#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABHD13	84945	genome.wustl.edu	37	13	108882099	108882099	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr13:108882099C>G	ENST00000375898.3	+	2	834	c.533C>G	c.(532-534)aCt>aGt	p.T178S		NM_032859.2	NP_116248.2	Q7L211	ABHDD_HUMAN	abhydrolase domain containing 13	178						integral component of membrane (GO:0016021)|membrane (GO:0016020)	hydrolase activity (GO:0016787)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					TACGTGATGACTAGACCTGAC	0.393																																					Pancreas(22;506 789 38166 45896 51596)	dbGAP											0													109.0	95.0	100.0					13																	108882099		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027812	CCDS32007.1	13q33.2	2007-04-03	2006-03-10	2006-03-10	ENSG00000139826	ENSG00000139826		"""Abhydrolase domain containing"""	20293	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 6"""	C13orf6			Standard	NM_032859		Approved	bA153I24.2, FLJ14906, BEM46L1	uc001vqq.3	Q7L211	OTTHUMG00000017330	ENST00000375898.3:c.533C>G	13.37:g.108882099C>G	ENSP00000365063:p.Thr178Ser		B3KWE7|Q8NBW1|Q96JX9	Missense_Mutation	SNP	pfam_AB_hydrolase_1,pfam_AXE1	p.T178S	ENST00000375898.3	37	c.533	CCDS32007.1	13	.	.	.	.	.	.	.	.	.	.	C	10.13	1.266717	0.23136	.	.	ENSG00000139826	ENST00000375898	T	0.39997	1.05	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.23451	0.0567	N	0.02685	-0.53	0.80722	D	1	B	0.20988	0.05	B	0.24701	0.055	T	0.17684	-1.0361	10	0.11182	T	0.66	-14.6002	19.5254	0.95203	0.0:1.0:0.0:0.0	.	178	Q7L211	ABHDD_HUMAN	S	178	ENSP00000365063:T178S	ENSP00000365063:T178S	T	+	2	0	ABHD13	107680100	0.995000	0.38212	0.985000	0.45067	0.998000	0.95712	3.243000	0.51392	2.857000	0.98124	0.650000	0.86243	ACT	ABHD13	-	pfam_AB_hydrolase_1,pfam_AXE1	ENSG00000139826		0.393	ABHD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD13	HGNC	protein_coding	OTTHUMT00000045743.1	110	0.00	0	C	NM_032859		108882099	108882099	+1	no_errors	ENST00000375898	ensembl	human	known	69_37n	missense	33	15.38	6	SNP	1.000	G
ADAMTS3	9508	genome.wustl.edu	37	4	73414439	73414439	+	Missense_Mutation	SNP	A	A	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr4:73414439A>T	ENST00000286657.4	-	3	296	c.260T>A	c.(259-261)tTt>tAt	p.F87Y	ADAMTS3_ENST00000505193.1_5'UTR	NM_014243.2	NP_055058.2	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 3	87					collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix organization (GO:0030198)|positive regulation of vascular endothelial growth factor signaling pathway (GO:1900748)|protein processing (GO:0016485)|vascular endothelial growth factor production (GO:0010573)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(33)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	76			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			ATCTTTTCCAAATGCCGTGAT	0.488																																					NSCLC(168;1941 2048 2918 13048 43078)	dbGAP											0													108.0	102.0	104.0					4																	73414439		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002364	CCDS3553.1	4q21	2008-07-29	2005-08-19		ENSG00000156140	ENSG00000156140	3.4.24.-	"""ADAM metallopeptidases with thrombospondin type 1 motif"""	219	protein-coding gene	gene with protein product		605011	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 3"""			10094461	Standard	NM_014243		Approved	KIAA0366, ADAMTS-4	uc003hgk.2	O15072	OTTHUMG00000129912	ENST00000286657.4:c.260T>A	4.37:g.73414439A>T	ENSP00000286657:p.Phe87Tyr		A1L3U9|Q9BXZ8	Missense_Mutation	SNP	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.F87Y	ENST00000286657.4	37	c.260	CCDS3553.1	4	.	.	.	.	.	.	.	.	.	.	A	16.78	3.216741	0.58452	.	.	ENSG00000156140	ENST00000286657	T	0.06768	3.26	5.74	5.74	0.90152	Peptidase M12B, propeptide (1);	0.000000	0.64402	D	0.000002	T	0.25606	0.0623	L	0.61387	1.9	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	T	0.00617	-1.1642	10	0.30854	T	0.27	.	15.5164	0.75828	1.0:0.0:0.0:0.0	.	87	O15072	ATS3_HUMAN	Y	87	ENSP00000286657:F87Y	ENSP00000286657:F87Y	F	-	2	0	ADAMTS3	73633303	1.000000	0.71417	1.000000	0.80357	0.466000	0.32739	9.224000	0.95209	2.308000	0.77769	0.523000	0.50628	TTT	ADAMTS3	-	pfam_Peptidase_M12B_N	ENSG00000156140		0.488	ADAMTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS3	HGNC	protein_coding	OTTHUMT00000252164.2	159	0.00	0	A			73414439	73414439	-1	no_errors	ENST00000286657	ensembl	human	known	69_37n	missense	40	21.57	11	SNP	1.000	T
ADCY8	114	genome.wustl.edu	37	8	131916201	131916201	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr8:131916201G>C	ENST00000286355.5	-	7	3820	c.1728C>G	c.(1726-1728)ttC>ttG	p.F576L	ADCY8_ENST00000377928.3_Missense_Mutation_p.F576L	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	576					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			GCTTCCTCAGGAATTCATTCC	0.468										HNSCC(32;0.087)																												dbGAP											0													188.0	173.0	178.0					8																	131916201		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.1728C>G	8.37:g.131916201G>C	ENSP00000286355:p.Phe576Leu			Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.F576L	ENST00000286355.5	37	c.1728	CCDS6363.1	8	.	.	.	.	.	.	.	.	.	.	G	19.02	3.746542	0.69418	.	.	ENSG00000155897	ENST00000286355;ENST00000377928;ENST00000522949	T;T;T	0.81163	-1.46;-1.46;-1.46	6.17	5.3	0.74995	Adenylyl cyclase class-3/4/guanylyl cyclase (3);	0.000000	0.85682	D	0.000000	T	0.78162	0.4240	N	0.26092	0.79	0.44477	D	0.997412	P;B	0.47034	0.889;0.238	P;B	0.51229	0.663;0.085	T	0.78293	-0.2260	10	0.40728	T	0.16	.	14.418	0.67163	0.0698:0.0:0.9302:0.0	.	576;576	E7EVL1;P40145	.;ADCY8_HUMAN	L	576;576;191	ENSP00000286355:F576L;ENSP00000367161:F576L;ENSP00000428010:F191L	ENSP00000286355:F576L	F	-	3	2	ADCY8	131985383	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.963000	0.49184	1.620000	0.50308	0.655000	0.94253	TTC	ADCY8	-	pfam_A/G_cyclase,superfamily_A/G_cyclase	ENSG00000155897		0.468	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY8	HGNC	protein_coding	OTTHUMT00000380080.1	88	0.00	0	G			131916201	131916201	-1	no_errors	ENST00000286355	ensembl	human	known	69_37n	missense	25	16.67	5	SNP	1.000	C
AHCY	191	genome.wustl.edu	37	20	32873245	32873245	+	Splice_Site	SNP	C	C	A			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr20:32873245C>A	ENST00000217426.2	-	9	1245		c.e9+1		AHCY_ENST00000538132.1_Splice_Site|CTD-3216D2.5_ENST00000609218.1_RNA	NM_000687.2	NP_000678.1	P23526	SAHH_HUMAN	adenosylhomocysteinase						cellular nitrogen compound metabolic process (GO:0034641)|chronic inflammatory response to antigenic stimulus (GO:0002439)|circadian sleep/wake cycle (GO:0042745)|homocysteine biosynthetic process (GO:0071268)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|S-adenosylhomocysteine catabolic process (GO:0019510)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|nucleus (GO:0005634)	adenosylhomocysteinase activity (GO:0004013)|adenyl nucleotide binding (GO:0030554)|NAD binding (GO:0051287)			endometrium(6)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						AATAAACCCACCTTCTTGGGC	0.532																																						dbGAP											0													64.0	61.0	62.0					20																	32873245		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			M61832	CCDS13233.1, CCDS54457.1	20q11.22	2009-06-12	2009-06-12		ENSG00000101444	ENSG00000101444	3.3.1.1		343	protein-coding gene	gene with protein product		180960	"""S-adenosylhomocysteine hydrolase"""			7079734, 6580258	Standard	NM_001161766		Approved	SAHH	uc002xai.3	P23526	OTTHUMG00000140098	ENST00000217426.2:c.1167+1G>T	20.37:g.32873245C>A			A8K307|B3KUN3|E1P5P2|F5H737|Q96A36	Splice_Site	SNP	-	e9+1	ENST00000217426.2	37	c.1167+1	CCDS13233.1	20	.	.	.	.	.	.	.	.	.	.	C	19.62	3.861521	0.71949	.	.	ENSG00000101444	ENST00000217426;ENST00000538132	.	.	.	4.9	4.9	0.64082	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.522	0.90956	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	AHCY	32336906	1.000000	0.71417	0.995000	0.50966	0.691000	0.40173	7.732000	0.84908	2.457000	0.83068	0.650000	0.86243	.	AHCY	-	-	ENSG00000101444		0.532	AHCY-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AHCY	HGNC	protein_coding	OTTHUMT00000078773.2	69	0.00	0	C	NM_000687	Intron	32873245	32873245	-1	no_errors	ENST00000217426	ensembl	human	known	69_37n	splice_site	31	22.50	9	SNP	1.000	A
AHSA1	10598	genome.wustl.edu	37	14	77929072	77929072	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr14:77929072A>G	ENST00000216479.3	+	4	602	c.442A>G	c.(442-444)Atg>Gtg	p.M148V	AHSA1_ENST00000535854.2_Missense_Mutation_p.M148V|AHSA1_ENST00000555457.1_Intron	NM_012111.2	NP_036243.1	O95433	AHSA1_HUMAN	AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast)	148					positive regulation of ATPase activity (GO:0032781)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	ATPase activator activity (GO:0001671)|chaperone binding (GO:0051087)			endometrium(1)|kidney(3)|large_intestine(1)|prostate(1)|skin(1)|stomach(1)	8			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0281)		AAGAGAAGCAATGGGAATTTA	0.453																																						dbGAP											0													128.0	121.0	123.0					14																	77929072		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ243310	CCDS9863.1	14q	2008-02-05	2003-04-04	2003-04-11		ENSG00000100591			1189	protein-coding gene	gene with protein product		608466	"""chromosome 14 open reading frame 3"""	C14orf3			Standard	NM_012111		Approved	p38	uc001xtw.3	O95433		ENST00000216479.3:c.442A>G	14.37:g.77929072A>G	ENSP00000216479:p.Met148Val		B2R9L2|B4DUR9|Q96IL6|Q9P060	Missense_Mutation	SNP	pfam_AHSA1_N,pfam_Activator_of_Hsp90_ATPase,superfamily_AHSA1_N	p.M148V	ENST00000216479.3	37	c.442	CCDS9863.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.85|11.85	1.760618|1.760618	0.31137|0.31137	.|.	.|.	ENSG00000100591|ENSG00000100591	ENST00000555133;ENST00000216479;ENST00000535854|ENST00000553374;ENST00000555729	.|.	.|.	.|.	5.74|5.74	-0.471|-0.471	0.12119|0.12119	Activator of Hsp90 ATPase, N-terminal (2);|.	0.394395|.	0.31221|.	N|.	0.008026|.	T|T	0.14184|0.14184	0.0343|0.0343	N|N	0.00538|0.00538	-1.39|-1.39	0.80722|0.80722	D|D	1|1	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.04013|.	0.001;0.0|.	T|T	0.16748|0.16748	-1.0392|-1.0392	9|5	0.32370|.	T|.	0.25|.	-4.0635|-4.0635	11.6531|11.6531	0.51301|0.51301	0.4549:0.0:0.5451:0.0|0.4549:0.0:0.5451:0.0	.|.	148;148|.	B4DUR9;O95433|.	.;AHSA1_HUMAN|.	V|S	13;148;148|93;66	.|.	ENSP00000216479:M148V|.	M|N	+|+	1|2	0|0	AHSA1|AHSA1	76998825|76998825	0.792000|0.792000	0.28813|0.28813	0.970000|0.970000	0.41538|0.41538	0.985000|0.985000	0.73830|0.73830	0.839000|0.839000	0.27586|0.27586	-0.098000|-0.098000	0.12285|0.12285	0.528000|0.528000	0.53228|0.53228	ATG|AAT	AHSA1	-	pfam_AHSA1_N,superfamily_AHSA1_N	ENSG00000100591		0.453	AHSA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AHSA1	HGNC	protein_coding	OTTHUMT00000414017.1	93	0.00	0	A	NM_012111		77929072	77929072	+1	no_errors	ENST00000216479	ensembl	human	known	69_37n	missense	27	28.95	11	SNP	0.465	G
ANAPC7	51434	genome.wustl.edu	37	12	110815309	110815309	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr12:110815309C>T	ENST00000455511.3	-	9	1348	c.1348G>A	c.(1348-1350)Gtt>Att	p.V450I	ANAPC7_ENST00000450008.2_Missense_Mutation_p.V450I|ANAPC7_ENST00000481473.1_5'UTR	NM_016238.2	NP_057322.2	Q9UJX3	APC7_HUMAN	anaphase promoting complex subunit 7	450					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)			breast(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)	19						TCAAGACAAACGGTGGCTAAA	0.433																																						dbGAP											0													239.0	205.0	216.0					12																	110815309		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF191340	CCDS9145.2, CCDS44971.1	12q13.12	2013-01-10			ENSG00000196510	ENSG00000196510		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	17380	protein-coding gene	gene with protein product		606949					Standard	NM_016238		Approved	APC7	uc001tqo.2	Q9UJX3	OTTHUMG00000157009	ENST00000455511.3:c.1348G>A	12.37:g.110815309C>T	ENSP00000394394:p.Val450Ile		Q96AC4|Q96GF4|Q9BU24|Q9NT16	Missense_Mutation	SNP	pfam_TPR_2,pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.V450I	ENST00000455511.3	37	c.1348	CCDS9145.2	12	.	.	.	.	.	.	.	.	.	.	C	26.7	4.761979	0.89932	.	.	ENSG00000196510	ENST00000455511;ENST00000481473;ENST00000486321;ENST00000450008;ENST00000471602	T;T	0.78003	-1.14;0.54	5.79	5.79	0.91817	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	D	0.86464	0.5939	M	0.67397	2.05	0.58432	D	0.999999	D;P	0.57899	0.981;0.547	D;B	0.65010	0.931;0.083	T	0.82930	-0.0213	10	0.28530	T	0.3	-30.9936	20.0313	0.97540	0.0:1.0:0.0:0.0	.	450;450	Q9UJX3-2;Q9UJX3	.;APC7_HUMAN	I	450;24;48;450;143	ENSP00000394394:V450I;ENSP00000402314:V450I	ENSP00000402314:V450I	V	-	1	0	ANAPC7	109299692	1.000000	0.71417	0.980000	0.43619	0.985000	0.73830	7.487000	0.81328	2.746000	0.94184	0.655000	0.94253	GTT	ANAPC7	-	pfscan_TPR-contain_dom	ENSG00000196510		0.433	ANAPC7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANAPC7	HGNC	protein_coding	OTTHUMT00000347075.3	317	0.00	0	C	NM_016238		110815309	110815309	-1	no_errors	ENST00000455511	ensembl	human	known	69_37n	missense	84	32.80	41	SNP	1.000	T
APOPT1	84334	genome.wustl.edu	37	14	104040485	104040485	+	Silent	SNP	C	C	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr14:104040485C>T	ENST00000409074.2	+	3	403	c.402C>T	c.(400-402)ggC>ggT	p.G134G	RP11-73M18.2_ENST00000472726.2_Silent_p.G134G|APOPT1_ENST00000477116.1_3'UTR|AL139300.1_ENST00000583855.1_RNA|APOPT1_ENST00000556253.2_Silent_p.G121G|APOPT1_ENST00000247618.4_Silent_p.G121G	NM_032374.3	NP_115750.2	Q96IL0	APOP1_HUMAN	apoptogenic 1, mitochondrial	134					intrinsic apoptotic signaling pathway (GO:0097193)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)	mitochondrion (GO:0005739)											AAACTAAAGGCCTGGGCCTGA	0.353																																						dbGAP											0													200.0	201.0	201.0					14																	104040485		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC007412	CCDS9983.2	14q32.33	2012-06-28	2012-06-28	2011-09-07	ENSG00000256053	ENSG00000256053			20492	protein-coding gene	gene with protein product	"""apoptogenic protein 1"""		"""chromosome 14 open reading frame 153"", ""apoptogenic 1"""	C14orf153		16782708, 18977203	Standard	NM_032374		Approved	MGC2562, APOP-1		Q96IL0	OTTHUMG00000153929	ENST00000409074.2:c.402C>T	14.37:g.104040485C>T			Q53G28	Silent	SNP	pfam_UPF0671	p.G134	ENST00000409074.2	37	c.402	CCDS9983.2	14																																																																																			APOPT1	-	pfam_UPF0671	ENSG00000256053		0.353	APOPT1-001	KNOWN	basic|CCDS	protein_coding	APOPT1	HGNC	protein_coding	OTTHUMT00000333060.2	257	0.00	0	C	NM_032374		104040485	104040485	+1	no_errors	ENST00000409074	ensembl	human	known	69_37n	silent	140	15.06	25	SNP	0.910	T
ASB11	140456	genome.wustl.edu	37	X	15306047	15306047	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chrX:15306047G>A	ENST00000480796.1	-	6	853	c.803C>T	c.(802-804)gCg>gTg	p.A268V	ASB11_ENST00000537676.1_Missense_Mutation_p.A247V|ASB11_ENST00000344384.4_Missense_Mutation_p.A247V|ASB11_ENST00000380470.3_Missense_Mutation_p.A251V			Q8WXH4	ASB11_HUMAN	ankyrin repeat and SOCS box containing 11, E3 ubiquitin protein ligase	268					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					breast(2)|central_nervous_system(4)|endometrium(1)|large_intestine(1)|lung(5)|ovary(2)|skin(1)	16	Hepatocellular(33;0.183)					TTTTGGAGCCGCCAGATCAAG	0.542																																						dbGAP											0													112.0	88.0	96.0					X																	15306047		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF425642	CCDS14164.1, CCDS35209.1, CCDS56596.1	Xp22.31	2014-02-10	2014-02-10		ENSG00000165192	ENSG00000165192		"""Ankyrin repeat domain containing"""	17186	protein-coding gene	gene with protein product		300626	"""ankyrin repeat and SOCS box-containing 11"", ""ankyrin repeat and SOCS box containing 11"""			24337577	Standard	NM_080873		Approved	DKFZp779E2460	uc004cwp.2	Q8WXH4	OTTHUMG00000021173	ENST00000480796.1:c.803C>T	X.37:g.15306047G>A	ENSP00000417914:p.Ala268Val		E9PEN1|Q3SYC4|Q7Z667	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C	p.A268V	ENST00000480796.1	37	c.803	CCDS14164.1	X	.	.	.	.	.	.	.	.	.	.	G	17.31	3.357695	0.61403	.	.	ENSG00000165192	ENST00000537676;ENST00000380470;ENST00000344384;ENST00000480796	D;D;D;D	0.81739	-1.53;-1.53;-1.53;-1.53	5.44	4.58	0.56647	Ankyrin repeat-containing domain (4);	0.084250	0.51477	N	0.000092	D	0.89853	0.6835	M	0.86953	2.85	0.48288	D	0.999624	B;D;D	0.89917	0.379;1.0;1.0	B;D;D	0.91635	0.187;0.999;0.999	D	0.89565	0.3809	10	0.42905	T	0.14	-6.0806	12.351	0.55148	0.0831:0.0:0.9169:0.0	.	251;268;247	Q7Z667;Q8WXH4;E9PEN1	.;ASB11_HUMAN;.	V	247;251;247;268	ENSP00000445465:A247V;ENSP00000369837:A251V;ENSP00000343408:A247V;ENSP00000417914:A268V	ENSP00000343408:A247V	A	-	2	0	ASB11	15215968	1.000000	0.71417	0.382000	0.26119	0.947000	0.59692	4.401000	0.59716	1.077000	0.40990	0.523000	0.50628	GCG	ASB11	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000165192		0.542	ASB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB11	HGNC	protein_coding	OTTHUMT00000055852.2	144	0.00	0	G			15306047	15306047	-1	no_errors	ENST00000480796	ensembl	human	known	69_37n	missense	44	20.00	11	SNP	0.985	A
ATAD2B	54454	genome.wustl.edu	37	2	24086409	24086409	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr2:24086409C>A	ENST00000238789.5	-	12	1664	c.1321G>T	c.(1321-1323)Ggc>Tgc	p.G441C		NM_001242338.1|NM_017552.2	NP_001229267.1|NP_060022.1	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B	441						nucleus (GO:0005634)	ATP binding (GO:0005524)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCAGGAGGGCCATAAAACAAA	0.388																																						dbGAP											0													22.0	20.0	21.0					2																	24086409		1819	4067	5886	-	-	-	SO:0001583	missense	0			AB033066	CCDS46227.1	2p24.1-p23.3	2010-04-21		2007-02-08	ENSG00000119778	ENSG00000119778		"""ATPases / AAA-type"""	29230	protein-coding gene	gene with protein product		615347					Standard	XM_005264372		Approved	KIAA1240	uc002rek.4	Q9ULI0	OTTHUMG00000151902	ENST00000238789.5:c.1321G>T	2.37:g.24086409C>A	ENSP00000238789:p.Gly441Cys		B9ZVQ5|Q6ZNA6|Q8N9E7	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Bromodomain,pfam_IstB_ATP-bd,superfamily_Bromodomain,smart_AAA+_ATPase,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.G441C	ENST00000238789.5	37	c.1321	CCDS46227.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.3|25.3	4.622524|4.622524	0.87460|0.87460	.|.	.|.	ENSG00000119778|ENSG00000119778	ENST00000238789|ENST00000366438	D|.	0.99926|.	-8.04|.	5.23|5.23	5.23|5.23	0.72850|0.72850	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);|.	.|.	.|.	.|.	.|.	D|D	0.91798|0.91798	0.7405|0.7405	H|H	0.99590|0.99590	4.645|4.645	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	D|D	0.95311|0.95311	0.8412|0.8412	9|5	0.87932|.	D|.	0|.	.|.	19.183|19.183	0.93630|0.93630	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	441|.	Q9ULI0|.	ATD2B_HUMAN|.	C|I	441|62	ENSP00000238789:G441C|.	ENSP00000238789:G441C|.	G|M	-|-	1|3	0|0	ATAD2B|ATAD2B	23939913|23939913	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.814000|7.814000	0.86154|0.86154	2.600000|2.600000	0.87896|0.87896	0.557000|0.557000	0.71058|0.71058	GGC|ATG	ATAD2B	-	pfam_ATPase_AAA_core,pfam_IstB_ATP-bd,smart_AAA+_ATPase	ENSG00000119778		0.388	ATAD2B-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	ATAD2B	HGNC	protein_coding	OTTHUMT00000324333.1	68	0.00	0	C	NM_017552		24086409	24086409	-1	no_errors	ENST00000238789	ensembl	human	known	69_37n	missense	25	35.90	14	SNP	1.000	A
ATP6V1A	523	genome.wustl.edu	37	3	113524322	113524322	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr3:113524322C>T	ENST00000273398.3	+	14	1819	c.1711C>T	c.(1711-1713)Cgt>Tgt	p.R571C	ATP6V1A_ENST00000538620.1_Missense_Mutation_p.R538C|ATP6V1A_ENST00000461496.1_3'UTR	NM_001690.3	NP_001681.2	P38606	VATA_HUMAN	ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A	571					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|microvillus (GO:0005902)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	ATP binding (GO:0005524)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34					Alendronate(DB00630)|Etidronic acid(DB01077)|Tiludronate(DB01133)	GTCCATTATTCGTGAGCACAT	0.373																																						dbGAP											0													123.0	114.0	117.0					3																	113524322		2203	4300	6503	-	-	-	SO:0001583	missense	0			L09235	CCDS2976.1	3q13.31	2010-04-21	2002-08-29	2003-04-25	ENSG00000114573	ENSG00000114573	3.6.3.14	"""ATPases / V-type"""	851	protein-coding gene	gene with protein product		607027	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), alpha polypeptide, 70kD, isoform 1"""	VPP2, ATP6A1, ATP6V1A1		8463241	Standard	NM_001690		Approved	Vma1, VA68	uc003eao.3	P38606	OTTHUMG00000159295	ENST00000273398.3:c.1711C>T	3.37:g.113524322C>T	ENSP00000273398:p.Arg571Cys		B2RBR8|B7Z1R5|D3DN75|Q53YD9|Q96DY6|Q9UHY3	Missense_Mutation	SNP	pfam_ATPase_F1/V1/A1_a/bsu_nucl-bd,pfam_ATPase_F1/V1/A1-cplx_a/bsu_C,pfam_ATPase_F1/V1/A1-cplx_a/bsu_N,superfamily_ATPase_F1/V1/A1-cplx_a/bsu_C,superfamily_ATPase_F1/A1-cplx_a/bsu_N,tigrfam_ATPase_V1-cplx_asu	p.R571C	ENST00000273398.3	37	c.1711	CCDS2976.1	3	.	.	.	.	.	.	.	.	.	.	C	19.91	3.914932	0.72983	.	.	ENSG00000114573	ENST00000545842;ENST00000273398;ENST00000538620	T;T	0.76968	-1.06;-1.06	5.96	5.96	0.96718	ATPase, F1/V1/A1 complex, alpha/beta subunit, C-terminal (2);	0.050563	0.85682	D	0.000000	D	0.89483	0.6728	M	0.91920	3.255	0.80722	D	1	D	0.89917	1.0	D	0.65874	0.939	D	0.91065	0.4888	10	0.87932	D	0	-7.5071	13.7849	0.63104	0.2677:0.7323:0.0:0.0	.	571	P38606	VATA_HUMAN	C	288;571;538	ENSP00000273398:R571C;ENSP00000439874:R538C	ENSP00000273398:R571C	R	+	1	0	ATP6V1A	115007012	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.803000	0.38863	2.832000	0.97577	0.655000	0.94253	CGT	ATP6V1A	-	pfam_ATPase_F1/V1/A1-cplx_a/bsu_C,superfamily_ATPase_F1/V1/A1-cplx_a/bsu_C,tigrfam_ATPase_V1-cplx_asu	ENSG00000114573		0.373	ATP6V1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V1A	HGNC	protein_coding	OTTHUMT00000354457.1	156	0.64	1	C	NM_001690		113524322	113524322	+1	no_errors	ENST00000273398	ensembl	human	known	69_37n	missense	87	13.86	14	SNP	1.000	T
ATP13A3	79572	genome.wustl.edu	37	3	194151723	194151723	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr3:194151723C>T	ENST00000439040.1	-	24	3364	c.2573G>A	c.(2572-2574)cGt>cAt	p.R858H	ATP13A3_ENST00000256031.4_Missense_Mutation_p.R858H			Q9H7F0	AT133_HUMAN	ATPase type 13A3	858						integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	24	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)		AGGTGCCATACGGGCAAACAC	0.373																																						dbGAP											0													93.0	89.0	91.0					3																	194151723		1882	4105	5987	-	-	-	SO:0001583	missense	0			AJ306929	CCDS43187.1	3q29	2010-04-20			ENSG00000133657	ENSG00000133657		"""ATPases / P-type"""	24113	protein-coding gene	gene with protein product	"""ATPase family homolog up regulated in senescence cells"""	610232				11867234	Standard	NM_024524		Approved	AFURS1	uc003fty.4	Q9H7F0	OTTHUMG00000156034	ENST00000439040.1:c.2573G>A	3.37:g.194151723C>T	ENSP00000416508:p.Arg858His		Q8NC11|Q96KS1	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_unknown-pump-sp,tigrfam_ATPase_P-typ_ion-transptr	p.R858H	ENST00000439040.1	37	c.2573	CCDS43187.1	3	.	.	.	.	.	.	.	.	.	.	C	36	5.681826	0.96774	.	.	ENSG00000133657	ENST00000439040;ENST00000256031;ENST00000310773	T;T	0.59502	0.26;0.26	5.88	5.88	0.94601	HAD-like domain (2);	0.000000	0.85682	D	0.000000	D	0.85396	0.5687	H	0.97158	3.95	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89466	0.3740	10	0.87932	D	0	-0.0816	20.2187	0.98312	0.0:1.0:0.0:0.0	.	858	Q9H7F0	AT133_HUMAN	H	858;858;596	ENSP00000416508:R858H;ENSP00000256031:R858H	ENSP00000256031:R858H	R	-	2	0	ATP13A3	195633012	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	7.818000	0.86416	2.780000	0.95670	0.655000	0.94253	CGT	ATP13A3	-	superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_unknown-pump-sp,tigrfam_ATPase_P-typ_ion-transptr	ENSG00000133657		0.373	ATP13A3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ATP13A3	HGNC	protein_coding	OTTHUMT00000342799.2	86	0.00	0	C	NM_024524		194151723	194151723	-1	no_errors	ENST00000256031	ensembl	human	known	69_37n	missense	21	19.23	5	SNP	1.000	T
BCAR1	9564	genome.wustl.edu	37	16	75267782	75267782	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr16:75267782T>C	ENST00000162330.5	-	6	2188	c.2062A>G	c.(2062-2064)Atc>Gtc	p.I688V	BCAR1_ENST00000535626.2_Missense_Mutation_p.I540V|BCAR1_ENST00000420641.3_Missense_Mutation_p.I706V|BCAR1_ENST00000538440.2_Missense_Mutation_p.I688V|BCAR1_ENST00000393422.2_Missense_Mutation_p.I706V|BCAR1_ENST00000393420.6_Missense_Mutation_p.I706V|BCAR1_ENST00000566982.1_5'UTR|BCAR1_ENST00000418647.3_Missense_Mutation_p.I734V|BCAR1_ENST00000546196.1_Missense_Mutation_p.I659V|BCAR1_ENST00000542031.2_Missense_Mutation_p.I686V	NM_001170717.1|NM_014567.3	NP_001164188.1|NP_055382.2	P56945	BCAR1_HUMAN	breast cancer anti-estrogen resistance 1	688					actin filament organization (GO:0007015)|antigen receptor-mediated signaling pathway (GO:0050851)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell division (GO:0051301)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epidermal growth factor receptor signaling pathway (GO:0007173)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell migration (GO:0010595)|regulation of apoptotic process (GO:0042981)|regulation of cell growth (GO:0001558)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(5)|endometrium(1)|kidney(6)|large_intestine(1)|liver(1)|lung(13)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)	35				BRCA - Breast invasive adenocarcinoma(221;0.169)		TGCCGCGTGATGCTGCCCTTT	0.642																																						dbGAP											0													44.0	39.0	41.0					16																	75267782		2198	4299	6497	-	-	-	SO:0001583	missense	0			AJ242987	CCDS10915.1, CCDS54037.1, CCDS54038.1, CCDS54039.1, CCDS54040.1, CCDS54041.1, CCDS54042.1, CCDS54043.1	16q22-q23	2011-04-13			ENSG00000050820	ENSG00000050820		"""Cas scaffolding proteins"""	971	protein-coding gene	gene with protein product	"""Crk-associated substrate"", ""Cas scaffolding protein family member 1"""	602941				8413311, 10639512	Standard	NM_001170714		Approved	P130Cas, Crkas, CAS, CASS1	uc010vnb.2	P56945	OTTHUMG00000137604	ENST00000162330.5:c.2062A>G	16.37:g.75267782T>C	ENSP00000162330:p.Ile688Val		B3KWD7|B4DEV4|B4DGB5|B4DIW5|B7Z7X7|E9PCL5|E9PCV2|F5GXA2|F5GXV6|F5H7Z0|F8WA69|Q6QEF7	Missense_Mutation	SNP	pfam_CAS_DUF3513,pfam_Serine_rich,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain,prints_Spectrin_alpha_SH3	p.I734V	ENST00000162330.5	37	c.2200	CCDS10915.1	16	.	.	.	.	.	.	.	.	.	.	T	21.5	4.151475	0.78001	.	.	ENSG00000050820	ENST00000162330;ENST00000393422;ENST00000420641;ENST00000538440;ENST00000418647;ENST00000535626;ENST00000393420;ENST00000542031;ENST00000546196	T;T;T;T;T;T;T;T;T	0.23754	1.89;1.89;1.89;1.89;1.89;1.89;1.89;1.89;1.89	5.34	5.34	0.76211	CAS family, DUF3513 (1);	0.059181	0.64402	D	0.000008	T	0.41719	0.1171	L	0.54323	1.7	0.47094	D	0.999317	P;P;P;P;P;P;P;P;P	0.51933	0.856;0.901;0.856;0.826;0.826;0.856;0.949;0.856;0.919	P;P;P;P;P;P;P;P;P	0.60949	0.881;0.456;0.881;0.811;0.811;0.881;0.63;0.881;0.592	T	0.10847	-1.0612	10	0.34782	T	0.22	-36.4637	13.5657	0.61817	0.0:0.0:0.0:1.0	.	706;540;734;686;706;706;688;688;478	B4DIW5;F5GXV6;E9PCL5;F5GXA2;F8WA69;E9PCV2;F5H7Z0;P56945;B3KWE2	.;.;.;.;.;.;.;BCAR1_HUMAN;.	V	688;706;706;688;734;540;706;686;659	ENSP00000162330:I688V;ENSP00000377074:I706V;ENSP00000392708:I706V;ENSP00000443841:I688V;ENSP00000391669:I734V;ENSP00000440370:I540V;ENSP00000377072:I706V;ENSP00000440415:I686V;ENSP00000442161:I659V	ENSP00000162330:I688V	I	-	1	0	BCAR1	73825283	1.000000	0.71417	1.000000	0.80357	0.864000	0.49448	5.750000	0.68712	2.155000	0.67459	0.533000	0.62120	ATC	BCAR1	-	pfam_CAS_DUF3513	ENSG00000050820		0.642	BCAR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCAR1	HGNC	protein_coding	OTTHUMT00000269017.1	48	0.00	0	T	NM_014567		75267782	75267782	-1	no_errors	ENST00000418647	ensembl	human	known	69_37n	missense	24	29.41	10	SNP	1.000	C
BIVM	54841	genome.wustl.edu	37	13	103459852	103459852	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr13:103459852G>T	ENST00000257336.1	+	3	914	c.235G>T	c.(235-237)Gcg>Tcg	p.A79S	BIVM_ENST00000448849.2_Intron|BIVM-ERCC5_ENST00000602836.1_Missense_Mutation_p.G50V|BIVM_ENST00000419638.1_Missense_Mutation_p.A79S	NM_017693.3	NP_060163.2	Q86UB2	BIVM_HUMAN	basic, immunoglobulin-like variable motif containing	79						cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)				endometrium(3)|kidney(2)|large_intestine(7)|lung(10)|skin(2)|urinary_tract(1)	25	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					TCTCAACCAGGCGACCTCAAT	0.438																																						dbGAP											0													147.0	137.0	141.0					13																	103459852		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF411385	CCDS9505.1, CCDS53879.1	13q33.1	2008-05-14			ENSG00000134897	ENSG00000134897			16034	protein-coding gene	gene with protein product						12036287	Standard	NM_017693		Approved	FLJ20159		Q86UB2	OTTHUMG00000017309	ENST00000257336.1:c.235G>T	13.37:g.103459852G>T	ENSP00000257336:p.Ala79Ser		Q2M1J2|Q9NXM4	Missense_Mutation	SNP	NULL	p.A79S	ENST00000257336.1	37	c.235	CCDS9505.1	13	.	.	.	.	.	.	.	.	.	.	G	25.4	4.632905	0.87660	.	.	ENSG00000134897;ENSG00000134897;ENSG00000134899	ENST00000257336;ENST00000419638;ENST00000418659	.	.	.	5.96	5.07	0.68467	.	0.058863	0.64402	D	0.000002	T	0.58977	0.2160	L	0.34521	1.04	0.80722	D	1	D;P	0.56521	0.976;0.906	P;P	0.51974	0.686;0.52	T	0.62172	-0.6910	9	0.66056	D	0.02	.	16.6845	0.85301	0.0:0.1293:0.8707:0.0	.	50;79	Q59FZ7;Q86UB2	.;BIVM_HUMAN	S	79;79;50	.	ENSP00000257336:A79S	A	+	1	0	ERCC5;BIVM	102257853	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.325000	0.72901	2.831000	0.97527	0.650000	0.86243	GCG	BIVM	-	NULL	ENSG00000134897		0.438	BIVM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BIVM	HGNC	protein_coding	OTTHUMT00000045704.2	116	0.00	0	G			103459852	103459852	+1	no_errors	ENST00000257336	ensembl	human	known	69_37n	missense	51	17.74	11	SNP	1.000	T
C14orf39	317761	genome.wustl.edu	37	14	60908795	60908795	+	Missense_Mutation	SNP	T	T	G			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr14:60908795T>G	ENST00000321731.3	-	17	1717	c.1558A>C	c.(1558-1560)Att>Ctt	p.I520L		NM_174978.2	NP_777638	Q8N1H7	S6OS1_HUMAN	chromosome 14 open reading frame 39	520					multicellular organismal development (GO:0007275)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)					breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(108;0.0448)		AACTTACCAATCTCTTGCTCT	0.294																																						dbGAP											0													85.0	91.0	89.0					14																	60908795		2202	4287	6489	-	-	-	SO:0001583	missense	0			AK098187	CCDS9746.1	14q23.1	2012-11-05	2012-11-05	2012-11-05	ENSG00000179008	ENSG00000179008			19849	protein-coding gene	gene with protein product							Standard	NM_174978		Approved	SIX6OS1	uc001xez.4	Q8N1H7	OTTHUMG00000140332	ENST00000321731.3:c.1558A>C	14.37:g.60908795T>G	ENSP00000324920:p.Ile520Leu		Q08AQ4	Missense_Mutation	SNP	NULL	p.I520L	ENST00000321731.3	37	c.1558	CCDS9746.1	14	.	.	.	.	.	.	.	.	.	.	T	11.06	1.529017	0.27387	.	.	ENSG00000179008	ENST00000321731	T	0.28666	1.6	5.17	2.82	0.32997	.	0.286285	0.30185	N	0.010205	T	0.27798	0.0684	M	0.67953	2.075	0.26936	N	0.966368	B	0.30937	0.301	B	0.30572	0.117	T	0.28396	-1.0045	10	0.59425	D	0.04	.	4.3434	0.11120	0.146:0.1634:0.0:0.6906	.	520	Q8N1H7	S6OS1_HUMAN	L	520	ENSP00000324920:I520L	ENSP00000324920:I520L	I	-	1	0	C14orf39	59978548	1.000000	0.71417	1.000000	0.80357	0.813000	0.45954	0.729000	0.26028	0.390000	0.25115	0.528000	0.53228	ATT	C14orf39	-	NULL	ENSG00000179008		0.294	C14orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf39	HGNC	protein_coding	OTTHUMT00000276948.1	142	0.00	0	T	NM_174978		60908795	60908795	-1	no_errors	ENST00000321731	ensembl	human	known	69_37n	missense	35	20.45	9	SNP	1.000	G
C16orf45	89927	genome.wustl.edu	37	16	15677024	15677024	+	Missense_Mutation	SNP	A	A	C			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr16:15677024A>C	ENST00000300006.4	+	5	790	c.431A>C	c.(430-432)gAa>gCa	p.E144A	C16orf45_ENST00000566490.1_Intron|C16orf45_ENST00000452191.2_Missense_Mutation_p.E127A|C16orf45_ENST00000561692.1_Missense_Mutation_p.E96A|C16orf45_ENST00000565913.1_3'UTR	NM_033201.2	NP_149978.1	Q96MC5	CP045_HUMAN	chromosome 16 open reading frame 45	144										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)	11						GAGCAAGAAGAAGACAAGGAA	0.388																																						dbGAP											0													131.0	129.0	130.0					16																	15677024		2197	4300	6497	-	-	-	SO:0001583	missense	0			AK057180	CCDS10561.1, CCDS45422.1	16p13.2	2012-10-09			ENSG00000166780	ENSG00000166780			19213	protein-coding gene	gene with protein product							Standard	NM_033201		Approved	FLJ32618	uc002ddo.3	Q96MC5	OTTHUMG00000129883	ENST00000300006.4:c.431A>C	16.37:g.15677024A>C	ENSP00000300006:p.Glu144Ala		O00223|O75769|Q8IZ36|Q96H25	Missense_Mutation	SNP	pfam_DUF3585	p.E144A	ENST00000300006.4	37	c.431	CCDS10561.1	16	.	.	.	.	.	.	.	.	.	.	A	26.3	4.719834	0.89205	.	.	ENSG00000166780	ENST00000300006;ENST00000452191	T;T	0.55930	0.49;0.49	5.5	5.5	0.81552	Domain of unknown function DUF3585 (1);	0.000000	0.85682	D	0.000000	T	0.75295	0.3830	M	0.85373	2.75	0.58432	D	0.999999	D;D	0.76494	0.999;0.997	D;D	0.81914	0.995;0.994	T	0.80167	-0.1495	10	0.87932	D	0	-18.3522	15.2489	0.73529	1.0:0.0:0.0:0.0	.	88;144	B4DE25;Q96MC5	.;CP045_HUMAN	A	144;127	ENSP00000300006:E144A;ENSP00000408976:E127A	ENSP00000300006:E144A	E	+	2	0	C16orf45	15584525	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.873000	0.87193	2.060000	0.61445	0.528000	0.53228	GAA	C16orf45	-	pfam_DUF3585	ENSG00000166780		0.388	C16orf45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf45	HGNC	protein_coding	OTTHUMT00000252130.2	97	0.00	0	A	NM_033201		15677024	15677024	+1	no_errors	ENST00000300006	ensembl	human	known	69_37n	missense	36	29.41	15	SNP	1.000	C
CDH7	1005	genome.wustl.edu	37	18	63491905	63491905	+	Silent	SNP	G	G	A			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr18:63491905G>A	ENST00000397968.2	+	6	1245	c.819G>A	c.(817-819)gaG>gaA	p.E273E	CDH7_ENST00000323011.3_Silent_p.E273E|CDH7_ENST00000536984.2_Silent_p.E273E	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	273	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				ACGTCCCAGAGTCATTACCTG	0.373																																						dbGAP											0													116.0	109.0	112.0					18																	63491905		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.819G>A	18.37:g.63491905G>A			Q9H157	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E273	ENST00000397968.2	37	c.819	CCDS11993.1	18																																																																																			CDH7	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin	ENSG00000081138		0.373	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH7	HGNC	protein_coding	OTTHUMT00000256217.2	188	0.00	0	G	NM_033646		63491905	63491905	+1	no_errors	ENST00000323011	ensembl	human	known	69_37n	silent	47	21.67	13	SNP	0.929	A
CDH8	1006	genome.wustl.edu	37	16	61823301	61823301	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr16:61823301C>G	ENST00000577390.1	-	8	2317	c.1363G>C	c.(1363-1365)Gac>Cac	p.D455H	CDH8_ENST00000299345.6_Missense_Mutation_p.D455H|CDH8_ENST00000577730.1_Missense_Mutation_p.D455H|CDH8_ENST00000584337.1_Missense_Mutation_p.D455H	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	455	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		AATTCTCTGTCAAGTGGTGTT	0.423																																						dbGAP											0													252.0	206.0	222.0					16																	61823301		2203	4300	6503	-	-	-	SO:0001583	missense	0			L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.1363G>C	16.37:g.61823301C>G	ENSP00000462701:p.Asp455His		B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.D455H	ENST00000577390.1	37	c.1363	CCDS10802.1	16	.	.	.	.	.	.	.	.	.	.	C	26.0	4.691101	0.88735	.	.	ENSG00000150394	ENST00000299345	T	0.65364	-0.15	5.44	5.44	0.79542	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.88190	0.6370	H	0.98276	4.19	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.92418	0.5943	10	0.87932	D	0	.	19.6178	0.95640	0.0:1.0:0.0:0.0	.	271;455	Q3LID3;P55286	.;CADH8_HUMAN	H	455	ENSP00000299345:D455H	ENSP00000299345:D455H	D	-	1	0	CDH8	60380802	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.299000	0.78831	2.716000	0.92895	0.491000	0.48974	GAC	CDH8	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000150394		0.423	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH8	HGNC	protein_coding	OTTHUMT00000268754.3	218	0.00	0	C	NM_001796		61823301	61823301	-1	no_errors	ENST00000577390	ensembl	human	known	69_37n	missense	88	11.11	11	SNP	1.000	G
CDH9	1007	genome.wustl.edu	37	5	26890044	26890044	+	Silent	SNP	G	G	A			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr5:26890044G>A	ENST00000231021.4	-	9	1585	c.1413C>T	c.(1411-1413)caC>caT	p.H471H		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	471	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						AGACAGGGATGTGGCTACTTT	0.403																																					Melanoma(8;187 585 15745 40864 52829)	dbGAP											0													159.0	163.0	162.0					5																	26890044		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.1413C>T	5.37:g.26890044G>A			Q3B7I5	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.H471	ENST00000231021.4	37	c.1413	CCDS3893.1	5																																																																																			CDH9	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000113100		0.403	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH9	HGNC	protein_coding	OTTHUMT00000207352.1	282	0.00	0	G	NM_016279		26890044	26890044	-1	no_errors	ENST00000231021	ensembl	human	known	69_37n	silent	64	13.51	10	SNP	0.003	A
CDK5RAP2	55755	genome.wustl.edu	37	9	123201828	123201828	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr9:123201828G>C	ENST00000349780.4	-	24	3750	c.3571C>G	c.(3571-3573)Cca>Gca	p.P1191A	CDK5RAP2_ENST00000360822.3_Missense_Mutation_p.P1159A|CDK5RAP2_ENST00000359309.3_Missense_Mutation_p.P1150A|CDK5RAP2_ENST00000360190.4_Missense_Mutation_p.P1191A	NM_018249.4	NP_060719.4	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	1191	Interaction with MAPRE1.				brain development (GO:0007420)|centrosome organization (GO:0051297)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of centriole replication (GO:0046600)|negative regulation of neuron differentiation (GO:0045665)|neurogenesis (GO:0022008)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of spindle checkpoint (GO:0090231)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)			breast(6)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	58						ATCATCTCTGGGGCCAGCGGA	0.488											OREG0019438	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													102.0	96.0	98.0					9																	123201828		2203	4300	6503	-	-	-	SO:0001583	missense	0			BK005504	CCDS6823.1, CCDS43871.1, CCDS75888.1	9q33.3	2014-02-21			ENSG00000136861	ENSG00000136861			18672	protein-coding gene	gene with protein product	"""centrosomin"""	608201	"""microcephaly, primary autosomal recessive 3"""	MCPH3		10721722, 17764569, 24466316	Standard	NM_018249		Approved	C48, FLJ10867, CEP215	uc004bkf.4	Q96SN8	OTTHUMG00000021043	ENST00000349780.4:c.3571C>G	9.37:g.123201828G>C	ENSP00000343818:p.Pro1191Ala	1524	Q5JV18|Q7Z3L4|Q7Z3U1|Q7Z7I6|Q9BSW0|Q9H6J6|Q9HCD9|Q9NV90|Q9UIW9	Missense_Mutation	SNP	pfam_Spindle_assoc	p.P1191A	ENST00000349780.4	37	c.3571	CCDS6823.1	9	.	.	.	.	.	.	.	.	.	.	G	12.16	1.853172	0.32699	.	.	ENSG00000136861	ENST00000360822;ENST00000359309;ENST00000349780;ENST00000360190;ENST00000416449;ENST00000425647;ENST00000345313	T;T;T;T;T;T	0.21361	4.0;3.9;4.0;3.91;2.33;2.01	5.46	4.46	0.54185	.	0.229942	0.31358	N	0.007791	T	0.19685	0.0473	L	0.57536	1.79	0.20703	N	0.999862	B;P;P;P;B;P	0.47545	0.419;0.573;0.573;0.897;0.437;0.573	B;B;B;B;B;B	0.44085	0.117;0.164;0.164;0.44;0.097;0.197	T	0.28138	-1.0053	10	0.39692	T	0.17	.	3.237	0.06768	0.1948:0.2821:0.523:0.0	.	201;960;1159;1191;1191;585	Q5JTU8;Q6MZT4;Q96SN8-2;Q96SN8-4;Q96SN8;B1AMJ5	.;.;.;.;CK5P2_HUMAN;.	A	1159;1150;1191;1191;585;201;963	ENSP00000354065:P1159A;ENSP00000352258:P1150A;ENSP00000343818:P1191A;ENSP00000353317:P1191A;ENSP00000400395:P585A;ENSP00000409941:P201A	ENSP00000341695:P963A	P	-	1	0	CDK5RAP2	122241649	0.126000	0.22350	0.605000	0.28930	0.638000	0.38207	0.451000	0.21779	2.561000	0.86390	0.557000	0.71058	CCA	CDK5RAP2	-	NULL	ENSG00000136861		0.488	CDK5RAP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDK5RAP2	HGNC	protein_coding	OTTHUMT00000055535.1	157	0.00	0	G	NM_018249		123201828	123201828	-1	no_errors	ENST00000349780	ensembl	human	known	69_37n	missense	53	14.52	9	SNP	0.465	C
CGN	57530	genome.wustl.edu	37	1	151492732	151492732	+	Silent	SNP	C	C	T	rs34671806		TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr1:151492732C>T	ENST00000271636.7	+	3	1097	c.964C>T	c.(964-966)Ctg>Ttg	p.L322L		NM_020770.2	NP_065821.1	Q9P2M7	CING_HUMAN	cingulin	316	Head.|Interacts with ZO-2.				transforming growth factor beta receptor signaling pathway (GO:0007179)	cell junction (GO:0030054)|myosin complex (GO:0016459)|tight junction (GO:0005923)	actin binding (GO:0003779)|motor activity (GO:0003774)			NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			CTATGGCATCCTGAGGGAGGG	0.527																																						dbGAP											0													30.0	32.0	31.0					1																	151492732		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB037740	CCDS999.1	1q21	2008-02-05			ENSG00000143375	ENSG00000143375			17429	protein-coding gene	gene with protein product		609473				11042084, 12529927	Standard	NM_020770		Approved	KIAA1319	uc009wmw.3	Q9P2M7	OTTHUMG00000012497	ENST00000271636.7:c.964C>T	1.37:g.151492732C>T			A6H8L3|A7MD22|Q5T386|Q9NR25	Silent	SNP	pfam_Myosin_tail	p.L322	ENST00000271636.7	37	c.964	CCDS999.1	1																																																																																			CGN	-	NULL	ENSG00000143375		0.527	CGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CGN	HGNC	protein_coding	OTTHUMT00000034900.3	41	0.00	0	C	NM_020770		151492732	151492732	+1	no_errors	ENST00000271636	ensembl	human	known	69_37n	silent	23	20.69	6	SNP	1.000	T
CKB	1152	genome.wustl.edu	37	14	103986486	103986486	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr14:103986486G>A	ENST00000348956.2	-	7	1297	c.940C>T	c.(940-942)Cgg>Tgg	p.R314W		NM_001823.4	NP_001814.2	P12277	KCRB_HUMAN	creatine kinase, brain	314	Phosphagen kinase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00843}.				cellular chloride ion homeostasis (GO:0030644)|cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)			lung(2)|prostate(1)	3		Melanoma(154;0.155)	Epithelial(46;0.14)		Creatine(DB00148)	AGTCGCAGCCGCTTAAGCACC	0.632																																					Esophageal Squamous(186;2492 2823 49929 50127)	dbGAP											0													42.0	47.0	45.0					14																	103986486		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9981.1	14q32.32	2012-10-02			ENSG00000166165	ENSG00000166165	2.7.3.2		1991	protein-coding gene	gene with protein product		123280		CKBB			Standard	NM_001823		Approved		uc001ynf.2	P12277	OTTHUMG00000171786	ENST00000348956.2:c.940C>T	14.37:g.103986486G>A	ENSP00000299198:p.Arg314Trp		A8K236|B2R5R4|Q2LE07|Q6FG40|Q9UC66	Missense_Mutation	SNP	pfam_ATP-guanido_PTrfase_cat,pfam_ATP-guanido_PTrfase_N,superfamily_ATP-guanido_PTrfase_N	p.R314W	ENST00000348956.2	37	c.940	CCDS9981.1	14	.	.	.	.	.	.	.	.	.	.	G	17.37	3.371302	0.61624	.	.	ENSG00000166165	ENST00000348956;ENST00000428256;ENST00000553610	T;T	0.12147	2.71;2.71	4.63	2.53	0.30540	ATP:guanido phosphotransferase, catalytic domain (2);Glutamine synthetase/guanido kinase, catalytic domain (1);	0.222920	0.42172	D	0.000751	T	0.39410	0.1077	M	0.88570	2.965	0.80722	D	1	D	0.89917	1.0	D	0.70227	0.968	T	0.44544	-0.9321	10	0.87932	D	0	-22.0712	10.9568	0.47362	0.0:0.0:0.3481:0.6519	.	314	P12277	KCRB_HUMAN	W	314;279;112	ENSP00000299198:R314W;ENSP00000451426:R112W	ENSP00000299198:R314W	R	-	1	2	CKB	103056239	0.987000	0.35691	1.000000	0.80357	0.493000	0.33554	1.610000	0.36869	0.900000	0.36469	0.462000	0.41574	CGG	CKB	-	pfam_ATP-guanido_PTrfase_cat	ENSG00000166165		0.632	CKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CKB	HGNC	protein_coding	OTTHUMT00000415111.1	50	0.00	0	G			103986486	103986486	-1	no_errors	ENST00000348956	ensembl	human	known	69_37n	missense	22	18.52	5	SNP	1.000	A
CLCN6	1185	genome.wustl.edu	37	1	11893963	11893963	+	Frame_Shift_Del	DEL	T	T	-			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr1:11893963delT	ENST00000346436.6	+	15	1454	c.1402delT	c.(1402-1404)ttcfs	p.F469fs	CLCN6_ENST00000312413.6_3'UTR|CLCN6_ENST00000376487.3_Frame_Shift_Del_p.F447fs|CLCN6_ENST00000376496.3_Frame_Shift_Del_p.F469fs	NM_001286.3	NP_001277	P51797	CLCN6_HUMAN	chloride channel, voltage-sensitive 6	469					cell volume homeostasis (GO:0006884)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|response to mechanical stimulus (GO:0009612)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|voltage-gated chloride channel activity (GO:0005247)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(4)	36	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000816)|KIRC - Kidney renal clear cell carcinoma(229;0.00268)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		TCTGGCCTTGTTCTTCGTTCT	0.547																																						dbGAP											0													309.0	256.0	274.0					1																	11893963		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			X83378	CCDS138.1, CCDS57972.1	1p36	2012-09-26	2012-02-23		ENSG00000011021	ENSG00000011021		"""Ion channels / Chloride channels : Voltage-sensitive"""	2024	protein-coding gene	gene with protein product		602726	"""chloride channel 6"""			8543009	Standard	NM_001286		Approved	CLC-6, KIAA0046, ClC-6	uc001ate.5	P51797	OTTHUMG00000002299	ENST00000346436.6:c.1402delT	1.37:g.11893963delT	ENSP00000234488:p.Phe469fs		A8K1T4|B4DGT7|F8W9R3|O60818|O60819|O60820|O60821|P78520|P78521|Q17R81|Q5SNW2|Q5SNW3|Q5SNX1|Q5SNX2|Q5SNX3|Q99427|Q99428|Q99429	Frame_Shift_Del	DEL	pfam_Cl-channel_volt-gated,pfam_Cysta_beta_synth_core,superfamily_Cl-channel_core,smart_Cysta_beta_synth_core,prints_Cl-channel_volt-gated,prints_Cl_channel-6	p.F468fs	ENST00000346436.6	37	c.1402	CCDS138.1	1																																																																																			CLCN6	-	pfam_Cl-channel_volt-gated,superfamily_Cl-channel_core	ENSG00000011021		0.547	CLCN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCN6	HGNC	protein_coding	OTTHUMT00000006639.2	262	0.00	0	T	NM_001286		11893963	11893963	+1	no_errors	ENST00000346436	ensembl	human	known	69_37n	frame_shift_del	68	38.60	44	DEL	1.000	-
COMP	1311	genome.wustl.edu	37	19	18899673	18899673	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr19:18899673G>A	ENST00000222271.2	-	6	622	c.578C>T	c.(577-579)cCc>cTc	p.P193L	COMP_ENST00000542601.2_Missense_Mutation_p.P160L|COMP_ENST00000425807.1_Missense_Mutation_p.P140L	NM_000095.2	NP_000086.2	P49747	COMP_HUMAN	cartilage oligomeric matrix protein	193	EGF-like 3; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|limb development (GO:0060173)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)|protease binding (GO:0002020)			breast(6)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						CACGGAGTTGGGGACGCAGTT	0.662																																						dbGAP											0													86.0	79.0	81.0					19																	18899673		2203	4300	6503	-	-	-	SO:0001583	missense	0			L32137	CCDS12385.1	19p13.1	2008-02-05				ENSG00000105664			2227	protein-coding gene	gene with protein product	"""thrombospondin-5"""	600310	"""cartilage oligomeric matrix protein (pseudoachondroplasia, epiphyseal dysplasia 1, multiple)"""	PSACH, EDM1, EPD1		7713493, 8307576	Standard	NM_000095		Approved	MED, THBS5	uc002nke.3	P49747	OTTHUMG00000169318	ENST00000222271.2:c.578C>T	19.37:g.18899673G>A	ENSP00000222271:p.Pro193Leu		B4DKJ3|O14592|Q16388|Q16389|Q2NL86|Q8N4T2	Missense_Mutation	SNP	pfam_Thrombospondin_C,pfam_EGF-like_Ca-bd,pfam_Thbs/COMP_coiled-coil,pfam_Thrombospondin_3-like_rpt,superfamily_ConA-like_lec_gl,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.P193L	ENST00000222271.2	37	c.578	CCDS12385.1	19	.	.	.	.	.	.	.	.	.	.	G	19.35	3.811718	0.70797	.	.	ENSG00000105664	ENST00000542601;ENST00000222271;ENST00000425807;ENST00000454701	D;D;T	0.87571	-2.27;-2.27;1.47	3.45	3.45	0.39498	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.247088	0.33916	U	0.004425	D	0.83372	0.5240	L	0.46741	1.465	0.51482	D	0.999927	B;B	0.14012	0.004;0.009	B;B	0.23852	0.049;0.02	T	0.81339	-0.0977	10	0.45353	T	0.12	-17.8823	14.0538	0.64754	0.0:0.0:1.0:0.0	.	140;193	B4DKJ3;P49747	.;COMP_HUMAN	L	160;193;140;180	ENSP00000439156:P160L;ENSP00000222271:P193L;ENSP00000403792:P140L	ENSP00000222271:P193L	P	-	2	0	COMP	18760673	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.156000	0.50708	1.779000	0.52309	0.555000	0.69702	CCC	COMP	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000105664		0.662	COMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COMP	HGNC	protein_coding	OTTHUMT00000403457.1	34	0.00	0	G	NM_000095		18899673	18899673	-1	no_errors	ENST00000222271	ensembl	human	known	69_37n	missense	18	25.00	6	SNP	1.000	A
CTNNA2	1496	genome.wustl.edu	37	2	80773158	80773158	+	Missense_Mutation	SNP	A	A	C			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr2:80773158A>C	ENST00000402739.4	+	10	1515	c.1510A>C	c.(1510-1512)Acc>Ccc	p.T504P	CTNNA2_ENST00000343114.3_Missense_Mutation_p.T183P|CTNNA2_ENST00000540488.1_Missense_Mutation_p.T504P|CTNNA2_ENST00000466387.1_Missense_Mutation_p.T504P|CTNNA2_ENST00000541047.1_Missense_Mutation_p.T504P|CTNNA2_ENST00000496558.1_Missense_Mutation_p.T504P|CTNNA2_ENST00000361291.4_Missense_Mutation_p.T538P	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	504					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						GGATGACATCACCTCAGTGGA	0.517																																						dbGAP											0													66.0	76.0	73.0					2																	80773158		2073	4202	6275	-	-	-	SO:0001583	missense	0				CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.1510A>C	2.37:g.80773158A>C	ENSP00000384638:p.Thr504Pro		B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.T538P	ENST00000402739.4	37	c.1612		2	.	.	.	.	.	.	.	.	.	.	A	31	5.068015	0.93950	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488;ENST00000343114;ENST00000409550	T;T;T;T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97;0.97;0.97;0.97	5.9	5.9	0.94986	.	0.056725	0.64402	N	0.000001	T	0.71324	0.3326	M	0.90483	3.12	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;1.0;0.999	D;D;D;D	0.81914	0.986;0.995;0.994;0.991	T	0.77485	-0.2570	9	.	.	.	.	16.3196	0.82941	1.0:0.0:0.0:0.0	.	136;504;504;504	F6KRI5;P26232;P26232-3;P26232-2	.;CTNA2_HUMAN;.;.	P	504;504;538;504;504;504;183;169	ENSP00000418191:T504P;ENSP00000419295:T504P;ENSP00000355398:T538P;ENSP00000384638:T504P;ENSP00000444675:T504P;ENSP00000441705:T504P;ENSP00000341500:T183P;ENSP00000386587:T169P	.	T	+	1	0	CTNNA2	80626669	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	9.339000	0.96797	2.248000	0.74166	0.459000	0.35465	ACC	CTNNA2	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin	ENSG00000066032		0.517	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	CTNNA2	HGNC	protein_coding	OTTHUMT00000328511.4	81	0.00	0	A	NM_004389		80773158	80773158	+1	no_errors	ENST00000361291	ensembl	human	known	69_37n	missense	32	15.79	6	SNP	1.000	C
PIEZO1	9780	genome.wustl.edu	37	16	88781476	88781476	+	IGR	SNP	G	G	A	rs550126852		TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr16:88781476G>A	ENST00000301015.9	-	0	8072				CTU2_ENST00000453996.2_Silent_p.P480P|CTU2_ENST00000567949.1_Silent_p.P551P|CTU2_ENST00000378384.3_Silent_p.P393P|MIR4722_ENST00000578292.1_RNA|CTU2_ENST00000312060.5_Intron	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1						cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						ACCCCCTGCCGCCGTACATCC	0.697													G|||	1	0.000199681	0.0	0.0	5008	,	,		13431	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													23.0	28.0	26.0					16																	88781476		2175	4279	6454	-	-	-	SO:0001628	intergenic_variant	0			D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776		16.37:g.88781476G>A			A6NHT9|A7E2B7|Q0KKZ9	Silent	SNP	pfam_Thiouridylase_cyt_su2	p.P551	ENST00000301015.9	37	c.1653	CCDS54058.1	16																																																																																			CTU2	-	NULL	ENSG00000174177		0.697	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	CTU2	HGNC	protein_coding	OTTHUMT00000345699.4	53	0.00	0	G	NM_014745		88781476	88781476	+1	no_errors	ENST00000567949	ensembl	human	known	69_37n	silent	25	39.02	16	SNP	0.030	A
CXorf57	55086	genome.wustl.edu	37	X	105879795	105879795	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chrX:105879795G>T	ENST00000372548.4	+	7	1435	c.1326G>T	c.(1324-1326)caG>caT	p.Q442H	CXorf57_ENST00000372544.2_Missense_Mutation_p.Q442H	NM_018015.5	NP_060485.4	Q6NSI4	CX057_HUMAN	chromosome X open reading frame 57	442							poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(6)|lung(11)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	31						TGTGTACACAGTTGAAAGTTG	0.348																																						dbGAP											0													158.0	141.0	147.0					X																	105879795		2203	4298	6501	-	-	-	SO:0001583	missense	0			AK024253	CCDS14519.1, CCDS55470.1	Xq22.3	2008-02-05			ENSG00000147231	ENSG00000147231			25486	protein-coding gene	gene with protein product							Standard	NM_018015		Approved	FLJ14191, FLJ10178	uc004emi.4	Q6NSI4	OTTHUMG00000022150	ENST00000372548.4:c.1326G>T	X.37:g.105879795G>T	ENSP00000361628:p.Gln442His		H7BY89|Q4G0L7|Q5JQS1|Q5JRF9|Q6PHY5|Q6PII9|Q6PJU8|Q9H7W5|Q9NWA6	Missense_Mutation	SNP	superfamily_NA-bd_OB-fold-like	p.Q442H	ENST00000372548.4	37	c.1326	CCDS14519.1	X	.	.	.	.	.	.	.	.	.	.	g	12.82	2.051654	0.36181	.	.	ENSG00000147231	ENST00000372544;ENST00000372548;ENST00000421550	T;T;T	0.50548	0.75;0.74;0.79	4.44	1.23	0.21249	.	0.283100	0.37219	N	0.002193	T	0.55449	0.1921	L	0.49350	1.555	0.27166	N	0.961048	D;D;P	0.89917	1.0;1.0;0.527	D;D;B	0.83275	0.996;0.996;0.365	T	0.46034	-0.9220	10	0.42905	T	0.14	-10.2825	6.9619	0.24601	0.3821:0.0:0.6179:0.0	.	442;442;442	A8K6R5;Q6NSI4;Q6NSI4-2	.;CX057_HUMAN;.	H	442;442;250	ENSP00000361623:Q442H;ENSP00000361628:Q442H;ENSP00000405866:Q250H	ENSP00000361623:Q442H	Q	+	3	2	CXorf57	105766451	1.000000	0.71417	0.879000	0.34478	0.793000	0.44817	1.215000	0.32431	-0.018000	0.14079	-0.444000	0.05651	CAG	CXorf57	-	NULL	ENSG00000147231		0.348	CXorf57-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf57	HGNC	protein_coding	OTTHUMT00000057800.2	210	0.00	0	G	NM_018015		105879795	105879795	+1	no_errors	ENST00000372548	ensembl	human	known	69_37n	missense	56	18.84	13	SNP	0.998	T
DGKI	9162	genome.wustl.edu	37	7	137293718	137293718	+	Silent	SNP	G	G	C			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr7:137293718G>C	ENST00000288490.5	-	10	1161	c.1161C>G	c.(1159-1161)ggC>ggG	p.G387G	DGKI_ENST00000446122.1_Silent_p.G387G|DGKI_ENST00000424189.2_Silent_p.G387G|DGKI_ENST00000453654.2_Silent_p.G87G	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	387	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						TCACCTGGTTGCCTCCACTCT	0.388																																						dbGAP											0													108.0	104.0	106.0					7																	137293718		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.1161C>G	7.37:g.137293718G>C			A4D1Q9|Q9NZ49	Silent	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.G387	ENST00000288490.5	37	c.1161	CCDS5845.1	7																																																																																			DGKI	-	pfam_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kinase_cat_dom	ENSG00000157680		0.388	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKI	HGNC	protein_coding	OTTHUMT00000341286.3	182	0.00	0	G	NM_004717		137293718	137293718	-1	no_errors	ENST00000424189	ensembl	human	known	69_37n	silent	81	17.35	17	SNP	0.999	C
DPP10	57628	genome.wustl.edu	37	2	116066924	116066924	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr2:116066924C>G	ENST00000410059.1	+	2	650	c.170C>G	c.(169-171)aCc>aGc	p.T57S	DPP10_ENST00000310323.8_Missense_Mutation_p.T50S|DPP10_ENST00000409163.1_Missense_Mutation_p.T7S|DPP10_ENST00000393147.2_Missense_Mutation_p.T61S	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	57						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						ATCCTCTTAACCCCAGGTAAT	0.408																																						dbGAP											0													209.0	185.0	193.0					2																	116066924		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.170C>G	2.37:g.116066924C>G	ENSP00000386565:p.Thr57Ser		A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9	p.T61S	ENST00000410059.1	37	c.182	CCDS46400.1	2	.	.	.	.	.	.	.	.	.	.	C	15.65	2.895939	0.52121	.	.	ENSG00000175497	ENST00000436732;ENST00000410059;ENST00000409163;ENST00000393146;ENST00000393147;ENST00000310323;ENST00000419287	T;T;T;T;T;T;T	0.52754	0.65;0.65;0.65;0.65;0.65;0.65;0.65	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.34890	0.0913	N	0.12961	0.28	0.54753	D	0.999987	B;P;P;B	0.39520	0.421;0.615;0.676;0.296	B;B;B;B	0.37480	0.21;0.1;0.251;0.104	T	0.24048	-1.0171	10	0.45353	T	0.12	-10.7248	18.386	0.90466	0.0:1.0:0.0:0.0	.	50;61;53;57	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	S	7;57;7;53;61;50;7	ENSP00000391092:T7S;ENSP00000386565:T57S;ENSP00000387038:T7S;ENSP00000376854:T53S;ENSP00000376855:T61S;ENSP00000309066:T50S;ENSP00000402499:T7S	ENSP00000309066:T50S	T	+	2	0	DPP10	115783394	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.298000	0.78815	2.595000	0.87683	0.655000	0.94253	ACC	DPP10	-	NULL	ENSG00000175497		0.408	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DPP10	HGNC	protein_coding	OTTHUMT00000330580.4	270	0.00	0	C	NM_020868		116066924	116066924	+1	no_errors	ENST00000393147	ensembl	human	known	69_37n	missense	44	33.33	22	SNP	1.000	G
DOCK10	55619	genome.wustl.edu	37	2	225652079	225652079	+	Silent	SNP	C	C	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr2:225652079C>T	ENST00000258390.7	-	49	5521	c.5454G>A	c.(5452-5454)gaG>gaA	p.E1818E	DOCK10_ENST00000409592.3_Silent_p.E1812E	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1818	DHR-2.				regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		TCCAGAGAAACTCCACACACA	0.413																																						dbGAP											0													199.0	196.0	197.0					2																	225652079		1985	4180	6165	-	-	-	SO:0001819	synonymous_variant	0			AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.5454G>A	2.37:g.225652079C>T			B3FL70|O75178|Q9NW06|Q9NXI8	Silent	SNP	pfam_DOCK,pfam_DUF3398,pfam_Pleckstrin_homology,superfamily_ARM-type_fold,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.E1818	ENST00000258390.7	37	c.5454	CCDS46528.1	2																																																																																			DOCK10	-	superfamily_ARM-type_fold	ENSG00000135905		0.413	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK10	HGNC	protein_coding	OTTHUMT00000331246.1	170	0.00	0	C			225652079	225652079	-1	no_errors	ENST00000258390	ensembl	human	known	69_37n	silent	67	17.28	14	SNP	0.998	T
DSCAM	1826	genome.wustl.edu	37	21	41465724	41465724	+	Silent	SNP	G	G	A			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr21:41465724G>A	ENST00000400454.1	-	21	4251	c.3774C>T	c.(3772-3774)agC>agT	p.S1258S		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	1258	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				CCACCCAGACGCTGTACTGAC	0.498																																					Melanoma(134;970 1778 1785 21664 32388)	dbGAP											0													73.0	71.0	71.0					21																	41465724		1963	4166	6129	-	-	-	SO:0001819	synonymous_variant	0			AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.3774C>T	21.37:g.41465724G>A			O60468	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub2,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.S1258	ENST00000400454.1	37	c.3774	CCDS42929.1	21																																																																																			DSCAM	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000171587		0.498	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAM	HGNC	protein_coding	OTTHUMT00000195029.1	91	0.00	0	G	NM_001389		41465724	41465724	-1	no_errors	ENST00000400454	ensembl	human	known	69_37n	silent	16	30.43	7	SNP	1.000	A
ELAVL1	1994	genome.wustl.edu	37	19	8032481	8032481	+	Silent	SNP	T	T	G			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr19:8032481T>G	ENST00000407627.2	-	5	753	c.624A>C	c.(622-624)ggA>ggC	p.G208G	ELAVL1_ENST00000593807.1_Intron|ELAVL1_ENST00000351593.5_Silent_p.G235G|ELAVL1_ENST00000596459.1_Silent_p.G208G	NM_001419.2	NP_001410.2	Q15717	ELAV1_HUMAN	ELAV like RNA binding protein 1	208					3'-UTR-mediated mRNA stabilization (GO:0070935)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA stabilization (GO:0048255)|multicellular organismal development (GO:0007275)|positive regulation of translation (GO:0045727)|regulation of stem cell maintenance (GO:2000036)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|double-stranded RNA binding (GO:0003725)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|mRNA 3'-UTR binding (GO:0003730)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	20						GAACGGGGCCTCCGAACCGTC	0.632																																						dbGAP											0													72.0	62.0	66.0					19																	8032481		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U38175	CCDS12193.1	19p13.2	2013-10-03	2013-10-03			ENSG00000066044		"""RNA binding motif (RRM) containing"""	3312	protein-coding gene	gene with protein product	"""embryonic lethal, abnormal vision, drosophila, homolog-like 1"", ""Hu antigen R"""	603466	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)"""	HUR		8626503, 9003489	Standard	NM_001419		Approved	HuR, Hua, MelG	uc002mjb.3	Q15717		ENST00000407627.2:c.624A>C	19.37:g.8032481T>G			B4DVB8|Q53XN6|Q9BTT1	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,prints_Hud_Sxl_RNA,tigrfam_ELAD_HUD_SF	p.G235	ENST00000407627.2	37	c.705	CCDS12193.1	19																																																																																			ELAVL1	-	tigrfam_ELAD_HUD_SF	ENSG00000066044		0.632	ELAVL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELAVL1	HGNC	protein_coding	OTTHUMT00000461494.3	84	0.00	0	T	NM_001419		8032481	8032481	-1	no_errors	ENST00000351593	ensembl	human	known	69_37n	silent	40	21.57	11	SNP	1.000	G
ELOVL5	60481	genome.wustl.edu	37	6	53140987	53140987	+	Nonsense_Mutation	SNP	G	G	C			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr6:53140987G>C	ENST00000542638.1	-	4	761	c.314C>G	c.(313-315)tCa>tGa	p.S105*	MIR5685_ENST00000579080.1_RNA|ELOVL5_ENST00000304434.6_Nonsense_Mutation_p.S105*|ELOVL5_ENST00000486973.1_5'UTR|ELOVL5_ENST00000541407.1_Nonsense_Mutation_p.S132*|ELOVL5_ENST00000370918.4_Nonsense_Mutation_p.S95*			Q9NYP7	ELOV5_HUMAN	ELOVL fatty acid elongase 5	105					alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|fatty acid elongation, monounsaturated fatty acid (GO:0034625)|fatty acid elongation, polyunsaturated fatty acid (GO:0034626)|linoleic acid metabolic process (GO:0043651)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	fatty acid elongase activity (GO:0009922)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	7	Lung NSC(77;0.116)					CTTCATATCTGATTCTCCTGC	0.363																																						dbGAP											0													84.0	75.0	78.0					6																	53140987		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF052129	CCDS4951.1, CCDS56433.1, CCDS56434.1, CCDS75470.1	6p21.1-p12.1	2014-07-30	2011-05-25		ENSG00000012660	ENSG00000012660			21308	protein-coding gene	gene with protein product		611805	"""ELOVL family member 5, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast)"", ""spinocerebellar ataxia 38"""	SCA38		10970790, 25065913	Standard	NM_021814		Approved	HELO1, dJ483K16.1	uc011dwx.2	Q9NYP7	OTTHUMG00000016249	ENST00000542638.1:c.314C>G	6.37:g.53140987G>C	ENSP00000440728:p.Ser105*		B4DZJ2|F6SH78|Q59EL3|Q5TGH5|Q6NXE7|Q7L2S5|Q8NCG4|Q9UI22	Nonsense_Mutation	SNP	pfam_GNS1_SUR4	p.S132*	ENST00000542638.1	37	c.395	CCDS4951.1	6	.	.	.	.	.	.	.	.	.	.	G	34	5.325798	0.95708	.	.	ENSG00000012660	ENST00000370918;ENST00000304434;ENST00000542638;ENST00000541407	.	.	.	6.03	6.03	0.97812	.	0.279277	0.39687	N	0.001285	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	-1.112	20.5666	0.99351	0.0:0.0:1.0:0.0	.	.	.	.	X	95;105;105;132	.	ENSP00000306640:S105X	S	-	2	0	ELOVL5	53248946	1.000000	0.71417	0.954000	0.39281	0.904000	0.53231	4.778000	0.62368	2.854000	0.98071	0.655000	0.94253	TCA	ELOVL5	-	pfam_GNS1_SUR4	ENSG00000012660		0.363	ELOVL5-203	KNOWN	basic|appris_principal|CCDS	protein_coding	ELOVL5	HGNC	protein_coding	OTTHUMT00000043566.1	138	0.00	0	G	NM_021814		53140987	53140987	-1	no_errors	ENST00000541407	ensembl	human	known	69_37n	nonsense	38	30.91	17	SNP	0.997	C
F8	2157	genome.wustl.edu	37	X	154133160	154133160	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chrX:154133160C>A	ENST00000360256.4	-	16	5712	c.5512G>T	c.(5512-5514)Gtg>Ttg	p.V1838L		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	1838	F5/8 type A 3.|Plastocyanin-like 5.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	TGATGTTGCACTTTCCAAAAG	0.413																																						dbGAP											0													157.0	130.0	139.0					X																	154133160		2203	4300	6503	-	-	-	SO:0001583	missense	0			M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.5512G>T	X.37:g.154133160C>A	ENSP00000353393:p.Val1838Leu		Q14286|Q5HY69	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.V1838L	ENST00000360256.4	37	c.5512	CCDS35457.1	X	.	.	.	.	.	.	.	.	.	.	C	16.40	3.111701	0.56398	.	.	ENSG00000185010	ENST00000360256	D	0.98512	-4.97	5.01	5.01	0.66863	Cupredoxin (2);	0.189290	0.45867	D	0.000336	D	0.97402	0.9150	L	0.59912	1.85	0.41376	D	0.987525	P	0.38677	0.642	B	0.43018	0.405	D	0.98331	1.0533	10	0.54805	T	0.06	-16.5976	16.2562	0.82517	0.0:1.0:0.0:0.0	.	1838	P00451	FA8_HUMAN	L	1838	ENSP00000353393:V1838L	ENSP00000353393:V1838L	V	-	1	0	F8	153786354	1.000000	0.71417	0.995000	0.50966	0.823000	0.46562	1.714000	0.37961	2.227000	0.72691	0.506000	0.49869	GTG	F8	-	superfamily_Cupredoxin	ENSG00000185010		0.413	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F8	HGNC	protein_coding	OTTHUMT00000058869.4	223	0.00	0	C			154133160	154133160	-1	no_errors	ENST00000360256	ensembl	human	known	69_37n	missense	27	63.01	46	SNP	0.931	A
FAM117A	81558	genome.wustl.edu	37	17	47793671	47793671	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr17:47793671G>A	ENST00000240364.2	-	7	996	c.917C>T	c.(916-918)tCt>tTt	p.S306F	FAM117A_ENST00000513602.1_Missense_Mutation_p.S34F|RP11-613C6.2_ENST00000512720.1_RNA|FAM117A_ENST00000514018.1_5'Flank	NM_030802.3	NP_110429.1	Q9C073	F117A_HUMAN	family with sequence similarity 117, member A	306										haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	17						GTGTCCTGGAGAGGAGGCTGT	0.547																																						dbGAP											0													63.0	52.0	56.0					17																	47793671		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC037572	CCDS11553.1	17q21.33	2006-04-26				ENSG00000121104			24179	protein-coding gene	gene with protein product	"""C/EBP induced protein"""					12477932	Standard	NM_030802		Approved		uc002ipk.3	Q9C073		ENST00000240364.2:c.917C>T	17.37:g.47793671G>A	ENSP00000240364:p.Ser306Phe		B7Z7Q3	Missense_Mutation	SNP	NULL	p.S306F	ENST00000240364.2	37	c.917	CCDS11553.1	17	.	.	.	.	.	.	.	.	.	.	G	23.0	4.364347	0.82463	.	.	ENSG00000121104	ENST00000240364;ENST00000511743	.	.	.	5.55	5.55	0.83447	.	0.378699	0.23517	N	0.047322	T	0.51550	0.1681	L	0.34521	1.04	0.46499	D	0.999072	P	0.51537	0.946	P	0.49012	0.598	T	0.54159	-0.8335	9	0.87932	D	0	-2.0293	14.877	0.70501	0.0:0.0:1.0:0.0	.	306	Q9C073	F117A_HUMAN	F	306;196	.	ENSP00000240364:S306F	S	-	2	0	FAM117A	45148670	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	1.319000	0.33655	2.894000	0.99253	0.655000	0.94253	TCT	FAM117A	-	NULL	ENSG00000121104		0.547	FAM117A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM117A	HGNC	protein_coding	OTTHUMT00000365736.1	83	0.00	0	G	NM_030802		47793671	47793671	-1	no_errors	ENST00000240364	ensembl	human	known	69_37n	missense	112	29.11	46	SNP	1.000	A
SPATA31A6	389730	genome.wustl.edu	37	9	43630592	43630592	+	Missense_Mutation	SNP	C	C	A	rs543743372		TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr9:43630592C>A	ENST00000332857.6	-	1	138	c.110G>T	c.(109-111)gGg>gTg	p.G37V	SPATA31A6_ENST00000496386.1_5'Flank	NM_001145196.1	NP_001138668.1	Q5VVP1	S31A6_HUMAN	SPATA31 subfamily A, member 6	37					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GAAGAAGAACCCCAGGGCAAA	0.498													C|||	1	0.000199681	0.0	0.0	5008	,	,		9605	0.0		0.0	False		,,,				2504	0.001					dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS75837.1	9p11.2	2012-10-15	2012-10-12	2012-10-12	ENSG00000185775	ENSG00000185775			32006	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A6"""	FAM75A6		20850414	Standard	NM_001145196		Approved	OTTHUMG00000013224	uc011lrb.2	Q5VVP1	OTTHUMG00000013224	ENST00000332857.6:c.110G>T	9.37:g.43630592C>A	ENSP00000329825:p.Gly37Val			Missense_Mutation	SNP	NULL	p.G37V	ENST00000332857.6	37	c.110	CCDS47973.1	9	.	.	.	.	.	.	.	.	.	.	C	12.26	1.884609	0.33255	.	.	ENSG00000185775	ENST00000332857	T	0.17370	2.28	1.96	0.992	0.19819	.	0.379536	0.19422	N	0.114662	T	0.13157	0.0319	L	0.38175	1.15	0.23975	N	0.9963	P	0.51933	0.949	P	0.47573	0.55	T	0.17653	-1.0362	10	0.16420	T	0.52	-5.6059	5.5217	0.16936	0.328:0.672:0.0:0.0	.	37	Q5VVP1	F75A6_HUMAN	V	37	ENSP00000329825:G37V	ENSP00000329825:G37V	G	-	2	0	FAM75A6	43570588	0.001000	0.12720	0.233000	0.24025	0.393000	0.30537	0.147000	0.16202	0.360000	0.24265	0.184000	0.17185	GGG	FAM75A6	-	NULL	ENSG00000185775		0.498	SPATA31A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM75A6	HGNC	protein_coding	OTTHUMT00000036987.1	144	0.00	0	C	NM_001145196		43630592	43630592	-1	no_errors	ENST00000332857	ensembl	human	known	69_37n	missense	36	30.19	16	SNP	0.303	A
FMN2	56776	genome.wustl.edu	37	1	240494024	240494024	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr1:240494024C>T	ENST00000319653.9	+	11	4789	c.4559C>T	c.(4558-4560)cCa>cTa	p.P1520L	FMN2_ENST00000545751.1_Missense_Mutation_p.P116L	NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1520	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GACATTCTTCCAAAACTGAAA	0.403																																						dbGAP											0													130.0	120.0	123.0					1																	240494024		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.4559C>T	1.37:g.240494024C>T	ENSP00000318884:p.Pro1520Leu		B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	pfam_FH2_actin-bd,pfam_Formin_homology_1,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg,pfscan_DEP_dom	p.P1520L	ENST00000319653.9	37	c.4559	CCDS31069.2	1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.195133	0.78902	.	.	ENSG00000155816	ENST00000319653;ENST00000545751;ENST00000537355	T;T	0.37915	1.17;1.17	5.67	5.67	0.87782	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.64402	D	0.000010	T	0.50565	0.1623	L	0.28115	0.83	0.80722	D	1	B;P;D;P	0.89917	0.035;0.72;1.0;0.885	B;P;D;P	0.97110	0.045;0.525;1.0;0.874	T	0.51284	-0.8725	10	0.59425	D	0.04	.	19.7714	0.96367	0.0:1.0:0.0:0.0	.	116;166;149;1520	B4DP05;F5H2C1;B4DN09;Q9NZ56	.;.;.;FMN2_HUMAN	L	1520;116;147	ENSP00000318884:P1520L;ENSP00000437918:P116L	ENSP00000318884:P1520L	P	+	2	0	FMN2	238560647	1.000000	0.71417	0.975000	0.42487	0.989000	0.77384	7.776000	0.85560	2.666000	0.90696	0.655000	0.94253	CCA	FMN2	-	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg	ENSG00000155816		0.403	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMN2	HGNC	protein_coding	OTTHUMT00000096217.2	156	0.00	0	C	XM_371352		240494024	240494024	+1	no_errors	ENST00000319653	ensembl	human	known	69_37n	missense	27	61.97	44	SNP	1.000	T
FUK	197258	genome.wustl.edu	37	16	70512513	70512513	+	Frame_Shift_Del	DEL	G	G	-			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr16:70512513delG	ENST00000288078.6	+	22	3121	c.2889delG	c.(2887-2889)ctgfs	p.L963fs	FUK_ENST00000378912.2_Frame_Shift_Del_p.L969fs|FUK_ENST00000571514.1_Frame_Shift_Del_p.L454fs	NM_145059.2	NP_659496.2	Q8N0W3	FUK_HUMAN	fucokinase	963						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|fucokinase activity (GO:0050201)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(11)|ovary(2)|prostate(2)	23		Ovarian(137;0.0694)				CCCACAGCCTGGTACGGCAAA	0.632																																						dbGAP											0													43.0	46.0	45.0					16																	70512513		1982	4165	6147	-	-	-	SO:0001589	frameshift_variant	0				CCDS10891.2	16q22.1	2008-02-05			ENSG00000157353	ENSG00000157353	2.7.1.52		29500	protein-coding gene	gene with protein product	"""L-fucose kinase"""	608675				12056818	Standard	XM_006721161		Approved	FLJ39408	uc002eyy.3	Q8N0W3	OTTHUMG00000074085	ENST00000288078.6:c.2889delG	16.37:g.70512513delG	ENSP00000288078:p.Leu963fs		Q5PSM3|Q5XKL6|Q6ZRA0|Q96MT9	Frame_Shift_Del	DEL	pfam_Fucokinase,pfam_GHMP_kinase_C_dom,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_Trimer_LpxA-like,prints_Galkinase	p.V970fs	ENST00000288078.6	37	c.2907	CCDS10891.2	16																																																																																			FUK	-	NULL	ENSG00000157353		0.632	FUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUK	HGNC	protein_coding	OTTHUMT00000157291.2	46	0.00	0	G	NM_145059		70512513	70512513	+1	no_errors	ENST00000378912	ensembl	human	known	69_37n	frame_shift_del	10	23.08	3	DEL	1.000	-
GABRA2	2555	genome.wustl.edu	37	4	46264108	46264108	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr4:46264108G>C	ENST00000510861.1	-	9	1067	c.894C>G	c.(892-894)atC>atG	p.I298M	GABRA2_ENST00000515082.1_Missense_Mutation_p.I298M|GABRA2_ENST00000356504.1_Missense_Mutation_p.I298M|GABRA2_ENST00000540012.1_Missense_Mutation_p.I243M|GABRA2_ENST00000381620.4_Missense_Mutation_p.I298M|GABRA2_ENST00000507069.1_Missense_Mutation_p.I298M|GABRA2_ENST00000514090.1_Missense_Mutation_p.I298M			P47869	GBRA2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 2	298					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|neurotransmitter transport (GO:0006836)|regulation of neurotransmitter levels (GO:0001505)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of synaptic vesicle membrane (GO:0030285)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	56					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	TCCGAGCACTGATGCTTAGAG	0.413																																						dbGAP											0													117.0	107.0	110.0					4																	46264108		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3471.1	4p12	2012-06-22			ENSG00000151834	ENSG00000151834		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4076	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 2"""	137140					Standard	NM_000807		Approved		uc010igc.2	P47869	OTTHUMG00000044266	ENST00000510861.1:c.894C>G	4.37:g.46264108G>C	ENSP00000421828:p.Ile298Met		A8K0U7|B7Z1H8|Q59G14	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_GABAAa_rcpt,prints_GABAA_rcpt,prints_GABBAa2_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.I243M	ENST00000510861.1	37	c.729	CCDS3471.1	4	.	.	.	.	.	.	.	.	.	.	G	18.14	3.557926	0.65538	.	.	ENSG00000151834	ENST00000510861;ENST00000514090;ENST00000381620;ENST00000356504;ENST00000540012;ENST00000507069;ENST00000515082	D;D;D;D;D;D;D	0.86297	-2.1;-2.1;-2.1;-2.1;-2.1;-2.1;-2.1	5.35	4.46	0.54185	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.89805	0.6821	L	0.39020	1.185	0.51012	D	0.999905	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.79108	0.992;0.974;0.989	D	0.90525	0.4491	10	0.72032	D	0.01	.	15.0659	0.71996	0.0:0.0:0.8583:0.1417	.	243;298;298	B7Z1H8;G5E9Z6;P47869	.;.;GBRA2_HUMAN	M	298;298;298;298;243;298;298	ENSP00000421828:I298M;ENSP00000421300:I298M;ENSP00000371033:I298M;ENSP00000348897:I298M;ENSP00000444409:I243M;ENSP00000427603:I298M;ENSP00000423840:I298M	ENSP00000348897:I298M	I	-	3	3	GABRA2	45958865	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.216000	0.51176	2.676000	0.91093	0.591000	0.81541	ATC	GABRA2	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,tigrfam_Neur_channel	ENSG00000151834		0.413	GABRA2-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	GABRA2	HGNC	protein_coding	OTTHUMT00000360848.2	117	0.00	0	G			46264108	46264108	-1	no_errors	ENST00000540012	ensembl	human	known	69_37n	missense	35	16.67	7	SNP	1.000	C
GARNL3	84253	genome.wustl.edu	37	9	130095401	130095401	+	Splice_Site	SNP	G	G	C			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr9:130095401G>C	ENST00000373387.4	+	9	1121		c.e9+1		GARNL3_ENST00000435213.2_Splice_Site|GARNL3_ENST00000314904.5_Splice_Site	NM_032293.4	NP_115669.3	Q5VVW2	GARL3_HUMAN	GTPase activating Rap/RanGAP domain-like 3						regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)|small GTPase regulator activity (GO:0005083)			NS(1)|central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(24)|ovary(1)|skin(1)|urinary_tract(2)	41						GATACCAAAAGTAAGCCTGCC	0.443																																						dbGAP											0													65.0	67.0	66.0					9																	130095401		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC034983	CCDS6869.2, CCDS69663.1	9q34.13	2009-09-14	2004-08-09		ENSG00000136895	ENSG00000136895			25425	protein-coding gene	gene with protein product			"""GTPase activating RANGAP domain-like 3"""			11230166	Standard	NM_032293		Approved	DKFZp761J1523, bA356B19.1	uc011mae.2	Q5VVW2	OTTHUMG00000020700	ENST00000373387.4:c.769+1G>C	9.37:g.130095401G>C			B4DEP7|B7Z3Q6|Q8IYU1|Q8N951|Q8ND89|Q9BQH6	Splice_Site	SNP	-	e9+1	ENST00000373387.4	37	c.769+1	CCDS6869.2	9	.	.	.	.	.	.	.	.	.	.	G	20.7	4.041886	0.75732	.	.	ENSG00000136895	ENST00000435213;ENST00000314904;ENST00000373387	.	.	.	5.07	5.07	0.68467	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.3617	0.87353	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GARNL3	129135222	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	8.865000	0.92300	2.525000	0.85131	0.557000	0.71058	.	GARNL3	-	-	ENSG00000136895		0.443	GARNL3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GARNL3	HGNC	protein_coding	OTTHUMT00000054151.3	106	0.93	1	G	NM_032293	Intron	130095401	130095401	+1	no_errors	ENST00000373387	ensembl	human	known	69_37n	splice_site	27	22.86	8	SNP	1.000	C
GATA3	2625	genome.wustl.edu	37	10	8111471	8111472	+	Frame_Shift_Ins	INS	-	-	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr10:8111471_8111472insT	ENST00000346208.3	+	5	1412_1413	c.957_958insT	c.(958-960)tgtfs	p.C320fs	GATA3_ENST00000379328.3_Frame_Shift_Ins_p.C321fs|GATA3_ENST00000461472.1_3'UTR			P23771	GATA3_HUMAN	GATA binding protein 3	320					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.C321fs*32(1)		NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						CCTGTGCGAACTGTCAGACCAC	0.51			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																															dbGAP		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	1	Insertion - Frameshift(1)	breast(1)	GRCh37	CM043921	GATA3	M																																				-	-	-	SO:0001589	frameshift_variant	0			X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.958dupT	10.37:g.8111472_8111472dupT	ENSP00000341619:p.Cys320fs		Q5VWG7|Q5VWG8|Q96J16	Frame_Shift_Ins	INS	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	p.C320fs	ENST00000346208.3	37	c.960_961	CCDS7083.1	10																																																																																			GATA3	-	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA	ENSG00000107485		0.510	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA3	HGNC	protein_coding	OTTHUMT00000046719.1	110	0.00	0	-	NM_001002295		8111471	8111472	+1	no_errors	ENST00000379328	ensembl	human	known	69_37n	frame_shift_ins	28	41.67	20	INS	1.000:1.000	T
GBP4	115361	genome.wustl.edu	37	1	89658761	89658761	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr1:89658761G>C	ENST00000355754.6	-	5	593	c.496C>G	c.(496-498)Cta>Gta	p.L166V		NM_052941.4	NP_443173.2	Q96PP9	GBP4_HUMAN	guanylate binding protein 4	166	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(19)|skin(1)|stomach(2)|urinary_tract(1)	33				all cancers(265;0.00723)|Epithelial(280;0.0291)		GCCCTGATTAGCTCTGCTAGC	0.453																																						dbGAP											0													115.0	107.0	110.0					1																	89658761		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF288814	CCDS721.1	1p22.2	2008-02-05			ENSG00000162654	ENSG00000162654			20480	protein-coding gene	gene with protein product		612466				16689661	Standard	NM_052941		Approved	Mpa2	uc001dnb.3	Q96PP9	OTTHUMG00000010663	ENST00000355754.6:c.496C>G	1.37:g.89658761G>C	ENSP00000359490:p.Leu166Val		B2R630|Q05D63|Q6NSL0|Q86T99	Missense_Mutation	SNP	pfam_Guanylate-bd_C,pfam_Guanylate-bd_N,superfamily_Guanylate-bd_C	p.L166V	ENST00000355754.6	37	c.496	CCDS721.1	1	.	.	.	.	.	.	.	.	.	.	G	9.664	1.144862	0.21288	.	.	ENSG00000162654	ENST00000355754	T	0.75154	-0.91	4.92	-0.344	0.12628	Guanylate-binding protein, N-terminal (1);	0.969423	0.08494	N	0.937525	T	0.72020	0.3409	M	0.91561	3.22	0.09310	N	1	P	0.46142	0.873	P	0.52189	0.692	T	0.64296	-0.6441	10	0.17832	T	0.49	.	8.5614	0.33514	0.4474:0.0:0.5526:0.0	.	166	Q96PP9	GBP4_HUMAN	V	166	ENSP00000359490:L166V	ENSP00000359490:L166V	L	-	1	2	GBP4	89431349	0.003000	0.15002	0.004000	0.12327	0.431000	0.31685	0.918000	0.28678	-0.137000	0.11455	-0.143000	0.13931	CTA	GBP4	-	pfam_Guanylate-bd_N	ENSG00000162654		0.453	GBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP4	HGNC	protein_coding	OTTHUMT00000029409.1	177	0.00	0	G	NM_052941		89658761	89658761	-1	no_errors	ENST00000355754	ensembl	human	known	69_37n	missense	48	34.25	25	SNP	0.061	C
GBAP1	2630	genome.wustl.edu	37	1	155187362	155187362	+	RNA	SNP	A	A	G			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr1:155187362A>G	ENST00000486869.1	-	0	296					NR_002188.2				glucosidase, beta, acid pseudogene 1																		TTAGCAGATGATAGGCGGCGA	0.517																																						dbGAP											0																																										-	-	-			0			J03060		1q22	2012-11-19	2010-01-19	2010-01-19	ENSG00000160766	ENSG00000160766			4178	pseudogene	pseudogene			"""glucosidase, beta; acid, pseudogene"""	GBAP			Standard	NR_002188		Approved		uc001fjd.3		OTTHUMG00000176393		1.37:g.155187362A>G				RNA	SNP	-	NULL	ENST00000486869.1	37	NULL		1																																																																																			GBAP1	-	-	ENSG00000160766		0.517	GBAP1-002	KNOWN	basic	processed_transcript	GBAP1	HGNC	pseudogene	OTTHUMT00000087219.2	26	0.00	0	A	NR_002188.2		155187362	155187362	-1	no_errors	ENST00000486869	ensembl	human	known	69_37n	rna	5	61.54	8	SNP	0.000	G
GGT1	2678	genome.wustl.edu	37	22	25023502	25023502	+	Missense_Mutation	SNP	C	C	T	rs3966247		TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr22:25023502C>T	ENST00000400382.1	+	12	1879	c.1124C>T	c.(1123-1125)aCg>aTg	p.T375M	GGT1_ENST00000404920.1_Missense_Mutation_p.T31M|GGT1_ENST00000466310.1_3'UTR|GGT1_ENST00000401885.1_Missense_Mutation_p.T31M|GGT1_ENST00000248923.4_Missense_Mutation_p.T375M|GGT1_ENST00000400380.1_Missense_Mutation_p.T375M|GGT1_ENST00000406383.2_Missense_Mutation_p.T375M|GGT1_ENST00000404532.1_Missense_Mutation_p.T31M|GGT1_ENST00000400383.1_Missense_Mutation_p.T375M|GGT1_ENST00000404223.1_Missense_Mutation_p.T31M|GGT1_ENST00000403838.1_Missense_Mutation_p.T31M			P19440	GGT1_HUMAN	gamma-glutamyltransferase 1	375					arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|cysteine biosynthetic process (GO:0019344)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione catabolic process (GO:0006751)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|regulation of immune system process (GO:0002682)|regulation of inflammatory response (GO:0050727)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|xenobiotic metabolic process (GO:0006805)|zymogen activation (GO:0031638)	anchored component of external side of plasma membrane (GO:0031362)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)			breast(1)|endometrium(2)|kidney(14)|large_intestine(2)|lung(6)|pancreas(1)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	40					Glutathione(DB00143)	GAGTTCTACACGCCGGATGAC	0.627																																						dbGAP											0													31.0	31.0	31.0					22																	25023502		2199	4289	6488	-	-	-	SO:0001583	missense	0			M24903	CCDS42992.1	22q11.23	2008-08-15			ENSG00000100031	ENSG00000100031	2.3.2.2	"""CD molecules"", ""Gamma-glutamyltransferases"""	4250	protein-coding gene	gene with protein product		612346		GGT		8104871, 18357469	Standard	NM_001288833		Approved	D22S672, D22S732, CD224	uc003aan.1	P19440	OTTHUMG00000030859	ENST00000400382.1:c.1124C>T	22.37:g.25023502C>T	ENSP00000383232:p.Thr375Met		Q08247|Q14404|Q8TBS1|Q9UMK1	Missense_Mutation	SNP	pfam_GGT_peptidase,prints_GGT_peptidase,tigrfam_GGT_peptidase	p.T375M	ENST00000400382.1	37	c.1124	CCDS42992.1	22	14	0.00641025641025641	5	0.01016260162601626	3	0.008287292817679558	3	0.005244755244755245	3	0.00395778364116095	.	5.417	0.262168	0.10239	.	.	ENSG00000100031	ENST00000248923;ENST00000412658;ENST00000400382;ENST00000400383;ENST00000400380;ENST00000406383;ENST00000401885;ENST00000404532;ENST00000403838;ENST00000404223;ENST00000404920	T;T;T;T;T;T;T;T;T;T;T	0.06849	3.25;3.25;3.25;3.25;3.25;3.25;3.25;3.25;3.25;3.25;3.25	3.54	0.128	0.14733	.	0.390577	0.25994	N	0.026986	T	0.04182	0.0116	L	0.49126	1.545	0.09310	N	0.999993	P	0.35780	0.52	B	0.32805	0.153	T	0.26326	-1.0106	10	0.42905	T	0.14	-29.1837	3.7692	0.08635	0.1785:0.5255:0.0:0.2959	rs3966247	375	P19440	GGT1_HUMAN	M	375;375;375;375;375;375;31;31;31;31;31	ENSP00000248923:T375M;ENSP00000393537:T375M;ENSP00000383232:T375M;ENSP00000383233:T375M;ENSP00000383231:T375M;ENSP00000385975:T375M;ENSP00000384381:T31M;ENSP00000385445:T31M;ENSP00000384820:T31M;ENSP00000385016:T31M;ENSP00000385001:T31M	ENSP00000248923:T375M	T	+	2	0	GGT1	23353502	0.004000	0.15560	0.292000	0.24919	0.056000	0.15407	0.018000	0.13422	0.277000	0.22141	0.298000	0.19748	ACG	GGT1	-	pfam_GGT_peptidase,tigrfam_GGT_peptidase	ENSG00000100031		0.627	GGT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GGT1	HGNC	protein_coding	OTTHUMT00000250797.1	79	0.00	0	C	NM_013430		25023502	25023502	+1	no_errors	ENST00000248923	ensembl	human	known	69_37n	missense	31	26.19	11	SNP	0.252	T
GNPAT	8443	genome.wustl.edu	37	1	231411054	231411054	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr1:231411054C>T	ENST00000366647.4	+	13	2000	c.1831C>T	c.(1831-1833)Ctt>Ttt	p.L611F	GNPAT_ENST00000469332.1_3'UTR|GNPAT_ENST00000366646.3_Missense_Mutation_p.L550F	NM_014236.3	NP_055051.1	O15228	GNPAT_HUMAN	glyceronephosphate O-acyltransferase	611					cellular lipid metabolic process (GO:0044255)|cerebellum morphogenesis (GO:0021587)|ether lipid biosynthetic process (GO:0008611)|glycerophospholipid biosynthetic process (GO:0046474)|membrane organization (GO:0061024)|paranodal junction assembly (GO:0030913)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to fatty acid (GO:0070542)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)|synapse assembly (GO:0007416)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	glycerone-phosphate O-acyltransferase activity (GO:0016287)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	23	Breast(184;0.0871)	all_cancers(173;0.2)|Prostate(94;0.183)				CACAAGTCAGCTTCTCGATCA	0.418																																						dbGAP											0													105.0	98.0	101.0					1																	231411054		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF043937	CCDS1592.1	1q42	2008-02-05			ENSG00000116906	ENSG00000116906	2.3.1.42		4416	protein-coding gene	gene with protein product		602744				9459311, 9536089	Standard	NM_014236		Approved	DHAPAT, DAPAT, DAP-AT	uc001hup.4	O15228	OTTHUMG00000038024	ENST00000366647.4:c.1831C>T	1.37:g.231411054C>T	ENSP00000355607:p.Leu611Phe		B4DNM9|Q5TBH7|Q9BWC2	Missense_Mutation	SNP	pfam_Acyltransferase,smart_Acyltransferase	p.L611F	ENST00000366647.4	37	c.1831	CCDS1592.1	1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.527533	0.85706	.	.	ENSG00000116906	ENST00000366647;ENST00000366646	T;T	0.69926	-0.44;-0.4	4.88	4.88	0.63580	.	0.129855	0.53938	D	0.000053	T	0.78534	0.4298	M	0.63843	1.955	0.80722	D	1	D;D	0.67145	0.996;0.991	D;P	0.64595	0.927;0.898	T	0.80973	-0.1143	10	0.87932	D	0	.	16.37	0.83353	0.0:1.0:0.0:0.0	.	550;611	B4DNM9;O15228	.;GNPAT_HUMAN	F	611;550	ENSP00000355607:L611F;ENSP00000355606:L550F	ENSP00000355606:L550F	L	+	1	0	GNPAT	229477677	1.000000	0.71417	0.976000	0.42696	0.876000	0.50452	5.842000	0.69417	2.535000	0.85469	0.460000	0.39030	CTT	GNPAT	-	NULL	ENSG00000116906		0.418	GNPAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GNPAT	HGNC	protein_coding	OTTHUMT00000092871.1	161	0.00	0	C			231411054	231411054	+1	no_errors	ENST00000366647	ensembl	human	known	69_37n	missense	109	10.66	13	SNP	0.999	T
GNPDA2	132789	genome.wustl.edu	37	4	44709931	44709931	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr4:44709931T>C	ENST00000295448.3	-	6	763	c.607A>G	c.(607-609)Ata>Gta	p.I203V	RP11-700J17.2_ENST00000610267.1_RNA|GNPDA2_ENST00000509756.1_Missense_Mutation_p.I203V|GNPDA2_ENST00000507534.1_Missense_Mutation_p.I133V|GNPDA2_ENST00000507917.1_Missense_Mutation_p.I169V|GNPDA2_ENST00000511187.1_5'UTR	NM_138335.2	NP_612208.1	Q8TDQ7	GNPI2_HUMAN	glucosamine-6-phosphate deaminase 2	203					carbohydrate metabolic process (GO:0005975)|N-acetylglucosamine metabolic process (GO:0006044)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	glucosamine-6-phosphate deaminase activity (GO:0004342)|hydrolase activity (GO:0016787)			endometrium(2)|large_intestine(1)|lung(7)|ovary(1)	11						GCCCCTGTTATAAGGATCATT	0.383																																					Colon(54;743 1010 7604 16453 19544)	dbGAP											0													95.0	85.0	88.0					4																	44709931		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF247786	CCDS3469.1, CCDS59472.1, CCDS59473.1	4p13	2006-04-12			ENSG00000163281	ENSG00000163281	3.5.99.6		21526	protein-coding gene	gene with protein product	"""glucosamine-6-phosphate isomerase"""	613222				12965206	Standard	NM_001270880		Approved	SB52	uc003gwy.4	Q8TDQ7	OTTHUMG00000099415	ENST00000295448.3:c.607A>G	4.37:g.44709931T>C	ENSP00000295448:p.Ile203Val		B4DJF3|Q2VYF1|Q59EA7|Q8NCZ8|Q96BJ4|Q96NC6	Missense_Mutation	SNP	pfam_Glc/Gal-6P_isomerase,tigrfam_Glucosamine6P_isomerase	p.I203V	ENST00000295448.3	37	c.607	CCDS3469.1	4	.	.	.	.	.	.	.	.	.	.	T	12.29	1.894574	0.33442	.	.	ENSG00000163281	ENST00000507917;ENST00000295448;ENST00000507534;ENST00000509756	T;T;T;T	0.35605	1.3;1.3;1.3;1.3	5.04	5.04	0.67666	Glucosamine/galactosamine-6-phosphate isomerase (1);	0.000000	0.85682	D	0.000000	T	0.23727	0.0574	N	0.25245	0.725	0.80722	D	1	B;B;B	0.19200	0.034;0.004;0.023	B;B;B	0.26864	0.074;0.008;0.041	T	0.05084	-1.0907	10	0.02654	T	1	-28.0346	14.4026	0.67060	0.0:0.0:0.0:1.0	.	169;203;203	Q2VYF1;Q8TDQ7-3;Q8TDQ7	.;.;GNPI2_HUMAN	V	169;203;133;203	ENSP00000425868:I169V;ENSP00000295448:I203V;ENSP00000427423:I133V;ENSP00000424061:I203V	ENSP00000295448:I203V	I	-	1	0	GNPDA2	44404688	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.482000	0.81143	2.240000	0.73641	0.533000	0.62120	ATA	GNPDA2	-	pfam_Glc/Gal-6P_isomerase,tigrfam_Glucosamine6P_isomerase	ENSG00000163281		0.383	GNPDA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNPDA2	HGNC	protein_coding	OTTHUMT00000216874.3	98	0.00	0	T	NM_138335		44709931	44709931	-1	no_errors	ENST00000295448	ensembl	human	known	69_37n	missense	32	31.91	15	SNP	1.000	C
GPR17	2840	genome.wustl.edu	37	2	128407626	128407626	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr2:128407626C>A	ENST00000272644.3	+	2	114	c.40C>A	c.(40-42)Cca>Aca	p.P14T	GPR17_ENST00000486700.1_Intron|GPR17_ENST00000544369.1_Missense_Mutation_p.P14T|LIMS2_ENST00000410038.1_5'Flank|LIMS2_ENST00000545738.2_Intron|LIMS2_ENST00000409808.2_Intron|LIMS2_ENST00000410011.1_Intron|LIMS2_ENST00000355119.4_Intron|LIMS2_ENST00000409254.1_Intron|GPR17_ENST00000393018.3_Missense_Mutation_p.P14T|LIMS2_ENST00000324938.5_Intron|LIMS2_ENST00000409455.1_Intron	NM_001161416.1|NM_001161417.1|NM_005291.2	NP_001154888.1|NP_001154889.1|NP_005282.1	Q13304	GPR17_HUMAN	G protein-coupled receptor 17	14					chemokine-mediated signaling pathway (GO:0070098)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)|urinary_tract(1)	19	Colorectal(110;0.1)	Ovarian(717;0.15)		BRCA - Breast invasive adenocarcinoma(221;0.0677)		CAGAAAGCCCCCAAGAGAGAT	0.577											OREG0014966	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													51.0	45.0	47.0					2																	128407626		2202	4299	6501	-	-	-	SO:0001583	missense	0				CCDS2148.1	2q21	2014-01-30			ENSG00000144230	ENSG00000144230		"""GPCR / Class A : Orphans"""	4471	protein-coding gene	gene with protein product		603071				8558062	Standard	NM_001161415		Approved		uc002tpc.3	Q13304	OTTHUMG00000131533	ENST00000272644.3:c.40C>A	2.37:g.128407626C>A	ENSP00000272644:p.Pro14Thr	1564	A8K9L0|B2R9X0|Q8N5S7|Q9UDZ6|Q9UE21	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_P2_purnocptor,prints_Protea_act_rcpt	p.P14T	ENST00000272644.3	37	c.40	CCDS2148.1	2	.	.	.	.	.	.	.	.	.	.	c	5.772	0.326851	0.10900	.	.	ENSG00000144230	ENST00000544369;ENST00000272644;ENST00000423019;ENST00000393018	T;T;T;T	0.66460	-0.21;-0.21;0.1;-0.21	2.49	-0.72	0.11195	.	1.234490	0.06799	N	0.788385	T	0.29783	0.0744	N	0.08118	0	0.09310	N	1	P	0.41232	0.743	B	0.23150	0.044	T	0.17715	-1.0360	10	0.13108	T	0.6	.	0.5957	0.00736	0.2353:0.3276:0.2561:0.181	.	14	Q13304	GPR17_HUMAN	T	14	ENSP00000442982:P14T;ENSP00000272644:P14T;ENSP00000387970:P14T;ENSP00000376741:P14T	ENSP00000272644:P14T	P	+	1	0	GPR17	128124096	0.002000	0.14202	0.000000	0.03702	0.082000	0.17680	0.663000	0.25053	-0.183000	0.10585	0.591000	0.81541	CCA	GPR17	-	NULL	ENSG00000144230		0.577	GPR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR17	HGNC	protein_coding	OTTHUMT00000254390.1	54	0.00	0	C			128407626	128407626	+1	no_errors	ENST00000272644	ensembl	human	known	69_37n	missense	17	22.73	5	SNP	0.000	A
GPR88	54112	genome.wustl.edu	37	1	101004699	101004699	+	Silent	SNP	C	C	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr1:101004699C>T	ENST00000315033.4	+	2	616	c.177C>T	c.(175-177)ttC>ttT	p.F59F		NM_022049.2	NP_071332.2	Q9GZN0	GPR88_HUMAN	G protein-coupled receptor 88	59					G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuronal action potential (GO:0019228)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			large_intestine(2)|skin(1)	3		all_epithelial(167;1.19e-05)|all_lung(203;0.00159)|Lung NSC(277;0.00171)		Epithelial(280;0.0372)|all cancers(265;0.0558)|COAD - Colon adenocarcinoma(174;0.141)|Colorectal(144;0.156)|Lung(183;0.189)		TGTCGTCCTTCCGAAAGCTGC	0.682																																						dbGAP											0													42.0	38.0	39.0					1																	101004699		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB042411	CCDS772.1	1p21.3	2012-08-21	2006-02-15		ENSG00000181656	ENSG00000181656		"""GPCR / Class A : Orphans"""	4539	protein-coding gene	gene with protein product		607468	"""G-protein coupled receptor 88"", ""G protein coupled receptor 88"""				Standard	NM_022049		Approved		uc001dth.3	Q9GZN0	OTTHUMG00000010981	ENST00000315033.4:c.177C>T	1.37:g.101004699C>T			Q29S24|Q6VN48	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.F59	ENST00000315033.4	37	c.177	CCDS772.1	1																																																																																			GPR88	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000181656		0.682	GPR88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR88	HGNC	protein_coding	OTTHUMT00000030212.1	21	0.00	0	C	NM_022049		101004699	101004699	+1	no_errors	ENST00000315033	ensembl	human	known	69_37n	silent	13	27.78	5	SNP	1.000	T
HIST1H4L	8368	genome.wustl.edu	37	6	27841034	27841034	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr6:27841034C>T	ENST00000355981.2	-	1	255	c.255G>A	c.(253-255)atG>atA	p.M85I	HIST1H3I_ENST00000328488.2_5'Flank	NM_003546.2	NP_003537.1	P62805	H4_HUMAN	histone cluster 1, H4l	85					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	13						AAACCACGTCCATGGCTGTGA	0.537																																						dbGAP											0													98.0	89.0	92.0					6																	27841034		2203	4300	6503	-	-	-	SO:0001583	missense	0			X83548	CCDS4637.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000198558	ENSG00000275126		"""Histones / Replication-dependent"""	4791	protein-coding gene	gene with protein product		602831	"""H4 histone family, member K"", ""histone 1, H4l"""	H4FK		9031620, 9439656, 12408966	Standard	NM_003546		Approved	H4.k, H4/k	uc003njz.3	P62805	OTTHUMG00000016211	ENST00000355981.2:c.255G>A	6.37:g.27841034C>T	ENSP00000348258:p.Met85Ile		A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_TAF_TATA-bd,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4	p.M85I	ENST00000355981.2	37	c.255	CCDS4637.1	6	.	.	.	.	.	.	.	.	.	.	C	18.70	3.679125	0.68042	.	.	ENSG00000198558	ENST00000355981	T	0.67523	-0.27	4.52	3.64	0.41730	.	0.000000	0.85682	D	0.000000	T	0.67059	0.2853	.	.	.	0.42403	D	0.992575	.	.	.	.	.	.	T	0.71712	-0.4510	7	0.62326	D	0.03	.	11.9039	0.52699	0.0:0.912:0.0:0.088	.	.	.	.	I	85	ENSP00000348258:M85I	ENSP00000348258:M85I	M	-	3	0	HIST1H4L	27949013	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	7.194000	0.77789	1.194000	0.43101	0.655000	0.94253	ATG	HIST1H4L	-	pfam_Histone_core_D,pfam_TAF_TATA-bd,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4	ENSG00000198558		0.537	HIST1H4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H4L	HGNC	protein_coding	OTTHUMT00000043513.1	91	0.00	0	C	NM_003546		27841034	27841034	-1	no_errors	ENST00000355981	ensembl	human	known	69_37n	missense	25	32.43	12	SNP	1.000	T
GRIK2	2898	genome.wustl.edu	37	6	102483396	102483396	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr6:102483396G>C	ENST00000421544.1	+	14	2756	c.2266G>C	c.(2266-2268)Ggc>Cgc	p.G756R	GRIK2_ENST00000369137.3_Missense_Mutation_p.G680R|GRIK2_ENST00000413795.1_Missense_Mutation_p.G756R|GRIK2_ENST00000318991.6_Missense_Mutation_p.G756R|GRIK2_ENST00000369138.1_Missense_Mutation_p.G756R|GRIK2_ENST00000369134.4_Missense_Mutation_p.G707R	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	756					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	GACACAGATTGGCGGCCTTAT	0.448																																						dbGAP											0													153.0	155.0	154.0					6																	102483396		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.2266G>C	6.37:g.102483396G>C	ENSP00000397026:p.Gly756Arg		A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.G756R	ENST00000421544.1	37	c.2266	CCDS5048.1	6	.	.	.	.	.	.	.	.	.	.	G	32	5.179363	0.94846	.	.	ENSG00000164418	ENST00000421544;ENST00000413795;ENST00000369138;ENST00000369137;ENST00000318991;ENST00000369134;ENST00000540076	T;T;T;T;T;T	0.15017	2.46;2.46;2.46;2.46;2.46;2.46	5.46	5.46	0.80206	Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.47135	0.1429	M	0.91406	3.205	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.59558	-0.7432	10	0.87932	D	0	.	19.301	0.94144	0.0:0.0:1.0:0.0	.	756;756;756	Q13002-5;Q13002;Q13002-2	.;GRIK2_HUMAN;.	R	756;756;756;680;756;707;531	ENSP00000397026:G756R;ENSP00000405596:G756R;ENSP00000358134:G756R;ENSP00000358133:G680R;ENSP00000313276:G756R;ENSP00000358130:G707R	ENSP00000313276:G756R	G	+	1	0	GRIK2	102590089	1.000000	0.71417	0.993000	0.49108	0.997000	0.91878	9.869000	0.99810	2.555000	0.86185	0.655000	0.94253	GGC	GRIK2	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000164418		0.448	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK2	HGNC	protein_coding	OTTHUMT00000043718.1	61	0.00	0	G			102483396	102483396	+1	no_errors	ENST00000421544	ensembl	human	known	69_37n	missense	41	14.58	7	SNP	1.000	C
HIST2H2AC	8338	genome.wustl.edu	37	1	149858554	149858554	+	Silent	SNP	G	G	A			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr1:149858554G>A	ENST00000331380.2	+	1	30	c.30G>A	c.(28-30)aaG>aaA	p.K10K	BOLA1_ENST00000369153.2_5'Flank|HIST2H2BE_ENST00000369155.2_5'Flank	NM_003517.2	NP_003508.1	Q16777	H2A2C_HUMAN	histone cluster 2, H2ac	10						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|ovary(1)|skin(1)	20	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			AAGGAGGCAAGGCCCGCGCCA	0.577																																						dbGAP											0													81.0	89.0	86.0					1																	149858554		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AY131973	CCDS937.1	1q21.2	2011-01-27	2006-10-11	2003-02-21	ENSG00000184260	ENSG00000184260		"""Histones / Replication-dependent"""	4738	protein-coding gene	gene with protein product		602797	"""H2A histone family, member Q"", ""histone 2, H2ac"""	H2A, H2AFQ		1469070, 9439656, 12408966	Standard	NM_003517		Approved	H2A/q	uc001etd.3	Q16777	OTTHUMG00000035825	ENST00000331380.2:c.30G>A	1.37:g.149858554G>A			Q6DRA7|Q8IUE5	Silent	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.K10	ENST00000331380.2	37	c.30	CCDS937.1	1																																																																																			HIST2H2AC	-	superfamily_Histone-fold,smart_Histone_H2A	ENSG00000184260		0.577	HIST2H2AC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST2H2AC	HGNC	protein_coding	OTTHUMT00000087128.1	70	0.00	0	G	NM_003517		149858554	149858554	+1	no_errors	ENST00000331380	ensembl	human	known	69_37n	silent	52	20.00	13	SNP	0.991	A
HMCN1	83872	genome.wustl.edu	37	1	185892721	185892721	+	Silent	SNP	C	C	A			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr1:185892721C>A	ENST00000271588.4	+	8	1450	c.1221C>A	c.(1219-1221)ggC>ggA	p.G407G	HMCN1_ENST00000367492.2_Silent_p.G407G	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	407					response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						AAGTAACAGGCTATGATAAAG	0.343																																						dbGAP											0													109.0	110.0	109.0					1																	185892721		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.1221C>A	1.37:g.185892721C>A			A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd,pfam_Thrombospondin_1_rpt,superfamily_Green_fluorescent_prot-like,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like	p.G407	ENST00000271588.4	37	c.1221	CCDS30956.1	1																																																																																			HMCN1	-	NULL	ENSG00000143341		0.343	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	136	0.00	0	C	NM_031935		185892721	185892721	+1	no_errors	ENST00000271588	ensembl	human	known	69_37n	silent	78	17.89	17	SNP	1.000	A
HPD	3242	genome.wustl.edu	37	12	122277893	122277893	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr12:122277893G>A	ENST00000289004.4	-	13	1051	c.1016C>T	c.(1015-1017)cCg>cTg	p.P339L	HPD_ENST00000543163.1_Missense_Mutation_p.P300L	NM_002150.2	NP_002141	P32754	HPPD_HUMAN	4-hydroxyphenylpyruvate dioxygenase	339					cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	4-hydroxyphenylpyruvate dioxygenase activity (GO:0003868)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(8)|urinary_tract(1)	18	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000105)|Epithelial(86;0.000352)|BRCA - Breast invasive adenocarcinoma(302;0.225)	Nitisinone(DB00348)	GTCCTGCACCGGTTTGGTGAA	0.632																																						dbGAP											0													113.0	95.0	101.0					12																	122277893		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC014790	CCDS9224.1, CCDS53839.1	12q24.31	2013-09-19			ENSG00000158104	ENSG00000158104	1.13.11.27		5147	protein-coding gene	gene with protein product	"""glyoxalase domain containing 3"""	609695		PPD			Standard	NM_001171993		Approved	4-HPPD, 4HPPD, GLOD3	uc001ubj.3	P32754	OTTHUMG00000169081	ENST00000289004.4:c.1016C>T	12.37:g.122277893G>A	ENSP00000289004:p.Pro339Leu		A8K461|B3KQ63|Q13234	Missense_Mutation	SNP	pfam_Glyas_Fos-R_dOase_dom,pirsf_4OHPhenylPyrv_dOase,tigrfam_4OHPhenylPyrv_dOase	p.P339L	ENST00000289004.4	37	c.1016	CCDS9224.1	12	.	.	.	.	.	.	.	.	.	.	G	34	5.344467	0.95807	.	.	ENSG00000158104	ENST00000289004;ENST00000545969;ENST00000543163	T;T	0.67171	-0.25;-0.25	5.47	4.58	0.56647	.	0.000000	0.85682	D	0.000000	D	0.83658	0.5302	M	0.89968	3.075	0.80722	D	1	D	0.89917	1.0	D	0.68039	0.955	D	0.87313	0.2313	10	0.87932	D	0	-19.6761	14.3279	0.66532	0.0718:0.0:0.9282:0.0	.	339	P32754	HPPD_HUMAN	L	339;336;300	ENSP00000289004:P339L;ENSP00000441677:P300L	ENSP00000289004:P339L	P	-	2	0	HPD	120762276	1.000000	0.71417	0.986000	0.45419	0.977000	0.68977	7.932000	0.87634	1.308000	0.44962	0.462000	0.41574	CCG	HPD	-	pirsf_4OHPhenylPyrv_dOase,tigrfam_4OHPhenylPyrv_dOase	ENSG00000158104		0.632	HPD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HPD	HGNC	protein_coding	OTTHUMT00000402184.1	72	0.00	0	G	NM_002150		122277893	122277893	-1	no_errors	ENST00000289004	ensembl	human	known	69_37n	missense	38	19.15	9	SNP	1.000	A
IFNA2	3440	genome.wustl.edu	37	9	21385064	21385064	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr9:21385064G>T	ENST00000380206.2	-	1	332	c.265C>A	c.(265-267)Ctc>Atc	p.L89I		NM_000605.3	NP_000596.2	P01563	IFNA2_HUMAN	interferon, alpha 2	89					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of gene expression (GO:0010629)|negative regulation of interleukin-13 secretion (GO:2000666)|negative regulation of interleukin-5 secretion (GO:2000663)|negative regulation of T cell differentiation (GO:0045581)|negative regulation of T-helper 2 cell cytokine production (GO:2000552)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral entry into host cell (GO:0046597)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	type I interferon receptor binding (GO:0005132)			breast(2)|large_intestine(4)|lung(6)|upper_aerodigestive_tract(1)	13				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.0173)		GTGCTGAAGAGATTGAAGATC	0.488																																						dbGAP											0													131.0	126.0	127.0					9																	21385064		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6506.1	9p22	2010-08-24			ENSG00000188379	ENSG00000188379		"""Interferons"""	5423	protein-coding gene	gene with protein product	"""alpha-2a interferon"", ""interferon alpha 2b"", ""interferon alpha A"""	147562				1385305	Standard	NM_000605		Approved	IFNA, IFN-alphaA	uc003zpb.3	P01563	OTTHUMG00000019674	ENST00000380206.2:c.265C>A	9.37:g.21385064G>T	ENSP00000369554:p.Leu89Ile		H2DF54|H2DF55|P01564|Q14606|Q6DJX8|Q96KI6	Missense_Mutation	SNP	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	p.L89I	ENST00000380206.2	37	c.265	CCDS6506.1	9	.	.	.	.	.	.	.	.	.	.	G	17.42	3.384955	0.61956	.	.	ENSG00000188379	ENST00000380206	T	0.54675	0.56	3.02	2.09	0.27110	.	0.261790	0.31589	N	0.007385	T	0.63319	0.2501	L	0.58669	1.825	0.23260	N	0.998028	P	0.47253	0.892	D	0.71870	0.975	T	0.51434	-0.8706	10	0.52906	T	0.07	.	7.4286	0.27113	0.0:0.0:0.53:0.47	.	89	Q6DJX8	.	I	89	ENSP00000369554:L89I	ENSP00000369554:L89I	L	-	1	0	IFNA2	21375064	0.356000	0.24930	0.094000	0.20943	0.924000	0.55760	0.405000	0.21015	0.448000	0.26722	0.484000	0.47621	CTC	IFNA2	-	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	ENSG00000188379		0.488	IFNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNA2	HGNC	protein_coding	OTTHUMT00000051903.1	179	0.00	0	G	NM_000605		21385064	21385064	-1	no_errors	ENST00000380206	ensembl	human	known	69_37n	missense	37	24.49	12	SNP	0.404	T
IKZF4	64375	genome.wustl.edu	37	12	56418866	56418866	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr12:56418866G>T	ENST00000262032.5	+	7	577	c.210G>T	c.(208-210)gaG>gaT	p.E70D	IKZF4_ENST00000547791.1_Missense_Mutation_p.E25D|IKZF4_ENST00000548601.1_3'UTR|IKZF4_ENST00000547167.1_Missense_Mutation_p.E70D|IKZF4_ENST00000431367.2_5'UTR			Q9H2S9	IKZF4_HUMAN	IKAROS family zinc finger 4 (Eos)	70					negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|lung(3)|ovary(1)|prostate(1)	8			UCEC - Uterine corpus endometrioid carcinoma (6;0.025)|OV - Ovarian serous cystadenocarcinoma(18;0.123)			TGGAGAAGGAGTTCCTCGGGG	0.562																																						dbGAP											0													19.0	23.0	22.0					12																	56418866		1841	4079	5920	-	-	-	SO:0001583	missense	0			AF230809	CCDS44917.1	12q13	2013-01-08	2006-08-25	2006-08-25		ENSG00000123411		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13179	protein-coding gene	gene with protein product		606239	"""zinc finger protein, subfamily 1A, 4 (Eos)"""	ZNFN1A4		10978333	Standard	NM_022465		Approved	Eos	uc001sjc.1	Q9H2S9		ENST00000262032.5:c.210G>T	12.37:g.56418866G>T	ENSP00000262032:p.Glu70Asp		Q96JP3	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E70D	ENST00000262032.5	37	c.210	CCDS44917.1	12	.	.	.	.	.	.	.	.	.	.	G	16.19	3.051845	0.55218	.	.	ENSG00000123411	ENST00000262032;ENST00000547167;ENST00000547791	T;T;T	0.09817	3.11;3.11;2.94	5.97	4.06	0.47325	.	.	.	.	.	T	0.05273	0.0140	N	0.08118	0	0.80722	D	1	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.06405	0.002;0.001;0.001	T	0.32534	-0.9903	9	0.38643	T	0.18	-16.7576	6.313	0.21174	0.1571:0.0:0.6946:0.1484	.	25;29;70	F8VPL6;Q9H2S9-2;Q9H2S9	.;.;IKZF4_HUMAN	D	70;70;25	ENSP00000262032:E70D;ENSP00000448419:E70D;ENSP00000450020:E25D	ENSP00000262032:E70D	E	+	3	2	IKZF4	54705133	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.762000	0.26503	1.498000	0.48600	0.655000	0.94253	GAG	IKZF4	-	NULL	ENSG00000123411		0.562	IKZF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IKZF4	HGNC	protein_coding	OTTHUMT00000407590.1	30	0.00	0	G	NM_022465		56418866	56418866	+1	no_errors	ENST00000262032	ensembl	human	known	69_37n	missense	16	20.00	4	SNP	1.000	T
IL12RB2	3595	genome.wustl.edu	37	1	67855764	67855764	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr1:67855764C>T	ENST00000262345.1	+	15	2639	c.1999C>T	c.(1999-2001)Cca>Tca	p.P667S	IL12RB2_ENST00000465396.1_3'UTR|IL12RB2_ENST00000544434.1_Missense_Mutation_p.P581S|IL12RB2_ENST00000541374.1_Intron|IL12RB2_ENST00000371000.1_Intron	NM_001559.2	NP_001550.1	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2	667					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma production (GO:0032609)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interferon-gamma production (GO:0032729)|response to lipopolysaccharide (GO:0032496)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(21)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	45						CAGAGAAATTCCAGATCCAGC	0.453																																						dbGAP											0													128.0	118.0	122.0					1																	67855764		2203	4300	6503	-	-	-	SO:0001583	missense	0			U64198	CCDS638.1, CCDS58006.1, CCDS58007.1, CCDS72805.1	1p31.3-p31.2	2014-07-15			ENSG00000081985	ENSG00000081985		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	5972	protein-coding gene	gene with protein product		601642				9284929, 8943050	Standard	NM_001559		Approved		uc001ddu.3	Q99665	OTTHUMG00000009094	ENST00000262345.1:c.1999C>T	1.37:g.67855764C>T	ENSP00000262345:p.Pro667Ser		B1AN98|B7ZKL9|F5H7L6|Q2M3V3	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_IgC2-like_lig-bd,pfam_IL6_recept-bd,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.P667S	ENST00000262345.1	37	c.1999	CCDS638.1	1	.	.	.	.	.	.	.	.	.	.	C	16.62	3.174565	0.57692	.	.	ENSG00000081985	ENST00000262345;ENST00000544434	D;D	0.90133	-2.62;-1.94	5.43	5.43	0.79202	.	0.047569	0.85682	N	0.000000	D	0.93943	0.8061	M	0.69823	2.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.94080	0.7343	10	0.66056	D	0.02	-18.8915	15.1344	0.72552	0.0:1.0:0.0:0.0	.	581;667	F5H7L6;Q99665	.;I12R2_HUMAN	S	667;581	ENSP00000262345:P667S;ENSP00000442443:P581S	ENSP00000262345:P667S	P	+	1	0	IL12RB2	67628352	1.000000	0.71417	1.000000	0.80357	0.776000	0.43924	3.731000	0.55013	2.713000	0.92767	0.655000	0.94253	CCA	IL12RB2	-	NULL	ENSG00000081985		0.453	IL12RB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL12RB2	HGNC	protein_coding	OTTHUMT00000025202.2	117	0.00	0	C	NM_001559		67855764	67855764	+1	no_errors	ENST00000262345	ensembl	human	known	69_37n	missense	38	13.64	6	SNP	1.000	T
IRAK4	51135	genome.wustl.edu	37	12	44176271	44176271	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr12:44176271C>A	ENST00000448290.2	+	9	1174	c.1103C>A	c.(1102-1104)tCt>tAt	p.S368Y	IRAK4_ENST00000431837.1_Missense_Mutation_p.S244Y|IRAK4_ENST00000440781.2_Missense_Mutation_p.S244Y|IRAK4_ENST00000551736.1_Missense_Mutation_p.S368Y	NM_016123.3	NP_057207.2	Q9NWZ3	IRAK4_HUMAN	interleukin-1 receptor-associated kinase 4	368	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine production (GO:0001816)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)					all_cancers(12;0.00149)	Lung NSC(34;0.0804)|all_lung(34;0.181)		GBM - Glioblastoma multiforme(48;0.04)		ACACCCAAATCTGATATTTAC	0.348																																						dbGAP											0													68.0	67.0	67.0					12																	44176271		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF155118	CCDS8744.1, CCDS44862.1	12q12	2014-09-17				ENSG00000198001			17967	protein-coding gene	gene with protein product		606883				3772297, 10508479	Standard	NM_001114182		Approved	NY-REN-64	uc001rnt.3	Q9NWZ3		ENST00000448290.2:c.1103C>A	12.37:g.44176271C>A	ENSP00000390651:p.Ser368Tyr		Q69FE1|Q8TDF7|Q9Y589	Missense_Mutation	SNP	pirsf_Interleukin-1_rcpt-assoc_kin4,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_DEATH-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S368Y	ENST00000448290.2	37	c.1103	CCDS8744.1	12	.	.	.	.	.	.	.	.	.	.	C	27.8	4.864060	0.91511	.	.	ENSG00000198001	ENST00000440781;ENST00000431837;ENST00000448290;ENST00000551736	D;D;D;D	0.94613	-3.47;-3.47;-3.47;-3.47	5.62	5.62	0.85841	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.97321	0.9124	M	0.79258	2.445	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97639	1.0147	10	0.87932	D	0	-21.7217	19.6622	0.95877	0.0:1.0:0.0:0.0	.	368	Q9NWZ3	IRAK4_HUMAN	Y	244;244;368;368	ENSP00000408734:S244Y;ENSP00000390327:S244Y;ENSP00000390651:S368Y;ENSP00000446490:S368Y	ENSP00000390327:S244Y	S	+	2	0	IRAK4	42462538	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.637000	0.89404	0.585000	0.79938	TCT	IRAK4	-	pirsf_Interleukin-1_rcpt-assoc_kin4,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000198001		0.348	IRAK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRAK4	HGNC	protein_coding	OTTHUMT00000403947.1	80	0.00	0	C			44176271	44176271	+1	no_errors	ENST00000448290	ensembl	human	known	69_37n	missense	26	33.33	13	SNP	1.000	A
ISYNA1	51477	genome.wustl.edu	37	19	18545910	18545910	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr19:18545910G>A	ENST00000338128.8	-	11	1707	c.1490C>T	c.(1489-1491)cCg>cTg	p.P497L	ISYNA1_ENST00000545187.1_Missense_Mutation_p.P347L|ISYNA1_ENST00000578963.1_Missense_Mutation_p.P369L|ISYNA1_ENST00000457269.4_Missense_Mutation_p.P443L|ISYNA1_ENST00000317018.6_Missense_Mutation_p.P295L	NM_001170938.1|NM_016368.4	NP_001164409.1|NP_057452.1	Q9NPH2	INO1_HUMAN	inositol-3-phosphate synthase 1	497					inositol biosynthetic process (GO:0006021)|inositol phosphate metabolic process (GO:0043647)|phospholipid biosynthetic process (GO:0008654)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	inositol-3-phosphate synthase activity (GO:0004512)			breast(1)|endometrium(1)|kidney(2)|lung(4)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	12						GTTCTGTGGCGGGAGCCCCAC	0.627																																						dbGAP											0													41.0	41.0	41.0					19																	18545910		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS12379.1, CCDS54234.1, CCDS62603.1	19p13.11	2014-09-04			ENSG00000105655	ENSG00000105655	5.5.1.4		29821	protein-coding gene	gene with protein product	"""myo-inositol 1-phosphate synthase"""	611670				15024000, 12941308	Standard	NM_016368		Approved	Ino1, INOS, IPS	uc002njd.2	Q9NPH2	OTTHUMG00000179027	ENST00000338128.8:c.1490C>T	19.37:g.18545910G>A	ENSP00000337746:p.Pro497Leu		B3KRT1|G5E9U0|Q6NXT5|Q7Z525|Q9BT65|Q9H2Y2|Q9NSU0|Q9NVW7	Missense_Mutation	SNP	pfam_Myo-inos-1-P_Synthase,pfam_Myo-inos-1-P_Synthase_GAPDH,pirsf_Myo-inos-1-P_Synthase	p.P497L	ENST00000338128.8	37	c.1490	CCDS12379.1	19	.	.	.	.	.	.	.	.	.	.	G	20.3	3.968654	0.74131	.	.	ENSG00000105655	ENST00000338128;ENST00000457269;ENST00000545187;ENST00000317018	.	.	.	4.09	4.09	0.47781	.	0.068022	0.64402	D	0.000014	T	0.67353	0.2884	L	0.61218	1.895	0.80722	D	1	D;D;D;D	0.76494	0.993;0.99;0.999;0.983	P;P;P;P	0.56343	0.573;0.746;0.796;0.574	T	0.72603	-0.4243	9	0.72032	D	0.01	-35.9399	14.1689	0.65495	0.0:0.0:1.0:0.0	.	295;443;497;347	B7Z3K3;G5E9U0;Q9NPH2;G3V1R9	.;.;INO1_HUMAN;.	L	497;443;347;295	.	ENSP00000315147:P295L	P	-	2	0	ISYNA1	18406910	0.967000	0.33354	0.917000	0.36280	0.463000	0.32649	2.472000	0.45136	2.023000	0.59567	0.561000	0.74099	CCG	ISYNA1	-	pirsf_Myo-inos-1-P_Synthase	ENSG00000105655		0.627	ISYNA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ISYNA1	HGNC	protein_coding	OTTHUMT00000444469.2	32	0.00	0	G	NM_016368		18545910	18545910	-1	no_errors	ENST00000338128	ensembl	human	known	69_37n	missense	21	19.23	5	SNP	0.996	A
KDM6A	7403	genome.wustl.edu	37	X	44913106	44913106	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chrX:44913106G>C	ENST00000377967.4	+	10	822	c.781G>C	c.(781-783)Gat>Cat	p.D261H	KDM6A_ENST00000382899.4_Missense_Mutation_p.D261H|KDM6A_ENST00000543216.1_Missense_Mutation_p.D261H|KDM6A_ENST00000536777.1_Missense_Mutation_p.D261H	NM_021140.2	NP_066963.2	O15550	KDM6A_HUMAN	lysine (K)-specific demethylase 6A	261	Interaction with SUPT6H. {ECO:0000250}.				canonical Wnt signaling pathway (GO:0060070)|heart morphogenesis (GO:0003007)|histone H3-K4 methylation (GO:0051568)|in utero embryonic development (GO:0001701)|mesodermal cell differentiation (GO:0048333)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|regulation of gene expression (GO:0010468)|respiratory system process (GO:0003016)|somite rostral/caudal axis specification (GO:0032525)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.0?(6)|p.0(4)		NS(1)|breast(7)|central_nervous_system(27)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(24)|kidney(24)|large_intestine(9)|liver(1)|lung(21)|oesophagus(11)|pancreas(2)|prostate(5)|skin(1)|soft_tissue(1)|urinary_tract(29)	170						TCTCCTGGGAGATAAAGCCAC	0.378			"""D, N, F, S"""		"""renal, oesophageal SCC, MM"""																																Colon(129;1273 1667 15230 27352 52914)	dbGAP		Rec	yes		X	Xp11.2	7403	"""lysine (K)-specific demethylase 6A, UTX"""		"""E, L"""	10	Whole gene deletion(6)|No detectable mRNA/protein(4)	haematopoietic_and_lymphoid_tissue(4)|oesophagus(2)|breast(2)|pancreas(2)											147.0	119.0	129.0					X																	44913106		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF000992	CCDS14265.1	Xp11.2	2014-09-17	2009-04-17	2009-04-17	ENSG00000147050	ENSG00000147050		"""Chromatin-modifying enzymes / K-demethylases"", ""Tetratricopeptide (TTC) repeat domain containing"""	12637	protein-coding gene	gene with protein product		300128	"""ubiquitously transcribed tetratricopeptide repeat, X chromosome"""	UTX		9499428, 9381176	Standard	XM_005272655		Approved		uc004dge.4	O15550	OTTHUMG00000021402	ENST00000377967.4:c.781G>C	X.37:g.44913106G>C	ENSP00000367203:p.Asp261His		Q52LL9|Q5JVQ7	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_TPR-1,smart_TPR_repeat,smart_JmjC_dom,pfscan_JmjC_dom,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.D261H	ENST00000377967.4	37	c.781	CCDS14265.1	X	.	.	.	.	.	.	.	.	.	.	G	24.0	4.485030	0.84854	.	.	ENSG00000147050	ENST00000377967;ENST00000536777;ENST00000382899;ENST00000543216	T;T;T;T	0.28895	1.59;1.59;2.05;1.59	5.43	5.43	0.79202	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.58552	0.2130	M	0.76328	2.33	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;0.999;0.999;0.999;0.998	D;D;D;D;D	0.85130	0.997;0.988;0.957;0.995;0.957	T	0.62671	-0.6805	10	0.87932	D	0	-17.5506	18.5475	0.91053	0.0:0.0:1.0:0.0	.	261;261;261;261;261	F8W8R6;F5H6S1;B7ZKN5;B4E253;O15550	.;.;.;.;KDM6A_HUMAN	H	261	ENSP00000367203:D261H;ENSP00000437405:D261H;ENSP00000372355:D261H;ENSP00000443078:D261H	ENSP00000367203:D261H	D	+	1	0	KDM6A	44798050	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.420000	0.97426	2.410000	0.81850	0.538000	0.68166	GAT	KDM6A	-	pfscan_TPR-contain_dom	ENSG00000147050		0.378	KDM6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM6A	HGNC	protein_coding	OTTHUMT00000056324.1	165	0.00	0	G	NM_021140		44913106	44913106	+1	no_errors	ENST00000382899	ensembl	human	known	69_37n	missense	33	23.26	10	SNP	1.000	C
KIAA0232	9778	genome.wustl.edu	37	4	6863768	6863768	+	Silent	SNP	A	A	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr4:6863768A>T	ENST00000307659.5	+	7	2114	c.1659A>T	c.(1657-1659)atA>atT	p.I553I	KIAA0232_ENST00000425103.1_Silent_p.I553I	NM_014743.2	NP_055558.2	Q92628	K0232_HUMAN	KIAA0232	553							ATP binding (GO:0005524)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(12)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	41						AATGTTGCATAGTGTTAGATG	0.453																																						dbGAP											0													164.0	158.0	160.0					4																	6863768		1987	4148	6135	-	-	-	SO:0001819	synonymous_variant	0			D86985	CCDS43209.1	4p16.1	2012-11-29			ENSG00000170871	ENSG00000170871			28992	protein-coding gene	gene with protein product						9039502	Standard	NM_014743		Approved		uc003gjq.4	Q92628	OTTHUMG00000160072	ENST00000307659.5:c.1659A>T	4.37:g.6863768A>T			A7E2D2	Silent	SNP	NULL	p.I553	ENST00000307659.5	37	c.1659	CCDS43209.1	4																																																																																			KIAA0232	-	NULL	ENSG00000170871		0.453	KIAA0232-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0232	HGNC	protein_coding	OTTHUMT00000359102.2	177	0.00	0	A	NM_014743		6863768	6863768	+1	no_errors	ENST00000307659	ensembl	human	known	69_37n	silent	55	17.91	12	SNP	1.000	T
KIAA1549L	25758	genome.wustl.edu	37	11	33581421	33581421	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr11:33581421T>C	ENST00000321505.4	+	6	3271	c.3091T>C	c.(3091-3093)Ttc>Ctc	p.F1031L	KIAA1549L_ENST00000389726.3_Missense_Mutation_p.F1037L|KIAA1549L_ENST00000265654.5_Missense_Mutation_p.F1037L			Q6ZVL6	K154L_HUMAN	KIAA1549-like	1031						integral component of membrane (GO:0016021)											GCTGGTGGGATTCTACCTCAC	0.577																																						dbGAP											0													120.0	127.0	124.0					11																	33581421		2110	4220	6330	-	-	-	SO:0001583	missense	0			U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.3091T>C	11.37:g.33581421T>C	ENSP00000315295:p.Phe1031Leu		B0QYU0	Missense_Mutation	SNP	NULL	p.F1037L	ENST00000321505.4	37	c.3109	CCDS44565.2	11	.	.	.	.	.	.	.	.	.	.	T	27.0	4.792319	0.90453	.	.	ENSG00000110427	ENST00000321505;ENST00000389726;ENST00000265654;ENST00000536568	.	.	.	5.45	5.45	0.79879	.	0.049279	0.85682	D	0.000000	T	0.77738	0.4175	M	0.68593	2.085	0.37399	D	0.912762	D;D	0.89917	0.999;1.0	D;D	0.87578	0.985;0.998	T	0.82768	-0.0294	9	0.72032	D	0.01	-22.6107	15.8	0.78447	0.0:0.0:0.0:1.0	.	1037;1037	E9PAT2;Q6ZVL6-2	.;.	L	1031;1037;1037;870	.	ENSP00000265654:F1037L	F	+	1	0	C11orf41	33537997	1.000000	0.71417	0.986000	0.45419	0.529000	0.34654	7.639000	0.83342	2.192000	0.70111	0.467000	0.42956	TTC	KIAA1549L	-	NULL	ENSG00000110427		0.577	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1549L	HGNC	protein_coding	OTTHUMT00000317998.1	47	0.00	0	T	NM_012194		33581421	33581421	+1	no_errors	ENST00000389726	ensembl	human	known	69_37n	missense	28	22.22	8	SNP	1.000	C
KIDINS220	57498	genome.wustl.edu	37	2	8919137	8919137	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr2:8919137G>A	ENST00000256707.3	-	19	2684	c.2503C>T	c.(2503-2505)Cgc>Tgc	p.R835C	KIDINS220_ENST00000427284.1_Missense_Mutation_p.R835C|KIDINS220_ENST00000319688.5_Missense_Mutation_p.R836C|KIDINS220_ENST00000473731.1_Missense_Mutation_p.R835C|KIDINS220_ENST00000418530.1_Missense_Mutation_p.R793C	NM_020738.2	NP_065789.1	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate, 220kDa	835	KAP NTPase.				activation of MAPKK activity (GO:0000186)|cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|dendrite morphogenesis (GO:0048813)|in utero embryonic development (GO:0001701)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of neuron projection development (GO:0010976)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|protein complex (GO:0043234)	PDZ domain binding (GO:0030165)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(25)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	60	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					ACTATGTTGCGCATGTAGTCA	0.403																																						dbGAP											0													250.0	224.0	232.0					2																	8919137		1894	4122	6016	-	-	-	SO:0001583	missense	0			AK025528	CCDS42650.1	2p24	2013-01-10			ENSG00000134313	ENSG00000134313		"""Ankyrin repeat domain containing"""	29508	protein-coding gene	gene with protein product	"""ankyrin repeat-rich membrane-spanning protein"""	615759				10998417, 10574462	Standard	NM_020738		Approved	ARMS	uc002qzc.2	Q9ULH0	OTTHUMG00000151658	ENST00000256707.3:c.2503C>T	2.37:g.8919137G>A	ENSP00000256707:p.Arg835Cys		A1L4N4|Q4VC08|Q6MZU2|Q9H889|Q9H9E4|Q9NT37|Q9UF42	Missense_Mutation	SNP	pfam_KAP_NTPase,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.R835C	ENST00000256707.3	37	c.2503	CCDS42650.1	2	.	.	.	.	.	.	.	.	.	.	G	16.77	3.215170	0.58452	.	.	ENSG00000134313	ENST00000496383;ENST00000541927;ENST00000256707;ENST00000427284;ENST00000418530;ENST00000473731;ENST00000489024;ENST00000319688	T;T;T;T;T;T;T	0.34275	1.37;1.37;1.37;1.37;1.37;1.37;1.37	5.64	5.64	0.86602	KAP P-loop (1);	0.000000	0.85682	D	0.000000	T	0.62109	0.2401	M	0.77820	2.39	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;0.996;0.999;1.0	T	0.64676	-0.6351	10	0.87932	D	0	.	15.6595	0.77174	0.0:0.0:0.8623:0.1377	.	836;836;793;835	B4DK94;E9PH70;Q9ULH0-2;Q9ULH0	.;.;.;KDIS_HUMAN	C	582;519;835;835;793;835;836;836	ENSP00000420364:R582C;ENSP00000256707:R835C;ENSP00000411849:R835C;ENSP00000414923:R793C;ENSP00000418974:R835C;ENSP00000419964:R836C;ENSP00000319947:R836C	ENSP00000256707:R835C	R	-	1	0	KIDINS220	8836588	1.000000	0.71417	1.000000	0.80357	0.328000	0.28507	4.165000	0.58196	2.820000	0.97059	0.650000	0.86243	CGC	KIDINS220	-	pfam_KAP_NTPase	ENSG00000134313		0.403	KIDINS220-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIDINS220	HGNC	protein_coding	OTTHUMT00000323408.2	208	0.00	0	G	NM_020738		8919137	8919137	-1	no_errors	ENST00000256707	ensembl	human	known	69_37n	missense	70	20.22	18	SNP	1.000	A
KIF16B	55614	genome.wustl.edu	37	20	16354954	16354954	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr20:16354954T>C	ENST00000354981.2	-	20	3455	c.3298A>G	c.(3298-3300)Agc>Ggc	p.S1100G	KIF16B_ENST00000378003.2_Missense_Mutation_p.S326G|KIF16B_ENST00000408042.1_Missense_Mutation_p.S1100G|KIF16B_ENST00000355755.3_Missense_Mutation_p.S1100G	NM_001199865.1|NM_024704.4	NP_001186794.1|NP_078980.3	Q96L93	KI16B_HUMAN	kinesin family member 16B	1100				S -> N (in Ref. 2; CAI46105). {ECO:0000305}.	ATP catabolic process (GO:0006200)|early endosome to late endosome transport (GO:0045022)|endoderm development (GO:0007492)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|formation of primary germ layer (GO:0001704)|Golgi to endosome transport (GO:0006895)|microtubule-based movement (GO:0007018)|receptor catabolic process (GO:0032801)|regulation of receptor recycling (GO:0001919)	early endosome (GO:0005769)|endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(24)|ovary(1)|prostate(15)|skin(3)|upper_aerodigestive_tract(2)	74						ACTGGCAAGCTGGAAGAAGCC	0.458																																						dbGAP											0													121.0	104.0	110.0					20																	16354954		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000142	CCDS13122.1, CCDS56178.1	20p11.23	2008-03-03	2008-03-03	2008-03-03	ENSG00000089177	ENSG00000089177		"""Kinesins"""	15869	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 23"""	C20orf23		16084724, 16782399	Standard	NM_024704		Approved	FLJ20135, dJ971B4.1, SNX23	uc010gci.2	Q96L93	OTTHUMG00000031927	ENST00000354981.2:c.3298A>G	20.37:g.16354954T>C	ENSP00000347076:p.Ser1100Gly		A6NKJ9|A7E2A8|B1AKG3|B1AKT7|C9JDN5|C9JI52|C9JSM8|C9JWJ7|Q2TBF5|Q5HYC0|Q5HYK1|Q5JWW3|Q5TFK5|Q86VL9|Q86YS5|Q8IYU0|Q9BQJ8|Q9BQM0|Q9BQM1|Q9BQM5|Q9H5U0|Q9HCI2|Q9NXN9	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.S1100G	ENST00000354981.2	37	c.3298	CCDS13122.1	20	.	.	.	.	.	.	.	.	.	.	T	12.30	1.896818	0.33535	.	.	ENSG00000089177	ENST00000354981;ENST00000355755;ENST00000377997;ENST00000378003;ENST00000408042	T;T;T;T	0.71222	-0.51;-0.54;2.44;-0.55	5.79	-4.51	0.03483	.	0.583340	0.19027	N	0.124643	T	0.50188	0.1601	L	0.44542	1.39	0.09310	N	1	B;B	0.09022	0.002;0.0	B;B	0.06405	0.002;0.0	T	0.26608	-1.0098	10	0.30854	T	0.27	.	3.4856	0.07618	0.0994:0.3065:0.1021:0.492	.	1100;1100	Q96L93-2;Q96L93	.;KI16B_HUMAN	G	1100;1100;944;326;1100	ENSP00000347076:S1100G;ENSP00000347995:S1100G;ENSP00000367242:S326G;ENSP00000384164:S1100G	ENSP00000347076:S1100G	S	-	1	0	KIF16B	16302954	0.013000	0.17824	0.000000	0.03702	0.023000	0.10783	-0.072000	0.11486	-0.437000	0.07243	-0.304000	0.09214	AGC	KIF16B	-	NULL	ENSG00000089177		0.458	KIF16B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF16B	HGNC	protein_coding	OTTHUMT00000078104.2	98	0.00	0	T	NM_017683		16354954	16354954	-1	no_errors	ENST00000408042	ensembl	human	known	69_37n	missense	53	20.90	14	SNP	0.001	C
KLHL10	317719	genome.wustl.edu	37	17	40004264	40004264	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr17:40004264C>G	ENST00000293303.4	+	5	1685	c.1532C>G	c.(1531-1533)cCc>cGc	p.P511R	RP11-156E6.1_ENST00000560400.1_RNA	NM_152467.3	NP_689680.2	Q6JEL2	KLH10_HUMAN	kelch-like family member 10	511					cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia morphogenesis (GO:0048808)|male gonad development (GO:0008584)|protein ubiquitination (GO:0016567)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	26		Breast(137;0.000162)				CGCACAATCCCCACTATGTTT	0.473																																						dbGAP											0													134.0	128.0	130.0					17																	40004264		1965	4148	6113	-	-	-	SO:0001583	missense	0			AK057224	CCDS42340.1	17q21.2	2013-01-30	2013-01-30		ENSG00000161594	ENSG00000161594		"""Kelch-like"", ""BTB/POZ domain containing"""	18829	protein-coding gene	gene with protein product		608778	"""kelch-like 10 (Drosophila)"""				Standard	NM_152467		Approved	FLJ32662	uc010cxr.3	Q6JEL2	OTTHUMG00000152510	ENST00000293303.4:c.1532C>G	17.37:g.40004264C>G	ENSP00000293303:p.Pro511Arg		Q6NW28|Q96MC0	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.P511R	ENST00000293303.4	37	c.1532	CCDS42340.1	17	.	.	.	.	.	.	.	.	.	.	C	15.90	2.970851	0.53614	.	.	ENSG00000161594	ENST00000293303	D	0.83335	-1.71	5.98	5.98	0.97165	Galactose oxidase, beta-propeller (1);	0.100830	0.64402	D	0.000002	D	0.82967	0.5152	M	0.62723	1.935	0.58432	D	0.999998	P	0.42409	0.779	B	0.40940	0.344	T	0.81906	-0.0718	9	.	.	.	.	19.0158	0.92894	0.0:1.0:0.0:0.0	.	511	Q6JEL2	KLH10_HUMAN	R	511	ENSP00000293303:P511R	.	P	+	2	0	KLHL10	37257790	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.551000	0.60740	2.838000	0.97847	0.591000	0.81541	CCC	KLHL10	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000161594		0.473	KLHL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL10	HGNC	protein_coding	OTTHUMT00000326535.1	137	0.00	0	C	NM_152467		40004264	40004264	+1	no_errors	ENST00000293303	ensembl	human	known	69_37n	missense	45	11.76	6	SNP	1.000	G
KRTAP10-5	386680	genome.wustl.edu	37	21	45999699	45999699	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr21:45999699G>A	ENST00000400372.1	-	1	782	c.757C>T	c.(757-759)Cgc>Tgc	p.R253C	TSPEAR_ENST00000323084.4_Intron	NM_198694.2	NP_941967.2	P60370	KR105_HUMAN	keratin associated protein 10-5	253	22 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				endometrium(2)|kidney(1)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	14						GAGGCCGGGCGGCAGCAGCTG	0.706																																						dbGAP											0													28.0	38.0	35.0					21																	45999699		2200	4291	6491	-	-	-	SO:0001583	missense	0			AJ566384	CCDS42958.1	21q22.3	2007-10-05			ENSG00000241123	ENSG00000241123		"""Keratin associated proteins"""	22969	protein-coding gene	gene with protein product				KRTAP18-5			Standard	NM_198694		Approved	KAP10.5, KAP18.5	uc002zfl.1	P60370	OTTHUMG00000057638	ENST00000400372.1:c.757C>T	21.37:g.45999699G>A	ENSP00000383223:p.Arg253Cys		Q0VAR7|Q0VAR8|Q70LJ3	Missense_Mutation	SNP	NULL	p.R253C	ENST00000400372.1	37	c.757	CCDS42958.1	21	.	.	.	.	.	.	.	.	.	.	g	9.347	1.064624	0.20067	.	.	ENSG00000241123	ENST00000400372	T	0.00882	5.58	3.26	1.33	0.21861	.	.	.	.	.	T	0.01592	0.0051	M	0.67700	2.07	0.35177	D	0.772085	P	0.42357	0.777	P	0.44732	0.459	T	0.56195	-0.8019	9	0.52906	T	0.07	.	3.5659	0.07900	0.25:0.2136:0.5364:0.0	.	253	P60370	KR105_HUMAN	C	253	ENSP00000383223:R253C	ENSP00000383223:R253C	R	-	1	0	KRTAP10-5	44824127	0.832000	0.29368	0.014000	0.15608	0.025000	0.11179	1.153000	0.31676	0.189000	0.20188	0.455000	0.32223	CGC	KRTAP10-5	-	NULL	ENSG00000241123		0.706	KRTAP10-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-5	HGNC	protein_coding	OTTHUMT00000128042.1	52	0.00	0	G			45999699	45999699	-1	no_errors	ENST00000400372	ensembl	human	known	69_37n	missense	25	37.50	15	SNP	0.881	A
LETM1	3954	genome.wustl.edu	37	4	1834627	1834627	+	Silent	SNP	A	A	G			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr4:1834627A>G	ENST00000302787.2	-	6	1220	c.924T>C	c.(922-924)ttT>ttC	p.F308F		NM_012318.2	NP_036450.1	O95202	LETM1_HUMAN	leucine zipper-EF-hand containing transmembrane protein 1	308	LETM1.				cristae formation (GO:0042407)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(2)|large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	13			all cancers(2;0.00756)|OV - Ovarian serous cystadenocarcinoma(23;0.00989)|Epithelial(3;0.0141)			ATAATTTGGAAAAACGCATGA	0.597																																						dbGAP											0													101.0	89.0	93.0					4																	1834627		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF061025	CCDS3355.1	4p16.3	2013-01-10			ENSG00000168924	ENSG00000168924		"""EF-hand domain containing"""	6556	protein-coding gene	gene with protein product	"""Mdm38 homolog (yeast)"""	604407				10486213	Standard	NM_012318		Approved		uc003gdv.3	O95202	OTTHUMG00000121149	ENST00000302787.2:c.924T>C	4.37:g.1834627A>G			B4DED2|Q9UF65	Silent	SNP	pfam_LETM1,pfscan_EF_HAND_2	p.F308	ENST00000302787.2	37	c.924	CCDS3355.1	4																																																																																			LETM1	-	pfam_LETM1	ENSG00000168924		0.597	LETM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LETM1	HGNC	protein_coding	OTTHUMT00000241634.1	61	0.00	0	A			1834627	1834627	-1	no_errors	ENST00000302787	ensembl	human	known	69_37n	silent	31	26.19	11	SNP	1.000	G
LIPI	149998	genome.wustl.edu	37	21	15554120	15554120	+	Missense_Mutation	SNP	G	G	T	rs570772306		TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr21:15554120G>T	ENST00000536861.1	-	4	601	c.602C>A	c.(601-603)aCg>aAg	p.T201K	LIPI_ENST00000344577.2_Missense_Mutation_p.T222K			Q6XZB0	LIPI_HUMAN	lipase, member I	201					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|phospholipase activity (GO:0004620)			endometrium(1)|kidney(13)|large_intestine(9)|liver(3)|lung(24)|ovary(3)|urinary_tract(1)	54				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)		CTTTGCATCCGTGTAATCTAA	0.383																																						dbGAP											0													105.0	99.0	101.0					21																	15554120		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC028732	CCDS13564.1	21q11.2	2012-07-31			ENSG00000188992	ENSG00000188992			18821	protein-coding gene	gene with protein product	"""membrane-associated phospholipase A1 beta"", ""cancer/testis antigen 17"""	609252				12719377	Standard	XM_005260924		Approved	PRED5, LPDL, CT17, mPA-PLA1beta, PLA1C	uc002yjm.3	Q6XZB0	OTTHUMG00000074258	ENST00000536861.1:c.602C>A	21.37:g.15554120G>T	ENSP00000440381:p.Thr201Lys		G1JSG3|G1JSG4|G1JSG5|G1JSG6|G1JSG7|G1JSG8|G1JSG9	Missense_Mutation	SNP	pfam_Lipase_N,pirsf_Lipoprotein_lipase_LIPH,prints_Lipase	p.T222K	ENST00000536861.1	37	c.665		21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.56|14.56	2.573049|2.573049	0.45902|0.45902	.|.	.|.	ENSG00000188992|ENSG00000188992	ENST00000400211|ENST00000344577;ENST00000536861;ENST00000382981	.|D;D	.|0.90261	.|-2.64;-2.64	5.46|5.46	4.58|4.58	0.56647|0.56647	.|.	.|0.104892	.|0.64402	.|D	.|0.000003	D|D	0.93749|0.93749	0.8002|0.8002	M|M	0.74467|0.74467	2.265|2.265	0.33700|0.33700	D|D	0.614415|0.614415	.|D;P	.|0.53885	.|0.963;0.937	.|P;P	.|0.57425	.|0.82;0.735	D|D	0.96464|0.96464	0.9343|0.9343	5|10	.|0.51188	.|T	.|0.08	.|.	15.8202|15.8202	0.78633|0.78633	0.0:0.0:0.8627:0.1373|0.0:0.0:0.8627:0.1373	.|.	.|201;222	.|G1JSG6;Q6XZB0-2	.|.;.	Q|K	80|222;201;96	.|ENSP00000343331:T222K;ENSP00000440381:T201K	.|ENSP00000343331:T222K	H|T	-|-	3|2	2|0	LIPI|LIPI	14475991|14475991	0.998000|0.998000	0.40836|0.40836	0.985000|0.985000	0.45067|0.45067	0.062000|0.062000	0.15995|0.15995	3.093000|3.093000	0.50217|0.50217	1.465000|1.465000	0.48006|0.48006	-0.122000|-0.122000	0.15005|0.15005	CAC|ACG	LIPI	-	pfam_Lipase_N,pirsf_Lipoprotein_lipase_LIPH	ENSG00000188992		0.383	LIPI-201	KNOWN	basic|appris_candidate	protein_coding	LIPI	HGNC	protein_coding		141	0.00	0	G	NM_198996		15554120	15554120	-1	no_errors	ENST00000344577	ensembl	human	known	69_37n	missense	25	37.50	15	SNP	0.998	T
LPIN2	9663	genome.wustl.edu	37	18	2937960	2937960	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr18:2937960C>G	ENST00000261596.4	-	7	1136	c.898G>C	c.(898-900)Gta>Cta	p.V300L		NM_014646.2	NP_055461.1	Q92539	LPIN2_HUMAN	lipin 2	300					cellular lipid metabolic process (GO:0044255)|dephosphorylation (GO:0016311)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)|transcription coactivator activity (GO:0003713)			autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	29				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		CTGGGAATTACCCGAAAATGA	0.423																																						dbGAP											0													156.0	147.0	150.0					18																	2937960		2203	4300	6503	-	-	-	SO:0001583	missense	0			D87436	CCDS11829.1	18p	2014-09-17			ENSG00000101577	ENSG00000101577			14450	protein-coding gene	gene with protein product		605519				11138012, 9039502	Standard	NM_014646		Approved	KIAA0249	uc002klo.3	Q92539	OTTHUMG00000131508	ENST00000261596.4:c.898G>C	18.37:g.2937960C>G	ENSP00000261596:p.Val300Leu		A7MD25|D3DUH3	Missense_Mutation	SNP	pfam_LNS2,pfam_Lipin_N,superfamily_HAD-like_dom,smart_LNS2	p.V300L	ENST00000261596.4	37	c.898	CCDS11829.1	18	.	.	.	.	.	.	.	.	.	.	C	18.70	3.680599	0.68042	.	.	ENSG00000101577	ENST00000261596	T	0.81247	-1.47	5.86	5.86	0.93980	.	0.234329	0.44097	D	0.000500	T	0.80093	0.4560	L	0.61387	1.9	0.80722	D	1	P	0.36162	0.54	B	0.37387	0.248	T	0.76913	-0.2783	10	0.27082	T	0.32	.	18.367	0.90394	0.0:1.0:0.0:0.0	.	300	Q92539	LPIN2_HUMAN	L	300	ENSP00000261596:V300L	ENSP00000261596:V300L	V	-	1	0	LPIN2	2927960	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.670000	0.74467	2.775000	0.95449	0.655000	0.94253	GTA	LPIN2	-	NULL	ENSG00000101577		0.423	LPIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPIN2	HGNC	protein_coding	OTTHUMT00000254363.2	153	0.00	0	C	NM_014646		2937960	2937960	-1	no_errors	ENST00000261596	ensembl	human	known	69_37n	missense	36	38.98	23	SNP	1.000	G
LRTM2	654429	genome.wustl.edu	37	12	1940299	1940299	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr12:1940299C>A	ENST00000543818.1	+	4	1108	c.266C>A	c.(265-267)gCc>gAc	p.A89D	CACNA2D4_ENST00000588077.1_Intron|CACNA2D4_ENST00000585732.1_Intron|LRTM2_ENST00000535041.1_Missense_Mutation_p.A89D|LRTM2_ENST00000543730.1_Intron|CACNA2D4_ENST00000382722.5_Intron|LRTM2_ENST00000299194.1_Missense_Mutation_p.A89D|CACNA2D4_ENST00000586184.1_Intron|CACNA2D4_ENST00000587995.1_Intron|CACNA2D4_ENST00000585708.1_Intron	NM_001039029.2|NM_001163925.1|NM_001163926.1	NP_001034118.1|NP_001157397.1|NP_001157398.1	Q8N967	LRTM2_HUMAN	leucine-rich repeats and transmembrane domains 2	89						integral component of membrane (GO:0016021)				NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	20	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.000834)			TGGGCTTTCGCCAACCTCTCC	0.622																																						dbGAP											0													57.0	65.0	62.0					12																	1940299		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095610	CCDS31726.1	12p13.33	2008-02-05				ENSG00000166159			32443	protein-coding gene	gene with protein product							Standard	NM_001039029		Approved		uc010sdx.1	Q8N967		ENST00000543818.1:c.266C>A	12.37:g.1940299C>A	ENSP00000446278:p.Ala89Asp		A7E2U6	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.A89D	ENST00000543818.1	37	c.266	CCDS31726.1	12	.	.	.	.	.	.	.	.	.	.	C	11.89	1.774424	0.31411	.	.	ENSG00000166159	ENST00000543818;ENST00000299194;ENST00000535041;ENST00000546167;ENST00000543694	T;T;T;D;D	0.83992	0.62;0.62;0.62;-1.79;-1.79	5.04	5.04	0.67666	.	0.205273	0.51477	D	0.000087	T	0.77505	0.4140	L	0.37697	1.125	0.50467	D	0.999879	B	0.27380	0.177	B	0.26094	0.066	T	0.73483	-0.3968	10	0.30078	T	0.28	.	18.3994	0.90511	0.0:1.0:0.0:0.0	.	89	Q8N967	LRTM2_HUMAN	D	89	ENSP00000446278:A89D;ENSP00000299194:A89D;ENSP00000444737:A89D;ENSP00000438678:A89D;ENSP00000444104:A89D	ENSP00000299194:A89D	A	+	2	0	LRTM2	1810560	0.998000	0.40836	0.992000	0.48379	0.990000	0.78478	3.812000	0.55628	2.345000	0.79718	0.561000	0.74099	GCC	LRTM2	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000166159		0.622	LRTM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LRTM2	HGNC	protein_coding	OTTHUMT00000398055.1	25	0.00	0	C			1940299	1940299	+1	no_errors	ENST00000299194	ensembl	human	known	69_37n	missense	14	26.32	5	SNP	0.997	A
MDH1B	130752	genome.wustl.edu	37	2	207625725	207625725	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr2:207625725C>A	ENST00000374412.3	-	2	310	c.35G>T	c.(34-36)tGt>tTt	p.C12F	MDH1B_ENST00000392214.2_Missense_Mutation_p.C12F|MDH1B_ENST00000454776.2_Missense_Mutation_p.C12F|MDH1B_ENST00000449792.1_Intron	NM_001039845.1|NM_001282940.1	NP_001034934.1|NP_001269869.1	Q5I0G3	MDH1B_HUMAN	malate dehydrogenase 1B, NAD (soluble)	12					carbohydrate metabolic process (GO:0005975)|malate metabolic process (GO:0006108)|tricarboxylic acid cycle (GO:0006099)		malate dehydrogenase activity (GO:0016615)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)			NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(14)|ovary(4)|stomach(1)	34				LUSC - Lung squamous cell carcinoma(261;0.0763)|Epithelial(149;0.131)|Lung(261;0.145)		ATAATATGGACAATCTGCTCT	0.323																																					Pancreas(76;29 1355 28675 37177 51207)	dbGAP											0													116.0	119.0	118.0					2																	207625725		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33365.1, CCDS63102.1	2q33.3	2008-05-27			ENSG00000138400	ENSG00000138400			17836	protein-coding gene	gene with protein product							Standard	NM_001039845		Approved	FLJ25341, RP11-95H11	uc002vbs.3	Q5I0G3	OTTHUMG00000132918	ENST00000374412.3:c.35G>T	2.37:g.207625725C>A	ENSP00000363533:p.Cys12Phe		A8K8M1|Q53TK9|Q8IV51	Missense_Mutation	SNP	pfam_Lactate/malate_DH_C,superfamily_Lactate_DH/Glyco_Ohase_4_C	p.C12F	ENST00000374412.3	37	c.35	CCDS33365.1	2	.	.	.	.	.	.	.	.	.	.	C	20.2	3.953522	0.73902	.	.	ENSG00000138400	ENST00000374412;ENST00000454776;ENST00000392214	T;T;T	0.59364	0.27;0.27;0.27	5.62	4.75	0.60458	.	0.088348	0.85682	D	0.000000	T	0.77356	0.4118	M	0.83012	2.62	0.49389	D	0.999786	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.982	T	0.81684	-0.0821	10	0.87932	D	0	-11.8178	14.858	0.70355	0.0:0.9307:0.0:0.0693	.	12;12	Q5I0G3-2;Q5I0G3	.;MDH1B_HUMAN	F	12	ENSP00000363533:C12F;ENSP00000389916:C12F;ENSP00000376049:C12F	ENSP00000363533:C12F	C	-	2	0	MDH1B	207333970	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.424000	0.66464	1.513000	0.48852	0.655000	0.94253	TGT	MDH1B	-	NULL	ENSG00000138400		0.323	MDH1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MDH1B	HGNC	protein_coding	OTTHUMT00000256429.2	136	0.00	0	C	NM_001039845		207625725	207625725	-1	no_errors	ENST00000374412	ensembl	human	known	69_37n	missense	33	17.50	7	SNP	1.000	A
SKA2	348235	genome.wustl.edu	37	17	57228573	57228573	+	Intron	SNP	C	C	T	rs370820064	byFrequency	TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr17:57228573C>T	ENST00000330137.7	-	1	139				SKA2_ENST00000437036.2_Intron|SKA2_ENST00000583927.1_Intron|SKA2_ENST00000581068.1_Intron|SKA2_ENST00000580541.1_Intron|SKA2_ENST00000583380.1_Intron|SKA2_ENST00000578105.1_Intron|MIR301A_ENST00000385261.1_RNA	NM_182620.3	NP_872426.1	Q8WVK7	SKA2_HUMAN	spindle and kinetochore associated complex subunit 2						cell division (GO:0051301)|chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of microtubule polymerization or depolymerization (GO:0031110)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|spindle microtubule (GO:0005876)	microtubule binding (GO:0008017)			lung(4)	4						TCAGAGCATTCGTTAGCAGTA	0.393													C|||	2	0.000399361	0.0008	0.0	5008	,	,		17860	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													93.0	82.0	85.0					17																	57228573		1568	3582	5150	-	-	-	SO:0001627	intron_variant	0			BC017873	CCDS45747.1, CCDS45748.1	17q23.2	2013-01-17	2009-08-19	2009-08-19	ENSG00000182628	ENSG00000182628			28006	protein-coding gene	gene with protein product			"""family with sequence similarity 33, member A"""	FAM33A		17093495, 19289083, 18583474	Standard	NM_182620		Approved	FLJ12758	uc010dde.1	Q8WVK7		ENST00000330137.7:c.33+3918G>A	17.37:g.57228573C>T			A6NIL3|B3KPL3|E9PCB8	RNA	SNP	-	NULL	ENST00000330137.7	37	NULL	CCDS45747.1	17																																																																																			MIR301A	-	-	ENSG00000207996		0.393	SKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR301A	HGNC	protein_coding	OTTHUMT00000445939.1	147	0.00	0	C	NM_182620		57228573	57228573	-1	no_errors	ENST00000385261	ensembl	human	known	69_37n	rna	67	12.99	10	SNP	1.000	T
MYD88	4615	genome.wustl.edu	37	3	38182756	38182756	+	Silent	SNP	C	C	G			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr3:38182756C>G	ENST00000396334.3	+	5	1093	c.909C>G	c.(907-909)gcC>gcG	p.A303A	MYD88_ENST00000443433.2_3'UTR|MYD88_ENST00000424893.1_Silent_p.A258A|MYD88_ENST00000481122.1_3'UTR|MYD88_ENST00000417037.2_Silent_p.A311A|MYD88_ENST00000495303.1_3'UTR	NM_002468.4	NP_002459.2	Q99836	MYD88_HUMAN	myeloid differentiation primary response 88	290					3'-UTR-mediated mRNA stabilization (GO:0070935)|cell surface receptor signaling pathway (GO:0007166)|cellular response to mechanical stimulus (GO:0071260)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-positive bacterium (GO:0050830)|establishment of endothelial intestinal barrier (GO:0090557)|immunoglobulin mediated immune response (GO:0016064)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of apoptotic process (GO:0043066)|negative regulation of growth of symbiont in host (GO:0044130)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-23 production (GO:0032747)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon production (GO:0032481)|regulation of inflammatory response (GO:0050727)|response to interleukin-1 (GO:0070555)|response to molecule of fungal origin (GO:0002238)|response to peptidoglycan (GO:0032494)|response to virus (GO:0009615)|signal transduction (GO:0007165)|Toll signaling pathway (GO:0008063)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|type I interferon biosynthetic process (GO:0045351)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)	death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|TIR domain binding (GO:0070976)			breast(1)|haematopoietic_and_lymphoid_tissue(226)|large_intestine(3)|lung(6)|upper_aerodigestive_tract(1)	237				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		CTCGCCTTGCCAAGGCCTTGT	0.542			Mis		ABC-DLBCL																																	dbGAP		Dom	yes		3	3p22	4615	myeloid differentiation primary response gene (88)		L	0													200.0	166.0	178.0					3																	38182756		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U84408	CCDS2674.2, CCDS54565.1, CCDS54566.1, CCDS54567.1, CCDS54568.1	3p22	2014-09-17	2012-11-15		ENSG00000172936	ENSG00000172936			7562	protein-coding gene	gene with protein product		602170	"""myeloid differentiation primary response gene (88)"""			9013863	Standard	NM_002468		Approved		uc003chx.3	Q99836	OTTHUMG00000131083	ENST00000396334.3:c.909C>G	3.37:g.38182756C>G			B4DKH8|B4DKU4|B4DQ60|B4DQ72|J3KPU4|J3KQ87|J3KQJ6|P78397|Q53XS7	Silent	SNP	pfam_TIR_dom,pfam_Death,superfamily_DEATH-like,superfamily_TIR_dom,smart_Death,smart_TIR_dom,pirsf_Myelin_different_resp_MyD88,pfscan_Death,pfscan_TIR_dom	p.A311	ENST00000396334.3	37	c.933	CCDS2674.2	3																																																																																			MYD88	-	pfam_TIR_dom,superfamily_TIR_dom,smart_TIR_dom,pirsf_Myelin_different_resp_MyD88,pfscan_TIR_dom	ENSG00000172936		0.542	MYD88-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYD88	HGNC	protein_coding	OTTHUMT00000253743.4	119	0.00	0	C	NM_002468		38182756	38182756	+1	no_errors	ENST00000417037	ensembl	human	known	69_37n	silent	43	24.56	14	SNP	1.000	G
MOBP	4336	genome.wustl.edu	37	3	39543701	39543701	+	Missense_Mutation	SNP	T	T	G			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr3:39543701T>G	ENST00000420739.1	+	3	365	c.141T>G	c.(139-141)tgT>tgG	p.C47W	MOBP_ENST00000428261.1_Missense_Mutation_p.C47W|MOBP_ENST00000447324.1_Missense_Mutation_p.C47W|MOBP_ENST00000441980.2_Missense_Mutation_p.C47W|MOBP_ENST00000383754.3_Missense_Mutation_p.C47W|MOBP_ENST00000396228.1_Missense_Mutation_p.C47W|MOBP_ENST00000311042.6_Missense_Mutation_p.C47W|MOBP_ENST00000354668.4_Missense_Mutation_p.C47W|MOBP_ENST00000415443.1_Missense_Mutation_p.C47W			Q13875	MOBP_HUMAN	myelin-associated oligodendrocyte basic protein	47					intracellular protein transport (GO:0006886)|nervous system development (GO:0007399)	cytoplasm (GO:0005737)		p.C47W(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)	6				KIRC - Kidney renal clear cell carcinoma(284;0.082)|Kidney(284;0.0998)		ACAGCATCTGTAAGAGCGGCT	0.557																																						dbGAP											1	Substitution - Missense(1)	ovary(1)											67.0	69.0	69.0					3																	39543701		2203	4300	6503	-	-	-	SO:0001583	missense	0			D28113	CCDS2687.1, CCDS63598.1, CCDS2688.1	3p21.33	2004-03-02			ENSG00000168314	ENSG00000168314			7189	protein-coding gene	gene with protein product		600948				7989345	Standard	NM_001278322		Approved		uc031ryw.1	Q13875	OTTHUMG00000131347	ENST00000420739.1:c.141T>G	3.37:g.39543701T>G	ENSP00000400491:p.Cys47Trp		A8K2C2|G5E945|Q13874|Q6DHZ6|Q8TBJ1	Missense_Mutation	SNP	NULL	p.C47W	ENST00000420739.1	37	c.141		3	.	.	.	.	.	.	.	.	.	.	T	10.43	1.347081	0.24426	.	.	ENSG00000168314	ENST00000451925;ENST00000354668;ENST00000428261;ENST00000420739;ENST00000415443;ENST00000447324;ENST00000383754;ENST00000436143;ENST00000441980;ENST00000311042;ENST00000396228	D;D;D;D;D;D;D;D;D	0.88277	-2.36;-2.36;-2.36;-2.36;-2.36;-2.36;-2.36;-2.36;-2.36	3.95	-4.87	0.03123	.	0.000000	0.85682	D	0.000000	D	0.92958	0.7759	.	.	.	0.58432	D	0.999996	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.85130	0.995;0.997;0.997	D	0.91681	0.5358	9	0.87932	D	0	-17.5155	13.9483	0.64099	0.0:0.7349:0.0:0.2651	.	47;47;47	Q13875;G5E945;Q13875-3	MOBP_HUMAN;.;.	W	47;47;47;47;47;47;47;58;47;47;47	ENSP00000346695:C47W;ENSP00000401312:C47W;ENSP00000400491:C47W;ENSP00000388148:C47W;ENSP00000409730:C47W;ENSP00000373261:C47W;ENSP00000388827:C47W;ENSP00000312293:C47W;ENSP00000379530:C47W	ENSP00000312293:C47W	C	+	3	2	MOBP	39518705	0.998000	0.40836	0.018000	0.16275	0.827000	0.46813	0.409000	0.21082	-1.053000	0.03218	-0.924000	0.02725	TGT	MOBP	-	NULL	ENSG00000168314		0.557	MOBP-001	KNOWN	basic	protein_coding	MOBP	HGNC	protein_coding	OTTHUMT00000343711.1	45	0.00	0	T	NM_006501, NM_182934, NM_182935		39543701	39543701	+1	no_errors	ENST00000354668	ensembl	human	known	69_37n	missense	26	13.33	4	SNP	0.951	G
MYH8	4626	genome.wustl.edu	37	17	10318692	10318692	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr17:10318692C>G	ENST00000403437.2	-	8	752	c.658G>C	c.(658-660)Gaa>Caa	p.E220Q	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	220	Myosin motor.				ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						ATTTGATCTTCCAGAGTCCCC	0.512									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																													dbGAP											0													118.0	117.0	117.0					17																	10318692		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Carney Complex Variant		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.658G>C	17.37:g.10318692C>G	ENSP00000384330:p.Glu220Gln		Q14910	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E220Q	ENST00000403437.2	37	c.658	CCDS11153.1	17	.	.	.	.	.	.	.	.	.	.	C	22.4	4.291171	0.80914	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	D	0.89123	-2.47	4.53	4.53	0.55603	Myosin head, motor domain (2);	0.000000	0.42294	U	0.000738	D	0.95211	0.8447	M	0.89478	3.035	0.58432	D	0.999998	D	0.69078	0.997	D	0.75484	0.986	D	0.95990	0.8985	10	0.66056	D	0.02	.	17.4462	0.87579	0.0:1.0:0.0:0.0	.	220	P13535	MYH8_HUMAN	Q	220	ENSP00000384330:E220Q	ENSP00000252173:E220Q	E	-	1	0	MYH8	10259417	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.498000	0.81546	2.356000	0.79943	0.655000	0.94253	GAA	MYH8	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000133020		0.512	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH8	HGNC	protein_coding	OTTHUMT00000252724.2	201	0.50	1	C	NM_002472		10318692	10318692	-1	no_errors	ENST00000403437	ensembl	human	known	69_37n	missense	24	42.86	18	SNP	1.000	G
NCKAP5	344148	genome.wustl.edu	37	2	133483301	133483301	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr2:133483301G>T	ENST00000409261.1	-	19	5985	c.5612C>A	c.(5611-5613)gCc>gAc	p.A1871D	NCKAP5_ENST00000405974.3_Missense_Mutation_p.A552D|NCKAP5_ENST00000409213.1_Missense_Mutation_p.A552D|NCKAP5_ENST00000317721.6_Missense_Mutation_p.A1871D	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1871										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						GCCACCGCTGGCAGAGTACGT	0.463																																						dbGAP											0													102.0	97.0	98.0					2																	133483301		1950	4169	6119	-	-	-	SO:0001583	missense	0			AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.5612C>A	2.37:g.133483301G>T	ENSP00000387128:p.Ala1871Asp		B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	NULL	p.A1871D	ENST00000409261.1	37	c.5612	CCDS46418.1	2	.	.	.	.	.	.	.	.	.	.	G	18.63	3.665222	0.67700	.	.	ENSG00000176771	ENST00000409261;ENST00000409213;ENST00000317721;ENST00000405974;ENST00000537661	T;T;T;T	0.57107	2.58;0.42;2.58;0.42	4.8	2.91	0.33838	.	1.854140	0.03972	U	0.291813	T	0.55386	0.1917	N	0.19112	0.55	0.23649	N	0.997201	P;D	0.61080	0.95;0.989	P;P	0.58873	0.625;0.847	T	0.50276	-0.8847	10	0.87932	D	0	.	8.0474	0.30557	0.0813:0.0:0.7627:0.156	.	552;1871	O14513-2;O14513	.;NCKP5_HUMAN	D	1871;552;1871;552;552	ENSP00000387128:A1871D;ENSP00000386952:A552D;ENSP00000380603:A1871D;ENSP00000385692:A552D	ENSP00000380603:A1871D	A	-	2	0	NCKAP5	133199771	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	1.526000	0.35964	1.253000	0.44018	0.563000	0.77884	GCC	NCKAP5	-	NULL	ENSG00000176771		0.463	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCKAP5	HGNC	protein_coding	OTTHUMT00000331663.1	150	0.00	0	G	NM_207481		133483301	133483301	-1	no_errors	ENST00000317721	ensembl	human	known	69_37n	missense	38	18.75	9	SNP	1.000	T
NCKAP1	10787	genome.wustl.edu	37	2	183843584	183843584	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr2:183843584C>A	ENST00000361354.4	-	14	1773	c.1401G>T	c.(1399-1401)atG>atT	p.M467I	NCKAP1_ENST00000360982.2_Missense_Mutation_p.M473I	NM_013436.3	NP_038464.1	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1	467					apical protein localization (GO:0045176)|apoptotic process (GO:0006915)|basal protein localization (GO:0045175)|central nervous system development (GO:0007417)|embryonic body morphogenesis (GO:0010172)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube development (GO:0035050)|endoderm development (GO:0007492)|establishment or maintenance of actin cytoskeleton polarity (GO:0030950)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|mesodermal cell migration (GO:0008078)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|paraxial mesoderm morphogenesis (GO:0048340)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|positive regulation of lamellipodium assembly (GO:0010592)|protein stabilization (GO:0050821)|Rac protein signal transduction (GO:0016601)|regulation of protein localization (GO:0032880)|somitogenesis (GO:0001756)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)			breast(3)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(11)|lung(16)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			TTAGGGAAGTCATAGTGTTAA	0.279																																						dbGAP											0													52.0	55.0	54.0					2																	183843584		2202	4296	6498	-	-	-	SO:0001583	missense	0			AB014509	CCDS2287.1, CCDS2288.1	2q32	2009-08-14			ENSG00000061676	ENSG00000061676			7666	protein-coding gene	gene with protein product		604891				10673335, 12181570, 9344857	Standard	NM_013436		Approved	Nap1, HEM2, NAP125	uc002upb.4	Q9Y2A7	OTTHUMG00000132623	ENST00000361354.4:c.1401G>T	2.37:g.183843584C>A	ENSP00000355348:p.Met467Ile		O60329|Q53QN5|Q53S94|Q53Y35	Missense_Mutation	SNP	pfam_Nck-associated_protein-1	p.M473I	ENST00000361354.4	37	c.1419	CCDS2287.1	2	.	.	.	.	.	.	.	.	.	.	C	15.92	2.975996	0.53720	.	.	ENSG00000061676	ENST00000361354;ENST00000360982	T;T	0.26810	1.71;1.71	5.44	5.44	0.79542	.	0.035510	0.85682	D	0.000000	T	0.12987	0.0315	N	0.02315	-0.6	0.80722	D	1	B;B	0.22541	0.071;0.058	B;B	0.22152	0.038;0.023	T	0.20672	-1.0268	10	0.17832	T	0.49	-6.2624	19.6286	0.95691	0.0:1.0:0.0:0.0	.	467;473	Q9Y2A7;Q9Y2A7-2	NCKP1_HUMAN;.	I	467;473	ENSP00000355348:M467I;ENSP00000354251:M473I	ENSP00000354251:M473I	M	-	3	0	NCKAP1	183551829	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.999000	0.70665	2.692000	0.91855	0.650000	0.86243	ATG	NCKAP1	-	pfam_Nck-associated_protein-1	ENSG00000061676		0.279	NCKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCKAP1	HGNC	protein_coding	OTTHUMT00000255867.2	95	0.00	0	C	NM_205842		183843584	183843584	-1	no_errors	ENST00000360982	ensembl	human	known	69_37n	missense	26	21.21	7	SNP	1.000	A
NCOR1	9611	genome.wustl.edu	37	17	15989636	15989636	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr17:15989636G>T	ENST00000268712.3	-	23	3394	c.3137C>A	c.(3136-3138)tCa>tAa	p.S1046*	NCOR1_ENST00000395851.1_Nonsense_Mutation_p.S1062*	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	1046	Interaction with ETO.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		TGGTTTTTCTGAAGCCACTGT	0.463																																						dbGAP											0													113.0	115.0	115.0					17																	15989636		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.3137C>A	17.37:g.15989636G>T	ENSP00000268712:p.Ser1046*		B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Nonsense_Mutation	SNP	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.S1046*	ENST00000268712.3	37	c.3137	CCDS11175.1	17	.	.	.	.	.	.	.	.	.	.	G	40	8.319525	0.98757	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849	.	.	.	5.73	5.73	0.89815	.	0.170562	0.52532	D	0.000064	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.5509	18.9451	0.92620	0.0:0.0:1.0:0.0	.	.	.	.	X	1046;1062;953	.	ENSP00000268712:S1046X	S	-	2	0	NCOR1	15930361	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.646000	0.83445	2.723000	0.93209	0.580000	0.79431	TCA	NCOR1	-	NULL	ENSG00000141027		0.463	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOR1	HGNC	protein_coding	OTTHUMT00000131751.5	135	0.74	1	G	NM_006311		15989636	15989636	-1	no_errors	ENST00000268712	ensembl	human	known	69_37n	nonsense	32	49.23	32	SNP	1.000	T
NDUFA6	4700	genome.wustl.edu	37	22	42483141	42483141	+	Missense_Mutation	SNP	G	G	A	rs8139803		TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr22:42483141G>A	ENST00000498737.2	-	2	388	c.256C>T	c.(256-258)Cgg>Tgg	p.R86W	NDUFA6_ENST00000470753.1_Missense_Mutation_p.R3W|NDUFA6_ENST00000602404.1_Missense_Mutation_p.R60W|RP1-257I20.14_ENST00000602718.1_RNA	NM_002490.3	NP_002481.2	P56556	NDUA6_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6, 14kDa	86					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			kidney(1)|lung(3)|upper_aerodigestive_tract(1)	5						ACTTTATCCCGTCCCATTTTC	0.428																																						dbGAP											0													166.0	153.0	157.0					22																	42483141		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF047182	CCDS33656.1	22q13.2	2010-05-07	2002-08-29		ENSG00000184983	ENSG00000184983		"""LYR motif containing"", ""Mitochondrial respiratory chain complex / Complex I"""	7690	protein-coding gene	gene with protein product	"""complex I B14 subunit"""	602138	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6 (14kD, B14)"""			9763676, 9425316	Standard	NM_002490		Approved	B14, LYRM6, CI-B14, NADHB14	uc003bcb.3	P56556	OTTHUMG00000151287	ENST00000498737.2:c.256C>T	22.37:g.42483141G>A	ENSP00000418842:p.Arg86Trp		B2RE54|O43675|Q6FGW0|Q6IBT8|Q6IC39	Missense_Mutation	SNP	pfam_Complex1_LYR	p.R86W	ENST00000498737.2	37	c.256	CCDS33656.1	22	.	.	.	.	.	.	.	.	.	.	g	22.4	4.291208	0.80914	.	.	ENSG00000184983	ENST00000498737	T	0.74526	-0.85	6.17	5.16	0.70880	.	0.000000	0.85682	D	0.000000	D	0.89361	0.6693	M	0.93720	3.45	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.92037	0.5638	10	0.87932	D	0	-17.7234	14.4581	0.67431	0.0:0.0:0.7317:0.2683	.	86	P56556	NDUA6_HUMAN	W	86	ENSP00000418842:R86W	ENSP00000418842:R86W	R	-	1	2	NDUFA6	40813087	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.880000	0.56145	1.643000	0.50594	-0.121000	0.15023	CGG	NDUFA6	-	pfam_Complex1_LYR	ENSG00000184983		0.428	NDUFA6-001	KNOWN	basic|CCDS	protein_coding	NDUFA6	HGNC	protein_coding	OTTHUMT00000322089.4	113	0.00	0	G	NM_002490		42483141	42483141	-1	no_errors	ENST00000498737	ensembl	human	known	69_37n	missense	37	21.28	10	SNP	0.999	A
NSL1	25936	genome.wustl.edu	37	1	212912896	212912896	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr1:212912896C>G	ENST00000366977.3	-	5	565	c.547G>C	c.(547-549)Gag>Cag	p.E183Q	NSL1_ENST00000366975.6_Intron|NSL1_ENST00000366978.1_Intron|NSL1_ENST00000422588.2_Missense_Mutation_p.G211A|NSL1_ENST00000366976.1_Intron	NM_015471.3	NP_056286.3	Q96IY1	NSL1_HUMAN	NSL1, MIS12 kinetochore complex component	183					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|MIS12/MIND type complex (GO:0000444)|nucleus (GO:0005634)				breast(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	9				OV - Ovarian serous cystadenocarcinoma(81;0.00597)|all cancers(67;0.00893)|GBM - Glioblastoma multiforme(131;0.0514)|Epithelial(68;0.102)		TCACTGATCTCCTTTGCTACT	0.333																																						dbGAP											0													146.0	134.0	138.0					1																	212912896		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF255793	CCDS1509.1, CCDS73025.1	1q41	2013-07-03	2013-07-03	2006-11-07	ENSG00000117697	ENSG00000117697			24548	protein-coding gene	gene with protein product		609174	"""chromosome 1 open reading frame 48"", ""NSL1, MIND kinetochore complex component, homolog (S. cerevisiae)"""	C1orf48		20819937	Standard	NM_015471		Approved	DC8, DKFZP566O1646, MIS14	uc001hjn.3	Q96IY1	OTTHUMG00000036806	ENST00000366977.3:c.547G>C	1.37:g.212912896C>G	ENSP00000355944:p.Glu183Gln		E7ETD5|Q5SY75|Q9H2M5|Q9NRN8|Q9Y415	Missense_Mutation	SNP	pfam_Kinetochore_Mis14	p.E183Q	ENST00000366977.3	37	c.547	CCDS1509.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.57|11.57	1.678844|1.678844	0.29783|0.29783	.|.	.|.	ENSG00000117697|ENSG00000117697	ENST00000366977|ENST00000422588	T|T	0.28895|0.54675	1.59|0.56	5.79|5.79	3.86|3.86	0.44501|0.44501	.|.	0.261848|.	0.37219|.	N|.	0.002184|.	T|T	0.36441|0.36441	0.0967|0.0967	N|N	0.11789|0.11789	0.175|0.175	0.21527|0.21527	N|N	0.999655|0.999655	B|B	0.19200|0.25048	0.034|0.117	B|B	0.23018|0.31812	0.043|0.136	T|T	0.34576|0.34576	-0.9823|-0.9823	10|9	0.09084|0.87932	T|D	0.74|0	-1.3083|-1.3083	7.8119|7.8119	0.29237|0.29237	0.0:0.5165:0.3934:0.0901|0.0:0.5165:0.3934:0.0901	.|.	183|211	Q96IY1|E7ETD5	NSL1_HUMAN|.	Q|A	183|211	ENSP00000355944:E183Q|ENSP00000388406:G211A	ENSP00000355944:E183Q|ENSP00000388406:G211A	E|G	-|-	1|2	0|0	NSL1|NSL1	210979519|210979519	1.000000|1.000000	0.71417|0.71417	0.982000|0.982000	0.44146|0.44146	0.990000|0.990000	0.78478|0.78478	0.769000|0.769000	0.26604|0.26604	1.421000|1.421000	0.47157|0.47157	0.655000|0.655000	0.94253|0.94253	GAG|GGA	NSL1	-	pfam_Kinetochore_Mis14	ENSG00000117697		0.333	NSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSL1	HGNC	protein_coding	OTTHUMT00000089398.2	324	0.00	0	C	NM_015471		212912896	212912896	-1	no_errors	ENST00000366977	ensembl	human	known	69_37n	missense	160	20.40	41	SNP	0.988	G
NUMBL	9253	genome.wustl.edu	37	19	41175875	41175875	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr19:41175875G>C	ENST00000252891.4	-	9	1254	c.1087C>G	c.(1087-1089)Ctg>Gtg	p.L363V	NUMBL_ENST00000540131.1_Missense_Mutation_p.L322V|NUMBL_ENST00000598779.1_Missense_Mutation_p.L322V	NM_004756.3	NP_004747.1	Q9Y6R0	NUMBL_HUMAN	numb homolog (Drosophila)-like	363					adherens junction organization (GO:0034332)|axonogenesis (GO:0007409)|cytokine-mediated signaling pathway (GO:0019221)|lateral ventricle development (GO:0021670)|nervous system development (GO:0007399)|neuroblast division in subventricular zone (GO:0021849)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of neurogenesis (GO:0050769)|protein metabolic process (GO:0019538)	cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)	16			Lung(22;0.000393)|LUSC - Lung squamous cell carcinoma(20;0.00105)			TGTGTGCACAGAGCGTTGATG	0.612																																						dbGAP											0													77.0	68.0	71.0					19																	41175875		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF015401	CCDS12561.1	19q13.13-q13.2	2008-07-17	2001-11-28			ENSG00000105245			8061	protein-coding gene	gene with protein product		604018	"""numb (Drosophila) homolog-like"""			9225980, 9303539	Standard	XM_006723471		Approved	NUMB-R, CTG3a, CAG3A, TNRC23, NUMBR, NUMBLIKE	uc002oon.3	Q9Y6R0		ENST00000252891.4:c.1087C>G	19.37:g.41175875G>C	ENSP00000252891:p.Leu363Val		Q7Z4J9	Missense_Mutation	SNP	pfam_Numb_domain,pfam_PTyr_interaction_dom,pfam_PTB,smart_PTyr_interaction_dom,pirsf_Numb/numb-like,pfscan_PTyr_interaction_dom	p.L363V	ENST00000252891.4	37	c.1087	CCDS12561.1	19	.	.	.	.	.	.	.	.	.	.	G	11.91	1.778232	0.31502	.	.	ENSG00000105245	ENST00000252891;ENST00000540131	T;T	0.59364	0.27;0.3	5.24	2.0	0.26442	NUMB domain (1);	0.170769	0.39544	N	0.001333	T	0.68732	0.3033	M	0.63843	1.955	0.45330	D	0.998329	D;D	0.76494	0.999;0.999	D;D	0.87578	0.998;0.998	T	0.67665	-0.5612	10	0.87932	D	0	-18.0537	8.6297	0.33911	0.2502:0.0:0.7498:0.0	.	363;363	A8K033;Q9Y6R0	.;NUMBL_HUMAN	V	363;322	ENSP00000252891:L363V;ENSP00000442759:L322V	ENSP00000252891:L363V	L	-	1	2	NUMBL	45867715	1.000000	0.71417	0.391000	0.26233	0.003000	0.03518	3.308000	0.51896	0.377000	0.24735	-0.253000	0.11424	CTG	NUMBL	-	pfam_Numb_domain,pirsf_Numb/numb-like	ENSG00000105245		0.612	NUMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUMBL	HGNC	protein_coding	OTTHUMT00000462749.2	43	0.00	0	G	NM_004756		41175875	41175875	-1	no_errors	ENST00000252891	ensembl	human	known	69_37n	missense	10	28.57	4	SNP	0.954	C
NUP160	23279	genome.wustl.edu	37	11	47869781	47869781	+	Silent	SNP	G	G	C			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr11:47869781G>C	ENST00000378460.2	-	1	238	c.192C>G	c.(190-192)gtC>gtG	p.V64V	NUP160_ENST00000526870.1_Silent_p.V64V|NUP160_ENST00000532747.1_Silent_p.V30V|NUP160_ENST00000530326.1_5'UTR	NM_015231.1	NP_056046.1	Q12769	NU160_HUMAN	nucleoporin 160kDa	64					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|biliary_tract(2)|breast(7)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(6)|prostate(2)|skin(2)|urinary_tract(2)	53						CAATGCTGCAGACTGTGAATT	0.637																																						dbGAP											0													76.0	78.0	77.0					11																	47869781		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			D83781	CCDS31484.1	11p11.12	2008-07-21	2002-08-29		ENSG00000030066	ENSG00000030066			18017	protein-coding gene	gene with protein product		607614	"""nucleoporin 160kD"""			11684705	Standard	NM_015231		Approved	KIAA0197, FLJ22583	uc001ngm.3	Q12769	OTTHUMG00000166534	ENST00000378460.2:c.192C>G	11.37:g.47869781G>C			B4DYE8|B4E2J9|Q08AD3|Q7Z5X6|Q96GB3|Q9H660	Silent	SNP	pfam_Nucleoporin_Nup160	p.V64	ENST00000378460.2	37	c.192	CCDS31484.1	11																																																																																			NUP160	-	pfam_Nucleoporin_Nup160	ENSG00000030066		0.637	NUP160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP160	HGNC	protein_coding	OTTHUMT00000390239.2	23	0.00	0	G	NM_015231		47869781	47869781	-1	no_errors	ENST00000378460	ensembl	human	known	69_37n	silent	11	35.29	6	SNP	0.103	C
OPTC	26254	genome.wustl.edu	37	1	203468972	203468972	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr1:203468972C>T	ENST00000367222.2	+	5	841	c.725C>T	c.(724-726)gCc>gTc	p.A242V		NM_014359.3	NP_055174.1	Q9UBM4	OPT_HUMAN	opticin	242					negative regulation of angiogenesis (GO:0016525)	proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			breast(1)|cervix(1)|kidney(5)|large_intestine(3)|lung(8)|pancreas(1)|stomach(1)	20			BRCA - Breast invasive adenocarcinoma(75;0.109)			CAGCCTGCAGCCTTCAGGGTG	0.587																																						dbGAP											0													86.0	88.0	87.0					1																	203468972		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF161702	CCDS1439.1	1q31	2008-02-05			ENSG00000188770	ENSG00000188770			8158	protein-coding gene	gene with protein product	"""oculoglycan"""	605127				10636917	Standard	NM_014359		Approved		uc001gzu.1	Q9UBM4	OTTHUMG00000036100	ENST00000367222.2:c.725C>T	1.37:g.203468972C>T	ENSP00000356191:p.Ala242Val		Q5T2G4	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.A242V	ENST00000367222.2	37	c.725	CCDS1439.1	1	.	.	.	.	.	.	.	.	.	.	c	16.58	3.163299	0.57476	.	.	ENSG00000188770	ENST00000367222	T	0.02498	4.27	4.57	3.58	0.41010	.	0.316447	0.28088	N	0.016642	T	0.04543	0.0124	L	0.46567	1.45	0.20821	N	0.999848	P	0.50066	0.931	P	0.48089	0.566	T	0.33059	-0.9883	10	0.45353	T	0.12	-25.3786	7.7815	0.29068	0.0:0.7413:0.1665:0.0922	.	242	Q9UBM4	OPT_HUMAN	V	242	ENSP00000356191:A242V	ENSP00000356191:A242V	A	+	2	0	OPTC	201735595	0.990000	0.36364	0.022000	0.16811	0.023000	0.10783	3.019000	0.49635	2.516000	0.84829	0.556000	0.70494	GCC	OPTC	-	NULL	ENSG00000188770		0.587	OPTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPTC	HGNC	protein_coding	OTTHUMT00000087964.1	57	0.00	0	C	NM_014359		203468972	203468972	+1	no_errors	ENST00000367222	ensembl	human	known	69_37n	missense	34	12.82	5	SNP	0.251	T
OBSCN	84033	genome.wustl.edu	37	1	228521396	228521396	+	Silent	SNP	C	C	A			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr1:228521396C>A	ENST00000422127.1	+	59	16013	c.15969C>A	c.(15967-15969)gtC>gtA	p.V5323V	OBSCN_ENST00000284548.11_Silent_p.V5323V|OBSCN_ENST00000570156.2_Silent_p.V6280V|OBSCN_ENST00000366707.4_Silent_p.V2957V|OBSCN_ENST00000366709.4_Silent_p.V2442V	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5323	Ig-like 50.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TCATCTCCGTCACCCGGGAGG	0.582																																						dbGAP											0													47.0	54.0	51.0					1																	228521396		2084	4232	6316	-	-	-	SO:0001819	synonymous_variant	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.15969C>A	1.37:g.228521396C>A			Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.V5323	ENST00000422127.1	37	c.15969	CCDS58065.1	1																																																																																			OBSCN	-	pfam_Ig_I-set,smart_Ig_sub2,smart_Ig_sub,pfscan_Ig-like	ENSG00000154358		0.582	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		54	0.00	0	C	NM_052843		228521396	228521396	+1	no_errors	ENST00000422127	ensembl	human	known	69_37n	silent	61	17.57	13	SNP	0.827	A
PALLD	23022	genome.wustl.edu	37	4	169632939	169632939	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr4:169632939C>T	ENST00000505667.1	+	10	2002	c.1829C>T	c.(1828-1830)aCg>aTg	p.T610M	PALLD_ENST00000335742.7_Missense_Mutation_p.T228M|PALLD_ENST00000512127.1_Missense_Mutation_p.T228M|PALLD_ENST00000261509.6_Missense_Mutation_p.T610M			Q8WX93	PALLD_HUMAN	palladin, cytoskeletal associated protein	610					cytoskeleton organization (GO:0007010)	actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	muscle alpha-actinin binding (GO:0051371)			breast(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(18)|ovary(3)|prostate(3)|skin(4)	48		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		GAGAGGGAAACGAACGGAGTC	0.493									Pancreatic Cancer, Familial Clustering of																												Esophageal Squamous(109;1482 1532 18347 40239 51172)	dbGAP											0													86.0	81.0	83.0					4																	169632939		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1	AB023209	CCDS34098.1, CCDS54818.1, CCDS54819.1, CCDS54820.1	4q32.3	2013-01-11			ENSG00000129116	ENSG00000129116		"""Immunoglobulin superfamily / I-set domain containing"""	17068	protein-coding gene	gene with protein product		608092				10231032, 10931874	Standard	NM_001166108		Approved	KIAA0992, SIH002, CGI-151	uc011cjx.2	Q8WX93	OTTHUMG00000161097	ENST00000505667.1:c.1829C>T	4.37:g.169632939C>T	ENSP00000425556:p.Thr610Met		B3KTG2|B5MD56|B7ZMM5|Q7L3E0|Q7Z3W0|Q86WE8|Q8N1M2|Q9UGA0|Q9UQF5|Q9Y2J6|Q9Y3E9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.T610M	ENST00000505667.1	37	c.1829	CCDS54818.1	4	.	.	.	.	.	.	.	.	.	.	c	11.42	1.632444	0.29068	.	.	ENSG00000129116	ENST00000261509;ENST00000335742;ENST00000505667;ENST00000512127	T;T;T;T	0.63255	-0.03;-0.02;0.24;0.04	5.81	4.98	0.66077	.	0.527730	0.13925	U	0.353337	T	0.67192	0.2867	L	0.51422	1.61	0.09310	N	1	D;P;D	0.67145	0.996;0.488;0.996	P;B;P	0.50791	0.65;0.168;0.65	T	0.61407	-0.7069	10	0.62326	D	0.03	.	15.4673	0.75412	0.0:0.7377:0.2623:0.0	.	610;228;610	B7ZMM5;B3KTG2;B2RTX2	.;.;.	M	610;228;610;228	ENSP00000261509:T610M;ENSP00000336735:T228M;ENSP00000425556:T610M;ENSP00000426947:T228M	ENSP00000261509:T610M	T	+	2	0	PALLD	169869514	0.103000	0.21917	0.008000	0.14137	0.000000	0.00434	1.841000	0.39240	1.484000	0.48361	-0.121000	0.15023	ACG	PALLD	-	NULL	ENSG00000129116		0.493	PALLD-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	PALLD	HGNC	protein_coding	OTTHUMT00000363762.1	100	0.00	0	C	NM_016081		169632939	169632939	+1	no_errors	ENST00000261509	ensembl	human	known	69_37n	missense	24	27.27	9	SNP	0.020	T
PDE10A	10846	genome.wustl.edu	37	6	165792776	165792776	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr6:165792776A>G	ENST00000366882.1	-	19	2016	c.1862T>C	c.(1861-1863)aTt>aCt	p.I621T	PDE10A_ENST00000354448.4_Missense_Mutation_p.I621T|PDE10A_ENST00000539869.2_Missense_Mutation_p.I631T			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	621					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)			breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	GTCTGTGGCAATGATGGCTTT	0.408																																					Esophageal Squamous(22;308 615 5753 12038 40624)	dbGAP											0													143.0	133.0	137.0					6																	165792776		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.1862T>C	6.37:g.165792776A>G	ENSP00000355847:p.Ile621Thr		Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.I631T	ENST00000366882.1	37	c.1892		6	.	.	.	.	.	.	.	.	.	.	A	16.33	3.091584	0.55968	.	.	ENSG00000112541	ENST00000366882;ENST00000539869;ENST00000343842;ENST00000354448;ENST00000392126	D;D	0.82984	-1.67;-1.67	5.95	5.95	0.96441	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.091308	0.64402	D	0.000001	T	0.81269	0.4787	M	0.71036	2.16	0.58432	D	0.999993	P;B	0.36438	0.553;0.015	P;B	0.44394	0.448;0.085	D	0.84547	0.0642	10	0.87932	D	0	.	12.2566	0.54627	0.9324:0.0:0.0676:0.0	.	631;621	Q9ULW9;Q9Y233	.;PDE10_HUMAN	T	621;649;631;621;620	ENSP00000355847:I621T;ENSP00000346435:I621T	ENSP00000341187:I631T	I	-	2	0	PDE10A	165712766	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	8.620000	0.90943	2.279000	0.76181	0.533000	0.62120	ATT	PDE10A	-	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom	ENSG00000112541		0.408	PDE10A-001	PUTATIVE	basic	protein_coding	PDE10A	HGNC	protein_coding	OTTHUMT00000043031.1	210	0.00	0	A			165792776	165792776	-1	no_errors	ENST00000539869	ensembl	human	known	69_37n	missense	29	53.23	33	SNP	1.000	G
PGA5	5222	genome.wustl.edu	37	11	61017398	61017398	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr11:61017398G>C	ENST00000312403.5	+	8	1114	c.929G>C	c.(928-930)aGc>aCc	p.S310T	CTD-2331C18.5_ENST00000537594.1_RNA|PGA5_ENST00000451616.2_Missense_Mutation_p.S156T|PGA4_ENST00000422676.2_Missense_Mutation_p.S310T|PGA5_ENST00000541528.1_Missense_Mutation_p.S50T	NM_014224.2	NP_055039.1	P0DJD9	PEPA5_HUMAN	pepsinogen 5, group I (pepsinogen A)	310					digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)			large_intestine(1)|skin(1)	2						ATGGTGGTCAGCTGCTCAGCC	0.567																																						dbGAP											0													55.0	55.0	55.0					11																	61017398		2202	4297	6499	-	-	-	SO:0001583	missense	0			BC029055	CCDS8001.1	11q13	2012-10-02			ENSG00000256713	ENSG00000256713	3.4.23.1		8887	protein-coding gene	gene with protein product		169730					Standard	NM_014224		Approved		uc001nqz.3	P0DJD9	OTTHUMG00000168075	ENST00000312403.5:c.929G>C	11.37:g.61017398G>C	ENSP00000309542:p.Ser310Thr		A8K749|B7ZW62|B7ZW75|P00790|Q7M4R0|Q8N1E3	Missense_Mutation	SNP	pfam_Peptidase_A1,pfam_Propep_A1,superfamily_Peptidase_aspartic,prints_Peptidase_A1	p.S310T	ENST00000312403.5	37	c.929	CCDS8001.1	11	.	.	.	.	.	.	.	.	.	.	G	15.39	2.820322	0.50633	.	.	ENSG00000229183;ENSG00000256713;ENSG00000256713;ENSG00000256713;ENSG00000256713;ENSG00000256713	ENST00000422676;ENST00000312403;ENST00000537359;ENST00000544083;ENST00000451616;ENST00000541528	T;T;T;T	0.60299	0.2;0.2;0.2;0.2	3.52	1.11	0.20524	.	0.123114	0.52532	D	0.000068	T	0.51652	0.1687	M	0.73217	2.22	0.21105	N	0.999781	B	0.28233	0.204	B	0.30179	0.112	T	0.49899	-0.8890	10	0.59425	D	0.04	.	6.3729	0.21491	0.4143:0.0:0.5857:0.0	.	310	B7ZW62	.	T	310;310;267;169;156;50	ENSP00000395402:S310T;ENSP00000309542:S310T;ENSP00000408739:S156T;ENSP00000441981:S50T	ENSP00000395402:S310T	S	+	2	0	PGA4;PGA5	60773974	1.000000	0.71417	0.009000	0.14445	0.931000	0.56810	0.595000	0.24029	0.130000	0.18549	0.430000	0.28490	AGC	PGA5	-	pfam_Peptidase_A1,superfamily_Peptidase_aspartic	ENSG00000256713		0.567	PGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGA5	HGNC	protein_coding	OTTHUMT00000397972.1	183	0.54	1	G	NM_014224		61017398	61017398	+1	no_errors	ENST00000312403	ensembl	human	known	69_37n	missense	83	20.95	22	SNP	0.765	C
PHIP	55023	genome.wustl.edu	37	6	79725444	79725444	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr6:79725444G>T	ENST00000275034.4	-	14	1459	c.1292C>A	c.(1291-1293)gCt>gAt	p.A431D		NM_017934.5	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	431					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(10)|kidney(4)|large_intestine(20)|lung(20)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	68		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		TCGATCCCAAGCTACCATAGT	0.353																																						dbGAP											0													169.0	140.0	150.0					6																	79725444		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF310250	CCDS4987.1	6q14	2013-01-09			ENSG00000146247	ENSG00000146247		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	15673	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 14"""	612870		WDR11		11018022	Standard	NM_017934		Approved	ndrp, FLJ20705, DCAF14, BRWD2	uc003pir.3	Q8WWQ0	OTTHUMG00000015071	ENST00000275034.4:c.1292C>A	6.37:g.79725444G>T	ENSP00000275034:p.Ala431Asp		A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_Quinonprotein_ADH-like,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Bromodomain	p.A431D	ENST00000275034.4	37	c.1292	CCDS4987.1	6	.	.	.	.	.	.	.	.	.	.	G	27.3	4.816777	0.90790	.	.	ENSG00000146247	ENST00000275034	T	0.47528	0.84	5.25	5.25	0.73442	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40-repeat-containing domain (1);	0.000000	0.64402	D	0.000001	T	0.64538	0.2607	M	0.83603	2.65	0.80722	D	1	D;D	0.64830	0.994;0.994	P;P	0.62885	0.908;0.908	T	0.67385	-0.5684	9	.	.	.	-14.289	18.1652	0.89723	0.0:0.0:1.0:0.0	.	431;431	A7J992;Q8WWQ0	.;PHIP_HUMAN	D	431	ENSP00000275034:A431D	.	A	-	2	0	PHIP	79782163	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	9.420000	0.97426	2.601000	0.87937	0.591000	0.81541	GCT	PHIP	-	superfamily_Quinonprotein_ADH-like,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000146247		0.353	PHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHIP	HGNC	protein_coding	OTTHUMT00000041297.2	194	0.00	0	G			79725444	79725444	-1	no_errors	ENST00000275034	ensembl	human	known	69_37n	missense	59	11.94	8	SNP	1.000	T
PIAS4	51588	genome.wustl.edu	37	19	4028738	4028738	+	Missense_Mutation	SNP	G	G	C	rs537389301	byFrequency	TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr19:4028738G>C	ENST00000262971.2	+	6	808	c.693G>C	c.(691-693)aaG>aaC	p.K231N	PIAS4_ENST00000596144.1_3'UTR	NM_015897.2	NP_056981.2	Q8N2W9	PIAS4_HUMAN	protein inhibitor of activated STAT, 4	231	PINIT. {ECO:0000255|PROSITE- ProRule:PRU00799}.				negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of keratinocyte apoptotic process (GO:1902174)|positive regulation of protein sumoylation (GO:0033235)|protein sumoylation (GO:0016925)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	DNA binding (GO:0003677)|SUMO ligase activity (GO:0019789)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(3)|pancreas(1)|skin(3)	17				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTCCAATAAGCCCGGGGTGG	0.667																																						dbGAP											0													64.0	63.0	64.0					19																	4028738		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF077952	CCDS12118.1	19p13.3	2011-10-11						"""Zinc fingers, MIZ-type"""	17002	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 6"""	605989				9724754	Standard	NM_015897		Approved	Piasg, PIASY, FLJ12419, ZMIZ6	uc002lzg.3	Q8N2W9		ENST00000262971.2:c.693G>C	19.37:g.4028738G>C	ENSP00000262971:p.Lys231Asn		O75926|Q96G19|Q9UN16	Missense_Mutation	SNP	pfam_Znf_MIZ,smart_SAP_DNA-bd,pfscan_Znf_MIZ,pfscan_SAP_DNA-bd	p.K231N	ENST00000262971.2	37	c.693	CCDS12118.1	19	.	.	.	.	.	.	.	.	.	.	G	17.64	3.438740	0.62955	.	.	ENSG00000105229	ENST00000262971	T	0.59224	0.28	4.74	3.46	0.39613	PINIT domain (1);	0.050222	0.85682	D	0.000000	T	0.64681	0.2620	M	0.68593	2.085	0.58432	D	0.999994	D	0.65815	0.995	P	0.58391	0.838	T	0.67369	-0.5688	10	0.87932	D	0	-34.8569	6.1602	0.20360	0.2771:0.0:0.7229:0.0	.	231	Q8N2W9	PIAS4_HUMAN	N	231	ENSP00000262971:K231N	ENSP00000262971:K231N	K	+	3	2	PIAS4	3979738	1.000000	0.71417	0.999000	0.59377	0.755000	0.42902	1.841000	0.39240	2.180000	0.69256	0.555000	0.69702	AAG	PIAS4	-	NULL	ENSG00000105229		0.667	PIAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIAS4	HGNC	protein_coding	OTTHUMT00000457496.1	26	0.00	0	G	NM_015897		4028738	4028738	+1	no_errors	ENST00000262971	ensembl	human	known	69_37n	missense	18	18.18	4	SNP	1.000	C
PIGB	9488	genome.wustl.edu	37	15	55633010	55633010	+	Silent	SNP	G	G	C			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr15:55633010G>C	ENST00000164305.5	+	8	1338	c.1047G>C	c.(1045-1047)ctG>ctC	p.L349L	PIGB_ENST00000539642.1_Silent_p.L154L|CCPG1_ENST00000563294.1_Intron	NM_004855.4	NP_004846.4	Q92521	PIGB_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class B	349					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	mannosyltransferase activity (GO:0000030)			endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	11				all cancers(107;0.0255)		TGTGGACACTGCTTGTTTATA	0.333																																						dbGAP											0													57.0	52.0	53.0					15																	55633010		1843	4089	5932	-	-	-	SO:0001819	synonymous_variant	0			D42138	CCDS61641.1	15q21.3	2013-02-26	2006-06-28		ENSG00000069943	ENSG00000069943		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	8959	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 3"", ""dol-P-Man dependent GPI mannosyltransferase"""	604122	"""phosphatidylinositol glycan, class B"""			8861954	Standard	NM_004855		Approved		uc002act.3	Q92521	OTTHUMG00000172654	ENST00000164305.5:c.1047G>C	15.37:g.55633010G>C			Q53FF9|Q8WVN7	Silent	SNP	pfam_GPI_mannosylTrfase	p.L349	ENST00000164305.5	37	c.1047		15																																																																																			PIGB	-	pfam_GPI_mannosylTrfase	ENSG00000069943		0.333	PIGB-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	PIGB	HGNC	protein_coding	OTTHUMT00000419687.1	99	0.00	0	G	NM_004855		55633010	55633010	+1	no_errors	ENST00000164305	ensembl	human	known	69_37n	silent	17	34.62	9	SNP	0.499	C
PLXND1	23129	genome.wustl.edu	37	3	129286352	129286352	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr3:129286352G>A	ENST00000324093.4	-	22	4247	c.4069C>T	c.(4069-4071)Cgc>Tgc	p.R1357C	PLXND1_ENST00000393239.1_Missense_Mutation_p.R1357C	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	1357					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)		PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						AAGAAGGTGCGGGTCACGAAG	0.607																																					Ovarian(97;366 1484 3738 22084 39045)	dbGAP											0													67.0	46.0	54.0					3																	129286352		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.4069C>T	3.37:g.129286352G>A	ENSP00000317128:p.Arg1357Cys		A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT_TIG_rcpt,pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.R1357C	ENST00000324093.4	37	c.4069	CCDS33854.1	3	.	.	.	.	.	.	.	.	.	.	G	25.0	4.588076	0.86851	.	.	ENSG00000004399	ENST00000324093;ENST00000393239	T;T	0.15603	2.41;2.41	5.3	5.3	0.74995	Plexin, cytoplasmic RasGAP domain (1);	0.123962	0.53938	D	0.000049	T	0.47097	0.1427	M	0.85041	2.73	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.52823	-0.8524	10	0.87932	D	0	.	15.3336	0.74234	0.0:0.0:0.8599:0.1401	.	1357	Q9Y4D7	PLXD1_HUMAN	C	1357	ENSP00000317128:R1357C;ENSP00000376931:R1357C	ENSP00000317128:R1357C	R	-	1	0	PLXND1	130769042	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.405000	0.66351	2.490000	0.84030	0.655000	0.94253	CGC	PLXND1	-	pfam_Plexin_cytoplasmic_RasGAP_dom	ENSG00000004399		0.607	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXND1	HGNC	protein_coding	OTTHUMT00000356132.4	41	0.00	0	G	NM_015103		129286352	129286352	-1	no_errors	ENST00000324093	ensembl	human	known	69_37n	missense	41	24.07	13	SNP	1.000	A
POLR3GL	84265	genome.wustl.edu	37	1	145457582	145457582	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr1:145457582C>A	ENST00000369314.1	-	5	454	c.348G>T	c.(346-348)gaG>gaT	p.E116D	POLR3GL_ENST00000369313.3_Missense_Mutation_p.E93D	NM_032305.1	NP_115681.1	Q9BT43	RPC7L_HUMAN	polymerase (RNA) III (DNA directed) polypeptide G (32kD)-like	116					gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase III promoter (GO:0006384)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)				endometrium(2)|large_intestine(1)|lung(1)	4	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GGATCTTTAGCTCCCGGGGTA	0.532											OREG0013747	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													72.0	73.0	72.0					1																	145457582		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC004355	CCDS72875.1	1q21.1	2008-02-05	2006-12-14		ENSG00000121851	ENSG00000121851			28466	protein-coding gene	gene with protein product			"""polymerase (RNA) III (DNA directed) polypeptide G (32kD) like"""			12477932	Standard	NM_032305		Approved	flj32422, MGC3200	uc001enp.1	Q9BT43	OTTHUMG00000013739	ENST00000369314.1:c.348G>T	1.37:g.145457582C>A	ENSP00000358320:p.Glu116Asp	1694	B1MVG5	Missense_Mutation	SNP	pfam_RNA_pol_III_Rpc31	p.E116D	ENST00000369314.1	37	c.348	CCDS914.1	1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.610035	0.87258	.	.	ENSG00000121851	ENST00000369314;ENST00000369313	.	.	.	5.26	4.21	0.49690	.	0.000000	0.85682	D	0.000000	T	0.76793	0.4037	M	0.92923	3.36	0.46981	D	0.99927	D	0.76494	0.999	D	0.81914	0.995	T	0.81357	-0.0969	9	0.72032	D	0.01	-23.9397	9.5038	0.39033	0.0:0.8722:0.0:0.1278	.	116	Q9BT43	RPC7L_HUMAN	D	116;93	.	ENSP00000358319:E93D	E	-	3	2	POLR3GL	144168939	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.323000	0.33701	1.195000	0.43115	0.655000	0.94253	GAG	POLR3GL	-	pfam_RNA_pol_III_Rpc31	ENSG00000121851		0.532	POLR3GL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR3GL	HGNC	protein_coding	OTTHUMT00000038510.1	117	0.00	0	C	NM_032305		145457582	145457582	-1	no_errors	ENST00000369314	ensembl	human	known	69_37n	missense	82	12.77	12	SNP	1.000	A
PRDM6	93166	genome.wustl.edu	37	5	122491625	122491625	+	Missense_Mutation	SNP	A	A	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr5:122491625A>T	ENST00000407847.4	+	4	1362	c.948A>T	c.(946-948)gaA>gaT	p.E316D	PRDM6_ENST00000464424.1_3'UTR	NM_001136239.1	NP_001129711.1	Q9NQX0	PRDM6_HUMAN	PR domain containing 6	316	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				negative regulation of smooth muscle cell differentiation (GO:0051151)|negative regulation of transcription, DNA-templated (GO:0045892)|neurogenesis (GO:0022008)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	7						ATGGTGGGGAACCTAGTAAGT	0.423																																						dbGAP											0													269.0	223.0	237.0					5																	122491625		692	1591	2283	-	-	-	SO:0001583	missense	0			AF272898	CCDS47259.1	5q21-q23	2013-01-08			ENSG00000061455	ENSG00000061455		"""Zinc fingers, C2H2-type"""	9350	protein-coding gene	gene with protein product							Standard	NM_001136239		Approved		uc003kti.3	Q9NQX0	OTTHUMG00000150469	ENST00000407847.4:c.948A>T	5.37:g.122491625A>T	ENSP00000384725:p.Glu316Asp		B5MCJ4|Q9NQW9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_SET_dom,smart_SET_dom,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.E316D	ENST00000407847.4	37	c.948	CCDS47259.1	5	.	.	.	.	.	.	.	.	.	.	A	13.65	2.301986	0.40694	.	.	ENSG00000061455	ENST00000407847	T	0.41400	1.0	5.76	-0.418	0.12344	SET domain (3);	0.060627	0.64402	D	0.000006	T	0.14313	0.0346	N	0.01250	-0.93	0.41441	D	0.987928	B	0.20550	0.046	B	0.22601	0.04	T	0.09015	-1.0694	10	0.20046	T	0.44	-17.4638	11.4455	0.50120	0.4619:0.0:0.5381:0.0	.	316	Q9NQX0	PRDM6_HUMAN	D	316	ENSP00000384725:E316D	ENSP00000384725:E316D	E	+	3	2	PRDM6	122519524	0.979000	0.34478	1.000000	0.80357	0.999000	0.98932	0.110000	0.15437	0.128000	0.18479	0.533000	0.62120	GAA	PRDM6	-	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	ENSG00000061455		0.423	PRDM6-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PRDM6	HGNC	protein_coding	OTTHUMT00000318226.2	182	0.00	0	A	XM_049619		122491625	122491625	+1	no_errors	ENST00000407847	ensembl	human	known	69_37n	missense	48	17.24	10	SNP	0.996	T
PRKCB	5579	genome.wustl.edu	37	16	24124299	24124299	+	Missense_Mutation	SNP	A	A	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr16:24124299A>T	ENST00000321728.7	+	8	1002	c.827A>T	c.(826-828)aAg>aTg	p.K276M	PRKCB_ENST00000303531.7_Missense_Mutation_p.K276M	NM_212535.2	NP_997700.1	P05771	KPCB_HUMAN	protein kinase C, beta	276					apoptotic process (GO:0006915)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|histone H3-T6 phosphorylation (GO:0035408)|intracellular signal transduction (GO:0035556)|lipoprotein transport (GO:0042953)|negative regulation of glucose transport (GO:0010829)|negative regulation of insulin receptor signaling pathway (GO:0046627)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|histone kinase activity (H3-T6 specific) (GO:0035403)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			central_nervous_system(3)|large_intestine(1)|lung(2)|ovary(3)	9					Tamoxifen(DB00675)|Vitamin E(DB00163)	TTCAGGTTTAAGTTACTGAGC	0.458																																						dbGAP											0													127.0	119.0	122.0					16																	24124299		2197	4300	6497	-	-	-	SO:0001583	missense	0			M13975	CCDS10618.1, CCDS10619.1	16p12	2009-07-10	2008-08-18	2008-08-18	ENSG00000166501	ENSG00000166501	2.7.11.1		9395	protein-coding gene	gene with protein product		176970	"""protein kinase C, beta 1"""	PRKCB2, PKCB, PRKCB1		3658678	Standard	NM_002738		Approved		uc002dme.3	P05771	OTTHUMG00000131615	ENST00000321728.7:c.827A>T	16.37:g.24124299A>T	ENSP00000318315:p.Lys276Met		C5IFJ8|D3DWF5|O43744|P05127|Q15138|Q93060|Q9UE49|Q9UE50|Q9UEH8|Q9UJ30|Q9UJ33	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_C2_Ca-dep,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_Ca-dep,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Protein_kinase_C_a/b/g,prints_DAG/PE-bd,prints_C2_dom,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.K276M	ENST00000321728.7	37	c.827	CCDS10618.1	16	.	.	.	.	.	.	.	.	.	.	A	28.1	4.893160	0.91889	.	.	ENSG00000166501	ENST00000321728;ENST00000303531	T;T	0.44482	0.92;0.92	5.73	5.73	0.89815	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.70046	0.3179	M	0.88241	2.94	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.994	T	0.75827	-0.3180	10	0.62326	D	0.03	.	15.1352	0.72558	1.0:0.0:0.0:0.0	.	276;276	P05771-2;P05771	.;KPCB_HUMAN	M	276	ENSP00000318315:K276M;ENSP00000305355:K276M	ENSP00000305355:K276M	K	+	2	0	PRKCB	24031800	1.000000	0.71417	0.991000	0.47740	0.959000	0.62525	8.526000	0.90588	2.308000	0.77769	0.533000	0.62120	AAG	PRKCB	-	superfamily_C2_Ca/lipid-bd_dom_CaLB,pirsf_Protein_kinase_C_a/b/g	ENSG00000166501		0.458	PRKCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCB	HGNC	protein_coding	OTTHUMT00000254504.2	127	0.00	0	A	NM_212535		24124299	24124299	+1	no_errors	ENST00000303531	ensembl	human	known	69_37n	missense	39	20.41	10	SNP	1.000	T
ZNF512B	57473	genome.wustl.edu	37	20	62626765	62626765	+	Intron	SNP	G	G	A			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr20:62626765G>A	ENST00000450537.1	-	2	56				ZNF512B_ENST00000217130.3_Intron|PRPF6_ENST00000535781.1_Missense_Mutation_p.G234D			Q96KM6	Z512B_HUMAN	zinc finger protein 512B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					ATGACACCTGGCACAGGTGAG	0.527																																						dbGAP											0													125.0	104.0	111.0					20																	62626765		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.5-27457C>T	20.37:g.62626765G>A			Q08AK9|Q9ULM4	Missense_Mutation	SNP	pfam_PRP1_N,smart_HAT,smart_TPR_repeat,pfscan_TPR-contain_dom	p.G234D	ENST00000450537.1	37	c.701	CCDS13548.1	20	.	.	.	.	.	.	.	.	.	.	G	15.84	2.952356	0.53293	.	.	ENSG00000101161	ENST00000266079;ENST00000535781	T;T	0.78003	-1.13;-1.14	5.1	5.1	0.69264	.	0.051410	0.85682	D	0.000000	T	0.79161	0.4399	M	0.83312	2.635	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.09377	0.004;0.0	T	0.75847	-0.3173	10	0.15066	T	0.55	.	18.533	0.90999	0.0:0.0:1.0:0.0	.	234;234	O94906-2;O94906	.;PRP6_HUMAN	D	234	ENSP00000266079:G234D;ENSP00000446216:G234D	ENSP00000266079:G234D	G	+	2	0	PRPF6	62097209	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.237000	0.95368	2.382000	0.81193	0.650000	0.86243	GGC	PRPF6	-	NULL	ENSG00000101161		0.527	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF6	HGNC	protein_coding	OTTHUMT00000080246.1	98	0.00	0	G	NM_020713		62626765	62626765	+1	no_errors	ENST00000266079	ensembl	human	known	69_37n	missense	35	22.22	10	SNP	1.000	A
RAD51D	5892	genome.wustl.edu	37	17	33443953	33443953	+	Intron	SNP	C	C	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr17:33443953C>T	ENST00000345365.6	-	3	519				RAD51L3-RFFL_ENST00000593039.1_Intron|RAD51D_ENST00000335858.7_Intron|RAD51D_ENST00000460118.2_Intron|RAD51D_ENST00000590380.1_Intron|RAD51D_ENST00000590016.1_Missense_Mutation_p.G83E|RAD51D_ENST00000394589.4_Intron|RAD51D_ENST00000360276.3_Intron	NM_002878.3	NP_002869.3	O75771	RA51D_HUMAN	RAD51 paralog D						ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|reciprocal meiotic recombination (GO:0007131)|strand invasion (GO:0042148)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Rad51B-Rad51C-Rad51D-XRCC2 complex (GO:0033063)|replication fork (GO:0005657)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|gamma-tubulin binding (GO:0043015)|single-stranded DNA binding (GO:0003697)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|liver(1)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	13						ATGCCCAAGTCCTGCCTTCTT	0.552								Direct reversal of damage																														dbGAP											0													95.0	85.0	88.0					17																	33443953		1568	3582	5150	-	-	-	SO:0001627	intron_variant	0			AF034956	CCDS11287.1, CCDS11288.1, CCDS45646.1	17q11	2014-09-17	2013-07-02	2011-07-01	ENSG00000185379	ENSG00000185379			9823	protein-coding gene	gene with protein product	"""recombination repair protein"", ""DNA repair protein RAD51 homolog 4"""	602954	"""RAD51 (S. cerevisiae)-like 3"", ""RAD51-like 3 (S. cerevisiae)"", ""RAD51 homolog D (S. cerevisiae)"""	RAD51L3		9570954	Standard	NM_001142571		Approved	R51H3, Trad, HsTRAD	uc010ctj.2	O75771	OTTHUMG00000132930	ENST00000345365.6:c.263+1566G>A	17.37:g.33443953C>T			B4DJU7|E1P637|O43537|O60355|O75196|O75847|O75848|O76073|O76085|O94908|Q9UFU5	Missense_Mutation	SNP	pfam_DNA_recomb/repair_Rad51_C,pfam_Circ_KaiC/RadA,smart_AAA+_ATPase,pfscan_DNA_recomb_RecA/RadB_ATP-bd	p.G83E	ENST00000345365.6	37	c.248	CCDS11287.1	17	.	.	.	.	.	.	.	.	.	.	C	6.548	0.469320	0.12461	.	.	ENSG00000185379	ENST00000394589	.	.	.	2.62	-0.807	0.10872	.	.	.	.	.	T	0.22044	0.0531	.	.	.	0.09310	N	0.999998	B	0.02656	0.0	B	0.08055	0.003	T	0.19844	-1.0293	7	0.24483	T	0.36	-2.1774	4.3076	0.10955	0.1779:0.5806:0.0:0.2415	.	83	B4DJU7	.	E	83	.	ENSP00000378090:G83E	G	-	2	0	RAD51D	30468066	0.001000	0.12720	0.002000	0.10522	0.002000	0.02628	-0.019000	0.12546	-0.436000	0.07254	-1.974000	0.00461	GGA	RAD51D	-	NULL	ENSG00000185379		0.552	RAD51D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD51D	HGNC	protein_coding	OTTHUMT00000256446.1	95	0.00	0	C	NM_002878		33443953	33443953	-1	no_errors	ENST00000590016	ensembl	human	known	69_37n	missense	34	26.09	12	SNP	0.002	T
RAI2	10742	genome.wustl.edu	37	X	17819682	17819682	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chrX:17819682G>T	ENST00000545871.1	-	3	909	c.449C>A	c.(448-450)aCc>aAc	p.T150N	RAI2_ENST00000331511.1_Missense_Mutation_p.T150N|RAI2_ENST00000360011.1_Missense_Mutation_p.T150N|RAI2_ENST00000415486.3_Missense_Mutation_p.T100N|RAI2_ENST00000451717.1_Missense_Mutation_p.T150N	NM_001172739.1|NM_001172743.1	NP_001166210|NP_001166214	Q9Y5P3	RAI2_HUMAN	retinoic acid induced 2	150					embryo development (GO:0009790)					breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|prostate(1)	22	Hepatocellular(33;0.183)					GTTGTGGATGGTACTGGAGGA	0.667																																						dbGAP											0													53.0	58.0	57.0					X																	17819682		2203	4297	6500	-	-	-	SO:0001583	missense	0			Z93242	CCDS14183.1, CCDS55374.1	Xp22	2008-02-05			ENSG00000131831	ENSG00000131831			9835	protein-coding gene	gene with protein product		300217				10049581, 10394933	Standard	NR_033348		Approved		uc010nfa.3	Q9Y5P3	OTTHUMG00000021209	ENST00000545871.1:c.449C>A	X.37:g.17819682G>T	ENSP00000444210:p.Thr150Asn		B1B1K2|B4DQM9|E7EMN4|Q8N6X7	Missense_Mutation	SNP	NULL	p.T150N	ENST00000545871.1	37	c.449	CCDS14183.1	X	.	.	.	.	.	.	.	.	.	.	G	12.09	1.833614	0.32421	.	.	ENSG00000131831	ENST00000331511;ENST00000360011;ENST00000545871;ENST00000451717;ENST00000415486	T;T;T;T;T	0.30182	1.54;1.54;1.54;1.54;1.54	5.21	5.21	0.72293	.	0.382578	0.25842	N	0.027955	T	0.20536	0.0494	N	0.08118	0	0.23559	N	0.997419	B;B	0.16603	0.018;0.018	B;B	0.18561	0.022;0.022	T	0.27123	-1.0083	10	0.66056	D	0.02	-8.985	17.8616	0.88783	0.0:0.0:1.0:0.0	.	100;150	E7EMN4;Q9Y5P3	.;RAI2_HUMAN	N	150;150;150;150;100	ENSP00000333456:T150N;ENSP00000353106:T150N;ENSP00000444210:T150N;ENSP00000401323:T150N;ENSP00000392578:T100N	ENSP00000333456:T150N	T	-	2	0	RAI2	17729603	1.000000	0.71417	0.566000	0.28421	0.884000	0.51177	6.732000	0.74790	2.407000	0.81776	0.600000	0.82982	ACC	RAI2	-	NULL	ENSG00000131831		0.667	RAI2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	RAI2	HGNC	protein_coding	OTTHUMT00000055937.1	58	0.00	0	G	NM_021785		17819682	17819682	-1	no_errors	ENST00000331511	ensembl	human	known	69_37n	missense	30	11.76	4	SNP	0.869	T
CLSTN3	9746	genome.wustl.edu	37	12	7280866	7280866	+	5'Flank	SNP	G	G	A			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr12:7280866G>A	ENST00000266546.6	+	0	0				RBP5_ENST00000542370.1_Silent_p.D74D|RBP5_ENST00000266560.3_Silent_p.D74D|RP11-273B20.1_ENST00000538062.1_RNA|RP11-273B20.1_ENST00000544657.1_RNA	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3						homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						CGCTCCTGAGGTCCTCCTCAA	0.567																																						dbGAP											0													163.0	127.0	139.0					12																	7280866		2203	4300	6503	-	-	-	SO:0001631	upstream_gene_variant	0			AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167		12.37:g.7280866G>A	Exception_encountered		D3DUT6|O94831|Q2T9J5|Q5UE57	Silent	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_Fatty_acid-bd	p.D74	ENST00000266546.6	37	c.222	CCDS8575.1	12																																																																																			RBP5	-	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_Fatty_acid-bd	ENSG00000139194		0.567	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBP5	HGNC	protein_coding	OTTHUMT00000398560.2	133	0.00	0	G	NM_014718		7280866	7280866	-1	no_errors	ENST00000266560	ensembl	human	known	69_37n	silent	55	12.50	8	SNP	1.000	A
RETSAT	54884	genome.wustl.edu	37	2	85570908	85570908	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr2:85570908G>C	ENST00000295802.4	-	10	1659	c.1547C>G	c.(1546-1548)aCt>aGt	p.T516S	RETSAT_ENST00000457495.2_Missense_Mutation_p.T455S|RETSAT_ENST00000475624.2_5'UTR|RETSAT_ENST00000263854.6_Missense_Mutation_p.D460E	NM_017750.3	NP_060220.3	Q6NUM9	RETST_HUMAN	retinol saturase (all-trans-retinol 13,14-reductase)	516					oxidation-reduction process (GO:0055114)|retinol metabolic process (GO:0042572)	endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear outer membrane (GO:0005640)	all-trans-retinol 13,14-reductase activity (GO:0051786)|oxidoreductase activity (GO:0016491)			NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	30					Vitamin A(DB00162)	GGATCCTGCAGTCACACTCTC	0.612																																						dbGAP											0													36.0	39.0	38.0					2																	85570908		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK075261	CCDS1972.1	2p11.2	2008-02-05			ENSG00000042445	ENSG00000042445	1.3.99.23		25991	protein-coding gene	gene with protein product						12975309, 15358783	Standard	NM_017750		Approved	FLJ20296	uc002spd.3	Q6NUM9	OTTHUMG00000154611	ENST00000295802.4:c.1547C>G	2.37:g.85570908G>C	ENSP00000295802:p.Thr516Ser		A6NIK3|Q53R95|Q53SA9|Q6UX05|Q8N2H5|Q96FA4|Q9NXE5	Missense_Mutation	SNP	pfam_Amino_oxidase,pfam_FAD_bind_dom,pfam_FAD-dep_OxRdtase,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_mOase_FAD-bd	p.T516S	ENST00000295802.4	37	c.1547	CCDS1972.1	2	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	12.09|12.09|12.09	1.833743|1.833743|1.833743	0.32421|0.32421|0.32421	.|.|.	.|.|.	ENSG00000042445|ENSG00000042445|ENSG00000042445	ENST00000263854|ENST00000449375|ENST00000295802;ENST00000457495	.|.|T;T	.|.|0.21361	.|.|2.01;2.03	5.02|5.02|5.02	1.1|1.1|1.1	0.20463|0.20463|0.20463	.|.|.	.|.|1.076080	.|.|0.07149	.|.|N	.|.|0.848794	T|T|T	0.12817|0.12817|0.12817	0.0311|0.0311|0.0311	N|N|N	0.17082|0.17082|0.17082	0.46|0.46|0.46	0.09310|0.09310|0.09310	N|N|N	1|1|1	.|.|B;B;B	.|.|0.06786	.|.|0.001;0.001;0.0	.|.|B;B;B	.|.|0.14023	.|.|0.01;0.01;0.003	T|T|T	0.34354|0.34354|0.34354	-0.9832|-0.9832|-0.9832	6|5|10	0.52906|.|0.42905	T|.|T	0.07|.|0.14	0.1272|0.1272|0.1272	5.1981|5.1981|5.1981	0.15249|0.15249|0.15249	0.2449:0.0:0.611:0.1441|0.2449:0.0:0.611:0.1441|0.2449:0.0:0.611:0.1441	.|.|.	.|.|455;455;516	.|.|G5E9N3;B4DKE1;Q6NUM9	.|.|.;.;RETST_HUMAN	E|V|S	460|305|516;455	.|.|ENSP00000295802:T516S;ENSP00000405040:T455S	ENSP00000263854:D460E|.|ENSP00000295802:T516S	D|L|T	-|-|-	3|1|2	2|2|0	RETSAT|RETSAT|RETSAT	85424419|85424419|85424419	0.000000|0.000000|0.000000	0.05858|0.05858|0.05858	0.568000|0.568000|0.568000	0.28447|0.28447|0.28447	0.878000|0.878000|0.878000	0.50629|0.50629|0.50629	0.110000|0.110000|0.110000	0.15437|0.15437|0.15437	-0.009000|-0.009000|-0.009000	0.14296|0.14296|0.14296	0.561000|0.561000|0.561000	0.74099|0.74099|0.74099	GAC|CTG|ACT	RETSAT	-	NULL	ENSG00000042445		0.612	RETSAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RETSAT	HGNC	protein_coding	OTTHUMT00000252489.1	52	0.00	0	G	NM_017750		85570908	85570908	-1	no_errors	ENST00000295802	ensembl	human	known	69_37n	missense	24	27.27	9	SNP	0.003	C
RFPL2	10739	genome.wustl.edu	37	22	32589028	32589028	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr22:32589028G>T	ENST00000400237.1	-	4	1352	c.417C>A	c.(415-417)tgC>tgA	p.C139*	RFPL2_ENST00000489846.1_5'UTR|RFPL2_ENST00000400236.3_Nonsense_Mutation_p.C49*|RFPL2_ENST00000248980.4_Nonsense_Mutation_p.C78*|RFPL2_ENST00000248983.4_Nonsense_Mutation_p.C49*			O75678	RFPL2_HUMAN	ret finger protein-like 2	139							zinc ion binding (GO:0008270)			endometrium(2)|kidney(4)|large_intestine(3)|lung(9)|ovary(1)|skin(2)	21						AAGAGCAACAGCAAAGTAGAT	0.522																																						dbGAP											0													110.0	112.0	111.0					22																	32589028		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AJ010231	CCDS43009.1, CCDS46694.1, CCDS43009.2	22q12.3	2008-06-12				ENSG00000128253		"""RING-type (C3HC4) zinc fingers"""	9979	protein-coding gene	gene with protein product		605969				10508838	Standard	NM_001098527		Approved	RNF79	uc003amg.3	O75678		ENST00000400237.1:c.417C>A	22.37:g.32589028G>T	ENSP00000383096:p.Cys139*			Nonsense_Mutation	SNP	pfam_RDM_domain_RFPL,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_PRY,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY	p.C139*	ENST00000400237.1	37	c.417	CCDS43009.2	22	.	.	.	.	.	.	.	.	.	.	G	40	7.982086	0.98594	.	.	ENSG00000128253	ENST00000248980;ENST00000248983;ENST00000400236;ENST00000400237	.	.	.	0.636	-0.606	0.11619	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	.	.	.	.	.	.	.	X	78;49;49;139	.	ENSP00000248980:C78X	C	-	3	2	RFPL2	30919028	0.872000	0.30054	0.001000	0.08648	0.001000	0.01503	0.823000	0.27366	-0.220000	0.09988	-0.384000	0.06662	TGC	RFPL2	-	pfam_RDM_domain_RFPL	ENSG00000128253		0.522	RFPL2-001	KNOWN	basic|CCDS	protein_coding	RFPL2	HGNC	protein_coding	OTTHUMT00000075262.2	208	0.00	0	G	NM_006605		32589028	32589028	-1	no_errors	ENST00000400237	ensembl	human	known	69_37n	nonsense	74	17.78	16	SNP	0.002	T
RPTN	126638	genome.wustl.edu	37	1	152128108	152128108	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr1:152128108C>G	ENST00000316073.3	-	3	1531	c.1467G>C	c.(1465-1467)aaG>aaC	p.K489N		NM_001122965.1	NP_001116437.1	Q6XPR3	RPTN_HUMAN	repetin	489	Gln-rich.					cornified envelope (GO:0001533)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|endometrium(14)|kidney(2)|large_intestine(1)|lung(32)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	59						GTCTGTCTATCTTACCATAGT	0.502																																						dbGAP											0													831.0	720.0	754.0					1																	152128108		1568	3582	5150	-	-	-	SO:0001583	missense	0			AK096436	CCDS41397.1	1q21.3	2013-01-10			ENSG00000215853	ENSG00000215853		"""EF-hand domain containing"""	26809	protein-coding gene	gene with protein product		613259				15854042	Standard	NM_001122965		Approved	FLJ39117	uc001ezs.1	Q6XPR3	OTTHUMG00000154095	ENST00000316073.3:c.1467G>C	1.37:g.152128108C>G	ENSP00000317895:p.Lys489Asn		B7ZBZ3	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.K489N	ENST00000316073.3	37	c.1467	CCDS41397.1	1	.	.	.	.	.	.	.	.	.	.	C	10.77	1.443904	0.25987	.	.	ENSG00000215853	ENST00000316073;ENST00000541545	T	0.12465	2.68	4.81	0.531	0.17108	.	.	.	.	.	T	0.01558	0.0050	N	0.08118	0	0.09310	N	1	B	0.13594	0.008	B	0.10450	0.005	T	0.48725	-0.9010	9	0.21014	T	0.42	.	5.153	0.15019	0.0:0.5739:0.1523:0.2738	.	489	Q6XPR3	RPTN_HUMAN	N	489;144	ENSP00000317895:K489N	ENSP00000317895:K489N	K	-	3	2	RPTN	150394732	0.000000	0.05858	0.001000	0.08648	0.010000	0.07245	-0.230000	0.09083	0.112000	0.17975	0.176000	0.17051	AAG	RPTN	-	NULL	ENSG00000215853		0.502	RPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPTN	HGNC	protein_coding	OTTHUMT00000333867.1	577	0.17	1	C	XM_371312		152128108	152128108	-1	no_errors	ENST00000316073	ensembl	human	known	69_37n	missense	304	14.85	53	SNP	0.001	G
SALL4	57167	genome.wustl.edu	37	20	50405579	50405579	+	Frame_Shift_Del	DEL	T	T	-			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr20:50405579delT	ENST00000217086.4	-	3	2674	c.2563delA	c.(2563-2565)atgfs	p.M855fs	SALL4_ENST00000483130.1_5'Flank|SALL4_ENST00000371539.3_Frame_Shift_Del_p.M78fs|SALL4_ENST00000395997.3_Frame_Shift_Del_p.M418fs	NM_020436.3	NP_065169.1	Q9UJQ4	SALL4_HUMAN	spalt-like transcription factor 4	855					embryonic limb morphogenesis (GO:0030326)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(27)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						AAAGGGGTCATCCCTGGGGAC	0.577																																						dbGAP											0													58.0	53.0	55.0					20																	50405579		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AK001666	CCDS13438.1	20q13.2	2014-09-17	2013-10-17		ENSG00000101115	ENSG00000101115		"""Zinc fingers, C2H2-type"""	15924	protein-coding gene	gene with protein product		607343	"""sal (Drosophila)-like 4"", ""sal-like 4 (Drosophila)"""				Standard	NM_020436		Approved	dJ1112F19.1, ZNF797	uc002xwh.4	Q9UJQ4	OTTHUMG00000032752	ENST00000217086.4:c.2563delA	20.37:g.50405579delT	ENSP00000217086:p.Met855fs		A2A2D8|Q540H3|Q6Y8G6	Frame_Shift_Del	DEL	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.M855fs	ENST00000217086.4	37	c.2563	CCDS13438.1	20																																																																																			SALL4	-	NULL	ENSG00000101115		0.577	SALL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL4	HGNC	protein_coding	OTTHUMT00000079738.3	54	0.00	0	T			50405579	50405579	-1	no_errors	ENST00000217086	ensembl	human	known	69_37n	frame_shift_del	32	21.95	9	DEL	0.000	-
SAMD9	54809	genome.wustl.edu	37	7	92731415	92731415	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr7:92731415G>C	ENST00000379958.2	-	3	4265	c.3996C>G	c.(3994-3996)tgC>tgG	p.C1332W		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	1332						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			GGTTTCTCCTGCATCTCTCTA	0.348																																						dbGAP											0													102.0	109.0	107.0					7																	92731415		2202	4299	6501	-	-	-	SO:0001583	missense	0			AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.3996C>G	7.37:g.92731415G>C	ENSP00000369292:p.Cys1332Trp		A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.C1332W	ENST00000379958.2	37	c.3996	CCDS34680.1	7	.	.	.	.	.	.	.	.	.	.	G	1.394	-0.579946	0.03854	.	.	ENSG00000205413	ENST00000379958	T	0.23147	1.92	4.32	-4.89	0.03103	.	1.308880	0.05504	N	0.558972	T	0.18257	0.0438	L	0.29908	0.895	0.09310	N	1	B	0.33637	0.42	B	0.28849	0.095	T	0.26326	-1.0106	10	0.40728	T	0.16	2.3472	14.066	0.64828	0.2674:0.0:0.7326:0.0	.	1332	Q5K651	SAMD9_HUMAN	W	1332	ENSP00000369292:C1332W	ENSP00000369292:C1332W	C	-	3	2	SAMD9	92569351	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.021000	0.03615	-0.685000	0.05177	-1.181000	0.01715	TGC	SAMD9	-	NULL	ENSG00000205413		0.348	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD9	HGNC	protein_coding	OTTHUMT00000341761.1	122	0.00	0	G	NM_017654		92731415	92731415	-1	no_errors	ENST00000379958	ensembl	human	known	69_37n	missense	31	26.19	11	SNP	0.000	C
SCYL3	57147	genome.wustl.edu	37	1	169825046	169825046	+	Silent	SNP	C	C	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr1:169825046C>T	ENST00000367770.1	-	11	1412	c.1365G>A	c.(1363-1365)ttG>ttA	p.L455L	SCYL3_ENST00000367772.4_Silent_p.L455L|SCYL3_ENST00000367771.6_Intron			Q8IZE3	PACE1_HUMAN	SCY1-like 3 (S. cerevisiae)	455					cell migration (GO:0016477)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)	ATP binding (GO:0005524)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(5)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					AGGGGTTCTCCAAGATTGGCG	0.423																																						dbGAP											0													91.0	85.0	87.0					1																	169825046		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC014662	CCDS1286.1, CCDS1287.1	1q24.2	2008-02-05			ENSG00000000457	ENSG00000000457			19285	protein-coding gene	gene with protein product	"""ezrin-binding partner PACE-1"""	608192				12651155	Standard	NM_020423		Approved	PACE-1, PACE1	uc001ggs.3	Q8IZE3	OTTHUMG00000035941	ENST00000367770.1:c.1365G>A	1.37:g.169825046C>T			A8K8Z2|Q5THA6|Q5THA8|Q8IZN9|Q96C56|Q9UBK6	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_HEAT_type_2,pfscan_Prot_kinase_cat_dom	p.L455	ENST00000367770.1	37	c.1365	CCDS1287.1	1																																																																																			SCYL3	-	NULL	ENSG00000000457		0.423	SCYL3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SCYL3	HGNC	protein_coding	OTTHUMT00000087550.4	134	0.00	0	C	NM_181093		169825046	169825046	-1	no_errors	ENST00000367770	ensembl	human	known	69_37n	silent	64	11.11	8	SNP	0.299	T
SEMG2	6407	genome.wustl.edu	37	20	43851891	43851891	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr20:43851891C>G	ENST00000372769.3	+	2	1708	c.1618C>G	c.(1618-1620)Cat>Gat	p.H540D		NM_003008.2	NP_002999.1	Q02383	SEMG2_HUMAN	semenogelin II	540	Repeat-rich region.				sexual reproduction (GO:0019953)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|secretory granule (GO:0030141)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(6)|lung(9)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Myeloproliferative disorder(115;0.0122)				CCTACTCAGTCATGAACAAAA	0.388																																						dbGAP											0													101.0	84.0	90.0					20																	43851891		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13346.1	20q12-q13.1	2008-07-02			ENSG00000124157	ENSG00000124157			10743	protein-coding gene	gene with protein product	"""Semenogelin 2"""	182141				1517240, 9523691	Standard	NM_003008		Approved	SGII	uc002xnk.3	Q02383	OTTHUMG00000032566	ENST00000372769.3:c.1618C>G	20.37:g.43851891C>G	ENSP00000361855:p.His540Asp		Q53ZU2|Q6X2M5|Q6X2M6	Missense_Mutation	SNP	pfam_Semenogelin	p.H540D	ENST00000372769.3	37	c.1618	CCDS13346.1	20	.	.	.	.	.	.	.	.	.	.	C	2.934	-0.220420	0.06061	.	.	ENSG00000124157	ENST00000372769	T	0.07688	3.17	1.38	-2.31	0.06765	.	.	.	.	.	T	0.08133	0.0203	L	0.55481	1.735	0.09310	N	1	B;B	0.33413	0.411;0.411	B;B	0.34652	0.131;0.187	T	0.26710	-1.0095	9	0.42905	T	0.14	.	5.217	0.15348	0.0:0.4207:0.0:0.5793	.	540;540	A8K6Z6;Q02383	.;SEMG2_HUMAN	D	540	ENSP00000361855:H540D	ENSP00000361855:H540D	H	+	1	0	SEMG2	43285305	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.062000	0.14389	-0.757000	0.04697	-0.768000	0.03414	CAT	SEMG2	-	pfam_Semenogelin	ENSG00000124157		0.388	SEMG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMG2	HGNC	protein_coding	OTTHUMT00000079417.1	85	0.00	0	C	NM_003008		43851891	43851891	+1	no_errors	ENST00000372769	ensembl	human	known	69_37n	missense	46	14.81	8	SNP	0.000	G
SLC6A13	6540	genome.wustl.edu	37	12	368960	368960	+	Intron	SNP	G	G	A			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr12:368960G>A	ENST00000343164.4	-	2	255				SLC6A13_ENST00000445055.2_Intron|SLC6A13_ENST00000436453.1_Missense_Mutation_p.L87F|RP11-283I3.4_ENST00000540868.1_RNA	NM_016615.4	NP_057699.2	Q9NSD5	S6A13_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 13						neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|prostate(1)|urinary_tract(1)	28	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)			AAGTGCAGGAGATGGAAGTAT	0.517																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U76343	CCDS8502.1, CCDS53729.1, CCDS58198.1	12p13.33	2013-07-19	2013-07-19		ENSG00000010379	ENSG00000010379		"""Solute carriers"""	11046	protein-coding gene	gene with protein product	"""GABA transporter 2"""	615097	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 13"""				Standard	NM_001243392		Approved	GAT2	uc001qic.2	Q9NSD5	OTTHUMG00000168053	ENST00000343164.4:c.202+56C>T	12.37:g.368960G>A			B4DJL1|Q8TCC2|Q8WW56	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport	p.L87F	ENST00000343164.4	37	c.259	CCDS8502.1	12	.	.	.	.	.	.	.	.	.	.	G	9.589	1.125737	0.20959	.	.	ENSG00000010379	ENST00000436453	T	0.58358	0.34	4.66	1.87	0.25490	.	.	.	.	.	T	0.39989	0.1099	.	.	.	0.18873	N	0.999983	B	0.06786	0.001	B	0.06405	0.002	T	0.34875	-0.9811	8	0.72032	D	0.01	.	6.4313	0.21798	0.3055:0.0:0.6945:0.0	.	87	Q8WW56	.	F	87	ENSP00000389316:L87F	ENSP00000389316:L87F	L	-	1	0	SLC6A13	239221	0.038000	0.19896	0.007000	0.13788	0.007000	0.05969	1.853000	0.39358	0.219000	0.20840	0.467000	0.42956	CTC	SLC6A13	-	NULL	ENSG00000010379		0.517	SLC6A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A13	HGNC	protein_coding	OTTHUMT00000397801.1	62	0.00	0	G	NM_016615		368960	368960	-1	no_errors	ENST00000436453	ensembl	human	putative	69_37n	missense	18	21.74	5	SNP	0.043	A
SMURF1	57154	genome.wustl.edu	37	7	98638117	98638117	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr7:98638117G>T	ENST00000361125.1	-	14	1831	c.1512C>A	c.(1510-1512)caC>caA	p.H504Q	SMURF1_ENST00000361368.2_Missense_Mutation_p.H478Q|AC004893.11_ENST00000468960.2_RNA	NM_020429.2	NP_065162.1	Q9HCE7	SMUF1_HUMAN	SMAD specific E3 ubiquitin protein ligase 1	504	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				BMP signaling pathway (GO:0030509)|cell differentiation (GO:0030154)|ectoderm development (GO:0007398)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of ossification (GO:0030279)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein export from nucleus (GO:0006611)|protein localization to cell surface (GO:0034394)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|receptor catabolic process (GO:0032801)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	activin binding (GO:0048185)|I-SMAD binding (GO:0070411)|ligase activity (GO:0016874)|R-SMAD binding (GO:0070412)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|urinary_tract(1)	25	all_cancers(62;1.05e-08)|all_epithelial(64;4.34e-09)|Lung NSC(181;0.00902)|all_lung(186;0.0145)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)|Lung(104;0.224)			CGTTGATGTAGTGTCCATGGA	0.542											OREG0018189	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													97.0	91.0	93.0					7																	98638117		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046845	CCDS34689.1, CCDS34690.1	7q21.1-q31.1	2004-07-29			ENSG00000198742	ENSG00000198742			16807	protein-coding gene	gene with protein product		605568				10458166	Standard	NM_020429		Approved	KIAA1625	uc003upu.2	Q9HCE7	OTTHUMG00000150272	ENST00000361125.1:c.1512C>A	7.37:g.98638117G>T	ENSP00000354621:p.His504Gln	1337	A4D279|B7ZMB6|B9EGV3|O75853|Q547Q3|Q9UJT8	Missense_Mutation	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,pfam_C2_Ca-dep,superfamily_HECT,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_WW_Rsp5_WWP,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_C2_membr_targeting,pfscan_WW_Rsp5_WWP	p.H504Q	ENST00000361125.1	37	c.1512	CCDS34690.1	7	.	.	.	.	.	.	.	.	.	.	G	29.8	5.033799	0.93575	.	.	ENSG00000198742	ENST00000361368;ENST00000361125	T;T	0.56444	0.46;0.46	5.6	5.6	0.85130	HECT (4);	0.000000	0.85682	D	0.000000	T	0.66607	0.2806	L	0.39085	1.19	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.998	T	0.67542	-0.5644	10	0.72032	D	0.01	.	19.9855	0.97347	0.0:0.0:1.0:0.0	.	478;504;478	Q9HCE7-2;Q9HCE7;B9EGV3	.;SMUF1_HUMAN;.	Q	478;504	ENSP00000355326:H478Q;ENSP00000354621:H504Q	ENSP00000354621:H504Q	H	-	3	2	SMURF1	98476053	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	6.670000	0.74467	2.806000	0.96561	0.655000	0.94253	CAC	SMURF1	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000198742		0.542	SMURF1-001	KNOWN	basic|CCDS	protein_coding	SMURF1	HGNC	protein_coding	OTTHUMT00000335001.2	71	0.00	0	G	NM_020429		98638117	98638117	-1	no_errors	ENST00000361125	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	1.000	T
SP140L	93349	genome.wustl.edu	37	2	231266471	231266471	+	Silent	SNP	G	G	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr2:231266471G>T	ENST00000415673.2	+	18	1679	c.1593G>T	c.(1591-1593)ggG>ggT	p.G531G	SP140L_ENST00000396563.4_3'UTR|SP140L_ENST00000243810.6_3'UTR	NM_138402.4	NP_612411.4	Q9H930	SP14L_HUMAN	SP140 nuclear body protein-like	531	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.					nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(7)|prostate(1)|skin(1)	20						AAGTGGAGGGGTTTGTACAAG	0.507																																						dbGAP											0													24.0	24.0	24.0					2																	231266471		1776	4023	5799	-	-	-	SO:0001819	synonymous_variant	0			BC004921	CCDS46538.1	2q37.1	2013-01-28			ENSG00000185404	ENSG00000185404		"""Zinc fingers, PHD-type"""	25105	protein-coding gene	gene with protein product						12477932	Standard	NM_138402		Approved		uc010fxm.1	Q9H930	OTTHUMG00000153730	ENST00000415673.2:c.1593G>T	2.37:g.231266471G>T			Q2M375|Q4ZG65|Q9BSP3	Silent	SNP	pfam_Sp100,pfam_SAND_dom,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_SAND_dom-like,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_SAND_dom,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_SAND_dom,pfscan_Bromodomain	p.G531	ENST00000415673.2	37	c.1593	CCDS46538.1	2																																																																																			SP140L	-	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain	ENSG00000185404		0.507	SP140L-009	KNOWN	basic|appris_principal|CCDS	protein_coding	SP140L	HGNC	protein_coding	OTTHUMT00000374538.1	92	0.00	0	G	NM_138402		231266471	231266471	+1	no_errors	ENST00000415673	ensembl	human	known	69_37n	silent	27	27.03	10	SNP	0.031	T
SPTSSA	171546	genome.wustl.edu	37	14	34904481	34904481	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr14:34904481C>T	ENST00000298130.4	-	2	290	c.142G>A	c.(142-144)Gca>Aca	p.A48T		NM_138288.3	NP_612145.2	Q969W0	SPTSA_HUMAN	serine palmitoyltransferase, small subunit A	48					sphingolipid biosynthetic process (GO:0030148)	integral component of membrane (GO:0016021)|serine C-palmitoyltransferase complex (GO:0017059)											GTGTATAGTGCCATCCCCACA	0.398																																						dbGAP											0													156.0	129.0	138.0					14																	34904481		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001993	CCDS9647.2	14q13.1	2011-07-26	2011-07-26	2011-07-26	ENSG00000165389	ENSG00000165389			20361	protein-coding gene	gene with protein product	"""small subunit of serine palmitoyltransferase A"""	613540	"""chromosome 14 open reading frame 147"""	C14orf147		19416851	Standard	NM_138288		Approved	ssSPTa	uc001wsc.3	Q969W0	OTTHUMG00000140212	ENST00000298130.4:c.142G>A	14.37:g.34904481C>T	ENSP00000298130:p.Ala48Thr		B2RD54|D3DS93|Q8WTZ7	Missense_Mutation	SNP	pfam_Ser_palmitoyltrfase_ssu-like	p.A48T	ENST00000298130.4	37	c.142	CCDS9647.2	14	.	.	.	.	.	.	.	.	.	.	.	22.8	4.338459	0.81911	.	.	ENSG00000165389	ENST00000298130	.	.	.	5.72	4.82	0.62117	.	0.067971	0.56097	D	0.000021	T	0.77850	0.4192	.	.	.	0.80722	D	1	D	0.65815	0.995	D	0.66716	0.946	T	0.78510	-0.2176	8	0.39692	T	0.17	-19.2885	16.996	0.86368	0.0:0.8725:0.1275:0.0	.	48	Q969W0	SPTSA_HUMAN	T	48	.	ENSP00000298130:A48T	A	-	1	0	SPTSSA	33974232	1.000000	0.71417	0.997000	0.53966	0.981000	0.71138	7.303000	0.78871	1.531000	0.49152	0.650000	0.86243	GCA	SPTSSA	-	pfam_Ser_palmitoyltrfase_ssu-like	ENSG00000165389		0.398	SPTSSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTSSA	HGNC	protein_coding	OTTHUMT00000276640.2	180	0.00	0	C	NM_138288		34904481	34904481	-1	no_errors	ENST00000298130	ensembl	human	known	69_37n	missense	74	20.43	19	SNP	1.000	T
SRCAP	10847	genome.wustl.edu	37	16	30745237	30745237	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr16:30745237G>T	ENST00000262518.4	+	30	6902	c.6517G>T	c.(6517-6519)Gag>Tag	p.E2173*	SRCAP_ENST00000395059.2_Nonsense_Mutation_p.E2111*|SRCAP_ENST00000344771.4_Nonsense_Mutation_p.E2015*	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	2173	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			ACGGACAGTGGAGGAGAACAT	0.473																																						dbGAP											0													85.0	74.0	78.0					16																	30745237		2197	4300	6497	-	-	-	SO:0001587	stop_gained	0			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.6517G>T	16.37:g.30745237G>T	ENSP00000262518:p.Glu2173*		B0JZA6|O15026|Q7Z744|Q9Y5L9	Nonsense_Mutation	SNP	pfam_SNF2_N,pfam_HSA,pfam_Helicase_C,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,smart_AT_hook_DNA-bd_motif,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_AT_hook-like	p.E2173*	ENST00000262518.4	37	c.6517	CCDS10689.2	16	.	.	.	.	.	.	.	.	.	.	G	47	13.279298	0.99732	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	.	.	.	5.24	5.24	0.73138	.	0.000000	0.49916	D	0.000125	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-13.1693	17.7482	0.88427	0.0:0.0:1.0:0.0	.	.	.	.	X	2173;2111;2015	.	ENSP00000262518:E2173X	E	+	1	0	SRCAP	30652738	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.405000	0.97313	2.715000	0.92844	0.563000	0.77884	GAG	SRCAP	-	pfscan_Helicase_C	ENSG00000080603		0.473	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRCAP	HGNC	protein_coding	OTTHUMT00000255523.1	115	0.86	1	G	NM_006662		30745237	30745237	+1	no_errors	ENST00000262518	ensembl	human	known	69_37n	nonsense	39	22.00	11	SNP	1.000	T
STAM2	10254	genome.wustl.edu	37	2	152977211	152977211	+	Silent	SNP	C	C	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr2:152977211C>T	ENST00000263904.4	-	14	1804	c.1455G>A	c.(1453-1455)gtG>gtA	p.V485V		NM_005843.4	NP_005834.4	O75886	STAM2_HUMAN	signal transducing adaptor molecule (SH3 domain and ITAM motif) 2	485					endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)				endometrium(3)|large_intestine(4)|lung(8)|ovary(1)	16				BRCA - Breast invasive adenocarcinoma(221;0.22)		ATGACATATCCACAGACATCC	0.448																																						dbGAP											0													187.0	158.0	168.0					2																	152977211		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF042274	CCDS2196.1	2q23.3	2009-04-29			ENSG00000115145	ENSG00000115145			11358	protein-coding gene	gene with protein product	"""HSE1 homolog (S. cerevisiae)"""	606244				10899310, 10993906	Standard	NM_005843		Approved	Hbp	uc002tyc.4	O75886	OTTHUMG00000131885	ENST00000263904.4:c.1455G>A	2.37:g.152977211C>T			A8K8A0|D3DPA1|Q7LDQ0|Q9UF58	Silent	SNP	pfam_VHS,pfam_SH3_domain,pfam_SH3_2,pfam_Ubiquitin-int_motif,superfamily_ENTH_VHS,superfamily_SH3_domain,smart_VHS_subgr,smart_Ubiquitin-int_motif,smart_SH3_domain,pfscan_SH3_domain,pfscan_Ubiquitin-int_motif,pfscan_VHS,prints_SH3_domain,prints_p67phox	p.V485	ENST00000263904.4	37	c.1455	CCDS2196.1	2																																																																																			STAM2	-	NULL	ENSG00000115145		0.448	STAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAM2	HGNC	protein_coding	OTTHUMT00000254835.2	137	0.00	0	C	NM_005843		152977211	152977211	-1	no_errors	ENST00000263904	ensembl	human	known	69_37n	silent	42	16.00	8	SNP	1.000	T
SUGP2	10147	genome.wustl.edu	37	19	19112432	19112432	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr19:19112432G>A	ENST00000601879.1	-	8	3278	c.2981C>T	c.(2980-2982)tCc>tTc	p.S994F	SUGP2_ENST00000600377.1_Missense_Mutation_p.S1008F|SUGP2_ENST00000337018.6_Missense_Mutation_p.S994F|SUGP2_ENST00000456085.2_Missense_Mutation_p.S763F|SUGP2_ENST00000452918.2_Missense_Mutation_p.S994F			Q8IX01	SUGP2_HUMAN	SURP and G patch domain containing 2	994					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						CTTCTTTTTGGACATGGGACG	0.428																																						dbGAP											0													118.0	99.0	106.0					19																	19112432		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002363	CCDS12392.1	19p13	2013-01-28	2010-08-10	2010-08-10	ENSG00000064607	ENSG00000064607		"""G patch domain containing"""	18641	protein-coding gene	gene with protein product		607993	"""splicing factor, arginine/serine-rich 14"""	SFRS14		12594045	Standard	NM_014884		Approved	KIAA0365	uc002nkx.2	Q8IX01		ENST00000601879.1:c.2981C>T	19.37:g.19112432G>A	ENSP00000472286:p.Ser994Phe		C9JI71|O15071|O60369|Q5JPH7|Q8WUF7	Missense_Mutation	SNP	pfam_Surp,pfam_G_patch_dom,superfamily_Surp,smart_Surp,smart_G_patch_dom,pfscan_Surp,pfscan_G_patch_dom	p.S994F	ENST00000601879.1	37	c.2981	CCDS12392.1	19	.	.	.	.	.	.	.	.	.	.	g	21.6	4.175683	0.78564	.	.	ENSG00000064607	ENST00000337018;ENST00000330854;ENST00000452918;ENST00000456085	T;T;T;T	0.12984	2.84;2.87;2.84;2.63	5.24	5.24	0.73138	.	0.730582	0.12339	N	0.477629	T	0.16041	0.0386	N	0.24115	0.695	0.21675	N	0.999593	D;P;P	0.62365	0.991;0.93;0.943	P;P;P	0.47744	0.556;0.459;0.547	T	0.15178	-1.0446	10	0.62326	D	0.03	-9.4134	15.9866	0.80157	0.0:0.0:1.0:0.0	.	763;994;994	E7ETX7;A8K5G0;Q8IX01	.;.;SUGP2_HUMAN	F	994;942;994;763	ENSP00000337926:S994F;ENSP00000332373:S942F;ENSP00000389380:S994F;ENSP00000409603:S763F	ENSP00000332373:S942F	S	-	2	0	SUGP2	18973432	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.510000	0.53393	2.447000	0.82792	0.580000	0.79431	TCC	SUGP2	-	NULL	ENSG00000064607		0.428	SUGP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SUGP2	HGNC	protein_coding	OTTHUMT00000464627.1	90	0.00	0	G	NM_001017392		19112432	19112432	-1	no_errors	ENST00000337018	ensembl	human	known	69_37n	missense	33	21.43	9	SNP	0.996	A
TBX15	6913	genome.wustl.edu	37	1	119467310	119467310	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr1:119467310T>C	ENST00000369429.3	-	4	661	c.652A>G	c.(652-654)Aaa>Gaa	p.K218E	TBX15_ENST00000207157.3_Missense_Mutation_p.K112E			Q96SF7	TBX15_HUMAN	T-box 15	218					embryonic cranial skeleton morphogenesis (GO:0048701)	Tle3-Aes complex (GO:0070722)	RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(19)|ovary(1)|pancreas(1)|skin(5)	37	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)		AGCTTGAGTTTGTCAAAACTG	0.458																																						dbGAP											0													163.0	156.0	158.0					1																	119467310		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK127536	CCDS30816.1	1p11.1	2008-02-05	2004-10-05		ENSG00000092607	ENSG00000092607		"""T-boxes"""	11594	protein-coding gene	gene with protein product		604127	"""T-box 14"""	TBX14		9693034	Standard	XM_005271162		Approved		uc001ehl.1	Q96SF7	OTTHUMG00000012263	ENST00000369429.3:c.652A>G	1.37:g.119467310T>C	ENSP00000358437:p.Lys218Glu		Q08E76|Q5JT54|Q5T9S7	Missense_Mutation	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.K218E	ENST00000369429.3	37	c.652		1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.337859	0.81911	.	.	ENSG00000092607	ENST00000207157;ENST00000369429	D;D	0.90732	-2.72;-2.72	5.96	5.96	0.96718	p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.96052	0.8714	M	0.92122	3.275	0.80722	D	1	D	0.69078	0.997	D	0.75020	0.985	D	0.96949	0.9693	10	0.87932	D	0	.	16.4484	0.83959	0.0:0.0:0.0:1.0	.	218	Q96SF7	TBX15_HUMAN	E	112;218	ENSP00000207157:K112E;ENSP00000358437:K218E	ENSP00000207157:K112E	K	-	1	0	TBX15	119268833	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.186000	0.72026	2.285000	0.76669	0.533000	0.62120	AAA	TBX15	-	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	ENSG00000092607		0.458	TBX15-002	PUTATIVE	not_organism_supported|upstream_ATG|basic|appris_principal	protein_coding	TBX15	HGNC	protein_coding	OTTHUMT00000034351.1	104	0.00	0	T	NM_152380		119467310	119467310	-1	no_errors	ENST00000369429	ensembl	human	known	69_37n	missense	28	26.32	10	SNP	1.000	C
TCP1	6950	genome.wustl.edu	37	6	160200683	160200683	+	Frame_Shift_Del	DEL	T	T	-			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr6:160200683delT	ENST00000321394.7	-	11	1710	c.1430delA	c.(1429-1431)aacfs	p.N477fs	TCP1_ENST00000420894.2_Intron|SNORA20_ENST00000384662.1_RNA|TCP1_ENST00000392168.2_Frame_Shift_Del_p.N322fs|TCP1_ENST00000544255.1_Frame_Shift_Del_p.N253fs	NM_030752.2	NP_110379.2	P17987	TCPA_HUMAN	t-complex 1	477					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|tubulin complex assembly (GO:0007021)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|nuclear heterochromatin (GO:0005720)|pericentriolar material (GO:0000242)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|large_intestine(3)|lung(2)	10		Breast(66;1.53e-05)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(65;4.05e-20)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)		ACGTTCTGGGTTAACCTGGGC	0.398																																						dbGAP											0													109.0	109.0	109.0					6																	160200683		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			X52882	CCDS5269.1, CCDS43522.1	6q25-q27	2012-10-02			ENSG00000120438	ENSG00000120438		"""Heat Shock Proteins / Chaperonins"""	11655	protein-coding gene	gene with protein product		186980				3476253, 3653076	Standard	NM_030752		Approved	D6S230E, CCT1, Ccta	uc003qsr.3	P17987	OTTHUMG00000015937	ENST00000321394.7:c.1430delA	6.37:g.160200683delT	ENSP00000317334:p.Asn477fs		E1P5B2|Q15556|Q5TCM3	Frame_Shift_Del	DEL	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,prints_Chaperone_TCP-1,prints_Chaprnin_Cpn60,tigrfam_Chap_CCT_alpha	p.N477fs	ENST00000321394.7	37	c.1430	CCDS5269.1	6																																																																																			TCP1	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,tigrfam_Chap_CCT_alpha	ENSG00000120438		0.398	TCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCP1	HGNC	protein_coding	OTTHUMT00000042917.2	83	0.00	0	T	NM_030752		160200683	160200683	-1	no_errors	ENST00000321394	ensembl	human	known	69_37n	frame_shift_del	32	20.00	8	DEL	1.000	-
TLR3	7098	genome.wustl.edu	37	4	187004105	187004105	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr4:187004105T>C	ENST00000296795.3	+	4	1369	c.1265T>C	c.(1264-1266)aTa>aCa	p.I422T	TLR3_ENST00000504367.1_Missense_Mutation_p.I145T	NM_003265.2	NP_003256.1	O15455	TLR3_HUMAN	toll-like receptor 3	422					activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to drug (GO:0035690)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|cellular response to interferon-gamma (GO:0071346)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|detection of virus (GO:0009597)|extrinsic apoptotic signaling pathway (GO:0097191)|hyperosmotic response (GO:0006972)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|microglial cell activation involved in immune response (GO:0002282)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic signaling pathway (GO:0097527)|negative regulation of osteoclast differentiation (GO:0045671)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type III interferon production (GO:0034346)|response to exogenous dsRNA (GO:0043330)|signal transduction (GO:0007165)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	double-stranded RNA binding (GO:0003725)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(5)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(30;1.14e-05)|GBM - Glioblastoma multiforme(59;0.000107)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.16)		ATCTCAAAAATAGAGAGTGAT	0.408																																						dbGAP											0													60.0	56.0	58.0					4																	187004105		2203	4299	6502	-	-	-	SO:0001583	missense	0			U88879	CCDS3846.1	4q35	2014-09-17				ENSG00000164342		"""CD molecules"""	11849	protein-coding gene	gene with protein product		603029				9435236	Standard	NM_003265		Approved	CD283	uc003iyq.3	O15455		ENST00000296795.3:c.1265T>C	4.37:g.187004105T>C	ENSP00000296795:p.Ile422Thr		B2RAI7|B7Z7K0|E6Y0F0|E6Y0F1|E9PGH4|Q4VAL2|Q504W0	Missense_Mutation	SNP	pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.I422T	ENST00000296795.3	37	c.1265	CCDS3846.1	4	.	.	.	.	.	.	.	.	.	.	T	16.23	3.064578	0.55432	.	.	ENSG00000164342	ENST00000296795;ENST00000542020;ENST00000504367	T;T	0.65549	-0.16;-0.16	5.78	3.21	0.36854	.	0.313252	0.38837	N	0.001552	T	0.78470	0.4288	M	0.93375	3.41	0.19300	N	0.999971	P	0.35493	0.505	P	0.50136	0.632	T	0.72197	-0.4363	10	0.87932	D	0	.	8.9359	0.35700	0.1255:0.0:0.1317:0.7427	.	422	O15455	TLR3_HUMAN	T	422;422;145	ENSP00000296795:I422T;ENSP00000423684:I145T	ENSP00000296795:I422T	I	+	2	0	TLR3	187241099	1.000000	0.71417	0.291000	0.24904	0.915000	0.54546	8.008000	0.88588	0.390000	0.25115	0.455000	0.32223	ATA	TLR3	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000164342		0.408	TLR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR3	HGNC	protein_coding	OTTHUMT00000360313.4	90	0.00	0	T			187004105	187004105	+1	no_errors	ENST00000296795	ensembl	human	known	69_37n	missense	15	25.00	5	SNP	0.126	C
TMEM132D	121256	genome.wustl.edu	37	12	129558828	129558828	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr12:129558828C>A	ENST00000422113.2	-	9	3218	c.2892G>T	c.(2890-2892)tgG>tgT	p.W964C	TMEM132D_ENST00000389441.4_Missense_Mutation_p.W502C	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	964					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		TTAACCCAACCCAGTCATGAG	0.468																																						dbGAP											0													131.0	117.0	121.0					12																	129558828		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.2892G>T	12.37:g.129558828C>A	ENSP00000408581:p.Trp964Cys		Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	NULL	p.W964C	ENST00000422113.2	37	c.2892	CCDS9266.1	12	.	.	.	.	.	.	.	.	.	.	C	15.02	2.709510	0.48517	.	.	ENSG00000151952	ENST00000389441;ENST00000422113	T;T	0.56103	0.48;0.68	4.14	4.14	0.48551	.	0.101138	0.45606	D	0.000341	T	0.77438	0.4130	M	0.89968	3.075	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.83371	0.0007	9	.	.	.	-19.6425	16.7565	0.85501	0.0:1.0:0.0:0.0	.	964;502	Q14C87;Q14C87-2	T132D_HUMAN;.	C	502;964	ENSP00000374092:W502C;ENSP00000408581:W964C	.	W	-	3	0	TMEM132D	128124781	1.000000	0.71417	0.939000	0.37840	0.497000	0.33675	7.526000	0.81920	2.002000	0.58637	0.411000	0.27672	TGG	TMEM132D	-	NULL	ENSG00000151952		0.468	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132D	HGNC	protein_coding	OTTHUMT00000399592.1	81	0.00	0	C	NM_133448		129558828	129558828	-1	no_errors	ENST00000422113	ensembl	human	known	69_37n	missense	31	20.51	8	SNP	1.000	A
TMEM186	25880	genome.wustl.edu	37	16	8890208	8890208	+	Silent	SNP	C	C	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr16:8890208C>T	ENST00000333050.6	-	2	276	c.243G>A	c.(241-243)ctG>ctA	p.L81L	PMM2_ENST00000566983.1_Intron|PMM2_ENST00000539622.1_5'Flank|PMM2_ENST00000268261.4_5'Flank|TMEM186_ENST00000564869.1_Intron|PMM2_ENST00000537352.1_5'Flank|PMM2_ENST00000569958.1_5'Flank	NM_015421.3	NP_056236.2	Q96B77	TM186_HUMAN	transmembrane protein 186	81						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				NS(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	9						CTACCACTGTCAGGGCAGTCT	0.517																																						dbGAP											0													117.0	103.0	108.0					16																	8890208		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			BC015912	CCDS10535.1	16p13.2	2008-02-05	2007-02-08	2007-02-08	ENSG00000184857	ENSG00000184857			24530	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 51"""	C16orf51		11230166	Standard	NM_015421		Approved	DKFZP564K2062	uc002cze.3	Q96B77	OTTHUMG00000129696	ENST00000333050.6:c.243G>A	16.37:g.8890208C>T			B2RAY0|Q9Y4T4	Silent	SNP	NULL	p.L81	ENST00000333050.6	37	c.243	CCDS10535.1	16																																																																																			TMEM186	-	NULL	ENSG00000184857		0.517	TMEM186-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM186	HGNC	protein_coding	OTTHUMT00000251903.1	112	0.00	0	C	NM_015421		8890208	8890208	-1	no_errors	ENST00000333050	ensembl	human	known	69_37n	silent	26	23.53	8	SNP	0.965	T
TMEM64	169200	genome.wustl.edu	37	8	91638033	91638033	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr8:91638033T>A	ENST00000458549.2	-	3	1186	c.1009A>T	c.(1009-1011)Aat>Tat	p.N337Y	TMEM64_ENST00000418210.2_Missense_Mutation_p.N285Y|TMEM64_ENST00000519519.1_Missense_Mutation_p.N76Y	NM_001008495.3	NP_001008495.2	Q6YI46	TMM64_HUMAN	transmembrane protein 64	337					cytosolic calcium ion homeostasis (GO:0051480)|positive regulation of bone resorption (GO:0045780)|positive regulation of osteoclast differentiation (GO:0045672)|regulation of ATPase activity (GO:0043462)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)	2			BRCA - Breast invasive adenocarcinoma(11;0.0598)			ATAGCTGCATTCAATTCCACT	0.338																																						dbGAP											0													90.0	83.0	85.0					8																	91638033		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL834364	CCDS34920.2, CCDS55260.1	8q21.3	2005-08-09			ENSG00000180694	ENSG00000180694			25441	protein-coding gene	gene with protein product							Standard	NM_001008495		Approved	DKFZp762C1112	uc003yen.2	Q6YI46	OTTHUMG00000157185	ENST00000458549.2:c.1009A>T	8.37:g.91638033T>A	ENSP00000414786:p.Asn337Tyr		B4DUC0|F5GXM4|Q2HIZ7|Q8N3G6	Missense_Mutation	SNP	pfam_SNARE_assoc	p.N337Y	ENST00000458549.2	37	c.1009	CCDS34920.2	8	.	.	.	.	.	.	.	.	.	.	T	19.35	3.811352	0.70797	.	.	ENSG00000180694	ENST00000458549;ENST00000418210;ENST00000422900;ENST00000519519	.	.	.	5.78	4.62	0.57501	.	0.000000	0.85682	D	0.000000	T	0.76564	0.4005	M	0.70595	2.14	0.80722	D	1	D;D;D	0.89917	1.0;0.983;1.0	D;P;D	0.91635	0.999;0.874;0.986	T	0.78023	-0.2366	9	0.72032	D	0.01	.	11.7873	0.52049	0.0:0.0688:0.0:0.9312	.	285;76;337	F5GXM4;Q6YI46-2;Q6YI46	.;.;TMM64_HUMAN	Y	337;285;154;76	.	ENSP00000411951:N285Y	N	-	1	0	TMEM64	91707209	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.110000	0.71535	1.011000	0.39340	0.533000	0.62120	AAT	TMEM64	-	NULL	ENSG00000180694		0.338	TMEM64-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM64	HGNC	protein_coding	OTTHUMT00000347825.1	153	0.00	0	T	NM_001008495		91638033	91638033	-1	no_errors	ENST00000458549	ensembl	human	known	69_37n	missense	48	20.00	12	SNP	1.000	A
TNFRSF25	8718	genome.wustl.edu	37	1	6522132	6522132	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr1:6522132G>T	ENST00000356876.3	-	9	934	c.847C>A	c.(847-849)Cct>Act	p.P283T	TNFRSF25_ENST00000351959.5_Missense_Mutation_p.P246T|TNFRSF25_ENST00000461703.2_5'Flank|TNFRSF25_ENST00000377782.3_Missense_Mutation_p.P292T|TNFRSF25_ENST00000348333.3_Missense_Mutation_p.P238T|TNFRSF25_ENST00000351748.3_Missense_Mutation_p.P100T	NM_003790.2|NM_148967.1	NP_003781.1|NP_683868.1	Q93038	TNR25_HUMAN	tumor necrosis factor receptor superfamily, member 25	283					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell surface receptor signaling pathway (GO:0007166)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|tumor necrosis factor-activated receptor activity (GO:0005031)			breast(1)|central_nervous_system(2)|endometrium(1)|lung(4)|prostate(1)|stomach(1)	10	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Acute lymphoblastic leukemia(12;0.00157)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;4.58e-35)|GBM - Glioblastoma multiforme(13;3.06e-27)|Colorectal(212;6.01e-08)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|BRCA - Breast invasive adenocarcinoma(365;0.00105)|STAD - Stomach adenocarcinoma(132;0.00158)|READ - Rectum adenocarcinoma(331;0.0419)		GGGTAGCCAGGGGTCCAGCTG	0.617																																						dbGAP											0													117.0	113.0	114.0					1																	6522132		2203	4300	6503	-	-	-	SO:0001583	missense	0			U72763	CCDS71.1, CCDS72.1, CCDS73.1, CCDS74.1, CCDS75.1	1p36.2	2008-02-05	2002-12-20	2002-12-20	ENSG00000215788	ENSG00000215788		"""Tumor necrosis factor receptor superfamily"""	11910	protein-coding gene	gene with protein product		603366	"""tumor necrosis factor receptor superfamily, member 12 (translocating chain-association membrane protein)"""	TNFRSF12		9052839, 8934525	Standard	NM_003790		Approved	DR3, TRAMP, WSL-1, LARD, WSL-LR, DDR3, TR3, APO-3	uc001anh.3	Q93038	OTTHUMG00000000831	ENST00000356876.3:c.847C>A	1.37:g.6522132G>T	ENSP00000349341:p.Pro283Thr		B1ALX2|B1ALX3|B7ZLL7|O00275|O00276|O00277|O00278|O00279|O00280|O14865|O14866|P78507|P78515|Q17RU4|Q92983|Q93036|Q93037|Q99722|Q99830|Q99831|Q9BY86|Q9UME0|Q9UME1|Q9UME5	Missense_Mutation	SNP	pfam_Death,superfamily_DEATH-like,smart_TNFR/NGFR_Cys_rich_reg,smart_Death,pfscan_Death,pfscan_TNFR/NGFR_Cys_rich_reg,prints_TNFR_25	p.P292T	ENST00000356876.3	37	c.874	CCDS71.1	1	.	.	.	.	.	.	.	.	.	.	G	7.325	0.617694	0.14129	.	.	ENSG00000215788	ENST00000356876;ENST00000377782;ENST00000351959;ENST00000351748;ENST00000348333	D;D;D;T;D	0.94576	-3.26;-3.46;-3.18;2.4;-2.28	4.62	0.108	0.14548	.	316.290000	0.00166	U	0.000008	D	0.93164	0.7823	M	0.68952	2.095	0.09310	N	1	P;P;P;P;P;P	0.43938	0.673;0.617;0.617;0.544;0.673;0.822	B;B;B;B;P;B	0.44860	0.242;0.382;0.382;0.272;0.462;0.194	T	0.80930	-0.1162	10	0.23302	T	0.38	-29.2181	3.5862	0.07972	0.355:0.1927:0.4523:0.0	.	292;238;246;283;284;100	Q93038-11;Q93038-9;Q93038-10;Q93038;Q93038-2;Q93038-8	.;.;.;TNR25_HUMAN;.;.	T	283;292;246;100;238	ENSP00000349341:P283T;ENSP00000367013:P292T;ENSP00000337713:P246T;ENSP00000326762:P100T;ENSP00000314451:P238T	ENSP00000314451:P238T	P	-	1	0	TNFRSF25	6444719	0.000000	0.05858	0.002000	0.10522	0.134000	0.20937	0.096000	0.15147	0.103000	0.17682	0.655000	0.94253	CCT	TNFRSF25	-	NULL	ENSG00000215788		0.617	TNFRSF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF25	HGNC	protein_coding	OTTHUMT00000002259.1	95	0.00	0	G	NM_148965		6522132	6522132	-1	no_errors	ENST00000377782	ensembl	human	known	69_37n	missense	20	25.93	7	SNP	0.000	T
TNS1	7145	genome.wustl.edu	37	2	218745658	218745658	+	Silent	SNP	G	G	A	rs201041076	byFrequency	TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr2:218745658G>A	ENST00000171887.4	-	16	1469	c.1017C>T	c.(1015-1017)taC>taT	p.Y339Y	TNS1_ENST00000310858.6_Silent_p.Y370Y|TNS1_ENST00000430930.1_Silent_p.Y339Y|TNS1_ENST00000419504.1_Silent_p.Y339Y	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	339					cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		TGAAGTTGTCGTAGGAGTCCC	0.592													G|||	2	0.000399361	0.0	0.0	5008	,	,		16707	0.002		0.0	False		,,,				2504	0.0					dbGAP											0													146.0	123.0	131.0					2																	218745658		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.1017C>T	2.37:g.218745658G>A			Q4ZG71|Q6IPI5	Nonsense_Mutation	SNP	pfam_Tensin_phosphatase_C2-dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,pfscan_Tensin_phosphatase_C2-dom	p.R115*	ENST00000171887.4	37	c.343	CCDS2407.1	2	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	6.325	0.428078	0.11987	.	.	ENSG00000079308	ENST00000453356	.	.	.	4.98	-9.96	0.00443	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8043	0.96521	0.3068:0.0:0.6932:0.0	.	.	.	.	X	115	.	.	R	-	1	2	TNS1	218453903	0.000000	0.05858	0.315000	0.25238	0.852000	0.48524	-2.395000	0.01053	-2.425000	0.00561	-1.036000	0.02392	CGA	TNS1	-	NULL	ENSG00000079308		0.592	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNS1	HGNC	protein_coding	OTTHUMT00000256672.2	90	0.00	0	G	NM_022648		218745658	218745658	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000453356	ensembl	human	putative	69_37n	nonsense	42	12.50	6	SNP	0.028	A
TRPM3	80036	genome.wustl.edu	37	9	73458041	73458041	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr9:73458041C>A	ENST00000377111.2	-	5	922	c.679G>T	c.(679-681)Gtt>Ttt	p.V227F	TRPM3_ENST00000396280.5_Missense_Mutation_p.V74F|TRPM3_ENST00000377097.3_Missense_Mutation_p.V74F|TRPM3_ENST00000408909.2_Missense_Mutation_p.V74F|TRPM3_ENST00000377110.3_Missense_Mutation_p.V227F|TRPM3_ENST00000377105.1_Missense_Mutation_p.V74F|TRPM3_ENST00000361823.5_Missense_Mutation_p.V74F|TRPM3_ENST00000358082.3_Missense_Mutation_p.V74F|TRPM3_ENST00000357533.2_Missense_Mutation_p.V229F|TRPM3_ENST00000396285.1_Missense_Mutation_p.V74F|TRPM3_ENST00000377106.1_Missense_Mutation_p.V74F|TRPM3_ENST00000423814.3_Missense_Mutation_p.V229F|TRPM3_ENST00000396283.1_Missense_Mutation_p.V74F|TRPM3_ENST00000360823.2_Missense_Mutation_p.V74F|TRPM3_ENST00000377101.1_Missense_Mutation_p.V74F|TRPM3_ENST00000396292.4_Missense_Mutation_p.V74F	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	227					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						TGACGAATAACACCTAAAAAA	0.383																																						dbGAP											0													51.0	49.0	49.0					9																	73458041		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.679G>T	9.37:g.73458041C>A	ENSP00000366315:p.Val227Phe		A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.V229F	ENST00000377111.2	37	c.685		9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.7|22.7	4.323106|4.323106	0.81580|0.81580	.|.	.|.	ENSG00000083067|ENSG00000083067	ENST00000396280|ENST00000377111;ENST00000377110;ENST00000377106;ENST00000360823;ENST00000377105;ENST00000357533;ENST00000408909;ENST00000396285;ENST00000396292;ENST00000358082;ENST00000423814;ENST00000377101;ENST00000396283;ENST00000361823;ENST00000455451	.|T;T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.08896	.|3.04;3.04;3.04;3.04;3.04;3.04;3.04;3.04;3.04;3.04;3.04;3.04;3.04;3.04	5.71|5.71	5.71|5.71	0.89125|0.89125	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.38665|0.38665	0.1049|0.1049	M|M	0.89353|0.89353	3.025|3.025	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D;D;D;D;D;D	.|0.89917	.|1.0;0.999;0.999;0.964;1.0;0.999;0.97;0.97;0.999;1.0;0.992	.|D;D;D;P;D;D;P;P;D;D;D	.|0.83275	.|0.987;0.983;0.979;0.82;0.995;0.996;0.665;0.665;0.996;0.994;0.943	T|T	0.36939|0.36939	-0.9727|-0.9727	5|10	.|0.87932	.|D	.|0	-24.7192|-24.7192	19.855|19.855	0.96755|0.96755	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|227;229;74;227;227;227;229;74;74;227;74	.|Q9HCF6;Q4VXD2;Q504Y1;Q9HCF6-2;Q9HCF6-10;Q9HCF6-4;A2A3F7;A2A3F4;G5E9G1;Q9HCF6-8;A2A3F3	.|TRPM3_HUMAN;.;.;.;.;.;.;.;.;.;.	F|F	73|227;227;74;74;74;229;74;74;74;74;229;74;74;74;74	.|ENSP00000366315:V227F;ENSP00000366314:V227F;ENSP00000366310:V74F;ENSP00000354066:V74F;ENSP00000366309:V74F;ENSP00000350140:V229F;ENSP00000386127:V74F;ENSP00000379581:V74F;ENSP00000379587:V74F;ENSP00000350791:V74F;ENSP00000389542:V229F;ENSP00000366305:V74F;ENSP00000379579:V74F;ENSP00000355395:V74F	.|ENSP00000350140:V229F	C|V	-|-	2|1	0|0	TRPM3|TRPM3	72647861|72647861	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.434000|0.434000	0.31775|0.31775	7.744000|7.744000	0.85034|0.85034	2.691000|2.691000	0.91804|0.91804	0.561000|0.561000	0.74099|0.74099	TGT|GTT	TRPM3	-	NULL	ENSG00000083067		0.383	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	TRPM3	HGNC	protein_coding	OTTHUMT00000214157.5	69	0.00	0	C	NM_206945		73458041	73458041	-1	no_errors	ENST00000423814	ensembl	human	known	69_37n	missense	20	20.00	5	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179438827	179438827	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr2:179438827G>T	ENST00000591111.1	-	276	67333	c.67109C>A	c.(67108-67110)cCa>cAa	p.P22370Q	TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P21443Q|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P15138Q|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P24011Q|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P15071Q|TTN_ENST00000460472.2_Missense_Mutation_p.P14946Q|TTN-AS1_ENST00000592600.1_RNA			Q8WZ42	TITIN_HUMAN	titin	22370	Fibronectin type-III 62. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGCTCAGATGGTGGACTGAT	0.423																																						dbGAP											0													111.0	105.0	107.0					2																	179438827		1982	4170	6152	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.67109C>A	2.37:g.179438827G>T	ENSP00000465570:p.Pro22370Gln		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.P21443Q	ENST00000591111.1	37	c.64328		2	.	.	.	.	.	.	.	.	.	.	G	18.97	3.735180	0.69189	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.47528	0.84;0.84;0.84;0.84	5.68	5.68	0.88126	Fibronectin, type III (3);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.81403	0.4815	H	0.97758	4.07	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.998;0.998;1.0	D	0.87636	0.2519	9	0.87932	D	0	.	19.7815	0.96417	0.0:0.0:1.0:0.0	.	14946;15071;15138;22370	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	Q	21443;14946;15138;15071;14944	ENSP00000343764:P21443Q;ENSP00000434586:P14946Q;ENSP00000340554:P15138Q;ENSP00000352154:P15071Q	ENSP00000340554:P15138Q	P	-	2	0	TTN	179147073	1.000000	0.71417	0.978000	0.43139	0.993000	0.82548	9.869000	0.99810	2.692000	0.91855	0.561000	0.74099	CCA	TTN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,pfscan_Fibronectin_type3	ENSG00000155657		0.423	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	114	0.00	0	G	NM_133378		179438827	179438827	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	52	14.75	9	SNP	1.000	T
UHRF1BP1L	23074	genome.wustl.edu	37	12	100444935	100444935	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr12:100444935G>C	ENST00000279907.7	-	16	3701	c.3489C>G	c.(3487-3489)aaC>aaG	p.N1163K	UHRF1BP1L_ENST00000545232.2_Missense_Mutation_p.N813K	NM_015054.1	NP_055869.1	A0JNW5	UH1BL_HUMAN	UHRF1 binding protein 1-like	1163										breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(21)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	50						AATTCTGTAGGTTTGCACCAG	0.353																																						dbGAP											0													133.0	124.0	127.0					12																	100444935		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS31882.1, CCDS31883.1	12q23.1	2011-04-15	2008-08-15		ENSG00000111647	ENSG00000111647			29102	protein-coding gene	gene with protein product							Standard	XM_005268737		Approved	KIAA0701	uc001tgq.3	A0JNW5	OTTHUMG00000170195	ENST00000279907.7:c.3489C>G	12.37:g.100444935G>C	ENSP00000279907:p.Asn1163Lys		A0PJE5|O75183|Q8NDL1|Q96C30|Q9BTS5|Q9H0F1	Missense_Mutation	SNP	NULL	p.N1163K	ENST00000279907.7	37	c.3489	CCDS31882.1	12	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.797063	0.00617	.	.	ENSG00000111647	ENST00000279907;ENST00000545232	T;T	0.09073	3.02;3.02	5.03	-2.31	0.06765	.	1.296430	0.04822	N	0.437076	T	0.03871	0.0109	N	0.16478	0.41	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.36866	-0.9730	10	0.06625	T	0.88	-2.4905	2.217	0.03962	0.4598:0.2002:0.2297:0.1103	.	1163	A0JNW5	UH1BL_HUMAN	K	1163;813	ENSP00000279907:N1163K;ENSP00000444824:N813K	ENSP00000279907:N1163K	N	-	3	2	UHRF1BP1L	98969066	0.001000	0.12720	0.001000	0.08648	0.084000	0.17831	0.041000	0.13927	-0.375000	0.07955	-0.142000	0.14014	AAC	UHRF1BP1L	-	NULL	ENSG00000111647		0.353	UHRF1BP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UHRF1BP1L	HGNC	protein_coding	OTTHUMT00000407875.1	201	0.00	0	G	NM_001006947		100444935	100444935	-1	no_errors	ENST00000279907	ensembl	human	known	69_37n	missense	85	18.27	19	SNP	0.000	C
USP9X	8239	genome.wustl.edu	37	X	41043849	41043849	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chrX:41043849C>G	ENST00000324545.8	+	23	4112	c.3479C>G	c.(3478-3480)aCt>aGt	p.T1160S	USP9X_ENST00000378308.2_Missense_Mutation_p.T1160S	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	1160					axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						CTTTTGCTAACTGCCATTGGC	0.438																																					Ovarian(172;1807 2695 35459 49286)	dbGAP											0													78.0	73.0	75.0					X																	41043849		2172	4283	6455	-	-	-	SO:0001583	missense	0			X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.3479C>G	X.37:g.41043849C>G	ENSP00000316357:p.Thr1160Ser		O75550|Q8WWT3|Q8WX12	Missense_Mutation	SNP	pfam_Peptidase_C19,superfamily_ARM-type_fold,pfscan_Peptidase_C19	p.T1160S	ENST00000324545.8	37	c.3479	CCDS43930.1	X	.	.	.	.	.	.	.	.	.	.	C	18.96	3.733141	0.69189	.	.	ENSG00000124486	ENST00000378308;ENST00000324545	T;T	0.16743	2.32;2.32	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.30293	0.0760	L	0.60455	1.87	0.58432	D	0.999999	D;P	0.53745	0.962;0.873	P;B	0.52031	0.688;0.409	T	0.01266	-1.1401	10	0.21540	T	0.41	.	18.9735	0.92724	0.0:1.0:0.0:0.0	.	1160;1160	Q93008-1;Q93008	.;USP9X_HUMAN	S	1160	ENSP00000367558:T1160S;ENSP00000316357:T1160S	ENSP00000316357:T1160S	T	+	2	0	USP9X	40928793	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.818000	0.86416	2.429000	0.82318	0.513000	0.50165	ACT	USP9X	-	NULL	ENSG00000124486		0.438	USP9X-003	KNOWN	basic|CCDS	protein_coding	USP9X	HGNC	protein_coding	OTTHUMT00000056250.4	157	0.00	0	C	NM_004652		41043849	41043849	+1	no_errors	ENST00000324545	ensembl	human	known	69_37n	missense	34	39.29	22	SNP	1.000	G
VAX1	11023	genome.wustl.edu	37	10	118891744	118891744	+	IGR	SNP	C	C	G			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr10:118891744C>G	ENST00000369206.5	-	0	1723				VAX1_ENST00000277905.2_Silent_p.G179G	NM_001112704.1	NP_001106175.1	Q5SQQ9	VAX1_HUMAN	ventral anterior homeobox 1						axon guidance (GO:0007411)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|palate development (GO:0060021)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(1)|lung(8)|ovary(2)	12				all cancers(201;0.0108)		ACCCTCTGCCCCCGGAGTCCC	0.527																																						dbGAP											0													49.0	61.0	57.0					10																	118891744		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0			AK127095	CCDS7597.1, CCDS44483.1	10q26.11	2011-06-20			ENSG00000148704	ENSG00000148704		"""Homeoboxes / ANTP class : NKL subclass"""	12660	protein-coding gene	gene with protein product		604294				9636075, 10485894	Standard	NM_199131		Approved		uc009xyx.3	Q5SQQ9	OTTHUMG00000019117		10.37:g.118891744C>G			B1AVW5|Q6ZSX0	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.G179	ENST00000369206.5	37	c.537	CCDS44483.1	10																																																																																			VAX1	-	NULL	ENSG00000148704		0.527	VAX1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	VAX1	HGNC	protein_coding	OTTHUMT00000050559.3	66	0.00	0	C	XM_301242		118891744	118891744	-1	no_errors	ENST00000277905	ensembl	human	known	69_37n	silent	27	20.59	7	SNP	0.000	G
WDR24	84219	genome.wustl.edu	37	16	735108	735109	+	Frame_Shift_Ins	INS	-	-	A			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr16:735108_735109insA	ENST00000248142.6	-	12	2476_2477	c.2477_2478insT	c.(2476-2478)gtgfs	p.V826fs	JMJD8_ENST00000562824.1_5'Flank|WDR24_ENST00000293883.4_Frame_Shift_Ins_p.V696fs|JMJD8_ENST00000293882.4_5'Flank|JMJD8_ENST00000562111.1_5'Flank|JMJD8_ENST00000412368.2_5'Flank|JMJD8_ENST00000454700.1_5'Flank|JMJD8_ENST00000609261.1_5'Flank			Q96S15	WDR24_HUMAN	WD repeat domain 24	826										breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|urinary_tract(3)	19		Hepatocellular(780;0.0218)				TCAGCTTGACCACCTCGTTGGA	0.658																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AL136863	CCDS10420.1	16p13.3	2013-01-09			ENSG00000127580	ENSG00000127580		"""WD repeat domain containing"""	20852	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 21"""	C16orf21		11230166	Standard	NM_032259		Approved	DKFZp434F054, JFP7	uc002ciz.1	Q96S15	OTTHUMG00000090421	ENST00000248142.6:c.2478dupT	16.37:g.735109_735109dupA	ENSP00000248142:p.Val826fs		A2IDB8|D3DU59|Q96GC7|Q9H0B7	Frame_Shift_Ins	INS	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V827fs	ENST00000248142.6	37	c.2478_2477		16																																																																																			WDR24	-	NULL	ENSG00000127580		0.658	WDR24-201	KNOWN	basic	protein_coding	WDR24	HGNC	protein_coding		24	0.00	0	-	NM_032259		735108	735109	-1	no_errors	ENST00000248142	ensembl	human	known	69_37n	frame_shift_ins	16	20.00	4	INS	1.000:1.000	A
XPNPEP3	63929	genome.wustl.edu	37	22	41253216	41253216	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr22:41253216G>C	ENST00000357137.4	+	1	115	c.31G>C	c.(31-33)Gtt>Ctt	p.V11L	XPNPEP3_ENST00000541156.1_Missense_Mutation_p.V11L|ST13_ENST00000216218.3_5'Flank|XPNPEP3_ENST00000482652.1_3'UTR|XPNPEP3_ENST00000414396.1_Missense_Mutation_p.V11L	NM_022098.3	NP_071381.1	Q9NQH7	XPP3_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 3, putative	11					glomerular filtration (GO:0003094)|protein processing (GO:0016485)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	aminopeptidase activity (GO:0004177)|manganese ion binding (GO:0030145)|metallopeptidase activity (GO:0008237)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	17						CCCCAAGCTGGTTCCCGCTGT	0.632																																					Ovarian(145;306 1841 7037 21878 30110)	dbGAP											0													64.0	53.0	57.0					22																	41253216		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14007.1, CCDS74869.1	22q13.2	2010-07-20			ENSG00000196236	ENSG00000196236			28052	protein-coding gene	gene with protein product		613553				15708373, 20179356	Standard	NM_022098		Approved	APP3, NPHPL1	uc003azh.3	Q9NQH7	OTTHUMG00000151312	ENST00000357137.4:c.31G>C	22.37:g.41253216G>C	ENSP00000349658:p.Val11Leu		B2R9G1|B7Z790|B7Z7B2|Q6I9V9|Q8NDA6|Q9BV27|Q9BVH0	Missense_Mutation	SNP	pfam_Pept_M24_structural-domain,pfam_Aminopep_P_N,superfamily_Pept_M24_structural-domain	p.V11L	ENST00000357137.4	37	c.31	CCDS14007.1	22	.	.	.	.	.	.	.	.	.	.	G	11.47	1.647955	0.29336	.	.	ENSG00000196236	ENST00000541156;ENST00000414396;ENST00000357137	T	0.78595	-1.19	5.31	4.28	0.50868	.	0.560642	0.19529	N	0.112091	T	0.59059	0.2166	N	0.24115	0.695	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.09377	0.004;0.001	T	0.49341	-0.8950	10	0.10111	T	0.7	.	7.1785	0.25760	0.0888:0.174:0.7372:0.0	.	11;11	Q9NQH7-5;Q9NQH7	.;XPP3_HUMAN	L	11	ENSP00000349658:V11L	ENSP00000349658:V11L	V	+	1	0	XPNPEP3	39583162	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	1.027000	0.30115	1.431000	0.47355	0.563000	0.77884	GTT	XPNPEP3	-	NULL	ENSG00000196236		0.632	XPNPEP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPNPEP3	HGNC	protein_coding	OTTHUMT00000322201.2	60	0.00	0	G	NM_022098		41253216	41253216	+1	no_errors	ENST00000357137	ensembl	human	known	69_37n	missense	21	19.23	5	SNP	0.997	C
MAP3K19	80122	genome.wustl.edu	37	2	135756375	135756375	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr2:135756375G>T	ENST00000375845.3	-	5	537	c.507C>A	c.(505-507)aaC>aaA	p.N169K	MAP3K19_ENST00000392918.3_Missense_Mutation_p.N169K|MAP3K19_ENST00000392915.1_Missense_Mutation_p.N186K|MAP3K19_ENST00000315513.3_5'UTR|MAP3K19_ENST00000375844.3_Missense_Mutation_p.N169K|MAP3K19_ENST00000392917.3_Missense_Mutation_p.N169K|MAP3K19_ENST00000358371.4_Intron	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	169							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)										ACTTGGAAATGTTCAGTTCTA	0.423																																						dbGAP											0													75.0	78.0	77.0					2																	135756375		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.507C>A	2.37:g.135756375G>T	ENSP00000365005:p.Asn169Lys		B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.N169K	ENST00000375845.3	37	c.507	CCDS2176.2	2	.	.	.	.	.	.	.	.	.	.	G	4.506	0.093948	0.08632	.	.	ENSG00000176601	ENST00000375845;ENST00000375844;ENST00000392918;ENST00000392917;ENST00000392915	T;T;T;T;T	0.71698	-0.49;-0.49;-0.59;-0.47;1.88	5.26	-5.77	0.02369	.	1.171460	0.06472	N	0.731299	T	0.56247	0.1972	M	0.62723	1.935	0.09310	N	0.999998	B;B;B;B;B;P	0.34462	0.001;0.225;0.01;0.225;0.006;0.454	B;B;B;B;B;B	0.27887	0.001;0.032;0.005;0.032;0.005;0.084	T	0.40813	-0.9543	10	0.25106	T	0.35	.	4.3797	0.11288	0.5967:0.117:0.1677:0.1185	.	169;169;169;186;169;169	B7ZMH9;Q56UN5-2;Q56UN5-4;A8MWG7;Q56UN5-5;Q56UN5	.;.;.;.;.;YSK4_HUMAN	K	169;169;169;169;186	ENSP00000365005:N169K;ENSP00000365004:N169K;ENSP00000376650:N169K;ENSP00000376649:N169K;ENSP00000376647:N186K	ENSP00000365004:N169K	N	-	3	2	YSK4	135472845	0.000000	0.05858	0.000000	0.03702	0.233000	0.25261	-1.156000	0.03160	-1.133000	0.02903	-0.345000	0.07892	AAC	YSK4	-	NULL	ENSG00000176601		0.423	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	YSK4	HGNC	protein_coding	OTTHUMT00000158244.1	127	0.00	0	G	NM_025052		135756375	135756375	-1	no_errors	ENST00000375845	ensembl	human	known	69_37n	missense	36	18.18	8	SNP	0.000	T
ZNF354A	6940	genome.wustl.edu	37	5	178154017	178154017	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr5:178154017C>G	ENST00000335815.2	-	3	340	c.143G>C	c.(142-144)aGg>aCg	p.R48T		NM_005649.2	NP_005640.2	O60765	Z354A_HUMAN	zinc finger protein 354A	48	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|large_intestine(7)|lung(3)|ovary(2)|skin(2)|stomach(2)	19	all_cancers(89;0.000536)|Renal(175;0.000159)|all_epithelial(37;0.000221)|Lung NSC(126;0.00308)|all_lung(126;0.00536)	all_cancers(40;0.0452)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.185)		GACCAGGTTCCTATAGTTCTC	0.468																																						dbGAP											0													106.0	106.0	106.0					5																	178154017		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF116030	CCDS4438.1	5q35.3	2013-01-08		2001-11-23	ENSG00000169131	ENSG00000169131		"""Zinc fingers, C2H2-type"", ""-"""	11628	protein-coding gene	gene with protein product		602444		TCF17		9465904	Standard	NM_005649		Approved	KID-1, EZNF, HKL1, KID1	uc003mjj.3	O60765	OTTHUMG00000130895	ENST00000335815.2:c.143G>C	5.37:g.178154017C>G	ENSP00000337122:p.Arg48Thr		Q9UNJ8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R48T	ENST00000335815.2	37	c.143	CCDS4438.1	5	.	.	.	.	.	.	.	.	.	.	C	0.976	-0.698550	0.03279	.	.	ENSG00000169131	ENST00000335815;ENST00000520331	T;T	0.02032	4.49;4.49	3.63	0.806	0.18708	Krueppel-associated box (4);	.	.	.	.	T	0.03095	0.0091	M	0.68317	2.08	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.39461	-0.9613	9	0.33141	T	0.24	-0.5793	5.4308	0.16452	0.0:0.5024:0.0:0.4976	.	48	O60765	Z354A_HUMAN	T	48	ENSP00000337122:R48T;ENSP00000429675:R48T	ENSP00000337122:R48T	R	-	2	0	ZNF354A	178086623	0.000000	0.05858	0.002000	0.10522	0.056000	0.15407	-0.226000	0.09139	0.339000	0.23719	0.561000	0.74099	AGG	ZNF354A	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000169131		0.468	ZNF354A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF354A	HGNC	protein_coding	OTTHUMT00000253481.1	195	0.00	0	C	NM_005649		178154017	178154017	-1	no_errors	ENST00000335815	ensembl	human	known	69_37n	missense	94	14.55	16	SNP	0.002	G
ZNF417	147687	genome.wustl.edu	37	19	58420121	58420121	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr19:58420121C>G	ENST00000312026.5	-	3	1689	c.1525G>C	c.(1525-1527)Gtt>Ctt	p.V509L	CTD-2583A14.9_ENST00000602124.1_Intron|ZNF417_ENST00000536263.1_Missense_Mutation_p.V310L|ZNF417_ENST00000595559.1_Missense_Mutation_p.V508L	NM_152475.2	NP_689688.2	Q8TAU3	ZN417_HUMAN	zinc finger protein 417	509					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|stomach(3)|upper_aerodigestive_tract(1)	18		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0151)		CTTTTATGAACATGAAGCGCA	0.398																																						dbGAP											0													91.0	80.0	84.0					19																	58420121		2203	4298	6501	-	-	-	SO:0001583	missense	0			BC025783	CCDS12965.1, CCDS74469.1	19q13.43	2013-01-08				ENSG00000173480		"""Zinc fingers, C2H2-type"", ""-"""	20646	protein-coding gene	gene with protein product							Standard	NM_152475		Approved	MGC34079	uc002qqq.3	Q8TAU3		ENST00000312026.5:c.1525G>C	19.37:g.58420121C>G	ENSP00000311319:p.Val509Leu		B4DEU1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V509L	ENST00000312026.5	37	c.1525	CCDS12965.1	19	.	.	.	.	.	.	.	.	.	.	.	1.426	-0.571591	0.03882	.	.	ENSG00000173480	ENST00000312026;ENST00000536263	T;T	0.18016	2.24;2.24	2.2	-4.4	0.03600	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06188	0.0160	N	0.17474	0.49	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.08055	0.002;0.003	T	0.39210	-0.9625	9	0.09590	T	0.72	.	0.6226	0.00780	0.1595:0.2321:0.227:0.3814	.	509;509	F5H0M9;Q8TAU3	.;ZN417_HUMAN	L	509;310	ENSP00000311319:V509L;ENSP00000442760:V310L	ENSP00000311319:V509L	V	-	1	0	ZNF417	63111933	0.000000	0.05858	0.000000	0.03702	0.105000	0.19272	-5.822000	0.00096	-2.350000	0.00617	0.306000	0.20318	GTT	ZNF417	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000173480		0.398	ZNF417-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF417	HGNC	protein_coding	OTTHUMT00000466860.1	188	0.00	0	C	NM_152475		58420121	58420121	-1	no_errors	ENST00000312026	ensembl	human	known	69_37n	missense	69	13.75	11	SNP	0.000	G
ZNF606	80095	genome.wustl.edu	37	19	58489955	58489955	+	Missense_Mutation	SNP	T	T	G			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr19:58489955T>G	ENST00000341164.4	-	7	2713	c.2093A>C	c.(2092-2094)cAc>cCc	p.H698P	ZNF606_ENST00000536132.1_Missense_Mutation_p.H608P	NM_025027.3	NP_079303.2	Q8WXB4	ZN606_HUMAN	zinc finger protein 606	698					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)		AGTTCTCCGGTGTGCAATGAG	0.403																																						dbGAP											0													98.0	98.0	98.0					19																	58489955		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB058755	CCDS12968.1	19q13.43	2013-01-08			ENSG00000166704	ENSG00000166704		"""Zinc fingers, C2H2-type"", ""-"""	25879	protein-coding gene	gene with protein product		613905		ZNF328		11347906	Standard	XM_005259276		Approved	FLJ14260, KIAA1852	uc002qqw.3	Q8WXB4	OTTHUMG00000169804	ENST00000341164.4:c.2093A>C	19.37:g.58489955T>G	ENSP00000343617:p.His698Pro		A8KAN2|Q8NE04|Q96JH5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H698P	ENST00000341164.4	37	c.2093	CCDS12968.1	19	.	.	.	.	.	.	.	.	.	.	T	16.87	3.241349	0.58995	.	.	ENSG00000166704	ENST00000341164;ENST00000536132	D;D	0.86865	-2.18;-2.18	4.43	4.43	0.53597	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.47852	D	0.000208	D	0.95436	0.8518	H	0.97131	3.945	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	D	0.96581	0.9430	10	0.87932	D	0	.	13.0673	0.59041	0.0:0.0:0.0:1.0	.	698	Q8WXB4	ZN606_HUMAN	P	698;608	ENSP00000343617:H698P;ENSP00000445624:H608P	ENSP00000343617:H698P	H	-	2	0	ZNF606	63181767	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.683000	0.61679	1.965000	0.57142	0.459000	0.35465	CAC	ZNF606	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000166704		0.403	ZNF606-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF606	HGNC	protein_coding	OTTHUMT00000405961.1	160	0.00	0	T	NM_025027		58489955	58489955	-1	no_errors	ENST00000341164	ensembl	human	known	69_37n	missense	70	15.66	13	SNP	1.000	G
ZSWIM6	57688	genome.wustl.edu	37	5	60839621	60839621	+	Missense_Mutation	SNP	A	A	T			TCGA-E9-A1RF-01A-11D-A159-09	TCGA-E9-A1RF-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	43983619-d863-4816-a334-445f6ca36541	0c36d388-c63d-4ab1-8303-6d5005708525	g.chr5:60839621A>T	ENST00000252744.5	+	14	3125	c.3125A>T	c.(3124-3126)tAc>tTc	p.Y1042F		NM_020928.1	NP_065979.1	Q9HCJ5	ZSWM6_HUMAN	zinc finger, SWIM-type containing 6	1042					neuron projection morphogenesis (GO:0048812)|regulation of neuron migration (GO:2001222)		zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)	8						CACCGCGGGTACCCCATGAGG	0.537																																						dbGAP											0													46.0	42.0	43.0					5																	60839621		692	1591	2283	-	-	-	SO:0001583	missense	0			BC039438	CCDS47215.1	5q12.1	2011-03-17			ENSG00000130449	ENSG00000130449		"""Zinc fingers, SWIM-type"""	29316	protein-coding gene	gene with protein product		615951				10997877, 16427614	Standard	NM_020928		Approved	KIAA1577	uc003jsr.3	Q9HCJ5	OTTHUMG00000162388	ENST00000252744.5:c.3125A>T	5.37:g.60839621A>T	ENSP00000252744:p.Tyr1042Phe			Missense_Mutation	SNP	pfscan_Znf_SWIM,prints_Antifreeze_1	p.Y1042F	ENST00000252744.5	37	c.3125	CCDS47215.1	5	.	.	.	.	.	.	.	.	.	.	a	13.58	2.279949	0.40294	.	.	ENSG00000130449	ENST00000252744	T	0.51817	0.69	5.04	5.04	0.67666	.	0.062575	0.64402	D	0.000003	T	0.46600	0.1401	L	0.49513	1.565	0.46499	D	0.999078	B	0.27416	0.178	B	0.33799	0.17	T	0.41556	-0.9502	10	0.35671	T	0.21	-9.8458	14.9297	0.70906	1.0:0.0:0.0:0.0	.	1042	Q9HCJ5	ZSWM6_HUMAN	F	1042	ENSP00000252744:Y1042F	ENSP00000252744:Y1042F	Y	+	2	0	ZSWIM6	60875378	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.136000	0.94489	2.113000	0.64589	0.454000	0.30748	TAC	ZSWIM6	-	NULL	ENSG00000130449		0.537	ZSWIM6-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ZSWIM6	HGNC	protein_coding	OTTHUMT00000368710.1	37	0.00	0	A	NM_020928		60839621	60839621	+1	no_errors	ENST00000252744	ensembl	human	known	69_37n	missense	15	21.05	4	SNP	1.000	T
