.1575G>C	15.37:g.71302313G>C	ENSP00000260382:p.Gln525His		B3KVX1|B7Z366|F5H1J4|G5E9T5|H0YLN4|Q9NXM6	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.Q525H	ENST00000260382.5	37	c.1575	CCDS32282.1	15	.	.	.	.	.	.	.	.	.	.	G	16.99	3.274537	0.59649	.	.	ENSG00000137821	ENST00000544974;ENST00000260382;ENST00000443425;ENST00000436542	T;T;T	0.36340	1.26;1.26;1.27	5.72	4.8	0.61643	.	0.000000	0.85682	D	0.000000	T	0.50837	0.1639	L	0.60455	1.87	0.45914	D	0.998755	D;D;D;D;D	0.76494	0.998;0.999;0.999;0.998;0.998	D;D;D;P;D	0.67725	0.948;0.953;0.953;0.898;0.929	T	0.49986	-0.8880	10	0.62326	D	0.03	-14.8332	9.2072	0.37296	0.1643:0.0:0.8357:0.0	.	530;497;481;525;515	B7Z366;G5E9Q1;G5E9T5;Q8IUZ0;F5H1J4	.;.;.;LRC49_HUMAN;.	H	515;525;481;497	ENSP00000439600:Q515H;ENSP00000260382:Q525H;ENSP00000414065:Q481H	ENSP00000260382:Q525H	Q	+	3	2	LRRC49	69089367	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.396000	0.44468	2.690000	0.91761	0.591000	0.81541	CAG	LRRC49	-	NULL	ENSG00000137821		0.303	LRRC49-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	LRRC49	HGNC	protein_coding	OTTHUMT00000417209.3	47	0.00	0	G	NM_017691		71302313	71302313	+1	no_errors	ENST00000260382	ensembl	human	known	69_37n	missense	27	15.62	5	SNP	1.000	C
LSR	51599	genome.wustl.edu	37	19	35749961	35749961	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr19:35749961G>A	ENST00000361790.3	+	3	871	c.712G>A	c.(712-714)Gtc>Atc	p.V238I	LSR_ENST00000597933.1_3'UTR|LSR_ENST00000427250.1_Intron|LSR_ENST00000602122.1_Missense_Mutation_p.V238I|LSR_ENST00000347609.4_Missense_Mutation_p.V201I|LSR_ENST00000360798.3_Missense_Mutation_p.V238I|LSR_ENST00000354900.3_Missense_Mutation_p.V238I	NM_205834.3	NP_991403.1	Q86X29	LSR_HUMAN	lipolysis stimulated lipoprotein receptor	238					embryo development (GO:0009790)|liver development (GO:0001889)	chylomicron (GO:0042627)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|low-density lipoprotein particle (GO:0034362)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	13	all_lung(56;3.91e-09)|Lung NSC(56;5.64e-09)|Esophageal squamous(110;0.162)		Epithelial(14;1.33e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.29e-18)|all cancers(14;7.11e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			AGAGCTCATCGTCCTTGGTGA	0.622																																						dbGAP											0													97.0	72.0	80.0					19																	35749961		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF130366	CCDS12449.1, CCDS12450.1, CCDS12451.1, CCDS59376.1	19q13.12	2013-01-11			ENSG00000105699	ENSG00000105699		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29572	protein-coding gene	gene with protein product	"""lipolysis-stimulated remnant"", ""immunoglobulin-like domain containing receptor 3"""					10224102	Standard	NM_015925		Approved	LISCH7, ILDR3	uc002nyl.3	Q86X29		ENST00000361790.3:c.712G>A	19.37:g.35749961G>A	ENSP00000354575:p.Val238Ile		A6NDW3|B4DKL4|E9PHD4|O00112|O00426|Q6ZT80|Q8NBM0|Q9BT33|Q9UQL3	Missense_Mutation	SNP	pfam_LISCH7,smart_Ig_sub,pfscan_Ig-like	p.V238I	ENST00000361790.3	37	c.712	CCDS12450.1	19	.	.	.	.	.	.	.	.	.	.	G	31	5.074032	0.94000	.	.	ENSG00000105699	ENST00000361790;ENST00000354900;ENST00000360798;ENST00000347609	T;T;T;T	0.77620	-1.04;-0.16;-0.88;-1.11	4.99	4.99	0.66335	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	D	0.84781	0.5548	L	0.49778	1.585	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.81914	0.995;0.981;0.96;0.958;0.937	D	0.86083	0.1545	10	0.87932	D	0	-36.7626	15.8213	0.78648	0.0:0.0:1.0:0.0	.	201;238;238;238;238	Q86X29-2;Q86X29-3;A6NDW3;E9PHD4;Q86X29	.;.;.;.;LSR_HUMAN	I	238;238;238;201	ENSP00000354575:V238I;ENSP00000346976:V238I;ENSP00000354034:V238I;ENSP00000262627:V201I	ENSP00000262627:V201I	V	+	1	0	LSR	40441801	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.832000	0.92079	2.606000	0.88127	0.561000	0.74099	GTC	LSR	-	smart_Ig_sub	ENSG00000105699		0.622	LSR-003	KNOWN	basic|appris_principal|CCDS	protein_coding	LSR	HGNC	protein_coding	OTTHUMT00000465513.2	32	0.00	0	G	NM_015925		35749961	35749961	+1	no_errors	ENST00000361790	ensembl	human	known	69_37n	missense	14	75.44	43	SNP	1.000	A
MAST1	22983	genome.wustl.edu	37	19	12962763	12962763	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr19:12962763G>C	ENST00000251472.4	+	8	829	c.790G>C	c.(790-792)Gag>Cag	p.E264Q	MAST1_ENST00000591495.1_Missense_Mutation_p.E260Q	NM_014975.2	NP_055790.1			microtubule associated serine/threonine kinase 1											NS(1)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(20)|ovary(5)|prostate(5)|skin(3)	56						TGAACGCTCTGAGAGCTTGGA	0.602																																						dbGAP											0													80.0	67.0	72.0					19																	12962763		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023190	CCDS32921.1	19p13.2	2008-02-05				ENSG00000105613			19034	protein-coding gene	gene with protein product		612256					Standard	NM_014975		Approved	SAST, KIAA0973	uc002mvm.3	Q9Y2H9		ENST00000251472.4:c.790G>C	19.37:g.12962763G>C	ENSP00000251472:p.Glu264Gln			Missense_Mutation	SNP	pfam_MA_Ser/Thr_Kinase_dom,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,superfamily_Kinase-like_dom,superfamily_MAST_pre-PK_dom,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PDZ,pfscan_PDZ,pfscan_Prot_kinase_cat_dom	p.E264Q	ENST00000251472.4	37	c.790	CCDS32921.1	19	.	.	.	.	.	.	.	.	.	.	G	27.1	4.804230	0.90623	.	.	ENSG00000105613	ENST00000251472;ENST00000542153	T	0.35789	1.29	5.06	5.06	0.68205	Microtubule-associated serine/threonine-protein kinase, domain (1);Microtubule-associated serine/threonine-protein kinase, pre-PK domain (2);	0.000000	0.85682	D	0.000000	T	0.58609	0.2134	M	0.89214	3.015	0.51767	D	0.999935	P;B	0.42620	0.785;0.029	P;B	0.50231	0.635;0.041	T	0.66448	-0.5921	10	0.62326	D	0.03	-16.7124	16.2983	0.82786	0.0:0.0:1.0:0.0	.	264;264	Q9Y2H9;F5H2S9	MAST1_HUMAN;.	Q	264	ENSP00000251472:E264Q	ENSP00000251472:E264Q	E	+	1	0	MAST1	12823763	1.000000	0.71417	0.998000	0.56505	0.952000	0.60782	7.788000	0.85771	2.529000	0.85273	0.305000	0.20034	GAG	MAST1	-	pfam_MA_Ser/Thr_Kinase_dom,superfamily_MAST_pre-PK_dom	ENSG00000105613		0.602	MAST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAST1	HGNC	protein_coding	OTTHUMT00000451733.2	27	0.00	0	G	NM_014975		12962763	12962763	+1	no_errors	ENST00000251472	ensembl	human	known	69_37n	missense	35	16.67	7	SNP	1.000	C
MAP4K1	11184	genome.wustl.edu	37	19	39098647	39098647	+	Silent	SNP	G	G	C			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr19:39098647G>C	ENST00000591517.1	-	15	1120	c.1092C>G	c.(1090-1092)ctC>ctG	p.L364L	MAP4K1_ENST00000396857.2_Silent_p.L364L|MAP4K1_ENST00000589002.1_5'UTR|MAP4K1_ENST00000589130.1_Silent_p.L360L|MAP4K1_ENST00000586296.1_Intron|MAP4K1_ENST00000423454.2_Silent_p.L26L	NM_007181.4	NP_009112.1	Q92918	M4K1_HUMAN	mitogen-activated protein kinase kinase kinase kinase 1	364					activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|cell proliferation (GO:0008283)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to stress (GO:0006950)	membrane (GO:0016020)	ATP binding (GO:0005524)|MAP kinase kinase kinase kinase activity (GO:0008349)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(24)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	44	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TGCTGCTCCTGAGGTCTCGAG	0.652																																						dbGAP											0													25.0	29.0	28.0					19																	39098647		2000	4152	6152	-	-	-	SO:0001819	synonymous_variant	0			U66464	CCDS42564.1, CCDS59385.1	19q13.1-q13.4	2011-06-09				ENSG00000104814	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6863	protein-coding gene	gene with protein product	"""hematopoietic progenitor kinase 1"""	601983				8824585	Standard	NM_001042600		Approved	HPK1	uc002oix.1	Q92918		ENST00000591517.1:c.1092C>G	19.37:g.39098647G>C				Nonsense_Mutation	SNP	pfam_Citron,smart_Citron	p.S42*	ENST00000591517.1	37	c.125	CCDS59385.1	19																																																																																			MAP4K1	-	NULL	ENSG00000104814		0.652	MAP4K1-002	KNOWN	basic|CCDS	protein_coding	MAP4K1	HGNC	protein_coding	OTTHUMT00000453390.1	74	0.00	0	G	NM_001042600		39098647	39098647	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000591921	ensembl	human	novel	69_37n	nonsense	99	13.91	16	SNP	0.033	C
MED15	51586	genome.wustl.edu	37	22	20907442	20907442	+	Silent	SNP	A	A	G			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr22:20907442A>G	ENST00000263205.7	+	4	288	c.219A>G	c.(217-219)aaA>aaG	p.K73K	MED15_ENST00000425759.2_Silent_p.K33K|MED15_ENST00000292733.7_Silent_p.K73K|MED15_ENST00000406969.1_Silent_p.K47K|MED15_ENST00000541476.1_Silent_p.K47K|MED15_ENST00000382974.2_Silent_p.K73K|MED15_ENST00000542773.1_Intron	NM_001003891.1	NP_001003891.1	Q96RN5	MED15_HUMAN	mediator complex subunit 15	73	Interaction with SREBF1.				gene expression (GO:0010467)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	25	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			ATAACAAGAAATCTCAAGCTT	0.363																																						dbGAP											0													202.0	180.0	187.0					22																	20907442		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF056191	CCDS13781.1, CCDS33602.1, CCDS74824.1	22q11.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000099917	ENSG00000099917			14248	protein-coding gene	gene with protein product		607372	"""trinucleotide repeat containing 7"", ""PC2 (positive cofactor 2, multiprotein complex) glutamine/Q-rich-associated protein"""	TNRC7, PCQAP		11024300, 11414760, 15175163	Standard	XM_005261632		Approved	TIG-1, CAG7A, Arc105	uc002zsp.3	Q96RN5	OTTHUMG00000150810	ENST00000263205.7:c.219A>G	22.37:g.20907442A>G			D3DX31|D3DX32|O15413|Q6IC31|Q8NF16|Q96CT0|Q96IH7|Q9P1T3	Missense_Mutation	SNP	pfam_Mediator_Med15_met	p.I41V	ENST00000263205.7	37	c.121	CCDS33602.1	22	.	.	.	.	.	.	.	.	.	.	A	9.801	1.180618	0.21787	.	.	ENSG00000099917	ENST00000423862	.	.	.	4.94	2.83	0.33086	.	.	.	.	.	T	0.55242	0.1908	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48603	-0.9021	4	.	.	.	.	7.0633	0.25137	0.8099:0.0:0.1901:0.0	.	.	.	.	V	41	.	.	I	+	1	0	MED15	19237442	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.021000	0.30040	0.761000	0.33130	0.379000	0.24179	ATC	MED15	-	pfam_Mediator_Med15_met	ENSG00000099917		0.363	MED15-004	KNOWN	basic|CCDS	protein_coding	MED15	HGNC	protein_coding	OTTHUMT00000320177.2	66	0.00	0	A	NM_015889		20907442	20907442	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000423862	ensembl	human	novel	69_37n	missense	37	15.91	7	SNP	1.000	G
MEIS1	4211	genome.wustl.edu	37	2	66798489	66798489	+	3'UTR	SNP	G	G	A	rs548020669		TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr2:66798489G>A	ENST00000272369.9	+	0	1779				MEIS1_ENST00000488550.1_3'UTR|AC007392.3_ENST00000433396.1_lincRNA|MEIS1_ENST00000444274.2_3'UTR|MEIS1_ENST00000398506.2_Missense_Mutation_p.R407H|MEIS1_ENST00000495021.2_3'UTR|MEIS1_ENST00000407092.2_Missense_Mutation_p.R409H	NM_002398.2	NP_002389.1	O00470	MEIS1_HUMAN	Meis homeobox 1						angiogenesis (GO:0001525)|definitive hemopoiesis (GO:0060216)|lens morphogenesis in camera-type eye (GO:0002089)|megakaryocyte development (GO:0035855)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron differentiation (GO:0045665)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(10)|prostate(2)|skin(1)|urinary_tract(1)	24						GCTCAGCTGCGTCATGGGCCC	0.592													G|||	1	0.000199681	0.0	0.0	5008	,	,		15473	0.001		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS46309.1	2p14	2011-06-20	2007-02-15		ENSG00000143995	ENSG00000143995		"""Homeoboxes / TALE class"""	7000	protein-coding gene	gene with protein product		601739	"""Meis1 (mouse) homolog"", ""Meis1, myeloid ecotropic viral integration site 1 homolog (mouse)"""			7565694	Standard	NM_002398		Approved		uc002sdu.3	O00470	OTTHUMG00000150714	ENST00000272369.9:c.*149G>A	2.37:g.66798489G>A			A8MV50	Missense_Mutation	SNP	pfam_Homeodomain,pfam_Homeobox_KN_domain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.R409H	ENST00000272369.9	37	c.1226	CCDS46309.1	2	.	.	.	.	.	.	.	.	.	.	G	16.09	3.024914	0.54683	.	.	ENSG00000143995	ENST00000407092;ENST00000398506	D;D	0.84800	-1.88;-1.9	4.96	4.96	0.65561	.	0.390690	0.08080	U	1.000000	D	0.93439	0.7907	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.90084	0.4172	9	0.87932	D	0	.	18.5674	0.91121	0.0:0.0:1.0:0.0	.	407	O00470-2	.	H	409;407	ENSP00000384461:R409H;ENSP00000381518:R407H	ENSP00000381518:R407H	R	+	2	0	MEIS1	66651993	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.966000	0.87956	2.451000	0.82905	0.563000	0.77884	CGT	MEIS1	-	NULL	ENSG00000143995		0.592	MEIS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEIS1	HGNC	protein_coding	OTTHUMT00000319725.4	42	0.00	0	G	NM_002398		66798489	66798489	+1	no_errors	ENST00000407092	ensembl	human	known	69_37n	missense	45	19.64	11	SNP	1.000	A
CYP27B1	1594	genome.wustl.edu	37	12	58162854	58162854	+	5'Flank	SNP	G	G	A			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr12:58162854G>A	ENST00000228606.4	-	0	0				METTL1_ENST00000324871.7_Silent_p.F252F|METTL1_ENST00000548681.1_5'Flank|METTL1_ENST00000257848.7_3'UTR|CYP27B1_ENST00000546496.1_5'Flank|METTL21B_ENST00000548256.1_5'Flank	NM_000785.3	NP_000776.1	O15528	CP27B_HUMAN	cytochrome P450, family 27, subfamily B, polypeptide 1						bone mineralization (GO:0030282)|calcitriol biosynthetic process from calciol (GO:0036378)|calcium ion homeostasis (GO:0055074)|calcium ion transport (GO:0006816)|decidualization (GO:0046697)|G1 to G0 transition (GO:0070314)|negative regulation of calcidiol 1-monooxygenase activity (GO:0010956)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of vitamin D 24-hydroxylase activity (GO:0010980)|positive regulation of vitamin D receptor signaling pathway (GO:0070564)|regulation of bone mineralization (GO:0030500)|response to estrogen (GO:0043627)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|response to vitamin D (GO:0033280)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D catabolic process (GO:0042369)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	calcidiol 1-monooxygenase activity (GO:0004498)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|urinary_tract(1)	15	all_cancers(7;8.09e-80)|Lung NSC(6;2.26e-27)|all_lung(6;1.99e-25)|all_epithelial(6;3.62e-18)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;1.97e-113)|all cancers(5;1.54e-78)|BRCA - Breast invasive adenocarcinoma(9;0.0294)		Alfacalcidol(DB01436)|Calcidiol(DB00146)|Corticotropin(DB01285)|Ergocalciferol(DB00153)	AGATGGCTGGGAAATTCTTCC	0.537																																						dbGAP											0													91.0	86.0	88.0					12																	58162854		2203	4300	6503	-	-	-	SO:0001631	upstream_gene_variant	0			AB006987	CCDS8954.1	12q14.1	2013-11-13	2003-01-14		ENSG00000111012	ENSG00000111012		"""Cytochrome P450s"""	2606	protein-coding gene	gene with protein product	"""VDDR I"", ""1alpha(OH)ase"", ""25-Hydroxyvitamin D3 1alpha-hydroxylase"""	609506	"""cytochrome P450, subfamily XXVIIB (25-hydroxyvitamin D-1-alpha-hydroxylase), polypeptide 1"""	VDD1, PDDR		9295274, 9344864	Standard	NM_000785		Approved	CYP1, P450c1	uc001spz.1	O15528	OTTHUMG00000170457		12.37:g.58162854G>A	Exception_encountered		B2RC61|Q548T3	Missense_Mutation	SNP	pfam_tRNA_(Gua-N-7)_MeTrfase	p.P117S	ENST00000228606.4	37	c.349	CCDS8954.1	12	.	.	.	.	.	.	.	.	.	.	G	8.742	0.919097	0.17982	.	.	ENSG00000037897	ENST00000548504	.	.	.	5.99	5.09	0.68999	.	.	.	.	.	T	0.57330	0.2046	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54370	-0.8304	4	.	.	.	-5.9984	6.9852	0.24725	0.2215:0.0:0.7785:0.0	.	.	.	.	S	117	.	.	P	-	1	0	METTL1	56449121	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.290000	0.33319	2.843000	0.97960	0.655000	0.94253	CCC	METTL1	-	pfam_tRNA_(Gua-N-7)_MeTrfase	ENSG00000037897		0.537	CYP27B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL1	HGNC	protein_coding	OTTHUMT00000409248.1	54	0.00	0	G	NM_000785		58162854	58162854	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000548504	ensembl	human	novel	69_37n	missense	31	18.42	7	SNP	1.000	A
RP11-24M17.4	0	genome.wustl.edu	37	15	76054333	76054333	+	RNA	SNP	A	A	G	rs2290484	byFrequency	TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr15:76054333A>G	ENST00000569596.1	+	0	62				MIR4313_ENST00000580760.1_lincRNA																							GCAGGGCCCCACCTGGCCATA	0.607													.|||	1195	0.238618	0.1369	0.3473	5008	,	,		19393	0.2867		0.2634	False		,,,				2504	0.2239					dbGAP											0																																										-	-	-			0																															15.37:g.76054333A>G				RNA	SNP	-	NULL	ENST00000569596.1	37	NULL		15																																																																																			MIR4313	-	-	ENSG00000261043		0.607	RP11-24M17.4-002	KNOWN	basic	lincRNA	MIR4313	HGNC	processed_transcript	OTTHUMT00000420499.1	10	0.00	0	A			76054333	76054333	-1	no_errors	ENST00000561777	ensembl	human	known	69_37n	rna	1	83.33	5	SNP	0.012	G
MLC1	23209	genome.wustl.edu	37	22	50500033	50500033	+	Silent	SNP	G	G	A			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr22:50500033G>A	ENST00000311597.5	-	12	1719	c.1113C>T	c.(1111-1113)gtC>gtT	p.V371V	MLC1_ENST00000538737.1_Silent_p.V337V|MLC1_ENST00000450140.2_Silent_p.V319V|MLC1_ENST00000395876.2_Silent_p.V371V|MLC1_ENST00000483836.1_5'UTR|MLC1_ENST00000535444.1_Silent_p.V292V|MLC1_ENST00000431262.2_Silent_p.V341V	NM_015166.3	NP_055981.1	Q15049	MLC1_HUMAN	megalencephalic leukoencephalopathy with subcortical cysts 1	371					caveolin-mediated endocytosis (GO:0072584)|cellular response to cholesterol (GO:0071397)|ion transport (GO:0006811)|positive regulation of intracellular transport (GO:0032388)|protein oligomerization (GO:0051259)|regulation of response to osmotic stress (GO:0047484)|transport (GO:0006810)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	protein complex binding (GO:0032403)|protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|pancreas(1)|prostate(3)	18		all_cancers(38;7.69e-11)|all_epithelial(38;9.52e-10)|all_lung(38;3.67e-05)|Breast(42;0.000776)|Lung NSC(38;0.000946)|Ovarian(80;0.0365)|Lung SC(80;0.113)		READ - Rectum adenocarcinoma(2;0.000669)|Colorectal(2;0.00242)|LUAD - Lung adenocarcinoma(64;0.0695)|BRCA - Breast invasive adenocarcinoma(115;0.216)		TTTGCACCACGACGGCTCTCC	0.632																																						dbGAP											0													67.0	62.0	64.0					22																	50500033		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D25217	CCDS14083.1	22q13.33	2007-03-20			ENSG00000100427	ENSG00000100427			17082	protein-coding gene	gene with protein product		605908				7584026, 7584028	Standard	XR_430476		Approved	MLC, KIAA0027, LVM, VL	uc003bjg.1	Q15049	OTTHUMG00000150236	ENST00000311597.5:c.1113C>T	22.37:g.50500033G>A			B3KW61|B7Z659|Q5JZ83|Q8TAG4|Q96RP5|Q9UGY8	Silent	SNP	NULL	p.V371	ENST00000311597.5	37	c.1113	CCDS14083.1	22																																																																																			MLC1	-	NULL	ENSG00000100427		0.632	MLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLC1	HGNC	protein_coding	OTTHUMT00000316979.2	55	0.00	0	G	NM_015166		50500033	50500033	-1	no_errors	ENST00000311597	ensembl	human	known	69_37n	silent	9	77.50	31	SNP	0.008	A
KMT2A	4297	genome.wustl.edu	37	11	118343199	118343199	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr11:118343199G>A	ENST00000389506.5	+	3	1325	c.1325G>A	c.(1324-1326)cGa>cAa	p.R442Q	KMT2A_ENST00000534358.1_Missense_Mutation_p.R442Q|KMT2A_ENST00000354520.4_Missense_Mutation_p.R442Q			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	442					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										AAAATTGCCCGATTAGAGTCT	0.463																																						dbGAP											0													119.0	130.0	126.0					11																	118343199		2200	4296	6496	-	-	-	SO:0001583	missense	0			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.1325G>A	11.37:g.118343199G>A	ENSP00000374157:p.Arg442Gln		E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_Bromodomain,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pirsf_MeTrfase_trithorax,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC,pfscan_Bromodomain	p.R442Q	ENST00000389506.5	37	c.1325	CCDS31686.1	11	.	.	.	.	.	.	.	.	.	.	G	16.98	3.272202	0.59649	.	.	ENSG00000118058	ENST00000534358;ENST00000531904;ENST00000389506;ENST00000354520;ENST00000328469	D;T;D;D	0.85861	-2.03;3.44;-2.04;-2.01	4.92	4.92	0.64577	.	0.000000	0.64402	D	0.000002	D	0.88426	0.6433	L	0.29908	0.895	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79108	0.992;0.992;0.988	D	0.89124	0.3505	10	0.56958	D	0.05	.	18.6691	0.91504	0.0:0.0:1.0:0.0	.	442;442;475	E9PQG7;Q03164;E9PR05	.;MLL1_HUMAN;.	Q	442;475;442;442;475	ENSP00000436786:R442Q;ENSP00000432391:R475Q;ENSP00000374157:R442Q;ENSP00000346516:R442Q	ENSP00000333556:R475Q	R	+	2	0	MLL	117848409	1.000000	0.71417	0.969000	0.41365	0.995000	0.86356	9.086000	0.94088	2.719000	0.93026	0.585000	0.79938	CGA	MLL	-	pirsf_MeTrfase_trithorax	ENSG00000118058		0.463	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL	HGNC	protein_coding	OTTHUMT00000399085.2	19	0.00	0	G	NM_005933		118343199	118343199	+1	no_errors	ENST00000389506	ensembl	human	known	69_37n	missense	13	31.58	6	SNP	1.000	A
MN1	4330	genome.wustl.edu	37	22	28194924	28194925	+	In_Frame_Ins	INS	-	-	TGT			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr22:28194924_28194925insTGT	ENST00000302326.4	-	1	2561_2562	c.1607_1608insACA	c.(1606-1608)cag>caACAg	p.536_536Q>QQ		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	536	Poly-Gln.				intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						gctgctgctgctgctgctgttg	0.653			T	ETV6	"""AML, meningioma"""																																	dbGAP		Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	0																																										-	-	-	SO:0001652	inframe_insertion	0			X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1607_1608insACA	22.37:g.28194924_28194925insTGT	ENSP00000304956:p.Gln550dup		A9Z1V9	In_Frame_Ins	INS	NULL	p.540in_frame_insQ	ENST00000302326.4	37	c.1608_1607	CCDS42998.1	22																																																																																			MN1	-	NULL	ENSG00000169184		0.653	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MN1	HGNC	protein_coding	OTTHUMT00000320737.1	50	0.00	0	-	NM_002430		28194924	28194925	-1	no_errors	ENST00000302326	ensembl	human	known	69_37n	in_frame_ins	30	18.92	7	INS	0.997:0.998	TGT
MOV10L1	54456	genome.wustl.edu	37	22	50591516	50591516	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr22:50591516C>A	ENST00000262794.5	+	22	3018	c.2935C>A	c.(2935-2937)Ctg>Atg	p.L979M	MOV10L1_ENST00000354853.2_Missense_Mutation_p.L22M|MOV10L1_ENST00000540615.1_Missense_Mutation_p.L959M|MOV10L1_ENST00000395843.1_Missense_Mutation_p.L22M|MOV10L1_ENST00000395852.1_Missense_Mutation_p.L106M|MOV10L1_ENST00000545383.1_Missense_Mutation_p.L979M|MOV10L1_ENST00000395858.3_Missense_Mutation_p.L979M	NM_018995.2	NP_061868.1	Q9BXT6	M10L1_HUMAN	Mov10 RISC complex RNA helicase like 1	979					ATP catabolic process (GO:0006200)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|magnesium ion binding (GO:0000287)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|prostate(1)|skin(9)|stomach(4)|urinary_tract(3)	67		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		CGAGGCCCTGCTGATGCTGCC	0.592																																						dbGAP											0													151.0	146.0	148.0					22																	50591516		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF285604	CCDS14084.1, CCDS54541.1, CCDS54542.1, CCDS54543.1	22q13.33	2014-07-02	2014-07-02		ENSG00000073146	ENSG00000073146			7201	protein-coding gene	gene with protein product	"""cardiac helicase activated by MEF2C protein"""	605794	"""Mov10 (mouse)-like 1"", ""Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)"""			11279525	Standard	NM_018995		Approved	DJ402G11.8, DKFZp434B0717, CHAMP	uc003bjj.3	Q9BXT6	OTTHUMG00000044648	ENST00000262794.5:c.2935C>A	22.37:g.50591516C>A	ENSP00000262794:p.Leu979Met		A7E211|A8MXC6|B7WPP1|B7Z7R1|F5H403|Q5TGD5|Q8NBD4|Q9NXW3|Q9UFB3|Q9UGX9	Missense_Mutation	SNP	superfamily_NA-bd_OB-fold-like	p.L979M	ENST00000262794.5	37	c.2935	CCDS14084.1	22	.	.	.	.	.	.	.	.	.	.	.	13.55	2.271839	0.40194	.	.	ENSG00000073146	ENST00000545383;ENST00000262794;ENST00000395858;ENST00000395843;ENST00000540615;ENST00000395852;ENST00000354853	D;D;D;D;D;D;D	0.84223	-1.82;-1.82;-1.82;-1.82;-1.82;-1.82;-1.82	4.97	3.94	0.45596	.	0.129158	0.53938	D	0.000060	D	0.87152	0.6106	L	0.31371	0.925	0.44395	D	0.997304	D;D;D;D;D	0.89917	1.0;0.988;0.985;0.997;0.987	D;D;P;D;P	0.76575	0.988;0.945;0.854;0.937;0.896	D	0.87975	0.2739	10	0.72032	D	0.01	-17.8336	13.1459	0.59461	0.0:0.9219:0.0:0.0781	.	959;22;106;979;979	F5H403;Q9BXT6-3;Q9BXT6-2;A8MXC6;Q9BXT6	.;.;.;.;M10L1_HUMAN	M	979;979;979;22;959;106;22	ENSP00000438978:L979M;ENSP00000262794:L979M;ENSP00000379199:L979M;ENSP00000379184:L22M;ENSP00000438542:L959M;ENSP00000379193:L106M;ENSP00000346917:L22M	ENSP00000262794:L979M	L	+	1	2	MOV10L1	48933643	1.000000	0.71417	0.930000	0.37139	0.028000	0.11728	2.147000	0.42226	1.070000	0.40811	0.462000	0.41574	CTG	MOV10L1	-	NULL	ENSG00000073146		0.592	MOV10L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MOV10L1	HGNC	protein_coding	OTTHUMT00000075009.2	94	0.00	0	C	NM_018995		50591516	50591516	+1	no_errors	ENST00000262794	ensembl	human	known	69_37n	missense	53	29.33	22	SNP	1.000	A
MPHOSPH10	10199	genome.wustl.edu	37	2	71371571	71371571	+	Missense_Mutation	SNP	A	A	C	rs577215721	byFrequency	TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr2:71371571A>C	ENST00000244230.2	+	8	1812	c.1460A>C	c.(1459-1461)gAa>gCa	p.E487A		NM_005791.2	NP_005782.1	O00566	MPP10_HUMAN	M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)	487					negative regulation of phosphatase activity (GO:0010923)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|rRNA processing (GO:0006364)	chromosome (GO:0005694)|nucleolus (GO:0005730)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|pancreas(2)|skin(2)|stomach(1)	26						AAAACAGCAGAAGAAGAAAAT	0.353																																						dbGAP											0													102.0	96.0	98.0					2																	71371571		2203	4300	6503	-	-	-	SO:0001583	missense	0			X98494	CCDS1916.1	2p13.3	2014-06-12			ENSG00000124383	ENSG00000124383			7213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 106"""	605503				8885239, 9450966	Standard	NM_005791		Approved	MPP10, MPP10P, CT90, PPP1R106	uc002sht.2	O00566	OTTHUMG00000129715	ENST00000244230.2:c.1460A>C	2.37:g.71371571A>C	ENSP00000244230:p.Glu487Ala		A0AVJ8	Missense_Mutation	SNP	pfam_Mpp10,pirsf_snoRNP_Mpp10	p.E487A	ENST00000244230.2	37	c.1460	CCDS1916.1	2	.	.	.	.	.	.	.	.	.	.	A	22.8	4.342115	0.81911	.	.	ENSG00000124383	ENST00000244230;ENST00000425650	T;T	0.22539	1.95;1.95	5.69	5.69	0.88448	.	0.046347	0.85682	D	0.000000	T	0.37625	0.1010	L	0.50847	1.595	0.58432	D	0.999999	D	0.55605	0.972	P	0.62740	0.906	T	0.02901	-1.1096	10	0.38643	T	0.18	.	14.2168	0.65797	1.0:0.0:0.0:0.0	.	487	O00566	MPP10_HUMAN	A	487;347	ENSP00000244230:E487A;ENSP00000393034:E347A	ENSP00000244230:E487A	E	+	2	0	MPHOSPH10	71225079	1.000000	0.71417	0.937000	0.37676	0.923000	0.55619	6.484000	0.73621	2.311000	0.77944	0.533000	0.62120	GAA	MPHOSPH10	-	pfam_Mpp10,pirsf_snoRNP_Mpp10	ENSG00000124383		0.353	MPHOSPH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPHOSPH10	HGNC	protein_coding	OTTHUMT00000251924.2	52	0.00	0	A	NM_005791		71371571	71371571	+1	no_errors	ENST00000244230	ensembl	human	known	69_37n	missense	48	26.15	17	SNP	1.000	C
MYBBP1A	10514	genome.wustl.edu	37	17	4452659	4452659	+	Silent	SNP	C	C	T			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr17:4452659C>T	ENST00000254718.4	-	10	1704	c.1398G>A	c.(1396-1398)gaG>gaA	p.E466E	MYBBP1A_ENST00000381556.2_Silent_p.E466E			Q9BQG0	MBB1A_HUMAN	MYB binding protein (P160) 1a	466	Interaction with MYB. {ECO:0000250}.				cellular response to glucose starvation (GO:0042149)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleocytoplasmic transport (GO:0006913)|osteoblast differentiation (GO:0001649)|positive regulation of cell cycle arrest (GO:0071158)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|NLS-dependent protein nuclear import complex (GO:0042564)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA-directed DNA polymerase activity (GO:0003887)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)	24						CCTCCTCCATCTCCAGGTGCA	0.607																																						dbGAP											0													100.0	66.0	77.0					17																	4452659		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF147709	CCDS11046.1, CCDS42238.1	17p13.3	2008-07-18			ENSG00000132382	ENSG00000132382			7546	protein-coding gene	gene with protein product	"""p53-activated protein-2"""	604885				10644447	Standard	NM_014520		Approved	P160, PAP2, FLJ37886	uc002fxz.4	Q9BQG0	OTTHUMG00000090747	ENST00000254718.4:c.1398G>A	17.37:g.4452659C>T			Q86VM3|Q9BW49|Q9P0V5|Q9UF99	Missense_Mutation	SNP	pfam_DNA_pol_V,superfamily_ARM-type_fold	p.D386N	ENST00000254718.4	37	c.1156	CCDS11046.1	17																																																																																			MYBBP1A	-	pfam_DNA_pol_V,superfamily_ARM-type_fold	ENSG00000132382		0.607	MYBBP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYBBP1A	HGNC	protein_coding	OTTHUMT00000207488.2	32	0.00	0	C	NM_014520		4452659	4452659	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000573116	ensembl	human	known	69_37n	missense	27	12.90	4	SNP	1.000	T
NDRG2	57447	genome.wustl.edu	37	14	21486165	21486165	+	Silent	SNP	G	G	A			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr14:21486165G>A	ENST00000556147.1	-	15	1870	c.930C>T	c.(928-930)ttC>ttT	p.F310F	NDRG2_ENST00000397847.2_Silent_p.F299F|NDRG2_ENST00000554143.1_Silent_p.F296F|NDRG2_ENST00000397858.1_Silent_p.F310F|NDRG2_ENST00000298684.5_Silent_p.F267F|NDRG2_ENST00000397855.3_Silent_p.F267F|NDRG2_ENST00000397851.2_Silent_p.F310F|NDRG2_ENST00000403829.3_Silent_p.F306F|NDRG2_ENST00000554277.1_5'Flank|NDRG2_ENST00000555158.1_Silent_p.F296F|NDRG2_ENST00000553503.1_Silent_p.F296F|NDRG2_ENST00000397856.3_Silent_p.F280F|NDRG2_ENST00000298687.5_Silent_p.F310F|NDRG2_ENST00000554104.1_Silent_p.F223F|NDRG2_ENST00000360463.3_Silent_p.F296F|NDRG2_ENST00000350792.3_Silent_p.F296F|NDRG2_ENST00000397853.3_Silent_p.F310F|NDRG2_ENST00000397844.2_Silent_p.F280F			Q9UN36	NDRG2_HUMAN	NDRG family member 2	310					cell differentiation (GO:0030154)|negative regulation of cytokine production (GO:0001818)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of smooth muscle cell proliferation (GO:0048662)|regulation of platelet-derived growth factor production (GO:0090361)|regulation of vascular endothelial growth factor production (GO:0010574)|substantia nigra development (GO:0021762)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)				breast(2)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	23	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;6.85e-11)|Epithelial(56;9.49e-09)|all cancers(55;3.84e-08)	GBM - Glioblastoma multiforme(265;0.0191)		TGCCTTGCAGGAAGTACTTGA	0.562																																						dbGAP											0													212.0	200.0	204.0					14																	21486165		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB033074	CCDS9564.1, CCDS9565.1, CCDS61384.1, CCDS61386.1, CCDS73613.1	14q11.2	2008-07-09			ENSG00000165795	ENSG00000165795			14460	protein-coding gene	gene with protein product		605272				10831399	Standard	NM_201535		Approved	KIAA1248, SYLD	uc001vyx.3	Q9UN36	OTTHUMG00000029619	ENST00000556147.1:c.930C>T	14.37:g.21486165G>A			B3KUE3|B4DE86|B7WP11|B7WPD5|D3DS07|D3DS10|Q567T1|Q68DW2|Q86U08|Q86U46|Q96FD3|Q96FT0|Q96JU0|Q96PN0|Q9BQH5|Q9ULH2	Missense_Mutation	SNP	pfam_Ndr	p.S226F	ENST00000556147.1	37	c.677	CCDS9565.1	14	.	.	.	.	.	.	.	.	.	.	G	9.816	1.184592	0.21870	.	.	ENSG00000165795	ENST00000553593	.	.	.	5.56	0.546	0.17196	.	.	.	.	.	T	0.55721	0.1938	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47674	-0.9099	4	.	.	.	-7.6329	8.9974	0.36061	0.4746:0.0:0.5254:0.0	.	.	.	.	F	226	.	.	S	-	2	0	NDRG2	20556005	1.000000	0.71417	0.998000	0.56505	0.967000	0.64934	1.448000	0.35112	0.056000	0.16144	-0.140000	0.14226	TCC	NDRG2	-	pfam_Ndr	ENSG00000165795		0.562	NDRG2-013	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	NDRG2	HGNC	protein_coding	OTTHUMT00000411717.1	68	0.00	0	G			21486165	21486165	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000553593	ensembl	human	putative	69_37n	missense	49	23.44	15	SNP	1.000	A
NFATC3	4775	genome.wustl.edu	37	16	68225648	68225648	+	Missense_Mutation	SNP	A	A	T	rs143269690		TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr16:68225648A>T	ENST00000346183.3	+	9	3100	c.3076A>T	c.(3076-3078)Att>Ttt	p.I1026F	NFATC3_ENST00000535127.2_3'UTR|SNORA48_ENST00000391143.1_RNA|NFATC3_ENST00000575270.1_Missense_Mutation_p.I1026F|NFATC3_ENST00000349223.5_Missense_Mutation_p.I1026F|NFATC3_ENST00000329524.4_Missense_Mutation_p.I1026F	NM_173165.2	NP_775188.1	Q12968	NFAC3_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3	1026					cellular respiration (GO:0045333)|cellular response to calcium ion (GO:0071277)|cellular response to lithium ion (GO:0071285)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	44		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)		CTTTGCAACCATTGGTCTGCA	0.423																																						dbGAP											0													176.0	168.0	171.0					16																	68225648		2198	4300	6498	-	-	-	SO:0001583	missense	0			L41067	CCDS10860.1, CCDS10861.1, CCDS10862.1	16q22	2009-11-24			ENSG00000072736	ENSG00000072736		"""Nuclear factor of activated T-cells"""	7777	protein-coding gene	gene with protein product		602698				7749981	Standard	NM_004555		Approved	NFAT4, NFATX	uc002evo.2	Q12968	OTTHUMG00000137555	ENST00000346183.3:c.3076A>T	16.37:g.68225648A>T	ENSP00000300659:p.Ile1026Phe		O75211|Q14516|Q99840|Q99841|Q99842	Missense_Mutation	SNP	pfam_RHD,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT_TIG_rcpt,pfscan_RHD,prints_NFAT	p.I1026F	ENST00000346183.3	37	c.3076	CCDS10860.1	16	.	.	.	.	.	.	.	.	.	.	A	22.6	4.317665	0.81469	.	.	ENSG00000072736	ENST00000349223;ENST00000346183;ENST00000329524;ENST00000535127	T;T;T	0.11169	2.81;2.82;2.8	5.7	5.7	0.88788	.	0.049376	0.85682	D	0.000000	T	0.22475	0.0542	L	0.58101	1.795	0.58432	D	0.999998	P;D;P;P	0.54772	0.933;0.968;0.933;0.933	B;P;B;B	0.51999	0.386;0.687;0.386;0.386	T	0.00322	-1.1818	10	0.66056	D	0.02	-11.4319	15.9681	0.79991	1.0:0.0:0.0:0.0	.	1026;1026;1026;1026	Q12968;Q12968-3;B5B2S0;B5B2S2	NFAC3_HUMAN;.;.;.	F	1026;1026;1026;547	ENSP00000264008:I1026F;ENSP00000300659:I1026F;ENSP00000331324:I1026F	ENSP00000331324:I1026F	I	+	1	0	NFATC3	66783149	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.667000	0.91153	2.170000	0.68504	0.454000	0.30748	ATT	NFATC3	-	NULL	ENSG00000072736		0.423	NFATC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NFATC3	HGNC	protein_coding	OTTHUMT00000268890.2	71	0.00	0	A	NM_004555		68225648	68225648	+1	no_errors	ENST00000346183	ensembl	human	known	69_37n	missense	38	22.45	11	SNP	1.000	T
NFKBIB	4793	genome.wustl.edu	37	19	39395737	39395737	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr19:39395737G>A	ENST00000313582.5	+	2	296	c.262G>A	c.(262-264)Gac>Aac	p.D88N	NFKBIB_ENST00000392079.3_Missense_Mutation_p.D56N|NFKBIB_ENST00000572515.1_Missense_Mutation_p.D88N	NM_002503.4	NP_002494.2	Q15653	IKBB_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta	88					innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of type I interferon production (GO:0032481)|signal transduction (GO:0007165)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)	8	all_cancers(60;4.39e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			TGAGTACATGGACCTGCAGAA	0.582																																					Pancreas(165;1492 2005 6979 7739 34483)	dbGAP											0													154.0	147.0	149.0					19																	39395737		2203	4300	6503	-	-	-	SO:0001583	missense	0			L40407	CCDS12524.1, CCDS74362.1	19q13.1	2013-01-10				ENSG00000104825		"""Ankyrin repeat domain containing"""	7798	protein-coding gene	gene with protein product		604495				9763672	Standard	NM_002503		Approved	IKBB, TRIP9	uc002ojw.3	Q15653		ENST00000313582.5:c.262G>A	19.37:g.39395737G>A	ENSP00000312988:p.Asp88Asn		A8K3F4|Q96BJ7	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.D88N	ENST00000313582.5	37	c.262	CCDS12524.1	19	.	.	.	.	.	.	.	.	.	.	G	13.96	2.392466	0.42410	.	.	ENSG00000104825	ENST00000509705;ENST00000313582;ENST00000392079	T;T	0.55052	0.54;0.78	5.12	4.08	0.47627	Ankyrin repeat-containing domain (4);	0.000000	0.56097	D	0.000030	T	0.22085	0.0532	N	0.02357	-0.585	0.42072	D	0.991215	B;B;B	0.33583	0.113;0.418;0.056	B;B;B	0.31442	0.097;0.13;0.026	T	0.30650	-0.9971	10	0.02654	T	1	-25.8928	12.4505	0.55675	0.0:0.0:0.8322:0.1678	.	111;56;88	Q59EM7;G5E9C2;Q15653	.;.;IKBB_HUMAN	N	111;88;56	ENSP00000312988:D88N;ENSP00000375929:D56N	ENSP00000312988:D88N	D	+	1	0	NFKBIB	44087577	1.000000	0.71417	0.987000	0.45799	0.858000	0.48976	3.044000	0.49830	1.371000	0.46172	0.655000	0.94253	GAC	NFKBIB	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000104825		0.582	NFKBIB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NFKBIB	HGNC	protein_coding	OTTHUMT00000438155.1	81	0.00	0	G	NM_002503		39395737	39395737	+1	no_errors	ENST00000313582	ensembl	human	known	69_37n	missense	115	10.16	13	SNP	0.998	A
NLRC3	197358	genome.wustl.edu	37	16	3602234	3602234	+	RNA	SNP	C	C	G			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr16:3602234C>G	ENST00000301749.7	-	0	2719				NLRC3_ENST00000448023.2_RNA|NLRC3_ENST00000419350.2_RNA|NLRC3_ENST00000359128.5_RNA|NLRC3_ENST00000603507.1_RNA	NM_178844.2	NP_849172.2	Q7RTR2	NLRC3_HUMAN	NLR family, CARD domain containing 3						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of protein ubiquitination (GO:0031396)|response to lipopolysaccharide (GO:0032496)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(16)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						TCAAGGGCATCTGCCATCCGC	0.552																																						dbGAP											0													95.0	92.0	93.0					16																	3602234		1951	4145	6096	-	-	-			0			BK001112	CCDS73817.1	16p13.3	2014-03-25			ENSG00000167984	ENSG00000167984		"""Nucleotide-binding domain and leucine rich repeat containing"""	29889	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 3"", ""NOD-like receptor C3"""	615648				15705585, 12766759	Standard	NM_178844		Approved	CLR16.2, FLJ00348, NOD3	uc010btn.3	Q7RTR2	OTTHUMG00000177561		16.37:g.3602234C>G			Q5EY36|Q8NF48|Q8NI01|Q8NI02|Q8TEL3	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase	p.D819H	ENST00000301749.7	37	c.2455		16	.	.	.	.	.	.	.	.	.	.	C	14.31	2.497386	0.44455	.	.	ENSG00000167984	ENST00000301749;ENST00000359128;ENST00000448023	T;T;T	0.53640	0.61;0.61;0.61	4.77	3.81	0.43845	.	0.512237	0.20559	N	0.089956	T	0.56441	0.1985	H	0.97186	3.955	0.23003	N	0.998443	P	0.35011	0.48	B	0.28139	0.086	T	0.62718	-0.6795	10	0.54805	T	0.06	.	7.9891	0.30229	0.0:0.8906:0.0:0.1094	.	819	C9JLH9	.	H	772;772;819	ENSP00000301749:D772H;ENSP00000352039:D772H;ENSP00000414415:D819H	ENSP00000301749:D772H	D	-	1	0	NLRC3	3542235	0.998000	0.40836	0.997000	0.53966	0.590000	0.36582	3.684000	0.54671	2.213000	0.71641	0.449000	0.29647	GAT	NLRC3	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000167984		0.552	NLRC3-201	KNOWN	basic|appris_principal	protein_coding	NLRC3	HGNC	polymorphic_pseudogene		67	0.00	0	C	NM_178844		3602234	3602234	-1	no_errors	ENST00000448023	ensembl	human	known	69_37n	missense	31	27.91	12	SNP	0.997	G
NOTCH3	4854	genome.wustl.edu	37	19	15296369	15296369	+	Silent	SNP	G	G	C			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr19:15296369G>C	ENST00000263388.2	-	13	2148	c.2073C>G	c.(2071-2073)ctC>ctG	p.L691L		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	691	EGF-like 17; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			GGGGGAGGCAGAGTGGGGGCA	0.642																																						dbGAP											0													55.0	47.0	50.0					19																	15296369		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.2073C>G	19.37:g.15296369G>C			Q9UEB3|Q9UPL3|Q9Y6L8	Silent	SNP	pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,pfam_Ankyrin_rpt,pfam_Notch_dom,pfam_Notch_NODP_dom,pfam_Notch_NOD_dom,pfam_EGF_extracell,pfam_DUF3454_notch,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,pirsf_Notch,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom,prints_Notch_3,prints_Notch_dom	p.L691	ENST00000263388.2	37	c.2073	CCDS12326.1	19																																																																																			NOTCH3	-	smart_EGF-like_Ca-bd,smart_EGF-like,pirsf_Notch,pfscan_EG-like_dom	ENSG00000074181		0.642	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH3	HGNC	protein_coding	OTTHUMT00000465714.1	44	0.00	0	G	NM_000435		15296369	15296369	-1	no_errors	ENST00000263388	ensembl	human	known	69_37n	silent	52	13.33	8	SNP	0.970	C
NUMBL	9253	genome.wustl.edu	37	19	41173889	41173889	+	Silent	SNP	C	C	T			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr19:41173889C>T	ENST00000252891.4	-	10	1481	c.1314G>A	c.(1312-1314)caG>caA	p.Q438Q	NUMBL_ENST00000540131.1_Silent_p.Q397Q|NUMBL_ENST00000598779.1_Silent_p.Q397Q	NM_004756.3	NP_004747.1	Q9Y6R0	NUMBL_HUMAN	numb homolog (Drosophila)-like	438	Poly-Gln.				adherens junction organization (GO:0034332)|axonogenesis (GO:0007409)|cytokine-mediated signaling pathway (GO:0019221)|lateral ventricle development (GO:0021670)|nervous system development (GO:0007399)|neuroblast division in subventricular zone (GO:0021849)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of neurogenesis (GO:0050769)|protein metabolic process (GO:0019538)	cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)	16			Lung(22;0.000393)|LUSC - Lung squamous cell carcinoma(20;0.00105)			gctgctgctgctgctgctgtt	0.662																																						dbGAP											0													8.0	8.0	8.0					19																	41173889		2113	4120	6233	-	-	-	SO:0001819	synonymous_variant	0			AF015401	CCDS12561.1	19q13.13-q13.2	2008-07-17	2001-11-28			ENSG00000105245			8061	protein-coding gene	gene with protein product		604018	"""numb (Drosophila) homolog-like"""			9225980, 9303539	Standard	XM_006723471		Approved	NUMB-R, CTG3a, CAG3A, TNRC23, NUMBR, NUMBLIKE	uc002oon.3	Q9Y6R0		ENST00000252891.4:c.1314G>A	19.37:g.41173889C>T			Q7Z4J9	Silent	SNP	pfam_Numb_domain,pfam_PTyr_interaction_dom,pfam_PTB,smart_PTyr_interaction_dom,pirsf_Numb/numb-like,pfscan_PTyr_interaction_dom	p.Q438	ENST00000252891.4	37	c.1314	CCDS12561.1	19																																																																																			NUMBL	-	pirsf_Numb/numb-like	ENSG00000105245		0.662	NUMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUMBL	HGNC	protein_coding	OTTHUMT00000462749.2	24	0.00	0	C	NM_004756		41173889	41173889	-1	no_errors	ENST00000252891	ensembl	human	known	69_37n	silent	30	38.78	19	SNP	1.000	T
OR51G2	81282	genome.wustl.edu	37	11	4936482	4936482	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr11:4936482C>T	ENST00000322013.3	-	1	440	c.412G>A	c.(412-414)Gtt>Att	p.V138I	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001005238.1	NP_001005238.1	Q8NGK0	O51G2_HUMAN	olfactory receptor, family 51, subfamily G, member 2	138						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(1)|large_intestine(9)|lung(12)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		AGAATGGAAACATAGTGCAAG	0.468																																						dbGAP											0													71.0	72.0	71.0					11																	4936482		2201	4298	6499	-	-	-	SO:0001583	missense	0			AB065794	CCDS31365.1	11p15.4	2012-08-09			ENSG00000176893	ENSG00000176893		"""GPCR / Class A : Olfactory receptors"""	15198	protein-coding gene	gene with protein product							Standard	NM_001005238		Approved		uc001lzr.1	Q8NGK0	OTTHUMG00000066501	ENST00000322013.3:c.412G>A	11.37:g.4936482C>T	ENSP00000322593:p.Val138Ile		Q6IFH7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.V138I	ENST00000322013.3	37	c.412	CCDS31365.1	11	.	.	.	.	.	.	.	.	.	.	C	13.30	2.197271	0.38806	.	.	ENSG00000176893	ENST00000322013	T	0.11169	2.8	5.58	3.68	0.42216	GPCR, rhodopsin-like superfamily (1);	0.263487	0.27155	N	0.020666	T	0.06462	0.0166	N	0.20483	0.58	0.09310	N	1	B	0.12630	0.006	B	0.04013	0.001	T	0.23154	-1.0196	10	0.72032	D	0.01	.	5.0028	0.14273	0.3067:0.5453:0.0:0.148	.	138	Q8NGK0	O51G2_HUMAN	I	138	ENSP00000322593:V138I	ENSP00000322593:V138I	V	-	1	0	OR51G2	4893058	0.000000	0.05858	0.998000	0.56505	0.911000	0.54048	-0.763000	0.04740	1.584000	0.49913	0.655000	0.94253	GTT	OR51G2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000176893		0.468	OR51G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51G2	HGNC	protein_coding	OTTHUMT00000142174.1	26	0.00	0	C	NM_001005238		4936482	4936482	-1	no_errors	ENST00000322013	ensembl	human	known	69_37n	missense	15	40.00	10	SNP	0.649	T
OR4S2	219431	genome.wustl.edu	37	11	55419048	55419048	+	Silent	SNP	G	G	A			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr11:55419048G>A	ENST00000312422.2	+	1	669	c.669G>A	c.(667-669)ctG>ctA	p.L223L		NM_001004059.2	NP_001004059.2	Q8NH73	OR4S2_HUMAN	olfactory receptor, family 4, subfamily S, member 2	223						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(4)|lung(28)|ovary(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_epithelial(135;0.0748)				TAGTTTCCCTGAGAAAGCAGT	0.483																																						dbGAP											0													165.0	133.0	144.0					11																	55419048		2178	4035	6213	-	-	-	SO:0001819	synonymous_variant	0			BK004390	CCDS31505.1	11q11	2012-08-09	2002-11-13	2002-11-15	ENSG00000174982	ENSG00000174982		"""GPCR / Class A : Olfactory receptors"""	15183	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily S, member 2 pseudogene"""	OR4S2P			Standard	NM_001004059		Approved	OST725	uc001nhs.1	Q8NH73	OTTHUMG00000166799	ENST00000312422.2:c.669G>A	11.37:g.55419048G>A			Q6IF72	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L223	ENST00000312422.2	37	c.669	CCDS31505.1	11																																																																																			OR4S2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000174982		0.483	OR4S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4S2	HGNC	protein_coding	OTTHUMT00000391503.1	116	0.00	0	G	NM_001004059		55419048	55419048	+1	no_errors	ENST00000312422	ensembl	human	known	69_37n	silent	74	19.57	18	SNP	0.044	A
OR5L1	219437	genome.wustl.edu	37	11	55579451	55579451	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr11:55579451G>T	ENST00000333973.2	+	1	598	c.509G>T	c.(508-510)aGa>aTa	p.R170I		NM_001004738.1	NP_001004738.1	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L, member 1	170						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(4)|liver(4)|lung(36)|ovary(2)|pancreas(1)|prostate(5)|skin(9)|stomach(4)|upper_aerodigestive_tract(3)	78		all_epithelial(135;0.208)				CCCTTCTATAGATCTAATGTG	0.463																																						dbGAP											0													222.0	204.0	210.0					11																	55579451		2200	4296	6496	-	-	-	SO:0001583	missense	0			AB065780	CCDS31509.1	11q11	2012-08-09			ENSG00000186117	ENSG00000186117		"""GPCR / Class A : Olfactory receptors"""	8350	protein-coding gene	gene with protein product							Standard	NM_001004738		Approved	OST262	uc001nhw.1	Q8NGL2	OTTHUMG00000166810	ENST00000333973.2:c.509G>T	11.37:g.55579451G>T	ENSP00000335529:p.Arg170Ile		B2RNK6|Q6IFD0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.R170I	ENST00000333973.2	37	c.509	CCDS31509.1	11	.	.	.	.	.	.	.	.	.	.	g	17.91	3.504596	0.64410	.	.	ENSG00000186117	ENST00000333973	T	0.37058	1.22	4.12	0.933	0.19471	GPCR, rhodopsin-like superfamily (1);	0.515151	0.18012	N	0.154508	T	0.44350	0.1289	L	0.53617	1.68	0.09310	N	1	D	0.57899	0.981	P	0.62885	0.908	T	0.27297	-1.0078	10	0.66056	D	0.02	-2.157	3.8145	0.08809	0.0854:0.1384:0.4926:0.2836	.	170	Q8NGL2	OR5L1_HUMAN	I	170	ENSP00000335529:R170I	ENSP00000335529:R170I	R	+	2	0	OR5L1	55336027	0.000000	0.05858	0.000000	0.03702	0.498000	0.33706	0.082000	0.14847	-0.092000	0.12417	0.428000	0.28381	AGA	OR5L1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000186117		0.463	OR5L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5L1	HGNC	protein_coding	OTTHUMT00000391514.1	99	0.00	0	G	NM_001004738		55579451	55579451	+1	no_errors	ENST00000333973	ensembl	human	known	69_37n	missense	48	23.81	15	SNP	0.002	T
PCDHGA4	56111	genome.wustl.edu	37	5	140736344	140736344	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr5:140736344G>C	ENST00000571252.1	+	1	1577	c.1577G>C	c.(1576-1578)aGa>aCa	p.R526T	PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018917.2	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4	526	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGCAGTTTAGAGACCTGCAG	0.517																																						dbGAP											0													132.0	142.0	139.0					5																	140736344		2148	4275	6423	-	-	-	SO:0001583	missense	0			AF152511	CCDS58979.1, CCDS58979.2, CCDS75331.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8702	other	protocadherin		606291				10380929	Standard	NM_018917		Approved	PCDH-GAMMA-A4		Q9Y5G9		ENST00000571252.1:c.1577G>C	5.37:g.140736344G>C	ENSP00000458570:p.Arg526Thr		Q9Y5D3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R526T	ENST00000571252.1	37	c.1577	CCDS58979.1	5																																																																																			PCDHGA4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000262576		0.517	PCDHGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA4	HGNC	protein_coding	OTTHUMT00000437959.1	43	0.00	0	G	NM_018917		140736344	140736344	+1	no_errors	ENST00000571252	ensembl	human	known	69_37n	missense	28	30.00	12	SNP	0.818	C
PLCL2	23228	genome.wustl.edu	37	3	17053215	17053215	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr3:17053215G>A	ENST00000418129.2	+	2	2464	c.1999G>A	c.(1999-2001)Gat>Aat	p.D667N	PLCL2_ENST00000396755.2_Missense_Mutation_p.D667N|PLCL2_ENST00000432376.1_Missense_Mutation_p.D667N	NM_001144382.1	NP_001137854.1	Q9UPR0	PLCL2_HUMAN	phospholipase C-like 2	793	PI-PLC Y-box. {ECO:0000255|PROSITE- ProRule:PRU00271}.				B cell proliferation involved in immune response (GO:0002322)|B-1a B cell differentiation (GO:0002337)|gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|negative regulation of B cell receptor signaling pathway (GO:0050859)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GABA receptor binding (GO:0050811)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	43						AATCCCTGCTGATTGTGCAGA	0.443																																						dbGAP											0													79.0	78.0	79.0					3																	17053215		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB029015	CCDS33713.1, CCDS74911.1	3p25.3-p25.1	2008-03-18	2002-02-18	2002-02-22	ENSG00000154822	ENSG00000154822			9064	protein-coding gene	gene with protein product		614276	"""phospholipase C, epsilon 2"""	PLCE2		10470851	Standard	NM_015184		Approved	KIAA1092	uc011awd.2	Q9UPR0	OTTHUMG00000155467	ENST00000418129.2:c.1999G>A	3.37:g.17053215G>A	ENSP00000409637:p.Asp667Asn		A8K5V4|Q8N498|Q9H8L0|Q9UFP9	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.D667N	ENST00000418129.2	37	c.1999	CCDS33713.1	3	.	.	.	.	.	.	.	.	.	.	G	18.63	3.665023	0.67700	.	.	ENSG00000154822	ENST00000418129;ENST00000285094;ENST00000396755;ENST00000432376	T;T;T	0.16457	2.34;2.34;2.34	4.96	4.96	0.65561	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.45895	0.1365	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.50004	-0.8878	9	0.87932	D	0	.	18.5703	0.91133	0.0:0.0:1.0:0.0	.	793	Q9UPR0	PLCL2_HUMAN	N	667;794;667;667	ENSP00000409637:D667N;ENSP00000379979:D667N;ENSP00000412836:D667N	ENSP00000285094:D794N	D	+	1	0	PLCL2	17028219	1.000000	0.71417	0.960000	0.40013	0.067000	0.16453	9.813000	0.99286	2.449000	0.82847	0.561000	0.74099	GAT	PLCL2	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	ENSG00000154822		0.443	PLCL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCL2	HGNC	protein_coding	OTTHUMT00000340250.3	53	0.00	0	G			17053215	17053215	+1	no_errors	ENST00000418129	ensembl	human	known	69_37n	missense	35	16.67	7	SNP	1.000	A
PDIA5	10954	genome.wustl.edu	37	3	122880757	122880757	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr3:122880757C>G	ENST00000316218.7	+	17	1605	c.1510C>G	c.(1510-1512)Ctc>Gtc	p.L504V	PDIA5_ENST00000467157.1_3'UTR	NM_006810.3	NP_006801.1	Q14554	PDIA5_HUMAN	protein disulfide isomerase family A, member 5	504	Thioredoxin 3. {ECO:0000255|PROSITE- ProRule:PRU00691}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|oxidation-reduction process (GO:0055114)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)	oxidoreductase activity (GO:0016491)|protein disulfide isomerase activity (GO:0003756)			breast(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	21				GBM - Glioblastoma multiforme(114;0.0427)		TATTCGAGCCCTCCGGGAGGG	0.453																																						dbGAP											0													70.0	76.0	74.0					3																	122880757		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK054963	CCDS3020.1	3q21.1	2009-11-20	2005-06-29		ENSG00000065485	ENSG00000065485	5.3.4.1	"""Protein disulfide isomerases"""	24811	protein-coding gene	gene with protein product			"""protein disulfide isomerase-associated 5"""			7556671	Standard	NM_006810		Approved	PDIR, FLJ30401	uc003egc.2	Q14554	OTTHUMG00000159558	ENST00000316218.7:c.1510C>G	3.37:g.122880757C>G	ENSP00000323313:p.Leu504Val		D3DN95|Q9BV43	Missense_Mutation	SNP	pfam_Thioredoxin_domain,pfam_AhpC/TSA,superfamily_Thioredoxin-like_fold,prints_Thioredoxin	p.L504V	ENST00000316218.7	37	c.1510	CCDS3020.1	3	.	.	.	.	.	.	.	.	.	.	C	16.16	3.044704	0.55110	.	.	ENSG00000065485	ENST00000316218	T	0.04360	3.64	5.59	5.59	0.84812	Thioredoxin-like fold (1);	0.063262	0.64402	D	0.000005	T	0.07279	0.0184	L	0.43923	1.385	0.53688	D	0.999977	P	0.39443	0.674	B	0.41088	0.347	T	0.47623	-0.9103	10	0.15952	T	0.53	.	17.764	0.88471	0.0:1.0:0.0:0.0	.	504	Q14554	PDIA5_HUMAN	V	504	ENSP00000323313:L504V	ENSP00000323313:L504V	L	+	1	0	PDIA5	124363447	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.161000	0.58170	2.639000	0.89480	0.650000	0.86243	CTC	PDIA5	-	NULL	ENSG00000065485		0.453	PDIA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDIA5	HGNC	protein_coding	OTTHUMT00000356192.1	44	0.00	0	C	NM_006810		122880757	122880757	+1	no_errors	ENST00000316218	ensembl	human	known	69_37n	missense	19	20.83	5	SNP	1.000	G
PNPLA6	10908	genome.wustl.edu	37	19	7621587	7621587	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr19:7621587C>T	ENST00000221249.6	+	29	3574	c.3143C>T	c.(3142-3144)tCa>tTa	p.S1048L	PNPLA6_ENST00000414982.3_Missense_Mutation_p.S1096L|PNPLA6_ENST00000600737.1_Missense_Mutation_p.S1086L|PNPLA6_ENST00000450331.3_Missense_Mutation_p.S1048L|PNPLA6_ENST00000545201.2_Missense_Mutation_p.S1021L	NM_006702.4	NP_006693.3	Q8IY17	PLPL6_HUMAN	patatin-like phospholipase domain containing 6	1087	Patatin.				angiogenesis (GO:0001525)|cell death (GO:0008219)|lipid catabolic process (GO:0016042)|organ morphogenesis (GO:0009887)|phosphatidylcholine metabolic process (GO:0046470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)	35						ATCACCGCCTCAGCCATGCGA	0.672																																						dbGAP											0													83.0	67.0	73.0					19																	7621587		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ004832	CCDS32891.1, CCDS54206.1, CCDS54207.1, CCDS59343.1	19p13.2	2013-09-11						"""Patatin-like phospholipase domain containing"""	16268	protein-coding gene	gene with protein product	"""neuropathy target esterase"""	603197				9576844, 16799181, 19029121	Standard	NM_006702		Approved	NTE, sws, iPLA2delta, SPG39	uc010xjq.2	Q8IY17		ENST00000221249.6:c.3143C>T	19.37:g.7621587C>T	ENSP00000221249:p.Ser1048Leu		A6NGQ0|B4DFB9|B7Z7T2|F5H5K9|J3KQS3|O60859|Q86W58|Q9UG58	Missense_Mutation	SNP	pfam_cNMP-bd_dom,pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.S1096L	ENST00000221249.6	37	c.3287	CCDS32891.1	19	.	.	.	.	.	.	.	.	.	.	c	29.6	5.016633	0.93404	.	.	ENSG00000032444	ENST00000221249;ENST00000545201;ENST00000414982;ENST00000450331	T;T;T;T	0.76448	-1.02;-1.02;-1.02;-1.02	4.97	4.97	0.65823	Acyl transferase/acyl hydrolase/lysophospholipase (1);Patatin/Phospholipase A2-related (1);	0.000000	0.64402	D	0.000001	D	0.86707	0.5997	M	0.66506	2.035	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.83275	0.996;0.988;0.994;0.993	D	0.88243	0.2911	10	0.87932	D	0	.	15.7561	0.78025	0.0:1.0:0.0:0.0	.	1087;1021;1086;1048	Q8IY17;F5H5K9;Q8IY17-3;Q8IY17-2	PLPL6_HUMAN;.;.;.	L	1048;1021;1096;1048	ENSP00000221249:S1048L;ENSP00000443323:S1021L;ENSP00000407509:S1096L;ENSP00000394348:S1048L	ENSP00000221249:S1048L	S	+	2	0	PNPLA6	7527587	1.000000	0.71417	0.927000	0.36925	0.974000	0.67602	7.810000	0.86072	2.312000	0.78011	0.557000	0.71058	TCA	PNPLA6	-	pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase	ENSG00000032444		0.672	PNPLA6-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	PNPLA6	HGNC	protein_coding	OTTHUMT00000459275.1	79	0.00	0	C	NM_006702		7621587	7621587	+1	no_errors	ENST00000414982	ensembl	human	known	69_37n	missense	129	12.84	19	SNP	1.000	T
POLR2J3	548644	genome.wustl.edu	37	7	102182031	102182031	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr7:102182031G>A	ENST00000379357.5	-	2	190	c.191C>T	c.(190-192)aCg>aTg	p.T64M	RP11-514P8.7_ENST00000514917.2_Silent_p.H276H|RP11-514P8.8_ENST00000481893.1_RNA			Q9H1A7	RPB1C_HUMAN	polymerase (RNA) II (DNA directed) polypeptide J3	0					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)										CTGCTCCAGCGTGAAGGTGGA	0.627																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS47673.1	7q22.1	2013-01-21			ENSG00000168255	ENSG00000168255		"""RNA polymerase subunits"""	33853	protein-coding gene	gene with protein product						15586814	Standard	NM_001097615		Approved		uc010lid.1	Q9H1A7	OTTHUMG00000150384	ENST00000379357.5:c.191C>T	7.37:g.102182031G>A	ENSP00000368662:p.Thr64Met		A6NKA1	Missense_Mutation	SNP	NULL	p.T64M	ENST00000379357.5	37	c.191		7	.	.	.	.	.	.	.	.	.	.	g	16.70	3.195804	0.58126	.	.	ENSG00000168255	ENST00000379357;ENST00000513506	T	0.67345	-0.26	3.74	3.74	0.42951	.	.	.	.	.	T	0.79569	0.4468	.	.	.	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.71414	0.973;0.973	T	0.82180	-0.0585	8	0.87932	D	0	-7.8126	11.4895	0.50373	0.0:0.0:1.0:0.0	.	64;64	B0FP48;E5RIL1	UPK3L_HUMAN;.	M	64;154	ENSP00000368662:T64M	ENSP00000368662:T64M	T	-	2	0	POLR2J3	101969036	0.982000	0.34865	0.928000	0.36995	0.871000	0.50021	2.232000	0.43018	1.832000	0.53329	0.544000	0.68410	ACG	POLR2J3	-	NULL	ENSG00000168255		0.627	POLR2J3-201	KNOWN	basic|appris_principal	protein_coding	POLR2J3	HGNC	protein_coding		8	0.00	0	G	NM_001097615		102182031	102182031	-1	no_errors	ENST00000379357	ensembl	human	known	69_37n	missense	1	75.00	3	SNP	0.968	A
POLR3A	11128	genome.wustl.edu	37	10	79745033	79745033	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr10:79745033G>A	ENST00000372371.3	-	24	3274	c.3137C>T	c.(3136-3138)aCc>aTc	p.T1046I		NM_007055.3	NP_008986.2	O14802	RPC1_HUMAN	polymerase (RNA) III (DNA directed) polypeptide A, 155kDa	1046					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|ribonucleoside binding (GO:0032549)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)			GGTCATCTGGGTGCCTGGCTC	0.557																																						dbGAP											0													134.0	131.0	132.0					10																	79745033		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF021351	CCDS7354.1	10q22-q23	2013-01-21			ENSG00000148606	ENSG00000148606		"""RNA polymerase subunits"""	30074	protein-coding gene	gene with protein product		614258				9331371, 12391170	Standard	NM_007055		Approved	RPC1, RPC155, hRPC155	uc001jzn.3	O14802	OTTHUMG00000018550	ENST00000372371.3:c.3137C>T	10.37:g.79745033G>A	ENSP00000361446:p.Thr1046Ile		Q8IW34|Q8TCW5	Missense_Mutation	SNP	pfam_RNA_pol_Rpb1_1,pfam_RNA_pol_Rpb1_5,pfam_RNA_pol_asu,pfam_RNA_pol_Rpb1_3,pfam_RNA_pol_Rpb1_4,smart_RNA_pol_N	p.T1046I	ENST00000372371.3	37	c.3137	CCDS7354.1	10	.	.	.	.	.	.	.	.	.	.	G	31	5.086239	0.94100	.	.	ENSG00000148606	ENST00000372371	D	0.88818	-2.43	5.95	5.95	0.96441	RNA polymerase Rpb1, domain 5 (1);	0.000000	0.85682	D	0.000000	D	0.97399	0.9149	H	0.99117	4.435	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98358	1.0547	9	.	.	.	-34.9577	20.3802	0.98930	0.0:0.0:1.0:0.0	.	1046	O14802	RPC1_HUMAN	I	1046	ENSP00000361446:T1046I	.	T	-	2	0	POLR3A	79415039	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.275000	0.95738	2.822000	0.97130	0.563000	0.77884	ACC	POLR3A	-	pfam_RNA_pol_Rpb1_5	ENSG00000148606		0.557	POLR3A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR3A	HGNC	protein_coding	OTTHUMT00000048923.1	38	0.00	0	G	NM_007055		79745033	79745033	-1	no_errors	ENST00000372371	ensembl	human	known	69_37n	missense	14	50.00	14	SNP	1.000	A
POU5F1	5460	genome.wustl.edu	37	6	31133443	31133443	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr6:31133443C>G	ENST00000259915.8	-	3	634	c.562G>C	c.(562-564)Gag>Cag	p.E188Q	POU5F1_ENST00000512818.1_5'UTR|POU5F1_ENST00000441888.3_5'UTR|POU5F1_ENST00000513407.1_5'UTR|POU5F1_ENST00000606567.1_Missense_Mutation_p.E18Q|POU5F1_ENST00000471529.2_5'UTR	NM_002701.4	NP_002692.2	Q01860	PO5F1_HUMAN	POU class 5 homeobox 1	188	POU-specific. {ECO:0000255|PROSITE- ProRule:PRU00530}.				anatomical structure morphogenesis (GO:0009653)|blastocyst development (GO:0001824)|BMP signaling pathway involved in heart induction (GO:0003130)|cardiac cell fate determination (GO:0060913)|cell fate commitment involved in formation of primary germ layer (GO:0060795)|endodermal cell fate specification (GO:0001714)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of gene silencing by miRNA (GO:0060965)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of asymmetric cell division (GO:0009786)|regulation of gene expression (GO:0010468)|regulation of heart induction by regulation of canonical Wnt signaling pathway (GO:0090081)|regulation of methylation-dependent chromatin silencing (GO:0090308)|regulation of transcription, DNA-templated (GO:0006355)|response to wounding (GO:0009611)|somatic stem cell maintenance (GO:0035019)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)		EWSR1/POU5F1(10)	breast(1)|large_intestine(2)|lung(3)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	13					Dopamine(DB00988)|Norepinephrine(DB00368)	TGCAGAGCCTCAAAGCGGCAG	0.537			T	EWSR1	sarcoma																																	dbGAP		Dom	yes		6	6p21.31	5460	"""POU domain, class 5, transcription factor 1"""		M	0													27.0	29.0	28.0					6																	31133443		1511	2709	4220	-	-	-	SO:0001583	missense	0			Z11898	CCDS34391.1, CCDS47398.1, CCDS47398.2, CCDS75420.1	6p21.33	2011-06-20	2007-07-13		ENSG00000204531	ENSG00000204531		"""Homeoboxes / POU class"""	9221	protein-coding gene	gene with protein product		164177	"""POU domain class 5, transcription factor 1"""	OTF3		1408763	Standard	NM_002701		Approved	OCT3, Oct4, MGC22487	uc003nsv.3	Q01860	OTTHUMG00000031206	ENST00000259915.8:c.562G>C	6.37:g.31133443C>G	ENSP00000259915:p.Glu188Gln		A6NCS1|A6NLL8|D2IYK4|P31359|Q15167|Q15168|Q16422|Q5STF3|Q5STF4	Missense_Mutation	SNP	pfam_POU_specific,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeodomain,pfscan_Homeodomain,pfscan_POU_specific,prints_POU	p.E188Q	ENST00000259915.8	37	c.562	CCDS34391.1	6	.	.	.	.	.	.	.	.	.	.	C	33	5.236674	0.95240	.	.	ENSG00000204531	ENST00000541552;ENST00000259915	D	0.94046	-3.34	5.54	5.54	0.83059	POU-specific (4);Lambda repressor-like, DNA-binding (2);POU (1);	0.000000	0.52532	D	0.000069	D	0.97136	0.9064	M	0.90082	3.085	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.97746	1.0211	10	0.87932	D	0	.	16.9704	0.86297	0.0:1.0:0.0:0.0	.	188;93	Q01860;D2IYK4	PO5F1_HUMAN;.	Q	93;188	ENSP00000259915:E188Q	ENSP00000259915:E188Q	E	-	1	0	POU5F1	31241422	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.712000	0.84684	2.591000	0.87537	0.637000	0.83480	GAG	POU5F1	-	pfam_POU_specific,superfamily_Lambda_DNA-bd_dom,smart_POU_specific,pfscan_POU_specific,prints_POU	ENSG00000204531		0.537	POU5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU5F1	HGNC	protein_coding	OTTHUMT00000076413.4	48	0.00	0	C	NM_002701		31133443	31133443	-1	no_errors	ENST00000259915	ensembl	human	known	69_37n	missense	46	13.21	7	SNP	1.000	G
PPM1M	132160	genome.wustl.edu	37	3	52282678	52282678	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr3:52282678G>A	ENST00000296487.4	+	7	861	c.457G>A	c.(457-459)Gat>Aat	p.D153N	PPM1M_ENST00000409502.3_Missense_Mutation_p.D102N|PPM1M_ENST00000323588.4_Missense_Mutation_p.D153N|PPM1M_ENST00000457351.2_Missense_Mutation_p.D314N			Q96MI6	PPM1M_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1M	153	PP2C-like.				protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|manganese ion binding (GO:0030145)			prostate(1)|urinary_tract(1)	2				BRCA - Breast invasive adenocarcinoma(193;2.4e-05)|Kidney(197;0.00171)|KIRC - Kidney renal clear cell carcinoma(197;0.00194)		GGAGAAATCGGATCTCAAGTA	0.567																																					NSCLC(151;810 2688 34365 49863)	dbGAP											0													156.0	139.0	145.0					3																	52282678		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK096681	CCDS46840.1	3p21.31	2012-04-17	2010-03-05		ENSG00000164088	ENSG00000164088		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	26506	protein-coding gene	gene with protein product	"""protein phosphatase 2C eta"""	608979	"""protein phosphatase 1M (PP2C domain containing)"""			12477932	Standard	NM_001122870		Approved	PP2Ceta, FLJ32332	uc011bed.2	Q96MI6	OTTHUMG00000153046	ENST00000296487.4:c.457G>A	3.37:g.52282678G>A	ENSP00000296487:p.Asp153Asn		Q8N8J9|Q96DB8	Missense_Mutation	SNP	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	p.D314N	ENST00000296487.4	37	c.940		3	.	.	.	.	.	.	.	.	.	.	G	28.5	4.927888	0.92389	.	.	ENSG00000164088	ENST00000457351;ENST00000296487;ENST00000409502;ENST00000323588	T;T;T;T	0.17213	2.29;2.29;2.29;2.29	4.78	4.78	0.61160	Protein phosphatase 2C-like (3);	0.282328	0.30830	N	0.008800	T	0.41166	0.1147	M	0.67700	2.07	0.58432	D	0.999997	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.91635	0.977;0.961;0.999	T	0.28427	-1.0044	10	0.72032	D	0.01	-0.3795	16.1686	0.81788	0.0:0.0:1.0:0.0	.	314;24;153	B7XGB9;Q96MI6-3;Q96MI6	.;.;PPM1M_HUMAN	N	314;153;102;153	ENSP00000393747:D314N;ENSP00000296487:D153N;ENSP00000387046:D102N;ENSP00000319894:D153N	ENSP00000296487:D153N	D	+	1	0	PPM1M	52257718	1.000000	0.71417	0.964000	0.40570	0.846000	0.48090	7.091000	0.76923	2.481000	0.83766	0.561000	0.74099	GAT	PPM1M	-	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	ENSG00000164088		0.567	PPM1M-001	KNOWN	basic	protein_coding	PPM1M	HGNC	protein_coding	OTTHUMT00000329230.2	43	0.00	0	G	NM_144641		52282678	52282678	+1	no_errors	ENST00000457351	ensembl	human	known	69_37n	missense	20	39.39	13	SNP	0.997	A
PRAMEF18	391003	genome.wustl.edu	37	1	13474983	13474983	+	Silent	SNP	G	G	A			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr1:13474983G>A	ENST00000376126.2	-	3	1145	c.1146C>T	c.(1144-1146)ttC>ttT	p.F382F		NM_001099850.1	NP_001093320.1	Q5VWM3	PRA18_HUMAN	PRAME family member 18	382					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					lung(2)|ovary(1)	3	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CGTGAAAGCAGAAAGTGGTGA	0.567																																						dbGAP											0													48.0	55.0	53.0					1																	13474983		2158	4242	6400	-	-	-	SO:0001819	synonymous_variant	0					1p36.21	2013-01-17			ENSG00000204491			"""-"""	30693	protein-coding gene	gene with protein product							Standard			Approved	OTTHUMG00000002932		Q5VWM3	OTTHUMG00000002932	ENST00000376126.2:c.1146C>T	1.37:g.13474983G>A				Silent	SNP	NULL	p.F382	ENST00000376126.2	37	c.1146	CCDS41258.1	1																																																																																			PRAMEF18	-	NULL	ENSG00000204491		0.567	PRAMEF18-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	PRAMEF18	HGNC	protein_coding	OTTHUMT00000008177.2	149	0.00	0	G	NM_001099850		13474983	13474983	-1	no_errors	ENST00000376126	ensembl	human	known	69_37n	silent	94	27.13	35	SNP	0.004	A
PRDM9	56979	genome.wustl.edu	37	5	23527492	23527492	+	Missense_Mutation	SNP	A	A	T	rs112815500	byFrequency	TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr5:23527492A>T	ENST00000296682.3	+	11	2477	c.2295A>T	c.(2293-2295)agA>agT	p.R765S		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	765					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)	p.R765S(2)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						ACCTCCTCAGACACCAGAGGA	0.572										HNSCC(3;0.000094)																												dbGAP											2	Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(1)|lung(1)											59.0	79.0	72.0					5																	23527492		2156	4296	6452	-	-	-	SO:0001583	missense	0			AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.2295A>T	5.37:g.23527492A>T	ENSP00000296682:p.Arg765Ser		B4DX22|Q27Q50	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_SSXRD_motif,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.R765S	ENST00000296682.3	37	c.2295	CCDS43307.1	5	.	.	.	.	.	.	.	.	.	.	T	0.004	-2.270564	0.00257	.	.	ENSG00000164256	ENST00000296682	T	0.25749	1.78	2.95	-5.91	0.02269	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13372	0.0324	L	0.38838	1.175	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.38845	-0.9642	9	0.08179	T	0.78	.	6.3167	0.21194	0.6783:0.0:0.1377:0.184	.	765	Q9NQV7	PRDM9_HUMAN	S	765	ENSP00000296682:R765S	ENSP00000296682:R765S	R	+	3	2	PRDM9	23563249	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	-9.315000	0.00012	-2.336000	0.00628	-2.032000	0.00423	AGA	PRDM9	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000164256		0.572	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM9	HGNC	protein_coding	OTTHUMT00000366375.1	46	0.00	0	A	NM_020227		23527492	23527492	+1	no_errors	ENST00000296682	ensembl	human	known	69_37n	missense	77	11.49	10	SNP	0.003	T
HELZ2	85441	genome.wustl.edu	37	20	62202569	62202569	+	Intron	SNP	A	A	C			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr20:62202569A>C	ENST00000467148.1	-	2	348				HELZ2_ENST00000479540.1_5'UTR	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator						cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										GCCCCGCTCCAAGCTCCTGGG	0.697																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.279-348T>G	20.37:g.62202569A>C			Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	RNA	SNP	-	NULL	ENST00000467148.1	37	NULL	CCDS33508.1	20																																																																																			RP4-697K14.7	-	-	ENSG00000130589		0.697	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PRIC285	Clone_based_vega_gene	protein_coding	OTTHUMT00000354127.1	32	0.00	0	A	NM_001037335		62202569	62202569	-1	no_errors	ENST00000479540	ensembl	human	known	69_37n	rna	67	11.84	9	SNP	0.993	C
PSG6	5675	genome.wustl.edu	37	19	43414865	43414865	+	Missense_Mutation	SNP	C	C	G	rs1058688		TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr19:43414865C>G	ENST00000292125.2	-	3	617	c.573G>C	c.(571-573)agG>agC	p.R191S	PSG6_ENST00000187910.2_Missense_Mutation_p.R191S|PSG6_ENST00000402603.4_Missense_Mutation_p.R191S	NM_002782.4	NP_002773.1	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6	191	Ig-like C2-type 1.		R -> S (in dbSNP:rs1058688).		female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.R191S(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(19)|ovary(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44		Prostate(69;0.00899)				ACAGCTGCAACCTGTGAGTCA	0.498																																						dbGAP											1	Substitution - Missense(1)	lung(1)											216.0	219.0	218.0					19																	43414865		2201	4300	6501	-	-	-	SO:0001583	missense	0				CCDS12613.1, CCDS33038.1	19q13.2	2013-01-29			ENSG00000170848	ENSG00000170848		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9523	protein-coding gene	gene with protein product		176395				1690992	Standard	NM_002782		Approved			Q00889	OTTHUMG00000151127	ENST00000292125.2:c.573G>C	19.37:g.43414865C>G	ENSP00000292125:p.Arg191Ser		O75244|Q15224|Q15235|Q549K1	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.R191S	ENST00000292125.2	37	c.573	CCDS12613.1	19	.	.	.	.	.	.	.	.	.	.	N	6.722	0.501943	0.12822	.	.	ENSG00000170848	ENST00000187910;ENST00000402603;ENST00000292125;ENST00000402456	T;T;T	0.00753	5.74;5.74;5.74	1.64	0.351	0.16042	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.02418	0.0074	M	0.64997	1.995	0.09310	N	1	D;B;B	0.67145	0.996;0.004;0.009	D;B;B	0.74023	0.982;0.031;0.044	T	0.46020	-0.9221	9	0.46703	T	0.11	.	5.4806	0.16721	0.0:0.6424:0.3575:0.0	rs1058688	191;191;191	Q00889;Q00889-2;B5MCE1	PSG6_HUMAN;.;.	S	191	ENSP00000187910:R191S;ENSP00000385736:R191S;ENSP00000292125:R191S	ENSP00000187910:R191S	R	-	3	2	PSG6	48106705	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.280000	0.08468	-0.017000	0.14103	0.194000	0.17425	AGG	PSG6	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000170848		0.498	PSG6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSG6	HGNC	protein_coding	OTTHUMT00000321436.1	157	0.00	0	C	NM_002782		43414865	43414865	-1	no_errors	ENST00000292125	ensembl	human	known	69_37n	missense	190	22.45	55	SNP	0.002	G
RGS4	5999	genome.wustl.edu	37	1	163042526	163042526	+	Intron	SNP	C	C	T			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr1:163042526C>T	ENST00000367909.6	+	3	489				RGS4_ENST00000367906.3_Intron|RGS4_ENST00000491263.1_3'UTR|RGS4_ENST00000367908.4_Intron|RGS4_ENST00000527809.1_Intron|RGS4_ENST00000421743.2_Intron|RGS4_ENST00000531057.1_Intron	NM_001113380.1|NM_005613.5	NP_001106851.1|NP_005604.1	P49798	RGS4_HUMAN	regulator of G-protein signaling 4						inactivation of MAPK activity (GO:0000188)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|upper_aerodigestive_tract(2)	21						CATTCAGGATCTTAGATTTCT	0.333																																					Ovarian(76;1257 1738 3039 6086)	dbGAP											0													30.0	25.0	27.0					1																	163042526		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			BC051869	CCDS1243.1, CCDS44270.1, CCDS44271.1, CCDS44272.1	1q23.3	2008-05-14	2007-08-14		ENSG00000117152	ENSG00000117152		"""Regulators of G-protein signaling"""	10000	protein-coding gene	gene with protein product		602516	"""regulator of G-protein signalling 4"", ""schizophrenia disorder 9"""	SCZD9		8602223, 8756726	Standard	NM_001102445		Approved		uc001gcl.4	P49798	OTTHUMG00000034417	ENST00000367909.6:c.150-69C>T	1.37:g.163042526C>T			A7XA56|A7XA58|A7XA59|A7YVV7|B1APZ3	RNA	SNP	-	NULL	ENST00000367909.6	37	NULL	CCDS1243.1	1																																																																																			RGS4	-	-	ENSG00000117152		0.333	RGS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS4	HGNC	protein_coding	OTTHUMT00000083197.2	56	0.00	0	C	NM_005613		163042526	163042526	+1	no_errors	ENST00000491263	ensembl	human	known	69_37n	rna	45	13.21	7	SNP	0.028	T
TCTA	6988	genome.wustl.edu	37	3	49449842	49449842	+	5'UTR	SNP	G	G	C	rs577154770	byFrequency	TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr3:49449842G>C	ENST00000273590.3	+	0	204				TCTA_ENST00000493381.1_3'UTR|RHOA_ENST00000422781.1_5'Flank|RHOA_ENST00000454011.2_5'Flank|RHOA_ENST00000418115.1_5'Flank|RHOA_ENST00000265538.3_5'UTR	NM_022171.2	NP_071503.1	P57738	TCTA_HUMAN	T-cell leukemia translocation altered							integral component of membrane (GO:0016021)				large_intestine(4)|lung(1)	5				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		AGTACCCCGGGTGGGGCGAGG	0.701													G|||	3	0.000599042	0.0	0.0	5008	,	,		15866	0.0		0.0	False		,,,				2504	0.0031					dbGAP											0													24.0	30.0	28.0					3																	49449842		2200	4294	6494	-	-	-	SO:0001623	5_prime_UTR_variant	0				CCDS2796.1	3p21	2012-02-27	2012-02-27		ENSG00000145022	ENSG00000145022			11692	protein-coding gene	gene with protein product		600690	"""T-cell leukemia translocation altered gene"""			7728759	Standard	NM_022171		Approved		uc003cwv.4	P57738	OTTHUMG00000156846	ENST00000273590.3:c.-18G>C	3.37:g.49449842G>C			B2R4I4|Q6I9U4|Q9BSB0	RNA	SNP	-	NULL	ENST00000273590.3	37	NULL	CCDS2796.1	3																																																																																			RHOA	-	-	ENSG00000067560		0.701	TCTA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOA	HGNC	protein_coding	OTTHUMT00000346210.1	34	0.00	0	G	NM_022171		49449842	49449842	-1	no_errors	ENST00000265538	ensembl	human	known	69_37n	rna	21	22.22	6	SNP	0.284	C
ROBO2	6092	genome.wustl.edu	37	3	77147378	77147378	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr3:77147378T>G	ENST00000461745.1	+	2	1175	c.275T>G	c.(274-276)tTc>tGc	p.F92C	ROBO2_ENST00000332191.8_Missense_Mutation_p.F92C|ROBO2_ENST00000487694.3_Missense_Mutation_p.F108C	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	92	Ig-like C2-type 1.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		TCCTTATTCTTCTTGCGCATC	0.542																																						dbGAP											0													87.0	93.0	91.0					3																	77147378		2031	4185	6216	-	-	-	SO:0001583	missense	0			AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.275T>G	3.37:g.77147378T>G	ENSP00000417164:p.Phe92Cys		O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.F92C	ENST00000461745.1	37	c.275	CCDS43109.1	3	.	.	.	.	.	.	.	.	.	.	T	18.47	3.630850	0.67015	.	.	ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191	T;T;T	0.67345	-0.26;-0.26;-0.26	5.26	5.26	0.73747	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);	0.000000	0.40728	U	0.001030	T	0.78451	0.4285	L	0.55481	1.735	0.30396	N	0.780505	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.997;0.998	T	0.82892	-0.0232	9	0.87932	D	0	.	15.1686	0.72850	0.0:0.0:0.0:1.0	.	108;92;92	Q19AB5;F8W703;Q9HCK4	.;.;ROBO2_HUMAN	C	108;108;108;92;92	ENSP00000417335:F108C;ENSP00000417164:F92C;ENSP00000327536:F92C	ENSP00000327536:F92C	F	+	2	0	ROBO2	77230068	1.000000	0.71417	1.000000	0.80357	0.264000	0.26372	8.037000	0.88933	1.978000	0.57642	0.533000	0.62120	TTC	ROBO2	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000185008		0.542	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ROBO2	HGNC	protein_coding	OTTHUMT00000352600.2	78	0.00	0	T	XM_031246		77147378	77147378	+1	no_errors	ENST00000461745	ensembl	human	known	69_37n	missense	16	50.00	16	SNP	1.000	G
RP1	6101	genome.wustl.edu	37	8	55540482	55540482	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr8:55540482C>T	ENST00000220676.1	+	4	4188	c.4040C>T	c.(4039-4041)tCc>tTc	p.S1347F		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	1347					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			TTTTTAAACTCCAAAGAAAAC	0.378																																					Colon(91;1014 1389 7634 14542 40420)	dbGAP											0													77.0	81.0	79.0					8																	55540482		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.4040C>T	8.37:g.55540482C>T	ENSP00000220676:p.Ser1347Phe			Missense_Mutation	SNP	pfam_Doublecortin_dom,superfamily_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.S1347F	ENST00000220676.1	37	c.4040	CCDS6160.1	8	.	.	.	.	.	.	.	.	.	.	C	3.134	-0.177788	0.06380	.	.	ENSG00000104237	ENST00000220676	T	0.32753	1.44	5.77	-0.216	0.13153	.	0.269718	0.26688	N	0.023014	T	0.17365	0.0417	N	0.19112	0.55	0.18873	N	0.999988	B	0.20887	0.049	B	0.17433	0.018	T	0.17137	-1.0379	10	0.52906	T	0.07	.	9.3846	0.38336	0.0:0.5603:0.0:0.4397	.	1347	P56715	RP1_HUMAN	F	1347	ENSP00000220676:S1347F	ENSP00000220676:S1347F	S	+	2	0	RP1	55703035	0.001000	0.12720	0.001000	0.08648	0.013000	0.08279	-0.033000	0.12246	-0.091000	0.12440	-0.136000	0.14681	TCC	RP1	-	NULL	ENSG00000104237		0.378	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1	HGNC	protein_coding	OTTHUMT00000378532.2	60	0.00	0	C	NM_006269		55540482	55540482	+1	no_errors	ENST00000220676	ensembl	human	known	69_37n	missense	66	13.16	10	SNP	0.032	T
RPTOR	57521	genome.wustl.edu	37	17	78933918	78933918	+	Frame_Shift_Del	DEL	C	C	-			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr17:78933918delC	ENST00000306801.3	+	30	3880	c.3518delC	c.(3517-3519)tccfs	p.S1173fs	CTD-2561B21.3_ENST00000571591.1_RNA|RPTOR_ENST00000575542.1_3'UTR|RPTOR_ENST00000544334.2_Frame_Shift_Del_p.S1015fs	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	1173					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						ACGAGTCTGTCCTGTGATTCC	0.622																																						dbGAP											0													143.0	98.0	113.0					17																	78933918		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.3518delC	17.37:g.78933918delC	ENSP00000307272:p.Ser1173fs		B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Frame_Shift_Del	DEL	pfam_HEAT,pfam_WD40_repeat,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom,prints_Raptor	p.C1174fs	ENST00000306801.3	37	c.3518	CCDS11773.1	17																																																																																			RPTOR	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000141564		0.622	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPTOR	HGNC	protein_coding	OTTHUMT00000438125.1	50	0.00	0	C	NM_020761		78933918	78933918	+1	no_errors	ENST00000306801	ensembl	human	known	69_37n	frame_shift_del	32	49.21	31	DEL	1.000	-
RTL1	388015	genome.wustl.edu	37	14	101350192	101350192	+	Frame_Shift_Del	DEL	C	C	-			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr14:101350192delC	ENST00000534062.1	-	1	992	c.934delG	c.(934-936)gtafs	p.V312fs	MIR432_ENST00000606207.1_RNA|MIR136_ENST00000385207.1_RNA|MIR127_ENST00000384876.1_RNA|MIR431_ENST00000385266.1_RNA|MIR433_ENST00000384837.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	312					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						AAGATGGGTACCAGGCTCTGG	0.607																																						dbGAP											0													65.0	63.0	64.0					14																	101350192		692	1591	2283	-	-	-	SO:0001589	frameshift_variant	0				CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.934delG	14.37:g.101350192delC	ENSP00000435342:p.Val312fs		E9PKS8	Frame_Shift_Del	DEL	pfam_Retrotrans_gag,superfamily_Peptidase_aspartic	p.V312fs	ENST00000534062.1	37	c.934	CCDS53910.1	14																																																																																			RTL1	-	pfam_Retrotrans_gag	ENSG00000254656		0.607	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTL1	HGNC	protein_coding	OTTHUMT00000395127.1	37	0.00	0	C	NM_001134888		101350192	101350192	-1	no_errors	ENST00000534062	ensembl	human	known	69_37n	frame_shift_del	11	15.38	2	DEL	0.931	-
SAA2	6289	genome.wustl.edu	37	11	18269511	18269511	+	Silent	SNP	G	G	T			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr11:18269511G>T	ENST00000526900.1	-	2	231	c.48C>A	c.(46-48)gtC>gtA	p.V16V	RNA5SP333_ENST00000363466.1_RNA|SAA2-SAA4_ENST00000524555.1_RNA|SAA2_ENST00000414546.2_Silent_p.V16V|SAA2_ENST00000530400.1_Silent_p.V16V|SAA2_ENST00000528349.1_Silent_p.V16V|SAA2_ENST00000256733.4_Silent_p.V16V|SAA2_ENST00000529528.1_Silent_p.V16V			P0DJI9	SAA2_HUMAN	serum amyloid A2	16					acute-phase response (GO:0006953)	extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)				central_nervous_system(1)|large_intestine(2)|lung(2)|prostate(1)	6						TTCGGCTGCTGACACTCAGGA	0.517																																						dbGAP											0													144.0	127.0	133.0					11																	18269511		2197	4291	6488	-	-	-	SO:0001819	synonymous_variant	0			M26152	CCDS7833.1, CCDS44548.1	11p15.1-p14	2008-07-21			ENSG00000134339	ENSG00000134339			10514	protein-coding gene	gene with protein product		104751				7686132	Standard	NM_030754		Approved			P0DJI9	OTTHUMG00000166484	ENST00000526900.1:c.48C>A	11.37:g.18269511G>T			G3XAK9|P02735|P02736|P02737|Q16730|Q16834|Q16835|Q16879|Q3KRB3|Q6FG67|Q96QN0|Q9UCK9|Q9UCL0	Silent	SNP	pfam_Serum_amyloid_A,smart_Serum_amyloid_A,pirsf_Serum_amyloid_A,prints_Serum_amyloid_A	p.V16	ENST00000526900.1	37	c.48	CCDS7833.1	11																																																																																			SAA2	-	pirsf_Serum_amyloid_A	ENSG00000134339		0.517	SAA2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SAA2	HGNC	protein_coding	OTTHUMT00000389983.1	109	0.00	0	G	NM_030754		18269511	18269511	-1	no_errors	ENST00000256733	ensembl	human	known	69_37n	silent	81	10.00	9	SNP	0.030	T
SEPT2	4735	genome.wustl.edu	37	2	242275429	242275429	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr2:242275429T>C	ENST00000391973.2	+	5	785	c.257T>C	c.(256-258)gTt>gCt	p.V86A	SEPT2_ENST00000401990.1_Missense_Mutation_p.V96A|SEPT2_ENST00000360051.3_Missense_Mutation_p.V86A|SEPT2_ENST00000407971.1_Missense_Mutation_p.V46A|SEPT2_ENST00000402092.2_Missense_Mutation_p.V86A|SEPT2_ENST00000391971.2_Missense_Mutation_p.V86A	NM_006155.1	NP_006146.1	Q15019	SEPT2_HUMAN	septin 2	86	Septin-type G.				cilium assembly (GO:0042384)|mitotic nuclear division (GO:0007067)|neuron projection development (GO:0031175)|regulation of L-glutamate transport (GO:0002036)|regulation of protein localization (GO:0032880)|smoothened signaling pathway (GO:0007224)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|ciliary membrane (GO:0060170)|ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|exocyst (GO:0000145)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|septin complex (GO:0031105)|synapse (GO:0045202)	enzyme regulator activity (GO:0030234)|GTP binding (GO:0005525)			central_nervous_system(2)|endometrium(1)|large_intestine(4)|lung(3)|skin(2)	12		all_cancers(19;7.62e-41)|all_epithelial(40;1.71e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.24e-34)|all cancers(36;7.15e-32)|OV - Ovarian serous cystadenocarcinoma(60;1.21e-15)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;3.16e-06)|Lung(119;7.81e-05)|LUSC - Lung squamous cell carcinoma(224;0.000742)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0889)		GCTTCAACTGTTGAAATTGAA	0.443																																						dbGAP											0													82.0	79.0	80.0					2																	242275429		2203	4300	6503	-	-	-	SO:0001583	missense	0			D28540	CCDS2548.1, CCDS63195.1, CCDS74682.1	2q37.3	2013-01-21	2005-01-11	2005-01-12	ENSG00000168385	ENSG00000168385		"""Septins"""	7729	protein-coding gene	gene with protein product		601506	"""neural precursor cell expressed, developmentally down-regulated 5"""	DIFF6, NEDD5		8697812	Standard	XM_005247011		Approved	KIAA0158, hNedd5, Pnutl3	uc002wbd.3	Q15019	OTTHUMG00000133394	ENST00000391973.2:c.257T>C	2.37:g.242275429T>C	ENSP00000375834:p.Val86Ala		B4DGE8|Q14132|Q53QU3|Q8IUK9|Q96CB0	Missense_Mutation	SNP	pfam_Cell_div_GTP-bd,pirsf_Septin,prints_Septin2	p.V86A	ENST00000391973.2	37	c.257	CCDS2548.1	2	.	.	.	.	.	.	.	.	.	.	T	22.9	4.353838	0.82243	.	.	ENSG00000168385	ENST00000391973;ENST00000428282;ENST00000360051;ENST00000407017;ENST00000391971;ENST00000401990;ENST00000407971;ENST00000436795;ENST00000411484;ENST00000434955;ENST00000402092;ENST00000443492;ENST00000437066;ENST00000391972;ENST00000449239	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.79749	1.23;1.23;1.23;0.75;1.23;0.75;-1.3;1.23;1.23;1.23;1.23;2.76;1.23;1.23	5.94	4.78	0.61160	.	0.000000	0.85682	D	0.000000	D	0.86016	0.5832	L	0.58583	1.82	0.80722	D	1	P;D;D	0.89917	0.953;1.0;1.0	P;D;D	0.91635	0.802;0.998;0.999	D	0.83766	0.0217	10	0.28530	T	0.3	.	12.32	0.54979	0.0:0.067:0.0:0.933	.	121;46;86	Q15019-2;B5MCX3;Q15019	.;.;SEPT2_HUMAN	A	86;46;86;46;86;96;46;86;97;86;86;46;86;121;86	ENSP00000375834:V86A;ENSP00000397195:V46A;ENSP00000353157:V86A;ENSP00000386001:V46A;ENSP00000375832:V86A;ENSP00000385109:V96A;ENSP00000384525:V46A;ENSP00000406181:V86A;ENSP00000394666:V97A;ENSP00000399767:V86A;ENSP00000385172:V86A;ENSP00000399195:V46A;ENSP00000412434:V86A;ENSP00000391717:V86A	ENSP00000353157:V86A	V	+	2	0	SEPT2	241924102	1.000000	0.71417	0.862000	0.33874	0.994000	0.84299	7.436000	0.80404	2.275000	0.75901	0.528000	0.53228	GTT	SEPT2	-	pfam_Cell_div_GTP-bd,pirsf_Septin,prints_Septin2	ENSG00000168385		0.443	SEPT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SEPT2	HGNC	protein_coding	OTTHUMT00000323177.3	59	0.00	0	T	NM_006155		242275429	242275429	+1	no_errors	ENST00000360051	ensembl	human	known	69_37n	missense	38	19.15	9	SNP	0.998	C
SH3BP1	23616	genome.wustl.edu	37	22	38046694	38046694	+	Silent	SNP	T	T	G			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr22:38046694T>G	ENST00000357436.4	+	16	1873	c.1560T>G	c.(1558-1560)gcT>gcG	p.A520A	SH3BP1_ENST00000599616.1_Silent_p.A456A|Z83844.1_ENST00000456099.1_RNA	NM_018957.3	NP_061830.3	Q9Y3L3	3BP1_HUMAN	SH3-domain binding protein 1	520					signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	Melanoma(58;0.0574)					cagctccagctccggccccag	0.652																																						dbGAP											0													26.0	30.0	29.0					22																	38046694		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0				CCDS13952.2	22q13.1	2011-07-04			ENSG00000100092	ENSG00000100092		"""Rho GTPase activating proteins"""	10824	protein-coding gene	gene with protein product						10591208, 12029088	Standard	NM_018957		Approved	ARHGAP43	uc003ati.3	Q9Y3L3	OTTHUMG00000030996	ENST00000357436.4:c.1560T>G	22.37:g.38046694T>G			Q5R3N0|Q6IBZ2|Q6ZVL9|Q96HQ5|Q9NSQ9	Silent	SNP	pfam_RhoGAP_dom,pfam_BAR_dom,superfamily_Rho_GTPase_activation_prot,smart_BAR_dom,smart_RhoGAP_dom,pfscan_BAR_dom,pfscan_RhoGAP_dom	p.A520	ENST00000357436.4	37	c.1560	CCDS13952.2	22																																																																																			SH3BP1	-	NULL	ENSG00000100092		0.652	SH3BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3BP1	HGNC	protein_coding	OTTHUMT00000075884.4	76	0.00	0	T	NM_018957		38046694	38046694	+1	no_errors	ENST00000357436	ensembl	human	known	69_37n	silent	10	81.48	44	SNP	0.004	G
SHISA9	729993	genome.wustl.edu	37	16	13329149	13329149	+	Frame_Shift_Del	DEL	G	G	-			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr16:13329149delG	ENST00000424107.3	+	5	1603	c.1158delG	c.(1156-1158)aagfs	p.K386fs	SHISA9_ENST00000558583.1_Frame_Shift_Del_p.K427fs			B4DS77	SHSA9_HUMAN	shisa family member 9	386					regulation of short-term neuronal synaptic plasticity (GO:0048172)	cell junction (GO:0030054)|dendritic spine membrane (GO:0032591)|ionotropic glutamate receptor complex (GO:0008328)|synapse (GO:0045202)				breast(1)|endometrium(2)|kidney(1)|lung(2)|prostate(1)|skin(2)	9						ACAGCAACAAGGGCAAGCTTG	0.612																																						dbGAP											0													109.0	133.0	126.0					16																	13329149		692	1591	2283	-	-	-	SO:0001589	frameshift_variant	0				CCDS45417.1, CCDS45418.1, CCDS45417.2, CCDS45418.2	16p13.12	2013-07-31	2013-07-31		ENSG00000237515	ENSG00000237515		"""Shisa homologs"""	37231	protein-coding gene	gene with protein product		613346	"""shisa homolog 9 (Xenopus laevis)"""				Standard	NM_001145205		Approved		uc010uyy.2	B4DS77	OTTHUMG00000154258	ENST00000424107.3:c.1158delG	16.37:g.13329149delG	ENSP00000407958:p.Lys386fs		C9J314|C9JCE9	Frame_Shift_Del	DEL	NULL	p.G428fs	ENST00000424107.3	37	c.1281	CCDS45417.2	16																																																																																			SHISA9	-	NULL	ENSG00000237515		0.612	SHISA9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SHISA9	HGNC	protein_coding	OTTHUMT00000334564.5	61	0.00	0	G	NM_001145204		13329149	13329149	+1	no_errors	ENST00000558583	ensembl	human	known	69_37n	frame_shift_del	37	24.49	12	DEL	1.000	-
SLC12A3	6559	genome.wustl.edu	37	16	56936397	56936397	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr16:56936397G>A	ENST00000563236.1	+	24	2858	c.2833G>A	c.(2833-2835)Gag>Aag	p.E945K	SLC12A3_ENST00000438926.2_Missense_Mutation_p.E954K|SLC12A3_ENST00000262502.5_Missense_Mutation_p.E944K|SLC12A3_ENST00000566786.1_Missense_Mutation_p.E953K			P55017	S12A3_HUMAN	solute carrier family 12 (sodium/chloride transporter), member 3	945					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:chloride symporter activity (GO:0015378)|transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(28)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	CTCAGATGAGGAGATTACGAA	0.567																																						dbGAP											0													82.0	71.0	75.0					16																	56936397		2198	4300	6498	-	-	-	SO:0001583	missense	0				CCDS10770.1, CCDS45491.1, CCDS58464.1	16q13	2013-07-18	2013-07-18		ENSG00000070915	ENSG00000070915		"""Solute carriers"""	10912	protein-coding gene	gene with protein product		600968				8812482	Standard	NM_000339		Approved	NCCT	uc002ekd.4	P55017	OTTHUMG00000133284	ENST00000563236.1:c.2833G>A	16.37:g.56936397G>A	ENSP00000456149:p.Glu945Lys		A8MSJ2|C9JNN9	Missense_Mutation	SNP	pfam_AA-permease_dom,pfam_AA_permease_N,prints_NaCl_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.E954K	ENST00000563236.1	37	c.2860	CCDS58464.1	16	.	.	.	.	.	.	.	.	.	.	G	28.4	4.913601	0.92178	.	.	ENSG00000070915	ENST00000438926;ENST00000262502	D	0.84298	-1.83	5.07	5.07	0.68467	.	0.049410	0.85682	D	0.000000	D	0.92851	0.7726	M	0.87900	2.915	0.80722	D	1	D;P;P	0.67145	0.996;0.83;0.894	D;P;P	0.65874	0.939;0.49;0.688	D	0.94137	0.7393	10	0.87932	D	0	.	17.016	0.86419	0.0:0.0:1.0:0.0	.	953;945;954	P55017-3;P55017;P55017-2	.;S12A3_HUMAN;.	K	953;954	ENSP00000402152:E953K	ENSP00000262502:E954K	E	+	1	0	SLC12A3	55493898	1.000000	0.71417	0.998000	0.56505	0.751000	0.42716	9.125000	0.94402	2.354000	0.79902	0.650000	0.86243	GAG	SLC12A3	-	tigrfam_Na/K/Cl_cotransptS	ENSG00000070915		0.567	SLC12A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC12A3	HGNC	protein_coding	OTTHUMT00000432337.1	27	0.00	0	G			56936397	56936397	+1	no_errors	ENST00000438926	ensembl	human	known	69_37n	missense	9	64.00	16	SNP	1.000	A
SLC35E3	55508	genome.wustl.edu	37	12	69158496	69158496	+	Silent	SNP	C	C	T			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr12:69158496C>T	ENST00000398004.2	+	5	1040	c.768C>T	c.(766-768)ttC>ttT	p.F256F	SLC35E3_ENST00000538043.1_Intron	NM_018656.2	NP_061126.2	Q7Z769	S35E3_HUMAN	solute carrier family 35, member E3	256						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	12	Breast(13;2.31e-06)|Renal(347;0.0684)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00372)			ATAACATGTTCGGACACTTCA	0.343																																						dbGAP											0													161.0	148.0	152.0					12																	69158496		1873	4114	5987	-	-	-	SO:0001819	synonymous_variant	0			AF148713, AY358943	CCDS41808.1	12q15	2014-09-04			ENSG00000175782	ENSG00000175782		"""Solute carriers"""	20864	protein-coding gene	gene with protein product						12975309	Standard	XM_005269006		Approved	BLOV1	uc001suh.3	Q7Z769	OTTHUMG00000169282	ENST00000398004.2:c.768C>T	12.37:g.69158496C>T			A8K0T0|Q0P5Y5|Q9P0V1	Silent	SNP	pfam_DUF250,pfam_DMT	p.F256	ENST00000398004.2	37	c.768	CCDS41808.1	12																																																																																			SLC35E3	-	pfam_DUF250,pfam_DMT	ENSG00000175782		0.343	SLC35E3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35E3	HGNC	protein_coding	OTTHUMT00000403241.1	92	0.00	0	C	NM_018656		69158496	69158496	+1	no_errors	ENST00000398004	ensembl	human	known	69_37n	silent	118	11.94	16	SNP	0.997	T
SMURF2	64750	genome.wustl.edu	37	17	62558993	62558993	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr17:62558993G>C	ENST00000262435.9	-	11	1295	c.1108C>G	c.(1108-1110)Cga>Gga	p.R370G	SMURF2_ENST00000578200.1_Intron	NM_022739.3	NP_073576.1	Q9HAU4	SMUF2_HUMAN	SMAD specific E3 ubiquitin protein ligase 2	370					BMP signaling pathway (GO:0030509)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|SMAD binding (GO:0046332)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)|skin(4)	22	Breast(5;1.32e-14)		BRCA - Breast invasive adenocarcinoma(8;9.88e-12)			ACCAGGTCTCGCTTGTACCTT	0.463																																						dbGAP											0													121.0	101.0	108.0					17																	62558993		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF301463	CCDS32707.1	17q22-q23	2012-10-05			ENSG00000108854	ENSG00000108854			16809	protein-coding gene	gene with protein product		605532				11016919	Standard	XM_005257585		Approved		uc002jep.1	Q9HAU4	OTTHUMG00000179189	ENST00000262435.9:c.1108C>G	17.37:g.62558993G>C	ENSP00000262435:p.Arg370Gly		Q52LL1|Q9H260	Missense_Mutation	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,pfam_C2_Ca-dep,superfamily_HECT,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_WW_Rsp5_WWP,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_C2_membr_targeting,pfscan_WW_Rsp5_WWP	p.R370G	ENST00000262435.9	37	c.1108	CCDS32707.1	17	.	.	.	.	.	.	.	.	.	.	G	12.79	2.043778	0.36085	.	.	ENSG00000108854	ENST00000262435	T	0.51071	0.72	5.82	4.83	0.62350	HECT (1);	0.000000	0.85682	D	0.000000	T	0.71753	0.3377	M	0.87900	2.915	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.77691	-0.2493	10	0.87932	D	0	.	13.7479	0.62887	0.0:0.0:0.7201:0.2799	.	370	Q9HAU4	SMUF2_HUMAN	G	370	ENSP00000262435:R370G	ENSP00000262435:R370G	R	-	1	2	SMURF2	59989455	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.083000	0.30815	1.423000	0.47198	0.650000	0.86243	CGA	SMURF2	-	superfamily_HECT	ENSG00000108854		0.463	SMURF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMURF2	HGNC	protein_coding	OTTHUMT00000445227.1	78	0.00	0	G	NM_022739		62558993	62558993	-1	no_errors	ENST00000262435	ensembl	human	known	69_37n	missense	82	15.46	15	SNP	1.000	C
SNAI1	6615	genome.wustl.edu	37	20	48604479	48604479	+	Silent	SNP	C	C	G	rs375610941		TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr20:48604479C>G	ENST00000244050.2	+	3	742	c.681C>G	c.(679-681)ctC>ctG	p.L227L		NM_005985.3	NP_005976.2	O95863	SNAI1_HUMAN	snail family zinc finger 1	227	Required for nuclear localization and interaction with KPNB1, NOTCH1 and PARP1.				cartilage morphogenesis (GO:0060536)|cell migration (GO:0016477)|epithelial to mesenchymal transition (GO:0001837)|hair follicle morphogenesis (GO:0031069)|left/right pattern formation (GO:0060972)|mesoderm formation (GO:0001707)|negative regulation of cell differentiation involved in embryonic placenta development (GO:0060806)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|Notch signaling involved in heart development (GO:0061314)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of tight junction assembly (GO:2000810)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	kinase binding (GO:0019900)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)	17			BRCA - Breast invasive adenocarcinoma(9;4.03e-06)			GGGCCCACCTCCAGACCCACT	0.632																																						dbGAP											0													129.0	109.0	116.0					20																	48604479		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF125377	CCDS13423.1	20q13.2	2013-05-23	2013-05-23		ENSG00000124216	ENSG00000124216		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	11128	protein-coding gene	gene with protein product		604238	"""snail 1 (drosophila homolog), zinc finger protein"", ""snail homolog 1 (Drosophila)"""			10585766	Standard	NM_005985		Approved	SNA, SLUGH2, SNAH, SNAIL1, SNAIL	uc002xuz.3	O95863	OTTHUMG00000033048	ENST00000244050.2:c.681C>G	20.37:g.48604479C>G			B2R842|Q9P113|Q9UBP7|Q9UHH7	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L227	ENST00000244050.2	37	c.681	CCDS13423.1	20																																																																																			SNAI1	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000124216		0.632	SNAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAI1	HGNC	protein_coding	OTTHUMT00000080350.1	41	0.00	0	C			48604479	48604479	+1	no_errors	ENST00000244050	ensembl	human	known	69_37n	silent	68	15.00	12	SNP	0.994	G
SSPO	23145	genome.wustl.edu	37	7	149477329	149477329	+	RNA	SNP	G	G	A			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr7:149477329G>A	ENST00000378016.2	+	0	1400							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CCCACAGAGCGCCTGTGCCCC	0.692																																						dbGAP											0													19.0	23.0	22.0					7																	149477329		1980	4119	6099	-	-	-			0			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149477329G>A			Q76B61	RNA	SNP	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			SSPO	-	-	ENSG00000197558		0.692	SSPO-202	KNOWN	basic	processed_transcript	SSPO	HGNC	processed_transcript		34	0.00	0	G			149477329	149477329	+1	no_errors	ENST00000262089	ensembl	human	known	69_37n	rna	19	45.71	16	SNP	0.999	A
STK32A	202374	genome.wustl.edu	37	5	146619205	146619205	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr5:146619205C>T	ENST00000397936.3	+	2	341	c.8C>T	c.(7-9)gCg>gTg	p.A3V	STK32A_ENST00000398523.3_Missense_Mutation_p.A3V|STK32A_ENST00000541094.1_Missense_Mutation_p.A3V|STK32A_ENST00000398521.3_Missense_Mutation_p.A3V	NM_001112724.1	NP_001106195.1	Q8WU08	ST32A_HUMAN	serine/threonine kinase 32A	3							ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|prostate(1)|skin(1)	13			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACCATGGGAGCGAACACTTCA	0.403																																						dbGAP											0													62.0	58.0	59.0					5																	146619205		1840	4099	5939	-	-	-	SO:0001583	missense	0				CCDS47299.1, CCDS75351.1	5q32	2008-02-05			ENSG00000169302	ENSG00000169302			28317	protein-coding gene	gene with protein product						12477932	Standard	NM_001112724		Approved	MGC22688, YANK1	uc010jgn.1	Q8WU08	OTTHUMG00000163411	ENST00000397936.3:c.8C>T	5.37:g.146619205C>T	ENSP00000381030:p.Ala3Val		B3KSY0	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.A3V	ENST00000397936.3	37	c.8	CCDS47299.1	5	.	.	.	.	.	.	.	.	.	.	C	16.42	3.118256	0.56505	.	.	ENSG00000169302	ENST00000397936;ENST00000541094;ENST00000398521;ENST00000398523	T;T;T;T	0.68331	-0.32;-0.12;-0.12;-0.32	4.93	4.93	0.64822	.	0.000000	0.44097	D	0.000490	T	0.68952	0.3057	N	0.22421	0.69	0.37354	D	0.910912	B;D;B;B	0.76494	0.089;0.999;0.145;0.009	B;D;B;B	0.68621	0.011;0.959;0.024;0.011	T	0.71334	-0.4624	10	0.39692	T	0.17	.	13.8217	0.63325	0.0:1.0:0.0:0.0	.	3;3;3;3	B7Z9H7;Q8WU08;Q8WU08-3;Q8WU08-2	.;ST32A_HUMAN;.;.	V	3	ENSP00000381030:A3V;ENSP00000443156:A3V;ENSP00000381533:A3V;ENSP00000381535:A3V	ENSP00000381030:A3V	A	+	2	0	STK32A	146599398	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	3.643000	0.54374	2.726000	0.93360	0.585000	0.79938	GCG	STK32A	-	NULL	ENSG00000169302		0.403	STK32A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	STK32A	HGNC	protein_coding	OTTHUMT00000373306.1	49	0.00	0	C	NM_145001		146619205	146619205	+1	no_errors	ENST00000397936	ensembl	human	known	69_37n	missense	11	63.33	19	SNP	1.000	T
STX3	6809	genome.wustl.edu	37	11	59554574	59554574	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr11:59554574A>G	ENST00000337979.4	+	3	726	c.179A>G	c.(178-180)tAc>tGc	p.Y60C	STX3_ENST00000437946.2_Intron|STX3_ENST00000529177.1_Missense_Mutation_p.Y60C|STX3_ENST00000535361.1_Missense_Mutation_p.Y60C|STX3_ENST00000300150.7_Missense_Mutation_p.Y29C	NM_001178040.1|NM_004177.4	NP_001171511.1|NP_004168.1	Q13277	STX3_HUMAN	syntaxin 3	60					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|long-term synaptic potentiation (GO:0060291)|membrane fusion (GO:0061025)|neuron projection development (GO:0031175)|neurotransmitter transport (GO:0006836)	apical plasma membrane (GO:0016324)|azurophil granule (GO:0042582)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|SNARE complex (GO:0031201)|specific granule (GO:0042581)|vacuole (GO:0005773)	arachidonic acid binding (GO:0050544)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|skin(1)	13						AAGAAACTCTACAGTATCATT	0.423																																						dbGAP											0													157.0	140.0	146.0					11																	59554574		2201	4295	6496	-	-	-	SO:0001583	missense	0			AJ002076	CCDS7975.1, CCDS53637.1	11q12.1	2008-02-05	2006-04-25	2006-04-25	ENSG00000166900	ENSG00000166900			11438	protein-coding gene	gene with protein product		600876	"""syntaxin 3A"""	STX3A		16598260, 16339081	Standard	NM_004177		Approved		uc001nog.3	Q13277	OTTHUMG00000167353	ENST00000337979.4:c.179A>G	11.37:g.59554574A>G	ENSP00000338562:p.Tyr60Cys		B4DME0|O43750|O43751|Q15360	Missense_Mutation	SNP	pfam_Syntaxin_N,pfam_T_SNARE_dom,superfamily_t-SNARE,smart_Syntaxin_N,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.Y60C	ENST00000337979.4	37	c.179	CCDS7975.1	11	.	.	.	.	.	.	.	.	.	.	A	18.84	3.709255	0.68615	.	.	ENSG00000166900	ENST00000300150;ENST00000337979;ENST00000535361;ENST00000529177;ENST00000528805	T;T;T;T;T	0.17370	2.28;2.28;2.28;2.28;2.28	5.01	5.01	0.66863	t-SNARE (1);Syntaxin, N-terminal (2);	0.123358	0.56097	D	0.000027	T	0.39009	0.1062	M	0.66939	2.045	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.70016	0.967;0.967	T	0.25117	-1.0141	10	0.87932	D	0	-11.1604	13.5719	0.61851	1.0:0.0:0.0:0.0	.	60;60	B4DME0;Q13277	.;STX3_HUMAN	C	29;60;60;60;12	ENSP00000300150:Y29C;ENSP00000338562:Y60C;ENSP00000441649:Y60C;ENSP00000433248:Y60C;ENSP00000431386:Y12C	ENSP00000300150:Y29C	Y	+	2	0	STX3	59311150	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.365000	0.59486	1.875000	0.54330	0.528000	0.53228	TAC	STX3	-	pfam_Syntaxin_N,superfamily_t-SNARE,smart_Syntaxin_N	ENSG00000166900		0.423	STX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STX3	HGNC	protein_coding	OTTHUMT00000394264.1	60	0.00	0	A	NM_004177		59554574	59554574	+1	no_errors	ENST00000337979	ensembl	human	known	69_37n	missense	15	75.41	46	SNP	1.000	G
TAB3	257397	genome.wustl.edu	37	X	30877660	30877660	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chrX:30877660G>C	ENST00000378933.1	-	2	223	c.46C>G	c.(46-48)Ctt>Gtt	p.L16V	TAB3_ENST00000378932.2_Missense_Mutation_p.L16V|TAB3_ENST00000378930.3_Missense_Mutation_p.L16V|TAB3_ENST00000288422.2_Missense_Mutation_p.L16V	NM_152787.3	NP_690000.2	Q8N5C8	TAB3_HUMAN	TGF-beta activated kinase 1/MAP3K7 binding protein 3	16	CUE. {ECO:0000255|PROSITE- ProRule:PRU00468}.				activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|skin(1)	27						CGTTGTCGAAGATCATGGAGA	0.453																																					Pancreas(164;1598 1985 29022 43301 49529)	dbGAP											0													99.0	77.0	84.0					X																	30877660		2202	4300	6502	-	-	-	SO:0001583	missense	0			AY331591	CCDS14226.1	Xp21.2	2010-02-05	2010-02-05	2010-02-05	ENSG00000157625	ENSG00000157625			30681	protein-coding gene	gene with protein product	"""TAK1 binding protein 3"""	300480	"""mitogen-activated protein kinase kinase kinase 7 interacting protein 3"""	MAP3K7IP3		14633987, 14670075	Standard	XM_005274482		Approved		uc004dcj.3	Q8N5C8	OTTHUMG00000021329	ENST00000378933.1:c.46C>G	X.37:g.30877660G>C	ENSP00000368215:p.Leu16Val		A6NDD9|Q6VQR0	Missense_Mutation	SNP	pfam_CUE,pfam_Znf_RanBP2,superfamily_UBA-like,smart_CUE,smart_Znf_RanBP2,pfscan_CUE,pfscan_Znf_RanBP2	p.L16V	ENST00000378933.1	37	c.46	CCDS14226.1	X	.	.	.	.	.	.	.	.	.	.	G	26.3	4.724981	0.89298	.	.	ENSG00000157625	ENST00000378933;ENST00000378930;ENST00000288422;ENST00000378932	D;D;D;D	0.86230	-2.08;-2.08;-2.08;-2.09	5.36	5.36	0.76844	Ubiquitin system component Cue (3);	0.000000	0.85682	D	0.000000	D	0.92916	0.7746	M	0.65975	2.015	0.80722	D	1	D;D	0.69078	0.996;0.997	D;D	0.85130	0.994;0.997	D	0.93663	0.6983	10	0.87932	D	0	-2.4141	18.178	0.89767	0.0:0.0:1.0:0.0	.	16;16	Q8N5C8-2;Q8N5C8	.;TAB3_HUMAN	V	16	ENSP00000368215:L16V;ENSP00000368212:L16V;ENSP00000288422:L16V;ENSP00000368214:L16V	ENSP00000288422:L16V	L	-	1	0	TAB3	30787581	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.476000	0.97823	2.229000	0.72834	0.506000	0.49869	CTT	TAB3	-	pfam_CUE,superfamily_UBA-like,smart_CUE,pfscan_CUE	ENSG00000157625		0.453	TAB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAB3	HGNC	protein_coding	OTTHUMT00000056173.1	61	0.00	0	G	NM_152787		30877660	30877660	-1	no_errors	ENST00000288422	ensembl	human	known	69_37n	missense	33	19.51	8	SNP	1.000	C
TIMM44	10469	genome.wustl.edu	37	19	7998980	7998980	+	Silent	SNP	G	G	A			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr19:7998980G>A	ENST00000270538.3	-	5	805	c.537C>T	c.(535-537)ctC>ctT	p.L179L	TIMM44_ENST00000598968.1_5'Flank	NM_006351.3	NP_006342.2	O43615	TIM44_HUMAN	translocase of inner mitochondrial membrane 44 homolog (yeast)	179					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|P-P-bond-hydrolysis-driven protein transmembrane transporter activity (GO:0015450)			NS(1)|endometrium(3)|kidney(3)|large_intestine(2)|liver(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	17						TCACCTGGGAGAGGGCTCTGA	0.697																																						dbGAP											0													68.0	74.0	72.0					19																	7998980		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF026030	CCDS12192.1	19p13.3-p13.2	2008-07-04				ENSG00000104980			17316	protein-coding gene	gene with protein product		605058				10848612, 10339406	Standard	NM_006351		Approved	TIM44	uc002miz.3	O43615		ENST00000270538.3:c.537C>T	19.37:g.7998980G>A			A8K0R9|D6W664|Q8N193	Silent	SNP	pfam_Tim44-related/Ribosome_L45,smart_Tim44-related/Ribosome_L45,pirsf_Tim44,tigrfam_Tim44	p.L179	ENST00000270538.3	37	c.537	CCDS12192.1	19																																																																																			TIMM44	-	pirsf_Tim44,tigrfam_Tim44	ENSG00000104980		0.697	TIMM44-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	TIMM44	HGNC	protein_coding	OTTHUMT00000461596.3	50	0.00	0	G			7998980	7998980	-1	no_errors	ENST00000270538	ensembl	human	known	69_37n	silent	39	20.41	10	SNP	0.936	A
TMPRSS11A	339967	genome.wustl.edu	37	4	68797734	68797734	+	Silent	SNP	G	G	A			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr4:68797734G>A	ENST00000334830.7	-	4	1052	c.306C>T	c.(304-306)atC>atT	p.I102I	TMPRSS11A_ENST00000508048.1_Silent_p.I98I|UBA6-AS1_ENST00000500538.2_RNA|TMPRSS11A_ENST00000396188.2_Silent_p.I99I			Q6ZMR5	TM11A_HUMAN	transmembrane protease, serine 11A	102	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell cycle (GO:0007049)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			breast(1)|cervix(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	29						CTTGGTTCTTGATATAATTTT	0.353																																					NSCLC(26;2 894 10941 14480 22546)	dbGAP											0													141.0	139.0	140.0					4																	68797734		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF071882	CCDS3519.1	4q13.2	2010-04-13			ENSG00000187054	ENSG00000187054		"""Serine peptidases / Transmembrane"""	27954	protein-coding gene	gene with protein product		611704				15328353	Standard	NM_182606		Approved	ECRG1	uc003hdr.1	Q6ZMR5	OTTHUMG00000129303	ENST00000334830.7:c.306C>T	4.37:g.68797734G>A			J3KNQ8|Q2NKI9|Q6JE90|Q7RTY4|Q86TK8	Silent	SNP	pirsf_Pept_S1A_HAT/DESC1,pfam_Peptidase_S1_S6,pfam_SEA,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.I102	ENST00000334830.7	37	c.306	CCDS3519.1	4																																																																																			TMPRSS11A	-	pirsf_Pept_S1A_HAT/DESC1,pfam_SEA	ENSG00000187054		0.353	TMPRSS11A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMPRSS11A	HGNC	protein_coding	OTTHUMT00000251433.3	76	0.00	0	G	NM_182606		68797734	68797734	-1	no_errors	ENST00000334830	ensembl	human	known	69_37n	silent	35	12.50	5	SNP	1.000	A
TMPRSS13	84000	genome.wustl.edu	37	11	117780640	117780640	+	Silent	SNP	C	C	T			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr11:117780640C>T	ENST00000430170.2	-	8	1077	c.990G>A	c.(988-990)gcG>gcA	p.A330A	TMPRSS13_ENST00000528626.1_Silent_p.A295A|TMPRSS13_ENST00000524993.1_Silent_p.A330A|TMPRSS13_ENST00000445164.2_Silent_p.A330A|TMPRSS13_ENST00000526090.1_Silent_p.A330A	NM_001244995.1	NP_001231924.1	Q9BYE2	TMPSD_HUMAN	transmembrane protease, serine 13	330	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					blood microparticle (GO:0072562)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|pancreas(1)|prostate(1)|urinary_tract(1)	20	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)		CCGAGGCCAGCGCCCCTCCCA	0.617																																						dbGAP											0													58.0	65.0	63.0					11																	117780640		2115	4222	6337	-	-	-	SO:0001819	synonymous_variant	0			AB048796	CCDS41721.1, CCDS55788.1, CCDS55789.1, CCDS58185.1	11q23	2010-04-13	2005-03-11	2005-03-12	ENSG00000137747	ENSG00000137747		"""Serine peptidases / Transmembrane"""	29808	protein-coding gene	gene with protein product		610050	"""transmembrane protease, serine 11"""	TMPRSS11		11267681	Standard	NM_001077263		Approved	MSPL	uc001prs.2	Q9BYE2	OTTHUMG00000166992	ENST00000430170.2:c.990G>A	11.37:g.117780640C>T			B4DTM9|E9PIJ5|F8WAJ3|Q86YM4|Q96JY8|Q9BYE1	Silent	SNP	pfam_Peptidase_S1_S6,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Srcr_rcpt-rel,superfamily_LDrepeatLR_classA_rpt,smart_Srcr_rcpt-rel,smart_Peptidase_S1_S6,pirsf_Peptidase_S1A_TMPRSS13,prints_Peptidase_S1A,pfscan_Srcr_rcpt,pfscan_Peptidase_S1_S6	p.A330	ENST00000430170.2	37	c.990	CCDS58185.1	11																																																																																			TMPRSS13	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pirsf_Peptidase_S1A_TMPRSS13,pfscan_Peptidase_S1_S6	ENSG00000137747		0.617	TMPRSS13-006	PUTATIVE	basic|appris_candidate|exp_conf|CCDS	protein_coding	TMPRSS13	HGNC	protein_coding	OTTHUMT00000392318.1	22	0.00	0	C	NM_032046		117780640	117780640	-1	no_errors	ENST00000445164	ensembl	human	known	69_37n	silent	27	35.71	15	SNP	0.006	T
TRRAP	8295	genome.wustl.edu	37	7	98565273	98565273	+	Silent	SNP	G	G	A			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr7:98565273G>A	ENST00000359863.4	+	50	7652	c.7443G>A	c.(7441-7443)caG>caA	p.Q2481Q	TRRAP_ENST00000355540.3_Silent_p.Q2463Q|TRRAP_ENST00000446306.3_Silent_p.Q2463Q	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	2481					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			CCTGTTCGCAGAACTGGGAAG	0.537																																						dbGAP											0													53.0	49.0	50.0					7																	98565273		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.7443G>A	7.37:g.98565273G>A			A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.R2203K	ENST00000359863.4	37	c.6608	CCDS59066.1	7	.	.	.	.	.	.	.	.	.	.	G	8.209	0.799947	0.16397	.	.	ENSG00000196367	ENST00000456197	.	.	.	5.93	4.11	0.48088	.	.	.	.	.	T	0.62221	0.2410	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57728	-0.7761	4	.	.	.	.	11.804	0.52143	0.1482:0.0:0.8518:0.0	.	.	.	.	K	2203	.	.	R	+	2	0	TRRAP	98403209	1.000000	0.71417	1.000000	0.80357	0.845000	0.48019	1.701000	0.37825	2.826000	0.97356	0.655000	0.94253	AGA	TRRAP	-	superfamily_ARM-type_fold	ENSG00000196367		0.537	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRRAP	HGNC	protein_coding	OTTHUMT00000317978.1	45	0.00	0	G	NM_003496		98565273	98565273	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000456197	ensembl	human	novel	69_37n	missense	25	34.21	13	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179623810	179623810	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr2:179623810C>T	ENST00000591111.1	-	44	10428	c.10204G>A	c.(10204-10206)Gaa>Aaa	p.E3402K	TTN_ENST00000589042.1_Missense_Mutation_p.E3402K|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E3402K|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.E3356K|TTN_ENST00000342175.6_Missense_Mutation_p.E3356K|TTN_ENST00000359218.5_Missense_Mutation_p.E3356K|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.E3402K|TTN-AS1_ENST00000590773.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13718	Ig-like 20.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCGGCAATTTCCAGTTGATAA	0.423																																						dbGAP											0													137.0	121.0	126.0					2																	179623810		2203	4300	6503	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10204G>A	2.37:g.179623810C>T	ENSP00000465570:p.Glu3402Lys		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.E3402K	ENST00000591111.1	37	c.10204		2	.	.	.	.	.	.	.	.	.	.	C	20.2	3.947170	0.73672	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870;ENST00000446208	T;T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25;-0.25	5.92	5.92	0.95590	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.79353	0.4431	L	0.46567	1.45	0.44880	D	0.997895	D;D;D;D;D	0.89917	0.999;0.999;0.999;0.999;1.0	D;D;D;D;D	0.87578	0.996;0.996;0.996;0.996;0.998	T	0.79487	-0.1783	9	0.87932	D	0	.	20.3214	0.98679	0.0:1.0:0.0:0.0	.	3356;3356;3356;3402;3402	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	K	3402;3356;3356;3356;3356;3402;7	ENSP00000343764:E3402K;ENSP00000434586:E3356K;ENSP00000340554:E3356K;ENSP00000352154:E3356K;ENSP00000354117:E3402K	ENSP00000340554:E3356K	E	-	1	0	TTN	179332055	1.000000	0.71417	0.998000	0.56505	0.959000	0.62525	7.786000	0.85741	2.804000	0.96469	0.655000	0.94253	GAA	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000155657		0.423	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	60	0.00	0	C	NM_133378		179623810	179623810	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	39	13.33	6	SNP	1.000	T
TUBB8	347688	genome.wustl.edu	37	10	93104	93104	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr10:93104C>T	ENST00000309812.4	-	4	1290	c.1228G>A	c.(1228-1230)Gag>Aag	p.E410K	TUBB8_ENST00000447903.2_Missense_Mutation_p.E338K|TUBB8_ENST00000413237.3_5'Flank	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	410					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		CTCTCGGCCTCGGTGAATTCC	0.552																																					Pancreas(192;2041 3010 9013 18103)	dbGAP											0													23.0	24.0	24.0					10																	93104		2172	4226	6398	-	-	-	SO:0001583	missense	0			AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.1228G>A	10.37:g.93104C>T	ENSP00000311042:p.Glu410Lys		Q5SQX9|Q8WZ78	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_myosin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin,prints_Alpha_tubulin	p.E410K	ENST00000309812.4	37	c.1228	CCDS7051.1	10	.	.	.	.	.	.	.	.	.	.	C	11.45	1.641706	0.29157	.	.	ENSG00000173876	ENST00000447903;ENST00000272035;ENST00000440680;ENST00000328974	D	0.88201	-2.35	.	.	.	Tubulin, C-terminal (1);Tubulin/FtsZ, C-terminal (1);	0.000000	0.64402	U	0.000013	D	0.87920	0.6299	H	0.95079	3.62	0.36350	D	0.860006	P;P	0.38711	0.643;0.467	B;B	0.22386	0.039;0.034	D	0.85282	0.1062	9	0.87932	D	0	.	5.9051	0.18992	0.0:0.9992:0.0:8.0E-4	.	373;410	C9JAA5;Q3ZCM7	.;TBB8_HUMAN	K	338;376;373;410	ENSP00000403895:E338K	ENSP00000272035:E376K	E	-	1	0	RP11-631M21.2	83104	0.999000	0.42202	0.509000	0.27700	0.512000	0.34134	5.268000	0.65536	0.119000	0.18210	0.121000	0.15741	GAG	TUBB8	-	superfamily_Tub_FtsZ_C,prints_Gamma_tubulin,prints_Delta_tubulin	ENSG00000173876		0.552	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB8	HGNC	protein_coding	OTTHUMT00000467795.1	81	0.00	0	C	NM_177987		93104	93104	-1	no_errors	ENST00000328974	ensembl	human	known	69_37n	missense	50	40.48	34	SNP	1.000	T
USP24	23358	genome.wustl.edu	37	1	55566622	55566622	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr1:55566622C>T	ENST00000294383.6	-	44	5160	c.5161G>A	c.(5161-5163)Gat>Aat	p.D1721N	USP24_ENST00000407756.1_Missense_Mutation_p.D1561N	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	1721	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						GTGTCATCATCCACTGAAAGT	0.378																																						dbGAP											0													114.0	108.0	110.0					1																	55566622		1879	4101	5980	-	-	-	SO:0001583	missense	0			AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.5161G>A	1.37:g.55566622C>T	ENSP00000294383:p.Asp1721Asn		Q6ZSY2|Q8N2Y4|Q9NXD1	Missense_Mutation	SNP	pfam_Peptidase_C19,superfamily_UBA-like,superfamily_ARM-type_fold,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Peptidase_C19	p.D1721N	ENST00000294383.6	37	c.5161	CCDS44154.2	1	.	.	.	.	.	.	.	.	.	.	C	16.57	3.159257	0.57368	.	.	ENSG00000162402	ENST00000294383;ENST00000407756	T;T	0.65549	-0.16;-0.16	5.68	5.68	0.88126	.	0.097490	0.64402	D	0.000001	T	0.55178	0.1904	N	0.25992	0.78	0.58432	D	0.999991	P	0.43938	0.822	B	0.43536	0.423	T	0.49579	-0.8925	10	0.21540	T	0.41	.	19.7964	0.96487	0.0:1.0:0.0:0.0	.	1561	B7WPF4	.	N	1721;1561	ENSP00000294383:D1721N;ENSP00000385700:D1561N	ENSP00000294383:D1721N	D	-	1	0	USP24	55339210	1.000000	0.71417	1.000000	0.80357	0.267000	0.26476	7.487000	0.81328	2.683000	0.91414	0.555000	0.69702	GAT	USP24	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000162402		0.378	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	USP24	HGNC	protein_coding	OTTHUMT00000022275.2	59	0.00	0	C			55566622	55566622	-1	no_errors	ENST00000294383	ensembl	human	known	69_37n	missense	25	51.92	27	SNP	1.000	T
VLDLR	7436	genome.wustl.edu	37	9	2650444	2650444	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr9:2650444G>A	ENST00000382100.3	+	15	2535	c.2179G>A	c.(2179-2181)Gat>Aat	p.D727N	VLDLR_ENST00000382099.2_Missense_Mutation_p.D727N	NM_003383.3	NP_003374.3	P98155	VLDLR_HUMAN	very low density lipoprotein receptor	727	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cholesterol metabolic process (GO:0008203)|glycoprotein transport (GO:0034436)|lipid transport (GO:0006869)|memory (GO:0007613)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|positive regulation of dendrite development (GO:1900006)|positive regulation of protein kinase activity (GO:0045860)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|signal transduction (GO:0007165)|ventral spinal cord development (GO:0021517)|very-low-density lipoprotein particle clearance (GO:0034447)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|very-low-density lipoprotein particle (GO:0034361)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|glycoprotein binding (GO:0001948)|glycoprotein transporter activity (GO:0034437)|low-density lipoprotein receptor activity (GO:0005041)|reelin receptor activity (GO:0038025)|very-low-density lipoprotein particle binding (GO:0034189)|very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	24				GBM - Glioblastoma multiforme(50;0.0668)|Lung(218;0.123)		ACAGATTAATGATCACTCTCC	0.408																																						dbGAP											0													158.0	131.0	140.0					9																	2650444		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6446.1, CCDS34979.1	9p24	2014-01-24			ENSG00000147852	ENSG00000147852		"""Low density lipoprotein receptors"""	12698	protein-coding gene	gene with protein product		192977				8294473	Standard	XM_006716864		Approved	CARMQ1, CHRMQ1, VLDLRCH	uc003zhk.1	P98155	OTTHUMG00000019447	ENST00000382100.3:c.2179G>A	9.37:g.2650444G>A	ENSP00000371532:p.Asp727Asn		B2RMZ7|D3DRH6|Q5VVF6	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EGF-like_Ca-bd,superfamily_LDrepeatLR_classA_rpt,superfamily_Growth_fac_rcpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.D727N	ENST00000382100.3	37	c.2179	CCDS6446.1	9	.	.	.	.	.	.	.	.	.	.	G	16.23	3.065202	0.55432	.	.	ENSG00000147852	ENST00000382100;ENST00000382099;ENST00000382092	T;T	0.80123	-1.34;-1.34	5.42	5.42	0.78866	Growth factor, receptor (1);Epidermal growth factor-like (1);	0.117523	0.38111	N	0.001807	T	0.74861	0.3772	N	0.20766	0.605	0.46874	D	0.999232	B;B;B	0.32526	0.374;0.258;0.325	B;B;B	0.41440	0.357;0.195;0.187	T	0.68907	-0.5285	10	0.14656	T	0.56	.	19.5778	0.95452	0.0:0.0:1.0:0.0	.	727;727;727	P98155-2;Q5VVF5;P98155	.;.;VLDLR_HUMAN	N	727;727;606	ENSP00000371532:D727N;ENSP00000371531:D727N	ENSP00000371524:D606N	D	+	1	0	VLDLR	2640444	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	5.594000	0.67557	2.704000	0.92352	0.467000	0.42956	GAT	VLDLR	-	superfamily_Growth_fac_rcpt,smart_EGF-like	ENSG00000147852		0.408	VLDLR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VLDLR	HGNC	protein_coding	OTTHUMT00000051519.2	48	0.00	0	G	NM_003383		2650444	2650444	+1	no_errors	ENST00000382100	ensembl	human	known	69_37n	missense	29	29.27	12	SNP	1.000	A
VPS13B	157680	genome.wustl.edu	37	8	100779156	100779156	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr8:100779156G>A	ENST00000358544.2	+	40	7391	c.7280G>A	c.(7279-7281)aGa>aAa	p.R2427K	VPS13B_ENST00000395996.1_3'UTR|VPS13B_ENST00000357162.2_Missense_Mutation_p.R2402K	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	2427					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			GATCTTTGGAGAATTGTCTTG	0.368																																					Colon(161;2205 2542 7338 31318)	dbGAP											0													74.0	70.0	71.0					8																	100779156		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.7280G>A	8.37:g.100779156G>A	ENSP00000351346:p.Arg2427Lys		C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	pfam_Autophagy-rel_C	p.R2427K	ENST00000358544.2	37	c.7280	CCDS6280.1	8	.	.	.	.	.	.	.	.	.	.	G	35	5.558836	0.96514	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.75938	-0.97;-0.98	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	D	0.85440	0.5697	M	0.61703	1.905	0.80722	D	1	D;D	0.64830	0.994;0.994	D;D	0.70716	0.913;0.97	D	0.85126	0.0972	10	0.66056	D	0.02	.	20.4024	0.99000	0.0:0.0:1.0:0.0	.	2402;2427	Q7Z7G8-2;Q7Z7G8	.;VP13B_HUMAN	K	2402;2427	ENSP00000349685:R2402K;ENSP00000351346:R2427K	ENSP00000349685:R2402K	R	+	2	0	VPS13B	100848332	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.229000	0.95273	2.827000	0.97445	0.650000	0.86243	AGA	VPS13B	-	NULL	ENSG00000132549		0.368	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13B	HGNC	protein_coding	OTTHUMT00000277138.1	50	0.00	0	G	NM_184042		100779156	100779156	+1	no_errors	ENST00000358544	ensembl	human	known	69_37n	missense	50	10.71	6	SNP	1.000	A
VSIG1	340547	genome.wustl.edu	37	X	107320311	107320311	+	Silent	SNP	C	C	T	rs200336582		TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chrX:107320311C>T	ENST00000217957.5	+	7	981	c.864C>T	c.(862-864)agC>agT	p.S288S	VSIG1_ENST00000415430.3_Silent_p.S324S	NM_182607.4	NP_872413.1	Q86XK7	VSIG1_HUMAN	V-set and immunoglobulin domain containing 1	288						integral component of membrane (GO:0016021)		p.S324S(2)|p.S288S(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	17						GGGGAGAAAGCGAAGCAATGC	0.443																																						dbGAP											3	Substitution - coding silent(3)	endometrium(3)											89.0	85.0	86.0					X																	107320311		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BX648658	CCDS14535.1, CCDS55474.1	Xq22.3	2013-01-29			ENSG00000101842	ENSG00000101842		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28675	protein-coding gene	gene with protein product		300620				12477932	Standard	NM_182607		Approved	MGC44287	uc011msk.2	Q86XK7	OTTHUMG00000022175	ENST00000217957.5:c.864C>T	X.37:g.107320311C>T			C9J4P2|Q6MZS4	Silent	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	p.S324	ENST00000217957.5	37	c.972	CCDS14535.1	X																																																																																			VSIG1	-	NULL	ENSG00000101842		0.443	VSIG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	VSIG1	HGNC	protein_coding	OTTHUMT00000057858.1	43	0.00	0	C	NM_182607		107320311	107320311	+1	no_errors	ENST00000415430	ensembl	human	known	69_37n	silent	6	71.43	15	SNP	0.000	T
YAF2	10138	genome.wustl.edu	37	12	42629602	42629602	+	Intron	SNP	G	G	T			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr12:42629602G>T	ENST00000534854.2	-	2	220				YAF2_ENST00000327791.4_Intron|PPHLN1_ENST00000549190.1_5'Flank|YAF2_ENST00000541702.2_5'UTR|YAF2_ENST00000442791.3_Intron|YAF2_ENST00000555248.2_Missense_Mutation_p.A117D|YAF2_ENST00000380788.3_Intron|YAF2_ENST00000380790.4_Intron	NM_005748.4	NP_005739.2	Q8IY57	YAF2_HUMAN	YY1 associated factor 2						negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(1)|large_intestine(1)|lung(3)|skin(1)	8	all_cancers(12;0.000425)	Lung NSC(34;0.0402)|all_lung(34;0.057)		GBM - Glioblastoma multiforme(48;0.0514)		TGGGCCTCAAGCCTCTTTTAA	0.458																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U72209	CCDS31775.1, CCDS53778.1, CCDS53779.1, CCDS53780.1	12q12	2014-09-04			ENSG00000015153	ENSG00000015153			17363	protein-coding gene	gene with protein product		607534				9016636	Standard	NM_001190977		Approved		uc001rmw.3	Q8IY57	OTTHUMG00000169380	ENST00000534854.2:c.152+1798C>A	12.37:g.42629602G>T			A8K5P0|B4DFU3|G3V465|Q99710	Missense_Mutation	SNP	pfam_Znf_RanBP2,pfam_Uncharacterised_FAM123,smart_Znf_RanBP2,pfscan_Znf_RanBP2	p.A117D	ENST00000534854.2	37	c.350	CCDS31775.1	12	.	.	.	.	.	.	.	.	.	.	G	9.866	1.197708	0.22037	.	.	ENSG00000258720	ENST00000555248	.	.	.	4.13	1.25	0.21368	.	.	.	.	.	T	0.16300	0.0392	N	0.08118	0	0.19300	N	0.999974	B	0.29085	0.232	B	0.28232	0.087	T	0.27502	-1.0072	7	.	.	.	.	6.3342	0.21287	0.1002:0.3603:0.5395:0.0	.	117	G3V465	.	D	117	.	.	A	-	2	0	YAF2	40915869	0.988000	0.35896	0.991000	0.47740	0.998000	0.95712	0.860000	0.27871	0.284000	0.22305	0.655000	0.94253	GCT	YAF2	-	NULL	ENSG00000015153		0.458	YAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YAF2	HGNC	protein_coding	OTTHUMT00000403781.1	63	0.00	0	G			42629602	42629602	-1	no_errors	ENST00000555248	ensembl	human	known	69_37n	missense	18	64.71	33	SNP	0.992	T
ZIC1	7545	genome.wustl.edu	37	3	147128862	147128862	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr3:147128862C>G	ENST00000282928.4	+	1	1692	c.963C>G	c.(961-963)atC>atG	p.I321M		NM_003412.3	NP_003403.2	Q15915	ZIC1_HUMAN	Zic family member 1	321					adult walking behavior (GO:0007628)|brain development (GO:0007420)|cell differentiation (GO:0030154)|inner ear morphogenesis (GO:0042472)|pattern specification process (GO:0007389)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord development (GO:0021510)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(4)|cervix(1)|endometrium(2)|large_intestine(8)|lung(38)|ovary(1)|prostate(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	63						ATTTAAAGATCCACAAAAGGA	0.587																																						dbGAP											0													45.0	48.0	47.0					3																	147128862		2203	4300	6503	-	-	-	SO:0001583	missense	0			D76435	CCDS3136.1	3q24	2013-01-08	2011-05-19		ENSG00000152977	ENSG00000152977		"""Zinc fingers, C2H2-type"""	12872	protein-coding gene	gene with protein product		600470	"""Zic family member 1 (odd-paired Drosophila homolog)"", ""Zic family member 1 (odd-paired homolog, Drosophila)"""			8542595	Standard	NM_003412		Approved	ZIC, ZNF201	uc003ewe.3	Q15915	OTTHUMG00000159456	ENST00000282928.4:c.963C>G	3.37:g.147128862C>G	ENSP00000282928:p.Ile321Met		Q2M3N1	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.I321M	ENST00000282928.4	37	c.963	CCDS3136.1	3	.	.	.	.	.	.	.	.	.	.	C	13.44	2.236449	0.39498	.	.	ENSG00000152977	ENST00000282928	D	0.96427	-4.01	3.89	2.98	0.34508	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.95736	0.8613	L	0.31578	0.945	0.58432	D	0.999996	P	0.47409	0.895	D	0.74023	0.982	D	0.94878	0.8036	10	0.87932	D	0	.	8.4508	0.32869	0.1647:0.7421:0.0:0.0932	.	321	Q15915	ZIC1_HUMAN	M	321	ENSP00000282928:I321M	ENSP00000282928:I321M	I	+	3	3	ZIC1	148611552	0.994000	0.37717	1.000000	0.80357	0.994000	0.84299	0.360000	0.20250	1.862000	0.54008	0.561000	0.74099	ATC	ZIC1	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000152977		0.587	ZIC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIC1	HGNC	protein_coding	OTTHUMT00000355497.1	40	0.00	0	C	NM_003412		147128862	147128862	+1	no_errors	ENST00000282928	ensembl	human	known	69_37n	missense	18	43.75	14	SNP	1.000	G
ZNF142	7701	genome.wustl.edu	37	2	219507867	219507867	+	Silent	SNP	G	G	A			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr2:219507867G>A	ENST00000449707.1	-	8	3793	c.3372C>T	c.(3370-3372)atC>atT	p.I1124I	ZNF142_ENST00000411696.2_Silent_p.I1124I	NM_001105537.1	NP_001099007.1	P52746	ZN142_HUMAN	zinc finger protein 142	1124					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(7)|endometrium(7)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38		Renal(207;0.0474)		Epithelial(149;5.21e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		GGCAGCCCCGGATCTGGTGAG	0.612																																					Colon(170;867 1942 8995 15834 18053)	dbGAP											0													36.0	42.0	40.0					2																	219507867		1973	4138	6111	-	-	-	SO:0001819	synonymous_variant	0			U09849	CCDS42817.1	2q35	2013-01-08	2006-06-13		ENSG00000115568	ENSG00000115568		"""Zinc fingers, C2H2-type"""	12927	protein-coding gene	gene with protein product		604083	"""zinc finger protein 142 (clone pHZ-49)"""				Standard	NM_001105537		Approved	KIAA0236, pHZ-49	uc002vin.4	P52746	OTTHUMG00000154736	ENST00000449707.1:c.3372C>T	2.37:g.219507867G>A			Q92510	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.I1124	ENST00000449707.1	37	c.3372	CCDS42817.1	2																																																																																			ZNF142	-	smart_Znf_C2H2-like	ENSG00000115568		0.612	ZNF142-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF142	HGNC	protein_coding	OTTHUMT00000336833.1	66	0.00	0	G	NM_005081		219507867	219507867	-1	no_errors	ENST00000411696	ensembl	human	known	69_37n	silent	83	15.31	15	SNP	0.306	A
ZNF146	7705	genome.wustl.edu	37	19	36727858	36727858	+	Silent	SNP	A	A	T			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr19:36727858A>T	ENST00000443387.2	+	4	1508	c.516A>T	c.(514-516)atA>atT	p.I172I	ZNF565_ENST00000355114.5_Intron|ZNF146_ENST00000456324.1_Silent_p.I172I	NM_007145.2	NP_009076.2	Q15072	OZF_HUMAN	zinc finger protein 146	172					regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	11	Esophageal squamous(110;0.162)					AGTACCTCATAAAACATCAGA	0.403																																						dbGAP											0													114.0	102.0	106.0					19																	36727858		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X70394	CCDS12492.1	19q13.1	2013-01-08				ENSG00000167635		"""Zinc fingers, C2H2-type"""	12931	protein-coding gene	gene with protein product		601505				10449921, 8641144	Standard	NM_001099639		Approved	OZF	uc010eeu.3	Q15072		ENST00000443387.2:c.516A>T	19.37:g.36727858A>T			Q2TB94	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.I172	ENST00000443387.2	37	c.516	CCDS12492.1	19																																																																																			ZNF146	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000167635		0.403	ZNF146-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF146	HGNC	protein_coding	OTTHUMT00000451706.1	40	0.00	0	A	NM_007145		36727858	36727858	+1	no_errors	ENST00000443387	ensembl	human	known	69_37n	silent	29	18.42	7	SNP	0.955	T
ZNF527	84503	genome.wustl.edu	37	19	37880273	37880273	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr19:37880273C>T	ENST00000436120.2	+	5	1429	c.1322C>T	c.(1321-1323)cCc>cTc	p.P441L	ZNF527_ENST00000587349.1_Intron	NM_032453.1	NP_115829.1	Q8NB42	ZN527_HUMAN	zinc finger protein 527	441					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	33			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GGAGAGAAACCCTTCAAATGT	0.433																																						dbGAP											0													65.0	71.0	69.0					19																	37880273		2198	4296	6494	-	-	-	SO:0001583	missense	0			AB058732, AK091585	CCDS42559.1	19q13.1	2013-01-08			ENSG00000189164	ENSG00000189164		"""Zinc fingers, C2H2-type"", ""-"""	29385	protein-coding gene	gene with protein product						11347906	Standard	NM_032453		Approved	KIAA1829	uc010efk.1	Q8NB42	OTTHUMG00000048173	ENST00000436120.2:c.1322C>T	19.37:g.37880273C>T	ENSP00000390179:p.Pro441Leu		B4DVL5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P441L	ENST00000436120.2	37	c.1322	CCDS42559.1	19	.	.	.	.	.	.	.	.	.	.	C	20.8	4.050457	0.75960	.	.	ENSG00000189164	ENST00000356178;ENST00000317566;ENST00000436120	.	.	.	3.42	3.42	0.39159	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.34088	N	0.004272	T	0.74574	0.3734	M	0.61703	1.905	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.72625	0.976;0.978	T	0.77867	-0.2428	9	0.62326	D	0.03	.	13.794	0.63160	0.0:1.0:0.0:0.0	.	441;409	Q8NB42;Q8NB42-2	ZN527_HUMAN;.	L	441;409;389	.	ENSP00000325231:P409L	P	+	2	0	ZNF527	42572113	0.928000	0.31464	0.987000	0.45799	0.987000	0.75469	4.318000	0.59190	1.769000	0.52152	0.655000	0.94253	CCC	ZNF527	-	pfscan_Znf_C2H2	ENSG00000189164		0.433	ZNF527-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF527	HGNC	protein_coding	OTTHUMT00000458434.1	29	0.00	0	C	NM_032453		37880273	37880273	+1	no_errors	ENST00000436120	ensembl	human	known	69_37n	missense	46	28.12	18	SNP	0.998	T
ZNF679	168417	genome.wustl.edu	37	7	63727200	63727200	+	Frame_Shift_Del	DEL	A	A	-			TCGA-E2-A574-01A-11D-A29N-09	TCGA-E2-A574-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afd1023-472c-4d73-a303-980c4e755a5d	dfbfaff6-e80b-4c47-8539-5ef2723f6ed9	g.chr7:63727200delA	ENST00000421025.1	+	5	1458	c.1189delA	c.(1189-1191)aatfs	p.N397fs	ZNF679_ENST00000255746.4_Frame_Shift_Del_p.N397fs	NM_001159524.1|NM_153363.2	NP_001152996.1|NP_699194.2	Q8IYX0	ZN679_HUMAN	zinc finger protein 679	397					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|lung(11)|skin(1)|stomach(1)	18						AAGTCTTGCTAATCATAAGAG	0.353																																						dbGAP											0													29.0	28.0	28.0					7																	63727200		692	1591	2283	-	-	-	SO:0001589	frameshift_variant	0			BC033523	CCDS47592.1	7q11.21	2013-01-08			ENSG00000197123	ENSG00000197123		"""Zinc fingers, C2H2-type"", ""-"""	28650	protein-coding gene	gene with protein product	"""hypothetical protein MGC42415"""					12477932	Standard	NM_153363		Approved	MGC42415	uc003tsx.3	Q8IYX0	OTTHUMG00000156486	ENST00000421025.1:c.1189delA	7.37:g.63727200delA	ENSP00000416809:p.Asn397fs			Frame_Shift_Del	DEL	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.N397fs	ENST00000421025.1	37	c.1189	CCDS47592.1	7																																																																																			ZNF679	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197123		0.353	ZNF679-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF679	HGNC	protein_coding	OTTHUMT00000344317.2	48	0.00	0	A	NM_153363		63727200	63727200	+1	no_errors	ENST00000255746	ensembl	human	known	69_37n	frame_shift_del	15	11.76	2	DEL	0.139	-
