#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAM20	8748	genome.wustl.edu	37	14	70989500	70989500	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr14:70989500C>A	ENST00000256389.3	-	2	2369	c.2125G>T	c.(2125-2127)Gca>Tca	p.A709S	RP11-486O13.4_ENST00000556646.1_lincRNA	NM_003814.4	NP_003805.3	O43506	ADA20_HUMAN	ADAM metallopeptidase domain 20	659					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(1)|skin(2)	27			KIRC - Kidney renal clear cell carcinoma(12;0.133)|Kidney(31;0.188)	all cancers(60;0.00294)|BRCA - Breast invasive adenocarcinoma(234;0.00668)|OV - Ovarian serous cystadenocarcinoma(108;0.0344)		TATGGGGGTGCCCATTCATGG	0.488																																						dbGAP											0													519.0	396.0	437.0					14																	70989500		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF029899	CCDS32111.1	14q24.2	2012-04-30	2005-08-18		ENSG00000134007	ENSG00000134007		"""ADAM metallopeptidase domain containing"""	199	protein-coding gene	gene with protein product		603712	"""a disintegrin and metalloproteinase domain 20"""			9469942	Standard	NM_003814		Approved		uc001xme.3	O43506	OTTHUMG00000167548	ENST00000256389.3:c.2125G>T	14.37:g.70989500C>A	ENSP00000256389:p.Ala709Ser		Q6GTZ1|Q9UKJ9	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.A709S	ENST00000256389.3	37	c.2125	CCDS32111.1	14	.	.	.	.	.	.	.	.	.	.	C	0.922	-0.715588	0.03206	.	.	ENSG00000134007	ENST00000256389	T	0.77489	-1.1	4.76	2.65	0.31530	.	0.462575	0.15740	N	0.246953	T	0.64159	0.2573	N	0.25380	0.74	0.25431	N	0.988187	B	0.23490	0.086	B	0.27500	0.08	T	0.43458	-0.9390	10	0.10377	T	0.69	.	12.5996	0.56489	0.2044:0.7956:0.0:0.0	.	659	O43506	ADA20_HUMAN	S	709	ENSP00000256389:A709S	ENSP00000256389:A709S	A	-	1	0	ADAM20	70059253	1.000000	0.71417	0.982000	0.44146	0.015000	0.08874	2.441000	0.44864	0.336000	0.23639	0.650000	0.86243	GCA	ADAM20	-	NULL	ENSG00000134007		0.488	ADAM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM20	HGNC	protein_coding	OTTHUMT00000395004.2	209	0.00	0	C			70989500	70989500	-1	no_errors	ENST00000256389	ensembl	human	known	69_37n	missense	140	16.17	27	SNP	1.000	A
ADCY5	111	genome.wustl.edu	37	3	123051483	123051483	+	Silent	SNP	C	C	T			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr3:123051483C>T	ENST00000462833.1	-	4	2658	c.1446G>A	c.(1444-1446)gcG>gcA	p.A482A	ADCY5_ENST00000309879.5_Silent_p.A132A|ADCY5_ENST00000491190.1_Silent_p.A115A	NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	482	Guanylate cyclase 1. {ECO:0000255|PROSITE-ProRule:PRU00099}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		TGCACTGGGACGCCAGGCTGG	0.592																																						dbGAP											0													50.0	43.0	46.0					3																	123051483		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.1446G>A	3.37:g.123051483C>T			B7Z8A6|Q7RTV7|Q8NFM3	Silent	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.A482	ENST00000462833.1	37	c.1446	CCDS3022.1	3																																																																																			ADCY5	-	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	ENSG00000173175		0.592	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY5	HGNC	protein_coding	OTTHUMT00000355889.4	31	0.00	0	C	XM_171048		123051483	123051483	-1	no_errors	ENST00000462833	ensembl	human	known	69_37n	silent	45	14.81	8	SNP	0.005	T
AMBN	258	genome.wustl.edu	37	4	71471931	71471931	+	Silent	SNP	A	A	G			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr4:71471931A>G	ENST00000322937.6	+	13	931	c.828A>G	c.(826-828)ggA>ggG	p.G276G	AMBN_ENST00000449493.2_Silent_p.G261G	NM_016519.5	NP_057603.1	Q9NP70	AMBN_HUMAN	ameloblastin (enamel matrix protein)	276					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|odontogenesis of dentin-containing tooth (GO:0042475)	proteinaceous extracellular matrix (GO:0005578)	growth factor activity (GO:0008083)|structural constituent of tooth enamel (GO:0030345)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)	29			Lung(101;0.235)			TGGCCTATGGAGCCATGTTTC	0.507																																						dbGAP											0													64.0	66.0	66.0					4																	71471931		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF209780	CCDS3543.1	4q21	2006-11-28	2006-04-27		ENSG00000178522	ENSG00000178522			452	protein-coding gene	gene with protein product		601259	"""ameloblastin, enamel matrix protein"""			9126491	Standard	NM_016519		Approved		uc003hfl.3	Q9NP70	OTTHUMG00000129913	ENST00000322937.6:c.828A>G	4.37:g.71471931A>G			Q3B862|Q9H2X1|Q9H4L1	Silent	SNP	pfam_Amelin,smart_Amelin	p.G276	ENST00000322937.6	37	c.828	CCDS3543.1	4																																																																																			AMBN	-	pfam_Amelin,smart_Amelin	ENSG00000178522		0.507	AMBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMBN	HGNC	protein_coding	OTTHUMT00000252165.1	47	0.00	0	A	NM_016519		71471931	71471931	+1	no_errors	ENST00000322937	ensembl	human	known	69_37n	silent	20	25.93	7	SNP	0.976	G
APOL3	80833	genome.wustl.edu	37	22	36541561	36541561	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr22:36541561C>T	ENST00000349314.2	-	2	347	c.310G>A	c.(310-312)Gaa>Aaa	p.E104K	APOL3_ENST00000397287.2_5'UTR|APOL3_ENST00000361710.2_5'UTR|APOL3_ENST00000487423.1_5'UTR|APOL3_ENST00000397293.2_Missense_Mutation_p.E33K|APOL3_ENST00000424878.2_5'UTR	NM_145640.2	NP_663615.1	O95236	APOL3_HUMAN	apolipoprotein L, 3	104					inflammatory response (GO:0006954)|lipoprotein metabolic process (GO:0042157)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)|signal transducer activity (GO:0004871)			endometrium(2)|large_intestine(1)|lung(1)|stomach(1)	5						TTCCAGGCTTCATTGTTAGTC	0.532																																						dbGAP											0													91.0	92.0	92.0					22																	36541561		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF305227	CCDS13922.1, CCDS13924.1	22q13.1	2013-01-24			ENSG00000128284	ENSG00000128284		"""Apolipoproteins"""	14868	protein-coding gene	gene with protein product		607253				11374903	Standard	NM_145640		Approved	CG12-1, APOLIII	uc003aot.3	O95236	OTTHUMG00000150632	ENST00000349314.2:c.310G>A	22.37:g.36541561C>T	ENSP00000344577:p.Glu104Lys		B1AHI4|B1AHI5|Q5U5N4|Q9BQ82|Q9BQA3	Missense_Mutation	SNP	pfam_ApoL	p.E104K	ENST00000349314.2	37	c.310	CCDS13922.1	22	.	.	.	.	.	.	.	.	.	.	C	14.67	2.604767	0.46423	.	.	ENSG00000128284	ENST00000397293;ENST00000349314	T;T	0.03951	3.75;3.75	3.41	0.0187	0.14117	.	1.746940	0.02801	N	0.123227	T	0.04634	0.0126	L	0.44542	1.39	0.18873	N	0.999985	B;B	0.34349	0.45;0.395	B;B	0.30316	0.114;0.069	T	0.40270	-0.9572	10	0.16896	T	0.51	.	4.353	0.11165	0.0:0.5381:0.2256:0.2363	.	104;33	O95236;O95236-2	APOL3_HUMAN;.	K	33;104	ENSP00000380461:E33K;ENSP00000344577:E104K	ENSP00000344577:E104K	E	-	1	0	APOL3	34871507	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-4.251000	0.00266	0.060000	0.16281	-0.672000	0.03802	GAA	APOL3	-	pfam_ApoL	ENSG00000128284		0.532	APOL3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	APOL3	HGNC	protein_coding	OTTHUMT00000319268.1	67	0.00	0	C	NM_145641		36541561	36541561	-1	no_errors	ENST00000349314	ensembl	human	known	69_37n	missense	43	14.00	7	SNP	0.000	T
ASH1L	55870	genome.wustl.edu	37	1	155449169	155449171	+	In_Frame_Del	DEL	AGG	AGG	-			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	AGG	AGG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr1:155449169_155449171delAGG	ENST00000368346.3	-	3	4129_4131	c.3490_3492delCCT	c.(3490-3492)cctdel	p.P1164del	ASH1L_ENST00000392403.3_In_Frame_Del_p.P1164del			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	1164					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			GCAACAAAGTAGGAGGAGATAAC	0.458																																						dbGAP											0										0,4264		0,0,2132						5.2	1.0			65	4,8246		1,2,4122	no	coding	ASH1L	NM_018489.2		1,2,6254	A1A1,A1R,RR		0.0485,0.0,0.032				4,12510				-	-	-	SO:0001651	inframe_deletion	0			AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.3490_3492delCCT	1.37:g.155449172_155449174delAGG	ENSP00000357330:p.Pro1164del		Q59GP1|Q5T714|Q5T715|Q9P2C7	In_Frame_Del	DEL	pfam_SET_dom,pfam_BAH_dom,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_AT_hook_DNA-bd_motif,smart_AWS,smart_SET_dom,smart_Bromodomain,smart_Znf_PHD,smart_BAH_dom,pfscan_AWS,pfscan_BAH_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Bromodomain	p.P1164in_frame_del	ENST00000368346.3	37	c.3492_3490		1																																																																																			ASH1L	-	NULL	ENSG00000116539		0.458	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	ASH1L	HGNC	protein_coding	OTTHUMT00000039400.1	44	0.00	0	AGG	NM_018489		155449169	155449171	-1	no_errors	ENST00000368346	ensembl	human	known	69_37n	in_frame_del	34	10.53	4	DEL	0.952:1.000:1.000	-
ATP6V0D2	245972	genome.wustl.edu	37	8	87153720	87153720	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr8:87153720G>T	ENST00000285393.3	+	4	665	c.523G>T	c.(523-525)Gaa>Taa	p.E175*	CTD-3118D11.2_ENST00000522679.1_RNA	NM_152565.1	NP_689778.1	Q8N8Y2	VA0D2_HUMAN	ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d2	175					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|proton-transporting V-type ATPase, V0 domain (GO:0033179)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	hydrogen ion transmembrane transporter activity (GO:0015078)			breast(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(9)|prostate(1)	27						TGCTCTAGATGAACTGAATAT	0.333																																						dbGAP											0													124.0	123.0	123.0					8																	87153720		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AY079172	CCDS6241.1	8q21.3	2014-01-28	2006-01-20	2002-05-24	ENSG00000147614	ENSG00000147614		"""ATPases / V-type"""	18266	protein-coding gene	gene with protein product			"""ATPase, H+ transporting, lysosomal 38kD, V0 subunit d isoform 2"", ""ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 2"", ""ATPase, H+ transporting, lysosomal 38kDa, V0 subunit D2"""			12384298	Standard	NM_152565		Approved	FLJ38708, VMA6, ATP6D2	uc003ydp.1	Q8N8Y2	OTTHUMG00000163637	ENST00000285393.3:c.523G>T	8.37:g.87153720G>T	ENSP00000285393:p.Glu175*			Nonsense_Mutation	SNP	pfam_ATPase_V0/A0-cplx_csu/dsu,superfamily_ATPase_V0/A0-cplx_csu/dsu,pirsf_ATPase_V0-cplx_dsu	p.E175*	ENST00000285393.3	37	c.523	CCDS6241.1	8	.	.	.	.	.	.	.	.	.	.	G	36	5.721985	0.96839	.	.	ENSG00000147614	ENST00000285393	.	.	.	5.57	4.67	0.58626	.	0.184781	0.44688	D	0.000438	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-5.2209	15.2641	0.73649	0.0:0.1408:0.8592:0.0	.	.	.	.	X	175	.	ENSP00000285393:E175X	E	+	1	0	ATP6V0D2	87222836	1.000000	0.71417	0.669000	0.29828	0.656000	0.38851	9.397000	0.97276	1.289000	0.44618	0.650000	0.86243	GAA	ATP6V0D2	-	pfam_ATPase_V0/A0-cplx_csu/dsu,superfamily_ATPase_V0/A0-cplx_csu/dsu,pirsf_ATPase_V0-cplx_dsu	ENSG00000147614		0.333	ATP6V0D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V0D2	HGNC	protein_coding	OTTHUMT00000374651.1	98	0.00	0	G	NM_152565		87153720	87153720	+1	no_errors	ENST00000285393	ensembl	human	known	69_37n	nonsense	111	23.97	35	SNP	1.000	T
BNC2	54796	genome.wustl.edu	37	9	16727800	16727800	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr9:16727800G>C	ENST00000380672.4	-	3	382	c.325C>G	c.(325-327)Caa>Gaa	p.Q109E	BNC2_ENST00000380666.2_Missense_Mutation_p.Q109E|BNC2_ENST00000380667.2_Intron|RP11-62F24.2_ENST00000450445.1_RNA|BNC2_ENST00000545497.1_Intron	NM_017637.5	NP_060107.3			basonuclin 2											NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		CTTACCTGTTGGGACATTCTG	0.378																																						dbGAP											0													192.0	181.0	185.0					9																	16727800		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.325C>G	9.37:g.16727800G>C	ENSP00000370047:p.Gln109Glu			Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q109E	ENST00000380672.4	37	c.325	CCDS6482.2	9	.	.	.	.	.	.	.	.	.	.	G	15.08	2.727439	0.48833	.	.	ENSG00000173068	ENST00000380672;ENST00000418777;ENST00000456672;ENST00000436939;ENST00000380666;ENST00000540340	T;T;T	0.03951	3.75;3.75;3.75	6.17	6.17	0.99709	.	0.295187	0.35378	N	0.003245	T	0.08223	0.0205	N	0.08118	0	0.48511	D	0.999663	P;P;P;P	0.52577	0.934;0.954;0.924;0.924	D;D;P;P	0.67900	0.909;0.954;0.857;0.9	T	0.35895	-0.9770	10	0.05436	T	0.98	-3.5552	20.8794	0.99867	0.0:0.0:1.0:0.0	.	109;109;67;109	Q06HC4;Q6ZN30-2;Q5H9S4;Q6ZN30	.;.;.;BNC2_HUMAN	E	109;66;109;109;109;109	ENSP00000370047:Q109E;ENSP00000408370:Q66E;ENSP00000370041:Q109E	ENSP00000370041:Q109E	Q	-	1	0	BNC2	16717800	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.193000	0.94954	2.941000	0.99782	0.655000	0.94253	CAA	BNC2	-	NULL	ENSG00000173068		0.378	BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BNC2	HGNC	protein_coding	OTTHUMT00000216901.5	120	0.00	0	G	NM_017637		16727800	16727800	-1	no_errors	ENST00000380672	ensembl	human	known	69_37n	missense	73	15.12	13	SNP	1.000	C
SSUH2	51066	genome.wustl.edu	37	3	8671361	8671361	+	Missense_Mutation	SNP	C	C	G	rs144988627	byFrequency	TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr3:8671361C>G	ENST00000317371.4	-	14	1736	c.511G>C	c.(511-513)Ggg>Cgg	p.G171R	SSUH2_ENST00000341795.3_Missense_Mutation_p.G171R|SSUH2_ENST00000544814.1_Missense_Mutation_p.G193R|SSUH2_ENST00000415132.1_Missense_Mutation_p.G171R			Q9Y2M2	SSUH2_HUMAN	ssu-2 homolog (C. elegans)	171	Cys-rich.					cytoplasm (GO:0005737)											GTGCCCGCCCCGTGGCAGCCG	0.627																																						dbGAP											0													78.0	82.0	81.0					3																	8671361		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB024705	CCDS2568.1, CCDS58815.1	3p25.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000125046	ENSG00000125046			24809	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 32"""	C3orf32		20205943	Standard	NM_001256748		Approved	fls485, ssu-2	uc011atg.3	Q9Y2M2	OTTHUMG00000122075	ENST00000317371.4:c.511G>C	3.37:g.8671361C>G	ENSP00000324551:p.Gly171Arg		A6NFA9|B3KS84|B7Z6E3|F5H2S5|Q7Z7K4	Missense_Mutation	SNP	superfamily_HSP_DnaJ_Cys-rich_dom	p.G193R	ENST00000317371.4	37	c.577	CCDS2568.1	3	.	.	.	.	.	.	.	.	.	.	C	15.62	2.886405	0.51908	.	.	ENSG00000125046	ENST00000341795;ENST00000317371;ENST00000415132;ENST00000544814	T;T;T;T	0.58506	0.33;0.33;0.35;0.34	4.68	4.68	0.58851	.	0.111334	0.64402	D	0.000010	T	0.75057	0.3798	M	0.79123	2.44	0.26843	N	0.968324	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.69300	-0.5181	10	0.87932	D	0	-36.8868	13.1227	0.59336	0.0:1.0:0.0:0.0	.	193;171	F5H2S5;Q9Y2M2	.;CC032_HUMAN	R	171;171;171;193	ENSP00000339150:G171R;ENSP00000324551:G171R;ENSP00000410757:G171R;ENSP00000439378:G193R	ENSP00000324551:G171R	G	-	1	0	C3orf32	8646361	0.921000	0.31238	0.127000	0.21898	0.404000	0.30871	4.337000	0.59310	2.154000	0.67381	0.467000	0.42956	GGG	C3orf32	-	superfamily_HSP_DnaJ_Cys-rich_dom	ENSG00000125046		0.627	SSUH2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	C3orf32	HGNC	protein_coding	OTTHUMT00000337900.1	54	0.00	0	C	NM_015931		8671361	8671361	-1	no_errors	ENST00000544814	ensembl	human	known	69_37n	missense	19	80.00	76	SNP	0.333	G
CALHM3	119395	genome.wustl.edu	37	10	105233294	105233294	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr10:105233294G>T	ENST00000369783.4	-	3	918	c.711C>A	c.(709-711)gaC>gaA	p.D237E		NM_001129742.1	NP_001123214.1	Q86XJ0	CAHM3_HUMAN	calcium homeostasis modulator 3	237					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)	2						GGTGCGCGAAGTCCCGCGCAT	0.642																																						dbGAP											0													8.0	11.0	10.0					10																	105233294		692	1587	2279	-	-	-	SO:0001583	missense	0			BC043367	CCDS44476.1	10q24.33	2008-07-02	2008-07-02	2008-07-02	ENSG00000183128	ENSG00000183128			23458	protein-coding gene	gene with protein product			"""family with sequence similarity 26, member A"""	FAM26A		18585350	Standard	NM_001129742		Approved	bA225H22.7	uc001kxg.4	Q86XJ0	OTTHUMG00000018989	ENST00000369783.4:c.711C>A	10.37:g.105233294G>T	ENSP00000358798:p.Asp237Glu		Q5W090|Q8IXR2	Missense_Mutation	SNP	NULL	p.D237E	ENST00000369783.4	37	c.711	CCDS44476.1	10	.	.	.	.	.	.	.	.	.	.	G	15.98	2.993032	0.54041	.	.	ENSG00000183128	ENST00000369783	T	0.16196	2.36	5.52	5.52	0.82312	.	0.126803	0.50627	D	0.000111	T	0.18841	0.0452	L	0.41824	1.3	0.45415	D	0.998397	B	0.33512	0.415	B	0.40329	0.326	T	0.01452	-1.1351	10	0.02654	T	1	.	19.4433	0.94836	0.0:0.0:1.0:0.0	.	237	Q86XJ0-2	.	E	237	ENSP00000358798:D237E	ENSP00000358798:D237E	D	-	3	2	CALHM3	105223284	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	2.371000	0.44248	2.590000	0.87494	0.462000	0.41574	GAC	CALHM3	-	NULL	ENSG00000183128		0.642	CALHM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALHM3	HGNC	protein_coding	OTTHUMT00000050157.1	9	0.00	0	G	NM_182494		105233294	105233294	-1	no_errors	ENST00000369783	ensembl	human	known	69_37n	missense	7	36.36	4	SNP	1.000	T
CASKIN1	57524	genome.wustl.edu	37	16	2236791	2236791	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr16:2236791C>G	ENST00000343516.6	-	10	1057	c.965G>C	c.(964-966)gGc>gCc	p.G322A	CASKIN1_ENST00000564289.1_5'Flank	NM_020764.3	NP_065815.1	Q8WXD9	CSKI1_HUMAN	CASK interacting protein 1	322	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|liver(1)|lung(7)|ovary(4)|prostate(5)|skin(3)	28						ATGGATGCAGCCCTTCCACCG	0.662																																						dbGAP											0													35.0	39.0	38.0					16																	2236791		2037	4167	6204	-	-	-	SO:0001583	missense	0			AF451977	CCDS42103.1	16p13.3	2013-01-10				ENSG00000167971		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20879	protein-coding gene	gene with protein product		612184				12040031	Standard	NM_020764		Approved	KIAA1306, ANKS5A	uc010bsg.1	Q8WXD9		ENST00000343516.6:c.965G>C	16.37:g.2236791C>G	ENSP00000345436:p.Gly322Ala		Q9P2P0	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_SAM_2,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SAM,pfscan_SH3_domain,prints_Ankyrin_rpt	p.G322A	ENST00000343516.6	37	c.965	CCDS42103.1	16	.	.	.	.	.	.	.	.	.	.	C	28.7	4.946815	0.92593	.	.	ENSG00000167971	ENST00000343516;ENST00000382453	T	0.14391	2.51	4.65	4.65	0.58169	Src homology-3 domain (3);Variant SH3 (1);	.	.	.	.	T	0.39410	0.1077	M	0.79343	2.45	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.20472	-1.0274	9	0.52906	T	0.07	-27.4704	16.6164	0.84917	0.0:1.0:0.0:0.0	.	322	Q8WXD9	CSKI1_HUMAN	A	322;151	ENSP00000345436:G322A	ENSP00000345436:G322A	G	-	2	0	CASKIN1	2176792	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.606000	0.82863	2.577000	0.86979	0.563000	0.77884	GGC	CASKIN1	-	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000167971		0.662	CASKIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASKIN1	HGNC	protein_coding	OTTHUMT00000435055.1	30	0.00	0	C	NM_020764		2236791	2236791	-1	no_errors	ENST00000343516	ensembl	human	known	69_37n	missense	17	34.62	9	SNP	1.000	G
CD163L1	283316	genome.wustl.edu	37	12	7531857	7531857	+	Silent	SNP	G	G	A			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr12:7531857G>A	ENST00000313599.3	-	9	2145	c.2088C>T	c.(2086-2088)agC>agT	p.S696S	CD163L1_ENST00000544331.1_5'UTR|CD163L1_ENST00000416109.2_Silent_p.S706S|CD163L1_ENST00000396630.1_Silent_p.S696S			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	696	SRCR 7. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						CACACCTGCTGCTTCCACCCA	0.458																																						dbGAP											0													89.0	71.0	77.0					12																	7531857		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.2088C>T	12.37:g.7531857G>A			B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Silent	SNP	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt,prints_Srcr_rcpt	p.S696	ENST00000313599.3	37	c.2088	CCDS8577.1	12																																																																																			CD163L1	-	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt	ENSG00000177675		0.458	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD163L1	HGNC	protein_coding	OTTHUMT00000399329.1	71	0.00	0	G	NM_174941		7531857	7531857	-1	no_errors	ENST00000313599	ensembl	human	known	69_37n	silent	44	26.67	16	SNP	0.675	A
CD93	22918	genome.wustl.edu	37	20	23065078	23065078	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr20:23065078G>C	ENST00000246006.4	-	1	1899	c.1752C>G	c.(1750-1752)ttC>ttG	p.F584L		NM_012072.3	NP_036204.2	Q9NPY3	C1QR1_HUMAN	CD93 molecule	584					macrophage activation (GO:0042116)|phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|receptor activity (GO:0004872)	p.F584L(1)		NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)					CTAGGATGTAGAATAAAAGCA	0.607																																						dbGAP											1	Substitution - Missense(1)	lung(1)											153.0	147.0	149.0					20																	23065078		2203	4300	6503	-	-	-	SO:0001583	missense	0			U94333	CCDS13149.1	20p11.21	2009-01-29	2006-03-28	2006-02-22	ENSG00000125810	ENSG00000125810		"""CD molecules"""	15855	protein-coding gene	gene with protein product		120577	"""matrix-remodelling associated 4"", ""complement component 1, q subcomponent, receptor 1"", ""CD93 antigen"""	MXRA4, C1QR1		9047234, 10648005	Standard	NM_012072		Approved	C1qRP, C1qR(P), dJ737E23.1, CDw93, ECSM3	uc002wsv.3	Q9NPY3	OTTHUMG00000032058	ENST00000246006.4:c.1752C>G	20.37:g.23065078G>C	ENSP00000246006:p.Phe584Leu		O00274	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_EGF-like_dom,pfam_C-type_lectin,superfamily_C-type_lectin_fold,superfamily_MFS_dom_general_subst_transpt,smart_C-type_lectin,smart_EGF-like,smart_EGF-like_Ca-bd,pirsf_CD93/CD141,pfscan_EG-like_dom,pfscan_C-type_lectin	p.F584L	ENST00000246006.4	37	c.1752	CCDS13149.1	20	.	.	.	.	.	.	.	.	.	.	G	19.76	3.887906	0.72410	.	.	ENSG00000125810	ENST00000246006	T	0.79845	-1.31	5.84	1.18	0.20946	.	0.207548	0.33959	N	0.004400	T	0.81088	0.4750	M	0.69823	2.125	0.32712	N	0.511407	D	0.58268	0.982	P	0.48738	0.588	D	0.84533	0.0634	10	0.62326	D	0.03	-30.6724	11.2587	0.49069	0.3681:0.0:0.6319:0.0	.	584	Q9NPY3	C1QR1_HUMAN	L	584	ENSP00000246006:F584L	ENSP00000246006:F584L	F	-	3	2	CD93	23013078	1.000000	0.71417	0.985000	0.45067	0.902000	0.53008	0.689000	0.25437	0.381000	0.24851	0.650000	0.86243	TTC	CD93	-	superfamily_MFS_dom_general_subst_transpt	ENSG00000125810		0.607	CD93-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CD93	HGNC	protein_coding	OTTHUMT00000078312.2	91	0.00	0	G	NM_012072		23065078	23065078	-1	no_errors	ENST00000246006	ensembl	human	known	69_37n	missense	54	12.90	8	SNP	0.976	C
CEL	1056	genome.wustl.edu	37	9	135946015	135946015	+	Missense_Mutation	SNP	T	T	C	rs77696629	byFrequency	TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr9:135946015T>C	ENST00000372080.4	+	10	1479	c.1463T>C	c.(1462-1464)aTc>aCc	p.I488T	CEL_ENST00000351304.7_Intron	NM_001807.3	NP_001798.2	P19835	CEL_HUMAN	carboxyl ester lipase	485					cholesterol catabolic process (GO:0006707)|fatty acid catabolic process (GO:0009062)|intestinal cholesterol absorption (GO:0030299)|intestinal lipid catabolic process (GO:0044258)|lipid digestion (GO:0044241)|lipid metabolic process (GO:0006629)|pancreatic juice secretion (GO:0030157)|protein esterification (GO:0018350)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	acylglycerol lipase activity (GO:0047372)|catalytic activity (GO:0003824)|heparin binding (GO:0008201)|hydrolase activity (GO:0016787)|sterol esterase activity (GO:0004771)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|pancreas(2)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)		AAGGCCATGATCGCCTACTGG	0.612																																						dbGAP											0													76.0	86.0	83.0					9																	135946015		2018	4177	6195	-	-	-	SO:0001583	missense	0			M54994	CCDS43896.1	9q34.3	2013-03-13	2013-03-13		ENSG00000170835	ENSG00000170835	3.1.1.3, 3.1.1.13		1848	protein-coding gene	gene with protein product	"""bile salt-stimulated lipase"""	114840				1676983	Standard	NM_001807		Approved	BSSL, MODY8	uc010naa.2	P19835	OTTHUMG00000020855	ENST00000372080.4:c.1463T>C	9.37:g.135946015T>C	ENSP00000361151:p.Ile488Thr		Q16398|Q5T7U7|Q9UCH1|Q9UP41	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3	p.I488T	ENST00000372080.4	37	c.1463	CCDS43896.1	9	.	.	.	.	.	.	.	.	.	.	T	22.0	4.234627	0.79800	.	.	ENSG00000170835	ENST00000372080;ENST00000303626	T	0.68025	-0.3	5.72	4.57	0.56435	Carboxylesterase, type B (1);	0.094910	0.64402	D	0.000001	T	0.72993	0.3530	L	0.38175	1.15	0.80722	D	1	D	0.54047	0.964	D	0.75020	0.985	T	0.74463	-0.3657	10	0.87932	D	0	.	11.5416	0.50669	0.134:0.0:0.0:0.866	.	485	P19835	CEL_HUMAN	T	488;487	ENSP00000361151:I488T	ENSP00000304021:I487T	I	+	2	0	CEL	134935836	1.000000	0.71417	0.959000	0.39883	0.951000	0.60555	7.622000	0.83099	0.976000	0.38417	0.391000	0.25812	ATC	CEL	-	pfam_CarbesteraseB	ENSG00000170835		0.612	CEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEL	HGNC	protein_coding	OTTHUMT00000054823.1	54	0.00	0	T			135946015	135946015	+1	no_errors	ENST00000372080	ensembl	human	known	69_37n	missense	38	13.64	6	SNP	1.000	C
CHMP7	91782	genome.wustl.edu	37	8	23114072	23114072	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr8:23114072C>T	ENST00000397677.1	+	5	1405	c.757C>T	c.(757-759)Cgc>Tgc	p.R253C	CHMP7_ENST00000313219.7_Missense_Mutation_p.R253C	NM_152272.3	NP_689485.1	Q8WUX9	CHMP7_HUMAN	charged multivesicular body protein 7	253					endosomal transport (GO:0016197)|late endosome to vacuole transport (GO:0045324)|membrane organization (GO:0061024)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|ESCRT III complex (GO:0000815)	protein transporter activity (GO:0008565)	p.R253G(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	11		Prostate(55;0.0513)		Colorectal(74;0.0155)|COAD - Colon adenocarcinoma(73;0.0632)		GCTTCTCTCACGCAAAGTGGA	0.532																																						dbGAP											1	Substitution - Missense(1)	central_nervous_system(1)											243.0	222.0	229.0					8																	23114072		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC019110	CCDS6040.1	8p21.2	2011-09-21	2011-09-21		ENSG00000147457	ENSG00000147457		"""Charged multivesicular body proteins"""	28439	protein-coding gene	gene with protein product		611130	"""CHMP family, member 7"""			16856878	Standard	NM_152272		Approved	MGC29816	uc003xdc.2	Q8WUX9	OTTHUMG00000131785	ENST00000397677.1:c.757C>T	8.37:g.23114072C>T	ENSP00000380794:p.Arg253Cys		B2RDT3|B4DKJ6|D3DSS1|Q8NDM1|Q9BT50	Missense_Mutation	SNP	pfam_Snf7	p.R253C	ENST00000397677.1	37	c.757	CCDS6040.1	8	.	.	.	.	.	.	.	.	.	.	C	21.8	4.200503	0.79015	.	.	ENSG00000147457	ENST00000397677;ENST00000313219	T;T	0.74947	-0.89;-0.89	5.97	5.09	0.68999	.	0.160010	0.56097	D	0.000035	T	0.71409	0.3336	N	0.22421	0.69	0.34705	D	0.727193	B;D	0.63046	0.009;0.992	B;P	0.54174	0.005;0.744	T	0.80621	-0.1301	10	0.62326	D	0.03	-1.6132	12.6091	0.56540	0.0:0.9224:0.0:0.0776	.	143;253	B3KRZ9;Q8WUX9	.;CHMP7_HUMAN	C	253	ENSP00000380794:R253C;ENSP00000324491:R253C	ENSP00000324491:R253C	R	+	1	0	CHMP7	23170017	0.994000	0.37717	0.881000	0.34555	0.938000	0.57974	2.700000	0.47085	1.520000	0.48965	0.655000	0.94253	CGC	CHMP7	-	pfam_Snf7	ENSG00000147457		0.532	CHMP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHMP7	HGNC	protein_coding	OTTHUMT00000254717.1	60	0.00	0	C	NM_152272		23114072	23114072	+1	no_errors	ENST00000313219	ensembl	human	known	69_37n	missense	24	27.27	9	SNP	0.752	T
CTNND2	1501	genome.wustl.edu	37	5	11082867	11082867	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr5:11082867C>A	ENST00000304623.8	-	16	2918	c.2729G>T	c.(2728-2730)tGc>tTc	p.C910F	CTNND2_ENST00000503622.1_Missense_Mutation_p.C573F|CTNND2_ENST00000458100.2_Missense_Mutation_p.C477F|CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000359640.2_Missense_Mutation_p.C852F|CTNND2_ENST00000511377.1_Missense_Mutation_p.C819F	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	910					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						GGCCACCGCGCACACCACACG	0.527																																						dbGAP											0													126.0	111.0	116.0					5																	11082867		2203	4300	6503	-	-	-	SO:0001583	missense	0			U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.2729G>T	5.37:g.11082867C>A	ENSP00000307134:p.Cys910Phe		B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.C910F	ENST00000304623.8	37	c.2729	CCDS3881.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.0|25.0	4.596897|4.596897	0.87055|0.87055	.|.	.|.	ENSG00000169862|ENSG00000169862	ENST00000538638|ENST00000304623;ENST00000359640;ENST00000511377;ENST00000458100;ENST00000503622	.|T;T;T;T;T	.|0.68331	.|-0.32;-0.32;-0.32;-0.32;-0.32	5.04|5.04	5.04|5.04	0.67666|0.67666	.|Armadillo-like helical (1);Armadillo-type fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	.|T	.|0.80649	.|0.4663	M|M	0.63428|0.63428	1.95|1.95	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.69078	.|0.997;0.997;0.996	.|D;D;D	.|0.83275	.|0.996;0.996;0.996	.|T	.|0.81797	.|-0.0768	.|10	.|0.59425	.|D	.|0.04	.|-15.6584	18.7557|18.7557	0.91832|0.91832	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|573;502;910	.|B4DRK2;B4DG58;Q9UQB3	.|.;.;CTND2_HUMAN	.|F	-1|910;852;819;477;573	.|ENSP00000307134:C910F;ENSP00000352661:C852F;ENSP00000426510:C819F;ENSP00000391155:C477F;ENSP00000426887:C573F	.|ENSP00000307134:C910F	.|C	-|-	.|2	.|0	CTNND2|CTNND2	11135867|11135867	1.000000|1.000000	0.71417|0.71417	0.989000|0.989000	0.46669|0.46669	0.969000|0.969000	0.65631|0.65631	6.042000|6.042000	0.70996|0.70996	2.505000|2.505000	0.84491|0.84491	0.563000|0.563000	0.77884|0.77884	.|TGC	CTNND2	-	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	ENSG00000169862		0.527	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNND2	HGNC	protein_coding	OTTHUMT00000206999.1	58	0.00	0	C	NM_001332		11082867	11082867	-1	no_errors	ENST00000304623	ensembl	human	known	69_37n	missense	56	45.10	46	SNP	1.000	A
DGCR14	8220	genome.wustl.edu	37	22	19121847	19121847	+	Silent	SNP	C	C	T	rs539108063		TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr22:19121847C>T	ENST00000252137.6	-	10	1336	c.1293G>A	c.(1291-1293)ccG>ccA	p.P431P		NM_022719.2	NP_073210.1	Q96DF8	DGC14_HUMAN	DiGeorge syndrome critical region gene 14	431					mRNA splicing, via spliceosome (GO:0000398)|nervous system development (GO:0007399)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)	16	Colorectal(54;0.0993)					GCCCACTGGCCGGGGTCTTGA	0.677													C|||	1	0.000199681	0.0	0.0	5008	,	,		15063	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													66.0	62.0	63.0					22																	19121847		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			L77566	CCDS13756.1	22q11.21	2007-02-20			ENSG00000100056	ENSG00000100056			16817	protein-coding gene	gene with protein product		601755	"""DiGeorge syndrome critical region gene 13"""	DGCR13		8776594, 9063747	Standard	NM_022719		Approved	DGSI, Es2el, ES2, DGS-H	uc002zou.3	Q96DF8	OTTHUMG00000150119	ENST00000252137.6:c.1293G>A	22.37:g.19121847C>T			Q49AH7|Q9BTZ4	Silent	SNP	pfam_Nuclear_protein_DGCR14	p.P431	ENST00000252137.6	37	c.1293	CCDS13756.1	22																																																																																			DGCR14	-	NULL	ENSG00000100056		0.677	DGCR14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGCR14	HGNC	protein_coding	OTTHUMT00000316432.2	132	0.00	0	C			19121847	19121847	-1	no_errors	ENST00000252137	ensembl	human	known	69_37n	silent	115	11.54	15	SNP	0.021	T
DMXL1	1657	genome.wustl.edu	37	5	118500331	118500331	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr5:118500331G>A	ENST00000311085.8	+	20	4912	c.4832G>A	c.(4831-4833)tGg>tAg	p.W1611*	DMXL1_ENST00000539542.1_Nonsense_Mutation_p.W1611*	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	1611										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		GTGGGGTGGTGGGTCCGGAAT	0.408																																						dbGAP											0													137.0	141.0	140.0					5																	118500331		2202	4300	6502	-	-	-	SO:0001587	stop_gained	0			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.4832G>A	5.37:g.118500331G>A	ENSP00000309690:p.Trp1611*			Nonsense_Mutation	SNP	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.W1611*	ENST00000311085.8	37	c.4832	CCDS4125.1	5	.	.	.	.	.	.	.	.	.	.	G	45	11.637140	0.99585	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	.	.	.	5.59	4.71	0.59529	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.6277	15.7144	0.77655	0.0:0.0:0.862:0.138	.	.	.	.	X	1611	.	ENSP00000309690:W1611X	W	+	2	0	DMXL1	118528230	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.744000	0.98853	1.320000	0.45209	0.585000	0.79938	TGG	DMXL1	-	pfam_Rav1p_C	ENSG00000172869		0.408	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMXL1	HGNC	protein_coding	OTTHUMT00000250862.1	78	0.00	0	G	NM_005509		118500331	118500331	+1	no_errors	ENST00000539542	ensembl	human	known	69_37n	nonsense	34	26.09	12	SNP	1.000	A
DPPA3	359787	genome.wustl.edu	37	12	7867843	7867843	+	Silent	SNP	T	T	C			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr12:7867843T>C	ENST00000345088.2	+	2	264	c.147T>C	c.(145-147)agT>agC	p.S49S		NM_199286.2	NP_954980.1	Q6W0C5	DPPA3_HUMAN	developmental pluripotency associated 3	49					chromatin modification (GO:0016568)|embryonic cleavage (GO:0040016)|negative regulation of DNA demethylation (GO:1901536)|protection of DNA demethylation of female pronucleus (GO:0044726)|regulation of genetic imprinting (GO:2000653)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(2)	8				Kidney(36;0.0887)		TCAACGCTAGTAGCGAATCTG	0.468																																						dbGAP											0													84.0	86.0	86.0					12																	7867843		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY317075	CCDS8582.1	12p13.31	2012-10-02			ENSG00000187569	ENSG00000187569			19199	protein-coding gene	gene with protein product		608408					Standard	NM_199286		Approved	Stella	uc001qtf.3	Q6W0C5	OTTHUMG00000168434	ENST00000345088.2:c.147T>C	12.37:g.7867843T>C			Q0P5U3|Q6JZS6	Silent	SNP	NULL	p.S49	ENST00000345088.2	37	c.147	CCDS8582.1	12																																																																																			DPPA3	-	NULL	ENSG00000187569		0.468	DPPA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPPA3	HGNC	protein_coding	OTTHUMT00000399718.1	65	0.00	0	T	NM_199286		7867843	7867843	+1	no_errors	ENST00000345088	ensembl	human	known	69_37n	silent	47	11.32	6	SNP	0.000	C
DPY19L2P1	554236	genome.wustl.edu	37	7	35131356	35131357	+	RNA	DEL	TG	TG	-	rs182353742|rs376288775	byFrequency	TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	TG	TG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr7:35131356_35131357delTG	ENST00000436258.1	-	0	2012_2013							Q6NXN4	D19P1_HUMAN	DPY19L2 pseudogene 1							integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)										AGGATGAGTTtgtgtgtgtgtg	0.406																																						dbGAP											0																																										-	-	-			0			BC066987		7p14.2	2014-03-18	2013-09-12		ENSG00000189212	ENSG00000189212			22305	pseudogene	pseudogene			"""dpy-19-like 2 pseudogene 1 (C. elegans)"""				Standard	NR_002833		Approved		uc031swy.1	Q6NXN4	OTTHUMG00000155026		7.37:g.35131366_35131367delTG			B4E2E3	RNA	DEL	-	NULL	ENST00000436258.1	37	NULL		7																																																																																			DPY19L2P1	-	-	ENSG00000189212		0.406	DPY19L2P1-002	KNOWN	basic	processed_transcript	DPY19L2P1	HGNC	pseudogene	OTTHUMT00000338113.1	15	0.00	0	TG			35131356	35131357	-1	no_errors	ENST00000436258	ensembl	human	known	69_37n	rna	16	11.11	2	DEL	0.000:0.000	-
DZIP1	22873	genome.wustl.edu	37	13	96293774	96293774	+	Silent	SNP	C	C	A			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr13:96293774C>A	ENST00000376829.2	-	5	1223	c.372G>T	c.(370-372)gcG>gcT	p.A124A	DZIP1_ENST00000466027.1_5'UTR|DZIP1_ENST00000347108.3_Silent_p.A124A|DZIP1_ENST00000361396.2_Silent_p.A124A|DZIP1_ENST00000361156.3_Silent_p.A124A	NM_198968.3	NP_945319.1	Q86YF9	DZIP1_HUMAN	DAZ interacting zinc finger protein 1	124					cilium assembly (GO:0042384)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(20)|lung(11)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	38	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.141)			TGGTGAACTGCGCCAGACGGA	0.607																																						dbGAP											0													107.0	81.0	90.0					13																	96293774		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB023213	CCDS9477.1, CCDS9478.1	13q32.1	2013-05-22	2013-05-22		ENSG00000134874	ENSG00000134874		"""Zinc fingers, C2H2-type"""	20908	protein-coding gene	gene with protein product		608671	"""DAZ interacting protein 1"""				Standard	NM_014934		Approved	KIAA0996, DZIP	uc001vmk.4	Q86YF9	OTTHUMG00000017224	ENST00000376829.2:c.372G>T	13.37:g.96293774C>A			Q5W078|Q5W079|Q8WY45|Q8WY46|Q9UGA5|Q9Y2K0	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A124	ENST00000376829.2	37	c.372	CCDS9478.1	13																																																																																			DZIP1	-	NULL	ENSG00000134874		0.607	DZIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DZIP1	HGNC	protein_coding	OTTHUMT00000045496.3	42	0.00	0	C	NM_014934		96293774	96293774	-1	no_errors	ENST00000347108	ensembl	human	known	69_37n	silent	16	40.74	11	SNP	0.996	A
FAM45A	404636	genome.wustl.edu	37	10	120871384	120871384	+	Silent	SNP	G	G	C	rs577612097	byFrequency	TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr10:120871384G>C	ENST00000361432.2	+	3	302	c.276G>C	c.(274-276)ctG>ctC	p.L92L	FAM45A_ENST00000535029.1_Silent_p.L92L|FAM45A_ENST00000544016.1_5'UTR	NM_207009.2	NP_996892.1	Q8TCE6	FA45A_HUMAN	family with sequence similarity 45, member A	92										breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	14		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0293)		CTATTGTCCTGACCGCCAAAG	0.289													G|||	6	0.00119808	0.0	0.0	5008	,	,		17322	0.0		0.0	False		,,,				2504	0.0061					dbGAP											0													142.0	142.0	142.0					10																	120871384		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF168713	CCDS7609.1	10q25	2008-09-04			ENSG00000119979	ENSG00000119979			31793	protein-coding gene	gene with protein product							Standard	NM_207009		Approved			Q8TCE6	OTTHUMG00000019143	ENST00000361432.2:c.276G>C	10.37:g.120871384G>C			B1AMV6|B4DDC3|D3DRC8|Q9NXW4	Silent	SNP	pfam_Secretory_pathway_prot_Avl9	p.L92	ENST00000361432.2	37	c.276	CCDS7609.1	10																																																																																			FAM45A	-	NULL	ENSG00000119979		0.289	FAM45A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM45A	HGNC	protein_coding	OTTHUMT00000050623.1	140	0.00	0	G	NM_207009		120871384	120871384	+1	no_errors	ENST00000361432	ensembl	human	known	69_37n	silent	86	22.32	25	SNP	1.000	C
FHOD3	80206	genome.wustl.edu	37	18	34298167	34298167	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr18:34298167C>T	ENST00000359247.4	+	15	2330	c.2330C>T	c.(2329-2331)cCg>cTg	p.P777L	FHOD3_ENST00000590592.1_Missense_Mutation_p.P969L|FHOD3_ENST00000591635.1_Intron|FHOD3_ENST00000257209.4_Missense_Mutation_p.P794L|FHOD3_ENST00000445677.1_Missense_Mutation_p.P756L|FHOD3_ENST00000592128.1_5'Flank	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	777					actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				GAAACAGCGCCGGTGCAGCCG	0.532																																						dbGAP											0													81.0	83.0	82.0					18																	34298167		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.2330C>T	18.37:g.34298167C>T	ENSP00000352186:p.Pro777Leu		A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Missense_Mutation	SNP	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,superfamily_ARM-type_fold,smart_Actin-bd_FH2/DRF_autoreg	p.P794L	ENST00000359247.4	37	c.2381		18	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.783910	0.00628	.	.	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	T;T;T	0.32515	1.45;1.46;1.46	4.63	2.57	0.30868	.	0.725109	0.13110	N	0.413022	T	0.15435	0.0372	N	0.17379	0.485	0.23784	N	0.996852	P;P;B	0.44946	0.846;0.76;0.188	B;B;B	0.33521	0.165;0.054;0.036	T	0.06232	-1.0838	10	0.39692	T	0.17	.	9.2139	0.37335	0.1704:0.7344:0.0:0.0953	.	756;777;794	Q2V2M9-2;Q2V2M9;Q2V2M9-3	.;FHOD3_HUMAN;.	L	794;777;756	ENSP00000257209:P794L;ENSP00000352186:P777L;ENSP00000411430:P756L	ENSP00000257209:P794L	P	+	2	0	FHOD3	32552165	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.735000	0.26115	0.391000	0.25143	-1.644000	0.00765	CCG	FHOD3	-	NULL	ENSG00000134775		0.532	FHOD3-001	PUTATIVE	basic	protein_coding	FHOD3	HGNC	protein_coding	OTTHUMT00000460884.1	41	0.00	0	C	XM_371114		34298167	34298167	+1	no_errors	ENST00000257209	ensembl	human	known	69_37n	missense	15	40.00	10	SNP	0.001	T
FLNB	2317	genome.wustl.edu	37	3	58087962	58087962	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr3:58087962C>G	ENST00000295956.4	+	9	1543	c.1378C>G	c.(1378-1380)Cga>Gga	p.R460G	FLNB_ENST00000490882.1_Missense_Mutation_p.R460G|FLNB_ENST00000357272.4_Missense_Mutation_p.R460G|FLNB_ENST00000358537.3_Missense_Mutation_p.R460G|FLNB_ENST00000429972.2_Missense_Mutation_p.R460G|FLNB_ENST00000348383.5_Missense_Mutation_p.R460G|FLNB_ENST00000419752.2_Missense_Mutation_p.R291G|FLNB_ENST00000493452.1_Missense_Mutation_p.R291G	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	460					actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		GGCCAGTGGCCGAGGCCTACA	0.517																																						dbGAP											0													72.0	79.0	77.0					3																	58087962		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.1378C>G	3.37:g.58087962C>G	ENSP00000295956:p.Arg460Gly		B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.R460G	ENST00000295956.4	37	c.1378	CCDS2885.1	3	.	.	.	.	.	.	.	.	.	.	C	21.0	4.084920	0.76642	.	.	ENSG00000136068	ENST00000295956;ENST00000490882;ENST00000358537;ENST00000429972;ENST00000348383;ENST00000357272;ENST00000493452;ENST00000419752	D;D;D;D;D;D;D;D	0.84730	-1.89;-1.89;-1.89;-1.89;-1.89;-1.89;-1.89;-1.89	5.43	4.53	0.55603	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.92596	0.7648	M	0.87617	2.895	0.58432	D	0.999999	P;D;P;B;P;P	0.61080	0.894;0.989;0.832;0.383;0.726;0.726	P;D;P;P;P;P	0.69307	0.758;0.963;0.737;0.806;0.737;0.737	D	0.93556	0.6891	10	0.62326	D	0.03	.	14.5666	0.68182	0.3421:0.6579:0.0:0.0	.	460;460;291;291;460;460	O75369-2;B2ZZ83;E7EN95;O75369-7;Q60FE7;O75369	.;.;.;.;.;FLNB_HUMAN	G	460;460;460;460;460;460;291;291	ENSP00000295956:R460G;ENSP00000420213:R460G;ENSP00000351339:R460G;ENSP00000415599:R460G;ENSP00000232447:R460G;ENSP00000349819:R460G;ENSP00000418510:R291G;ENSP00000414532:R291G	ENSP00000295956:R460G	R	+	1	2	FLNB	58063002	0.998000	0.40836	1.000000	0.80357	0.976000	0.68499	4.020000	0.57189	1.394000	0.46624	0.591000	0.81541	CGA	FLNB	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000136068		0.517	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FLNB	HGNC	protein_coding	OTTHUMT00000353569.1	44	0.00	0	C	NM_001457		58087962	58087962	+1	no_errors	ENST00000295956	ensembl	human	known	69_37n	missense	34	24.44	11	SNP	1.000	G
FRY	10129	genome.wustl.edu	37	13	32698787	32698787	+	Silent	SNP	T	T	C			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr13:32698787T>C	ENST00000380250.3	+	6	1100	c.604T>C	c.(604-606)Ttg>Ctg	p.L202L		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	202						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		TGTTATTAACTTGGCTTTCAA	0.313																																						dbGAP											0													65.0	59.0	61.0					13																	32698787		1831	4079	5910	-	-	-	SO:0001819	synonymous_variant	0			AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.604T>C	13.37:g.32698787T>C			Q9Y3N6	Silent	SNP	superfamily_ARM-type_fold	p.L202	ENST00000380250.3	37	c.604	CCDS41875.1	13																																																																																			FRY	-	NULL	ENSG00000073910		0.313	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRY	HGNC	protein_coding	OTTHUMT00000044405.1	50	0.00	0	T	NM_023037		32698787	32698787	+1	no_errors	ENST00000380250	ensembl	human	known	69_37n	silent	46	16.36	9	SNP	1.000	C
FXYD3	5349	genome.wustl.edu	37	19	35614360	35614360	+	Nonstop_Mutation	SNP	G	G	C			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr19:35614360G>C	ENST00000344013.6	+	9	459	c.263G>C	c.(262-264)tGa>tCa	p.*88S	FXYD3_ENST00000604255.1_Nonstop_Mutation_p.*145S|FXYD3_ENST00000406988.1_Nonstop_Mutation_p.*88S|FXYD3_ENST00000604621.1_Nonstop_Mutation_p.*88S|FXYD3_ENST00000604404.1_Nonstop_Mutation_p.*88S|FXYD3_ENST00000346446.5_Nonstop_Mutation_p.*114S|LGI4_ENST00000493050.1_5'Flank|FXYD3_ENST00000604804.1_Nonstop_Mutation_p.*117S|FXYD3_ENST00000603524.1_Nonstop_Mutation_p.*117S|FXYD3_ENST00000435734.2_Nonstop_Mutation_p.*114S|FXYD3_ENST00000603181.1_Nonstop_Mutation_p.*88S|FXYD3_ENST00000535103.1_Nonstop_Mutation_p.*145S			Q14802	FXYD3_HUMAN	FXYD domain containing ion transport regulator 3	0					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of catalytic activity (GO:0050790)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			endometrium(1)|lung(2)|prostate(1)	4	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.54e-20)|OV - Ovarian serous cystadenocarcinoma(14;1.33e-18)|all cancers(14;4.27e-17)|LUSC - Lung squamous cell carcinoma(66;0.0849)			GCCCAAAGCTGATGAGGACAG	0.517																																						dbGAP											0													133.0	112.0	119.0					19																	35614360		2203	4300	6503	-	-	-	SO:0001578	stop_lost	0			X93036	CCDS12442.1, CCDS12443.1, CCDS46048.1, CCDS46049.1, CCDS46050.1	19q13.11-q13.12	2008-05-14	2002-01-14			ENSG00000089356			4027	protein-coding gene	gene with protein product		604996	"""FXYD domain-containing ion transport regulator 3"""	PLML		7836447, 10950925	Standard	NM_005971		Approved	MAT-8	uc010xsm.2	Q14802		ENST00000344013.6:c.263G>C	19.37:g.35614360G>C	ENSP00000339499:p.*88Serext*1		A6NDE0|C9JDU2|F5H174|F8WB34|Q13211|Q6IB59	Nonstop_Mutation	SNP	pfam_Ion-transport_regulator_FXYD	p.*145S	ENST00000344013.6	37	c.434	CCDS12442.1	19	.	.	.	.	.	.	.	.	.	.	G	3.349	-0.132955	0.06711	.	.	ENSG00000089356	ENST00000435734;ENST00000346446;ENST00000344013;ENST00000406988;ENST00000535103	.	.	.	3.32	2.25	0.28309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.4887	0.33086	0.0:0.2403:0.7597:0.0	.	.	.	.	S	145;114;88;88;145	.	.	X	+	2	2	FXYD3	40306200	0.993000	0.37304	0.891000	0.34965	0.257000	0.26127	1.698000	0.37794	0.732000	0.32470	0.498000	0.49722	TGA	FXYD3	-	NULL	ENSG00000089356		0.517	FXYD3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FXYD3	HGNC	protein_coding	OTTHUMT00000468985.1	90	0.00	0	G	NM_021910		35614360	35614360	+1	no_errors	ENST00000435734	ensembl	human	known	69_37n	nonstop	73	34.82	39	SNP	0.971	C
GABARAP	11337	genome.wustl.edu	37	17	7144763	7144763	+	Silent	SNP	G	G	A			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr17:7144763G>A	ENST00000302386.5	-	3	625	c.186C>T	c.(184-186)ttC>ttT	p.F62F	PHF23_ENST00000571362.1_5'Flank|GABARAP_ENST00000577035.1_5'UTR|GABARAP_ENST00000571253.1_5'UTR|GABARAP_ENST00000573928.1_Silent_p.F62F|PHF23_ENST00000576955.1_5'Flank|PHF23_ENST00000454255.2_5'Flank|PHF23_ENST00000320316.3_5'Flank|GABARAP_ENST00000571129.1_5'UTR|CTD-2545G14.7_ENST00000570760.2_3'UTR	NM_007278.1	NP_009209.1	O95166	GBRAP_HUMAN	GABA(A) receptor-associated protein	62	Interaction with GABRG2. {ECO:0000255}.|Interaction with GPHN. {ECO:0000250}.				autophagy (GO:0006914)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|microtubule cytoskeleton organization (GO:0000226)|protein targeting (GO:0006605)|synaptic transmission (GO:0007268)	actin cytoskeleton (GO:0015629)|autophagic vacuole (GO:0005776)|autophagic vacuole membrane (GO:0000421)|axoneme (GO:0005930)|cell body (GO:0044297)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-tubulin binding (GO:0048487)|GABA receptor binding (GO:0050811)			breast(1)|lung(2)	3						TCCGGATCAAGAAGTAGAACT	0.483																																						dbGAP											0													169.0	179.0	175.0					17																	7144763		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF161586	CCDS11092.1	17p13.1	2014-02-12			ENSG00000170296	ENSG00000170296			4067	protein-coding gene	gene with protein product		605125				9892355	Standard	NM_007278		Approved	MM46, ATG8A	uc002gfb.3	O95166	OTTHUMG00000102156	ENST00000302386.5:c.186C>T	17.37:g.7144763G>A				Missense_Mutation	SNP	NULL	p.S36F	ENST00000302386.5	37	c.107	CCDS11092.1	17																																																																																			GABARAP	-	NULL	ENSG00000170296		0.483	GABARAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABARAP	HGNC	protein_coding	OTTHUMT00000220000.2	48	0.00	0	G			7144763	7144763	-1	no_errors	ENST00000570856	ensembl	human	known	69_37n	missense	39	27.78	15	SNP	1.000	A
GALNTL6	442117	genome.wustl.edu	37	4	173961139	173961141	+	In_Frame_Del	DEL	AGA	AGA	-	rs369616934		TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	AGA	AGA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr4:173961139_173961141delAGA	ENST00000506823.1	+	13	2351_2353	c.1694_1696delAGA	c.(1693-1698)gagaag>gag	p.K567del	GALNTL6_ENST00000508122.1_In_Frame_Del_p.K550del	NM_001034845.2	NP_001030017.2	Q49A17	GLTL6_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 6	567	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.K567delK(1)		breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(2)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	45						AACCCCGCAGAGAAGAAGATTTT	0.424																																						dbGAP											1	Deletion - In frame(1)	lung(1)																																								-	-	-	SO:0001651	inframe_deletion	0				CCDS34104.1	4q34.1	2014-03-13	2014-03-13		ENSG00000174473	ENSG00000174473		"""Glycosyltransferase family 2 domain containing"""	33844	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 6"""	615138	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6"""				Standard	NM_001034845		Approved	GALNT17, GalNAc-T6L	uc003isv.3	Q49A17	OTTHUMG00000160807	ENST00000506823.1:c.1694_1696delAGA	4.37:g.173961145_173961147delAGA	ENSP00000423313:p.Lys567del		Q2L4S6	In_Frame_Del	DEL	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.K567in_frame_del	ENST00000506823.1	37	c.1694_1696	CCDS34104.1	4																																																																																			GALNTL6	-	pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	ENSG00000174473		0.424	GALNTL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNTL6	HGNC	protein_coding	OTTHUMT00000362395.1	73	0.00	0	AGA	NM_001034845		173961139	173961141	+1	no_errors	ENST00000506823	ensembl	human	known	69_37n	in_frame_del	93	14.68	16	DEL	1.000:1.000:1.000	-
GOLGA3	2802	genome.wustl.edu	37	12	133349744	133349744	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr12:133349744C>T	ENST00000450791.2	-	23	4627	c.4444G>A	c.(4444-4446)Gac>Aac	p.D1482N	GOLGA3_ENST00000204726.3_Missense_Mutation_p.D1482N			Q08378	GOGA3_HUMAN	golgin A3	1482					intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		CTCTGTGGGTCGCCGCGTGGG	0.692																																						dbGAP											0													18.0	20.0	19.0					12																	133349744		2188	4282	6470	-	-	-	SO:0001583	missense	0			AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.4444G>A	12.37:g.133349744C>T	ENSP00000410378:p.Asp1482Asn		A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Missense_Mutation	SNP	superfamily_Prefoldin	p.D1482N	ENST00000450791.2	37	c.4444	CCDS9281.1	12	.	.	.	.	.	.	.	.	.	.	C	12.18	1.859768	0.32884	.	.	ENSG00000090615	ENST00000204726;ENST00000450791	T;T	0.31247	1.5;1.5	5.4	3.57	0.40892	.	0.401030	0.24296	N	0.039773	T	0.36963	0.0986	L	0.27053	0.805	0.21386	N	0.999706	D	0.76494	0.999	P	0.61070	0.883	T	0.19418	-1.0306	10	0.51188	T	0.08	.	12.4901	0.55895	0.0:0.8483:0.0:0.1517	.	1482	Q08378	GOGA3_HUMAN	N	1482	ENSP00000204726:D1482N;ENSP00000410378:D1482N	ENSP00000204726:D1482N	D	-	1	0	GOLGA3	131859817	0.123000	0.22298	0.001000	0.08648	0.000000	0.00434	1.725000	0.38074	0.357000	0.24183	-0.813000	0.03139	GAC	GOLGA3	-	NULL	ENSG00000090615		0.692	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GOLGA3	HGNC	protein_coding	OTTHUMT00000397569.2	31	0.00	0	C	NM_005895		133349744	133349744	-1	no_errors	ENST00000204726	ensembl	human	known	69_37n	missense	30	25.00	10	SNP	0.011	T
GPHN	10243	genome.wustl.edu	37	14	67147848	67147848	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr14:67147848C>A	ENST00000315266.5	+	2	1209	c.88C>A	c.(88-90)Ctt>Att	p.L30I	GPHN_ENST00000459628.1_Missense_Mutation_p.L30I|GPHN_ENST00000478722.1_Missense_Mutation_p.L30I|GPHN_ENST00000305960.9_Missense_Mutation_p.L30I|GPHN_ENST00000543237.1_Missense_Mutation_p.L30I	NM_001024218.1	NP_001019389.1	Q9NQX3	GEPH_HUMAN	gephyrin	30	MPT Mo-transferase.				establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycine receptor clustering (GO:0072579)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|molybdopterin adenylyltransferase activity (GO:0061598)|molybdopterin molybdotransferase activity (GO:0061599)|transferase activity (GO:0016740)			large_intestine(8)|liver(1)|ovary(2)|stomach(1)	12		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)		CTTCAGGAATCTTGCAGAAGA	0.313			T	MLL	AL																																	dbGAP		Dom	yes		14	14q24	10243	gephyrin (GPH)		L	0													82.0	85.0	84.0					14																	67147848		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037806	CCDS9777.1, CCDS32103.1	14q23.3	2008-04-22			ENSG00000171723	ENSG00000171723			15465	protein-coding gene	gene with protein product		603930				1319186, 10325225, 18403029	Standard	XM_005267250		Approved	KIAA1385	uc001xix.3	Q9NQX3	OTTHUMG00000029785	ENST00000315266.5:c.88C>A	14.37:g.67147848C>A	ENSP00000312771:p.Leu30Ile		Q9H4E9|Q9P2G2	Missense_Mutation	SNP	pfam_Mopterin-bd,pfam_MoeA_linker/N,pfam_MoeA_C_domain_IV,superfamily_MoeA_linker/N,superfamily_Mopterin-bd,superfamily_MoeA_C_domain_IV,smart_Mopterin-bd,tigrfam_Mo_cofactor_synthesis	p.L30I	ENST00000315266.5	37	c.88	CCDS32103.1	14	.	.	.	.	.	.	.	.	.	.	C	17.14	3.314693	0.60524	.	.	ENSG00000171723	ENST00000315266;ENST00000478722;ENST00000459628;ENST00000543237;ENST00000305960	T;T;T;T;T	0.77229	-1.08;-1.08;-1.08;-1.08;-1.08	5.11	5.11	0.69529	Molybdenum cofactor synthesis (1);Molybdopterin binding (4);	0.000000	0.85682	D	0.000000	T	0.76891	0.4051	N	0.10782	0.045	0.49130	D	0.999755	P;P;B;P;P	0.45986	0.811;0.87;0.118;0.706;0.667	P;D;P;D;P	0.69142	0.87;0.962;0.747;0.921;0.595	T	0.75560	-0.3275	10	0.23891	T	0.37	-5.4652	16.0118	0.80409	0.0:1.0:0.0:0.0	.	30;30;30;30;30	F8W7D6;F5H039;Q9NQX3;Q9NQX3-2;G3V582	.;.;GEPH_HUMAN;.;.	I	30	ENSP00000312771:L30I;ENSP00000417901:L30I;ENSP00000452220:L30I;ENSP00000438404:L30I;ENSP00000303019:L30I	ENSP00000303019:L30I	L	+	1	0	GPHN	66217601	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.865000	0.75500	2.374000	0.81015	0.579000	0.79373	CTT	GPHN	-	pfam_Mopterin-bd,superfamily_Mopterin-bd,smart_Mopterin-bd,tigrfam_Mo_cofactor_synthesis	ENSG00000171723		0.313	GPHN-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	GPHN	HGNC	protein_coding	OTTHUMT00000074299.2	53	0.00	0	C	NM_020806		67147848	67147848	+1	no_errors	ENST00000478722	ensembl	human	known	69_37n	missense	36	18.18	8	SNP	1.000	A
GRHPR	9380	genome.wustl.edu	37	9	37422820	37422820	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr9:37422820C>T	ENST00000318158.6	+	1	158	c.73C>T	c.(73-75)Cgg>Tgg	p.R25W	GRHPR_ENST00000493368.1_Intron|GRHPR_ENST00000607784.1_Missense_Mutation_p.R25W	NM_012203.1	NP_036335.1	Q9UBQ7	GRHPR_HUMAN	glyoxylate reductase/hydroxypyruvate reductase	25					cellular nitrogen compound metabolic process (GO:0034641)|dicarboxylic acid metabolic process (GO:0043648)|excretion (GO:0007588)|glyoxylate metabolic process (GO:0046487)|metabolic process (GO:0008152)|oxidation-reduction process (GO:0055114)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|peroxisomal matrix (GO:0005782)	carboxylic acid binding (GO:0031406)|glycerate dehydrogenase activity (GO:0008465)|glyoxylate reductase (NADP) activity (GO:0030267)|hydroxypyruvate reductase activity (GO:0016618)|NAD binding (GO:0051287)|NADPH binding (GO:0070402)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12				GBM - Glioblastoma multiforme(29;0.00687)		CGCGCTCGCCCGGGCGGCAGA	0.726																																						dbGAP											0													9.0	11.0	10.0					9																	37422820		2180	4269	6449	-	-	-	SO:0001583	missense	0			AF134895	CCDS6609.1	9q12	2012-07-13			ENSG00000137106	ENSG00000137106	1.1.1.79, 1.1.1.81		4570	protein-coding gene	gene with protein product	"""primary hyperoxaluria type 2"""	604296		GLXR		10524214, 10484776	Standard	XM_005251631		Approved	PH2	uc003zzu.1	Q9UBQ7	OTTHUMG00000019914	ENST00000318158.6:c.73C>T	9.37:g.37422820C>T	ENSP00000313432:p.Arg25Trp		Q5T945|Q9H3E9|Q9H636|Q9UKX1	Missense_Mutation	SNP	pfam_D-isomer_2_OHA_DH_NAD-bd,pfam_D-isomer_2_OHA_DH_cat_dom,pfam_6PGDH_NADP-bd,pfam_NADP_OxRdtase_F420	p.R25W	ENST00000318158.6	37	c.73	CCDS6609.1	9	.	.	.	.	.	.	.	.	.	.	C	15.89	2.966597	0.53507	.	.	ENSG00000137106	ENST00000377824;ENST00000318158	D;D	0.84223	-1.82;-1.82	4.94	0.646	0.17789	D-isomer specific 2-hydroxyacid dehydrogenase, catalytic domain (1);NAD(P)-binding domain (1);	0.867200	0.10565	N	0.659856	D	0.83335	0.5232	L	0.61036	1.89	0.09310	N	0.999999	P	0.50443	0.935	B	0.37943	0.261	T	0.74788	-0.3546	10	0.87932	D	0	.	18.9283	0.92553	0.0:0.3865:0.6135:0.0	.	25	Q9UBQ7	GRHPR_HUMAN	W	25	ENSP00000367055:R25W;ENSP00000313432:R25W	ENSP00000313432:R25W	R	+	1	2	GRHPR	37412820	0.016000	0.18221	0.275000	0.24674	0.211000	0.24417	-0.340000	0.07821	0.027000	0.15297	0.485000	0.47835	CGG	GRHPR	-	pfam_D-isomer_2_OHA_DH_cat_dom	ENSG00000137106		0.726	GRHPR-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRHPR	HGNC	protein_coding	OTTHUMT00000052442.1	19	0.00	0	C	NM_012203		37422820	37422820	+1	no_errors	ENST00000377824	ensembl	human	known	69_37n	missense	14	36.36	8	SNP	0.151	T
HERC2	8924	genome.wustl.edu	37	15	28479350	28479350	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr15:28479350C>G	ENST00000261609.7	-	27	4192	c.4084G>C	c.(4084-4086)Gac>Cac	p.D1362H		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CTGCAGTGGTCCTCGTCTTTC	0.572																																						dbGAP											0													1.0	1.0	1.0					15																	28479350		320	613	933	-	-	-	SO:0001583	missense	0			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.4084G>C	15.37:g.28479350C>G	ENSP00000261609:p.Asp1362His			Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_CPH_domain,pfam_Mib_Herc2,pfam_Cyt_B5,pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_HECT,superfamily_Galactose-bd-like,superfamily_Cyt_B5,superfamily_UBA-like,superfamily_CUB,smart_Beta-propeller_rpt_TECPR,smart_Znf_ZZ,smart_HECT,pfscan_HECT,pfscan_Znf_ZZ,pfscan_Reg_chr_condens,pfscan_Cyt_B5,prints_Reg_chr_condens	p.D1362H	ENST00000261609.7	37	c.4084	CCDS10021.1	15	.	.	.	.	.	.	.	.	.	.	C	19.29	3.798975	0.70567	.	.	ENSG00000128731	ENST00000261609	T	0.39056	1.1	4.25	4.25	0.50352	.	0.110120	0.64402	D	0.000014	T	0.59280	0.2182	L	0.50333	1.59	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.63024	-0.6729	10	0.62326	D	0.03	.	17.2311	0.86984	0.0:1.0:0.0:0.0	.	1362	O95714	HERC2_HUMAN	H	1362	ENSP00000261609:D1362H	ENSP00000261609:D1362H	D	-	1	0	HERC2	26152945	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.296000	0.78790	2.364000	0.80123	0.555000	0.69702	GAC	HERC2	-	NULL	ENSG00000128731		0.572	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC2	HGNC	protein_coding	OTTHUMT00000251358.2	19	0.00	0	C	NM_004667		28479350	28479350	-1	no_errors	ENST00000261609	ensembl	human	known	69_37n	missense	13	46.15	12	SNP	1.000	G
HERC1	8925	genome.wustl.edu	37	15	64067208	64067208	+	Silent	SNP	T	T	C			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr15:64067208T>C	ENST00000443617.2	-	2	702	c.615A>G	c.(613-615)ccA>ccG	p.P205P		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	205					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						CTAATGATAATGGTGGCAAAG	0.418																																						dbGAP											0													219.0	213.0	215.0					15																	64067208		1947	4141	6088	-	-	-	SO:0001819	synonymous_variant	0			U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.615A>G	15.37:g.64067208T>C			Q8IW65	Silent	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_WD40_repeat,pfam_SPRY_rcpt,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_HECT,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl,superfamily_UBA-like,superfamily_ARM-type_fold,smart_SPla/RYanodine_receptor_subgr,smart_WD40_repeat,smart_HECT,pfscan_B30.2/SPRY,pfscan_HECT,pfscan_Reg_chr_condens,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Reg_chr_condens	p.P205	ENST00000443617.2	37	c.615	CCDS45277.1	15																																																																																			HERC1	-	NULL	ENSG00000103657		0.418	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC1	HGNC	protein_coding	OTTHUMT00000418523.1	39	0.00	0	T	NM_003922		64067208	64067208	-1	no_errors	ENST00000443617	ensembl	human	known	69_37n	silent	22	38.89	14	SNP	0.998	C
HPGDS	27306	genome.wustl.edu	37	4	95239059	95239059	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr4:95239059C>A	ENST00000295256.5	-	3	281	c.191G>T	c.(190-192)aGc>aTc	p.S64I	HPGDS_ENST00000514774.1_5'UTR	NM_014485.2	NP_055300.1	O60760	HPGDS_HUMAN	hematopoietic prostaglandin D synthase	64	GST N-terminal.|Glutathione binding.				arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|glutathione derivative biosynthetic process (GO:1901687)|locomotory behavior (GO:0007626)|prostaglandin metabolic process (GO:0006693)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	calcium ion binding (GO:0005509)|glutathione transferase activity (GO:0004364)|magnesium ion binding (GO:0000287)|prostaglandin-D synthase activity (GO:0004667)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|lung(3)|ovary(1)|urinary_tract(1)	7					Glutathione(DB00143)	TATTGCTAGGCTCTGGTGAAG	0.308																																					Colon(86;1802 1843 17863 46794)	dbGAP											0													96.0	98.0	97.0					4																	95239059		2203	4300	6503	-	-	-	SO:0001583	missense	0			D82073	CCDS3640.1	4q22.2	2012-06-21			ENSG00000163106	ENSG00000163106		"""Glutathione S-transferases / Soluble"""	17890	protein-coding gene	gene with protein product	"""glutathione S-transferase sigma"""	602598				9323136, 9353279, 11672424	Standard	XM_005262932		Approved	GSTS, PGDS, H-PGDS, PGD2, GSTS1-1	uc003hte.1	O60760	OTTHUMG00000130974	ENST00000295256.5:c.191G>T	4.37:g.95239059C>A	ENSP00000295256:p.Ser64Ile		Q6FHT9	Missense_Mutation	SNP	pfam_Glutathione_S-Trfase_N,pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold	p.S64I	ENST00000295256.5	37	c.191	CCDS3640.1	4	.	.	.	.	.	.	.	.	.	.	C	21.4	4.141116	0.77775	.	.	ENSG00000163106	ENST00000295256	T	0.17691	2.26	5.48	5.48	0.80851	Glutathione S-transferase, N-terminal (2);Thioredoxin-like fold (2);	0.000000	0.85682	D	0.000000	T	0.55816	0.1944	H	0.96239	3.79	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.69851	-0.5033	10	0.87932	D	0	.	14.8519	0.70303	0.0:1.0:0.0:0.0	.	64	O60760	HPGDS_HUMAN	I	64	ENSP00000295256:S64I	ENSP00000295256:S64I	S	-	2	0	HPGDS	95458082	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	4.722000	0.61958	2.575000	0.86900	0.650000	0.86243	AGC	HPGDS	-	pfam_Glutathione_S-Trfase_N,superfamily_Thioredoxin-like_fold	ENSG00000163106		0.308	HPGDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPGDS	HGNC	protein_coding	OTTHUMT00000253587.1	74	0.00	0	C	NM_014485		95239059	95239059	-1	no_errors	ENST00000295256	ensembl	human	known	69_37n	missense	53	26.39	19	SNP	1.000	A
IGDCC4	57722	genome.wustl.edu	37	15	65689327	65689327	+	Splice_Site	SNP	T	T	A			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr15:65689327T>A	ENST00000352385.2	-	6	1051	c.842A>T	c.(841-843)gAc>gTc	p.D281V		NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4	281	Ig-like C2-type 3.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						GGGCTTCCCGTCTGGGGAAGG	0.622																																						dbGAP											0													29.0	28.0	28.0					15																	65689327		2189	4287	6476	-	-	-	SO:0001630	splice_region_variant	0				CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.842-1A>T	15.37:g.65689327T>A			Q9HCE4	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.D281V	ENST00000352385.2	37	c.842	CCDS10206.1	15	.	.	.	.	.	.	.	.	.	.	T	23.4	4.412384	0.83340	.	.	ENSG00000103742	ENST00000352385	T	0.34275	1.37	4.15	4.15	0.48705	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.124363	0.51477	U	0.000094	T	0.63815	0.2543	M	0.87547	2.89	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.71467	-0.4584	10	0.87932	D	0	.	13.1895	0.59702	0.0:0.0:0.0:1.0	.	281	Q8TDY8	IGDC4_HUMAN	V	281	ENSP00000319623:D281V	ENSP00000319623:D281V	D	-	2	0	IGDCC4	63476380	1.000000	0.71417	0.996000	0.52242	0.950000	0.60333	7.867000	0.87062	1.502000	0.48669	0.379000	0.24179	GAC	IGDCC4	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000103742		0.622	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	IGDCC4	HGNC	protein_coding	OTTHUMT00000256825.2	32	0.00	0	T	NM_020962	Missense_Mutation	65689327	65689327	-1	no_errors	ENST00000352385	ensembl	human	novel	69_37n	missense	20	20.00	5	SNP	1.000	A
KDM5C	8242	genome.wustl.edu	37	X	53247464	53247464	+	Silent	SNP	G	G	A			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chrX:53247464G>A	ENST00000375401.3	-	3	877	c.345C>T	c.(343-345)ctC>ctT	p.L115L	KDM5C_ENST00000375379.3_Silent_p.L115L|KDM5C_ENST00000404049.3_Silent_p.L115L|KDM5C_ENST00000452825.3_Intron|KDM5C_ENST00000375383.3_Intron	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	115	ARID. {ECO:0000255|PROSITE- ProRule:PRU00355}.				histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						TTACTTTGCTGAGACTGTAGA	0.468			"""N, F, S"""		clear cell renal carcinoma																																	dbGAP		Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	0													74.0	64.0	68.0					X																	53247464		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.345C>T	X.37:g.53247464G>A			B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Silent	SNP	pfam_Lys_sp_deMease_like_dom,pfam_JmjC_dom,pfam_ARID/BRIGHT_DNA-bd,pfam_Znf_C5HC2,pfam_Znf_PHD-finger,pfam_TF_JmjN,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_Znf_PHD,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_ARID/BRIGHT_DNA-bd	p.L115	ENST00000375401.3	37	c.345	CCDS14351.1	X																																																																																			KDM5C	-	pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	ENSG00000126012		0.468	KDM5C-005	KNOWN	basic|CCDS	protein_coding	KDM5C	HGNC	protein_coding	OTTHUMT00000056737.2	74	0.00	0	G	NM_004187		53247464	53247464	-1	no_errors	ENST00000375401	ensembl	human	known	69_37n	silent	50	13.79	8	SNP	1.000	A
ICE1	23379	genome.wustl.edu	37	5	5465079	5465079	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr5:5465079G>A	ENST00000296564.7	+	13	5854	c.5632G>A	c.(5632-5634)Gct>Act	p.A1878T		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		1878					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						CCTCCCTCCAGCTGAAGTTGC	0.507																																						dbGAP											0													66.0	67.0	66.0					5																	5465079		1889	4118	6007	-	-	-	SO:0001583	missense	0																														ENST00000296564.7:c.5632G>A	5.37:g.5465079G>A	ENSP00000296564:p.Ala1878Thr		Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	superfamily_Vitellinogen_superhlx	p.A1878T	ENST00000296564.7	37	c.5632	CCDS47187.1	5	.	.	.	.	.	.	.	.	.	.	G	12.53	1.965004	0.34659	.	.	ENSG00000164151	ENST00000296564	T	0.11277	2.79	5.6	-3.63	0.04529	.	.	.	.	.	T	0.07188	0.0182	L	0.44542	1.39	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.47195	-0.9136	9	0.08837	T	0.75	-4.8706	7.5339	0.27700	0.2587:0.419:0.3223:0.0	.	1878	Q9Y2F5	K0947_HUMAN	T	1878	ENSP00000296564:A1878T	ENSP00000296564:A1878T	A	+	1	0	KIAA0947	5518079	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	0.441000	0.21611	-0.515000	0.06479	-0.444000	0.05651	GCT	KIAA0947	-	NULL	ENSG00000164151		0.507	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0947	HGNC	protein_coding	OTTHUMT00000365575.1	67	0.00	0	G			5465079	5465079	+1	no_errors	ENST00000296564	ensembl	human	known	69_37n	missense	81	13.83	13	SNP	0.000	A
LRRC16B	90668	genome.wustl.edu	37	14	24534925	24534925	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr14:24534925G>T	ENST00000342740.5	+	34	3645	c.3491G>T	c.(3490-3492)aGa>aTa	p.R1164I	LRRC16B_ENST00000334420.7_Intron	NM_138360.3	NP_612369.3	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B	1164						cytoplasm (GO:0005737)				breast(3)|central_nervous_system(2)|cervix(3)|endometrium(7)|kidney(1)|large_intestine(9)|liver(1)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	52				GBM - Glioblastoma multiforme(265;0.019)		GGGTTGGAAAGAGCCAAGGGT	0.622																																						dbGAP											0													126.0	110.0	116.0					14																	24534925		2203	4300	6503	-	-	-	SO:0001583	missense	0			AI017934	CCDS32054.1	14q11.2-q12	2010-09-10	2008-02-12	2008-02-12					20272	protein-coding gene	gene with protein product		614716	"""chromosome 14 open reading frame 121"""	C14orf121		19846667	Standard	NM_138360		Approved	BC008134, crml-1, CARMIL3	uc001wlj.2	Q8ND23		ENST00000342740.5:c.3491G>T	14.37:g.24534925G>T	ENSP00000340467:p.Arg1164Ile		Q8TEF7|Q96HS9	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.R1164I	ENST00000342740.5	37	c.3491	CCDS32054.1	14	.	.	.	.	.	.	.	.	.	.	G	24.9	4.586601	0.86851	.	.	ENSG00000186648	ENST00000342740	T	0.16073	2.37	5.4	5.4	0.78164	.	0.000000	0.52532	D	0.000078	T	0.26159	0.0638	N	0.19112	0.55	0.80722	D	1	D	0.61080	0.989	D	0.69654	0.965	T	0.02226	-1.1192	10	0.45353	T	0.12	-11.9386	14.6697	0.68934	0.0:0.0:1.0:0.0	.	1164	Q8ND23	LR16B_HUMAN	I	1164	ENSP00000340467:R1164I	ENSP00000340467:R1164I	R	+	2	0	LRRC16B	23604765	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.990000	0.49401	2.522000	0.85027	0.655000	0.94253	AGA	LRRC16B	-	NULL	ENSG00000186648		0.622	LRRC16B-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRC16B	HGNC	protein_coding	OTTHUMT00000416527.1	61	0.00	0	G	NM_138360		24534925	24534925	+1	no_errors	ENST00000342740	ensembl	human	known	69_37n	missense	49	20.97	13	SNP	1.000	T
LSM14B	149986	genome.wustl.edu	37	20	60706418	60706418	+	Missense_Mutation	SNP	A	A	T	rs556214103		TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr20:60706418A>T	ENST00000279068.6	+	7	1002	c.842A>T	c.(841-843)aAg>aTg	p.K281M	LSM14B_ENST00000253001.4_Missense_Mutation_p.K281M	NM_144703.2	NP_653304.2	Q9BX40	LS14B_HUMAN	LSM14B, SCD6 homolog B (S. cerevisiae)	281					multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)	ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|lung(4)	8	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.28e-07)			GTAGATGACAAGGCTGAGAAG	0.587																																						dbGAP											0													43.0	48.0	46.0					20																	60706418		2016	4172	6188	-	-	-	SO:0001583	missense	0			AF172328	CCDS46626.1	20q13.33	2010-01-27	2006-12-21	2006-01-24	ENSG00000149657	ENSG00000149657			15887	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 40"", ""family with sequence similarity 61, member B"", ""LSM14 homolog B (SCD6, S. cerevisiae)"""	C20orf40, FAM61B			Standard	NM_144703		Approved	FT005, bA11M20.3, FLJ25473, LSM13, RAP55B	uc010gjy.1	Q9BX40	OTTHUMG00000032901	ENST00000279068.6:c.842A>T	20.37:g.60706418A>T	ENSP00000279068:p.Lys281Met		Q6PFW8|Q96LH8	Missense_Mutation	SNP	pfam_FDF_dom,superfamily_LSM_dom	p.K281M	ENST00000279068.6	37	c.842	CCDS46626.1	20	.	.	.	.	.	.	.	.	.	.	A	17.04	3.286559	0.59867	.	.	ENSG00000149657	ENST00000279068;ENST00000253001;ENST00000361670	T;T;T	0.54279	0.72;0.75;0.58	5.26	3.04	0.35103	.	0.412793	0.25984	N	0.027053	T	0.65407	0.2688	M	0.70595	2.14	0.34777	D	0.734373	D;D;D	0.69078	0.997;0.995;0.994	P;P;P	0.62649	0.905;0.905;0.874	T	0.73905	-0.3835	10	0.87932	D	0	.	9.2245	0.37398	0.8524:0.0:0.1476:0.0	.	201;281;281	E9PG81;Q9BX40;Q9BX40-2	.;LS14B_HUMAN;.	M	281;281;201	ENSP00000279068:K281M;ENSP00000253001:K281M;ENSP00000355209:K201M	ENSP00000253001:K281M	K	+	2	0	LSM14B	60139813	0.974000	0.33945	0.771000	0.31576	0.664000	0.39144	2.424000	0.44714	0.476000	0.27440	0.459000	0.35465	AAG	LSM14B	-	NULL	ENSG00000149657		0.587	LSM14B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LSM14B	HGNC	protein_coding	OTTHUMT00000079996.4	50	0.00	0	A	NM_144703		60706418	60706418	+1	no_errors	ENST00000253001	ensembl	human	known	69_37n	missense	54	11.48	7	SNP	0.922	T
LYRM4	57128	genome.wustl.edu	37	6	5109694	5109694	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr6:5109694T>C	ENST00000330636.4	-	3	444	c.239A>G	c.(238-240)aAg>aGg	p.K80R	LYRM4_ENST00000468929.1_Missense_Mutation_p.S40G|LYRM4_ENST00000606472.1_5'Flank|LYRM4_ENST00000464010.1_3'UTR	NM_020408.4	NP_065141.3	Q9HD34	LYRM4_HUMAN	LYR motif containing 4	80					small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)				endometrium(1)	1	Ovarian(93;0.11)	all_hematologic(90;0.0901)				AATGATCAGCTTGTCAGTTGA	0.562																																					NSCLC(130;1006 2426 17608 36797)	dbGAP											0													140.0	130.0	133.0					6																	5109694		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF258559	CCDS4493.1, CCDS54961.1	6p25.1	2008-02-05	2006-09-19	2006-09-19	ENSG00000214113	ENSG00000214113		"""LYR motif containing"""	21365	protein-coding gene	gene with protein product		613311	"""chromosome 6 open reading frame 149"""	C6orf149			Standard	XM_005249239		Approved	CGI-203, ISD11	uc021ykw.1	Q9HD34	OTTHUMG00000014173	ENST00000330636.4:c.239A>G	6.37:g.5109694T>C	ENSP00000418787:p.Lys80Arg		A8K543|Q5XKP1	Missense_Mutation	SNP	pfam_Complex1_LYR	p.K80R	ENST00000330636.4	37	c.239	CCDS4493.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.38|14.38	2.518419|2.518419	0.44763|0.44763	.|.	.|.	ENSG00000214113|ENSG00000214113	ENST00000330636|ENST00000468929	T|T	0.47869|0.55413	0.83|0.52	5.42|5.42	5.42|5.42	0.78866|0.78866	.|.	0.000000|.	0.48286|.	U|.	0.000182|.	T|T	0.56470|0.56470	0.1987|0.1987	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	P|.	0.37636|.	0.603|.	B|.	0.32149|.	0.141|.	T|T	0.63919|0.63919	-0.6528|-0.6528	9|6	0.31617|0.87932	T|D	0.26|0	.|.	11.86|11.86	0.52461|0.52461	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	80|.	Q9HD34|.	LYRM4_HUMAN|.	R|G	80|40	ENSP00000418787:K80R|ENSP00000418321:S40G	ENSP00000418787:K80R|ENSP00000418321:S40G	K|S	-|-	2|1	0|0	LYRM4|LYRM4	5054693|5054693	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	2.084000|2.084000	0.41625|0.41625	2.050000|2.050000	0.60909|0.60909	0.533000|0.533000	0.62120|0.62120	AAG|AGC	LYRM4	-	NULL	ENSG00000214113		0.562	LYRM4-001	KNOWN	basic|CCDS	protein_coding	LYRM4	HGNC	protein_coding	OTTHUMT00000353461.3	87	0.00	0	T	NM_020408		5109694	5109694	-1	no_errors	ENST00000330636	ensembl	human	known	69_37n	missense	59	24.36	19	SNP	1.000	C
MAP7D2	256714	genome.wustl.edu	37	X	20069029	20069029	+	Intron	SNP	G	G	C			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chrX:20069029G>C	ENST00000379651.3	-	5	614				MAP7D2_ENST00000452324.3_Intron|MAP7D2_ENST00000379643.5_Missense_Mutation_p.L211V|MAP7D2_ENST00000543767.1_Intron|MAP7D2_ENST00000443379.3_Intron	NM_152780.3	NP_689993.2	Q96T17	MA7D2_HUMAN	MAP7 domain containing 2						microtubule cytoskeleton organization (GO:0000226)	microtubule (GO:0005874)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	37						CGCGAAACAAGAATGGCTTCC	0.398																																						dbGAP											0													56.0	44.0	48.0					X																	20069029		1560	3567	5127	-	-	-	SO:0001627	intron_variant	0			BC089400	CCDS14195.1, CCDS55384.1, CCDS55385.1, CCDS55386.1	Xp22.12	2008-02-05			ENSG00000184368	ENSG00000184368			25899	protein-coding gene	gene with protein product						12477932	Standard	NM_152780		Approved	FLJ14503	uc010nfo.2	Q96T17	OTTHUMG00000021228	ENST00000379651.3:c.595+1966C>G	X.37:g.20069029G>C			B7Z2J8|B7Z3S7|B9EGC7|C9JMA4|C9JYW0|Q5EBN1|Q5JPS7|Q6PIC7|Q8N792	Missense_Mutation	SNP	pfam_E-MAP-115	p.L211V	ENST00000379651.3	37	c.631	CCDS14195.1	X	.	.	.	.	.	.	.	.	.	.	G	0.036	-1.305147	0.01353	.	.	ENSG00000184368	ENST00000379643	T	0.04809	3.55	5.78	3.8	0.43715	.	0.511160	0.17373	N	0.176586	T	0.03305	0.0096	.	.	.	0.80722	D	1	P	0.43287	0.802	B	0.36719	0.231	T	0.58047	-0.7705	9	0.16420	T	0.52	.	8.8748	0.35339	0.0:0.1045:0.595:0.3005	.	211	Q96T17-2	.	V	211	ENSP00000368964:L211V	ENSP00000368964:L211V	L	-	1	0	MAP7D2	19978950	1.000000	0.71417	0.959000	0.39883	0.327000	0.28475	2.091000	0.41691	1.177000	0.42855	0.544000	0.68410	CTT	MAP7D2	-	NULL	ENSG00000184368		0.398	MAP7D2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP7D2	HGNC	protein_coding	OTTHUMT00000056001.1	66	0.00	0	G	NM_152780		20069029	20069029	-1	no_errors	ENST00000379643	ensembl	human	known	69_37n	missense	41	45.33	34	SNP	1.000	C
MAPT	4137	genome.wustl.edu	37	17	44087762	44087762	+	Silent	SNP	C	C	T			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr17:44087762C>T	ENST00000571987.1	+	10	1860	c.1860C>T	c.(1858-1860)ggC>ggT	p.G620G	MAPT_ENST00000262410.5_Silent_p.G620G|MAPT_ENST00000431008.3_Intron|MAPT_ENST00000334239.8_Intron|MAPT_ENST00000351559.5_Silent_p.G303G|MAPT_ENST00000344290.5_Silent_p.G638G|MAPT_ENST00000570299.1_Intron|MAPT_ENST00000574436.1_Silent_p.G303G|MAPT_ENST00000446361.3_Silent_p.G245G|MAPT_ENST00000576518.1_Intron|MAPT_ENST00000535772.1_Intron|MAPT_ENST00000347967.5_Intron|MAPT_ENST00000420682.2_Silent_p.G274G|MAPT_ENST00000340799.5_Silent_p.G274G|MAPT_ENST00000415613.2_Silent_p.G638G			P10636	TAU_HUMAN	microtubule-associated protein tau	620			G -> V (in PSNP1). {ECO:0000269|PubMed:16157753}.		adult walking behavior (GO:0007628)|apoptotic process (GO:0006915)|axon cargo transport (GO:0008088)|axon extension (GO:0048675)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|generation of neurons (GO:0048699)|microtubule cytoskeleton organization (GO:0000226)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of microtubule polymerization (GO:0031116)|regulation of autophagy (GO:0010506)|regulation of microtubule polymerization (GO:0031113)|regulation of microtubule-based movement (GO:0060632)	axon (GO:0030424)|axoneme (GO:0005930)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|growth cone (GO:0030426)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nuclear periphery (GO:0034399)|plasma membrane (GO:0005886)|tubulin complex (GO:0045298)	apolipoprotein binding (GO:0034185)|enzyme binding (GO:0019899)|lipoprotein particle binding (GO:0071813)|microtubule binding (GO:0008017)|SH3 domain binding (GO:0017124)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		Melanoma(429;0.216)			Docetaxel(DB01248)|Paclitaxel(DB01229)	TCCCGGGAGGCGGCAGTGTGA	0.488																																						dbGAP											0													46.0	37.0	40.0					17																	44087762		2200	4293	6493	-	-	-	SO:0001819	synonymous_variant	0			J03778	CCDS11499.1, CCDS11500.1, CCDS11501.1, CCDS11502.1, CCDS45715.1, CCDS45716.1, CCDS56033.1	17q21	2014-09-17			ENSG00000186868	ENSG00000186868			6893	protein-coding gene	gene with protein product	"""G protein beta1/gamma2 subunit-interacting factor 1"", ""microtubule-associated protein tau, isoform 4"", ""protein phosphatase 1, regulatory subunit 103"""	157140		DDPAC, MAPTL		7936241, 3131773	Standard	NM_001123067		Approved	MTBT1, tau, PPND, FTDP-17, TAU, MSTD, MTBT2, FLJ31424, MGC138549, PPP1R103	uc010dau.3	P10636	OTTHUMG00000168833	ENST00000571987.1:c.1860C>T	17.37:g.44087762C>T			P18518|Q14799|Q15549|Q15550|Q15551|Q1RMF6|Q53YB1|Q5CZI7|Q5XWF0|Q6QT54|Q9UDJ3|Q9UMH0|Q9UQ96	Silent	SNP	pfam_Tau/MAP_tubulin-bd_rpt,prints_Tau_protein	p.G638	ENST00000571987.1	37	c.1914	CCDS11501.1	17																																																																																			MAPT	-	pfam_Tau/MAP_tubulin-bd_rpt	ENSG00000186868		0.488	MAPT-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	MAPT	HGNC	protein_coding	OTTHUMT00000440133.1	35	0.00	0	C	NM_016835		44087762	44087762	+1	no_errors	ENST00000344290	ensembl	human	known	69_37n	silent	19	40.62	13	SNP	0.998	T
MMRN1	22915	genome.wustl.edu	37	4	90857362	90857362	+	Nonsense_Mutation	SNP	T	T	A			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr4:90857362T>A	ENST00000394980.1	+	7	2850	c.2531T>A	c.(2530-2532)tTg>tAg	p.L844*	MMRN1_ENST00000394981.1_Intron|MMRN1_ENST00000264790.2_Nonsense_Mutation_p.L844*|MMRN1_ENST00000508372.1_Nonsense_Mutation_p.L586*			Q13201	MMRN1_HUMAN	multimerin 1	844					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)				breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|liver(2)|lung(34)|ovary(5)|prostate(1)|skin(6)|stomach(1)|urinary_tract(2)	72		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		ATGAGTCATTTGGAAGAAAAA	0.348																																						dbGAP											0													34.0	36.0	36.0					4																	90857362		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0			U27109	CCDS3635.1	4q22	2008-02-05	2004-03-02	2004-03-02	ENSG00000138722	ENSG00000138722		"""EMI domain containing"""	7178	protein-coding gene	gene with protein product	"""glycoprotein Ia*"""	601456	"""multimerin"""	MMRN		7629143, 10828608	Standard	NM_007351		Approved	ECM, EMILIN4, GPIa*	uc003hst.3	Q13201	OTTHUMG00000130947	ENST00000394980.1:c.2531T>A	4.37:g.90857362T>A	ENSP00000378431:p.Leu844*		Q4W5L1|Q6P3T8|Q6ZUL9	Nonsense_Mutation	SNP	pfam_C1q,pfam_EMI_domain,pfam_EGF-like_dom,superfamily_Tumour_necrosis_fac-like,smart_EGF-like,smart_EGF-like_Ca-bd,smart_C1q,pfscan_C1q,pfscan_EG-like_dom,pfscan_EMI_domain,prints_C1q	p.L844*	ENST00000394980.1	37	c.2531	CCDS3635.1	4	.	.	.	.	.	.	.	.	.	.	T	38	6.925695	0.97940	.	.	ENSG00000138722	ENST00000394980;ENST00000264790;ENST00000508372	.	.	.	5.3	5.3	0.74995	.	0.211412	0.32386	N	0.006164	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.9619	0.79936	0.0:0.0:0.0:1.0	.	.	.	.	X	844;844;586	.	ENSP00000264790:L844X	L	+	2	0	MMRN1	91076385	0.997000	0.39634	0.882000	0.34594	0.023000	0.10783	5.148000	0.64857	2.308000	0.77769	0.533000	0.62120	TTG	MMRN1	-	NULL	ENSG00000138722		0.348	MMRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMRN1	HGNC	protein_coding	OTTHUMT00000253546.2	40	0.00	0	T	NM_007351		90857362	90857362	+1	no_errors	ENST00000264790	ensembl	human	known	69_37n	nonsense	19	29.63	8	SNP	0.495	A
NAMPT	10135	genome.wustl.edu	37	7	105893543	105893543	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr7:105893543G>A	ENST00000222553.3	-	10	1592	c.1285C>T	c.(1285-1287)Cga>Tga	p.R429*		NM_005746.2	NP_005737.1	P43490	NAMPT_HUMAN	nicotinamide phosphoribosyltransferase	429					cell-cell signaling (GO:0007267)|circadian regulation of gene expression (GO:0032922)|NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|nicotinamide metabolic process (GO:0006769)|positive regulation of cell proliferation (GO:0008284)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|nicotinamide phosphoribosyltransferase activity (GO:0047280)|nicotinate-nucleotide diphosphorylase (carboxylating) activity (GO:0004514)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	14						AAAGATAATCGGCCCTTTTTG	0.408																																						dbGAP											0													83.0	82.0	82.0					7																	105893543		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0			U02020	CCDS5737.1	7q22.3	2012-10-02	2008-03-27	2008-03-27	ENSG00000105835	ENSG00000105835			30092	protein-coding gene	gene with protein product	"""visfatin"""	608764	"""pre-B-cell colony enhancing factor 1"""	PBEF1		8289818	Standard	NM_005746		Approved	PBEF	uc003vdq.3	P43490	OTTHUMG00000140388	ENST00000222553.3:c.1285C>T	7.37:g.105893543G>A	ENSP00000222553:p.Arg429*		A4D0Q9|A4D0R0|Q3KQV0|Q8WW95	Nonsense_Mutation	SNP	pfam_Nic_PRibTrfase-like,superfamily_Quinolinate_PRibosylTrfase_C,pirsf_Nicotinamide_PRibTrfase	p.R429*	ENST00000222553.3	37	c.1285	CCDS5737.1	7	.	.	.	.	.	.	.	.	.	.	G	41	8.593961	0.98877	.	.	ENSG00000105835	ENST00000222553	.	.	.	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.7873	13.0228	0.58799	0.0:0.0:0.7188:0.2812	.	.	.	.	X	429	.	ENSP00000222553:R429X	R	-	1	2	NAMPT	105680779	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	3.245000	0.51407	2.672000	0.90937	0.655000	0.94253	CGA	NAMPT	-	pfam_Nic_PRibTrfase-like,superfamily_Quinolinate_PRibosylTrfase_C,pirsf_Nicotinamide_PRibTrfase	ENSG00000105835		0.408	NAMPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAMPT	HGNC	protein_coding	OTTHUMT00000277146.1	72	0.00	0	G	NM_182790		105893543	105893543	-1	no_errors	ENST00000222553	ensembl	human	known	69_37n	nonsense	73	12.05	10	SNP	0.996	A
NEDD9	4739	genome.wustl.edu	37	6	11190372	11190372	+	Missense_Mutation	SNP	G	G	A	rs3734401	byFrequency	TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr6:11190372G>A	ENST00000379446.5	-	5	1896	c.1730C>T	c.(1729-1731)aCg>aTg	p.T577M	RP3-510L9.1_ENST00000500636.2_RNA|NEDD9_ENST00000504387.1_Missense_Mutation_p.T577M	NM_001271033.1|NM_006403.3	NP_001257962.1|NP_006394.1	Q14511	CASL_HUMAN	neural precursor cell expressed, developmentally down-regulated 9	577			T -> M (in dbSNP:rs3734401).		actin filament bundle assembly (GO:0051017)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|integrin-mediated signaling pathway (GO:0007229)|mitotic nuclear division (GO:0007067)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle pole (GO:0000922)				endometrium(3)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)			TGGGTACTCCGTTGAGTTCAT	0.617													G|||	4	0.000798722	0.0	0.0	5008	,	,		20412	0.004		0.0	False		,,,				2504	0.0					dbGAP											0													73.0	70.0	71.0					6																	11190372		2203	4300	6503	-	-	-	SO:0001583	missense	0			L43821	CCDS4520.1, CCDS34340.1, CCDS47373.1, CCDS75400.1	6p25-p24	2011-04-13			ENSG00000111859	ENSG00000111859		"""Cas scaffolding proteins"""	7733	protein-coding gene	gene with protein product	"""Cas scaffolding protein family member 2"", ""Cas-like"""	602265					Standard	NM_182966		Approved	HEF1, CAS-L, CASS2	uc003mzv.2	Q14511	OTTHUMG00000014255	ENST00000379446.5:c.1730C>T	6.37:g.11190372G>A	ENSP00000368759:p.Thr577Met		A8K9G7|A8MSJ9|G5E9Y9|Q5T9R4|Q5XKI0	Missense_Mutation	SNP	pfam_CAS_DUF3513,pfam_Serine_rich,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.T577M	ENST00000379446.5	37	c.1730	CCDS4520.1	6	3	0.0013736263736263737	0	0.0	0	0.0	3	0.005244755244755245	0	0.0	G	7.057	0.565669	0.13560	.	.	ENSG00000111859	ENST00000379446;ENST00000504387	T;T	0.41400	1.0;1.13	5.7	1.88	0.25563	.	1.051440	0.07493	N	0.905921	T	0.07458	0.0188	N	0.08118	0	0.24055	N	0.996036	B;P;P	0.39131	0.27;0.646;0.661	B;B;B	0.34590	0.09;0.186;0.115	T	0.21724	-1.0237	10	0.51188	T	0.08	1.6197	3.1947	0.06629	0.1992:0.1203:0.556:0.1245	rs3734401;rs3734401	577;577;577	G5E9Y9;A8K9G7;Q14511	.;.;CASL_HUMAN	M	577	ENSP00000368759:T577M;ENSP00000422871:T577M	ENSP00000368759:T577M	T	-	2	0	NEDD9	11298358	0.139000	0.22563	0.000000	0.03702	0.039000	0.13416	2.829000	0.48128	0.059000	0.16252	0.650000	0.86243	ACG	NEDD9	-	NULL	ENSG00000111859		0.617	NEDD9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEDD9	HGNC	protein_coding	OTTHUMT00000039853.2	60	0.00	0	G	NM_006403		11190372	11190372	-1	no_errors	ENST00000379446	ensembl	human	known	69_37n	missense	47	16.07	9	SNP	0.001	A
OGDHL	55753	genome.wustl.edu	37	10	50964886	50964886	+	Missense_Mutation	SNP	C	C	T	rs145127820	byFrequency	TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr10:50964886C>T	ENST00000374103.4	-	3	396	c.311G>A	c.(310-312)cGg>cAg	p.R104Q	OGDHL_ENST00000432695.1_Intron|OGDHL_ENST00000419399.1_Intron	NM_018245.2	NP_060715.2	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like	104					glycolytic process (GO:0006096)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	61						GGTCTTGGTCCGACTTGAGAC	0.612													c|||	4	0.000798722	0.0	0.0	5008	,	,		20627	0.004		0.0	False		,,,				2504	0.0					dbGAP											0													91.0	87.0	88.0					10																	50964886		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001713	CCDS7234.1, CCDS44390.1, CCDS44391.1	10q11.23	2013-09-20			ENSG00000197444	ENSG00000197444			25590	protein-coding gene	gene with protein product						10574462	Standard	NM_018245		Approved	FLJ10851	uc001jie.3	Q9ULD0	OTTHUMG00000018200	ENST00000374103.4:c.311G>A	10.37:g.50964886C>T	ENSP00000363216:p.Arg104Gln		A8K2G1|B4DKG2|B4E193|Q8TAN9|Q9NVA0	Missense_Mutation	SNP	pfam_DH_E1,pfam_Transketolase-like_Pyr-bd,smart_Transketolase-like_Pyr-bd,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	p.R104Q	ENST00000374103.4	37	c.311	CCDS7234.1	10	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	c	5.561	0.288428	0.10513	.	.	ENSG00000197444	ENST00000374103	T	0.40756	1.02	5.56	1.06	0.20224	.	0.864760	0.10167	N	0.707582	T	0.16342	0.0393	N	0.02708	-0.52	0.42755	D	0.99378	B	0.02656	0.0	B	0.01281	0.0	T	0.19910	-1.0291	10	0.09843	T	0.71	.	7.5943	0.28039	0.0:0.6166:0.1239:0.2596	.	104	Q9ULD0	OGDHL_HUMAN	Q	104	ENSP00000363216:R104Q	ENSP00000363216:R104Q	R	-	2	0	OGDHL	50634892	0.000000	0.05858	0.109000	0.21407	0.200000	0.23975	-0.098000	0.11024	0.301000	0.22738	-0.185000	0.12909	CGG	OGDHL	-	pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	ENSG00000197444		0.612	OGDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OGDHL	HGNC	protein_coding	OTTHUMT00000048007.1	54	0.00	0	C	NM_018245		50964886	50964886	-1	no_errors	ENST00000374103	ensembl	human	known	69_37n	missense	64	14.67	11	SNP	0.488	T
NOC3L	64318	genome.wustl.edu	37	10	96101465	96101465	+	Silent	SNP	G	G	A			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr10:96101465G>A	ENST00000371361.3	-	14	1709	c.1609C>T	c.(1609-1611)Ctg>Ttg	p.L537L	NOC3L_ENST00000543788.1_Silent_p.L275L|NOC3L_ENST00000371350.1_Silent_p.L537L	NM_022451.9	NP_071896.8	Q8WTT2	NOC3L_HUMAN	nucleolar complex associated 3 homolog (S. cerevisiae)	537					fat cell differentiation (GO:0045444)	nuclear speck (GO:0016607)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			endometrium(3)|large_intestine(17)|lung(5)|ovary(1)|skin(2)|stomach(1)	29		Colorectal(252;0.0897)				ACTACTAACAGATCATCAAAA	0.259																																						dbGAP											0													56.0	53.0	54.0					10																	96101465		2203	4294	6497	-	-	-	SO:0001819	synonymous_variant	0			AL355341	CCDS7433.1	10q23.33	2004-04-20	2005-08-01	2005-08-01	ENSG00000173145	ENSG00000173145			24034	protein-coding gene	gene with protein product		610769	"""chromosome 10 open reading frame 117"""	C10orf117		15564382	Standard	NM_022451		Approved	AD24, FLJ12820, FAD24	uc001kjq.1	Q8WTT2	OTTHUMG00000018788	ENST00000371361.3:c.1609C>T	10.37:g.96101465G>A			Q9H5M6|Q9H9D8	Silent	SNP	pfam_CCAAT-binding_factor,pfam_NOC3p,superfamily_ARM-type_fold,pirsf_Nucleolar_cplx-assoc_3	p.L537	ENST00000371361.3	37	c.1609	CCDS7433.1	10																																																																																			NOC3L	-	superfamily_ARM-type_fold,pirsf_Nucleolar_cplx-assoc_3	ENSG00000173145		0.259	NOC3L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NOC3L	HGNC	protein_coding	OTTHUMT00000049466.1	57	0.00	0	G	NM_022451		96101465	96101465	-1	no_errors	ENST00000371350	ensembl	human	known	69_37n	silent	35	40.68	24	SNP	0.996	A
OPA1	4976	genome.wustl.edu	37	3	193355804	193355804	+	Nonsense_Mutation	SNP	C	C	T	rs104893752		TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr3:193355804C>T	ENST00000392438.3	+	9	1168	c.934C>T	c.(934-936)Cga>Tga	p.R312*	OPA1_ENST00000361828.2_Nonsense_Mutation_p.R330*|OPA1_ENST00000361908.3_Nonsense_Mutation_p.R349*|OPA1_ENST00000361510.2_Nonsense_Mutation_p.R367*|OPA1_ENST00000361715.2_Nonsense_Mutation_p.R331*|OPA1_ENST00000361150.2_Nonsense_Mutation_p.R313*	NM_015560.2	NP_056375.2	O60313	OPA1_HUMAN	optic atrophy 1 (autosomal dominant)	312	Dynamin-type G.				apoptotic process (GO:0006915)|axon transport of mitochondrion (GO:0019896)|cellular senescence (GO:0090398)|GTP catabolic process (GO:0006184)|inner mitochondrial membrane organization (GO:0007007)|mitochondrial fission (GO:0000266)|mitochondrial fusion (GO:0008053)|mitochondrion organization (GO:0007005)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|neural tube closure (GO:0001843)|visual perception (GO:0007601)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial crista (GO:0030061)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)			breast(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(4)|lung(15)|upper_aerodigestive_tract(1)|urinary_tract(2)	31	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		TGCCCAAGCTCGAATATTCCC	0.438																																						dbGAP											0			GRCh37	CM066588	OPA1	M	rs104893752						178.0	164.0	169.0					3																	193355804		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB011139	CCDS33917.1, CCDS43186.1	3q29	2014-09-17			ENSG00000198836	ENSG00000198836			8140	protein-coding gene	gene with protein product	"""mitochondrial dynamin-like GTPase"", ""dynamin-like guanosine triphosphatase"", ""Dynamin-like 120 kDa protein, mitochondrial"""	605290				9490303	Standard	NM_015560		Approved	NTG, KIAA0567, FLJ12460, NPG, MGM1	uc003ftg.3	O60313	OTTHUMG00000149897	ENST00000392438.3:c.934C>T	3.37:g.193355804C>T	ENSP00000376233:p.Arg312*		D3DNW4	Nonsense_Mutation	SNP	pfam_Dynamin_GTPase,smart_Dynamin_GTPase,prints_Dynamin	p.R367*	ENST00000392438.3	37	c.1099	CCDS43186.1	3	.	.	.	.	.	.	.	.	.	.	C	38	7.231063	0.98150	.	.	ENSG00000198836	ENST00000361908;ENST00000392438;ENST00000361510;ENST00000361715;ENST00000361828;ENST00000361150	.	.	.	5.6	5.6	0.85130	.	0.057065	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.1251	18.5979	0.91235	0.0:1.0:0.0:0.0	.	.	.	.	X	349;312;367;331;330;313	.	ENSP00000354781:R313X	R	+	1	2	OPA1	194838498	0.998000	0.40836	0.994000	0.49952	0.992000	0.81027	3.877000	0.56123	2.630000	0.89119	0.591000	0.81541	CGA	OPA1	-	pfam_Dynamin_GTPase,smart_Dynamin_GTPase	ENSG00000198836		0.438	OPA1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	OPA1	HGNC	protein_coding	OTTHUMT00000313812.2	145	0.68	1	C	NM_130837		193355804	193355804	+1	no_errors	ENST00000361510	ensembl	human	known	69_37n	nonsense	252	12.50	36	SNP	1.000	T
OR3A4P	390756	genome.wustl.edu	37	17	3213991	3213991	+	RNA	SNP	C	C	G			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr17:3213991C>G	ENST00000573491.1	-	0	359																											ATCTGGCCATCTGCCAGTCCC	0.567																																						dbGAP											0													78.0	80.0	79.0					17																	3213991		2203	4300	6503	-	-	-			0																															17.37:g.3213991C>G				RNA	SNP	-	NULL	ENST00000573491.1	37	NULL		17																																																																																			OR3A4P	-	-	ENSG00000180068		0.567	RP11-64J4.2-001	KNOWN	basic	sense_overlapping	OR3A4P	HGNC	sense_overlapping	OTTHUMT00000438371.1	76	0.00	0	C			3213991	3213991	+1	no_errors	ENST00000323164	ensembl	human	known	69_37n	rna	46	23.33	14	SNP	0.991	G
ORC2	4999	genome.wustl.edu	37	2	201790582	201790582	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr2:201790582C>T	ENST00000234296.2	-	13	1373	c.1124G>A	c.(1123-1125)tGg>tAg	p.W375*	RN7SL694P_ENST00000584245.1_RNA	NM_006190.4	NP_006181.1	Q13416	ORC2_HUMAN	origin recognition complex, subunit 2	375					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	condensed chromosome inner kinetochore (GO:0000939)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	DNA replication origin binding (GO:0003688)			breast(1)|endometrium(1)|large_intestine(2)|lung(10)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	20						GTTTACTATCCAGTCTAGCTG	0.348																																						dbGAP											0													150.0	144.0	146.0					2																	201790582		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS2334.1	2q33	2010-10-12	2010-10-12	2010-10-12	ENSG00000115942	ENSG00000115942			8488	protein-coding gene	gene with protein product		601182	"""origin recognition complex, subunit 2 (yeast homolog)-like"", ""origin recognition complex, subunit 2-like (yeast)"", ""origin recognition complex, subunit 2 homolog (yeast)"""	ORC2L		8808289	Standard	NM_006190		Approved		uc002uwr.3	Q13416	OTTHUMG00000132783	ENST00000234296.2:c.1124G>A	2.37:g.201790582C>T	ENSP00000234296:p.Trp375*		Q13204|Q53TX5	Nonsense_Mutation	SNP	pfam_ORC2	p.W375*	ENST00000234296.2	37	c.1124	CCDS2334.1	2	.	.	.	.	.	.	.	.	.	.	C	37	6.480046	0.97598	.	.	ENSG00000115942	ENST00000234296	.	.	.	5.34	4.46	0.54185	.	0.338502	0.33110	N	0.005262	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	-4.1704	7.6907	0.28567	0.2666:0.6508:0.0:0.0826	.	.	.	.	X	375	.	ENSP00000234296:W375X	W	-	2	0	ORC2	201498827	1.000000	0.71417	0.999000	0.59377	0.776000	0.43924	2.764000	0.47613	1.396000	0.46663	0.585000	0.79938	TGG	ORC2	-	pfam_ORC2	ENSG00000115942		0.348	ORC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ORC2	HGNC	protein_coding	OTTHUMT00000256191.2	103	0.00	0	C	NM_006190		201790582	201790582	-1	no_errors	ENST00000234296	ensembl	human	known	69_37n	nonsense	62	30.34	27	SNP	0.999	T
OTUD7B	56957	genome.wustl.edu	37	1	149943095	149943095	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr1:149943095C>A	ENST00000369135.4	-	3	464	c.170G>T	c.(169-171)aGt>aTt	p.S57I	OTUD7B_ENST00000479905.1_5'UTR	NM_020205.2	NP_064590.2	Q6GQQ9	OTU7B_HUMAN	OTU deubiquitinase 7B	57					mucosal immune response (GO:0002385)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of protein localization to nucleus (GO:1900181)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|DNA binding (GO:0003677)|Lys48-specific deubiquitinase activity (GO:1990380)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Breast(34;0.0009)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.247)			ACTCCCCTCACTAAAGGATGG	0.542																																						dbGAP											0													89.0	89.0	89.0					1																	149943095		1905	4135	6040	-	-	-	SO:0001583	missense	0			AJ293573	CCDS72903.1	1q21.2	2014-02-24	2014-02-24	2006-07-07	ENSG00000163113	ENSG00000264522		"""OTU domain containing"""	16683	protein-coding gene	gene with protein product		611748	"""zinc finger, A20 domain containing 1"", ""OTU domain containing 7B"""	ZA20D1		11463333, 23827681	Standard	NM_020205		Approved	CEZANNE	uc001etn.3	Q6GQQ9	OTTHUMG00000012291	ENST00000369135.4:c.170G>T	1.37:g.149943095C>A	ENSP00000358131:p.Ser57Ile		B7Z643|D3DUZ8|Q5SZ60|Q8WWA7|Q9NQ53|Q9UFF4	Missense_Mutation	SNP	pfam_OTU,superfamily_UBA-like,smart_Znf_A20,pfscan_OTU,pfscan_Znf_A20	p.S57I	ENST00000369135.4	37	c.170	CCDS41389.1	1	.	.	.	.	.	.	.	.	.	.	C	14.33	2.504429	0.44558	.	.	ENSG00000163113	ENST00000369135;ENST00000543330;ENST00000417191	T;T	0.32515	1.45;1.46	5.34	5.34	0.76211	.	0.324511	0.35970	N	0.002867	T	0.13543	0.0328	L	0.36672	1.1	0.40056	D	0.975831	B	0.29936	0.262	B	0.32533	0.147	T	0.04467	-1.0949	9	.	.	.	-19.5563	12.0183	0.53329	0.0:0.9176:0.0:0.0823	.	57	Q6GQQ9	OTU7B_HUMAN	I	57	ENSP00000358131:S57I;ENSP00000408231:S57I	.	S	-	2	0	OTUD7B	148209719	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	2.163000	0.42377	2.776000	0.95493	0.650000	0.86243	AGT	OTUD7B	-	NULL	ENSG00000163113		0.542	OTUD7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTUD7B	HGNC	protein_coding	OTTHUMT00000034146.3	54	0.00	0	C	NM_020205		149943095	149943095	-1	no_errors	ENST00000369135	ensembl	human	known	69_37n	missense	47	16.07	9	SNP	1.000	A
PCDH20	64881	genome.wustl.edu	37	13	61986915	61986918	+	Frame_Shift_Del	DEL	AACC	AACC	-	rs3812872	byFrequency	TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	AACC	AACC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr13:61986915_61986918delAACC	ENST00000409186.1	-	5	3419_3422	c.1314_1317delGGTT	c.(1312-1317)gtggttfs	p.VV438fs	PCDH20_ENST00000409204.4_Frame_Shift_Del_p.VV438fs			Q8N6Y1	PCD20_HUMAN	protocadherin 20	438	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(14)|liver(1)|lung(23)|ovary(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	58		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		CTTTCAGATAAACCACACCATCTA	0.422																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF169693	CCDS9442.2	13q21	2010-01-26			ENSG00000197991	ENSG00000197991		"""Cadherins / Protocadherins : Non-clustered"""	14257	protein-coding gene	gene with protein product		614449					Standard	NM_022843		Approved	PCDH13, FLJ22218	uc001vid.4	Q8N6Y1	OTTHUMG00000017012	ENST00000409186.1:c.1314_1317delGGTT	13.37:g.61986915_61986918delAACC	ENSP00000386653:p.Val438fs		A8K1K9|B1AQU2|Q8NDN4|Q9NRT9	Frame_Shift_Del	DEL	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V439fs	ENST00000409186.1	37	c.1317_1314	CCDS9442.2	13																																																																																			PCDH20	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000197991		0.422	PCDH20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PCDH20	HGNC	protein_coding	OTTHUMT00000333054.2	59	0.00	0	AACC	NM_022843		61986915	61986918	-1	no_errors	ENST00000409186	ensembl	human	known	69_37n	frame_shift_del	31	16.22	6	DEL	0.963:0.998:0.990:0.068	-
PCDHB7	56129	genome.wustl.edu	37	5	140553150	140553150	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr5:140553150C>G	ENST00000231137.3	+	1	908	c.734C>G	c.(733-735)tCg>tGg	p.S245W		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	245					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTTGTGCGGTCGCTCTACAAG	0.547																																						dbGAP											0													61.0	66.0	64.0					5																	140553150		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.734C>G	5.37:g.140553150C>G	ENSP00000231137:p.Ser245Trp		A1L3Y8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S245W	ENST00000231137.3	37	c.734	CCDS4249.1	5	.	.	.	.	.	.	.	.	.	.	C	9.491	1.100805	0.20552	.	.	ENSG00000113212	ENST00000231137;ENST00000543636	T	0.02763	4.17	4.61	4.61	0.57282	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.14960	0.0361	M	0.93241	3.395	0.21220	N	0.999758	D	0.57571	0.98	P	0.52881	0.712	T	0.12811	-1.0533	9	0.87932	D	0	.	11.7989	0.52116	0.292:0.708:0.0:0.0	.	245	Q9Y5E2	PCDB7_HUMAN	W	245;28	ENSP00000231137:S245W	ENSP00000231137:S245W	S	+	2	0	PCDHB7	140533334	0.000000	0.05858	0.038000	0.18304	0.006000	0.05464	0.255000	0.18333	2.248000	0.74166	0.655000	0.94253	TCG	PCDHB7	-	superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin	ENSG00000113212		0.547	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB7	HGNC	protein_coding	OTTHUMT00000251803.2	38	0.00	0	C	NM_018940		140553150	140553150	+1	no_errors	ENST00000231137	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	0.098	G
PLS1	5357	genome.wustl.edu	37	3	142430425	142430425	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr3:142430425G>A	ENST00000337777.3	+	15	1925	c.1712G>A	c.(1711-1713)aGg>aAg	p.R571K	PLS1_ENST00000497002.1_Missense_Mutation_p.R571K|PLS1_ENST00000457734.2_Missense_Mutation_p.R571K	NM_002670.2	NP_002661.2	Q14651	PLSI_HUMAN	plastin 1	571	Actin-binding 2.|CH 4. {ECO:0000255|PROSITE- ProRule:PRU00044}.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	27						GAAATGATCAGGAGAGAAAAC	0.338																																						dbGAP											0													85.0	87.0	86.0					3																	142430425		2203	4299	6502	-	-	-	SO:0001583	missense	0			L20826	CCDS3125.1	3q23	2013-01-10	2010-02-10		ENSG00000120756	ENSG00000120756		"""EF-hand domain containing"""	9090	protein-coding gene	gene with protein product		602734	"""plastin 1 (I isoform)"""			8139549	Standard	NM_002670		Approved	I-plastin, Plastin-1	uc003euz.3	Q14651	OTTHUMG00000159292	ENST00000337777.3:c.1712G>A	3.37:g.142430425G>A	ENSP00000336831:p.Arg571Lys		A8K2Q1|D3DNG3|Q8NEG6	Missense_Mutation	SNP	pfam_CH-domain,pfam_EF-hand,superfamily_CH-domain,smart_EF_hand_Ca-bd,smart_CH-domain,pfscan_CH-domain,pfscan_EF_HAND_2	p.R571K	ENST00000337777.3	37	c.1712	CCDS3125.1	3	.	.	.	.	.	.	.	.	.	.	G	4.255	0.046331	0.08243	.	.	ENSG00000120756	ENST00000457734;ENST00000337777;ENST00000497002	D;D;D	0.94862	-3.54;-3.54;-3.54	5.92	1.91	0.25777	Calponin homology domain (5);	0.135292	0.64402	N	0.000003	T	0.74726	0.3754	N	0.00483	-1.445	0.33567	D	0.598173	B	0.02656	0.0	B	0.01281	0.0	T	0.71803	-0.4482	10	0.02654	T	1	-12.7085	7.1888	0.25814	0.7464:0.1222:0.1314:0.0	.	571	Q14651	PLSI_HUMAN	K	571	ENSP00000387890:R571K;ENSP00000336831:R571K;ENSP00000418700:R571K	ENSP00000336831:R571K	R	+	2	0	PLS1	143913115	1.000000	0.71417	0.993000	0.49108	0.961000	0.63080	4.363000	0.59473	0.460000	0.27045	-0.300000	0.09419	AGG	PLS1	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000120756		0.338	PLS1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PLS1	HGNC	protein_coding	OTTHUMT00000354435.1	60	0.00	0	G	NM_002670		142430425	142430425	+1	no_errors	ENST00000337777	ensembl	human	known	69_37n	missense	72	11.11	9	SNP	0.999	A
PRRC2C	23215	genome.wustl.edu	37	1	171526725	171526725	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr1:171526725C>T	ENST00000338920.4	+	19	5705	c.5468C>T	c.(5467-5469)aCt>aTt	p.T1823I	PRRC2C_ENST00000367742.3_Missense_Mutation_p.T1825I|PRRC2C_ENST00000392078.3_Missense_Mutation_p.T1825I|PRRC2C_ENST00000426496.2_Missense_Mutation_p.T1823I	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	1823	Ala-rich.				hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										ccagcctctacttcagctgca	0.547																																						dbGAP											0													98.0	95.0	96.0					1																	171526725		1719	3085	4804	-	-	-	SO:0001583	missense	0			AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.5468C>T	1.37:g.171526725C>T	ENSP00000343629:p.Thr1823Ile		Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Missense_Mutation	SNP	pfam_BAT2_N	p.T1825I	ENST00000338920.4	37	c.5474	CCDS1296.2	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.85|10.85	1.467900|1.467900	0.26335|0.26335	.|.	.|.	ENSG00000117523|ENSG00000117523	ENST00000495585|ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080	.|T;T;T;T	.|0.02177	.|4.41;4.41;4.44;4.44	4.14|4.14	4.14|4.14	0.48551|0.48551	.|.	.|0.778923	.|0.10507	.|N	.|0.666696	T|T	0.00936|0.00936	0.0031|0.0031	N|N	0.08118|0.08118	0|0	0.20074|0.20074	N|N	0.999931|0.999931	.|P	.|0.39250	.|0.665	.|B	.|0.43018	.|0.405	T|T	0.53816|0.53816	-0.8385|-0.8385	5|10	.|0.72032	.|D	.|0.01	.|.	12.2921|12.2921	0.54825|0.54825	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1823	.|Q9Y520-4	.|.	F|I	371|1825;1777;1823;1825;1823;1580	.|ENSP00000375928:T1825I;ENSP00000410219:T1823I;ENSP00000356716:T1825I;ENSP00000343629:T1823I	.|ENSP00000343629:T1823I	L|T	+|+	1|2	0|0	PRRC2C|PRRC2C	169793349|169793349	0.014000|0.014000	0.17966|0.17966	0.292000|0.292000	0.24919|0.24919	0.200000|0.200000	0.23975|0.23975	2.966000|2.966000	0.49208|0.49208	2.612000|2.612000	0.88384|0.88384	0.549000|0.549000	0.68633|0.68633	CTT|ACT	PRRC2C	-	NULL	ENSG00000117523		0.547	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRRC2C	HGNC	protein_coding	OTTHUMT00000314826.4	91	0.00	0	C	NM_015172		171526725	171526725	+1	no_errors	ENST00000392078	ensembl	human	known	69_37n	missense	72	15.29	13	SNP	0.346	T
PTK2	5747	genome.wustl.edu	37	8	141756921	141756921	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr8:141756921G>C	ENST00000522684.1	-	18	1685	c.1456C>G	c.(1456-1458)Ctg>Gtg	p.L486V	PTK2_ENST00000520151.1_Intron|PTK2_ENST00000395218.2_Missense_Mutation_p.L486V|PTK2_ENST00000521059.1_Missense_Mutation_p.L486V|PTK2_ENST00000538769.1_Missense_Mutation_p.L154V|PTK2_ENST00000519465.1_Missense_Mutation_p.L114V|PTK2_ENST00000519419.1_Missense_Mutation_p.L530V|PTK2_ENST00000535192.1_Missense_Mutation_p.L486V|PTK2_ENST00000340930.3_Missense_Mutation_p.L486V|PTK2_ENST00000517887.1_Missense_Mutation_p.L530V	NM_153831.3	NP_722560.1	Q05397	FAK1_HUMAN	protein tyrosine kinase 2	486	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell motility (GO:0048870)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|central nervous system neuron axonogenesis (GO:0021955)|embryo development (GO:0009790)|endothelial cell migration (GO:0043542)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|establishment of nucleus localization (GO:0040023)|extracellular matrix organization (GO:0030198)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|growth hormone receptor signaling pathway (GO:0060396)|heart morphogenesis (GO:0003007)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of organ growth (GO:0046621)|negative regulation of synapse assembly (GO:0051964)|netrin-activated signaling pathway (GO:0038007)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|placenta development (GO:0001890)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|regulation of endothelial cell migration (GO:0010594)|regulation of focal adhesion assembly (GO:0051893)|regulation of osteoblast differentiation (GO:0045667)|regulation of Rho GTPase activity (GO:0032319)|signal complex assembly (GO:0007172)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)	apical plasma membrane (GO:0016324)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|stress fiber (GO:0001725)	actin binding (GO:0003779)|ATP binding (GO:0005524)|JUN kinase binding (GO:0008432)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(6)|lung(23)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	48	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			ACTCCAATCAGCTTCACAATA	0.403																																						dbGAP											0													124.0	102.0	109.0					8																	141756921		2203	4300	6503	-	-	-	SO:0001583	missense	0			L13616	CCDS6381.1, CCDS56557.1	8q24.3	2013-02-18	2013-02-18		ENSG00000169398	ENSG00000169398	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9611	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 71"""	600758	"""PTK2 protein tyrosine kinase 2"""			8422239	Standard	NM_153831		Approved	FAK, FADK, FAK1, PPP1R71	uc003yvt.3	Q05397	OTTHUMG00000067438	ENST00000522684.1:c.1456C>G	8.37:g.141756921G>C	ENSP00000429911:p.Leu486Val		B4E2N6|F5H4S4|Q14291|Q9UD85	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Focal_adhesion_kin_target_dom,pfam_Prot_kinase_cat_dom,pfam_FERM_central,superfamily_Kinase-like_dom,superfamily_Focal_adhesion_kin_target_dom,superfamily_FERM_central,smart_Band_41_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_FERM_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.L486V	ENST00000522684.1	37	c.1456	CCDS6381.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.41|19.41	3.822485|3.822485	0.71028|0.71028	.|.	.|.	ENSG00000169398|ENSG00000169398	ENST00000519654|ENST00000522684;ENST00000535192;ENST00000519465;ENST00000517887;ENST00000521059;ENST00000395214;ENST00000395218;ENST00000354438;ENST00000395221;ENST00000523539;ENST00000340930;ENST00000538769;ENST00000519419;ENST00000521986;ENST00000342207;ENST00000519024	.|T;T;T;T;T;T;T;T;T;T;T;T	.|0.69040	.|-0.37;-0.37;-0.37;-0.37;-0.37;-0.37;-0.37;-0.37;-0.37;-0.37;-0.37;-0.37	5.63|5.63	0.735|0.735	0.18300|0.18300	.|Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.|0.159143	.|0.43579	.|D	.|0.000542	T|T	0.73473|0.73473	0.3591|0.3591	L|L	0.52206|0.52206	1.635|1.635	0.53005|0.53005	D|D	0.999967|0.999967	.|D;D;D;D;D;D;D;D;D;D	.|0.89917	.|0.999;0.997;1.0;0.997;1.0;0.997;1.0;1.0;1.0;1.0	.|D;D;D;D;D;D;D;D;D;D	.|0.91635	.|0.979;0.998;0.997;0.954;0.997;0.95;0.995;0.996;0.999;0.995	T|T	0.72308|0.72308	-0.4332|-0.4332	5|10	.|0.87932	.|D	.|0	.|.	10.1569|10.1569	0.42827|0.42827	0.3967:0.0:0.6033:0.0|0.3967:0.0:0.6033:0.0	.|.	.|486;181;406;486;508;486;438;334;154;114	.|B4E2N6;B4DH13;Q59GN8;Q05397;Q658W2;Q8IYN9;Q59GM6;Q05397-2;Q8N9D7;E9PEI4	.|.;.;.;FAK1_HUMAN;.;.;.;.;.;.	G|V	496|486;486;114;530;486;438;486;407;181;158;486;154;530;184;332;121	.|ENSP00000429911:L486V;ENSP00000438009:L486V;ENSP00000429170:L114V;ENSP00000429082:L530V;ENSP00000429474:L486V;ENSP00000378644:L486V;ENSP00000428492:L158V;ENSP00000341189:L486V;ENSP00000445742:L154V;ENSP00000429129:L530V;ENSP00000430603:L184V;ENSP00000428232:L121V	.|ENSP00000341189:L486V	A|L	-|-	2|1	0|2	PTK2|PTK2	141826103|141826103	1.000000|1.000000	0.71417|0.71417	0.990000|0.990000	0.47175|0.47175	0.994000|0.994000	0.84299|0.84299	1.358000|1.358000	0.34102|0.34102	0.139000|0.139000	0.18822|0.18822	-0.151000|-0.151000	0.13558|0.13558	GCT|CTG	PTK2	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000169398		0.403	PTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTK2	HGNC	protein_coding	OTTHUMT00000378054.5	58	0.00	0	G	NM_005607		141756921	141756921	-1	no_errors	ENST00000395218	ensembl	human	known	69_37n	missense	55	15.38	10	SNP	1.000	C
QTRTD1	79691	genome.wustl.edu	37	3	113795785	113795785	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr3:113795785C>T	ENST00000493014.1	+	3	492	c.424C>T	c.(424-426)Cca>Tca	p.P142S	QTRTD1_ENST00000479882.1_Missense_Mutation_p.P125S|QTRTD1_ENST00000281273.4_Missense_Mutation_p.P248S|QTRTD1_ENST00000485050.1_Missense_Mutation_p.P260S	NM_001256836.1	NP_001243765.1			queuine tRNA-ribosyltransferase domain containing 1											central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|skin(2)	10						GGAGGACAAGCCAAGGCCAGT	0.537																																						dbGAP											0													48.0	39.0	42.0					3																	113795785		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK023022	CCDS33828.1, CCDS58846.1, CCDS58845.1, CCDS58844.1	3q13.31	2010-11-16			ENSG00000151576	ENSG00000151576			25771	protein-coding gene	gene with protein product						12477932	Standard	NM_024638		Approved	FLJ12960	uc003eaz.4	Q9H974	OTTHUMG00000159336	ENST00000493014.1:c.424C>T	3.37:g.113795785C>T	ENSP00000419169:p.Pro142Ser			Missense_Mutation	SNP	pfam_tRNA_ribo_trans,superfamily_tRNA_ribo_trans,tigrfam_tRNA_ribo_trans	p.P248S	ENST00000493014.1	37	c.742	CCDS58845.1	3	.	.	.	.	.	.	.	.	.	.	C	34	5.379004	0.95945	.	.	ENSG00000151576	ENST00000485050;ENST00000281273;ENST00000479882;ENST00000493014	.	.	.	5.71	5.71	0.89125	.	0.054642	0.85682	D	0.000000	D	0.85969	0.5821	M	0.92219	3.285	0.80722	D	1	D;D;D	0.65815	0.995;0.993;0.986	P;P;D	0.63597	0.896;0.863;0.916	D	0.88789	0.3276	9	0.87932	D	0	-12.5883	19.8525	0.96745	0.0:1.0:0.0:0.0	.	142;125;248	B7Z472;B7Z5R2;Q9H974	.;.;QTRD1_HUMAN	S	260;248;125;142	.	ENSP00000281273:P248S	P	+	1	0	QTRTD1	115278475	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	7.416000	0.80143	2.681000	0.91329	0.655000	0.94253	CCA	QTRTD1	-	pfam_tRNA_ribo_trans,superfamily_tRNA_ribo_trans,tigrfam_tRNA_ribo_trans	ENSG00000151576		0.537	QTRTD1-004	PUTATIVE	basic|exp_conf|CCDS	protein_coding	QTRTD1	HGNC	protein_coding	OTTHUMT00000354711.1	31	0.00	0	C	NM_024638		113795785	113795785	+1	no_errors	ENST00000281273	ensembl	human	known	69_37n	missense	50	10.71	6	SNP	1.000	T
RBM10	8241	genome.wustl.edu	37	X	47045972	47045972	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chrX:47045972G>A	ENST00000377604.3	+	24	3509	c.2767G>A	c.(2767-2769)Gtg>Atg	p.V923M	RBM10_ENST00000345781.6_Missense_Mutation_p.V846M|RBM10_ENST00000329236.7_Missense_Mutation_p.V845M	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10	923					3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						CAAGACAATGGTGACCCGCTT	0.612																																					Melanoma(171;120 2705 19495 39241)	dbGAP											0													77.0	55.0	62.0					X																	47045972		2203	4300	6503	-	-	-	SO:0001583	missense	0			U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	ENST00000377604.3:c.2767G>A	X.37:g.47045972G>A	ENSP00000366829:p.Val923Met		C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	Missense_Mutation	SNP	pfam_G_patch_dom,pfam_RRM_dom,pfam_Znf_RanBP2,smart_RRM_dom,smart_Znf_RanBP2,smart_G_patch_dom,pfscan_Znf_RanBP2,pfscan_Znf_C2H2,pfscan_G_patch_dom,pfscan_RRM_dom	p.V923M	ENST00000377604.3	37	c.2767	CCDS14274.1	X	.	.	.	.	.	.	.	.	.	.	G	14.33	2.502702	0.44558	.	.	ENSG00000182872	ENST00000377604;ENST00000329236;ENST00000345781	T;T;T	0.17213	2.98;2.29;2.56	5.53	4.62	0.57501	.	0.280822	0.26146	N	0.026073	T	0.09468	0.0233	N	0.01352	-0.895	0.36438	D	0.865305	P;P;D;P;B	0.53151	0.662;0.877;0.958;0.662;0.013	B;P;P;B;B	0.54544	0.234;0.606;0.755;0.234;0.025	T	0.26883	-1.0090	10	0.30078	T	0.28	-18.9458	7.0864	0.25259	0.0:0.239:0.5926:0.1684	.	846;988;922;845;923	P98175-3;Q7Z3D7;P98175-2;P98175-4;P98175	.;.;.;.;RBM10_HUMAN	M	923;845;846	ENSP00000366829:V923M;ENSP00000328848:V845M;ENSP00000329659:V846M	ENSP00000328848:V845M	V	+	1	0	RBM10	46930916	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.619000	0.36965	2.471000	0.83476	0.600000	0.82982	GTG	RBM10	-	NULL	ENSG00000182872		0.612	RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM10	HGNC	protein_coding	OTTHUMT00000056381.1	24	0.00	0	G	NM_005676		47045972	47045972	+1	no_errors	ENST00000377604	ensembl	human	known	69_37n	missense	26	16.13	5	SNP	1.000	A
RC3H2	54542	genome.wustl.edu	37	9	125652667	125652667	+	Silent	SNP	C	C	T			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr9:125652667C>T	ENST00000373670.1	-	3	1107	c.507G>A	c.(505-507)caG>caA	p.Q169Q	RC3H2_ENST00000357244.2_Silent_p.Q169Q|RC3H2_ENST00000373665.2_Silent_p.Q169Q|RC3H2_ENST00000423239.2_Silent_p.Q169Q|RC3H2_ENST00000478216.1_5'UTR|RC3H2_ENST00000471874.2_Silent_p.Q169Q|RC3H2_ENST00000335387.5_Silent_p.Q169Q			Q9HBD1	RC3H2_HUMAN	ring finger and CCCH-type domains 2	169					B cell homeostasis (GO:0001782)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymph node development (GO:0048535)|multicellular organism growth (GO:0035264)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|post-embryonic development (GO:0009791)|posttranscriptional regulation of gene expression (GO:0010608)|protein polyubiquitination (GO:0000209)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(6)|large_intestine(4)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33						GGTTCTGGTGCTGTAATATCA	0.493																																						dbGAP											0													85.0	86.0	85.0					9																	125652667		1946	4151	6097	-	-	-	SO:0001819	synonymous_variant	0			AK000308	CCDS43874.1, CCDS48014.1	9q34	2013-01-18	2010-09-15	2007-02-06	ENSG00000056586	ENSG00000056586		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	21461	protein-coding gene	gene with protein product		615231	"""membrane associated DNA binding protein"", ""ring finger and CCCH-type zinc finger domains 2"""	MNAB		10938276	Standard	NM_001100588		Approved	FLJ20301, FLJ20713, RNF164	uc010mwc.1	Q9HBD1	OTTHUMG00000020632	ENST00000373670.1:c.507G>A	9.37:g.125652667C>T			Q4VXB1|Q5JPD7|Q86ST6|Q8N3D6|Q96F27|Q9H5J2|Q9HBD2|Q9NWN9|Q9NXE1	Silent	SNP	pfam_Znf_CCCH,smart_Znf_RING,smart_Znf_CCCH,pfscan_Znf_RING	p.Q169	ENST00000373670.1	37	c.507	CCDS43874.1	9																																																																																			RC3H2	-	NULL	ENSG00000056586		0.493	RC3H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RC3H2	HGNC	protein_coding	OTTHUMT00000053966.1	75	0.00	0	C	NM_018835		125652667	125652667	-1	no_errors	ENST00000357244	ensembl	human	known	69_37n	silent	41	48.75	39	SNP	1.000	T
RECQL5	9400	genome.wustl.edu	37	17	73657754	73657754	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr17:73657754C>G	ENST00000317905.5	-	5	965	c.806G>C	c.(805-807)aGa>aCa	p.R269T	RECQL5_ENST00000423245.2_Missense_Mutation_p.R242T|RECQL5_ENST00000340830.5_Missense_Mutation_p.R269T|RECQL5_ENST00000584999.1_Missense_Mutation_p.R269T|RECQL5_ENST00000420326.2_Missense_Mutation_p.R269T	NM_004259.6	NP_004250.4	O94762	RECQ5_HUMAN	RecQ protein-like 5	269	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				chromosome separation (GO:0051304)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|mitotic nuclear division (GO:0007067)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA helicase activity (GO:0003678)|nucleic acid binding (GO:0003676)|RNA polymerase II core binding (GO:0000993)			breast(1)|cervix(3)|endometrium(3)|kidney(7)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	36	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			ACAAGCCTCTCTAGTCCTGCA	0.522								Other identified genes with known or suspected DNA repair function																														dbGAP											0													85.0	80.0	81.0					17																	73657754		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB006533	CCDS32735.1, CCDS42380.1, CCDS45777.1	17q25	2014-03-07	2014-03-07	2014-03-07	ENSG00000108469	ENSG00000108469			9950	protein-coding gene	gene with protein product	"""RecQ protein 5"""	603781				9878247	Standard	NM_004259		Approved	RecQ5, FLJ90603	uc010dgl.3	O94762		ENST00000317905.5:c.806G>C	17.37:g.73657754C>G	ENSP00000317636:p.Arg269Thr		Q9H0B1|Q9P1W7|Q9UNC8	Missense_Mutation	SNP	pfam_RecQ_helicase-like_5,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.R269T	ENST00000317905.5	37	c.806	CCDS42380.1	17	.	.	.	.	.	.	.	.	.	.	C	17.49	3.403531	0.62288	.	.	ENSG00000108469	ENST00000423245;ENST00000317905;ENST00000420326;ENST00000340830	T;T;T	0.05855	3.38;3.38;3.38	5.95	5.95	0.96441	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.33556	0.0867	M	0.87381	2.88	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.996;0.996	T	0.06481	-1.0824	10	0.87932	D	0	-6.0157	20.3932	0.98965	0.0:1.0:0.0:0.0	.	269;242;269	O94762;Q6P4G0;O94762-3	RECQ5_HUMAN;.;.	T	269	ENSP00000317636:R269T;ENSP00000414933:R269T;ENSP00000341983:R269T	ENSP00000317636:R269T	R	-	2	0	RECQL5	71169349	1.000000	0.71417	0.941000	0.38009	0.991000	0.79684	7.677000	0.84024	2.824000	0.97209	0.655000	0.94253	AGA	RECQL5	-	pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	ENSG00000108469		0.522	RECQL5-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	RECQL5	HGNC	protein_coding	OTTHUMT00000448207.1	28	0.00	0	C	NM_004259		73657754	73657754	-1	no_errors	ENST00000317905	ensembl	human	known	69_37n	missense	41	28.07	16	SNP	1.000	G
RFX4	5992	genome.wustl.edu	37	12	107002600	107002600	+	Missense_Mutation	SNP	C	C	G	rs201747242		TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr12:107002600C>G	ENST00000392842.1	+	2	483	c.69C>G	c.(67-69)aaC>aaG	p.N23K	RP11-144F15.1_ENST00000551505.1_Intron|RFX4_ENST00000357881.4_Missense_Mutation_p.N32K	NM_213594.2	NP_998759.1	Q33E94	RFX4_HUMAN	regulatory factor X, 4 (influences HLA class II expression)	23					cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|dorsal spinal cord development (GO:0021516)|midbrain development (GO:0030901)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein processing (GO:0070613)|telencephalon development (GO:0021537)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(20)|pancreas(1)|upper_aerodigestive_tract(1)	35						GATGTCTCAACGAAAGTGAAA	0.348																																						dbGAP											0													88.0	75.0	80.0					12																	107002600		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB044245	CCDS9106.1, CCDS9108.1, CCDS55880.1	12q24	2008-08-05			ENSG00000111783	ENSG00000111783			9985	protein-coding gene	gene with protein product		603958				8600444, 11682486	Standard	NM_213594		Approved		uc001tlt.3	Q33E94	OTTHUMG00000169173	ENST00000392842.1:c.69C>G	12.37:g.107002600C>G	ENSP00000376585:p.Asn23Lys		A8K5Y0|B2RDW4|Q33DW6|Q33DW7|Q33E95|Q6YM53|Q8MHQ1|Q8NC78|Q8NDF9|Q8SNA1|Q96S80|Q9BXI0	Missense_Mutation	SNP	pfam_DNA-bd_RFX	p.N32K	ENST00000392842.1	37	c.96	CCDS9106.1	12	.	.	.	.	.	.	.	.	.	.	C	14.01	2.407932	0.42715	.	.	ENSG00000111783	ENST00000392842;ENST00000357881;ENST00000266774	T;T	0.68181	-0.16;-0.31	4.93	-3.74	0.04385	.	0.101940	0.64402	D	0.000004	T	0.42426	0.1202	N	0.14661	0.345	0.80722	D	1	B;B;B	0.30634	0.288;0.288;0.099	B;B;B	0.28553	0.091;0.091;0.03	T	0.05500	-1.0881	10	0.45353	T	0.12	-7.9969	11.4792	0.50316	0.0:0.219:0.0:0.781	.	32;32;23	Q33E94-2;Q33E94-4;Q33E94	.;.;RFX4_HUMAN	K	23;32;32	ENSP00000376585:N23K;ENSP00000350552:N32K	ENSP00000266774:N32K	N	+	3	2	RFX4	105526730	0.989000	0.36119	0.983000	0.44433	0.992000	0.81027	0.257000	0.18369	-0.629000	0.05575	-0.484000	0.04775	AAC	RFX4	-	NULL	ENSG00000111783		0.348	RFX4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX4	HGNC	protein_coding	OTTHUMT00000402707.1	40	0.00	0	C	NM_032491		107002600	107002600	+1	no_errors	ENST00000357881	ensembl	human	known	69_37n	missense	34	12.82	5	SNP	0.983	G
RPTN	126638	genome.wustl.edu	37	1	152129314	152129314	+	Missense_Mutation	SNP	A	A	C			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr1:152129314A>C	ENST00000316073.3	-	3	325	c.261T>G	c.(259-261)caT>caG	p.H87Q		NM_001122965.1	NP_001116437.1	Q6XPR3	RPTN_HUMAN	repetin	87	S-100-like. {ECO:0000250}.					cornified envelope (GO:0001533)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|endometrium(14)|kidney(2)|large_intestine(1)|lung(32)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	59						TGTCTAGCTTATGATAGCAGG	0.468																																						dbGAP											0													281.0	235.0	249.0					1																	152129314		1568	3582	5150	-	-	-	SO:0001583	missense	0			AK096436	CCDS41397.1	1q21.3	2013-01-10			ENSG00000215853	ENSG00000215853		"""EF-hand domain containing"""	26809	protein-coding gene	gene with protein product		613259				15854042	Standard	NM_001122965		Approved	FLJ39117	uc001ezs.1	Q6XPR3	OTTHUMG00000154095	ENST00000316073.3:c.261T>G	1.37:g.152129314A>C	ENSP00000317895:p.His87Gln		B7ZBZ3	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.H87Q	ENST00000316073.3	37	c.261	CCDS41397.1	1	.	.	.	.	.	.	.	.	.	.	A	10.13	1.264675	0.23136	.	.	ENSG00000215853	ENST00000316073	T	0.11930	2.73	5.03	3.85	0.44370	EF-hand-like domain (1);	.	.	.	.	T	0.02571	0.0078	N	0.25890	0.77	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.42068	-0.9473	9	0.09590	T	0.72	-0.4093	8.592	0.33693	0.7901:0.0:0.0:0.2098	.	87	Q6XPR3	RPTN_HUMAN	Q	87	ENSP00000317895:H87Q	ENSP00000317895:H87Q	H	-	3	2	RPTN	150395938	0.002000	0.14202	0.775000	0.31657	0.501000	0.33797	0.295000	0.19065	1.888000	0.54679	0.443000	0.29094	CAT	RPTN	-	NULL	ENSG00000215853		0.468	RPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPTN	HGNC	protein_coding	OTTHUMT00000333867.1	167	0.00	0	A	XM_371312		152129314	152129314	-1	no_errors	ENST00000316073	ensembl	human	known	69_37n	missense	116	13.43	18	SNP	0.042	C
SLC10A1	6554	genome.wustl.edu	37	14	70252848	70252848	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr14:70252848G>T	ENST00000216540.4	-	2	666	c.533C>A	c.(532-534)tCc>tAc	p.S178Y		NM_003049.3	NP_003040.1	Q14973	NTCP_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 1	178					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bile acid:sodium symporter activity (GO:0008508)			NS(1)|breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)	14				all cancers(60;0.00228)|BRCA - Breast invasive adenocarcinoma(234;0.0137)|OV - Ovarian serous cystadenocarcinoma(108;0.0226)	Bumetanide(DB00887)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Ethinyl Estradiol(DB00977)|Indomethacin(DB00328)|Liothyronine(DB00279)|Liotrix(DB01583)|Pitavastatin(DB08860)|Probenecid(DB01032)|Progesterone(DB00396)|Testosterone(DB00624)|Ursodeoxycholic acid(DB01586)	TGGCCGTTTGGATTTGAGGAC	0.443																																						dbGAP											0													192.0	162.0	172.0					14																	70252848		2203	4300	6503	-	-	-	SO:0001583	missense	0			L21893	CCDS9797.1	14q24.2	2013-07-18	2013-07-18		ENSG00000100652	ENSG00000100652		"""Solute carriers"""	10905	protein-coding gene	gene with protein product		182396				8132774	Standard	NM_003049		Approved	NTCP	uc001xlr.2	Q14973	OTTHUMG00000171236	ENST00000216540.4:c.533C>A	14.37:g.70252848G>T	ENSP00000216540:p.Ser178Tyr		B9EGB6|Q2TU29	Missense_Mutation	SNP	pfam_BilAc/Na_symport,tigrfam_Bil_ac_transpt	p.S178Y	ENST00000216540.4	37	c.533	CCDS9797.1	14	.	.	.	.	.	.	.	.	.	.	G	9.956	1.221452	0.22457	.	.	ENSG00000100652	ENST00000216540	T	0.10573	2.86	5.01	5.01	0.66863	.	0.509628	0.23125	N	0.051657	T	0.06325	0.0163	N	0.17564	0.495	0.32138	N	0.585903	B	0.17038	0.02	B	0.17979	0.02	T	0.08617	-1.0713	10	0.02654	T	1	-14.485	13.4034	0.60896	0.0:0.0:0.8057:0.1942	.	178	Q14973	NTCP_HUMAN	Y	178	ENSP00000216540:S178Y	ENSP00000216540:S178Y	S	-	2	0	SLC10A1	69322601	0.999000	0.42202	0.977000	0.42913	0.871000	0.50021	2.981000	0.49329	2.759000	0.94783	0.561000	0.74099	TCC	SLC10A1	-	pfam_BilAc/Na_symport,tigrfam_Bil_ac_transpt	ENSG00000100652		0.443	SLC10A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC10A1	HGNC	protein_coding	OTTHUMT00000412464.1	113	0.88	1	G			70252848	70252848	-1	no_errors	ENST00000216540	ensembl	human	known	69_37n	missense	97	18.33	22	SNP	0.977	T
SLC12A2	6558	genome.wustl.edu	37	5	127474573	127474573	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr5:127474573G>A	ENST00000262461.2	+	9	1783	c.1594G>A	c.(1594-1596)Gtt>Att	p.V532I	SLC12A2_ENST00000343225.4_Missense_Mutation_p.V532I	NM_001046.2	NP_001037.1	P55011	S12A2_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 2	532					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|branching involved in mammary gland duct morphogenesis (GO:0060444)|chloride transmembrane transport (GO:1902476)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|gamma-aminobutyric acid signaling pathway (GO:0007214)|hyperosmotic response (GO:0006972)|ion transport (GO:0006811)|mammary duct terminal end bud growth (GO:0060763)|multicellular organism growth (GO:0035264)|positive regulation of cell volume (GO:0045795)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transepithelial ammonium transport (GO:0070634)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ammonium transmembrane transporter activity (GO:0008519)|sodium:potassium:chloride symporter activity (GO:0008511)			breast(3)|endometrium(5)|kidney(5)|large_intestine(12)|lung(16)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)|Quinethazone(DB01325)	TACTACATTGGTTTACGTAGG	0.318																																						dbGAP											0													94.0	97.0	96.0					5																	127474573		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4144.1, CCDS58965.1	5q23.3	2014-06-13	2013-07-18		ENSG00000064651	ENSG00000064651		"""Solute carriers"""	10911	protein-coding gene	gene with protein product	"""bumetanide-sensitive sodium-(potassium)-chloride cotransporter 1"", ""basolateral Na-K-Cl symporter"", ""protein phosphatase 1, regulatory subunit 141"""	600840				7629105	Standard	NM_001256461		Approved	NKCC1, BSC, BSC2, PPP1R141	uc003kus.3	P55011	OTTHUMG00000128983	ENST00000262461.2:c.1594G>A	5.37:g.127474573G>A	ENSP00000262461:p.Val532Ile		Q8N713|Q8WWH7	Missense_Mutation	SNP	pfam_AA-permease_dom,pfam_AA_permease_N,prints_Na/K/Cl_cotranspt1,prints_Na/K/Cl_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.V532I	ENST00000262461.2	37	c.1594	CCDS4144.1	5	.	.	.	.	.	.	.	.	.	.	G	13.73	2.323476	0.41096	.	.	ENSG00000064651	ENST00000262461;ENST00000343225	D;D	0.98633	-5.04;-5.04	4.96	4.96	0.65561	Amino acid permease domain (1);	0.134947	0.49916	D	0.000138	D	0.97623	0.9221	L	0.31804	0.96	0.58432	D	0.999996	D;D	0.56287	0.968;0.975	P;P	0.53518	0.469;0.728	D	0.97168	0.9842	10	0.30854	T	0.27	.	18.4157	0.90568	0.0:0.0:1.0:0.0	.	532;532	P55011-3;P55011	.;S12A2_HUMAN	I	532	ENSP00000262461:V532I;ENSP00000340878:V532I	ENSP00000262461:V532I	V	+	1	0	SLC12A2	127502472	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.066000	0.76734	2.573000	0.86826	0.650000	0.86243	GTT	SLC12A2	-	pfam_AA-permease_dom,tigrfam_Na/K/Cl_cotransptS	ENSG00000064651		0.318	SLC12A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC12A2	HGNC	protein_coding	OTTHUMT00000250972.1	90	0.00	0	G	NM_001046		127474573	127474573	+1	no_errors	ENST00000262461	ensembl	human	known	69_37n	missense	60	17.81	13	SNP	1.000	A
SLC1A6	6511	genome.wustl.edu	37	19	15073025	15073025	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr19:15073025G>A	ENST00000221742.3	-	5	731	c.724C>T	c.(724-726)Cgg>Tgg	p.R242W	SLC1A6_ENST00000600144.1_Missense_Mutation_p.R242W|SLC1A6_ENST00000430939.2_Missense_Mutation_p.R178W|SLC1A6_ENST00000544886.2_Missense_Mutation_p.R242W|SLC1A6_ENST00000598504.1_Missense_Mutation_p.R242W	NM_005071.1	NP_005062.1	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6	242					aspartate transport (GO:0015810)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(8)|liver(1)|lung(12)|ovary(3)|pancreas(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42						CCCAAGGCCCGAGTGACATTT	0.602																																						dbGAP											0													89.0	85.0	86.0					19																	15073025		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12321.1, CCDS62578.1	19p13.12	2013-07-15			ENSG00000105143	ENSG00000105143		"""Solute carriers"""	10944	protein-coding gene	gene with protein product		600637				7791878	Standard	NM_005071		Approved	EAAT4	uc002naa.2	P48664	OTTHUMG00000183351	ENST00000221742.3:c.724C>T	19.37:g.15073025G>A	ENSP00000221742:p.Arg242Trp		Q8N753	Missense_Mutation	SNP	pfam_Na-dicarboxylate_symporter,prints_Na-dicarboxylate_symporter	p.R242W	ENST00000221742.3	37	c.724	CCDS12321.1	19	.	.	.	.	.	.	.	.	.	.	g	15.74	2.923164	0.52653	.	.	ENSG00000105143	ENST00000430939;ENST00000221742;ENST00000544886	T;T;T	0.71698	-0.59;0.46;1.19	4.42	0.814	0.18756	.	0.448602	0.23268	N	0.050055	T	0.72128	0.3422	L	0.42245	1.32	0.09310	N	1	D;D;D	0.89917	1.0;0.999;0.994	D;D;D	0.74348	0.983;0.948;0.948	T	0.60120	-0.7325	10	0.56958	D	0.05	-11.5054	4.4567	0.11647	0.1133:0.0:0.501:0.3856	.	178;242;242	E7EV13;Q8N753;P48664	.;.;EAA4_HUMAN	W	178;242;242	ENSP00000409386:R178W;ENSP00000221742:R242W;ENSP00000446175:R242W	ENSP00000221742:R242W	R	-	1	2	SLC1A6	14934025	0.372000	0.25064	0.073000	0.20177	0.996000	0.88848	1.508000	0.35769	0.079000	0.16929	0.454000	0.30748	CGG	SLC1A6	-	pfam_Na-dicarboxylate_symporter	ENSG00000105143		0.602	SLC1A6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC1A6	HGNC	protein_coding	OTTHUMT00000466283.1	55	0.00	0	G	NM_005071		15073025	15073025	-1	no_errors	ENST00000221742	ensembl	human	known	69_37n	missense	73	12.94	11	SNP	0.076	A
TBC1D8	11138	genome.wustl.edu	37	2	101650049	101650049	+	Frame_Shift_Del	DEL	A	A	-			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr2:101650049delA	ENST00000376840.4	-	10	1729	c.1730delT	c.(1729-1731)ttgfs	p.L577fs	TBC1D8_ENST00000409318.1_Frame_Shift_Del_p.L592fs			O95759	TBCD8_HUMAN	TBC1 domain family, member 8 (with GRAM domain)	577	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				blood circulation (GO:0008015)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	32						ATAGGCCGTCAAGACTCTCCT	0.572																																						dbGAP											0													90.0	103.0	98.0					2																	101650049		2193	4297	6490	-	-	-	SO:0001589	frameshift_variant	0			AB024057	CCDS46375.1	2q12.1	2011-11-30			ENSG00000204634	ENSG00000204634			17791	protein-coding gene	gene with protein product	"""BUB2-like protein 1"", ""vascular Rab-GAP/TBC-containing protein"""					10373574	Standard	NM_001102426		Approved	HBLP1, VRP, AD3	uc010fiv.3	O95759	OTTHUMG00000153040	ENST00000376840.4:c.1730delT	2.37:g.101650049delA	ENSP00000366036:p.Leu577fs		A6NDL4|A8K9W1|B9A6K4|Q53SQ4|Q9UQ32	Frame_Shift_Del	DEL	pfam_Rab-GTPase-TBC_dom,pfam_GRAM,superfamily_Rab-GTPase-TBC_dom,smart_GRAM,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.L592fs	ENST00000376840.4	37	c.1775	CCDS46375.1	2																																																																																			TBC1D8	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000204634		0.572	TBC1D8-011	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D8	HGNC	protein_coding	OTTHUMT00000376092.1	83	0.00	0	A	NM_007063		101650049	101650049	-1	no_errors	ENST00000409318	ensembl	human	known	69_37n	frame_shift_del	81	17.35	17	DEL	1.000	-
STK25	10494	genome.wustl.edu	37	2	242437657	242437657	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr2:242437657G>A	ENST00000316586.4	-	9	1374	c.1025C>T	c.(1024-1026)tCa>tTa	p.S342L	STK25_ENST00000535007.1_Missense_Mutation_p.S248L|STK25_ENST00000405585.1_Missense_Mutation_p.S265L|STK25_ENST00000401869.1_Missense_Mutation_p.S342L|STK25_ENST00000478403.1_5'UTR|STK25_ENST00000543554.1_Missense_Mutation_p.S248L|STK25_ENST00000403346.3_Missense_Mutation_p.S342L|STK25_ENST00000405883.3_Missense_Mutation_p.S265L	NM_001271977.1|NM_001271978.1|NM_001282308.1	NP_001258906.1|NP_001258907.1|NP_001269237.1	O00506	STK25_HUMAN	serine/threonine kinase 25	342					establishment or maintenance of cell polarity (GO:0007163)|Golgi localization (GO:0051645)|positive regulation of axonogenesis (GO:0050772)|response to oxidative stress (GO:0006979)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|kidney(1)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	10		all_cancers(19;2.09e-34)|all_epithelial(40;2.09e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Ovarian(221;0.069)|Lung NSC(271;0.0886)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.2)		Epithelial(32;8.24e-34)|all cancers(36;3.46e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.6e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.1e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0839)		GACCTTCTGTGAACTGTGCAG	0.662																																					NSCLC(99;1100 1566 7679 28647 48345)	dbGAP											0													149.0	128.0	135.0					2																	242437657		2203	4300	6503	-	-	-	SO:0001583	missense	0			D63780	CCDS2549.1, CCDS63199.1, CCDS63200.1	2q37.3	2010-06-25	2010-06-25		ENSG00000115694	ENSG00000115694			11404	protein-coding gene	gene with protein product		602255	"""serine/threonine kinase 25 (Ste20, yeast homolog)"""			8887545, 9160885, 15037601	Standard	NM_001271977		Approved	SOK1, YSK1	uc002wbp.4	O00506	OTTHUMG00000133408	ENST00000316586.4:c.1025C>T	2.37:g.242437657G>A	ENSP00000325748:p.Ser342Leu		A8K6Z3|A8K7D2|B7Z9K1|Q15522|Q5BJF1	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.S342L	ENST00000316586.4	37	c.1025	CCDS2549.1	2	.	.	.	.	.	.	.	.	.	.	G	12.42	1.932702	0.34096	.	.	ENSG00000115694	ENST00000316586;ENST00000403346;ENST00000401869;ENST00000405883;ENST00000545437;ENST00000405585;ENST00000543554;ENST00000535007	T;T;T;T;T;T;T	0.36699	1.24;1.24;1.24;1.24;1.24;1.24;1.24	5.24	5.24	0.73138	.	0.521728	0.20030	N	0.100729	T	0.21761	0.0524	N	0.08118	0	0.40192	D	0.977411	B;B;B	0.26363	0.0;0.0;0.147	B;B;B	0.23275	0.001;0.001;0.045	T	0.08973	-1.0696	10	0.23891	T	0.37	.	17.3948	0.87442	0.0:0.0:1.0:0.0	.	268;265;342	B4DVS7;A8K6Z3;O00506	.;.;STK25_HUMAN	L	342;342;342;265;248;265;248;248	ENSP00000325748:S342L;ENSP00000384162:S342L;ENSP00000385687:S342L;ENSP00000384444:S265L;ENSP00000385541:S265L;ENSP00000444886:S248L;ENSP00000446008:S248L	ENSP00000325748:S342L	S	-	2	0	STK25	242086330	0.970000	0.33590	0.897000	0.35233	0.507000	0.33981	3.882000	0.56160	2.619000	0.88677	0.561000	0.74099	TCA	STK25	-	NULL	ENSG00000115694		0.662	STK25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK25	HGNC	protein_coding	OTTHUMT00000257265.4	38	0.00	0	G	NM_006374		242437657	242437657	-1	no_errors	ENST00000316586	ensembl	human	known	69_37n	missense	55	11.29	7	SNP	0.856	A
TGFBR3	7049	genome.wustl.edu	37	1	92185007	92185007	+	Silent	SNP	C	C	T			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr1:92185007C>T	ENST00000525962.1	-	9	1489	c.1428G>A	c.(1426-1428)tcG>tcA	p.S476S	TGFBR3_ENST00000212355.4_Silent_p.S476S|TGFBR3_ENST00000370399.2_Silent_p.S475S			Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III	476	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				blastocyst development (GO:0001824)|blood vessel development (GO:0001568)|BMP signaling pathway (GO:0030509)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell proliferation (GO:0060038)|cell growth (GO:0016049)|cell migration (GO:0016477)|definitive erythrocyte differentiation (GO:0060318)|definitive hemopoiesis (GO:0060216)|epithelial to mesenchymal transition (GO:0001837)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|negative regulation of cellular component movement (GO:0051271)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of protein binding (GO:0043393)|response to follicle-stimulating hormone (GO:0032354)|response to hypoxia (GO:0001666)|response to luteinizing hormone (GO:0034699)|response to prostaglandin E (GO:0034695)|transforming growth factor beta receptor complex assembly (GO:0007181)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	coreceptor activity (GO:0015026)|glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|PDZ domain binding (GO:0030165)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type III (GO:0070123)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)	p.S476S(1)		endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(24)|ovary(3)|prostate(4)|skin(1)|stomach(1)|urinary_tract(3)	55		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		CGTCCATCCCCGAGTAGCCAC	0.512																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											104.0	92.0	96.0					1																	92185007		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L07594	CCDS30770.1, CCDS55614.1	1p33-p32	2008-02-05	2007-02-15		ENSG00000069702	ENSG00000069702		"""Proteoglycans / Cell surface : Other"""	11774	protein-coding gene	gene with protein product	"""betaglycan proteoglycan"""	600742	"""transforming growth factor, beta receptor III (betaglycan, 300kDa)"""			1333192, 1319842	Standard	NM_001195684		Approved	betaglycan, BGCAN	uc001doh.3	Q03167	OTTHUMG00000010097	ENST00000525962.1:c.1428G>A	1.37:g.92185007C>T			A0AUW8|A8K5N0|B9EG88|Q5T2T4|Q5U731|Q9UGI2	Silent	SNP	pfam_Zona_pellucida_Endoglin/CD105,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105,prints_Endoglin/CD105_subgr	p.S476	ENST00000525962.1	37	c.1428	CCDS30770.1	1																																																																																			TGFBR3	-	pfam_Zona_pellucida_Endoglin/CD105,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105	ENSG00000069702		0.512	TGFBR3-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TGFBR3	HGNC	protein_coding	OTTHUMT00000382308.1	35	0.00	0	C	NM_003243		92185007	92185007	-1	no_errors	ENST00000212355	ensembl	human	known	69_37n	silent	30	18.92	7	SNP	0.000	T
TMEM115	11070	genome.wustl.edu	37	3	50392784	50392784	+	Missense_Mutation	SNP	G	G	A	rs200775541		TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr3:50392784G>A	ENST00000266025.3	-	2	1592	c.1046C>T	c.(1045-1047)cCg>cTg	p.P349L	XXcos-LUCA11.5_ENST00000606589.1_Intron	NM_007024.4	NP_008955.1	Q12893	TM115_HUMAN	transmembrane protein 115	349					negative regulation of cell proliferation (GO:0008285)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(2)|endometrium(1)|lung(1)|prostate(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		TTACAGCGTCGGGGGAGCTGC	0.632																																						dbGAP											0													45.0	45.0	45.0					3																	50392784		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC011948	CCDS2828.1	3p21.31	2008-11-04			ENSG00000126062	ENSG00000126062			30055	protein-coding gene	gene with protein product	"""placental protein 6"""	607069				11085536	Standard	NM_007024		Approved	PL6	uc003dan.1	Q12893	OTTHUMG00000044212	ENST00000266025.3:c.1046C>T	3.37:g.50392784G>A	ENSP00000266025:p.Pro349Leu		A2IDB7|O14568|Q6IAY4|Q9UIX3	Missense_Mutation	SNP	pfam_DUF1751_Mem_euk	p.P349L	ENST00000266025.3	37	c.1046	CCDS2828.1	3	.	.	.	.	.	.	.	.	.	.	G	10.98	1.504898	0.26949	.	.	ENSG00000126062	ENST00000266025	.	.	.	5.17	3.22	0.36961	.	0.312241	0.35320	N	0.003299	T	0.25121	0.0610	N	0.22421	0.69	0.09310	N	0.999996	B	0.26708	0.157	B	0.15052	0.012	T	0.18209	-1.0344	9	0.72032	D	0.01	-15.1206	6.8816	0.24177	0.0887:0.0:0.6975:0.2137	.	349	Q12893	TM115_HUMAN	L	349	.	ENSP00000266025:P349L	P	-	2	0	TMEM115	50367788	1.000000	0.71417	0.603000	0.28903	0.331000	0.28603	5.142000	0.64820	0.595000	0.29777	0.563000	0.77884	CCG	TMEM115	-	NULL	ENSG00000126062		0.632	TMEM115-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM115	HGNC	protein_coding	OTTHUMT00000102784.3	30	0.00	0	G	NM_007024		50392784	50392784	-1	no_errors	ENST00000266025	ensembl	human	known	69_37n	missense	18	33.33	9	SNP	0.294	A
TP53	7157	genome.wustl.edu	37	17	7574012	7574012	+	Frame_Shift_Del	DEL	C	C	-	rs17882252	byFrequency	TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr17:7574012delC	ENST00000269305.4	-	10	1204	c.1015delG	c.(1015-1017)gagfs	p.E339fs	TP53_ENST00000359597.4_Intron|TP53_ENST00000420246.2_3'UTR|TP53_ENST00000455263.2_3'UTR|TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Frame_Shift_Del_p.E339fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	339	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		E -> K (in a sporadic cancer; somatic mutation; dbSNP:rs17882252). {ECO:0000269|Ref.12}.|E -> Q (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E339*(14)|p.0?(8)|p.E339fs*8(2)|p.E339Q(1)|p.?(1)|p.F338fs*6(1)|p.F338_E339>L(1)|p.E339fs*13(1)|p.I332fs*5(1)|p.E339K(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CGGAACATCTCGAAGCGCTCA	0.537		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	31	Substitution - Nonsense(14)|Whole gene deletion(8)|Insertion - Frameshift(3)|Unknown(2)|Deletion - Frameshift(2)|Substitution - Missense(2)	upper_aerodigestive_tract(5)|breast(5)|liver(4)|bone(4)|large_intestine(3)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(2)|pancreas(2)|stomach(1)|oesophagus(1)|ovary(1)	GRCh37	CM984588	TP53	M	rs17882252						59.0	46.0	51.0					17																	7574012		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.1015delG	17.37:g.7574012delC	ENSP00000269305:p.Glu339fs		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.E339fs	ENST00000269305.4	37	c.1015	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_tetrameristn,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	ENSG00000141510		0.537	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	26	0.00	0	C	NM_000546		7574012	7574012	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	frame_shift_del	12	43.48	10	DEL	0.996	-
TRGC1	6966	genome.wustl.edu	37	7	38305276	38305276	+	RNA	SNP	T	T	G			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr7:38305276T>G	ENST00000443402.2	-	0	3					NM_001003799.1|NM_001003806.1	NP_001003799.1|NP_001003806.1	P0CF51	TRGC1_HUMAN	T cell receptor gamma constant 1							integral component of membrane (GO:0016021)											ATCAAGTTGTTTATCTATGGG	0.383																																						dbGAP											0													111.0	121.0	118.0					7																	38305276		1794	4070	5864	-	-	-			0			M14996		7p14	2012-02-07			ENSG00000211689	ENSG00000211689		"""T cell receptors / TRG locus"""	12275	other	T cell receptor gene	"""T-cell receptor, gamma, constant region C1"""	186970		TCRGC1		2879283	Standard	NG_001336		Approved	C1		P0CF51	OTTHUMG00000155219		7.37:g.38305276T>G				Missense_Mutation	SNP	pfam_Ig_C1-set,smart_Ig_C1-set,pfscan_Ig-like	p.N2H	ENST00000443402.2	37	c.4		7																																																																																			TRGC1	-	NULL	ENSG00000211689		0.383	TRGC1-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	TR_C_gene	TRGC1	HGNC	TR_C_gene	OTTHUMT00000338825.3	57	0.00	0	T	NG_001336		38305276	38305276	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000443402	ensembl	human	known	69_37n	missense	71	16.47	14	SNP	0.000	G
TTN	7273	genome.wustl.edu	37	2	179469856	179469856	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr2:179469856T>C	ENST00000591111.1	-	230	49349	c.49125A>G	c.(49123-49125)atA>atG	p.I16375M	TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.I9076M|TTN_ENST00000460472.2_Missense_Mutation_p.I8951M|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.I9143M|TTN_ENST00000589042.1_Missense_Mutation_p.I18016M|TTN_ENST00000342992.6_Missense_Mutation_p.I15448M|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	16375	Ig-like 100.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTCCTTGGTTATCTGAAGTG	0.463																																						dbGAP											0													153.0	141.0	145.0					2																	179469856		1875	4102	5977	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.49125A>G	2.37:g.179469856T>C	ENSP00000465570:p.Ile16375Met		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.I15448M	ENST00000591111.1	37	c.46344		2	.	.	.	.	.	.	.	.	.	.	T	9.252	1.040880	0.19669	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.68624	-0.34;-0.34;-0.34;-0.34	5.78	3.06	0.35304	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.46678	0.1405	N	0.17564	0.495	0.33425	D	0.580335	P;P;P;P	0.35551	0.509;0.509;0.509;0.509	B;B;B;B	0.32465	0.091;0.091;0.091;0.146	T	0.58940	-0.7547	9	0.87932	D	0	.	7.5681	0.27892	0.1867:0.0:0.202:0.6112	.	8951;9076;9143;16375	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	M	15448;8951;9143;9076;8951	ENSP00000343764:I15448M;ENSP00000434586:I8951M;ENSP00000340554:I9143M;ENSP00000352154:I9076M	ENSP00000340554:I9143M	I	-	3	3	TTN	179178101	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	0.994000	0.29693	0.987000	0.38709	0.460000	0.39030	ATA	TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000155657		0.463	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	77	0.00	0	T	NM_133378		179469856	179469856	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	73	10.98	9	SNP	0.997	C
UBR3	130507	genome.wustl.edu	37	2	170780651	170780651	+	Missense_Mutation	SNP	A	A	C			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr2:170780651A>C	ENST00000272793.5	+	13	2040	c.1990A>C	c.(1990-1992)Atg>Ctg	p.M664L	UBR3_ENST00000418381.1_Missense_Mutation_p.M664L			Q6ZT12	UBR3_HUMAN	ubiquitin protein ligase E3 component n-recognin 3 (putative)	664					embryo development (GO:0009790)|in utero embryonic development (GO:0001701)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)|suckling behavior (GO:0001967)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(3)|stomach(1)	33						GGAAATGTTAATGAAACTAAT	0.284																																						dbGAP											0													45.0	40.0	42.0					2																	170780651		692	1581	2273	-	-	-	SO:0001583	missense	0			AL834144	CCDS2238.2	2q31.1	2008-06-23	2008-06-23	2007-11-29	ENSG00000144357	ENSG00000144357		"""Ubiquitin protein ligase E3 component n-recognins"""	30467	protein-coding gene	gene with protein product		613831	"""zinc finger protein 650"""	ZNF650		17462990	Standard	NM_172070		Approved	KIAA2024, DKFZp434P117, FLJ37422	uc010zdi.2	Q6ZT12	OTTHUMG00000132229	ENST00000272793.5:c.1990A>C	2.37:g.170780651A>C	ENSP00000272793:p.Met664Leu		B4DZR7|Q2KHN5|Q6ZR55|Q6ZSC2|Q8IVE7|Q8ND96	Missense_Mutation	SNP	pfam_Znf_N-recognin,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.M664L	ENST00000272793.5	37	c.1990		2	.	.	.	.	.	.	.	.	.	.	A	10.80	1.453730	0.26161	.	.	ENSG00000144357	ENST00000272793;ENST00000442603;ENST00000418381	T;T	0.44881	0.91;0.91	5.93	5.93	0.95920	.	.	.	.	.	T	0.31009	0.0783	N	0.04508	-0.205	0.80722	D	1	P	0.40970	0.734	P	0.50825	0.651	T	0.16247	-1.0409	9	0.02654	T	1	.	16.3766	0.83401	1.0:0.0:0.0:0.0	.	664	Q6ZT12	UBR3_HUMAN	L	664	ENSP00000272793:M664L;ENSP00000396068:M664L	ENSP00000272793:M664L	M	+	1	0	UBR3	170488897	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.263000	0.75096	0.533000	0.62120	ATG	UBR3	-	NULL	ENSG00000144357		0.284	UBR3-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	UBR3	HGNC	protein_coding	OTTHUMT00000255290.2	50	0.00	0	A	NM_172070		170780651	170780651	+1	no_errors	ENST00000272793	ensembl	human	known	69_37n	missense	21	38.24	13	SNP	1.000	C
TTN	7273	genome.wustl.edu	37	2	179499514	179499514	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr2:179499514G>T	ENST00000591111.1	-	179	37388	c.37164C>A	c.(37162-37164)gaC>gaA	p.D12388E	TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.D5089E|TTN_ENST00000460472.2_Missense_Mutation_p.D4964E|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.D5156E|TTN_ENST00000589042.1_Missense_Mutation_p.D14029E|TTN_ENST00000342992.6_Missense_Mutation_p.D11461E|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000418062.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12388					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CACCAGCTTGGTCCAGTTTGA	0.403																																						dbGAP											0													140.0	135.0	137.0					2																	179499514		1836	4093	5929	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.37164C>A	2.37:g.179499514G>T	ENSP00000465570:p.Asp12388Glu		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.D11461E	ENST00000591111.1	37	c.34383		2	.	.	.	.	.	.	.	.	.	.	G	13.60	2.286050	0.40394	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.32988	1.43;1.43;1.43;1.43	6.17	5.29	0.74685	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.20981	0.0505	N	0.21282	0.65	0.42050	D	0.991115	B;B;B;B	0.21606	0.058;0.058;0.058;0.058	B;B;B;B	0.20184	0.028;0.028;0.028;0.028	T	0.06320	-1.0833	9	0.87932	D	0	.	8.2179	0.31524	0.1402:0.1399:0.7199:0.0	.	4964;5089;5156;12388	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	E	11461;4964;5156;5089;4964	ENSP00000343764:D11461E;ENSP00000434586:D4964E;ENSP00000340554:D5156E;ENSP00000352154:D5089E	ENSP00000340554:D5156E	D	-	3	2	TTN	179207759	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.660000	0.25009	1.616000	0.50265	0.655000	0.94253	GAC	TTN	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub	ENSG00000155657		0.403	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	108	0.00	0	G	NM_133378		179499514	179499514	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	62	36.73	36	SNP	1.000	T
ULK2	9706	genome.wustl.edu	37	17	19699015	19699015	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr17:19699015G>A	ENST00000395544.4	-	20	2520	c.2021C>T	c.(2020-2022)tCa>tTa	p.S674L	ULK2_ENST00000361658.2_Missense_Mutation_p.S674L|ULK2_ENST00000580130.1_5'Flank	NM_014683.3	NP_055498.3	Q8IYT8	ULK2_HUMAN	unc-51 like autophagy activating kinase 2	674					autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|negative regulation of collateral sprouting (GO:0048671)|protein autophosphorylation (GO:0046777)|regulation of autophagy (GO:0010506)|response to starvation (GO:0042594)|signal transduction (GO:0007165)	ATG1/UKL1 signaling complex (GO:0034273)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|pre-autophagosomal structure membrane (GO:0034045)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(1)|skin(4)|stomach(1)	6	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					TTGTTGATCTGATAACTTCCC	0.338																																						dbGAP											0													190.0	190.0	190.0					17																	19699015		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014523	CCDS11213.1	17p11.2	2014-02-12	2013-07-02		ENSG00000083290	ENSG00000083290	2.7.11.1		13480	protein-coding gene	gene with protein product		608650	"""unc-51 (C. elegans)-like kinase 2"", ""unc-51-like kinase 2 (C. elegans)"""			10557072	Standard	NM_014683		Approved	KIAA0623, Unc51.2, ATG1B	uc002gwn.3	Q8IYT8	OTTHUMG00000059511	ENST00000395544.4:c.2021C>T	17.37:g.19699015G>A	ENSP00000378914:p.Ser674Leu		A8MY69|O75119	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser/Thr_kinase_C,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ser/Thr_kin_STPK_Ulk-1/2,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.S674L	ENST00000395544.4	37	c.2021	CCDS11213.1	17	.	.	.	.	.	.	.	.	.	.	G	29.1	4.975316	0.92919	.	.	ENSG00000083290	ENST00000361658;ENST00000395544	T;T	0.44881	0.91;0.91	5.57	5.57	0.84162	.	0.127225	0.56097	D	0.000034	T	0.65565	0.2703	M	0.69823	2.125	0.50467	D	0.99987	D	0.64830	0.994	D	0.74348	0.983	T	0.67833	-0.5568	10	0.87932	D	0	-4.5267	18.5287	0.90983	0.0:0.0:1.0:0.0	.	674	Q8IYT8	ULK2_HUMAN	L	674	ENSP00000354877:S674L;ENSP00000378914:S674L	ENSP00000354877:S674L	S	-	2	0	ULK2	19639607	1.000000	0.71417	1.000000	0.80357	0.621000	0.37620	9.106000	0.94253	2.628000	0.89032	0.655000	0.94253	TCA	ULK2	-	pirsf_Ser/Thr_kin_STPK_Ulk-1/2	ENSG00000083290		0.338	ULK2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	ULK2	HGNC	protein_coding	OTTHUMT00000132375.2	131	0.00	0	G	NM_014683		19699015	19699015	-1	no_errors	ENST00000361658	ensembl	human	known	69_37n	missense	72	21.74	20	SNP	1.000	A
VASH2	79805	genome.wustl.edu	37	1	213145986	213145986	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr1:213145986G>T	ENST00000517399.1	+	5	562	c.562G>T	c.(562-564)Gga>Tga	p.G188*	VASH2_ENST00000366967.2_Nonsense_Mutation_p.G84*|VASH2_ENST00000366965.2_Nonsense_Mutation_p.G144*|VASH2_ENST00000366966.2_Nonsense_Mutation_p.G123*|VASH2_ENST00000366964.3_Nonsense_Mutation_p.G46*|VASH2_ENST00000366968.4_Nonsense_Mutation_p.G123*|VASH2_ENST00000271776.4_3'UTR			Q86V25	VASH2_HUMAN	vasohibin 2	188					positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)	cytoplasm (GO:0005737)				endometrium(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	7				OV - Ovarian serous cystadenocarcinoma(81;0.00479)|all cancers(67;0.00844)|GBM - Glioblastoma multiforme(131;0.0496)|Epithelial(68;0.0986)		CTACTTCTCAGGAAACTACTT	0.507																																						dbGAP											0													113.0	107.0	109.0					1																	213145986		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK022567	CCDS1511.1, CCDS44315.1, CCDS44316.1, CCDS73026.1	1q23	2008-02-05			ENSG00000143494	ENSG00000143494			25723	protein-coding gene	gene with protein product		610471				16528006	Standard	XR_247041		Approved	FLJ12505	uc001hjw.3	Q86V25	OTTHUMG00000036925	ENST00000517399.1:c.562G>T	1.37:g.213145986G>T	ENSP00000428324:p.Gly188*		B4DYZ5|Q2VT46|Q5VTE7|Q5VTE9|Q7Z6E3|Q8IZ24|Q9H9W5	Nonsense_Mutation	SNP	NULL	p.G188*	ENST00000517399.1	37	c.562	CCDS1511.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.200216	0.94997	.	.	ENSG00000143494	ENST00000366966;ENST00000366964;ENST00000366968;ENST00000366965;ENST00000366967;ENST00000517399	.	.	.	5.26	5.26	0.73747	.	0.112506	0.64402	D	0.000018	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-16.5391	19.2409	0.93883	0.0:0.0:1.0:0.0	.	.	.	.	X	123;46;123;144;84;188	.	ENSP00000355931:G46X	G	+	1	0	VASH2	211212609	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.602000	0.98312	2.620000	0.88729	0.655000	0.94253	GGA	VASH2	-	NULL	ENSG00000143494		0.507	VASH2-013	KNOWN	basic|appris_principal|CCDS	protein_coding	VASH2	HGNC	protein_coding	OTTHUMT00000381686.1	81	0.00	0	G	NM_024749		213145986	213145986	+1	no_errors	ENST00000517399	ensembl	human	known	69_37n	nonsense	58	14.71	10	SNP	1.000	T
VCPIP1	80124	genome.wustl.edu	37	8	67546842	67546842	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr8:67546842G>A	ENST00000310421.4	-	3	3821	c.3563C>T	c.(3562-3564)gCc>gTc	p.A1188V		NM_025054.4	NP_079330.2	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex interacting protein 1	1188					endoplasmic reticulum membrane fusion (GO:0016320)|Golgi reassembly (GO:0090168)|mitotic nuclear division (GO:0007067)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)	ubiquitin-specific protease activity (GO:0004843)			breast(7)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(6)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)			TGACCTTGTGGCAAAGGCTGC	0.448																																					NSCLC(179;265 2915 6144 43644)	dbGAP											0													163.0	137.0	146.0					8																	67546842		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB058753	CCDS6192.1	8q13	2014-02-24			ENSG00000175073	ENSG00000175073		"""OTU domain containing"""	30897	protein-coding gene	gene with protein product		611745				11347906, 12509440	Standard	NM_025054		Approved	VCIP135, KIAA1850, FLJ23132, DUBA3	uc003xwn.3	Q96JH7	OTTHUMG00000164560	ENST00000310421.4:c.3563C>T	8.37:g.67546842G>A	ENSP00000309031:p.Ala1188Val		Q504T4|Q86T93|Q86W01|Q8N3A9|Q9H5R8	Missense_Mutation	SNP	pfam_OTU,pfscan_OTU	p.A1188V	ENST00000310421.4	37	c.3563	CCDS6192.1	8	.	.	.	.	.	.	.	.	.	.	G	13.07	2.126906	0.37533	.	.	ENSG00000175073	ENST00000310421	T	0.34472	1.36	5.59	4.72	0.59763	.	0.450700	0.20972	N	0.082372	T	0.26955	0.0660	N	0.19112	0.55	0.32875	D	0.509731	B	0.02656	0.0	B	0.01281	0.0	T	0.28870	-1.0030	10	0.72032	D	0.01	-4.0E-4	14.4178	0.67163	0.0709:0.0:0.9291:0.0	.	1188	Q96JH7	VCIP1_HUMAN	V	1188	ENSP00000309031:A1188V	ENSP00000309031:A1188V	A	-	2	0	VCPIP1	67709396	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.184000	0.50926	1.364000	0.46038	0.591000	0.81541	GCC	VCPIP1	-	NULL	ENSG00000175073		0.448	VCPIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VCPIP1	HGNC	protein_coding	OTTHUMT00000379227.1	60	0.00	0	G			67546842	67546842	-1	no_errors	ENST00000310421	ensembl	human	known	69_37n	missense	79	13.19	12	SNP	1.000	A
VPS53	55275	genome.wustl.edu	37	17	556562	556562	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr17:556562C>T	ENST00000571805.1	-	7	713	c.577G>A	c.(577-579)Ggg>Agg	p.G193R	VPS53_ENST00000401468.3_Intron|VPS53_ENST00000291074.5_Missense_Mutation_p.G164R|VPS53_ENST00000446250.2_5'UTR|VPS53_ENST00000574029.1_Intron|VPS53_ENST00000576149.1_Intron|VPS53_ENST00000437048.2_Missense_Mutation_p.G193R			Q5VIR6	VPS53_HUMAN	vacuolar protein sorting 53 homolog (S. cerevisiae)	193					protein transport (GO:0015031)	endosome (GO:0005768)|GARP complex (GO:0000938)|membrane (GO:0016020)				breast(1)|endometrium(4)|large_intestine(5)|lung(8)|prostate(1)	19				UCEC - Uterine corpus endometrioid carcinoma (25;0.0265)		TGCGGAATCCCCATATACTTG	0.502																																						dbGAP											0													132.0	126.0	128.0					17																	556562		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS10995.1, CCDS45558.1	17p13.3	2007-07-13	2006-12-19			ENSG00000141252			25608	protein-coding gene	gene with protein product		615850	"""vacuolar protein sorting 53 (yeast)"""			15878329	Standard	NM_018289		Approved	FLJ10979, HCCS1	uc010cjo.2	Q5VIR6		ENST00000571805.1:c.577G>A	17.37:g.556562C>T	ENSP00000459312:p.Gly193Arg		A8K2S8|B3FH42|Q8WYW3|Q9BRR2|Q9BY02|Q9NV25	Missense_Mutation	SNP	pfam_Vps53_N,pfam_Vacuolar_sorting-assoc_54	p.G193R	ENST00000571805.1	37	c.577		17	.	.	.	.	.	.	.	.	.	.	C	27.8	4.863446	0.91511	.	.	ENSG00000141252	ENST00000437048;ENST00000291074;ENST00000389040	T;T;T	0.30182	1.54;1.54;1.54	5.76	5.76	0.90799	Vps53-like, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.37758	0.1015	L	0.53249	1.67	0.80722	D	1	P;P;P	0.46395	0.877;0.605;0.877	B;P;P	0.44518	0.446;0.449;0.452	T	0.06041	-1.0849	10	0.45353	T	0.12	-22.9086	18.8872	0.92383	0.0:1.0:0.0:0.0	.	193;193;164	Q5VIR6-4;Q5VIR6;Q5VIR6-2	.;VPS53_HUMAN;.	R	193;164;193	ENSP00000401435:G193R;ENSP00000291074:G164R;ENSP00000373692:G193R	ENSP00000291074:G164R	G	-	1	0	VPS53	503312	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.213000	0.77950	2.882000	0.98803	0.655000	0.94253	GGG	VPS53	-	pfam_Vps53_N,pfam_Vacuolar_sorting-assoc_54	ENSG00000141252		0.502	VPS53-006	KNOWN	basic	protein_coding	VPS53	HGNC	protein_coding	OTTHUMT00000436940.2	93	0.00	0	C	NM_018289		556562	556562	-1	no_errors	ENST00000437048	ensembl	human	known	69_37n	missense	63	14.86	11	SNP	1.000	T
ZNF142	7701	genome.wustl.edu	37	2	219513520	219513520	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr2:219513520C>T	ENST00000449707.1	-	6	1532	c.1111G>A	c.(1111-1113)Gag>Aag	p.E371K	ZNF142_ENST00000411696.2_Missense_Mutation_p.E371K	NM_001105537.1	NP_001099007.1	P52746	ZN142_HUMAN	zinc finger protein 142	371					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(7)|endometrium(7)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38		Renal(207;0.0474)		Epithelial(149;5.21e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		CAGCGCAGCTCTTCACTGCCA	0.527											OREG0015202	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Colon(170;867 1942 8995 15834 18053)	dbGAP											0													74.0	73.0	73.0					2																	219513520		2090	4231	6321	-	-	-	SO:0001583	missense	0			U09849	CCDS42817.1	2q35	2013-01-08	2006-06-13		ENSG00000115568	ENSG00000115568		"""Zinc fingers, C2H2-type"""	12927	protein-coding gene	gene with protein product		604083	"""zinc finger protein 142 (clone pHZ-49)"""				Standard	NM_001105537		Approved	KIAA0236, pHZ-49	uc002vin.4	P52746	OTTHUMG00000154736	ENST00000449707.1:c.1111G>A	2.37:g.219513520C>T	ENSP00000408643:p.Glu371Lys	2259	Q92510	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E371K	ENST00000449707.1	37	c.1111	CCDS42817.1	2	.	.	.	.	.	.	.	.	.	.	C	16.05	3.014065	0.54468	.	.	ENSG00000115568	ENST00000449707;ENST00000411696	T;T	0.12039	2.72;2.72	5.61	5.61	0.85477	Zinc finger, C2H2 (1);	0.140763	0.64402	D	0.000007	T	0.14874	0.0359	N	0.25647	0.755	0.36300	D	0.856968	P;P	0.47762	0.9;0.859	B;P	0.46208	0.334;0.507	T	0.03761	-1.1006	10	0.45353	T	0.12	-12.9012	15.8113	0.78568	0.0:0.8272:0.1728:0.0	.	371;208	P52746;A8MWU9	ZN142_HUMAN;.	K	371	ENSP00000408643:E371K;ENSP00000398798:E371K	ENSP00000398798:E371K	E	-	1	0	ZNF142	219221764	0.996000	0.38824	1.000000	0.80357	0.998000	0.95712	2.446000	0.44908	2.793000	0.96121	0.655000	0.94253	GAG	ZNF142	-	pfscan_Znf_C2H2	ENSG00000115568		0.527	ZNF142-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF142	HGNC	protein_coding	OTTHUMT00000336833.1	48	0.00	0	C	NM_005081		219513520	219513520	-1	no_errors	ENST00000411696	ensembl	human	known	69_37n	missense	48	20.00	12	SNP	0.998	T
ZNF577	84765	genome.wustl.edu	37	19	52381691	52381691	+	Silent	SNP	G	G	T			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr19:52381691G>T	ENST00000301399.5	-	5	503	c.138C>A	c.(136-138)gtC>gtA	p.V46V	ZNF577_ENST00000412216.1_Silent_p.V46V|ZNF577_ENST00000485702.1_5'UTR|ZNF577_ENST00000420592.1_Silent_p.V46V|ZNF577_ENST00000451628.2_Silent_p.V46V	NM_032679.2	NP_116068.2	Q9BSK1	ZN577_HUMAN	zinc finger protein 577	46	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		CCTTGTACAAGACCTTCTGAG	0.433																																						dbGAP											0													157.0	129.0	138.0					19																	52381691		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL832871	CCDS12842.2, CCDS46160.1	19q13.41	2013-09-20			ENSG00000161551	ENSG00000161551		"""Zinc fingers, C2H2-type"", ""-"""	28673	protein-coding gene	gene with protein product						12477932	Standard	NM_032679		Approved	MGC4400	uc010yde.2	Q9BSK1	OTTHUMG00000157045	ENST00000301399.5:c.138C>A	19.37:g.52381691G>T			A8K0B4|A8K6Z7|C9JFB9	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V46	ENST00000301399.5	37	c.138	CCDS12842.2	19																																																																																			ZNF577	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000161551		0.433	ZNF577-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF577	HGNC	protein_coding	OTTHUMT00000347243.1	74	0.00	0	G	NM_032679		52381691	52381691	-1	no_errors	ENST00000301399	ensembl	human	known	69_37n	silent	106	11.67	14	SNP	0.908	T
ZNF551	90233	genome.wustl.edu	37	19	58199270	58199270	+	Missense_Mutation	SNP	C	C	T	rs560670635		TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr19:58199270C>T	ENST00000282296.5	+	3	1812	c.1627C>T	c.(1627-1629)Cgc>Tgc	p.R543C	AC003006.7_ENST00000599221.1_Intron|AC003006.7_ENST00000594684.1_Intron|ZNF551_ENST00000596085.1_Intron|ZNF551_ENST00000356715.4_Missense_Mutation_p.R527C			Q7Z340	ZN551_HUMAN	zinc finger protein 551	543					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)	15		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		TTTTAGACAGCGCTCTGGCCT	0.443													.|||	1	0.000199681	0.0	0.0	5008	,	,		22102	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													79.0	75.0	77.0					19																	58199270		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX538151	CCDS12959.1, CCDS12959.2	19q13.43	2013-09-20			ENSG00000204519	ENSG00000204519		"""Zinc fingers, C2H2-type"", ""-"""	25108	protein-coding gene	gene with protein product							Standard	NM_138347		Approved	DKFZp686H1038	uc002qpw.5	Q7Z340	OTTHUMG00000183470	ENST00000282296.5:c.1627C>T	19.37:g.58199270C>T	ENSP00000282296:p.Arg543Cys		B4DU22|P17034|Q8N246|Q9BRY1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R543C	ENST00000282296.5	37	c.1627	CCDS12959.2	19	.	.	.	.	.	.	.	.	.	.	C	5.375	0.254502	0.10185	.	.	ENSG00000204519	ENST00000356715;ENST00000282296;ENST00000359821	.	.	.	2.21	-4.42	0.03579	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.28699	0.0711	L	0.31664	0.95	0.09310	N	1	D	0.67145	0.996	P	0.48114	0.567	T	0.27971	-1.0058	8	0.39692	T	0.17	.	10.8494	0.46761	0.6773:0.3227:0.0:0.0	.	543	Q7Z340	ZN551_HUMAN	C	543;527;326	.	ENSP00000282296:R527C	R	+	1	0	ZNF551	62891082	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-5.180000	0.00144	-1.370000	0.02144	-0.310000	0.09108	CGC	ZNF551	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000204519		0.443	ZNF551-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF551	HGNC	protein_coding	OTTHUMT00000466803.2	55	0.00	0	C	NM_138347		58199270	58199270	+1	no_errors	ENST00000356715	ensembl	human	known	69_37n	missense	20	66.67	40	SNP	0.000	T
ZNF862	643641	genome.wustl.edu	37	7	149559197	149559197	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1RH-01A-21D-A167-09	TCGA-E9-A1RH-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2ecb84c0-c307-4fa9-85e3-2f722dd365a3	eb6b01e0-150f-4c06-81a8-bd7df58aa879	g.chr7:149559197G>T	ENST00000223210.4	+	7	3193	c.2948G>T	c.(2947-2949)gGa>gTa	p.G983V	RP4-751H13.7_ENST00000608963.1_RNA	NM_001099220.1	NP_001092690.1	O60290	ZN862_HUMAN	zinc finger protein 862	983					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|skin(1)	34						CTCCCAACAGGATACAGTGAG	0.552																																						dbGAP											0													72.0	77.0	76.0					7																	149559197		2009	4193	6202	-	-	-	SO:0001583	missense	0			AB011115	CCDS47741.1	7q36.1	2013-01-11			ENSG00000106479	ENSG00000106479		"""Zinc fingers, C2H2-type"", ""-"""	34519	protein-coding gene	gene with protein product							Standard	NM_001099220		Approved		uc010lpn.3	O60290	OTTHUMG00000158093	ENST00000223210.4:c.2948G>T	7.37:g.149559197G>T	ENSP00000223210:p.Gly983Val		A0AUL8	Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_HATC,superfamily_Krueppel-associated_box,superfamily_RNaseH-like_dom,smart_Krueppel-associated_box,smart_Znf_TTF,pfscan_Krueppel-associated_box	p.G983V	ENST00000223210.4	37	c.2948	CCDS47741.1	7	.	.	.	.	.	.	.	.	.	.	G	11.11	1.542925	0.27563	.	.	ENSG00000106479	ENST00000223210	T	0.01113	5.32	5.25	4.36	0.52297	.	0.115697	0.38778	N	0.001564	T	0.02012	0.0063	L	0.32530	0.975	0.50467	D	0.999872	P	0.52463	0.953	P	0.51918	0.684	T	0.72337	-0.4324	10	0.32370	T	0.25	-27.153	11.5277	0.50591	0.0:0.2013:0.7987:0.0	.	983	O60290	ZN862_HUMAN	V	983	ENSP00000223210:G983V	ENSP00000223210:G983V	G	+	2	0	ZNF862	149190130	0.861000	0.29849	0.077000	0.20336	0.510000	0.34073	2.745000	0.47459	1.193000	0.43086	0.561000	0.74099	GGA	ZNF862	-	NULL	ENSG00000106479		0.552	ZNF862-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF862	HGNC	protein_coding	OTTHUMT00000350165.1	19	0.00	0	G	NM_001099220		149559197	149559197	+1	no_errors	ENST00000223210	ensembl	human	known	69_37n	missense	10	47.37	9	SNP	0.731	T
