#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACACB	32	genome.wustl.edu	37	12	109687895	109687895	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr12:109687895G>T	ENST00000338432.7	+	41	5895	c.5776G>T	c.(5776-5778)Gtc>Ttc	p.V1926F	ACACB_ENST00000377848.3_Missense_Mutation_p.V1926F|ACACB_ENST00000543201.1_Missense_Mutation_p.V592F|ACACB_ENST00000377854.5_Missense_Mutation_p.V1856F			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	1926	Carboxyltransferase.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	CGAAGAGATCGTCACCATTAG	0.418																																						dbGAP											0													118.0	104.0	109.0					12																	109687895		2203	4300	6503	-	-	-	SO:0001583	missense	0			U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.5776G>T	12.37:g.109687895G>T	ENSP00000341044:p.Val1926Phe		A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Missense_Mutation	SNP	pfam_AcCoA_COase_cen,pfam_Carboxyl_trans,pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_Biotin_lipoyl,superfamily_PreATP-grasp_fold,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_COA_CT_N,pfscan_COA_CT_C,pfscan_Biotin_lipoyl	p.V1926F	ENST00000338432.7	37	c.5776	CCDS31898.1	12	.	.	.	.	.	.	.	.	.	.	G	7.171	0.587645	0.13812	.	.	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000377854;ENST00000390027;ENST00000543201;ENST00000396233	D;D;D;D	0.97114	-4.25;-4.25;-4.25;-4.25	5.44	0.456	0.16655	Carboxyl transferase (1);Acetyl-coenzyme A carboxyltransferase, N-terminal (1);	0.237373	0.42548	D	0.000682	D	0.94384	0.8194	N	0.17345	0.48	0.42293	D	0.992145	D	0.67145	0.996	D	0.65773	0.938	D	0.89734	0.3928	10	0.02654	T	1	.	11.2469	0.49002	0.3046:0.0:0.6954:0.0	.	1926	O00763	ACACB_HUMAN	F	1926;1926;1856;1157;592;35	ENSP00000341044:V1926F;ENSP00000367079:V1926F;ENSP00000367085:V1856F;ENSP00000444075:V592F	ENSP00000341044:V1926F	V	+	1	0	ACACB	108172278	0.709000	0.27886	0.139000	0.22197	0.963000	0.63663	1.170000	0.31883	0.098000	0.17522	0.561000	0.74099	GTC	ACACB	-	pfam_Carboxyl_trans,pfscan_COA_CT_N	ENSG00000076555		0.418	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACACB	HGNC	protein_coding	OTTHUMT00000403077.1	48	0.00	0	G	NM_001093		109687895	109687895	+1	no_errors	ENST00000338432	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	0.472	T
ALMS1	7840	genome.wustl.edu	37	2	73800418	73800418	+	Missense_Mutation	SNP	G	G	A	rs201646938	byFrequency	TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr2:73800418G>A	ENST00000264448.6	+	16	11522	c.11411G>A	c.(11410-11412)cGa>cAa	p.R3804Q	ALMS1_ENST00000409009.1_Missense_Mutation_p.R3762Q	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	3804					endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						TCACCCAGACGAATTAAATTA	0.473													G|||	2	0.000399361	0.0015	0.0	5008	,	,		20266	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													106.0	105.0	105.0					2																	73800418		1952	4147	6099	-	-	-	SO:0001583	missense	0			AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.11411G>A	2.37:g.73800418G>A	ENSP00000264448:p.Arg3804Gln		Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	NULL	p.R3804Q	ENST00000264448.6	37	c.11411	CCDS42697.1	2	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	G	15.43	2.831866	0.50845	.	.	ENSG00000116127	ENST00000409009;ENST00000264448	T;T	0.06687	3.27;3.27	5.52	-4.55	0.03441	.	0.700058	0.11797	N	0.528573	T	0.05410	0.0143	L	0.46157	1.445	0.39380	D	0.96624	P;P;P	0.50272	0.824;0.824;0.933	B;B;B	0.36922	0.086;0.086;0.236	T	0.45702	-0.9243	10	0.30854	T	0.27	.	6.62	0.22798	0.5728:0.0:0.2373:0.1899	.	3804;3762;3804	Q8TCU4-3;B8ZZJ3;Q8TCU4	.;.;ALMS1_HUMAN	Q	3762;3804	ENSP00000386627:R3762Q;ENSP00000264448:R3804Q	ENSP00000264448:R3804Q	R	+	2	0	ALMS1	73653926	0.311000	0.24536	0.783000	0.31826	0.935000	0.57460	0.142000	0.16096	-0.986000	0.03498	-0.140000	0.14226	CGA	ALMS1	-	NULL	ENSG00000116127		0.473	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALMS1	HGNC	protein_coding	OTTHUMT00000327776.1	15	0.00	0	G	NM_015120		73800418	73800418	+1	no_errors	ENST00000264448	ensembl	human	known	69_37n	missense	7	41.67	5	SNP	0.601	A
ARMC9	80210	genome.wustl.edu	37	2	232234731	232234732	+	3'UTR	DNP	CC	CC	AA			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr2:232234731_232234732CC>AA	ENST00000483477.1	+	0	2328_2329							Q7Z3E5	ARMC9_HUMAN	armadillo repeat containing 9							extracellular vesicular exosome (GO:0070062)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		Renal(207;0.0112)|all_lung(227;0.0744)|all_hematologic(139;0.0749)|Acute lymphoblastic leukemia(138;0.167)|Medulloblastoma(418;0.184)|Lung NSC(271;0.205)		Epithelial(121;1.43e-10)|LUSC - Lung squamous cell carcinoma(224;0.017)|Lung(119;0.0189)		GGACTGGAACCCACCCAAGGCA	0.639																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			BC004514	CCDS2484.1, CCDS74666.1	2q37.1	2013-02-14			ENSG00000135931	ENSG00000135931		"""Armadillo repeat containing"""	20730	protein-coding gene	gene with protein product						11347906	Standard	NM_025139		Approved	FLJ12584, KIAA1868, ARM, KU-MEL-1	uc031rrs.1	Q7Z3E5	OTTHUMG00000133229	Exception_encountered	2.37:g.232234731_232234732delinsAA			Q53TI3|Q6P162|Q7L594|Q86WG2|Q96JF9|Q9H9R8	RNA	SNP	-	NULL	ENST00000483477.1	37	NULL		2																																																																																			ARMC9	-	-	ENSG00000135931		0.639	ARMC9-003	KNOWN	basic	processed_transcript	ARMC9	HGNC	protein_coding	OTTHUMT00000332953.2	40	0.00	0	C	NM_025139		232234731|232234732	232234731|232234732	+1	no_errors	ENST00000483477	ensembl	human	known	69_37n	rna	45|47	11.76|11.32	6	SNP	0.000	A
ASZ1	136991	genome.wustl.edu	37	7	117008695	117008695	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr7:117008695T>A	ENST00000284629.2	-	11	1194	c.1132A>T	c.(1132-1134)Att>Ttt	p.I378F		NM_130768.2	NP_570124.1			ankyrin repeat, SAM and basic leucine zipper domain containing 1											breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(3)|skin(1)	24	Lung NSC(10;0.00156)|all_lung(10;0.00175)		STAD - Stomach adenocarcinoma(10;0.000512)			AACTCAGTAATAACATTCTGT	0.308																																						dbGAP											0													100.0	107.0	105.0					7																	117008695		2202	4292	6494	-	-	-	SO:0001583	missense	0			AF461259	CCDS5772.1	7q31.2	2013-01-10	2005-03-15	2004-07-16	ENSG00000154438	ENSG00000154438		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	1350	protein-coding gene	gene with protein product		605797	"""ankyrin-like 1"""	C7orf7, ANKL1		12040005, 11279520	Standard	NM_130768		Approved	Orf3, GASZ, ALP1, CT1.19	uc003vjb.2	Q8WWH4	OTTHUMG00000064565	ENST00000284629.2:c.1132A>T	7.37:g.117008695T>A	ENSP00000284629:p.Ile378Phe			Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SAM_2,pfam_SAM_type1,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.I378F	ENST00000284629.2	37	c.1132	CCDS5772.1	7	.	.	.	.	.	.	.	.	.	.	T	20.4	3.988942	0.74589	.	.	ENSG00000154438	ENST00000284629	T	0.30182	1.54	5.2	5.2	0.72013	.	0.287809	0.37437	N	0.002082	T	0.49253	0.1546	L	0.56769	1.78	0.42420	D	0.992636	D;D	0.71674	0.998;0.998	D;D	0.67103	0.949;0.949	T	0.40627	-0.9553	10	0.29301	T	0.29	-0.4577	15.358	0.74443	0.0:0.0:0.0:1.0	.	378;378	B7ZM20;Q8WWH4	.;ASZ1_HUMAN	F	378	ENSP00000284629:I378F	ENSP00000284629:I378F	I	-	1	0	ASZ1	116795931	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.144000	0.42197	2.102000	0.63906	0.459000	0.35465	ATT	ASZ1	-	NULL	ENSG00000154438		0.308	ASZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASZ1	HGNC	protein_coding	OTTHUMT00000138907.7	24	0.00	0	T	NM_130768		117008695	117008695	-1	no_errors	ENST00000284629	ensembl	human	known	69_37n	missense	18	21.74	5	SNP	1.000	A
ATF3	467	genome.wustl.edu	37	1	212793520	212793520	+	3'UTR	SNP	G	G	A	rs142921239	byFrequency	TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr1:212793520G>A	ENST00000341491.4	+	0	1434				ATF3_ENST00000492118.1_3'UTR|ATF3_ENST00000366987.2_3'UTR	NM_001040619.2|NM_001206488.2|NM_001674.3	NP_001035709.1|NP_001193417.2|NP_001665.1	P18847	ATF3_HUMAN	activating transcription factor 3						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|gluconeogenesis (GO:0006094)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)	6				OV - Ovarian serous cystadenocarcinoma(81;0.00628)|all cancers(67;0.0097)|GBM - Glioblastoma multiforme(131;0.0388)|Epithelial(68;0.0933)	Pseudoephedrine(DB00852)	CTGTCACCACGTGCAGTATCT	0.463													G|||	13	0.00259585	0.0008	0.0029	5008	,	,		18675	0.0		0.002	False		,,,				2504	0.0082					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			L19871	CCDS1506.1, CCDS41464.1, CCDS55688.1, CCDS58059.1	1q32.3	2013-01-10			ENSG00000162772	ENSG00000162772		"""basic leucine zipper proteins"""	785	protein-coding gene	gene with protein product		603148				7515060	Standard	NM_001674		Approved		uc021pit.1	P18847	OTTHUMG00000036747	ENST00000341491.4:c.*623G>A	1.37:g.212793520G>A			Q5VTZ2|Q6ICQ9|Q7Z566|Q8WYM6	RNA	SNP	-	NULL	ENST00000341491.4	37	NULL	CCDS1506.1	1																																																																																			ATF3	-	-	ENSG00000162772		0.463	ATF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATF3	HGNC	protein_coding	OTTHUMT00000089296.1	8	0.00	0	G	NM_001674		212793520	212793520	+1	no_errors	ENST00000492118	ensembl	human	known	69_37n	rna	4	71.43	10	SNP	0.000	A
ATG5	9474	genome.wustl.edu	37	6	106649958	106649958	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr6:106649958T>A	ENST00000369076.3	-	7	903	c.580A>T	c.(580-582)Act>Tct	p.T194S	ATG5_ENST00000360666.4_Silent_p.R70R|ATG5_ENST00000475645.1_5'UTR|ATG5_ENST00000343245.3_Missense_Mutation_p.T194S|ATG5_ENST00000369070.1_Missense_Mutation_p.T116S	NM_004849.2	NP_004840.1	Q9H1Y0	ATG5_HUMAN	autophagy related 5	194					apoptotic process (GO:0006915)|autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|blood vessel remodeling (GO:0001974)|heart contraction (GO:0060047)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of type I interferon production (GO:0032480)|negative stranded viral RNA replication (GO:0039689)|otolith development (GO:0048840)|post-translational protein modification (GO:0043687)|regulation of cilium assembly (GO:1902017)|regulation of cytokine secretion involved in immune response (GO:0002739)|response to drug (GO:0042493)|response to fungus (GO:0009620)|vasodilation (GO:0042311)|ventricular cardiac muscle cell development (GO:0055015)	autophagic vacuole (GO:0005776)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|membrane (GO:0016020)|pre-autophagosomal structure membrane (GO:0034045)				endometrium(1)|large_intestine(5)|lung(1)|prostate(1)	8	Breast(9;0.0296)	all_cancers(87;0.000301)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0612)|Lung NSC(302;0.216)	BRCA - Breast invasive adenocarcinoma(8;0.00802)	OV - Ovarian serous cystadenocarcinoma(136;0.128)|Epithelial(106;0.159)|all cancers(137;0.18)		GGTCTTTCAGTCGTTGTCTAT	0.368																																						dbGAP											0													94.0	87.0	89.0					6																	106649958		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y11588	CCDS5055.1, CCDS69159.1, CCDS75498.1	6q21	2014-02-12	2012-06-06	2005-09-11	ENSG00000057663	ENSG00000057663			589	protein-coding gene	gene with protein product		604261	"""APG5 (autophagy 5, S. cerevisiae)-like"", ""APG5 autophagy 5-like (S. cerevisiae)"", ""ATG5 autophagy related 5 homolog (S. cerevisiae)"""	APG5L		9563500, 11349150, 15778222	Standard	NM_001286111		Approved	ASP, APG5, hAPG5	uc003prf.3	Q9H1Y0	OTTHUMG00000016193	ENST00000369076.3:c.580A>T	6.37:g.106649958T>A	ENSP00000358072:p.Thr194Ser		O60875|Q5JVR2|Q68DI4|Q9H2B8|Q9HCZ7	Missense_Mutation	SNP	pfam_Autophagy-rel_prot_5	p.T194S	ENST00000369076.3	37	c.580	CCDS5055.1	6	.	.	.	.	.	.	.	.	.	.	T	9.413	1.081104	0.20309	.	.	ENSG00000057663	ENST00000369076;ENST00000343245;ENST00000369070	.	.	.	5.09	5.09	0.68999	.	0.366363	0.34110	N	0.004242	T	0.10680	0.0261	N	0.03903	-0.33	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.09377	0.002;0.004	T	0.19418	-1.0306	9	0.05351	T	0.99	-9.185	12.8409	0.57802	0.0:0.0:0.0:1.0	.	116;194	Q9H1Y0-2;Q9H1Y0	.;ATG5_HUMAN	S	194;194;116	.	ENSP00000343313:T194S	T	-	1	0	ATG5	106756651	1.000000	0.71417	0.936000	0.37596	0.966000	0.64601	5.967000	0.70403	1.919000	0.55581	0.459000	0.35465	ACT	ATG5	-	pfam_Autophagy-rel_prot_5	ENSG00000057663		0.368	ATG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG5	HGNC	protein_coding	OTTHUMT00000043476.1	26	0.00	0	T	NM_004849		106649958	106649958	-1	no_errors	ENST00000343245	ensembl	human	known	69_37n	missense	22	15.38	4	SNP	0.991	A
BRD2	6046	genome.wustl.edu	37	6	32942393	32942394	+	Frame_Shift_Del	DEL	CC	CC	-	rs529211144		TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	CC	CC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr6:32942393_32942394delCC	ENST00000374825.4	+	3	1885_1886	c.184_185delCC	c.(184-186)ccafs	p.P64fs	BRD2_ENST00000395289.2_Frame_Shift_Del_p.P64fs|XXbac-BPG181M17.6_ENST00000580587.1_RNA|BRD2_ENST00000395287.1_Frame_Shift_Del_p.P64fs|BRD2_ENST00000449085.2_Frame_Shift_Del_p.P17fs|BRD2_ENST00000443797.2_5'UTR|BRD2_ENST00000374831.4_Frame_Shift_Del_p.P64fs	NM_005104.3	NP_005095.1	P25440	BRD2_HUMAN	bromodomain containing 2	64	Poly-Pro.				chromatin modification (GO:0016568)|nucleosome assembly (GO:0006334)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(3)|stomach(2)	5						TGCCAACCCACCACCCCCGGAG	0.53																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			X96670	CCDS4762.1, CCDS56420.1, CCDS56421.1	6p21.3	2010-12-23	2002-01-14		ENSG00000204256	ENSG00000204256			1103	protein-coding gene	gene with protein product		601540	"""bromodomain-containing 2"""			1352711, 8781126	Standard	NM_005104		Approved	KIAA9001, RING3, D6S113E, NAT, FSRG1	uc021ywf.1	P25440	OTTHUMG00000031241	ENST00000374825.4:c.184_185delCC	6.37:g.32942393_32942394delCC	ENSP00000363958:p.Pro64fs		A2AAU0|B0S7P0|B1AZT1|O00699|O00700|Q15310|Q5STC9|Q63HQ9|Q658Y7|Q6P3U2|Q969U4	Frame_Shift_Del	DEL	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.P62fs	ENST00000374825.4	37	c.184_185	CCDS4762.1	6																																																																																			BRD2	-	superfamily_Bromodomain	ENSG00000204256		0.530	BRD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	BRD2	HGNC	protein_coding	OTTHUMT00000076503.2	34	0.00	0	CC			32942393	32942394	+1	no_errors	ENST00000395289	ensembl	human	known	69_37n	frame_shift_del	26	31.58	12	DEL	1.000:1.000	-
ATG5	9474	genome.wustl.edu	37	6	106649961	106649961	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr6:106649961T>A	ENST00000369076.3	-	7	900	c.577A>T	c.(577-579)Acg>Tcg	p.T193S	ATG5_ENST00000360666.4_Missense_Mutation_p.Q69H|ATG5_ENST00000475645.1_5'UTR|ATG5_ENST00000343245.3_Missense_Mutation_p.T193S|ATG5_ENST00000369070.1_Missense_Mutation_p.T115S	NM_004849.2	NP_004840.1	Q9H1Y0	ATG5_HUMAN	autophagy related 5	193					apoptotic process (GO:0006915)|autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|blood vessel remodeling (GO:0001974)|heart contraction (GO:0060047)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of type I interferon production (GO:0032480)|negative stranded viral RNA replication (GO:0039689)|otolith development (GO:0048840)|post-translational protein modification (GO:0043687)|regulation of cilium assembly (GO:1902017)|regulation of cytokine secretion involved in immune response (GO:0002739)|response to drug (GO:0042493)|response to fungus (GO:0009620)|vasodilation (GO:0042311)|ventricular cardiac muscle cell development (GO:0055015)	autophagic vacuole (GO:0005776)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|membrane (GO:0016020)|pre-autophagosomal structure membrane (GO:0034045)				endometrium(1)|large_intestine(5)|lung(1)|prostate(1)	8	Breast(9;0.0296)	all_cancers(87;0.000301)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0612)|Lung NSC(302;0.216)	BRCA - Breast invasive adenocarcinoma(8;0.00802)	OV - Ovarian serous cystadenocarcinoma(136;0.128)|Epithelial(106;0.159)|all cancers(137;0.18)		CTTTCAGTCGTTGTCTATTTG	0.383																																						dbGAP											0													88.0	83.0	85.0					6																	106649961		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y11588	CCDS5055.1, CCDS69159.1, CCDS75498.1	6q21	2014-02-12	2012-06-06	2005-09-11	ENSG00000057663	ENSG00000057663			589	protein-coding gene	gene with protein product		604261	"""APG5 (autophagy 5, S. cerevisiae)-like"", ""APG5 autophagy 5-like (S. cerevisiae)"", ""ATG5 autophagy related 5 homolog (S. cerevisiae)"""	APG5L		9563500, 11349150, 15778222	Standard	NM_001286111		Approved	ASP, APG5, hAPG5	uc003prf.3	Q9H1Y0	OTTHUMG00000016193	ENST00000369076.3:c.577A>T	6.37:g.106649961T>A	ENSP00000358072:p.Thr193Ser		O60875|Q5JVR2|Q68DI4|Q9H2B8|Q9HCZ7	Missense_Mutation	SNP	pfam_Autophagy-rel_prot_5	p.T193S	ENST00000369076.3	37	c.577	CCDS5055.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.01|11.01	1.514167|1.514167	0.27123|0.27123	.|.	.|.	ENSG00000057663|ENSG00000057663	ENST00000360666|ENST00000369076;ENST00000343245;ENST00000369070	.|.	.|.	.|.	5.09|5.09	5.09|5.09	0.68999|0.68999	.|.	.|0.337981	.|0.36628	.|N	.|0.002489	T|T	0.10294|0.10294	0.0252|0.0252	N|N	0.20766|0.20766	0.605|0.605	0.23889|0.23889	N|N	0.99655|0.99655	B|B;B	0.31351|0.09022	0.32|0.002;0.001	B|B;B	0.34138|0.11329	0.176|0.003;0.006	T|T	0.16100|0.16100	-1.0414|-1.0414	8|9	0.39692|0.07644	T|T	0.17|0.81	-11.7045|-11.7045	12.8409|12.8409	0.57802|0.57802	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	69|115;193	Q7Z3H3|Q9H1Y0-2;Q9H1Y0	.|.;ATG5_HUMAN	H|S	69|193;193;115	.|.	ENSP00000353884:Q69H|ENSP00000343313:T193S	Q|T	-|-	3|1	2|0	ATG5|ATG5	106756654|106756654	1.000000|1.000000	0.71417|0.71417	0.687000|0.687000	0.30102|0.30102	0.959000|0.959000	0.62525|0.62525	5.967000|5.967000	0.70403|0.70403	1.919000|1.919000	0.55581|0.55581	0.459000|0.459000	0.35465|0.35465	CAA|ACG	ATG5	-	pfam_Autophagy-rel_prot_5	ENSG00000057663		0.383	ATG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG5	HGNC	protein_coding	OTTHUMT00000043476.1	26	0.00	0	T	NM_004849		106649961	106649961	-1	no_errors	ENST00000343245	ensembl	human	known	69_37n	missense	21	16.00	4	SNP	0.961	A
DDIAS	220042	genome.wustl.edu	37	11	82644836	82644836	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr11:82644836C>G	ENST00000533655.1	+	6	2668	c.2456C>G	c.(2455-2457)gCc>gGc	p.A819G	C11orf82_ENST00000430323.2_Missense_Mutation_p.A819G|C11orf82_ENST00000525361.1_Intron|C11orf82_ENST00000528759.1_3'UTR|C11orf82_ENST00000329143.3_Missense_Mutation_p.A518G	NM_145018.3	NP_659455.3	Q8IXT1	DDIAS_HUMAN		819					apoptotic process (GO:0006915)|cellular response to cytokine stimulus (GO:0071345)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to hydroperoxide (GO:0071447)|cellular response to UV (GO:0034644)|hemopoiesis (GO:0030097)|mitotic cell cycle arrest (GO:0071850)|negative regulation of fibroblast apoptotic process (GO:2000270)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.A819V(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(17)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	33						AAACAGCAAGCCAGCCCAAGC	0.368																																						dbGAP											1	Substitution - Missense(1)	skin(1)											28.0	30.0	29.0					11																	82644836		2202	4296	6498	-	-	-	SO:0001583	missense	0																														ENST00000533655.1:c.2456C>G	11.37:g.82644836C>G	ENSP00000435421:p.Ala819Gly		Q96LK6|Q9H856	Missense_Mutation	SNP	pfam_Rep_factor-A_C,superfamily_NA-bd_OB-fold-like	p.A819G	ENST00000533655.1	37	c.2456	CCDS8263.1	11	.	.	.	.	.	.	.	.	.	.	C	14.56	2.570405	0.45798	.	.	ENSG00000165490	ENST00000430323;ENST00000533655;ENST00000329143	T;T;T	0.25414	2.1;2.1;1.8	6.16	4.27	0.50696	.	0.508271	0.18885	N	0.128478	T	0.23133	0.0559	M	0.62723	1.935	0.09310	N	1	B	0.29909	0.261	B	0.24269	0.052	T	0.16512	-1.0400	9	.	.	.	.	7.4307	0.27126	0.0:0.7152:0.139:0.1457	.	819	Q8IXT1	NOXIN_HUMAN	G	819;819;518	ENSP00000414687:A819G;ENSP00000435421:A819G;ENSP00000329930:A518G	.	A	+	2	0	C11orf82	82322484	0.002000	0.14202	0.001000	0.08648	0.830000	0.47004	1.367000	0.34204	0.906000	0.36621	0.650000	0.86243	GCC	C11orf82	-	NULL	ENSG00000165490		0.368	C11orf82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf82	HGNC	protein_coding	OTTHUMT00000391936.1	23	0.00	0	C			82644836	82644836	+1	no_errors	ENST00000430323	ensembl	human	known	69_37n	missense	17	22.73	5	SNP	0.001	G
CACTIN	58509	genome.wustl.edu	37	19	3619189	3619189	+	Silent	SNP	G	G	A			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr19:3619189G>A	ENST00000429344.2	-	5	988	c.936C>T	c.(934-936)gcC>gcT	p.A312A	CACTIN_ENST00000221899.3_Silent_p.A244A|CACTIN_ENST00000248420.5_Silent_p.A312A	NM_001080543.1	NP_001074012.1	Q8WUQ7	CATIN_HUMAN	cactin, spliceosome C complex subunit	312					cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)										TGATGTACTTGGCCAGCAGGT	0.642																																						dbGAP											0													66.0	69.0	68.0					19																	3619189		2152	4255	6407	-	-	-	SO:0001819	synonymous_variant	0			BC019848	CCDS45920.1	19p13.3	2012-06-08	2012-06-08	2012-06-08	ENSG00000105298	ENSG00000105298			29938	protein-coding gene	gene with protein product	"""NY REN 24 antigen"", ""functional spliceosome-associated protein c"", ""cactin homolog (Drosophila)"""		"""chromosome 19 open reading frame 29"""	C19orf29		8619474, 9110174, 21429463, 20829348	Standard	NM_001080543		Approved	NY-REN-24, fSAPc, cactin	uc002lyh.3	Q8WUQ7		ENST00000429344.2:c.936C>T	19.37:g.3619189G>A			A6NNA9|A9UL12|O75229|Q7LE08|Q9BTA6|Q9Y5A4	Nonsense_Mutation	SNP	pfam_Cactin_dom	p.Q1*	ENST00000429344.2	37	c.1	CCDS45920.1	19																																																																																			CACTIN	-	NULL	ENSG00000105298		0.642	CACTIN-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	CACTIN	HGNC	protein_coding	OTTHUMT00000457370.2	43	0.00	0	G			3619189	3619189	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000589321	ensembl	human	known	69_37n	nonsense	35	12.50	5	SNP	1.000	A
CELA2B	51032	genome.wustl.edu	37	1	15807633	15807633	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr1:15807633C>A	ENST00000375910.3	+	3	195	c.170C>A	c.(169-171)aCc>aAc	p.T57N	CELA2B_ENST00000494280.1_3'UTR	NM_015849.2	NP_056933	P08218	CEL2B_HUMAN	chymotrypsin-like elastase family, member 2B	57	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)	8						TGGTACCACACCTGCGGAGGG	0.622																																						dbGAP											0													129.0	113.0	118.0					1																	15807633		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS30605.1	1p36.21	2009-07-09			ENSG00000215704	ENSG00000215704			29995	protein-coding gene	gene with protein product	"""pancreatic elastase IIB"""	609444				3646943, 16327289	Standard	NM_015849		Approved	RP11-265F14.2, ELA2B	uc001awl.3	P08218	OTTHUMG00000002259	ENST00000375910.3:c.170C>A	1.37:g.15807633C>A	ENSP00000365075:p.Thr57Asn		Q14D16|Q6ISM5|Q96QV5	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.T57N	ENST00000375910.3	37	c.170	CCDS30605.1	1	.	.	.	.	.	.	.	.	.	.	C	13.39	2.222562	0.39300	.	.	ENSG00000215704	ENST00000375910;ENST00000375909;ENST00000422901	D;D	0.89270	-2.49;-2.49	4.0	3.07	0.35406	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.102905	0.40554	N	0.001075	T	0.79639	0.4480	N	0.05199	-0.095	0.33172	D	0.548438	P	0.35780	0.52	B	0.41666	0.363	D	0.83960	0.0321	10	0.66056	D	0.02	.	11.1566	0.48491	0.1846:0.8154:0.0:0.0	.	57	P08218	CEL2B_HUMAN	N	57;29;41	ENSP00000365075:T57N;ENSP00000399811:T41N	ENSP00000365074:T29N	T	+	2	0	CELA2B	15680220	1.000000	0.71417	1.000000	0.80357	0.632000	0.37999	2.705000	0.47127	0.992000	0.38840	0.603000	0.83216	ACC	CELA2B	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000215704		0.622	CELA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELA2B	HGNC	protein_coding	OTTHUMT00000006448.1	44	0.00	0	C	NM_015849		15807633	15807633	+1	no_errors	ENST00000375910	ensembl	human	known	69_37n	missense	26	54.39	31	SNP	1.000	A
CHERP	10523	genome.wustl.edu	37	19	16641615	16641615	+	Frame_Shift_Del	DEL	C	C	-			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr19:16641615delC	ENST00000198939.6	-	6	820	c.784delG	c.(784-786)gccfs	p.A262fs	CTD-3222D19.2_ENST00000409035.1_Intron|CHERP_ENST00000546361.2_Frame_Shift_Del_p.A251fs					calcium homeostasis endoplasmic reticulum protein											endometrium(3)|kidney(2)|large_intestine(4)|lung(9)|ovary(2)|stomach(1)|urinary_tract(3)	24						TCCTCCACGGCCAAGAAGCTG	0.682																																						dbGAP											0													43.0	49.0	47.0					19																	16641615		1978	4150	6128	-	-	-	SO:0001589	frameshift_variant	0			U94836	CCDS42518.1	19p13.1	2013-01-28				ENSG00000085872		"""G patch domain containing"""	16930	protein-coding gene	gene with protein product						8896557, 10794731	Standard	NM_006387		Approved	ERPROT213-21, DAN16	uc002nei.1	Q8IWX8	OTTHUMG00000169304	ENST00000198939.6:c.784delG	19.37:g.16641615delC	ENSP00000198939:p.Ala262fs			Frame_Shift_Del	DEL	pfam_Surp,pfam_G_patch_dom,pfam_RNA_pol_II-bd,superfamily_Surp,superfamily_ENTH_VHS,smart_Surp,smart_G_patch_dom,pfscan_Surp,pfscan_G_patch_dom	p.A251fs	ENST00000198939.6	37	c.751		19																																																																																			CHERP	-	pfam_RNA_pol_II-bd,superfamily_ENTH_VHS	ENSG00000085872		0.682	CHERP-003	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	CHERP	HGNC	protein_coding	OTTHUMT00000403372.1	70	0.00	0	C	NM_006387		16641615	16641615	-1	no_errors	ENST00000546361	ensembl	human	known	69_37n	frame_shift_del	52	20.90	14	DEL	1.000	-
CRISPLD2	83716	genome.wustl.edu	37	16	84884220	84884220	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr16:84884220G>T	ENST00000262424.5	+	5	763	c.539G>T	c.(538-540)tGc>tTc	p.C180F	CRISPLD2_ENST00000564567.1_Missense_Mutation_p.C180F|CRISPLD2_ENST00000567845.1_Missense_Mutation_p.C180F|AC025280.1_ENST00000584136.1_RNA|CRISPLD2_ENST00000566431.1_3'UTR	NM_031476.3	NP_113664.1	Q9H0B8	CRLD2_HUMAN	cysteine-rich secretory protein LCCL domain containing 2	180	SCP.				extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|lung development (GO:0030324)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|transport vesicle (GO:0030133)	heparin binding (GO:0008201)			endometrium(3)|large_intestine(5)|lung(8)|prostate(1)|stomach(1)	18						GTGAACACCTGCCGGAAGATG	0.483																																						dbGAP											0													168.0	153.0	158.0					16																	84884220		2199	4300	6499	-	-	-	SO:0001583	missense	0			AL136861	CCDS10949.1	16q24.1	2008-02-05	2005-02-16	2005-02-16	ENSG00000103196	ENSG00000103196			25248	protein-coding gene	gene with protein product		612434	"""LCCL domain containing cysteine-rich secretory protein 2"""	LCRISP2		11230166	Standard	NM_031476		Approved	DKFZP434B044	uc010voh.1	Q9H0B8	OTTHUMG00000137644	ENST00000262424.5:c.539G>T	16.37:g.84884220G>T	ENSP00000262424:p.Cys180Phe		D3DUM0|Q6P590|Q6UWH0|Q6UXC6|Q96IB1|Q96K61	Missense_Mutation	SNP	pfam_LCCL,pfam_CAP_domain,superfamily_CAP_domain,superfamily_LCCL,smart_Allrgn_V5/Tpx1,smart_LCCL,pfscan_LCCL,prints_Allrgn_V5/Tpx1	p.C180F	ENST00000262424.5	37	c.539	CCDS10949.1	16	.	.	.	.	.	.	.	.	.	.	G	23.9	4.468353	0.84533	.	.	ENSG00000103196	ENST00000262424	T	0.14391	2.51	5.84	5.84	0.93424	CAP domain (3);	0.000000	0.85682	D	0.000000	T	0.47040	0.1424	M	0.88181	2.935	0.80722	D	1	P;D;D	0.89917	0.513;1.0;1.0	D;D;D	0.91635	0.914;0.999;0.999	T	0.52373	-0.8584	10	0.87932	D	0	.	18.7059	0.91639	0.0:0.0:1.0:0.0	.	180;180;180	Q9H0B8;Q9H0B8-2;Q9H0B8-3	CRLD2_HUMAN;.;.	F	180	ENSP00000262424:C180F	ENSP00000262424:C180F	C	+	2	0	CRISPLD2	83441721	1.000000	0.71417	0.999000	0.59377	0.822000	0.46500	9.306000	0.96204	2.768000	0.95171	0.561000	0.74099	TGC	CRISPLD2	-	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1	ENSG00000103196		0.483	CRISPLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRISPLD2	HGNC	protein_coding	OTTHUMT00000269086.2	63	0.00	0	G	NM_031476		84884220	84884220	+1	no_errors	ENST00000262424	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	1.000	T
CSMD1	64478	genome.wustl.edu	37	8	2967826	2967826	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr8:2967826G>T	ENST00000520002.1	-	44	7020	c.6465C>A	c.(6463-6465)aaC>aaA	p.N2155K	CSMD1_ENST00000537824.1_Missense_Mutation_p.N2154K|CSMD1_ENST00000602723.1_Missense_Mutation_p.N2155K|CSMD1_ENST00000400186.3_Missense_Mutation_p.N2155K|CSMD1_ENST00000542608.1_Missense_Mutation_p.N2154K|CSMD1_ENST00000602557.1_Missense_Mutation_p.N2155K			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2155	CUB 13. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		AGATGGTGCCGTTCTGAGAAG	0.473																																						dbGAP											0													82.0	80.0	81.0					8																	2967826		1916	4129	6045	-	-	-	SO:0001583	missense	0					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.6465C>A	8.37:g.2967826G>T	ENSP00000430733:p.Asn2155Lys		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.N2155K	ENST00000520002.1	37	c.6465		8	.	.	.	.	.	.	.	.	.	.	G	13.45	2.240176	0.39598	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608	T;T;T;T	0.27104	1.69;1.69;1.69;1.69	5.2	-4.3	0.03710	CUB (5);	0.000000	0.85682	D	0.000000	T	0.42787	0.1218	M	0.62016	1.91	0.80722	D	1	D;D;D	0.89917	0.999;0.998;1.0	D;D;D	0.91635	0.996;0.98;0.999	T	0.30880	-0.9963	10	0.87932	D	0	.	14.8123	0.70006	0.8023:0.0:0.1977:0.0	.	2155;2155;2154	E5RIG2;Q96PZ7;F5H2I8	.;CSMD1_HUMAN;.	K	2155;2155;2016;2154;2154	ENSP00000383047:N2155K;ENSP00000430733:N2155K;ENSP00000441462:N2154K;ENSP00000446243:N2154K	ENSP00000320445:N2016K	N	-	3	2	CSMD1	2955233	0.950000	0.32346	0.061000	0.19648	0.185000	0.23345	0.207000	0.17395	-1.415000	0.02022	-1.667000	0.00748	AAC	CSMD1	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000183117		0.473	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	HGNC	protein_coding	OTTHUMT00000374500.2	29	0.00	0	G	NM_033225		2967826	2967826	-1	no_errors	ENST00000520002	ensembl	human	known	69_37n	missense	20	16.67	4	SNP	0.953	T
DAB2	1601	genome.wustl.edu	37	5	39376958	39376958	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr5:39376958C>A	ENST00000320816.6	-	12	2398	c.1931G>T	c.(1930-1932)gGg>gTg	p.G644V	DAB2_ENST00000509337.1_Missense_Mutation_p.G623V|DAB2_ENST00000545653.1_Missense_Mutation_p.G623V|DAB2_ENST00000339788.6_Missense_Mutation_p.G426V	NM_001343.3	NP_001334.2	P98082	DAB2_HUMAN	Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)	644	Sufficient for interaction with GRB2. {ECO:0000250}.				activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cell morphogenesis involved in differentiation (GO:0000904)|cell proliferation (GO:0008283)|cellular response to transforming growth factor beta stimulus (GO:0071560)|clathrin coat assembly (GO:0048268)|endoderm development (GO:0007492)|excretion (GO:0007588)|in utero embryonic development (GO:0001701)|leading edge cell differentiation (GO:0035026)|membrane organization (GO:0061024)|myeloid cell differentiation (GO:0030099)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein binding (GO:0032091)|negative regulation of protein localization to plasma membrane (GO:1903077)|negative regulation of transcription, DNA-templated (GO:0045892)|pinocytosis (GO:0006907)|positive regulation of cell migration (GO:0030335)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of endocytosis (GO:0045807)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor recycling (GO:0001921)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|clathrin coat of coated pit (GO:0030132)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	cargo receptor activity (GO:0038024)|clathrin adaptor activity (GO:0035615)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein C-terminus binding (GO:0008022)|SMAD binding (GO:0046332)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(9)|lung(19)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	47	all_lung(31;0.000197)		Epithelial(62;0.137)			CTCTTTATCCCCAAGTGGGTC	0.557											OREG0016586	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													58.0	63.0	61.0					5																	39376958		2203	4300	6503	-	-	-	SO:0001583	missense	0			U53446	CCDS34149.1, CCDS58946.1	5p13.1	2013-10-03	2013-03-08		ENSG00000153071	ENSG00000153071			2662	protein-coding gene	gene with protein product		601236	"""disabled (Drosophila) homolog 2 (mitogen-responsive phosphoprotein)"", ""disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)"""			8660969, 9620555	Standard	NM_001343		Approved	DOC-2	uc003jlx.3	P98082	OTTHUMG00000162043	ENST00000320816.6:c.1931G>T	5.37:g.39376958C>A	ENSP00000313391:p.Gly644Val	885	A6NES5|Q13598|Q9BTY0|Q9UK04	Missense_Mutation	SNP	pfam_PTyr_interaction_dom,smart_PTyr_interaction_dom,pfscan_PTyr_interaction_dom	p.G644V	ENST00000320816.6	37	c.1931	CCDS34149.1	5	.	.	.	.	.	.	.	.	.	.	C	19.89	3.910192	0.72983	.	.	ENSG00000153071	ENST00000320816;ENST00000339788;ENST00000545653;ENST00000509337	T;T;T;T	0.50277	0.75;0.75;0.75;0.75	5.09	4.21	0.49690	.	0.051536	0.85682	D	0.000000	T	0.66858	0.2832	M	0.72894	2.215	0.80722	D	1	D;D	0.63880	0.993;0.993	D;D	0.71656	0.943;0.974	T	0.71265	-0.4644	10	0.72032	D	0.01	-2.4264	15.1362	0.72569	0.0:0.839:0.161:0.0	.	644;623	P98082;P98082-3	DAB2_HUMAN;.	V	644;426;623;623	ENSP00000313391:G644V;ENSP00000345508:G426V;ENSP00000439919:G623V;ENSP00000426245:G623V	ENSP00000313391:G644V	G	-	2	0	DAB2	39412715	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	4.588000	0.60999	1.098000	0.41479	0.655000	0.94253	GGG	DAB2	-	NULL	ENSG00000153071		0.557	DAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAB2	HGNC	protein_coding	OTTHUMT00000367014.1	63	0.00	0	C	NM_001343		39376958	39376958	-1	no_errors	ENST00000320816	ensembl	human	known	69_37n	missense	41	32.79	20	SNP	1.000	A
DCTN2	10540	genome.wustl.edu	37	12	57932304	57932304	+	Intron	SNP	G	G	A			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr12:57932304G>A	ENST00000548249.1	-	3	373				DCTN2_ENST00000543672.1_Intron|DCTN2_ENST00000537439.1_Intron|DCTN2_ENST00000551400.1_5'UTR|DCTN2_ENST00000434715.3_Silent_p.L40L	NM_001261412.1|NM_001261413.1	NP_001248341.1|NP_001248342.1	Q13561	DCTN2_HUMAN	dynactin 2 (p50)						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|vesicle (GO:0031982)	motor activity (GO:0003774)|spectrin binding (GO:0030507)			endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|upper_aerodigestive_tract(2)	11						CTTCTTACCAGCTCCTTGTGG	0.418																																						dbGAP											0													51.0	50.0	50.0					12																	57932304		1859	4109	5968	-	-	-	SO:0001627	intron_variant	0			U50733	CCDS44930.1, CCDS58245.1, CCDS73489.1	12q13.3	2008-05-14				ENSG00000175203			2712	protein-coding gene	gene with protein product		607376				8647893	Standard	NM_001261412		Approved	RBP50, DCTN-50	uc001som.2	Q13561	OTTHUMG00000170124	ENST00000548249.1:c.106-2676C>T	12.37:g.57932304G>A			B2RBK5|Q86YN2|Q9BW17	Silent	SNP	pfam_Dynamitin_2su	p.L40	ENST00000548249.1	37	c.118	CCDS58245.1	12																																																																																			DCTN2	-	pfam_Dynamitin_2su	ENSG00000175203		0.418	DCTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCTN2	HGNC	protein_coding	OTTHUMT00000407393.2	20	0.00	0	G	NM_006400		57932304	57932304	-1	no_errors	ENST00000434715	ensembl	human	known	69_37n	silent	25	30.56	11	SNP	1.000	A
DOPEY1	23033	genome.wustl.edu	37	6	83847275	83847275	+	Missense_Mutation	SNP	A	A	C			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr6:83847275A>C	ENST00000349129.2	+	21	3774	c.3514A>C	c.(3514-3516)Aca>Cca	p.T1172P	DOPEY1_ENST00000369739.3_Missense_Mutation_p.T1163P|DOPEY1_ENST00000237163.5_Missense_Mutation_p.T1153P	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	1172					protein transport (GO:0015031)					breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		TGCATCAGTTACATCTCAATT	0.403																																						dbGAP											0													93.0	92.0	92.0					6																	83847275		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.3514A>C	6.37:g.83847275A>C	ENSP00000195654:p.Thr1172Pro		Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Missense_Mutation	SNP	pfam_Dopey_N,superfamily_ARM-type_fold	p.T1172P	ENST00000349129.2	37	c.3514	CCDS4996.1	6	.	.	.	.	.	.	.	.	.	.	A	0.762	-0.768892	0.02974	.	.	ENSG00000083097	ENST00000349129;ENST00000237163;ENST00000369739	T;T	0.23348	1.91;1.92	5.69	0.446	0.16602	.	0.396217	0.28262	N	0.015994	T	0.04272	0.0118	N	0.19112	0.55	0.19945	N	0.999948	B;B;B	0.33448	0.203;0.412;0.167	B;B;B	0.28011	0.085;0.062;0.039	T	0.32693	-0.9897	10	0.42905	T	0.14	.	6.5256	0.22299	0.6269:0.2441:0.129:0.0	.	1063;1163;1172	E1P545;B2RWN9;Q5JWR5	.;.;DOP1_HUMAN	P	1172;1153;1153	ENSP00000195654:T1172P;ENSP00000237163:T1153P	ENSP00000237163:T1153P	T	+	1	0	DOPEY1	83903994	0.043000	0.20138	0.019000	0.16419	0.334000	0.28698	0.707000	0.25704	-0.135000	0.11495	-0.467000	0.05162	ACA	DOPEY1	-	superfamily_ARM-type_fold	ENSG00000083097		0.403	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DOPEY1	HGNC	protein_coding	OTTHUMT00000043785.2	21	0.00	0	A	NM_015018		83847275	83847275	+1	no_errors	ENST00000349129	ensembl	human	known	69_37n	missense	16	50.00	16	SNP	0.006	C
E4F1	1877	genome.wustl.edu	37	16	2283116	2283116	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr16:2283116A>G	ENST00000301727.4	+	7	1036	c.988A>G	c.(988-990)Acc>Gcc	p.T330A	DNASE1L2_ENST00000564065.1_5'Flank|RP11-304L19.12_ENST00000564055.1_lincRNA|E4F1_ENST00000565090.1_Missense_Mutation_p.T330A|E4F1_ENST00000564139.1_Missense_Mutation_p.T330A	NM_004424.3	NP_004415.2	Q66K89	E4F1_HUMAN	E4F transcription factor 1	330					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|mitotic cell cycle arrest (GO:0071850)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|regulation of cell cycle process (GO:0010564)|regulation of growth (GO:0040008)|regulation of mitotic cell cycle, embryonic (GO:0009794)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	cAMP response element binding (GO:0035497)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			ovary(1)	1						TGCCAAGGGCACCGTCATCCA	0.647																																						dbGAP											0													101.0	100.0	100.0					16																	2283116		2198	4300	6498	-	-	-	SO:0001583	missense	0			U87269	CCDS32370.1, CCDS73809.1, CCDS73810.1	16p13.3	2013-01-08				ENSG00000167967		"""Zinc fingers, C2H2-type"""	3121	protein-coding gene	gene with protein product		603022				9763670, 8828041	Standard	XM_005255155		Approved	E4F	uc002cpm.3	Q66K89		ENST00000301727.4:c.988A>G	16.37:g.2283116A>G	ENSP00000301727:p.Thr330Ala		A8K2R4|O00146	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T330A	ENST00000301727.4	37	c.988	CCDS32370.1	16	.	.	.	.	.	.	.	.	.	.	A	10.54	1.379391	0.24944	.	.	ENSG00000167967	ENST00000301727	T	0.06218	3.33	5.31	5.31	0.75309	.	0.257228	0.44285	D	0.000467	T	0.05135	0.0137	L	0.38531	1.155	0.29722	N	0.838602	B;B	0.34015	0.435;0.075	B;B	0.27887	0.084;0.026	T	0.16512	-1.0400	10	0.07325	T	0.83	-23.7427	14.225	0.65853	1.0:0.0:0.0:0.0	.	326;330	E9PFZ8;Q66K89	.;E4F1_HUMAN	A	330	ENSP00000301727:T330A	ENSP00000301727:T330A	T	+	1	0	E4F1	2223117	1.000000	0.71417	0.987000	0.45799	0.980000	0.70556	4.613000	0.61176	2.234000	0.73211	0.459000	0.35465	ACC	E4F1	-	NULL	ENSG00000167967		0.647	E4F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	E4F1	HGNC	protein_coding	OTTHUMT00000435225.1	41	0.00	0	A	NM_004424		2283116	2283116	+1	no_errors	ENST00000301727	ensembl	human	known	69_37n	missense	59	18.06	13	SNP	0.981	G
ECI1	1632	genome.wustl.edu	37	16	2296901	2296901	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr16:2296901G>C	ENST00000301729.4	-	3	300	c.253C>G	c.(253-255)Ctg>Gtg	p.L85V	ECI1_ENST00000562238.1_Missense_Mutation_p.L85V|ECI1_ENST00000570258.1_Missense_Mutation_p.L26V	NM_001919.3	NP_001910.2	P42126	ECI1_HUMAN	enoyl-CoA delta isomerase 1	85					cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	dodecenoyl-CoA delta-isomerase activity (GO:0004165)|intramolecular oxidoreductase activity (GO:0016860)			endometrium(1)|large_intestine(2)|lung(6)	9						TCATTCTCCAGCTTCTCCAGG	0.527																																						dbGAP											0													61.0	57.0	58.0					16																	2296901		2198	4300	6498	-	-	-	SO:0001583	missense	0				CCDS10464.1, CCDS58410.1	16p13.3	2011-03-15	2011-03-15	2011-03-15	ENSG00000167969	ENSG00000167969	5.3.3.8		2703	protein-coding gene	gene with protein product	"""3,2 trans-enoyl-CoA isomerase"""	600305	"""dodecenoyl-Coenzyme A delta isomerase (3,2 trans-enoyl-Coenzyme A isomerase)"", ""dodecenoyl-CoA isomerase"""	DCI		7829074	Standard	NM_001178029		Approved		uc002cpr.3	P42126	OTTHUMG00000128830	ENST00000301729.4:c.253C>G	16.37:g.2296901G>C	ENSP00000301729:p.Leu85Val		A8K512|Q13290|Q7Z2L6|Q7Z2L7|Q9BUB8|Q9BW05|Q9UDG6	Missense_Mutation	SNP	pfam_Crotonase_core	p.L85V	ENST00000301729.4	37	c.253	CCDS10464.1	16	.	.	.	.	.	.	.	.	.	.	G	17.16	3.318451	0.60524	.	.	ENSG00000167969	ENST00000301729	T	0.69435	-0.4	5.21	4.26	0.50523	Crotonase, core (1);	0.000000	0.64402	D	0.000001	T	0.75170	0.3813	L	0.61387	1.9	0.80722	D	1	D;P	0.61697	0.99;0.467	D;P	0.63488	0.915;0.726	T	0.73503	-0.3962	10	0.33141	T	0.24	-23.9575	11.4127	0.49935	0.0865:0.0:0.9135:0.0	.	85;85	P42126-2;P42126	.;ECI1_HUMAN	V	85	ENSP00000301729:L85V	ENSP00000301729:L85V	L	-	1	2	ECI1	2236902	1.000000	0.71417	1.000000	0.80357	0.540000	0.34992	6.035000	0.70940	1.444000	0.47605	0.655000	0.94253	CTG	ECI1	-	pfam_Crotonase_core	ENSG00000167969		0.527	ECI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ECI1	HGNC	protein_coding	OTTHUMT00000250768.1	51	0.00	0	G			2296901	2296901	-1	no_errors	ENST00000301729	ensembl	human	known	69_37n	missense	70	12.50	10	SNP	1.000	C
FAF1	11124	genome.wustl.edu	37	1	51048354	51048354	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr1:51048354G>T	ENST00000396153.2	-	12	1500	c.1049C>A	c.(1048-1050)cCt>cAt	p.P350H	FAF1_ENST00000545823.1_Missense_Mutation_p.P108H|FAF1_ENST00000472808.1_5'UTR|FAF1_ENST00000371778.4_Missense_Mutation_p.P350H|RNU6-1026P_ENST00000384465.1_RNA	NM_007051.2	NP_008982.1	Q9UNN5	FAF1_HUMAN	Fas (TNFRSF6) associated factor 1	350					apoptotic process (GO:0006915)|cell death (GO:0008219)|cytoplasmic sequestering of NF-kappaB (GO:0007253)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of protein complex assembly (GO:0031334)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of cell adhesion (GO:0030155)|regulation of protein catabolic process (GO:0042176)|regulation of protein kinase activity (GO:0045859)	CD95 death-inducing signaling complex (GO:0031265)|Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	heat shock protein binding (GO:0031072)|NF-kappaB binding (GO:0051059)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)	p.0?(1)		breast(2)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|pancreas(2)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(3;3.18e-11)|all cancers(3;0.00526)		AAAAAATACAGGATGGCAATC	0.328																																						dbGAP											1	Whole gene deletion(1)	thyroid(1)											81.0	89.0	86.0					1																	51048354		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF132938	CCDS554.1	1p32.3	2012-09-20			ENSG00000185104	ENSG00000185104		"""UBX domain containing"""	3578	protein-coding gene	gene with protein product	"""TNFRSF6-associated factor 1"", ""UBX domain protein 3A"""	604460				10462485	Standard	NM_007051		Approved	CGI-03, hFAF1, HFAF1s, UBXD12, UBXN3A	uc001cse.1	Q9UNN5	OTTHUMG00000007930	ENST00000396153.2:c.1049C>A	1.37:g.51048354G>T	ENSP00000379457:p.Pro350His		Q549F0|Q9UF34|Q9UNT3|Q9Y2Z3	Missense_Mutation	SNP	pfam_UBX,superfamily_UBA-like,smart_UAS,smart_UBX,pfscan_UBX	p.P350H	ENST00000396153.2	37	c.1049	CCDS554.1	1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.768347	0.90020	.	.	ENSG00000185104	ENST00000396153;ENST00000371778;ENST00000545823;ENST00000371780;ENST00000543607	T;T;T	0.50277	0.75;0.75;0.75	5.61	5.61	0.85477	UAS (1);	0.000000	0.85682	D	0.000000	T	0.74869	0.3773	M	0.86343	2.81	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.78979	-0.1990	10	0.87932	D	0	-21.435	19.6375	0.95740	0.0:0.0:1.0:0.0	.	108;350	B4DEJ6;Q9UNN5	.;FAF1_HUMAN	H	350;350;108;190;198	ENSP00000379457:P350H;ENSP00000360843:P350H;ENSP00000438870:P108H	ENSP00000360843:P350H	P	-	2	0	FAF1	50820942	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.444000	0.97578	2.640000	0.89533	0.655000	0.94253	CCT	FAF1	-	smart_UAS	ENSG00000185104		0.328	FAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAF1	HGNC	protein_coding	OTTHUMT00000021807.1	17	0.00	0	G	NM_007051		51048354	51048354	-1	no_errors	ENST00000371778	ensembl	human	known	69_37n	missense	13	18.75	3	SNP	1.000	T
FAM13C	220965	genome.wustl.edu	37	10	61023902	61023902	+	Missense_Mutation	SNP	T	T	G			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr10:61023902T>G	ENST00000373868.2	-	9	1054	c.967A>C	c.(967-969)Aat>Cat	p.N323H	FAM13C_ENST00000419214.2_Intron|FAM13C_ENST00000442566.3_Missense_Mutation_p.N344H|FAM13C_ENST00000373867.3_Missense_Mutation_p.N240H|FAM13C_ENST00000422313.2_Missense_Mutation_p.N323H|FAM13C_ENST00000435852.2_Missense_Mutation_p.N323H|FAM13C_ENST00000277705.6_Missense_Mutation_p.N344H|FAM13C_ENST00000468840.2_Missense_Mutation_p.N240H	NM_198215.3	NP_937858.2	Q8NE31	FA13C_HUMAN	family with sequence similarity 13, member C	323										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						ACTTCAGGATTAGAAGTCTTG	0.458																																						dbGAP											0													113.0	103.0	106.0					10																	61023902		2203	4300	6503	-	-	-	SO:0001583	missense	0			U79304	CCDS31207.1, CCDS44406.1, CCDS7255.1, CCDS53538.1	10q21	2009-09-15	2009-01-20	2009-01-20	ENSG00000148541	ENSG00000148541			19371	protein-coding gene	gene with protein product			"""family with sequence similarity 13, member C1"""	FAM13C1			Standard	NM_001001971		Approved		uc001jkn.3	Q8NE31	OTTHUMG00000018277	ENST00000373868.2:c.967A>C	10.37:g.61023902T>G	ENSP00000362975:p.Asn323His		B7ZB77|Q5T631|Q6P2M3|Q99787	Missense_Mutation	SNP	NULL	p.N323H	ENST00000373868.2	37	c.967	CCDS7255.1	10	.	.	.	.	.	.	.	.	.	.	T	12.57	1.978193	0.34942	.	.	ENSG00000148541	ENST00000373867;ENST00000373868;ENST00000442566;ENST00000277705;ENST00000468840;ENST00000435852;ENST00000422313;ENST00000468696	T;T;T;T;T;T;T;T	0.77229	-1.08;-1.08;-1.08;-1.08;-1.08;-1.08;-1.08;-1.08	5.84	5.84	0.93424	.	0.133152	0.51477	D	0.000092	D	0.87466	0.6184	M	0.71581	2.175	0.38388	D	0.945337	D;D;D;D	0.89917	1.0;0.976;0.981;1.0	D;P;P;D	0.91635	0.999;0.629;0.855;0.999	D	0.89529	0.3784	10	0.66056	D	0.02	-24.318	16.2055	0.82126	0.0:0.0:0.0:1.0	.	323;240;323;323	B7Z2K3;B7ZB77;Q8NE31-2;Q8NE31	.;.;.;FA13C_HUMAN	H	240;323;344;344;240;323;323;101	ENSP00000362974:N240H;ENSP00000362975:N323H;ENSP00000395661:N344H;ENSP00000277705:N344H;ENSP00000423896:N240H;ENSP00000392302:N323H;ENSP00000400241:N323H;ENSP00000445068:N101H	ENSP00000277705:N344H	N	-	1	0	FAM13C	60693908	1.000000	0.71417	1.000000	0.80357	0.556000	0.35491	4.129000	0.57957	2.226000	0.72624	0.482000	0.46254	AAT	FAM13C	-	NULL	ENSG00000148541		0.458	FAM13C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM13C	HGNC	protein_coding	OTTHUMT00000048162.2	42	0.00	0	T			61023902	61023902	-1	no_errors	ENST00000373868	ensembl	human	known	69_37n	missense	49	19.67	12	SNP	0.999	G
FAM26D	221301	genome.wustl.edu	37	6	116875223	116875223	+	Nonsense_Mutation	SNP	C	C	G			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr6:116875223C>G	ENST00000368596.3	+	1	311	c.267C>G	c.(265-267)taC>taG	p.Y89*	FAM26D_ENST00000368597.2_Intron|FAM26D_ENST00000405399.1_Intron|FAM26D_ENST00000416171.2_Intron			Q5JW98	FA26D_HUMAN	family with sequence similarity 26, member D	89					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				endometrium(1)|lung(5)	6		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0258)|all cancers(137;0.0458)|OV - Ovarian serous cystadenocarcinoma(136;0.0694)|Epithelial(106;0.222)		CCCCTCCATACAGGAGAATCA	0.527																																						dbGAP											0																																										-	-	-	SO:0001587	stop_gained	0			AK056801	CCDS5109.1, CCDS59032.1	6q22.31	2008-02-05	2007-03-19	2007-03-19	ENSG00000164451	ENSG00000164451			21094	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 78"""	C6orf78			Standard	NM_153036		Approved	FLJ32239	uc010ked.4	Q5JW98	OTTHUMG00000015443	ENST00000368596.3:c.267C>G	6.37:g.116875223C>G	ENSP00000357585:p.Tyr89*		B0QZ25|B0QZ27|B4DTQ0|Q96MK0	Nonsense_Mutation	SNP	NULL	p.Y89*	ENST00000368596.3	37	c.267		6	.	.	.	.	.	.	.	.	.	.	C	9.431	1.085547	0.20390	.	.	ENSG00000164451	ENST00000368596	.	.	.	6.11	-5.81	0.02340	.	2.364290	0.01159	N	0.006581	.	.	.	.	.	.	0.21740	N	0.99956	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.5595	3.7988	0.08750	0.4457:0.13:0.3061:0.1183	.	.	.	.	X	89	.	ENSP00000357585:Y89X	Y	+	3	2	FAM26D	116981916	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-1.168000	0.03123	-0.733000	0.04850	0.655000	0.94253	TAC	FAM26D	-	NULL	ENSG00000164451		0.527	FAM26D-002	KNOWN	basic|appris_principal	protein_coding	FAM26D	HGNC	protein_coding	OTTHUMT00000041958.1	34	0.00	0	C	NM_153036		116875223	116875223	+1	no_errors	ENST00000368596	ensembl	human	known	69_37n	nonsense	18	57.14	24	SNP	0.000	G
FBN2	2201	genome.wustl.edu	37	5	127666379	127666379	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr5:127666379C>T	ENST00000508053.1	-	39	5205	c.4231G>A	c.(4231-4233)Gaa>Aaa	p.E1411K	FBN2_ENST00000508989.1_Missense_Mutation_p.E1378K|FBN2_ENST00000507835.1_Missense_Mutation_p.E261K|FBN2_ENST00000262464.4_Missense_Mutation_p.E1411K			P35556	FBN2_HUMAN	fibrillin 2	1411	EGF-like 23; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.E1411Q(2)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TTAGAACATTCGTCCAGATCT	0.428																																						dbGAP											2	Substitution - Missense(2)	lung(2)											107.0	101.0	103.0					5																	127666379		2203	4300	6503	-	-	-	SO:0001583	missense	0			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.4231G>A	5.37:g.127666379C>T	ENSP00000424571:p.Glu1411Lys		B4DU01|Q59ES6	Missense_Mutation	SNP	pirsf_Fibrillin,pfam_EGF-like_Ca-bd,pfam_EGF-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Cadherin-like,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.E1411K	ENST00000508053.1	37	c.4231	CCDS34222.1	5	.	.	.	.	.	.	.	.	.	.	C	25.2	4.613919	0.87359	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000507835;ENST00000508989	D;D;D;D	0.98849	-5.18;-5.18;-5.18;-5.18	5.14	5.14	0.70334	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.64402	D	0.000008	D	0.99510	0.9825	H	0.97291	3.975	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.993	D	0.98096	1.0412	10	0.87932	D	0	.	19.1483	0.93477	0.0:1.0:0.0:0.0	.	1378;1411	D6RJI3;P35556	.;FBN2_HUMAN	K	1411;1411;261;1378	ENSP00000262464:E1411K;ENSP00000424571:E1411K;ENSP00000426839:E261K;ENSP00000425596:E1378K	ENSP00000262464:E1411K	E	-	1	0	FBN2	127694278	1.000000	0.71417	0.947000	0.38551	0.977000	0.68977	7.585000	0.82584	2.835000	0.97688	0.591000	0.81541	GAA	FBN2	-	pirsf_Fibrillin,pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000138829		0.428	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN2	HGNC	protein_coding	OTTHUMT00000371618.2	34	0.00	0	C	NM_001999		127666379	127666379	-1	no_errors	ENST00000262464	ensembl	human	known	69_37n	missense	25	35.90	14	SNP	1.000	T
FLT3	2322	genome.wustl.edu	37	13	28631541	28631541	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr13:28631541G>T	ENST00000241453.7	-	4	508	c.427C>A	c.(427-429)Ctt>Att	p.L143I	FLT3_ENST00000380982.4_Missense_Mutation_p.L143I|FLT3_ENST00000537084.1_Missense_Mutation_p.L143I	NM_004119.2	NP_004110.2	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3	143					B cell differentiation (GO:0030183)|cellular response to cytokine stimulus (GO:0071345)|common myeloid progenitor cell proliferation (GO:0035726)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell differentiation (GO:0097028)|hemopoiesis (GO:0030097)|leukocyte homeostasis (GO:0001776)|lymphocyte proliferation (GO:0046651)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|pro-B cell differentiation (GO:0002328)|pro-T cell differentiation (GO:0002572)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor signaling pathway (GO:0038084)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|cytokine receptor activity (GO:0004896)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(12329)|kidney(2)|large_intestine(8)|lung(30)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12390	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Ponatinib(DB08901)|Sorafenib(DB00398)|Sunitinib(DB01268)	TGAATAAAAAGTAGGTATTCT	0.373			"""Mis, O"""		"""AML, ALL"""																																	dbGAP		Dom	yes		13	13q12	2322	fms-related tyrosine kinase 3		L	0													127.0	128.0	128.0					13																	28631541		2203	4300	6503	-	-	-	SO:0001583	missense	0			U02687	CCDS31953.1	13q12	2014-09-17			ENSG00000122025	ENSG00000122025	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3765	protein-coding gene	gene with protein product		136351				8394751	Standard	NM_004119		Approved	STK1, FLK2, CD135	uc001urw.3	P36888	OTTHUMG00000016646	ENST00000241453.7:c.427C>A	13.37:g.28631541G>T	ENSP00000241453:p.Leu143Ile		A0AVG9|B7ZLT7|B7ZLT8|F5H0A0|Q13414	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.L143I	ENST00000241453.7	37	c.427	CCDS31953.1	13	.	.	.	.	.	.	.	.	.	.	G	19.94	3.919298	0.73098	.	.	ENSG00000122025	ENST00000241453;ENST00000380982;ENST00000537084	T;T;T	0.42900	0.96;0.96;0.96	5.8	4.96	0.65561	.	0.095546	0.44097	D	0.000488	T	0.48095	0.1481	L	0.32530	0.975	0.28099	N	0.931482	P;P	0.49307	0.922;0.873	P;P	0.59546	0.859;0.726	T	0.42816	-0.9429	10	0.54805	T	0.06	.	11.0491	0.47876	0.1474:0.0:0.8526:0.0	.	143;143	P36888-2;P36888	.;FLT3_HUMAN	I	143	ENSP00000241453:L143I;ENSP00000370369:L143I;ENSP00000438139:L143I	ENSP00000241453:L143I	L	-	1	0	FLT3	27529541	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.557000	0.45871	1.456000	0.47831	0.561000	0.74099	CTT	FLT3	-	NULL	ENSG00000122025		0.373	FLT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FLT3	HGNC	protein_coding	OTTHUMT00000044319.2	63	0.00	0	G			28631541	28631541	-1	no_errors	ENST00000380982	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	0.994	T
FREM3	166752	genome.wustl.edu	37	4	144617328	144617328	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr4:144617328T>C	ENST00000329798.5	-	1	4500	c.4501A>G	c.(4501-4503)Act>Gct	p.T1501A		NM_001168235.1	NP_001161707.1	P0C091	FREM3_HUMAN	FRAS1 related extracellular matrix 3	1501					cell adhesion (GO:0007155)|cell communication (GO:0007154)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|prostate(1)	8						TCATTTGAAGTATGGACATAG	0.433																																						dbGAP											0													85.0	69.0	74.0					4																	144617328		692	1591	2283	-	-	-	SO:0001583	missense	0			BX091796	CCDS54808.1	4q31.21	2011-06-09			ENSG00000183090	ENSG00000183090			25172	protein-coding gene	gene with protein product		608946				15345741	Standard	NM_001168235		Approved		uc021xsj.1	P0C091	OTTHUMG00000161577	ENST00000329798.5:c.4501A>G	4.37:g.144617328T>C	ENSP00000332886:p.Thr1501Ala			Missense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.T1501A	ENST00000329798.5	37	c.4501	CCDS54808.1	4	.	.	.	.	.	.	.	.	.	.	T	12.72	2.021900	0.35701	.	.	ENSG00000183090	ENST00000329798	T	0.27890	1.64	4.2	1.73	0.24493	.	0.138974	0.46145	D	0.000301	T	0.44932	0.1317	M	0.81682	2.555	0.38052	D	0.935808	.	.	.	.	.	.	T	0.44236	-0.9341	8	0.54805	T	0.06	-2.4318	7.8128	0.29241	0.0:0.1718:0.0:0.8282	.	.	.	.	A	1501	ENSP00000332886:T1501A	ENSP00000332886:T1501A	T	-	1	0	FREM3	144836778	1.000000	0.71417	0.136000	0.22124	0.320000	0.28249	4.436000	0.59948	0.193000	0.20303	0.460000	0.39030	ACT	FREM3	-	NULL	ENSG00000183090		0.433	FREM3-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	FREM3	HGNC	protein_coding	OTTHUMT00000365391.1	52	0.00	0	T	XM_094074		144617328	144617328	-1	no_errors	ENST00000329798	ensembl	human	putative	69_37n	missense	22	15.38	4	SNP	1.000	C
FRMD7	90167	genome.wustl.edu	37	X	131220043	131220043	+	Missense_Mutation	SNP	A	A	T			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chrX:131220043A>T	ENST00000298542.4	-	6	577	c.402T>A	c.(400-402)caT>caA	p.H134Q	FRMD7_ENST00000370879.1_Missense_Mutation_p.H14Q|FRMD7_ENST00000464296.1_Missense_Mutation_p.H119Q	NM_194277.2	NP_919253.1	Q6ZUT3	FRMD7_HUMAN	FERM domain containing 7	134	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				regulation of neuron projection development (GO:0010975)	cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(12)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24	Acute lymphoblastic leukemia(192;0.000127)					CTGTTTCTTCATGAAAGTCTC	0.428																																						dbGAP											0													239.0	194.0	209.0					X																	131220043		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL161984	CCDS35397.1	Xq26.2	2014-09-17	2006-09-01	2006-09-01	ENSG00000165694	ENSG00000165694			8079	protein-coding gene	gene with protein product		300628	"""nystagmus 1, congenital"""	NYS, NYS1		2063919, 17013395	Standard	NM_194277		Approved	FLJ43346	uc004ewn.3	Q6ZUT3	OTTHUMG00000022421	ENST00000298542.4:c.402T>A	X.37:g.131220043A>T	ENSP00000298542:p.His134Gln		C0LLJ3|Q5JX99	Missense_Mutation	SNP	pfam_FERM_PH-like_C,pfam_FERM_N,pfam_FERM-adjacent,pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam	p.H134Q	ENST00000298542.4	37	c.402	CCDS35397.1	X	.	.	.	.	.	.	.	.	.	.	A	13.54	2.268691	0.40095	.	.	ENSG00000165694	ENST00000370879;ENST00000298542;ENST00000464296	T;T;T	0.71222	-0.55;-0.55;-0.55	5.88	4.72	0.59763	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.152826	0.56097	D	0.000025	T	0.62441	0.2428	N	0.25286	0.73	0.29253	N	0.871868	P;B	0.51933	0.949;0.07	P;B	0.51550	0.673;0.159	T	0.61412	-0.7068	10	0.72032	D	0.01	.	5.4077	0.16330	0.6961:0.1464:0.1575:0.0	.	119;134	Q6ZUT3-2;Q6ZUT3	.;FRMD7_HUMAN	Q	14;134;119	ENSP00000359916:H14Q;ENSP00000298542:H134Q;ENSP00000417996:H119Q	ENSP00000298542:H134Q	H	-	3	2	FRMD7	131047724	0.931000	0.31567	1.000000	0.80357	0.985000	0.73830	0.178000	0.16820	0.847000	0.35167	0.441000	0.28932	CAT	FRMD7	-	pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	ENSG00000165694		0.428	FRMD7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRMD7	HGNC	protein_coding	OTTHUMT00000355031.1	34	0.00	0	A	NM_194277		131220043	131220043	-1	no_errors	ENST00000298542	ensembl	human	known	69_37n	missense	17	37.04	10	SNP	1.000	T
FSIP2	401024	genome.wustl.edu	37	2	186673767	186673767	+	Frame_Shift_Del	DEL	T	T	-			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr2:186673767delT	ENST00000424728.1	+	17	19734	c.19734delT	c.(19732-19734)aatfs	p.N6578fs	FSIP2_ENST00000343098.5_Frame_Shift_Del_p.N6667fs			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	6578										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						GTGGGAGAAATTACTCCTTAG	0.393																																						dbGAP											0													72.0	65.0	67.0					2																	186673767		1858	4106	5964	-	-	-	SO:0001589	frameshift_variant	0			AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.19734delT	2.37:g.186673767delT	ENSP00000401306:p.Asn6578fs		Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Frame_Shift_Del	DEL	NULL	p.Y6668fs	ENST00000424728.1	37	c.20001		2																																																																																			FSIP2	-	NULL	ENSG00000188738		0.393	FSIP2-001	KNOWN	basic	protein_coding	FSIP2	HGNC	protein_coding	OTTHUMT00000332778.3	15	0.00	0	T	NM_173651		186673767	186673767	+1	no_errors	ENST00000343098	ensembl	human	known	69_37n	frame_shift_del	3	40.00	2	DEL	0.013	-
GOLGA7	51125	genome.wustl.edu	37	8	41367138	41367138	+	3'UTR	SNP	G	G	T			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr8:41367138G>T	ENST00000357743.4	+	0	666				GOLGA7_ENST00000520817.1_3'UTR|GOLGA7_ENST00000518270.1_3'UTR|GOLGA7_ENST00000405786.2_3'UTR|GOLGA7_ENST00000521417.1_3'UTR	NM_001002296.1	NP_001002296.1	Q7Z5G4	GOGA7_HUMAN	golgin A7						Golgi to plasma membrane protein transport (GO:0043001)|peptidyl-L-cysteine S-palmitoylation (GO:0018230)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|intrinsic component of Golgi membrane (GO:0031228)|palmitoyltransferase complex (GO:0002178)				breast(1)|large_intestine(1)	2	Ovarian(28;0.014)|Colorectal(14;0.0234)|Lung SC(25;0.211)	all_lung(54;0.000771)|Lung NSC(58;0.0031)|Hepatocellular(245;0.014)|Esophageal squamous(32;0.0559)	Colorectal(10;0.0014)|OV - Ovarian serous cystadenocarcinoma(14;0.00596)|LUSC - Lung squamous cell carcinoma(45;0.0137)|COAD - Colon adenocarcinoma(11;0.0147)			TGTATCCACTGGCCGACCGCA	0.473																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF125102	CCDS34887.1, CCDS55226.1	8p11.21	2011-10-25	2010-02-12		ENSG00000147533	ENSG00000147533			24876	protein-coding gene	gene with protein product		609453	"""golgi autoantigen, golgin subfamily a, 7"""			11042152	Standard	NM_001174124		Approved	GCP16, HSPC041, GOLGA3AP1, GOLGA7A	uc003xnu.3	Q7Z5G4	OTTHUMG00000164077	ENST00000357743.4:c.*51G>T	8.37:g.41367138G>T			D3DSX9|J3KQ24|Q96EQ4|Q9P1S0|Q9Y5U7	RNA	SNP	-	NULL	ENST00000357743.4	37	NULL	CCDS34887.1	8																																																																																			GOLGA7	-	-	ENSG00000147533		0.473	GOLGA7-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GOLGA7	HGNC	protein_coding	OTTHUMT00000377142.1	34	0.00	0	G	NM_016099		41367138	41367138	+1	no_errors	ENST00000521417	ensembl	human	known	69_37n	rna	34	10.53	4	SNP	0.999	T
GUCY2F	2986	genome.wustl.edu	37	X	108635324	108635324	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chrX:108635324G>A	ENST00000218006.2	-	14	2888	c.2597C>T	c.(2596-2598)gCt>gTt	p.A866V		NM_001522.2	NP_001513.2	P51841	GUC2F_HUMAN	guanylate cyclase 2F, retinal	866					intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(6)|large_intestine(14)|lung(33)|prostate(3)|skin(1)	67						GAGAGATTCAGCAACTGATCT	0.448																																						dbGAP											0													69.0	60.0	63.0					X																	108635324		2203	4300	6503	-	-	-	SO:0001583	missense	0			L37378	CCDS14545.1	Xq22	2008-08-01			ENSG00000101890	ENSG00000101890			4691	protein-coding gene	gene with protein product	"""guanylate cyclase 2D-like, membrane (retina-specific)"""	300041				8838319, 7777544	Standard	NM_001522		Approved	GUC2DL, GC-F, RetGC-2, ROS-GC2, CYGF	uc004eod.4	P51841	OTTHUMG00000022184	ENST00000218006.2:c.2597C>T	X.37:g.108635324G>A	ENSP00000218006:p.Ala866Val		Q9UJF1	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Haem_no_assoc-bd,superfamily_A/G_cyclase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_A/G_cyclase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_A/G_cyclase	p.A866V	ENST00000218006.2	37	c.2597	CCDS14545.1	X	.	.	.	.	.	.	.	.	.	.	G	21.4	4.138021	0.77775	.	.	ENSG00000101890	ENST00000218006	D	0.95307	-3.67	4.2	4.2	0.49525	Haem NO binding associated (1);Adenylyl cyclase class-3/4/guanylyl cyclase (1);	0.000000	0.85682	D	0.000000	D	0.96830	0.8965	M	0.80746	2.51	0.58432	D	0.999995	D	0.71674	0.998	D	0.80764	0.994	D	0.96920	0.9673	10	0.62326	D	0.03	.	13.4004	0.60879	0.0:0.0:1.0:0.0	.	866	P51841	GUC2F_HUMAN	V	866	ENSP00000218006:A866V	ENSP00000218006:A866V	A	-	2	0	GUCY2F	108521980	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.807000	0.86032	2.327000	0.79052	0.513000	0.50165	GCT	GUCY2F	-	pfam_Haem_no_assoc-bd,smart_A/G_cyclase	ENSG00000101890		0.448	GUCY2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCY2F	HGNC	protein_coding	OTTHUMT00000057884.1	21	0.00	0	G	NM_001522		108635324	108635324	-1	no_errors	ENST00000218006	ensembl	human	known	69_37n	missense	16	20.00	4	SNP	1.000	A
HORMAD2	150280	genome.wustl.edu	37	22	30494914	30494914	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr22:30494914C>T	ENST00000336726.6	+	3	480	c.125C>T	c.(124-126)tCc>tTc	p.S42F	HORMAD2_ENST00000403975.1_Missense_Mutation_p.S42F	NM_152510.2	NP_689723.1	Q8N7B1	HORM2_HUMAN	HORMA domain containing 2	42	HORMA. {ECO:0000255|PROSITE- ProRule:PRU00109}.				meiotic nuclear division (GO:0007126)|meiotic sister chromatid cohesion (GO:0051177)	chromosome (GO:0005694)|nucleus (GO:0005634)				large_intestine(1)|lung(1)	2			Epithelial(10;0.125)			TTTGCTACTTCCATCTCATGT	0.398																																						dbGAP											0													109.0	100.0	103.0					22																	30494914		1847	4078	5925	-	-	-	SO:0001583	missense	0			AK098703	CCDS46683.1	22q12.2	2014-01-21			ENSG00000176635	ENSG00000176635			28383	protein-coding gene	gene with protein product						12477932	Standard	NM_152510		Approved	MGC26710, CT46.2	uc003agy.3	Q8N7B1	OTTHUMG00000150881	ENST00000336726.6:c.125C>T	22.37:g.30494914C>T	ENSP00000336984:p.Ser42Phe		B5MEB2|Q8NHR2	Missense_Mutation	SNP	pfam_HORMA_DNA-bd,superfamily_HORMA_DNA-bd,pfscan_HORMA_DNA-bd	p.S42F	ENST00000336726.6	37	c.125	CCDS46683.1	22	.	.	.	.	.	.	.	.	.	.	C	17.80	3.477551	0.63849	.	.	ENSG00000176635	ENST00000336726;ENST00000403975	T;T	0.41400	1.0;1.0	5.44	3.29	0.37713	DNA-binding HORMA (4);	0.219048	0.39544	N	0.001335	T	0.62804	0.2458	M	0.85945	2.785	0.30795	N	0.740476	D	0.55800	0.973	P	0.60682	0.878	T	0.68895	-0.5288	10	0.59425	D	0.04	-6.3585	12.3138	0.54944	0.0:0.6748:0.3252:0.0	.	42	Q8N7B1	HORM2_HUMAN	F	42	ENSP00000336984:S42F;ENSP00000385055:S42F	ENSP00000336984:S42F	S	+	2	0	HORMAD2	28824914	0.562000	0.26586	0.976000	0.42696	0.965000	0.64279	0.388000	0.20735	0.812000	0.34326	0.650000	0.86243	TCC	HORMAD2	-	pfam_HORMA_DNA-bd,superfamily_HORMA_DNA-bd,pfscan_HORMA_DNA-bd	ENSG00000176635		0.398	HORMAD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HORMAD2	HGNC	protein_coding	OTTHUMT00000320416.2	38	0.00	0	C	NM_152510		30494914	30494914	+1	no_errors	ENST00000336726	ensembl	human	known	69_37n	missense	10	61.54	16	SNP	0.959	T
IQCK	124152	genome.wustl.edu	37	16	19775192	19775192	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr16:19775192C>G	ENST00000320394.6	+	6	1196	c.497C>G	c.(496-498)gCc>gGc	p.A166G	IQCK_ENST00000541926.1_Missense_Mutation_p.A166G|IQCK_ENST00000564186.1_Missense_Mutation_p.A166G|CTD-2380F24.1_ENST00000565817.1_RNA|CTD-2380F24.1_ENST00000564490.1_RNA|CTD-2380F24.1_ENST00000568843.1_RNA|IQCK_ENST00000562762.1_3'UTR|IQCK_ENST00000433597.2_Missense_Mutation_p.A78G	NM_153208.1	NP_694940.1	Q8N0W5	IQCK_HUMAN	IQ motif containing K	166										kidney(1)|large_intestine(2)|lung(2)|skin(1)	6						AAATTCATTGCCTGTGATTTT	0.363																																						dbGAP											0													126.0	124.0	124.0					16																	19775192		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF520569	CCDS10580.1	16p12.3	2008-02-05			ENSG00000174628	ENSG00000174628			28556	protein-coding gene	gene with protein product						10493829	Standard	NM_153208		Approved	MGC35048, FLJ36575	uc002dgr.3	Q8N0W5	OTTHUMG00000131453	ENST00000320394.6:c.497C>G	16.37:g.19775192C>G	ENSP00000324901:p.Ala166Gly		B2RDU0|O43327|Q8NFF4	Missense_Mutation	SNP	NULL	p.A166G	ENST00000320394.6	37	c.497	CCDS10580.1	16	.	.	.	.	.	.	.	.	.	.	C	21.3	4.125858	0.77436	.	.	ENSG00000174628	ENST00000320394;ENST00000541926;ENST00000433597	T;T;T	0.26518	1.73;1.73;1.73	5.21	5.21	0.72293	.	0.000000	0.51477	D	0.000088	T	0.42787	0.1218	L	0.39898	1.24	0.35779	D	0.821539	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.39921	-0.9590	9	.	.	.	-16.801	17.1364	0.86740	0.0:1.0:0.0:0.0	.	166;166	B4DXE1;Q8N0W5	.;IQCK_HUMAN	G	166;166;78	ENSP00000324901:A166G;ENSP00000439344:A166G;ENSP00000406013:A78G	.	A	+	2	0	IQCK	19682693	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.084000	0.50143	2.720000	0.93068	0.650000	0.86243	GCC	IQCK	-	NULL	ENSG00000174628		0.363	IQCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQCK	HGNC	protein_coding	OTTHUMT00000254273.2	13	0.00	0	C	NM_153208		19775192	19775192	+1	no_errors	ENST00000320394	ensembl	human	known	69_37n	missense	5	58.33	7	SNP	1.000	G
KIAA0825	285600	genome.wustl.edu	37	5	93805804	93805804	+	Silent	SNP	C	C	G			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr5:93805804C>G	ENST00000513200.3	-	9	1806	c.1734G>C	c.(1732-1734)ctG>ctC	p.L578L	KIAA0825_ENST00000427991.2_Silent_p.L578L|KIAA0825_ENST00000312498.7_Silent_p.L578L	NM_001145678.1	NP_001139150.1	Q8IV33	K0825_HUMAN	KIAA0825	578										breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(1)|pancreas(1)|prostate(1)|skin(1)	13						GGACAAGCACCAGGAATATGG	0.413																																						dbGAP											0													132.0	111.0	117.0					5																	93805804		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			BX648338	CCDS4070.1	5q15	2011-02-23	2011-02-23	2011-02-23	ENSG00000185261	ENSG00000185261			28532	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 36"""	C5orf36		12477932	Standard	NM_173665		Approved	DKFZp686F0372, MGC34713	uc011cuk.2	Q8IV33	OTTHUMG00000131331	ENST00000513200.3:c.1734G>C	5.37:g.93805804C>G			O94914|Q6ZNN2	Silent	SNP	NULL	p.L578	ENST00000513200.3	37	c.1734		5																																																																																			KIAA0825	-	NULL	ENSG00000185261		0.413	KIAA0825-001	KNOWN	not_organism_supported|basic	protein_coding	KIAA0825	HGNC	protein_coding	OTTHUMT00000254102.5	17	0.00	0	C	NM_173665		93805804	93805804	-1	no_errors	ENST00000427991	ensembl	human	known	69_37n	silent	9	40.00	6	SNP	1.000	G
KIAA1217	56243	genome.wustl.edu	37	10	24833322	24833323	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	AA	AA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr10:24833322_24833323delAA	ENST00000376454.3	+	19	5153_5154	c.5123_5124delAA	c.(5122-5124)caafs	p.Q1708fs	KIAA1217_ENST00000376452.3_Intron|KIAA1217_ENST00000307544.6_Intron|KIAA1217_ENST00000458595.1_Intron|KIAA1217_ENST00000376451.2_Frame_Shift_Del_p.Q1391fs|KIAA1217_ENST00000376462.1_Intron|KIAA1217_ENST00000396445.1_Intron|KIAA1217_ENST00000396446.1_Intron	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	1708					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						CACATAGCCCAAGAGGCCTCTC	0.505																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.5123_5124delAA	10.37:g.24833322_24833323delAA	ENSP00000365637:p.Gln1708fs		A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Frame_Shift_Del	DEL	pfam_AIP3_C	p.Q1708fs	ENST00000376454.3	37	c.5123_5124	CCDS31165.1	10																																																																																			KIAA1217	-	NULL	ENSG00000120549		0.505	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1217	HGNC	protein_coding	OTTHUMT00000047223.2	24	0.00	0	AA	NM_019590		24833322	24833323	+1	no_errors	ENST00000376454	ensembl	human	known	69_37n	frame_shift_del	17	34.48	10	DEL	0.001:0.001	-
KLK10	5655	genome.wustl.edu	37	19	51519314	51519314	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr19:51519314T>C	ENST00000309958.3	-	4	586	c.368A>G	c.(367-369)cAg>cGg	p.Q123R	KLK10_ENST00000358789.3_Missense_Mutation_p.Q123R|KLK10_ENST00000391805.1_Missense_Mutation_p.Q123R|CTC-518B2.12_ENST00000596286.1_RNA	NM_002776.4	NP_002767.2	O43240	KLK10_HUMAN	kallikrein-related peptidase 10	123	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cell cycle (GO:0007049)	extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	13		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00885)		GCCTGAGCCCTGGTGGTACTT	0.652																																						dbGAP											0													43.0	37.0	39.0					19																	51519314		2197	4292	6489	-	-	-	SO:0001583	missense	0			AF024605	CCDS12817.1	19q13	2011-03-07	2006-10-27			ENSG00000129451		"""Kallikreins"""	6358	protein-coding gene	gene with protein product		602673	"""kallikrein 10"""	PRSSL1		8764136, 9533035, 16800724, 16800723, 10675891	Standard	NM_145888		Approved	NES1	uc002pva.3	O43240		ENST00000309958.3:c.368A>G	19.37:g.51519314T>C	ENSP00000311746:p.Gln123Arg		A6NC12|Q53YL3|Q99920|Q9GZW9	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.Q123R	ENST00000309958.3	37	c.368	CCDS12817.1	19	.	.	.	.	.	.	.	.	.	.	t	1.859	-0.463121	0.04476	.	.	ENSG00000129451	ENST00000391805;ENST00000309958;ENST00000358789	D;D;D	0.88664	-2.41;-2.41;-2.41	4.67	-5.92	0.02261	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.968779	0.08366	N	0.956872	T	0.65091	0.2658	N	0.01277	-0.915	0.09310	N	1	B	0.02656	0.0	B	0.09377	0.004	T	0.55585	-0.8118	10	0.40728	T	0.16	.	5.0354	0.14432	0.0989:0.077:0.4534:0.3707	.	123	O43240	KLK10_HUMAN	R	123	ENSP00000375681:Q123R;ENSP00000311746:Q123R;ENSP00000351640:Q123R	ENSP00000311746:Q123R	Q	-	2	0	KLK10	56211126	0.000000	0.05858	0.000000	0.03702	0.223000	0.24884	-0.043000	0.12043	-0.901000	0.03891	0.533000	0.62120	CAG	KLK10	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000129451		0.652	KLK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLK10	HGNC	protein_coding	OTTHUMT00000464337.2	39	0.00	0	T	NM_002776		51519314	51519314	-1	no_errors	ENST00000309958	ensembl	human	known	69_37n	missense	25	37.50	15	SNP	0.000	C
KRT28	162605	genome.wustl.edu	37	17	38956060	38956060	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr17:38956060C>T	ENST00000306658.7	-	1	151	c.86G>A	c.(85-87)gGc>gAc	p.G29D		NM_181535.3	NP_853513.2			keratin 28											NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30		Breast(137;0.000301)				GCCTGCAAAGCCTGCACCTCC	0.522																																					Melanoma(19;789 869 15380 26882 39836)	dbGAP											0													94.0	102.0	99.0					17																	38956060		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK129827	CCDS11376.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000173908	ENSG00000173908		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30842	protein-coding gene	gene with protein product			"""keratin 25D"""	KRT25D		16831889	Standard	NM_181535		Approved		uc002hvh.1	Q7Z3Y7	OTTHUMG00000133365	ENST00000306658.7:c.86G>A	17.37:g.38956060C>T	ENSP00000305263:p.Gly29Asp			Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_I	p.G29D	ENST00000306658.7	37	c.86	CCDS11376.1	17	.	.	.	.	.	.	.	.	.	.	C	16.37	3.103928	0.56291	.	.	ENSG00000173908	ENST00000306658	D	0.86097	-2.07	5.37	4.39	0.52855	.	0.461581	0.20313	N	0.094789	D	0.84338	0.5450	L	0.43923	1.385	0.40317	D	0.978789	P	0.48694	0.914	P	0.49597	0.616	D	0.85559	0.1226	10	0.59425	D	0.04	.	12.9319	0.58292	0.0:0.9214:0.0:0.0786	.	29	Q7Z3Y7	K1C28_HUMAN	D	29	ENSP00000305263:G29D	ENSP00000305263:G29D	G	-	2	0	KRT28	36209586	0.986000	0.35501	0.930000	0.37139	0.287000	0.27160	2.126000	0.42026	2.675000	0.91044	0.650000	0.86243	GGC	KRT28	-	NULL	ENSG00000173908		0.522	KRT28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT28	HGNC	protein_coding	OTTHUMT00000257201.2	19	0.00	0	C	NM_181535		38956060	38956060	-1	no_errors	ENST00000306658	ensembl	human	known	69_37n	missense	7	65.00	13	SNP	0.973	T
KRT13	3860	genome.wustl.edu	37	17	39659292	39659292	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr17:39659292G>T	ENST00000246635.3	-	4	840	c.794C>A	c.(793-795)aCc>aAc	p.T265N	KRT13_ENST00000336861.3_Missense_Mutation_p.T265N|AC019349.5_ENST00000411759.1_RNA|KRT13_ENST00000587544.1_Missense_Mutation_p.T265N|KRT13_ENST00000587118.1_5'Flank	NM_153490.2	NP_705694	P13646	K1C13_HUMAN	keratin 13	265	Linker 12.|Rod.				cellular response to retinoic acid (GO:0071300)|cytoskeleton organization (GO:0007010)|response to radiation (GO:0009314)|tongue morphogenesis (GO:0043587)	extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	33		Breast(137;0.000286)				AATGCCTGGGGTGGCATCCAT	0.582																																						dbGAP											0													233.0	221.0	225.0					17																	39659292		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11396.1, CCDS11397.1	17q21.2	2013-06-20			ENSG00000171401	ENSG00000171401		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6415	protein-coding gene	gene with protein product	"""keratin, type I cytoskeletal 13"", ""cytokeratin 13"""	148065				16831889	Standard	NM_153490		Approved	K13, CK13, MGC3781, MGC161462	uc002hwu.1	P13646	OTTHUMG00000133434	ENST00000246635.3:c.794C>A	17.37:g.39659292G>T	ENSP00000246635:p.Thr265Asn		Q53G54|Q6AZK5|Q8N240	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_I	p.T265N	ENST00000246635.3	37	c.794	CCDS11396.1	17	.	.	.	.	.	.	.	.	.	.	G	17.42	3.385073	0.61956	.	.	ENSG00000171401	ENST00000246635;ENST00000336861;ENST00000157775	D;T	0.88586	-2.4;-1.36	4.32	4.32	0.51571	Filament (1);	0.424077	0.19792	N	0.105959	D	0.88066	0.6337	N	0.11870	0.19	0.09310	N	1	P;D;P;D	0.54207	0.864;0.965;0.69;0.965	P;D;P;D	0.63703	0.533;0.917;0.596;0.917	T	0.82043	-0.0653	10	0.87932	D	0	.	14.6393	0.68711	0.0:0.1457:0.8543:0.0	.	253;265;265;265	P13646-2;A1A4E9;P13646-3;P13646	.;.;.;K1C13_HUMAN	N	265;265;253	ENSP00000246635:T265N;ENSP00000336604:T265N	ENSP00000157775:T253N	T	-	2	0	KRT13	36912818	0.990000	0.36364	0.621000	0.29145	0.912000	0.54170	4.616000	0.61197	2.401000	0.81631	0.561000	0.74099	ACC	KRT13	-	pfam_F,superfamily_Prefoldin,prints_Keratin_I	ENSG00000171401		0.582	KRT13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KRT13	HGNC	protein_coding	OTTHUMT00000257297.1	29	0.00	0	G	NM_153490		39659292	39659292	-1	no_errors	ENST00000246635	ensembl	human	known	69_37n	missense	14	46.15	12	SNP	0.108	T
LINGO4	339398	genome.wustl.edu	37	1	151774826	151774826	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr1:151774826G>C	ENST00000368820.3	-	2	1292	c.355C>G	c.(355-357)Cgg>Ggg	p.R119G		NM_001004432.2	NP_001004432.1	Q6UY18	LIGO4_HUMAN	leucine rich repeat and Ig domain containing 4	119						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(4)|large_intestine(5)|lung(4)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	21	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			ATTCTGAGCCGATTGCCCTGC	0.577																																						dbGAP											0													74.0	71.0	72.0					1																	151774826		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS30855.1	1q21.3	2013-01-11	2007-02-01	2007-02-01	ENSG00000213171	ENSG00000213171		"""Immunoglobulin superfamily / I-set domain containing"""	31814	protein-coding gene	gene with protein product		609794	"""leucine rich repeat neuronal 6D"""	LRRN6D			Standard	NM_001004432		Approved		uc001ezf.1	Q6UY18	OTTHUMG00000013059	ENST00000368820.3:c.355C>G	1.37:g.151774826G>C	ENSP00000357810:p.Arg119Gly			Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Ig_V-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.R119G	ENST00000368820.3	37	c.355	CCDS30855.1	1	.	.	.	.	.	.	.	.	.	.	G	15.03	2.712691	0.48517	.	.	ENSG00000213171	ENST00000368820	T	0.59502	0.26	5.13	3.06	0.35304	.	0.000000	0.43919	D	0.000517	T	0.54111	0.1838	L	0.49126	1.545	0.43942	D	0.996609	D	0.56746	0.977	D	0.64321	0.924	T	0.59337	-0.7473	10	0.72032	D	0.01	.	7.2625	0.26212	0.0:0.155:0.4893:0.3557	.	119	Q6UY18	LIGO4_HUMAN	G	119	ENSP00000357810:R119G	ENSP00000357810:R119G	R	-	1	2	LINGO4	150041450	1.000000	0.71417	0.977000	0.42913	0.996000	0.88848	2.188000	0.42612	1.352000	0.45808	0.462000	0.41574	CGG	LINGO4	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000213171		0.577	LINGO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINGO4	HGNC	protein_coding	OTTHUMT00000036639.1	28	0.00	0	G	XM_291387		151774826	151774826	-1	no_errors	ENST00000368820	ensembl	human	known	69_37n	missense	39	23.53	12	SNP	0.997	C
MANBA	4126	genome.wustl.edu	37	4	103610766	103610766	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr4:103610766G>T	ENST00000226578.4	-	7	1024	c.925C>A	c.(925-927)Ctg>Atg	p.L309M	MANBA_ENST00000505239.1_Missense_Mutation_p.L252M	NM_005908.3	NP_005899.3	O00462	MANBA_HUMAN	mannosidase, beta A, lysosomal	309					cellular protein modification process (GO:0006464)|glycoprotein catabolic process (GO:0006516)|mannan catabolic process (GO:0046355)	intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)	beta-mannosidase activity (GO:0004567)|mannose binding (GO:0005537)			cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;4.44e-08)		CCTCCATCCAGTTCAAAAAGA	0.284																																						dbGAP											0													94.0	97.0	96.0					4																	103610766		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3658.1	4q24	2013-09-20			ENSG00000109323	ENSG00000109323	3.2.1.25		6831	protein-coding gene	gene with protein product		609489				7876128	Standard	NM_005908		Approved		uc003hwg.3	O00462	OTTHUMG00000131123	ENST00000226578.4:c.925C>A	4.37:g.103610766G>T	ENSP00000226578:p.Leu309Met		Q96BC3|Q9NYX9	Missense_Mutation	SNP	pfam_Glyco_hydro_2_N,pfam_Glyco_hydro_2_TIM,superfamily_Glycoside_hydrolase_SF,superfamily_Galactose-bd-like,superfamily_Glyco_hydro_2_Ig-like	p.L309M	ENST00000226578.4	37	c.925	CCDS3658.1	4	.	.	.	.	.	.	.	.	.	.	G	5.031	0.191345	0.09547	.	.	ENSG00000109323	ENST00000226578;ENST00000505239	D;D	0.83506	-1.73;-1.73	4.94	1.32	0.21799	.	0.424834	0.23360	N	0.049039	T	0.71804	0.3383	L	0.52364	1.645	0.21256	N	0.999745	B;B	0.34241	0.323;0.444	B;B	0.32677	0.048;0.15	T	0.57774	-0.7753	10	0.27785	T	0.31	-19.8649	3.9788	0.09486	0.3423:0.0:0.4651:0.1926	.	252;309	E9PFW2;O00462	.;MANBA_HUMAN	M	309;252	ENSP00000226578:L309M;ENSP00000427322:L252M	ENSP00000226578:L309M	L	-	1	2	MANBA	103829814	0.971000	0.33674	0.013000	0.15412	0.591000	0.36615	0.846000	0.27682	0.095000	0.17434	-0.140000	0.14226	CTG	MANBA	-	superfamily_Glyco_hydro_2_Ig-like	ENSG00000109323		0.284	MANBA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MANBA	HGNC	protein_coding	OTTHUMT00000253803.2	52	0.00	0	G			103610766	103610766	-1	no_errors	ENST00000226578	ensembl	human	known	69_37n	missense	30	11.76	4	SNP	0.097	T
MPP1	4354	genome.wustl.edu	37	X	154020090	154020090	+	Silent	SNP	G	G	A			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chrX:154020090G>A	ENST00000369534.3	-	3	426	c.279C>T	c.(277-279)tcC>tcT	p.S93S	MPP1_ENST00000462825.1_Intron|MPP1_ENST00000413259.3_Silent_p.S63S|MPP1_ENST00000393531.1_Silent_p.S93S	NM_001166460.1|NM_001166461.1|NM_002436.3	NP_001159932.1|NP_001159933.1|NP_002427.1	Q00013	EM55_HUMAN	membrane protein, palmitoylated 1, 55kDa	93	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				nucleotide phosphorylation (GO:0046939)|regulation of neutrophil chemotaxis (GO:0090022)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cortical cytoskeleton (GO:0030863)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(9)|ovary(2)|prostate(1)	21	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CCACCGTACAGGACTGTTTTT	0.423																																						dbGAP											0													127.0	99.0	108.0					X																	154020090		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS14762.1, CCDS55544.1, CCDS55545.1	Xq28	2008-03-04	2002-08-29		ENSG00000130830	ENSG00000130830			7219	protein-coding gene	gene with protein product		305360	"""membrane protein, palmitoylated 1 (55kD)"""	DXS552E		1713685	Standard	NM_002436		Approved	PEMP	uc004fmp.2	Q00013	OTTHUMG00000024244	ENST00000369534.3:c.279C>T	X.37:g.154020090G>A			B4DZV5|G3XAI1|Q2TSB6|Q5J7V5	Silent	SNP	pfam_Guanylate_kin,pfam_PDZ,pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_PDZ,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin	p.S93	ENST00000369534.3	37	c.279	CCDS14762.1	X																																																																																			MPP1	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000130830		0.423	MPP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	MPP1	HGNC	protein_coding	OTTHUMT00000061191.3	33	0.00	0	G	NM_002436		154020090	154020090	-1	no_errors	ENST00000369534	ensembl	human	known	69_37n	silent	24	36.84	14	SNP	0.031	A
MSH4	4438	genome.wustl.edu	37	1	76356408	76356408	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr1:76356408G>A	ENST00000263187.3	+	17	2358	c.2254G>A	c.(2254-2256)Gac>Aac	p.D752N		NM_002440.3	NP_002431.2	O15457	MSH4_HUMAN	mutS homolog 4	752					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|female gamete generation (GO:0007292)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|ovarian follicle development (GO:0001541)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)			breast(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(26)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	47						TAATGCTAATGACAAATCGCT	0.303								Mismatch excision repair (MMR)																														dbGAP											0													113.0	108.0	110.0					1																	76356408		2202	4296	6498	-	-	-	SO:0001583	missense	0			U89293	CCDS670.1	1p31	2013-09-12	2013-09-12		ENSG00000057468	ENSG00000057468			7327	protein-coding gene	gene with protein product		602105	"""mutS (E. coli) homolog 4"", ""mutS homolog 4 (E. coli)"""			9299235	Standard	NM_002440		Approved		uc001dhd.2	O15457	OTTHUMG00000009788	ENST00000263187.3:c.2254G>A	1.37:g.76356408G>A	ENSP00000263187:p.Asp752Asn		Q5T4U6|Q8NEB3|Q9UNP8	Missense_Mutation	SNP	pfam_DNA_mismatch_repair_MutS_C,pfam_DNA_mismatch_repair_MutS_core,pfam_DNA_mismatch_repair_MutS_connt,pfam_DNA_mismatch_repair_MutS_clamp,superfamily_DNA_mismatch_repair_MutS_core,superfamily_DNA_mismatch_repair_MutS_connt,smart_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_C	p.D752N	ENST00000263187.3	37	c.2254	CCDS670.1	1	.	.	.	.	.	.	.	.	.	.	G	10.50	1.367105	0.24771	.	.	ENSG00000057468	ENST00000263187	D	0.85556	-2.0	5.69	3.84	0.44239	DNA mismatch repair protein MutS, C-terminal (2);	0.148479	0.64402	N	0.000013	T	0.50633	0.1627	N	0.10645	0.015	0.39882	D	0.973655	B	0.02656	0.0	B	0.06405	0.002	T	0.42120	-0.9470	10	0.18710	T	0.47	-31.9844	9.5984	0.39589	0.2123:0.0:0.7877:0.0	.	752	O15457	MSH4_HUMAN	N	752	ENSP00000263187:D752N	ENSP00000263187:D752N	D	+	1	0	MSH4	76128996	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.000000	0.40816	0.769000	0.33313	0.655000	0.94253	GAC	MSH4	-	pfam_DNA_mismatch_repair_MutS_C,smart_DNA_mismatch_repair_MutS_C	ENSG00000057468		0.303	MSH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSH4	HGNC	protein_coding	OTTHUMT00000026983.1	47	0.00	0	G	NM_002440		76356408	76356408	+1	no_errors	ENST00000263187	ensembl	human	known	69_37n	missense	29	17.14	6	SNP	0.999	A
MUC4	4585	genome.wustl.edu	37	3	195480050	195480050	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr3:195480050C>T	ENST00000346145.4	-	19	2711	c.2672G>A	c.(2671-2673)tGc>tAc	p.C891Y	MUC4_ENST00000475231.1_Missense_Mutation_p.C5075Y|MUC4_ENST00000349607.4_Missense_Mutation_p.C840Y|MUC4_ENST00000463781.3_Missense_Mutation_p.C5127Y	NM_004532.5	NP_004523.3	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	1884	Ser-rich.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TTGATTGTAGCAGTAATTCAC	0.612																																						dbGAP											0													141.0	135.0	137.0					3																	195480050		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000346145.4:c.2672G>A	3.37:g.195480050C>T	ENSP00000304207:p.Cys891Tyr		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.C5127Y	ENST00000346145.4	37	c.15380	CCDS3310.1	3	.	.	.	.	.	.	.	.	.	.	.	7.702	0.693395	0.15039	.	.	ENSG00000145113	ENST00000349607;ENST00000346145;ENST00000463781;ENST00000475231;ENST00000392409	T;T;T;T	0.57273	0.41;0.77;0.54;0.75	5.58	4.71	0.59529	.	0.000000	0.64402	D	0.000020	T	0.72684	0.3491	M	0.80847	2.515	0.28045	N	0.933579	D;D;D;D;D;D	0.89917	0.998;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.994;0.999;0.999;0.996;0.996;0.999	T	0.69982	-0.4997	10	0.87932	D	0	-24.4641	13.1097	0.59267	0.1608:0.8392:0.0:0.0	.	4999;840;891;5127;5075;1832	E7ESK3;Q99102-12;Q99102-13;E9PDY6;E7ENC5;Q99102-10	.;.;.;.;.;.	Y	840;891;5127;5075;1627	ENSP00000338109:C840Y;ENSP00000304207:C891Y;ENSP00000417498:C5127Y;ENSP00000420243:C5075Y	ENSP00000304207:C891Y	C	-	2	0	MUC4	196965721	0.999000	0.42202	0.986000	0.45419	0.002000	0.02628	1.580000	0.36547	1.376000	0.46267	-0.233000	0.12211	TGC	MUC4	-	smart_EGF-like,pfscan_EG-like_dom	ENSG00000145113		0.612	MUC4-015	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000341862.1	22	0.00	0	C	NM_018406		195480050	195480050	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	missense	18	57.14	24	SNP	0.983	T
NELL1	4745	genome.wustl.edu	37	11	20805317	20805317	+	Silent	SNP	T	T	G			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr11:20805317T>G	ENST00000357134.5	+	3	428	c.276T>G	c.(274-276)acT>acG	p.T92T	NELL1_ENST00000532434.1_Silent_p.T92T|NELL1_ENST00000325319.5_Silent_p.T92T|NELL1_ENST00000298925.5_Silent_p.T120T	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	92	Laminin G-like.				cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						TTTTGGCCACTGTACAGCAGA	0.433																																						dbGAP											0													118.0	106.0	110.0					11																	20805317		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.276T>G	11.37:g.20805317T>G			B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Silent	SNP	pfam_EGF-like_Ca-bd,pfam_VWF_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,smart_VWC_out,smart_VWF_C,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_VWF_C	p.T92	ENST00000357134.5	37	c.276	CCDS7855.1	11																																																																																			NELL1	-	superfamily_ConA-like_lec_gl,smart_Laminin_G	ENSG00000165973		0.433	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NELL1	HGNC	protein_coding	OTTHUMT00000387588.1	30	0.00	0	T	NM_006157		20805317	20805317	+1	no_errors	ENST00000357134	ensembl	human	known	69_37n	silent	26	16.13	5	SNP	0.004	G
NWD1	284434	genome.wustl.edu	37	19	16842052	16842052	+	Missense_Mutation	SNP	G	G	T	rs8107776	byFrequency	TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr19:16842052G>T	ENST00000552788.1	+	1	44	c.44G>T	c.(43-45)tGc>tTc	p.C15F	NWD1_ENST00000524140.2_Missense_Mutation_p.C15F|NWD1_ENST00000549814.1_Missense_Mutation_p.C15F|NWD1_ENST00000523826.1_5'UTR|NWD1_ENST00000379808.3_Missense_Mutation_p.C15F			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	15				C -> F (in Ref. 1; CAH18655). {ECO:0000305}.			ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						ACCCTGAAGTGCCAGACCTTC	0.498													g|||	2480	0.495208	0.6407	0.3718	5008	,	,		16503	0.2619		0.6133	False		,,,				2504	0.5051					dbGAP											0																																										-	-	-	SO:0001583	missense	0			BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.44G>T	19.37:g.16842052G>T	ENSP00000447224:p.Cys15Phe		C9J021|Q68CT3	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.C15F	ENST00000552788.1	37	c.44		19	1082	0.49542124542124544	313	0.6361788617886179	159	0.43922651933701656	153	0.2674825174825175	457	0.6029023746701847	g	7.655	0.683798	0.14907	.	.	ENSG00000188039	ENST00000524140;ENST00000549814;ENST00000379808;ENST00000552788	T;T;T;T	0.55413	0.52;0.58;0.52;0.58	4.68	-2.14	0.07123	.	1.465170	0.04678	N	0.411842	T	0.00012	0.0000	N	0.08118	0	0.20489	P	0.999892517	B	0.02656	0.0	B	0.01281	0.0	T	0.43589	-0.9382	9	0.08599	T	0.76	.	2.026	0.03519	0.1803:0.2826:0.3931:0.144	rs8107776;rs56832634	15	Q149M9-3	.	F	15	ENSP00000428579:C15F;ENSP00000447548:C15F;ENSP00000369136:C15F;ENSP00000447224:C15F	ENSP00000369136:C15F	C	+	2	0	NWD1	16703052	0.993000	0.37304	0.418000	0.26571	0.470000	0.32858	0.024000	0.13555	-0.140000	0.11394	0.437000	0.28790	TGC	NWD1	-	NULL	ENSG00000188039		0.498	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	NWD1	HGNC	protein_coding	OTTHUMT00000403569.1	16	0.00	0	G	NM_001007525		16842052	16842052	+1	no_errors	ENST00000379808	ensembl	human	known	69_37n	missense	21	25.00	7	SNP	0.578	T
OBSCN	84033	genome.wustl.edu	37	1	228487757	228487757	+	Intron	SNP	T	T	A			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr1:228487757T>A	ENST00000422127.1	+	43	11703				OBSCN_ENST00000602685.1_3'UTR|OBSCN_ENST00000366709.4_Intron|RP5-1139B12.4_ENST00000602778.1_RNA|OBSCN_ENST00000570156.2_Missense_Mutation_p.L4550Q|OBSCN_ENST00000366707.4_Missense_Mutation_p.L1240Q|OBSCN_ENST00000284548.11_Intron|OBSCN_ENST00000359599.6_3'UTR	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF						apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				AGTTGTGAGCTGCAGATTCGT	0.577																																						dbGAP											0													128.0	105.0	112.0					1																	228487757		876	1991	2867	-	-	-	SO:0001627	intron_variant	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.11659+5013T>A	1.37:g.228487757T>A			Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_DH-domain,pfam_Fibronectin_type3,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.L1240Q	ENST00000422127.1	37	c.3719	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	T	17.52	3.409828	0.62399	.	.	ENSG00000154358	ENST00000366707	T	0.68479	-0.33	4.37	4.37	0.52481	.	.	.	.	.	T	0.77322	0.4113	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.80979	-0.1140	6	0.87932	D	0	.	13.7409	0.62847	0.0:0.0:0.0:1.0	.	.	.	.	Q	1240	ENSP00000355668:L1240Q	ENSP00000355668:L1240Q	L	+	2	0	OBSCN	226554380	1.000000	0.71417	1.000000	0.80357	0.038000	0.13279	6.989000	0.76219	1.809000	0.52856	0.459000	0.35465	CTG	OBSCN	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000154358		0.577	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		48	0.00	0	T	NM_052843		228487757	228487757	+1	no_errors	ENST00000366707	ensembl	human	known	69_37n	missense	52	21.21	14	SNP	1.000	A
OR4F17	81099	genome.wustl.edu	37	19	111016	111016	+	Missense_Mutation	SNP	T	T	G	rs200336441		TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr19:111016T>G	ENST00000585993.1	+	2	477	c.338T>G	c.(337-339)tTt>tGt	p.F113C	OR4F17_ENST00000318050.3_Missense_Mutation_p.F113C			Q8NGA8	O4F17_HUMAN	olfactory receptor, family 4, subfamily F, member 17	113						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			lung(2)	2		all_cancers(10;1.05e-30)|all_epithelial(18;3.04e-19)|Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;2.49e-05)|all_lung(49;4.36e-05)|Breast(49;0.000304)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCATGGGCTTTGACAGATAT	0.463																																						dbGAP											0													1.0	1.0	1.0					19																	111016		76	150	226	-	-	-	SO:0001583	missense	0			AC005605	CCDS32854.1	19p13.3	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	15381	protein-coding gene	gene with protein product				OR4F19, OR4F11P, OR4F18			Standard	NM_001005240		Approved		uc002loc.1	Q8NGA8		ENST00000585993.1:c.338T>G	19.37:g.111016T>G	ENSP00000467301:p.Phe113Cys		B2RNE8	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.F113C	ENST00000585993.1	37	c.338	CCDS32854.1	19	.	.	.	.	.	.	.	.	.	.	.	9.777	1.174271	0.21704	.	.	ENSG00000176695	ENST00000442916;ENST00000318050	T	0.00520	6.85	2.55	2.55	0.30701	GPCR, rhodopsin-like superfamily (1);	0.156294	0.30193	N	0.010181	T	0.01189	0.0039	M	0.75884	2.315	0.31291	N	0.689393	D	0.76494	0.999	D	0.74674	0.984	T	0.24154	-1.0168	10	0.72032	D	0.01	.	4.9478	0.13999	0.2703:0.0:0.0:0.7297	.	113	Q8NGA8	O4F17_HUMAN	C	161;113	ENSP00000315047:F113C	ENSP00000315047:F113C	F	+	2	0	OR4F17	62016	0.698000	0.27777	1.000000	0.80357	0.325000	0.28411	0.344000	0.19962	1.410000	0.46936	0.346000	0.21813	TTT	OR4F17	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000176695		0.463	OR4F17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4F17	HGNC	protein_coding	OTTHUMT00000451410.1	12	0.00	0	T			111016	111016	+1	no_errors	ENST00000318050	ensembl	human	known	69_37n	missense	5	37.50	3	SNP	0.999	G
OR52A5	390054	genome.wustl.edu	37	11	5153313	5153313	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr11:5153313A>G	ENST00000307388.1	-	1	559	c.560T>C	c.(559-561)aTc>aCc	p.I187T		NM_001005160.2	NP_001005160.1	Q9H2C5	O52A5_HUMAN	olfactory receptor, family 52, subfamily A, member 5	187					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(18)|skin(3)	35		Medulloblastoma(188;0.0049)|all_neural(188;0.0442)|Breast(177;0.0675)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.2)		CAGCTTCACGATGGCCATGTG	0.418																																						dbGAP											0													125.0	119.0	121.0					11																	5153313		2201	4298	6499	-	-	-	SO:0001583	missense	0			BK004433	CCDS31373.1	11p15.4	2012-08-09			ENSG00000171944	ENSG00000171944		"""GPCR / Class A : Olfactory receptors"""	19580	protein-coding gene	gene with protein product							Standard	NM_001005160		Approved		uc010qyx.2	Q9H2C5	OTTHUMG00000066616	ENST00000307388.1:c.560T>C	11.37:g.5153313A>G	ENSP00000303469:p.Ile187Thr			Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.I187T	ENST00000307388.1	37	c.560	CCDS31373.1	11	.	.	.	.	.	.	.	.	.	.	A	16.87	3.241379	0.58995	.	.	ENSG00000171944	ENST00000307388	T	0.00237	8.47	5.09	5.09	0.68999	GPCR, rhodopsin-like superfamily (1);	0.278564	0.25723	N	0.028733	T	0.00496	0.0016	M	0.77103	2.36	0.38222	D	0.940786	D	0.53885	0.963	P	0.59825	0.864	T	0.78204	-0.2295	10	0.87932	D	0	.	13.8388	0.63426	1.0:0.0:0.0:0.0	.	187	Q9H2C5	O52A5_HUMAN	T	187	ENSP00000303469:I187T	ENSP00000303469:I187T	I	-	2	0	OR52A5	5109889	0.995000	0.38212	0.995000	0.50966	0.293000	0.27360	8.218000	0.89768	2.132000	0.65825	0.460000	0.39030	ATC	OR52A5	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000171944		0.418	OR52A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52A5	HGNC	protein_coding	OTTHUMT00000142823.1	23	0.00	0	A	NM_001005160		5153313	5153313	-1	no_errors	ENST00000307388	ensembl	human	known	69_37n	missense	34	12.82	5	SNP	0.982	G
PASD1	139135	genome.wustl.edu	37	X	150832673	150832673	+	Silent	SNP	G	G	T			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chrX:150832673G>T	ENST00000370357.4	+	11	1169	c.924G>T	c.(922-924)gtG>gtT	p.V308V		NM_173493.2	NP_775764.2	Q8IV76	PASD1_HUMAN	PAS domain containing 1	308						nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(3)|liver(1)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48	Acute lymphoblastic leukemia(192;6.56e-05)					AGTTCTCGGTGGATCAGGTGG	0.582																																						dbGAP											0													109.0	91.0	97.0					X																	150832673		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY270020	CCDS35431.1	Xq28	2009-08-06			ENSG00000166049	ENSG00000166049			20686	protein-coding gene	gene with protein product	"""cancer/testis antigen 63"""					15122589, 15162151	Standard	NM_173493		Approved	CT63	uc004fev.4	Q8IV76	OTTHUMG00000024169	ENST00000370357.4:c.924G>T	X.37:g.150832673G>T			Q3MNE0|Q69HD7|Q8N7X9	Silent	SNP	smart_PAS,pfscan_PAS	p.V308	ENST00000370357.4	37	c.924	CCDS35431.1	X																																																																																			PASD1	-	NULL	ENSG00000166049		0.582	PASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PASD1	HGNC	protein_coding	OTTHUMT00000060879.2	35	0.00	0	G	NM_173493		150832673	150832673	+1	no_errors	ENST00000370357	ensembl	human	known	69_37n	silent	21	12.50	3	SNP	0.005	T
PGAM1	5223	genome.wustl.edu	37	10	99192356	99192356	+	3'UTR	SNP	C	C	G			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr10:99192356C>G	ENST00000334828.5	+	0	988				PGAM1_ENST00000467867.1_3'UTR	NM_002629.2	NP_002620.1	P18669	PGAM1_HUMAN	phosphoglycerate mutase 1 (brain)						carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|regulation of glycolytic process (GO:0006110)|regulation of pentose-phosphate shunt (GO:0043456)|respiratory burst (GO:0045730)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	bisphosphoglycerate 2-phosphatase activity (GO:0004083)|bisphosphoglycerate mutase activity (GO:0004082)|phosphoglycerate mutase activity (GO:0004619)|protein kinase binding (GO:0019901)			endometrium(1)|kidney(1)|large_intestine(3)|lung(1)	6		Colorectal(252;0.162)		Epithelial(162;8.36e-10)|all cancers(201;5.62e-08)		CCCACCTGCACATGTCACACT	0.592																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			BC010038	CCDS7458.1	10q25.3	2012-10-02			ENSG00000171314	ENSG00000171314	5.4.2.1		8888	protein-coding gene	gene with protein product	"""Phosphoglycerate mutase A, nonmuscle form"""	172250		PGAMA		2846553	Standard	NM_002629		Approved	PGAM-B	uc001knh.3	P18669	OTTHUMG00000018846	ENST00000334828.5:c.*75C>G	10.37:g.99192356C>G			Q9BWC0	RNA	SNP	-	NULL	ENST00000334828.5	37	NULL	CCDS7458.1	10																																																																																			PGAM1	-	-	ENSG00000171314		0.592	PGAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGAM1	HGNC	protein_coding	OTTHUMT00000049652.1	25	0.00	0	C	NM_002629		99192356	99192356	+1	no_errors	ENST00000467867	ensembl	human	known	69_37n	rna	7	41.67	5	SNP	0.167	G
PHF12	57649	genome.wustl.edu	37	17	27238259	27238259	+	Intron	SNP	G	G	T			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr17:27238259G>T	ENST00000332830.4	-	10	2900				PHF12_ENST00000582655.1_Intron|PHF12_ENST00000577226.1_Intron	NM_001033561.1	NP_001028733.1			PHD finger protein 12											breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30	all_cancers(5;1.95e-14)|all_epithelial(6;5e-18)|Lung NSC(42;0.01)		Epithelial(11;1.64e-05)|all cancers(11;7.47e-05)|BRCA - Breast invasive adenocarcinoma(11;9.79e-05)			TTGCCATCTGGGGACGGAGCA	0.567																																						dbGAP											0													131.0	107.0	115.0					17																	27238259		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AB040956	CCDS11247.1, CCDS32598.1	17q11.2	2013-01-28			ENSG00000109118	ENSG00000109118		"""Zinc fingers, PHD-type"""	20816	protein-coding gene	gene with protein product						11390640	Standard	XM_005258015		Approved	PF1, KIAA1523	uc002hdg.1	Q96QT6	OTTHUMG00000132676	ENST00000332830.4:c.2090-4C>A	17.37:g.27238259G>T				RNA	SNP	-	NULL	ENST00000332830.4	37	NULL	CCDS32598.1	17																																																																																			PHF12	-	-	ENSG00000109118		0.567	PHF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF12	HGNC	protein_coding	OTTHUMT00000255941.1	44	0.00	0	G	NM_020889		27238259	27238259	-1	no_errors	ENST00000579563	ensembl	human	known	69_37n	rna	37	13.95	6	SNP	1.000	T
PSIP1	11168	genome.wustl.edu	37	9	15472724	15472724	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr9:15472724G>C	ENST00000380733.4	-	10	1226	c.883C>G	c.(883-885)Cag>Gag	p.Q295E	PSIP1_ENST00000380716.4_Missense_Mutation_p.Q295E|PSIP1_ENST00000380738.4_Missense_Mutation_p.Q295E|PSIP1_ENST00000380715.1_Missense_Mutation_p.Q295E|PSIP1_ENST00000397519.2_Missense_Mutation_p.Q295E			O75475	PSIP1_HUMAN	PC4 and SFRS1 interacting protein 1	295					establishment of integrated proviral latency (GO:0075713)|mRNA 5'-splice site recognition (GO:0000395)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to heat (GO:0009408)|response to oxidative stress (GO:0006979)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear heterochromatin (GO:0005720)|nuclear periphery (GO:0034399)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription coactivator activity (GO:0001105)|supercoiled DNA binding (GO:0097100)			breast(2)|endometrium(2)|kidney(1)|lung(3)|prostate(1)	9				GBM - Glioblastoma multiforme(50;2.38e-06)		TGAGCAGTCTGAAAGTTCCTC	0.398																																						dbGAP											0													180.0	158.0	166.0					9																	15472724		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF098482	CCDS6479.1, CCDS6480.1	9p22.2	2008-02-05	2004-02-24		ENSG00000164985	ENSG00000164985			9527	protein-coding gene	gene with protein product		603620	"""PC4 and SFRS1 interacting protein 2"""	PSIP2		9822615, 9885563	Standard	NM_033222		Approved	p52, LEDGF, p75	uc003zlw.4	O75475	OTTHUMG00000021021	ENST00000380733.4:c.883C>G	9.37:g.15472724G>C	ENSP00000370109:p.Gln295Glu		D3DRI9|O00256|O95368|Q6P391|Q86YB9|Q9NZI3|Q9UER6	Missense_Mutation	SNP	pfam_LEDGF,pfam_PWWP,smart_PWWP,prints_Treacle-like_TCS,pfscan_PWWP	p.Q295E	ENST00000380733.4	37	c.883	CCDS6479.1	9	.	.	.	.	.	.	.	.	.	.	G	12.49	1.953675	0.34471	.	.	ENSG00000164985	ENST00000380733;ENST00000380738;ENST00000380715;ENST00000380716;ENST00000397519	T;T;T;T;T	0.41400	1.02;1.02;1.0;1.0;1.0	6.07	5.15	0.70609	.	0.390063	0.27531	N	0.018947	T	0.39436	0.1078	L	0.47716	1.5	0.34094	D	0.661117	B;B	0.31817	0.341;0.139	B;B	0.32762	0.152;0.037	T	0.52480	-0.8570	10	0.36615	T	0.2	.	15.5515	0.76155	0.0:0.1372:0.8628:0.0	.	295;295	O75475-2;O75475	.;PSIP1_HUMAN	E	295	ENSP00000370109:Q295E;ENSP00000370114:Q295E;ENSP00000370091:Q295E;ENSP00000370092:Q295E;ENSP00000380653:Q295E	ENSP00000370091:Q295E	Q	-	1	0	PSIP1	15462724	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	4.766000	0.62279	1.521000	0.48983	0.585000	0.79938	CAG	PSIP1	-	NULL	ENSG00000164985		0.398	PSIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PSIP1	HGNC	protein_coding	OTTHUMT00000055445.1	51	0.00	0	G	NM_033222		15472724	15472724	-1	no_errors	ENST00000380733	ensembl	human	known	69_37n	missense	40	33.33	20	SNP	0.999	C
PTGES2	80142	genome.wustl.edu	37	9	130883459	130883459	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr9:130883459C>G	ENST00000338961.6	-	7	1843	c.1099G>C	c.(1099-1101)Gag>Cag	p.E367Q	RP11-395P17.3_ENST00000418747.1_RNA|RP11-395P17.3_ENST00000536815.1_RNA|PTGES2_ENST00000483625.1_5'Flank|PTGES2_ENST00000277462.5_Missense_Mutation_p.E176Q	NM_001256335.1|NM_025072.6	NP_001243264.1|NP_079348.1	Q9H7Z7	PGES2_HUMAN	prostaglandin E synthase 2	367	GST C-terminal.				cell redox homeostasis (GO:0045454)|positive regulation of transcription, DNA-templated (GO:0045893)|prostaglandin biosynthetic process (GO:0001516)|secretion (GO:0046903)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|electron carrier activity (GO:0009055)|glutathione binding (GO:0043295)|heme binding (GO:0020037)|lyase activity (GO:0016829)|prostaglandin-E synthase activity (GO:0050220)|protein disulfide oxidoreductase activity (GO:0015035)			endometrium(1)|large_intestine(1)|lung(2)	4						ATGGCCCTCTCCACCCGCAGG	0.677																																						dbGAP											0													65.0	51.0	56.0					9																	130883459		2200	4299	6499	-	-	-	SO:0001583	missense	0			AK024100	CCDS6891.1	9q34.12	2008-05-06	2002-06-13	2002-06-14	ENSG00000148334	ENSG00000148334			17822	protein-coding gene	gene with protein product		608152	"""chromosome 9 open reading frame 15"""	C9orf15		11866447	Standard	NM_025072		Approved	FLJ14038	uc004bti.4	Q9H7Z7	OTTHUMG00000020730	ENST00000338961.6:c.1099G>C	9.37:g.130883459C>G	ENSP00000345341:p.Glu367Gln		Q53EW9|Q5SYV6|Q96GI0|Q96GL2	Missense_Mutation	SNP	pfam_Glutaredoxin,pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold	p.E367Q	ENST00000338961.6	37	c.1099	CCDS6891.1	9	.	.	.	.	.	.	.	.	.	.	C	16.40	3.111714	0.56398	.	.	ENSG00000148334	ENST00000338961;ENST00000277462	T;T	0.41400	1.0;1.0	5.06	5.06	0.68205	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Glutathione S-transferase, C-terminal (1);	0.170321	0.52532	D	0.000069	T	0.34716	0.0907	L	0.48642	1.525	0.46458	D	0.999057	B	0.27910	0.193	B	0.23419	0.046	T	0.14504	-1.0470	10	0.37606	T	0.19	.	10.9816	0.47497	0.0:0.9145:0.0:0.0855	.	367	Q9H7Z7	PGES2_HUMAN	Q	367;176	ENSP00000345341:E367Q;ENSP00000277462:E176Q	ENSP00000277462:E176Q	E	-	1	0	PTGES2	129923280	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	4.200000	0.58433	2.355000	0.79922	0.491000	0.48974	GAG	PTGES2	-	pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like	ENSG00000148334		0.677	PTGES2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGES2	HGNC	protein_coding	OTTHUMT00000054339.1	32	0.00	0	C			130883459	130883459	-1	no_errors	ENST00000338961	ensembl	human	known	69_37n	missense	33	32.65	16	SNP	1.000	G
RB1	5925	genome.wustl.edu	37	13	48881458	48881459	+	Frame_Shift_Ins	INS	-	-	AT			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr13:48881458_48881459insAT	ENST00000267163.4	+	2	318_319	c.180_181insAT	c.(181-183)tgtfs	p.C61fs		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	61					androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(3)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TTACTGCATTATGTCAGAAATT	0.322		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																												dbGAP	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	18	Whole gene deletion(15)|Unknown(3)	bone(10)|haematopoietic_and_lymphoid_tissue(2)|breast(2)|eye(1)|soft_tissue(1)|endometrium(1)|stomach(1)																																								-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database		M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	Exception_encountered	13.37:g.48881458_48881459insAT	ENSP00000267163:p.Cys61fs		A8K5E3|P78499|Q5VW46|Q8IZL4	Frame_Shift_Ins	INS	pfam_Rb_C,pfam_RB_A,pfam_RB_B,pfam_DUF3452_retinoblatoma-assoc,superfamily_Cyclin-like,superfamily_FH2_actin-bd,smart_Cyclin-like	p.C60fs	ENST00000267163.4	37	c.180_181	CCDS31973.1	13																																																																																			RB1	-	superfamily_FH2_actin-bd,superfamily_Cyclin-like	ENSG00000139687		0.322	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	HGNC	protein_coding	OTTHUMT00000044884.1	15	0.00	0	-			48881458	48881459	+1	no_errors	ENST00000267163	ensembl	human	known	69_37n	frame_shift_ins	10	41.18	7	INS	1.000:1.000	AT
RIPK3	11035	genome.wustl.edu	37	14	24806073	24806073	+	Intron	SNP	G	G	C			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr14:24806073G>C	ENST00000216274.5	-	9	1555				ADCY4_ENST00000558563.1_5'Flank|ADCY4_ENST00000396747.3_5'Flank|ADCY4_ENST00000310677.4_5'Flank|RIPK3_ENST00000554338.1_5'Flank|RP11-934B9.3_ENST00000555591.1_Intron|ADCY4_ENST00000418030.2_5'Flank|ADCY4_ENST00000554068.2_5'Flank	NM_006871.3	NP_006862.2	Q9Y572	RIPK3_HUMAN	receptor-interacting serine-threonine kinase 3						activation of protein kinase activity (GO:0032147)|amyloid fibril formation (GO:1990000)|apoptotic signaling pathway (GO:0097190)|cellular protein modification process (GO:0006464)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|lymph node development (GO:0048535)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of ligase activity (GO:0051351)|positive regulation of necroptotic process (GO:0060545)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phosphatase activity (GO:0010922)|positive regulation of protein deacetylation (GO:0090312)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of type I interferon production (GO:0032481)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of activated T cell proliferation (GO:0046006)|regulation of activation-induced cell death of T cells (GO:0070235)|regulation of adaptive immune response (GO:0002819)|regulation of CD8-positive, alpha-beta cytotoxic T cell extravasation (GO:2000452)|regulation of interferon-gamma production (GO:0032649)|regulation of T cell mediated cytotoxicity (GO:0001914)|signal transduction (GO:0007165)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|ripoptosome (GO:0097342)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|NF-kappaB-inducing kinase activity (GO:0004704)|protein complex binding (GO:0032403)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription coactivator activity (GO:0003713)			NS(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23				GBM - Glioblastoma multiforme(265;0.0181)		GGAAAAGAAAGAGGTAGAGAA	0.512																																					Pancreas(58;918 1191 4668 13304 15331)	dbGAP											0													100.0	97.0	98.0					14																	24806073		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF156884	CCDS9628.1	14q12	2006-05-15			ENSG00000129465	ENSG00000129465			10021	protein-coding gene	gene with protein product		605817				10339433, 10358032	Standard	NM_006871		Approved	RIP3	uc001wpb.3	Q9Y572	OTTHUMG00000029349	ENST00000216274.5:c.1336+17C>G	14.37:g.24806073G>C			B4DJL9|C4AM87|Q5J795|Q5J796|Q6P5Y1	Silent	SNP	NULL	p.L132	ENST00000216274.5	37	c.396	CCDS9628.1	14																																																																																			RIPK3	-	NULL	ENSG00000129465		0.512	RIPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIPK3	HGNC	protein_coding	OTTHUMT00000073203.4	37	0.00	0	G	NM_006871		24806073	24806073	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000554569	ensembl	human	putative	69_37n	silent	21	51.16	22	SNP	0.000	C
RNF111	54778	genome.wustl.edu	37	15	59377902	59377902	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr15:59377902C>T	ENST00000557998.1	+	10	2755	c.2468C>T	c.(2467-2469)cCt>cTt	p.P823L	RNF111_ENST00000434298.1_Missense_Mutation_p.P832L|RNF111_ENST00000348370.4_Missense_Mutation_p.P823L|RNF111_ENST00000559209.1_Missense_Mutation_p.P832L|RNF111_ENST00000561186.1_Missense_Mutation_p.P832L	NM_001270530.1	NP_001257459.1	Q6ZNA4	RN111_HUMAN	ring finger protein 111	823					gene expression (GO:0010467)|pattern specification process (GO:0007389)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein polyubiquitination (GO:0000209)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ligase activity (GO:0016874)|SUMO polymer binding (GO:0032184)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35				all cancers(107;0.194)		ACTTATACACCTGGTGCATTG	0.423																																					NSCLC(72;983 1365 10746 34387 47081)	dbGAP											0													156.0	129.0	138.0					15																	59377902		2192	4291	6483	-	-	-	SO:0001583	missense	0			AL157474	CCDS10169.1, CCDS58365.1, CCDS58366.1	15q21	2013-01-09			ENSG00000157450	ENSG00000157450		"""RING-type (C3HC4) zinc fingers"""	17384	protein-coding gene	gene with protein product		605840				11298452	Standard	NM_017610		Approved	ARK, Arkadia, FLJ38008, DKFZP761D081	uc002aft.4	Q6ZNA4	OTTHUMG00000132716	ENST00000557998.1:c.2468C>T	15.37:g.59377902C>T	ENSP00000452732:p.Pro823Leu		C9JUS4|H0YN55|Q6P9A4|Q6ZMU2|Q7L428|Q7Z346|Q8N1P9|Q8WUA3|Q9NSR1	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.P832L	ENST00000557998.1	37	c.2495	CCDS58366.1	15	.	.	.	.	.	.	.	.	.	.	C	20.3	3.961521	0.74016	.	.	ENSG00000157450	ENST00000348370;ENST00000434298	T;T	0.15256	2.44;2.46	5.27	5.27	0.74061	.	0.137727	0.56097	D	0.000031	T	0.14917	0.0360	N	0.25647	0.755	0.80722	D	1	P;P;P	0.39424	0.673;0.483;0.617	B;B;B	0.36464	0.225;0.084;0.173	T	0.02917	-1.1094	10	0.46703	T	0.11	-18.6814	18.233	0.89939	0.0:1.0:0.0:0.0	.	832;823;823	Q6ZNA4-3;Q6ZNA4;Q6ZNA4-2	.;RN111_HUMAN;.	L	823;832	ENSP00000288199:P823L;ENSP00000393641:P832L	ENSP00000288199:P823L	P	+	2	0	RNF111	57165194	1.000000	0.71417	0.997000	0.53966	0.946000	0.59487	6.583000	0.74053	2.610000	0.88304	0.655000	0.94253	CCT	RNF111	-	NULL	ENSG00000157450		0.423	RNF111-003	KNOWN	basic|CCDS	protein_coding	RNF111	HGNC	protein_coding	OTTHUMT00000416012.1	36	0.00	0	C	NM_017610		59377902	59377902	+1	no_errors	ENST00000434298	ensembl	human	known	69_37n	missense	23	23.33	7	SNP	1.000	T
RPRD1B	58490	genome.wustl.edu	37	20	36718278	36718278	+	3'UTR	SNP	G	G	C			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr20:36718278G>C	ENST00000373433.4	+	0	1384				RPRD1B_ENST00000471511.1_3'UTR	NM_021215.3	NP_067038.1	Q9NQG5	RPR1B_HUMAN	regulation of nuclear pre-mRNA domain containing 1B						dephosphorylation of RNA polymerase II C-terminal domain (GO:0070940)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle process (GO:0010564)|transcription, DNA-templated (GO:0006351)	DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nucleus (GO:0005634)	RNA polymerase II core binding (GO:0000993)			endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)	12						AACTGACTAGGATGGGTGTCA	0.527																																						dbGAP											0													71.0	70.0	71.0					20																	36718278		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			AL109823	CCDS13301.1	20q11.21-q12	2012-02-09	2008-08-15	2008-07-28	ENSG00000101413	ENSG00000101413			16209	protein-coding gene	gene with protein product		614694	"""chromosome 20 open reading frame 77"""	C20orf77		22231121	Standard	NM_021215		Approved	dJ1057B20.2, DKFZp434P0735, CREPT, FLJ44520, NET60	uc002xho.4	Q9NQG5	OTTHUMG00000032434	ENST00000373433.4:c.*1G>C	20.37:g.36718278G>C			Q1WDE7|Q6PKF4	RNA	SNP	-	NULL	ENST00000373433.4	37	NULL	CCDS13301.1	20																																																																																			RPRD1B	-	-	ENSG00000101413		0.527	RPRD1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPRD1B	HGNC	protein_coding	OTTHUMT00000079142.2	25	0.00	0	G	NM_021215		36718278	36718278	+1	no_errors	ENST00000471511	ensembl	human	known	69_37n	rna	15	42.31	11	SNP	0.996	C
SAFB	6294	genome.wustl.edu	37	19	5653376	5653376	+	Missense_Mutation	SNP	A	A	T			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr19:5653376A>T	ENST00000292123.5	+	11	1578	c.1471A>T	c.(1471-1473)Acc>Tcc	p.T491S	SAFB_ENST00000433404.1_Missense_Mutation_p.T321S|SAFB_ENST00000592224.1_Missense_Mutation_p.T491S|SAFB_ENST00000588852.1_Missense_Mutation_p.T491S|SAFB_ENST00000538656.1_Missense_Mutation_p.T334S|SAFB_ENST00000454510.1_Missense_Mutation_p.T422S	NM_001201338.1|NM_001201339.1|NM_002967.3	NP_001188267.1|NP_001188268.1|NP_002958.2	Q15424	SAFB1_HUMAN	scaffold attachment factor B	491					chromatin organization (GO:0006325)|growth (GO:0040007)|hormone metabolic process (GO:0042445)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(6)|ovary(2)|skin(1)	23				UCEC - Uterine corpus endometrioid carcinoma (162;0.000222)		GGGAAAGAAAACCTCTGACAA	0.458																																					Colon(88;338 1345 6184 8214 20897)	dbGAP											0													61.0	59.0	60.0					19																	5653376		2203	4300	6503	-	-	-	SO:0001583	missense	0			L43631	CCDS12142.1, CCDS56077.1, CCDS59339.1, CCDS59340.1	19p13.3-p13.2	2013-02-12				ENSG00000160633		"""RNA binding motif (RRM) containing"""	10520	protein-coding gene	gene with protein product	"""Hsp27 ERE-TATA binding protein"""	602895				9605873, 8600450	Standard	NM_002967		Approved	HET, SAFB1	uc002mcg.3	Q15424		ENST00000292123.5:c.1471A>T	19.37:g.5653376A>T	ENSP00000292123:p.Thr491Ser		A0AV56|B7Z5B6|B7ZLP6|F5H0H3|O60406|Q59HH8	Missense_Mutation	SNP	pfam_RRM_dom,pfam_SAP_DNA-bd,smart_SAP_DNA-bd,smart_RRM_dom,pfscan_SAP_DNA-bd,pfscan_RRM_dom	p.T491S	ENST00000292123.5	37	c.1471	CCDS12142.1	19	.	.	.	.	.	.	.	.	.	.	A	7.716	0.696247	0.15106	.	.	ENSG00000160633	ENST00000454510;ENST00000540206;ENST00000433404;ENST00000292123;ENST00000538656	T;T;T;T	0.74002	-0.8;-0.8;-0.8;-0.8	5.34	-2.37	0.06643	.	1.122680	0.06684	N	0.768481	T	0.49795	0.1578	N	0.04508	-0.205	0.21290	N	0.999737	B;B;B;B;B;B;B	0.19200	0.0;0.034;0.0;0.003;0.017;0.003;0.017	B;B;B;B;B;B;B	0.20955	0.001;0.032;0.002;0.008;0.017;0.008;0.017	T	0.30416	-0.9979	10	0.22706	T	0.39	-0.0279	8.6168	0.33838	0.3789:0.1756:0.4455:0.0	.	290;334;422;491;491;491;491	B7Z1C7;B7Z2F6;F5H0H3;B7ZLP5;A0AV56;Q15424;B7ZLP6	.;.;.;.;.;SAFB1_HUMAN;.	S	422;386;321;491;334	ENSP00000415895:T422S;ENSP00000404545:T321S;ENSP00000292123:T491S;ENSP00000438880:T334S	ENSP00000292123:T491S	T	+	1	0	SAFB	5604376	0.161000	0.22892	0.054000	0.19295	0.904000	0.53231	1.197000	0.32211	-0.716000	0.04962	0.460000	0.39030	ACC	SAFB	-	NULL	ENSG00000160633		0.458	SAFB-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	SAFB	HGNC	protein_coding	OTTHUMT00000451641.2	21	0.00	0	A			5653376	5653376	+1	no_errors	ENST00000588852	ensembl	human	known	69_37n	missense	13	51.85	14	SNP	0.802	T
RYR1	6261	genome.wustl.edu	37	19	38974020	38974020	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr19:38974020A>G	ENST00000359596.3	+	33	4798	c.4798A>G	c.(4798-4800)Atg>Gtg	p.M1600V	RYR1_ENST00000360985.3_Missense_Mutation_p.M1600V|RYR1_ENST00000355481.4_Missense_Mutation_p.M1600V			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1600	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GCAGATGCTGATGCCAGTGTC	0.672																																						dbGAP											0													16.0	16.0	16.0					19																	38974020		2185	4284	6469	-	-	-	SO:0001583	missense	0			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.4798A>G	19.37:g.38974020A>G	ENSP00000352608:p.Met1600Val		Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.M1600V	ENST00000359596.3	37	c.4798	CCDS33011.1	19	.	.	.	.	.	.	.	.	.	.	A	11.53	1.665188	0.29604	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.96522	-4.03;-4.04;-4.03	5.0	3.91	0.45181	.	0.073339	0.51477	U	0.000082	D	0.86180	0.5871	N	0.00926	-1.1	0.25965	N	0.982574	B;B	0.30236	0.274;0.08	B;B	0.28991	0.08;0.097	T	0.81143	-0.1067	10	0.42905	T	0.14	.	11.1385	0.48390	0.8456:0.1544:0.0:0.0	.	1600;1600	P21817-2;P21817	.;RYR1_HUMAN	V	1600	ENSP00000352608:M1600V;ENSP00000347667:M1600V;ENSP00000354254:M1600V	ENSP00000347667:M1600V	M	+	1	0	RYR1	43665860	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.308000	0.78929	1.894000	0.54839	0.374000	0.22700	ATG	RYR1	-	NULL	ENSG00000196218		0.672	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	HGNC	protein_coding	OTTHUMT00000462137.1	53	0.00	0	A			38974020	38974020	+1	no_errors	ENST00000359596	ensembl	human	known	69_37n	missense	54	34.15	28	SNP	0.995	G
SCML2	10389	genome.wustl.edu	37	X	18278329	18278329	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chrX:18278329T>C	ENST00000251900.4	-	9	1190	c.1031A>G	c.(1030-1032)gAt>gGt	p.D344G	SCML2_ENST00000398048.3_Missense_Mutation_p.D80G	NM_006089.2	NP_006080.1	Q9UQR0	SCML2_HUMAN	sex comb on midleg-like 2 (Drosophila)	344					anatomical structure morphogenesis (GO:0009653)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	36	Hepatocellular(33;0.183)					AGAAGCGACATCTTTATATAA	0.343																																					Esophageal Squamous(100;1252 1965 19021 35517)	dbGAP											0													70.0	65.0	67.0					X																	18278329		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y18004	CCDS14185.1	Xp22	2013-01-10	2001-11-28		ENSG00000102098	ENSG00000102098		"""Sterile alpha motif (SAM) domain containing"""	10581	protein-coding gene	gene with protein product		300208	"""sex comb on midleg (Drosophila)-like 2"""			10331946	Standard	NM_006089		Approved		uc004cyl.2	Q9UQR0	OTTHUMG00000021212	ENST00000251900.4:c.1031A>G	X.37:g.18278329T>C	ENSP00000251900:p.Asp344Gly		Q5JXE6|Q86U98|Q8IWD0|Q8NDP2|Q9UGC5	Missense_Mutation	SNP	pfam_Mbt,pfam_DUF3588,pfam_SAM_type1,superfamily_SAM/pointed,smart_Mbt,smart_SAM,pfscan_Mbt	p.D344G	ENST00000251900.4	37	c.1031	CCDS14185.1	X	.	.	.	.	.	.	.	.	.	.	T	11.11	1.542942	0.27563	.	.	ENSG00000102098	ENST00000251900;ENST00000398048;ENST00000442000	T;T	0.59083	1.89;0.29	4.12	4.12	0.48240	.	4.887320	0.00397	N	0.000056	T	0.57110	0.2031	L	0.59436	1.845	0.09310	N	1	B;B;B	0.27559	0.0;0.181;0.0	B;B;B	0.19148	0.0;0.024;0.001	T	0.46062	-0.9218	10	0.59425	D	0.04	.	8.6521	0.34040	0.0:0.0:0.0:1.0	.	312;80;344	B4DZR9;B4DRC2;Q9UQR0	.;.;SCML2_HUMAN	G	344;80;312	ENSP00000251900:D344G;ENSP00000381126:D80G	ENSP00000251900:D344G	D	-	2	0	SCML2	18188250	0.000000	0.05858	0.003000	0.11579	0.004000	0.04260	0.300000	0.19156	1.638000	0.50547	0.437000	0.28790	GAT	SCML2	-	NULL	ENSG00000102098		0.343	SCML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCML2	HGNC	protein_coding	OTTHUMT00000055941.1	65	0.00	0	T	NM_006089		18278329	18278329	-1	no_errors	ENST00000251900	ensembl	human	known	69_37n	missense	35	35.19	19	SNP	0.005	C
SHROOM3	57619	genome.wustl.edu	37	4	77661463	77661463	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr4:77661463G>T	ENST00000296043.6	+	5	3090	c.2137G>T	c.(2137-2139)Ggg>Tgg	p.G713W		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	713					actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			TCCTGACCTCGGGAGCCATCT	0.672																																						dbGAP											0													45.0	57.0	53.0					4																	77661463		2175	4258	6433	-	-	-	SO:0001583	missense	0			AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.2137G>T	4.37:g.77661463G>T	ENSP00000296043:p.Gly713Trp		Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Missense_Mutation	SNP	pfam_ASD2,pfam_ASD1,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.G713W	ENST00000296043.6	37	c.2137	CCDS3579.2	4	.	.	.	.	.	.	.	.	.	.	g	12.01	1.809642	0.31961	.	.	ENSG00000138771	ENST00000296043	T	0.30981	1.51	5.47	-2.4	0.06583	.	0.381368	0.23070	N	0.052263	T	0.09247	0.0228	N	0.03608	-0.345	0.09310	N	1	B;B;B	0.10296	0.003;0.003;0.001	B;B;B	0.06405	0.002;0.001;0.001	T	0.12400	-1.0549	10	0.52906	T	0.07	-4.6499	1.1179	0.01718	0.2875:0.2235:0.0896:0.3994	.	537;713;491	B4E244;Q8TF72;B3KY47	.;SHRM3_HUMAN;.	W	713	ENSP00000296043:G713W	ENSP00000296043:G713W	G	+	1	0	SHROOM3	77880487	0.000000	0.05858	0.008000	0.14137	0.002000	0.02628	-0.205000	0.09411	0.038000	0.15604	0.558000	0.71614	GGG	SHROOM3	-	NULL	ENSG00000138771		0.672	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM3	HGNC	protein_coding	OTTHUMT00000252408.2	47	0.00	0	G	NM_020859		77661463	77661463	+1	no_errors	ENST00000296043	ensembl	human	known	69_37n	missense	21	12.50	3	SNP	0.000	T
SLC1A7	6512	genome.wustl.edu	37	1	53569223	53569223	+	Silent	SNP	G	G	T			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr1:53569223G>T	ENST00000371494.4	-	5	619	c.492C>A	c.(490-492)acC>acA	p.T164T		NM_006671.4	NP_006662.3	O00341	EAA5_HUMAN	solute carrier family 1 (glutamate transporter), member 7	164					dicarboxylic acid transport (GO:0006835)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)	26				Colorectal(1306;0.234)		TGACAACTGGGGTGGTCTTGG	0.552																																					NSCLC(128;80 1811 21245 38490 51715)	dbGAP											0													46.0	50.0	49.0					1																	53569223		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U76362	CCDS574.1, CCDS72796.1, CCDS72797.1, CCDS72798.1	1p32.3	2013-05-22			ENSG00000162383	ENSG00000162383		"""Solute carriers"""	10945	protein-coding gene	gene with protein product		604471				9108121	Standard	NM_001287597		Approved	EAAT5	uc001cuy.3	O00341	OTTHUMG00000008937	ENST00000371494.4:c.492C>A	1.37:g.53569223G>T			Q5VVZ0|Q969Z8|Q9BW45	Silent	SNP	pfam_Na-dicarboxylate_symporter,prints_Na-dicarboxylate_symporter	p.T164	ENST00000371494.4	37	c.492	CCDS574.1	1																																																																																			SLC1A7	-	pfam_Na-dicarboxylate_symporter	ENSG00000162383		0.552	SLC1A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC1A7	HGNC	protein_coding	OTTHUMT00000024746.1	31	0.00	0	G	NM_006671		53569223	53569223	-1	no_errors	ENST00000371494	ensembl	human	known	69_37n	silent	18	43.75	14	SNP	0.941	T
SPATA6L	55064	genome.wustl.edu	37	9	4629098	4629098	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr9:4629098C>G	ENST00000454239.2	-	6	667	c.422G>C	c.(421-423)aGa>aCa	p.R141T	SPATA6L_ENST00000381890.5_Missense_Mutation_p.R155T|SPATA6L_ENST00000475086.1_Missense_Mutation_p.R83T|SPATA6L_ENST00000223517.5_5'UTR|SPATA6L_ENST00000381895.5_5'UTR			Q8N4H0	SPA6L_HUMAN	spermatogenesis associated 6-like	141																	TACAAGAAATCTGTTTCTATG	0.303																																						dbGAP											0													55.0	55.0	55.0					9																	4629098		1806	4065	5871	-	-	-	SO:0001583	missense	0			AK000920	CCDS43785.1, CCDS43785.2	9p24.2	2012-03-15	2012-03-15	2012-03-15	ENSG00000106686	ENSG00000106686			25472	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 68"""	C9orf68			Standard	NM_001039395		Approved	FLJ10058	uc011llz.2	Q8N4H0	OTTHUMG00000019469	ENST00000454239.2:c.422G>C	9.37:g.4629098C>G	ENSP00000404277:p.Arg141Thr		B4DIY4|Q5JVJ5|Q8IY90	Missense_Mutation	SNP	NULL	p.R141T	ENST00000454239.2	37	c.422		9	.	.	.	.	.	.	.	.	.	.	C	14.50	2.553469	0.45487	.	.	ENSG00000106686	ENST00000454239;ENST00000381890;ENST00000475086	T;T;T	0.46819	1.85;0.86;1.75	5.23	5.23	0.72850	.	0.000000	0.56097	D	0.000026	T	0.60508	0.2274	L	0.57536	1.79	0.80722	D	1	D;P;P	0.89917	1.0;0.82;0.867	D;B;B	0.87578	0.998;0.343;0.359	T	0.55903	-0.8067	10	0.06236	T	0.91	-18.8246	15.7068	0.77588	0.0:1.0:0.0:0.0	.	83;141;155	B4DIY4;Q8N4H0;Q8N4H0-2	.;CI068_HUMAN;.	T	141;155;83	ENSP00000404277:R141T;ENSP00000371314:R155T;ENSP00000417063:R83T	ENSP00000371314:R155T	R	-	2	0	C9orf68	4619098	0.996000	0.38824	1.000000	0.80357	0.904000	0.53231	0.694000	0.25512	2.445000	0.82738	0.650000	0.86243	AGA	SPATA6L	-	NULL	ENSG00000106686		0.303	SPATA6L-202	KNOWN	basic	protein_coding	SPATA6L	HGNC	protein_coding		23	0.00	0	C	NM_017985		4629098	4629098	-1	no_errors	ENST00000454239	ensembl	human	known	69_37n	missense	19	34.48	10	SNP	0.997	G
ST18	9705	genome.wustl.edu	37	8	53092687	53092687	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr8:53092687G>A	ENST00000276480.7	-	9	955	c.272C>T	c.(271-273)aCc>aTc	p.T91I		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	91					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				GCTACCTGCGGTAGAGTGACC	0.522																																						dbGAP											0													265.0	215.0	232.0					8																	53092687		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.272C>T	8.37:g.53092687G>A	ENSP00000276480:p.Thr91Ile		Q17RY1	Missense_Mutation	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.T91I	ENST00000276480.7	37	c.272	CCDS6149.1	8	.	.	.	.	.	.	.	.	.	.	G	10.54	1.380105	0.24944	.	.	ENSG00000147488	ENST00000276480;ENST00000517580	T;T	0.46819	0.89;0.86	5.53	0.991	0.19813	.	1.268580	0.05039	N	0.476019	T	0.31827	0.0809	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.18681	-1.0329	10	0.21014	T	0.42	0.0445	7.441	0.27183	0.3127:0.1316:0.5557:0.0	.	91	O60284	ST18_HUMAN	I	91	ENSP00000276480:T91I;ENSP00000428521:T91I	ENSP00000276480:T91I	T	-	2	0	ST18	53255240	0.001000	0.12720	0.000000	0.03702	0.037000	0.13140	0.952000	0.29149	0.212000	0.20703	0.655000	0.94253	ACC	ST18	-	NULL	ENSG00000147488		0.522	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST18	HGNC	protein_coding	OTTHUMT00000377867.1	60	0.00	0	G			53092687	53092687	-1	no_errors	ENST00000276480	ensembl	human	known	69_37n	missense	39	29.09	16	SNP	0.000	A
TBC1D3P5	440419	genome.wustl.edu	37	17	25758564	25758564	+	RNA	SNP	G	G	A	rs75258876	byFrequency	TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr17:25758564G>A	ENST00000586223.1	+	0	2998					NR_033892.1				TBC1 domain family, member 3 pseudogene 5																		GACTTCTGACGACACCATGAG	0.458											OREG0024258	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	129	0.0257588	0.0045	0.0331	5008	,	,		19306	0.003		0.0765	False		,,,				2504	0.0204					dbGAP											0																																										-	-	-			0					17q11.1	2014-03-20			ENSG00000266433	ENSG00000266433			43567	pseudogene	pseudogene							Standard	NR_033892		Approved		uc002gzg.3		OTTHUMG00000179156		17.37:g.25758564G>A		781		RNA	SNP	-	NULL	ENST00000586223.1	37	NULL		17																																																																																			TBC1D3P5	-	-	ENSG00000266433		0.458	TBC1D3P5-003	KNOWN	non_canonical_TEC|basic	processed_transcript	TBC1D3P5	HGNC	pseudogene	OTTHUMT00000451073.1	14	0.00	0	G	NR_033892		25758564	25758564	+1	no_errors	ENST00000586223	ensembl	human	known	69_37n	rna	6	45.45	5	SNP	0.002	A
TMEM151B	441151	genome.wustl.edu	37	6	44243614	44243614	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr6:44243614A>G	ENST00000451188.2	+	3	1328	c.1051A>G	c.(1051-1053)Agc>Ggc	p.S351G	TMEM151B_ENST00000438774.2_Intron|RP11-444E17.6_ENST00000505802.1_Intron	NM_001137560.1	NP_001131032.1	Q8IW70	T151B_HUMAN	transmembrane protein 151B	351						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)	6						CCTCAGCCCCAGCGATGAGCT	0.692																																						dbGAP											0													9.0	11.0	10.0					6																	44243614		683	1572	2255	-	-	-	SO:0001583	missense	0			AK126839	CCDS47437.1	6p21.1	2009-04-17	2007-10-25	2007-10-25	ENSG00000178233	ENSG00000178233			21315	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 137"", ""transmembrane protein 193"""	C6orf137, TMEM193			Standard	NM_001137560		Approved	bA444E17.5	uc003oxh.2	Q8IW70	OTTHUMG00000014765	ENST00000451188.2:c.1051A>G	6.37:g.44243614A>G	ENSP00000393161:p.Ser351Gly		Q5T9V7	Missense_Mutation	SNP	NULL	p.S351G	ENST00000451188.2	37	c.1051	CCDS47437.1	6	.	.	.	.	.	.	.	.	.	.	A	7.484	0.649235	0.14516	.	.	ENSG00000178233	ENST00000451188	.	.	.	4.51	2.18	0.27775	.	0.330003	0.34959	N	0.003547	T	0.09335	0.0230	N	0.11560	0.145	0.80722	D	1	B	0.12013	0.005	B	0.12156	0.007	T	0.33317	-0.9873	9	0.02654	T	1	-16.389	6.3725	0.21489	0.7251:0.0:0.2749:0.0	.	351	Q8IW70	T151B_HUMAN	G	351	.	ENSP00000393161:S351G	S	+	1	0	TMEM151B	44351592	1.000000	0.71417	1.000000	0.80357	0.778000	0.44026	1.596000	0.36718	0.873000	0.35799	0.379000	0.24179	AGC	TMEM151B	-	NULL	ENSG00000178233		0.692	TMEM151B-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	TMEM151B	HGNC	protein_coding	OTTHUMT00000040740.2	9	0.00	0	A	NM_001039704		44243614	44243614	+1	no_errors	ENST00000451188	ensembl	human	known	69_37n	missense	11	26.67	4	SNP	1.000	G
TMPRSS12	283471	genome.wustl.edu	37	12	51252720	51252720	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr12:51252720A>G	ENST00000398458.3	+	3	568	c.536A>G	c.(535-537)aAa>aGa	p.K179R	TMPRSS12_ENST00000551456.1_Missense_Mutation_p.K179R	NM_182559.2	NP_872365	Q86WS5	TMPSC_HUMAN	transmembrane (C-terminal) protease, serine 12	179	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	18						CACTTAAAAAAAGCAGTGAGG	0.323																																						dbGAP											0													41.0	38.0	39.0					12																	51252720		1813	4072	5885	-	-	-	SO:0001583	missense	0			BC048112	CCDS44881.1	12q13.12	2014-08-12	2010-04-21		ENSG00000186452	ENSG00000186452		"""Serine peptidases / Transmembrane"""	28779	protein-coding gene	gene with protein product			"""transmembrane protease, serine 12"""				Standard	NM_182559		Approved	MGC57341, CT151	uc001rwx.4	Q86WS5	OTTHUMG00000169483	ENST00000398458.3:c.536A>G	12.37:g.51252720A>G	ENSP00000381476:p.Lys179Arg		B9ZVX2	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.K179R	ENST00000398458.3	37	c.536	CCDS44881.1	12	.	.	.	.	.	.	.	.	.	.	A	10.57	1.386865	0.25031	.	.	ENSG00000186452	ENST00000551456;ENST00000398458	T;D	0.88431	0.25;-2.38	5.89	3.14	0.36123	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.464290	0.20583	N	0.089495	T	0.74053	0.3666	N	0.05592	-0.015	0.21915	N	0.999477	B;B	0.20164	0.042;0.015	B;B	0.17433	0.018;0.018	T	0.57957	-0.7721	10	0.13108	T	0.6	-23.742	9.4607	0.38783	0.8295:0.0:0.1705:0.0	.	179;179	F8WBX2;Q86WS5	.;TMPSC_HUMAN	R	179	ENSP00000447259:K179R;ENSP00000381476:K179R	ENSP00000381476:K179R	K	+	2	0	TMPRSS12	49538987	0.998000	0.40836	1.000000	0.80357	0.965000	0.64279	1.324000	0.33712	1.007000	0.39238	0.455000	0.32223	AAA	TMPRSS12	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	ENSG00000186452		0.323	TMPRSS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS12	HGNC	protein_coding	OTTHUMT00000404289.1	34	0.00	0	A	NM_182559		51252720	51252720	+1	no_errors	ENST00000398458	ensembl	human	known	69_37n	missense	23	42.50	17	SNP	0.968	G
TRPC4AP	26133	genome.wustl.edu	37	20	33645320	33645320	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr20:33645320T>C	ENST00000252015.2	-	4	558	c.469A>G	c.(469-471)Aaa>Gaa	p.K157E	TRPC4AP_ENST00000432634.2_Missense_Mutation_p.K118E|TRPC4AP_ENST00000451813.2_Missense_Mutation_p.K157E			Q8TEL6	TP4AP_HUMAN	transient receptor potential cation channel, subfamily C, member 4 associated protein	157	Interaction with TNFRSF1A. {ECO:0000250}.				calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|protein ubiquitination (GO:0016567)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process (GO:0006511)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|skin(1)|stomach(1)|urinary_tract(1)	32			BRCA - Breast invasive adenocarcinoma(18;0.00936)			TACTTACTTTTCAGTTTCTGT	0.383																																						dbGAP											0													110.0	110.0	110.0					20																	33645320		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055022	CCDS13246.1, CCDS46591.1	20q11.23	2014-06-13	2003-10-06	2003-10-08	ENSG00000100991	ENSG00000100991			16181	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 158"""	608430	"""chromosome 20 open reading frame 188"""	C20orf188			Standard	NM_015638		Approved	DKFZP727M231, DKFZp586C1223, dJ756N5.2, TRRP4AP, PPP1R158	uc002xbk.3	Q8TEL6	OTTHUMG00000032319	ENST00000252015.2:c.469A>G	20.37:g.33645320T>C	ENSP00000252015:p.Lys157Glu		E1P5Q0|E1P5Q1|Q96H82|Q9BVB8|Q9H429|Q9UFS6	Missense_Mutation	SNP	pfam_DUF3689	p.K157E	ENST00000252015.2	37	c.469	CCDS13246.1	20	.	.	.	.	.	.	.	.	.	.	T	15.48	2.845267	0.51164	.	.	ENSG00000100991	ENST00000252015;ENST00000451813;ENST00000432634;ENST00000541994	.	.	.	4.84	4.84	0.62591	.	0.145940	0.64402	D	0.000011	T	0.40791	0.1131	L	0.27053	0.805	0.80722	D	1	B;B;B	0.29716	0.118;0.255;0.118	B;B;B	0.24394	0.037;0.053;0.037	T	0.28490	-1.0042	9	0.11485	T	0.65	.	14.2381	0.65941	0.0:0.0:0.0:1.0	.	118;157;157	B4E0Q1;E1P5Q0;Q8TEL6	.;.;TP4AP_HUMAN	E	157;157;118;142	.	ENSP00000252015:K157E	K	-	1	0	TRPC4AP	33108981	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	4.671000	0.61590	2.020000	0.59435	0.455000	0.32223	AAA	TRPC4AP	-	NULL	ENSG00000100991		0.383	TRPC4AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC4AP	HGNC	protein_coding	OTTHUMT00000078832.2	99	0.00	0	T	NM_015638		33645320	33645320	-1	no_errors	ENST00000252015	ensembl	human	known	69_37n	missense	74	35.65	41	SNP	1.000	C
TTN	7273	genome.wustl.edu	37	2	179586824	179586824	+	Silent	SNP	T	T	C			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr2:179586824T>C	ENST00000591111.1	-	76	21839	c.21615A>G	c.(21613-21615)gtA>gtG	p.V7205V	TTN-AS1_ENST00000585451.1_RNA|RP11-171I2.1_ENST00000590024.1_RNA|TTN_ENST00000342992.6_Silent_p.V6278V|TTN_ENST00000359218.5_Intron|TTN_ENST00000342175.6_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Silent_p.V7522V			Q8WZ42	TITIN_HUMAN	titin	12773	Ig-like 54.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CATCTATAGATACAGGCTTGA	0.398																																						dbGAP											0													182.0	175.0	177.0					2																	179586824		1924	4129	6053	-	-	-	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.21615A>G	2.37:g.179586824T>C			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.V6278	ENST00000591111.1	37	c.18834		2																																																																																			TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,pfscan_Ig-like	ENSG00000155657		0.398	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	39	0.00	0	T	NM_133378		179586824	179586824	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	silent	11	67.65	23	SNP	0.742	C
UHMK1	127933	genome.wustl.edu	37	1	162482580	162482580	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr1:162482580G>A	ENST00000489294.1	+	6	1149	c.991G>A	c.(991-993)Gat>Aat	p.D331N	UHMK1_ENST00000282169.8_3'UTR|UHMK1_ENST00000545294.1_Missense_Mutation_p.D257N|UHMK1_ENST00000538489.1_Missense_Mutation_p.D331N	NM_175866.4	NP_787062.1	Q8TAS1	UHMK1_HUMAN	U2AF homology motif (UHM) kinase 1	331	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176, ECO:0000305}.				cell cycle arrest (GO:0007050)|neuron projection development (GO:0031175)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of translational initiation (GO:0045948)|protein autophosphorylation (GO:0046777)|regulation of protein export from nucleus (GO:0046825)	axon (GO:0030424)|dendrite cytoplasm (GO:0032839)|neuronal ribonucleoprotein granule (GO:0071598)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|ribonucleoprotein complex binding (GO:0043021)|RNA binding (GO:0003723)|transferase activity (GO:0016740)			endometrium(1)|large_intestine(2)|lung(6)|prostate(2)	11	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.126)			TGTGCTGGATGATGATTATCT	0.323																																						dbGAP											0													155.0	153.0	154.0					1																	162482580		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC026046	CCDS1239.1, CCDS53423.1, CCDS53424.1	1q23.1	2013-02-12			ENSG00000152332	ENSG00000152332		"""RNA binding motif (RRM) containing"""	19683	protein-coding gene	gene with protein product		608849				12093740, 12782393	Standard	NM_175866		Approved	KIS, Kist	uc001gcc.2	Q8TAS1	OTTHUMG00000031373	ENST00000489294.1:c.991G>A	1.37:g.162482580G>A	ENSP00000420270:p.Asp331Asn		A8K8K4|G3V1M1|Q96C22	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_RRM_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_RRM_dom,pfscan_RRM_dom,pfscan_Prot_kinase_cat_dom	p.D331N	ENST00000489294.1	37	c.991	CCDS1239.1	1	.	.	.	.	.	.	.	.	.	.	G	19.74	3.884341	0.72410	.	.	ENSG00000152332	ENST00000545294;ENST00000538489;ENST00000489294	T;T;T	0.77620	-0.09;-1.11;-0.93	4.86	4.86	0.63082	RNA recognition motif domain (2);Protein kinase-like domain (1);	0.108198	0.64402	D	0.000008	T	0.64182	0.2575	L	0.42686	1.345	.	.	.	B;B;B	0.25904	0.029;0.137;0.081	B;B;B	0.31290	0.078;0.127;0.108	T	0.67821	-0.5571	9	0.54805	T	0.06	-7.7554	15.18	0.72947	0.0:0.0:1.0:0.0	.	331;331;257	Q8TAS1-2;Q8TAS1;G3V1M1	.;UHMK1_HUMAN;.	N	257;331;331	ENSP00000441226:D257N;ENSP00000446416:D331N;ENSP00000420270:D331N	ENSP00000420270:D331N	D	+	1	0	UHMK1	160749204	1.000000	0.71417	0.956000	0.39512	0.312000	0.27988	8.657000	0.91106	2.689000	0.91719	0.655000	0.94253	GAT	UHMK1	-	superfamily_Kinase-like_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000152332		0.323	UHMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UHMK1	HGNC	protein_coding	OTTHUMT00000076788.1	34	0.00	0	G	NM_175866		162482580	162482580	+1	no_errors	ENST00000489294	ensembl	human	known	69_37n	missense	46	19.30	11	SNP	1.000	A
WBP1	23559	genome.wustl.edu	37	2	74687076	74687076	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr2:74687076G>T	ENST00000233615.2	+	3	523	c.249G>T	c.(247-249)agG>agT	p.R83S	WBP1_ENST00000409737.1_Missense_Mutation_p.R80S|WBP1_ENST00000393972.3_Missense_Mutation_p.R117S|MOGS_ENST00000462443.1_5'Flank|WBP1_ENST00000494741.1_3'UTR	NM_012477.3	NP_036609.1	Q96G27	WBP1_HUMAN	WW domain binding protein 1	83							WW domain binding (GO:0050699)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|ovary(1)|urinary_tract(1)	8						CTAAACTCAGGCTGCAACAAC	0.572																																						dbGAP											0													68.0	66.0	67.0					2																	74687076		2203	4300	6503	-	-	-	SO:0001583	missense	0			U79457	CCDS1943.1	2p12	2012-04-20			ENSG00000239779	ENSG00000239779			12737	protein-coding gene	gene with protein product		606961				7644498	Standard	NM_012477		Approved	WBP-1	uc002slj.2	Q96G27	OTTHUMG00000129958	ENST00000233615.2:c.249G>T	2.37:g.74687076G>T	ENSP00000233615:p.Arg83Ser		B2RE02|O95637	Missense_Mutation	SNP	pfam_Uncharacterised_WW-bd	p.R83S	ENST00000233615.2	37	c.249	CCDS1943.1	2	.	.	.	.	.	.	.	.	.	.	G	16.22	3.060447	0.55432	.	.	ENSG00000239779	ENST00000233615;ENST00000393972;ENST00000409737;ENST00000428943	.	.	.	4.62	1.6	0.23607	.	.	.	.	.	T	0.67850	0.2937	M	0.74258	2.255	0.38690	D	0.952734	D;D	0.69078	0.997;0.997	D;D	0.80764	0.994;0.994	T	0.69312	-0.5178	8	0.87932	D	0	-10.588	2.3869	0.04368	0.0973:0.1658:0.3953:0.3417	.	80;83	B8ZZ95;Q96G27	.;WBP1_HUMAN	S	83;117;80;142	.	ENSP00000233615:R83S	R	+	3	2	WBP1	74540584	0.399000	0.25287	1.000000	0.80357	0.993000	0.82548	-0.213000	0.09305	1.107000	0.41642	0.555000	0.69702	AGG	WBP1	-	pfam_Uncharacterised_WW-bd	ENSG00000239779		0.572	WBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WBP1	HGNC	protein_coding	OTTHUMT00000252221.2	23	0.00	0	G	NM_012477		74687076	74687076	+1	no_errors	ENST00000233615	ensembl	human	known	69_37n	missense	10	41.18	7	SNP	0.995	T
WDR1	9948	genome.wustl.edu	37	4	10117755	10117755	+	Silent	SNP	G	G	T			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr4:10117755G>T	ENST00000499869.2	-	2	313	c.120C>A	c.(118-120)gtC>gtA	p.V40V	WDR1_ENST00000502702.1_Silent_p.V40V|WDR1_ENST00000382452.2_Silent_p.V40V|RNA5SP155_ENST00000411154.1_RNA|WDR1_ENST00000382451.2_Silent_p.V40V			O75083	WDR1_HUMAN	WD repeat domain 1	40					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|sensory perception of sound (GO:0007605)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)				endometrium(3)|lung(5)|ovary(2)|pancreas(1)|urinary_tract(1)	12				STAD - Stomach adenocarcinoma(129;0.000703)|Colorectal(103;0.0057)|LUSC - Lung squamous cell carcinoma(721;0.0232)		TCCTTAGGATGACGCACTTTC	0.587																																						dbGAP											0													55.0	67.0	63.0					4																	10117755		2011	4173	6184	-	-	-	SO:0001819	synonymous_variant	0			AF020260	CCDS54739.1, CCDS54740.1	4p16.1	2013-01-09			ENSG00000071127	ENSG00000071127		"""WD repeat domain containing"""	12754	protein-coding gene	gene with protein product		604734				10036186	Standard	NM_017491		Approved		uc021xlv.1	O75083	OTTHUMG00000160253	ENST00000499869.2:c.120C>A	4.37:g.10117755G>T			A8K6E9|A8MPU4|O75313|Q8N6E5|Q9UG05|Q9UG78|Q9UQE0	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V40	ENST00000499869.2	37	c.120	CCDS54740.1	4																																																																																			WDR1	-	superfamily_WD40_repeat_dom	ENSG00000071127		0.587	WDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR1	HGNC	protein_coding	OTTHUMT00000359877.1	71	0.00	0	G			10117755	10117755	-1	no_errors	ENST00000382452	ensembl	human	known	69_37n	silent	47	27.69	18	SNP	1.000	T
WDR17	116966	genome.wustl.edu	37	4	177083309	177083309	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr4:177083309C>T	ENST00000280190.4	+	22	3062	c.2906C>T	c.(2905-2907)gCc>gTc	p.A969V	WDR17_ENST00000393643.2_Missense_Mutation_p.A945V|WDR17_ENST00000507824.2_Missense_Mutation_p.A952V|WDR17_ENST00000508596.1_Missense_Mutation_p.A945V			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	969										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		TGCCATCTTGCCATAGATAAT	0.363																																						dbGAP											0													85.0	81.0	82.0					4																	177083309		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.2906C>T	4.37:g.177083309C>T	ENSP00000280190:p.Ala969Val		E7EQX0|Q0QD35	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.A969V	ENST00000280190.4	37	c.2906	CCDS3825.1	4	.	.	.	.	.	.	.	.	.	.	C	22.7	4.322353	0.81580	.	.	ENSG00000150627	ENST00000508596;ENST00000393643;ENST00000280190;ENST00000507824	T;T;T	0.63096	0.04;0.05;-0.02	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.80116	0.4564	M	0.73598	2.24	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.85130	0.997;0.993;0.993	T	0.78422	-0.2210	10	0.42905	T	0.14	-24.116	19.842	0.96693	0.0:1.0:0.0:0.0	.	945;945;969	E7EP77;E7EQX0;Q8IZU2	.;.;WDR17_HUMAN	V	945;945;969;952	ENSP00000422763:A945V;ENSP00000377258:A945V;ENSP00000280190:A969V	ENSP00000280190:A969V	A	+	2	0	WDR17	177320303	1.000000	0.71417	0.596000	0.28811	0.619000	0.37552	5.515000	0.67049	2.700000	0.92200	0.650000	0.86243	GCC	WDR17	-	NULL	ENSG00000150627		0.363	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR17	HGNC	protein_coding	OTTHUMT00000362334.2	43	0.00	0	C			177083309	177083309	+1	no_errors	ENST00000280190	ensembl	human	known	69_37n	missense	16	15.00	3	SNP	1.000	T
WDR35	57539	genome.wustl.edu	37	2	20147950	20147950	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr2:20147950G>T	ENST00000345530.3	-	15	1647	c.1532C>A	c.(1531-1533)aCt>aAt	p.T511N	WDR35_ENST00000416055.2_Missense_Mutation_p.T76N|WDR35_ENST00000281405.4_Missense_Mutation_p.T500N	NM_001006657.1	NP_001006658.1	Q9P2L0	WDR35_HUMAN	WD repeat domain 35	511					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)				breast(1)|endometrium(5)|kidney(8)|large_intestine(8)|lung(16)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATCTGATGCAGTTATGGCACA	0.289																																						dbGAP											0													42.0	43.0	43.0					2																	20147950		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037757	CCDS1695.1, CCDS33152.1	2p24.3	2014-02-21			ENSG00000118965	ENSG00000118965		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	29250	protein-coding gene	gene with protein product		613602				10718198	Standard	NM_001006657		Approved	MGC33196, KIAA1336, IFT121, IFTA1	uc002rdi.3	Q9P2L0	OTTHUMG00000090737	ENST00000345530.3:c.1532C>A	2.37:g.20147950G>T	ENSP00000314444:p.Thr511Asn		B3KVI5|Q4ZG01|Q8NE11	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pirsf_WD_repeat_p35,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T511N	ENST00000345530.3	37	c.1532	CCDS33152.1	2	.	.	.	.	.	.	.	.	.	.	G	22.9	4.352596	0.82132	.	.	ENSG00000118965	ENST00000345530;ENST00000281405;ENST00000416055;ENST00000453014	D;D;D;D	0.94138	-3.36;-3.36;-3.36;-3.36	5.26	5.26	0.73747	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.96355	0.8811	M	0.76002	2.32	0.80722	D	1	P;D;P;D	0.89917	0.906;1.0;0.955;0.994	P;D;P;D	0.71870	0.848;0.975;0.635;0.947	D	0.96345	0.9254	10	0.54805	T	0.06	-22.8879	17.8707	0.88810	0.0:0.0:1.0:0.0	.	511;500;511;76	F8WB94;Q9P2L0-2;Q9P2L0;B3KR94	.;.;WDR35_HUMAN;.	N	511;500;76;46	ENSP00000314444:T511N;ENSP00000281405:T500N;ENSP00000399159:T76N;ENSP00000404409:T46N	ENSP00000281405:T500N	T	-	2	0	WDR35	20011431	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.748000	0.91615	2.476000	0.83614	0.655000	0.94253	ACT	WDR35	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_WD_repeat_p35	ENSG00000118965		0.289	WDR35-001	KNOWN	basic|CCDS	protein_coding	WDR35	HGNC	protein_coding	OTTHUMT00000207472.2	33	0.00	0	G	NM_020779		20147950	20147950	-1	no_errors	ENST00000345530	ensembl	human	known	69_37n	missense	14	17.65	3	SNP	1.000	T
ZBED5	58486	genome.wustl.edu	37	11	10875564	10875564	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr11:10875564G>C	ENST00000432999.2	-	3	1427	c.929C>G	c.(928-930)tCt>tGt	p.S310C	ZBED5_ENST00000525350.1_Intron|ZBED5_ENST00000413761.2_Missense_Mutation_p.S310C	NM_001143667.1|NM_021211.3	NP_001137139.1|NP_067034.2	Q49AG3	ZBED5_HUMAN	zinc finger, BED-type containing 5	310							DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)	4						actttgcaaagattcacacag	0.363																																						dbGAP											0													44.0	34.0	37.0					11																	10875564		692	1591	2283	-	-	-	SO:0001583	missense	0			AF205601		11p15.3	2013-05-03			ENSG00000236287	ENSG00000236287		"""Zinc fingers, BED-type"""	30803	protein-coding gene	gene with protein product		615251				10607616, 23533661	Standard	NM_021211		Approved	Buster1	uc009ygh.3	Q49AG3	OTTHUMG00000150341	ENST00000432999.2:c.929C>G	11.37:g.10875564G>C	ENSP00000398106:p.Ser310Cys		B2RCC1|Q05D82|Q86WW3|Q9NT24|Q9UBJ4	Missense_Mutation	SNP	superfamily_RNaseH-like_dom,pfscan_Znf_BED_prd	p.S310C	ENST00000432999.2	37	c.929		11	.	.	.	.	.	.	.	.	.	.	G	13.71	2.318779	0.41096	.	.	ENSG00000236287	ENST00000432999;ENST00000413761	T;T	0.23754	1.89;1.89	4.0	4.0	0.46444	Ribonuclease H-like (1);	.	.	.	.	T	0.42404	0.1201	L	0.50333	1.59	0.30100	N	0.807555	D	0.76494	0.999	D	0.66847	0.947	T	0.26677	-1.0096	9	0.72032	D	0.01	.	11.9058	0.52711	0.0:0.0:1.0:0.0	.	310	Q49AG3	ZBED5_HUMAN	C	310	ENSP00000398106:S310C;ENSP00000415939:S310C	ENSP00000415939:S310C	S	-	2	0	ZBED5	10832140	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.451000	0.52964	2.518000	0.84900	0.650000	0.86243	TCT	ZBED5	-	superfamily_RNaseH-like_dom	ENSG00000236287		0.363	ZBED5-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	ZBED5	HGNC	protein_coding	OTTHUMT00000317691.1	26	0.00	0	G	NM_021211		10875564	10875564	-1	no_errors	ENST00000413761	ensembl	human	putative	69_37n	missense	10	44.44	8	SNP	1.000	C
ZNF721	170960	genome.wustl.edu	37	4	436142	436142	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr4:436142G>C	ENST00000338977.5	-	2	2126	c.2078C>G	c.(2077-2079)gCc>gGc	p.A693G	ZNF721_ENST00000507078.1_Intron|ABCA11P_ENST00000451020.2_RNA|ZNF721_ENST00000506646.1_Intron|ZNF721_ENST00000511833.2_Missense_Mutation_p.A705G			Q8TF20	ZN721_HUMAN	zinc finger protein 721	693					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(15)|lung(6)|ovary(1)|skin(1)|stomach(5)|urinary_tract(1)	33						CCTACTAAAGGCTTTGCCACA	0.433																																						dbGAP											0													63.0	67.0	65.0					4																	436142		2099	4252	6351	-	-	-	SO:0001583	missense	0			AK092362	CCDS46991.1	4p16.3	2013-01-08			ENSG00000182903	ENSG00000182903		"""Zinc fingers, C2H2-type"", ""-"""	29425	protein-coding gene	gene with protein product						11853319	Standard	NM_133474		Approved	KIAA1982	uc003gag.4	Q8TF20		ENST00000338977.5:c.2078C>G	4.37:g.436142G>C	ENSP00000340524:p.Ala693Gly		Q69YG7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A705G	ENST00000338977.5	37	c.2114		4	.	.	.	.	.	.	.	.	.	.	G	9.726	1.161061	0.21538	.	.	ENSG00000182903	ENST00000338977;ENST00000511833	T;T	0.36340	1.26;1.26	0.701	0.701	0.18104	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.20981	0.0505	L	0.37507	1.11	0.09310	N	0.999998	P;P;P	0.41569	0.755;0.755;0.711	B;B;B	0.33690	0.168;0.168;0.104	T	0.13845	-1.0494	9	0.46703	T	0.11	.	3.8174	0.08821	0.0:1.0E-4:0.5769:0.423	.	693;705;705	Q8TF20;D9N162;Q8TF20-2	ZN721_HUMAN;.;.	G	693;705	ENSP00000340524:A693G;ENSP00000428878:A705G	ENSP00000340524:A693G	A	-	2	0	ZNF721	426142	0.000000	0.05858	0.008000	0.14137	0.020000	0.10135	-0.006000	0.12833	0.672000	0.31204	0.184000	0.17185	GCC	ZNF721	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000182903		0.433	ZNF721-001	KNOWN	basic|appris_candidate	protein_coding	ZNF721	HGNC	protein_coding	OTTHUMT00000357939.1	52	0.00	0	G	NM_133474		436142	436142	-1	no_errors	ENST00000511833	ensembl	human	known	69_37n	missense	12	60.00	18	SNP	0.701	C
ZYX	7791	genome.wustl.edu	37	7	143085893	143085893	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A3HO-01A-11D-A20S-09	TCGA-E9-A3HO-10A-02D-A20S-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	76ac3cf6-352b-401d-b029-f523a9133fd9	e3be43c8-9ab3-48dd-b8e6-de5fa770d861	g.chr7:143085893C>T	ENST00000322764.5	+	8	1693	c.1348C>T	c.(1348-1350)Ccc>Tcc	p.P450S	ZYX_ENST00000392910.2_Missense_Mutation_p.P293S|ZYX_ENST00000449423.2_Missense_Mutation_p.P363S|EPHA1_ENST00000458129.1_5'Flank	NM_001010972.1|NM_003461.4	NP_001010972.1|NP_003452.1	Q15942	ZYX_HUMAN	zyxin	450	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|integrin-mediated signaling pathway (GO:0007229)|regulation of inflammatory response (GO:0050727)|signal transduction (GO:0007165)|stress fiber assembly (GO:0043149)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)	17	Melanoma(164;0.205)					CTGCGGGGAGCCCATCACTGA	0.657																																						dbGAP											0													69.0	67.0	68.0					7																	143085893		2203	4300	6503	-	-	-	SO:0001583	missense	0			X95735	CCDS5883.1	7q32	2010-02-26			ENSG00000159840	ENSG00000159840			13200	protein-coding gene	gene with protein product		602002				8917469, 8940160	Standard	XM_005250052		Approved		uc003wcx.3	Q15942	OTTHUMG00000023822	ENST00000322764.5:c.1348C>T	7.37:g.143085893C>T	ENSP00000324422:p.Pro450Ser		A4D2G6|Q6I9S4	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.P450S	ENST00000322764.5	37	c.1348	CCDS5883.1	7	.	.	.	.	.	.	.	.	.	.	C	18.86	3.712495	0.68730	.	.	ENSG00000159840	ENST00000322764;ENST00000354434;ENST00000449423;ENST00000392910;ENST00000446634	D;D;D;D;D	0.88201	-2.35;-2.35;-2.35;-2.35;-2.35	4.72	4.72	0.59763	Zinc finger, LIM-type (4);	0.303458	0.26518	N	0.023934	D	0.89462	0.6722	L	0.51914	1.62	0.31449	N	0.671003	D;D	0.59357	0.985;0.967	P;P	0.52598	0.703;0.696	D	0.90078	0.4168	10	0.66056	D	0.02	.	13.0232	0.58800	0.2033:0.7967:0.0:0.0	.	363;450	B4DQR8;Q15942	.;ZYX_HUMAN	S	450;418;363;293;140	ENSP00000324422:P450S;ENSP00000346417:P418S;ENSP00000394158:P363S;ENSP00000376642:P293S;ENSP00000403714:P140S	ENSP00000324422:P450S	P	+	1	0	ZYX	142796015	1.000000	0.71417	1.000000	0.80357	0.778000	0.44026	1.576000	0.36504	2.311000	0.77944	0.484000	0.47621	CCC	ZYX	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	ENSG00000159840		0.657	ZYX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZYX	HGNC	protein_coding	OTTHUMT00000156296.2	36	0.00	0	C	NM_003461		143085893	143085893	+1	no_errors	ENST00000322764	ensembl	human	known	69_37n	missense	21	54.35	25	SNP	1.000	T
