#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA9	10350	genome.wustl.edu	37	17	67031525	67031525	+	Frame_Shift_Del	DEL	A	A	-			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr17:67031525delA	ENST00000340001.4	-	8	1201	c.990delT	c.(988-990)cttfs	p.L330fs	ABCA9_ENST00000453985.2_Frame_Shift_Del_p.L330fs|ABCA9_ENST00000370732.2_Frame_Shift_Del_p.L330fs	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	330					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					CCAAGCCCGTAAGGAAAGGTT	0.408																																						dbGAP											0													127.0	121.0	123.0					17																	67031525		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.990delT	17.37:g.67031525delA	ENSP00000342216:p.Leu330fs		Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Frame_Shift_Del	DEL	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.T331fs	ENST00000340001.4	37	c.990	CCDS11681.1	17																																																																																			ABCA9	-	NULL	ENSG00000154258		0.408	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA9	HGNC	protein_coding	OTTHUMT00000277072.2	29	0.00	0	A	NM_172386		67031525	67031525	-1	no_errors	ENST00000340001	ensembl	human	known	69_37n	frame_shift_del	46	18.97	11	DEL	0.113	-
ABCD1	215	genome.wustl.edu	37	X	152991469	152991469	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chrX:152991469G>A	ENST00000218104.3	+	1	1147	c.748G>A	c.(748-750)Gtg>Atg	p.V250M	BCAP31_ENST00000345046.6_5'Flank|BCAP31_ENST00000441714.1_5'Flank|BCAP31_ENST00000458587.2_5'Flank|ABCD1_ENST00000370129.4_Missense_Mutation_p.V65M	NM_000033.3	NP_000024.2	P33897	ABCD1_HUMAN	ATP-binding cassette, sub-family D (ALD), member 1	250	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				alpha-linolenic acid metabolic process (GO:0036109)|ATP catabolic process (GO:0006200)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|linoleic acid metabolic process (GO:0043651)|long-chain fatty acid catabolic process (GO:0042758)|peroxisomal long-chain fatty acid import (GO:0015910)|peroxisomal membrane transport (GO:0015919)|peroxisome organization (GO:0007031)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid catabolic process (GO:0042760)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|peroxisomal fatty-acyl-CoA transporter activity (GO:0005325)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(2)	18	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CGCCGGCCTCGTGGTGTTCCT	0.701																																						dbGAP											0													21.0	21.0	21.0					X																	152991469		2196	4294	6490	-	-	-	SO:0001583	missense	0			Z21876	CCDS14728.1	Xq28	2012-03-14			ENSG00000101986	ENSG00000101986		"""ATP binding cassette transporters / subfamily D"""	61	protein-coding gene	gene with protein product		300371		ALD		8441467, 6795626	Standard	NM_000033		Approved	AMN, ALDP, adrenoleukodystrophy	uc004fif.2	P33897	OTTHUMG00000024215	ENST00000218104.3:c.748G>A	X.37:g.152991469G>A	ENSP00000218104:p.Val250Met		Q6GTZ2	Missense_Mutation	SNP	pfam_ABC_Ald_N,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1,tigrfam_FA_transporter	p.V250M	ENST00000218104.3	37	c.748	CCDS14728.1	X	.	.	.	.	.	.	.	.	.	.	G	16.42	3.117043	0.56505	.	.	ENSG00000101986	ENST00000218104;ENST00000370129	D;D	0.99671	-6.35;-6.35	5.37	5.37	0.77165	ABC transporter, N-terminal (1);ABC transporter, integral membrane type 1 (1);	0.068711	0.56097	D	0.000024	D	0.99474	0.9813	M	0.64567	1.98	0.58432	D	0.999997	D	0.89917	1.0	D	0.87578	0.998	D	0.98847	1.0757	10	0.51188	T	0.08	-25.464	16.8847	0.86072	0.0:0.0:1.0:0.0	.	250	P33897	ABCD1_HUMAN	M	250;65	ENSP00000218104:V250M;ENSP00000359147:V65M	ENSP00000218104:V250M	V	+	1	0	ABCD1	152644663	1.000000	0.71417	0.995000	0.50966	0.126000	0.20510	9.455000	0.97625	2.247000	0.74100	0.529000	0.55759	GTG	ABCD1	-	pfam_ABC_Ald_N,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1,tigrfam_FA_transporter	ENSG00000101986		0.701	ABCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCD1	HGNC	protein_coding	OTTHUMT00000061041.1	12	0.00	0	G	NM_000033		152991469	152991469	+1	no_errors	ENST00000218104	ensembl	human	known	69_37n	missense	13	35.00	7	SNP	1.000	A
ADCY8	114	genome.wustl.edu	37	8	132051949	132051949	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr8:132051949G>T	ENST00000286355.5	-	1	2723	c.631C>A	c.(631-633)Ctc>Atc	p.L211I	ADCY8_ENST00000377928.3_Missense_Mutation_p.L211I	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	211					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			ATGCCCTTGAGCGGGTCCATG	0.592										HNSCC(32;0.087)																												dbGAP											0													62.0	65.0	64.0					8																	132051949		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.631C>A	8.37:g.132051949G>T	ENSP00000286355:p.Leu211Ile			Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.L211I	ENST00000286355.5	37	c.631	CCDS6363.1	8	.	.	.	.	.	.	.	.	.	.	G	8.716	0.913233	0.17907	.	.	ENSG00000155897	ENST00000286355;ENST00000377928	T;T	0.46819	0.86;0.86	5.46	4.58	0.56647	.	0.186803	0.37955	N	0.001868	T	0.22475	0.0542	N	0.04959	-0.14	0.25048	N	0.991155	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.15065	-1.0450	10	0.17369	T	0.5	.	7.1802	0.25768	0.0834:0.0:0.6513:0.2652	.	211;211	E7EVL1;P40145	.;ADCY8_HUMAN	I	211	ENSP00000286355:L211I;ENSP00000367161:L211I	ENSP00000286355:L211I	L	-	1	0	ADCY8	132121131	0.999000	0.42202	1.000000	0.80357	0.957000	0.61999	2.036000	0.41165	1.318000	0.45170	0.455000	0.32223	CTC	ADCY8	-	NULL	ENSG00000155897		0.592	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY8	HGNC	protein_coding	OTTHUMT00000380080.1	32	0.00	0	G			132051949	132051949	-1	no_errors	ENST00000286355	ensembl	human	known	69_37n	missense	41	24.07	13	SNP	0.816	T
AFAP1L1	134265	genome.wustl.edu	37	5	148702277	148702277	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr5:148702277T>C	ENST00000296721.4	+	15	1905	c.1807T>C	c.(1807-1809)Tcc>Ccc	p.S603P	AFAP1L1_ENST00000515000.1_Missense_Mutation_p.S603P	NM_001146337.1|NM_152406.2	NP_001139809.1|NP_689619.1	Q8TED9	AF1L1_HUMAN	actin filament associated protein 1-like 1	603						cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(10)|ovary(1)|pancreas(1)|skin(2)	26			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACGCCACGCCTCCAGTGAGTT	0.587																																						dbGAP											0													34.0	29.0	31.0					5																	148702277		2201	4295	6496	-	-	-	SO:0001583	missense	0			AK094067	CCDS34274.1, CCDS54932.1	5q33.1	2013-01-10			ENSG00000157510	ENSG00000157510		"""Pleckstrin homology (PH) domain containing"""	26714	protein-coding gene	gene with protein product		614410					Standard	NM_152406		Approved	FLJ36748	uc003lqh.3	Q8TED9	OTTHUMG00000163441	ENST00000296721.4:c.1807T>C	5.37:g.148702277T>C	ENSP00000296721:p.Ser603Pro		Q08AN4|Q08AN5|Q8IW82|Q8N8Z5|Q8N9Q4	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.S603P	ENST00000296721.4	37	c.1807	CCDS34274.1	5	.	.	.	.	.	.	.	.	.	.	T	25.7	4.663480	0.88251	.	.	ENSG00000157510	ENST00000296721;ENST00000515000	D;D	0.91740	-2.9;-2.9	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	D	0.95541	0.8551	M	0.73962	2.25	0.58432	D	0.999999	D;D	0.89917	1.0;0.998	D;D	0.80764	0.994;0.986	D	0.95876	0.8895	10	0.66056	D	0.02	-23.8507	14.9017	0.70684	0.0:0.0:0.0:1.0	.	603;603	Q8TED9-2;Q8TED9	.;AF1L1_HUMAN	P	603	ENSP00000296721:S603P;ENSP00000424427:S603P	ENSP00000296721:S603P	S	+	1	0	AFAP1L1	148682470	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	6.629000	0.74267	2.177000	0.69029	0.454000	0.30748	TCC	AFAP1L1	-	NULL	ENSG00000157510		0.587	AFAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFAP1L1	HGNC	protein_coding	OTTHUMT00000373443.1	21	0.00	0	T	NM_152406		148702277	148702277	+1	no_errors	ENST00000296721	ensembl	human	known	69_37n	missense	10	58.33	14	SNP	1.000	C
AGPAT4	56895	genome.wustl.edu	37	6	161575278	161575278	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr6:161575278A>G	ENST00000320285.4	-	4	625	c.413T>C	c.(412-414)tTc>tCc	p.F138S	AGPAT4_ENST00000366911.5_Silent_p.L81L|AGPAT4_ENST00000457520.2_Intron|AGPAT4_ENST00000366908.5_3'UTR|AGPAT4_ENST00000366906.5_Missense_Mutation_p.F76S	NM_020133.2	NP_064518.1	Q9NRZ5	PLCD_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 4	138					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)			endometrium(1)|large_intestine(10)|lung(10)|ovary(2)|skin(2)	25		Breast(66;0.000289)|Ovarian(120;0.0266)|Prostate(117;0.0285)		OV - Ovarian serous cystadenocarcinoma(65;2.23e-17)|BRCA - Breast invasive adenocarcinoma(81;3.58e-05)		CATCTCGGTGAAGTACCACAT	0.552																																						dbGAP											0													123.0	107.0	113.0					6																	161575278		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF156776	CCDS5280.1	6q25.3	2013-02-05	2013-02-05		ENSG00000026652	ENSG00000026652	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	20885	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, delta"""	614795	"""1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta)"""				Standard	XM_005267052		Approved	LPAAT-delta, dJ473J16.2	uc003qtr.1	Q9NRZ5	OTTHUMG00000015966	ENST00000320285.4:c.413T>C	6.37:g.161575278A>G	ENSP00000314036:p.Phe138Ser		B4DSF9|Q5TEF0	Missense_Mutation	SNP	pfam_Acyltransferase,smart_Acyltransferase	p.F138S	ENST00000320285.4	37	c.413	CCDS5280.1	6	.	.	.	.	.	.	.	.	.	.	A	24.9	4.579231	0.86645	.	.	ENSG00000026652	ENST00000320285;ENST00000366906	D;D	0.90844	-2.74;-2.74	4.25	4.25	0.50352	Phospholipid/glycerol acyltransferase (2);	0.000000	0.85682	D	0.000000	D	0.94032	0.8088	M	0.84326	2.69	0.80722	D	1	D;D	0.76494	0.999;0.959	D;P	0.72338	0.977;0.703	D	0.94357	0.7584	10	0.54805	T	0.06	-32.6733	13.5299	0.61615	1.0:0.0:0.0:0.0	.	138;138	B4DHC0;Q9NRZ5	.;PLCD_HUMAN	S	138;76	ENSP00000314036:F138S;ENSP00000355873:F76S	ENSP00000314036:F138S	F	-	2	0	AGPAT4	161495268	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	8.877000	0.92386	1.791000	0.52520	0.529000	0.55759	TTC	AGPAT4	-	pfam_Acyltransferase,smart_Acyltransferase	ENSG00000026652		0.552	AGPAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGPAT4	HGNC	protein_coding	OTTHUMT00000042983.1	39	0.00	0	A	NM_020133		161575278	161575278	-1	no_errors	ENST00000320285	ensembl	human	known	69_37n	missense	26	25.71	9	SNP	1.000	G
ARHGEF6	9459	genome.wustl.edu	37	X	135750295	135750295	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chrX:135750295C>T	ENST00000250617.6	-	22	3429	c.2224G>A	c.(2224-2226)Gaa>Aaa	p.E742K	ARHGEF6_ENST00000370620.1_Missense_Mutation_p.E588K|ARHGEF6_ENST00000535227.1_Missense_Mutation_p.E615K|ARHGEF6_ENST00000370622.1_Missense_Mutation_p.E588K	NM_004840.2	NP_004831.1	Q15052	ARHG6_HUMAN	Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6	742					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell junction assembly (GO:0034329)|JNK cascade (GO:0007254)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|intracellular (GO:0005622)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(1)|lung(14)|prostate(1)	38	Acute lymphoblastic leukemia(192;0.000127)					GATTTCAGTTCTTCTTCCAGG	0.458																																						dbGAP											0													241.0	196.0	212.0					X																	135750295		2203	4300	6503	-	-	-	SO:0001583	missense	0			D13631	CCDS14660.1	Xq26	2013-01-10	2002-05-23		ENSG00000129675	ENSG00000129675		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	685	protein-coding gene	gene with protein product	"""Rac/Cdc42 guanine exchange factor (GEF) 6"", ""PAK-interacting exchange factor, alpha"", ""rho guanine nucleotide exchange factor 6"""	300267	"""mental retardation, X-linked 46"""	MRX46		7584048, 9659915	Standard	NM_004840		Approved	alphaPIX, Cool-2, KIAA0006, alpha-PIX, Cool2	uc004fab.3	Q15052	OTTHUMG00000022518	ENST00000250617.6:c.2224G>A	X.37:g.135750295C>T	ENSP00000250617:p.Glu742Lys		A6NMW9|A8K6S7|B1AL37|Q15396|Q5JQ66|Q7Z3W1|Q86XH0	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_2,pfam_SH3_domain,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_DH-domain,superfamily_CH-domain,superfamily_SH3_domain,smart_CH-domain,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_CH-domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain,prints_SH3_domain,prints_SM22_calponin	p.E742K	ENST00000250617.6	37	c.2224	CCDS14660.1	X	.	.	.	.	.	.	.	.	.	.	C	24.9	4.586511	0.86851	.	.	ENSG00000129675	ENST00000250617;ENST00000370620;ENST00000370622;ENST00000535736;ENST00000535227	T;T;T;T	0.80824	-1.21;-1.02;-1.02;-1.42	5.49	5.49	0.81192	.	0.097992	0.64402	D	0.000001	D	0.84329	0.5448	M	0.80746	2.51	0.80722	D	1	B;B	0.31790	0.265;0.34	B;B	0.37480	0.2;0.251	D	0.85369	0.1112	10	0.87932	D	0	.	17.267	0.87089	0.0:1.0:0.0:0.0	.	615;742	B7Z3C7;Q15052	.;ARHG6_HUMAN	K	742;588;588;588;615	ENSP00000250617:E742K;ENSP00000359654:E588K;ENSP00000359656:E588K;ENSP00000439483:E615K	ENSP00000250617:E742K	E	-	1	0	ARHGEF6	135577961	1.000000	0.71417	0.998000	0.56505	0.934000	0.57294	7.063000	0.76714	2.288000	0.76882	0.513000	0.50165	GAA	ARHGEF6	-	NULL	ENSG00000129675		0.458	ARHGEF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF6	HGNC	protein_coding	OTTHUMT00000058511.2	150	0.00	0	C	NM_004840		135750295	135750295	-1	no_errors	ENST00000250617	ensembl	human	known	69_37n	missense	157	10.80	19	SNP	1.000	T
ARL6IP1	23204	genome.wustl.edu	37	16	18810156	18810156	+	Splice_Site	SNP	C	C	G			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr16:18810156C>G	ENST00000304414.7	-	2	248	c.37G>C	c.(37-39)Gct>Cct	p.A13P	ARL6IP1_ENST00000546206.2_5'UTR|RP11-1035H13.3_ENST00000567078.2_Splice_Site_p.A13P|ARL6IP1_ENST00000562819.1_Splice_Site_p.A13P	NM_015161.1	NP_055976.1	Q15041	AR6P1_HUMAN	ADP-ribosylation factor-like 6 interacting protein 1	13					cell death (GO:0008219)|cotranslational protein targeting to membrane (GO:0006613)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|Sec61 translocon complex (GO:0005784)				breast(1)|large_intestine(2)|lung(6)|pancreas(1)|prostate(1)	11						GTCTCTGCAGCCTAAATACCA	0.413																																						dbGAP											0													214.0	195.0	201.0					16																	18810156		2197	4300	6497	-	-	-	SO:0001630	splice_region_variant	0			BC010281	CCDS10572.1	16p12-p11.2	2014-03-12	2006-09-26	2006-09-26	ENSG00000170540	ENSG00000170540			697	protein-coding gene	gene with protein product		607669	"""ADP-ribosylation factor-like 6 interacting protein"""	ARL6IP		24482476	Standard	NM_015161		Approved	AIP1, ARMER, KIAA0069, SPG61	uc002dfl.1	Q15041	OTTHUMG00000131367	ENST00000304414.7:c.37-1G>C	16.37:g.18810156C>G				Missense_Mutation	SNP	pfam_Reticulon	p.A13P	ENST00000304414.7	37	c.37	CCDS10572.1	16	.	.	.	.	.	.	.	.	.	.	c	27.0	4.795468	0.90453	.	.	ENSG00000170540	ENST00000304414	.	.	.	4.5	4.5	0.54988	.	0.000000	0.85682	D	0.000000	T	0.71134	0.3304	L	0.59436	1.845	0.80722	D	1	D	0.67145	0.996	P	0.56788	0.806	T	0.71130	-0.4682	9	0.35671	T	0.21	-10.3472	17.1491	0.86773	0.0:1.0:0.0:0.0	.	13	Q15041	AR6P1_HUMAN	P	13	.	ENSP00000306788:A13P	A	-	1	0	ARL6IP1	18717657	1.000000	0.71417	1.000000	0.80357	0.696000	0.40369	7.818000	0.86416	2.198000	0.70561	0.563000	0.77884	GCT	ARL6IP1	-	NULL	ENSG00000170540		0.413	ARL6IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARL6IP1	HGNC	protein_coding	OTTHUMT00000254156.2	63	0.00	0	C	NM_015161	Missense_Mutation	18810156	18810156	-1	no_errors	ENST00000304414	ensembl	human	known	69_37n	missense	101	11.40	13	SNP	1.000	G
ATP10A	57194	genome.wustl.edu	37	15	25953412	25953412	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr15:25953412T>C	ENST00000356865.6	-	11	2491	c.2380A>G	c.(2380-2382)Agc>Ggc	p.S794G		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	794					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		TGAGTTTTGCTCCGAATCTTT	0.532																																						dbGAP											0													129.0	110.0	116.0					15																	25953412		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.2380A>G	15.37:g.25953412T>C	ENSP00000349325:p.Ser794Gly		Q4G0S9|Q969I4	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.S794G	ENST00000356865.6	37	c.2380	CCDS32178.1	15	.	.	.	.	.	.	.	.	.	.	T	12.58	1.980587	0.34942	.	.	ENSG00000206190	ENST00000356865	T	0.69926	-0.44	4.84	4.84	0.62591	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.327073	0.39615	N	0.001314	T	0.57504	0.2058	L	0.41824	1.3	0.24599	N	0.993783	B	0.29805	0.257	B	0.36030	0.216	T	0.50101	-0.8867	10	0.27082	T	0.32	-32.9458	9.0551	0.36401	0.0:0.0825:0.0:0.9175	.	794	O60312	AT10A_HUMAN	G	794	ENSP00000349325:S794G	ENSP00000349325:S794G	S	-	1	0	ATP10A	23504505	0.952000	0.32445	0.367000	0.25926	0.789000	0.44602	2.018000	0.40991	1.812000	0.52913	0.533000	0.62120	AGC	ATP10A	-	superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,tigrfam_ATPase_P-typ_Plipid-transl	ENSG00000206190		0.532	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10A	HGNC	protein_coding	OTTHUMT00000414830.1	57	0.00	0	T	NM_024490		25953412	25953412	-1	no_errors	ENST00000356865	ensembl	human	known	69_37n	missense	39	17.02	8	SNP	0.565	C
AUTS2	26053	genome.wustl.edu	37	7	69364341	69364341	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr7:69364341G>T	ENST00000342771.4	+	2	700	c.379G>T	c.(379-381)Gaa>Taa	p.E127*	AUTS2_ENST00000403018.2_Nonsense_Mutation_p.E127*|AUTS2_ENST00000406775.2_Nonsense_Mutation_p.E127*	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	127										breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		GAAGAAACGAGAAGCACTTAC	0.483																																						dbGAP											0													114.0	106.0	109.0					7																	69364341		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.379G>T	7.37:g.69364341G>T	ENSP00000344087:p.Glu127*		A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Nonsense_Mutation	SNP	prints_AUTS2	p.E127*	ENST00000342771.4	37	c.379	CCDS5539.1	7	.	.	.	.	.	.	.	.	.	.	G	38	7.184618	0.98121	.	.	ENSG00000158321	ENST00000406775;ENST00000342771;ENST00000403018	.	.	.	5.65	5.65	0.86999	.	0.000000	0.64402	D	0.000013	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-13.587	14.091	0.64990	0.071:0.0:0.929:0.0	.	.	.	.	X	127	.	.	E	+	1	0	AUTS2	69002277	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.605000	0.74155	2.941000	0.99782	0.655000	0.94253	GAA	AUTS2	-	NULL	ENSG00000158321		0.483	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AUTS2	HGNC	protein_coding	OTTHUMT00000251971.2	44	0.00	0	G			69364341	69364341	+1	no_errors	ENST00000342771	ensembl	human	known	69_37n	nonsense	39	30.36	17	SNP	1.000	T
AUTS2	26053	genome.wustl.edu	37	7	70252256	70252256	+	Silent	SNP	C	C	T			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr7:70252256C>T	ENST00000342771.4	+	18	2691	c.2370C>T	c.(2368-2370)caC>caT	p.H790H	AUTS2_ENST00000406775.2_Silent_p.H766H	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	790										breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		GCAACCCTCACGAACCCTGGA	0.597																																						dbGAP											0													61.0	50.0	54.0					7																	70252256		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.2370C>T	7.37:g.70252256C>T			A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Silent	SNP	prints_AUTS2	p.H790	ENST00000342771.4	37	c.2370	CCDS5539.1	7																																																																																			AUTS2	-	NULL	ENSG00000158321		0.597	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AUTS2	HGNC	protein_coding	OTTHUMT00000251971.2	32	0.00	0	C			70252256	70252256	+1	no_errors	ENST00000342771	ensembl	human	known	69_37n	silent	25	16.67	5	SNP	1.000	T
NUTM1	256646	genome.wustl.edu	37	15	34646055	34646055	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr15:34646055G>C	ENST00000333756.4	+	4	1128	c.973G>C	c.(973-975)Gag>Cag	p.E325Q	NUTM1_ENST00000537011.1_Missense_Mutation_p.E353Q|NUTM1_ENST00000438749.3_Missense_Mutation_p.E343Q	NM_175741.1	NP_786883	Q86Y26	NUTM1_HUMAN	NUT midline carcinoma, family member 1	325						cytoplasm (GO:0005737)|nucleus (GO:0005634)											CCTGGCCTCTGAGGTTTGCCA	0.537																																						dbGAP											0													84.0	82.0	83.0					15																	34646055		2201	4298	6499	-	-	-	SO:0001583	missense	0			AF482429	CCDS32190.1, CCDS61584.1, CCDS61585.1	15q14	2014-01-28	2013-03-14	2013-03-14	ENSG00000184507	ENSG00000184507			29919	protein-coding gene	gene with protein product	"""nuclear protein in testis"""	608963	"""chromosome 15 open reading frame 55"""	C15orf55		12543779	Standard	NM_175741		Approved	NUT, DKFZp434O192, FAM22H	uc001zif.3	Q86Y26	OTTHUMG00000172348	ENST00000333756.4:c.973G>C	15.37:g.34646055G>C	ENSP00000329448:p.Glu325Gln		B4DZ00|B7Z7Y4|E7EVE8|F5H4I6|Q86YS8|Q8N7F2|Q9NTB3	Missense_Mutation	SNP	NULL	p.E325Q	ENST00000333756.4	37	c.973	CCDS32190.1	15	.	.	.	.	.	.	.	.	.	.	G	18.78	3.697249	0.68386	.	.	ENSG00000184507	ENST00000537011;ENST00000438749;ENST00000333756	T;T;T	0.36699	1.24;1.24;1.24	5.49	5.49	0.81192	Nuclear Testis  protein, N-terminal (1);	0.249580	0.28414	N	0.015430	T	0.60209	0.2251	M	0.75264	2.295	0.37379	D	0.911964	D;D;D	0.89917	0.997;0.996;1.0	P;D;D	0.78314	0.898;0.919;0.991	T	0.66984	-0.5785	10	0.59425	D	0.04	.	14.8705	0.70453	0.0:0.0:1.0:0.0	.	343;353;325	E7EVE8;F5H4I6;Q86Y26	.;.;NUT_HUMAN	Q	353;343;325	ENSP00000444896:E353Q;ENSP00000407031:E343Q;ENSP00000329448:E325Q	ENSP00000329448:E325Q	E	+	1	0	C15orf55	32433347	1.000000	0.71417	0.998000	0.56505	0.877000	0.50540	4.888000	0.63164	2.571000	0.86741	0.557000	0.71058	GAG	C15orf55	-	NULL	ENSG00000184507		0.537	NUTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C15orf55	HGNC	protein_coding	OTTHUMT00000418026.1	40	0.00	0	G	NM_175741		34646055	34646055	+1	no_errors	ENST00000333756	ensembl	human	known	69_37n	missense	39	15.22	7	SNP	1.000	C
C20orf24	55969	genome.wustl.edu	37	20	35236207	35236207	+	Silent	SNP	C	C	T			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr20:35236207C>T	ENST00000373852.5	+	2	339	c.204C>T	c.(202-204)ttC>ttT	p.F68F	C20orf24_ENST00000342422.3_Silent_p.F68F|C20orf24_ENST00000344795.3_Silent_p.F68F|TGIF2-C20orf24_ENST00000558530.1_Silent_p.F94F			Q9BUV8	CT024_HUMAN	chromosome 20 open reading frame 24	68										breast(1)|kidney(1)|lung(2)	4	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)				TACGAGGGTTCTTGGGAATAG	0.403																																						dbGAP											0													160.0	147.0	151.0					20																	35236207		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF112213	CCDS13279.1, CCDS13280.1, CCDS56190.1	20q11.23	2011-01-25			ENSG00000101084	ENSG00000101084			15870	protein-coding gene	gene with protein product						15178406	Standard	NM_018840		Approved	PNAS-11, RIP5		Q9BUV8	OTTHUMG00000032384	ENST00000373852.5:c.204C>T	20.37:g.35236207C>T			E1P5U0|O00605|Q5QPG6|Q5QPG7|Q9BT03|Q9BZU7|Q9UI05	Silent	SNP	NULL	p.F68	ENST00000373852.5	37	c.204	CCDS56190.1	20																																																																																			C20orf24	-	NULL	ENSG00000101084		0.403	C20orf24-001	KNOWN	basic|CCDS	protein_coding	C20orf24	HGNC	protein_coding	OTTHUMT00000079006.1	133	0.00	0	C	NM_018840		35236207	35236207	+1	no_errors	ENST00000373852	ensembl	human	known	69_37n	silent	207	14.46	35	SNP	1.000	T
CR1	1378	genome.wustl.edu	37	1	207791576	207791576	+	Silent	SNP	G	G	A			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr1:207791576G>A	ENST00000367049.4	+	42	7050	c.7050G>A	c.(7048-7050)ttG>ttA	p.L2350L	CR1_ENST00000400960.2_Silent_p.L1900L|CR1_ENST00000367052.1_Silent_p.L1900L|CR1_ENST00000367053.1_Silent_p.L1900L|CR1_ENST00000367051.1_Silent_p.L1900L	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1900					complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						GGAGCCAATTGGATCATTATT	0.438																																						dbGAP											0													237.0	223.0	228.0					1																	207791576		1915	4127	6042	-	-	-	SO:0001819	synonymous_variant	0			Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.7050G>A	1.37:g.207791576G>A			Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Nonsense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.W523*	ENST00000367049.4	37	c.1568	CCDS44308.1	1	.	.	.	.	.	.	.	.	.	.	G	8.643	0.896382	0.17686	.	.	ENSG00000203710	ENST00000529814	.	.	.	4.19	-1.28	0.09318	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.6916	0.12783	0.0:0.2678:0.4124:0.3198	.	.	.	.	X	523	.	.	W	+	2	0	CR1	205858199	0.000000	0.05858	0.000000	0.03702	0.697000	0.40408	-0.329000	0.07935	-0.214000	0.10078	-0.457000	0.05445	TGG	CR1	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000203710		0.438	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	CR1	HGNC	protein_coding	OTTHUMT00000382527.1	89	0.00	0	G	NM_000573		207791576	207791576	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000529814	ensembl	human	novel	69_37n	nonsense	108	10.74	13	SNP	0.000	A
CTSB	1508	genome.wustl.edu	37	8	11704610	11704610	+	Frame_Shift_Del	DEL	G	G	-	rs577703408		TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr8:11704610delG	ENST00000353047.6	-	8	997	c.744delC	c.(742-744)cccfs	p.P248fs	CTSB_ENST00000534510.1_Frame_Shift_Del_p.P248fs|CTSB_ENST00000453527.2_Frame_Shift_Del_p.P248fs|CTSB_ENST00000345125.3_Frame_Shift_Del_p.P248fs|CTSB_ENST00000531089.1_Frame_Shift_Del_p.P248fs|RP11-589N15.2_ENST00000602711.1_RNA|CTSB_ENST00000530640.2_Frame_Shift_Del_p.P248fs|CTSB_ENST00000533455.1_Frame_Shift_Del_p.P248fs|CTSB_ENST00000415599.2_3'UTR|CTSB_ENST00000434271.1_Frame_Shift_Del_p.P248fs|CTSB_ENST00000525076.1_5'Flank	NM_001908.3	NP_001899.1	P07858	CATB_HUMAN	cathepsin B	248					cellular response to thyroid hormone stimulus (GO:0097067)|collagen catabolic process (GO:0030574)|decidualization (GO:0046697)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of apoptotic process (GO:0042981)|regulation of catalytic activity (GO:0050790)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|perinuclear region of cytoplasm (GO:0048471)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|peptidase activity (GO:0008233)|proteoglycan binding (GO:0043394)	p.P248P(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(1)	16	all_epithelial(15;0.205)		STAD - Stomach adenocarcinoma(15;0.00546)	COAD - Colon adenocarcinoma(149;0.184)		CTCCCTCCACGGGGCCGTTTT	0.562																																						dbGAP											1	Substitution - coding silent(1)	endometrium(1)											87.0	82.0	84.0					8																	11704610		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			M14221	CCDS5986.1	8p23.1	2012-10-02			ENSG00000164733	ENSG00000164733	3.4.22.1	"""Cathepsins"""	2527	protein-coding gene	gene with protein product		116810				8112600, 3463996	Standard	XM_006716244		Approved		uc003wuq.3	P07858	OTTHUMG00000090799	ENST00000353047.6:c.744delC	8.37:g.11704610delG	ENSP00000345672:p.Pro248fs		B3KQR5|B3KRR5|Q503A6|Q96D87	Frame_Shift_Del	DEL	pfam_Peptidase_C1A_C,pfam_Propeptide_C1A,smart_Peptidase_C1A_C,prints_Peptidase_C1A_C	p.V249fs	ENST00000353047.6	37	c.744	CCDS5986.1	8																																																																																			CTSB	-	pfam_Peptidase_C1A_C,smart_Peptidase_C1A_C	ENSG00000164733		0.562	CTSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTSB	HGNC	protein_coding	OTTHUMT00000207586.3	35	0.00	0	G	NM_147780		11704610	11704610	-1	no_errors	ENST00000353047	ensembl	human	known	69_37n	frame_shift_del	47	12.96	7	DEL	0.016	-
CUL7	9820	genome.wustl.edu	37	6	43019030	43019030	+	Silent	SNP	C	C	G			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr6:43019030C>G	ENST00000265348.3	-	4	994	c.909G>C	c.(907-909)ctG>ctC	p.L303L	CUL7_ENST00000535468.1_Silent_p.L387L			Q14999	CUL7_HUMAN	cullin 7	303					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial to mesenchymal transition (GO:0001837)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|mitotic cytokinesis (GO:0000281)|placenta development (GO:0001890)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	3M complex (GO:1990393)|anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|Cul7-RING ubiquitin ligase complex (GO:0031467)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(8)|liver(1)|lung(11)|ovary(3)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	49			all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			GCTCCGAGATCAGGGTGCCCA	0.632																																						dbGAP											0													63.0	66.0	65.0					6																	43019030		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC033647	CCDS4881.1, CCDS55003.1	6p21.1	2011-05-24	2004-03-22	2004-03-22	ENSG00000044090	ENSG00000044090			21024	protein-coding gene	gene with protein product		609577	"""KIAA0076"""	KIAA0076		12481031, 12904573	Standard	NM_014780		Approved	dJ20C7.5	uc011dvb.2	Q14999	OTTHUMG00000014718	ENST00000265348.3:c.909G>C	6.37:g.43019030C>G			B4DYZ0|F5H0L1|Q5T654	Silent	SNP	pfam_Cullin_N,pfam_CPH_domain,pfam_APC_su10/DOC_dom,superfamily_Galactose-bd-like,superfamily_Cullin_homology,superfamily_ARM-type_fold,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.L387	ENST00000265348.3	37	c.1161	CCDS4881.1	6																																																																																			CUL7	-	NULL	ENSG00000044090		0.632	CUL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL7	HGNC	protein_coding	OTTHUMT00000040575.1	22	0.00	0	C	NM_014780		43019030	43019030	-1	no_errors	ENST00000535468	ensembl	human	known	69_37n	silent	19	20.83	5	SNP	1.000	G
CXorf22	170063	genome.wustl.edu	37	X	35989890	35989890	+	Splice_Site	SNP	G	G	C			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chrX:35989890G>C	ENST00000297866.5	+	12	2223		c.e12+1			NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22											breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						GAGAAGAAAGGCACGTGCAAT	0.368																																						dbGAP											0													53.0	48.0	50.0					X																	35989890		2202	4300	6502	-	-	-	SO:0001630	splice_region_variant	0			BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.2157+1G>C	X.37:g.35989890G>C			Q5JRM8|Q8N6X8	Splice_Site	SNP	-	e12+1	ENST00000297866.5	37	c.2157+1	CCDS14237.2	X	.	.	.	.	.	.	.	.	.	.	G	10.73	1.432186	0.25813	.	.	ENSG00000165164	ENST00000297866	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3564	0.66740	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CXorf22	35899811	1.000000	0.71417	0.988000	0.46212	0.021000	0.10359	5.483000	0.66838	2.467000	0.83353	0.600000	0.82982	.	CXorf22	-	-	ENSG00000165164		0.368	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf22	HGNC	protein_coding	OTTHUMT00000056216.2	23	0.00	0	G	NM_152632	Intron	35989890	35989890	+1	no_errors	ENST00000297866	ensembl	human	known	69_37n	splice_site	21	15.38	4	SNP	0.996	C
CYP24A1	1591	genome.wustl.edu	37	20	52786155	52786155	+	Nonsense_Mutation	SNP	C	C	A	rs115260488	byFrequency	TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr20:52786155C>A	ENST00000216862.3	-	4	1009	c.616G>T	c.(616-618)Gaa>Taa	p.E206*	CYP24A1_ENST00000395954.3_Nonsense_Mutation_p.E64*|CYP24A1_ENST00000395955.3_Nonsense_Mutation_p.E206*	NM_000782.4	NP_000773.2	Q07973	CP24A_HUMAN	cytochrome P450, family 24, subfamily A, polypeptide 1	206					osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|response to vitamin D (GO:0033280)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D catabolic process (GO:0042369)|vitamin D metabolic process (GO:0042359)|vitamin D receptor signaling pathway (GO:0070561)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)	1-alpha,25-dihydroxyvitamin D3 24-hydroxylase activity (GO:0030342)|25-hydroxycholecalciferol-24-hydroxylase activity (GO:0008403)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)			breast(2)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Lung NSC(4;1.08e-05)|all_lung(4;2.7e-05)		STAD - Stomach adenocarcinoma(23;0.206)		Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Corticotropin(DB01285)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	TTGTTCAGTTCGCTGTACAAG	0.428																																						dbGAP											0													144.0	117.0	126.0					20																	52786155		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U60669	CCDS33491.1, CCDS46616.1	20q13.2-q13.3	2003-02-28	2003-02-14	2003-02-28	ENSG00000019186	ENSG00000019186		"""Cytochrome P450s"""	2602	protein-coding gene	gene with protein product		126065	"""cytochrome P450, subfamily XXIV (vitamin D 24-hydroxylase)"""	CYP24			Standard	NM_000782		Approved	CP24, P450-CC24	uc002xwv.2	Q07973	OTTHUMG00000032773	ENST00000216862.3:c.616G>T	20.37:g.52786155C>A	ENSP00000216862:p.Glu206*		Q15807|Q32ML3|Q5I2W7	Nonsense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_CYP24A_mit,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450	p.E206*	ENST00000216862.3	37	c.616	CCDS33491.1	20	.	.	.	.	.	.	.	.	.	.	C	38	6.897957	0.97920	.	.	ENSG00000019186	ENST00000216862;ENST00000395955;ENST00000395954	.	.	.	5.63	4.67	0.58626	.	0.185014	0.49305	D	0.000144	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-2.2657	13.5139	0.61528	0.0:0.8435:0.1565:0.0	.	.	.	.	X	206;206;64	.	ENSP00000216862:E206X	E	-	1	0	CYP24A1	52219562	1.000000	0.71417	0.412000	0.26496	0.962000	0.63368	5.715000	0.68430	1.337000	0.45525	0.563000	0.77884	GAA	CYP24A1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000019186		0.428	CYP24A1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP24A1	HGNC	protein_coding	OTTHUMT00000079769.2	40	0.00	0	C			52786155	52786155	-1	no_errors	ENST00000216862	ensembl	human	known	69_37n	nonsense	63	12.50	9	SNP	0.986	A
DENND5A	23258	genome.wustl.edu	37	11	9202357	9202357	+	Missense_Mutation	SNP	C	C	T	rs200439974		TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr11:9202357C>T	ENST00000328194.3	-	6	1732	c.1412G>A	c.(1411-1413)cGg>cAg	p.R471Q	DENND5A_ENST00000526523.1_5'Flank|DENND5A_ENST00000530044.1_Missense_Mutation_p.R471Q	NM_001243254.1|NM_015213.3	NP_001230183.1|NP_056028.2	Q6IQ26	DEN5A_HUMAN	DENN/MADD domain containing 5A	471					positive regulation of Rab GTPase activity (GO:0032851)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(7)|kidney(2)|large_intestine(8)|liver(1)|lung(16)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						GGCTTGCAGCCGGGCAATAGT	0.522													C|||	1	0.000199681	0.0	0.0	5008	,	,		19797	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													121.0	129.0	126.0					11																	9202357		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB029014	CCDS31423.1, CCDS58119.1	11p15.3	2012-10-03	2008-08-14	2008-08-14	ENSG00000184014	ENSG00000184014		"""DENN/MADD domain containing"""	19344	protein-coding gene	gene with protein product			"""RAB6 interacting protein 1"""	RAB6IP1		10470851	Standard	NM_015213		Approved	KIAA1091, FLJ22354, FLJ33829, FLJ43455	uc001mhl.3	Q6IQ26	OTTHUMG00000165716	ENST00000328194.3:c.1412G>A	11.37:g.9202357C>T	ENSP00000328524:p.Arg471Gln		B4DJ15|E9PS91|Q96GN3|Q9H6U7|Q9UFV0|Q9UPR1	Missense_Mutation	SNP	pfam_DENN_dom,pfam_Run,pfam_uDENN_dom,pfam_dDENN_dom,pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,smart_Run,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom,pfscan_LipOase_LH2,pfscan_Run	p.R471Q	ENST00000328194.3	37	c.1412	CCDS31423.1	11	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	33	5.238797	0.95240	.	.	ENSG00000184014	ENST00000328194;ENST00000530044	T;T	0.66638	-0.22;-0.22	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.81059	0.4744	M	0.68593	2.085	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.96;0.998	T	0.81022	-0.1121	10	0.48119	T	0.1	.	18.9318	0.92570	0.0:1.0:0.0:0.0	.	471;471	E9PS91;Q6IQ26	.;DEN5A_HUMAN	Q	471	ENSP00000328524:R471Q;ENSP00000435866:R471Q	ENSP00000328524:R471Q	R	-	2	0	DENND5A	9158933	1.000000	0.71417	0.997000	0.53966	0.921000	0.55340	7.442000	0.80503	2.537000	0.85549	0.552000	0.68991	CGG	DENND5A	-	NULL	ENSG00000184014		0.522	DENND5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND5A	HGNC	protein_coding	OTTHUMT00000385910.2	22	0.00	0	C	NM_015213		9202357	9202357	-1	no_errors	ENST00000328194	ensembl	human	known	69_37n	missense	10	44.44	8	SNP	1.000	T
DIP2B	57609	genome.wustl.edu	37	12	51108327	51108327	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr12:51108327G>C	ENST00000301180.5	+	23	2833	c.2799G>C	c.(2797-2799)atG>atC	p.M933I		NM_173602.2	NP_775873.2	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B (Drosophila)	933						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(15)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	60						ACATCCTCATGTGCCCCCATA	0.458																																						dbGAP											0													124.0	113.0	117.0					12																	51108327		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB040896	CCDS31799.1	12q13.12	2012-10-02	2006-01-13		ENSG00000066084	ENSG00000066084			29284	protein-coding gene	gene with protein product		611379					Standard	XM_005269044		Approved	KIAA1463, FLJ34278	uc001rwv.3	Q9P265	OTTHUMG00000169475	ENST00000301180.5:c.2799G>C	12.37:g.51108327G>C	ENSP00000301180:p.Met933Ile		Q6B011|Q8N1L5|Q8NB38	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.M933I	ENST00000301180.5	37	c.2799	CCDS31799.1	12	.	.	.	.	.	.	.	.	.	.	G	20.2	3.953261	0.73902	.	.	ENSG00000066084	ENST00000301180	T	0.40476	1.03	5.32	5.32	0.75619	.	0.036228	0.85682	D	0.000000	T	0.48537	0.1505	M	0.84511	2.7	0.80722	D	1	P	0.35226	0.491	B	0.27500	0.08	T	0.55509	-0.8130	10	0.46703	T	0.11	-26.2673	18.5538	0.91075	0.0:0.0:1.0:0.0	.	933	Q9P265	DIP2B_HUMAN	I	933	ENSP00000301180:M933I	ENSP00000301180:M933I	M	+	3	0	DIP2B	49394594	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.657000	0.98554	2.941000	0.99782	0.655000	0.94253	ATG	DIP2B	-	NULL	ENSG00000066084		0.458	DIP2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DIP2B	HGNC	protein_coding	OTTHUMT00000404243.1	60	0.00	0	G	NM_173602		51108327	51108327	+1	no_errors	ENST00000301180	ensembl	human	known	69_37n	missense	66	12.99	10	SNP	1.000	C
DMD	1756	genome.wustl.edu	37	X	32716093	32716093	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chrX:32716093C>A	ENST00000357033.4	-	9	1060	c.854G>T	c.(853-855)gGa>gTa	p.G285V	DMD_ENST00000288447.4_Missense_Mutation_p.G277V|DMD_ENST00000378677.2_Missense_Mutation_p.G281V	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	285					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TCTCTCATATCCCTGTGCTAG	0.507																																						dbGAP											0													132.0	93.0	106.0					X																	32716093		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.854G>T	X.37:g.32716093C>A	ENSP00000354923:p.Gly285Val		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.G285V	ENST00000357033.4	37	c.854	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	C	13.53	2.265452	0.40095	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280;ENST00000288447	T;T;T	0.72942	0.1;0.09;-0.7	5.63	4.76	0.60689	.	.	.	.	.	T	0.72120	0.3421	L	0.48642	1.525	0.80722	D	1	D;P;B;P	0.57899	0.981;0.95;0.083;0.917	P;P;B;P	0.52758	0.708;0.698;0.03;0.502	T	0.72337	-0.4324	9	0.42905	T	0.14	.	13.0852	0.59135	0.0:0.9212:0.0:0.0788	.	277;277;285;281	Q4G0X0;P11532-4;P11532;E9PDN5	.;.;DMD_HUMAN;.	V	277;281;285;285;162;277	ENSP00000367948:G281V;ENSP00000354923:G285V;ENSP00000288447:G277V	ENSP00000288447:G277V	G	-	2	0	DMD	32626014	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	5.422000	0.66453	2.358000	0.79984	0.538000	0.68166	GGA	DMD	-	pirsf_Dystrophin/utrophin	ENSG00000198947		0.507	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	79	0.00	0	C	NM_004006		32716093	32716093	-1	no_errors	ENST00000357033	ensembl	human	known	69_37n	missense	67	13.92	11	SNP	1.000	A
EXT2	2132	genome.wustl.edu	37	11	44130752	44130752	+	Missense_Mutation	SNP	G	G	A	rs563383543	byFrequency	TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr11:44130752G>A	ENST00000343631.3	+	3	674	c.545G>A	c.(544-546)cGa>cAa	p.R182Q	EXT2_ENST00000533608.1_Missense_Mutation_p.R182Q|EXT2_ENST00000395673.3_Missense_Mutation_p.R215Q|EXT2_ENST00000358681.4_Missense_Mutation_p.R182Q|EXT2_ENST00000529186.1_3'UTR			Q93063	EXT2_HUMAN	exostosin glycosyltransferase 2	182					carbohydrate metabolic process (GO:0005975)|cell differentiation (GO:0030154)|cellular polysaccharide biosynthetic process (GO:0033692)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|mesoderm formation (GO:0001707)|ossification (GO:0001503)|protein glycosylation (GO:0006486)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|membrane (GO:0016020)	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)|glucuronosyltransferase activity (GO:0015020)|heparan sulfate N-acetylglucosaminyltransferase activity (GO:0042328)|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity (GO:0050509)|protein heterodimerization activity (GO:0046982)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|lung(17)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	32						AGGTGGGATCGAGGTACGAAT	0.443			"""Mis, N, F, S"""			"""exostoses, osteosarcoma"""			Hereditary Multiple Exostoses																													dbGAP	yes	Rec		Multiple Exostoses Type 2	11	11p12-p11	2132	multiple exostoses type 2 gene		M	0													106.0	105.0	105.0					11																	44130752		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	HME, Hereditary Exostoses, Multiple Osteochondromatosis, Multiple Cartilaginous Exostoses		CCDS7908.1, CCDS53618.1, CCDS53619.1	11p12-p11	2014-09-17	2013-03-01		ENSG00000151348	ENSG00000151348	2.4.1.224, 2.4.1.225	"""Exostosin glycosyltransferase family"""	3513	protein-coding gene	gene with protein product	"""Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase"""	608210	"""exostoses (multiple) 2"", ""exostosin 2"""			8162019, 9576285	Standard	NM_000401		Approved	SOTV	uc001mya.3	Q93063	OTTHUMG00000166498	ENST00000343631.3:c.545G>A	11.37:g.44130752G>A	ENSP00000342656:p.Arg182Gln		B2R5Z6|C9JU51|J3KPT2|O15288	Missense_Mutation	SNP	pfam_HexNAc_Trfase_a,pfam_Exostosin	p.R215Q	ENST00000343631.3	37	c.644	CCDS7908.1	11	.	.	.	.	.	.	.	.	.	.	G	15.73	2.920621	0.52653	.	.	ENSG00000151348	ENST00000533608;ENST00000358681;ENST00000395673;ENST00000343631	D;D;D;D	0.98381	-4.9;-4.9;-4.9;-4.9	5.48	5.48	0.80851	.	0.128841	0.52532	D	0.000073	D	0.95934	0.8676	L	0.38175	1.15	0.58432	D	0.999991	B;B;B;B;B	0.26708	0.048;0.153;0.126;0.157;0.157	B;B;B;B;B	0.21360	0.016;0.034;0.02;0.034;0.034	D	0.94117	0.7376	10	0.23302	T	0.38	3.7097	19.3624	0.94446	0.0:0.0:1.0:0.0	.	182;182;182;182;195	Q6NUL1;C9JU51;Q93063-2;Q93063;D3DR24	.;.;.;EXT2_HUMAN;.	Q	182;182;215;182	ENSP00000431173:R182Q;ENSP00000351509:R182Q;ENSP00000379032:R215Q;ENSP00000342656:R182Q	ENSP00000342656:R182Q	R	+	2	0	EXT2	44087328	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.232000	0.58645	2.567000	0.86603	0.655000	0.94253	CGA	EXT2	-	pfam_Exostosin	ENSG00000151348		0.443	EXT2-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	EXT2	HGNC	protein_coding	OTTHUMT00000390074.1	68	0.00	0	G	NM_000401		44130752	44130752	+1	no_errors	ENST00000395673	ensembl	human	known	69_37n	missense	52	11.86	7	SNP	1.000	A
FBXW8	26259	genome.wustl.edu	37	12	117426610	117426610	+	Missense_Mutation	SNP	A	A	C			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr12:117426610A>C	ENST00000309909.5	+	7	1257	c.1175A>C	c.(1174-1176)gAc>gCc	p.D392A	FBXW8_ENST00000455858.2_Missense_Mutation_p.D326A|RP11-231I16.1_ENST00000548738.1_RNA			Q8N3Y1	FBXW8_HUMAN	F-box and WD repeat domain containing 8	392					cell proliferation (GO:0008283)|Golgi organization (GO:0007030)|labyrinthine layer blood vessel development (GO:0060716)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|spongiotrophoblast layer development (GO:0060712)	Cul7-RING ubiquitin ligase complex (GO:0031467)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|SCF ubiquitin ligase complex (GO:0019005)				endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	22	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0353)		ACATGTCTAGACGTCTCGGCC	0.517																																						dbGAP											0													99.0	101.0	100.0					12																	117426610		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF176707	CCDS9182.1, CCDS44988.1	12q24.23	2013-01-09	2007-02-08	2003-06-13				"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13597	protein-coding gene	gene with protein product		609073	"""F-box only protein 29"", ""F-box and WD-40 domain protein 8"""	FBXO29		10531035, 10531037	Standard	NM_012174		Approved	FBX29, FBW6, FBW8	uc001twg.1	Q8N3Y1	OTTHUMG00000169329	ENST00000309909.5:c.1175A>C	12.37:g.117426610A>C	ENSP00000310686:p.Asp392Ala		Q9UK95	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_F-box_dom_cyclin-like,superfamily_Quinonprotein_ADH-like,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_WD40_repeat,pfscan_F-box_dom_cyclin-like,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D392A	ENST00000309909.5	37	c.1175	CCDS9182.1	12	.	.	.	.	.	.	.	.	.	.	A	24.3	4.516721	0.85495	.	.	ENSG00000174989	ENST00000309909;ENST00000455858;ENST00000505227	T;T	0.03689	3.84;3.84	5.9	5.9	0.94986	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);	0.000000	0.85682	D	0.000000	T	0.18676	0.0448	M	0.76002	2.32	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.984	T	0.00080	-1.2109	10	0.66056	D	0.02	-22.5875	16.3317	0.83023	1.0:0.0:0.0:0.0	.	392;326	Q8N3Y1;Q8N3Y1-2	FBXW8_HUMAN;.	A	392;326;326	ENSP00000310686:D392A;ENSP00000389144:D326A	ENSP00000310686:D392A	D	+	2	0	FBXW8	115910993	1.000000	0.71417	0.971000	0.41717	0.833000	0.47200	6.314000	0.72848	2.264000	0.75181	0.533000	0.62120	GAC	FBXW8	-	pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like	ENSG00000174989		0.517	FBXW8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW8	HGNC	protein_coding	OTTHUMT00000403561.1	33	0.00	0	A	NM_012174		117426610	117426610	+1	no_errors	ENST00000309909	ensembl	human	known	69_37n	missense	22	21.43	6	SNP	1.000	C
FGG	2266	genome.wustl.edu	37	4	155533233	155533233	+	Nonsense_Mutation	SNP	C	C	A			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr4:155533233C>A	ENST00000336098.3	-	3	282	c.244G>T	c.(244-246)Gaa>Taa	p.E82*	FGG_ENST00000407946.1_Nonsense_Mutation_p.E82*|FGG_ENST00000404648.3_Nonsense_Mutation_p.E82*|FGG_ENST00000405164.1_Nonsense_Mutation_p.E82*	NM_021870.2	NP_068656.2	P02679	FIBG_HUMAN	fibrinogen gamma chain	82					blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(9)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	TGTTTGACTTCTGATGTTTTG	0.338																																						dbGAP											0													177.0	161.0	167.0					4																	155533233		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS3788.1, CCDS47153.1	4q28	2014-09-17			ENSG00000171557	ENSG00000171557		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3694	protein-coding gene	gene with protein product		134850	"""fibrinogen, gamma polypeptide"""				Standard	NM_000509		Approved		uc003ioj.3	P02679	OTTHUMG00000150329	ENST00000336098.3:c.244G>T	4.37:g.155533233C>A	ENSP00000336829:p.Glu82*		A8K057|P04469|P04470|Q53Y18|Q96A14|Q96KJ3|Q9UC62|Q9UC63|Q9UCF3	Nonsense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C,pfam_Fibrinogen_a/b/g_coil_dom,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	p.E82*	ENST00000336098.3	37	c.244	CCDS3788.1	4	.	.	.	.	.	.	.	.	.	.	C	16.48	3.134782	0.56828	.	.	ENSG00000171557	ENST00000404648;ENST00000405164;ENST00000336098;ENST00000407946	.	.	.	6.17	6.17	0.99709	.	0.243029	0.47852	D	0.000214	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	.	9.913	0.41417	0.198:0.7336:0.0:0.0684	.	.	.	.	X	82	.	ENSP00000336829:E82X	E	-	1	0	FGG	155752683	0.929000	0.31497	0.998000	0.56505	0.325000	0.28411	1.823000	0.39062	2.941000	0.99782	0.655000	0.94253	GAA	FGG	-	pfam_Fibrinogen_a/b/g_coil_dom	ENSG00000171557		0.338	FGG-002	KNOWN	basic|CCDS	protein_coding	FGG	HGNC	protein_coding	OTTHUMT00000317581.1	184	0.00	0	C	NM_021870		155533233	155533233	-1	no_errors	ENST00000336098	ensembl	human	known	69_37n	nonsense	202	17.55	43	SNP	0.967	A
FOXP1	27086	genome.wustl.edu	37	3	71027086	71027087	+	Frame_Shift_Del	DEL	AG	AG	-	rs534691598|rs79651000		TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr3:71027086_71027087delAG	ENST00000318789.4	-	15	1765_1766	c.1240_1241delCT	c.(1240-1242)ctgfs	p.L414fs	FOXP1_ENST00000491238.1_Frame_Shift_Del_p.L416fs|FOXP1_ENST00000493089.1_Frame_Shift_Del_p.L414fs|FOXP1_ENST00000475937.1_Frame_Shift_Del_p.L414fs|FOXP1_ENST00000484350.1_Frame_Shift_Del_p.L338fs|FOXP1_ENST00000468577.1_Frame_Shift_Del_p.L414fs|FOXP1_ENST00000498215.1_Frame_Shift_Del_p.L414fs	NM_001244810.1|NM_001244813.1|NM_032682.5	NP_001231739.1|NP_001231742.1|NP_116071.2	Q9H334	FOXP1_HUMAN	forkhead box P1	414					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)		GACGGGAGTCAGGGGGGCGGTT	0.569			T	PAX5	ALL																																	dbGAP		Dom	yes		3	3p14.1	27086	forkhead box P1		L	0																																										-	-	-	SO:0001589	frameshift_variant	0			AF146696	CCDS2914.1, CCDS33785.1, CCDS58837.1, CCDS58838.1, CCDS58839.1, CCDS74963.1, CCDS74964.1	3p14.1	2008-07-18			ENSG00000114861	ENSG00000114861		"""Forkhead boxes"""	3823	protein-coding gene	gene with protein product	"""fork head-related protein like B"", ""glutamine-rich factor 1"", ""PAX5/FOXP1 fusion protein"""	605515				8265594, 11751404	Standard	NM_032682		Approved	QRF1, 12CC4, HSPC215, hFKH1B	uc003doj.3	Q9H334	OTTHUMG00000158803	ENST00000318789.4:c.1240_1241delCT	3.37:g.71027086_71027087delAG	ENSP00000318902:p.Leu414fs		A3QVP8|B3KV70|G5E9V8|Q8NAN6|Q9BSG9|Q9H332|Q9H333|Q9P0R1	Frame_Shift_Del	DEL	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.L414fs	ENST00000318789.4	37	c.1241_1240	CCDS2914.1	3																																																																																			FOXP1	-	NULL	ENSG00000114861		0.569	FOXP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FOXP1	HGNC	protein_coding	OTTHUMT00000352250.1	89	0.00	0	AG	NM_032682		71027086	71027087	-1	no_errors	ENST00000318789	ensembl	human	known	69_37n	frame_shift_del	42	26.47	18	DEL	1.000:1.000	-
GLP2R	9340	genome.wustl.edu	37	17	9774137	9774137	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr17:9774137G>C	ENST00000262441.5	+	10	1643	c.1130G>C	c.(1129-1131)aGa>aCa	p.R377T	GLP2R_ENST00000574745.1_Missense_Mutation_p.R197T	NM_004246.1	NP_004237.1	O95838	GLP2R_HUMAN	glucagon-like peptide 2 receptor	377					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|positive regulation of cell proliferation (GO:0008284)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|glucagon receptor activity (GO:0004967)			endometrium(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	44					Glucagon recombinant(DB00040)|Teduglutide(DB08900)	ATGTGCTTCAGAGATTATAAA	0.413																																						dbGAP											0													129.0	139.0	135.0					17																	9774137		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF105367	CCDS11150.1	17p13.3	2012-08-10			ENSG00000065325	ENSG00000065325		"""GPCR / Class B : Glucagon receptors"""	4325	protein-coding gene	gene with protein product		603659				9990065	Standard	NM_004246		Approved		uc002gmd.1	O95838	OTTHUMG00000130269	ENST00000262441.5:c.1130G>C	17.37:g.9774137G>C	ENSP00000262441:p.Arg377Thr		Q4VAT3	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.R377T	ENST00000262441.5	37	c.1130	CCDS11150.1	17	.	.	.	.	.	.	.	.	.	.	G	9.915	1.210507	0.22289	.	.	ENSG00000065325	ENST00000396206;ENST00000262441	T	0.36699	1.24	6.11	3.09	0.35607	GPCR, family 2-like (1);	0.194086	0.26428	N	0.024430	T	0.13072	0.0317	N	0.03224	-0.385	0.25939	N	0.982892	B	0.11235	0.004	B	0.12156	0.007	T	0.34004	-0.9846	10	0.02654	T	1	.	8.9888	0.36010	0.2295:0.0:0.7705:0.0	.	377	O95838	GLP2R_HUMAN	T	377	ENSP00000262441:R377T	ENSP00000262441:R377T	R	+	2	0	GLP2R	9714862	1.000000	0.71417	1.000000	0.80357	0.748000	0.42578	1.295000	0.33377	0.471000	0.27319	0.655000	0.94253	AGA	GLP2R	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like	ENSG00000065325		0.413	GLP2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLP2R	HGNC	protein_coding	OTTHUMT00000252601.4	104	0.00	0	G			9774137	9774137	+1	no_errors	ENST00000262441	ensembl	human	known	69_37n	missense	52	26.76	19	SNP	1.000	C
HELZ	9931	genome.wustl.edu	37	17	65074605	65074605	+	Silent	SNP	G	G	A			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr17:65074605G>A	ENST00000358691.5	-	33	5758	c.5592C>T	c.(5590-5592)ggC>ggT	p.G1864G	HELZ_ENST00000580168.1_Silent_p.G1865G	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	1864						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					GTGGAAACTGGCCAAGATGCT	0.577																																						dbGAP											0													191.0	190.0	191.0					17																	65074605		2005	4177	6182	-	-	-	SO:0001819	synonymous_variant	0			D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.5592C>T	17.37:g.65074605G>A			I6L9H4	Silent	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.G1864	ENST00000358691.5	37	c.5592	CCDS42374.1	17																																																																																			HELZ	-	NULL	ENSG00000198265		0.577	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HELZ	HGNC	protein_coding	OTTHUMT00000447068.1	21	0.00	0	G	NM_014877		65074605	65074605	-1	no_errors	ENST00000358691	ensembl	human	known	69_37n	silent	17	22.73	5	SNP	1.000	A
IGKV1D-17	28900	genome.wustl.edu	37	2	90121682	90121682	+	RNA	SNP	C	C	A			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr2:90121682C>A	ENST00000483379.1	+	0	206									immunoglobulin kappa variable 1D-17																		CCCTGCTCAGCTCCTGGGGCT	0.522																																						dbGAP											0													73.0	54.0	60.0					2																	90121682		1838	4074	5912	-	-	-			0			X63392		2p11.2	2012-02-08			ENSG00000242766	ENSG00000242766		"""Immunoglobulins / IGK locus"""	5749	other	immunoglobulin gene							Standard	NG_000833		Approved				OTTHUMG00000151610		2.37:g.90121682C>A				Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.L9I	ENST00000483379.1	37	c.25		2																																																																																			IGKV1D-17	-	NULL	ENSG00000242766		0.522	IGKV1D-17-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGKV1D-17	HGNC	IG_V_gene	OTTHUMT00000323282.1	66	0.00	0	C	NG_000833		90121682	90121682	+1	no_stop_codon	ENST00000483379	ensembl	human	known	69_37n	missense	80	13.98	13	SNP	0.819	A
IL17RD	54756	genome.wustl.edu	37	3	57132299	57132299	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr3:57132299C>T	ENST00000296318.7	-	12	1520	c.1432G>A	c.(1432-1434)Gtc>Atc	p.V478I	IL17RD_ENST00000463523.1_Missense_Mutation_p.V334I|IL17RD_ENST00000427856.2_Missense_Mutation_p.V454I|IL17RD_ENST00000320057.5_Missense_Mutation_p.V334I	NM_017563.3	NP_060033.3	Q8NFM7	I17RD_HUMAN	interleukin 17 receptor D	478	SEFIR. {ECO:0000255|PROSITE- ProRule:PRU00867}.				signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(1)|ovary(1)|pancreas(1)	16				KIRC - Kidney renal clear cell carcinoma(284;0.0173)|Kidney(284;0.0204)		TCAAAGTAGACGGCGATAAAC	0.557																																						dbGAP											0													54.0	51.0	52.0					3																	57132299		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF494208	CCDS2880.2	3p21.1	2008-02-05			ENSG00000144730	ENSG00000144730		"""Interleukins and interleukin receptors"""	17616	protein-coding gene	gene with protein product		606807				11802164, 12604616	Standard	NM_017563		Approved	SEF, IL17RLM, FLJ35755, IL-17RD	uc003dil.3	Q8NFM7	OTTHUMG00000150171	ENST00000296318.7:c.1432G>A	3.37:g.57132299C>T	ENSP00000296318:p.Val478Ile		Q2NKP7|Q58EZ7|Q6RVF4|Q6UWI5|Q8N113|Q8NFS0|Q9UFA0	Missense_Mutation	SNP	pfam_SEFIR,superfamily_TIR_dom	p.V478I	ENST00000296318.7	37	c.1432	CCDS2880.2	3	.	.	.	.	.	.	.	.	.	.	C	31	5.090794	0.94149	.	.	ENSG00000144730	ENST00000296318;ENST00000320057;ENST00000427856;ENST00000463523	T;T;T;T	0.36878	1.23;1.23;1.23;1.23	5.54	5.54	0.83059	SEFIR (1);	0.000000	0.85682	D	0.000000	T	0.59074	0.2167	L	0.56769	1.78	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.976;0.997;0.974	T	0.56745	-0.7928	10	0.49607	T	0.09	-12.16	19.4954	0.95070	0.0:1.0:0.0:0.0	.	334;478;454	B4DXM5;Q8NFM7;Q8NFM7-3	.;I17RD_HUMAN;.	I	478;334;454;334	ENSP00000296318:V478I;ENSP00000322250:V334I;ENSP00000399209:V454I;ENSP00000417516:V334I	ENSP00000296318:V478I	V	-	1	0	IL17RD	57107339	1.000000	0.71417	0.983000	0.44433	0.899000	0.52679	7.083000	0.76859	2.607000	0.88179	0.655000	0.94253	GTC	IL17RD	-	pfam_SEFIR	ENSG00000144730		0.557	IL17RD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	IL17RD	HGNC	protein_coding	OTTHUMT00000316680.1	37	0.00	0	C	NM_017563		57132299	57132299	-1	no_errors	ENST00000296318	ensembl	human	known	69_37n	missense	21	22.22	6	SNP	1.000	T
KIF21B	23046	genome.wustl.edu	37	1	200944041	200944041	+	Splice_Site	SNP	G	G	T			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr1:200944041G>T	ENST00000422435.2	-	34	4931	c.4615C>A	c.(4615-4617)Caa>Aaa	p.Q1539K	KIF21B_ENST00000332129.2_Splice_Site_p.Q1526K|KIF21B_ENST00000461742.2_Splice_Site_p.Q1539K|KIF21B_ENST00000360529.5_Splice_Site_p.Q1526K	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	1539					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						TTGGGGATTTGCTGTGAGAGG	0.647																																						dbGAP											0													59.0	63.0	62.0					1																	200944041		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.4615-1C>A	1.37:g.200944041G>T			B2RP62|B7ZMI0|Q5T4J3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_Prefoldin,smart_Kinesin_motor_dom,smart_WD40_repeat,pfscan_Kinesin_motor_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Kinesin_motor_dom	p.Q1539K	ENST00000422435.2	37	c.4615	CCDS58056.1	1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.116382	0.77323	.	.	ENSG00000116852	ENST00000332129;ENST00000360529;ENST00000461742;ENST00000422435;ENST00000539858	T;T;T;T	0.05996	3.36;3.36;3.36;3.36	4.71	4.71	0.59529	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.25232	0.0613	M	0.75085	2.285	0.58432	D	0.999999	D;D;D;D	0.69078	0.985;0.997;0.985;0.982	D;D;D;D	0.76071	0.981;0.987;0.981;0.968	T	0.01591	-1.1317	10	0.36615	T	0.2	.	17.7324	0.88382	0.0:0.0:1.0:0.0	.	1526;1539;1539;1526	B7ZMI0;B2RP62;O75037;O75037-2	.;.;KI21B_HUMAN;.	K	1526;1526;1539;1539;1539	ENSP00000328494:Q1526K;ENSP00000353724:Q1526K;ENSP00000433808:Q1539K;ENSP00000411831:Q1539K	ENSP00000328494:Q1526K	Q	-	1	0	KIF21B	199210664	1.000000	0.71417	1.000000	0.80357	0.462000	0.32619	9.685000	0.98661	2.163000	0.67991	0.556000	0.70494	CAA	KIF21B	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000116852		0.647	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF21B	HGNC	protein_coding	OTTHUMT00000382635.1	37	0.00	0	G	XM_371332	Missense_Mutation	200944041	200944041	-1	no_errors	ENST00000422435	ensembl	human	known	69_37n	missense	35	37.50	21	SNP	1.000	T
KRT83	3889	genome.wustl.edu	37	12	52714811	52714811	+	Silent	SNP	G	G	A			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr12:52714811G>A	ENST00000293670.3	-	1	371	c.309C>T	c.(307-309)aaC>aaT	p.N103N		NM_002282.3	NP_002273.3	P78385	KRT83_HUMAN	keratin 83	103	Head.				aging (GO:0007568)|epidermis development (GO:0008544)|hair cycle (GO:0042633)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(9)|prostate(1)|skin(4)|stomach(7)|upper_aerodigestive_tract(1)	32	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		CGCACTGCGCGTTGGGGTCTA	0.632																																					GBM(41;747 834 12702 24089 39393)|Esophageal Squamous(97;805 1414 12559 28198 31861)	dbGAP											0													176.0	160.0	165.0					12																	52714811		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X99141	CCDS8823.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000170523	ENSG00000170523		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6460	protein-coding gene	gene with protein product	"""hard keratin type II"""	602765	"""keratin, hair, basic, 3"""	KRTHB3		9084137, 16831889	Standard	NM_002282		Approved	Hb-3	uc001saf.2	P78385	OTTHUMG00000169632	ENST00000293670.3:c.309C>T	12.37:g.52714811G>A			A1A4S9|B2RC21|Q6NT21|Q9NSB3	Silent	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.N103	ENST00000293670.3	37	c.309	CCDS8823.1	12																																																																																			KRT83	-	NULL	ENSG00000170523		0.632	KRT83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT83	HGNC	protein_coding	OTTHUMT00000405182.1	136	0.73	1	G	NM_002282		52714811	52714811	-1	no_errors	ENST00000293670	ensembl	human	known	69_37n	silent	78	20.41	20	SNP	0.986	A
L1TD1	54596	genome.wustl.edu	37	1	62673207	62673207	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr1:62673207G>T	ENST00000498273.1	+	3	1202	c.907G>T	c.(907-909)Gcc>Tcc	p.A303S		NM_001164835.1|NM_019079.4	NP_001158307.1|NP_061952.3	Q5T7N2	LITD1_HUMAN	LINE-1 type transposase domain containing 1	303										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	35						tagaaaatttgccagccaaaa	0.303																																						dbGAP											0													27.0	27.0	27.0					1																	62673207		1544	2691	4235	-	-	-	SO:0001583	missense	0			BC060808	CCDS619.1	1p31.3	2009-01-12			ENSG00000240563	ENSG00000240563			25595	protein-coding gene	gene with protein product						12477932	Standard	NM_001164835		Approved	FLJ10884, ECAT11	uc001dae.4	Q5T7N2	OTTHUMG00000008914	ENST00000498273.1:c.907G>T	1.37:g.62673207G>T	ENSP00000419901:p.Ala303Ser		Q8NDA1|Q9NUV8|Q9NV78	Missense_Mutation	SNP	pfam_Transposase_22,superfamily_STAT_TF_coiled-coil	p.A303S	ENST00000498273.1	37	c.907	CCDS619.1	1	.	.	.	.	.	.	.	.	.	.	G	10.28	1.305999	0.23736	.	.	ENSG00000240563	ENST00000498273	T	0.13778	2.56	2.35	-0.197	0.13228	.	.	.	.	.	T	0.07818	0.0196	N	0.22421	0.69	0.09310	N	1	P	0.35033	0.481	B	0.33042	0.157	T	0.30268	-0.9984	9	0.49607	T	0.09	.	4.5843	0.12275	0.6347:0.0:0.3653:0.0	.	303	Q5T7N2	LITD1_HUMAN	S	303	ENSP00000419901:A303S	ENSP00000419901:A303S	A	+	1	0	L1TD1	62445795	0.018000	0.18449	0.002000	0.10522	0.310000	0.27922	-0.045000	0.12003	-0.049000	0.13379	-0.373000	0.07131	GCC	L1TD1	-	pfam_Transposase_22	ENSG00000240563		0.303	L1TD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	L1TD1	HGNC	protein_coding	OTTHUMT00000024688.1	30	0.00	0	G	NM_019079		62673207	62673207	+1	no_errors	ENST00000498273	ensembl	human	known	69_37n	missense	26	29.73	11	SNP	0.003	T
MAP3K4	4216	genome.wustl.edu	37	6	161510422	161510422	+	Silent	SNP	G	G	A			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr6:161510422G>A	ENST00000392142.4	+	11	3040	c.2892G>A	c.(2890-2892)caG>caA	p.Q964Q	MAP3K4_ENST00000366919.2_Silent_p.Q964Q|MAP3K4_ENST00000366920.2_Silent_p.Q964Q|MAP3K4_ENST00000348824.7_Silent_p.Q964Q	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	964					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		CTTTCCAGCAGTCCATTGAGG	0.468																																						dbGAP											0													169.0	165.0	166.0					6																	161510422		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.2892G>A	6.37:g.161510422G>A			A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Q964	ENST00000392142.4	37	c.2892	CCDS34565.1	6																																																																																			MAP3K4	-	NULL	ENSG00000085511		0.468	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP3K4	HGNC	protein_coding	OTTHUMT00000042988.3	81	0.00	0	G			161510422	161510422	+1	no_errors	ENST00000392142	ensembl	human	known	69_37n	silent	82	18.00	18	SNP	1.000	A
MBTPS2	51360	genome.wustl.edu	37	X	21887782	21887782	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chrX:21887782G>A	ENST00000379484.5	+	7	1055	c.956G>A	c.(955-957)aGt>aAt	p.S319N	MBTPS2_ENST00000365779.2_Missense_Mutation_p.S319N	NM_015884.3	NP_056968.1	O43462	MBTP2_HUMAN	membrane-bound transcription factor peptidase, site 2	319	Cys-rich.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cholesterol metabolic process (GO:0008203)|endoplasmic reticulum unfolded protein response (GO:0030968)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|endometrium(3)|large_intestine(3)|lung(13)|ovary(1)|skin(2)	24						CAGCAGTTAAGTTTCCCAGTT	0.363																																						dbGAP											0													100.0	86.0	91.0					X																	21887782		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF019612	CCDS14201.1	Xp22.12-p22.11	2014-02-03	2005-08-17		ENSG00000012174	ENSG00000012174			15455	protein-coding gene	gene with protein product		300294	"""membrane-bound transcription factor protease, site 2"", ""keratosis follicularis spinulosa decalvans"""	KFSD		9847074, 9659902, 20672378	Standard	NM_015884		Approved	S2P	uc004dae.3	O43462	OTTHUMG00000021237	ENST00000379484.5:c.956G>A	X.37:g.21887782G>A	ENSP00000368798:p.Ser319Asn		Q9UM70|Q9UMD3	Missense_Mutation	SNP	pfam_Peptidase_M50,superfamily_PDZ,prints_Pept_M50_SREBP	p.S319N	ENST00000379484.5	37	c.956	CCDS14201.1	X	.	.	.	.	.	.	.	.	.	.	G	13.72	2.321295	0.41096	.	.	ENSG00000012174	ENST00000379484;ENST00000365779	D;D	0.93659	-3.26;-2.13	4.56	4.56	0.56223	Peptidase M50 (1);	0.267254	0.46145	D	0.000316	D	0.89255	0.6663	L	0.39397	1.21	0.28735	N	0.902281	B;B	0.16166	0.016;0.015	B;B	0.11329	0.006;0.005	T	0.77021	-0.2742	10	0.13853	T	0.58	-16.0446	16.8801	0.86060	0.0:0.0:1.0:0.0	.	319;319	O43462;B9ZVQ3	MBTP2_HUMAN;.	N	319	ENSP00000368798:S319N;ENSP00000368796:S319N	ENSP00000368796:S319N	S	+	2	0	MBTPS2	21797703	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.692000	0.61746	2.250000	0.74265	0.600000	0.82982	AGT	MBTPS2	-	pfam_Peptidase_M50	ENSG00000012174		0.363	MBTPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBTPS2	HGNC	protein_coding	OTTHUMT00000056026.1	39	0.00	0	G			21887782	21887782	+1	no_errors	ENST00000379484	ensembl	human	known	69_37n	missense	47	14.55	8	SNP	1.000	A
MFAP5	8076	genome.wustl.edu	37	12	8814696	8814696	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr12:8814696G>A	ENST00000359478.2	-	2	192	c.5C>T	c.(4-6)tCg>tTg	p.S2L	MFAP5_ENST00000396549.2_Missense_Mutation_p.S2L|MFAP5_ENST00000543369.1_Missense_Mutation_p.S2L|RP11-20D14.3_ENST00000544922.1_RNA|RP11-20D14.3_ENST00000539089.1_RNA|MFAP5_ENST00000433590.2_Missense_Mutation_p.S2L|MFAP5_ENST00000535336.1_Missense_Mutation_p.S2L|MFAP5_ENST00000538107.1_5'UTR|MFAP5_ENST00000540087.1_Missense_Mutation_p.S2L	NM_003480.2	NP_003471.1	Q13361	MFAP5_HUMAN	microfibrillar associated protein 5	2					extracellular fibril organization (GO:0043206)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|microfibril (GO:0001527)	extracellular matrix structural constituent (GO:0005201)			breast(1)|endometrium(2)|large_intestine(4)|lung(5)|skin(1)	13	Lung SC(5;0.184)					TCCCAAGAGCGACATATCTAT	0.507																																						dbGAP											0													107.0	98.0	101.0					12																	8814696		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK124368	CCDS8595.1, CCDS73437.1	12p13.1-p12.3	2004-04-05				ENSG00000197614			29673	protein-coding gene	gene with protein product		601103				9792630, 8557636	Standard	XM_005253485		Approved	MAGP2, MP25	uc001qut.1	Q13361		ENST00000359478.2:c.5C>T	12.37:g.8814696G>A	ENSP00000352455:p.Ser2Leu		B0AZL6|D3DUV1|Q7Z490	Missense_Mutation	SNP	pfam_MAGP	p.S2L	ENST00000359478.2	37	c.5	CCDS8595.1	12	.	.	.	.	.	.	.	.	.	.	G	0.017	-1.510323	0.00984	.	.	ENSG00000197614	ENST00000359478;ENST00000433590;ENST00000396549;ENST00000543369;ENST00000535336;ENST00000540087;ENST00000544889	.	.	.	4.79	2.27	0.28462	.	0.545140	0.16143	N	0.227627	T	0.06050	0.0157	N	0.00197	-1.87	0.22366	N	0.999169	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.04013	0.0;0.001;0.001	T	0.37776	-0.9691	8	.	.	.	-0.6497	6.3877	0.21569	0.7997:0.0:0.2003:0.0	.	2;2;2	B3KW70;Q13361;Q7Z490	.;MFAP5_HUMAN;.	L	2	.	.	S	-	2	0	MFAP5	8705963	0.866000	0.29940	0.700000	0.30305	0.213000	0.24496	1.289000	0.33307	0.408000	0.25621	-0.423000	0.05987	TCG	MFAP5	-	NULL	ENSG00000197614		0.507	MFAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFAP5	HGNC	protein_coding	OTTHUMT00000400656.2	46	0.00	0	G	NM_003480		8814696	8814696	-1	no_errors	ENST00000359478	ensembl	human	known	69_37n	missense	36	14.29	6	SNP	0.891	A
MUC4	4585	genome.wustl.edu	37	3	195486130	195486130	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr3:195486130G>T	ENST00000346145.4	-	16	2182	c.2143C>A	c.(2143-2145)Cag>Aag	p.Q715K	MUC4_ENST00000475231.1_Missense_Mutation_p.Q4899K|MUC4_ENST00000463781.3_Missense_Mutation_p.Q4951K|MUC4_ENST00000349607.4_Missense_Mutation_p.Q664K	NM_004532.5	NP_004523.3	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	1708					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGCGGGTACTGATCTGAAACA	0.517																																						dbGAP											0													176.0	171.0	173.0					3																	195486130		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000346145.4:c.2143C>A	3.37:g.195486130G>T	ENSP00000304207:p.Gln715Lys		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.Q4951K	ENST00000346145.4	37	c.14851	CCDS3310.1	3	.	.	.	.	.	.	.	.	.	.	.	4.538	0.099823	0.08681	.	.	ENSG00000145113	ENST00000349607;ENST00000346145;ENST00000463781;ENST00000475231;ENST00000392409	T;T;T;T	0.37058	1.22;1.58;1.52;1.55	4.69	0.804	0.18697	.	0.937497	0.08904	N	0.876850	T	0.27134	0.0665	L	0.44542	1.39	0.21841	N	0.999511	B;B;B;B;B;B	0.24768	0.064;0.001;0.001;0.01;0.01;0.111	B;B;B;B;B;B	0.23419	0.046;0.006;0.006;0.005;0.005;0.025	T	0.32348	-0.9910	10	0.15066	T	0.55	-1.8736	7.4052	0.26987	0.0:0.3065:0.378:0.3156	.	4823;664;715;4951;4899;1656	E7ESK3;Q99102-12;Q99102-13;E9PDY6;E7ENC5;Q99102-10	.;.;.;.;.;.	K	664;715;4951;4899;1451	ENSP00000338109:Q664K;ENSP00000304207:Q715K;ENSP00000417498:Q4951K;ENSP00000420243:Q4899K	ENSP00000304207:Q715K	Q	-	1	0	MUC4	196971801	0.998000	0.40836	0.929000	0.37066	0.254000	0.26022	0.081000	0.14823	-0.031000	0.13781	-0.553000	0.04205	CAG	MUC4	-	NULL	ENSG00000145113		0.517	MUC4-015	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000341862.1	39	0.00	0	G	NM_018406		195486130	195486130	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	missense	23	46.51	20	SNP	0.972	T
MYH7B	57644	genome.wustl.edu	37	20	33585277	33585277	+	Missense_Mutation	SNP	C	C	A	rs540290584		TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr20:33585277C>A	ENST00000262873.7	+	30	3799	c.3707C>A	c.(3706-3708)gCc>gAc	p.A1236D		NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	1194						membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			CGGCACGAGGCCACAGTGGCG	0.771																																						dbGAP											0													5.0	8.0	7.0					20																	33585277		1844	3661	5505	-	-	-	SO:0001583	missense	0			AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.3707C>A	20.37:g.33585277C>A	ENSP00000262873:p.Ala1236Asp		Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Myosin_S1_N,superfamily_Prefoldin,superfamily_tRNA-bd_arm,superfamily_t-SNARE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.A1236D	ENST00000262873.7	37	c.3707	CCDS42869.1	20	.	.	.	.	.	.	.	.	.	.	C	35	5.486363	0.96323	.	.	ENSG00000078814	ENST00000262873	T	0.78126	-1.15	4.73	4.73	0.59995	Myosin tail (1);	0.000000	0.37669	N	0.001987	D	0.85177	0.5637	M	0.89658	3.05	0.53005	D	0.999962	D	0.54772	0.968	P	0.47299	0.543	D	0.89509	0.3770	10	0.87932	D	0	.	17.9076	0.88923	0.0:1.0:0.0:0.0	.	1194	A7E2Y1	MYH7B_HUMAN	D	1236	ENSP00000262873:A1236D	ENSP00000262873:A1236D	A	+	2	0	MYH7B	33048938	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	5.904000	0.69886	2.456000	0.83038	0.563000	0.77884	GCC	MYH7B	-	pfam_Myosin_tail	ENSG00000078814		0.771	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH7B	HGNC	protein_coding	OTTHUMT00000078833.2	15	0.00	0	C	NM_020884		33585277	33585277	+1	no_errors	ENST00000262873	ensembl	human	novel	69_37n	missense	9	40.00	6	SNP	1.000	A
NBEA	26960	genome.wustl.edu	37	13	35716469	35716469	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr13:35716469G>T	ENST00000400445.3	+	18	2934	c.2400G>T	c.(2398-2400)ttG>ttT	p.L800F	NBEA_ENST00000540320.1_Missense_Mutation_p.L800F|NBEA_ENST00000310336.4_Missense_Mutation_p.L800F|NBEA_ENST00000379939.2_Missense_Mutation_p.L800F	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	800					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		GGCTGATGTTGCATACAAACA	0.363																																						dbGAP											0													165.0	157.0	159.0					13																	35716469		1864	4108	5972	-	-	-	SO:0001583	missense	0			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.2400G>T	13.37:g.35716469G>T	ENSP00000383295:p.Leu800Phe		B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_DUF1088,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_ConA-like_lec_gl,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat_dom	p.L800F	ENST00000400445.3	37	c.2400	CCDS45026.1	13	.	.	.	.	.	.	.	.	.	.	G	14.83	2.652109	0.47362	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336	T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11	5.24	2.58	0.30949	.	0.226724	0.31760	N	0.007119	T	0.58424	0.2121	M	0.80183	2.485	0.80722	D	1	P	0.41313	0.745	B	0.38562	0.276	T	0.55347	-0.8155	10	0.52906	T	0.07	.	5.2396	0.15464	0.2246:0.0:0.6328:0.1426	.	800	Q5T321	.	F	800	ENSP00000440951:L800F;ENSP00000383295:L800F;ENSP00000369271:L800F;ENSP00000308534:L800F	ENSP00000308534:L800F	L	+	3	2	NBEA	34614469	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	1.086000	0.30853	0.229000	0.21039	0.591000	0.81541	TTG	NBEA	-	superfamily_ARM-type_fold	ENSG00000172915		0.363	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NBEA	HGNC	protein_coding		69	0.00	0	G	NM_015678		35716469	35716469	+1	no_errors	ENST00000310336	ensembl	human	known	69_37n	missense	37	22.92	11	SNP	1.000	T
NLGN4X	57502	genome.wustl.edu	37	X	5811039	5811039	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chrX:5811039G>T	ENST00000381095.3	-	6	2897	c.2270C>A	c.(2269-2271)cCg>cAg	p.P757Q	NLGN4X_ENST00000381093.2_Missense_Mutation_p.P777Q|NLGN4X_ENST00000275857.6_Missense_Mutation_p.P757Q|NLGN4X_ENST00000381092.1_Missense_Mutation_p.P757Q|NLGN4X_ENST00000538097.1_Missense_Mutation_p.P757Q	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	757					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)			breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						GTAGTCTGGCGGGCAGGTGAG	0.562																																						dbGAP											0													236.0	180.0	199.0					X																	5811039		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.2270C>A	X.37:g.5811039G>T	ENSP00000370485:p.Pro757Gln		Q6UX10|Q9ULG0	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Neuroligin	p.P777Q	ENST00000381095.3	37	c.2330	CCDS14126.1	X	.	.	.	.	.	.	.	.	.	.	G	12.57	1.978027	0.34942	.	.	ENSG00000146938	ENST00000381095;ENST00000381093;ENST00000275857;ENST00000381092;ENST00000538097	T;T;T;T;T	0.19532	2.14;2.14;2.14;2.14;2.14	3.82	3.82	0.43975	.	0.000000	0.34460	N	0.003953	T	0.43389	0.1245	M	0.73962	2.25	0.58432	D	0.999995	P;D;P	0.62365	0.921;0.991;0.953	P;D;P	0.64144	0.64;0.922;0.803	T	0.45556	-0.9253	10	0.52906	T	0.07	.	14.222	0.65833	0.0:0.0:1.0:0.0	.	814;757;777	A6NMU8;Q8N0W4;Q8N0W4-2	.;NLGNX_HUMAN;.	Q	757;777;757;757;757	ENSP00000370485:P757Q;ENSP00000370483:P777Q;ENSP00000275857:P757Q;ENSP00000370482:P757Q;ENSP00000439203:P757Q	ENSP00000275857:P757Q	P	-	2	0	NLGN4X	5821039	1.000000	0.71417	0.704000	0.30370	0.313000	0.28021	8.247000	0.89830	1.508000	0.48769	0.513000	0.50165	CCG	NLGN4X	-	NULL	ENSG00000146938		0.562	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	NLGN4X	HGNC	protein_coding	OTTHUMT00000055673.1	123	0.00	0	G	NM_020742		5811039	5811039	-1	no_errors	ENST00000381093	ensembl	human	known	69_37n	missense	113	18.12	25	SNP	0.998	T
NUAK1	9891	genome.wustl.edu	37	12	106480580	106480580	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr12:106480580G>T	ENST00000261402.2	-	3	1824	c.445C>A	c.(445-447)Cgc>Agc	p.R149S		NM_014840.2	NP_055655.1	O60285	NUAK1_HUMAN	NUAK family, SNF1-like kinase, 1	149	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell adhesion (GO:0007155)|cellular response to DNA damage stimulus (GO:0006974)|regulation of cell adhesion (GO:0030155)|regulation of cell proliferation (GO:0042127)|regulation of cellular senescence (GO:2000772)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37						TCACTGAGGCGTCGCCGCTCA	0.537																																						dbGAP											0													141.0	114.0	123.0					12																	106480580		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011109	CCDS31892.1	12q23.3	2005-08-09				ENSG00000074590			14311	protein-coding gene	gene with protein product	"""AMP-activated protein kinase family member 5"""	608130				12409306, 13679856	Standard	NM_014840		Approved	ARK5, KIAA0537, NuaK1	uc001tlj.1	O60285	OTTHUMG00000169763	ENST00000261402.2:c.445C>A	12.37:g.106480580G>T	ENSP00000261402:p.Arg149Ser		A7MD39|Q96KA8	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.R149S	ENST00000261402.2	37	c.445	CCDS31892.1	12	.	.	.	.	.	.	.	.	.	.	G	17.45	3.391709	0.62066	.	.	ENSG00000074590	ENST00000261402;ENST00000359413;ENST00000548902	T;T	0.25085	1.82;1.82	5.92	3.9	0.45041	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.51477	D	0.000086	T	0.31702	0.0805	L	0.42686	1.345	0.46749	D	0.999184	P	0.38167	0.621	P	0.45946	0.498	T	0.18745	-1.0327	10	0.87932	D	0	.	14.2159	0.65792	0.0:0.0:0.5893:0.4107	.	149	O60285	NUAK1_HUMAN	S	149;149;18	ENSP00000261402:R149S;ENSP00000448288:R18S	ENSP00000261402:R149S	R	-	1	0	NUAK1	105004710	0.992000	0.36948	0.885000	0.34714	0.983000	0.72400	2.147000	0.42226	1.457000	0.47850	0.655000	0.94253	CGC	NUAK1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000074590		0.537	NUAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUAK1	HGNC	protein_coding	OTTHUMT00000405767.2	52	0.00	0	G	NM_014840		106480580	106480580	-1	no_errors	ENST00000261402	ensembl	human	known	69_37n	missense	48	11.11	6	SNP	0.694	T
NOS1	4842	genome.wustl.edu	37	12	117662851	117662851	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr12:117662851G>T	ENST00000338101.4	-	25	3902	c.3898C>A	c.(3898-3900)Caa>Aaa	p.Q1300K	NOS1_ENST00000344089.3_3'UTR|NOS1_ENST00000317775.6_Missense_Mutation_p.Q1266K			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		TGCCGCTGTTGCCAGAAGCTT	0.612																																					Esophageal Squamous(162;1748 2599 51982 52956)	dbGAP											0													138.0	152.0	147.0					12																	117662851		1949	4148	6097	-	-	-	SO:0001583	missense	0				CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.3898C>A	12.37:g.117662851G>T	ENSP00000337459:p.Gln1300Lys			Missense_Mutation	SNP	pfam_NO_synthase_oxygenase_dom,pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,pfam_PDZ,superfamily_NO_synthase_oxygenase_dom,superfamily_Riboflavin_synthase-like_b-brl,superfamily_PDZ,smart_PDZ,pirsf_NOS_met,pfscan_PDZ,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.Q1266K	ENST00000338101.4	37	c.3796	CCDS55890.1	12	.	.	.	.	.	.	.	.	.	.	G	33	5.286212	0.95517	.	.	ENSG00000089250	ENST00000397605;ENST00000317775;ENST00000338101	D;D	0.82526	-1.62;-1.62	4.93	4.93	0.64822	Oxidoreductase FAD/NAD(P)-binding (1);Flavoprotein pyridine nucleotide cytochrome reductase (1);	0.000000	0.85682	D	0.000000	D	0.93983	0.8073	H	0.95679	3.705	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95617	0.8677	10	0.87932	D	0	-27.2767	18.3244	0.90248	0.0:0.0:1.0:0.0	.	1266	P29475	NOS1_HUMAN	K	1161;1266;1300	ENSP00000320758:Q1266K;ENSP00000337459:Q1300K	ENSP00000320758:Q1266K	Q	-	1	0	NOS1	116147234	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.629000	0.98417	2.555000	0.86185	0.561000	0.74099	CAA	NOS1	-	pfam_OxRdtase_FAD/NAD-bd,pirsf_NOS_met,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase	ENSG00000089250		0.612	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	NOS1	HGNC	protein_coding	OTTHUMT00000268053.1	48	0.00	0	G			117662851	117662851	-1	no_errors	ENST00000317775	ensembl	human	known	69_37n	missense	31	18.42	7	SNP	1.000	T
NXF5	55998	genome.wustl.edu	37	X	101096303	101096303	+	Splice_Site	SNP	C	C	A	rs367701186		TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chrX:101096303C>A	ENST00000361708.2	-	7	681		c.e7-1		NXF5_ENST00000473265.2_Splice_Site|NXF5_ENST00000537026.1_Splice_Site			Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5						mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|skin(1)	30						TCATGGTCAGCTGCAGAGATA	0.537																																						dbGAP											0													36.0	38.0	37.0					X																	101096303		2203	4294	6497	-	-	-	SO:0001630	splice_region_variant	0			AJ277654	CCDS14491.1, CCDS14491.2	Xq22	2008-07-28			ENSG00000126952	ENSG00000126952			8075	protein-coding gene	gene with protein product		300319				11566096	Standard	NM_032946		Approved		uc011mrk.1	Q9H1B4	OTTHUMG00000022042	ENST00000361708.2:c.322-1G>T	X.37:g.101096303C>A			A2RRM0|B1AV82|B1AV83|B1AV84|B1AV85|Q9H1B0|Q9H1B1|Q9H1B2|Q9H1B3	Splice_Site	SNP	-	e5-1	ENST00000361708.2	37	c.322-1		X	.	.	.	.	.	.	.	.	.	.	c	7.344	0.621449	0.14193	.	.	ENSG00000126952	ENST00000537026;ENST00000473265;ENST00000361708	.	.	.	2.18	1.31	0.21738	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.4553	0.11640	0.0:0.7996:0.0:0.2004	.	.	.	.	.	-1	.	.	.	-	.	.	NXF5	100982959	1.000000	0.71417	0.167000	0.22817	0.044000	0.14063	4.220000	0.58567	0.402000	0.25451	-0.509000	0.04479	.	NXF5	-	-	ENSG00000126952		0.537	NXF5-201	KNOWN	basic	protein_coding	NXF5	HGNC	protein_coding		96	0.00	0	C		Intron	101096303	101096303	-1	no_errors	ENST00000263032	ensembl	human	known	69_37n	splice_site	105	11.02	13	SNP	1.000	A
OBSCN	84033	genome.wustl.edu	37	1	228482539	228482539	+	Silent	SNP	G	G	A			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr1:228482539G>A	ENST00000422127.1	+	43	11498	c.11454G>A	c.(11452-11454)acG>acA	p.T3818T	OBSCN_ENST00000359599.6_Silent_p.T2665T|RP5-1139B12.4_ENST00000602778.1_RNA|OBSCN_ENST00000284548.11_Silent_p.T3818T|OBSCN_ENST00000366707.4_Silent_p.T937T|OBSCN_ENST00000570156.2_Silent_p.T4247T|OBSCN_ENST00000366709.4_Silent_p.T937T	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	3818	Ig-like 39.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				AAGGGGCCACGGCCGTGCTGC	0.582																																						dbGAP											0													105.0	109.0	108.0					1																	228482539		1937	4128	6065	-	-	-	SO:0001819	synonymous_variant	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.11454G>A	1.37:g.228482539G>A			Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.R1094Q	ENST00000422127.1	37	c.3281	CCDS58065.1	1																																																																																			OBSCN	-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000154358		0.582	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		68	0.00	0	G	NM_052843		228482539	228482539	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000483539	ensembl	human	novel	69_37n	missense	82	27.43	31	SNP	0.000	A
OR10AD1	121275	genome.wustl.edu	37	12	48596743	48596743	+	Silent	SNP	G	G	A			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr12:48596743G>A	ENST00000310248.2	-	1	427	c.333C>T	c.(331-333)gcC>gcT	p.A111A		NM_001004134.1	NP_001004134.1	Q8NGE0	O10AD_HUMAN	olfactory receptor, family 10, subfamily AD, member 1	111						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|stomach(1)|urinary_tract(1)	9						GGATGCACTCGGCCACACCAA	0.498																																						dbGAP											0													101.0	89.0	93.0					12																	48596743		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS31787.1	12q13.11	2013-09-24	2002-11-13	2002-11-15	ENSG00000172640	ENSG00000172640		"""GPCR / Class A : Olfactory receptors"""	14819	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily AD, member 1 pseudogene"""	OR10AD1P			Standard	NM_001004134		Approved		uc001rrl.1	Q8NGE0	OTTHUMG00000168027	ENST00000310248.2:c.333C>T	12.37:g.48596743G>A			B9EGT9|Q6IFA8	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.A111	ENST00000310248.2	37	c.333	CCDS31787.1	12																																																																																			OR10AD1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000172640		0.498	OR10AD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10AD1	HGNC	protein_coding	OTTHUMT00000397577.1	42	0.00	0	G			48596743	48596743	-1	no_errors	ENST00000310248	ensembl	human	known	69_37n	silent	37	13.95	6	SNP	0.438	A
OR2L13	284521	genome.wustl.edu	37	1	248262934	248262934	+	Missense_Mutation	SNP	C	C	A	rs201512312		TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr1:248262934C>A	ENST00000358120.2	+	2	402	c.257C>A	c.(256-258)tCc>tAc	p.S86Y	OR2L13_ENST00000366478.2_Missense_Mutation_p.S86Y			Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L, member 13	86						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(32)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	59	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			AACTTCCTGTCCGGCCAGAAA	0.542																																						dbGAP											0													235.0	208.0	217.0					1																	248262934		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC028158	CCDS1637.1	1q44	2012-08-09			ENSG00000196071	ENSG00000196071		"""GPCR / Class A : Olfactory receptors"""	19578	protein-coding gene	gene with protein product				OR2L14			Standard	NM_175911		Approved		uc001ids.3	Q8N349	OTTHUMG00000040446	ENST00000358120.2:c.257C>A	1.37:g.248262934C>A	ENSP00000350836:p.Ser86Tyr		Q5VUR5	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.S86Y	ENST00000358120.2	37	c.257	CCDS1637.1	1	.	.	.	.	.	.	.	.	.	.	C	0.801	-0.755543	0.03019	.	.	ENSG00000196071	ENST00000366478;ENST00000358120	T;T	0.04970	3.52;3.52	4.07	2.13	0.27403	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43260	D	0.000585	T	0.18215	0.0437	M	0.90922	3.16	0.09310	N	1	D	0.76494	0.999	D	0.85130	0.997	T	0.45977	-0.9224	10	0.02654	T	1	.	1.1236	0.01730	0.1582:0.4187:0.1541:0.269	.	86	Q8N349	OR2LD_HUMAN	Y	86	ENSP00000355434:S86Y;ENSP00000350836:S86Y	ENSP00000350836:S86Y	S	+	2	0	OR2L13	246329557	0.000000	0.05858	0.012000	0.15200	0.116000	0.19942	-0.231000	0.09069	0.901000	0.36495	0.650000	0.86243	TCC	OR2L13	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000196071		0.542	OR2L13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L13	HGNC	protein_coding	OTTHUMT00000097342.1	62	0.00	0	C	NM_175911		248262934	248262934	+1	no_errors	ENST00000358120	ensembl	human	known	69_37n	missense	95	15.18	17	SNP	0.000	A
OR4C46	119749	genome.wustl.edu	37	11	51515861	51515861	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr11:51515861G>T	ENST00000328188.1	+	1	580	c.580G>T	c.(580-582)Gaa>Taa	p.E194*		NM_001004703.1	NP_001004703.1	A6NHA9	O4C46_HUMAN	olfactory receptor, family 4, subfamily C, member 46	194						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(5)|large_intestine(5)|lung(31)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	48						CCATATGCTGGAACTCTTCAT	0.463																																						dbGAP											0													137.0	121.0	127.0					11																	51515861		2201	4296	6497	-	-	-	SO:0001587	stop_gained	0				CCDS73288.1	11p11.12	2012-08-09			ENSG00000185926	ENSG00000185926		"""GPCR / Class A : Olfactory receptors"""	31271	protein-coding gene	gene with protein product		614273					Standard	NM_001004703		Approved		uc010ric.2	A6NHA9	OTTHUMG00000166705	ENST00000328188.1:c.580G>T	11.37:g.51515861G>T	ENSP00000329056:p.Glu194*			Nonsense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.E194*	ENST00000328188.1	37	c.580	CCDS31498.1	11	.	.	.	.	.	.	.	.	.	.	.	3.453	-0.111527	0.06881	.	.	ENSG00000185926	ENST00000328188	.	.	.	2.47	1.48	0.22813	.	0.000000	0.46442	D	0.000285	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	8.7535	0.34633	0.0:0.2367:0.7632:0.0	.	.	.	.	X	194	.	ENSP00000329056:E194X	E	+	1	0	OR4C46	51372437	0.206000	0.23470	0.002000	0.10522	0.006000	0.05464	-0.232000	0.09055	0.361000	0.24292	0.121000	0.15741	GAA	OR4C46	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000185926		0.463	OR4C46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C46	HGNC	protein_coding	OTTHUMT00000391155.1	70	0.00	0	G	NM_001004703		51515861	51515861	+1	no_errors	ENST00000328188	ensembl	human	known	69_37n	nonsense	73	33.03	36	SNP	0.003	T
PAK2	5062	genome.wustl.edu	37	3	196547338	196547338	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr3:196547338G>A	ENST00000327134.3	+	13	1572	c.1250G>A	c.(1249-1251)cGg>cAg	p.R417Q		NM_002577.4	NP_002568.2	Q13177	PAK2_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 2	417	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in execution phase of apoptosis (GO:2001271)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of defense response to virus by virus (GO:0050690)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activator activity (GO:0030296)			breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)	12	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)		GTGGTTACACGGAAAGCTTAT	0.507																																						dbGAP											0													157.0	131.0	139.0					3																	196547338		2203	4300	6503	-	-	-	SO:0001583	missense	0			U24153	CCDS3321.1	3q29	2008-06-17	2008-06-17			ENSG00000180370	2.7.11.1		8591	protein-coding gene	gene with protein product	"""S6/H4 kinase"""	605022	"""p21 (CDKN1A)-activated kinase 2"""			7744004, 7618083	Standard	NM_002577		Approved	PAK65, PAKgamma	uc003fwy.4	Q13177		ENST00000327134.3:c.1250G>A	3.37:g.196547338G>A	ENSP00000314067:p.Arg417Gln		Q13154|Q6ISC3	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PAK_box_Rho-bd,superfamily_Kinase-like_dom,superfamily_WASP_C,smart_PAK_box_Rho-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_PAK_box_Rho-bd,pfscan_Prot_kinase_cat_dom	p.R417Q	ENST00000327134.3	37	c.1250	CCDS3321.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.9|21.9	4.213888|4.213888	0.79352|0.79352	.|.	.|.	ENSG00000180370|ENSG00000180370	ENST00000426668|ENST00000327134	.|T	.|0.13657	.|2.57	4.69|4.69	4.69|4.69	0.59074|0.59074	.|Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.053164	.|0.64402	.|D	.|0.000001	T|T	0.23649|0.23649	0.0572|0.0572	N|N	0.20304|0.20304	0.555|0.555	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.72982	.|0.979	T|T	0.04767|0.04767	-1.0928|-1.0928	5|10	.|0.37606	.|T	.|0.19	.|.	18.1858|18.1858	0.89792|0.89792	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|417	.|Q13177	.|PAK2_HUMAN	R|Q	160|417	.|ENSP00000314067:R417Q	.|ENSP00000314067:R417Q	G|R	+|+	1|2	0|0	PAK2|PAK2	198031735|198031735	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.996000|0.996000	0.88848|0.88848	9.208000|9.208000	0.95075|0.95075	2.593000|2.593000	0.87608|0.87608	0.655000|0.655000	0.94253|0.94253	GGA|CGG	PAK2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000180370		0.507	PAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAK2	HGNC	protein_coding	OTTHUMT00000340548.1	44	0.00	0	G	NM_002577		196547338	196547338	+1	no_errors	ENST00000327134	ensembl	human	known	69_37n	missense	46	22.03	13	SNP	1.000	A
PCDHB12	56124	genome.wustl.edu	37	5	140589271	140589271	+	Silent	SNP	C	C	T			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr5:140589271C>T	ENST00000239450.2	+	1	981	c.792C>T	c.(790-792)gtC>gtT	p.V264V	PCDHB12_ENST00000541609.1_Intron	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	264	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTGTGACCGTCTCAGCCTGGG	0.418																																						dbGAP											0													144.0	151.0	149.0					5																	140589271		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.792C>T	5.37:g.140589271C>T			B4DDU1	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V264	ENST00000239450.2	37	c.792	CCDS4254.1	5																																																																																			PCDHB12	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000120328		0.418	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB12	HGNC	protein_coding	OTTHUMT00000251815.2	66	0.00	0	C	NM_018932		140589271	140589271	+1	no_errors	ENST00000239450	ensembl	human	known	69_37n	silent	62	20.25	16	SNP	0.021	T
PDZRN4	29951	genome.wustl.edu	37	12	41966546	41966546	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr12:41966546T>A	ENST00000402685.2	+	10	1973	c.1965T>A	c.(1963-1965)aaT>aaA	p.N655K	PDZRN4_ENST00000298919.7_Missense_Mutation_p.N395K|PDZRN4_ENST00000539469.2_Missense_Mutation_p.N397K	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	655							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				TTGAATGCAATCAAGGGGAGC	0.448																																						dbGAP											0													121.0	109.0	113.0					12																	41966546		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.1965T>A	12.37:g.41966546T>A	ENSP00000384197:p.Asn655Lys		Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,superfamily_TRAF-like,smart_Znf_RING,smart_PDZ,pfscan_PDZ,pfscan_Znf_RING	p.N655K	ENST00000402685.2	37	c.1965	CCDS53777.1	12	.	.	.	.	.	.	.	.	.	.	T	9.622	1.134001	0.21123	.	.	ENSG00000165966	ENST00000402685;ENST00000539469;ENST00000298919	T;T;T	0.72835	-0.69;3.79;3.78	4.38	-5.34	0.02705	.	0.652493	0.14883	N	0.292867	T	0.63674	0.2531	L	0.54323	1.7	0.09310	N	0.999998	B;B;B	0.31026	0.304;0.226;0.03	B;B;B	0.37650	0.096;0.255;0.038	T	0.58662	-0.7597	10	0.42905	T	0.14	-9.0596	11.8117	0.52185	0.0:0.6273:0.1151:0.2576	.	655;395;397	Q6ZMN7;Q6ZMN7-4;Q6ZMN7-2	PZRN4_HUMAN;.;.	K	655;397;395	ENSP00000384197:N655K;ENSP00000439990:N397K;ENSP00000298919:N395K	ENSP00000298919:N395K	N	+	3	2	PDZRN4	40252813	0.990000	0.36364	0.000000	0.03702	0.624000	0.37722	0.389000	0.20751	-0.967000	0.03582	0.528000	0.53228	AAT	PDZRN4	-	NULL	ENSG00000165966		0.448	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZRN4	HGNC	protein_coding	OTTHUMT00000403701.1	47	0.00	0	T	NM_013377		41966546	41966546	+1	no_errors	ENST00000402685	ensembl	human	known	69_37n	missense	45	13.46	7	SNP	0.016	A
PHACTR2	9749	genome.wustl.edu	37	6	144033228	144033228	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr6:144033228G>T	ENST00000427704.2	+	2	219	c.89G>T	c.(88-90)aGa>aTa	p.R30I	PHACTR2_ENST00000397980.3_Missense_Mutation_p.R41I|PHACTR2_ENST00000305766.6_Missense_Mutation_p.R30I|PHACTR2_ENST00000367584.4_Missense_Mutation_p.R98I|PHACTR2_ENST00000440869.2_Missense_Mutation_p.R41I|PHACTR2_ENST00000367582.3_Missense_Mutation_p.R41I	NM_001100166.1|NM_014721.2	NP_001093636.1|NP_055536.2	O75167	PHAR2_HUMAN	phosphatase and actin regulator 2	30							protein phosphatase inhibitor activity (GO:0004864)	p.R41K(1)|p.R30K(1)		NS(3)|breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30				OV - Ovarian serous cystadenocarcinoma(155;1.58e-05)|GBM - Glioblastoma multiforme(68;0.0386)		CCCTTCAAAAGAAAGGGGAAA	0.428																																					Pancreas(12;292 433 7358 48260 52635)|Ovarian(20;501 618 3485 36581 49208)	dbGAP											2	Substitution - Missense(2)	lung(2)											107.0	106.0	106.0					6																	144033228		1827	4080	5907	-	-	-	SO:0001583	missense	0			AB014580	CCDS43512.1, CCDS47492.1, CCDS47493.1, CCDS47494.1	6q24.1	2013-01-24	2004-05-20	2004-05-20	ENSG00000112419	ENSG00000112419		"""Phosphatase and actin regulators"""	20956	protein-coding gene	gene with protein product		608724	"""chromosome 6 open reading frame 56"""	C6orf56		9734811, 15107502	Standard	NM_001100164		Approved	KIAA0680	uc010khi.3	O75167	OTTHUMG00000015732	ENST00000427704.2:c.89G>T	6.37:g.144033228G>T	ENSP00000391763:p.Arg30Ile		A6NKP5|A7MCZ5|A8MZC0|B2RWP7|B4DN76|B4DPB5|B4DTH7|Q5TFA0|Q68DM2	Missense_Mutation	SNP	pfam_RPEL_repeat,smart_RPEL_repeat,pfscan_RPEL_repeat	p.R41I	ENST00000427704.2	37	c.122	CCDS47492.1	6	.	.	.	.	.	.	.	.	.	.	G	31	5.084300	0.94100	.	.	ENSG00000112419	ENST00000367584;ENST00000427704;ENST00000305766;ENST00000440869;ENST00000367582;ENST00000451827;ENST00000397980;ENST00000367583	T;T;T;T;T	0.52983	0.64;0.97;0.73;0.99;0.76	5.93	5.93	0.95920	.	0.156590	0.56097	D	0.000021	T	0.63046	0.2478	L	0.59436	1.845	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.999;0.999	D;D;D;D	0.85130	0.997;0.964;0.952;0.921	T	0.63488	-0.6626	10	0.87932	D	0	.	20.3495	0.98807	0.0:0.0:1.0:0.0	.	41;30;41;30	O75167-4;O75167-5;O75167-2;O75167	.;.;.;PHAR2_HUMAN	I	98;30;30;41;41;41;41;41	ENSP00000356556:R98I;ENSP00000391763:R30I;ENSP00000305530:R30I;ENSP00000417038:R41I;ENSP00000356554:R41I	ENSP00000305530:R30I	R	+	2	0	PHACTR2	144074921	1.000000	0.71417	0.991000	0.47740	0.969000	0.65631	6.739000	0.74827	2.814000	0.96858	0.591000	0.81541	AGA	PHACTR2	-	NULL	ENSG00000112419		0.428	PHACTR2-001	KNOWN	basic|CCDS	protein_coding	PHACTR2	HGNC	protein_coding	OTTHUMT00000042528.2	43	0.00	0	G	NM_014721		144033228	144033228	+1	no_errors	ENST00000440869	ensembl	human	known	69_37n	missense	58	20.55	15	SNP	1.000	T
PIK3CA	5290	genome.wustl.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	T	rs121913279		TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr3:178952085A>T	ENST00000263967.3	+	21	3297	c.3140A>T	c.(3139-3141)cAt>cTt	p.H1047L	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)											99.0	89.0	92.0					3																	178952085		1912	4130	6042	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>T	3.37:g.178952085A>T	ENSP00000263967:p.His1047Leu		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.H1047L	ENST00000263967.3	37	c.3140	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	4.518	0.096038	0.08681	.	.	ENSG00000121879	ENST00000263967	T	0.78126	-1.15	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.47002	0.1422	N	0.00611	-1.325	0.80722	D	1	B	0.14438	0.01	B	0.12156	0.007	T	0.58053	-0.7704	10	0.02654	T	1	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	L	1047	ENSP00000263967:H1047L	ENSP00000263967:H1047L	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	43	0.00	0	A			178952085	178952085	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	19	58.70	27	SNP	1.000	T
PRAMEF12	390999	genome.wustl.edu	37	1	12837483	12837483	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr1:12837483G>A	ENST00000357726.4	+	3	1220	c.1193G>A	c.(1192-1194)cGc>cAc	p.R398H		NM_001080830.1	NP_001074299.1	O95522	PRA12_HUMAN	PRAME family member 12	398					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(9)|ovary(3)|skin(1)|urinary_tract(1)	23	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00818)|Colorectal(212;5.04e-06)|Kidney(185;4.99e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000198)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		AACCTGCTGCGCCACACCGTC	0.612																																						dbGAP											0													101.0	109.0	106.0					1																	12837483		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS41254.1	1p36.21	2013-01-17			ENSG00000116726	ENSG00000116726		"""-"""	22125	protein-coding gene	gene with protein product							Standard	NM_001080830		Approved	OTTHUMG00000001927	uc001aui.3	O95522	OTTHUMG00000001927	ENST00000357726.4:c.1193G>A	1.37:g.12837483G>A	ENSP00000350358:p.Arg398His			Missense_Mutation	SNP	NULL	p.R398H	ENST00000357726.4	37	c.1193	CCDS41254.1	1	.	.	.	.	.	.	.	.	.	.	.	12.09	1.834059	0.32421	.	.	ENSG00000116726	ENST00000357726	T	0.49432	0.78	2.72	-4.59	0.03400	.	1.840070	0.03109	N	0.162197	T	0.33411	0.0862	N	0.12663	0.25	0.09310	N	1	D	0.71674	0.998	P	0.54664	0.758	T	0.24548	-1.0157	10	0.13853	T	0.58	.	1.9917	0.03448	0.5218:0.1467:0.1832:0.1482	.	398	O95522	PRA12_HUMAN	H	398	ENSP00000350358:R398H	ENSP00000350358:R398H	R	+	2	0	PRAMEF12	12760070	0.000000	0.05858	0.000000	0.03702	0.139000	0.21198	-0.904000	0.04080	-1.226000	0.02574	0.195000	0.17529	CGC	PRAMEF12	-	NULL	ENSG00000116726		0.612	PRAMEF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF12	HGNC	protein_coding	OTTHUMT00000005457.1	85	0.00	0	G	XM_372760		12837483	12837483	+1	no_errors	ENST00000357726	ensembl	human	known	69_37n	missense	53	34.15	28	SNP	0.000	A
PTPRJ	5795	genome.wustl.edu	37	11	48175418	48175418	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr11:48175418G>A	ENST00000418331.2	+	19	3561	c.3209G>A	c.(3208-3210)cGc>cAc	p.R1070H		NM_002843.3	NP_002834.3	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	1070	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				contact inhibition (GO:0060242)|heart development (GO:0007507)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of vascular permeability (GO:0043116)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of cell adhesion (GO:0045785)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion (GO:0030155)|vasculogenesis (GO:0001570)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|mitogen-activated protein kinase binding (GO:0051019)|phosphatase activity (GO:0016791)|platelet-derived growth factor receptor binding (GO:0005161)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|endometrium(7)|kidney(7)|large_intestine(5)|lung(15)|ovary(1)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						GGAAAGAATCGCTATAATAAT	0.393																																						dbGAP											0													116.0	113.0	114.0					11																	48175418		2201	4298	6499	-	-	-	SO:0001583	missense	0			U10886	CCDS7945.1, CCDS44596.1	11p11.2	2013-02-11			ENSG00000149177	ENSG00000149177		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9673	protein-coding gene	gene with protein product		600925				7937872, 7994032	Standard	NM_001098503		Approved	DEP1, HPTPeta, CD148	uc001ngp.4	Q12913	OTTHUMG00000166573	ENST00000418331.2:c.3209G>A	11.37:g.48175418G>A	ENSP00000400010:p.Arg1070His		Q15255|Q6P4H4|Q8NHM2|Q9UDA9	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.R1070H	ENST00000418331.2	37	c.3209	CCDS7945.1	11	.	.	.	.	.	.	.	.	.	.	G	34	5.394114	0.96009	.	.	ENSG00000149177	ENST00000418331	D	0.90788	-2.73	5.59	5.59	0.84812	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	.	.	.	.	D	0.97801	0.9278	H	0.99705	4.715	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99466	1.0944	9	0.87932	D	0	.	17.1061	0.86664	0.0:0.0:1.0:0.0	.	1070	Q12913	PTPRJ_HUMAN	H	1070	ENSP00000400010:R1070H	ENSP00000400010:R1070H	R	+	2	0	PTPRJ	48131994	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.060000	0.93907	2.622000	0.88805	0.563000	0.77884	CGC	PTPRJ	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000149177		0.393	PTPRJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRJ	HGNC	protein_coding	OTTHUMT00000390525.1	50	0.00	0	G			48175418	48175418	+1	no_errors	ENST00000418331	ensembl	human	known	69_37n	missense	64	15.79	12	SNP	1.000	A
RNF214	257160	genome.wustl.edu	37	11	117109661	117109661	+	Missense_Mutation	SNP	A	A	C			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr11:117109661A>C	ENST00000531452.1	+	3	498	c.452A>C	c.(451-453)gAa>gCa	p.E151A	RNF214_ENST00000530849.1_Intron|RNF214_ENST00000300650.4_Missense_Mutation_p.E151A|RNF214_ENST00000531287.1_Intron	NM_001077239.1|NM_001278249.1	NP_001070707.1|NP_001265178.1	Q8ND24	RN214_HUMAN	ring finger protein 214	151							zinc ion binding (GO:0008270)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	23	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.88e-05)|Epithelial(105;0.000397)|all cancers(92;0.00258)		AATTGCTCTGAAGAGAAATCC	0.532																																						dbGAP											0													53.0	55.0	55.0					11																	117109661		1949	4152	6101	-	-	-	SO:0001583	missense	0			AL834448	CCDS41720.1, CCDS60976.1	11q23.3	2014-02-12	2007-02-16		ENSG00000167257	ENSG00000167257		"""RING-type (C3HC4) zinc fingers"""	25335	protein-coding gene	gene with protein product							Standard	NM_001077239		Approved	DKFZp547C195	uc001pqt.4	Q8ND24	OTTHUMG00000167069	ENST00000531452.1:c.452A>C	11.37:g.117109661A>C	ENSP00000431643:p.Glu151Ala		B2RUW0|B4DTD1	Missense_Mutation	SNP	pfscan_Znf_RING	p.E151A	ENST00000531452.1	37	c.452	CCDS41720.1	11	.	.	.	.	.	.	.	.	.	.	A	18.68	3.675456	0.67928	.	.	ENSG00000167257	ENST00000531452;ENST00000300650	T;T	0.36699	1.24;1.24	5.71	4.55	0.56014	.	0.603508	0.16558	N	0.209160	T	0.48554	0.1506	L	0.44542	1.39	0.32088	N	0.592267	D	0.56035	0.974	D	0.70487	0.969	T	0.54132	-0.8339	9	.	.	.	-7.1722	9.5822	0.39495	0.8233:0.1767:0.0:0.0	.	151	Q8ND24	RN214_HUMAN	A	151	ENSP00000431643:E151A;ENSP00000300650:E151A	.	E	+	2	0	RNF214	116614871	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.516000	0.35856	0.944000	0.37579	0.482000	0.46254	GAA	RNF214	-	NULL	ENSG00000167257		0.532	RNF214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF214	HGNC	protein_coding	OTTHUMT00000392884.1	21	0.00	0	A	NM_001077239		117109661	117109661	+1	no_errors	ENST00000300650	ensembl	human	known	69_37n	missense	8	38.46	5	SNP	1.000	C
RNF8	9025	genome.wustl.edu	37	6	37349063	37349063	+	Silent	SNP	T	T	C			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr6:37349063T>C	ENST00000373479.4	+	7	1567	c.1374T>C	c.(1372-1374)aaT>aaC	p.N458N	RNF8_ENST00000469731.1_Intron	NM_003958.3|NM_183078.2	NP_003949.1|NP_898901.1	O76064	RNF8_HUMAN	ring finger protein 8, E3 ubiquitin protein ligase	458					cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|histone exchange (GO:0043486)|histone H2A K63-linked ubiquitination (GO:0070535)|histone H2A ubiquitination (GO:0033522)|histone H2B ubiquitination (GO:0033523)|interstrand cross-link repair (GO:0036297)|isotype switching (GO:0045190)|mitotic nuclear division (GO:0007067)|negative regulation of translational elongation (GO:0045900)|positive regulation of DNA repair (GO:0045739)|protein autoubiquitination (GO:0051865)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|response to ionizing radiation (GO:0010212)|spermatid development (GO:0007286)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromosome, telomeric region (GO:0000781)|nucleolus (GO:0005730)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)|ubiquitin ligase complex (GO:0000151)	acid-amino acid ligase activity (GO:0016881)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	13						ATTGCATTAATAAGATGGTAA	0.408																																						dbGAP											0													118.0	106.0	110.0					6																	37349063		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB012770	CCDS4833.1, CCDS4834.1	6p21.3	2013-01-09	2012-02-23		ENSG00000112130	ENSG00000112130		"""RING-type (C3HC4) zinc fingers"""	10071	protein-coding gene	gene with protein product		611685	"""ring finger protein (C3HC4 type) 8"", ""ring finger protein 8"""			9734811, 9852682	Standard	NM_003958		Approved	KIAA0646	uc003onq.4	O76064	OTTHUMG00000014620	ENST00000373479.4:c.1374T>C	6.37:g.37349063T>C			A6NN24|A8MYC0|B4DPG0|Q53H16|Q5NKW5	Silent	SNP	pfam_FHA_dom,pfam_Znf_C3HC4_RING-type,superfamily_SMAD_FHA_domain,smart_FHA_dom,smart_Znf_RING,pirsf_E3_Ub_ligase_RNF8,pfscan_FHA_dom,pfscan_Znf_RING	p.N458	ENST00000373479.4	37	c.1374	CCDS4834.1	6																																																																																			RNF8	-	pirsf_E3_Ub_ligase_RNF8	ENSG00000112130		0.408	RNF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF8	HGNC	protein_coding	OTTHUMT00000040403.2	36	0.00	0	T			37349063	37349063	+1	no_errors	ENST00000373479	ensembl	human	known	69_37n	silent	49	19.67	12	SNP	0.997	C
SAGE1	55511	genome.wustl.edu	37	X	134988302	134988302	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chrX:134988302G>T	ENST00000370709.3	+	5	574	c.574G>T	c.(574-576)Gcc>Tcc	p.A192S	SAGE1_ENST00000324447.3_Missense_Mutation_p.A192S|SAGE1_ENST00000537770.1_Intron|SAGE1_ENST00000535938.1_Missense_Mutation_p.A192S			Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1	192						nucleus (GO:0005634)				breast(5)|endometrium(5)|large_intestine(10)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	55	Acute lymphoblastic leukemia(192;0.000127)					TCCTATTCCAGCCATGAGTGC	0.438																																						dbGAP											0													143.0	127.0	133.0					X																	134988302		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ278111	CCDS14652.1	Xq26	2009-03-25			ENSG00000181433	ENSG00000181433			30369	protein-coding gene	gene with protein product	"""cancer/testis antigen 14"""	300359				10919659	Standard	NM_018666		Approved	SAGE, CT14	uc004ezh.3	Q9NXZ1	OTTHUMG00000022496	ENST00000370709.3:c.574G>T	X.37:g.134988302G>T	ENSP00000359743:p.Ala192Ser		Q5JNW0	Missense_Mutation	SNP	NULL	p.A192S	ENST00000370709.3	37	c.574	CCDS14652.1	X	.	.	.	.	.	.	.	.	.	.	G	9.484	1.098961	0.20552	.	.	ENSG00000181433	ENST00000324447;ENST00000535938;ENST00000370709	T;T;T	0.37058	1.22;1.22;1.22	0.892	-1.78	0.07957	.	0.177362	0.37136	U	0.002234	T	0.15955	0.0384	N	0.08118	0	0.09310	N	1	P	0.51537	0.946	P	0.47162	0.54	T	0.33369	-0.9871	9	0.21540	T	0.41	.	.	.	.	.	192	Q9NXZ1	SAGE1_HUMAN	S	192	ENSP00000323191:A192S;ENSP00000445959:A192S;ENSP00000359743:A192S	ENSP00000323191:A192S	A	+	1	0	SAGE1	134815968	0.000000	0.05858	0.002000	0.10522	0.007000	0.05969	-3.064000	0.00622	-1.198000	0.02669	0.190000	0.17370	GCC	SAGE1	-	NULL	ENSG00000181433		0.438	SAGE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAGE1	HGNC	protein_coding	OTTHUMT00000058448.1	65	0.00	0	G	NM_018666		134988302	134988302	+1	no_errors	ENST00000324447	ensembl	human	known	69_37n	missense	74	17.58	16	SNP	0.002	T
SCN9A	6335	genome.wustl.edu	37	2	167163024	167163024	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr2:167163024C>T	ENST00000409435.1	-	3	462	c.463G>A	c.(463-465)Gtc>Atc	p.V155I	SCN9A_ENST00000375387.4_Missense_Mutation_p.V156I|SCN9A_ENST00000303354.6_Missense_Mutation_p.V156I|SCN9A_ENST00000409672.1_Missense_Mutation_p.V155I			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	155					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ACTTACTCGACATTTTTGGTC	0.373																																						dbGAP											0													75.0	75.0	75.0					2																	167163024		1876	4159	6035	-	-	-	SO:0001583	missense	0			X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.463G>A	2.37:g.167163024C>T	ENSP00000386330:p.Val155Ile		A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2	p.V156I	ENST00000409435.1	37	c.466	CCDS46441.1	2	.	.	.	.	.	.	.	.	.	.	c	24.2	4.499588	0.85176	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435;ENST00000454569;ENST00000452182	D;D;D;D;D;D	0.98550	-4.99;-4.99;-4.99;-4.99;-4.99;-4.99	5.96	5.96	0.96718	Ion transport (1);	0.000000	0.56097	D	0.000032	D	0.98874	0.9619	M	0.76727	2.345	0.80722	D	1	D;D;D	0.65815	0.995;0.987;0.957	D;D;P	0.73380	0.966;0.98;0.862	D	0.99218	1.0878	10	0.51188	T	0.08	.	20.4192	0.99033	0.0:1.0:0.0:0.0	.	155;155;156	E7EUN6;Q15858;E9PF08	.;SCN9A_HUMAN;.	I	155;156;156;155;20;20	ENSP00000386306:V155I;ENSP00000364536:V156I;ENSP00000304748:V156I;ENSP00000386330:V155I;ENSP00000413212:V20I;ENSP00000393141:V20I	ENSP00000304748:V156I	V	-	1	0	SCN9A	166871270	1.000000	0.71417	1.000000	0.80357	0.380000	0.30137	4.956000	0.63645	2.831000	0.97527	0.650000	0.86243	GTC	SCN9A	-	pfam_Ion_trans_dom	ENSG00000169432		0.373	SCN9A-004	KNOWN	basic|CCDS	protein_coding	SCN9A	HGNC	protein_coding	OTTHUMT00000333639.1	95	0.00	0	C	NM_002977		167163024	167163024	-1	no_errors	ENST00000303354	ensembl	human	known	69_37n	missense	97	20.33	25	SNP	1.000	T
SEC16B	89866	genome.wustl.edu	37	1	177929522	177929522	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr1:177929522G>T	ENST00000308284.6	-	8	1042	c.953C>A	c.(952-954)tCc>tAc	p.S318Y	SEC16B_ENST00000464631.2_Missense_Mutation_p.S319Y|RP4-798P15.3_ENST00000354921.3_RNA	NM_033127.2	NP_149118.2	Q96JE7	SC16B_HUMAN	SEC16 homolog B (S. cerevisiae)	318					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|peroxisome fission (GO:0016559)|peroxisome organization (GO:0007031)|positive regulation of gene expression (GO:0010628)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endoplasmic reticulum (GO:0070972)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)				central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)|stomach(1)	35						TTGCTCTTCGGAATCATTAAG	0.433																																						dbGAP											0													51.0	47.0	48.0					1																	177929522		1834	4098	5932	-	-	-	SO:0001583	missense	0			AK090411	CCDS44281.1	1q25.2	2012-10-08	2007-06-20	2007-06-20	ENSG00000120341	ENSG00000120341			30301	protein-coding gene	gene with protein product	"""regucalcin gene promotor region related protein"""	612855	"""leucine zipper transcription regulator 2"""	LZTR2		11572484, 11605020	Standard	NM_033127		Approved	RGPR, PGPR-p117	uc001gli.1	Q96JE7	OTTHUMG00000167206	ENST00000308284.6:c.953C>A	1.37:g.177929522G>T	ENSP00000308339:p.Ser318Tyr		A3EYF1|Q5HYF6|Q8N7D6|Q96GX6	Missense_Mutation	SNP	NULL	p.S318Y	ENST00000308284.6	37	c.953	CCDS44281.1	1	.	.	.	.	.	.	.	.	.	.	G	12.62	1.992003	0.35131	.	.	ENSG00000120341	ENST00000308284;ENST00000464631	T;T	0.47528	0.84;0.84	5.9	1.9	0.25705	Sec16, central conserved domain (1);	0.349793	0.27787	N	0.017843	T	0.44180	0.1281	L	0.34521	1.04	0.20821	N	0.999844	P;P;P	0.52316	0.952;0.9;0.747	P;P;P	0.53689	0.732;0.659;0.492	T	0.28459	-1.0043	10	0.56958	D	0.05	-4.2869	7.1095	0.25382	0.1446:0.2643:0.5911:0.0	.	319;319;318	E9PK14;B1AM08;Q96JE7	.;.;SC16B_HUMAN	Y	318;319	ENSP00000308339:S318Y;ENSP00000431727:S319Y	ENSP00000308339:S318Y	S	-	2	0	AL359075.1	176196145	0.997000	0.39634	0.813000	0.32504	0.082000	0.17680	2.447000	0.44917	0.098000	0.17522	-0.133000	0.14855	TCC	SEC16B	-	NULL	ENSG00000120341		0.433	SEC16B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC16B	Clone_based_vega_gene	protein_coding	OTTHUMT00000084773.16	43	0.00	0	G	NM_033127		177929522	177929522	-1	no_errors	ENST00000308284	ensembl	human	known	69_37n	missense	59	19.18	14	SNP	0.650	T
TBC1D8	11138	genome.wustl.edu	37	2	101650087	101650087	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr2:101650087G>C	ENST00000376840.4	-	10	1691	c.1692C>G	c.(1690-1692)ttC>ttG	p.F564L	TBC1D8_ENST00000409318.1_Missense_Mutation_p.F579L			O95759	TBCD8_HUMAN	TBC1 domain family, member 8 (with GRAM domain)	564	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				blood circulation (GO:0008015)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	32						TTTCGTTCTGGAAGGCGGGGT	0.582																																						dbGAP											0													92.0	107.0	102.0					2																	101650087		2201	4300	6501	-	-	-	SO:0001583	missense	0			AB024057	CCDS46375.1	2q12.1	2011-11-30			ENSG00000204634	ENSG00000204634			17791	protein-coding gene	gene with protein product	"""BUB2-like protein 1"", ""vascular Rab-GAP/TBC-containing protein"""					10373574	Standard	NM_001102426		Approved	HBLP1, VRP, AD3	uc010fiv.3	O95759	OTTHUMG00000153040	ENST00000376840.4:c.1692C>G	2.37:g.101650087G>C	ENSP00000366036:p.Phe564Leu		A6NDL4|A8K9W1|B9A6K4|Q53SQ4|Q9UQ32	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_GRAM,superfamily_Rab-GTPase-TBC_dom,smart_GRAM,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.F579L	ENST00000376840.4	37	c.1737	CCDS46375.1	2	.	.	.	.	.	.	.	.	.	.	G	27.2	4.808157	0.90707	.	.	ENSG00000204634	ENST00000376840;ENST00000409318	T;T	0.07908	3.15;3.15	5.12	4.23	0.50019	Rab-GAP/TBC domain (4);	0.158903	0.44688	D	0.000428	T	0.28333	0.0700	M	0.79475	2.455	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.01557	-1.1325	10	0.62326	D	0.03	-28.7703	13.0004	0.58672	0.0776:0.0:0.9224:0.0	.	579;564	B7Z6L4;O95759	.;TBCD8_HUMAN	L	564;579	ENSP00000366036:F564L;ENSP00000386856:F579L	ENSP00000366036:F564L	F	-	3	2	TBC1D8	101016519	1.000000	0.71417	1.000000	0.80357	0.827000	0.46813	5.525000	0.67110	2.377000	0.81083	0.655000	0.94253	TTC	TBC1D8	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000204634		0.582	TBC1D8-011	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D8	HGNC	protein_coding	OTTHUMT00000376092.1	79	0.00	0	G	NM_007063		101650087	101650087	-1	no_errors	ENST00000409318	ensembl	human	known	69_37n	missense	68	15.00	12	SNP	1.000	C
THAP10	56906	genome.wustl.edu	37	15	71175114	71175114	+	Missense_Mutation	SNP	C	C	T	rs544136510		TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr15:71175114C>T	ENST00000249861.4	-	2	1075	c.563G>A	c.(562-564)cGt>cAt	p.R188H	LRRC49_ENST00000544974.2_Intron	NM_020147.3	NP_064532.1	Q9P2Z0	THA10_HUMAN	THAP domain containing 10	188							DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|kidney(1)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	12						ACTACGGTGACGGGGCCTTTT	0.378													C|||	1	0.000199681	0.0	0.0	5008	,	,		20264	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													115.0	113.0	114.0					15																	71175114		2199	4297	6496	-	-	-	SO:0001583	missense	0			AL360202	CCDS10237.1	15q22.32	2013-01-25			ENSG00000129028	ENSG00000129028		"""THAP (C2CH-type zinc finger) domain containing"""	23193	protein-coding gene	gene with protein product		612538				12575992	Standard	NM_020147		Approved		uc002asv.3	Q9P2Z0	OTTHUMG00000133388	ENST00000249861.4:c.563G>A	15.37:g.71175114C>T	ENSP00000249861:p.Arg188His		B2R8R0	Missense_Mutation	SNP	pfam_Znf_C2CH,smart_Znf_C2CH,pfscan_Znf_C2CH	p.R188H	ENST00000249861.4	37	c.563	CCDS10237.1	15	.	.	.	.	.	.	.	.	.	.	C	0.256	-1.002823	0.02128	.	.	ENSG00000129028	ENST00000249861	.	.	.	3.09	-0.0811	0.13704	.	.	.	.	.	T	0.14960	0.0361	N	0.08118	0	0.09310	N	1	B	0.13145	0.007	B	0.01281	0.0	T	0.19095	-1.0316	8	0.39692	T	0.17	.	1.6666	0.02803	0.1291:0.2141:0.4495:0.2073	.	188	Q9P2Z0	THA10_HUMAN	H	188	.	ENSP00000249861:R188H	R	-	2	0	THAP10	68962168	0.226000	0.23696	0.007000	0.13788	0.412000	0.31113	0.135000	0.15952	-0.222000	0.09958	-2.234000	0.00290	CGT	THAP10	-	NULL	ENSG00000129028		0.378	THAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THAP10	HGNC	protein_coding	OTTHUMT00000257242.2	100	0.00	0	C	NM_020147		71175114	71175114	-1	no_errors	ENST00000249861	ensembl	human	known	69_37n	missense	73	25.51	25	SNP	0.129	T
TMED1	11018	genome.wustl.edu	37	19	10943683	10943683	+	Silent	SNP	C	C	T	rs201164097		TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr19:10943683C>T	ENST00000214869.2	-	4	770	c.672G>A	c.(670-672)ccG>ccA	p.P224P	TMED1_ENST00000591695.1_Missense_Mutation_p.R163Q|TMED1_ENST00000588289.1_Silent_p.P79P	NM_006858.2	NP_006849.1	Q13445	TMED1_HUMAN	transmembrane emp24 protein transport domain containing 1	224					cell-cell signaling (GO:0007267)|protein transport (GO:0015031)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|lung(2)|ovary(3)|prostate(1)|skin(1)	10						ACGTGGGCACCGGGCGCTTGT	0.602													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18306	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													42.0	43.0	43.0					19																	10943683		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U41804	CCDS12249.1	19p13.2	2008-02-05	2005-08-26			ENSG00000099203			17291	protein-coding gene	gene with protein product		605395	"""transmembrane emp24 domain containing 1"""			11466339, 8621446	Standard	NM_006858		Approved	ST2L, MGC1270, IL1RL1LG, Il1rl1l	uc002mpy.3	Q13445		ENST00000214869.2:c.672G>A	19.37:g.10943683C>T				Missense_Mutation	SNP	pfam_GOLD,superfamily_GOLD	p.R163Q	ENST00000214869.2	37	c.488	CCDS12249.1	19																																																																																			TMED1	-	NULL	ENSG00000099203		0.602	TMED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMED1	HGNC	protein_coding	OTTHUMT00000452614.1	16	0.00	0	C	NM_006858		10943683	10943683	-1	no_errors	ENST00000591695	ensembl	human	putative	69_37n	missense	9	43.75	7	SNP	0.000	T
TRPS1	7227	genome.wustl.edu	37	8	116426722	116426722	+	Silent	SNP	C	C	A			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr8:116426722C>A	ENST00000220888.5	-	6	3534	c.3375G>T	c.(3373-3375)ccG>ccT	p.P1125P	TRPS1_ENST00000519076.1_Silent_p.P879P|TRPS1_ENST00000395715.3_Silent_p.P1138P|TRPS1_ENST00000520276.1_Silent_p.P1129P			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	1125	Mediates interaction with RNF4. {ECO:0000250}.				chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.P1125P(1)|p.P1138P(1)		autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			TCAAGTAGTGCGGATTCCCAG	0.473									Langer-Giedion syndrome																													dbGAP											2	Substitution - coding silent(2)	endometrium(2)											91.0	90.0	91.0					8																	116426722		1965	4148	6113	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.3375G>T	8.37:g.116426722C>A			B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	pfam_Znf_GATA,smart_Znf_GATA,prints_Znf_GATA,pfscan_Znf_GATA	p.A250S	ENST00000220888.5	37	c.748		8	.	.	.	.	.	.	.	.	.	.	C	2.714	-0.268101	0.05716	.	.	ENSG00000104447	ENST00000518018	.	.	.	5.72	4.84	0.62591	.	.	.	.	.	T	0.60209	0.2251	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58463	-0.7632	4	.	.	.	.	9.3919	0.38378	0.0:0.7969:0.0:0.2031	.	.	.	.	S	250	.	.	A	-	1	0	TRPS1	116495898	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.923000	0.40055	1.412000	0.46977	0.655000	0.94253	GCA	TRPS1	-	NULL	ENSG00000104447		0.473	TRPS1-002	KNOWN	basic	protein_coding	TRPS1	HGNC	protein_coding	OTTHUMT00000286436.3	106	0.00	0	C	NM_014112		116426722	116426722	-1	no_start_codon:pseudogene:no_stop_codon	ENST00000518018	ensembl	human	putative	69_37n	missense	113	13.74	18	SNP	1.000	A
WDR35	57539	genome.wustl.edu	37	2	20145695	20145695	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr2:20145695G>C	ENST00000345530.3	-	17	1845	c.1730C>G	c.(1729-1731)aCg>aGg	p.T577R	WDR35_ENST00000416055.2_Missense_Mutation_p.T142R|WDR35_ENST00000281405.4_Missense_Mutation_p.T566R	NM_001006657.1	NP_001006658.1	Q9P2L0	WDR35_HUMAN	WD repeat domain 35	577					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)				breast(1)|endometrium(5)|kidney(8)|large_intestine(8)|lung(16)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CGTACTGTCCGTTACTCGAGC	0.398																																						dbGAP											0													163.0	151.0	155.0					2																	20145695		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037757	CCDS1695.1, CCDS33152.1	2p24.3	2014-02-21			ENSG00000118965	ENSG00000118965		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	29250	protein-coding gene	gene with protein product		613602				10718198	Standard	NM_001006657		Approved	MGC33196, KIAA1336, IFT121, IFTA1	uc002rdi.3	Q9P2L0	OTTHUMG00000090737	ENST00000345530.3:c.1730C>G	2.37:g.20145695G>C	ENSP00000314444:p.Thr577Arg		B3KVI5|Q4ZG01|Q8NE11	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pirsf_WD_repeat_p35,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T577R	ENST00000345530.3	37	c.1730	CCDS33152.1	2	.	.	.	.	.	.	.	.	.	.	G	14.77	2.633524	0.47049	.	.	ENSG00000118965	ENST00000345530;ENST00000281405;ENST00000416055;ENST00000453014	D;D;D;D	0.92099	-2.97;-2.97;-2.97;-2.97	5.7	4.81	0.61882	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.282341	0.40144	N	0.001163	D	0.91260	0.7245	L	0.60455	1.87	0.25152	N	0.990416	B;P;B;D	0.55385	0.036;0.905;0.004;0.971	B;P;B;P	0.50270	0.043;0.606;0.01;0.636	D	0.83674	0.0168	10	0.14656	T	0.56	-12.0631	13.1877	0.59691	0.0761:0.0:0.9239:0.0	.	577;566;577;142	F8WB94;Q9P2L0-2;Q9P2L0;B3KR94	.;.;WDR35_HUMAN;.	R	577;566;142;112	ENSP00000314444:T577R;ENSP00000281405:T566R;ENSP00000399159:T142R;ENSP00000404409:T112R	ENSP00000281405:T566R	T	-	2	0	WDR35	20009176	0.000000	0.05858	0.995000	0.50966	0.975000	0.68041	0.502000	0.22594	2.690000	0.91761	0.650000	0.86243	ACG	WDR35	-	superfamily_WD40_repeat_dom,pirsf_WD_repeat_p35	ENSG00000118965		0.398	WDR35-001	KNOWN	basic|CCDS	protein_coding	WDR35	HGNC	protein_coding	OTTHUMT00000207472.2	77	0.00	0	G	NM_020779		20145695	20145695	-1	no_errors	ENST00000345530	ensembl	human	known	69_37n	missense	82	16.83	17	SNP	0.231	C
TTN	7273	genome.wustl.edu	37	2	179604866	179604866	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr2:179604866G>T	ENST00000591111.1	-	46	12367	c.12143C>A	c.(12142-12144)gCa>gAa	p.A4048E	TTN_ENST00000359218.5_Missense_Mutation_p.A4127E|TTN_ENST00000460472.2_Missense_Mutation_p.A4002E|TTN_ENST00000342992.6_Intron|TTN_ENST00000342175.6_Missense_Mutation_p.A4194E|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000582847.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.A4365E|TTN-AS1_ENST00000590773.1_RNA			Q8WZ42	TITIN_HUMAN	titin	0					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTCTTTATTGCCACGGGCTC	0.443																																						dbGAP											0													68.0	68.0	68.0					2																	179604866		1852	4097	5949	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.12143C>A	2.37:g.179604866G>T	ENSP00000465570:p.Ala4048Glu		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.A4194E	ENST00000591111.1	37	c.12581		2	.	.	.	.	.	.	.	.	.	.	G	3.187	-0.166634	0.06461	.	.	ENSG00000155657	ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T	0.59638	0.32;0.25;0.25	5.92	-4.04	0.04010	.	.	.	.	.	T	0.33614	0.0869	N	0.17082	0.46	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.27331	-1.0077	9	0.87932	D	0	.	3.7557	0.08585	0.414:0.0784:0.3841:0.1234	.	4002;4127;4194	D3DPF9;E7EQE6;E7ET18	.;.;.	E	4002;4194;4127;4002	ENSP00000434586:A4002E;ENSP00000340554:A4194E;ENSP00000352154:A4127E	ENSP00000340554:A4194E	A	-	2	0	TTN	179313111	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.257000	0.08745	-0.346000	0.08312	0.655000	0.94253	GCA	TTN	-	superfamily_RNaseH-like_dom	ENSG00000155657		0.443	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	58	0.00	0	G	NM_133378		179604866	179604866	-1	no_errors	ENST00000342175	ensembl	human	known	69_37n	missense	45	13.46	7	SNP	0.000	T
XBP1	7494	genome.wustl.edu	37	22	29195125	29195126	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	CT	CT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr22:29195125_29195126delCT	ENST00000216037.6	-	2	315_316	c.243_244delAG	c.(241-246)agagtafs	p.RV81fs	XBP1_ENST00000405219.3_Frame_Shift_Del_p.RV31fs|XBP1_ENST00000344347.5_Frame_Shift_Del_p.RV81fs|CTA-292E10.6_ENST00000451486.1_RNA|CTA-292E10.6_ENST00000418292.1_RNA|CTA-292E10.6_ENST00000458080.1_RNA|CTA-292E10.6_ENST00000585003.1_RNA|XBP1_ENST00000403532.3_Frame_Shift_Del_p.RV81fs	NM_001079539.1|NM_005080.3	NP_001073007.1|NP_005071.2	P17861	XBP1_HUMAN	X-box binding protein 1	81	Basic motif. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cellular response to antibiotic (GO:0071236)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial cell maturation involved in salivary gland development (GO:0060691)|exocrine pancreas development (GO:0031017)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|positive regulation of endoplasmic reticulum unfolded protein response (GO:1900103)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|serotonin secretion, neurotransmission (GO:0060096)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|large_intestine(1)|lung(1)	5						TGAGCTGCTACTCTGTTTTTCA	0.401																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			M31627	CCDS13847.1	22q12.1	2013-01-10			ENSG00000100219	ENSG00000100219		"""basic leucine zipper proteins"""	12801	protein-coding gene	gene with protein product		194355		XBP2		1718857, 2196176	Standard	NM_001079539		Approved		uc003aec.3	P17861	OTTHUMG00000151094	ENST00000216037.6:c.243_244delAG	22.37:g.29195127_29195128delCT	ENSP00000216037:p.Arg81fs		Q8WYK6|Q969P1|Q96BD7	Frame_Shift_Del	DEL	pfam_bZIP_2,pfam_bZIP_1,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.R81fs	ENST00000216037.6	37	c.244_243	CCDS13847.1	22																																																																																			XBP1	-	pfam_bZIP_2,pfam_bZIP_1,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP	ENSG00000100219		0.401	XBP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	XBP1	HGNC	protein_coding	OTTHUMT00000321274.1	55	0.00	0	CT	NM_005080		29195125	29195126	-1	no_errors	ENST00000344347	ensembl	human	known	69_37n	frame_shift_del	64	14.67	11	DEL	1.000:1.000	-
XIRP2	129446	genome.wustl.edu	37	2	168104572	168104572	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr2:168104572G>T	ENST00000409195.1	+	9	6759	c.6670G>T	c.(6670-6672)Gaa>Taa	p.E2224*	XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000295237.9_Nonsense_Mutation_p.E2224*|XIRP2_ENST00000409273.1_Nonsense_Mutation_p.E2002*|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409043.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	2049					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						CAATGTAACAGAAATGAAAGT	0.343																																						dbGAP											0													52.0	47.0	48.0					2																	168104572		1832	4089	5921	-	-	-	SO:0001587	stop_gained	0			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.6670G>T	2.37:g.168104572G>T	ENSP00000386840:p.Glu2224*		A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Nonsense_Mutation	SNP	pfam_Actin-binding_Xin_repeat,superfamily_FH2_actin-bd	p.E2224*	ENST00000409195.1	37	c.6670	CCDS42769.1	2	.	.	.	.	.	.	.	.	.	.	G	44	11.056517	0.99509	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	.	.	.	5.93	2.17	0.27698	.	0.255913	0.39083	N	0.001478	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	-8.4764	7.6682	0.28443	0.4466:0.0:0.5534:0.0	.	.	.	.	X	2224;2224;2002	.	ENSP00000295237:E2224X	E	+	1	0	XIRP2	167812818	0.052000	0.20516	0.759000	0.31340	0.056000	0.15407	0.108000	0.15396	0.421000	0.25980	-0.794000	0.03295	GAA	XIRP2	-	NULL	ENSG00000163092		0.343	XIRP2-001	KNOWN	basic|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333547.1	36	0.00	0	G	NM_152381		168104572	168104572	+1	no_errors	ENST00000295237	ensembl	human	known	69_37n	nonsense	29	17.14	6	SNP	0.094	T
ZNF251	90987	genome.wustl.edu	37	8	145948581	145948581	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr8:145948581A>G	ENST00000292562.7	-	5	739	c.464T>C	c.(463-465)tTg>tCg	p.L155S	ZNF251_ENST00000524394.1_Intron	NM_138367.1	NP_612376.1	Q9BRH9	ZN251_HUMAN	zinc finger protein 251	155					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|kidney(1)|large_intestine(5)|lung(9)|stomach(1)	17	all_cancers(97;3.54e-11)|all_epithelial(106;2.65e-10)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.75e-39)|Epithelial(56;7.54e-38)|all cancers(56;6.19e-33)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.11)	GBM - Glioblastoma multiforme(99;0.198)		GGGTTTGTTCAAACTCTGCCC	0.488																																						dbGAP											0													71.0	71.0	71.0					8																	145948581		1826	4071	5897	-	-	-	SO:0001583	missense	0			AK000435	CCDS47944.1	8q24.3	2013-01-08			ENSG00000198169	ENSG00000198169		"""Zinc fingers, C2H2-type"", ""-"""	13045	protein-coding gene	gene with protein product							Standard	NM_138367		Approved		uc003zdv.4	Q9BRH9	OTTHUMG00000165189	ENST00000292562.7:c.464T>C	8.37:g.145948581A>G	ENSP00000292562:p.Leu155Ser		Q2M219	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L155S	ENST00000292562.7	37	c.464	CCDS47944.1	8	.	.	.	.	.	.	.	.	.	.	A	9.334	1.061285	0.19987	.	.	ENSG00000198169	ENST00000292562	T	0.07327	3.2	1.84	1.84	0.25277	.	.	.	.	.	T	0.04679	0.0127	N	0.14661	0.345	0.09310	N	0.999997	B	0.21905	0.062	B	0.17098	0.017	T	0.43163	-0.9408	9	0.21014	T	0.42	-0.3466	7.6525	0.28356	1.0:0.0:0.0:0.0	.	155	Q9BRH9	ZN251_HUMAN	S	155	ENSP00000292562:L155S	ENSP00000292562:L155S	L	-	2	0	ZNF251	145919390	0.000000	0.05858	0.052000	0.19188	0.207000	0.24258	0.014000	0.13333	1.094000	0.41399	0.379000	0.24179	TTG	ZNF251	-	NULL	ENSG00000198169		0.488	ZNF251-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF251	HGNC	protein_coding	OTTHUMT00000382541.1	40	0.00	0	A	NM_138367		145948581	145948581	-1	no_errors	ENST00000292562	ensembl	human	known	69_37n	missense	42	46.15	36	SNP	0.273	G
ZNF267	10308	genome.wustl.edu	37	16	31926615	31926615	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr16:31926615C>G	ENST00000300870.10	+	4	1254	c.1045C>G	c.(1045-1047)Ccc>Gcc	p.P349A		NM_001265588.1|NM_003414.5	NP_001252517.1|NP_003405	Q14586	ZN267_HUMAN	zinc finger protein 267	349					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(5)|kidney(1)|large_intestine(14)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	41						CGAAGAGAAACCCTGTAAATG	0.363																																						dbGAP											0													114.0	120.0	118.0					16																	31926615		2197	4300	6497	-	-	-	SO:0001583	missense	0			X78925	CCDS32440.1	16p11.2	2013-01-08			ENSG00000185947	ENSG00000185947		"""Zinc fingers, C2H2-type"", ""-"""	13060	protein-coding gene	gene with protein product		604752				7865130	Standard	NM_003414		Approved	HZF2	uc002ecs.5	Q14586		ENST00000300870.10:c.1045C>G	16.37:g.31926615C>G	ENSP00000300870:p.Pro349Ala		A0JNZ9|Q8NE41|Q9NRJ0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P349A	ENST00000300870.10	37	c.1045	CCDS32440.1	16	.	.	.	.	.	.	.	.	.	.	.	7.280	0.608904	0.14066	.	.	ENSG00000185947	ENST00000300870	T	0.20200	2.09	0.458	-0.911	0.10507	Zinc finger, C2H2 (1);	.	.	.	.	T	0.22820	0.0551	M	0.80508	2.5	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.04268	-1.0964	9	0.66056	D	0.02	.	5.9439	0.19207	0.0:0.672:0.328:0.0	.	349	Q14586	ZN267_HUMAN	A	349	ENSP00000300870:P349A	ENSP00000300870:P349A	P	+	1	0	ZNF267	31834116	0.011000	0.17503	0.003000	0.11579	0.003000	0.03518	2.049000	0.41288	-0.463000	0.06973	-0.458000	0.05436	CCC	ZNF267	-	pfscan_Znf_C2H2	ENSG00000185947		0.363	ZNF267-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF267	HGNC	protein_coding	OTTHUMT00000432446.2	47	0.00	0	C	NM_003414		31926615	31926615	+1	no_errors	ENST00000300870	ensembl	human	known	69_37n	missense	41	40.58	28	SNP	0.996	G
ZNF546	339327	genome.wustl.edu	37	19	40521668	40521668	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr19:40521668G>T	ENST00000347077.4	+	7	2707	c.2491G>T	c.(2491-2493)Gaa>Taa	p.E831*	ZNF546_ENST00000600094.1_Nonsense_Mutation_p.E805*|ZNF546_ENST00000596894.1_Intron	NM_178544.3	NP_848639.2	Q86UE3	ZN546_HUMAN	zinc finger protein 546	831					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(15)|lung(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)	34	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					TATTAGTGAGGAAGTCCTATG	0.323																																						dbGAP											0													45.0	49.0	48.0					19																	40521668		2203	4298	6501	-	-	-	SO:0001587	stop_gained	0			BC045649	CCDS12548.1	19q13.2	2013-01-08				ENSG00000187187		"""Zinc fingers, C2H2-type"", ""-"""	28671	protein-coding gene	gene with protein product				ZNF49		12477932	Standard	XM_005258853		Approved	MGC43537	uc002oms.2	Q86UE3		ENST00000347077.4:c.2491G>T	19.37:g.40521668G>T	ENSP00000339823:p.Glu831*		A8K913	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E831*	ENST00000347077.4	37	c.2491	CCDS12548.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|g	33|33	5.263200|5.263200	0.95399|0.95399	.|.	.|.	ENSG00000187187|ENSG00000187187	ENST00000392042|ENST00000347077	.|.	.|.	.|.	2.81|2.81	2.81|2.81	0.32909|0.32909	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.28978|0.28978	N|N	0.888814|0.888814	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|0.02654	.|T	.|1	.|.	5.7627|5.7627	0.18209|0.18209	0.1444:0.0:0.8556:0.0|0.1444:0.0:0.8556:0.0	.|.	.|.	.|.	.|.	.|X	-1|831	.|.	.|ENSP00000339823:E831X	.|E	+|+	.|1	.|0	ZNF546|ZNF546	45213508|45213508	.|.	.|.	0.501000|0.501000	0.27601|0.27601	0.162000|0.162000	0.22319|0.22319	.|.	.|.	1.868000|1.868000	0.54150|0.54150	0.655000|0.655000	0.94253|0.94253	.|GAA	ZNF546	-	pfscan_Znf_C2H2	ENSG00000187187		0.323	ZNF546-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF546	HGNC	protein_coding	OTTHUMT00000462495.2	14	0.00	0	G	NM_178544		40521668	40521668	+1	no_errors	ENST00000347077	ensembl	human	known	69_37n	nonsense	18	28.00	7	SNP	1.000	T
ZNF528	84436	genome.wustl.edu	37	19	52919654	52919654	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E9-A295-01A-11D-A16D-09	TCGA-E9-A295-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f3d5e986-046f-4f75-8abc-67a3b99f742d	cd761feb-9a20-4495-8943-c6243532a5cf	g.chr19:52919654G>T	ENST00000360465.3	+	7	1975	c.1549G>T	c.(1549-1551)Gga>Tga	p.G517*	ZNF528_ENST00000391788.2_3'UTR	NM_032423.2	NP_115799.2	Q3MIS6	ZN528_HUMAN	zinc finger protein 528	517					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(6)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	39				GBM - Glioblastoma multiforme(134;0.00249)|OV - Ovarian serous cystadenocarcinoma(262;0.00817)		AATTCATACAGGAGAAAAGCC	0.388																																						dbGAP											0													54.0	53.0	54.0					19																	52919654		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB058730	CCDS33091.1	19q13	2013-01-08			ENSG00000167555	ENSG00000167555		"""Zinc fingers, C2H2-type"", ""-"""	29384	protein-coding gene	gene with protein product		615580				11347906	Standard	NM_032423		Approved	KIAA1827	uc002pzh.3	Q3MIS6	OTTHUMG00000156494	ENST00000360465.3:c.1549G>T	19.37:g.52919654G>T	ENSP00000353652:p.Gly517*		B3KPN4|Q86T88|Q96JK0	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G517*	ENST00000360465.3	37	c.1549	CCDS33091.1	19	.	.	.	.	.	.	.	.	.	.	G	35	5.446218	0.96187	.	.	ENSG00000167555	ENST00000360465	.	.	.	1.83	1.83	0.25207	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	10.6285	0.45521	0.0:0.0:1.0:0.0	.	.	.	.	X	517	.	ENSP00000353652:G517X	G	+	1	0	ZNF528	57611466	0.004000	0.15560	0.021000	0.16686	0.020000	0.10135	1.332000	0.33805	0.986000	0.38683	0.557000	0.71058	GGA	ZNF528	-	pfscan_Znf_C2H2	ENSG00000167555		0.388	ZNF528-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF528	HGNC	protein_coding	OTTHUMT00000344336.1	42	0.00	0	G	NM_032423		52919654	52919654	+1	no_errors	ENST00000360465	ensembl	human	known	69_37n	nonsense	49	15.52	9	SNP	0.998	T
