#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAM11	4185	genome.wustl.edu	37	17	42855138	42855138	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr17:42855138G>C	ENST00000200557.6	+	23	2146	c.1977G>C	c.(1975-1977)atG>atC	p.M659I	ADAM11_ENST00000535346.1_Missense_Mutation_p.M459I	NM_002390.4	NP_002381.2	O75078	ADA11_HUMAN	ADAM metallopeptidase domain 11	659	Cys-rich.				integrin-mediated signaling pathway (GO:0007229)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(15)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Prostate(33;0.0959)				GGCCTAACATGTTGTGCCTGG	0.652																																						dbGAP											0													48.0	45.0	46.0					17																	42855138		2203	4299	6502	-	-	-	SO:0001583	missense	0			D17390	CCDS11486.1	17q21.3	2014-08-12	2005-08-18		ENSG00000073670			"""ADAM metallopeptidase domain containing"""	189	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, cysteine-rich protein"""	155120	"""a disintegrin and metalloproteinase domain 11"""	MDC		8252040	Standard	XM_005257373		Approved		uc002ihh.3	O75078	OTTHUMG00000179038	ENST00000200557.6:c.1977G>C	17.37:g.42855138G>C	ENSP00000200557:p.Met659Ile		Q14808|Q14809|Q14810	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,prints_Blood-coag_inhib_Disintegrin,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B	p.M659I	ENST00000200557.6	37	c.1977	CCDS11486.1	17	.	.	.	.	.	.	.	.	.	.	G	20.2	3.949897	0.73787	.	.	ENSG00000073670	ENST00000200557;ENST00000535346	T;T	0.02140	4.43;4.83	4.36	4.36	0.52297	ADAM, cysteine-rich (1);	0.000000	0.85682	D	0.000000	T	0.11495	0.0280	M	0.86178	2.8	0.58432	D	0.999999	P;D	0.65815	0.769;0.995	P;P	0.58391	0.486;0.838	T	0.02471	-1.1154	10	0.44086	T	0.13	.	15.8196	0.78628	0.0:0.0:1.0:0.0	.	459;659	B4DKD2;O75078	.;ADA11_HUMAN	I	659;459	ENSP00000200557:M659I;ENSP00000443773:M459I	ENSP00000200557:M659I	M	+	3	0	ADAM11	40210664	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.546000	0.82137	2.256000	0.74724	0.561000	0.74099	ATG	ADAM11	-	smart_ADAM_Cys-rich	ENSG00000073670		0.652	ADAM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM11	HGNC	protein_coding	OTTHUMT00000444531.1	25	0.00	0	G	NM_002390		42855138	42855138	+1	no_errors	ENST00000200557	ensembl	human	known	69_37n	missense	19	29.63	8	SNP	1.000	C
CCDC39	339829	genome.wustl.edu	37	3	180379771	180379771	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr3:180379771C>T	ENST00000442201.2	-	3	354	c.235G>A	c.(235-237)Gag>Aag	p.E79K	CCDC39_ENST00000273654.4_Missense_Mutation_p.E163K	NM_181426.1	NP_852091.1	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	79					axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)				NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			CTTTCAGTCTCACGCTCCCTT	0.333																																						dbGAP											0													73.0	62.0	65.0					3																	180379771		1810	4065	5875	-	-	-	SO:0001583	missense	0			BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000442201.2:c.235G>A	3.37:g.180379771C>T	ENSP00000405708:p.Glu79Lys		B4E2H1	Missense_Mutation	SNP	superfamily_Prefoldin,superfamily_tRNA-bd_arm	p.E79K	ENST00000442201.2	37	c.235	CCDS46964.1	3	.	.	.	.	.	.	.	.	.	.	C	25.1	4.598206	0.87055	.	.	ENSG00000145075	ENST00000273654;ENST00000442201;ENST00000471307	T	0.81247	-1.47	5.38	5.38	0.77491	.	0.095377	0.64402	D	0.000001	D	0.82632	0.5079	M	0.65975	2.015	0.58432	D	0.999994	B	0.28400	0.21	B	0.34873	0.191	T	0.81803	-0.0765	10	0.62326	D	0.03	-7.9742	19.1199	0.93358	0.0:1.0:0.0:0.0	.	79	Q9UFE4	CCD39_HUMAN	K	163;79;61	ENSP00000418702:E61K	ENSP00000273654:E163K	E	-	1	0	CCDC39	181862465	1.000000	0.71417	0.997000	0.53966	0.727000	0.41649	6.612000	0.74187	2.502000	0.84385	0.655000	0.94253	GAG	CCDC39	-	superfamily_tRNA-bd_arm	ENSG00000145075		0.333	CCDC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC39	HGNC	protein_coding	OTTHUMT00000349783.3	79	0.00	0	C	XM_291028		180379771	180379771	-1	no_errors	ENST00000442201	ensembl	human	known	69_37n	missense	36	21.74	10	SNP	1.000	T
ALG3	10195	genome.wustl.edu	37	3	183963556	183963556	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr3:183963556C>T	ENST00000397676.3	-	2	271	c.241G>A	c.(241-243)Gtc>Atc	p.V81I	ALG3_ENST00000455059.1_Missense_Mutation_p.V41I|ALG3_ENST00000445626.2_Missense_Mutation_p.V33I|ALG3_ENST00000418734.2_Intron|ALG3_ENST00000463495.1_5'Flank|EIF2B5_ENST00000444495.1_Intron	NM_005787.5	NP_005778.1	Q92685	ALG3_HUMAN	ALG3, alpha-1,3- mannosyltransferase	81					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-1,3-mannosyltransferase activity (GO:0000033)|dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase activity (GO:0052925)			kidney(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(1)	9	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CCATTGATGACGCCTTCTACC	0.517																																						dbGAP											0													112.0	108.0	109.0					3																	183963556		2068	4209	6277	-	-	-	SO:0001583	missense	0			BC002839	CCDS46967.1, CCDS46968.1	3q27.3	2013-02-26	2013-02-26		ENSG00000214160	ENSG00000214160	2.4.1.258	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	23056	protein-coding gene	gene with protein product	"""carbohydrate deficient glycoprotein syndrome type IV"", ""dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase"", ""dol-P-Man dependent alpha-1,3- mannosyltransferase"""	608750	"""asparagine-linked glycosylation 3 homolog (yeast, alpha-1,3-mannosyltransferase)"", ""asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae)"""			1058125	Standard	NM_005787		Approved	NOT56L, Not56, CDGS4, D16Ertd36e	uc003fne.2	Q92685	OTTHUMG00000156823	ENST00000397676.3:c.241G>A	3.37:g.183963556C>T	ENSP00000380793:p.Val81Ile		A8JZZ6|Q9BT71	Missense_Mutation	SNP	pfam_Glycosyltransferase_ALG3	p.V81I	ENST00000397676.3	37	c.241	CCDS46968.1	3	.	.	.	.	.	.	.	.	.	.	C	14.66	2.601656	0.46423	.	.	ENSG00000214160	ENST00000397676;ENST00000445626;ENST00000455059	D;D;D	0.85088	-1.94;-1.94;-1.94	4.73	3.82	0.43975	.	0.163924	0.38492	U	0.001663	T	0.78130	0.4235	N	0.25031	0.7	0.80722	D	1	P;P;P	0.50369	0.751;0.846;0.934	B;P;P	0.46917	0.312;0.531;0.47	T	0.75059	-0.3451	10	0.29301	T	0.29	-12.212	11.4944	0.50400	0.3347:0.6653:0.0:0.0	.	33;41;81	A8JZZ6;C9J7S5;Q92685	.;.;ALG3_HUMAN	I	81;33;41	ENSP00000380793:V81I;ENSP00000402744:V33I;ENSP00000397613:V41I	ENSP00000380793:V81I	V	-	1	0	ALG3	185446250	1.000000	0.71417	0.989000	0.46669	0.492000	0.33523	4.468000	0.60162	1.167000	0.42706	0.456000	0.33151	GTC	ALG3	-	pfam_Glycosyltransferase_ALG3	ENSG00000214160		0.517	ALG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG3	HGNC	protein_coding	OTTHUMT00000346033.1	61	0.00	0	C	NM_005787		183963556	183963556	-1	no_errors	ENST00000397676	ensembl	human	known	69_37n	missense	11	54.17	13	SNP	0.992	T
CDH9	1007	genome.wustl.edu	37	5	26881562	26881562	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr5:26881562C>A	ENST00000231021.4	-	12	2225	c.2053G>T	c.(2053-2055)Gac>Tac	p.D685Y		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	685					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						AGTTTACTGTCTTCTCTTGCC	0.438																																					Melanoma(8;187 585 15745 40864 52829)	dbGAP											0													193.0	187.0	189.0					5																	26881562		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.2053G>T	5.37:g.26881562C>A	ENSP00000231021:p.Asp685Tyr		Q3B7I5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D685Y	ENST00000231021.4	37	c.2053	CCDS3893.1	5	.	.	.	.	.	.	.	.	.	.	C	17.48	3.401414	0.62288	.	.	ENSG00000113100	ENST00000231021	T	0.56444	0.46	4.96	4.96	0.65561	Cadherin, cytoplasmic domain (1);	0.323774	0.37095	N	0.002248	T	0.71970	0.3403	M	0.77820	2.39	0.42064	D	0.991178	P;P	0.47762	0.9;0.686	P;P	0.62649	0.905;0.823	T	0.73404	-0.3993	9	.	.	.	.	17.1426	0.86758	0.0:1.0:0.0:0.0	.	278;685	B4DFP0;Q9ULB4	.;CADH9_HUMAN	Y	685	ENSP00000231021:D685Y	.	D	-	1	0	CDH9	26917319	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.853000	0.62911	2.447000	0.82792	0.557000	0.71058	GAC	CDH9	-	pfam_Cadherin_cytoplasmic-dom	ENSG00000113100		0.438	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH9	HGNC	protein_coding	OTTHUMT00000207352.1	97	0.00	0	C	NM_016279		26881562	26881562	-1	no_errors	ENST00000231021	ensembl	human	known	69_37n	missense	54	15.62	10	SNP	1.000	A
DCHS2	54798	genome.wustl.edu	37	4	155160378	155160378	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr4:155160378T>A	ENST00000357232.4	-	24	6070	c.6071A>T	c.(6070-6072)aAc>aTc	p.N2024I		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2024	Cadherin 18. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		GTAAGAAATGTTCTCATTGCT	0.383																																						dbGAP											0													64.0	64.0	64.0					4																	155160378		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.6071A>T	4.37:g.155160378T>A	ENSP00000349768:p.Asn2024Ile		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	pfam_Cadherin,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.N2024I	ENST00000357232.4	37	c.6071	CCDS3785.1	4	.	.	.	.	.	.	.	.	.	.	T	8.678	0.904425	0.17760	.	.	ENSG00000197410	ENST00000357232	T	0.68331	-0.32	5.92	0.327	0.15913	Cadherin (4);Cadherin-like (1);	0.769865	0.12433	N	0.469382	T	0.67692	0.2920	H	0.95816	3.725	0.09310	N	1	B	0.30021	0.265	B	0.24155	0.051	T	0.62918	-0.6752	10	0.41790	T	0.15	.	1.7664	0.03003	0.1841:0.1441:0.1098:0.5621	.	2024	Q6V1P9	PCD23_HUMAN	I	2024	ENSP00000349768:N2024I	ENSP00000349768:N2024I	N	-	2	0	DCHS2	155379828	0.012000	0.17670	0.327000	0.25402	0.226000	0.24999	0.901000	0.28445	0.469000	0.27268	-0.421000	0.06004	AAC	DCHS2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000197410		0.383	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365281.2	61	0.00	0	T	NM_001142552		155160378	155160378	-1	no_errors	ENST00000357232	ensembl	human	known	69_37n	missense	26	29.73	11	SNP	0.026	A
DCHS2	54798	genome.wustl.edu	37	4	155411020	155411020	+	Silent	SNP	G	G	T			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr4:155411020G>T	ENST00000339452.1	-	1	1848	c.1488C>A	c.(1486-1488)ccC>ccA	p.P496P	DCHS2_ENST00000456341.2_Silent_p.P489P|DCHS2_ENST00000443500.1_Silent_p.P496P	NM_001142552.1	NP_001136024.1	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1650	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		CTCTGTCCAGGGGCCCCTCCA	0.652																																						dbGAP											0													38.0	42.0	41.0					4																	155411020		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000339452.1:c.1488C>A	4.37:g.155411020G>T			B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Silent	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P496	ENST00000339452.1	37	c.1488	CCDS47150.1	4																																																																																			DCHS2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000197410		0.652	DCHS2-002	KNOWN	basic|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365282.1	13	0.00	0	G	NM_001142552		155411020	155411020	-1	no_errors	ENST00000339452	ensembl	human	known	69_37n	silent	24	25.00	8	SNP	0.997	T
DHX8	1659	genome.wustl.edu	37	17	41570310	41570310	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr17:41570310C>A	ENST00000262415.3	+	6	837	c.765C>A	c.(763-765)gaC>gaA	p.D255E	DHX8_ENST00000540306.1_Missense_Mutation_p.D255E	NM_004941.1	NP_004932.1	Q14562	DHX8_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 8	255					ATP catabolic process (GO:0006200)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.08)		AGCATGTGGACCGCCCTCCTC	0.527																																					NSCLC(56;1548 1661 49258 49987)	dbGAP											0													113.0	111.0	111.0					17																	41570310		2203	4300	6503	-	-	-	SO:0001583	missense	0			D50487	CCDS11464.1	17q21.31	2005-08-19	2003-06-13	2003-06-20		ENSG00000067596		"""DEAH-boxes"""	2749	protein-coding gene	gene with protein product		600396	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 8 (RNA helicase)"""	DDX8		7935475	Standard	NM_004941		Approved	HRH1, PRP22, PRPF22	uc002idu.1	Q14562		ENST00000262415.3:c.765C>A	17.37:g.41570310C>A	ENSP00000262415:p.Asp255Glu			Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_DUF1605,pfam_Rbsml_prot_S1_RNA-bd_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_NA-bd_OB-fold-like,smart_RNA-binding_domain_S1,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Rbsml_prot_S1_RNA-bd_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.D255E	ENST00000262415.3	37	c.765	CCDS11464.1	17	.	.	.	.	.	.	.	.	.	.	C	7.573	0.667081	0.14710	.	.	ENSG00000067596	ENST00000540306;ENST00000262415	T;T	0.42513	0.97;0.97	5.33	5.33	0.75918	.	0.154075	0.56097	D	0.000034	T	0.28366	0.0701	L	0.38175	1.15	0.45554	D	0.998504	B;B	0.16396	0.017;0.002	B;B	0.14578	0.011;0.002	T	0.08452	-1.0721	10	0.02654	T	1	.	11.479	0.50314	0.0:0.918:0.0:0.082	.	255;255	F5H658;Q14562	.;DHX8_HUMAN	E	255	ENSP00000437886:D255E;ENSP00000262415:D255E	ENSP00000262415:D255E	D	+	3	2	DHX8	38925836	1.000000	0.71417	1.000000	0.80357	0.554000	0.35429	1.437000	0.34991	2.489000	0.83994	0.591000	0.81541	GAC	DHX8	-	NULL	ENSG00000067596		0.527	DHX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX8	HGNC	protein_coding	OTTHUMT00000453485.1	47	0.00	0	C			41570310	41570310	+1	no_errors	ENST00000262415	ensembl	human	known	69_37n	missense	26	16.13	5	SNP	1.000	A
DIP2A	23181	genome.wustl.edu	37	21	47910571	47910571	+	Silent	SNP	C	C	G			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr21:47910571C>G	ENST00000417564.2	+	3	243	c.222C>G	c.(220-222)gcC>gcG	p.A74A	DIP2A_ENST00000457905.3_Silent_p.A74A|DIP2A_ENST00000435722.3_Silent_p.A74A|DIP2A_ENST00000427143.2_Intron|DIP2A_ENST00000400274.1_Silent_p.A74A|DIP2A_ENST00000318711.7_Silent_p.A74A|DIP2A_ENST00000466639.1_Silent_p.A74A			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	74	DMAP-interaction.				multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		AAACCACGGCCGCTGCACCCA	0.552																																						dbGAP											0													28.0	31.0	30.0					21																	47910571		1945	4101	6046	-	-	-	SO:0001819	synonymous_variant	0			AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.222C>G	21.37:g.47910571C>G			A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Silent	SNP	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.A74	ENST00000417564.2	37	c.222	CCDS46655.1	21																																																																																			DIP2A	-	pfam_DMAP1-bd	ENSG00000160305		0.552	DIP2A-012	KNOWN	basic|CCDS	protein_coding	DIP2A	HGNC	protein_coding	OTTHUMT00000376736.1	44	0.00	0	C	NM_015151		47910571	47910571	+1	no_errors	ENST00000318711	ensembl	human	known	69_37n	silent	23	37.84	14	SNP	0.000	G
DIS3L2	129563	genome.wustl.edu	37	2	232995451	232995451	+	Frame_Shift_Del	DEL	C	C	-			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr2:232995451delC	ENST00000409401.3	+	7	899	c.724delC	c.(724-726)ccafs	p.P242fs	DIS3L2_ENST00000409307.1_Intron|DIS3L2_ENST00000273009.6_Intron|DIS3L2_ENST00000470087.1_3'UTR|DIS3L2_ENST00000360410.4_Intron|DIS3L2_ENST00000325385.7_Intron	NM_001257282.1	NP_001244211.1			DIS3 like 3'-5' exoribonuclease 2											breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(2)|urinary_tract(1)	40		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		CAGATTTTCTCCACGTGTCCA	0.423																																						dbGAP											0													68.0	65.0	66.0					2																	232995451		1881	4102	5983	-	-	-	SO:0001589	frameshift_variant	0			BC026166	CCDS42834.1, CCDS58752.1, CCDS58753.1	2q37.1	2014-09-17	2014-03-05		ENSG00000144535	ENSG00000144535			28648	protein-coding gene	gene with protein product		614184	"""family with sequence similarity 6, member A"", ""DIS3 mitotic control homolog (S. cerevisiae)-like 2"""	FAM6A		22306653, 23503588	Standard	NM_152383		Approved	FLJ36974, MGC42174	uc010fxz.3	Q8IYB7	OTTHUMG00000153385	ENST00000409401.3:c.724delC	2.37:g.232995451delC	ENSP00000386594:p.Pro242fs			Frame_Shift_Del	DEL	NULL	p.P242fs	ENST00000409401.3	37	c.724	CCDS58753.1	2																																																																																			DIS3L2	-	NULL	ENSG00000144535		0.423	DIS3L2-003	KNOWN	basic|CCDS	protein_coding	DIS3L2	HGNC	protein_coding	OTTHUMT00000330976.1	40	0.00	0	C	NM_152383		232995451	232995451	+1	no_errors	ENST00000409401	ensembl	human	known	69_37n	frame_shift_del	14	12.50	2	DEL	0.000	-
DNAJC28	54943	genome.wustl.edu	37	21	34860884	34860884	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr21:34860884C>G	ENST00000314399.3	-	2	1255	c.817G>C	c.(817-819)Gca>Cca	p.A273P	DNAJC28_ENST00000381947.3_Missense_Mutation_p.A273P|DNAJC28_ENST00000402202.1_Missense_Mutation_p.A273P	NM_017833.3	NP_060303.2	Q9NX36	DJC28_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 28	273										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(5)|skin(1)|urinary_tract(1)	18						ACTAAAATTGCCTCTCTGAGT	0.388																																						dbGAP											0													171.0	170.0	170.0					21																	34860884		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000468	CCDS13626.1	21q22.11	2011-09-02	2008-06-17	2008-06-17	ENSG00000177692	ENSG00000177692		"""Heat shock proteins / DNAJ (HSP40)"""	1297	protein-coding gene	gene with protein product	"""Orf28"""		"""chromosome 21 open reading frame 55"""	C21orf55			Standard	NM_017833		Approved	C21orf78	uc002yrw.3	Q9NX36	OTTHUMG00000065531	ENST00000314399.3:c.817G>C	21.37:g.34860884C>G	ENSP00000320303:p.Ala273Pro		D3DSF2	Missense_Mutation	SNP	pfam_DnaJ_homolog_subfam-C_membr-28,pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,pfscan_DnaJ_N	p.A273P	ENST00000314399.3	37	c.817	CCDS13626.1	21	.	.	.	.	.	.	.	.	.	.	C	11.84	1.758702	0.31137	.	.	ENSG00000177692	ENST00000381947;ENST00000314399;ENST00000402202	.	.	.	5.37	3.53	0.40419	DnaJ homologue, subfamily C, member 28, conserved domain (1);	0.508177	0.21823	N	0.068597	T	0.31071	0.0785	L	0.60455	1.87	0.09310	N	1	P	0.39157	0.662	B	0.39617	0.305	T	0.13899	-1.0492	9	0.30854	T	0.27	-2.8561	5.1919	0.15214	0.149:0.6264:0.0:0.2246	.	273	Q9NX36	DJC28_HUMAN	P	273	.	ENSP00000320303:A273P	A	-	1	0	DNAJC28	33782754	0.009000	0.17119	0.290000	0.24890	0.940000	0.58332	0.682000	0.25335	0.626000	0.30322	0.650000	0.86243	GCA	DNAJC28	-	pfam_DnaJ_homolog_subfam-C_membr-28	ENSG00000177692		0.388	DNAJC28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC28	HGNC	protein_coding	OTTHUMT00000140454.3	83	0.00	0	C			34860884	34860884	-1	no_errors	ENST00000314399	ensembl	human	known	69_37n	missense	58	29.27	24	SNP	0.017	G
EFHD1	80303	genome.wustl.edu	37	2	233546363	233546365	+	In_Frame_Del	DEL	GGA	GGA	-			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	GGA	GGA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr2:233546363_233546365delGGA	ENST00000264059.3	+	4	1131_1133	c.654_656delGGA	c.(652-657)cgggag>cgg	p.E222del	EFHD1_ENST00000409708.1_In_Frame_Del_p.E110del|EFHD1_ENST00000410095.1_In_Frame_Del_p.E110del|snoU13_ENST00000459149.1_RNA|EFHD1_ENST00000409613.1_In_Frame_Del_p.E126del	NM_025202.3	NP_079478.1	Q9BUP0	EFHD1_HUMAN	EF-hand domain family, member D1	222					neuron projection development (GO:0031175)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|large_intestine(2)|lung(3)	7		all_hematologic(139;0.0123)|Acute lymphoblastic leukemia(138;0.0182)|Breast(86;0.0199)|Renal(207;0.025)		Epithelial(121;2.08e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000383)|LUSC - Lung squamous cell carcinoma(224;0.00825)|Lung(119;0.0101)		AGCGGAAGCGGGAGGAGGAGGAG	0.547																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0				CCDS2497.1, CCDS58755.1	2q37.1	2014-07-01	2005-01-25		ENSG00000115468	ENSG00000115468		"""EF-hand domain containing"""	29556	protein-coding gene	gene with protein product	"""swiprosin-2"""	611617	"""EF hand domain containing 1"""			21244694	Standard	NM_025202		Approved	FLJ13612	uc002vtc.3	Q9BUP0	OTTHUMG00000133263	ENST00000264059.3:c.654_656delGGA	2.37:g.233546372_233546374delGGA	ENSP00000264059:p.Glu222del		B2RD83|E9PFH3|Q9BTF8|Q9H8I2|Q9HBQ0	In_Frame_Del	DEL	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.E222in_frame_del	ENST00000264059.3	37	c.654_656	CCDS2497.1	2																																																																																			EFHD1	-	NULL	ENSG00000115468		0.547	EFHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFHD1	HGNC	protein_coding	OTTHUMT00000257040.2	47	0.00	0	GGA	NM_025202		233546363	233546365	+1	no_errors	ENST00000264059	ensembl	human	known	69_37n	in_frame_del	17	15.00	3	DEL	0.139:0.908:0.992	-
EGFL8	80864	genome.wustl.edu	37	6	32133979	32133979	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr6:32133979G>A	ENST00000395512.1	+	2	142	c.37G>A	c.(37-39)Gga>Aga	p.G13R	PPT2-EGFL8_ENST00000422437.1_3'UTR|EGFL8_ENST00000333845.6_Missense_Mutation_p.G13R|PPT2-EGFL8_ENST00000453656.2_3'UTR|PPT2_ENST00000437001.2_3'UTR|AGPAT1_ENST00000490711.1_5'Flank			Q99944	EGFL8_HUMAN	EGF-like-domain, multiple 8	13						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(4)|urinary_tract(1)	10						TCTCTTAGGCGGATTCTCCTT	0.602																																						dbGAP											0													83.0	69.0	74.0					6																	32133979		2203	4300	6503	-	-	-	SO:0001583	missense	0			U89336	CCDS4743.1	6p21	2010-06-25	2003-05-21	2003-05-23	ENSG00000241404	ENSG00000241404			13944	protein-coding gene	gene with protein product		609897	"""chromosome 6 open reading frame 8"""	C6orf8			Standard	NM_030652		Approved	NG3		Q99944	OTTHUMG00000031222	ENST00000395512.1:c.37G>A	6.37:g.32133979G>A	ENSP00000378888:p.Gly13Arg		B0S884|G5E9Q0|Q5JP23|Q5SSX3|Q8IV30	Missense_Mutation	SNP	pfam_EMI_domain,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom,pfscan_EMI_domain	p.G13R	ENST00000395512.1	37	c.37	CCDS4743.1	6	.	.	.	.	.	.	.	.	.	.	G	13.58	2.278677	0.40294	.	.	ENSG00000241404	ENST00000333845;ENST00000395512;ENST00000432129	D;D;T	0.92595	-3.07;-3.07;1.49	5.16	2.35	0.29111	.	.	.	.	.	T	0.75982	0.3924	L	0.32530	0.975	0.09310	N	1	B	0.27416	0.178	B	0.21151	0.033	T	0.67917	-0.5546	9	0.72032	D	0.01	-3.824	7.1767	0.25749	0.0896:0.3296:0.5808:0.0	.	13	Q99944	EGFL8_HUMAN	R	13	ENSP00000333380:G13R;ENSP00000378888:G13R;ENSP00000401694:G13R	ENSP00000333380:G13R	G	+	1	0	EGFL8	32241957	0.306000	0.24490	0.026000	0.17262	0.347000	0.29111	1.321000	0.33678	0.314000	0.23086	-0.305000	0.09177	GGA	EGFL8	-	NULL	ENSG00000241404		0.602	EGFL8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EGFL8	HGNC	protein_coding	OTTHUMT00000076463.3	48	0.00	0	G	NM_030652		32133979	32133979	+1	no_errors	ENST00000333845	ensembl	human	known	69_37n	missense	25	34.21	13	SNP	0.017	A
EPHA5	2044	genome.wustl.edu	37	4	66356262	66356262	+	Missense_Mutation	SNP	A	A	T			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr4:66356262A>T	ENST00000273854.3	-	5	1835	c.1235T>A	c.(1234-1236)gTc>gAc	p.V412D	EPHA5_ENST00000511294.1_Missense_Mutation_p.V412D|EPHA5_ENST00000432638.2_Intron|EPHA5_ENST00000354839.4_Missense_Mutation_p.V412D	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	412	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						AAGGTACCTGACATGACCGCC	0.502										TSP Lung(17;0.13)																												dbGAP											0													120.0	92.0	102.0					4																	66356262		2203	4300	6503	-	-	-	SO:0001583	missense	0			L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.1235T>A	4.37:g.66356262A>T	ENSP00000273854:p.Val412Asp		Q7Z3F2	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pirsf_Tyr_kinase_ephrin_rcpt,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.V412D	ENST00000273854.3	37	c.1235	CCDS3513.1	4	.	.	.	.	.	.	.	.	.	.	A	26.5	4.746768	0.89663	.	.	ENSG00000145242	ENST00000273854;ENST00000354839;ENST00000511294	T;T;T	0.77489	-1.1;-1.03;-1.1	6.08	6.08	0.98989	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.56097	D	0.000038	D	0.90807	0.7113	M	0.92555	3.32	0.80722	D	1	D;D;D;D	0.67145	0.989;0.996;0.987;0.994	D;D;D;D	0.74674	0.962;0.984;0.936;0.938	D	0.92789	0.6247	10	0.87932	D	0	.	16.6512	0.85203	1.0:0.0:0.0:0.0	.	412;412;412;412	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	D	412	ENSP00000273854:V412D;ENSP00000346899:V412D;ENSP00000427638:V412D	ENSP00000273854:V412D	V	-	2	0	EPHA5	66038857	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.474000	0.81024	2.333000	0.79357	0.482000	0.46254	GTC	EPHA5	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pirsf_Tyr_kinase_ephrin_rcpt,pfscan_Fibronectin_type3	ENSG00000145242		0.502	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPHA5	HGNC	protein_coding	OTTHUMT00000251388.2	50	0.00	0	A	NM_004439		66356262	66356262	-1	no_errors	ENST00000273854	ensembl	human	known	69_37n	missense	28	12.50	4	SNP	1.000	T
ETV1	2115	genome.wustl.edu	37	7	14025746	14025746	+	Intron	SNP	G	G	T			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr7:14025746G>T	ENST00000430479.1	-	5	849				ETV1_ENST00000420159.2_Missense_Mutation_p.T19K|ETV1_ENST00000405358.4_Intron|ETV1_ENST00000242066.5_Intron|ETV1_ENST00000405218.2_Intron|ETV1_ENST00000399357.3_Missense_Mutation_p.T19K|ETV1_ENST00000476720.2_5'Flank|ETV1_ENST00000403685.1_Intron|ETV1_ENST00000403527.1_Missense_Mutation_p.T19K|ETV1_ENST00000343495.5_Intron|ETV1_ENST00000405192.2_Intron	NM_004956.4	NP_004947.2	P50549	ETV1_HUMAN	ets variant 1						axon guidance (GO:0007411)|cell differentiation (GO:0030154)|mechanosensory behavior (GO:0007638)|muscle organ development (GO:0007517)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		TMPRSS2/ETV1(34)|ACSL3_ENST00000357430/ETV1(2)|EWSR1/ETV1(7)|KLK2/ETV1(3)|SLC45A3/ETV1(3)|HNRNPA2B1/ETV1(8)	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31						CACACCTAACGTTCTGTGTTG	0.353			T	"""EWSR1, TMPRSS2, SLC45A3, C15orf21, HNRNPA2B1. ACSL3"""	"""Ewing sarcoma, prostate"""																																	dbGAP		Dom	yes		7	7p22	2115	ets variant gene 1		"""M, E"""	0													82.0	70.0	73.0					7																	14025746		1568	3581	5149	-	-	-	SO:0001627	intron_variant	0				CCDS55083.1, CCDS55084.1, CCDS55085.1, CCDS55086.1, CCDS55087.1, CCDS55088.1	7p22	2008-09-12	2008-09-12		ENSG00000006468	ENSG00000006468			3490	protein-coding gene	gene with protein product		600541	"""ets variant gene 1"""			1340465	Standard	NM_004956		Approved	ER81	uc003ssw.4	P50549	OTTHUMG00000152403	ENST00000430479.1:c.181+516C>A	7.37:g.14025746G>T			A4D118|B2R768|B7Z2I4|B7Z618|B7Z9P2|C9JT37|E9PHB1|F5GXR2|O75849|Q4KMQ6|Q59GA7|Q6AI30|Q9UQ71|Q9Y636	Missense_Mutation	SNP	pfam_ETS_PEA3_N,pfam_Ets,smart_Ets,pfscan_Ets,prints_Ets	p.T19K	ENST00000430479.1	37	c.56	CCDS55088.1	7	.	.	.	.	.	.	.	.	.	.	G	16.81	3.225475	0.58668	.	.	ENSG00000006468	ENST00000420159;ENST00000399357;ENST00000403527;ENST00000438956;ENST00000443608	T;T;T;T;T	0.33865	3.03;2.82;2.81;2.04;1.39	5.88	5.88	0.94601	.	.	.	.	.	T	0.25044	0.0608	N	0.08118	0	0.24878	N	0.992249	B;B;B	0.20164	0.034;0.042;0.042	B;B;B	0.24155	0.03;0.051;0.051	T	0.23868	-1.0176	9	0.56958	D	0.05	.	15.7427	0.77914	0.0:0.1358:0.8642:0.0	.	19;19;19	F5GXR2;B7Z9P2;E9PHB1	.;.;.	K	19	ENSP00000411626:T19K;ENSP00000382293:T19K;ENSP00000384138:T19K;ENSP00000393078:T19K;ENSP00000394710:T19K	ENSP00000382293:T19K	T	-	2	0	ETV1	13992271	1.000000	0.71417	0.973000	0.42090	0.991000	0.79684	3.332000	0.52083	2.805000	0.96524	0.551000	0.68910	ACG	ETV1	-	NULL	ENSG00000006468		0.353	ETV1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	ETV1	HGNC	protein_coding	OTTHUMT00000326111.1	66	0.00	0	G	NM_004956		14025746	14025746	-1	no_errors	ENST00000420159	ensembl	human	known	69_37n	missense	38	15.56	7	SNP	0.988	T
GNB2L1	10399	genome.wustl.edu	37	5	180665141	180665141	+	Silent	SNP	G	G	C			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr5:180665141G>C	ENST00000512805.1	-	6	1143	c.735C>G	c.(733-735)cgC>cgG	p.R245R	GNB2L1_ENST00000511566.1_Intron|GNB2L1_ENST00000511900.1_Silent_p.R197R|GNB2L1_ENST00000514455.1_Silent_p.R29R|GNB2L1_ENST00000376817.4_Silent_p.R201R|GNB2L1_ENST00000505461.1_5'Flank|GNB2L1_ENST00000504726.1_Intron	NM_006098.4	NP_006089.1	P63244	GBLP_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1	245					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cell cycle (GO:0007049)|gastrulation (GO:0007369)|negative regulation of cell growth (GO:0030308)|negative regulation of gene expression (GO:0010629)|negative regulation of hydrogen peroxide-induced neuron death (GO:1903208)|negative regulation of phagocytosis (GO:0050765)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein tyrosine kinase activity (GO:0061099)|negative regulation of translation (GO:0017148)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cAMP catabolic process (GO:0030822)|positive regulation of cell migration (GO:0030335)|positive regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051343)|positive regulation of gastrulation (GO:2000543)|positive regulation of GTPase activity (GO:0043547)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein phosphorylation (GO:0001934)|regulation of cell cycle (GO:0051726)|regulation of cell division (GO:0051302)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|regulation of protein localization (GO:0032880)|rhythmic process (GO:0048511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|midbody (GO:0030496)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|phagocytic cup (GO:0001891)|small ribosomal subunit (GO:0015935)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|ion channel inhibitor activity (GO:0008200)|poly(A) RNA binding (GO:0044822)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase inhibitor activity (GO:0030292)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|SH2 domain binding (GO:0042169)			lung(3)|skin(2)	5	all_cancers(89;8.79e-06)|all_epithelial(37;1.13e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0654)	all_cancers(40;0.000209)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.101)|all cancers(165;0.11)		ACAGCCAGTAGCGGTTAGGGC	0.552																																						dbGAP											0													167.0	146.0	153.0					5																	180665141		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M24194	CCDS34324.1	5q35.3	2013-01-10				ENSG00000204628		"""WD repeat domain containing"""	4399	protein-coding gene	gene with protein product	"""Receptor for Activated C Kinase 1"""	176981				8302854, 2499885	Standard	NM_006098		Approved	Gnb2-rs1, RACK1, H12.3	uc003mni.1	P63244		ENST00000512805.1:c.735C>G	5.37:g.180665141G>C			B3KTJ0|D3DWS0|P25388|P99049|Q53HU2|Q5J8M6|Q5VLR4|Q6FH47	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.L152V	ENST00000512805.1	37	c.454	CCDS34324.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.21|10.21	1.288122|1.288122	0.23478|0.23478	.|.	.|.	ENSG00000204628|ENSG00000204628	ENST00000507756;ENST00000509535|ENST00000509148;ENST00000502905;ENST00000504128	.|.	.|.	.|.	5.67|5.67	0.554|0.554	0.17241|0.17241	.|.	.|.	.|.	.|.	.|.	T|T	0.44993|0.44993	0.1320|0.1320	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.21724|0.21724	-1.0237|-1.0237	4|4	.|.	.|.	.|.	-14.8759|-14.8759	3.4547|3.4547	0.07511|0.07511	0.3256:0.0:0.3777:0.2967|0.3256:0.0:0.3777:0.2967	.|.	.|.	.|.	.|.	G|V	176;103|19;126;152	.|.	.|.	A|L	-|-	2|1	0|2	GNB2L1|GNB2L1	180597747|180597747	0.978000|0.978000	0.34361|0.34361	0.994000|0.994000	0.49952|0.49952	0.992000|0.992000	0.81027|0.81027	0.124000|0.124000	0.15728|0.15728	-0.180000|-0.180000	0.10637|0.10637	0.655000|0.655000	0.94253|0.94253	GCT|CTA	GNB2L1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000204628		0.552	GNB2L1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	GNB2L1	HGNC	protein_coding	OTTHUMT00000372943.2	49	0.00	0	G	NM_006098		180665141	180665141	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000504128	ensembl	human	putative	69_37n	missense	34	17.07	7	SNP	0.996	C
GTF3C4	9329	genome.wustl.edu	37	9	135553785	135553785	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr9:135553785A>G	ENST00000372146.4	+	2	1343	c.779A>G	c.(778-780)cAg>cGg	p.Q260R	GTF3C4_ENST00000483873.2_Intron	NM_012204.2	NP_036336.2	Q9UKN8	TF3C4_HUMAN	general transcription factor IIIC, polypeptide 4, 90kDa	260					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|positive regulation of catalytic activity (GO:0043085)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase III promoter (GO:0006384)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)|enzyme activator activity (GO:0008047)|histone acetyltransferase activity (GO:0004402)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;8.15e-07)|Epithelial(140;2.6e-05)		TGTACCACCCAGCAGGTCAAG	0.557																																					Pancreas(142;417 1875 11086 31973 47667)	dbGAP											0													114.0	111.0	112.0					9																	135553785		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF142328	CCDS6953.1	9q34.3	2011-07-01	2002-08-29		ENSG00000125484	ENSG00000125484		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""General transcription factors"""	4667	protein-coding gene	gene with protein product		604892	"""general transcription factor IIIC, polypeptide 4 (90kD)"""			10523658	Standard	NM_012204		Approved	TFIIIC90, KAT12	uc010mzv.3	Q9UKN8	OTTHUMG00000020842	ENST00000372146.4:c.779A>G	9.37:g.135553785A>G	ENSP00000361219:p.Gln260Arg		Q5VZJ7	Missense_Mutation	SNP	superfamily_WD40_repeat_dom	p.Q260R	ENST00000372146.4	37	c.779	CCDS6953.1	9	.	.	.	.	.	.	.	.	.	.	A	15.15	2.748855	0.49257	.	.	ENSG00000125484	ENST00000372146	T	0.46063	0.88	5.82	5.82	0.92795	Transcription factor IIIC, 90kDa subunit, N-terminal (1);	0.052616	0.85682	D	0.000000	T	0.29458	0.0734	N	0.19112	0.55	0.50813	D	0.999891	P	0.39831	0.69	B	0.36666	0.23	T	0.07712	-1.0758	10	0.33141	T	0.24	-26.5357	15.0128	0.71562	1.0:0.0:0.0:0.0	.	260	Q9UKN8	TF3C4_HUMAN	R	260	ENSP00000361219:Q260R	ENSP00000361219:Q260R	Q	+	2	0	GTF3C4	134543606	1.000000	0.71417	0.999000	0.59377	0.971000	0.66376	8.484000	0.90445	2.225000	0.72522	0.459000	0.35465	CAG	GTF3C4	-	NULL	ENSG00000125484		0.557	GTF3C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF3C4	HGNC	protein_coding	OTTHUMT00000054792.1	46	0.00	0	A			135553785	135553785	+1	no_errors	ENST00000372146	ensembl	human	known	69_37n	missense	29	12.12	4	SNP	1.000	G
HLA-DRB1	3123	genome.wustl.edu	37	6	32552016	32552016	+	Silent	SNP	C	C	A	rs17880973		TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr6:32552016C>A	ENST00000360004.5	-	2	345	c.240G>T	c.(238-240)acG>acT	p.T80T		NM_002124.3	NP_002115.2	Q30167	2B1A_HUMAN	major histocompatibility complex, class II, DR beta 1	80	Beta-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)				large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	10						GCCCCAGCTCCGTCACCGCCC	0.642										Multiple Myeloma(14;0.17)																												dbGAP											0													37.0	40.0	39.0					6																	32552016		2195	4294	6489	-	-	-	SO:0001819	synonymous_variant	0			AJ297583	CCDS47409.1	6p21.3	2013-01-11			ENSG00000196126	ENSG00000196126		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4948	protein-coding gene	gene with protein product		142857		HLA-DR1B			Standard	NM_001243965		Approved		uc011eri.2	P01911	OTTHUMG00000031196	ENST00000360004.5:c.240G>T	6.37:g.32552016C>A			P01914|Q9MYF5	Silent	SNP	pfam_MHC_II_b_N,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N,smart_Ig_C1-set,pfscan_Ig-like	p.T80	ENST00000360004.5	37	c.240	CCDS47409.1	6																																																																																			HLA-DRB1	-	pfam_MHC_II_b_N,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N	ENSG00000196126		0.642	HLA-DRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-DRB1	HGNC	protein_coding	OTTHUMT00000076393.3	10	0.00	0	C	NM_002124		32552016	32552016	-1	no_errors	ENST00000360004	ensembl	human	known	69_37n	silent	2	80.00	8	SNP	0.834	A
HYAL4	23553	genome.wustl.edu	37	7	123508629	123508629	+	Missense_Mutation	SNP	A	A	G	rs566715243		TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr7:123508629A>G	ENST00000223026.4	+	3	940	c.302A>G	c.(301-303)tAt>tGt	p.Y101C	HYAL4_ENST00000476325.1_Missense_Mutation_p.Y101C	NM_012269.2	NP_036401.2	Q2M3T9	HYAL4_HUMAN	hyaluronoglucosaminidase 4	101					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate catabolic process (GO:0030207)|glycosaminoglycan catabolic process (GO:0006027)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)	hyalurononglucosaminidase activity (GO:0004415)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	23						TATCCGTGGTATACATCACAA	0.408																																						dbGAP											0													61.0	67.0	65.0					7																	123508629		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF009010	CCDS5789.1	7q31.3	2010-01-14			ENSG00000106302	ENSG00000106302			5323	protein-coding gene	gene with protein product	"""hyaluronidase 4"""	604510				10493834	Standard	NM_012269		Approved		uc003vlc.3	Q2M3T9	OTTHUMG00000157349	ENST00000223026.4:c.302A>G	7.37:g.123508629A>G	ENSP00000223026:p.Tyr101Cys		D0VXG1|Q9UL99|Q9Y6T9	Missense_Mutation	SNP	pfam_Hyaluronidase,superfamily_Glycoside_hydrolase_SF,pirsf_Hyaluronidase,prints_Hyaluronidase,prints_Glyco_hydro_56_PH20	p.Y101C	ENST00000223026.4	37	c.302	CCDS5789.1	7	.	.	.	.	.	.	.	.	.	.	A	12.67	2.007366	0.35415	.	.	ENSG00000106302	ENST00000223026;ENST00000476325	T;T	0.23552	1.9;1.9	5.49	4.29	0.51040	Aldolase-type TIM barrel (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.50017	0.1591	M	0.85630	2.765	0.39539	D	0.968781	D;D	0.89917	1.0;1.0	D;D	0.77004	0.98;0.989	T	0.56123	-0.8031	9	.	.	.	-17.5699	7.7619	0.28957	0.8062:0.0:0.0696:0.1242	.	101;101	F8WDH9;Q2M3T9	.;HYAL4_HUMAN	C	101	ENSP00000223026:Y101C;ENSP00000417186:Y101C	.	Y	+	2	0	HYAL4	123295865	1.000000	0.71417	0.997000	0.53966	0.179000	0.23085	6.007000	0.70731	2.088000	0.63022	0.533000	0.62120	TAT	HYAL4	-	pfam_Hyaluronidase,superfamily_Glycoside_hydrolase_SF,pirsf_Hyaluronidase	ENSG00000106302		0.408	HYAL4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HYAL4	HGNC	protein_coding	OTTHUMT00000348545.1	32	0.00	0	A	NM_012269		123508629	123508629	+1	no_errors	ENST00000223026	ensembl	human	known	69_37n	missense	18	18.18	4	SNP	0.998	G
IRS1	3667	genome.wustl.edu	37	2	227661664	227661664	+	Frame_Shift_Del	DEL	C	C	-			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr2:227661664delC	ENST00000305123.5	-	1	2811	c.1791delG	c.(1789-1791)gggfs	p.G597fs	IRS1_ENST00000498335.1_5'Flank	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	597					cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.H598fs*13(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		GGCGGTGGTGCCCCCCCCGAC	0.687											OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Insertion - Frameshift(1)	ovary(1)											36.0	36.0	36.0					2																	227661664		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.1791delG	2.37:g.227661664delC	ENSP00000304895:p.Gly597fs	2321		Frame_Shift_Del	DEL	pfam_Insln_rcpt_S1,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,prints_Insln_rcpt_S1,pfscan_Pleckstrin_homology,pfscan_Insln_rcpt_S1	p.H598fs	ENST00000305123.5	37	c.1791	CCDS2463.1	2																																																																																			IRS1	-	NULL	ENSG00000169047		0.687	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRS1	HGNC	protein_coding	OTTHUMT00000256886.3	22	0.00	0	C	NM_005544		227661664	227661664	-1	no_errors	ENST00000305123	ensembl	human	known	69_37n	frame_shift_del	11	15.38	2	DEL	0.995	-
KATNB1	10300	genome.wustl.edu	37	16	57789124	57789124	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr16:57789124G>C	ENST00000379661.3	+	15	1782	c.1390G>C	c.(1390-1392)Ggg>Cgg	p.G464R		NM_005886.2	NP_005877.2			katanin p80 (WD repeat containing) subunit B 1											cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_neural(199;0.223)				CGAGCCCATCGGGCTGAAGGC	0.662																																						dbGAP											0													27.0	30.0	29.0					16																	57789124		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF052432	CCDS10788.1	16q12.2	2013-01-09	2003-03-13		ENSG00000140854	ENSG00000140854		"""WD repeat domain containing"""	6217	protein-coding gene	gene with protein product		602703	"""katanin p80 (WD40-containing) subunit B 1"""			9568719	Standard	XM_006721121		Approved		uc002eml.1	Q9BVA0	OTTHUMG00000133467	ENST00000379661.3:c.1390G>C	16.37:g.57789124G>C	ENSP00000368982:p.Gly464Arg			Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.G464R	ENST00000379661.3	37	c.1390	CCDS10788.1	16	.	.	.	.	.	.	.	.	.	.	G	18.68	3.675956	0.67928	.	.	ENSG00000140854	ENST00000379661	T	0.56444	0.46	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.64549	0.2608	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.67106	-0.5754	10	0.66056	D	0.02	-42.7552	18.0175	0.89246	0.0:0.0:1.0:0.0	.	464	Q9BVA0	KTNB1_HUMAN	R	464	ENSP00000368982:G464R	ENSP00000368982:G464R	G	+	1	0	KATNB1	56346625	1.000000	0.71417	0.879000	0.34478	0.027000	0.11550	8.853000	0.92222	2.517000	0.84864	0.650000	0.86243	GGG	KATNB1	-	NULL	ENSG00000140854		0.662	KATNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KATNB1	HGNC	protein_coding	OTTHUMT00000257343.3	22	0.00	0	G			57789124	57789124	+1	no_errors	ENST00000379661	ensembl	human	known	69_37n	missense	14	26.32	5	SNP	1.000	C
KCNH6	81033	genome.wustl.edu	37	17	61619777	61619777	+	Silent	SNP	C	C	A			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr17:61619777C>A	ENST00000583023.1	+	9	2141	c.2130C>A	c.(2128-2130)gtC>gtA	p.V710V	KCNH6_ENST00000581784.1_Silent_p.V657V|KCNH6_ENST00000456941.2_Silent_p.V657V|KCNH6_ENST00000314672.5_Silent_p.V710V	NM_030779.2	NP_110406.1	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 6	710					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(4)|large_intestine(6)|lung(20)|ovary(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	54					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	AGCTGGAGGTCACCTTCAACC	0.627																																						dbGAP											0													88.0	76.0	80.0					17																	61619777		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF311913	CCDS11638.1, CCDS11639.1, CCDS62290.1	17q23.3	2012-07-05				ENSG00000173826		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18862	protein-coding gene	gene with protein product		608168				16382104	Standard	NM_030779		Approved	Kv11.2, erg2, HERG2	uc002jay.3	Q9H252		ENST00000583023.1:c.2130C>A	17.37:g.61619777C>A			Q9BRD7	Silent	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_Ion_trans_2,pfam_PAS_fold,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,prints_K_chnl_volt-dep_ELK,prints_2pore_dom_K_chnl,pfscan_cNMP-bd_dom	p.V710	ENST00000583023.1	37	c.2130	CCDS11638.1	17																																																																																			KCNH6	-	smart_cNMP-bd_dom	ENSG00000173826		0.627	KCNH6-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH6	HGNC	protein_coding	OTTHUMT00000443853.1	41	0.00	0	C	NM_030779		61619777	61619777	+1	no_errors	ENST00000583023	ensembl	human	known	69_37n	silent	27	15.62	5	SNP	1.000	A
KCNN3	3782	genome.wustl.edu	37	1	154842243	154842244	+	Missense_Mutation	DNP	AA	AA	CT			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr1:154842243_154842244AA>CT	ENST00000271915.4	-	1	512_513	c.197_198TT>AG	c.(196-198)cTT>cAG	p.L66Q	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	66	Gln-rich.				potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	gctgctgctgaagctgcggagg	0.703																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.197_198delinsCT	1.37:g.154842243_154842244delinsCT	ENSP00000271915:p.Leu66Gln		B1ANX0|O43517|Q86VF9|Q8WXG7	Silent|Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_SK,pfam_CaM-bd_dom,pfam_Ion_trans_2,superfamily_CaM-bd_dom,prints_K_chnl_Ca-activ_SK	p.L66|p.L66H	ENST00000271915.4	37	c.198|c.197	CCDS30880.1	1																																																																																			KCNN3	-	NULL	ENSG00000143603		0.703	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	KCNN3	HGNC	protein_coding	OTTHUMT00000090688.3	8	0.00	0	A	NM_002249		154842243|154842244	154842243|154842244	-1	no_errors	ENST00000271915	ensembl	human	known	69_37n	silent|missense	17|16	39.29|40.74	11	SNP	0.000|0.166	C|T
KRTAP22-2	100288287	genome.wustl.edu	37	21	31962623	31962623	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr21:31962623G>T	ENST00000382830.2	-	1	93	c.71C>A	c.(70-72)tCt>tAt	p.S24Y	KRTAP6-3_ENST00000391624.1_5'Flank	NM_001164434.1	NP_001157906.1	Q3LI68	KR222_HUMAN	keratin associated protein 22-2	24						intermediate filament (GO:0005882)											GGCATATCCAGAGTTACCATA	0.433																																						dbGAP											0													155.0	134.0	141.0					21																	31962623		692	1591	2283	-	-	-	SO:0001583	missense	0			AB096950	CCDS46641.1	21q22.11	2009-11-23			ENSG00000206106	ENSG00000206106		"""Keratin associated proteins"""	37091	protein-coding gene	gene with protein product							Standard	NM_001164434		Approved	KAP22.2	uc021wih.1	Q3LI68	OTTHUMG00000065630	ENST00000382830.2:c.71C>A	21.37:g.31962623G>T	ENSP00000372281:p.Ser24Tyr			Missense_Mutation	SNP	NULL	p.S24Y	ENST00000382830.2	37	c.71	CCDS46641.1	21	.	.	.	.	.	.	.	.	.	.	G	9.055	0.993103	0.19043	.	.	ENSG00000206106	ENST00000382830	.	.	.	4.31	-8.61	0.00885	.	3.128040	0.02843	U	0.128132	T	0.36908	0.0984	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.50533	-0.8817	6	0.87932	D	0	.	7.8916	0.29682	0.1286:0.6081:0.1058:0.1575	.	.	.	.	Y	24	.	ENSP00000372281:S24Y	S	-	2	0	KRTAP22-2	30884494	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.822000	0.04448	-2.464000	0.00534	-1.415000	0.01116	TCT	KRTAP22-2	-	NULL	ENSG00000206106		0.433	KRTAP22-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP22-2	HGNC	protein_coding	OTTHUMT00000140633.2	53	0.00	0	G	XM_002343740		31962623	31962623	-1	no_errors	ENST00000382830	ensembl	human	known	69_37n	missense	22	29.03	9	SNP	0.000	T
LCORL	254251	genome.wustl.edu	37	4	17885617	17885617	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr4:17885617C>T	ENST00000382226.5	-	7	1643	c.1535G>A	c.(1534-1536)aGt>aAt	p.S512N	LCORL_ENST00000382224.1_Missense_Mutation_p.S428N|LCORL_ENST00000539056.1_Intron|LCORL_ENST00000326877.4_Intron	NM_001166139.1	NP_001159611.1	Q8N3X6	LCORL_HUMAN	ligand dependent nuclear receptor corepressor-like	512					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)			kidney(1)|large_intestine(1)|lung(1)|prostate(1)	4						GGGCTGCTTACTGTCTTTTCG	0.398																																						dbGAP											0													125.0	96.0	105.0					4																	17885617		692	1590	2282	-	-	-	SO:0001583	missense	0				CCDS3425.1, CCDS54749.1	4p15.32	2006-06-14			ENSG00000178177	ENSG00000178177			30776	protein-coding gene	gene with protein product		611799				12560079	Standard	NM_153686		Approved	MLR1, FLJ30696	uc021xmr.1	Q8N3X6	OTTHUMG00000128538	ENST00000382226.5:c.1535G>A	4.37:g.17885617C>T	ENSP00000371661:p.Ser512Asn		Q96NK1	Missense_Mutation	SNP	pfam_HTH_Psq,superfamily_Homeodomain-like,pfscan_HTH_Psq	p.S512N	ENST00000382226.5	37	c.1535	CCDS54749.1	4	.	.	.	.	.	.	.	.	.	.	C	0.980	-0.697483	0.03279	.	.	ENSG00000178177	ENST00000382224;ENST00000382226	.	.	.	5.19	-1.88	0.07713	.	0.292068	0.37393	N	0.002104	T	0.12305	0.0299	N	0.08118	0	0.20821	N	0.999845	.	.	.	.	.	.	T	0.35649	-0.9780	7	0.02654	T	1	.	9.5666	0.39402	0.0:0.3713:0.0:0.6287	.	.	.	.	N	428;512	.	ENSP00000371659:S428N	S	-	2	0	LCORL	17494715	0.995000	0.38212	0.951000	0.38953	0.982000	0.71751	1.277000	0.33167	-0.473000	0.06871	-0.302000	0.09304	AGT	LCORL	-	NULL	ENSG00000178177		0.398	LCORL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LCORL	HGNC	protein_coding		71	0.00	0	C	NM_153686		17885617	17885617	-1	no_errors	ENST00000382226	ensembl	human	known	69_37n	missense	36	14.29	6	SNP	1.000	T
LILRB5	10990	genome.wustl.edu	37	19	54758227	54758227	+	Splice_Site	SNP	C	C	T			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr19:54758227C>T	ENST00000316219.5	-	7	1414		c.e7+1		LILRB5_ENST00000450632.1_Splice_Site|LILRB5_ENST00000449561.2_Splice_Site|LILRB5_ENST00000345866.6_Splice_Site	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5						cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CAGTGACTCACCAGGTGTGGG	0.632																																						dbGAP											0													22.0	24.0	23.0					19																	54758227		2194	4295	6489	-	-	-	SO:0001630	splice_region_variant	0			AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.1306+1G>A	19.37:g.54758227C>T			Q8N760	Splice_Site	SNP	-	e7+1	ENST00000316219.5	37	c.1279+1	CCDS12885.1	19	.	.	.	.	.	.	.	.	.	.	C	3.021	-0.201822	0.06219	.	.	ENSG00000105609	ENST00000316219;ENST00000450632;ENST00000449561;ENST00000345866	.	.	.	2.08	-2.04	0.07343	.	.	.	.	.	.	.	.	.	.	.	0.20403	N	0.999904	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.891	0.01254	0.2343:0.3765:0.2305:0.1586	.	.	.	.	.	-1	.	.	.	-	.	.	LILRB5	59450039	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	-0.778000	0.04664	-0.334000	0.08463	0.471000	0.43371	.	LILRB5	-	-	ENSG00000105609		0.632	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB5	HGNC	protein_coding	OTTHUMT00000142877.2	21	0.00	0	C		Intron	54758227	54758227	-1	no_errors	ENST00000450632	ensembl	human	known	69_37n	splice_site	15	46.43	13	SNP	0.000	T
LPA	4018	genome.wustl.edu	37	6	161007579	161007579	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr6:161007579T>C	ENST00000316300.5	-	25	4075	c.4031A>G	c.(4030-4032)gAg>gGg	p.E1344G	LPA_ENST00000447678.1_Missense_Mutation_p.E1344G			P08519	APOA_HUMAN	lipoprotein, Lp(a)	3852	Kringle 12. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	GTTGCAGTACTCCCATCTGAC	0.507																																						dbGAP											0													130.0	131.0	131.0					6																	161007579		2184	4289	6473	-	-	-	SO:0001583	missense	0			X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.4031A>G	6.37:g.161007579T>C	ENSP00000321334:p.Glu1344Gly		Q5VTD7|Q9UD88	Missense_Mutation	SNP	pfam_Kringle,pfam_Peptidase_S1_S6,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_Kringle,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_Kringle,pfscan_Peptidase_S1_S6	p.E1344G	ENST00000316300.5	37	c.4031	CCDS43523.1	6	.	.	.	.	.	.	.	.	.	.	t	15.50	2.853277	0.51270	.	.	ENSG00000198670	ENST00000316300;ENST00000447678	T;T	0.67345	-0.26;-0.26	2.56	2.56	0.30785	Kringle (4);Kringle-like fold (1);	.	.	.	.	T	0.76948	0.4059	M	0.89030	3	0.39412	D	0.966765	D	0.56035	0.974	D	0.76071	0.987	T	0.79303	-0.1859	9	0.72032	D	0.01	.	8.5773	0.33605	0.0:0.0:0.0:1.0	.	3852	P08519	APOA_HUMAN	G	1344	ENSP00000321334:E1344G;ENSP00000395608:E1344G	ENSP00000321334:E1344G	E	-	2	0	LPA	160927569	1.000000	0.71417	0.990000	0.47175	0.604000	0.37047	5.712000	0.68407	1.162000	0.42619	0.358000	0.22013	GAG	LPA	-	pfam_Kringle,superfamily_Kringle-like,smart_Kringle,pfscan_Kringle	ENSG00000198670		0.507	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPA	HGNC	protein_coding	OTTHUMT00000042957.1	111	0.00	0	T	NM_005577		161007579	161007579	-1	no_errors	ENST00000316300	ensembl	human	known	69_37n	missense	43	14.00	7	SNP	1.000	C
LRP2	4036	genome.wustl.edu	37	2	169993902	169993902	+	Splice_Site	SNP	C	C	A			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr2:169993902C>A	ENST00000263816.3	-	76	13905	c.13620G>T	c.(13618-13620)caG>caT	p.Q4540H		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	4540					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	GGTTTCTCACCTGGATTGGCT	0.433																																						dbGAP											0													189.0	174.0	179.0					2																	169993902		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.13620+1G>T	2.37:g.169993902C>A			O00711|Q16215	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.Q4540H	ENST00000263816.3	37	c.13620	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	C	15.81	2.943401	0.53079	.	.	ENSG00000081479	ENST00000263816	D	0.89810	-2.57	5.45	4.56	0.56223	.	0.560844	0.20590	N	0.089370	T	0.76593	0.4009	N	0.14661	0.345	0.80722	D	1	P	0.41748	0.761	B	0.35971	0.215	T	0.75405	-0.3329	9	.	.	.	.	10.779	0.46367	0.1293:0.8007:0.0:0.07	.	4540	P98164	LRP2_HUMAN	H	4540	ENSP00000263816:Q4540H	.	Q	-	3	2	LRP2	169702148	1.000000	0.71417	0.977000	0.42913	0.871000	0.50021	1.761000	0.38440	2.547000	0.85894	0.563000	0.77884	CAG	LRP2	-	NULL	ENSG00000081479		0.433	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2	75	0.00	0	C	NM_004525	Missense_Mutation	169993902	169993902	-1	no_errors	ENST00000263816	ensembl	human	known	69_37n	missense	42	20.75	11	SNP	0.984	A
MACF1	23499	genome.wustl.edu	37	1	39838233	39838233	+	Missense_Mutation	SNP	T	T	C	rs574942051		TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr1:39838233T>C	ENST00000372915.3	+	51	13280	c.13193T>C	c.(13192-13194)aTg>aCg	p.M4398T	MACF1_ENST00000564288.1_Missense_Mutation_p.M4393T|MACF1_ENST00000317713.7_Missense_Mutation_p.M2331T|MACF1_ENST00000361689.2_Missense_Mutation_p.M2331T|MACF1_ENST00000545844.1_Missense_Mutation_p.M2331T|MACF1_ENST00000289893.4_Missense_Mutation_p.M2833T|MACF1_ENST00000476350.1_3'UTR|MACF1_ENST00000567887.1_Missense_Mutation_p.M4430T|MACF1_ENST00000539005.1_Missense_Mutation_p.M2331T			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	4398					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AATCTCATCATGGAAATCACA	0.388																																						dbGAP											0													71.0	71.0	71.0					1																	39838233		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.13193T>C	1.37:g.39838233T>C	ENSP00000362006:p.Met4398Thr		B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_Ca-bd,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_HAND_2	p.M2331T	ENST00000372915.3	37	c.6992		1	.	.	.	.	.	.	.	.	.	.	T	6.041	0.375898	0.11409	.	.	ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893	T;T;T;T;T;T	0.61392	0.15;0.22;0.15;0.11;0.3;1.28	5.87	4.76	0.60689	.	0.098967	0.44097	D	0.000495	T	0.46870	0.1415	L	0.36672	1.1	0.80722	D	1	B;B;B;B	0.20368	0.044;0.001;0.001;0.001	B;B;B;B	0.29353	0.101;0.006;0.004;0.002	T	0.28267	-1.0049	10	0.13108	T	0.6	.	11.7339	0.51755	0.0:0.0685:0.0:0.9315	.	4398;2331;2331;2296	Q9UPN3;F8W8Q1;Q9UPN3-2;Q9UPN3-3	MACF1_HUMAN;.;.;.	T	2331;4398;2331;2331;2331;2833	ENSP00000439537:M2331T;ENSP00000362006:M4398T;ENSP00000354573:M2331T;ENSP00000313438:M2331T;ENSP00000444364:M2331T;ENSP00000289893:M2833T	ENSP00000289893:M2833T	M	+	2	0	MACF1	39610820	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.144000	0.58057	1.070000	0.40811	0.529000	0.55759	ATG	MACF1	-	smart_Spectrin/alpha-actinin	ENSG00000127603		0.388	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	60	0.00	0	T	NM_033044		39838233	39838233	+1	no_errors	ENST00000317713	ensembl	human	known	69_37n	missense	38	13.64	6	SNP	1.000	C
MAP3K1	4214	genome.wustl.edu	37	5	56177954	56177954	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr5:56177954C>T	ENST00000399503.3	+	14	2927	c.2927C>T	c.(2926-2928)tCc>tTc	p.S976F		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	976					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		TCTCATCATTCCCAATTAATG	0.448																																						dbGAP											0													138.0	133.0	135.0					5																	56177954		1908	4127	6035	-	-	-	SO:0001583	missense	0			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.2927C>T	5.37:g.56177954C>T	ENSP00000382423:p.Ser976Phe			Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Prot_kinase_cat_dom	p.S976F	ENST00000399503.3	37	c.2927	CCDS43318.1	5	.	.	.	.	.	.	.	.	.	.	C	15.62	2.888325	0.52014	.	.	ENSG00000095015	ENST00000399503	T	0.72282	-0.64	5.71	5.71	0.89125	.	0.233917	0.38326	N	0.001728	T	0.68357	0.2992	L	0.36672	1.1	0.43885	D	0.996508	P	0.37955	0.612	B	0.41088	0.347	T	0.68288	-0.5448	10	0.48119	T	0.1	.	19.8546	0.96752	0.0:1.0:0.0:0.0	.	976	Q13233	M3K1_HUMAN	F	976	ENSP00000382423:S976F	ENSP00000382423:S976F	S	+	2	0	MAP3K1	56213711	1.000000	0.71417	0.993000	0.49108	0.985000	0.73830	6.473000	0.73572	2.697000	0.92050	0.655000	0.94253	TCC	MAP3K1	-	NULL	ENSG00000095015		0.448	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	HGNC	protein_coding	OTTHUMT00000132309.2	86	0.00	0	C	XM_042066		56177954	56177954	+1	no_errors	ENST00000399503	ensembl	human	novel	69_37n	missense	23	17.86	5	SNP	1.000	T
MICA	100507436	genome.wustl.edu	37	6	31378388	31378388	+	Missense_Mutation	SNP	G	G	A	rs1051785|rs386699190	byFrequency	TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr6:31378388G>A	ENST00000449934.2	+	2	193	c.139G>A	c.(139-141)Gct>Act	p.A47T	HCP5_ENST00000414046.2_RNA	NM_001177519.1	NP_001170990.1			MHC class I polypeptide-related sequence A											breast(1)|endometrium(3)|kidney(1)	5		Ovarian(999;0.0253)				AGGGTTTCTTGCTGAGGTACA	0.532													g|||	324	0.0646965	0.0832	0.0533	5008	,	,		19486	0.0665		0.0736	False		,,,				2504	0.0368					dbGAP											0													21.0	23.0	22.0					6																	31378388		692	1591	2283	-	-	-	SO:0001583	missense	0			L14848	CCDS56412.1, CCDS75421.1	6p21.3	2013-01-11			ENSG00000204520	ENSG00000204520		"""Immunoglobulin superfamily / C1-set domain containing"""	7090	protein-coding gene	gene with protein product		600169				8022771	Standard	NM_000247		Approved	PERB11.1	uc003ntk.1	Q29983	OTTHUMG00000031073	ENST00000449934.2:c.139G>A	6.37:g.31378388G>A	ENSP00000413079:p.Ala47Thr			Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like	p.A47T	ENST00000449934.2	37	c.139	CCDS56412.1	6	142	0.06501831501831502	33	0.06707317073170732	23	0.06353591160220995	39	0.06818181818181818	47	0.06200527704485488	N	11.46	1.646749	0.29246	.	.	ENSG00000204520	ENST00000364810;ENST00000399172;ENST00000449934;ENST00000421350	T;T	0.01981	4.52;4.52	2.89	-2.53	0.06326	.	0.450854	0.16219	N	0.224130	T	0.00524	0.0017	.	.	.	0.80722	P	0.0	B	0.25007	0.116	B	0.29942	0.109	T	0.47005	-0.9150	8	0.36615	T	0.2	.	1.2016	0.01886	0.1299:0.1868:0.3044:0.3789	rs1051785;rs3192166;rs16899588;rs17200151;rs17883926	47	Q96QC4	.	T	47;47;47;34	ENSP00000413079:A47T;ENSP00000402410:A34T	ENSP00000365394:A47T	A	+	1	0	MICA	31486367	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-0.423000	0.07034	-0.415000	0.07484	0.306000	0.20318	GCT	MICA	-	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog	ENSG00000204520		0.532	MICA-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	MICA	HGNC	protein_coding	OTTHUMT00000076101.7	8	0.00	0	G	NM_001177519		31378388	31378388	+1	no_errors	ENST00000364810	ensembl	human	known	69_37n	missense	1	85.71	6	SNP	0.000	A
MID1	4281	genome.wustl.edu	37	X	10442722	10442722	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chrX:10442722G>A	ENST00000317552.4	-	6	1482	c.1082C>T	c.(1081-1083)aCc>aTc	p.T361I	MID1_ENST00000380779.1_Missense_Mutation_p.T361I|MID1_ENST00000380780.1_Missense_Mutation_p.T361I|MID1_ENST00000453318.2_Missense_Mutation_p.T361I|MID1_ENST00000380782.2_Missense_Mutation_p.T361I|MID1_ENST00000380785.1_Missense_Mutation_p.T361I|MID1_ENST00000380787.1_Missense_Mutation_p.T361I	NM_000381.3|NM_033289.1	NP_000372.1|NP_150631.1	O15344	TRI18_HUMAN	midline 1	361	COS. {ECO:0000255|PROSITE- ProRule:PRU00586}.				microtubule cytoskeleton organization (GO:0000226)|negative regulation of microtubule depolymerization (GO:0007026)|pattern specification process (GO:0007389)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein localization to microtubule (GO:0035372)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	ligase activity (GO:0016874)|microtubule binding (GO:0008017)|phosphoprotein binding (GO:0051219)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	26						TAAGGCAAAGGTGTCAAATGT	0.378																																						dbGAP											0													128.0	118.0	122.0					X																	10442722		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y13667	CCDS14138.1, CCDS75952.1, CCDS75953.1	Xp22	2014-06-18	2014-06-18		ENSG00000101871	ENSG00000101871		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	7095	protein-coding gene	gene with protein product	"""Opitz/BBB syndrome"""	300552				9354791, 9425238	Standard	NM_001098624		Approved	OS, FXY, TRIM18, RNF59	uc004cti.4	O15344	OTTHUMG00000021127	ENST00000317552.4:c.1082C>T	X.37:g.10442722G>A	ENSP00000312678:p.Thr361Ile		B2RCG2|O75361|Q9BZX5	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Fibronectin_type3,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.T361I	ENST00000317552.4	37	c.1082	CCDS14138.1	X	.	.	.	.	.	.	.	.	.	.	G	16.71	3.198205	0.58126	.	.	ENSG00000101871	ENST00000453318;ENST00000317552;ENST00000380785;ENST00000380779;ENST00000380787;ENST00000380780;ENST00000380782;ENST00000454373;ENST00000413894	T;T;T;T;T;T;T;T	0.52754	0.65;0.65;0.65;0.65;0.65;0.65;1.13;1.12	5.96	5.96	0.96718	COS domain (1);	0.000000	0.85682	D	0.000000	T	0.38268	0.1034	L	0.29908	0.895	0.53005	D	0.99996	B;B;B	0.34103	0.437;0.437;0.183	B;B;B	0.28709	0.093;0.093;0.093	T	0.13469	-1.0508	10	0.34782	T	0.22	.	19.314	0.94204	0.0:0.0:1.0:0.0	.	361;361;311	A8K5A0;O15344;B4DLX8	.;TRI18_HUMAN;.	I	361;361;361;361;361;361;361;311;361	ENSP00000414521:T361I;ENSP00000312678:T361I;ENSP00000370162:T361I;ENSP00000370156:T361I;ENSP00000370164:T361I;ENSP00000370157:T361I;ENSP00000370159:T361I;ENSP00000391154:T361I	ENSP00000312678:T361I	T	-	2	0	MID1	10402722	1.000000	0.71417	0.993000	0.49108	0.970000	0.65996	9.241000	0.95402	2.513000	0.84729	0.600000	0.82982	ACC	MID1	-	NULL	ENSG00000101871		0.378	MID1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MID1	HGNC	protein_coding	OTTHUMT00000055738.1	99	0.00	0	G			10442722	10442722	-1	no_errors	ENST00000317552	ensembl	human	known	69_37n	missense	33	21.43	9	SNP	1.000	A
NFE2L3	9603	genome.wustl.edu	37	7	26225179	26225180	+	Frame_Shift_Del	DEL	AA	AA	-	rs144789579	byFrequency	TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	AA	AA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr7:26225179_26225180delAA	ENST00000056233.3	+	4	2120_2121	c.1861_1862delAA	c.(1861-1863)aagfs	p.K621fs		NM_004289.6	NP_004280.5	Q9Y4A8	NF2L3_HUMAN	nuclear factor, erythroid 2-like 3	621	bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(5)|urinary_tract(7)	29						GGAAACTCTTAAGAGAGAGCAA	0.332																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB010812	CCDS5396.1	7p15.2	2013-08-23	2013-08-23		ENSG00000050344	ENSG00000050344		"""basic leucine zipper proteins"""	7783	protein-coding gene	gene with protein product		604135	"""nuclear factor (erythroid-derived 2)-like 3"""			10037736	Standard	NM_004289		Approved	Nrf3	uc003sxq.3	Q9Y4A8	OTTHUMG00000023882	ENST00000056233.3:c.1861_1862delAA	7.37:g.26225179_26225180delAA	ENSP00000056233:p.Lys621fs		Q6NUS0|Q7Z498|Q86UJ4|Q86VR5|Q9UQA4	Frame_Shift_Del	DEL	pfam_bZIP_1,pfam_bZIP_Maf,pfam_bZIP_2,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.K621fs	ENST00000056233.3	37	c.1861_1862	CCDS5396.1	7																																																																																			NFE2L3	-	pfam_bZIP_1,pfam_bZIP_Maf,pfam_bZIP_2,smart_bZIP,pfscan_bZIP	ENSG00000050344		0.332	NFE2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFE2L3	HGNC	protein_coding	OTTHUMT00000214088.1	41	0.00	0	AA			26225179	26225180	+1	no_errors	ENST00000056233	ensembl	human	known	69_37n	frame_shift_del	15	34.78	8	DEL	0.004:0.004	-
OR13C5	138799	genome.wustl.edu	37	9	107361066	107361066	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr9:107361066G>T	ENST00000374779.2	-	1	722	c.629C>A	c.(628-630)cCt>cAt	p.P210H		NM_001004482.1	NP_001004482.1	Q8NGS8	O13C5_HUMAN	olfactory receptor, family 13, subfamily C, member 5	210						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|pancreas(2)|prostate(2)|skin(4)	28						TAATAACAAAGGTGTCAATAG	0.418																																						dbGAP											0													159.0	149.0	152.0					9																	107361066		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35091.1	9q31.1	2012-10-03			ENSG00000255800	ENSG00000277556		"""GPCR / Class A : Olfactory receptors"""	15100	protein-coding gene	gene with protein product							Standard	NM_001004482		Approved		uc011lvp.2	Q8NGS8	OTTHUMG00000020408	ENST00000374779.2:c.629C>A	9.37:g.107361066G>T	ENSP00000363911:p.Pro210His		B2RNE5|B9EGW5|Q6IF53	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.P210H	ENST00000374779.2	37	c.629	CCDS35091.1	9	.	.	.	.	.	.	.	.	.	.	G	17.93	3.509579	0.64522	.	.	ENSG00000255800	ENST00000374779	T	0.57273	0.41	4.17	4.17	0.49024	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36893	U	0.002346	T	0.80798	0.4692	H	0.96833	3.89	0.09310	N	1	D	0.89917	1.0	D	0.87578	0.998	T	0.76280	-0.3017	10	0.87932	D	0	.	14.0519	0.64742	0.0:0.0:1.0:0.0	.	210	Q8NGS8	O13C5_HUMAN	H	210	ENSP00000363911:P210H	ENSP00000363911:P210H	P	-	2	0	OR13C5	106400887	0.983000	0.35010	0.036000	0.18154	0.712000	0.41017	6.233000	0.72320	2.169000	0.68431	0.531000	0.56144	CCT	OR13C5	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000255800		0.418	OR13C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C5	HGNC	protein_coding	OTTHUMT00000053479.2	36	0.00	0	G	NM_001004482		107361066	107361066	-1	no_errors	ENST00000374779	ensembl	human	known	69_37n	missense	24	17.24	5	SNP	0.012	T
PARP8	79668	genome.wustl.edu	37	5	50130705	50130705	+	Intron	SNP	G	G	T			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr5:50130705G>T	ENST00000281631.5	+	25	2535				PARP8_ENST00000511363.2_Intron|PARP8_ENST00000505554.1_Intron|PARP8_ENST00000503750.2_Intron|PARP8_ENST00000514067.2_Intron|PARP8_ENST00000505697.2_Intron	NM_001178056.1|NM_024615.3	NP_001171527.1|NP_078891.2	Q8N3A8	PARP8_HUMAN	poly (ADP-ribose) polymerase family, member 8							intracellular (GO:0005622)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Lung NSC(810;0.0305)|Breast(144;0.222)				TATTAAGTCGGAATGGACTAG	0.323																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AL834477	CCDS3954.1, CCDS54849.1	5q11.2	2010-02-16			ENSG00000151883	ENSG00000151883		"""Poly (ADP-ribose) polymerases"""	26124	protein-coding gene	gene with protein product						15273990	Standard	NM_001178055		Approved	FLJ21308, pART16	uc003joo.3	Q8N3A8	OTTHUMG00000096969	ENST00000281631.5:c.2378-60G>T	5.37:g.50130705G>T			Q3KRB7|Q6DHZ1|Q9H754	Nonsense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.E514*	ENST00000281631.5	37	c.1540	CCDS3954.1	5	.	.	.	.	.	.	.	.	.	.	G	39	7.438896	0.98286	.	.	ENSG00000151883	ENST00000503561	.	.	.	4.98	-2.09	0.07232	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.6448	0.28315	0.6486:0.0:0.2182:0.1332	.	.	.	.	X	514	.	.	E	+	1	0	PARP8	50166462	0.001000	0.12720	0.000000	0.03702	0.047000	0.14425	0.577000	0.23758	-0.330000	0.08514	0.655000	0.94253	GAA	PARP8	-	pfscan_Poly(ADP-ribose)pol_cat_dom	ENSG00000151883		0.323	PARP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP8	HGNC	protein_coding	OTTHUMT00000214035.3	61	0.00	0	G	NM_024615		50130705	50130705	+1	no_errors	ENST00000503561	ensembl	human	novel	69_37n	nonsense	24	22.58	7	SNP	0.000	T
PCDHA2	56146	genome.wustl.edu	37	5	140174742	140174742	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr5:140174742C>T	ENST00000526136.1	+	1	193	c.193C>T	c.(193-195)Cgg>Tgg	p.R65W	PCDHA2_ENST00000378132.1_Missense_Mutation_p.R65W|PCDHA2_ENST00000520672.2_Missense_Mutation_p.R65W|PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	65	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGCCTGTTCCGGGTGGCGTC	0.637																																						dbGAP											0													52.0	63.0	59.0					5																	140174742		2197	4291	6488	-	-	-	SO:0001583	missense	0			AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.193C>T	5.37:g.140174742C>T	ENSP00000431748:p.Arg65Trp		O75287|Q9BTV3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.R65W	ENST00000526136.1	37	c.193	CCDS54914.1	5	.	.	.	.	.	.	.	.	.	.	c	17.56	3.419373	0.62622	.	.	ENSG00000204969	ENST00000520672;ENST00000378132;ENST00000526136	T;T;T	0.38887	1.11;1.11;1.11	3.66	2.74	0.32292	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.000000	0.36268	U	0.002685	T	0.76300	0.3968	H	0.99336	4.52	0.28259	N	0.924904	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.994;0.995;0.994	T	0.74188	-0.3746	10	0.87932	D	0	.	10.5125	0.44870	0.3651:0.6349:0.0:0.0	.	65;65;65	Q9Y5H9-3;Q9Y5H9;Q9Y5H9-2	.;PCDA2_HUMAN;.	W	65	ENSP00000430584:R65W;ENSP00000367372:R65W;ENSP00000431748:R65W	ENSP00000367372:R65W	R	+	1	2	PCDHA2	140154926	0.856000	0.29760	1.000000	0.80357	0.987000	0.75469	1.534000	0.36051	0.822000	0.34565	0.644000	0.83932	CGG	PCDHA2	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000204969		0.637	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA2	HGNC	protein_coding	OTTHUMT00000372877.3	34	0.00	0	C	NM_018905		140174742	140174742	+1	no_errors	ENST00000526136	ensembl	human	known	69_37n	missense	22	21.43	6	SNP	0.658	T
PCDHGB3	56102	genome.wustl.edu	37	5	140752364	140752364	+	Silent	SNP	C	C	A			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr5:140752364C>A	ENST00000576222.1	+	1	2534	c.2403C>A	c.(2401-2403)ggC>ggA	p.G801G	PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA6_ENST00000517434.1_5'Flank	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3	801					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTAATTCAGGCAATTTGCAAA	0.323																																						dbGAP											0													39.0	36.0	37.0					5																	140752364		1836	4080	5916	-	-	-	SO:0001819	synonymous_variant	0			AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.2403C>A	5.37:g.140752364C>A			A7E229|Q9Y5C7	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.G801	ENST00000576222.1	37	c.2403	CCDS58980.1	5																																																																																			PCDHGB3	-	NULL	ENSG00000262209		0.323	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB3	HGNC	protein_coding	OTTHUMT00000437094.1	33	0.00	0	C	NM_018924		140752364	140752364	+1	no_errors	ENST00000576222	ensembl	human	known	69_37n	silent	10	28.57	4	SNP	0.005	A
PITPNM3	83394	genome.wustl.edu	37	17	6387550	6387550	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr17:6387550G>T	ENST00000262483.8	-	5	424	c.337C>A	c.(337-339)Cac>Aac	p.H113N	PITPNM3_ENST00000421306.3_Missense_Mutation_p.H77N	NM_031220.3	NP_112497.2	Q9BZ71	PITM3_HUMAN	PITPNM family member 3	113					phosphatidylinositol metabolic process (GO:0046488)|phospholipid transport (GO:0015914)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)|receptor tyrosine kinase binding (GO:0030971)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(3)|skin(2)	36				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		CTGTCTTCGTGGATCTCGATG	0.577																																						dbGAP											0													160.0	137.0	145.0					17																	6387550		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF334586	CCDS11076.1, CCDS54080.1	17p13	2013-07-18	2013-07-18	2013-07-18	ENSG00000091622	ENSG00000091622		"""GPCR / Class A : Chemokine receptors : Atypical"""	21043	protein-coding gene	gene with protein product	"""atypical chemokine receptor 6"""	608921	"""cone rod dystrophy 5"""	CORD5		10022914	Standard	NM_031220		Approved	NIR1, RDGBA3, ACKR6	uc002gdd.4	Q9BZ71	OTTHUMG00000102039	ENST00000262483.8:c.337C>A	17.37:g.6387550G>T	ENSP00000262483:p.His113Asn		A1A5D0|F8WEW5|Q59GH9|Q9NPQ4	Missense_Mutation	SNP	pfam_DDHD,pfam_LNS2,superfamily_HAD-like_dom,smart_LNS2,pfscan_DDHD	p.H113N	ENST00000262483.8	37	c.337	CCDS11076.1	17	.	.	.	.	.	.	.	.	.	.	G	10.38	1.333394	0.24167	.	.	ENSG00000091622	ENST00000262483;ENST00000421306	T;T	0.19105	2.17;2.17	5.54	5.54	0.83059	.	0.195954	0.44688	D	0.000429	T	0.18130	0.0435	L	0.29908	0.895	0.37084	D	0.899107	P;P	0.35226	0.491;0.454	B;B	0.34824	0.19;0.15	T	0.08932	-1.0698	10	0.27785	T	0.31	-11.7658	17.3603	0.87348	0.0:0.0:1.0:0.0	.	77;113	F8WEW5;Q9BZ71	.;PITM3_HUMAN	N	113;77	ENSP00000262483:H113N;ENSP00000407882:H77N	ENSP00000262483:H113N	H	-	1	0	PITPNM3	6328274	1.000000	0.71417	0.985000	0.45067	0.491000	0.33493	5.663000	0.68038	2.779000	0.95612	0.655000	0.94253	CAC	PITPNM3	-	NULL	ENSG00000091622		0.577	PITPNM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PITPNM3	HGNC	protein_coding	OTTHUMT00000219824.2	41	0.00	0	G	NM_031220		6387550	6387550	-1	no_errors	ENST00000262483	ensembl	human	known	69_37n	missense	21	16.00	4	SNP	0.995	T
PNMAL1	55228	genome.wustl.edu	37	19	46973547	46973549	+	In_Frame_Del	DEL	TTC	TTC	-	rs554105663|rs200109291	byFrequency	TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	TTC	TTC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr19:46973547_46973549delTTC	ENST00000313683.10	-	2	1049_1051	c.744_746delGAA	c.(742-747)aagaac>aac	p.K248del	PNMAL1_ENST00000602246.1_Intron|PNMAL1_ENST00000438932.2_In_Frame_Del_p.K248del	NM_001103149.1|NM_018215.3	NP_001096619.1|NP_060685.2	Q86V59	PNML1_HUMAN	paraneoplastic Ma antigen family-like 1	248										cervix(1)|endometrium(2)|large_intestine(8)|lung(8)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	25		Ovarian(192;0.00965)|all_neural(266;0.0459)		OV - Ovarian serous cystadenocarcinoma(262;0.000166)|all cancers(93;0.0014)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)		CTGCCTGGAGTTCTTCTTCTGCT	0.522														3	0.000599042	0.0	0.0	5008	,	,		20117	0.003		0.0	False		,,,				2504	0.0					dbGAP											0									,	8,4256		2,4,2126					,	-2.5	0.0			92	12,8242		6,0,4121	no	coding,coding	PNMAL1	NM_018215.3,NM_001103149.1	,	8,4,6247	A1A1,A1R,RR		0.1454,0.1876,0.1598	,	,		20,12498				-	-	-	SO:0001651	inframe_deletion	0			BC026026	CCDS33059.1, CCDS46124.1	19q13.32	2014-02-12	2012-02-09			ENSG00000182013		"""Paraneoplastic Ma antigens"""	25578	protein-coding gene	gene with protein product			"""PNMA-like 1"""			12477932	Standard	NM_018215		Approved	KIAA1183L, FLJ10781	uc002peq.4	Q86V59		ENST00000313683.10:c.744_746delGAA	19.37:g.46973553_46973555delTTC	ENSP00000318131:p.Lys248del		A8K2F3|Q5U638|Q8N3H4|Q9NVE8	In_Frame_Del	DEL	NULL	p.K248in_frame_del	ENST00000313683.10	37	c.746_744	CCDS33059.1	19																																																																																			PNMAL1	-	NULL	ENSG00000182013		0.522	PNMAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PNMAL1	HGNC	protein_coding	OTTHUMT00000403929.1	17	0.00	0	TTC	NM_018215		46973547	46973549	-1	no_errors	ENST00000313683	ensembl	human	known	69_37n	in_frame_del	9	30.77	4	DEL	0.000:0.000:0.000	-
PRPF38A	84950	genome.wustl.edu	37	1	52871446	52871446	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr1:52871446G>C	ENST00000257181.9	+	2	411	c.225G>C	c.(223-225)ttG>ttC	p.L75F	ORC1_ENST00000371568.3_5'Flank|ORC1_ENST00000371566.1_5'Flank|PRPF38A_ENST00000474048.1_Intron	NM_032864.3	NP_116253.2	Q8NAV1	PR38A_HUMAN	pre-mRNA processing factor 38A	75					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			cervix(2)|kidney(1)|large_intestine(2)|liver(1)|lung(2)|stomach(1)	9						GTTTAACCTTGAAGATGCTTC	0.378																																						dbGAP											0													109.0	106.0	107.0					1																	52871446		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK092038	CCDS567.1	1p32.3	2013-10-03	2013-10-03		ENSG00000134748	ENSG00000134748			25930	protein-coding gene	gene with protein product			"""PRP38 pre-mRNA processing factor 38 (yeast) domain containing A"""			12477932	Standard	NM_032864		Approved	FLJ14936, Prp38	uc001ctw.4	Q8NAV1	OTTHUMG00000008199	ENST00000257181.9:c.225G>C	1.37:g.52871446G>C	ENSP00000257181:p.Leu75Phe		Q96JW1|Q9BVZ8	Missense_Mutation	SNP	pfam_PRP38	p.L75F	ENST00000257181.9	37	c.225	CCDS567.1	1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.410249	0.83340	.	.	ENSG00000134748	ENST00000257181	.	.	.	5.72	5.72	0.89469	.	0.144057	0.48286	D	0.000190	T	0.76849	0.4045	M	0.63843	1.955	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	T	0.70204	-0.4936	9	0.20519	T	0.43	-7.2537	19.8722	0.96854	0.0:0.0:1.0:0.0	.	75	Q8NAV1	PR38A_HUMAN	F	75	.	ENSP00000257181:L75F	L	+	3	2	PRPF38A	52644034	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.562000	0.67346	2.700000	0.92200	0.585000	0.79938	TTG	PRPF38A	-	pfam_PRP38	ENSG00000134748		0.378	PRPF38A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF38A	HGNC	protein_coding	OTTHUMT00000022459.2	80	0.00	0	G	NM_032864		52871446	52871446	+1	no_errors	ENST00000257181	ensembl	human	known	69_37n	missense	37	15.91	7	SNP	1.000	C
PRRC2C	23215	genome.wustl.edu	37	1	171494044	171494044	+	Silent	SNP	A	A	G			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr1:171494044A>G	ENST00000338920.4	+	10	1371	c.1134A>G	c.(1132-1134)caA>caG	p.Q378Q	PRRC2C_ENST00000476522.1_3'UTR|PRRC2C_ENST00000392078.3_Silent_p.Q380Q|PRRC2C_ENST00000367742.3_Silent_p.Q380Q|PRRC2C_ENST00000426496.2_Silent_p.Q378Q	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	378					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										CATCTTCCCAAATACCTGCCC	0.383																																						dbGAP											0													80.0	70.0	74.0					1																	171494044		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.1134A>G	1.37:g.171494044A>G			Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Silent	SNP	pfam_BAT2_N	p.Q380	ENST00000338920.4	37	c.1140	CCDS1296.2	1																																																																																			PRRC2C	-	NULL	ENSG00000117523		0.383	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRRC2C	HGNC	protein_coding	OTTHUMT00000314826.4	58	0.00	0	A	NM_015172		171494044	171494044	+1	no_errors	ENST00000392078	ensembl	human	known	69_37n	silent	38	25.49	13	SNP	0.862	G
PTDSS1	9791	genome.wustl.edu	37	8	97274333	97274333	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr8:97274333G>A	ENST00000517309.1	+	1	391	c.65G>A	c.(64-66)cGg>cAg	p.R22Q	PTDSS1_ENST00000455950.2_5'UTR|MTERFD1_ENST00000287025.3_5'Flank|MTERFD1_ENST00000523821.1_5'Flank	NM_014754.1	NP_055569.1	P48651	PTSS1_HUMAN	phosphatidylserine synthase 1	22					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylserine biosynthetic process (GO:0006659)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			endometrium(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|stomach(1)	29	Breast(36;6.18e-05)				Phosphatidylserine(DB00144)	ATGCATTTCCGGATGATCAAC	0.597																																						dbGAP											0													202.0	159.0	174.0					8																	97274333		2203	4300	6503	-	-	-	SO:0001583	missense	0			D14694	CCDS6271.1	8q22	2008-05-02			ENSG00000156471	ENSG00000156471			9587	protein-coding gene	gene with protein product		612792					Standard	NM_014754		Approved	KIAA0024, PSSA, PSS1	uc003yht.1	P48651	OTTHUMG00000164687	ENST00000517309.1:c.65G>A	8.37:g.97274333G>A	ENSP00000430548:p.Arg22Gln		E5RFC5|Q9BUQ5	Missense_Mutation	SNP	pfam_PSS	p.R22Q	ENST00000517309.1	37	c.65	CCDS6271.1	8	.	.	.	.	.	.	.	.	.	.	G	16.57	3.161479	0.57368	.	.	ENSG00000156471	ENST00000517309	T	0.44482	0.92	4.2	4.2	0.49525	.	0.000000	0.64402	D	0.000002	T	0.29945	0.0749	L	0.43152	1.355	0.80722	D	1	P	0.39520	0.676	B	0.29942	0.109	T	0.11372	-1.0590	10	0.16420	T	0.52	-13.8285	14.9005	0.70675	0.0:0.0:1.0:0.0	.	22	P48651	PTSS1_HUMAN	Q	22	ENSP00000430548:R22Q	ENSP00000337331:R22Q	R	+	2	0	PTDSS1	97343509	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.819000	0.91997	2.169000	0.68431	0.557000	0.71058	CGG	PTDSS1	-	NULL	ENSG00000156471		0.597	PTDSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTDSS1	HGNC	protein_coding	OTTHUMT00000379743.2	32	0.00	0	G			97274333	97274333	+1	no_errors	ENST00000517309	ensembl	human	known	69_37n	missense	47	11.32	6	SNP	1.000	A
PTPN13	5783	genome.wustl.edu	37	4	87671758	87671758	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr4:87671758C>G	ENST00000411767.2	+	18	2849	c.2786C>G	c.(2785-2787)gCt>gGt	p.A929G	PTPN13_ENST00000511467.1_Missense_Mutation_p.A929G|PTPN13_ENST00000427191.2_Missense_Mutation_p.A929G|PTPN13_ENST00000436978.1_Missense_Mutation_p.A929G|PTPN13_ENST00000316707.6_Intron			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	929					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		TCAGTTCAAGCTGAGATTCTG	0.463																																						dbGAP											0													75.0	75.0	75.0					4																	87671758		1962	4158	6120	-	-	-	SO:0001583	missense	0				CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.2786C>G	4.37:g.87671758C>G	ENSP00000407249:p.Ala929Gly		B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Missense_Mutation	SNP	pirsf_Tyr_Pase_non-rcpt_typ-13,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_FERM_central,superfamily_PDZ,superfamily_PAZ,smart_KIND,smart_Band_41_domain,smart_PDZ,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam,pfscan_FERM_domain,pfscan_PDZ,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.A929G	ENST00000411767.2	37	c.2786	CCDS47094.1	4	.	.	.	.	.	.	.	.	.	.	C	22.1	4.245447	0.80024	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000411767;ENST00000511467;ENST00000357349	T;T;T;T	0.53206	0.63;0.66;0.63;0.66	6.16	6.16	0.99307	.	0.000000	0.51477	D	0.000095	T	0.63379	0.2506	L	0.57536	1.79	0.47153	D	0.999336	B;D;D	0.65815	0.36;0.983;0.995	B;P;P	0.61722	0.112;0.659;0.893	T	0.50882	-0.8775	10	0.17832	T	0.49	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	929;929;929	Q12923-3;Q12923;Q12923-4	.;PTN13_HUMAN;.	G	929;929;929;929;897	ENSP00000408368:A929G;ENSP00000394794:A929G;ENSP00000407249:A929G;ENSP00000426626:A929G	ENSP00000349909:A897G	A	+	2	0	PTPN13	87890782	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.024000	0.70857	2.937000	0.99478	0.650000	0.86243	GCT	PTPN13	-	pirsf_Tyr_Pase_non-rcpt_typ-13	ENSG00000163629		0.463	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPN13	HGNC	protein_coding	OTTHUMT00000363191.1	29	0.00	0	C			87671758	87671758	+1	no_errors	ENST00000436978	ensembl	human	known	69_37n	missense	16	23.81	5	SNP	1.000	G
PTPRN2	5799	genome.wustl.edu	37	7	157691399	157691399	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr7:157691399G>T	ENST00000389418.4	-	12	1763	c.1754C>A	c.(1753-1755)tCt>tAt	p.S585Y	PTPRN2_ENST00000404321.2_Missense_Mutation_p.S608Y|PTPRN2_ENST00000389413.3_Missense_Mutation_p.S556Y|PTPRN2_ENST00000389416.4_Missense_Mutation_p.S568Y|PTPRN2_ENST00000409483.1_Missense_Mutation_p.S547Y	NM_002847.3	NP_002838.2	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N polypeptide 2	585					negative regulation of GTPase activity (GO:0034260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum lumen (GO:0005788)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(1)|lung(42)|ovary(4)|pleura(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	86	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		TTTCAGTCCAGAGGTTTCCTC	0.522																																						dbGAP											0													152.0	161.0	158.0					7																	157691399		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002385	CCDS5947.1, CCDS5948.1, CCDS5949.1	7q36	2011-06-09			ENSG00000155093	ENSG00000155093		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9677	protein-coding gene	gene with protein product	"""IAR PTPRP"""	601698				8954911, 9220540	Standard	NM_130842		Approved	KIAA0387, phogrin, ICAAR, IA-2beta	uc003wno.3	Q92932	OTTHUMG00000152646	ENST00000389418.4:c.1754C>A	7.37:g.157691399G>T	ENSP00000374069:p.Ser585Tyr		E9PC57|Q8N4I5|Q92662|Q9Y4F8|Q9Y4I6	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Receptor_IA-2,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.S608Y	ENST00000389418.4	37	c.1823	CCDS5947.1	7	.	.	.	.	.	.	.	.	.	.	.	19.46	3.830938	0.71258	.	.	ENSG00000155093	ENST00000409483;ENST00000389413;ENST00000389416;ENST00000389418;ENST00000404321	T;T;T;T;T	0.03152	4.04;4.06;4.03;4.04;4.03	5.33	5.33	0.75918	.	0.832767	0.09979	N	0.731291	T	0.12817	0.0311	L	0.34521	1.04	0.21020	N	0.999807	D;D;P;D;P	0.69078	0.979;0.983;0.942;0.997;0.953	P;P;P;D;P	0.69479	0.81;0.752;0.708;0.964;0.808	T	0.39742	-0.9599	10	0.87932	D	0	.	17.2186	0.86951	0.0:0.0:1.0:0.0	.	608;547;556;568;585	Q92932-3;E7EM83;Q92932-2;E9PC57;Q92932	.;.;.;.;PTPR2_HUMAN	Y	547;556;568;585;608	ENSP00000387114:S547Y;ENSP00000374064:S556Y;ENSP00000374067:S568Y;ENSP00000374069:S585Y;ENSP00000385464:S608Y	ENSP00000374064:S556Y	S	-	2	0	PTPRN2	157384160	1.000000	0.71417	0.202000	0.23494	0.061000	0.15899	4.390000	0.59646	2.491000	0.84063	0.655000	0.94253	TCT	PTPRN2	-	pfam_Receptor_IA-2	ENSG00000155093		0.522	PTPRN2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTPRN2	HGNC	protein_coding	OTTHUMT00000353214.1	81	0.00	0	G			157691399	157691399	-1	no_errors	ENST00000404321	ensembl	human	known	69_37n	missense	39	17.02	8	SNP	0.332	T
RLF	6018	genome.wustl.edu	37	1	40702996	40702996	+	Missense_Mutation	SNP	A	A	T			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr1:40702996A>T	ENST00000372771.4	+	8	2649	c.2622A>T	c.(2620-2622)gaA>gaT	p.E874D		NM_012421.3	NP_036553.2	Q13129	RLF_HUMAN	rearranged L-myc fusion	874					chromosome organization (GO:0051276)|DNA integration (GO:0015074)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(18)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(4)|urinary_tract(2)	68	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)			TCTGTGCAGAATCAGCTAATT	0.363																																						dbGAP											0													50.0	53.0	52.0					1																	40702996		2202	4298	6500	-	-	-	SO:0001583	missense	0				CCDS448.1	1p32	2010-05-07	2005-08-16		ENSG00000117000	ENSG00000117000		"""Zinc fingers, C2H2-type"""	10025	protein-coding gene	gene with protein product		180610	"""rearranged L-myc fusion sequence"""			1649386	Standard	NM_012421		Approved	ZNF292L, Zn-15L	uc001cfc.4	Q13129	OTTHUMG00000005763	ENST00000372771.4:c.2622A>T	1.37:g.40702996A>T	ENSP00000361857:p.Glu874Asp		Q14CQ1|Q9NU60	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E874D	ENST00000372771.4	37	c.2622	CCDS448.1	1	.	.	.	.	.	.	.	.	.	.	A	0.062	-1.222086	0.01530	.	.	ENSG00000117000	ENST00000372771;ENST00000535839	T	0.14144	2.53	5.44	0.551	0.17225	.	0.646567	0.16444	N	0.214171	T	0.04497	0.0123	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.39078	-0.9631	10	0.13853	T	0.58	-1.2378	1.4796	0.02433	0.4981:0.1055:0.2107:0.1856	.	567;874	F5H2M5;Q13129	.;RLF_HUMAN	D	874;567	ENSP00000361857:E874D	ENSP00000361857:E874D	E	+	3	2	RLF	40475583	0.002000	0.14202	0.803000	0.32268	0.923000	0.55619	0.720000	0.25896	0.530000	0.28619	0.533000	0.62120	GAA	RLF	-	NULL	ENSG00000117000		0.363	RLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RLF	HGNC	protein_coding	OTTHUMT00000015767.1	34	0.00	0	A	NM_012421		40702996	40702996	+1	no_errors	ENST00000372771	ensembl	human	known	69_37n	missense	22	35.29	12	SNP	0.001	T
RNF157	114804	genome.wustl.edu	37	17	74150372	74150372	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr17:74150372G>A	ENST00000269391.6	-	17	1934	c.1802C>T	c.(1801-1803)aCg>aTg	p.T601M	RNF157-AS1_ENST00000585542.1_RNA|RNF157-AS1_ENST00000590137.1_RNA|RNF157-AS1_ENST00000586661.1_RNA|RNF157-AS1_ENST00000592748.1_RNA|RNF157-AS1_ENST00000586627.1_RNA|RNF157_ENST00000319945.6_Missense_Mutation_p.T579M	NM_052916.2	NP_443148.1	Q96PX1	RN157_HUMAN	ring finger protein 157	601							zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	25			LUSC - Lung squamous cell carcinoma(166;0.187)			ACCTTCCTGCGTGGGTGATCC	0.443																																					GBM(186;507 2120 27388 27773 52994)	dbGAP											0													196.0	178.0	184.0					17																	74150372		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091467	CCDS32740.1	17q25.3	2004-02-27			ENSG00000141576	ENSG00000141576		"""RING-type (C3HC4) zinc fingers"""	29402	protein-coding gene	gene with protein product						11572484	Standard	NM_052916		Approved	KIAA1917	uc002jqz.3	Q96PX1	OTTHUMG00000132627	ENST00000269391.6:c.1802C>T	17.37:g.74150372G>A	ENSP00000269391:p.Thr601Met		Q8NB72|Q96N56	Missense_Mutation	SNP	smart_Znf_RING,pfscan_Znf_RING	p.T601M	ENST00000269391.6	37	c.1802	CCDS32740.1	17	.	.	.	.	.	.	.	.	.	.	G	11.96	1.795151	0.31777	.	.	ENSG00000141576	ENST00000269391;ENST00000319945	T;T	0.26373	1.81;1.74	5.28	3.2	0.36748	.	0.579212	0.19054	N	0.123970	T	0.19366	0.0465	L	0.46157	1.445	0.19575	N	0.999969	B;P	0.37708	0.018;0.606	B;B	0.36666	0.013;0.23	T	0.17167	-1.0378	10	0.51188	T	0.08	-19.559	3.7762	0.08661	0.2277:0.0:0.5845:0.1878	.	579;601	Q96PX1-2;Q96PX1	.;RN157_HUMAN	M	601;579	ENSP00000269391:T601M;ENSP00000321837:T579M	ENSP00000269391:T601M	T	-	2	0	RNF157	71661967	0.991000	0.36638	0.003000	0.11579	0.835000	0.47333	3.286000	0.51724	0.568000	0.29311	-0.222000	0.12452	ACG	RNF157	-	NULL	ENSG00000141576		0.443	RNF157-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF157	HGNC	protein_coding	OTTHUMT00000255874.2	58	0.00	0	G	XM_290732		74150372	74150372	-1	no_errors	ENST00000269391	ensembl	human	known	69_37n	missense	17	22.73	5	SNP	0.026	A
SCN7A	6332	genome.wustl.edu	37	2	167273377	167273377	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr2:167273377T>C	ENST00000409855.1	-	20	3380	c.3254A>G	c.(3253-3255)tAt>tGt	p.Y1085C		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	1085					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	AATGCATTCATAGAATCTGCC	0.403																																						dbGAP											0													97.0	86.0	90.0					2																	167273377		1884	4115	5999	-	-	-	SO:0001583	missense	0			M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.3254A>G	2.37:g.167273377T>C	ENSP00000386796:p.Tyr1085Cys			Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.Y1085C	ENST00000409855.1	37	c.3254	CCDS46442.1	2	.	.	.	.	.	.	.	.	.	.	T	15.46	2.839689	0.51057	.	.	ENSG00000136546	ENST00000409855;ENST00000259060	D	0.98512	-4.97	5.08	3.87	0.44632	Ion transport (1);	0.000000	0.49305	D	0.000150	D	0.98801	0.9596	M	0.89095	3.005	0.28186	N	0.927954	D	0.89917	1.0	D	0.74348	0.983	D	0.95208	0.8323	10	0.66056	D	0.02	.	10.4282	0.44391	0.0:0.0:0.1626:0.8374	.	1085	Q01118	SCN7A_HUMAN	C	1085	ENSP00000386796:Y1085C	ENSP00000259060:Y1085C	Y	-	2	0	SCN7A	166981623	0.000000	0.05858	1.000000	0.80357	0.978000	0.69477	0.231000	0.17872	2.147000	0.66899	0.528000	0.53228	TAT	SCN7A	-	pfam_Ion_trans_dom	ENSG00000136546		0.403	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN7A	HGNC	protein_coding	OTTHUMT00000333745.1	74	0.00	0	T			167273377	167273377	-1	no_errors	ENST00000409855	ensembl	human	known	69_37n	missense	10	69.70	23	SNP	0.588	C
SLC39A12	221074	genome.wustl.edu	37	10	18242296	18242296	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr10:18242296G>A	ENST00000377369.2	+	2	364	c.91G>A	c.(91-93)Gcc>Acc	p.A31T	SLC39A12_ENST00000377371.3_Missense_Mutation_p.A31T|SLC39A12_ENST00000377374.4_Missense_Mutation_p.A31T|SLC39A12_ENST00000539911.1_Intron	NM_001145195.1|NM_001282733.1|NM_001282734.1	NP_001138667.1|NP_001269662.1|NP_001269663.1	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter), member 12	31					regulation of microtubule polymerization (GO:0031113)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)|zinc ion transmembrane import (GO:0071578)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	zinc ion transmembrane transporter activity (GO:0005385)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(5)|lung(38)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	60						CAAACCCTCAGCCCAGGATAG	0.537																																						dbGAP											0													96.0	94.0	95.0					10																	18242296		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS7124.1, CCDS44362.1, CCDS60493.1, CCDS60494.1	10p12.33	2013-05-22			ENSG00000148482	ENSG00000148482		"""Solute carriers"""	20860	protein-coding gene	gene with protein product		608734	"""solute carrier family 39 (metal ion transporter), member 12"""			12659941	Standard	NM_152725		Approved	FLJ30499	uc001ipo.2	Q504Y0	OTTHUMG00000017759	ENST00000377369.2:c.91G>A	10.37:g.18242296G>A	ENSP00000366586:p.Ala31Thr		B7ZL35|C9JJL4|Q49AN8|Q4G0L3|Q5VWV8|Q5VWV9|Q6NZY5|Q96NN4	Missense_Mutation	SNP	pfam_ZIP	p.A31T	ENST00000377369.2	37	c.91	CCDS44362.1	10	.	.	.	.	.	.	.	.	.	.	G	6.331	0.429237	0.11987	.	.	ENSG00000148482	ENST00000377369;ENST00000377374;ENST00000377371	T;T;T	0.21932	1.98;1.98;1.98	5.96	-5.06	0.02946	.	1.284030	0.04822	N	0.437080	T	0.07954	0.0199	N	0.02916	-0.46	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.39820	-0.9595	10	0.10902	T	0.67	-0.3834	10.9741	0.47456	0.283:0.1147:0.6023:0.0	.	31;31;31	Q504Y0-4;Q504Y0;Q504Y0-3	.;S39AC_HUMAN;.	T	31	ENSP00000366586:A31T;ENSP00000366591:A31T;ENSP00000366588:A31T	ENSP00000366586:A31T	A	+	1	0	SLC39A12	18282302	0.000000	0.05858	0.000000	0.03702	0.232000	0.25224	-0.125000	0.10579	-0.699000	0.05077	-0.794000	0.03295	GCC	SLC39A12	-	NULL	ENSG00000148482		0.537	SLC39A12-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC39A12	HGNC	protein_coding		59	0.00	0	G	NM_152725		18242296	18242296	+1	no_errors	ENST00000377369	ensembl	human	known	69_37n	missense	41	12.77	6	SNP	0.000	A
STEAP1	26872	genome.wustl.edu	37	7	89790307	89790307	+	Silent	SNP	G	G	A			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr7:89790307G>A	ENST00000297205.2	+	3	473	c.273G>A	c.(271-273)ctG>ctA	p.L91L	STEAP2-AS1_ENST00000478318.2_RNA	NM_012449.2	NP_036581.1	Q9UHE8	STEA1_HUMAN	six transmembrane epithelial antigen of the prostate 1	91					ion transport (GO:0006811)|iron ion homeostasis (GO:0055072)|transmembrane transport (GO:0055085)	cell-cell junction (GO:0005911)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	channel activity (GO:0015267)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|transporter activity (GO:0005215)			kidney(2)|large_intestine(3)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	14	all_hematologic(106;0.112)					ACACTCTTCTGAGGGAAGTAA	0.388																																						dbGAP											0													99.0	98.0	99.0					7																	89790307		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF186249	CCDS5614.1	7q21	2011-08-31	2005-02-21	2005-02-24	ENSG00000164647	ENSG00000164647		"""Serine peptidases / Serine peptidases"""	11378	protein-coding gene	gene with protein product		604415	"""six transmembrane epithelial antigen of the prostate"""	STEAP			Standard	NM_012449		Approved	PRSS24	uc003ujx.3	Q9UHE8	OTTHUMG00000023006	ENST00000297205.2:c.273G>A	7.37:g.89790307G>A			A4D1E0|O95034	Silent	SNP	pfam_Fe3_Rdtase_TM_dom	p.L91	ENST00000297205.2	37	c.273	CCDS5614.1	7																																																																																			STEAP1	-	NULL	ENSG00000164647		0.388	STEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STEAP1	HGNC	protein_coding	OTTHUMT00000059327.3	95	0.00	0	G	NM_012449		89790307	89790307	+1	no_errors	ENST00000297205	ensembl	human	known	69_37n	silent	45	13.46	7	SNP	0.505	A
TLL1	7092	genome.wustl.edu	37	4	167012408	167012408	+	Silent	SNP	T	T	C	rs183270184		TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr4:167012408T>C	ENST00000061240.2	+	19	3218	c.2571T>C	c.(2569-2571)ctT>ctC	p.L857L	TLL1_ENST00000507499.1_Silent_p.L880L	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	857	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		CAGATCCCCTTGTGGCTACTG	0.398																																						dbGAP											0													98.0	92.0	94.0					4																	167012408		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.2571T>C	4.37:g.167012408T>C			B2RMU2|Q96AN3|Q9NQS4	Silent	SNP	pfam_CUB,pfam_Peptidase_M12A,pfam_EGF-like_Ca-bd,superfamily_CUB,smart_Peptidase_Metallo,smart_CUB,smart_EGF-like_Ca-bd,smart_EGF-like,pirsf_BMP_1/tolloid-like,pfscan_CUB,pfscan_EG-like_dom,prints_Peptidase_M12A	p.L857	ENST00000061240.2	37	c.2571	CCDS3811.1	4																																																																																			TLL1	-	pfam_CUB,superfamily_CUB,smart_CUB,pirsf_BMP_1/tolloid-like,pfscan_CUB	ENSG00000038295		0.398	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLL1	HGNC	protein_coding	OTTHUMT00000363821.1	37	0.00	0	T			167012408	167012408	+1	no_errors	ENST00000061240	ensembl	human	known	69_37n	silent	26	18.75	6	SNP	0.458	C
TMEM171	134285	genome.wustl.edu	37	5	72424228	72424228	+	Missense_Mutation	SNP	A	A	T			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr5:72424228A>T	ENST00000454765.2	+	3	1125	c.652A>T	c.(652-654)Ata>Tta	p.I218L	TMEM171_ENST00000287773.5_Missense_Mutation_p.I218L			Q8WVE6	TM171_HUMAN	transmembrane protein 171	218						integral component of membrane (GO:0016021)				endometrium(5)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|stomach(1)	15		Lung NSC(167;0.0378)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;1.87e-54)|Lung(70;0.115)		TGACTCGGTAATAATATTTCC	0.408																																					NSCLC(112;638 2280 27369 30736)	dbGAP											0													209.0	211.0	210.0					5																	72424228		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC018083	CCDS4017.1, CCDS54869.1	5q13.2	2008-02-05			ENSG00000157111	ENSG00000157111			27031	protein-coding gene	gene with protein product						12477932	Standard	NM_173490		Approved	PRP2	uc003kcm.2	Q8WVE6	OTTHUMG00000131269	ENST00000454765.2:c.652A>T	5.37:g.72424228A>T	ENSP00000415030:p.Ile218Leu		Q8N0S1|Q8TDT7	Missense_Mutation	SNP	NULL	p.I218L	ENST00000454765.2	37	c.652	CCDS4017.1	5	.	.	.	.	.	.	.	.	.	.	A	13.41	2.228509	0.39399	.	.	ENSG00000157111	ENST00000454765;ENST00000287773	T;T	0.23950	1.88;1.88	5.42	5.42	0.78866	.	0.168316	0.38897	N	0.001536	T	0.22399	0.0540	L	0.55103	1.725	0.28132	N	0.930139	P;P	0.35507	0.506;0.506	B;B	0.28139	0.086;0.086	T	0.20472	-1.0274	10	0.41790	T	0.15	-8.0629	11.124	0.48306	0.862:0.0:0.0:0.138	.	218;218	Q8WVE6-2;Q8WVE6	.;TM171_HUMAN	L	218	ENSP00000415030:I218L;ENSP00000287773:I218L	ENSP00000287773:I218L	I	+	1	0	TMEM171	72459984	1.000000	0.71417	0.987000	0.45799	0.141000	0.21300	2.681000	0.46926	2.054000	0.61138	0.460000	0.39030	ATA	TMEM171	-	NULL	ENSG00000157111		0.408	TMEM171-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM171	HGNC	protein_coding	OTTHUMT00000254037.2	122	0.00	0	A	NM_173490		72424228	72424228	+1	no_errors	ENST00000454765	ensembl	human	known	69_37n	missense	66	18.52	15	SNP	0.999	T
TP53	7157	genome.wustl.edu	37	17	7578263	7578263	+	Nonsense_Mutation	SNP	G	G	A	rs397516435		TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chr17:7578263G>A	ENST00000269305.4	-	6	775	c.586C>T	c.(586-588)Cga>Tga	p.R196*	TP53_ENST00000445888.2_Nonsense_Mutation_p.R196*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R196*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R196*|TP53_ENST00000574684.1_Intron|TP53_ENST00000359597.4_Nonsense_Mutation_p.R196*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R196*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	196	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R196*(167)|p.R64*(14)|p.R103*(14)|p.0?(8)|p.R196fs*51(7)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.R196R(2)|p.I195fs*50(1)|p.R64fs*>27(1)|p.R103fs*51(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I195fs*12(1)|p.P59_E66>Q(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCTTCCACTCGGATAAGATGC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	232	Substitution - Nonsense(195)|Deletion - Frameshift(11)|Whole gene deletion(8)|Deletion - In frame(5)|Complex - deletion inframe(5)|Unknown(5)|Substitution - coding silent(2)|Complex - frameshift(1)	large_intestine(54)|breast(29)|upper_aerodigestive_tract(22)|lung(22)|haematopoietic_and_lymphoid_tissue(17)|skin(17)|biliary_tract(11)|central_nervous_system(11)|oesophagus(11)|ovary(11)|stomach(8)|urinary_tract(7)|bone(4)|liver(3)|pancreas(3)|eye(1)|kidney(1)	GRCh37	CM941329	TP53	M							102.0	91.0	94.0					17																	7578263		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.586C>T	17.37:g.7578263G>A	ENSP00000269305:p.Arg196*		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R196*	ENST00000269305.4	37	c.586	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	14.02	2.409843	0.42715	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.41	4.44	0.53790	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.9531	12.3046	0.54895	0.0827:0.0:0.9173:0.0	.	.	.	.	X	196;196;196;196;196;196;185;103;64;103;64	.	ENSP00000269305:R196X	R	-	1	2	TP53	7518988	1.000000	0.71417	0.997000	0.53966	0.023000	0.10783	2.166000	0.42406	1.427000	0.47276	-0.140000	0.14226	CGA	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	76	0.00	0	G	NM_000546		7578263	7578263	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	nonsense	16	58.97	23	SNP	1.000	A
WDR13	64743	genome.wustl.edu	37	X	48460302	48460302	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1N9-01A-11D-A14G-09	TCGA-E9-A1N9-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2aa7a1db-40a5-421b-97ab-1031e6fa7f04	8ad40192-c404-4cfa-b30c-1e76452dadbc	g.chrX:48460302C>T	ENST00000218056.5	+	6	1467	c.962C>T	c.(961-963)gCg>gTg	p.A321V	WDR13_ENST00000376729.5_Missense_Mutation_p.A321V	NM_001166426.1|NM_017883.4	NP_001159898.1|NP_060353	Q9H1Z4	WDR13_HUMAN	WD repeat domain 13	321						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|large_intestine(4)|lung(4)|ovary(2)	11						CTGCTCTGGGCGGGTGATGAC	0.597																																						dbGAP											0													69.0	56.0	61.0					X																	48460302		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF329819	CCDS14302.1	Xp11.23	2013-01-09			ENSG00000101940	ENSG00000101940		"""WD repeat domain containing"""	14352	protein-coding gene	gene with protein product		300512					Standard	NM_017883		Approved		uc004dkj.2	Q9H1Z4	OTTHUMG00000024119	ENST00000218056.5:c.962C>T	X.37:g.48460302C>T	ENSP00000218056:p.Ala321Val		Q06DW8|Q06DX0|Q06DX1|Q9BUL7|Q9NWW4	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A321V	ENST00000218056.5	37	c.962	CCDS14302.1	X	.	.	.	.	.	.	.	.	.	.	C	17.84	3.486841	0.63962	.	.	ENSG00000101940	ENST00000376729;ENST00000218056	T;T	0.63580	-0.05;-0.05	5.4	5.4	0.78164	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.53626	0.1808	L	0.49640	1.575	0.58432	D	0.999999	P	0.41748	0.761	B	0.32090	0.14	T	0.60414	-0.7268	10	0.51188	T	0.08	-0.136	15.575	0.76368	0.0:1.0:0.0:0.0	.	321	Q9H1Z4	WDR13_HUMAN	V	321	ENSP00000365919:A321V;ENSP00000218056:A321V	ENSP00000218056:A321V	A	+	2	0	WDR13	48345246	1.000000	0.71417	0.970000	0.41538	0.878000	0.50629	6.761000	0.74945	2.272000	0.75746	0.431000	0.28591	GCG	WDR13	-	superfamily_WD40_repeat_dom	ENSG00000101940		0.597	WDR13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR13	HGNC	protein_coding	OTTHUMT00000060743.2	34	0.00	0	C			48460302	48460302	+1	no_errors	ENST00000218056	ensembl	human	known	69_37n	missense	11	26.67	4	SNP	1.000	T
