#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCC3	8714	genome.wustl.edu	37	17	48755286	48755286	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A247-01A-11D-A167-09	TCGA-E9-A247-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7c184a2b-d857-444a-936c-43e38a196df9	9a71e51e-6adf-4b93-b968-3849fcc81504	g.chr17:48755286C>G	ENST00000285238.8	+	24	3640	c.3560C>G	c.(3559-3561)cCc>cGc	p.P1187R		NM_003786.3	NP_003777.2	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 3	1187	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Doxorubicin(DB00997)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indomethacin(DB00328)|Lamivudine(DB00709)|Leucovorin(DB00650)|Methotrexate(DB00563)|Metyrapone(DB01011)|Nifedipine(DB01115)|Omeprazole(DB00338)|Phenobarbital(DB01174)|Probenecid(DB01032)|Rifampicin(DB01045)|Sulfinpyrazone(DB01138)|Verapamil(DB00661)|Vincristine(DB00541)	AGCTGCTACCCCTACATCATC	0.572																																						dbGAP											0													84.0	90.0	88.0					17																	48755286		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y17151	CCDS32681.1, CCDS45739.1	17q21	2012-03-14			ENSG00000108846	ENSG00000108846		"""ATP binding cassette transporters / subfamily C"""	54	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter 2"""	604323				8894702, 9827529	Standard	NM_003786		Approved	MRP3, cMOAT2, EST90757, MLP2, MOAT-D	uc002isl.3	O15438	OTTHUMG00000162245	ENST00000285238.8:c.3560C>G	17.37:g.48755286C>G	ENSP00000285238:p.Pro1187Arg		B2RPA9|D3DTX9|O60265|O60922|O75621|O95078|O95289|O95290|Q86X85|Q9UN52	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1,tigrfam_Multidrug-R_assoc	p.P1187R	ENST00000285238.8	37	c.3560	CCDS32681.1	17	.	.	.	.	.	.	.	.	.	.	C	13.69	2.312376	0.40895	.	.	ENSG00000108846	ENST00000285238	D	0.87650	-2.28	5.61	2.53	0.30540	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.320592	0.33438	N	0.004911	D	0.92883	0.7736	M	0.93638	3.44	0.80722	D	1	D	0.56968	0.978	P	0.58780	0.845	D	0.91665	0.5345	10	0.87932	D	0	-11.5963	8.4369	0.32793	0.1266:0.74:0.0:0.1335	.	1187	O15438	MRP3_HUMAN	R	1187	ENSP00000285238:P1187R	ENSP00000285238:P1187R	P	+	2	0	ABCC3	46110285	0.999000	0.42202	0.073000	0.20177	0.281000	0.26958	4.024000	0.57218	0.315000	0.23110	-0.182000	0.12963	CCC	ABCC3	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1,tigrfam_Multidrug-R_assoc	ENSG00000108846		0.572	ABCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC3	HGNC	protein_coding	OTTHUMT00000368083.2	30	0.00	0	C	NM_020038		48755286	48755286	+1	no_errors	ENST00000285238	ensembl	human	known	69_37n	missense	27	18.18	6	SNP	0.999	G
ABCC9	10060	genome.wustl.edu	37	12	22086768	22086768	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A247-01A-11D-A167-09	TCGA-E9-A247-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7c184a2b-d857-444a-936c-43e38a196df9	9a71e51e-6adf-4b93-b968-3849fcc81504	g.chr12:22086768C>T	ENST00000261201.4	-	2	231	c.232G>A	c.(232-234)Gct>Act	p.A78T	ABCC9_ENST00000538350.1_Missense_Mutation_p.A78T|ABCC9_ENST00000345162.2_Missense_Mutation_p.A78T|ABCC9_ENST00000326684.4_Missense_Mutation_p.A78T|ABCC9_ENST00000261200.4_Missense_Mutation_p.A78T	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	78					defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	AACAGGAGAGCGAATGTAAGA	0.428																																						dbGAP											0													192.0	163.0	172.0					12																	22086768		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.232G>A	12.37:g.22086768C>T	ENSP00000261201:p.Ala78Thr		O60707	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,prints_Sulphorea_rcpt,prints_Sulphonylurea_rcpt-2,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.A78T	ENST00000261201.4	37	c.232	CCDS8694.1	12	.	.	.	.	.	.	.	.	.	.	C	11.46	1.645247	0.29246	.	.	ENSG00000069431	ENST00000261200;ENST00000261201;ENST00000345162;ENST00000326684;ENST00000538350	D;D;D;D;D	0.96619	-4.07;-4.07;-4.07;-4.07;-4.07	4.62	3.73	0.42828	.	0.320203	0.35013	N	0.003516	D	0.86994	0.6067	N	0.03324	-0.35	0.27503	N	0.951935	B;B;B;B	0.22346	0.068;0.017;0.001;0.0	B;B;B;B	0.13407	0.009;0.006;0.001;0.0	T	0.77776	-0.2461	10	0.19590	T	0.45	-18.0103	8.1467	0.31115	0.0:0.7665:0.0:0.2335	.	78;78;78;78	G3V1N6;Q8N4N7;O60706;O60706-2	.;.;ABCC9_HUMAN;.	T	78	ENSP00000261200:A78T;ENSP00000261201:A78T;ENSP00000261202:A78T;ENSP00000317518:A78T;ENSP00000442604:A78T	ENSP00000261200:A78T	A	-	1	0	ABCC9	21978035	1.000000	0.71417	0.603000	0.28903	0.975000	0.68041	1.966000	0.40481	1.311000	0.45024	0.471000	0.43371	GCT	ABCC9	-	NULL	ENSG00000069431		0.428	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	ABCC9	HGNC	protein_coding	OTTHUMT00000402230.1	61	0.00	0	C	NM_005691		22086768	22086768	-1	no_errors	ENST00000261200	ensembl	human	known	69_37n	missense	44	39.73	29	SNP	0.993	T
ANK2	287	genome.wustl.edu	37	4	114257194	114257194	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A247-01A-11D-A167-09	TCGA-E9-A247-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7c184a2b-d857-444a-936c-43e38a196df9	9a71e51e-6adf-4b93-b968-3849fcc81504	g.chr4:114257194G>A	ENST00000357077.4	+	30	3625	c.3572G>A	c.(3571-3573)cGg>cAg	p.R1191Q	ANK2_ENST00000509550.1_Missense_Mutation_p.R367Q|ANK2_ENST00000264366.6_Missense_Mutation_p.R1158Q|ANK2_ENST00000506722.1_Missense_Mutation_p.R1182Q|ANK2_ENST00000394537.3_Missense_Mutation_p.R1191Q	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1191	ZU5 2. {ECO:0000255|PROSITE- ProRule:PRU00485}.				atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CTCACCAAGCGGATCCGCGTA	0.507																																						dbGAP											0													71.0	72.0	72.0					4																	114257194		2203	4300	6503	-	-	-	SO:0001583	missense	0			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.3572G>A	4.37:g.114257194G>A	ENSP00000349588:p.Arg1191Gln		Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,smart_ZU5,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_ZU5,prints_Ankyrin_rpt	p.R1191Q	ENST00000357077.4	37	c.3572	CCDS3702.1	4	.	.	.	.	.	.	.	.	.	.	G	31	5.060252	0.93846	.	.	ENSG00000145362	ENST00000503423;ENST00000506722;ENST00000431447;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056;ENST00000509550	T;T;T;T;T;T;T	0.73152	-0.72;-0.72;-0.72;-0.72;-0.32;-0.32;-0.72	5.27	5.27	0.74061	.	0.000000	0.44688	D	0.000439	D	0.84124	0.5403	M	0.74881	2.28	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.994;1.0;0.994;0.967;1.0;0.966;0.961	P;D;P;P;D;P;P	0.76071	0.605;0.961;0.677;0.726;0.987;0.505;0.846	D	0.84274	0.0490	9	.	.	.	.	18.9084	0.92472	0.0:0.0:1.0:0.0	.	367;1158;203;1191;1191;1182;1182	E9PCH6;Q01484;Q7Z344;Q01484-2;Q01484-4;Q01484-5;F8WEF9	.;ANK2_HUMAN;.;.;.;.;.	Q	1104;1182;237;1206;1191;1191;1158;1182;367	ENSP00000421011:R1104Q;ENSP00000421067:R1182Q;ENSP00000424722:R1206Q;ENSP00000378044:R1191Q;ENSP00000349588:R1191Q;ENSP00000264366:R1158Q;ENSP00000426944:R367Q	.	R	+	2	0	ANK2	114476643	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.599000	0.61076	2.455000	0.83008	0.655000	0.94253	CGG	ANK2	-	NULL	ENSG00000145362		0.507	ANK2-001	KNOWN	basic|CCDS	protein_coding	ANK2	HGNC	protein_coding	OTTHUMT00000256422.2	17	0.00	0	G	NM_001148		114257194	114257194	+1	no_errors	ENST00000357077	ensembl	human	known	69_37n	missense	24	17.24	5	SNP	1.000	A
ANKRD30B	374860	genome.wustl.edu	37	18	14803745	14803745	+	Missense_Mutation	SNP	A	A	G	rs45533337		TCGA-E9-A247-01A-11D-A167-09	TCGA-E9-A247-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7c184a2b-d857-444a-936c-43e38a196df9	9a71e51e-6adf-4b93-b968-3849fcc81504	g.chr18:14803745A>G	ENST00000358984.4	+	24	2386	c.2206A>G	c.(2206-2208)Act>Gct	p.T736A	ANKRD30B_ENST00000579292.1_Intron	NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	736										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						TTTCCTTGAGACTCTCTTACA	0.289																																						dbGAP											0													25.0	22.0	23.0					18																	14803745		688	1579	2267	-	-	-	SO:0001583	missense	0			BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.2206A>G	18.37:g.14803745A>G	ENSP00000351875:p.Thr736Ala		B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.T736A	ENST00000358984.4	37	c.2206	CCDS54182.1	18	.	.	.	.	.	.	.	.	.	.	N	5.153	0.213833	0.09810	.	.	ENSG00000180777	ENST00000358984;ENST00000320584;ENST00000277669	T	0.06371	3.31	1.16	1.16	0.20824	.	.	.	.	.	T	0.04861	0.0131	L	0.29908	0.895	0.09310	N	1	B	0.16396	0.017	B	0.08055	0.003	T	0.36817	-0.9732	9	0.87932	D	0	.	4.5782	0.12245	1.0:0.0:0.0:0.0	.	736	F8WAG3	.	A	736;11;4	ENSP00000351875:T736A	ENSP00000277669:T4A	T	+	1	0	ANKRD30B	14793745	0.037000	0.19845	0.001000	0.08648	0.001000	0.01503	1.570000	0.36439	0.807000	0.34208	0.440000	0.28878	ACT	ANKRD30B	-	NULL	ENSG00000180777		0.289	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD30B	HGNC	protein_coding	OTTHUMT00000443557.1	50	0.00	0	A	NM_001145029		14803745	14803745	+1	no_errors	ENST00000358984	ensembl	human	known	69_37n	missense	32	11.11	4	SNP	0.001	G
BCL9	607	genome.wustl.edu	37	1	147091300	147091300	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A247-01A-11D-A167-09	TCGA-E9-A247-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7c184a2b-d857-444a-936c-43e38a196df9	9a71e51e-6adf-4b93-b968-3849fcc81504	g.chr1:147091300C>T	ENST00000234739.3	+	8	2079	c.1339C>T	c.(1339-1341)Cca>Tca	p.P447S		NM_004326.2	NP_004317.2	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	447	Pro-rich.				canonical Wnt signaling pathway (GO:0060070)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|large_intestine(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	7	all_hematologic(923;0.115)					TGAAATGGTTCCACCTTCTAT	0.537			T	"""IGH@, IGL@"""	B-ALL																																	dbGAP		Dom	yes		1	1q21	607	B-cell CLL/lymphoma 9		L	0																																										-	-	-	SO:0001583	missense	0			Y13620	CCDS30833.1	1q21	2008-02-05			ENSG00000116128	ENSG00000116128			1008	protein-coding gene	gene with protein product		602597				9490669	Standard	NM_004326		Approved		uc001epq.3	O00512	OTTHUMG00000014031	ENST00000234739.3:c.1339C>T	1.37:g.147091300C>T	ENSP00000234739:p.Pro447Ser		Q5T489	Missense_Mutation	SNP	pfam_BCL9_beta-catenin-bd_dom	p.P447S	ENST00000234739.3	37	c.1339	CCDS30833.1	1	.	.	.	.	.	.	.	.	.	.	C	8.517	0.867858	0.17250	.	.	ENSG00000116128	ENST00000234739	T	0.75821	-0.97	5.47	3.61	0.41365	.	0.101561	0.64402	D	0.000002	T	0.45736	0.1357	L	0.47716	1.5	0.44110	D	0.996885	B;B	0.09022	0.002;0.002	B;B	0.13407	0.009;0.009	T	0.42732	-0.9434	10	0.09590	T	0.72	-2.4462	11.4242	0.50001	0.0:0.8063:0.1262:0.0676	.	447;447	Q1JQ81;O00512	.;BCL9_HUMAN	S	447	ENSP00000234739:P447S	ENSP00000234739:P447S	P	+	1	0	BCL9	145557924	1.000000	0.71417	0.881000	0.34555	0.997000	0.91878	3.747000	0.55134	0.879000	0.35944	0.556000	0.70494	CCA	BCL9	-	NULL	ENSG00000116128		0.537	BCL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL9	HGNC	protein_coding	OTTHUMT00000039468.1	12	0.00	0	C	NM_004326		147091300	147091300	+1	no_errors	ENST00000234739	ensembl	human	known	69_37n	missense	5	70.59	12	SNP	0.977	T
C11orf70	85016	genome.wustl.edu	37	11	101951992	101951992	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A247-01A-11D-A167-09	TCGA-E9-A247-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7c184a2b-d857-444a-936c-43e38a196df9	9a71e51e-6adf-4b93-b968-3849fcc81504	g.chr11:101951992G>A	ENST00000434758.2	+	6	683	c.655G>A	c.(655-657)Gtc>Atc	p.V219I	C11orf70_ENST00000526781.1_Missense_Mutation_p.V219I	NM_032930.2	NP_116319.2	Q9BRQ4	CK070_HUMAN	chromosome 11 open reading frame 70	219										breast(1)|kidney(1)|lung(5)|ovary(1)|prostate(2)|skin(2)	12	all_epithelial(12;0.0137)	Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.0137)	Lung(13;0.245)	BRCA - Breast invasive adenocarcinoma(274;0.0335)		TACCTCTTCTGTCTTTAAAGT	0.303																																						dbGAP											0													86.0	89.0	88.0					11																	101951992		2203	4295	6498	-	-	-	SO:0001583	missense	0			AK094851	CCDS8313.1, CCDS8313.2, CCDS53698.1	11q22.1	2012-05-31			ENSG00000137691	ENSG00000137691			28188	protein-coding gene	gene with protein product							Standard	NM_032930		Approved	MGC13040	uc001pgp.3	Q9BRQ4	OTTHUMG00000167320	ENST00000434758.2:c.655G>A	11.37:g.101951992G>A	ENSP00000414390:p.Val219Ile		E9PJU1	Missense_Mutation	SNP	NULL	p.V219I	ENST00000434758.2	37	c.655	CCDS8313.2	11	.	.	.	.	.	.	.	.	.	.	G	13.02	2.113210	0.37339	.	.	ENSG00000137691	ENST00000434758;ENST00000526781;ENST00000423732	.	.	.	5.74	-2.11	0.07187	.	0.456344	0.26765	N	0.022611	T	0.38506	0.1043	L	0.28608	0.87	0.80722	D	1	B	0.12013	0.005	B	0.14023	0.01	T	0.08953	-1.0697	9	0.23302	T	0.38	-1.217	10.9751	0.47461	0.5022:0.0:0.4978:0.0	.	219	Q9BRQ4	CK070_HUMAN	I	219;219;181	.	ENSP00000392150:V181I	V	+	1	0	C11orf70	101457202	0.898000	0.30612	0.572000	0.28498	0.982000	0.71751	1.068000	0.30629	-0.326000	0.08564	0.563000	0.77884	GTC	C11orf70	-	NULL	ENSG00000137691		0.303	C11orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf70	HGNC	protein_coding	OTTHUMT00000394144.1	69	0.00	0	G	NM_032930		101951992	101951992	+1	no_errors	ENST00000434758	ensembl	human	known	69_37n	missense	11	59.26	16	SNP	0.941	A
CACTIN	58509	genome.wustl.edu	37	19	3619155	3619155	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A247-01A-11D-A167-09	TCGA-E9-A247-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7c184a2b-d857-444a-936c-43e38a196df9	9a71e51e-6adf-4b93-b968-3849fcc81504	g.chr19:3619155C>T	ENST00000429344.2	-	5	1022	c.970G>A	c.(970-972)Gtg>Atg	p.V324M	CACTIN_ENST00000248420.5_Missense_Mutation_p.V324M|CACTIN_ENST00000221899.3_Missense_Mutation_p.V256M	NM_001080543.1	NP_001074012.1	Q8WUQ7	CATIN_HUMAN	cactin, spliceosome C complex subunit	324					cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)										TGCATCTCCACGGCCAGATCG	0.637																																						dbGAP											0													69.0	75.0	73.0					19																	3619155		2160	4255	6415	-	-	-	SO:0001583	missense	0			BC019848	CCDS45920.1	19p13.3	2012-06-08	2012-06-08	2012-06-08	ENSG00000105298	ENSG00000105298			29938	protein-coding gene	gene with protein product	"""NY REN 24 antigen"", ""functional spliceosome-associated protein c"", ""cactin homolog (Drosophila)"""		"""chromosome 19 open reading frame 29"""	C19orf29		8619474, 9110174, 21429463, 20829348	Standard	NM_001080543		Approved	NY-REN-24, fSAPc, cactin	uc002lyh.3	Q8WUQ7		ENST00000429344.2:c.970G>A	19.37:g.3619155C>T	ENSP00000415078:p.Val324Met		A6NNA9|A9UL12|O75229|Q7LE08|Q9BTA6|Q9Y5A4	Missense_Mutation	SNP	pfam_Cactin_dom,pfam_Cactin_C	p.V256M	ENST00000429344.2	37	c.766	CCDS45920.1	19	.	.	.	.	.	.	.	.	.	.	C	24.1	4.494197	0.85069	.	.	ENSG00000105298	ENST00000429344;ENST00000248420;ENST00000446452;ENST00000221899	.	.	.	4.73	4.73	0.59995	Cactin, domain (1);	0.000000	0.64402	D	0.000003	T	0.55273	0.1910	L	0.28192	0.835	0.80722	D	1	P;D	0.53619	0.782;0.961	B;P	0.51487	0.355;0.671	T	0.55909	-0.8066	9	0.37606	T	0.19	.	16.2699	0.82608	0.0:1.0:0.0:0.0	.	324;324	Q8WUQ7-2;Q8WUQ7	.;CS029_HUMAN	M	324;324;136;256	.	ENSP00000221899:V256M	V	-	1	0	C19orf29	3570155	1.000000	0.71417	0.962000	0.40283	0.896000	0.52359	7.596000	0.82721	2.175000	0.68902	0.561000	0.74099	GTG	CACTIN	-	pfam_Cactin_dom	ENSG00000105298		0.637	CACTIN-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	CACTIN	HGNC	protein_coding	OTTHUMT00000457370.2	28	0.00	0	C			3619155	3619155	-1	no_errors	ENST00000221899	ensembl	human	known	69_37n	missense	13	31.58	6	SNP	1.000	T
CMYA5	202333	genome.wustl.edu	37	5	79035212	79035212	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A247-01A-11D-A167-09	TCGA-E9-A247-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7c184a2b-d857-444a-936c-43e38a196df9	9a71e51e-6adf-4b93-b968-3849fcc81504	g.chr5:79035212A>G	ENST00000446378.2	+	2	10655	c.10624A>G	c.(10624-10626)Ata>Gta	p.I3542V		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	3542	Amphipathic helix H1.				negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		TGACACAGCTATAAGTGCTGT	0.328																																						dbGAP											0													33.0	29.0	30.0					5																	79035212		1867	4051	5918	-	-	-	SO:0001583	missense	0			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.10624A>G	5.37:g.79035212A>G	ENSP00000394770:p.Ile3542Val		A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3	p.I3542V	ENST00000446378.2	37	c.10624	CCDS47238.1	5	.	.	.	.	.	.	.	.	.	.	A	15.40	2.820966	0.50633	.	.	ENSG00000164309	ENST00000446378	T	0.27104	1.69	6.17	6.17	0.99709	.	0.000000	0.64402	D	0.000007	T	0.40347	0.1113	L	0.50333	1.59	0.28510	N	0.913583	D	0.61697	0.99	P	0.60286	0.872	T	0.41395	-0.9511	10	0.87932	D	0	.	11.338	0.49516	0.9251:0.0:0.0749:0.0	.	3542	Q8N3K9	CMYA5_HUMAN	V	3542	ENSP00000394770:I3542V	ENSP00000394770:I3542V	I	+	1	0	CMYA5	79070968	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	2.523000	0.45580	2.371000	0.80710	0.533000	0.62120	ATA	CMYA5	-	NULL	ENSG00000164309		0.328	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMYA5	HGNC	protein_coding	OTTHUMT00000369497.1	33	0.00	0	A	NM_153610		79035212	79035212	+1	no_errors	ENST00000446378	ensembl	human	known	69_37n	missense	15	37.50	9	SNP	1.000	G
CSMD1	64478	genome.wustl.edu	37	8	3081256	3081256	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A247-01A-11D-A167-09	TCGA-E9-A247-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7c184a2b-d857-444a-936c-43e38a196df9	9a71e51e-6adf-4b93-b968-3849fcc81504	g.chr8:3081256G>T	ENST00000520002.1	-	29	5037	c.4482C>A	c.(4480-4482)ttC>ttA	p.F1494L	CSMD1_ENST00000537824.1_Missense_Mutation_p.F1493L|CSMD1_ENST00000539096.1_Missense_Mutation_p.F1493L|CSMD1_ENST00000602723.1_Missense_Mutation_p.F1494L|CSMD1_ENST00000523387.1_5'UTR|CSMD1_ENST00000542608.1_Missense_Mutation_p.F1493L|CSMD1_ENST00000602557.1_Missense_Mutation_p.F1494L|CSMD1_ENST00000400186.3_Missense_Mutation_p.F1494L			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1494	CUB 9. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GGTACCTTTTGAATATCAAGG	0.388																																						dbGAP											0													101.0	100.0	100.0					8																	3081256		1840	4079	5919	-	-	-	SO:0001583	missense	0					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.4482C>A	8.37:g.3081256G>T	ENSP00000430733:p.Phe1494Leu		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.F1494L	ENST00000520002.1	37	c.4482		8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.67|17.67	3.446079|3.446079	0.63178|0.63178	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096|ENST00000335551	T;T;T;T;T|.	0.39997|.	1.05;1.05;1.05;1.05;1.05|.	5.08|5.08	4.19|4.19	0.49359|0.49359	CUB (5);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77089|0.77089	0.4079|0.4079	M|M	0.84846|0.84846	2.72|2.72	0.58432|0.58432	D|D	0.999997|0.999997	D;B;P|.	0.65815|.	0.995;0.108;0.756|.	D;B;P|.	0.77004|.	0.989;0.159;0.591|.	T|T	0.79546|0.79546	-0.1759|-0.1759	10|5	0.62326|.	D|.	0.03|.	.|.	13.2732|13.2732	0.60172|0.60172	0.0771:0.0:0.9229:0.0|0.0771:0.0:0.9229:0.0	.|.	1494;1494;1494|.	E5RIG2;Q96PZ7;Q96PZ7-4|.	.;CSMD1_HUMAN;.|.	L|K	1494;1494;1356;1493;1493;1493|974	ENSP00000383047:F1494L;ENSP00000430733:F1494L;ENSP00000441462:F1493L;ENSP00000446243:F1493L;ENSP00000441675:F1493L|.	ENSP00000320445:F1356L|.	F|Q	-|-	3|1	2|0	CSMD1|CSMD1	3068663|3068663	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.962000|0.962000	0.63368|0.63368	5.402000|5.402000	0.66332|0.66332	2.508000|2.508000	0.84585|0.84585	0.650000|0.650000	0.86243|0.86243	TTC|CAA	CSMD1	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000183117		0.388	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	HGNC	protein_coding	OTTHUMT00000374500.2	24	0.00	0	G	NM_033225		3081256	3081256	-1	no_errors	ENST00000520002	ensembl	human	known	69_37n	missense	20	25.93	7	SNP	1.000	T
ELN	2006	genome.wustl.edu	37	7	73474894	73474894	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A247-01A-11D-A167-09	TCGA-E9-A247-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7c184a2b-d857-444a-936c-43e38a196df9	9a71e51e-6adf-4b93-b968-3849fcc81504	g.chr7:73474894T>C	ENST00000320399.6	+	25	1810	c.1810T>C	c.(1810-1812)Tct>Cct	p.S604P	ELN_ENST00000458204.1_Intron|ELN_ENST00000252034.7_Intron|ELN_ENST00000357036.5_Intron|ELN_ENST00000380584.4_Intron|ELN_ENST00000380562.4_Intron|ELN_ENST00000380576.5_Intron|ELN_ENST00000429192.1_Intron|CTB-51J22.1_ENST00000435932.1_RNA|ELN_ENST00000445912.1_Intron|ELN_ENST00000320492.7_Intron|ELN_ENST00000358929.4_Missense_Mutation_p.S639P|ELN_ENST00000414324.1_Intron|ELN_ENST00000380553.4_Intron|ELN_ENST00000380575.4_Intron			P15502	ELN_HUMAN	elastin	0	Ala-rich.				blood circulation (GO:0008015)|blood vessel remodeling (GO:0001974)|cell proliferation (GO:0008283)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|organ morphogenesis (GO:0009887)|regulation of actin filament polymerization (GO:0030833)|respiratory gaseous exchange (GO:0007585)|skeletal muscle tissue development (GO:0007519)|stress fiber assembly (GO:0043149)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(4)|pancreas(2)|prostate(1)|skin(2)|stomach(1)	32		Lung NSC(55;0.159)				TCCCTCCTCCTCTCAGCACCT	0.587			T	PAX5	B-ALL		"""Supravalvular Aortic Stenosis, Cutis laxa , Williams-Beuren Syndrome"""																															dbGAP		Dom	yes		7	7q11.23	2006	elastin	yes	L	0													299.0	251.0	266.0					7																	73474894		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS5562.2, CCDS43598.1, CCDS43599.1, CCDS47611.1, CCDS47612.1, CCDS64673.1, CCDS64674.1, CCDS64675.1, CCDS64676.1, CCDS64677.1, CCDS64678.1, CCDS75616.1, CCDS75617.1	7q11.1-q21.1	2008-08-01	2008-08-01		ENSG00000049540	ENSG00000049540			3327	protein-coding gene	gene with protein product	"""tropoelastin"", ""supravalvular aortic stenosis"", ""Williams-Beuren syndrome"""	130160				8096434	Standard	NM_001278939		Approved	WBS, WS, SVAS	uc003tzn.3	P15502	OTTHUMG00000150229	ENST00000320399.6:c.1810T>C	7.37:g.73474894T>C	ENSP00000313565:p.Ser604Pro		B3KTS6|O15336|O15337|Q14233|Q14234|Q14235|Q14238|Q6P0L4|Q6ZWJ6|Q75MU5|Q7Z316|Q7Z3F5|Q9UMF5	Missense_Mutation	SNP	prints_Tropoelastin	p.S639P	ENST00000320399.6	37	c.1915	CCDS43599.1	7	.	.	.	.	.	.	.	.	.	.	T	12.85	2.060360	0.36373	.	.	ENSG00000049540	ENST00000358929;ENST00000320399	T;T	0.34859	1.36;1.34	4.51	-2.34	0.06704	.	.	.	.	.	T	0.21347	0.0514	.	.	.	0.09310	N	0.999996	.	.	.	.	.	.	T	0.28364	-1.0046	5	.	.	.	.	4.2276	0.10587	0.164:0.3839:0.0:0.4521	.	.	.	.	P	639;604	ENSP00000351807:S639P;ENSP00000313565:S604P	.	S	+	1	0	ELN	73112830	0.003000	0.15002	0.000000	0.03702	0.020000	0.10135	0.868000	0.27982	-0.508000	0.06540	0.454000	0.30748	TCT	ELN	-	NULL	ENSG00000049540		0.587	ELN-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ELN	HGNC	protein_coding	OTTHUMT00000252377.1	51	0.00	0	T	NM_000501		73474894	73474894	+1	no_errors	ENST00000358929	ensembl	human	known	69_37n	missense	43	48.19	40	SNP	0.000	C
ACSM3	6296	genome.wustl.edu	37	16	20802184	20802184	+	Intron	SNP	T	T	G			TCGA-E9-A247-01A-11D-A167-09	TCGA-E9-A247-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7c184a2b-d857-444a-936c-43e38a196df9	9a71e51e-6adf-4b93-b968-3849fcc81504	g.chr16:20802184T>G	ENST00000289416.5	+	10	1801				ACSM3_ENST00000567387.1_Intron|ERI2_ENST00000300005.3_Missense_Mutation_p.Q268P|ACSM3_ENST00000450120.2_Intron	NM_005622.3	NP_005613.2	Q53FZ2	ACSM3_HUMAN	acyl-CoA synthetase medium-chain family member 3						cholesterol homeostasis (GO:0042632)|fatty acid biosynthetic process (GO:0006633)|regulation of blood pressure (GO:0008217)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty acid ligase activity (GO:0015645)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)	21						AAATTCTTGCTGAAGAAAAGC	0.453																																						dbGAP											0													102.0	110.0	107.0					16																	20802184		2201	4300	6501	-	-	-	SO:0001627	intron_variant	0			D16350	CCDS10589.1, CCDS45435.1	16p13.11	2006-02-08	2005-09-08	2005-09-08	ENSG00000005187	ENSG00000005187		"""Acyl-CoA synthetase family"""	10522	protein-coding gene	gene with protein product		145505	"""SA (rat hypertension-associated) homolog"", ""SA hypertension-associated homolog (rat)"""	SAH		7843754, 7907320, 11470804	Standard	NM_005622		Approved	SA	uc002dhr.3	Q53FZ2	OTTHUMG00000131552	ENST00000289416.5:c.1326+174T>G	16.37:g.20802184T>G			O60363|Q13732|Q15425|Q7KYM6|Q9BUA2	Missense_Mutation	SNP	pfam_Exonuclease_RNaseT/DNA_pol3,superfamily_RNaseH-like_dom,smart_Exonuclease	p.Q268P	ENST00000289416.5	37	c.803	CCDS10589.1	16	.	.	.	.	.	.	.	.	.	.	T	10.34	1.321866	0.23994	.	.	ENSG00000196678	ENST00000300005	.	.	.	2.92	1.83	0.25207	.	.	.	.	.	T	0.14485	0.0350	.	.	.	0.09310	N	1	P	0.46020	0.871	B	0.31812	0.136	T	0.12142	-1.0559	7	0.37606	T	0.19	.	4.5493	0.12105	0.0:0.1539:0.0:0.8461	.	268	A8K979-4	.	P	268	.	ENSP00000300005:Q268P	Q	-	2	0	ERI2	20709685	0.000000	0.05858	0.013000	0.15412	0.092000	0.18411	0.300000	0.19156	0.526000	0.28541	0.454000	0.30748	CAG	ERI2	-	NULL	ENSG00000196678		0.453	ACSM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERI2	HGNC	protein_coding	OTTHUMT00000254414.2	34	0.00	0	T	NM_005622		20802184	20802184	-1	no_errors	ENST00000300005	ensembl	human	known	69_37n	missense	45	15.09	8	SNP	0.018	G
FAT4	79633	genome.wustl.edu	37	4	126372690	126372690	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A247-01A-11D-A167-09	TCGA-E9-A247-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7c184a2b-d857-444a-936c-43e38a196df9	9a71e51e-6adf-4b93-b968-3849fcc81504	g.chr4:126372690G>A	ENST00000394329.3	+	9	10532	c.10519G>A	c.(10519-10521)Ggg>Agg	p.G3507R	FAT4_ENST00000335110.5_Missense_Mutation_p.G1805R	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3507	Cadherin 33. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						AAATGATAACGGGCCCATGCT	0.483																																						dbGAP											0													105.0	104.0	105.0					4																	126372690		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.10519G>A	4.37:g.126372690G>A	ENSP00000377862:p.Gly3507Arg		A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl,smart_Cadherin,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.G3507R	ENST00000394329.3	37	c.10519	CCDS3732.3	4	.	.	.	.	.	.	.	.	.	.	G	23.4	4.412241	0.83340	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.37235	1.21;1.21	5.77	5.77	0.91146	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.34932	U	0.003564	T	0.48960	0.1529	N	0.17901	0.54	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.997;1.0	T	0.52283	-0.8596	10	0.66056	D	0.02	.	19.9983	0.97395	0.0:0.0:1.0:0.0	.	1805;3507;3507	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	R	3507;1805	ENSP00000377862:G3507R;ENSP00000335169:G1805R	ENSP00000335169:G1805R	G	+	1	0	FAT4	126592140	1.000000	0.71417	0.977000	0.42913	0.939000	0.58152	9.666000	0.98612	2.724000	0.93272	0.561000	0.74099	GGG	FAT4	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000196159		0.483	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	HGNC	protein_coding	OTTHUMT00000256765.2	45	0.00	0	G	NM_024582		126372690	126372690	+1	no_errors	ENST00000394329	ensembl	human	known	69_37n	missense	37	15.91	7	SNP	1.000	A
FREM2	341640	genome.wustl.edu	37	13	39261493	39261493	+	Silent	SNP	C	C	G			TCGA-E9-A247-01A-11D-A167-09	TCGA-E9-A247-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7c184a2b-d857-444a-936c-43e38a196df9	9a71e51e-6adf-4b93-b968-3849fcc81504	g.chr13:39261493C>G	ENST00000280481.7	+	1	228	c.12C>G	c.(10-12)gcC>gcG	p.A4A		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	4					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TGCACTCAGCCGGGACTCCCG	0.667																																						dbGAP											0													16.0	17.0	16.0					13																	39261493		2199	4297	6496	-	-	-	SO:0001819	synonymous_variant	0			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.12C>G	13.37:g.39261493C>G			Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Silent	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.A4	ENST00000280481.7	37	c.12	CCDS31960.1	13																																																																																			FREM2	-	NULL	ENSG00000150893		0.667	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FREM2	HGNC	protein_coding	OTTHUMT00000044599.2	15	0.00	0	C	NM_207361		39261493	39261493	+1	no_errors	ENST00000280481	ensembl	human	known	69_37n	silent	7	50.00	7	SNP	0.000	G
FRMPD2	143162	genome.wustl.edu	37	10	49448466	49448466	+	Silent	SNP	G	G	A			TCGA-E9-A247-01A-11D-A167-09	TCGA-E9-A247-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7c184a2b-d857-444a-936c-43e38a196df9	9a71e51e-6adf-4b93-b968-3849fcc81504	g.chr10:49448466G>A	ENST00000374201.3	-	6	939	c.637C>T	c.(637-639)Ctg>Ttg	p.L213L	FRMPD2_ENST00000407470.4_Silent_p.L182L|FRMPD2_ENST00000305531.3_Silent_p.L189L	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	213					tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)			NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		GTCCCACGCAGCCTCTTCCTG	0.597																																						dbGAP											0													70.0	63.0	65.0					10																	49448466		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.637C>T	10.37:g.49448466G>A			B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Silent	SNP	pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_PDZ,superfamily_FERM_central,superfamily_Kinase-like_dom,smart_KIND,smart_Band_41_domain,smart_PDZ,pfscan_FERM_domain,pfscan_PDZ,prints_Band_41_fam	p.L213	ENST00000374201.3	37	c.637	CCDS31195.1	10																																																																																			FRMPD2	-	NULL	ENSG00000170324		0.597	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMPD2	HGNC	protein_coding	OTTHUMT00000047923.3	20	0.00	0	G	NM_152428		49448466	49448466	-1	no_errors	ENST00000374201	ensembl	human	known	69_37n	silent	26	18.75	6	SNP	0.998	A
HIST1H3F	8968	genome.wustl.edu	37	6	26250661	26250661	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A247-01A-11D-A167-09	TCGA-E9-A247-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7c184a2b-d857-444a-936c-43e38a196df9	9a71e51e-6adf-4b93-b968-3849fcc81504	g.chr6:26250661G>A	ENST00000446824.2	-	1	174	c.173C>T	c.(172-174)tCg>tTg	p.S58L	HIST1H2BH_ENST00000356350.2_5'Flank	NM_021018.2	NP_066298.1	P68431	H31_HUMAN	histone cluster 1, H3f	58					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			lung(6)|urinary_tract(1)	7						TAGCTCAGTCGATTTCTGATA	0.607											OREG0017241	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													118.0	120.0	119.0					6																	26250661		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z80786	CCDS4600.1	6p22.1	2011-01-27	2006-10-11	2003-03-14	ENSG00000256316	ENSG00000277775		"""Histones / Replication-dependent"""	4773	protein-coding gene	gene with protein product		602816	"""H3 histone family, member I"", ""histone 1, H3f"""	H3FI		9119399, 12408966	Standard	NM_021018		Approved	H3/i	uc003nhg.1	P68431	OTTHUMG00000014435	ENST00000446824.2:c.173C>T	6.37:g.26250661G>A	ENSP00000444823:p.Ser58Leu	785	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.S58L	ENST00000446824.2	37	c.173	CCDS4600.1	6	.	.	.	.	.	.	.	.	.	.	.	16.53	3.148117	0.57151	.	.	ENSG00000256316	ENST00000446824	T	0.71579	-0.58	4.82	4.82	0.62117	.	.	.	.	.	T	0.79305	0.4423	.	.	.	0.45747	D	0.998643	.	.	.	.	.	.	T	0.81895	-0.0723	6	0.87932	D	0	.	17.7536	0.88442	0.0:0.0:1.0:0.0	.	.	.	.	L	58	ENSP00000444823:S58L	ENSP00000444823:S58L	S	-	2	0	HIST1H3F	26358640	1.000000	0.71417	0.993000	0.49108	0.020000	0.10135	7.620000	0.83070	2.602000	0.87976	0.561000	0.74099	TCG	HIST1H3F	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	ENSG00000256316		0.607	HIST1H3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H3F	HGNC	protein_coding	OTTHUMT00000040098.1	44	0.00	0	G	NM_021018		26250661	26250661	-1	no_errors	ENST00000446824	ensembl	human	known	69_37n	missense	29	25.64	10	SNP	1.000	A
INSM2	84684	genome.wustl.edu	37	14	36005145	36005145	+	Silent	SNP	C	C	A	rs530312723		TCGA-E9-A247-01A-11D-A167-09	TCGA-E9-A247-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7c184a2b-d857-444a-936c-43e38a196df9	9a71e51e-6adf-4b93-b968-3849fcc81504	g.chr14:36005145C>A	ENST00000307169.3	+	1	1898	c.1687C>A	c.(1687-1689)Cgg>Agg	p.R563R		NM_032594.3	NP_115983.3	Q96T92	INSM2_HUMAN	insulinoma-associated 2	563					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	10	Breast(36;0.122)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(9;2.16e-07)|Lung(238;2.63e-07)|Epithelial(34;0.00145)|all cancers(34;0.00452)	GBM - Glioblastoma multiforme(112;0.0223)		GATGCCACTGCGGCCTGGCTG	0.552																																						dbGAP											0													46.0	49.0	48.0					14																	36005145		2171	4233	6404	-	-	-	SO:0001819	synonymous_variant	0			AF260323	CCDS9657.1	14q13.1	2013-01-08			ENSG00000168348	ENSG00000168348		"""Zinc fingers, C2H2-type"""	17539	protein-coding gene	gene with protein product	"""mlt 1"""	614027					Standard	NM_032594		Approved	IA-6	uc001wth.1	Q96T92	OTTHUMG00000140223	ENST00000307169.3:c.1687C>A	14.37:g.36005145C>A			A1L432|J9Y024|Q8N8K7|Q96Q84	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R563	ENST00000307169.3	37	c.1687	CCDS9657.1	14																																																																																			INSM2	-	NULL	ENSG00000168348		0.552	INSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INSM2	HGNC	protein_coding	OTTHUMT00000276686.1	12	0.00	0	C			36005145	36005145	+1	no_errors	ENST00000307169	ensembl	human	known	69_37n	silent	6	53.85	7	SNP	0.992	A
KCNS1	3787	genome.wustl.edu	37	20	43723698	43723698	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A247-01A-11D-A167-09	TCGA-E9-A247-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7c184a2b-d857-444a-936c-43e38a196df9	9a71e51e-6adf-4b93-b968-3849fcc81504	g.chr20:43723698C>T	ENST00000306117.1	-	5	1790	c.1394G>A	c.(1393-1395)cGg>cAg	p.R465Q	KCNS1_ENST00000537075.1_Missense_Mutation_p.R465Q	NM_002251.3	NP_002242.2	Q96KK3	KCNS1_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 1	465					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel regulator activity (GO:0015459)			endometrium(1)|lung(3)|ovary(1)|stomach(1)	6		Myeloproliferative disorder(115;0.0122)				CTTCTGGCGCCGGTAGAAGTG	0.592																																						dbGAP											0													102.0	101.0	101.0					20																	43723698		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF043473	CCDS13342.1	20q12	2011-07-05			ENSG00000124134	ENSG00000124134		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6300	protein-coding gene	gene with protein product		602905				9305895, 16382104	Standard	NM_002251		Approved	Kv9.1	uc002xnc.3	Q96KK3	OTTHUMG00000033079	ENST00000306117.1:c.1394G>A	20.37:g.43723698C>T	ENSP00000307694:p.Arg465Gln		A2RUL9|B7ZM31|O43652|Q6DJU6	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv6	p.R465Q	ENST00000306117.1	37	c.1394	CCDS13342.1	20	.	.	.	.	.	.	.	.	.	.	C	13.01	2.107948	0.37242	.	.	ENSG00000124134	ENST00000306117;ENST00000537075	D;D	0.97811	-4.55;-4.55	5.57	4.58	0.56647	.	0.125023	0.53938	N	0.000046	D	0.93546	0.7940	L	0.27053	0.805	0.45318	D	0.998319	B	0.02656	0.0	B	0.06405	0.002	D	0.89542	0.3793	10	0.23302	T	0.38	.	9.9154	0.41430	0.0:0.8373:0.0:0.1627	.	465	Q96KK3	KCNS1_HUMAN	Q	465	ENSP00000307694:R465Q;ENSP00000445595:R465Q	ENSP00000307694:R465Q	R	-	2	0	KCNS1	43157112	0.961000	0.32948	1.000000	0.80357	0.988000	0.76386	2.132000	0.42083	1.257000	0.44085	-0.367000	0.07326	CGG	KCNS1	-	NULL	ENSG00000124134		0.592	KCNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNS1	HGNC	protein_coding	OTTHUMT00000080507.3	35	0.00	0	C	NM_002251		43723698	43723698	-1	no_errors	ENST00000306117	ensembl	human	known	69_37n	missense	25	16.67	5	SNP	1.000	T
KRTAP4-6	81871	genome.wustl.edu	37	17	39296499	39296499	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A247-01A-11D-A167-09	TCGA-E9-A247-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7c184a2b-d857-444a-936c-43e38a196df9	9a71e51e-6adf-4b93-b968-3849fcc81504	g.chr17:39296499G>A	ENST00000345847.4	-	1	240	c.241C>T	c.(241-243)Cgc>Tgc	p.R81C		NM_030976.1	NP_112238.1	Q9BYQ5	KRA46_HUMAN	keratin associated protein 4-6	81	30 X 5 AA repeats of C-C-[IRQVEL]-[SPTR]- [STVQRCP].					keratin filament (GO:0045095)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(1)|prostate(1)|urinary_tract(1)	9						CAGCTAGGGCGGCAGCAGGTG	0.657																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AJ406938	CCDS54125.1	17q21.2	2013-06-25			ENSG00000198090	ENSG00000198090		"""Keratin associated proteins"""	18909	protein-coding gene	gene with protein product			"""keratin associated protein 4-15"""	KRTAP4-15			Standard	NM_030976		Approved	KAP4.6, KAP4.15	uc010cxk.2	Q9BYQ5	OTTHUMG00000133634	ENST00000345847.4:c.241C>T	17.37:g.39296499G>A	ENSP00000328270:p.Arg81Cys		Q9BYR1	Missense_Mutation	SNP	pfam_Keratin-assoc	p.R81C	ENST00000345847.4	37	c.241	CCDS54125.1	17	.	.	.	.	.	.	.	.	.	.	.	14.10	2.433848	0.43224	.	.	ENSG00000198090	ENST00000345847	T	0.01516	4.81	4.11	3.11	0.35812	.	0.178389	0.21173	U	0.078950	T	0.08179	0.0204	M	0.86573	2.825	0.40816	D	0.983467	.	.	.	.	.	.	T	0.01001	-1.1485	8	0.59425	D	0.04	.	9.1245	0.36807	0.0:0.0:0.6034:0.3965	.	.	.	.	C	81	ENSP00000328270:R81C	ENSP00000328270:R81C	R	-	1	0	KRTAP4-6	36550025	0.000000	0.05858	0.880000	0.34516	0.353000	0.29299	-0.634000	0.05477	0.702000	0.31825	0.586000	0.80456	CGC	KRTAP4-6	-	NULL	ENSG00000198090		0.657	KRTAP4-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP4-6	HGNC	protein_coding	OTTHUMT00000257779.1	33	0.00	0	G			39296499	39296499	-1	no_errors	ENST00000345847	ensembl	human	known	69_37n	missense	32	13.51	5	SNP	0.992	A
OR5M8	219484	genome.wustl.edu	37	11	56258125	56258125	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A247-01A-11D-A167-09	TCGA-E9-A247-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7c184a2b-d857-444a-936c-43e38a196df9	9a71e51e-6adf-4b93-b968-3849fcc81504	g.chr11:56258125C>A	ENST00000327216.2	-	1	746	c.722G>T	c.(721-723)gGc>gTc	p.G241V		NM_001005282.1	NP_001005282.1	Q8NGP6	OR5M8_HUMAN	olfactory receptor, family 5, subfamily M, member 8	241						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(22)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	Esophageal squamous(21;0.00352)					CAGATGGGAGCCACAGGTAGA	0.408																																						dbGAP											0													36.0	39.0	38.0					11																	56258125		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB065744	CCDS31533.1	11q11	2012-08-09			ENSG00000181371	ENSG00000181371		"""GPCR / Class A : Olfactory receptors"""	14846	protein-coding gene	gene with protein product							Standard	NM_001005282		Approved		uc001nix.1	Q8NGP6	OTTHUMG00000166877	ENST00000327216.2:c.722G>T	11.37:g.56258125C>A	ENSP00000323354:p.Gly241Val		B2RNM5|Q6IEW3|Q96RB8	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.G241V	ENST00000327216.2	37	c.722	CCDS31533.1	11	.	.	.	.	.	.	.	.	.	.	C	11.82	1.751227	0.31046	.	.	ENSG00000181371	ENST00000327216	T	0.35421	1.31	4.35	2.34	0.29019	GPCR, rhodopsin-like superfamily (1);	0.175734	0.27198	N	0.020470	T	0.41328	0.1154	L	0.55990	1.75	0.25112	N	0.990707	B	0.29671	0.254	B	0.43575	0.424	T	0.44174	-0.9345	10	0.62326	D	0.03	-3.0059	8.8382	0.35126	0.1701:0.6656:0.1643:0.0	.	241	Q8NGP6	OR5M8_HUMAN	V	241	ENSP00000323354:G241V	ENSP00000323354:G241V	G	-	2	0	OR5M8	56014701	0.000000	0.05858	0.979000	0.43373	0.937000	0.57800	-0.625000	0.05534	0.355000	0.24131	0.632000	0.83419	GGC	OR5M8	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000181371		0.408	OR5M8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5M8	HGNC	protein_coding	OTTHUMT00000391641.1	29	0.00	0	C	NM_001005282		56258125	56258125	-1	no_errors	ENST00000327216	ensembl	human	known	69_37n	missense	21	16.00	4	SNP	0.094	A
PCDHGC4	56098	genome.wustl.edu	37	5	140866811	140866811	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A247-01A-11D-A167-09	TCGA-E9-A247-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7c184a2b-d857-444a-936c-43e38a196df9	9a71e51e-6adf-4b93-b968-3849fcc81504	g.chr5:140866811C>G	ENST00000306593.1	+	1	2071	c.2071C>G	c.(2071-2073)Ctc>Gtc	p.L691V	PCDHGC5_ENST00000252087.1_5'Flank|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_018928.2|NM_032406.1	NP_061751.1|NP_115782.1	Q9Y5F7	PCDGL_HUMAN	protocadherin gamma subfamily C, 4	691					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(13)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	42			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCGTCTAACCCTCTACTTGGC	0.498																																						dbGAP											0													149.0	123.0	132.0					5																	140866811		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152525	CCDS4262.1, CCDS75349.1	5q31	2010-01-26			ENSG00000242419	ENSG00000242419		"""Cadherins / Protocadherins : Clustered"""	8717	other	protocadherin		606305				10380929	Standard	NM_018928		Approved	PCDH-GAMMA-C4		Q9Y5F7	OTTHUMG00000129625	ENST00000306593.1:c.2071C>G	5.37:g.140866811C>G	ENSP00000306918:p.Leu691Val		Q495T2|Q9Y5C3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L691V	ENST00000306593.1	37	c.2071	CCDS4262.1	5	.	.	.	.	.	.	.	.	.	.	C	11.87	1.767107	0.31320	.	.	ENSG00000242419	ENST00000306593	T	0.54071	0.59	5.67	4.79	0.61399	.	.	.	.	.	T	0.63896	0.2550	L	0.52905	1.665	0.26743	N	0.970342	D;D	0.89917	1.0;0.995	D;P	0.72625	0.978;0.788	T	0.55464	-0.8137	9	0.56958	D	0.05	.	6.8428	0.23973	0.1426:0.7093:0.0:0.1481	.	691;691	Q9Y5F7-2;Q9Y5F7	.;PCDGL_HUMAN	V	691	ENSP00000306918:L691V	ENSP00000306918:L691V	L	+	1	0	PCDHGC4	140846995	0.054000	0.20591	1.000000	0.80357	0.691000	0.40173	0.438000	0.21559	1.363000	0.46019	0.591000	0.81541	CTC	PCDHGC4	-	NULL	ENSG00000242419		0.498	PCDHGC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGC4	HGNC	protein_coding	OTTHUMT00000251820.1	54	0.00	0	C	NM_018928		140866811	140866811	+1	no_errors	ENST00000306593	ensembl	human	known	69_37n	missense	42	19.23	10	SNP	0.980	G
POF1B	79983	genome.wustl.edu	37	X	84634256	84634256	+	Silent	SNP	G	G	T			TCGA-E9-A247-01A-11D-A167-09	TCGA-E9-A247-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7c184a2b-d857-444a-936c-43e38a196df9	9a71e51e-6adf-4b93-b968-3849fcc81504	g.chrX:84634256G>T	ENST00000262753.4	-	2	349	c.204C>A	c.(202-204)ccC>ccA	p.P68P	POF1B_ENST00000373145.3_Silent_p.P68P	NM_024921.3	NP_079197.3	Q8WVV4	POF1B_HUMAN	premature ovarian failure, 1B	68						tight junction (GO:0005923)				central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|liver(2)|lung(17)|ovary(1)|prostate(1)	35						GTGAGTTGAAGGGGTCCAAGG	0.517																																						dbGAP											0													117.0	91.0	100.0					X																	84634256		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC017500	CCDS14452.1	Xq21.2	2008-02-05			ENSG00000124429	ENSG00000124429			13711	protein-coding gene	gene with protein product		300603				11299520	Standard	NM_024921		Approved	POF, FLJ22792	uc004eer.2	Q8WVV4	OTTHUMG00000021934	ENST00000262753.4:c.204C>A	X.37:g.84634256G>T			A8K2U5|Q5H9E9|Q5H9F0|Q8NG12|Q9H5Y2|Q9H738|Q9H744	Silent	SNP	NULL	p.P68	ENST00000262753.4	37	c.204	CCDS14452.1	X																																																																																			POF1B	-	NULL	ENSG00000124429		0.517	POF1B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	POF1B	HGNC	protein_coding	OTTHUMT00000057391.2	47	0.00	0	G	NM_024921		84634256	84634256	-1	no_errors	ENST00000373145	ensembl	human	known	69_37n	silent	19	36.67	11	SNP	0.931	T
POLE	5426	genome.wustl.edu	37	12	133250274	133250274	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A247-01A-11D-A167-09	TCGA-E9-A247-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7c184a2b-d857-444a-936c-43e38a196df9	9a71e51e-6adf-4b93-b968-3849fcc81504	g.chr12:133250274A>G	ENST00000320574.5	-	13	1289	c.1246T>C	c.(1246-1248)Tac>Cac	p.Y416H	POLE_ENST00000535270.1_Missense_Mutation_p.Y389H	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	416					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	ACAGGAAGGTAACTGTCCCTC	0.572								DNA polymerases (catalytic subunits)																														dbGAP											0													155.0	144.0	147.0					12																	133250274		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.1246T>C	12.37:g.133250274A>G	ENSP00000322570:p.Tyr416His		Q13533|Q86VH9	Missense_Mutation	SNP	pfam_DNA_pol_e_suA_C,pfam_DNA-dir_DNA_pol_B_exonuc,pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_3'-5'_exonuclease_PolB-like,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B	p.Y427H	ENST00000320574.5	37	c.1279	CCDS9278.1	12	.	.	.	.	.	.	.	.	.	.	A	18.26	3.584883	0.65992	.	.	ENSG00000177084	ENST00000320574;ENST00000455752;ENST00000535270;ENST00000539006;ENST00000376577;ENST00000535934	T;T;T;T	0.48522	4.85;4.85;4.85;0.81	5.63	5.63	0.86233	DNA-directed DNA polymerase, family B, exonuclease domain (1);Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.76219	0.3957	M	0.92317	3.295	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.82816	-0.0270	10	0.87932	D	0	.	15.8351	0.78791	1.0:0.0:0.0:0.0	.	389;416	F5H1D6;Q07864	.;DPOE1_HUMAN	H	416;427;389;196;351;34	ENSP00000322570:Y416H;ENSP00000406383:Y427H;ENSP00000445753:Y389H;ENSP00000442519:Y196H	ENSP00000322570:Y416H	Y	-	1	0	POLE	131760347	1.000000	0.71417	0.992000	0.48379	0.255000	0.26057	9.239000	0.95389	2.152000	0.67230	0.260000	0.18958	TAC	POLE	-	pfam_DNA-dir_DNA_pol_B_exonuc,pfam_3'-5'_exonuclease_PolB-like,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B	ENSG00000177084		0.572	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLE	HGNC	protein_coding	OTTHUMT00000397689.2	33	0.00	0	A	NM_006231		133250274	133250274	-1	no_errors	ENST00000455752	ensembl	human	known	69_37n	missense	19	32.14	9	SNP	1.000	G
PPARGC1A	10891	genome.wustl.edu	37	4	23815386	23815386	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E9-A247-01A-11D-A167-09	TCGA-E9-A247-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7c184a2b-d857-444a-936c-43e38a196df9	9a71e51e-6adf-4b93-b968-3849fcc81504	g.chr4:23815386G>A	ENST00000264867.2	-	8	1839	c.1720C>T	c.(1720-1722)Cga>Tga	p.R574*	PPARGC1A_ENST00000509702.1_5'UTR	NM_013261.3	NP_037393.1	Q9UBK2	PRGC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 alpha	574	Arg/Ser-rich.|Mediates interaction with RNF34. {ECO:0000269|PubMed:22064484}.				androgen metabolic process (GO:0008209)|androgen receptor signaling pathway (GO:0030521)|brown fat cell differentiation (GO:0050873)|cellular glucose homeostasis (GO:0001678)|cellular respiration (GO:0045333)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|cellular response to nitrite (GO:0071250)|cellular response to oxidative stress (GO:0034599)|cellular response to thyroid hormone stimulus (GO:0097067)|cellular response to tumor necrosis factor (GO:0071356)|circadian regulation of gene expression (GO:0032922)|digestion (GO:0007586)|fatty acid oxidation (GO:0019395)|flavone metabolic process (GO:0051552)|galactose metabolic process (GO:0006012)|gluconeogenesis (GO:0006094)|mitochondrion organization (GO:0007005)|mRNA processing (GO:0006397)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of receptor activity (GO:2000272)|positive regulation of ATP biosynthetic process (GO:2001171)|positive regulation of cellular respiration (GO:1901857)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of histone acetylation (GO:0035066)|positive regulation of mitochondrial DNA metabolic process (GO:1901860)|positive regulation of mitochondrion organization (GO:0010822)|positive regulation of muscle tissue development (GO:1901863)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|regulation of circadian rhythm (GO:0042752)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|response to cold (GO:0009409)|response to epinephrine (GO:0071871)|response to leucine (GO:0043201)|response to muscle activity (GO:0014850)|response to norepinephrine (GO:0071873)|response to starvation (GO:0042594)|response to statin (GO:0036273)|RNA splicing (GO:0008380)|temperature homeostasis (GO:0001659)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytosol (GO:0005829)|DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|liver(1)|lung(24)|ovary(3)|skin(5)	51		Breast(46;0.0503)				GACCTGTGTCGAGAAAAGGAC	0.448																																					Esophageal Squamous(29;694 744 13796 34866 44181)	dbGAP											0													86.0	86.0	86.0					4																	23815386		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF106698	CCDS3429.1	4p15.1	2013-02-12	2006-10-17	2004-02-04	ENSG00000109819	ENSG00000109819		"""RNA binding motif (RRM) containing"""	9237	protein-coding gene	gene with protein product		604517	"""peroxisome proliferative activated receptor, gamma, coactivator 1"", ""peroxisome proliferative activated receptor, gamma, coactivator 1, alpha"""	PPARGC1		10585775	Standard	NM_013261		Approved	PGC1, PGC1A	uc003gqs.3	Q9UBK2	OTTHUMG00000097747	ENST00000264867.2:c.1720C>T	4.37:g.23815386G>A	ENSP00000264867:p.Arg574*		B7Z406|G8DM16|I3RTT5|I3RTT6|I3RTT7|I3RTT8|I3RTT9|Q3LIG1|Q4W5M7|Q9UN32	Nonsense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R574*	ENST00000264867.2	37	c.1720	CCDS3429.1	4	.	.	.	.	.	.	.	.	.	.	G	37	6.333026	0.97480	.	.	ENSG00000109819	ENST00000264867	.	.	.	6.16	5.32	0.75619	.	0.125321	0.56097	D	0.000027	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.6326	17.0779	0.86591	0.0:0.0:0.8721:0.1279	.	.	.	.	X	574	.	ENSP00000264867:R574X	R	-	1	2	PPARGC1A	23424484	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.813000	0.69201	1.611000	0.50210	-0.175000	0.13238	CGA	PPARGC1A	-	NULL	ENSG00000109819		0.448	PPARGC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPARGC1A	HGNC	protein_coding	OTTHUMT00000214976.1	43	0.00	0	G	NM_013261		23815386	23815386	-1	no_errors	ENST00000264867	ensembl	human	known	69_37n	nonsense	42	14.29	7	SNP	1.000	A
PPFIA3	8541	genome.wustl.edu	37	19	49632226	49632226	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A247-01A-11D-A167-09	TCGA-E9-A247-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7c184a2b-d857-444a-936c-43e38a196df9	9a71e51e-6adf-4b93-b968-3849fcc81504	g.chr19:49632226C>T	ENST00000334186.4	+	4	813	c.464C>T	c.(463-465)gCt>gTt	p.A155V	PPFIA3_ENST00000602351.1_Missense_Mutation_p.A155V	NM_003660.2	NP_003651.1	O75145	LIPA3_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3	155					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|presynaptic active zone (GO:0048786)				NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(16)|pancreas(1)|prostate(1)|skin(4)|urinary_tract(1)	35		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000203)|GBM - Glioblastoma multiforme(486;0.00307)|Epithelial(262;0.00677)		GTGCTCAAAGCTCTAAAGTCT	0.572																																						dbGAP											0													52.0	56.0	55.0					19																	49632226		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF034800	CCDS12758.1	19q13.33	2013-09-23			ENSG00000177380	ENSG00000177380		"""Sterile alpha motif (SAM) domain containing"""	9247	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase, receptor type, f polypeptide, alpha 3"", ""liprin-alpha 3"", ""liprin"""	603144				9624153, 9734811	Standard	NM_003660		Approved	KIAA0654, LPNA3, MGC126567, MGC126569	uc002pmr.3	O75145	OTTHUMG00000183213	ENST00000334186.4:c.464C>T	19.37:g.49632226C>T	ENSP00000335614:p.Ala155Val		A8K142|Q3MJA0|Q9H8B5|Q9UEW4	Missense_Mutation	SNP	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.A155V	ENST00000334186.4	37	c.464	CCDS12758.1	19	.	.	.	.	.	.	.	.	.	.	C	35	5.569601	0.96540	.	.	ENSG00000177380	ENST00000334186;ENST00000421230	T	0.48836	0.8	4.74	4.74	0.60224	.	0.000000	0.47093	D	0.000247	T	0.58366	0.2117	L	0.29908	0.895	0.80722	D	1	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.91635	0.999;0.995;0.999	T	0.62525	-0.6836	10	0.87932	D	0	-7.1424	17.0217	0.86435	0.0:1.0:0.0:0.0	.	79;155;155	B4DEU8;O75145-2;O75145	.;.;LIPA3_HUMAN	V	155;79	ENSP00000335614:A155V	ENSP00000335614:A155V	A	+	2	0	PPFIA3	54324038	1.000000	0.71417	1.000000	0.80357	0.826000	0.46750	7.585000	0.82584	2.646000	0.89796	0.563000	0.77884	GCT	PPFIA3	-	NULL	ENSG00000177380		0.572	PPFIA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPFIA3	HGNC	protein_coding	OTTHUMT00000465688.1	29	0.00	0	C	NM_003660		49632226	49632226	+1	no_errors	ENST00000334186	ensembl	human	known	69_37n	missense	17	32.00	8	SNP	1.000	T
RAB18	22931	genome.wustl.edu	37	10	27798830	27798830	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A247-01A-11D-A167-09	TCGA-E9-A247-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7c184a2b-d857-444a-936c-43e38a196df9	9a71e51e-6adf-4b93-b968-3849fcc81504	g.chr10:27798830C>G	ENST00000356940.6	+	2	197	c.95C>G	c.(94-96)aCg>aGg	p.T32R	RAB18_ENST00000535776.1_Missense_Mutation_p.T32R|RAB18_ENST00000465772.1_3'UTR|RAB18_ENST00000375802.3_Missense_Mutation_p.T32R	NM_001256410.1|NM_001256415.1|NM_021252.4	NP_001243339.1|NP_001243344.1|NP_067075.1	Q9NP72	RAB18_HUMAN	RAB18, member RAS oncogene family	32					brain development (GO:0007420)|endoplasmic reticulum tubular network organization (GO:0071786)|eye development (GO:0001654)|GTP catabolic process (GO:0006184)|lipid particle organization (GO:0034389)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			kidney(1)|large_intestine(1)|lung(1)	3						ACAGATGATACGTTTGATCCA	0.338																																						dbGAP											0													115.0	115.0	115.0					10																	27798830		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ277145	CCDS7155.1, CCDS58073.1, CCDS73080.1, CCDS73081.1	10p12	2011-03-07			ENSG00000099246	ENSG00000099246		"""RAB, member RAS oncogene"""	14244	protein-coding gene	gene with protein product		602207				10648831	Standard	NM_021252		Approved		uc001itw.4	Q9NP72	OTTHUMG00000017861	ENST00000356940.6:c.95C>G	10.37:g.27798830C>G	ENSP00000349415:p.Thr32Arg		B3KMC7|B7Z333|D3DRW1|Q53FX8|Q56UN9|Q6FIH1	Nonsense_Mutation	SNP	pfam_Small_GTPase,pfam_Small_GTPase_ARF/SAR,pfam_MIRO-like,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Small_GTPase_Ras,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.Y115*	ENST00000356940.6	37	c.345	CCDS7155.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.53|16.53	3.149979|3.149979	0.57151|0.57151	.|.	.|.	ENSG00000099246|ENSG00000099246	ENST00000356940;ENST00000535776;ENST00000540268;ENST00000375802|ENST00000423465	T;T;T|.	0.76709|.	-1.04;-1.04;0.03|.	5.68|5.68	5.68|5.68	0.88126|0.88126	Small GTP-binding protein domain (1);|.	.|.	.|.	.|.	.|.	T|.	0.47893|.	0.1470|.	N|N	0.17082|0.17082	0.46|0.46	0.35595|0.35595	D|D	0.807439|0.807439	B;B;B;B|.	0.34226|.	0.443;0.262;0.027;0.036|.	B;B;B;B|.	0.34301|.	0.179;0.066;0.086;0.049|.	T|.	0.50931|.	-0.8769|.	9|.	0.38643|.	T|.	0.18|.	.|.	18.724|18.724	0.91705|0.91705	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	32;32;32;32|.	B7Z333;B7Z4P9;Q56UN9;Q9NP72|.	.;.;.;RAB18_HUMAN|.	R|X	32|115	ENSP00000349415:T32R;ENSP00000439321:T32R;ENSP00000364960:T32R|.	ENSP00000349415:T32R|.	T|Y	+|+	2|3	0|2	RAB18|RAB18	27838836|27838836	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.967000|0.967000	0.64934|0.64934	5.868000|5.868000	0.69605|0.69605	2.838000|2.838000	0.97847|0.97847	0.655000|0.655000	0.94253|0.94253	ACG|TAC	RAB18	-	pfam_Small_GTPase,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Small_GTPase_Ras,tigrfam_Small_GTP-bd_dom	ENSG00000099246		0.338	RAB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB18	HGNC	protein_coding	OTTHUMT00000047326.2	71	0.00	0	C	NM_021252		27798830	27798830	+1	no_start_codon:pseudogene	ENST00000423465	ensembl	human	known	69_37n	nonsense	64	17.95	14	SNP	1.000	G
RTTN	25914	genome.wustl.edu	37	18	67684825	67684825	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A247-01A-11D-A167-09	TCGA-E9-A247-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7c184a2b-d857-444a-936c-43e38a196df9	9a71e51e-6adf-4b93-b968-3849fcc81504	g.chr18:67684825T>C	ENST00000255674.6	-	46	6525	c.6239A>G	c.(6238-6240)aAg>aGg	p.K2080R	RTTN_ENST00000579986.1_5'UTR|RTTN_ENST00000454359.1_3'UTR	NM_173630.3	NP_775901.3	Q86VV8	RTTN_HUMAN	rotatin	2080					determination of left/right symmetry (GO:0007368)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(35)|ovary(4)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Esophageal squamous(42;0.129)				CAGGAGTAACTTCAACCAAAG	0.378																																						dbGAP											0													142.0	134.0	136.0					18																	67684825		1867	4106	5973	-	-	-	SO:0001583	missense	0			AL117635	CCDS42443.1	18q22.1	2008-08-01				ENSG00000176225			18654	protein-coding gene	gene with protein product		610436				11900971	Standard	NM_173630		Approved	DKFZP434G145	uc002lkp.2	Q86VV8		ENST00000255674.6:c.6239A>G	18.37:g.67684825T>C	ENSP00000255674:p.Lys2080Arg		Q68CS9|Q6ZRL8|Q6ZTK3|Q86TG4|Q8N8N8|Q8TBQ4|Q96IN9|Q9UFJ4	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.K2080R	ENST00000255674.6	37	c.6239	CCDS42443.1	18	.	.	.	.	.	.	.	.	.	.	T	12.48	1.951931	0.34471	.	.	ENSG00000176225	ENST00000255674	T	0.46451	0.87	5.52	5.52	0.82312	Armadillo-like helical (1);Armadillo-type fold (1);	0.063645	0.64402	D	0.000013	T	0.32734	0.0839	L	0.33485	1.01	0.80722	D	1	B	0.31931	0.347	B	0.28011	0.085	T	0.08411	-1.0723	10	0.25751	T	0.34	.	15.932	0.79668	0.0:0.0:0.0:1.0	.	2080	Q86VV8	RTTN_HUMAN	R	2080	ENSP00000255674:K2080R	ENSP00000255674:K2080R	K	-	2	0	RTTN	65835805	1.000000	0.71417	0.997000	0.53966	0.369000	0.29798	3.286000	0.51724	2.222000	0.72286	0.455000	0.32223	AAG	RTTN	-	superfamily_ARM-type_fold	ENSG00000176225		0.378	RTTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTTN	HGNC	protein_coding	OTTHUMT00000442988.1	57	0.00	0	T	NM_173630		67684825	67684825	-1	no_errors	ENST00000255674	ensembl	human	known	69_37n	missense	48	25.76	17	SNP	1.000	C
SLC29A3	55315	genome.wustl.edu	37	10	73111493	73111496	+	Frame_Shift_Del	DEL	CTAC	CTAC	-			TCGA-E9-A247-01A-11D-A167-09	TCGA-E9-A247-10A-01D-A167-09	CTAC	CTAC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7c184a2b-d857-444a-936c-43e38a196df9	9a71e51e-6adf-4b93-b968-3849fcc81504	g.chr10:73111493_73111496delCTAC	ENST00000373189.5	+	4	610_613	c.558_561delCTAC	c.(556-561)atctacfs	p.IY186fs	SLC29A3_ENST00000469204.1_3'UTR	NM_001174098.1|NM_018344.5	NP_001167569.1|NP_060814.4	Q9BZD2	S29A3_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 3	186					transmembrane transport (GO:0055085)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	nucleoside transmembrane transporter activity (GO:0005337)			endometrium(3)|kidney(2)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	15						GCAGCAGCATCTACGGCATGACCG	0.574																																					Esophageal Squamous(200;1319 2142 18949 31248 39672)	dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF326987	CCDS7310.1	10q22.2	2013-07-17	2013-07-17		ENSG00000198246	ENSG00000198246		"""Solute carriers"""	23096	protein-coding gene	gene with protein product		612373	"""solute carrier family 29 (nucleoside transporters), member 3"""			11396612	Standard	NM_018344		Approved	ENT3, FLJ11160	uc001jrr.4	Q9BZD2	OTTHUMG00000018424	ENST00000373189.5:c.558_561delCTAC	10.37:g.73111493_73111496delCTAC	ENSP00000362285:p.Ile186fs		B2RB50|B4E2Z9|B7ZA37|Q0VAM9|Q5T465|Q7RTT8|Q8IVZ0|Q9BWI2|Q9NUS9	Frame_Shift_Del	DEL	pfam_Eqnu_transpt,prints_Eqnu_transpt	p.I186fs	ENST00000373189.5	37	c.558_561	CCDS7310.1	10																																																																																			SLC29A3	-	pfam_Eqnu_transpt,prints_Eqnu_transpt	ENSG00000198246		0.574	SLC29A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC29A3	HGNC	protein_coding	OTTHUMT00000048544.1	22	0.00	0	CTAC	NM_018344		73111493	73111496	+1	no_errors	ENST00000373189	ensembl	human	known	69_37n	frame_shift_del	14	46.15	12	DEL	0.993:0.988:0.391:0.033	-
SYTL4	94121	genome.wustl.edu	37	X	99942108	99942108	+	Silent	SNP	G	G	A			TCGA-E9-A247-01A-11D-A167-09	TCGA-E9-A247-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7c184a2b-d857-444a-936c-43e38a196df9	9a71e51e-6adf-4b93-b968-3849fcc81504	g.chrX:99942108G>A	ENST00000372989.1	-	13	1471	c.1140C>T	c.(1138-1140)tgC>tgT	p.C380C	SYTL4_ENST00000455616.1_Silent_p.C380C|SYTL4_ENST00000276141.6_Silent_p.C380C|SYTL4_ENST00000372981.1_3'UTR|SYTL4_ENST00000263033.5_Silent_p.C380C|SYTL4_ENST00000454200.2_Silent_p.C382C	NM_080737.2	NP_542775.2	Q96C24	SYTL4_HUMAN	synaptotagmin-like 4	380	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|multivesicular body sorting pathway (GO:0071985)|negative regulation of insulin secretion (GO:0046676)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|synaptic vesicle (GO:0008021)	neurexin family protein binding (GO:0042043)|phospholipid binding (GO:0005543)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(2)	27					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CCAGCTGATGGCACTCCTTCA	0.527																																						dbGAP											0													103.0	80.0	88.0					X																	99942108		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS14472.1	Xq21.33	2008-07-31	2008-07-31		ENSG00000102362	ENSG00000102362			15588	protein-coding gene	gene with protein product	"""granuphilin-a"", ""exophilin-2"""	300723					Standard	NM_080737		Approved		uc010nnc.3	Q96C24	OTTHUMG00000022004	ENST00000372989.1:c.1140C>T	X.37:g.99942108G>A			Q5H9J3|Q5JPG8|Q8N9P4|Q9H4R0|Q9H4R1	Silent	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Znf_FYVE_PHD,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Rab-bd_domain,prints_Synaptotagmin	p.C382	ENST00000372989.1	37	c.1146	CCDS14472.1	X																																																																																			SYTL4	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting,prints_Synaptotagmin	ENSG00000102362		0.527	SYTL4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SYTL4	HGNC	protein_coding	OTTHUMT00000057488.1	38	0.00	0	G	NM_080737		99942108	99942108	-1	no_errors	ENST00000454200	ensembl	human	known	69_37n	silent	13	31.58	6	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179611371	179611371	+	Intron	SNP	C	C	G			TCGA-E9-A247-01A-11D-A167-09	TCGA-E9-A247-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7c184a2b-d857-444a-936c-43e38a196df9	9a71e51e-6adf-4b93-b968-3849fcc81504	g.chr2:179611371C>G	ENST00000591111.1	-	46	10585				TTN_ENST00000360870.5_Missense_Mutation_p.E5252D|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Intron|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000578746.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GACACATGTACTCTCCCCCTT	0.413																																						dbGAP											0													149.0	140.0	143.0					2																	179611371		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10361-4723G>C	2.37:g.179611371C>G			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Titin_Z,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.E5252D	ENST00000591111.1	37	c.15756		2	.	.	.	.	.	.	.	.	.	.	C	13.56	2.272722	0.40194	.	.	ENSG00000155657	ENST00000360870;ENST00000306136	T	0.68025	-0.3	5.95	1.22	0.21188	.	.	.	.	.	T	0.55130	0.1901	L	0.39020	1.185	0.80722	D	1	P	0.48407	0.91	P	0.49012	0.598	T	0.49597	-0.8923	9	0.13853	T	0.58	.	5.4506	0.16563	0.0:0.4508:0.1403:0.4089	.	5252	Q8WZ42-6	.	D	5252;533	ENSP00000354117:E5252D	ENSP00000304714:E533D	E	-	3	2	TTN	179319616	0.719000	0.27986	1.000000	0.80357	0.985000	0.73830	-0.116000	0.10724	0.664000	0.31047	0.655000	0.94253	GAG	TTN	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000155657		0.413	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	72	0.00	0	C	NM_133378		179611371	179611371	-1	no_errors	ENST00000360870	ensembl	human	known	69_37n	missense	39	25.00	13	SNP	0.993	G
USH2A	7399	genome.wustl.edu	37	1	216591941	216591941	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A247-01A-11D-A167-09	TCGA-E9-A247-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7c184a2b-d857-444a-936c-43e38a196df9	9a71e51e-6adf-4b93-b968-3849fcc81504	g.chr1:216591941C>T	ENST00000307340.3	-	3	952	c.566G>A	c.(565-567)cGc>cAc	p.R189H	USH2A_ENST00000366942.3_Missense_Mutation_p.R189H|USH2A_ENST00000366943.2_Missense_Mutation_p.R189H	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	189					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ATTTACTGTGCGATAATAAAA	0.363										HNSCC(13;0.011)																												dbGAP											0													129.0	123.0	125.0					1																	216591941		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.566G>A	1.37:g.216591941C>T	ENSP00000305941:p.Arg189His		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.R189H	ENST00000307340.3	37	c.566	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.120714	0.77436	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.74315	-0.83;-0.83;-0.83	5.62	3.76	0.43208	Concanavalin A-like lectin/glucanase (1);LamG-like jellyroll fold (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.43579	U	0.000557	D	0.83147	0.5191	M	0.65975	2.015	0.37858	D	0.929605	D;P	0.89917	1.0;0.798	D;B	0.73380	0.98;0.229	D	0.85453	0.1162	10	0.87932	D	0	.	11.9499	0.52948	0.0:0.8597:0.0:0.1403	.	189;189	O75445-2;O75445	.;USH2A_HUMAN	H	189	ENSP00000305941:R189H;ENSP00000355910:R189H;ENSP00000355909:R189H	ENSP00000305941:R189H	R	-	2	0	USH2A	214658564	1.000000	0.71417	0.993000	0.49108	0.993000	0.82548	1.593000	0.36686	0.729000	0.32403	0.655000	0.94253	CGC	USH2A	-	superfamily_ConA-like_lec_gl,smart_LamG-like	ENSG00000042781		0.363	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	65	0.00	0	C	NM_007123		216591941	216591941	-1	no_errors	ENST00000366943	ensembl	human	known	69_37n	missense	52	21.21	14	SNP	1.000	T
CFAP44	55779	genome.wustl.edu	37	3	113049172	113049172	+	Missense_Mutation	SNP	C	C	T	rs183028814		TCGA-E9-A247-01A-11D-A167-09	TCGA-E9-A247-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7c184a2b-d857-444a-936c-43e38a196df9	9a71e51e-6adf-4b93-b968-3849fcc81504	g.chr3:113049172C>T	ENST00000393845.2	-	26	4025	c.3959G>A	c.(3958-3960)cGt>cAt	p.R1320H	WDR52_ENST00000308346.6_5'Flank	NM_001164496.1	NP_001157968.1														breast(2)|central_nervous_system(3)|endometrium(3)|kidney(5)|large_intestine(7)|lung(26)|prostate(1)|urinary_tract(2)	49						TATTGAATCACGGGTTGTCAA	0.453													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18660	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													148.0	128.0	134.0					3																	113049172		692	1591	2283	-	-	-	SO:0001583	missense	0																														ENST00000393845.2:c.3959G>A	3.37:g.113049172C>T	ENSP00000377428:p.Arg1320His			Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R1320H	ENST00000393845.2	37	c.3959	CCDS54624.1	3	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	15.92	2.975602	0.53720	.	.	ENSG00000206530	ENST00000393845	T	0.12039	2.72	5.86	4.06	0.47325	.	0.784854	0.10675	U	0.647090	T	0.07683	0.0193	N	0.24115	0.695	0.09310	N	0.999999	P	0.35684	0.515	B	0.26864	0.074	T	0.25222	-1.0138	10	0.18276	T	0.48	-10.8455	8.1665	0.31230	0.0:0.7281:0.0:0.2719	.	1320	Q96MT7-2	.	H	1320	ENSP00000377428:R1320H	ENSP00000377428:R1320H	R	-	2	0	WDR52	114531862	0.098000	0.21812	0.165000	0.22776	0.004000	0.04260	1.049000	0.30392	1.488000	0.48433	-0.266000	0.10368	CGT	WDR52	-	NULL	ENSG00000206530		0.453	WDR52-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR52	HGNC	protein_coding		62	0.00	0	C			113049172	113049172	-1	no_errors	ENST00000393845	ensembl	human	known	69_37n	missense	8	80.00	32	SNP	0.019	T
WHSC1L1	54904	genome.wustl.edu	37	8	38173482	38173482	+	Nonsense_Mutation	SNP	G	G	C			TCGA-E9-A247-01A-11D-A167-09	TCGA-E9-A247-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7c184a2b-d857-444a-936c-43e38a196df9	9a71e51e-6adf-4b93-b968-3849fcc81504	g.chr8:38173482G>C	ENST00000317025.8	-	10	2451	c.1934C>G	c.(1933-1935)tCa>tGa	p.S645*	WHSC1L1_ENST00000433384.2_Nonsense_Mutation_p.S645*|WHSC1L1_ENST00000527502.1_Nonsense_Mutation_p.S645*|WHSC1L1_ENST00000525081.1_5'Flank	NM_023034.1	NP_075447.1	Q9BZ95	NSD3_HUMAN	Wolf-Hirschhorn syndrome candidate 1-like 1	645					histone lysine methylation (GO:0034968)|histone methylation (GO:0016571)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	24	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			TCTGTATGCTGAACTAGTCAT	0.418			T	NUP98	AML																																	dbGAP		Dom	yes		8	8p12	54904	Wolf-Hirschhorn syndrome candidate 1-like 1 (NSD3)		L	0													158.0	152.0	154.0					8																	38173482		2104	4224	6328	-	-	-	SO:0001587	stop_gained	0			AF332469	CCDS6105.1, CCDS43729.1	8p11.2	2013-05-20			ENSG00000147548	ENSG00000147548			12767	protein-coding gene	gene with protein product		607083				10802047, 23269674	Standard	NM_023034		Approved	FLJ20353, NSD3	uc003xli.3	Q9BZ95		ENST00000317025.8:c.1934C>G	8.37:g.38173482G>C	ENSP00000313983:p.Ser645*		B7ZL11|D3DSX1|Q1RMD3|Q3B796|Q6ZSA5|Q9BYU8|Q9BYU9|Q9H2M8|Q9H9W9|Q9NXA6	Nonsense_Mutation	SNP	pfam_PWWP,pfam_SET_dom,superfamily_Znf_FYVE_PHD,smart_PWWP,smart_Znf_PHD,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger	p.S645*	ENST00000317025.8	37	c.1934	CCDS43729.1	8	.	.	.	.	.	.	.	.	.	.	G	42	9.668253	0.99234	.	.	ENSG00000147548	ENST00000433384;ENST00000317025;ENST00000446459;ENST00000527502	.	.	.	5.85	4.95	0.65309	.	0.525202	0.15033	U	0.284321	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	.	16.5757	0.84637	0.0:0.1347:0.8653:0.0	.	.	.	.	X	645;645;582;645	.	ENSP00000313983:S645X	S	-	2	0	WHSC1L1	38292639	1.000000	0.71417	0.847000	0.33407	0.973000	0.67179	5.232000	0.65332	1.436000	0.47453	0.650000	0.86243	TCA	WHSC1L1	-	NULL	ENSG00000147548		0.418	WHSC1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WHSC1L1	HGNC	protein_coding	OTTHUMT00000381924.3	57	0.00	0	G	NM_023034		38173482	38173482	-1	no_errors	ENST00000317025	ensembl	human	known	69_37n	nonsense	35	58.33	49	SNP	1.000	C
ZBTB48	3104	genome.wustl.edu	37	1	6640763	6640763	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A247-01A-11D-A167-09	TCGA-E9-A247-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7c184a2b-d857-444a-936c-43e38a196df9	9a71e51e-6adf-4b93-b968-3849fcc81504	g.chr1:6640763G>T	ENST00000377674.4	+	2	252	c.94G>T	c.(94-96)Gtg>Ttg	p.V32L		NM_001278647.1|NM_001278648.1|NM_005341.2	NP_001265576.1|NP_001265577.1|NP_005332.1	P10074	ZBT48_HUMAN	zinc finger and BTB domain containing 48	32	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	11	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.35e-07)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(304;0.00109)|STAD - Stomach adenocarcinoma(132;0.017)|READ - Rectum adenocarcinoma(331;0.0642)		CACTCTGGACGTGGGGGGCCT	0.612																																					Esophageal Squamous(125;1449 1657 4031 29866 49542)	dbGAP											0													78.0	76.0	77.0					1																	6640763		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC013573	CCDS84.1	1p36.3	2013-01-08	2006-09-20	2006-09-20	ENSG00000204859	ENSG00000204859		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	4930	protein-coding gene	gene with protein product		165270	"""GLI-Kruppel family member HKR3"""	HKR3		2850480, 8661141	Standard	NM_001278647		Approved	ZNF855	uc001anx.3	P10074	OTTHUMG00000001438	ENST00000377674.4:c.94G>T	1.37:g.6640763G>T	ENSP00000366902:p.Val32Leu		Q5SY19	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.V32L	ENST00000377674.4	37	c.94	CCDS84.1	1	.	.	.	.	.	.	.	.	.	.	G	17.61	3.431241	0.62844	.	.	ENSG00000204859	ENST00000319084;ENST00000435905;ENST00000377674	T;T;T	0.32753	1.44;1.44;1.44	5.59	5.59	0.84812	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.201533	0.43416	D	0.000579	T	0.52613	0.1745	M	0.88775	2.98	0.48395	D	0.999648	D	0.56287	0.975	P	0.49637	0.617	T	0.61554	-0.7039	10	0.51188	T	0.08	-27.5603	18.1489	0.89668	0.0:0.0:1.0:0.0	.	32	P10074	ZBT48_HUMAN	L	32	ENSP00000313416:V32L;ENSP00000416054:V32L;ENSP00000366902:V32L	ENSP00000313416:V32L	V	+	1	0	ZBTB48	6563350	1.000000	0.71417	0.992000	0.48379	0.084000	0.17831	7.526000	0.81920	2.618000	0.88619	0.563000	0.77884	GTG	ZBTB48	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	ENSG00000204859		0.612	ZBTB48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB48	HGNC	protein_coding	OTTHUMT00000004193.1	33	0.00	0	G	NM_005341		6640763	6640763	+1	no_errors	ENST00000377674	ensembl	human	known	69_37n	missense	14	30.00	6	SNP	0.993	T
ZNF69	7620	genome.wustl.edu	37	19	12016108	12016108	+	Missense_Mutation	SNP	C	C	T	rs201646792		TCGA-E9-A247-01A-11D-A167-09	TCGA-E9-A247-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7c184a2b-d857-444a-936c-43e38a196df9	9a71e51e-6adf-4b93-b968-3849fcc81504	g.chr19:12016108C>T	ENST00000429654.2	+	4	1036	c.896C>T	c.(895-897)aCg>aTg	p.T299M	ZNF69_ENST00000340180.5_Intron			Q9UC07	ZNF69_HUMAN	zinc finger protein 69	299					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|skin(2)	4				Lung(535;0.011)		AGGATTCACACGGGAGAGAAG	0.428													c|||	1	0.000199681	0.0	0.0	5008	,	,		21644	0.0		0.001	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001583	missense	0			X60076	CCDS32914.1	19p13.2	2013-01-08	2006-05-12		ENSG00000198429	ENSG00000198429		"""Zinc fingers, C2H2-type"", ""-"""	13138	protein-coding gene	gene with protein product		194543	"""zinc finger protein 69 (Cos5)"""			1639391	Standard	NM_021915		Approved	Cos5	uc002mst.4	Q9UC07	OTTHUMG00000156526	ENST00000429654.2:c.896C>T	19.37:g.12016108C>T	ENSP00000402985:p.Thr299Met		Q86VA7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T299M	ENST00000429654.2	37	c.896		19	.	.	.	.	.	.	.	.	.	.	c	5.905	0.350981	0.11182	.	.	ENSG00000198429	ENST00000429654	T	0.26373	1.74	0.94	-0.181	0.13291	.	.	.	.	.	T	0.26448	0.0646	.	.	.	0.27170	N	0.960939	.	.	.	.	.	.	T	0.28332	-1.0047	6	0.59425	D	0.04	.	7.4807	0.27404	0.0:0.8301:0.0:0.1699	.	.	.	.	M	299	ENSP00000402985:T299M	ENSP00000402985:T299M	T	+	2	0	ZNF69	11877108	0.009000	0.17119	0.247000	0.24249	0.007000	0.05969	-0.006000	0.12833	-0.084000	0.12595	-1.111000	0.02071	ACG	ZNF69	-	pfscan_Znf_C2H2	ENSG00000198429		0.428	ZNF69-002	KNOWN	basic|appris_principal	protein_coding	ZNF69	HGNC	protein_coding	OTTHUMT00000344082.1	65	0.00	0	C	NM_021915		12016108	12016108	+1	no_errors	ENST00000429654	ensembl	human	known	69_37n	missense	35	30.00	15	SNP	0.992	T
